data_6WLN
# 
_entry.id   6WLN 
# 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.329 
_audit_conform.dict_location   http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic 
# 
loop_
_database_2.database_id 
_database_2.database_code 
PDB   6WLN         
WWPDB D_1000248529 
EMDB  EMD-21835    
# 
loop_
_pdbx_database_related.db_name 
_pdbx_database_related.details 
_pdbx_database_related.db_id 
_pdbx_database_related.content_type 
EMDB . EMD-21835 'associated EM volume' 
EMDB . EMD-21831 'other EM volume'      
EMDB . EMD-21832 'other EM volume'      
EMDB . EMD-21833 'other EM volume'      
EMDB . EMD-21834 'other EM volume'      
EMDB . EMD-21836 'other EM volume'      
EMDB . EMD-21838 'other EM volume'      
EMDB . EMD-21839 'other EM volume'      
EMDB . EMD-21840 'other EM volume'      
EMDB . EMD-21841 'other EM volume'      
EMDB . EMD-21842 'other EM volume'      
# 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.status_code_sf                  ? 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.entry_id                        6WLN 
_pdbx_database_status.recvd_initial_deposition_date   2020-04-20 
_pdbx_database_status.SG_entry                        N 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.status_code_nmr_data            ? 
_pdbx_database_status.methods_development_category    ? 
_pdbx_database_status.pdb_format_compatible           Y 
# 
loop_
_audit_author.name 
_audit_author.pdbx_ordinal 
_audit_author.identifier_ORCID 
'Kappel, K.'      1  0000-0002-2129-199X 
'Zhang, K.'       2  ?                   
'Su, Z.'          3  ?                   
'Watkins, A.M.'   4  ?                   
'Kladwang, W.'    5  ?                   
'Li, S.'          6  ?                   
'Pintilie, G.'    7  ?                   
'Topkar, V.V.'    8  ?                   
'Rangan, R.'      9  ?                   
'Zheludev, I.N.'  10 ?                   
'Yesselman, J.D.' 11 ?                   
'Chiu, W.'        12 ?                   
'Das, R.'         13 ?                   
# 
_citation.abstract                  ? 
_citation.abstract_id_CAS           ? 
_citation.book_id_ISBN              ? 
_citation.book_publisher            ? 
_citation.book_publisher_city       ? 
_citation.book_title                ? 
_citation.coordinate_linkage        ? 
_citation.country                   US 
_citation.database_id_Medline       ? 
_citation.details                   ? 
_citation.id                        primary 
_citation.journal_abbrev            Nat.Methods 
_citation.journal_id_ASTM           ? 
_citation.journal_id_CSD            ? 
_citation.journal_id_ISSN           1548-7105 
_citation.journal_full              ? 
_citation.journal_issue             ? 
_citation.journal_volume            17 
_citation.language                  ? 
_citation.page_first                699 
_citation.page_last                 707 
_citation.title                     'Accelerated cryo-EM-guided determination of three-dimensional RNA-only structures.' 
_citation.year                      2020 
_citation.database_id_CSD           ? 
_citation.pdbx_database_id_DOI      10.1038/s41592-020-0878-9 
_citation.pdbx_database_id_PubMed   32616928 
_citation.unpublished_flag          ? 
# 
loop_
_citation_author.citation_id 
_citation_author.name 
_citation_author.ordinal 
_citation_author.identifier_ORCID 
primary 'Kappel, K.'      1  ? 
primary 'Zhang, K.'       2  ? 
primary 'Su, Z.'          3  ? 
primary 'Watkins, A.M.'   4  ? 
primary 'Kladwang, W.'    5  ? 
primary 'Li, S.'          6  ? 
primary 'Pintilie, G.'    7  ? 
primary 'Topkar, V.V.'    8  ? 
primary 'Rangan, R.'      9  ? 
primary 'Zheludev, I.N.'  10 ? 
primary 'Yesselman, J.D.' 11 ? 
primary 'Chiu, W.'        12 ? 
primary 'Das, R.'         13 ? 
# 
_entity.id                         1 
_entity.type                       polymer 
_entity.src_method                 syn 
_entity.pdbx_description           'RNA (349-MER)' 
_entity.formula_weight             112788.719 
_entity.pdbx_number_of_molecules   1 
_entity.pdbx_ec                    ? 
_entity.pdbx_mutation              ? 
_entity.pdbx_fragment              ? 
_entity.details                    ? 
# 
_entity_poly.entity_id                      1 
_entity_poly.type                           polyribonucleotide 
_entity_poly.nstd_linkage                   no 
_entity_poly.nstd_monomer                   no 
_entity_poly.pdbx_seq_one_letter_code       
;GGAUCUUACUUGGUAGACUCGCAGGAAGUCUACCGAGUAAGAGAAAGAGGAAAGACGGCCAAAUUGCGGGAAAGGGGACA
ACAGCCGUUCAGUACCAAGUCUCAGGGAAACUUCAGAUGGCCUCGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCC
UAACCACGCAGUCAAGUCCUAAGUCAACAGCCUUGGCUGUUGAUAUGGAUGCAUUUCGAUCCAACCGAGGCUCAUUCUUG
UAAUUCAUGGCCGUCGGGGAGGCACUUCGGUGCCUCUGAUAACAACUUGAAAUAAGGUUGGCUCAACGGCGCGUGACAGA
CAAUUCGCGCUGGAACUGCAGUCGGACCU
;
_entity_poly.pdbx_seq_one_letter_code_can   
;GGAUCUUACUUGGUAGACUCGCAGGAAGUCUACCGAGUAAGAGAAAGAGGAAAGACGGCCAAAUUGCGGGAAAGGGGACA
ACAGCCGUUCAGUACCAAGUCUCAGGGAAACUUCAGAUGGCCUCGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCC
UAACCACGCAGUCAAGUCCUAAGUCAACAGCCUUGGCUGUUGAUAUGGAUGCAUUUCGAUCCAACCGAGGCUCAUUCUUG
UAAUUCAUGGCCGUCGGGGAGGCACUUCGGUGCCUCUGAUAACAACUUGAAAUAAGGUUGGCUCAACGGCGCGUGACAGA
CAAUUCGCGCUGGAACUGCAGUCGGACCU
;
_entity_poly.pdbx_strand_id                 A 
_entity_poly.pdbx_target_identifier         ? 
# 
loop_
_entity_poly_seq.entity_id 
_entity_poly_seq.num 
_entity_poly_seq.mon_id 
_entity_poly_seq.hetero 
1 1   G n 
1 2   G n 
1 3   A n 
1 4   U n 
1 5   C n 
1 6   U n 
1 7   U n 
1 8   A n 
1 9   C n 
1 10  U n 
1 11  U n 
1 12  G n 
1 13  G n 
1 14  U n 
1 15  A n 
1 16  G n 
1 17  A n 
1 18  C n 
1 19  U n 
1 20  C n 
1 21  G n 
1 22  C n 
1 23  A n 
1 24  G n 
1 25  G n 
1 26  A n 
1 27  A n 
1 28  G n 
1 29  U n 
1 30  C n 
1 31  U n 
1 32  A n 
1 33  C n 
1 34  C n 
1 35  G n 
1 36  A n 
1 37  G n 
1 38  U n 
1 39  A n 
1 40  A n 
1 41  G n 
1 42  A n 
1 43  G n 
1 44  A n 
1 45  A n 
1 46  A n 
1 47  G n 
1 48  A n 
1 49  G n 
1 50  G n 
1 51  A n 
1 52  A n 
1 53  A n 
1 54  G n 
1 55  A n 
1 56  C n 
1 57  G n 
1 58  G n 
1 59  C n 
1 60  C n 
1 61  A n 
1 62  A n 
1 63  A n 
1 64  U n 
1 65  U n 
1 66  G n 
1 67  C n 
1 68  G n 
1 69  G n 
1 70  G n 
1 71  A n 
1 72  A n 
1 73  A n 
1 74  G n 
1 75  G n 
1 76  G n 
1 77  G n 
1 78  A n 
1 79  C n 
1 80  A n 
1 81  A n 
1 82  C n 
1 83  A n 
1 84  G n 
1 85  C n 
1 86  C n 
1 87  G n 
1 88  U n 
1 89  U n 
1 90  C n 
1 91  A n 
1 92  G n 
1 93  U n 
1 94  A n 
1 95  C n 
1 96  C n 
1 97  A n 
1 98  A n 
1 99  G n 
1 100 U n 
1 101 C n 
1 102 U n 
1 103 C n 
1 104 A n 
1 105 G n 
1 106 G n 
1 107 G n 
1 108 A n 
1 109 A n 
1 110 A n 
1 111 C n 
1 112 U n 
1 113 U n 
1 114 C n 
1 115 A n 
1 116 G n 
1 117 A n 
1 118 U n 
1 119 G n 
1 120 G n 
1 121 C n 
1 122 C n 
1 123 U n 
1 124 C n 
1 125 G n 
1 126 C n 
1 127 A n 
1 128 A n 
1 129 A n 
1 130 G n 
1 131 G n 
1 132 G n 
1 133 U n 
1 134 A n 
1 135 U n 
1 136 G n 
1 137 G n 
1 138 U n 
1 139 A n 
1 140 A n 
1 141 U n 
1 142 A n 
1 143 A n 
1 144 G n 
1 145 C n 
1 146 U n 
1 147 G n 
1 148 A n 
1 149 C n 
1 150 G n 
1 151 G n 
1 152 A n 
1 153 C n 
1 154 A n 
1 155 U n 
1 156 G n 
1 157 G n 
1 158 U n 
1 159 C n 
1 160 C n 
1 161 U n 
1 162 A n 
1 163 A n 
1 164 C n 
1 165 C n 
1 166 A n 
1 167 C n 
1 168 G n 
1 169 C n 
1 170 A n 
1 171 G n 
1 172 U n 
1 173 C n 
1 174 A n 
1 175 A n 
1 176 G n 
1 177 U n 
1 178 C n 
1 179 C n 
1 180 U n 
1 181 A n 
1 182 A n 
1 183 G n 
1 184 U n 
1 185 C n 
1 186 A n 
1 187 A n 
1 188 C n 
1 189 A n 
1 190 G n 
1 191 C n 
1 192 C n 
1 193 U n 
1 194 U n 
1 195 G n 
1 196 G n 
1 197 C n 
1 198 U n 
1 199 G n 
1 200 U n 
1 201 U n 
1 202 G n 
1 203 A n 
1 204 U n 
1 205 A n 
1 206 U n 
1 207 G n 
1 208 G n 
1 209 A n 
1 210 U n 
1 211 G n 
1 212 C n 
1 213 A n 
1 214 U n 
1 215 U n 
1 216 U n 
1 217 C n 
1 218 G n 
1 219 A n 
1 220 U n 
1 221 C n 
1 222 C n 
1 223 A n 
1 224 A n 
1 225 C n 
1 226 C n 
1 227 G n 
1 228 A n 
1 229 G n 
1 230 G n 
1 231 C n 
1 232 U n 
1 233 C n 
1 234 A n 
1 235 U n 
1 236 U n 
1 237 C n 
1 238 U n 
1 239 U n 
1 240 G n 
1 241 U n 
1 242 A n 
1 243 A n 
1 244 U n 
1 245 U n 
1 246 C n 
1 247 A n 
1 248 U n 
1 249 G n 
1 250 G n 
1 251 C n 
1 252 C n 
1 253 G n 
1 254 U n 
1 255 C n 
1 256 G n 
1 257 G n 
1 258 G n 
1 259 G n 
1 260 A n 
1 261 G n 
1 262 G n 
1 263 C n 
1 264 A n 
1 265 C n 
1 266 U n 
1 267 U n 
1 268 C n 
1 269 G n 
1 270 G n 
1 271 U n 
1 272 G n 
1 273 C n 
1 274 C n 
1 275 U n 
1 276 C n 
1 277 U n 
1 278 G n 
1 279 A n 
1 280 U n 
1 281 A n 
1 282 A n 
1 283 C n 
1 284 A n 
1 285 A n 
1 286 C n 
1 287 U n 
1 288 U n 
1 289 G n 
1 290 A n 
1 291 A n 
1 292 A n 
1 293 U n 
1 294 A n 
1 295 A n 
1 296 G n 
1 297 G n 
1 298 U n 
1 299 U n 
1 300 G n 
1 301 G n 
1 302 C n 
1 303 U n 
1 304 C n 
1 305 A n 
1 306 A n 
1 307 C n 
1 308 G n 
1 309 G n 
1 310 C n 
1 311 G n 
1 312 C n 
1 313 G n 
1 314 U n 
1 315 G n 
1 316 A n 
1 317 C n 
1 318 A n 
1 319 G n 
1 320 A n 
1 321 C n 
1 322 A n 
1 323 A n 
1 324 U n 
1 325 U n 
1 326 C n 
1 327 G n 
1 328 C n 
1 329 G n 
1 330 C n 
1 331 U n 
1 332 G n 
1 333 G n 
1 334 A n 
1 335 A n 
1 336 C n 
1 337 U n 
1 338 G n 
1 339 C n 
1 340 A n 
1 341 G n 
1 342 U n 
1 343 C n 
1 344 G n 
1 345 G n 
1 346 A n 
1 347 C n 
1 348 C n 
1 349 U n 
# 
_pdbx_entity_src_syn.entity_id              1 
_pdbx_entity_src_syn.pdbx_src_id            1 
_pdbx_entity_src_syn.pdbx_alt_source_flag   sample 
_pdbx_entity_src_syn.pdbx_beg_seq_num       1 
_pdbx_entity_src_syn.pdbx_end_seq_num       349 
_pdbx_entity_src_syn.organism_scientific    'synthetic construct' 
_pdbx_entity_src_syn.organism_common_name   ? 
_pdbx_entity_src_syn.ncbi_taxonomy_id       32630 
_pdbx_entity_src_syn.details                ? 
# 
_struct_ref.id                         1 
_struct_ref.db_name                    PDB 
_struct_ref.db_code                    6WLN 
_struct_ref.pdbx_db_accession          6WLN 
_struct_ref.pdbx_db_isoform            ? 
_struct_ref.entity_id                  1 
_struct_ref.pdbx_seq_one_letter_code   ? 
_struct_ref.pdbx_align_begin           1 
# 
_struct_ref_seq.align_id                      1 
_struct_ref_seq.ref_id                        1 
_struct_ref_seq.pdbx_PDB_id_code              6WLN 
_struct_ref_seq.pdbx_strand_id                A 
_struct_ref_seq.seq_align_beg                 1 
_struct_ref_seq.pdbx_seq_align_beg_ins_code   ? 
_struct_ref_seq.seq_align_end                 349 
_struct_ref_seq.pdbx_seq_align_end_ins_code   ? 
_struct_ref_seq.pdbx_db_accession             6WLN 
_struct_ref_seq.db_align_beg                  -10 
_struct_ref_seq.pdbx_db_align_beg_ins_code    ? 
_struct_ref_seq.db_align_end                  338 
_struct_ref_seq.pdbx_db_align_end_ins_code    ? 
_struct_ref_seq.pdbx_auth_seq_align_beg       -10 
_struct_ref_seq.pdbx_auth_seq_align_end       338 
# 
loop_
_chem_comp.id 
_chem_comp.type 
_chem_comp.mon_nstd_flag 
_chem_comp.name 
_chem_comp.pdbx_synonyms 
_chem_comp.formula 
_chem_comp.formula_weight 
A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O8 P'  323.197 
G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 
U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE"   ? 'C9 H13 N2 O9 P'  324.181 
# 
_exptl.absorpt_coefficient_mu     ? 
_exptl.absorpt_correction_T_max   ? 
_exptl.absorpt_correction_T_min   ? 
_exptl.absorpt_correction_type    ? 
_exptl.absorpt_process_details    ? 
_exptl.entry_id                   6WLN 
_exptl.crystals_number            ? 
_exptl.details                    ? 
_exptl.method                     'ELECTRON MICROSCOPY' 
_exptl.method_details             ? 
# 
_struct.entry_id                     6WLN 
_struct.title                        'hc16 ligase product models, 10.0 Angstrom resolution' 
_struct.pdbx_descriptor              'RNA (349-MER)' 
_struct.pdbx_model_details           ? 
_struct.pdbx_formula_weight          ? 
_struct.pdbx_formula_weight_method   ? 
_struct.pdbx_model_type_details      ? 
_struct.pdbx_CASP_flag               N 
# 
_struct_keywords.entry_id        6WLN 
_struct_keywords.text            'ribozyme, RNA' 
_struct_keywords.pdbx_keywords   RNA 
# 
_struct_asym.id                            A 
_struct_asym.pdbx_blank_PDB_chainid_flag   N 
_struct_asym.pdbx_modified                 N 
_struct_asym.entity_id                     1 
_struct_asym.details                       ? 
# 
loop_
_struct_conn.id 
_struct_conn.conn_type_id 
_struct_conn.pdbx_leaving_atom_flag 
_struct_conn.pdbx_PDB_id 
_struct_conn.ptnr1_label_asym_id 
_struct_conn.ptnr1_label_comp_id 
_struct_conn.ptnr1_label_seq_id 
_struct_conn.ptnr1_label_atom_id 
_struct_conn.pdbx_ptnr1_label_alt_id 
_struct_conn.pdbx_ptnr1_PDB_ins_code 
_struct_conn.pdbx_ptnr1_standard_comp_id 
_struct_conn.ptnr1_symmetry 
_struct_conn.ptnr2_label_asym_id 
_struct_conn.ptnr2_label_comp_id 
_struct_conn.ptnr2_label_seq_id 
_struct_conn.ptnr2_label_atom_id 
_struct_conn.pdbx_ptnr2_label_alt_id 
_struct_conn.pdbx_ptnr2_PDB_ins_code 
_struct_conn.ptnr1_auth_asym_id 
_struct_conn.ptnr1_auth_comp_id 
_struct_conn.ptnr1_auth_seq_id 
_struct_conn.ptnr2_auth_asym_id 
_struct_conn.ptnr2_auth_comp_id 
_struct_conn.ptnr2_auth_seq_id 
_struct_conn.ptnr2_symmetry 
_struct_conn.pdbx_ptnr3_label_atom_id 
_struct_conn.pdbx_ptnr3_label_seq_id 
_struct_conn.pdbx_ptnr3_label_comp_id 
_struct_conn.pdbx_ptnr3_label_asym_id 
_struct_conn.pdbx_ptnr3_label_alt_id 
_struct_conn.pdbx_ptnr3_PDB_ins_code 
_struct_conn.details 
_struct_conn.pdbx_dist_value 
_struct_conn.pdbx_value_order 
hydrog1   hydrog ? ? A A 3   N6 ? ? ? 1_555 A G 43  N3 ? ? A A -8  A G 32  1_555 ? ? ? ? ? ? TYPE_11_PAIR  ? ? 
hydrog2   hydrog ? ? A A 3   N7 ? ? ? 1_555 A G 43  N2 ? ? A A -8  A G 32  1_555 ? ? ? ? ? ? TYPE_11_PAIR  ? ? 
hydrog3   hydrog ? ? A U 4   N3 ? ? ? 1_555 A A 42  N1 ? ? A U -7  A A 31  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog4   hydrog ? ? A U 4   O4 ? ? ? 1_555 A A 42  N6 ? ? A U -7  A A 31  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog5   hydrog ? ? A C 5   N3 ? ? ? 1_555 A G 41  N1 ? ? A C -6  A G 30  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog6   hydrog ? ? A C 5   N4 ? ? ? 1_555 A G 41  O6 ? ? A C -6  A G 30  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog7   hydrog ? ? A C 5   O2 ? ? ? 1_555 A G 41  N2 ? ? A C -6  A G 30  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog8   hydrog ? ? A U 6   N3 ? ? ? 1_555 A A 40  N1 ? ? A U -5  A A 29  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog9   hydrog ? ? A U 6   O4 ? ? ? 1_555 A A 40  N6 ? ? A U -5  A A 29  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog10  hydrog ? ? A U 7   N3 ? ? ? 1_555 A A 39  N1 ? ? A U -4  A A 28  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog11  hydrog ? ? A U 7   O4 ? ? ? 1_555 A A 39  N6 ? ? A U -4  A A 28  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog12  hydrog ? ? A A 8   N1 ? ? ? 1_555 A U 38  N3 ? ? A A -3  A U 27  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog13  hydrog ? ? A A 8   N6 ? ? ? 1_555 A U 38  O4 ? ? A A -3  A U 27  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog14  hydrog ? ? A C 9   N3 ? ? ? 1_555 A G 37  N1 ? ? A C -2  A G 26  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog15  hydrog ? ? A C 9   N4 ? ? ? 1_555 A G 37  O6 ? ? A C -2  A G 26  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog16  hydrog ? ? A C 9   O2 ? ? ? 1_555 A G 37  N2 ? ? A C -2  A G 26  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog17  hydrog ? ? A U 10  N3 ? ? ? 1_555 A A 36  N1 ? ? A U -1  A A 25  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog18  hydrog ? ? A U 10  O4 ? ? ? 1_555 A A 36  N6 ? ? A U -1  A A 25  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog19  hydrog ? ? A U 11  N3 ? ? ? 1_555 A G 35  O6 ? ? A U 0   A G 24  1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog20  hydrog ? ? A U 11  O2 ? ? ? 1_555 A G 35  N1 ? ? A U 0   A G 24  1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog21  hydrog ? ? A G 12  N1 ? ? ? 1_555 A C 34  N3 ? ? A G 1   A C 23  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog22  hydrog ? ? A G 12  N2 ? ? ? 1_555 A C 34  O2 ? ? A G 1   A C 23  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog23  hydrog ? ? A G 12  O6 ? ? ? 1_555 A C 34  N4 ? ? A G 1   A C 23  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog24  hydrog ? ? A G 12  N2 ? ? ? 1_555 A A 228 N3 ? ? A G 1   A A 217 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? 
hydrog25  hydrog ? ? A G 13  N1 ? ? ? 1_555 A C 33  N3 ? ? A G 2   A C 22  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog26  hydrog ? ? A G 13  N2 ? ? ? 1_555 A C 33  O2 ? ? A G 2   A C 22  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog27  hydrog ? ? A G 13  O6 ? ? ? 1_555 A C 33  N4 ? ? A G 2   A C 22  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog28  hydrog ? ? A U 14  N3 ? ? ? 1_555 A A 32  N1 ? ? A U 3   A A 21  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog29  hydrog ? ? A U 14  O4 ? ? ? 1_555 A A 32  N6 ? ? A U 3   A A 21  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog30  hydrog ? ? A A 15  N1 ? ? ? 1_555 A U 31  N3 ? ? A A 4   A U 20  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog31  hydrog ? ? A A 15  N6 ? ? ? 1_555 A U 31  O4 ? ? A A 4   A U 20  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog32  hydrog ? ? A G 16  O6 ? ? ? 1_555 A A 23  N6 ? ? A G 5   A A 12  1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? 
hydrog33  hydrog ? ? A G 16  N1 ? ? ? 1_555 A C 30  N3 ? ? A G 5   A C 19  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog34  hydrog ? ? A G 16  N2 ? ? ? 1_555 A C 30  O2 ? ? A G 5   A C 19  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog35  hydrog ? ? A G 16  O6 ? ? ? 1_555 A C 30  N4 ? ? A G 5   A C 19  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog36  hydrog ? ? A A 17  N1 ? ? ? 1_555 A U 29  N3 ? ? A A 6   A U 18  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog37  hydrog ? ? A A 17  N6 ? ? ? 1_555 A U 29  O4 ? ? A A 6   A U 18  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog38  hydrog ? ? A C 18  N3 ? ? ? 1_555 A G 28  N1 ? ? A C 7   A G 17  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog39  hydrog ? ? A C 18  N4 ? ? ? 1_555 A G 28  O6 ? ? A C 7   A G 17  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog40  hydrog ? ? A C 18  O2 ? ? ? 1_555 A G 28  N2 ? ? A C 7   A G 17  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog41  hydrog ? ? A U 19  N3 ? ? ? 1_555 A A 27  N1 ? ? A U 8   A A 16  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog42  hydrog ? ? A U 19  O4 ? ? ? 1_555 A A 27  N6 ? ? A U 8   A A 16  1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog43  hydrog ? ? A C 20  N3 ? ? ? 1_555 A A 26  N6 ? ? A C 9   A A 15  1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? 
hydrog44  hydrog ? ? A G 21  N1 ? ? ? 1_555 A C 126 N3 ? ? A G 10  A C 115 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog45  hydrog ? ? A G 21  N2 ? ? ? 1_555 A C 126 O2 ? ? A G 10  A C 115 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog46  hydrog ? ? A G 21  O6 ? ? ? 1_555 A C 126 N4 ? ? A G 10  A C 115 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog47  hydrog ? ? A C 22  N3 ? ? ? 1_555 A G 125 N1 ? ? A C 11  A G 114 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog48  hydrog ? ? A C 22  N4 ? ? ? 1_555 A G 125 O6 ? ? A C 11  A G 114 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog49  hydrog ? ? A C 22  O2 ? ? ? 1_555 A G 125 N2 ? ? A C 11  A G 114 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog50  hydrog ? ? A G 25  N2 ? ? ? 1_555 A A 78  N1 ? ? A G 14  A A 67  1_555 ? ? ? ? ? ? TYPE_10_PAIR  ? ? 
hydrog51  hydrog ? ? A G 25  N3 ? ? ? 1_555 A A 78  N6 ? ? A G 14  A A 67  1_555 ? ? ? ? ? ? TYPE_10_PAIR  ? ? 
hydrog52  hydrog ? ? A A 48  N6 ? ? ? 1_555 A A 279 N3 ? ? A A 37  A A 268 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? 
hydrog53  hydrog ? ? A G 49  O6 ? ? ? 1_555 A G 278 N2 ? ? A G 38  A G 267 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? 
hydrog54  hydrog ? ? A G 54  N1 ? ? ? 1_555 A C 255 N3 ? ? A G 43  A C 244 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog55  hydrog ? ? A G 54  N2 ? ? ? 1_555 A C 255 O2 ? ? A G 43  A C 244 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog56  hydrog ? ? A G 54  O6 ? ? ? 1_555 A C 255 N4 ? ? A G 43  A C 244 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog57  hydrog ? ? A A 55  N1 ? ? ? 1_555 A U 254 N3 ? ? A A 44  A U 243 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog58  hydrog ? ? A A 55  N6 ? ? ? 1_555 A U 254 O4 ? ? A A 44  A U 243 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog59  hydrog ? ? A C 56  N3 ? ? ? 1_555 A G 253 N1 ? ? A C 45  A G 242 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog60  hydrog ? ? A C 56  N4 ? ? ? 1_555 A G 253 O6 ? ? A C 45  A G 242 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog61  hydrog ? ? A C 56  O2 ? ? ? 1_555 A G 253 N2 ? ? A C 45  A G 242 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog62  hydrog ? ? A G 57  N1 ? ? ? 1_555 A C 252 N3 ? ? A G 46  A C 241 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog63  hydrog ? ? A G 57  N2 ? ? ? 1_555 A C 252 O2 ? ? A G 46  A C 241 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog64  hydrog ? ? A G 57  O6 ? ? ? 1_555 A C 252 N4 ? ? A G 46  A C 241 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog65  hydrog ? ? A G 58  N1 ? ? ? 1_555 A C 251 N3 ? ? A G 47  A C 240 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog66  hydrog ? ? A G 58  N2 ? ? ? 1_555 A C 251 O2 ? ? A G 47  A C 240 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog67  hydrog ? ? A G 58  O6 ? ? ? 1_555 A C 251 N4 ? ? A G 47  A C 240 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog68  hydrog ? ? A C 59  N3 ? ? ? 1_555 A G 250 N1 ? ? A C 48  A G 239 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog69  hydrog ? ? A C 59  N4 ? ? ? 1_555 A G 250 O6 ? ? A C 48  A G 239 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog70  hydrog ? ? A C 59  O2 ? ? ? 1_555 A G 250 N2 ? ? A C 48  A G 239 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog71  hydrog ? ? A C 60  N3 ? ? ? 1_555 A G 249 N1 ? ? A C 49  A G 238 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog72  hydrog ? ? A C 60  N4 ? ? ? 1_555 A G 249 O6 ? ? A C 49  A G 238 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog73  hydrog ? ? A C 60  O2 ? ? ? 1_555 A G 249 N2 ? ? A C 49  A G 238 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog74  hydrog ? ? A A 61  N1 ? ? ? 1_555 A U 248 N3 ? ? A A 50  A U 237 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog75  hydrog ? ? A A 61  N6 ? ? ? 1_555 A U 248 O4 ? ? A A 50  A U 237 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog76  hydrog ? ? A A 62  N6 ? ? ? 1_555 A G 66  O6 ? ? A A 51  A G 55  1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? 
hydrog77  hydrog ? ? A A 62  N6 ? ? ? 1_555 A G 240 O6 ? ? A A 51  A G 229 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? 
hydrog78  hydrog ? ? A A 62  N6 ? ? ? 1_555 A U 241 O4 ? ? A A 51  A U 230 1_555 ? ? ? ? ? ? 'A-U PAIR'    ? ? 
hydrog79  hydrog ? ? A A 63  N1 ? ? ? 1_555 A U 244 N3 ? ? A A 52  A U 233 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog80  hydrog ? ? A A 63  N6 ? ? ? 1_555 A U 244 O4 ? ? A A 52  A U 233 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog81  hydrog ? ? A U 64  N3 ? ? ? 1_555 A A 243 N1 ? ? A U 53  A A 232 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog82  hydrog ? ? A U 64  O4 ? ? ? 1_555 A A 243 N6 ? ? A U 53  A A 232 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog83  hydrog ? ? A U 65  N3 ? ? ? 1_555 A A 242 N1 ? ? A U 54  A A 231 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog84  hydrog ? ? A U 65  O4 ? ? ? 1_555 A A 242 N6 ? ? A U 54  A A 231 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog85  hydrog ? ? A G 66  N1 ? ? ? 1_555 A U 241 O2 ? ? A G 55  A U 230 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog86  hydrog ? ? A G 66  O6 ? ? ? 1_555 A U 241 N3 ? ? A G 55  A U 230 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog87  hydrog ? ? A C 67  N3 ? ? ? 1_555 A G 240 N1 ? ? A C 56  A G 229 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog88  hydrog ? ? A C 67  N4 ? ? ? 1_555 A G 240 O6 ? ? A C 56  A G 229 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog89  hydrog ? ? A C 67  O2 ? ? ? 1_555 A G 240 N2 ? ? A C 56  A G 229 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog90  hydrog ? ? A G 68  N1 ? ? ? 1_555 A U 239 O2 ? ? A G 57  A U 228 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog91  hydrog ? ? A G 68  O6 ? ? ? 1_555 A U 239 N3 ? ? A G 57  A U 228 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog92  hydrog ? ? A G 69  N1 ? ? ? 1_555 A U 238 O2 ? ? A G 58  A U 227 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog93  hydrog ? ? A G 69  O6 ? ? ? 1_555 A U 238 N3 ? ? A G 58  A U 227 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog94  hydrog ? ? A G 70  N1 ? ? ? 1_555 A C 237 N3 ? ? A G 59  A C 226 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog95  hydrog ? ? A G 70  N2 ? ? ? 1_555 A C 237 O2 ? ? A G 59  A C 226 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog96  hydrog ? ? A G 70  O6 ? ? ? 1_555 A C 237 N4 ? ? A G 59  A C 226 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog97  hydrog ? ? A A 71  N1 ? ? ? 1_555 A U 236 N3 ? ? A A 60  A U 225 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog98  hydrog ? ? A A 71  N6 ? ? ? 1_555 A U 236 O4 ? ? A A 60  A U 225 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog99  hydrog ? ? A A 72  N1 ? ? ? 1_555 A U 235 N3 ? ? A A 61  A U 224 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog100 hydrog ? ? A A 72  N6 ? ? ? 1_555 A U 235 O4 ? ? A A 61  A U 224 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog101 hydrog ? ? A A 73  N1 ? ? ? 1_555 A A 234 N6 ? ? A A 62  A A 223 1_555 ? ? ? ? ? ? TYPE_5_PAIR   ? ? 
hydrog102 hydrog ? ? A A 73  N6 ? ? ? 1_555 A A 234 N7 ? ? A A 62  A A 223 1_555 ? ? ? ? ? ? TYPE_5_PAIR   ? ? 
hydrog103 hydrog ? ? A G 74  N1 ? ? ? 1_555 A C 233 N3 ? ? A G 63  A C 222 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog104 hydrog ? ? A G 74  N2 ? ? ? 1_555 A C 233 O2 ? ? A G 63  A C 222 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog105 hydrog ? ? A G 74  O6 ? ? ? 1_555 A C 233 N4 ? ? A G 63  A C 222 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog106 hydrog ? ? A G 75  N1 ? ? ? 1_555 A U 232 O2 ? ? A G 64  A U 221 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog107 hydrog ? ? A G 75  O6 ? ? ? 1_555 A U 232 N3 ? ? A G 64  A U 221 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog108 hydrog ? ? A G 76  N1 ? ? ? 1_555 A C 231 N3 ? ? A G 65  A C 220 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog109 hydrog ? ? A G 76  N2 ? ? ? 1_555 A C 231 O2 ? ? A G 65  A C 220 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog110 hydrog ? ? A G 76  O6 ? ? ? 1_555 A C 231 N4 ? ? A G 65  A C 220 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog111 hydrog ? ? A G 77  N2 ? ? ? 1_555 A G 230 N7 ? ? A G 66  A G 219 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? 
hydrog112 hydrog ? ? A G 84  N1 ? ? ? 1_555 A A 152 N3 ? ? A G 73  A A 141 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? 
hydrog113 hydrog ? ? A C 85  N3 ? ? ? 1_555 A G 151 N1 ? ? A C 74  A G 140 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog114 hydrog ? ? A C 85  N4 ? ? ? 1_555 A G 151 O6 ? ? A C 74  A G 140 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog115 hydrog ? ? A C 85  O2 ? ? ? 1_555 A G 151 N2 ? ? A C 74  A G 140 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog116 hydrog ? ? A C 86  N3 ? ? ? 1_555 A G 150 N1 ? ? A C 75  A G 139 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog117 hydrog ? ? A C 86  N4 ? ? ? 1_555 A G 150 O6 ? ? A C 75  A G 139 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog118 hydrog ? ? A C 86  O2 ? ? ? 1_555 A G 150 N2 ? ? A C 75  A G 139 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog119 hydrog ? ? A G 87  N1 ? ? ? 1_555 A C 149 N3 ? ? A G 76  A C 138 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog120 hydrog ? ? A G 87  N2 ? ? ? 1_555 A C 149 O2 ? ? A G 76  A C 138 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog121 hydrog ? ? A G 87  O6 ? ? ? 1_555 A C 149 N4 ? ? A G 76  A C 138 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog122 hydrog ? ? A U 89  N3 ? ? ? 1_555 A A 148 N1 ? ? A U 78  A A 137 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog123 hydrog ? ? A U 89  O4 ? ? ? 1_555 A A 148 N6 ? ? A U 78  A A 137 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog124 hydrog ? ? A C 90  N3 ? ? ? 1_555 A G 147 N1 ? ? A C 79  A G 136 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog125 hydrog ? ? A C 90  N4 ? ? ? 1_555 A G 147 O6 ? ? A C 79  A G 136 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog126 hydrog ? ? A C 90  O2 ? ? ? 1_555 A G 147 N2 ? ? A C 79  A G 136 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog127 hydrog ? ? A A 91  N1 ? ? ? 1_555 A U 146 N3 ? ? A A 80  A U 135 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog128 hydrog ? ? A A 91  N6 ? ? ? 1_555 A U 146 O4 ? ? A A 80  A U 135 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog129 hydrog ? ? A G 92  N1 ? ? ? 1_555 A C 145 N3 ? ? A G 81  A C 134 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog130 hydrog ? ? A G 92  N2 ? ? ? 1_555 A C 145 O2 ? ? A G 81  A C 134 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog131 hydrog ? ? A G 92  O6 ? ? ? 1_555 A C 145 N4 ? ? A G 81  A C 134 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog132 hydrog ? ? A U 93  N3 ? ? ? 1_555 A A 143 N1 ? ? A U 82  A A 132 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog133 hydrog ? ? A U 93  O4 ? ? ? 1_555 A A 143 N6 ? ? A U 82  A A 132 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog134 hydrog ? ? A A 94  N1 ? ? ? 1_555 A U 138 N3 ? ? A A 83  A U 127 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog135 hydrog ? ? A A 94  N6 ? ? ? 1_555 A U 138 O4 ? ? A A 83  A U 127 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog136 hydrog ? ? A C 95  N3 ? ? ? 1_555 A G 137 N1 ? ? A C 84  A G 126 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog137 hydrog ? ? A C 95  N4 ? ? ? 1_555 A G 137 O6 ? ? A C 84  A G 126 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog138 hydrog ? ? A C 95  O2 ? ? ? 1_555 A G 137 N2 ? ? A C 84  A G 126 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog139 hydrog ? ? A C 96  O2 ? ? ? 1_555 A G 120 N2 ? ? A C 85  A G 109 1_555 ? ? ? ? ? ? 'C-G PAIR'    ? ? 
hydrog140 hydrog ? ? A C 96  N3 ? ? ? 1_555 A G 136 N1 ? ? A C 85  A G 125 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog141 hydrog ? ? A C 96  N4 ? ? ? 1_555 A G 136 O6 ? ? A C 85  A G 125 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog142 hydrog ? ? A C 96  O2 ? ? ? 1_555 A G 136 N2 ? ? A C 85  A G 125 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog143 hydrog ? ? A G 99  N1 ? ? ? 1_555 A U 118 O2 ? ? A G 88  A U 107 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog144 hydrog ? ? A G 99  O6 ? ? ? 1_555 A U 118 N3 ? ? A G 88  A U 107 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog145 hydrog ? ? A U 100 N3 ? ? ? 1_555 A A 117 N1 ? ? A U 89  A A 106 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog146 hydrog ? ? A U 100 O4 ? ? ? 1_555 A A 117 N6 ? ? A U 89  A A 106 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog147 hydrog ? ? A C 101 N3 ? ? ? 1_555 A G 116 N1 ? ? A C 90  A G 105 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog148 hydrog ? ? A C 101 N4 ? ? ? 1_555 A G 116 O6 ? ? A C 90  A G 105 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog149 hydrog ? ? A C 101 O2 ? ? ? 1_555 A G 116 N2 ? ? A C 90  A G 105 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog150 hydrog ? ? A U 102 N3 ? ? ? 1_555 A A 115 N1 ? ? A U 91  A A 104 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog151 hydrog ? ? A U 102 O4 ? ? ? 1_555 A A 115 N6 ? ? A U 91  A A 104 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog152 hydrog ? ? A G 105 N1 ? ? ? 1_555 A U 112 O2 ? ? A G 94  A U 101 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog153 hydrog ? ? A G 105 O6 ? ? ? 1_555 A U 112 N3 ? ? A G 94  A U 101 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog154 hydrog ? ? A G 105 N2 ? ? ? 1_555 A U 113 O4 ? ? A G 94  A U 102 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? 
hydrog155 hydrog ? ? A G 106 N1 ? ? ? 1_555 A C 111 N3 ? ? A G 95  A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog156 hydrog ? ? A G 106 N2 ? ? ? 1_555 A C 111 O2 ? ? A G 95  A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog157 hydrog ? ? A G 106 O6 ? ? ? 1_555 A C 111 N4 ? ? A G 95  A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog158 hydrog ? ? A G 107 N2 ? ? ? 1_555 A A 110 N7 ? ? A G 96  A A 99  1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? 
hydrog159 hydrog ? ? A G 120 N2 ? ? ? 1_555 A G 137 N3 ? ? A G 109 A G 126 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? 
hydrog160 hydrog ? ? A C 121 N3 ? ? ? 1_555 A G 131 N1 ? ? A C 110 A G 120 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog161 hydrog ? ? A C 121 N4 ? ? ? 1_555 A G 131 O6 ? ? A C 110 A G 120 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog162 hydrog ? ? A C 121 O2 ? ? ? 1_555 A G 131 N2 ? ? A C 110 A G 120 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog163 hydrog ? ? A C 122 N3 ? ? ? 1_555 A G 130 N1 ? ? A C 111 A G 119 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog164 hydrog ? ? A C 122 N4 ? ? ? 1_555 A G 130 O6 ? ? A C 111 A G 119 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog165 hydrog ? ? A C 122 O2 ? ? ? 1_555 A G 130 N2 ? ? A C 111 A G 119 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog166 hydrog ? ? A U 123 N3 ? ? ? 1_555 A A 129 N1 ? ? A U 112 A A 118 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog167 hydrog ? ? A U 123 O4 ? ? ? 1_555 A A 129 N6 ? ? A U 112 A A 118 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog168 hydrog ? ? A C 124 O2 ? ? ? 1_555 A A 128 N6 ? ? A C 113 A A 117 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? 
hydrog169 hydrog ? ? A A 140 N3 ? ? ? 1_555 A A 148 N6 ? ? A A 129 A A 137 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? 
hydrog170 hydrog ? ? A C 159 N4 ? ? ? 1_555 A U 349 O2 ? ? A C 148 A U 338 1_555 ? ? ? ? ? ? 'C-U MISPAIR' ? ? 
hydrog171 hydrog ? ? A A 162 N6 ? ? ? 1_555 A C 347 O2 ? ? A A 151 A C 336 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? 
hydrog172 hydrog ? ? A A 163 N6 ? ? ? 1_555 A C 347 O2 ? ? A A 152 A C 336 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? 
hydrog173 hydrog ? ? A C 164 N3 ? ? ? 1_555 A G 345 N1 ? ? A C 153 A G 334 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog174 hydrog ? ? A C 164 N4 ? ? ? 1_555 A G 345 O6 ? ? A C 153 A G 334 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog175 hydrog ? ? A C 164 O2 ? ? ? 1_555 A G 345 N2 ? ? A C 153 A G 334 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog176 hydrog ? ? A C 165 N3 ? ? ? 1_555 A G 344 N1 ? ? A C 154 A G 333 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog177 hydrog ? ? A C 165 N4 ? ? ? 1_555 A G 344 O6 ? ? A C 154 A G 333 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog178 hydrog ? ? A C 165 O2 ? ? ? 1_555 A G 344 N2 ? ? A C 154 A G 333 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog179 hydrog ? ? A A 166 N1 ? ? ? 1_555 A U 342 N3 ? ? A A 155 A U 331 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog180 hydrog ? ? A A 166 N6 ? ? ? 1_555 A U 342 O4 ? ? A A 155 A U 331 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog181 hydrog ? ? A C 167 N3 ? ? ? 1_555 A G 341 N1 ? ? A C 156 A G 330 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog182 hydrog ? ? A C 167 N4 ? ? ? 1_555 A G 341 O6 ? ? A C 156 A G 330 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog183 hydrog ? ? A C 167 O2 ? ? ? 1_555 A G 341 N2 ? ? A C 156 A G 330 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog184 hydrog ? ? A G 168 N1 ? ? ? 1_555 A C 339 N3 ? ? A G 157 A C 328 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog185 hydrog ? ? A G 168 N2 ? ? ? 1_555 A C 339 O2 ? ? A G 157 A C 328 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog186 hydrog ? ? A G 168 O6 ? ? ? 1_555 A C 339 N4 ? ? A G 157 A C 328 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog187 hydrog ? ? A G 168 N2 ? ? ? 1_555 A A 340 N7 ? ? A G 157 A A 329 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? 
hydrog188 hydrog ? ? A C 169 N3 ? ? ? 1_555 A G 338 N1 ? ? A C 158 A G 327 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog189 hydrog ? ? A C 169 N4 ? ? ? 1_555 A G 338 O6 ? ? A C 158 A G 327 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog190 hydrog ? ? A C 169 O2 ? ? ? 1_555 A G 338 N2 ? ? A C 158 A G 327 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog191 hydrog ? ? A A 170 N1 ? ? ? 1_555 A U 337 N3 ? ? A A 159 A U 326 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog192 hydrog ? ? A A 170 N6 ? ? ? 1_555 A U 337 O4 ? ? A A 159 A U 326 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog193 hydrog ? ? A G 171 N1 ? ? ? 1_555 A C 336 N3 ? ? A G 160 A C 325 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog194 hydrog ? ? A G 171 N2 ? ? ? 1_555 A C 336 O2 ? ? A G 160 A C 325 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog195 hydrog ? ? A G 171 O6 ? ? ? 1_555 A C 336 N4 ? ? A G 160 A C 325 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog196 hydrog ? ? A U 172 N3 ? ? ? 1_555 A A 335 N1 ? ? A U 161 A A 324 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog197 hydrog ? ? A U 172 O4 ? ? ? 1_555 A A 335 N6 ? ? A U 161 A A 324 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog198 hydrog ? ? A G 176 N1 ? ? ? 1_555 A U 210 O2 ? ? A G 165 A U 199 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog199 hydrog ? ? A G 176 O6 ? ? ? 1_555 A U 210 N3 ? ? A G 165 A U 199 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog200 hydrog ? ? A U 177 N3 ? ? ? 1_555 A A 209 N1 ? ? A U 166 A A 198 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog201 hydrog ? ? A U 177 O4 ? ? ? 1_555 A A 209 N6 ? ? A U 166 A A 198 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog202 hydrog ? ? A C 178 N4 ? ? ? 1_555 A G 208 O6 ? ? A C 167 A G 197 1_555 ? ? ? ? ? ? 'C-G PAIR'    ? ? 
hydrog203 hydrog ? ? A U 180 N3 ? ? ? 1_555 A A 205 N1 ? ? A U 169 A A 194 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog204 hydrog ? ? A U 180 O4 ? ? ? 1_555 A A 205 N6 ? ? A U 169 A A 194 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog205 hydrog ? ? A G 183 N1 ? ? ? 1_555 A U 204 O2 ? ? A G 172 A U 193 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog206 hydrog ? ? A G 183 O6 ? ? ? 1_555 A U 204 N3 ? ? A G 172 A U 193 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog207 hydrog ? ? A U 184 N3 ? ? ? 1_555 A A 203 N1 ? ? A U 173 A A 192 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog208 hydrog ? ? A U 184 O4 ? ? ? 1_555 A A 203 N6 ? ? A U 173 A A 192 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog209 hydrog ? ? A C 185 N3 ? ? ? 1_555 A G 202 N1 ? ? A C 174 A G 191 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog210 hydrog ? ? A C 185 N4 ? ? ? 1_555 A G 202 O6 ? ? A C 174 A G 191 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog211 hydrog ? ? A C 185 O2 ? ? ? 1_555 A G 202 N2 ? ? A C 174 A G 191 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog212 hydrog ? ? A A 186 N1 ? ? ? 1_555 A U 201 N3 ? ? A A 175 A U 190 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog213 hydrog ? ? A A 186 N6 ? ? ? 1_555 A U 201 O4 ? ? A A 175 A U 190 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog214 hydrog ? ? A A 187 N1 ? ? ? 1_555 A U 200 N3 ? ? A A 176 A U 189 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog215 hydrog ? ? A A 187 N6 ? ? ? 1_555 A U 200 O4 ? ? A A 176 A U 189 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog216 hydrog ? ? A C 188 N3 ? ? ? 1_555 A G 199 N1 ? ? A C 177 A G 188 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog217 hydrog ? ? A C 188 N4 ? ? ? 1_555 A G 199 O6 ? ? A C 177 A G 188 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog218 hydrog ? ? A C 188 O2 ? ? ? 1_555 A G 199 N2 ? ? A C 177 A G 188 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog219 hydrog ? ? A A 189 N1 ? ? ? 1_555 A U 198 N3 ? ? A A 178 A U 187 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog220 hydrog ? ? A A 189 N6 ? ? ? 1_555 A U 198 O4 ? ? A A 178 A U 187 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog221 hydrog ? ? A G 190 N1 ? ? ? 1_555 A C 197 N3 ? ? A G 179 A C 186 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog222 hydrog ? ? A G 190 N2 ? ? ? 1_555 A C 197 O2 ? ? A G 179 A C 186 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog223 hydrog ? ? A G 190 O6 ? ? ? 1_555 A C 197 N4 ? ? A G 179 A C 186 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog224 hydrog ? ? A C 191 N3 ? ? ? 1_555 A G 196 N1 ? ? A C 180 A G 185 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog225 hydrog ? ? A C 191 N4 ? ? ? 1_555 A G 196 O6 ? ? A C 180 A G 185 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog226 hydrog ? ? A C 191 O2 ? ? ? 1_555 A G 196 N2 ? ? A C 180 A G 185 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog227 hydrog ? ? A U 216 O2 ? ? ? 1_555 A C 221 N4 ? ? A U 205 A C 210 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? 
hydrog228 hydrog ? ? A G 218 N1 ? ? ? 1_555 A C 304 N3 ? ? A G 207 A C 293 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog229 hydrog ? ? A G 218 N2 ? ? ? 1_555 A C 304 O2 ? ? A G 207 A C 293 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog230 hydrog ? ? A G 218 O6 ? ? ? 1_555 A C 304 N4 ? ? A G 207 A C 293 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog231 hydrog ? ? A A 219 N1 ? ? ? 1_555 A U 303 N3 ? ? A A 208 A U 292 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog232 hydrog ? ? A A 219 N6 ? ? ? 1_555 A U 303 O4 ? ? A A 208 A U 292 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog233 hydrog ? ? A U 220 N3 ? ? ? 1_555 A C 302 N3 ? ? A U 209 A C 291 1_555 ? ? ? ? ? ? TYPE_18_PAIR  ? ? 
hydrog234 hydrog ? ? A U 220 O4 ? ? ? 1_555 A C 302 N4 ? ? A U 209 A C 291 1_555 ? ? ? ? ? ? TYPE_18_PAIR  ? ? 
hydrog235 hydrog ? ? A C 221 N3 ? ? ? 1_555 A G 301 N1 ? ? A C 210 A G 290 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog236 hydrog ? ? A C 221 N4 ? ? ? 1_555 A G 301 O6 ? ? A C 210 A G 290 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog237 hydrog ? ? A C 221 O2 ? ? ? 1_555 A G 301 N2 ? ? A C 210 A G 290 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog238 hydrog ? ? A C 222 N3 ? ? ? 1_555 A G 300 N1 ? ? A C 211 A G 289 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog239 hydrog ? ? A C 222 N4 ? ? ? 1_555 A G 300 O6 ? ? A C 211 A G 289 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog240 hydrog ? ? A C 222 O2 ? ? ? 1_555 A G 300 N2 ? ? A C 211 A G 289 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog241 hydrog ? ? A A 223 N1 ? ? ? 1_555 A U 299 N3 ? ? A A 212 A U 288 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog242 hydrog ? ? A A 223 N6 ? ? ? 1_555 A U 299 O4 ? ? A A 212 A U 288 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog243 hydrog ? ? A A 224 N1 ? ? ? 1_555 A U 298 N3 ? ? A A 213 A U 287 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog244 hydrog ? ? A A 224 N6 ? ? ? 1_555 A U 298 O4 ? ? A A 213 A U 287 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog245 hydrog ? ? A C 225 N3 ? ? ? 1_555 A G 297 N1 ? ? A C 214 A G 286 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog246 hydrog ? ? A C 225 N4 ? ? ? 1_555 A G 297 O6 ? ? A C 214 A G 286 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog247 hydrog ? ? A C 225 O2 ? ? ? 1_555 A G 297 N2 ? ? A C 214 A G 286 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog248 hydrog ? ? A C 226 N3 ? ? ? 1_555 A G 296 N1 ? ? A C 215 A G 285 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog249 hydrog ? ? A C 226 N4 ? ? ? 1_555 A G 296 O6 ? ? A C 215 A G 285 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog250 hydrog ? ? A C 226 O2 ? ? ? 1_555 A G 296 N2 ? ? A C 215 A G 285 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog251 hydrog ? ? A A 228 N6 ? ? ? 1_555 A U 293 O4 ? ? A A 217 A U 282 1_555 ? ? ? ? ? ? 'A-U PAIR'    ? ? 
hydrog252 hydrog ? ? A G 258 N1 ? ? ? 1_555 A U 277 O2 ? ? A G 247 A U 266 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog253 hydrog ? ? A G 258 O6 ? ? ? 1_555 A U 277 N3 ? ? A G 247 A U 266 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog254 hydrog ? ? A G 259 N1 ? ? ? 1_555 A C 276 N3 ? ? A G 248 A C 265 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog255 hydrog ? ? A G 259 N2 ? ? ? 1_555 A C 276 O2 ? ? A G 248 A C 265 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog256 hydrog ? ? A G 259 O6 ? ? ? 1_555 A C 276 N4 ? ? A G 248 A C 265 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog257 hydrog ? ? A A 260 N1 ? ? ? 1_555 A U 275 N3 ? ? A A 249 A U 264 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog258 hydrog ? ? A A 260 N6 ? ? ? 1_555 A U 275 O4 ? ? A A 249 A U 264 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog259 hydrog ? ? A G 261 N1 ? ? ? 1_555 A C 274 N3 ? ? A G 250 A C 263 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog260 hydrog ? ? A G 261 N2 ? ? ? 1_555 A C 274 O2 ? ? A G 250 A C 263 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog261 hydrog ? ? A G 261 O6 ? ? ? 1_555 A C 274 N4 ? ? A G 250 A C 263 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog262 hydrog ? ? A G 262 N1 ? ? ? 1_555 A C 273 N3 ? ? A G 251 A C 262 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog263 hydrog ? ? A G 262 N2 ? ? ? 1_555 A C 273 O2 ? ? A G 251 A C 262 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog264 hydrog ? ? A G 262 O6 ? ? ? 1_555 A C 273 N4 ? ? A G 251 A C 262 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog265 hydrog ? ? A C 263 N3 ? ? ? 1_555 A G 272 N1 ? ? A C 252 A G 261 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog266 hydrog ? ? A C 263 N4 ? ? ? 1_555 A G 272 O6 ? ? A C 252 A G 261 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog267 hydrog ? ? A C 263 O2 ? ? ? 1_555 A G 272 N2 ? ? A C 252 A G 261 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog268 hydrog ? ? A A 264 N1 ? ? ? 1_555 A U 271 N3 ? ? A A 253 A U 260 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog269 hydrog ? ? A A 264 N6 ? ? ? 1_555 A U 271 O4 ? ? A A 253 A U 260 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog270 hydrog ? ? A C 265 N3 ? ? ? 1_555 A G 270 N1 ? ? A C 254 A G 259 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog271 hydrog ? ? A C 265 N4 ? ? ? 1_555 A G 270 O6 ? ? A C 254 A G 259 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog272 hydrog ? ? A C 265 O2 ? ? ? 1_555 A G 270 N2 ? ? A C 254 A G 259 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog273 hydrog ? ? A U 293 N3 ? ? ? 1_555 A A 295 N7 ? ? A U 282 A A 284 1_555 ? ? ? ? ? ? HOOGSTEEN     ? ? 
hydrog274 hydrog ? ? A U 293 O4 ? ? ? 1_555 A A 295 N6 ? ? A U 282 A A 284 1_555 ? ? ? ? ? ? HOOGSTEEN     ? ? 
hydrog275 hydrog ? ? A A 305 N6 ? ? ? 1_555 A G 333 O6 ? ? A A 294 A G 322 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? 
hydrog276 hydrog ? ? A C 307 N3 ? ? ? 1_555 A G 332 N1 ? ? A C 296 A G 321 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog277 hydrog ? ? A C 307 N4 ? ? ? 1_555 A G 332 O6 ? ? A C 296 A G 321 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog278 hydrog ? ? A C 307 O2 ? ? ? 1_555 A G 332 N2 ? ? A C 296 A G 321 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog279 hydrog ? ? A G 308 N1 ? ? ? 1_555 A U 331 O2 ? ? A G 297 A U 320 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog280 hydrog ? ? A G 308 O6 ? ? ? 1_555 A U 331 N3 ? ? A G 297 A U 320 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog281 hydrog ? ? A G 309 N1 ? ? ? 1_555 A C 330 N3 ? ? A G 298 A C 319 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog282 hydrog ? ? A G 309 N2 ? ? ? 1_555 A C 330 O2 ? ? A G 298 A C 319 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog283 hydrog ? ? A G 309 O6 ? ? ? 1_555 A C 330 N4 ? ? A G 298 A C 319 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog284 hydrog ? ? A C 310 N3 ? ? ? 1_555 A G 329 N1 ? ? A C 299 A G 318 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog285 hydrog ? ? A C 310 N4 ? ? ? 1_555 A G 329 O6 ? ? A C 299 A G 318 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog286 hydrog ? ? A C 310 O2 ? ? ? 1_555 A G 329 N2 ? ? A C 299 A G 318 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog287 hydrog ? ? A G 311 N1 ? ? ? 1_555 A C 328 N3 ? ? A G 300 A C 317 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog288 hydrog ? ? A G 311 N2 ? ? ? 1_555 A C 328 O2 ? ? A G 300 A C 317 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog289 hydrog ? ? A G 311 O6 ? ? ? 1_555 A C 328 N4 ? ? A G 300 A C 317 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog290 hydrog ? ? A C 312 N3 ? ? ? 1_555 A G 327 N1 ? ? A C 301 A G 316 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog291 hydrog ? ? A C 312 N4 ? ? ? 1_555 A G 327 O6 ? ? A C 301 A G 316 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog292 hydrog ? ? A C 312 O2 ? ? ? 1_555 A G 327 N2 ? ? A C 301 A G 316 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog293 hydrog ? ? A G 313 N1 ? ? ? 1_555 A C 326 N3 ? ? A G 302 A C 315 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog294 hydrog ? ? A G 313 N2 ? ? ? 1_555 A C 326 O2 ? ? A G 302 A C 315 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog295 hydrog ? ? A G 313 O6 ? ? ? 1_555 A C 326 N4 ? ? A G 302 A C 315 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog296 hydrog ? ? A G 315 N1 ? ? ? 1_555 A U 325 O2 ? ? A G 304 A U 314 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog297 hydrog ? ? A G 315 O6 ? ? ? 1_555 A U 325 N3 ? ? A G 304 A U 314 1_555 ? ? ? ? ? ? TYPE_28_PAIR  ? ? 
hydrog298 hydrog ? ? A A 316 N1 ? ? ? 1_555 A U 324 N3 ? ? A A 305 A U 313 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog299 hydrog ? ? A A 316 N6 ? ? ? 1_555 A U 324 O4 ? ? A A 305 A U 313 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog300 hydrog ? ? A C 317 N3 ? ? ? 1_555 A A 323 N6 ? ? A C 306 A A 312 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? 
hydrog301 hydrog ? ? A A 318 N3 ? ? ? 1_555 A A 322 N6 ? ? A A 307 A A 311 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? 
# 
_struct_conn_type.id          hydrog 
_struct_conn_type.criteria    ? 
_struct_conn_type.reference   ? 
# 
_atom_sites.entry_id                    6WLN 
_atom_sites.Cartn_transf_matrix[1][1]   ? 
_atom_sites.Cartn_transf_matrix[1][2]   ? 
_atom_sites.Cartn_transf_matrix[1][3]   ? 
_atom_sites.Cartn_transf_matrix[2][1]   ? 
_atom_sites.Cartn_transf_matrix[2][2]   ? 
_atom_sites.Cartn_transf_matrix[2][3]   ? 
_atom_sites.Cartn_transf_matrix[3][1]   ? 
_atom_sites.Cartn_transf_matrix[3][2]   ? 
_atom_sites.Cartn_transf_matrix[3][3]   ? 
_atom_sites.Cartn_transf_vector[1]      ? 
_atom_sites.Cartn_transf_vector[2]      ? 
_atom_sites.Cartn_transf_vector[3]      ? 
_atom_sites.fract_transf_matrix[1][1]   1.000000 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   1.000000 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   1.000000 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
_atom_sites.solution_primary            ? 
_atom_sites.solution_secondary          ? 
_atom_sites.solution_hydrogens          ? 
_atom_sites.special_details             ? 
# 
loop_
_atom_type.symbol 
C 
H 
N 
O 
P 
# 
loop_
_atom_site.group_PDB 
_atom_site.id 
_atom_site.type_symbol 
_atom_site.label_atom_id 
_atom_site.label_alt_id 
_atom_site.label_comp_id 
_atom_site.label_asym_id 
_atom_site.label_entity_id 
_atom_site.label_seq_id 
_atom_site.pdbx_PDB_ins_code 
_atom_site.Cartn_x 
_atom_site.Cartn_y 
_atom_site.Cartn_z 
_atom_site.occupancy 
_atom_site.B_iso_or_equiv 
_atom_site.pdbx_formal_charge 
_atom_site.auth_seq_id 
_atom_site.auth_comp_id 
_atom_site.auth_asym_id 
_atom_site.auth_atom_id 
_atom_site.pdbx_PDB_model_num 
ATOM 1      C "C5'"  . G A 1 1   ? 148.475 144.644 135.643 1.00 0.00 ? -10 G A "C5'"  1  
ATOM 2      C "C4'"  . G A 1 1   ? 148.661 144.314 137.103 1.00 0.00 ? -10 G A "C4'"  1  
ATOM 3      O "O4'"  . G A 1 1   ? 149.833 145.032 137.572 1.00 0.00 ? -10 G A "O4'"  1  
ATOM 4      C "C3'"  . G A 1 1   ? 147.538 144.746 138.034 1.00 0.00 ? -10 G A "C3'"  1  
ATOM 5      O "O3'"  . G A 1 1   ? 146.502 143.785 138.134 1.00 0.00 ? -10 G A "O3'"  1  
ATOM 6      C "C2'"  . G A 1 1   ? 148.259 144.963 139.361 1.00 0.00 ? -10 G A "C2'"  1  
ATOM 7      O "O2'"  . G A 1 1   ? 148.476 143.733 140.037 1.00 0.00 ? -10 G A "O2'"  1  
ATOM 8      C "C1'"  . G A 1 1   ? 149.607 145.515 138.891 1.00 0.00 ? -10 G A "C1'"  1  
ATOM 9      N N9     . G A 1 1   ? 149.623 146.990 138.859 1.00 0.00 ? -10 G A N9     1  
ATOM 10     C C8     . G A 1 1   ? 149.625 147.798 137.748 1.00 0.00 ? -10 G A C8     1  
ATOM 11     N N7     . G A 1 1   ? 149.641 149.071 138.039 1.00 0.00 ? -10 G A N7     1  
ATOM 12     C C5     . G A 1 1   ? 149.651 149.106 139.426 1.00 0.00 ? -10 G A C5     1  
ATOM 13     C C6     . G A 1 1   ? 149.668 150.210 140.317 1.00 0.00 ? -10 G A C6     1  
ATOM 14     O O6     . G A 1 1   ? 149.680 151.416 140.049 1.00 0.00 ? -10 G A O6     1  
ATOM 15     N N1     . G A 1 1   ? 149.673 149.795 141.646 1.00 0.00 ? -10 G A N1     1  
ATOM 16     C C2     . G A 1 1   ? 149.660 148.487 142.064 1.00 0.00 ? -10 G A C2     1  
ATOM 17     N N2     . G A 1 1   ? 149.667 148.285 143.390 1.00 0.00 ? -10 G A N2     1  
ATOM 18     N N3     . G A 1 1   ? 149.644 147.449 141.243 1.00 0.00 ? -10 G A N3     1  
ATOM 19     C C4     . G A 1 1   ? 149.639 147.830 139.948 1.00 0.00 ? -10 G A C4     1  
ATOM 20     H "H4'"  . G A 1 1   ? 148.818 143.353 137.219 1.00 0.00 ? -10 G A "H4'"  1  
ATOM 21     H "H3'"  . G A 1 1   ? 147.161 145.593 137.720 1.00 0.00 ? -10 G A "H3'"  1  
ATOM 22     H "H2'"  . G A 1 1   ? 147.785 145.609 139.926 1.00 0.00 ? -10 G A "H2'"  1  
ATOM 23     H "HO2'" . G A 1 1   ? 147.773 143.100 139.780 1.00 0.00 ? -10 G A "HO2'" 1  
ATOM 24     H "H1'"  . G A 1 1   ? 150.317 145.194 139.485 1.00 0.00 ? -10 G A "H1'"  1  
ATOM 25     H H8     . G A 1 1   ? 149.615 147.455 136.830 1.00 0.00 ? -10 G A H8     1  
ATOM 26     H H1     . G A 1 1   ? 149.685 150.492 142.335 1.00 0.00 ? -10 G A H1     1  
ATOM 27     H H21    . G A 1 1   ? 149.679 149.048 144.004 1.00 0.00 ? -10 G A H21    1  
ATOM 28     H H22    . G A 1 1   ? 149.659 147.372 143.747 1.00 0.00 ? -10 G A H22    1  
ATOM 29     P P      . G A 1 2   ? 144.964 144.250 138.109 1.00 0.00 ? -9  G A P      1  
ATOM 30     O OP1    . G A 1 2   ? 144.114 143.044 138.282 1.00 0.00 ? -9  G A OP1    1  
ATOM 31     O OP2    . G A 1 2   ? 144.767 145.123 136.924 1.00 0.00 ? -9  G A OP2    1  
ATOM 32     O "O5'"  . G A 1 2   ? 144.811 145.151 139.415 1.00 0.00 ? -9  G A "O5'"  1  
ATOM 33     C "C5'"  . G A 1 2   ? 143.650 145.066 140.227 1.00 0.00 ? -9  G A "C5'"  1  
ATOM 34     C "C4'"  . G A 1 2   ? 143.775 143.977 141.263 1.00 0.00 ? -9  G A "C4'"  1  
ATOM 35     O "O4'"  . G A 1 2   ? 145.192 143.747 141.557 1.00 0.00 ? -9  G A "O4'"  1  
ATOM 36     C "C3'"  . G A 1 2   ? 143.075 144.233 142.589 1.00 0.00 ? -9  G A "C3'"  1  
ATOM 37     O "O3'"  . G A 1 2   ? 142.517 143.059 143.155 1.00 0.00 ? -9  G A "O3'"  1  
ATOM 38     C "C2'"  . G A 1 2   ? 144.221 144.733 143.477 1.00 0.00 ? -9  G A "C2'"  1  
ATOM 39     O "O2'"  . G A 1 2   ? 143.977 144.444 144.846 1.00 0.00 ? -9  G A "O2'"  1  
ATOM 40     C "C1'"  . G A 1 2   ? 145.373 143.856 142.969 1.00 0.00 ? -9  G A "C1'"  1  
ATOM 41     N N9     . G A 1 2   ? 146.691 144.460 143.238 1.00 0.00 ? -9  G A N9     1  
ATOM 42     C C8     . G A 1 2   ? 146.998 145.798 143.294 1.00 0.00 ? -9  G A C8     1  
ATOM 43     N N7     . G A 1 2   ? 148.257 146.026 143.551 1.00 0.00 ? -9  G A N7     1  
ATOM 44     C C5     . G A 1 2   ? 148.817 144.762 143.673 1.00 0.00 ? -9  G A C5     1  
ATOM 45     C C6     . G A 1 2   ? 150.153 144.371 143.951 1.00 0.00 ? -9  G A C6     1  
ATOM 46     O O6     . G A 1 2   ? 151.140 145.089 144.150 1.00 0.00 ? -9  G A O6     1  
ATOM 47     N N1     . G A 1 2   ? 150.285 142.986 143.985 1.00 0.00 ? -9  G A N1     1  
ATOM 48     C C2     . G A 1 2   ? 149.263 142.092 143.779 1.00 0.00 ? -9  G A C2     1  
ATOM 49     N N2     . G A 1 2   ? 149.586 140.792 143.853 1.00 0.00 ? -9  G A N2     1  
ATOM 50     N N3     . G A 1 2   ? 148.014 142.443 143.520 1.00 0.00 ? -9  G A N3     1  
ATOM 51     C C4     . G A 1 2   ? 147.864 143.784 143.483 1.00 0.00 ? -9  G A C4     1  
ATOM 52     H "H5'"  . G A 1 2   ? 142.874 144.879 139.658 1.00 0.00 ? -9  G A "H5'"  1  
ATOM 53     H "H5''" . G A 1 2   ? 143.513 145.925 140.680 1.00 0.00 ? -9  G A "H5''" 1  
ATOM 54     H "H4'"  . G A 1 2   ? 143.419 143.153 140.869 1.00 0.00 ? -9  G A "H4'"  1  
ATOM 55     H "H3'"  . G A 1 2   ? 142.374 144.910 142.498 1.00 0.00 ? -9  G A "H3'"  1  
ATOM 56     H "H2'"  . G A 1 2   ? 144.397 145.687 143.333 1.00 0.00 ? -9  G A "H2'"  1  
ATOM 57     H "HO2'" . G A 1 2   ? 144.581 144.983 145.399 1.00 0.00 ? -9  G A "HO2'" 1  
ATOM 58     H "H1'"  . G A 1 2   ? 145.324 142.975 143.395 1.00 0.00 ? -9  G A "H1'"  1  
ATOM 59     H H8     . G A 1 2   ? 146.339 146.509 143.154 1.00 0.00 ? -9  G A H8     1  
ATOM 60     H H1     . G A 1 2   ? 151.176 142.623 144.170 1.00 0.00 ? -9  G A H1     1  
ATOM 61     H H21    . G A 1 2   ? 150.508 140.523 144.044 1.00 0.00 ? -9  G A H21    1  
ATOM 62     H H22    . G A 1 2   ? 148.897 140.107 143.714 1.00 0.00 ? -9  G A H22    1  
ATOM 63     P P      . A A 1 3   ? 140.998 143.060 143.681 1.00 0.00 ? -8  A A P      1  
ATOM 64     O OP1    . A A 1 3   ? 140.480 144.448 143.590 1.00 0.00 ? -8  A A OP1    1  
ATOM 65     O OP2    . A A 1 3   ? 140.961 142.346 144.982 1.00 0.00 ? -8  A A OP2    1  
ATOM 66     O "O5'"  . A A 1 3   ? 140.219 142.172 142.610 1.00 0.00 ? -8  A A "O5'"  1  
ATOM 67     C "C5'"  . A A 1 3   ? 140.552 140.806 142.416 1.00 0.00 ? -8  A A "C5'"  1  
ATOM 68     C "C4'"  . A A 1 3   ? 141.579 140.635 141.325 1.00 0.00 ? -8  A A "C4'"  1  
ATOM 69     O "O4'"  . A A 1 3   ? 142.812 141.263 141.763 1.00 0.00 ? -8  A A "O4'"  1  
ATOM 70     C "C3'"  . A A 1 3   ? 141.968 139.202 140.993 1.00 0.00 ? -8  A A "C3'"  1  
ATOM 71     O "O3'"  . A A 1 3   ? 141.117 138.606 140.029 1.00 0.00 ? -8  A A "O3'"  1  
ATOM 72     C "C2'"  . A A 1 3   ? 143.394 139.350 140.493 1.00 0.00 ? -8  A A "C2'"  1  
ATOM 73     O "O2'"  . A A 1 3   ? 143.424 139.800 139.147 1.00 0.00 ? -8  A A "O2'"  1  
ATOM 74     C "C1'"  . A A 1 3   ? 143.909 140.455 141.397 1.00 0.00 ? -8  A A "C1'"  1  
ATOM 75     N N9     . A A 1 3   ? 144.518 139.924 142.631 1.00 0.00 ? -8  A A N9     1  
ATOM 76     C C8     . A A 1 3   ? 144.004 139.950 143.905 1.00 0.00 ? -8  A A C8     1  
ATOM 77     N N7     . A A 1 3   ? 144.783 139.396 144.800 1.00 0.00 ? -8  A A N7     1  
ATOM 78     C C5     . A A 1 3   ? 145.886 138.976 144.069 1.00 0.00 ? -8  A A C5     1  
ATOM 79     C C6     . A A 1 3   ? 147.071 138.316 144.437 1.00 0.00 ? -8  A A C6     1  
ATOM 80     N N6     . A A 1 3   ? 147.354 137.945 145.688 1.00 0.00 ? -8  A A N6     1  
ATOM 81     N N1     . A A 1 3   ? 147.967 138.043 143.464 1.00 0.00 ? -8  A A N1     1  
ATOM 82     C C2     . A A 1 3   ? 147.683 138.414 142.208 1.00 0.00 ? -8  A A C2     1  
ATOM 83     N N3     . A A 1 3   ? 146.606 139.039 141.739 1.00 0.00 ? -8  A A N3     1  
ATOM 84     C C4     . A A 1 3   ? 145.735 139.295 142.732 1.00 0.00 ? -8  A A C4     1  
ATOM 85     H "H5'"  . A A 1 3   ? 139.742 140.310 142.173 1.00 0.00 ? -8  A A "H5'"  1  
ATOM 86     H "H5''" . A A 1 3   ? 140.910 140.441 143.252 1.00 0.00 ? -8  A A "H5''" 1  
ATOM 87     H "H4'"  . A A 1 3   ? 141.276 141.079 140.506 1.00 0.00 ? -8  A A "H4'"  1  
ATOM 88     H "H3'"  . A A 1 3   ? 141.958 138.659 141.809 1.00 0.00 ? -8  A A "H3'"  1  
ATOM 89     H "H2'"  . A A 1 3   ? 143.903 138.521 140.611 1.00 0.00 ? -8  A A "H2'"  1  
ATOM 90     H "HO2'" . A A 1 3   ? 144.356 139.866 138.854 1.00 0.00 ? -8  A A "HO2'" 1  
ATOM 91     H "H1'"  . A A 1 3   ? 144.571 140.991 140.911 1.00 0.00 ? -8  A A "H1'"  1  
ATOM 92     H H8     . A A 1 3   ? 143.134 140.346 144.123 1.00 0.00 ? -8  A A H8     1  
ATOM 93     H H61    . A A 1 3   ? 148.198 137.487 145.884 1.00 0.00 ? -8  A A H61    1  
ATOM 94     H H62    . A A 1 3   ? 146.720 138.132 146.410 1.00 0.00 ? -8  A A H62    1  
ATOM 95     H H2     . A A 1 3   ? 148.366 138.193 141.540 1.00 0.00 ? -8  A A H2     1  
ATOM 96     P P      . U A 1 4   ? 141.264 137.045 139.676 1.00 0.00 ? -7  U A P      1  
ATOM 97     O OP1    . U A 1 4   ? 140.309 136.728 138.584 1.00 0.00 ? -7  U A OP1    1  
ATOM 98     O OP2    . U A 1 4   ? 141.206 136.281 140.947 1.00 0.00 ? -7  U A OP2    1  
ATOM 99     O "O5'"  . U A 1 4   ? 142.740 136.920 139.092 1.00 0.00 ? -7  U A "O5'"  1  
ATOM 100    C "C5'"  . U A 1 4   ? 143.272 135.659 138.719 1.00 0.00 ? -7  U A "C5'"  1  
ATOM 101    C "C4'"  . U A 1 4   ? 144.567 135.367 139.435 1.00 0.00 ? -7  U A "C4'"  1  
ATOM 102    O "O4'"  . U A 1 4   ? 144.734 136.285 140.548 1.00 0.00 ? -7  U A "O4'"  1  
ATOM 103    C "C3'"  . U A 1 4   ? 144.689 133.990 140.068 1.00 0.00 ? -7  U A "C3'"  1  
ATOM 104    O "O3'"  . U A 1 4   ? 145.039 132.982 139.138 1.00 0.00 ? -7  U A "O3'"  1  
ATOM 105    C "C2'"  . U A 1 4   ? 145.737 134.214 141.149 1.00 0.00 ? -7  U A "C2'"  1  
ATOM 106    O "O2'"  . U A 1 4   ? 147.047 134.246 140.601 1.00 0.00 ? -7  U A "O2'"  1  
ATOM 107    C "C1'"  . U A 1 4   ? 145.372 135.616 141.642 1.00 0.00 ? -7  U A "C1'"  1  
ATOM 108    N N1     . U A 1 4   ? 144.474 135.581 142.822 1.00 0.00 ? -7  U A N1     1  
ATOM 109    C C2     . U A 1 4   ? 145.048 135.276 144.043 1.00 0.00 ? -7  U A C2     1  
ATOM 110    O O2     . U A 1 4   ? 146.237 135.040 144.179 1.00 0.00 ? -7  U A O2     1  
ATOM 111    N N3     . U A 1 4   ? 144.178 135.256 145.106 1.00 0.00 ? -7  U A N3     1  
ATOM 112    C C4     . U A 1 4   ? 142.824 135.505 145.077 1.00 0.00 ? -7  U A C4     1  
ATOM 113    O O4     . U A 1 4   ? 142.176 135.448 146.123 1.00 0.00 ? -7  U A O4     1  
ATOM 114    C C5     . U A 1 4   ? 142.299 135.813 143.781 1.00 0.00 ? -7  U A C5     1  
ATOM 115    C C6     . U A 1 4   ? 143.123 135.841 142.728 1.00 0.00 ? -7  U A C6     1  
ATOM 116    H "H5'"  . U A 1 4   ? 143.432 135.651 137.751 1.00 0.00 ? -7  U A "H5'"  1  
ATOM 117    H "H5''" . U A 1 4   ? 142.621 134.961 138.939 1.00 0.00 ? -7  U A "H5''" 1  
ATOM 118    H "H4'"  . U A 1 4   ? 145.311 135.494 138.807 1.00 0.00 ? -7  U A "H4'"  1  
ATOM 119    H "H3'"  . U A 1 4   ? 143.837 133.757 140.492 1.00 0.00 ? -7  U A "H3'"  1  
ATOM 120    H "H2'"  . U A 1 4   ? 145.660 133.552 141.867 1.00 0.00 ? -7  U A "H2'"  1  
ATOM 121    H "HO2'" . U A 1 4   ? 147.038 133.810 139.724 1.00 0.00 ? -7  U A "HO2'" 1  
ATOM 122    H "H1'"  . U A 1 4   ? 146.191 136.103 141.874 1.00 0.00 ? -7  U A "H1'"  1  
ATOM 123    H H3     . U A 1 4   ? 144.565 135.041 145.981 1.00 0.00 ? -7  U A H3     1  
ATOM 124    H H5     . U A 1 4   ? 141.346 136.005 143.668 1.00 0.00 ? -7  U A H5     1  
ATOM 125    H H6     . U A 1 4   ? 142.741 136.053 141.853 1.00 0.00 ? -7  U A H6     1  
ATOM 126    P P      . C A 1 5   ? 144.564 131.463 139.372 1.00 0.00 ? -6  C A P      1  
ATOM 127    O OP1    . C A 1 5   ? 144.954 130.670 138.177 1.00 0.00 ? -6  C A OP1    1  
ATOM 128    O OP2    . C A 1 5   ? 143.143 131.486 139.803 1.00 0.00 ? -6  C A OP2    1  
ATOM 129    O "O5'"  . C A 1 5   ? 145.446 130.968 140.602 1.00 0.00 ? -6  C A "O5'"  1  
ATOM 130    C "C5'"  . C A 1 5   ? 146.821 130.651 140.432 1.00 0.00 ? -6  C A "C5'"  1  
ATOM 131    C "C4'"  . C A 1 5   ? 147.457 130.223 141.733 1.00 0.00 ? -6  C A "C4'"  1  
ATOM 132    O "O4'"  . C A 1 5   ? 147.342 131.286 142.715 1.00 0.00 ? -6  C A "O4'"  1  
ATOM 133    C "C3'"  . C A 1 5   ? 146.833 129.017 142.418 1.00 0.00 ? -6  C A "C3'"  1  
ATOM 134    O "O3'"  . C A 1 5   ? 147.243 127.783 141.854 1.00 0.00 ? -6  C A "O3'"  1  
ATOM 135    C "C2'"  . C A 1 5   ? 147.263 129.200 143.867 1.00 0.00 ? -6  C A "C2'"  1  
ATOM 136    O "O2'"  . C A 1 5   ? 148.615 128.804 144.057 1.00 0.00 ? -6  C A "O2'"  1  
ATOM 137    C "C1'"  . C A 1 5   ? 147.163 130.718 144.027 1.00 0.00 ? -6  C A "C1'"  1  
ATOM 138    N N1     . C A 1 5   ? 145.866 131.138 144.616 1.00 0.00 ? -6  C A N1     1  
ATOM 139    C C2     . C A 1 5   ? 145.686 130.984 145.997 1.00 0.00 ? -6  C A C2     1  
ATOM 140    O O2     . C A 1 5   ? 146.602 130.505 146.679 1.00 0.00 ? -6  C A O2     1  
ATOM 141    N N3     . C A 1 5   ? 144.514 131.359 146.559 1.00 0.00 ? -6  C A N3     1  
ATOM 142    C C4     . C A 1 5   ? 143.542 131.871 145.803 1.00 0.00 ? -6  C A C4     1  
ATOM 143    N N4     . C A 1 5   ? 142.403 132.227 146.402 1.00 0.00 ? -6  C A N4     1  
ATOM 144    C C5     . C A 1 5   ? 143.697 132.037 144.397 1.00 0.00 ? -6  C A C5     1  
ATOM 145    C C6     . C A 1 5   ? 144.859 131.665 143.852 1.00 0.00 ? -6  C A C6     1  
ATOM 146    H "H5'"  . C A 1 5   ? 147.290 131.440 140.093 1.00 0.00 ? -6  C A "H5'"  1  
ATOM 147    H "H5''" . C A 1 5   ? 146.903 129.925 139.782 1.00 0.00 ? -6  C A "H5''" 1  
ATOM 148    H "H4'"  . C A 1 5   ? 148.407 130.040 141.573 1.00 0.00 ? -6  C A "H4'"  1  
ATOM 149    H "H3'"  . C A 1 5   ? 145.855 129.087 142.364 1.00 0.00 ? -6  C A "H3'"  1  
ATOM 150    H "H2'"  . C A 1 5   ? 146.660 128.735 144.484 1.00 0.00 ? -6  C A "H2'"  1  
ATOM 151    H "HO2'" . C A 1 5   ? 148.841 128.887 145.005 1.00 0.00 ? -6  C A "HO2'" 1  
ATOM 152    H "H1'"  . C A 1 5   ? 147.895 131.034 144.595 1.00 0.00 ? -6  C A "H1'"  1  
ATOM 153    H H41    . C A 1 5   ? 142.301 132.111 147.370 1.00 0.00 ? -6  C A H41    1  
ATOM 154    H H42    . C A 1 5   ? 141.672 132.607 145.873 1.00 0.00 ? -6  C A H42    1  
ATOM 155    H H5     . C A 1 5   ? 142.977 132.417 143.849 1.00 0.00 ? -6  C A H5     1  
ATOM 156    H H6     . C A 1 5   ? 144.986 131.773 142.888 1.00 0.00 ? -6  C A H6     1  
ATOM 157    P P      . U A 1 6   ? 146.299 126.487 141.972 1.00 0.00 ? -5  U A P      1  
ATOM 158    O OP1    . U A 1 6   ? 146.921 125.392 141.184 1.00 0.00 ? -5  U A OP1    1  
ATOM 159    O OP2    . U A 1 6   ? 144.906 126.904 141.675 1.00 0.00 ? -5  U A OP2    1  
ATOM 160    O "O5'"  . U A 1 6   ? 146.378 126.093 143.513 1.00 0.00 ? -5  U A "O5'"  1  
ATOM 161    C "C5'"  . U A 1 6   ? 147.597 125.648 144.091 1.00 0.00 ? -5  U A "C5'"  1  
ATOM 162    C "C4'"  . U A 1 6   ? 147.476 125.481 145.586 1.00 0.00 ? -5  U A "C4'"  1  
ATOM 163    O "O4'"  . U A 1 6   ? 147.150 126.754 146.202 1.00 0.00 ? -5  U A "O4'"  1  
ATOM 164    C "C3'"  . U A 1 6   ? 146.381 124.545 146.070 1.00 0.00 ? -5  U A "C3'"  1  
ATOM 165    O "O3'"  . U A 1 6   ? 146.736 123.176 145.970 1.00 0.00 ? -5  U A "O3'"  1  
ATOM 166    C "C2'"  . U A 1 6   ? 146.151 125.013 147.500 1.00 0.00 ? -5  U A "C2'"  1  
ATOM 167    O "O2'"  . U A 1 6   ? 147.164 124.531 148.369 1.00 0.00 ? -5  U A "O2'"  1  
ATOM 168    C "C1'"  . U A 1 6   ? 146.301 126.528 147.352 1.00 0.00 ? -5  U A "C1'"  1  
ATOM 169    N N1     . U A 1 6   ? 144.995 127.212 147.198 1.00 0.00 ? -5  U A N1     1  
ATOM 170    C C2     . U A 1 6   ? 144.248 127.411 148.343 1.00 0.00 ? -5  U A C2     1  
ATOM 171    O O2     . U A 1 6   ? 144.617 127.054 149.449 1.00 0.00 ? -5  U A O2     1  
ATOM 172    N N3     . U A 1 6   ? 143.048 128.049 148.153 1.00 0.00 ? -5  U A N3     1  
ATOM 173    C C4     . U A 1 6   ? 142.524 128.498 146.959 1.00 0.00 ? -5  U A C4     1  
ATOM 174    O O4     . U A 1 6   ? 141.427 129.054 146.950 1.00 0.00 ? -5  U A O4     1  
ATOM 175    C C5     . U A 1 6   ? 143.352 128.257 145.815 1.00 0.00 ? -5  U A C5     1  
ATOM 176    C C6     . U A 1 6   ? 144.527 127.640 145.973 1.00 0.00 ? -5  U A C6     1  
ATOM 177    H "H5'"  . U A 1 6   ? 148.301 126.304 143.900 1.00 0.00 ? -5  U A "H5'"  1  
ATOM 178    H "H5''" . U A 1 6   ? 147.845 124.788 143.693 1.00 0.00 ? -5  U A "H5''" 1  
ATOM 179    H "H4'"  . U A 1 6   ? 148.336 125.170 145.939 1.00 0.00 ? -5  U A "H4'"  1  
ATOM 180    H "H3'"  . U A 1 6   ? 145.566 124.703 145.546 1.00 0.00 ? -5  U A "H3'"  1  
ATOM 181    H "H2'"  . U A 1 6   ? 145.255 124.772 147.817 1.00 0.00 ? -5  U A "H2'"  1  
ATOM 182    H "HO2'" . U A 1 6   ? 146.968 124.823 149.282 1.00 0.00 ? -5  U A "HO2'" 1  
ATOM 183    H "H1'"  . U A 1 6   ? 146.764 126.887 148.139 1.00 0.00 ? -5  U A "H1'"  1  
ATOM 184    H H3     . U A 1 6   ? 142.503 128.199 148.952 1.00 0.00 ? -5  U A H3     1  
ATOM 185    H H5     . U A 1 6   ? 143.061 128.546 144.925 1.00 0.00 ? -5  U A H5     1  
ATOM 186    H H6     . U A 1 6   ? 145.074 127.486 145.175 1.00 0.00 ? -5  U A H6     1  
ATOM 187    P P      . U A 1 7   ? 145.598 122.054 145.806 1.00 0.00 ? -4  U A P      1  
ATOM 188    O OP1    . U A 1 7   ? 146.268 120.744 145.597 1.00 0.00 ? -4  U A OP1    1  
ATOM 189    O OP2    . U A 1 7   ? 144.613 122.541 144.808 1.00 0.00 ? -4  U A OP2    1  
ATOM 190    O "O5'"  . U A 1 7   ? 144.883 122.019 147.229 1.00 0.00 ? -4  U A "O5'"  1  
ATOM 191    C "C5'"  . U A 1 7   ? 145.575 121.570 148.383 1.00 0.00 ? -4  U A "C5'"  1  
ATOM 192    C "C4'"  . U A 1 7   ? 144.745 121.735 149.632 1.00 0.00 ? -4  U A "C4'"  1  
ATOM 193    O "O4'"  . U A 1 7   ? 144.451 123.142 149.849 1.00 0.00 ? -4  U A "O4'"  1  
ATOM 194    C "C3'"  . U A 1 7   ? 143.376 121.071 149.620 1.00 0.00 ? -4  U A "C3'"  1  
ATOM 195    O "O3'"  . U A 1 7   ? 143.434 119.679 149.877 1.00 0.00 ? -4  U A "O3'"  1  
ATOM 196    C "C2'"  . U A 1 7   ? 142.618 121.858 150.678 1.00 0.00 ? -4  U A "C2'"  1  
ATOM 197    O "O2'"  . U A 1 7   ? 142.981 121.445 151.987 1.00 0.00 ? -4  U A "O2'"  1  
ATOM 198    C "C1'"  . U A 1 7   ? 143.141 123.275 150.441 1.00 0.00 ? -4  U A "C1'"  1  
ATOM 199    N N1     . U A 1 7   ? 142.243 124.068 149.568 1.00 0.00 ? -4  U A N1     1  
ATOM 200    C C2     . U A 1 7   ? 141.111 124.608 150.151 1.00 0.00 ? -4  U A C2     1  
ATOM 201    O O2     . U A 1 7   ? 140.832 124.460 151.328 1.00 0.00 ? -4  U A O2     1  
ATOM 202    N N3     . U A 1 7   ? 140.310 125.333 149.303 1.00 0.00 ? -4  U A N3     1  
ATOM 203    C C4     . U A 1 7   ? 140.516 125.571 147.963 1.00 0.00 ? -4  U A C4     1  
ATOM 204    O O4     . U A 1 7   ? 139.699 126.247 147.334 1.00 0.00 ? -4  U A O4     1  
ATOM 205    C C5     . U A 1 7   ? 141.705 124.983 147.427 1.00 0.00 ? -4  U A C5     1  
ATOM 206    C C6     . U A 1 7   ? 142.505 124.271 148.228 1.00 0.00 ? -4  U A C6     1  
ATOM 207    H "H5'"  . U A 1 7   ? 146.403 122.086 148.480 1.00 0.00 ? -4  U A "H5'"  1  
ATOM 208    H "H5''" . U A 1 7   ? 145.800 120.623 148.274 1.00 0.00 ? -4  U A "H5''" 1  
ATOM 209    H "H4'"  . U A 1 7   ? 145.255 121.398 150.398 1.00 0.00 ? -4  U A "H4'"  1  
ATOM 210    H "H3'"  . U A 1 7   ? 142.955 121.219 148.747 1.00 0.00 ? -4  U A "H3'"  1  
ATOM 211    H "H2'"  . U A 1 7   ? 141.647 121.806 150.539 1.00 0.00 ? -4  U A "H2'"  1  
ATOM 212    H "HO2'" . U A 1 7   ? 142.447 121.946 152.640 1.00 0.00 ? -4  U A "HO2'" 1  
ATOM 213    H "H1'"  . U A 1 7   ? 143.242 123.733 151.301 1.00 0.00 ? -4  U A "H1'"  1  
ATOM 214    H H3     . U A 1 7   ? 139.502 125.726 149.698 1.00 0.00 ? -4  U A H3     1  
ATOM 215    H H5     . U A 1 7   ? 141.933 125.100 146.480 1.00 0.00 ? -4  U A H5     1  
ATOM 216    H H6     . U A 1 7   ? 143.312 123.878 147.840 1.00 0.00 ? -4  U A H6     1  
ATOM 217    P P      . A A 1 8   ? 142.304 118.698 149.293 1.00 0.00 ? -3  A A P      1  
ATOM 218    O OP1    . A A 1 8   ? 142.705 117.302 149.591 1.00 0.00 ? -3  A A OP1    1  
ATOM 219    O OP2    . A A 1 8   ? 142.029 119.100 147.891 1.00 0.00 ? -3  A A OP2    1  
ATOM 220    O "O5'"  . A A 1 8   ? 141.013 119.037 150.164 1.00 0.00 ? -3  A A "O5'"  1  
ATOM 221    C "C5'"  . A A 1 8   ? 140.966 118.724 151.548 1.00 0.00 ? -3  A A "C5'"  1  
ATOM 222    C "C4'"  . A A 1 8   ? 139.717 119.269 152.198 1.00 0.00 ? -3  A A "C4'"  1  
ATOM 223    O "O4'"  . A A 1 8   ? 139.701 120.716 152.096 1.00 0.00 ? -3  A A "O4'"  1  
ATOM 224    C "C3'"  . A A 1 8   ? 138.397 118.839 151.572 1.00 0.00 ? -3  A A "C3'"  1  
ATOM 225    O "O3'"  . A A 1 8   ? 137.998 117.538 151.962 1.00 0.00 ? -3  A A "O3'"  1  
ATOM 226    C "C2'"  . A A 1 8   ? 137.444 119.933 152.027 1.00 0.00 ? -3  A A "C2'"  1  
ATOM 227    O "O2'"  . A A 1 8   ? 137.044 119.742 153.374 1.00 0.00 ? -3  A A "O2'"  1  
ATOM 228    C "C1'"  . A A 1 8   ? 138.338 121.172 151.945 1.00 0.00 ? -3  A A "C1'"  1  
ATOM 229    N N9     . A A 1 8   ? 138.153 121.909 150.680 1.00 0.00 ? -3  A A N9     1  
ATOM 230    C C8     . A A 1 8   ? 138.976 121.922 149.583 1.00 0.00 ? -3  A A C8     1  
ATOM 231    N N7     . A A 1 8   ? 138.542 122.678 148.606 1.00 0.00 ? -3  A A N7     1  
ATOM 232    C C5     . A A 1 8   ? 137.351 123.200 149.090 1.00 0.00 ? -3  A A C5     1  
ATOM 233    C C6     . A A 1 8   ? 136.405 124.079 148.534 1.00 0.00 ? -3  A A C6     1  
ATOM 234    N N6     . A A 1 8   ? 136.515 124.607 147.314 1.00 0.00 ? -3  A A N6     1  
ATOM 235    N N1     . A A 1 8   ? 135.329 124.400 149.283 1.00 0.00 ? -3  A A N1     1  
ATOM 236    C C2     . A A 1 8   ? 135.218 123.869 150.508 1.00 0.00 ? -3  A A C2     1  
ATOM 237    N N3     . A A 1 8   ? 136.041 123.034 151.141 1.00 0.00 ? -3  A A N3     1  
ATOM 238    C C4     . A A 1 8   ? 137.099 122.734 150.369 1.00 0.00 ? -3  A A C4     1  
ATOM 239    H "H5'"  . A A 1 8   ? 141.749 119.111 151.991 1.00 0.00 ? -3  A A "H5'"  1  
ATOM 240    H "H5''" . A A 1 8   ? 140.984 117.750 151.657 1.00 0.00 ? -3  A A "H5''" 1  
ATOM 241    H "H4'"  . A A 1 8   ? 139.716 119.016 153.144 1.00 0.00 ? -3  A A "H4'"  1  
ATOM 242    H "H3'"  . A A 1 8   ? 138.481 118.870 150.595 1.00 0.00 ? -3  A A "H3'"  1  
ATOM 243    H "H2'"  . A A 1 8   ? 136.671 120.009 151.426 1.00 0.00 ? -3  A A "H2'"  1  
ATOM 244    H "HO2'" . A A 1 8   ? 136.415 120.450 153.625 1.00 0.00 ? -3  A A "HO2'" 1  
ATOM 245    H "H1'"  . A A 1 8   ? 138.143 121.765 152.701 1.00 0.00 ? -3  A A "H1'"  1  
ATOM 246    H H8     . A A 1 8   ? 139.813 121.412 149.534 1.00 0.00 ? -3  A A H8     1  
ATOM 247    H H61    . A A 1 8   ? 135.820 125.216 146.980 1.00 0.00 ? -3  A A H61    1  
ATOM 248    H H62    . A A 1 8   ? 137.287 124.389 146.751 1.00 0.00 ? -3  A A H62    1  
ATOM 249    H H2     . A A 1 8   ? 134.419 124.132 151.011 1.00 0.00 ? -3  A A H2     1  
ATOM 250    P P      . C A 1 9   ? 137.072 116.650 150.991 1.00 0.00 ? -2  C A P      1  
ATOM 251    O OP1    . C A 1 9   ? 136.935 115.300 151.595 1.00 0.00 ? -2  C A OP1    1  
ATOM 252    O OP2    . C A 1 9   ? 137.594 116.786 149.609 1.00 0.00 ? -2  C A OP2    1  
ATOM 253    O "O5'"  . C A 1 9   ? 135.650 117.365 151.056 1.00 0.00 ? -2  C A "O5'"  1  
ATOM 254    C "C5'"  . C A 1 9   ? 134.883 117.354 152.249 1.00 0.00 ? -2  C A "C5'"  1  
ATOM 255    C "C4'"  . C A 1 9   ? 133.633 118.194 152.115 1.00 0.00 ? -2  C A "C4'"  1  
ATOM 256    O "O4'"  . C A 1 9   ? 133.993 119.575 151.848 1.00 0.00 ? -2  C A "O4'"  1  
ATOM 257    C "C3'"  . C A 1 9   ? 132.700 117.826 150.973 1.00 0.00 ? -2  C A "C3'"  1  
ATOM 258    O "O3'"  . C A 1 9   ? 131.876 116.710 151.269 1.00 0.00 ? -2  C A "O3'"  1  
ATOM 259    C "C2'"  . C A 1 9   ? 131.923 119.116 150.751 1.00 0.00 ? -2  C A "C2'"  1  
ATOM 260    O "O2'"  . C A 1 9   ? 130.912 119.283 151.734 1.00 0.00 ? -2  C A "O2'"  1  
ATOM 261    C "C1'"  . C A 1 9   ? 133.010 120.170 150.975 1.00 0.00 ? -2  C A "C1'"  1  
ATOM 262    N N1     . C A 1 9   ? 133.627 120.621 149.705 1.00 0.00 ? -2  C A N1     1  
ATOM 263    C C2     . C A 1 9   ? 132.931 121.549 148.919 1.00 0.00 ? -2  C A C2     1  
ATOM 264    O O2     . C A 1 9   ? 131.826 121.961 149.305 1.00 0.00 ? -2  C A O2     1  
ATOM 265    N N3     . C A 1 9   ? 133.472 121.977 147.756 1.00 0.00 ? -2  C A N3     1  
ATOM 266    C C4     . C A 1 9   ? 134.660 121.516 147.364 1.00 0.00 ? -2  C A C4     1  
ATOM 267    N N4     . C A 1 9   ? 135.154 121.967 146.207 1.00 0.00 ? -2  C A N4     1  
ATOM 268    C C5     . C A 1 9   ? 135.392 120.574 148.137 1.00 0.00 ? -2  C A C5     1  
ATOM 269    C C6     . C A 1 9   ? 134.849 120.159 149.287 1.00 0.00 ? -2  C A C6     1  
ATOM 270    H "H5'"  . C A 1 9   ? 135.428 117.709 152.984 1.00 0.00 ? -2  C A "H5'"  1  
ATOM 271    H "H5''" . C A 1 9   ? 134.627 116.433 152.458 1.00 0.00 ? -2  C A "H5''" 1  
ATOM 272    H "H4'"  . C A 1 9   ? 133.136 118.155 152.960 1.00 0.00 ? -2  C A "H4'"  1  
ATOM 273    H "H3'"  . C A 1 9   ? 133.231 117.632 150.173 1.00 0.00 ? -2  C A "H3'"  1  
ATOM 274    H "H2'"  . C A 1 9   ? 131.560 119.166 149.844 1.00 0.00 ? -2  C A "H2'"  1  
ATOM 275    H "HO2'" . C A 1 9   ? 130.413 120.106 151.543 1.00 0.00 ? -2  C A "HO2'" 1  
ATOM 276    H "H1'"  . C A 1 9   ? 132.626 120.942 151.441 1.00 0.00 ? -2  C A "H1'"  1  
ATOM 277    H H41    . C A 1 9   ? 134.648 122.617 145.675 1.00 0.00 ? -2  C A H41    1  
ATOM 278    H H42    . C A 1 9   ? 136.025 121.649 145.889 1.00 0.00 ? -2  C A H42    1  
ATOM 279    H H5     . C A 1 9   ? 136.266 120.243 147.842 1.00 0.00 ? -2  C A H5     1  
ATOM 280    H H6     . C A 1 9   ? 135.337 119.510 149.835 1.00 0.00 ? -2  C A H6     1  
ATOM 281    P P      . U A 1 10  ? 131.311 115.788 150.079 1.00 0.00 ? -1  U A P      1  
ATOM 282    O OP1    . U A 1 10  ? 130.603 114.634 150.689 1.00 0.00 ? -1  U A OP1    1  
ATOM 283    O OP2    . U A 1 10  ? 132.416 115.546 149.119 1.00 0.00 ? -1  U A OP2    1  
ATOM 284    O "O5'"  . U A 1 10  ? 130.225 116.708 149.361 1.00 0.00 ? -1  U A "O5'"  1  
ATOM 285    C "C5'"  . U A 1 10  ? 129.050 117.119 150.044 1.00 0.00 ? -1  U A "C5'"  1  
ATOM 286    C "C4'"  . U A 1 10  ? 128.235 118.082 149.218 1.00 0.00 ? -1  U A "C4'"  1  
ATOM 287    O "O4'"  . U A 1 10  ? 128.996 119.294 148.975 1.00 0.00 ? -1  U A "O4'"  1  
ATOM 288    C "C3'"  . U A 1 10  ? 127.841 117.607 147.827 1.00 0.00 ? -1  U A "C3'"  1  
ATOM 289    O "O3'"  . U A 1 10  ? 126.734 116.722 147.838 1.00 0.00 ? -1  U A "O3'"  1  
ATOM 290    C "C2'"  . U A 1 10  ? 127.570 118.914 147.095 1.00 0.00 ? -1  U A "C2'"  1  
ATOM 291    O "O2'"  . U A 1 10  ? 126.300 119.446 147.442 1.00 0.00 ? -1  U A "O2'"  1  
ATOM 292    C "C1'"  . U A 1 10  ? 128.660 119.818 147.673 1.00 0.00 ? -1  U A "C1'"  1  
ATOM 293    N N1     . U A 1 10  ? 129.858 119.882 146.800 1.00 0.00 ? -1  U A N1     1  
ATOM 294    C C2     . U A 1 10  ? 129.788 120.707 145.693 1.00 0.00 ? -1  U A C2     1  
ATOM 295    O O2     . U A 1 10  ? 128.803 121.369 145.415 1.00 0.00 ? -1  U A O2     1  
ATOM 296    N N3     . U A 1 10  ? 130.921 120.735 144.916 1.00 0.00 ? -1  U A N3     1  
ATOM 297    C C4     . U A 1 10  ? 132.091 120.038 145.125 1.00 0.00 ? -1  U A C4     1  
ATOM 298    O O4     . U A 1 10  ? 133.024 120.170 144.331 1.00 0.00 ? -1  U A O4     1  
ATOM 299    C C5     . U A 1 10  ? 132.090 119.206 146.289 1.00 0.00 ? -1  U A C5     1  
ATOM 300    C C6     . U A 1 10  ? 131.002 119.160 147.065 1.00 0.00 ? -1  U A C6     1  
ATOM 301    H "H5'"  . U A 1 10  ? 129.306 117.556 150.885 1.00 0.00 ? -1  U A "H5'"  1  
ATOM 302    H "H5''" . U A 1 10  ? 128.506 116.331 150.246 1.00 0.00 ? -1  U A "H5''" 1  
ATOM 303    H "H4'"  . U A 1 10  ? 127.422 118.315 149.717 1.00 0.00 ? -1  U A "H4'"  1  
ATOM 304    H "H3'"  . U A 1 10  ? 128.608 117.160 147.412 1.00 0.00 ? -1  U A "H3'"  1  
ATOM 305    H "H2'"  . U A 1 10  ? 127.669 118.810 146.125 1.00 0.00 ? -1  U A "H2'"  1  
ATOM 306    H "HO2'" . U A 1 10  ? 126.148 120.268 146.928 1.00 0.00 ? -1  U A "HO2'" 1  
ATOM 307    H "H1'"  . U A 1 10  ? 128.303 120.722 147.794 1.00 0.00 ? -1  U A "H1'"  1  
ATOM 308    H H3     . U A 1 10  ? 130.892 121.313 144.126 1.00 0.00 ? -1  U A H3     1  
ATOM 309    H H5     . U A 1 10  ? 132.882 118.675 146.516 1.00 0.00 ? -1  U A H5     1  
ATOM 310    H H6     . U A 1 10  ? 131.026 118.583 147.855 1.00 0.00 ? -1  U A H6     1  
ATOM 311    P P      . U A 1 11  ? 126.599 115.585 146.711 1.00 0.00 ? 0   U A P      1  
ATOM 312    O OP1    . U A 1 11  ? 125.389 114.777 147.016 1.00 0.00 ? 0   U A OP1    1  
ATOM 313    O OP2    . U A 1 11  ? 127.914 114.913 146.575 1.00 0.00 ? 0   U A OP2    1  
ATOM 314    O "O5'"  . U A 1 11  ? 126.319 116.402 145.372 1.00 0.00 ? 0   U A "O5'"  1  
ATOM 315    C "C5'"  . U A 1 11  ? 125.130 117.161 145.215 1.00 0.00 ? 0   U A "C5'"  1  
ATOM 316    C "C4'"  . U A 1 11  ? 125.177 118.018 143.973 1.00 0.00 ? 0   U A "C4'"  1  
ATOM 317    O "O4'"  . U A 1 11  ? 126.285 118.954 144.058 1.00 0.00 ? 0   U A "O4'"  1  
ATOM 318    C "C3'"  . U A 1 11  ? 125.412 117.286 142.662 1.00 0.00 ? 0   U A "C3'"  1  
ATOM 319    O "O3'"  . U A 1 11  ? 124.239 116.686 142.142 1.00 0.00 ? 0   U A "O3'"  1  
ATOM 320    C "C2'"  . U A 1 11  ? 125.988 118.377 141.769 1.00 0.00 ? 0   U A "C2'"  1  
ATOM 321    O "O2'"  . U A 1 11  ? 124.967 119.234 141.282 1.00 0.00 ? 0   U A "O2'"  1  
ATOM 322    C "C1'"  . U A 1 11  ? 126.858 119.153 142.761 1.00 0.00 ? 0   U A "C1'"  1  
ATOM 323    N N1     . U A 1 11  ? 128.273 118.708 142.735 1.00 0.00 ? 0   U A N1     1  
ATOM 324    C C2     . U A 1 11  ? 129.060 119.167 141.695 1.00 0.00 ? 0   U A C2     1  
ATOM 325    O O2     . U A 1 11  ? 128.642 119.907 140.821 1.00 0.00 ? 0   U A O2     1  
ATOM 326    N N3     . U A 1 11  ? 130.361 118.730 141.714 1.00 0.00 ? 0   U A N3     1  
ATOM 327    C C4     . U A 1 11  ? 130.945 117.897 142.645 1.00 0.00 ? 0   U A C4     1  
ATOM 328    O O4     . U A 1 11  ? 132.135 117.594 142.522 1.00 0.00 ? 0   U A O4     1  
ATOM 329    C C5     . U A 1 11  ? 130.072 117.463 143.692 1.00 0.00 ? 0   U A C5     1  
ATOM 330    C C6     . U A 1 11  ? 128.801 117.874 143.698 1.00 0.00 ? 0   U A C6     1  
ATOM 331    H "H5'"  . U A 1 11  ? 125.016 117.739 145.998 1.00 0.00 ? 0   U A "H5'"  1  
ATOM 332    H "H5''" . U A 1 11  ? 124.367 116.551 145.152 1.00 0.00 ? 0   U A "H5''" 1  
ATOM 333    H "H4'"  . U A 1 11  ? 124.340 118.523 143.907 1.00 0.00 ? 0   U A "H4'"  1  
ATOM 334    H "H3'"  . U A 1 11  ? 126.093 116.593 142.798 1.00 0.00 ? 0   U A "H3'"  1  
ATOM 335    H "H2'"  . U A 1 11  ? 126.525 118.000 141.041 1.00 0.00 ? 0   U A "H2'"  1  
ATOM 336    H "HO2'" . U A 1 11  ? 124.104 118.774 141.351 1.00 0.00 ? 0   U A "HO2'" 1  
ATOM 337    H "H1'"  . U A 1 11  ? 126.816 120.109 142.550 1.00 0.00 ? 0   U A "H1'"  1  
ATOM 338    H H3     . U A 1 11  ? 130.936 119.044 140.986 1.00 0.00 ? 0   U A H3     1  
ATOM 339    H H5     . U A 1 11  ? 130.404 116.869 144.397 1.00 0.00 ? 0   U A H5     1  
ATOM 340    H H6     . U A 1 11  ? 128.222 117.563 144.425 1.00 0.00 ? 0   U A H6     1  
ATOM 341    P P      . G A 1 12  ? 124.344 115.468 141.100 1.00 0.00 ? 1   G A P      1  
ATOM 342    O OP1    . G A 1 12  ? 122.968 115.004 140.792 1.00 0.00 ? 1   G A OP1    1  
ATOM 343    O OP2    . G A 1 12  ? 125.345 114.502 141.621 1.00 0.00 ? 1   G A OP2    1  
ATOM 344    O "O5'"  . G A 1 12  ? 124.945 116.135 139.783 1.00 0.00 ? 1   G A "O5'"  1  
ATOM 345    C "C5'"  . G A 1 12  ? 124.274 116.023 138.538 1.00 0.00 ? 1   G A "C5'"  1  
ATOM 346    C "C4'"  . G A 1 12  ? 124.866 116.947 137.503 1.00 0.00 ? 1   G A "C4'"  1  
ATOM 347    O "O4'"  . G A 1 12  ? 125.932 117.731 138.099 1.00 0.00 ? 1   G A "O4'"  1  
ATOM 348    C "C3'"  . G A 1 12  ? 125.522 116.278 136.305 1.00 0.00 ? 1   G A "C3'"  1  
ATOM 349    O "O3'"  . G A 1 12  ? 124.589 115.864 135.321 1.00 0.00 ? 1   G A "O3'"  1  
ATOM 350    C "C2'"  . G A 1 12  ? 126.491 117.345 135.818 1.00 0.00 ? 1   G A "C2'"  1  
ATOM 351    O "O2'"  . G A 1 12  ? 125.819 118.352 135.077 1.00 0.00 ? 1   G A "O2'"  1  
ATOM 352    C "C1'"  . G A 1 12  ? 126.978 117.943 137.140 1.00 0.00 ? 1   G A "C1'"  1  
ATOM 353    N N9     . G A 1 12  ? 128.238 117.326 137.597 1.00 0.00 ? 1   G A N9     1  
ATOM 354    C C8     . G A 1 12  ? 128.404 116.446 138.638 1.00 0.00 ? 1   G A C8     1  
ATOM 355    N N7     . G A 1 12  ? 129.644 116.073 138.804 1.00 0.00 ? 1   G A N7     1  
ATOM 356    C C5     . G A 1 12  ? 130.339 116.747 137.811 1.00 0.00 ? 1   G A C5     1  
ATOM 357    C C6     . G A 1 12  ? 131.722 116.741 137.490 1.00 0.00 ? 1   G A C6     1  
ATOM 358    O O6     . G A 1 12  ? 132.636 116.116 138.041 1.00 0.00 ? 1   G A O6     1  
ATOM 359    N N1     . G A 1 12  ? 132.003 117.569 136.407 1.00 0.00 ? 1   G A N1     1  
ATOM 360    C C2     . G A 1 12  ? 131.072 118.307 135.719 1.00 0.00 ? 1   G A C2     1  
ATOM 361    N N2     . G A 1 12  ? 131.534 119.048 134.702 1.00 0.00 ? 1   G A N2     1  
ATOM 362    N N3     . G A 1 12  ? 129.780 118.323 136.008 1.00 0.00 ? 1   G A N3     1  
ATOM 363    C C4     . G A 1 12  ? 129.488 117.525 137.056 1.00 0.00 ? 1   G A C4     1  
ATOM 364    H "H5'"  . G A 1 12  ? 123.328 116.245 138.663 1.00 0.00 ? 1   G A "H5'"  1  
ATOM 365    H "H5''" . G A 1 12  ? 124.344 115.099 138.219 1.00 0.00 ? 1   G A "H5''" 1  
ATOM 366    H "H4'"  . G A 1 12  ? 124.165 117.555 137.183 1.00 0.00 ? 1   G A "H4'"  1  
ATOM 367    H "H3'"  . G A 1 12  ? 126.032 115.498 136.614 1.00 0.00 ? 1   G A "H3'"  1  
ATOM 368    H "H2'"  . G A 1 12  ? 127.233 116.954 135.309 1.00 0.00 ? 1   G A "H2'"  1  
ATOM 369    H "HO2'" . G A 1 12  ? 124.960 118.000 134.765 1.00 0.00 ? 1   G A "HO2'" 1  
ATOM 370    H "H1'"  . G A 1 12  ? 127.106 118.908 137.033 1.00 0.00 ? 1   G A "H1'"  1  
ATOM 371    H H8     . G A 1 12  ? 127.667 116.130 139.202 1.00 0.00 ? 1   G A H8     1  
ATOM 372    H H1     . G A 1 12  ? 132.937 117.625 136.114 1.00 0.00 ? 1   G A H1     1  
ATOM 373    H H21    . G A 1 12  ? 132.489 119.040 134.481 1.00 0.00 ? 1   G A H21    1  
ATOM 374    H H22    . G A 1 12  ? 130.916 119.597 134.173 1.00 0.00 ? 1   G A H22    1  
ATOM 375    P P      . G A 1 13  ? 124.946 114.646 134.334 1.00 0.00 ? 2   G A P      1  
ATOM 376    O OP1    . G A 1 13  ? 123.760 114.388 133.477 1.00 0.00 ? 2   G A OP1    1  
ATOM 377    O OP2    . G A 1 13  ? 125.516 113.545 135.149 1.00 0.00 ? 2   G A OP2    1  
ATOM 378    O "O5'"  . G A 1 13  ? 126.105 115.227 133.409 1.00 0.00 ? 2   G A "O5'"  1  
ATOM 379    C "C5'"  . G A 1 13  ? 125.827 116.205 132.417 1.00 0.00 ? 2   G A "C5'"  1  
ATOM 380    C "C4'"  . G A 1 13  ? 127.081 116.641 131.703 1.00 0.00 ? 2   G A "C4'"  1  
ATOM 381    O "O4'"  . G A 1 13  ? 128.026 117.190 132.659 1.00 0.00 ? 2   G A "O4'"  1  
ATOM 382    C "C3'"  . G A 1 13  ? 127.863 115.545 130.997 1.00 0.00 ? 2   G A "C3'"  1  
ATOM 383    O "O3'"  . G A 1 13  ? 127.312 115.194 129.738 1.00 0.00 ? 2   G A "O3'"  1  
ATOM 384    C "C2'"  . G A 1 13  ? 129.262 116.141 130.905 1.00 0.00 ? 2   G A "C2'"  1  
ATOM 385    O "O2'"  . G A 1 13  ? 129.349 117.095 129.856 1.00 0.00 ? 2   G A "O2'"  1  
ATOM 386    C "C1'"  . G A 1 13  ? 129.373 116.867 132.246 1.00 0.00 ? 2   G A "C1'"  1  
ATOM 387    N N9     . G A 1 13  ? 130.066 116.052 133.264 1.00 0.00 ? 2   G A N9     1  
ATOM 388    C C8     . G A 1 13  ? 129.502 115.398 134.331 1.00 0.00 ? 2   G A C8     1  
ATOM 389    N N7     . G A 1 13  ? 130.374 114.757 135.060 1.00 0.00 ? 2   G A N7     1  
ATOM 390    C C5     . G A 1 13  ? 131.588 115.002 134.436 1.00 0.00 ? 2   G A C5     1  
ATOM 391    C C6     . G A 1 13  ? 132.899 114.568 134.769 1.00 0.00 ? 2   G A C6     1  
ATOM 392    O O6     . G A 1 13  ? 133.257 113.857 135.715 1.00 0.00 ? 2   G A O6     1  
ATOM 393    N N1     . G A 1 13  ? 133.843 115.051 133.867 1.00 0.00 ? 2   G A N1     1  
ATOM 394    C C2     . G A 1 13  ? 133.564 115.848 132.785 1.00 0.00 ? 2   G A C2     1  
ATOM 395    N N2     . G A 1 13  ? 134.610 116.211 132.029 1.00 0.00 ? 2   G A N2     1  
ATOM 396    N N3     . G A 1 13  ? 132.348 116.258 132.464 1.00 0.00 ? 2   G A N3     1  
ATOM 397    C C4     . G A 1 13  ? 131.416 115.801 133.324 1.00 0.00 ? 2   G A C4     1  
ATOM 398    H "H5'"  . G A 1 13  ? 125.413 116.984 132.845 1.00 0.00 ? 2   G A "H5'"  1  
ATOM 399    H "H5''" . G A 1 13  ? 125.201 115.828 131.764 1.00 0.00 ? 2   G A "H5''" 1  
ATOM 400    H "H4'"  . G A 1 13  ? 126.850 117.337 131.052 1.00 0.00 ? 2   G A "H4'"  1  
ATOM 401    H "H3'"  . G A 1 13  ? 127.892 114.750 131.568 1.00 0.00 ? 2   G A "H3'"  1  
ATOM 402    H "H2'"  . G A 1 13  ? 129.946 115.443 130.819 1.00 0.00 ? 2   G A "H2'"  1  
ATOM 403    H "HO2'" . G A 1 13  ? 130.210 116.990 129.400 1.00 0.00 ? 2   G A "HO2'" 1  
ATOM 404    H "H1'"  . G A 1 13  ? 129.853 117.712 132.122 1.00 0.00 ? 2   G A "H1'"  1  
ATOM 405    H H8     . G A 1 13  ? 128.541 115.411 134.525 1.00 0.00 ? 2   G A H8     1  
ATOM 406    H H1     . G A 1 13  ? 134.778 114.800 134.020 1.00 0.00 ? 2   G A H1     1  
ATOM 407    H H21    . G A 1 13  ? 135.514 115.911 132.261 1.00 0.00 ? 2   G A H21    1  
ATOM 408    H H22    . G A 1 13  ? 134.474 116.780 131.242 1.00 0.00 ? 2   G A H22    1  
ATOM 409    P P      . U A 1 14  ? 127.541 113.719 129.142 1.00 0.00 ? 3   U A P      1  
ATOM 410    O OP1    . U A 1 14  ? 126.757 113.604 127.886 1.00 0.00 ? 3   U A OP1    1  
ATOM 411    O OP2    . U A 1 14  ? 127.318 112.741 130.236 1.00 0.00 ? 3   U A OP2    1  
ATOM 412    O "O5'"  . U A 1 14  ? 129.087 113.693 128.761 1.00 0.00 ? 3   U A "O5'"  1  
ATOM 413    C "C5'"  . U A 1 14  ? 129.599 114.518 127.727 1.00 0.00 ? 3   U A "C5'"  1  
ATOM 414    C "C4'"  . U A 1 14  ? 131.099 114.405 127.613 1.00 0.00 ? 3   U A "C4'"  1  
ATOM 415    O "O4'"  . U A 1 14  ? 131.723 114.853 128.845 1.00 0.00 ? 3   U A "O4'"  1  
ATOM 416    C "C3'"  . U A 1 14  ? 131.652 113.003 127.406 1.00 0.00 ? 3   U A "C3'"  1  
ATOM 417    O "O3'"  . U A 1 14  ? 131.548 112.558 126.064 1.00 0.00 ? 3   U A "O3'"  1  
ATOM 418    C "C2'"  . U A 1 14  ? 133.085 113.136 127.897 1.00 0.00 ? 3   U A "C2'"  1  
ATOM 419    O "O2'"  . U A 1 14  ? 133.906 113.772 126.929 1.00 0.00 ? 3   U A "O2'"  1  
ATOM 420    C "C1'"  . U A 1 14  ? 132.913 114.072 129.095 1.00 0.00 ? 3   U A "C1'"  1  
ATOM 421    N N1     . U A 1 14  ? 132.802 113.335 130.375 1.00 0.00 ? 3   U A N1     1  
ATOM 422    C C2     . U A 1 14  ? 133.975 112.869 130.938 1.00 0.00 ? 3   U A C2     1  
ATOM 423    O O2     . U A 1 14  ? 135.070 113.037 130.431 1.00 0.00 ? 3   U A O2     1  
ATOM 424    N N3     . U A 1 14  ? 133.824 112.192 132.123 1.00 0.00 ? 3   U A N3     1  
ATOM 425    C C4     . U A 1 14  ? 132.645 111.937 132.792 1.00 0.00 ? 3   U A C4     1  
ATOM 426    O O4     . U A 1 14  ? 132.674 111.312 133.855 1.00 0.00 ? 3   U A O4     1  
ATOM 427    C C5     . U A 1 14  ? 131.473 112.450 132.152 1.00 0.00 ? 3   U A C5     1  
ATOM 428    C C6     . U A 1 14  ? 131.591 113.114 130.998 1.00 0.00 ? 3   U A C6     1  
ATOM 429    H "H5'"  . U A 1 14  ? 129.362 115.451 127.916 1.00 0.00 ? 3   U A "H5'"  1  
ATOM 430    H "H5''" . U A 1 14  ? 129.193 114.253 126.876 1.00 0.00 ? 3   U A "H5''" 1  
ATOM 431    H "H4'"  . U A 1 14  ? 131.403 114.978 126.877 1.00 0.00 ? 3   U A "H4'"  1  
ATOM 432    H "H3'"  . U A 1 14  ? 131.169 112.380 127.990 1.00 0.00 ? 3   U A "H3'"  1  
ATOM 433    H "H2'"  . U A 1 14  ? 133.453 112.270 128.174 1.00 0.00 ? 3   U A "H2'"  1  
ATOM 434    H "HO2'" . U A 1 14  ? 133.476 113.703 126.053 1.00 0.00 ? 3   U A "HO2'" 1  
ATOM 435    H "H1'"  . U A 1 14  ? 133.675 114.687 129.140 1.00 0.00 ? 3   U A "H1'"  1  
ATOM 436    H H3     . U A 1 14  ? 134.644 111.853 132.541 1.00 0.00 ? 3   U A H3     1  
ATOM 437    H H5     . U A 1 14  ? 130.591 112.317 132.559 1.00 0.00 ? 3   U A H5     1  
ATOM 438    H H6     . U A 1 14  ? 130.773 113.454 130.578 1.00 0.00 ? 3   U A H6     1  
ATOM 439    P P      . A A 1 15  ? 131.423 110.989 125.739 1.00 0.00 ? 4   A A P      1  
ATOM 440    O OP1    . A A 1 15  ? 131.187 110.841 124.281 1.00 0.00 ? 4   A A OP1    1  
ATOM 441    O OP2    . A A 1 15  ? 130.465 110.394 126.703 1.00 0.00 ? 4   A A OP2    1  
ATOM 442    O "O5'"  . A A 1 15  ? 132.873 110.414 126.065 1.00 0.00 ? 4   A A "O5'"  1  
ATOM 443    C "C5'"  . A A 1 15  ? 133.994 110.765 125.267 1.00 0.00 ? 4   A A "C5'"  1  
ATOM 444    C "C4'"  . A A 1 15  ? 135.276 110.211 125.837 1.00 0.00 ? 4   A A "C4'"  1  
ATOM 445    O "O4'"  . A A 1 15  ? 135.519 110.785 127.147 1.00 0.00 ? 4   A A "O4'"  1  
ATOM 446    C "C3'"  . A A 1 15  ? 135.302 108.709 126.079 1.00 0.00 ? 4   A A "C3'"  1  
ATOM 447    O "O3'"  . A A 1 15  ? 135.537 107.961 124.897 1.00 0.00 ? 4   A A "O3'"  1  
ATOM 448    C "C2'"  . A A 1 15  ? 136.400 108.561 127.122 1.00 0.00 ? 4   A A "C2'"  1  
ATOM 449    O "O2'"  . A A 1 15  ? 137.689 108.644 126.532 1.00 0.00 ? 4   A A "O2'"  1  
ATOM 450    C "C1'"  . A A 1 15  ? 136.167 109.800 127.987 1.00 0.00 ? 4   A A "C1'"  1  
ATOM 451    N N9     . A A 1 15  ? 135.359 109.501 129.184 1.00 0.00 ? 4   A A N9     1  
ATOM 452    C C8     . A A 1 15  ? 134.028 109.767 129.390 1.00 0.00 ? 4   A A C8     1  
ATOM 453    N N7     . A A 1 15  ? 133.588 109.381 130.562 1.00 0.00 ? 4   A A N7     1  
ATOM 454    C C5     . A A 1 15  ? 134.704 108.822 131.169 1.00 0.00 ? 4   A A C5     1  
ATOM 455    C C6     . A A 1 15  ? 134.899 108.229 132.429 1.00 0.00 ? 4   A A C6     1  
ATOM 456    N N6     . A A 1 15  ? 133.933 108.093 133.340 1.00 0.00 ? 4   A A N6     1  
ATOM 457    N N1     . A A 1 15  ? 136.135 107.772 132.724 1.00 0.00 ? 4   A A N1     1  
ATOM 458    C C2     . A A 1 15  ? 137.104 107.907 131.810 1.00 0.00 ? 4   A A C2     1  
ATOM 459    N N3     . A A 1 15  ? 137.044 108.446 130.593 1.00 0.00 ? 4   A A N3     1  
ATOM 460    C C4     . A A 1 15  ? 135.801 108.889 130.331 1.00 0.00 ? 4   A A C4     1  
ATOM 461    H "H5'"  . A A 1 15  ? 134.062 111.743 125.222 1.00 0.00 ? 4   A A "H5'"  1  
ATOM 462    H "H5''" . A A 1 15  ? 133.866 110.413 124.362 1.00 0.00 ? 4   A A "H5''" 1  
ATOM 463    H "H4'"  . A A 1 15  ? 136.018 110.450 125.242 1.00 0.00 ? 4   A A "H4'"  1  
ATOM 464    H "H3'"  . A A 1 15  ? 134.447 108.430 126.470 1.00 0.00 ? 4   A A "H3'"  1  
ATOM 465    H "H2'"  . A A 1 15  ? 136.293 107.737 127.643 1.00 0.00 ? 4   A A "H2'"  1  
ATOM 466    H "HO2'" . A A 1 15  ? 138.367 108.511 127.226 1.00 0.00 ? 4   A A "HO2'" 1  
ATOM 467    H "H1'"  . A A 1 15  ? 137.034 110.173 128.263 1.00 0.00 ? 4   A A "H1'"  1  
ATOM 468    H H8     . A A 1 15  ? 133.460 110.208 128.723 1.00 0.00 ? 4   A A H8     1  
ATOM 469    H H61    . A A 1 15  ? 134.130 107.669 134.203 1.00 0.00 ? 4   A A H61    1  
ATOM 470    H H62    . A A 1 15  ? 133.029 108.416 133.150 1.00 0.00 ? 4   A A H62    1  
ATOM 471    H H2     . A A 1 15  ? 137.982 107.558 132.072 1.00 0.00 ? 4   A A H2     1  
ATOM 472    P P      . G A 1 16  ? 135.000 106.451 124.777 1.00 0.00 ? 5   G A P      1  
ATOM 473    O OP1    . G A 1 16  ? 135.272 105.973 123.398 1.00 0.00 ? 5   G A OP1    1  
ATOM 474    O OP2    . G A 1 16  ? 133.615 106.411 125.308 1.00 0.00 ? 5   G A OP2    1  
ATOM 475    O "O5'"  . G A 1 16  ? 135.934 105.629 125.775 1.00 0.00 ? 5   G A "O5'"  1  
ATOM 476    C "C5'"  . G A 1 16  ? 137.317 105.456 125.504 1.00 0.00 ? 5   G A "C5'"  1  
ATOM 477    C "C4'"  . G A 1 16  ? 138.022 104.768 126.646 1.00 0.00 ? 5   G A "C4'"  1  
ATOM 478    O "O4'"  . G A 1 16  ? 137.915 105.577 127.847 1.00 0.00 ? 5   G A "O4'"  1  
ATOM 479    C "C3'"  . G A 1 16  ? 137.467 103.414 127.058 1.00 0.00 ? 5   G A "C3'"  1  
ATOM 480    O "O3'"  . G A 1 16  ? 137.887 102.360 126.206 1.00 0.00 ? 5   G A "O3'"  1  
ATOM 481    C "C2'"  . G A 1 16  ? 137.960 103.275 128.491 1.00 0.00 ? 5   G A "C2'"  1  
ATOM 482    O "O2'"  . G A 1 16  ? 139.329 102.899 128.531 1.00 0.00 ? 5   G A "O2'"  1  
ATOM 483    C "C1'"  . G A 1 16  ? 137.825 104.711 129.000 1.00 0.00 ? 5   G A "C1'"  1  
ATOM 484    N N9     . G A 1 16  ? 136.562 104.920 129.737 1.00 0.00 ? 5   G A N9     1  
ATOM 485    C C8     . G A 1 16  ? 135.436 105.567 129.285 1.00 0.00 ? 5   G A C8     1  
ATOM 486    N N7     . G A 1 16  ? 134.473 105.596 130.168 1.00 0.00 ? 5   G A N7     1  
ATOM 487    C C5     . G A 1 16  ? 134.996 104.930 131.266 1.00 0.00 ? 5   G A C5     1  
ATOM 488    C C6     . G A 1 16  ? 134.416 104.644 132.530 1.00 0.00 ? 5   G A C6     1  
ATOM 489    O O6     . G A 1 16  ? 133.287 104.936 132.940 1.00 0.00 ? 5   G A O6     1  
ATOM 490    N N1     . G A 1 16  ? 135.294 103.947 133.352 1.00 0.00 ? 5   G A N1     1  
ATOM 491    C C2     . G A 1 16  ? 136.569 103.572 133.005 1.00 0.00 ? 5   G A C2     1  
ATOM 492    N N2     . G A 1 16  ? 137.268 102.903 133.935 1.00 0.00 ? 5   G A N2     1  
ATOM 493    N N3     . G A 1 16  ? 137.123 103.831 131.831 1.00 0.00 ? 5   G A N3     1  
ATOM 494    C C4     . G A 1 16  ? 136.283 104.506 131.017 1.00 0.00 ? 5   G A C4     1  
ATOM 495    H "H5'"  . G A 1 16  ? 137.726 106.333 125.353 1.00 0.00 ? 5   G A "H5'"  1  
ATOM 496    H "H5''" . G A 1 16  ? 137.417 104.914 124.693 1.00 0.00 ? 5   G A "H5''" 1  
ATOM 497    H "H4'"  . G A 1 16  ? 138.970 104.668 126.416 1.00 0.00 ? 5   G A "H4'"  1  
ATOM 498    H "H3'"  . G A 1 16  ? 136.486 103.455 127.059 1.00 0.00 ? 5   G A "H3'"  1  
ATOM 499    H "H2'"  . G A 1 16  ? 137.399 102.658 129.006 1.00 0.00 ? 5   G A "H2'"  1  
ATOM 500    H "HO2'" . G A 1 16  ? 139.601 102.787 129.464 1.00 0.00 ? 5   G A "HO2'" 1  
ATOM 501    H "H1'"  . G A 1 16  ? 138.581 104.922 129.585 1.00 0.00 ? 5   G A "H1'"  1  
ATOM 502    H H8     . G A 1 16  ? 135.361 105.965 128.393 1.00 0.00 ? 5   G A H8     1  
ATOM 503    H H1     . G A 1 16  ? 134.979 103.707 134.248 1.00 0.00 ? 5   G A H1     1  
ATOM 504    H H21    . G A 1 16  ? 136.866 102.707 134.807 1.00 0.00 ? 5   G A H21    1  
ATOM 505    H H22    . G A 1 16  ? 138.183 102.608 133.744 1.00 0.00 ? 5   G A H22    1  
ATOM 506    P P      . A A 1 17  ? 136.976 101.048 126.039 1.00 0.00 ? 6   A A P      1  
ATOM 507    O OP1    . A A 1 17  ? 137.584 100.195 124.986 1.00 0.00 ? 6   A A OP1    1  
ATOM 508    O OP2    . A A 1 17  ? 135.562 101.481 125.905 1.00 0.00 ? 6   A A OP2    1  
ATOM 509    O "O5'"  . A A 1 17  ? 137.128 100.293 127.434 1.00 0.00 ? 6   A A "O5'"  1  
ATOM 510    C "C5'"  . A A 1 17  ? 138.374 99.741  127.833 1.00 0.00 ? 6   A A "C5'"  1  
ATOM 511    C "C4'"  . A A 1 17  ? 138.318 99.202  129.240 1.00 0.00 ? 6   A A "C4'"  1  
ATOM 512    O "O4'"  . A A 1 17  ? 138.024 100.279 130.167 1.00 0.00 ? 6   A A "O4'"  1  
ATOM 513    C "C3'"  . A A 1 17  ? 137.236 98.172  129.516 1.00 0.00 ? 6   A A "C3'"  1  
ATOM 514    O "O3'"  . A A 1 17  ? 137.581 96.871  129.068 1.00 0.00 ? 6   A A "O3'"  1  
ATOM 515    C "C2'"  . A A 1 17  ? 137.058 98.270  131.025 1.00 0.00 ? 6   A A "C2'"  1  
ATOM 516    O "O2'"  . A A 1 17  ? 138.098 97.590  131.712 1.00 0.00 ? 6   A A "O2'"  1  
ATOM 517    C "C1'"  . A A 1 17  ? 137.215 99.776  131.252 1.00 0.00 ? 6   A A "C1'"  1  
ATOM 518    N N9     . A A 1 17  ? 135.911 100.467 131.313 1.00 0.00 ? 6   A A N9     1  
ATOM 519    C C8     . A A 1 17  ? 135.313 101.227 130.339 1.00 0.00 ? 6   A A C8     1  
ATOM 520    N N7     . A A 1 17  ? 134.150 101.714 130.691 1.00 0.00 ? 6   A A N7     1  
ATOM 521    C C5     . A A 1 17  ? 133.967 101.242 131.984 1.00 0.00 ? 6   A A C5     1  
ATOM 522    C C6     . A A 1 17  ? 132.927 101.407 132.913 1.00 0.00 ? 6   A A C6     1  
ATOM 523    N N6     . A A 1 17  ? 131.825 102.120 132.672 1.00 0.00 ? 6   A A N6     1  
ATOM 524    N N1     . A A 1 17  ? 133.056 100.803 134.116 1.00 0.00 ? 6   A A N1     1  
ATOM 525    C C2     . A A 1 17  ? 134.161 100.087 134.358 1.00 0.00 ? 6   A A C2     1  
ATOM 526    N N3     . A A 1 17  ? 135.207 99.861  133.565 1.00 0.00 ? 6   A A N3     1  
ATOM 527    C C4     . A A 1 17  ? 135.045 100.472 132.378 1.00 0.00 ? 6   A A C4     1  
ATOM 528    H "H5'"  . A A 1 17  ? 139.061 100.439 127.785 1.00 0.00 ? 6   A A "H5'"  1  
ATOM 529    H "H5''" . A A 1 17  ? 138.613 99.016  127.221 1.00 0.00 ? 6   A A "H5''" 1  
ATOM 530    H "H4'"  . A A 1 17  ? 139.189 98.816  129.467 1.00 0.00 ? 6   A A "H4'"  1  
ATOM 531    H "H3'"  . A A 1 17  ? 136.404 98.451  129.077 1.00 0.00 ? 6   A A "H3'"  1  
ATOM 532    H "H2'"  . A A 1 17  ? 136.174 97.956  131.305 1.00 0.00 ? 6   A A "H2'"  1  
ATOM 533    H "HO2'" . A A 1 17  ? 137.945 97.662  132.675 1.00 0.00 ? 6   A A "HO2'" 1  
ATOM 534    H "H1'"  . A A 1 17  ? 137.706 99.929  132.085 1.00 0.00 ? 6   A A "H1'"  1  
ATOM 535    H H8     . A A 1 17  ? 135.720 101.389 129.462 1.00 0.00 ? 6   A A H8     1  
ATOM 536    H H61    . A A 1 17  ? 131.131 102.199 133.362 1.00 0.00 ? 6   A A H61    1  
ATOM 537    H H62    . A A 1 17  ? 131.707 102.567 131.808 1.00 0.00 ? 6   A A H62    1  
ATOM 538    H H2     . A A 1 17  ? 134.206 99.671  135.243 1.00 0.00 ? 6   A A H2     1  
ATOM 539    P P      . C A 1 18  ? 136.432 95.834  128.637 1.00 0.00 ? 7   C A P      1  
ATOM 540    O OP1    . C A 1 18  ? 137.092 94.620  128.089 1.00 0.00 ? 7   C A OP1    1  
ATOM 541    O OP2    . C A 1 18  ? 135.440 96.564  127.809 1.00 0.00 ? 7   C A OP2    1  
ATOM 542    O "O5'"  . C A 1 18  ? 135.733 95.436  130.011 1.00 0.00 ? 7   C A "O5'"  1  
ATOM 543    C "C5'"  . C A 1 18  ? 136.422 94.664  130.982 1.00 0.00 ? 7   C A "C5'"  1  
ATOM 544    C "C4'"  . C A 1 18  ? 135.614 94.512  132.248 1.00 0.00 ? 7   C A "C4'"  1  
ATOM 545    O "O4'"  . C A 1 18  ? 135.354 95.817  132.826 1.00 0.00 ? 7   C A "O4'"  1  
ATOM 546    C "C3'"  . C A 1 18  ? 134.233 93.895  132.092 1.00 0.00 ? 7   C A "C3'"  1  
ATOM 547    O "O3'"  . C A 1 18  ? 134.266 92.481  131.986 1.00 0.00 ? 7   C A "O3'"  1  
ATOM 548    C "C2'"  . C A 1 18  ? 133.503 94.397  133.330 1.00 0.00 ? 7   C A "C2'"  1  
ATOM 549    O "O2'"  . C A 1 18  ? 133.873 93.657  134.483 1.00 0.00 ? 7   C A "O2'"  1  
ATOM 550    C "C1'"  . C A 1 18  ? 134.054 95.819  133.453 1.00 0.00 ? 7   C A "C1'"  1  
ATOM 551    N N1     . C A 1 18  ? 133.162 96.826  132.829 1.00 0.00 ? 7   C A N1     1  
ATOM 552    C C2     . C A 1 18  ? 132.020 97.230  133.533 1.00 0.00 ? 7   C A C2     1  
ATOM 553    O O2     . C A 1 18  ? 131.789 96.737  134.647 1.00 0.00 ? 7   C A O2     1  
ATOM 554    N N3     . C A 1 18  ? 131.189 98.147  132.986 1.00 0.00 ? 7   C A N3     1  
ATOM 555    C C4     . C A 1 18  ? 131.460 98.661  131.785 1.00 0.00 ? 7   C A C4     1  
ATOM 556    N N4     . C A 1 18  ? 130.611 99.563  131.285 1.00 0.00 ? 7   C A N4     1  
ATOM 557    C C5     . C A 1 18  ? 132.612 98.271  131.045 1.00 0.00 ? 7   C A C5     1  
ATOM 558    C C6     . C A 1 18  ? 133.426 97.363  131.598 1.00 0.00 ? 7   C A C6     1  
ATOM 559    H "H5'"  . C A 1 18  ? 137.272 95.101  131.196 1.00 0.00 ? 7   C A "H5'"  1  
ATOM 560    H "H5''" . C A 1 18  ? 136.603 93.774  130.613 1.00 0.00 ? 7   C A "H5''" 1  
ATOM 561    H "H4'"  . C A 1 18  ? 136.130 93.978  132.890 1.00 0.00 ? 7   C A "H4'"  1  
ATOM 562    H "H3'"  . C A 1 18  ? 133.803 94.266  131.294 1.00 0.00 ? 7   C A "H3'"  1  
ATOM 563    H "H2'"  . C A 1 18  ? 132.531 94.401  133.198 1.00 0.00 ? 7   C A "H2'"  1  
ATOM 564    H "HO2'" . C A 1 18  ? 133.364 93.987  135.253 1.00 0.00 ? 7   C A "HO2'" 1  
ATOM 565    H "H1'"  . C A 1 18  ? 134.180 96.038  134.400 1.00 0.00 ? 7   C A "H1'"  1  
ATOM 566    H H41    . C A 1 18  ? 129.818 99.828  131.798 1.00 0.00 ? 7   C A H41    1  
ATOM 567    H H42    . C A 1 18  ? 130.781 99.960  130.405 1.00 0.00 ? 7   C A H42    1  
ATOM 568    H H5     . C A 1 18  ? 132.802 98.656  130.163 1.00 0.00 ? 7   C A H5     1  
ATOM 569    H H6     . C A 1 18  ? 134.223 97.081  131.102 1.00 0.00 ? 7   C A H6     1  
ATOM 570    P P      . U A 1 19  ? 133.086 91.700  131.222 1.00 0.00 ? 8   U A P      1  
ATOM 571    O OP1    . U A 1 19  ? 133.455 90.264  131.154 1.00 0.00 ? 8   U A OP1    1  
ATOM 572    O OP2    . U A 1 19  ? 132.779 92.441  129.973 1.00 0.00 ? 8   U A OP2    1  
ATOM 573    O "O5'"  . U A 1 19  ? 131.836 91.842  132.199 1.00 0.00 ? 8   U A "O5'"  1  
ATOM 574    C "C5'"  . U A 1 19  ? 131.837 91.229  133.481 1.00 0.00 ? 8   U A "C5'"  1  
ATOM 575    C "C4'"  . U A 1 19  ? 130.617 91.610  134.282 1.00 0.00 ? 8   U A "C4'"  1  
ATOM 576    O "O4'"  . U A 1 19  ? 130.597 93.044  134.506 1.00 0.00 ? 8   U A "O4'"  1  
ATOM 577    C "C3'"  . U A 1 19  ? 129.271 91.321  133.632 1.00 0.00 ? 8   U A "C3'"  1  
ATOM 578    O "O3'"  . U A 1 19  ? 128.886 89.961  133.740 1.00 0.00 ? 8   U A "O3'"  1  
ATOM 579    C "C2'"  . U A 1 19  ? 128.339 92.279  134.358 1.00 0.00 ? 8   U A "C2'"  1  
ATOM 580    O "O2'"  . U A 1 19  ? 128.000 91.790  135.648 1.00 0.00 ? 8   U A "O2'"  1  
ATOM 581    C "C1'"  . U A 1 19  ? 129.231 93.513  134.515 1.00 0.00 ? 8   U A "C1'"  1  
ATOM 582    N N1     . U A 1 19  ? 129.003 94.509  133.440 1.00 0.00 ? 8   U A N1     1  
ATOM 583    C C2     . U A 1 19  ? 127.885 95.315  133.553 1.00 0.00 ? 8   U A C2     1  
ATOM 584    O O2     . U A 1 19  ? 127.100 95.237  134.482 1.00 0.00 ? 8   U A O2     1  
ATOM 585    N N3     . U A 1 19  ? 127.716 96.223  132.537 1.00 0.00 ? 8   U A N3     1  
ATOM 586    C C4     . U A 1 19  ? 128.530 96.405  131.439 1.00 0.00 ? 8   U A C4     1  
ATOM 587    O O4     . U A 1 19  ? 128.242 97.266  130.608 1.00 0.00 ? 8   U A O4     1  
ATOM 588    C C5     . U A 1 19  ? 129.669 95.538  131.389 1.00 0.00 ? 8   U A C5     1  
ATOM 589    C C6     . U A 1 19  ? 129.858 94.645  132.366 1.00 0.00 ? 8   U A C6     1  
ATOM 590    H "H5'"  . U A 1 19  ? 132.641 91.514  133.968 1.00 0.00 ? 8   U A "H5'"  1  
ATOM 591    H "H5''" . U A 1 19  ? 131.858 90.258  133.371 1.00 0.00 ? 8   U A "H5''" 1  
ATOM 592    H "H4'"  . U A 1 19  ? 130.656 91.155  135.148 1.00 0.00 ? 8   U A "H4'"  1  
ATOM 593    H "H3'"  . U A 1 19  ? 129.314 91.569  132.685 1.00 0.00 ? 8   U A "H3'"  1  
ATOM 594    H "H2'"  . U A 1 19  ? 127.541 92.478  133.824 1.00 0.00 ? 8   U A "H2'"  1  
ATOM 595    H "HO2'" . U A 1 19  ? 128.164 90.826  135.677 1.00 0.00 ? 8   U A "HO2'" 1  
ATOM 596    H "H1'"  . U A 1 19  ? 129.059 93.931  135.384 1.00 0.00 ? 8   U A "H1'"  1  
ATOM 597    H H3     . U A 1 19  ? 126.929 96.805  132.597 1.00 0.00 ? 8   U A H3     1  
ATOM 598    H H5     . U A 1 19  ? 130.301 95.598  130.644 1.00 0.00 ? 8   U A H5     1  
ATOM 599    H H6     . U A 1 19  ? 130.642 94.061  132.308 1.00 0.00 ? 8   U A H6     1  
ATOM 600    P P      . C A 1 20  ? 128.243 89.199  132.480 1.00 0.00 ? 9   C A P      1  
ATOM 601    O OP1    . C A 1 20  ? 128.180 87.751  132.802 1.00 0.00 ? 9   C A OP1    1  
ATOM 602    O OP2    . C A 1 20  ? 128.956 89.648  131.258 1.00 0.00 ? 9   C A OP2    1  
ATOM 603    O "O5'"  . C A 1 20  ? 126.751 89.753  132.413 1.00 0.00 ? 9   C A "O5'"  1  
ATOM 604    C "C5'"  . C A 1 20  ? 125.765 89.307  133.331 1.00 0.00 ? 9   C A "C5'"  1  
ATOM 605    C "C4'"  . C A 1 20  ? 124.421 89.934  133.053 1.00 0.00 ? 9   C A "C4'"  1  
ATOM 606    O "O4'"  . C A 1 20  ? 124.485 91.373  133.291 1.00 0.00 ? 9   C A "O4'"  1  
ATOM 607    C "C3'"  . C A 1 20  ? 123.908 89.816  131.627 1.00 0.00 ? 9   C A "C3'"  1  
ATOM 608    O "O3'"  . C A 1 20  ? 123.342 88.547  131.346 1.00 0.00 ? 9   C A "O3'"  1  
ATOM 609    C "C2'"  . C A 1 20  ? 122.915 90.967  131.532 1.00 0.00 ? 9   C A "C2'"  1  
ATOM 610    O "O2'"  . C A 1 20  ? 121.662 90.614  132.099 1.00 0.00 ? 9   C A "O2'"  1  
ATOM 611    C "C1'"  . C A 1 20  ? 123.587 92.014  132.418 1.00 0.00 ? 9   C A "C1'"  1  
ATOM 612    N N1     . C A 1 20  ? 124.293 93.052  131.626 1.00 0.00 ? 9   C A N1     1  
ATOM 613    C C2     . C A 1 20  ? 123.555 94.144  131.152 1.00 0.00 ? 9   C A C2     1  
ATOM 614    O O2     . C A 1 20  ? 122.342 94.211  131.405 1.00 0.00 ? 9   C A O2     1  
ATOM 615    N N3     . C A 1 20  ? 124.175 95.104  130.428 1.00 0.00 ? 9   C A N3     1  
ATOM 616    C C4     . C A 1 20  ? 125.479 95.009  130.170 1.00 0.00 ? 9   C A C4     1  
ATOM 617    N N4     . C A 1 20  ? 126.048 95.980  129.452 1.00 0.00 ? 9   C A N4     1  
ATOM 618    C C5     . C A 1 20  ? 126.257 93.912  130.637 1.00 0.00 ? 9   C A C5     1  
ATOM 619    C C6     . C A 1 20  ? 125.633 92.969  131.353 1.00 0.00 ? 9   C A C6     1  
ATOM 620    H "H5'"  . C A 1 20  ? 126.046 89.542  134.240 1.00 0.00 ? 9   C A "H5'"  1  
ATOM 621    H "H5''" . C A 1 20  ? 125.683 88.333  133.263 1.00 0.00 ? 9   C A "H5''" 1  
ATOM 622    H "H4'"  . C A 1 20  ? 123.759 89.543  133.660 1.00 0.00 ? 9   C A "H4'"  1  
ATOM 623    H "H3'"  . C A 1 20  ? 124.646 89.978  131.003 1.00 0.00 ? 9   C A "H3'"  1  
ATOM 624    H "H2'"  . C A 1 20  ? 122.819 91.283  130.610 1.00 0.00 ? 9   C A "H2'"  1  
ATOM 625    H "HO2'" . C A 1 20  ? 121.030 91.350  131.962 1.00 0.00 ? 9   C A "HO2'" 1  
ATOM 626    H "H1'"  . C A 1 20  ? 122.911 92.440  132.984 1.00 0.00 ? 9   C A "H1'"  1  
ATOM 627    H H41    . C A 1 20  ? 125.509 96.733  129.131 1.00 0.00 ? 9   C A H41    1  
ATOM 628    H H42    . C A 1 20  ? 127.005 95.939  129.245 1.00 0.00 ? 9   C A H42    1  
ATOM 629    H H5     . C A 1 20  ? 127.216 93.851  130.442 1.00 0.00 ? 9   C A H5     1  
ATOM 630    H H6     . C A 1 20  ? 126.152 92.206  131.683 1.00 0.00 ? 9   C A H6     1  
ATOM 631    P P      . G A 1 21  ? 124.206 87.450  130.559 1.00 0.00 ? 10  G A P      1  
ATOM 632    O OP1    . G A 1 21  ? 123.770 86.093  130.977 1.00 0.00 ? 10  G A OP1    1  
ATOM 633    O OP2    . G A 1 21  ? 125.601 87.887  130.823 1.00 0.00 ? 10  G A OP2    1  
ATOM 634    O "O5'"  . G A 1 21  ? 123.932 87.595  128.996 1.00 0.00 ? 10  G A "O5'"  1  
ATOM 635    C "C5'"  . G A 1 21  ? 124.910 87.204  128.045 1.00 0.00 ? 10  G A "C5'"  1  
ATOM 636    C "C4'"  . G A 1 21  ? 124.835 88.043  126.793 1.00 0.00 ? 10  G A "C4'"  1  
ATOM 637    O "O4'"  . G A 1 21  ? 123.476 88.041  126.283 1.00 0.00 ? 10  G A "O4'"  1  
ATOM 638    C "C3'"  . G A 1 21  ? 125.167 89.518  126.957 1.00 0.00 ? 10  G A "C3'"  1  
ATOM 639    O "O3'"  . G A 1 21  ? 126.560 89.773  126.977 1.00 0.00 ? 10  G A "O3'"  1  
ATOM 640    C "C2'"  . G A 1 21  ? 124.446 90.153  125.776 1.00 0.00 ? 10  G A "C2'"  1  
ATOM 641    O "O2'"  . G A 1 21  ? 125.173 89.970  124.570 1.00 0.00 ? 10  G A "O2'"  1  
ATOM 642    C "C1'"  . G A 1 21  ? 123.165 89.321  125.715 1.00 0.00 ? 10  G A "C1'"  1  
ATOM 643    N N9     . G A 1 21  ? 122.053 89.958  126.444 1.00 0.00 ? 10  G A N9     1  
ATOM 644    C C8     . G A 1 21  ? 121.516 89.568  127.648 1.00 0.00 ? 10  G A C8     1  
ATOM 645    N N7     . G A 1 21  ? 120.534 90.334  128.043 1.00 0.00 ? 10  G A N7     1  
ATOM 646    C C5     . G A 1 21  ? 120.415 91.285  127.040 1.00 0.00 ? 10  G A C5     1  
ATOM 647    C C6     . G A 1 21  ? 119.522 92.381  126.913 1.00 0.00 ? 10  G A C6     1  
ATOM 648    O O6     . G A 1 21  ? 118.627 92.739  127.688 1.00 0.00 ? 10  G A O6     1  
ATOM 649    N N1     . G A 1 21  ? 119.747 93.093  125.739 1.00 0.00 ? 10  G A N1     1  
ATOM 650    C C2     . G A 1 21  ? 120.708 92.791  124.805 1.00 0.00 ? 10  G A C2     1  
ATOM 651    N N2     . G A 1 21  ? 120.772 93.595  123.734 1.00 0.00 ? 10  G A N2     1  
ATOM 652    N N3     . G A 1 21  ? 121.546 91.772  124.912 1.00 0.00 ? 10  G A N3     1  
ATOM 653    C C4     . G A 1 21  ? 121.345 91.069  126.047 1.00 0.00 ? 10  G A C4     1  
ATOM 654    H "H5'"  . G A 1 21  ? 124.769 86.264  127.809 1.00 0.00 ? 10  G A "H5'"  1  
ATOM 655    H "H5''" . G A 1 21  ? 125.801 87.303  128.443 1.00 0.00 ? 10  G A "H5''" 1  
ATOM 656    H "H4'"  . G A 1 21  ? 125.428 87.656  126.116 1.00 0.00 ? 10  G A "H4'"  1  
ATOM 657    H "H3'"  . G A 1 21  ? 124.767 89.846  127.791 1.00 0.00 ? 10  G A "H3'"  1  
ATOM 658    H "H2'"  . G A 1 21  ? 124.251 91.100  125.941 1.00 0.00 ? 10  G A "H2'"  1  
ATOM 659    H "HO2'" . G A 1 21  ? 124.714 90.442  123.845 1.00 0.00 ? 10  G A "HO2'" 1  
ATOM 660    H "H1'"  . G A 1 21  ? 122.908 89.186  124.780 1.00 0.00 ? 10  G A "H1'"  1  
ATOM 661    H H8     . G A 1 21  ? 121.835 88.796  128.158 1.00 0.00 ? 10  G A H8     1  
ATOM 662    H H1     . G A 1 21  ? 119.175 93.868  125.566 1.00 0.00 ? 10  G A H1     1  
ATOM 663    H H21    . G A 1 21  ? 120.156 94.351  123.648 1.00 0.00 ? 10  G A H21    1  
ATOM 664    H H22    . G A 1 21  ? 121.440 93.427  123.035 1.00 0.00 ? 10  G A H22    1  
ATOM 665    P P      . C A 1 22  ? 127.133 91.059  127.754 1.00 0.00 ? 11  C A P      1  
ATOM 666    O OP1    . C A 1 22  ? 128.617 91.018  127.678 1.00 0.00 ? 11  C A OP1    1  
ATOM 667    O OP2    . C A 1 22  ? 126.470 91.130  129.080 1.00 0.00 ? 11  C A OP2    1  
ATOM 668    O "O5'"  . C A 1 22  ? 126.630 92.293  126.883 1.00 0.00 ? 11  C A "O5'"  1  
ATOM 669    C "C5'"  . C A 1 22  ? 127.220 92.587  125.625 1.00 0.00 ? 11  C A "C5'"  1  
ATOM 670    C "C4'"  . C A 1 22  ? 126.562 93.774  124.965 1.00 0.00 ? 11  C A "C4'"  1  
ATOM 671    O "O4'"  . C A 1 22  ? 125.148 93.514  124.774 1.00 0.00 ? 11  C A "O4'"  1  
ATOM 672    C "C3'"  . C A 1 22  ? 126.594 95.079  125.747 1.00 0.00 ? 11  C A "C3'"  1  
ATOM 673    O "O3'"  . C A 1 22  ? 127.835 95.758  125.644 1.00 0.00 ? 11  C A "O3'"  1  
ATOM 674    C "C2'"  . C A 1 22  ? 125.424 95.851  125.156 1.00 0.00 ? 11  C A "C2'"  1  
ATOM 675    O "O2'"  . C A 1 22  ? 125.762 96.413  123.896 1.00 0.00 ? 11  C A "O2'"  1  
ATOM 676    C "C1'"  . C A 1 22  ? 124.400 94.736  124.943 1.00 0.00 ? 11  C A "C1'"  1  
ATOM 677    N N1     . C A 1 22  ? 123.442 94.627  126.072 1.00 0.00 ? 11  C A N1     1  
ATOM 678    C C2     . C A 1 22  ? 122.397 95.556  126.149 1.00 0.00 ? 11  C A C2     1  
ATOM 679    O O2     . C A 1 22  ? 122.304 96.437  125.280 1.00 0.00 ? 11  C A O2     1  
ATOM 680    N N3     . C A 1 22  ? 121.511 95.480  127.167 1.00 0.00 ? 11  C A N3     1  
ATOM 681    C C4     . C A 1 22  ? 121.633 94.526  128.089 1.00 0.00 ? 11  C A C4     1  
ATOM 682    N N4     . C A 1 22  ? 120.734 94.488  129.076 1.00 0.00 ? 11  C A N4     1  
ATOM 683    C C5     . C A 1 22  ? 122.684 93.567  128.040 1.00 0.00 ? 11  C A C5     1  
ATOM 684    C C6     . C A 1 22  ? 123.555 93.652  127.027 1.00 0.00 ? 11  C A C6     1  
ATOM 685    H "H5'"  . C A 1 22  ? 127.130 91.806  125.040 1.00 0.00 ? 11  C A "H5'"  1  
ATOM 686    H "H5''" . C A 1 22  ? 128.171 92.780  125.756 1.00 0.00 ? 11  C A "H5''" 1  
ATOM 687    H "H4'"  . C A 1 22  ? 126.979 93.919  124.089 1.00 0.00 ? 11  C A "H4'"  1  
ATOM 688    H "H3'"  . C A 1 22  ? 126.409 94.891  126.693 1.00 0.00 ? 11  C A "H3'"  1  
ATOM 689    H "H2'"  . C A 1 22  ? 125.090 96.531  125.778 1.00 0.00 ? 11  C A "H2'"  1  
ATOM 690    H "HO2'" . C A 1 22  ? 126.738 96.463  123.820 1.00 0.00 ? 11  C A "HO2'" 1  
ATOM 691    H "H1'"  . C A 1 22  ? 123.905 94.901  124.113 1.00 0.00 ? 11  C A "H1'"  1  
ATOM 692    H H41    . C A 1 22  ? 120.014 95.151  129.109 1.00 0.00 ? 11  C A H41    1  
ATOM 693    H H42    . C A 1 22  ? 120.798 93.799  129.770 1.00 0.00 ? 11  C A H42    1  
ATOM 694    H H5     . C A 1 22  ? 122.766 92.867  128.722 1.00 0.00 ? 11  C A H5     1  
ATOM 695    H H6     . C A 1 22  ? 124.284 93.000  126.976 1.00 0.00 ? 11  C A H6     1  
ATOM 696    P P      . A A 1 23  ? 128.375 96.646  126.870 1.00 0.00 ? 12  A A P      1  
ATOM 697    O OP1    . A A 1 23  ? 129.608 97.343  126.425 1.00 0.00 ? 12  A A OP1    1  
ATOM 698    O OP2    . A A 1 23  ? 128.414 95.785  128.079 1.00 0.00 ? 12  A A OP2    1  
ATOM 699    O "O5'"  . A A 1 23  ? 127.238 97.741  127.083 1.00 0.00 ? 12  A A "O5'"  1  
ATOM 700    C "C5'"  . A A 1 23  ? 127.472 98.888  127.887 1.00 0.00 ? 12  A A "C5'"  1  
ATOM 701    C "C4'"  . A A 1 23  ? 126.370 99.906  127.734 1.00 0.00 ? 12  A A "C4'"  1  
ATOM 702    O "O4'"  . A A 1 23  ? 126.325 100.774 128.911 1.00 0.00 ? 12  A A "O4'"  1  
ATOM 703    C "C3'"  . A A 1 23  ? 126.467 100.817 126.519 1.00 0.00 ? 12  A A "C3'"  1  
ATOM 704    O "O3'"  . A A 1 23  ? 125.202 101.159 125.980 1.00 0.00 ? 12  A A "O3'"  1  
ATOM 705    C "C2'"  . A A 1 23  ? 127.065 102.082 127.130 1.00 0.00 ? 12  A A "C2'"  1  
ATOM 706    O "O2'"  . A A 1 23  ? 126.704 103.234 126.383 1.00 0.00 ? 12  A A "O2'"  1  
ATOM 707    C "C1'"  . A A 1 23  ? 126.342 102.106 128.489 1.00 0.00 ? 12  A A "C1'"  1  
ATOM 708    N N9     . A A 1 23  ? 127.064 102.917 129.488 1.00 0.00 ? 12  A A N9     1  
ATOM 709    C C8     . A A 1 23  ? 126.534 103.763 130.431 1.00 0.00 ? 12  A A C8     1  
ATOM 710    N N7     . A A 1 23  ? 127.434 104.349 131.182 1.00 0.00 ? 12  A A N7     1  
ATOM 711    C C5     . A A 1 23  ? 128.640 103.855 130.702 1.00 0.00 ? 12  A A C5     1  
ATOM 712    C C6     . A A 1 23  ? 129.975 104.089 131.076 1.00 0.00 ? 12  A A C6     1  
ATOM 713    N N6     . A A 1 23  ? 130.334 104.913 132.063 1.00 0.00 ? 12  A A N6     1  
ATOM 714    N N1     . A A 1 23  ? 130.941 103.438 130.394 1.00 0.00 ? 12  A A N1     1  
ATOM 715    C C2     . A A 1 23  ? 130.582 102.610 129.404 1.00 0.00 ? 12  A A C2     1  
ATOM 716    N N3     . A A 1 23  ? 129.364 102.309 128.960 1.00 0.00 ? 12  A A N3     1  
ATOM 717    C C4     . A A 1 23  ? 128.426 102.973 129.659 1.00 0.00 ? 12  A A C4     1  
ATOM 718    H "H5'"  . A A 1 23  ? 128.323 99.296  127.623 1.00 0.00 ? 12  A A "H5'"  1  
ATOM 719    H "H5''" . A A 1 23  ? 127.527 98.615  128.826 1.00 0.00 ? 12  A A "H5''" 1  
ATOM 720    H "H4'"  . A A 1 23  ? 125.513 99.437  127.653 1.00 0.00 ? 12  A A "H4'"  1  
ATOM 721    H "H3'"  . A A 1 23  ? 127.101 100.431 125.878 1.00 0.00 ? 12  A A "H3'"  1  
ATOM 722    H "H2'"  . A A 1 23  ? 128.037 102.005 127.234 1.00 0.00 ? 12  A A "H2'"  1  
ATOM 723    H "HO2'" . A A 1 23  ? 127.298 103.973 126.632 1.00 0.00 ? 12  A A "HO2'" 1  
ATOM 724    H "H1'"  . A A 1 23  ? 125.437 102.464 128.371 1.00 0.00 ? 12  A A "H1'"  1  
ATOM 725    H H8     . A A 1 23  ? 125.571 103.915 130.533 1.00 0.00 ? 12  A A H8     1  
ATOM 726    H H61    . A A 1 23  ? 131.282 105.036 132.278 1.00 0.00 ? 12  A A H61    1  
ATOM 727    H H62    . A A 1 23  ? 129.650 105.397 132.571 1.00 0.00 ? 12  A A H62    1  
ATOM 728    H H2     . A A 1 23  ? 131.321 102.162 128.941 1.00 0.00 ? 12  A A H2     1  
ATOM 729    P P      . G A 1 24  ? 124.897 100.923 124.420 1.00 0.00 ? 13  G A P      1  
ATOM 730    O OP1    . G A 1 24  ? 124.176 99.632  124.282 1.00 0.00 ? 13  G A OP1    1  
ATOM 731    O OP2    . G A 1 24  ? 126.157 101.145 123.667 1.00 0.00 ? 13  G A OP2    1  
ATOM 732    O "O5'"  . G A 1 24  ? 123.884 102.095 124.043 1.00 0.00 ? 13  G A "O5'"  1  
ATOM 733    C "C5'"  . G A 1 24  ? 122.574 102.129 124.587 1.00 0.00 ? 13  G A "C5'"  1  
ATOM 734    C "C4'"  . G A 1 24  ? 122.125 103.542 124.863 1.00 0.00 ? 13  G A "C4'"  1  
ATOM 735    O "O4'"  . G A 1 24  ? 122.974 104.152 125.895 1.00 0.00 ? 13  G A "O4'"  1  
ATOM 736    C "C3'"  . G A 1 24  ? 122.133 104.490 123.672 1.00 0.00 ? 13  G A "C3'"  1  
ATOM 737    O "O3'"  . G A 1 24  ? 121.027 105.376 123.663 1.00 0.00 ? 13  G A "O3'"  1  
ATOM 738    C "C2'"  . G A 1 24  ? 123.386 105.325 123.913 1.00 0.00 ? 13  G A "C2'"  1  
ATOM 739    O "O2'"  . G A 1 24  ? 123.256 106.623 123.352 1.00 0.00 ? 13  G A "O2'"  1  
ATOM 740    C "C1'"  . G A 1 24  ? 123.361 105.425 125.423 1.00 0.00 ? 13  G A "C1'"  1  
ATOM 741    N N9     . G A 1 24  ? 124.688 105.752 125.980 1.00 0.00 ? 13  G A N9     1  
ATOM 742    C C8     . G A 1 24  ? 125.894 105.727 125.324 1.00 0.00 ? 13  G A C8     1  
ATOM 743    N N7     . G A 1 24  ? 126.900 106.068 126.084 1.00 0.00 ? 13  G A N7     1  
ATOM 744    C C5     . G A 1 24  ? 126.323 106.334 127.317 1.00 0.00 ? 13  G A C5     1  
ATOM 745    C C6     . G A 1 24  ? 126.914 106.750 128.538 1.00 0.00 ? 13  G A C6     1  
ATOM 746    O O6     . G A 1 24  ? 128.105 106.972 128.781 1.00 0.00 ? 13  G A O6     1  
ATOM 747    N N1     . G A 1 24  ? 125.962 106.903 129.542 1.00 0.00 ? 13  G A N1     1  
ATOM 748    C C2     . G A 1 24  ? 124.614 106.686 129.391 1.00 0.00 ? 13  G A C2     1  
ATOM 749    N N2     . G A 1 24  ? 123.853 106.887 130.477 1.00 0.00 ? 13  G A N2     1  
ATOM 750    N N3     . G A 1 24  ? 124.051 106.299 128.258 1.00 0.00 ? 13  G A N3     1  
ATOM 751    C C4     . G A 1 24  ? 124.958 106.144 127.271 1.00 0.00 ? 13  G A C4     1  
ATOM 752    H "H5'"  . G A 1 24  ? 122.561 101.620 125.424 1.00 0.00 ? 13  G A "H5'"  1  
ATOM 753    H "H5''" . G A 1 24  ? 121.953 101.714 123.952 1.00 0.00 ? 13  G A "H5''" 1  
ATOM 754    H "H4'"  . G A 1 24  ? 121.200 103.524 125.188 1.00 0.00 ? 13  G A "H4'"  1  
ATOM 755    H "H3'"  . G A 1 24  ? 122.249 103.971 122.850 1.00 0.00 ? 13  G A "H3'"  1  
ATOM 756    H "H2'"  . G A 1 24  ? 124.190 104.868 123.589 1.00 0.00 ? 13  G A "H2'"  1  
ATOM 757    H "HO2'" . G A 1 24  ? 124.077 107.130 123.525 1.00 0.00 ? 13  G A "HO2'" 1  
ATOM 758    H "H1'"  . G A 1 24  ? 122.715 106.110 125.695 1.00 0.00 ? 13  G A "H1'"  1  
ATOM 759    H H8     . G A 1 24  ? 125.992 105.479 124.381 1.00 0.00 ? 13  G A H8     1  
ATOM 760    H H1     . G A 1 24  ? 126.280 107.189 130.424 1.00 0.00 ? 13  G A H1     1  
ATOM 761    H H21    . G A 1 24  ? 124.263 107.174 131.319 1.00 0.00 ? 13  G A H21    1  
ATOM 762    H H22    . G A 1 24  ? 122.884 106.748 130.429 1.00 0.00 ? 13  G A H22    1  
ATOM 763    P P      . G A 1 25  ? 119.796 105.121 122.661 1.00 0.00 ? 14  G A P      1  
ATOM 764    O OP1    . G A 1 25  ? 119.590 103.654 122.550 1.00 0.00 ? 14  G A OP1    1  
ATOM 765    O OP2    . G A 1 25  ? 120.028 105.925 121.434 1.00 0.00 ? 14  G A OP2    1  
ATOM 766    O "O5'"  . G A 1 25  ? 118.542 105.738 123.426 1.00 0.00 ? 14  G A "O5'"  1  
ATOM 767    C "C5'"  . G A 1 25  ? 118.534 107.098 123.835 1.00 0.00 ? 14  G A "C5'"  1  
ATOM 768    C "C4'"  . G A 1 25  ? 117.135 107.581 124.125 1.00 0.00 ? 14  G A "C4'"  1  
ATOM 769    O "O4'"  . G A 1 25  ? 116.362 107.730 122.916 1.00 0.00 ? 14  G A "O4'"  1  
ATOM 770    C "C3'"  . G A 1 25  ? 116.291 106.686 125.020 1.00 0.00 ? 14  G A "C3'"  1  
ATOM 771    O "O3'"  . G A 1 25  ? 116.420 107.001 126.396 1.00 0.00 ? 14  G A "O3'"  1  
ATOM 772    C "C2'"  . G A 1 25  ? 114.853 106.951 124.551 1.00 0.00 ? 14  G A "C2'"  1  
ATOM 773    O "O2'"  . G A 1 25  ? 114.298 108.083 125.205 1.00 0.00 ? 14  G A "O2'"  1  
ATOM 774    C "C1'"  . G A 1 25  ? 115.021 107.296 123.063 1.00 0.00 ? 14  G A "C1'"  1  
ATOM 775    N N9     . G A 1 25  ? 114.801 106.125 122.193 1.00 0.00 ? 14  G A N9     1  
ATOM 776    C C8     . G A 1 25  ? 115.034 104.806 122.499 1.00 0.00 ? 14  G A C8     1  
ATOM 777    N N7     . G A 1 25  ? 114.743 103.993 121.520 1.00 0.00 ? 14  G A N7     1  
ATOM 778    C C5     . G A 1 25  ? 114.289 104.824 120.506 1.00 0.00 ? 14  G A C5     1  
ATOM 779    C C6     . G A 1 25  ? 113.829 104.515 119.200 1.00 0.00 ? 14  G A C6     1  
ATOM 780    O O6     . G A 1 25  ? 113.728 103.407 118.661 1.00 0.00 ? 14  G A O6     1  
ATOM 781    N N1     . G A 1 25  ? 113.465 105.661 118.500 1.00 0.00 ? 14  G A N1     1  
ATOM 782    C C2     . G A 1 25  ? 113.534 106.941 118.993 1.00 0.00 ? 14  G A C2     1  
ATOM 783    N N2     . G A 1 25  ? 113.137 107.920 118.165 1.00 0.00 ? 14  G A N2     1  
ATOM 784    N N3     . G A 1 25  ? 113.961 107.243 120.208 1.00 0.00 ? 14  G A N3     1  
ATOM 785    C C4     . G A 1 25  ? 114.319 106.144 120.905 1.00 0.00 ? 14  G A C4     1  
ATOM 786    H "H5'"  . G A 1 25  ? 118.922 107.648 123.124 1.00 0.00 ? 14  G A "H5'"  1  
ATOM 787    H "H5''" . G A 1 25  ? 119.079 107.191 124.645 1.00 0.00 ? 14  G A "H5''" 1  
ATOM 788    H "H4'"  . G A 1 25  ? 117.186 108.458 124.561 1.00 0.00 ? 14  G A "H4'"  1  
ATOM 789    H "H3'"  . G A 1 25  ? 116.512 105.750 124.838 1.00 0.00 ? 14  G A "H3'"  1  
ATOM 790    H "H2'"  . G A 1 25  ? 114.289 106.157 124.657 1.00 0.00 ? 14  G A "H2'"  1  
ATOM 791    H "HO2'" . G A 1 25  ? 113.365 108.188 124.923 1.00 0.00 ? 14  G A "HO2'" 1  
ATOM 792    H "H1'"  . G A 1 25  ? 114.390 108.006 122.820 1.00 0.00 ? 14  G A "H1'"  1  
ATOM 793    H H8     . G A 1 25  ? 115.384 104.506 123.363 1.00 0.00 ? 14  G A H8     1  
ATOM 794    H H1     . G A 1 25  ? 113.134 105.543 117.585 1.00 0.00 ? 14  G A H1     1  
ATOM 795    H H21    . G A 1 25  ? 112.820 107.705 117.264 1.00 0.00 ? 14  G A H21    1  
ATOM 796    H H22    . G A 1 25  ? 113.164 108.854 118.463 1.00 0.00 ? 14  G A H22    1  
ATOM 797    P P      . A A 1 26  ? 117.873 106.997 127.081 1.00 0.00 ? 15  A A P      1  
ATOM 798    O OP1    . A A 1 26  ? 117.714 106.884 128.552 1.00 0.00 ? 15  A A OP1    1  
ATOM 799    O OP2    . A A 1 26  ? 118.507 108.207 126.501 1.00 0.00 ? 15  A A OP2    1  
ATOM 800    O "O5'"  . A A 1 26  ? 118.687 105.724 126.573 1.00 0.00 ? 15  A A "O5'"  1  
ATOM 801    C "C5'"  . A A 1 26  ? 119.649 105.095 127.406 1.00 0.00 ? 15  A A "C5'"  1  
ATOM 802    C "C4'"  . A A 1 26  ? 119.002 104.134 128.372 1.00 0.00 ? 15  A A "C4'"  1  
ATOM 803    O "O4'"  . A A 1 26  ? 118.992 102.812 127.781 1.00 0.00 ? 15  A A "O4'"  1  
ATOM 804    C "C3'"  . A A 1 26  ? 119.734 103.917 129.688 1.00 0.00 ? 15  A A "C3'"  1  
ATOM 805    O "O3'"  . A A 1 26  ? 119.523 104.964 130.619 1.00 0.00 ? 15  A A "O3'"  1  
ATOM 806    C "C2'"  . A A 1 26  ? 119.076 102.620 130.131 1.00 0.00 ? 15  A A "C2'"  1  
ATOM 807    O "O2'"  . A A 1 26  ? 117.755 102.847 130.600 1.00 0.00 ? 15  A A "O2'"  1  
ATOM 808    C "C1'"  . A A 1 26  ? 119.017 101.864 128.810 1.00 0.00 ? 15  A A "C1'"  1  
ATOM 809    N N9     . A A 1 26  ? 120.178 100.973 128.627 1.00 0.00 ? 15  A A N9     1  
ATOM 810    C C8     . A A 1 26  ? 121.181 101.075 127.695 1.00 0.00 ? 15  A A C8     1  
ATOM 811    N N7     . A A 1 26  ? 122.081 100.127 127.781 1.00 0.00 ? 15  A A N7     1  
ATOM 812    C C5     . A A 1 26  ? 121.642 99.347  128.842 1.00 0.00 ? 15  A A C5     1  
ATOM 813    C C6     . A A 1 26  ? 122.159 98.183  129.440 1.00 0.00 ? 15  A A C6     1  
ATOM 814    N N6     . A A 1 26  ? 123.279 97.579  129.037 1.00 0.00 ? 15  A A N6     1  
ATOM 815    N N1     . A A 1 26  ? 121.478 97.656  130.480 1.00 0.00 ? 15  A A N1     1  
ATOM 816    C C2     . A A 1 26  ? 120.355 98.262  130.885 1.00 0.00 ? 15  A A C2     1  
ATOM 817    N N3     . A A 1 26  ? 119.769 99.357  130.404 1.00 0.00 ? 15  A A N3     1  
ATOM 818    C C4     . A A 1 26  ? 120.472 99.857  129.372 1.00 0.00 ? 15  A A C4     1  
ATOM 819    H "H5'"  . A A 1 26  ? 120.131 105.781 127.914 1.00 0.00 ? 15  A A "H5'"  1  
ATOM 820    H "H5''" . A A 1 26  ? 120.286 104.605 126.847 1.00 0.00 ? 15  A A "H5''" 1  
ATOM 821    H "H4'"  . A A 1 26  ? 118.082 104.412 128.563 1.00 0.00 ? 15  A A "H4'"  1  
ATOM 822    H "H3'"  . A A 1 26  ? 120.698 103.780 129.571 1.00 0.00 ? 15  A A "H3'"  1  
ATOM 823    H "H2'"  . A A 1 26  ? 119.622 102.149 130.794 1.00 0.00 ? 15  A A "H2'"  1  
ATOM 824    H "HO2'" . A A 1 26  ? 117.698 103.755 130.963 1.00 0.00 ? 15  A A "HO2'" 1  
ATOM 825    H "H1'"  . A A 1 26  ? 118.191 101.336 128.774 1.00 0.00 ? 15  A A "H1'"  1  
ATOM 826    H H8     . A A 1 26  ? 121.221 101.791 127.026 1.00 0.00 ? 15  A A H8     1  
ATOM 827    H H61    . A A 1 26  ? 123.590 96.769  129.494 1.00 0.00 ? 15  A A H61    1  
ATOM 828    H H62    . A A 1 26  ? 123.790 97.944  128.285 1.00 0.00 ? 15  A A H62    1  
ATOM 829    H H2     . A A 1 26  ? 119.898 97.840  131.643 1.00 0.00 ? 15  A A H2     1  
ATOM 830    P P      . A A 1 27  ? 120.596 105.237 131.784 1.00 0.00 ? 16  A A P      1  
ATOM 831    O OP1    . A A 1 27  ? 120.068 106.319 132.652 1.00 0.00 ? 16  A A OP1    1  
ATOM 832    O OP2    . A A 1 27  ? 121.931 105.388 131.153 1.00 0.00 ? 16  A A OP2    1  
ATOM 833    O "O5'"  . A A 1 27  ? 120.601 103.887 132.628 1.00 0.00 ? 16  A A "O5'"  1  
ATOM 834    C "C5'"  . A A 1 27  ? 119.448 103.468 133.342 1.00 0.00 ? 16  A A "C5'"  1  
ATOM 835    C "C4'"  . A A 1 27  ? 119.750 102.303 134.251 1.00 0.00 ? 16  A A "C4'"  1  
ATOM 836    O "O4'"  . A A 1 27  ? 119.914 101.095 133.463 1.00 0.00 ? 16  A A "O4'"  1  
ATOM 837    C "C3'"  . A A 1 27  ? 121.036 102.402 135.056 1.00 0.00 ? 16  A A "C3'"  1  
ATOM 838    O "O3'"  . A A 1 27  ? 120.897 103.184 136.230 1.00 0.00 ? 16  A A "O3'"  1  
ATOM 839    C "C2'"  . A A 1 27  ? 121.368 100.941 135.329 1.00 0.00 ? 16  A A "C2'"  1  
ATOM 840    O "O2'"  . A A 1 27  ? 120.566 100.418 136.379 1.00 0.00 ? 16  A A "O2'"  1  
ATOM 841    C "C1'"  . A A 1 27  ? 120.953 100.282 134.012 1.00 0.00 ? 16  A A "C1'"  1  
ATOM 842    N N9     . A A 1 27  ? 122.078 100.190 133.061 1.00 0.00 ? 16  A A N9     1  
ATOM 843    C C8     . A A 1 27  ? 122.313 100.969 131.955 1.00 0.00 ? 16  A A C8     1  
ATOM 844    N N7     . A A 1 27  ? 123.401 100.643 131.301 1.00 0.00 ? 16  A A N7     1  
ATOM 845    C C5     . A A 1 27  ? 123.917 99.576  132.024 1.00 0.00 ? 16  A A C5     1  
ATOM 846    C C6     . A A 1 27  ? 125.061 98.778  131.847 1.00 0.00 ? 16  A A C6     1  
ATOM 847    N N6     . A A 1 27  ? 125.930 98.941  130.847 1.00 0.00 ? 16  A A N6     1  
ATOM 848    N N1     . A A 1 27  ? 125.287 97.797  132.746 1.00 0.00 ? 16  A A N1     1  
ATOM 849    C C2     . A A 1 27  ? 124.417 97.633  133.752 1.00 0.00 ? 16  A A C2     1  
ATOM 850    N N3     . A A 1 27  ? 123.306 98.318  134.021 1.00 0.00 ? 16  A A N3     1  
ATOM 851    C C4     . A A 1 27  ? 123.112 99.286  133.111 1.00 0.00 ? 16  A A C4     1  
ATOM 852    H "H5'"  . A A 1 27  ? 118.751 103.204 132.702 1.00 0.00 ? 16  A A "H5'"  1  
ATOM 853    H "H5''" . A A 1 27  ? 119.117 104.218 133.881 1.00 0.00 ? 16  A A "H5''" 1  
ATOM 854    H "H4'"  . A A 1 27  ? 118.997 102.180 134.868 1.00 0.00 ? 16  A A "H4'"  1  
ATOM 855    H "H3'"  . A A 1 27  ? 121.737 102.790 134.492 1.00 0.00 ? 16  A A "H3'"  1  
ATOM 856    H "H2'"  . A A 1 27  ? 122.325 100.818 135.508 1.00 0.00 ? 16  A A "H2'"  1  
ATOM 857    H "HO2'" . A A 1 27  ? 120.211 101.160 136.907 1.00 0.00 ? 16  A A "HO2'" 1  
ATOM 858    H "H1'"  . A A 1 27  ? 120.606 99.383  134.193 1.00 0.00 ? 16  A A "H1'"  1  
ATOM 859    H H8     . A A 1 27  ? 121.722 101.703 131.681 1.00 0.00 ? 16  A A H8     1  
ATOM 860    H H61    . A A 1 27  ? 126.711 98.352  130.776 1.00 0.00 ? 16  A A H61    1  
ATOM 861    H H62    . A A 1 27  ? 125.787 99.648  130.183 1.00 0.00 ? 16  A A H62    1  
ATOM 862    H H2     . A A 1 27  ? 124.626 96.907  134.376 1.00 0.00 ? 16  A A H2     1  
ATOM 863    P P      . G A 1 28  ? 122.156 103.995 136.813 1.00 0.00 ? 17  G A P      1  
ATOM 864    O OP1    . G A 1 28  ? 121.664 104.889 137.893 1.00 0.00 ? 17  G A OP1    1  
ATOM 865    O OP2    . G A 1 28  ? 122.902 104.571 135.667 1.00 0.00 ? 17  G A OP2    1  
ATOM 866    O "O5'"  . G A 1 28  ? 123.066 102.869 137.481 1.00 0.00 ? 17  G A "O5'"  1  
ATOM 867    C "C5'"  . G A 1 28  ? 122.628 102.167 138.633 1.00 0.00 ? 17  G A "C5'"  1  
ATOM 868    C "C4'"  . G A 1 28  ? 123.572 101.047 138.991 1.00 0.00 ? 17  G A "C4'"  1  
ATOM 869    O "O4'"  . G A 1 28  ? 123.647 100.097 137.895 1.00 0.00 ? 17  G A "O4'"  1  
ATOM 870    C "C3'"  . G A 1 28  ? 125.020 101.446 139.233 1.00 0.00 ? 17  G A "C3'"  1  
ATOM 871    O "O3'"  . G A 1 28  ? 125.241 101.962 140.535 1.00 0.00 ? 17  G A "O3'"  1  
ATOM 872    C "C2'"  . G A 1 28  ? 125.773 100.152 138.952 1.00 0.00 ? 17  G A "C2'"  1  
ATOM 873    O "O2'"  . G A 1 28  ? 125.673 99.249  140.045 1.00 0.00 ? 17  G A "O2'"  1  
ATOM 874    C "C1'"  . G A 1 28  ? 124.981 99.590  137.770 1.00 0.00 ? 17  G A "C1'"  1  
ATOM 875    N N9     . G A 1 28  ? 125.568 99.977  136.473 1.00 0.00 ? 17  G A N9     1  
ATOM 876    C C8     . G A 1 28  ? 125.076 100.896 135.578 1.00 0.00 ? 17  G A C8     1  
ATOM 877    N N7     . G A 1 28  ? 125.817 101.025 134.512 1.00 0.00 ? 17  G A N7     1  
ATOM 878    C C5     . G A 1 28  ? 126.866 100.140 134.717 1.00 0.00 ? 17  G A C5     1  
ATOM 879    C C6     . G A 1 28  ? 127.989 99.840  133.900 1.00 0.00 ? 17  G A C6     1  
ATOM 880    O O6     . G A 1 28  ? 128.286 100.315 132.798 1.00 0.00 ? 17  G A O6     1  
ATOM 881    N N1     . G A 1 28  ? 128.807 98.881  134.487 1.00 0.00 ? 17  G A N1     1  
ATOM 882    C C2     . G A 1 28  ? 128.577 98.285  135.703 1.00 0.00 ? 17  G A C2     1  
ATOM 883    N N2     . G A 1 28  ? 129.483 97.379  136.104 1.00 0.00 ? 17  G A N2     1  
ATOM 884    N N3     . G A 1 28  ? 127.536 98.555  136.473 1.00 0.00 ? 17  G A N3     1  
ATOM 885    C C4     . G A 1 28  ? 126.730 99.486  135.921 1.00 0.00 ? 17  G A C4     1  
ATOM 886    H "H5'"  . G A 1 28  ? 121.738 101.793 138.461 1.00 0.00 ? 17  G A "H5'"  1  
ATOM 887    H "H5''" . G A 1 28  ? 122.572 102.791 139.385 1.00 0.00 ? 17  G A "H5''" 1  
ATOM 888    H "H4'"  . G A 1 28  ? 123.232 100.585 139.787 1.00 0.00 ? 17  G A "H4'"  1  
ATOM 889    H "H3'"  . G A 1 28  ? 125.284 102.119 138.571 1.00 0.00 ? 17  G A "H3'"  1  
ATOM 890    H "H2'"  . G A 1 28  ? 126.707 100.325 138.708 1.00 0.00 ? 17  G A "H2'"  1  
ATOM 891    H "HO2'" . G A 1 28  ? 126.203 98.450  139.845 1.00 0.00 ? 17  G A "HO2'" 1  
ATOM 892    H "H1'"  . G A 1 28  ? 124.951 98.613  137.833 1.00 0.00 ? 17  G A "H1'"  1  
ATOM 893    H H8     . G A 1 28  ? 124.248 101.401 135.725 1.00 0.00 ? 17  G A H8     1  
ATOM 894    H H1     . G A 1 28  ? 129.610 98.610  133.994 1.00 0.00 ? 17  G A H1     1  
ATOM 895    H H21    . G A 1 28  ? 130.257 97.174  135.540 1.00 0.00 ? 17  G A H21    1  
ATOM 896    H H22    . G A 1 28  ? 129.371 96.923  136.964 1.00 0.00 ? 17  G A H22    1  
ATOM 897    P P      . U A 1 29  ? 126.397 103.050 140.784 1.00 0.00 ? 18  U A P      1  
ATOM 898    O OP1    . U A 1 29  ? 126.225 103.597 142.155 1.00 0.00 ? 18  U A OP1    1  
ATOM 899    O OP2    . U A 1 29  ? 126.416 103.975 139.622 1.00 0.00 ? 18  U A OP2    1  
ATOM 900    O "O5'"  . U A 1 29  ? 127.742 102.198 140.759 1.00 0.00 ? 18  U A "O5'"  1  
ATOM 901    C "C5'"  . U A 1 29  ? 128.023 101.247 141.774 1.00 0.00 ? 18  U A "C5'"  1  
ATOM 902    C "C4'"  . U A 1 29  ? 129.312 100.509 141.506 1.00 0.00 ? 18  U A "C4'"  1  
ATOM 903    O "O4'"  . U A 1 29  ? 129.200 99.751  140.274 1.00 0.00 ? 18  U A "O4'"  1  
ATOM 904    C "C3'"  . U A 1 29  ? 130.548 101.372 141.300 1.00 0.00 ? 18  U A "C3'"  1  
ATOM 905    O "O3'"  . U A 1 29  ? 131.143 101.790 142.518 1.00 0.00 ? 18  U A "O3'"  1  
ATOM 906    C "C2'"  . U A 1 29  ? 131.444 100.473 140.461 1.00 0.00 ? 18  U A "C2'"  1  
ATOM 907    O "O2'"  . U A 1 29  ? 132.078 99.484  141.261 1.00 0.00 ? 18  U A "O2'"  1  
ATOM 908    C "C1'"  . U A 1 29  ? 130.423 99.790  139.547 1.00 0.00 ? 18  U A "C1'"  1  
ATOM 909    N N1     . U A 1 29  ? 130.235 100.521 138.271 1.00 0.00 ? 18  U A N1     1  
ATOM 910    C C2     . U A 1 29  ? 131.203 100.349 137.297 1.00 0.00 ? 18  U A C2     1  
ATOM 911    O O2     . U A 1 29  ? 132.181 99.636  137.449 1.00 0.00 ? 18  U A O2     1  
ATOM 912    N N3     . U A 1 29  ? 130.986 101.043 136.132 1.00 0.00 ? 18  U A N3     1  
ATOM 913    C C4     . U A 1 29  ? 129.925 101.874 135.844 1.00 0.00 ? 18  U A C4     1  
ATOM 914    O O4     . U A 1 29  ? 129.874 102.431 134.745 1.00 0.00 ? 18  U A O4     1  
ATOM 915    C C5     . U A 1 29  ? 128.964 102.005 136.897 1.00 0.00 ? 18  U A C5     1  
ATOM 916    C C6     . U A 1 29  ? 129.149 101.339 138.042 1.00 0.00 ? 18  U A C6     1  
ATOM 917    H "H5'"  . U A 1 29  ? 127.289 100.600 141.819 1.00 0.00 ? 18  U A "H5'"  1  
ATOM 918    H "H5''" . U A 1 29  ? 128.095 101.710 142.636 1.00 0.00 ? 18  U A "H5''" 1  
ATOM 919    H "H4'"  . U A 1 29  ? 129.477 99.889  142.246 1.00 0.00 ? 18  U A "H4'"  1  
ATOM 920    H "H3'"  . U A 1 29  ? 130.304 102.162 140.773 1.00 0.00 ? 18  U A "H3'"  1  
ATOM 921    H "H2'"  . U A 1 29  ? 132.095 100.992 139.943 1.00 0.00 ? 18  U A "H2'"  1  
ATOM 922    H "HO2'" . U A 1 29  ? 132.675 98.951  140.696 1.00 0.00 ? 18  U A "HO2'" 1  
ATOM 923    H "H1'"  . U A 1 29  ? 130.719 98.875  139.357 1.00 0.00 ? 18  U A "H1'"  1  
ATOM 924    H H3     . U A 1 29  ? 131.660 100.935 135.430 1.00 0.00 ? 18  U A H3     1  
ATOM 925    H H5     . U A 1 29  ? 128.178 102.575 136.777 1.00 0.00 ? 18  U A H5     1  
ATOM 926    H H6     . U A 1 29  ? 128.478 101.446 138.746 1.00 0.00 ? 18  U A H6     1  
ATOM 927    P P      . C A 1 30  ? 131.940 103.182 142.593 1.00 0.00 ? 19  C A P      1  
ATOM 928    O OP1    . C A 1 30  ? 132.254 103.455 144.018 1.00 0.00 ? 19  C A OP1    1  
ATOM 929    O OP2    . C A 1 30  ? 131.189 104.187 141.800 1.00 0.00 ? 19  C A OP2    1  
ATOM 930    O "O5'"  . C A 1 30  ? 133.311 102.882 141.835 1.00 0.00 ? 19  C A "O5'"  1  
ATOM 931    C "C5'"  . C A 1 30  ? 134.267 101.989 142.386 1.00 0.00 ? 19  C A "C5'"  1  
ATOM 932    C "C4'"  . C A 1 30  ? 135.414 101.747 141.436 1.00 0.00 ? 19  C A "C4'"  1  
ATOM 933    O "O4'"  . C A 1 30  ? 134.920 101.132 140.215 1.00 0.00 ? 19  C A "O4'"  1  
ATOM 934    C "C3'"  . C A 1 30  ? 136.159 102.982 140.953 1.00 0.00 ? 19  C A "C3'"  1  
ATOM 935    O "O3'"  . C A 1 30  ? 137.123 103.445 141.881 1.00 0.00 ? 19  C A "O3'"  1  
ATOM 936    C "C2'"  . C A 1 30  ? 136.757 102.514 139.632 1.00 0.00 ? 19  C A "C2'"  1  
ATOM 937    O "O2'"  . C A 1 30  ? 137.913 101.717 139.847 1.00 0.00 ? 19  C A "O2'"  1  
ATOM 938    C "C1'"  . C A 1 30  ? 135.635 101.629 139.086 1.00 0.00 ? 19  C A "C1'"  1  
ATOM 939    N N1     . C A 1 30  ? 134.723 102.372 138.184 1.00 0.00 ? 19  C A N1     1  
ATOM 940    C C2     . C A 1 30  ? 135.139 102.618 136.870 1.00 0.00 ? 19  C A C2     1  
ATOM 941    O O2     . C A 1 30  ? 136.255 102.212 136.501 1.00 0.00 ? 19  C A O2     1  
ATOM 942    N N3     . C A 1 30  ? 134.325 103.294 136.026 1.00 0.00 ? 19  C A N3     1  
ATOM 943    C C4     . C A 1 30  ? 133.134 103.718 136.445 1.00 0.00 ? 19  C A C4     1  
ATOM 944    N N4     . C A 1 30  ? 132.364 104.379 135.578 1.00 0.00 ? 19  C A N4     1  
ATOM 945    C C5     . C A 1 30  ? 132.681 103.484 137.772 1.00 0.00 ? 19  C A C5     1  
ATOM 946    C C6     . C A 1 30  ? 133.495 102.815 138.599 1.00 0.00 ? 19  C A C6     1  
ATOM 947    H "H5'"  . C A 1 30  ? 133.830 101.137 142.585 1.00 0.00 ? 19  C A "H5'"  1  
ATOM 948    H "H5''" . C A 1 30  ? 134.619 102.372 143.216 1.00 0.00 ? 19  C A "H5''" 1  
ATOM 949    H "H4'"  . C A 1 30  ? 136.052 101.138 141.862 1.00 0.00 ? 19  C A "H4'"  1  
ATOM 950    H "H3'"  . C A 1 30  ? 135.514 103.698 140.776 1.00 0.00 ? 19  C A "H3'"  1  
ATOM 951    H "H2'"  . C A 1 30  ? 136.942 103.269 139.035 1.00 0.00 ? 19  C A "H2'"  1  
ATOM 952    H "HO2'" . C A 1 30  ? 138.295 101.471 138.977 1.00 0.00 ? 19  C A "HO2'" 1  
ATOM 953    H "H1'"  . C A 1 30  ? 136.027 100.872 138.599 1.00 0.00 ? 19  C A "H1'"  1  
ATOM 954    H H41    . C A 1 30  ? 132.681 104.538 134.663 1.00 0.00 ? 19  C A H41    1  
ATOM 955    H H42    . C A 1 30  ? 131.482 104.704 135.855 1.00 0.00 ? 19  C A H42    1  
ATOM 956    H H5     . C A 1 30  ? 131.802 103.800 138.073 1.00 0.00 ? 19  C A H5     1  
ATOM 957    H H6     . C A 1 30  ? 133.200 102.644 139.517 1.00 0.00 ? 19  C A H6     1  
ATOM 958    P P      . U A 1 31  ? 137.490 105.010 141.951 1.00 0.00 ? 20  U A P      1  
ATOM 959    O OP1    . U A 1 31  ? 138.309 105.235 143.170 1.00 0.00 ? 20  U A OP1    1  
ATOM 960    O OP2    . U A 1 31  ? 136.241 105.785 141.753 1.00 0.00 ? 20  U A OP2    1  
ATOM 961    O "O5'"  . U A 1 31  ? 138.423 105.242 140.681 1.00 0.00 ? 20  U A "O5'"  1  
ATOM 962    C "C5'"  . U A 1 31  ? 139.718 104.666 140.613 1.00 0.00 ? 20  U A "C5'"  1  
ATOM 963    C "C4'"  . U A 1 31  ? 140.385 104.953 139.288 1.00 0.00 ? 20  U A "C4'"  1  
ATOM 964    O "O4'"  . U A 1 31  ? 139.629 104.338 138.211 1.00 0.00 ? 20  U A "O4'"  1  
ATOM 965    C "C3'"  . U A 1 31  ? 140.478 106.417 138.885 1.00 0.00 ? 20  U A "C3'"  1  
ATOM 966    O "O3'"  . U A 1 31  ? 141.571 107.088 139.490 1.00 0.00 ? 20  U A "O3'"  1  
ATOM 967    C "C2'"  . U A 1 31  ? 140.572 106.341 137.369 1.00 0.00 ? 20  U A "C2'"  1  
ATOM 968    O "O2'"  . U A 1 31  ? 141.880 105.981 136.949 1.00 0.00 ? 20  U A "O2'"  1  
ATOM 969    C "C1'"  . U A 1 31  ? 139.618 105.183 137.064 1.00 0.00 ? 20  U A "C1'"  1  
ATOM 970    N N1     . U A 1 31  ? 138.238 105.650 136.786 1.00 0.00 ? 20  U A N1     1  
ATOM 971    C C2     . U A 1 31  ? 137.985 106.159 135.527 1.00 0.00 ? 20  U A C2     1  
ATOM 972    O O2     . U A 1 31  ? 138.835 106.235 134.657 1.00 0.00 ? 20  U A O2     1  
ATOM 973    N N3     . U A 1 31  ? 136.694 106.580 135.317 1.00 0.00 ? 20  U A N3     1  
ATOM 974    C C4     . U A 1 31  ? 135.650 106.545 136.217 1.00 0.00 ? 20  U A C4     1  
ATOM 975    O O4     . U A 1 31  ? 134.544 106.961 135.876 1.00 0.00 ? 20  U A O4     1  
ATOM 976    C C5     . U A 1 31  ? 135.985 106.005 137.499 1.00 0.00 ? 20  U A C5     1  
ATOM 977    C C6     . U A 1 31  ? 137.236 105.588 137.731 1.00 0.00 ? 20  U A C6     1  
ATOM 978    H "H5'"  . U A 1 31  ? 139.644 103.697 140.728 1.00 0.00 ? 20  U A "H5'"  1  
ATOM 979    H "H5''" . U A 1 31  ? 140.271 105.035 141.331 1.00 0.00 ? 20  U A "H5''" 1  
ATOM 980    H "H4'"  . U A 1 31  ? 141.288 104.568 139.302 1.00 0.00 ? 20  U A "H4'"  1  
ATOM 981    H "H3'"  . U A 1 31  ? 139.645 106.872 139.133 1.00 0.00 ? 20  U A "H3'"  1  
ATOM 982    H "H2'"  . U A 1 31  ? 140.272 107.173 136.946 1.00 0.00 ? 20  U A "H2'"  1  
ATOM 983    H "HO2'" . U A 1 31  ? 142.511 106.167 137.676 1.00 0.00 ? 20  U A "HO2'" 1  
ATOM 984    H "H1'"  . U A 1 31  ? 139.951 104.681 136.289 1.00 0.00 ? 20  U A "H1'"  1  
ATOM 985    H H3     . U A 1 31  ? 136.493 106.944 134.430 1.00 0.00 ? 20  U A H3     1  
ATOM 986    H H5     . U A 1 31  ? 135.304 105.942 138.200 1.00 0.00 ? 20  U A H5     1  
ATOM 987    H H6     . U A 1 31  ? 137.438 105.224 138.618 1.00 0.00 ? 20  U A H6     1  
ATOM 988    P P      . A A 1 32  ? 141.478 108.660 139.809 1.00 0.00 ? 21  A A P      1  
ATOM 989    O OP1    . A A 1 32  ? 142.640 109.028 140.660 1.00 0.00 ? 21  A A OP1    1  
ATOM 990    O OP2    . A A 1 32  ? 140.101 108.954 140.281 1.00 0.00 ? 21  A A OP2    1  
ATOM 991    O "O5'"  . A A 1 32  ? 141.669 109.355 138.388 1.00 0.00 ? 21  A A "O5'"  1  
ATOM 992    C "C5'"  . A A 1 32  ? 142.915 109.296 137.710 1.00 0.00 ? 21  A A "C5'"  1  
ATOM 993    C "C4'"  . A A 1 32  ? 142.815 109.867 136.318 1.00 0.00 ? 21  A A "C4'"  1  
ATOM 994    O "O4'"  . A A 1 32  ? 141.865 109.098 135.537 1.00 0.00 ? 21  A A "O4'"  1  
ATOM 995    C "C3'"  . A A 1 32  ? 142.304 111.297 136.218 1.00 0.00 ? 21  A A "C3'"  1  
ATOM 996    O "O3'"  . A A 1 32  ? 143.314 112.264 136.462 1.00 0.00 ? 21  A A "O3'"  1  
ATOM 997    C "C2'"  . A A 1 32  ? 141.737 111.349 134.808 1.00 0.00 ? 21  A A "C2'"  1  
ATOM 998    O "O2'"  . A A 1 32  ? 142.769 111.483 133.841 1.00 0.00 ? 21  A A "O2'"  1  
ATOM 999    C "C1'"  . A A 1 32  ? 141.112 109.960 134.678 1.00 0.00 ? 21  A A "C1'"  1  
ATOM 1000   N N9     . A A 1 32  ? 139.686 109.954 135.059 1.00 0.00 ? 21  A A N9     1  
ATOM 1001   C C8     . A A 1 32  ? 139.127 109.498 136.227 1.00 0.00 ? 21  A A C8     1  
ATOM 1002   N N7     . A A 1 32  ? 137.823 109.626 136.273 1.00 0.00 ? 21  A A N7     1  
ATOM 1003   C C5     . A A 1 32  ? 137.502 110.206 135.053 1.00 0.00 ? 21  A A C5     1  
ATOM 1004   C C6     . A A 1 32  ? 136.278 110.597 134.484 1.00 0.00 ? 21  A A C6     1  
ATOM 1005   N N6     . A A 1 32  ? 135.099 110.461 135.096 1.00 0.00 ? 21  A A N6     1  
ATOM 1006   N N1     . A A 1 32  ? 136.303 111.143 133.249 1.00 0.00 ? 21  A A N1     1  
ATOM 1007   C C2     . A A 1 32  ? 137.486 111.281 132.635 1.00 0.00 ? 21  A A C2     1  
ATOM 1008   N N3     . A A 1 32  ? 138.703 110.951 133.065 1.00 0.00 ? 21  A A N3     1  
ATOM 1009   C C4     . A A 1 32  ? 138.641 110.412 134.295 1.00 0.00 ? 21  A A C4     1  
ATOM 1010   H "H5'"  . A A 1 32  ? 143.203 108.360 137.650 1.00 0.00 ? 21  A A "H5'"  1  
ATOM 1011   H "H5''" . A A 1 32  ? 143.580 109.805 138.218 1.00 0.00 ? 21  A A "H5''" 1  
ATOM 1012   H "H4'"  . A A 1 32  ? 143.696 109.816 135.889 1.00 0.00 ? 21  A A "H4'"  1  
ATOM 1013   H "H3'"  . A A 1 32  ? 141.576 111.423 136.863 1.00 0.00 ? 21  A A "H3'"  1  
ATOM 1014   H "H2'"  . A A 1 32  ? 141.062 112.056 134.716 1.00 0.00 ? 21  A A "H2'"  1  
ATOM 1015   H "HO2'" . A A 1 32  ? 142.365 111.573 132.953 1.00 0.00 ? 21  A A "HO2'" 1  
ATOM 1016   H "H1'"  . A A 1 32  ? 141.204 109.645 133.755 1.00 0.00 ? 21  A A "H1'"  1  
ATOM 1017   H H8     . A A 1 32  ? 139.653 109.114 136.959 1.00 0.00 ? 21  A A H8     1  
ATOM 1018   H H61    . A A 1 32  ? 134.277 110.752 134.648 1.00 0.00 ? 21  A A H61    1  
ATOM 1019   H H62    . A A 1 32  ? 135.054 110.066 135.992 1.00 0.00 ? 21  A A H62    1  
ATOM 1020   H H2     . A A 1 32  ? 137.450 111.683 131.741 1.00 0.00 ? 21  A A H2     1  
ATOM 1021   P P      . C A 1 33  ? 142.930 113.684 137.109 1.00 0.00 ? 22  C A P      1  
ATOM 1022   O OP1    . C A 1 33  ? 144.191 114.375 137.481 1.00 0.00 ? 22  C A OP1    1  
ATOM 1023   O OP2    . C A 1 33  ? 141.885 113.455 138.139 1.00 0.00 ? 22  C A OP2    1  
ATOM 1024   O "O5'"  . C A 1 33  ? 142.267 114.491 135.904 1.00 0.00 ? 22  C A "O5'"  1  
ATOM 1025   C "C5'"  . C A 1 33  ? 143.039 114.895 134.785 1.00 0.00 ? 22  C A "C5'"  1  
ATOM 1026   C "C4'"  . C A 1 33  ? 142.178 115.490 133.698 1.00 0.00 ? 22  C A "C4'"  1  
ATOM 1027   O "O4'"  . C A 1 33  ? 141.217 114.504 133.234 1.00 0.00 ? 22  C A "O4'"  1  
ATOM 1028   C "C3'"  . C A 1 33  ? 141.321 116.682 134.099 1.00 0.00 ? 22  C A "C3'"  1  
ATOM 1029   O "O3'"  . C A 1 33  ? 142.034 117.906 134.085 1.00 0.00 ? 22  C A "O3'"  1  
ATOM 1030   C "C2'"  . C A 1 33  ? 140.182 116.626 133.090 1.00 0.00 ? 22  C A "C2'"  1  
ATOM 1031   O "O2'"  . C A 1 33  ? 140.583 117.142 131.830 1.00 0.00 ? 22  C A "O2'"  1  
ATOM 1032   C "C1'"  . C A 1 33  ? 139.963 115.118 132.963 1.00 0.00 ? 22  C A "C1'"  1  
ATOM 1033   N N1     . C A 1 33  ? 138.928 114.619 133.903 1.00 0.00 ? 22  C A N1     1  
ATOM 1034   C C2     . C A 1 33  ? 137.580 114.828 133.585 1.00 0.00 ? 22  C A C2     1  
ATOM 1035   O O2     . C A 1 33  ? 137.292 115.420 132.535 1.00 0.00 ? 22  C A O2     1  
ATOM 1036   N N3     . C A 1 33  ? 136.620 114.381 134.424 1.00 0.00 ? 22  C A N3     1  
ATOM 1037   C C4     . C A 1 33  ? 136.957 113.747 135.547 1.00 0.00 ? 22  C A C4     1  
ATOM 1038   N N4     . C A 1 33  ? 135.973 113.325 136.347 1.00 0.00 ? 22  C A N4     1  
ATOM 1039   C C5     . C A 1 33  ? 138.316 113.519 135.902 1.00 0.00 ? 22  C A C5     1  
ATOM 1040   C C6     . C A 1 33  ? 139.258 113.963 135.061 1.00 0.00 ? 22  C A C6     1  
ATOM 1041   H "H5'"  . C A 1 33  ? 143.515 114.117 134.425 1.00 0.00 ? 22  C A "H5'"  1  
ATOM 1042   H "H5''" . C A 1 33  ? 143.696 115.563 135.073 1.00 0.00 ? 22  C A "H5''" 1  
ATOM 1043   H "H4'"  . C A 1 33  ? 142.753 115.751 132.949 1.00 0.00 ? 22  C A "H4'"  1  
ATOM 1044   H "H3'"  . C A 1 33  ? 140.961 116.531 134.998 1.00 0.00 ? 22  C A "H3'"  1  
ATOM 1045   H "H2'"  . C A 1 33  ? 139.381 117.079 133.429 1.00 0.00 ? 22  C A "H2'"  1  
ATOM 1046   H "HO2'" . C A 1 33  ? 139.810 117.152 131.229 1.00 0.00 ? 22  C A "HO2'" 1  
ATOM 1047   H "H1'"  . C A 1 33  ? 139.695 114.905 132.045 1.00 0.00 ? 22  C A "H1'"  1  
ATOM 1048   H H41    . C A 1 33  ? 135.037 113.484 136.101 1.00 0.00 ? 22  C A H41    1  
ATOM 1049   H H42    . C A 1 33  ? 136.188 112.854 137.180 1.00 0.00 ? 22  C A H42    1  
ATOM 1050   H H5     . C A 1 33  ? 138.552 113.050 136.728 1.00 0.00 ? 22  C A H5     1  
ATOM 1051   H H6     . C A 1 33  ? 140.200 113.817 135.288 1.00 0.00 ? 22  C A H6     1  
ATOM 1052   P P      . C A 1 34  ? 141.630 119.091 135.092 1.00 0.00 ? 23  C A P      1  
ATOM 1053   O OP1    . C A 1 34  ? 142.662 120.154 134.989 1.00 0.00 ? 23  C A OP1    1  
ATOM 1054   O OP2    . C A 1 34  ? 141.328 118.485 136.414 1.00 0.00 ? 23  C A OP2    1  
ATOM 1055   O "O5'"  . C A 1 34  ? 140.271 119.661 134.489 1.00 0.00 ? 23  C A "O5'"  1  
ATOM 1056   C "C5'"  . C A 1 34  ? 140.252 120.327 133.235 1.00 0.00 ? 23  C A "C5'"  1  
ATOM 1057   C "C4'"  . C A 1 34  ? 138.844 120.646 132.795 1.00 0.00 ? 23  C A "C4'"  1  
ATOM 1058   O "O4'"  . C A 1 34  ? 138.088 119.418 132.631 1.00 0.00 ? 23  C A "O4'"  1  
ATOM 1059   C "C3'"  . C A 1 34  ? 138.009 121.468 133.765 1.00 0.00 ? 23  C A "C3'"  1  
ATOM 1060   O "O3'"  . C A 1 34  ? 138.273 122.858 133.683 1.00 0.00 ? 23  C A "O3'"  1  
ATOM 1061   C "C2'"  . C A 1 34  ? 136.586 121.095 133.376 1.00 0.00 ? 23  C A "C2'"  1  
ATOM 1062   O "O2'"  . C A 1 34  ? 136.173 121.782 132.203 1.00 0.00 ? 23  C A "O2'"  1  
ATOM 1063   C "C1'"  . C A 1 34  ? 136.737 119.608 133.053 1.00 0.00 ? 23  C A "C1'"  1  
ATOM 1064   N N1     . C A 1 34  ? 136.429 118.743 134.218 1.00 0.00 ? 23  C A N1     1  
ATOM 1065   C C2     . C A 1 34  ? 135.084 118.537 134.557 1.00 0.00 ? 23  C A C2     1  
ATOM 1066   O O2     . C A 1 34  ? 134.201 119.079 133.878 1.00 0.00 ? 23  C A O2     1  
ATOM 1067   N N3     . C A 1 34  ? 134.777 117.753 135.616 1.00 0.00 ? 23  C A N3     1  
ATOM 1068   C C4     . C A 1 34  ? 135.746 117.183 136.329 1.00 0.00 ? 23  C A C4     1  
ATOM 1069   N N4     . C A 1 34  ? 135.395 116.418 137.365 1.00 0.00 ? 23  C A N4     1  
ATOM 1070   C C5     . C A 1 34  ? 137.121 117.373 136.013 1.00 0.00 ? 23  C A C5     1  
ATOM 1071   C C6     . C A 1 34  ? 137.415 118.149 134.964 1.00 0.00 ? 23  C A C6     1  
ATOM 1072   H "H5'"  . C A 1 34  ? 140.674 119.752 132.564 1.00 0.00 ? 23  C A "H5'"  1  
ATOM 1073   H "H5''" . C A 1 34  ? 140.761 121.160 133.308 1.00 0.00 ? 23  C A "H5''" 1  
ATOM 1074   H "H4'"  . C A 1 34  ? 138.883 121.114 131.933 1.00 0.00 ? 23  C A "H4'"  1  
ATOM 1075   H "H3'"  . C A 1 34  ? 138.183 121.159 134.679 1.00 0.00 ? 23  C A "H3'"  1  
ATOM 1076   H "H2'"  . C A 1 34  ? 135.961 121.239 134.119 1.00 0.00 ? 23  C A "H2'"  1  
ATOM 1077   H "HO2'" . C A 1 34  ? 135.236 121.566 132.018 1.00 0.00 ? 23  C A "HO2'" 1  
ATOM 1078   H "H1'"  . C A 1 34  ? 136.145 119.371 132.310 1.00 0.00 ? 23  C A "H1'"  1  
ATOM 1079   H H41    . C A 1 34  ? 134.447 116.289 137.581 1.00 0.00 ? 23  C A H41    1  
ATOM 1080   H H42    . C A 1 34  ? 136.084 115.982 137.910 1.00 0.00 ? 23  C A H42    1  
ATOM 1081   H H5     . C A 1 34  ? 137.829 116.948 136.543 1.00 0.00 ? 23  C A H5     1  
ATOM 1082   H H6     . C A 1 34  ? 138.355 118.290 134.728 1.00 0.00 ? 23  C A H6     1  
ATOM 1083   P P      . G A 1 35  ? 137.851 123.763 134.977 1.00 0.00 ? 24  G A P      1  
ATOM 1084   O OP1    . G A 1 35  ? 138.583 125.056 134.952 1.00 0.00 ? 24  G A OP1    1  
ATOM 1085   O OP2    . G A 1 35  ? 138.043 122.835 136.120 1.00 0.00 ? 24  G A OP2    1  
ATOM 1086   O "O5'"  . G A 1 35  ? 136.293 124.078 134.853 1.00 0.00 ? 24  G A "O5'"  1  
ATOM 1087   C "C5'"  . G A 1 35  ? 135.685 124.253 133.583 1.00 0.00 ? 24  G A "C5'"  1  
ATOM 1088   C "C4'"  . G A 1 35  ? 134.183 124.346 133.695 1.00 0.00 ? 24  G A "C4'"  1  
ATOM 1089   O "O4'"  . G A 1 35  ? 133.615 123.011 133.780 1.00 0.00 ? 24  G A "O4'"  1  
ATOM 1090   C "C3'"  . G A 1 35  ? 133.650 125.054 134.930 1.00 0.00 ? 24  G A "C3'"  1  
ATOM 1091   O "O3'"  . G A 1 35  ? 133.685 126.466 134.818 1.00 0.00 ? 24  G A "O3'"  1  
ATOM 1092   C "C2'"  . G A 1 35  ? 132.242 124.488 135.055 1.00 0.00 ? 24  G A "C2'"  1  
ATOM 1093   O "O2'"  . G A 1 35  ? 131.355 125.098 134.129 1.00 0.00 ? 24  G A "O2'"  1  
ATOM 1094   C "C1'"  . G A 1 35  ? 132.462 123.031 134.649 1.00 0.00 ? 24  G A "C1'"  1  
ATOM 1095   N N9     . G A 1 35  ? 132.683 122.155 135.815 1.00 0.00 ? 24  G A N9     1  
ATOM 1096   C C8     . G A 1 35  ? 133.864 121.570 136.204 1.00 0.00 ? 24  G A C8     1  
ATOM 1097   N N7     . G A 1 35  ? 133.746 120.844 137.281 1.00 0.00 ? 24  G A N7     1  
ATOM 1098   C C5     . G A 1 35  ? 132.408 120.956 137.627 1.00 0.00 ? 24  G A C5     1  
ATOM 1099   C C6     . G A 1 35  ? 131.687 120.388 138.709 1.00 0.00 ? 24  G A C6     1  
ATOM 1100   O O6     . G A 1 35  ? 132.102 119.646 139.608 1.00 0.00 ? 24  G A O6     1  
ATOM 1101   N N1     . G A 1 35  ? 130.346 120.760 138.684 1.00 0.00 ? 24  G A N1     1  
ATOM 1102   C C2     . G A 1 35  ? 129.771 121.575 137.737 1.00 0.00 ? 24  G A C2     1  
ATOM 1103   N N2     . G A 1 35  ? 128.461 121.821 137.881 1.00 0.00 ? 24  G A N2     1  
ATOM 1104   N N3     . G A 1 35  ? 130.433 122.110 136.725 1.00 0.00 ? 24  G A N3     1  
ATOM 1105   C C4     . G A 1 35  ? 131.736 121.761 136.732 1.00 0.00 ? 24  G A C4     1  
ATOM 1106   H "H5'"  . G A 1 35  ? 135.916 123.492 133.011 1.00 0.00 ? 24  G A "H5'"  1  
ATOM 1107   H "H5''" . G A 1 35  ? 136.026 125.076 133.175 1.00 0.00 ? 24  G A "H5''" 1  
ATOM 1108   H "H4'"  . G A 1 35  ? 133.831 124.790 132.897 1.00 0.00 ? 24  G A "H4'"  1  
ATOM 1109   H "H3'"  . G A 1 35  ? 134.176 124.782 135.711 1.00 0.00 ? 24  G A "H3'"  1  
ATOM 1110   H "H2'"  . G A 1 35  ? 131.906 124.556 135.976 1.00 0.00 ? 24  G A "H2'"  1  
ATOM 1111   H "HO2'" . G A 1 35  ? 131.738 125.953 133.837 1.00 0.00 ? 24  G A "HO2'" 1  
ATOM 1112   H "H1'"  . G A 1 35  ? 131.685 122.711 134.144 1.00 0.00 ? 24  G A "H1'"  1  
ATOM 1113   H H8     . G A 1 35  ? 134.709 121.685 135.721 1.00 0.00 ? 24  G A H8     1  
ATOM 1114   H H1     . G A 1 35  ? 129.768 120.413 139.396 1.00 0.00 ? 24  G A H1     1  
ATOM 1115   H H21    . G A 1 35  ? 127.964 121.427 138.627 1.00 0.00 ? 24  G A H21    1  
ATOM 1116   H H22    . G A 1 35  ? 127.997 122.396 137.234 1.00 0.00 ? 24  G A H22    1  
ATOM 1117   P P      . A A 1 36  ? 133.935 127.375 136.119 1.00 0.00 ? 25  A A P      1  
ATOM 1118   O OP1    . A A 1 36  ? 134.083 128.783 135.676 1.00 0.00 ? 25  A A OP1    1  
ATOM 1119   O OP2    . A A 1 36  ? 135.009 126.741 136.924 1.00 0.00 ? 25  A A OP2    1  
ATOM 1120   O "O5'"  . A A 1 36  ? 132.572 127.256 136.938 1.00 0.00 ? 25  A A "O5'"  1  
ATOM 1121   C "C5'"  . A A 1 36  ? 131.362 127.787 136.418 1.00 0.00 ? 25  A A "C5'"  1  
ATOM 1122   C "C4'"  . A A 1 36  ? 130.191 127.480 137.318 1.00 0.00 ? 25  A A "C4'"  1  
ATOM 1123   O "O4'"  . A A 1 36  ? 129.981 126.046 137.381 1.00 0.00 ? 25  A A "O4'"  1  
ATOM 1124   C "C3'"  . A A 1 36  ? 130.342 127.897 138.774 1.00 0.00 ? 25  A A "C3'"  1  
ATOM 1125   O "O3'"  . A A 1 36  ? 130.057 129.267 138.991 1.00 0.00 ? 25  A A "O3'"  1  
ATOM 1126   C "C2'"  . A A 1 36  ? 129.386 126.953 139.490 1.00 0.00 ? 25  A A "C2'"  1  
ATOM 1127   O "O2'"  . A A 1 36  ? 128.039 127.379 139.347 1.00 0.00 ? 25  A A "O2'"  1  
ATOM 1128   C "C1'"  . A A 1 36  ? 129.586 125.660 138.699 1.00 0.00 ? 25  A A "C1'"  1  
ATOM 1129   N N9     . A A 1 36  ? 130.614 124.791 139.301 1.00 0.00 ? 25  A A N9     1  
ATOM 1130   C C8     . A A 1 36  ? 131.897 124.572 138.859 1.00 0.00 ? 25  A A C8     1  
ATOM 1131   N N7     . A A 1 36  ? 132.579 123.743 139.610 1.00 0.00 ? 25  A A N7     1  
ATOM 1132   C C5     . A A 1 36  ? 131.687 123.391 140.615 1.00 0.00 ? 25  A A C5     1  
ATOM 1133   C C6     . A A 1 36  ? 131.801 122.539 141.727 1.00 0.00 ? 25  A A C6     1  
ATOM 1134   N N6     . A A 1 36  ? 132.910 121.856 142.026 1.00 0.00 ? 25  A A N6     1  
ATOM 1135   N N1     . A A 1 36  ? 130.725 122.409 142.530 1.00 0.00 ? 25  A A N1     1  
ATOM 1136   C C2     . A A 1 36  ? 129.613 123.092 142.231 1.00 0.00 ? 25  A A C2     1  
ATOM 1137   N N3     . A A 1 36  ? 129.384 123.922 141.217 1.00 0.00 ? 25  A A N3     1  
ATOM 1138   C C4     . A A 1 36  ? 130.475 124.030 140.435 1.00 0.00 ? 25  A A C4     1  
ATOM 1139   H "H5'"  . A A 1 36  ? 131.195 127.397 135.533 1.00 0.00 ? 25  A A "H5'"  1  
ATOM 1140   H "H5''" . A A 1 36  ? 131.451 128.758 136.328 1.00 0.00 ? 25  A A "H5''" 1  
ATOM 1141   H "H4'"  . A A 1 36  ? 129.388 127.905 136.950 1.00 0.00 ? 25  A A "H4'"  1  
ATOM 1142   H "H3'"  . A A 1 36  ? 131.259 127.708 139.068 1.00 0.00 ? 25  A A "H3'"  1  
ATOM 1143   H "H2'"  . A A 1 36  ? 129.632 126.838 140.432 1.00 0.00 ? 25  A A "H2'"  1  
ATOM 1144   H "HO2'" . A A 1 36  ? 128.029 128.328 139.106 1.00 0.00 ? 25  A A "HO2'" 1  
ATOM 1145   H "H1'"  . A A 1 36  ? 128.736 125.172 138.650 1.00 0.00 ? 25  A A "H1'"  1  
ATOM 1146   H H8     . A A 1 36  ? 132.268 124.996 138.058 1.00 0.00 ? 25  A A H8     1  
ATOM 1147   H H61    . A A 1 36  ? 132.928 121.277 142.817 1.00 0.00 ? 25  A A H61    1  
ATOM 1148   H H62    . A A 1 36  ? 133.702 121.936 141.457 1.00 0.00 ? 25  A A H62    1  
ATOM 1149   H H2     . A A 1 36  ? 128.860 122.964 142.846 1.00 0.00 ? 25  A A H2     1  
ATOM 1150   P P      . G A 1 37  ? 130.797 130.070 140.171 1.00 0.00 ? 26  G A P      1  
ATOM 1151   O OP1    . G A 1 37  ? 130.497 131.515 140.004 1.00 0.00 ? 26  G A OP1    1  
ATOM 1152   O OP2    . G A 1 37  ? 132.210 129.613 140.221 1.00 0.00 ? 26  G A OP2    1  
ATOM 1153   O "O5'"  . G A 1 37  ? 130.070 129.566 141.496 1.00 0.00 ? 26  G A "O5'"  1  
ATOM 1154   C "C5'"  . G A 1 37  ? 128.709 129.885 141.748 1.00 0.00 ? 26  G A "C5'"  1  
ATOM 1155   C "C4'"  . G A 1 37  ? 128.199 129.192 142.986 1.00 0.00 ? 26  G A "C4'"  1  
ATOM 1156   O "O4'"  . G A 1 37  ? 128.276 127.753 142.813 1.00 0.00 ? 26  G A "O4'"  1  
ATOM 1157   C "C3'"  . G A 1 37  ? 128.977 129.451 144.265 1.00 0.00 ? 26  G A "C3'"  1  
ATOM 1158   O "O3'"  . G A 1 37  ? 128.626 130.676 144.890 1.00 0.00 ? 26  G A "O3'"  1  
ATOM 1159   C "C2'"  . G A 1 37  ? 128.657 128.224 145.107 1.00 0.00 ? 26  G A "C2'"  1  
ATOM 1160   O "O2'"  . G A 1 37  ? 127.364 128.320 145.689 1.00 0.00 ? 26  G A "O2'"  1  
ATOM 1161   C "C1'"  . G A 1 37  ? 128.641 127.123 144.044 1.00 0.00 ? 26  G A "C1'"  1  
ATOM 1162   N N9     . G A 1 37  ? 129.949 126.454 143.918 1.00 0.00 ? 26  G A N9     1  
ATOM 1163   C C8     . G A 1 37  ? 130.859 126.594 142.900 1.00 0.00 ? 26  G A C8     1  
ATOM 1164   N N7     . G A 1 37  ? 131.932 125.868 143.065 1.00 0.00 ? 26  G A N7     1  
ATOM 1165   C C5     . G A 1 37  ? 131.717 125.208 144.267 1.00 0.00 ? 26  G A C5     1  
ATOM 1166   C C6     . G A 1 37  ? 132.534 124.284 144.969 1.00 0.00 ? 26  G A C6     1  
ATOM 1167   O O6     . G A 1 37  ? 133.648 123.849 144.656 1.00 0.00 ? 26  G A O6     1  
ATOM 1168   N N1     . G A 1 37  ? 131.932 123.861 146.150 1.00 0.00 ? 26  G A N1     1  
ATOM 1169   C C2     . G A 1 37  ? 130.703 124.276 146.601 1.00 0.00 ? 26  G A C2     1  
ATOM 1170   N N2     . G A 1 37  ? 130.289 123.755 147.767 1.00 0.00 ? 26  G A N2     1  
ATOM 1171   N N3     . G A 1 37  ? 129.931 125.137 145.956 1.00 0.00 ? 26  G A N3     1  
ATOM 1172   C C4     . G A 1 37  ? 130.498 125.559 144.807 1.00 0.00 ? 26  G A C4     1  
ATOM 1173   H "H5'"  . G A 1 37  ? 128.170 129.607 140.978 1.00 0.00 ? 26  G A "H5'"  1  
ATOM 1174   H "H5''" . G A 1 37  ? 128.624 130.854 141.863 1.00 0.00 ? 26  G A "H5''" 1  
ATOM 1175   H "H4'"  . G A 1 37  ? 127.262 129.445 143.128 1.00 0.00 ? 26  G A "H4'"  1  
ATOM 1176   H "H3'"  . G A 1 37  ? 129.937 129.460 144.063 1.00 0.00 ? 26  G A "H3'"  1  
ATOM 1177   H "H2'"  . G A 1 37  ? 129.348 128.059 145.782 1.00 0.00 ? 26  G A "H2'"  1  
ATOM 1178   H "HO2'" . G A 1 37  ? 127.209 127.533 146.252 1.00 0.00 ? 26  G A "HO2'" 1  
ATOM 1179   H "H1'"  . G A 1 37  ? 127.955 126.462 144.273 1.00 0.00 ? 26  G A "H1'"  1  
ATOM 1180   H H8     . G A 1 37  ? 130.720 127.177 142.124 1.00 0.00 ? 26  G A H8     1  
ATOM 1181   H H1     . G A 1 37  ? 132.425 123.219 146.702 1.00 0.00 ? 26  G A H1     1  
ATOM 1182   H H21    . G A 1 37  ? 130.853 123.117 148.248 1.00 0.00 ? 26  G A H21    1  
ATOM 1183   H H22    . G A 1 37  ? 129.420 124.014 148.136 1.00 0.00 ? 26  G A H22    1  
ATOM 1184   P P      . U A 1 38  ? 129.709 131.475 145.770 1.00 0.00 ? 27  U A P      1  
ATOM 1185   O OP1    . U A 1 38  ? 129.153 132.819 146.075 1.00 0.00 ? 27  U A OP1    1  
ATOM 1186   O OP2    . U A 1 38  ? 131.023 131.364 145.089 1.00 0.00 ? 27  U A OP2    1  
ATOM 1187   O "O5'"  . U A 1 38  ? 129.784 130.651 147.129 1.00 0.00 ? 27  U A "O5'"  1  
ATOM 1188   C "C5'"  . U A 1 38  ? 128.677 130.604 148.016 1.00 0.00 ? 27  U A "C5'"  1  
ATOM 1189   C "C4'"  . U A 1 38  ? 128.949 129.708 149.200 1.00 0.00 ? 27  U A "C4'"  1  
ATOM 1190   O "O4'"  . U A 1 38  ? 129.142 128.340 148.752 1.00 0.00 ? 27  U A "O4'"  1  
ATOM 1191   C "C3'"  . U A 1 38  ? 130.208 130.016 149.998 1.00 0.00 ? 27  U A "C3'"  1  
ATOM 1192   O "O3'"  . U A 1 38  ? 130.024 131.063 150.937 1.00 0.00 ? 27  U A "O3'"  1  
ATOM 1193   C "C2'"  . U A 1 38  ? 130.532 128.673 150.635 1.00 0.00 ? 27  U A "C2'"  1  
ATOM 1194   O "O2'"  . U A 1 38  ? 129.694 128.416 151.754 1.00 0.00 ? 27  U A "O2'"  1  
ATOM 1195   C "C1'"  . U A 1 38  ? 130.168 127.704 149.511 1.00 0.00 ? 27  U A "C1'"  1  
ATOM 1196   N N1     . U A 1 38  ? 131.327 127.394 148.639 1.00 0.00 ? 27  U A N1     1  
ATOM 1197   C C2     . U A 1 38  ? 132.246 126.475 149.114 1.00 0.00 ? 27  U A C2     1  
ATOM 1198   O O2     . U A 1 38  ? 132.139 125.926 150.197 1.00 0.00 ? 27  U A O2     1  
ATOM 1199   N N3     . U A 1 38  ? 133.302 126.217 148.273 1.00 0.00 ? 27  U A N3     1  
ATOM 1200   C C4     . U A 1 38  ? 133.531 126.773 147.034 1.00 0.00 ? 27  U A C4     1  
ATOM 1201   O O4     . U A 1 38  ? 134.532 126.438 146.396 1.00 0.00 ? 27  U A O4     1  
ATOM 1202   C C5     . U A 1 38  ? 132.540 127.714 146.606 1.00 0.00 ? 27  U A C5     1  
ATOM 1203   C C6     . U A 1 38  ? 131.502 127.982 147.404 1.00 0.00 ? 27  U A C6     1  
ATOM 1204   H "H5'"  . U A 1 38  ? 127.895 130.266 147.534 1.00 0.00 ? 27  U A "H5'"  1  
ATOM 1205   H "H5''" . U A 1 38  ? 128.487 131.509 148.339 1.00 0.00 ? 27  U A "H5''" 1  
ATOM 1206   H "H4'"  . U A 1 38  ? 128.176 129.740 149.801 1.00 0.00 ? 27  U A "H4'"  1  
ATOM 1207   H "H3'"  . U A 1 38  ? 130.927 130.260 149.380 1.00 0.00 ? 27  U A "H3'"  1  
ATOM 1208   H "H2'"  . U A 1 38  ? 131.482 128.606 150.872 1.00 0.00 ? 27  U A "H2'"  1  
ATOM 1209   H "HO2'" . U A 1 38  ? 129.317 129.263 152.072 1.00 0.00 ? 27  U A "HO2'" 1  
ATOM 1210   H "H1'"  . U A 1 38  ? 129.821 126.873 149.894 1.00 0.00 ? 27  U A "H1'"  1  
ATOM 1211   H H3     . U A 1 38  ? 133.965 125.570 148.592 1.00 0.00 ? 27  U A H3     1  
ATOM 1212   H H5     . U A 1 38  ? 132.623 128.156 145.736 1.00 0.00 ? 27  U A H5     1  
ATOM 1213   H H6     . U A 1 38  ? 130.839 128.630 147.088 1.00 0.00 ? 27  U A H6     1  
ATOM 1214   P P      . A A 1 39  ? 131.260 132.007 151.345 1.00 0.00 ? 28  A A P      1  
ATOM 1215   O OP1    . A A 1 39  ? 130.728 133.141 152.141 1.00 0.00 ? 28  A A OP1    1  
ATOM 1216   O OP2    . A A 1 39  ? 132.057 132.278 150.122 1.00 0.00 ? 28  A A OP2    1  
ATOM 1217   O "O5'"  . A A 1 39  ? 132.140 131.096 152.314 1.00 0.00 ? 28  A A "O5'"  1  
ATOM 1218   C "C5'"  . A A 1 39  ? 131.659 130.719 153.596 1.00 0.00 ? 28  A A "C5'"  1  
ATOM 1219   C "C4'"  . A A 1 39  ? 132.596 129.753 154.276 1.00 0.00 ? 28  A A "C4'"  1  
ATOM 1220   O "O4'"  . A A 1 39  ? 132.697 128.533 153.498 1.00 0.00 ? 28  A A "O4'"  1  
ATOM 1221   C "C3'"  . A A 1 39  ? 134.037 130.216 154.426 1.00 0.00 ? 28  A A "C3'"  1  
ATOM 1222   O "O3'"  . A A 1 39  ? 134.230 131.076 155.536 1.00 0.00 ? 28  A A "O3'"  1  
ATOM 1223   C "C2'"  . A A 1 39  ? 134.798 128.902 154.532 1.00 0.00 ? 28  A A "C2'"  1  
ATOM 1224   O "O2'"  . A A 1 39  ? 134.674 128.336 155.829 1.00 0.00 ? 28  A A "O2'"  1  
ATOM 1225   C "C1'"  . A A 1 39  ? 134.038 128.028 153.535 1.00 0.00 ? 28  A A "C1'"  1  
ATOM 1226   N N9     . A A 1 39  ? 134.641 128.064 152.188 1.00 0.00 ? 28  A A N9     1  
ATOM 1227   C C8     . A A 1 39  ? 134.195 128.742 151.083 1.00 0.00 ? 28  A A C8     1  
ATOM 1228   N N7     . A A 1 39  ? 134.950 128.580 150.023 1.00 0.00 ? 28  A A N7     1  
ATOM 1229   C C5     . A A 1 39  ? 135.961 127.735 150.461 1.00 0.00 ? 28  A A C5     1  
ATOM 1230   C C6     . A A 1 39  ? 137.080 127.182 149.812 1.00 0.00 ? 28  A A C6     1  
ATOM 1231   N N6     . A A 1 39  ? 137.379 127.407 148.532 1.00 0.00 ? 28  A A N6     1  
ATOM 1232   N N1     . A A 1 39  ? 137.891 126.382 150.536 1.00 0.00 ? 28  A A N1     1  
ATOM 1233   C C2     . A A 1 39  ? 137.591 126.156 151.822 1.00 0.00 ? 28  A A C2     1  
ATOM 1234   N N3     . A A 1 39  ? 136.570 126.618 152.540 1.00 0.00 ? 28  A A N3     1  
ATOM 1235   C C4     . A A 1 39  ? 135.784 127.412 151.792 1.00 0.00 ? 28  A A C4     1  
ATOM 1236   H "H5'"  . A A 1 39  ? 130.780 130.295 153.497 1.00 0.00 ? 28  A A "H5'"  1  
ATOM 1237   H "H5''" . A A 1 39  ? 131.566 131.520 154.152 1.00 0.00 ? 28  A A "H5''" 1  
ATOM 1238   H "H4'"  . A A 1 39  ? 132.238 129.537 155.162 1.00 0.00 ? 28  A A "H4'"  1  
ATOM 1239   H "H3'"  . A A 1 39  ? 134.313 130.682 153.608 1.00 0.00 ? 28  A A "H3'"  1  
ATOM 1240   H "H2'"  . A A 1 39  ? 135.737 129.008 154.271 1.00 0.00 ? 28  A A "H2'"  1  
ATOM 1241   H "HO2'" . A A 1 39  ? 134.409 129.036 156.459 1.00 0.00 ? 28  A A "HO2'" 1  
ATOM 1242   H "H1'"  . A A 1 39  ? 134.019 127.102 153.859 1.00 0.00 ? 28  A A "H1'"  1  
ATOM 1243   H H8     . A A 1 39  ? 133.387 129.299 151.083 1.00 0.00 ? 28  A A H8     1  
ATOM 1244   H H61    . A A 1 39  ? 138.175 126.993 148.135 1.00 0.00 ? 28  A A H61    1  
ATOM 1245   H H62    . A A 1 39  ? 136.805 127.985 147.988 1.00 0.00 ? 28  A A H62    1  
ATOM 1246   H H2     . A A 1 39  ? 138.213 125.569 152.301 1.00 0.00 ? 28  A A H2     1  
ATOM 1247   P P      . A A 1 40  ? 135.386 132.195 155.501 1.00 0.00 ? 29  A A P      1  
ATOM 1248   O OP1    . A A 1 40  ? 135.187 133.097 156.662 1.00 0.00 ? 29  A A OP1    1  
ATOM 1249   O OP2    . A A 1 40  ? 135.434 132.762 154.131 1.00 0.00 ? 29  A A OP2    1  
ATOM 1250   O "O5'"  . A A 1 40  ? 136.728 131.369 155.740 1.00 0.00 ? 29  A A "O5'"  1  
ATOM 1251   C "C5'"  . A A 1 40  ? 136.988 130.748 156.989 1.00 0.00 ? 29  A A "C5'"  1  
ATOM 1252   C "C4'"  . A A 1 40  ? 138.262 129.945 156.953 1.00 0.00 ? 29  A A "C4'"  1  
ATOM 1253   O "O4'"  . A A 1 40  ? 138.140 128.870 155.984 1.00 0.00 ? 29  A A "O4'"  1  
ATOM 1254   C "C3'"  . A A 1 40  ? 139.513 130.693 156.517 1.00 0.00 ? 29  A A "C3'"  1  
ATOM 1255   O "O3'"  . A A 1 40  ? 140.105 131.441 157.565 1.00 0.00 ? 29  A A "O3'"  1  
ATOM 1256   C "C2'"  . A A 1 40  ? 140.402 129.577 155.987 1.00 0.00 ? 29  A A "C2'"  1  
ATOM 1257   O "O2'"  . A A 1 40  ? 141.008 128.853 157.046 1.00 0.00 ? 29  A A "O2'"  1  
ATOM 1258   C "C1'"  . A A 1 40  ? 139.379 128.678 155.292 1.00 0.00 ? 29  A A "C1'"  1  
ATOM 1259   N N9     . A A 1 40  ? 139.224 129.009 153.862 1.00 0.00 ? 29  A A N9     1  
ATOM 1260   C C8     . A A 1 40  ? 138.195 129.689 153.260 1.00 0.00 ? 29  A A C8     1  
ATOM 1261   N N7     . A A 1 40  ? 138.342 129.830 151.966 1.00 0.00 ? 29  A A N7     1  
ATOM 1262   C C5     . A A 1 40  ? 139.549 129.200 151.695 1.00 0.00 ? 29  A A C5     1  
ATOM 1263   C C6     . A A 1 40  ? 140.268 129.001 150.504 1.00 0.00 ? 29  A A C6     1  
ATOM 1264   N N6     . A A 1 40  ? 139.858 129.436 149.311 1.00 0.00 ? 29  A A N6     1  
ATOM 1265   N N1     . A A 1 40  ? 141.437 128.331 150.581 1.00 0.00 ? 29  A A N1     1  
ATOM 1266   C C2     . A A 1 40  ? 141.850 127.894 151.778 1.00 0.00 ? 29  A A C2     1  
ATOM 1267   N N3     . A A 1 40  ? 141.265 128.020 152.967 1.00 0.00 ? 29  A A N3     1  
ATOM 1268   C C4     . A A 1 40  ? 140.104 128.691 152.856 1.00 0.00 ? 29  A A C4     1  
ATOM 1269   H "H5'"  . A A 1 40  ? 136.242 130.153 157.214 1.00 0.00 ? 29  A A "H5'"  1  
ATOM 1270   H "H5''" . A A 1 40  ? 137.065 131.438 157.680 1.00 0.00 ? 29  A A "H5''" 1  
ATOM 1271   H "H4'"  . A A 1 40  ? 138.419 129.555 157.839 1.00 0.00 ? 29  A A "H4'"  1  
ATOM 1272   H "H3'"  . A A 1 40  ? 139.284 131.299 155.780 1.00 0.00 ? 29  A A "H3'"  1  
ATOM 1273   H "H2'"  . A A 1 40  ? 141.067 129.919 155.353 1.00 0.00 ? 29  A A "H2'"  1  
ATOM 1274   H "HO2'" . A A 1 40  ? 140.991 129.401 157.858 1.00 0.00 ? 29  A A "HO2'" 1  
ATOM 1275   H "H1'"  . A A 1 40  ? 139.654 127.740 155.382 1.00 0.00 ? 29  A A "H1'"  1  
ATOM 1276   H H8     . A A 1 40  ? 137.423 130.039 153.753 1.00 0.00 ? 29  A A H8     1  
ATOM 1277   H H61    . A A 1 40  ? 140.404 129.266 148.514 1.00 0.00 ? 29  A A H61    1  
ATOM 1278   H H62    . A A 1 40  ? 139.012 129.924 149.230 1.00 0.00 ? 29  A A H62    1  
ATOM 1279   H H2     . A A 1 40  ? 142.705 127.414 151.779 1.00 0.00 ? 29  A A H2     1  
ATOM 1280   P P      . G A 1 41  ? 140.902 132.797 157.242 1.00 0.00 ? 30  G A P      1  
ATOM 1281   O OP1    . G A 1 41  ? 141.173 133.491 158.527 1.00 0.00 ? 30  G A OP1    1  
ATOM 1282   O OP2    . G A 1 41  ? 140.175 133.510 156.162 1.00 0.00 ? 30  G A OP2    1  
ATOM 1283   O "O5'"  . G A 1 41  ? 142.293 132.295 156.650 1.00 0.00 ? 30  G A "O5'"  1  
ATOM 1284   C "C5'"  . G A 1 41  ? 143.229 131.612 157.470 1.00 0.00 ? 30  G A "C5'"  1  
ATOM 1285   C "C4'"  . G A 1 41  ? 144.399 131.097 156.667 1.00 0.00 ? 30  G A "C4'"  1  
ATOM 1286   O "O4'"  . G A 1 41  ? 143.929 130.158 155.665 1.00 0.00 ? 30  G A "O4'"  1  
ATOM 1287   C "C3'"  . G A 1 41  ? 145.168 132.138 155.866 1.00 0.00 ? 30  G A "C3'"  1  
ATOM 1288   O "O3'"  . G A 1 41  ? 146.113 132.848 156.649 1.00 0.00 ? 30  G A "O3'"  1  
ATOM 1289   C "C2'"  . G A 1 41  ? 145.796 131.307 154.758 1.00 0.00 ? 30  G A "C2'"  1  
ATOM 1290   O "O2'"  . G A 1 41  ? 146.933 130.593 155.227 1.00 0.00 ? 30  G A "O2'"  1  
ATOM 1291   C "C1'"  . G A 1 41  ? 144.677 130.309 154.453 1.00 0.00 ? 30  G A "C1'"  1  
ATOM 1292   N N9     . G A 1 41  ? 143.805 130.770 153.356 1.00 0.00 ? 30  G A N9     1  
ATOM 1293   C C8     . G A 1 41  ? 142.526 131.258 153.461 1.00 0.00 ? 30  G A C8     1  
ATOM 1294   N N7     . G A 1 41  ? 142.005 131.588 152.310 1.00 0.00 ? 30  G A N7     1  
ATOM 1295   C C5     . G A 1 41  ? 143.003 131.299 151.388 1.00 0.00 ? 30  G A C5     1  
ATOM 1296   C C6     . G A 1 41  ? 143.022 131.449 149.976 1.00 0.00 ? 30  G A C6     1  
ATOM 1297   O O6     . G A 1 41  ? 142.130 131.877 149.236 1.00 0.00 ? 30  G A O6     1  
ATOM 1298   N N1     . G A 1 41  ? 144.234 131.035 149.434 1.00 0.00 ? 30  G A N1     1  
ATOM 1299   C C2     . G A 1 41  ? 145.293 130.542 150.156 1.00 0.00 ? 30  G A C2     1  
ATOM 1300   N N2     . G A 1 41  ? 146.382 130.194 149.453 1.00 0.00 ? 30  G A N2     1  
ATOM 1301   N N3     . G A 1 41  ? 145.289 130.398 151.472 1.00 0.00 ? 30  G A N3     1  
ATOM 1302   C C4     . G A 1 41  ? 144.120 130.794 152.018 1.00 0.00 ? 30  G A C4     1  
ATOM 1303   H "H5'"  . G A 1 41  ? 142.784 130.856 157.905 1.00 0.00 ? 30  G A "H5'"  1  
ATOM 1304   H "H5''" . G A 1 41  ? 143.561 132.227 158.158 1.00 0.00 ? 30  G A "H5''" 1  
ATOM 1305   H "H4'"  . G A 1 41  ? 145.019 130.636 157.268 1.00 0.00 ? 30  G A "H4'"  1  
ATOM 1306   H "H3'"  . G A 1 41  ? 144.535 132.774 155.472 1.00 0.00 ? 30  G A "H3'"  1  
ATOM 1307   H "H2'"  . G A 1 41  ? 146.012 131.854 153.974 1.00 0.00 ? 30  G A "H2'"  1  
ATOM 1308   H "HO2'" . G A 1 41  ? 147.346 130.120 154.476 1.00 0.00 ? 30  G A "HO2'" 1  
ATOM 1309   H "H1'"  . G A 1 41  ? 145.069 129.441 154.217 1.00 0.00 ? 30  G A "H1'"  1  
ATOM 1310   H H8     . G A 1 41  ? 142.051 131.350 154.313 1.00 0.00 ? 30  G A H8     1  
ATOM 1311   H H1     . G A 1 41  ? 144.339 131.101 148.462 1.00 0.00 ? 30  G A H1     1  
ATOM 1312   H H21    . G A 1 41  ? 146.394 130.295 148.479 1.00 0.00 ? 30  G A H21    1  
ATOM 1313   H H22    . G A 1 41  ? 147.169 129.835 149.914 1.00 0.00 ? 30  G A H22    1  
ATOM 1314   P P      . A A 1 42  ? 146.499 134.361 156.269 1.00 0.00 ? 31  A A P      1  
ATOM 1315   O OP1    . A A 1 42  ? 147.348 134.907 157.358 1.00 0.00 ? 31  A A OP1    1  
ATOM 1316   O OP2    . A A 1 42  ? 145.253 135.072 155.884 1.00 0.00 ? 31  A A OP2    1  
ATOM 1317   O "O5'"  . A A 1 42  ? 147.403 134.213 154.965 1.00 0.00 ? 31  A A "O5'"  1  
ATOM 1318   C "C5'"  . A A 1 42  ? 148.677 133.588 155.028 1.00 0.00 ? 31  A A "C5'"  1  
ATOM 1319   C "C4'"  . A A 1 42  ? 149.291 133.443 153.659 1.00 0.00 ? 31  A A "C4'"  1  
ATOM 1320   O "O4'"  . A A 1 42  ? 148.453 132.596 152.830 1.00 0.00 ? 31  A A "O4'"  1  
ATOM 1321   C "C3'"  . A A 1 42  ? 149.432 134.725 152.853 1.00 0.00 ? 31  A A "C3'"  1  
ATOM 1322   O "O3'"  . A A 1 42  ? 150.578 135.481 153.210 1.00 0.00 ? 31  A A "O3'"  1  
ATOM 1323   C "C2'"  . A A 1 42  ? 149.463 134.214 151.419 1.00 0.00 ? 31  A A "C2'"  1  
ATOM 1324   O "O2'"  . A A 1 42  ? 150.737 133.683 151.088 1.00 0.00 ? 31  A A "O2'"  1  
ATOM 1325   C "C1'"  . A A 1 42  ? 148.449 133.071 151.483 1.00 0.00 ? 31  A A "C1'"  1  
ATOM 1326   N N9     . A A 1 42  ? 147.097 133.506 151.082 1.00 0.00 ? 31  A A N9     1  
ATOM 1327   C C8     . A A 1 42  ? 146.008 133.731 151.889 1.00 0.00 ? 31  A A C8     1  
ATOM 1328   N N7     . A A 1 42  ? 144.937 134.111 151.239 1.00 0.00 ? 31  A A N7     1  
ATOM 1329   C C5     . A A 1 42  ? 145.345 134.141 149.912 1.00 0.00 ? 31  A A C5     1  
ATOM 1330   C C6     . A A 1 42  ? 144.674 134.466 148.721 1.00 0.00 ? 31  A A C6     1  
ATOM 1331   N N6     . A A 1 42  ? 143.392 134.841 148.673 1.00 0.00 ? 31  A A N6     1  
ATOM 1332   N N1     . A A 1 42  ? 145.370 134.392 147.565 1.00 0.00 ? 31  A A N1     1  
ATOM 1333   C C2     . A A 1 42  ? 146.653 134.017 147.614 1.00 0.00 ? 31  A A C2     1  
ATOM 1334   N N3     . A A 1 42  ? 147.396 133.687 148.671 1.00 0.00 ? 31  A A N3     1  
ATOM 1335   C C4     . A A 1 42  ? 146.672 133.771 149.802 1.00 0.00 ? 31  A A C4     1  
ATOM 1336   H "H5'"  . A A 1 42  ? 148.577 132.699 155.429 1.00 0.00 ? 31  A A "H5'"  1  
ATOM 1337   H "H5''" . A A 1 42  ? 149.270 134.127 155.591 1.00 0.00 ? 31  A A "H5''" 1  
ATOM 1338   H "H4'"  . A A 1 42  ? 150.174 133.025 153.751 1.00 0.00 ? 31  A A "H4'"  1  
ATOM 1339   H "H3'"  . A A 1 42  ? 148.630 135.276 152.981 1.00 0.00 ? 31  A A "H3'"  1  
ATOM 1340   H "H2'"  . A A 1 42  ? 149.182 134.908 150.785 1.00 0.00 ? 31  A A "H2'"  1  
ATOM 1341   H "HO2'" . A A 1 42  ? 151.401 134.036 151.713 1.00 0.00 ? 31  A A "HO2'" 1  
ATOM 1342   H "H1'"  . A A 1 42  ? 148.742 132.341 150.897 1.00 0.00 ? 31  A A "H1'"  1  
ATOM 1343   H H8     . A A 1 42  ? 146.031 133.617 152.863 1.00 0.00 ? 31  A A H8     1  
ATOM 1344   H H61    . A A 1 42  ? 142.977 135.055 147.810 1.00 0.00 ? 31  A A H61    1  
ATOM 1345   H H62    . A A 1 42  ? 142.867 134.900 149.498 1.00 0.00 ? 31  A A H62    1  
ATOM 1346   H H2     . A A 1 42  ? 147.114 133.980 146.750 1.00 0.00 ? 31  A A H2     1  
ATOM 1347   P P      . G A 1 43  ? 150.462 137.070 153.424 1.00 0.00 ? 32  G A P      1  
ATOM 1348   O OP1    . G A 1 43  ? 151.773 137.566 153.914 1.00 0.00 ? 32  G A OP1    1  
ATOM 1349   O OP2    . G A 1 43  ? 149.234 137.339 154.214 1.00 0.00 ? 32  G A OP2    1  
ATOM 1350   O "O5'"  . G A 1 43  ? 150.237 137.642 151.954 1.00 0.00 ? 32  G A "O5'"  1  
ATOM 1351   C "C5'"  . G A 1 43  ? 151.069 137.234 150.878 1.00 0.00 ? 32  G A "C5'"  1  
ATOM 1352   C "C4'"  . G A 1 43  ? 150.407 137.475 149.544 1.00 0.00 ? 32  G A "C4'"  1  
ATOM 1353   O "O4'"  . G A 1 43  ? 149.240 136.579 149.376 1.00 0.00 ? 32  G A "O4'"  1  
ATOM 1354   C "C3'"  . G A 1 43  ? 149.794 138.852 149.342 1.00 0.00 ? 32  G A "C3'"  1  
ATOM 1355   O "O3'"  . G A 1 43  ? 150.756 139.845 149.026 1.00 0.00 ? 32  G A "O3'"  1  
ATOM 1356   C "C2'"  . G A 1 43  ? 148.827 138.550 148.168 1.00 0.00 ? 32  G A "C2'"  1  
ATOM 1357   O "O2'"  . G A 1 43  ? 149.536 138.369 146.950 1.00 0.00 ? 32  G A "O2'"  1  
ATOM 1358   C "C1'"  . G A 1 43  ? 148.251 137.196 148.638 1.00 0.00 ? 32  G A "C1'"  1  
ATOM 1359   N N9     . G A 1 43  ? 147.086 137.367 149.527 1.00 0.00 ? 32  G A N9     1  
ATOM 1360   C C8     . G A 1 43  ? 147.066 137.284 150.898 1.00 0.00 ? 32  G A C8     1  
ATOM 1361   N N7     . G A 1 43  ? 145.880 137.482 151.408 1.00 0.00 ? 32  G A N7     1  
ATOM 1362   C C5     . G A 1 43  ? 145.068 137.711 150.307 1.00 0.00 ? 32  G A C5     1  
ATOM 1363   C C6     . G A 1 43  ? 143.678 137.988 150.232 1.00 0.00 ? 32  G A C6     1  
ATOM 1364   O O6     . G A 1 43  ? 142.861 138.088 151.155 1.00 0.00 ? 32  G A O6     1  
ATOM 1365   N N1     . G A 1 43  ? 143.258 138.153 148.915 1.00 0.00 ? 32  G A N1     1  
ATOM 1366   C C2     . G A 1 43  ? 144.072 138.064 147.811 1.00 0.00 ? 32  G A C2     1  
ATOM 1367   N N2     . G A 1 43  ? 143.483 138.255 146.621 1.00 0.00 ? 32  G A N2     1  
ATOM 1368   N N3     . G A 1 43  ? 145.368 137.807 147.868 1.00 0.00 ? 32  G A N3     1  
ATOM 1369   C C4     . G A 1 43  ? 145.796 137.644 149.138 1.00 0.00 ? 32  G A C4     1  
ATOM 1370   H "H5'"  . G A 1 43  ? 151.265 136.278 150.970 1.00 0.00 ? 32  G A "H5'"  1  
ATOM 1371   H "H5''" . G A 1 43  ? 151.909 137.737 150.914 1.00 0.00 ? 32  G A "H5''" 1  
ATOM 1372   H "H4'"  . G A 1 43  ? 151.052 137.283 148.831 1.00 0.00 ? 32  G A "H4'"  1  
ATOM 1373   H "H3'"  . G A 1 43  ? 149.287 139.099 150.142 1.00 0.00 ? 32  G A "H3'"  1  
ATOM 1374   H "H2'"  . G A 1 43  ? 148.135 139.238 148.087 1.00 0.00 ? 32  G A "H2'"  1  
ATOM 1375   H "HO2'" . G A 1 43  ? 150.382 138.860 146.998 1.00 0.00 ? 32  G A "HO2'" 1  
ATOM 1376   H "H1'"  . G A 1 43  ? 147.991 136.663 147.858 1.00 0.00 ? 32  G A "H1'"  1  
ATOM 1377   H H8     . G A 1 43  ? 147.860 137.094 151.439 1.00 0.00 ? 32  G A H8     1  
ATOM 1378   H H1     . G A 1 43  ? 142.309 138.347 148.766 1.00 0.00 ? 32  G A H1     1  
ATOM 1379   H H21    . G A 1 43  ? 142.523 138.446 146.571 1.00 0.00 ? 32  G A H21    1  
ATOM 1380   H H22    . G A 1 43  ? 144.014 138.204 145.798 1.00 0.00 ? 32  G A H22    1  
ATOM 1381   P P      . A A 1 44  ? 150.686 141.289 149.728 1.00 0.00 ? 33  A A P      1  
ATOM 1382   O OP1    . A A 1 44  ? 151.969 141.989 149.470 1.00 0.00 ? 33  A A OP1    1  
ATOM 1383   O OP2    . A A 1 44  ? 150.221 141.099 151.125 1.00 0.00 ? 33  A A OP2    1  
ATOM 1384   O "O5'"  . A A 1 44  ? 149.538 142.051 148.927 1.00 0.00 ? 33  A A "O5'"  1  
ATOM 1385   C "C5'"  . A A 1 44  ? 149.724 142.431 147.572 1.00 0.00 ? 33  A A "C5'"  1  
ATOM 1386   C "C4'"  . A A 1 44  ? 148.502 143.117 147.016 1.00 0.00 ? 33  A A "C4'"  1  
ATOM 1387   O "O4'"  . A A 1 44  ? 147.423 142.154 146.868 1.00 0.00 ? 33  A A "O4'"  1  
ATOM 1388   C "C3'"  . A A 1 44  ? 147.898 144.211 147.884 1.00 0.00 ? 33  A A "C3'"  1  
ATOM 1389   O "O3'"  . A A 1 44  ? 148.600 145.439 147.796 1.00 0.00 ? 33  A A "O3'"  1  
ATOM 1390   C "C2'"  . A A 1 44  ? 146.470 144.282 147.364 1.00 0.00 ? 33  A A "C2'"  1  
ATOM 1391   O "O2'"  . A A 1 44  ? 146.396 145.039 146.165 1.00 0.00 ? 33  A A "O2'"  1  
ATOM 1392   C "C1'"  . A A 1 44  ? 146.204 142.809 147.046 1.00 0.00 ? 33  A A "C1'"  1  
ATOM 1393   N N9     . A A 1 44  ? 145.435 142.140 148.112 1.00 0.00 ? 33  A A N9     1  
ATOM 1394   C C8     . A A 1 44  ? 145.901 141.282 149.078 1.00 0.00 ? 33  A A C8     1  
ATOM 1395   N N7     . A A 1 44  ? 144.971 140.846 149.891 1.00 0.00 ? 33  A A N7     1  
ATOM 1396   C C5     . A A 1 44  ? 143.813 141.458 149.432 1.00 0.00 ? 33  A A C5     1  
ATOM 1397   C C6     . A A 1 44  ? 142.477 141.406 149.867 1.00 0.00 ? 33  A A C6     1  
ATOM 1398   N N6     . A A 1 44  ? 142.066 140.679 150.909 1.00 0.00 ? 33  A A N6     1  
ATOM 1399   N N1     . A A 1 44  ? 141.566 142.136 149.189 1.00 0.00 ? 33  A A N1     1  
ATOM 1400   C C2     . A A 1 44  ? 141.978 142.866 148.144 1.00 0.00 ? 33  A A C2     1  
ATOM 1401   N N3     . A A 1 44  ? 143.203 142.995 147.640 1.00 0.00 ? 33  A A N3     1  
ATOM 1402   C C4     . A A 1 44  ? 144.085 142.258 148.337 1.00 0.00 ? 33  A A C4     1  
ATOM 1403   H "H5'"  . A A 1 44  ? 149.912 141.631 147.038 1.00 0.00 ? 33  A A "H5'"  1  
ATOM 1404   H "H5''" . A A 1 44  ? 150.489 143.041 147.512 1.00 0.00 ? 33  A A "H5''" 1  
ATOM 1405   H "H4'"  . A A 1 44  ? 148.720 143.490 146.136 1.00 0.00 ? 33  A A "H4'"  1  
ATOM 1406   H "H3'"  . A A 1 44  ? 147.888 143.912 148.817 1.00 0.00 ? 33  A A "H3'"  1  
ATOM 1407   H "H2'"  . A A 1 44  ? 145.855 144.622 148.048 1.00 0.00 ? 33  A A "H2'"  1  
ATOM 1408   H "HO2'" . A A 1 44  ? 147.177 145.628 146.111 1.00 0.00 ? 33  A A "HO2'" 1  
ATOM 1409   H "H1'"  . A A 1 44  ? 145.714 142.742 146.199 1.00 0.00 ? 33  A A "H1'"  1  
ATOM 1410   H H8     . A A 1 44  ? 146.843 141.019 149.152 1.00 0.00 ? 33  A A H8     1  
ATOM 1411   H H61    . A A 1 44  ? 141.120 140.683 151.166 1.00 0.00 ? 33  A A H61    1  
ATOM 1412   H H62    . A A 1 44  ? 142.709 140.142 151.416 1.00 0.00 ? 33  A A H62    1  
ATOM 1413   H H2     . A A 1 44  ? 141.278 143.377 147.686 1.00 0.00 ? 33  A A H2     1  
ATOM 1414   P P      . A A 1 45  ? 149.348 146.036 149.088 1.00 0.00 ? 34  A A P      1  
ATOM 1415   O OP1    . A A 1 45  ? 150.117 147.233 148.662 1.00 0.00 ? 34  A A OP1    1  
ATOM 1416   O OP2    . A A 1 45  ? 150.047 144.919 149.771 1.00 0.00 ? 34  A A OP2    1  
ATOM 1417   O "O5'"  . A A 1 45  ? 148.159 146.523 150.030 1.00 0.00 ? 34  A A "O5'"  1  
ATOM 1418   C "C5'"  . A A 1 45  ? 147.276 147.556 149.616 1.00 0.00 ? 34  A A "C5'"  1  
ATOM 1419   C "C4'"  . A A 1 45  ? 145.968 147.499 150.363 1.00 0.00 ? 34  A A "C4'"  1  
ATOM 1420   O "O4'"  . A A 1 45  ? 145.291 146.245 150.117 1.00 0.00 ? 34  A A "O4'"  1  
ATOM 1421   C "C3'"  . A A 1 45  ? 146.063 147.553 151.880 1.00 0.00 ? 34  A A "C3'"  1  
ATOM 1422   O "O3'"  . A A 1 45  ? 146.199 148.871 152.381 1.00 0.00 ? 34  A A "O3'"  1  
ATOM 1423   C "C2'"  . A A 1 45  ? 144.754 146.921 152.322 1.00 0.00 ? 34  A A "C2'"  1  
ATOM 1424   O "O2'"  . A A 1 45  ? 143.682 147.849 152.245 1.00 0.00 ? 34  A A "O2'"  1  
ATOM 1425   C "C1'"  . A A 1 45  ? 144.549 145.843 151.256 1.00 0.00 ? 34  A A "C1'"  1  
ATOM 1426   N N9     . A A 1 45  ? 145.058 144.528 151.690 1.00 0.00 ? 34  A A N9     1  
ATOM 1427   C C8     . A A 1 45  ? 146.323 144.019 151.530 1.00 0.00 ? 34  A A C8     1  
ATOM 1428   N N7     . A A 1 45  ? 146.475 142.815 152.024 1.00 0.00 ? 34  A A N7     1  
ATOM 1429   C C5     . A A 1 45  ? 145.224 142.509 152.545 1.00 0.00 ? 34  A A C5     1  
ATOM 1430   C C6     . A A 1 45  ? 144.726 141.373 153.207 1.00 0.00 ? 34  A A C6     1  
ATOM 1431   N N6     . A A 1 45  ? 145.459 140.288 153.469 1.00 0.00 ? 34  A A N6     1  
ATOM 1432   N N1     . A A 1 45  ? 143.433 141.389 153.596 1.00 0.00 ? 34  A A N1     1  
ATOM 1433   C C2     . A A 1 45  ? 142.698 142.477 153.334 1.00 0.00 ? 34  A A C2     1  
ATOM 1434   N N3     . A A 1 45  ? 143.052 143.604 152.720 1.00 0.00 ? 34  A A N3     1  
ATOM 1435   C C4     . A A 1 45  ? 144.343 143.556 152.346 1.00 0.00 ? 34  A A C4     1  
ATOM 1436   H "H5'"  . A A 1 45  ? 147.100 147.460 148.656 1.00 0.00 ? 34  A A "H5'"  1  
ATOM 1437   H "H5''" . A A 1 45  ? 147.700 148.424 149.777 1.00 0.00 ? 34  A A "H5''" 1  
ATOM 1438   H "H4'"  . A A 1 45  ? 145.392 148.229 150.051 1.00 0.00 ? 34  A A "H4'"  1  
ATOM 1439   H "H3'"  . A A 1 45  ? 146.806 146.986 152.176 1.00 0.00 ? 34  A A "H3'"  1  
ATOM 1440   H "H2'"  . A A 1 45  ? 144.829 146.526 153.216 1.00 0.00 ? 34  A A "H2'"  1  
ATOM 1441   H "HO2'" . A A 1 45  ? 142.850 147.397 152.496 1.00 0.00 ? 34  A A "HO2'" 1  
ATOM 1442   H "H1'"  . A A 1 45  ? 143.593 145.770 151.047 1.00 0.00 ? 34  A A "H1'"  1  
ATOM 1443   H H8     . A A 1 45  ? 147.047 144.511 151.088 1.00 0.00 ? 34  A A H8     1  
ATOM 1444   H H61    . A A 1 45  ? 145.055 139.526 153.934 1.00 0.00 ? 34  A A H61    1  
ATOM 1445   H H62    . A A 1 45  ? 146.399 140.254 153.196 1.00 0.00 ? 34  A A H62    1  
ATOM 1446   H H2     . A A 1 45  ? 141.766 142.439 153.637 1.00 0.00 ? 34  A A H2     1  
ATOM 1447   P P      . A A 1 46  ? 147.377 149.225 153.416 1.00 0.00 ? 35  A A P      1  
ATOM 1448   O OP1    . A A 1 46  ? 147.751 150.648 153.219 1.00 0.00 ? 35  A A OP1    1  
ATOM 1449   O OP2    . A A 1 46  ? 148.417 148.171 153.306 1.00 0.00 ? 35  A A OP2    1  
ATOM 1450   O "O5'"  . A A 1 46  ? 146.687 149.089 154.846 1.00 0.00 ? 35  A A "O5'"  1  
ATOM 1451   C "C5'"  . A A 1 46  ? 145.643 149.967 155.237 1.00 0.00 ? 35  A A "C5'"  1  
ATOM 1452   C "C4'"  . A A 1 46  ? 144.531 149.227 155.938 1.00 0.00 ? 35  A A "C4'"  1  
ATOM 1453   O "O4'"  . A A 1 46  ? 144.185 148.041 155.169 1.00 0.00 ? 35  A A "O4'"  1  
ATOM 1454   C "C3'"  . A A 1 46  ? 144.854 148.693 157.324 1.00 0.00 ? 35  A A "C3'"  1  
ATOM 1455   O "O3'"  . A A 1 46  ? 144.682 149.660 158.346 1.00 0.00 ? 35  A A "O3'"  1  
ATOM 1456   C "C2'"  . A A 1 46  ? 143.906 147.509 157.456 1.00 0.00 ? 35  A A "C2'"  1  
ATOM 1457   O "O2'"  . A A 1 46  ? 142.590 147.938 157.779 1.00 0.00 ? 35  A A "O2'"  1  
ATOM 1458   C "C1'"  . A A 1 46  ? 143.912 146.957 156.036 1.00 0.00 ? 35  A A "C1'"  1  
ATOM 1459   N N9     . A A 1 46  ? 144.952 145.928 155.845 1.00 0.00 ? 35  A A N9     1  
ATOM 1460   C C8     . A A 1 46  ? 146.221 146.093 155.347 1.00 0.00 ? 35  A A C8     1  
ATOM 1461   N N7     . A A 1 46  ? 146.917 144.984 155.297 1.00 0.00 ? 35  A A N7     1  
ATOM 1462   C C5     . A A 1 46  ? 146.049 144.022 155.796 1.00 0.00 ? 35  A A C5     1  
ATOM 1463   C C6     . A A 1 46  ? 146.185 142.638 156.002 1.00 0.00 ? 35  A A C6     1  
ATOM 1464   N N6     . A A 1 46  ? 147.296 141.954 155.721 1.00 0.00 ? 35  A A N6     1  
ATOM 1465   N N1     . A A 1 46  ? 145.128 141.972 156.515 1.00 0.00 ? 35  A A N1     1  
ATOM 1466   C C2     . A A 1 46  ? 144.013 142.658 156.798 1.00 0.00 ? 35  A A C2     1  
ATOM 1467   N N3     . A A 1 46  ? 143.765 143.958 156.648 1.00 0.00 ? 35  A A N3     1  
ATOM 1468   C C4     . A A 1 46  ? 144.835 144.591 156.137 1.00 0.00 ? 35  A A C4     1  
ATOM 1469   H "H5'"  . A A 1 46  ? 145.280 150.408 154.441 1.00 0.00 ? 35  A A "H5'"  1  
ATOM 1470   H "H5''" . A A 1 46  ? 146.005 150.647 155.842 1.00 0.00 ? 35  A A "H5''" 1  
ATOM 1471   H "H4'"  . A A 1 46  ? 143.747 149.813 155.996 1.00 0.00 ? 35  A A "H4'"  1  
ATOM 1472   H "H3'"  . A A 1 46  ? 145.778 148.364 157.335 1.00 0.00 ? 35  A A "H3'"  1  
ATOM 1473   H "H2'"  . A A 1 46  ? 144.241 146.850 158.099 1.00 0.00 ? 35  A A "H2'"  1  
ATOM 1474   H "HO2'" . A A 1 46  ? 142.016 147.151 157.883 1.00 0.00 ? 35  A A "HO2'" 1  
ATOM 1475   H "H1'"  . A A 1 46  ? 143.033 146.575 155.831 1.00 0.00 ? 35  A A "H1'"  1  
ATOM 1476   H H8     . A A 1 46  ? 146.574 146.960 155.056 1.00 0.00 ? 35  A A H8     1  
ATOM 1477   H H61    . A A 1 46  ? 147.332 140.988 155.887 1.00 0.00 ? 35  A A H61    1  
ATOM 1478   H H62    . A A 1 46  ? 148.075 142.416 155.348 1.00 0.00 ? 35  A A H62    1  
ATOM 1479   H H2     . A A 1 46  ? 143.276 142.129 157.168 1.00 0.00 ? 35  A A H2     1  
ATOM 1480   P P      . G A 1 47  ? 143.592 150.830 158.188 1.00 0.00 ? 36  G A P      1  
ATOM 1481   O OP1    . G A 1 47  ? 143.476 151.561 159.476 1.00 0.00 ? 36  G A OP1    1  
ATOM 1482   O OP2    . G A 1 47  ? 142.415 150.101 157.649 1.00 0.00 ? 36  G A OP2    1  
ATOM 1483   O "O5'"  . G A 1 47  ? 144.083 151.862 157.078 1.00 0.00 ? 36  G A "O5'"  1  
ATOM 1484   C "C5'"  . G A 1 47  ? 144.874 152.988 157.429 1.00 0.00 ? 36  G A "C5'"  1  
ATOM 1485   C "C4'"  . G A 1 47  ? 145.864 153.330 156.343 1.00 0.00 ? 36  G A "C4'"  1  
ATOM 1486   O "O4'"  . G A 1 47  ? 145.155 153.450 155.089 1.00 0.00 ? 36  G A "O4'"  1  
ATOM 1487   C "C3'"  . G A 1 47  ? 146.626 154.635 156.522 1.00 0.00 ? 36  G A "C3'"  1  
ATOM 1488   O "O3'"  . G A 1 47  ? 147.807 154.485 157.292 1.00 0.00 ? 36  G A "O3'"  1  
ATOM 1489   C "C2'"  . G A 1 47  ? 146.903 155.083 155.124 1.00 0.00 ? 36  G A "C2'"  1  
ATOM 1490   O "O2'"  . G A 1 47  ? 148.037 154.418 154.585 1.00 0.00 ? 36  G A "O2'"  1  
ATOM 1491   C "C1'"  . G A 1 47  ? 145.634 154.588 154.403 1.00 0.00 ? 36  G A "C1'"  1  
ATOM 1492   N N9     . G A 1 47  ? 144.576 155.616 154.371 1.00 0.00 ? 36  G A N9     1  
ATOM 1493   C C8     . G A 1 47  ? 143.511 155.740 155.230 1.00 0.00 ? 36  G A C8     1  
ATOM 1494   N N7     . G A 1 47  ? 142.739 156.754 154.947 1.00 0.00 ? 36  G A N7     1  
ATOM 1495   C C5     . G A 1 47  ? 143.330 157.337 153.836 1.00 0.00 ? 36  G A C5     1  
ATOM 1496   C C6     . G A 1 47  ? 142.946 158.475 153.080 1.00 0.00 ? 36  G A C6     1  
ATOM 1497   O O6     . G A 1 47  ? 141.973 159.218 153.248 1.00 0.00 ? 36  G A O6     1  
ATOM 1498   N N1     . G A 1 47  ? 143.830 158.716 152.032 1.00 0.00 ? 36  G A N1     1  
ATOM 1499   C C2     . G A 1 47  ? 144.941 157.961 151.748 1.00 0.00 ? 36  G A C2     1  
ATOM 1500   N N2     . G A 1 47  ? 145.673 158.352 150.694 1.00 0.00 ? 36  G A N2     1  
ATOM 1501   N N3     . G A 1 47  ? 145.310 156.899 152.445 1.00 0.00 ? 36  G A N3     1  
ATOM 1502   C C4     . G A 1 47  ? 144.466 156.647 153.467 1.00 0.00 ? 36  G A C4     1  
ATOM 1503   H "H5'"  . G A 1 47  ? 145.360 152.793 158.256 1.00 0.00 ? 36  G A "H5'"  1  
ATOM 1504   H "H5''" . G A 1 47  ? 144.285 153.758 157.579 1.00 0.00 ? 36  G A "H5''" 1  
ATOM 1505   H "H4'"  . G A 1 47  ? 146.507 152.595 156.259 1.00 0.00 ? 36  G A "H4'"  1  
ATOM 1506   H "H3'"  . G A 1 47  ? 146.035 155.279 156.963 1.00 0.00 ? 36  G A "H3'"  1  
ATOM 1507   H "H2'"  . G A 1 47  ? 146.995 156.057 155.070 1.00 0.00 ? 36  G A "H2'"  1  
ATOM 1508   H "HO2'" . G A 1 47  ? 148.738 155.078 154.404 1.00 0.00 ? 36  G A "HO2'" 1  
ATOM 1509   H "H1'"  . G A 1 47  ? 145.860 154.325 153.486 1.00 0.00 ? 36  G A "H1'"  1  
ATOM 1510   H H8     . G A 1 47  ? 143.345 155.129 155.977 1.00 0.00 ? 36  G A H8     1  
ATOM 1511   H H1     . G A 1 47  ? 143.643 159.485 151.454 1.00 0.00 ? 36  G A H1     1  
ATOM 1512   H H21    . G A 1 47  ? 145.407 159.138 150.173 1.00 0.00 ? 36  G A H21    1  
ATOM 1513   H H22    . G A 1 47  ? 146.478 157.851 150.444 1.00 0.00 ? 36  G A H22    1  
ATOM 1514   P P      . A A 1 48  ? 148.240 155.628 158.336 1.00 0.00 ? 37  A A P      1  
ATOM 1515   O OP1    . A A 1 48  ? 149.209 155.035 159.291 1.00 0.00 ? 37  A A OP1    1  
ATOM 1516   O OP2    . A A 1 48  ? 147.006 156.274 158.848 1.00 0.00 ? 37  A A OP2    1  
ATOM 1517   O "O5'"  . A A 1 48  ? 149.018 156.692 157.440 1.00 0.00 ? 37  A A "O5'"  1  
ATOM 1518   C "C5'"  . A A 1 48  ? 150.230 156.347 156.786 1.00 0.00 ? 37  A A "C5'"  1  
ATOM 1519   C "C4'"  . A A 1 48  ? 150.503 157.254 155.612 1.00 0.00 ? 37  A A "C4'"  1  
ATOM 1520   O "O4'"  . A A 1 48  ? 149.391 157.184 154.679 1.00 0.00 ? 37  A A "O4'"  1  
ATOM 1521   C "C3'"  . A A 1 48  ? 150.611 158.738 155.926 1.00 0.00 ? 37  A A "C3'"  1  
ATOM 1522   O "O3'"  . A A 1 48  ? 151.907 159.123 156.350 1.00 0.00 ? 37  A A "O3'"  1  
ATOM 1523   C "C2'"  . A A 1 48  ? 150.269 159.354 154.577 1.00 0.00 ? 37  A A "C2'"  1  
ATOM 1524   O "O2'"  . A A 1 48  ? 151.359 159.251 153.672 1.00 0.00 ? 37  A A "O2'"  1  
ATOM 1525   C "C1'"  . A A 1 48  ? 149.140 158.436 154.101 1.00 0.00 ? 37  A A "C1'"  1  
ATOM 1526   N N9     . A A 1 48  ? 147.817 158.894 154.568 1.00 0.00 ? 37  A A N9     1  
ATOM 1527   C C8     . A A 1 48  ? 147.155 158.532 155.716 1.00 0.00 ? 37  A A C8     1  
ATOM 1528   N N7     . A A 1 48  ? 145.988 159.111 155.857 1.00 0.00 ? 37  A A N7     1  
ATOM 1529   C C5     . A A 1 48  ? 145.872 159.907 154.726 1.00 0.00 ? 37  A A C5     1  
ATOM 1530   C C6     . A A 1 48  ? 144.860 160.775 154.279 1.00 0.00 ? 37  A A C6     1  
ATOM 1531   N N6     . A A 1 48  ? 143.725 160.996 154.947 1.00 0.00 ? 37  A A N6     1  
ATOM 1532   N N1     . A A 1 48  ? 145.056 161.418 153.108 1.00 0.00 ? 37  A A N1     1  
ATOM 1533   C C2     . A A 1 48  ? 146.195 161.198 152.438 1.00 0.00 ? 37  A A C2     1  
ATOM 1534   N N3     . A A 1 48  ? 147.218 160.407 152.755 1.00 0.00 ? 37  A A N3     1  
ATOM 1535   C C4     . A A 1 48  ? 146.991 159.783 153.924 1.00 0.00 ? 37  A A C4     1  
ATOM 1536   H "H5'"  . A A 1 48  ? 150.170 155.422 156.468 1.00 0.00 ? 37  A A "H5'"  1  
ATOM 1537   H "H5''" . A A 1 48  ? 150.970 156.418 157.424 1.00 0.00 ? 37  A A "H5''" 1  
ATOM 1538   H "H4'"  . A A 1 48  ? 151.323 156.965 155.159 1.00 0.00 ? 37  A A "H4'"  1  
ATOM 1539   H "H3'"  . A A 1 48  ? 149.957 159.014 156.603 1.00 0.00 ? 37  A A "H3'"  1  
ATOM 1540   H "H2'"  . A A 1 48  ? 149.961 160.280 154.672 1.00 0.00 ? 37  A A "H2'"  1  
ATOM 1541   H "HO2'" . A A 1 48  ? 151.115 159.688 152.830 1.00 0.00 ? 37  A A "HO2'" 1  
ATOM 1542   H "H1'"  . A A 1 48  ? 149.144 158.395 153.121 1.00 0.00 ? 37  A A "H1'"  1  
ATOM 1543   H H8     . A A 1 48  ? 147.523 157.901 156.369 1.00 0.00 ? 37  A A H8     1  
ATOM 1544   H H61    . A A 1 48  ? 143.056 161.613 154.584 1.00 0.00 ? 37  A A H61    1  
ATOM 1545   H H62    . A A 1 48  ? 143.561 160.540 155.799 1.00 0.00 ? 37  A A H62    1  
ATOM 1546   H H2     . A A 1 48  ? 146.288 161.689 151.594 1.00 0.00 ? 37  A A H2     1  
ATOM 1547   P P      . G A 1 49  ? 152.108 160.453 157.229 1.00 0.00 ? 38  G A P      1  
ATOM 1548   O OP1    . G A 1 49  ? 153.190 160.195 158.214 1.00 0.00 ? 38  G A OP1    1  
ATOM 1549   O OP2    . G A 1 49  ? 150.773 160.896 157.704 1.00 0.00 ? 38  G A OP2    1  
ATOM 1550   O "O5'"  . G A 1 49  ? 152.642 161.530 156.184 1.00 0.00 ? 38  G A "O5'"  1  
ATOM 1551   C "C5'"  . G A 1 49  ? 152.378 162.913 156.363 1.00 0.00 ? 38  G A "C5'"  1  
ATOM 1552   C "C4'"  . G A 1 49  ? 152.010 163.581 155.061 1.00 0.00 ? 38  G A "C4'"  1  
ATOM 1553   O "O4'"  . G A 1 49  ? 150.985 162.759 154.461 1.00 0.00 ? 38  G A "O4'"  1  
ATOM 1554   C "C3'"  . G A 1 49  ? 151.402 164.971 155.173 1.00 0.00 ? 38  G A "C3'"  1  
ATOM 1555   O "O3'"  . G A 1 49  ? 152.372 166.004 155.130 1.00 0.00 ? 38  G A "O3'"  1  
ATOM 1556   C "C2'"  . G A 1 49  ? 150.395 165.031 154.041 1.00 0.00 ? 38  G A "C2'"  1  
ATOM 1557   O "O2'"  . G A 1 49  ? 151.019 165.375 152.813 1.00 0.00 ? 38  G A "O2'"  1  
ATOM 1558   C "C1'"  . G A 1 49  ? 149.934 163.582 153.975 1.00 0.00 ? 38  G A "C1'"  1  
ATOM 1559   N N9     . G A 1 49  ? 148.717 163.349 154.775 1.00 0.00 ? 38  G A N9     1  
ATOM 1560   C C8     . G A 1 49  ? 148.614 162.631 155.942 1.00 0.00 ? 38  G A C8     1  
ATOM 1561   N N7     . G A 1 49  ? 147.399 162.600 156.420 1.00 0.00 ? 38  G A N7     1  
ATOM 1562   C C5     . G A 1 49  ? 146.655 163.343 155.515 1.00 0.00 ? 38  G A C5     1  
ATOM 1563   C C6     . G A 1 49  ? 145.273 163.663 155.504 1.00 0.00 ? 38  G A C6     1  
ATOM 1564   O O6     . G A 1 49  ? 144.401 163.341 156.320 1.00 0.00 ? 38  G A O6     1  
ATOM 1565   N N1     . G A 1 49  ? 144.935 164.440 154.400 1.00 0.00 ? 38  G A N1     1  
ATOM 1566   C C2     . G A 1 49  ? 145.814 164.858 153.431 1.00 0.00 ? 38  G A C2     1  
ATOM 1567   N N2     . G A 1 49  ? 145.299 165.602 152.441 1.00 0.00 ? 38  G A N2     1  
ATOM 1568   N N3     . G A 1 49  ? 147.105 164.567 153.429 1.00 0.00 ? 38  G A N3     1  
ATOM 1569   C C4     . G A 1 49  ? 147.453 163.813 154.493 1.00 0.00 ? 38  G A C4     1  
ATOM 1570   H "H5'"  . G A 1 49  ? 153.176 163.347 156.731 1.00 0.00 ? 38  G A "H5'"  1  
ATOM 1571   H "H5''" . G A 1 49  ? 151.637 163.018 156.997 1.00 0.00 ? 38  G A "H5''" 1  
ATOM 1572   H "H4'"  . G A 1 49  ? 152.775 163.617 154.448 1.00 0.00 ? 38  G A "H4'"  1  
ATOM 1573   H "H3'"  . G A 1 49  ? 150.926 165.014 156.027 1.00 0.00 ? 38  G A "H3'"  1  
ATOM 1574   H "H2'"  . G A 1 49  ? 149.652 165.635 154.253 1.00 0.00 ? 38  G A "H2'"  1  
ATOM 1575   H "HO2'" . G A 1 49  ? 150.335 165.437 152.114 1.00 0.00 ? 38  G A "HO2'" 1  
ATOM 1576   H "H1'"  . G A 1 49  ? 149.764 163.336 153.042 1.00 0.00 ? 38  G A "H1'"  1  
ATOM 1577   H H8     . G A 1 49  ? 149.373 162.186 156.372 1.00 0.00 ? 38  G A H8     1  
ATOM 1578   H H1     . G A 1 49  ? 143.997 164.709 154.309 1.00 0.00 ? 38  G A H1     1  
ATOM 1579   H H21    . G A 1 49  ? 144.345 165.822 152.435 1.00 0.00 ? 38  G A H21    1  
ATOM 1580   H H22    . G A 1 49  ? 145.879 165.929 151.721 1.00 0.00 ? 38  G A H22    1  
ATOM 1581   P P      . G A 1 50  ? 152.165 167.342 155.996 1.00 0.00 ? 39  G A P      1  
ATOM 1582   O OP1    . G A 1 50  ? 153.402 168.158 155.886 1.00 0.00 ? 39  G A OP1    1  
ATOM 1583   O OP2    . G A 1 50  ? 151.661 166.949 157.336 1.00 0.00 ? 39  G A OP2    1  
ATOM 1584   O "O5'"  . G A 1 50  ? 150.996 168.116 155.238 1.00 0.00 ? 39  G A "O5'"  1  
ATOM 1585   C "C5'"  . G A 1 50  ? 150.456 169.318 155.766 1.00 0.00 ? 39  G A "C5'"  1  
ATOM 1586   C "C4'"  . G A 1 50  ? 148.949 169.327 155.694 1.00 0.00 ? 39  G A "C4'"  1  
ATOM 1587   O "O4'"  . G A 1 50  ? 148.480 167.998 155.369 1.00 0.00 ? 39  G A "O4'"  1  
ATOM 1588   C "C3'"  . G A 1 50  ? 148.222 169.692 156.980 1.00 0.00 ? 39  G A "C3'"  1  
ATOM 1589   O "O3'"  . G A 1 50  ? 148.006 171.086 157.118 1.00 0.00 ? 39  G A "O3'"  1  
ATOM 1590   C "C2'"  . G A 1 50  ? 146.918 168.917 156.866 1.00 0.00 ? 39  G A "C2'"  1  
ATOM 1591   O "O2'"  . G A 1 50  ? 145.992 169.588 156.024 1.00 0.00 ? 39  G A "O2'"  1  
ATOM 1592   C "C1'"  . G A 1 50  ? 147.379 167.637 156.174 1.00 0.00 ? 39  G A "C1'"  1  
ATOM 1593   N N9     . G A 1 50  ? 147.841 166.619 157.137 1.00 0.00 ? 39  G A N9     1  
ATOM 1594   C C8     . G A 1 50  ? 149.140 166.318 157.468 1.00 0.00 ? 39  G A C8     1  
ATOM 1595   N N7     . G A 1 50  ? 149.236 165.365 158.355 1.00 0.00 ? 39  G A N7     1  
ATOM 1596   C C5     . G A 1 50  ? 147.921 165.016 158.627 1.00 0.00 ? 39  G A C5     1  
ATOM 1597   C C6     . G A 1 50  ? 147.392 164.041 159.512 1.00 0.00 ? 39  G A C6     1  
ATOM 1598   O O6     . G A 1 50  ? 148.002 163.265 160.256 1.00 0.00 ? 39  G A O6     1  
ATOM 1599   N N1     . G A 1 50  ? 146.001 164.018 159.478 1.00 0.00 ? 39  G A N1     1  
ATOM 1600   C C2     . G A 1 50  ? 145.218 164.830 158.694 1.00 0.00 ? 39  G A C2     1  
ATOM 1601   N N2     . G A 1 50  ? 143.892 164.659 158.799 1.00 0.00 ? 39  G A N2     1  
ATOM 1602   N N3     . G A 1 50  ? 145.698 165.742 157.865 1.00 0.00 ? 39  G A N3     1  
ATOM 1603   C C4     . G A 1 50  ? 147.047 165.781 157.883 1.00 0.00 ? 39  G A C4     1  
ATOM 1604   H "H5'"  . G A 1 50  ? 150.805 170.078 155.254 1.00 0.00 ? 39  G A "H5'"  1  
ATOM 1605   H "H5''" . G A 1 50  ? 150.733 169.409 156.702 1.00 0.00 ? 39  G A "H5''" 1  
ATOM 1606   H "H4'"  . G A 1 50  ? 148.666 169.941 154.984 1.00 0.00 ? 39  G A "H4'"  1  
ATOM 1607   H "H3'"  . G A 1 50  ? 148.735 169.369 157.749 1.00 0.00 ? 39  G A "H3'"  1  
ATOM 1608   H "H2'"  . G A 1 50  ? 146.535 168.728 157.749 1.00 0.00 ? 39  G A "H2'"  1  
ATOM 1609   H "HO2'" . G A 1 50  ? 146.165 170.551 156.062 1.00 0.00 ? 39  G A "HO2'" 1  
ATOM 1610   H "H1'"  . G A 1 50  ? 146.642 167.271 155.641 1.00 0.00 ? 39  G A "H1'"  1  
ATOM 1611   H H8     . G A 1 50  ? 149.917 166.770 157.078 1.00 0.00 ? 39  G A H8     1  
ATOM 1612   H H1     . G A 1 50  ? 145.547 163.372 160.059 1.00 0.00 ? 39  G A H1     1  
ATOM 1613   H H21    . G A 1 50  ? 143.528 163.986 159.411 1.00 0.00 ? 39  G A H21    1  
ATOM 1614   H H22    . G A 1 50  ? 143.283 165.211 158.264 1.00 0.00 ? 39  G A H22    1  
ATOM 1615   P P      . A A 1 51  ? 147.909 171.747 158.579 1.00 0.00 ? 40  A A P      1  
ATOM 1616   O OP1    . A A 1 51  ? 148.235 173.190 158.455 1.00 0.00 ? 40  A A OP1    1  
ATOM 1617   O OP2    . A A 1 51  ? 148.681 170.898 159.521 1.00 0.00 ? 40  A A OP2    1  
ATOM 1618   O "O5'"  . A A 1 51  ? 146.365 171.621 158.956 1.00 0.00 ? 40  A A "O5'"  1  
ATOM 1619   C "C5'"  . A A 1 51  ? 145.412 172.540 158.443 1.00 0.00 ? 40  A A "C5'"  1  
ATOM 1620   C "C4'"  . A A 1 51  ? 144.152 171.840 157.998 1.00 0.00 ? 40  A A "C4'"  1  
ATOM 1621   O "O4'"  . A A 1 51  ? 144.451 170.439 157.779 1.00 0.00 ? 40  A A "O4'"  1  
ATOM 1622   C "C3'"  . A A 1 51  ? 143.008 171.826 158.999 1.00 0.00 ? 40  A A "C3'"  1  
ATOM 1623   O "O3'"  . A A 1 51  ? 142.218 173.002 158.956 1.00 0.00 ? 40  A A "O3'"  1  
ATOM 1624   C "C2'"  . A A 1 51  ? 142.225 170.582 158.606 1.00 0.00 ? 40  A A "C2'"  1  
ATOM 1625   O "O2'"  . A A 1 51  ? 141.389 170.832 157.486 1.00 0.00 ? 40  A A "O2'"  1  
ATOM 1626   C "C1'"  . A A 1 51  ? 143.344 169.637 158.186 1.00 0.00 ? 40  A A "C1'"  1  
ATOM 1627   N N9     . A A 1 51  ? 143.763 168.748 159.286 1.00 0.00 ? 40  A A N9     1  
ATOM 1628   C C8     . A A 1 51  ? 144.901 168.829 160.050 1.00 0.00 ? 40  A A C8     1  
ATOM 1629   N N7     . A A 1 51  ? 144.996 167.889 160.958 1.00 0.00 ? 40  A A N7     1  
ATOM 1630   C C5     . A A 1 51  ? 143.844 167.136 160.780 1.00 0.00 ? 40  A A C5     1  
ATOM 1631   C C6     . A A 1 51  ? 143.349 165.992 161.432 1.00 0.00 ? 40  A A C6     1  
ATOM 1632   N N6     . A A 1 51  ? 143.980 165.384 162.439 1.00 0.00 ? 40  A A N6     1  
ATOM 1633   N N1     . A A 1 51  ? 142.168 165.490 161.011 1.00 0.00 ? 40  A A N1     1  
ATOM 1634   C C2     . A A 1 51  ? 141.535 166.101 160.001 1.00 0.00 ? 40  A A C2     1  
ATOM 1635   N N3     . A A 1 51  ? 141.898 167.179 159.310 1.00 0.00 ? 40  A A N3     1  
ATOM 1636   C C4     . A A 1 51  ? 143.075 167.654 159.754 1.00 0.00 ? 40  A A C4     1  
ATOM 1637   H "H5'"  . A A 1 51  ? 145.803 173.012 157.677 1.00 0.00 ? 40  A A "H5'"  1  
ATOM 1638   H "H5''" . A A 1 51  ? 145.188 173.191 159.139 1.00 0.00 ? 40  A A "H5''" 1  
ATOM 1639   H "H4'"  . A A 1 51  ? 143.833 172.232 157.158 1.00 0.00 ? 40  A A "H4'"  1  
ATOM 1640   H "H3'"  . A A 1 51  ? 143.369 171.715 159.904 1.00 0.00 ? 40  A A "H3'"  1  
ATOM 1641   H "H2'"  . A A 1 51  ? 141.719 170.222 159.365 1.00 0.00 ? 40  A A "H2'"  1  
ATOM 1642   H "HO2'" . A A 1 51  ? 140.476 170.551 157.702 1.00 0.00 ? 40  A A "HO2'" 1  
ATOM 1643   H "H1'"  . A A 1 51  ? 143.044 169.096 157.425 1.00 0.00 ? 40  A A "H1'"  1  
ATOM 1644   H H8     . A A 1 51  ? 145.579 169.527 159.929 1.00 0.00 ? 40  A A H8     1  
ATOM 1645   H H61    . A A 1 51  ? 143.585 164.588 162.855 1.00 0.00 ? 40  A A H61    1  
ATOM 1646   H H62    . A A 1 51  ? 144.838 165.730 162.761 1.00 0.00 ? 40  A A H62    1  
ATOM 1647   H H2     . A A 1 51  ? 140.683 165.697 159.734 1.00 0.00 ? 40  A A H2     1  
ATOM 1648   P P      . A A 1 52  ? 141.260 173.378 160.191 1.00 0.00 ? 41  A A P      1  
ATOM 1649   O OP1    . A A 1 52  ? 140.850 174.797 160.040 1.00 0.00 ? 41  A A OP1    1  
ATOM 1650   O OP2    . A A 1 52  ? 141.927 172.936 161.441 1.00 0.00 ? 41  A A OP2    1  
ATOM 1651   O "O5'"  . A A 1 52  ? 139.973 172.466 159.971 1.00 0.00 ? 41  A A "O5'"  1  
ATOM 1652   C "C5'"  . A A 1 52  ? 139.107 172.681 158.866 1.00 0.00 ? 41  A A "C5'"  1  
ATOM 1653   C "C4'"  . A A 1 52  ? 138.166 171.521 158.665 1.00 0.00 ? 41  A A "C4'"  1  
ATOM 1654   O "O4'"  . A A 1 52  ? 138.909 170.277 158.639 1.00 0.00 ? 41  A A "O4'"  1  
ATOM 1655   C "C3'"  . A A 1 52  ? 137.138 171.297 159.764 1.00 0.00 ? 41  A A "C3'"  1  
ATOM 1656   O "O3'"  . A A 1 52  ? 136.015 172.155 159.656 1.00 0.00 ? 41  A A "O3'"  1  
ATOM 1657   C "C2'"  . A A 1 52  ? 136.805 169.824 159.597 1.00 0.00 ? 41  A A "C2'"  1  
ATOM 1658   O "O2'"  . A A 1 52  ? 135.931 169.615 158.497 1.00 0.00 ? 41  A A "O2'"  1  
ATOM 1659   C "C1'"  . A A 1 52  ? 138.182 169.253 159.261 1.00 0.00 ? 41  A A "C1'"  1  
ATOM 1660   N N9     . A A 1 52  ? 138.915 168.823 160.467 1.00 0.00 ? 41  A A N9     1  
ATOM 1661   C C8     . A A 1 52  ? 139.859 169.526 161.176 1.00 0.00 ? 41  A A C8     1  
ATOM 1662   N N7     . A A 1 52  ? 140.335 168.876 162.208 1.00 0.00 ? 41  A A N7     1  
ATOM 1663   C C5     . A A 1 52  ? 139.661 167.663 162.179 1.00 0.00 ? 41  A A C5     1  
ATOM 1664   C C6     . A A 1 52  ? 139.716 166.528 163.008 1.00 0.00 ? 41  A A C6     1  
ATOM 1665   N N6     . A A 1 52  ? 140.513 166.428 164.074 1.00 0.00 ? 41  A A N6     1  
ATOM 1666   N N1     . A A 1 52  ? 138.913 165.487 162.702 1.00 0.00 ? 41  A A N1     1  
ATOM 1667   C C2     . A A 1 52  ? 138.112 165.587 161.633 1.00 0.00 ? 41  A A C2     1  
ATOM 1668   N N3     . A A 1 52  ? 137.972 166.599 160.779 1.00 0.00 ? 41  A A N3     1  
ATOM 1669   C C4     . A A 1 52  ? 138.784 167.618 161.112 1.00 0.00 ? 41  A A C4     1  
ATOM 1670   H "H5'"  . A A 1 52  ? 139.646 172.799 158.055 1.00 0.00 ? 41  A A "H5'"  1  
ATOM 1671   H "H5''" . A A 1 52  ? 138.584 173.495 159.022 1.00 0.00 ? 41  A A "H5''" 1  
ATOM 1672   H "H4'"  . A A 1 52  ? 137.697 171.634 157.811 1.00 0.00 ? 41  A A "H4'"  1  
ATOM 1673   H "H3'"  . A A 1 52  ? 137.561 171.431 160.638 1.00 0.00 ? 41  A A "H3'"  1  
ATOM 1674   H "H2'"  . A A 1 52  ? 136.445 169.440 160.424 1.00 0.00 ? 41  A A "H2'"  1  
ATOM 1675   H "HO2'" . A A 1 52  ? 135.740 168.657 158.419 1.00 0.00 ? 41  A A "HO2'" 1  
ATOM 1676   H "H1'"  . A A 1 52  ? 138.079 168.490 158.652 1.00 0.00 ? 41  A A "H1'"  1  
ATOM 1677   H H8     . A A 1 52  ? 140.148 170.430 160.932 1.00 0.00 ? 41  A A H8     1  
ATOM 1678   H H61    . A A 1 52  ? 140.508 165.611 164.615 1.00 0.00 ? 41  A A H61    1  
ATOM 1679   H H62    . A A 1 52  ? 141.105 167.171 164.315 1.00 0.00 ? 41  A A H62    1  
ATOM 1680   H H2     . A A 1 52  ? 137.549 164.804 161.454 1.00 0.00 ? 41  A A H2     1  
ATOM 1681   P P      . A A 1 53  ? 135.545 173.034 160.917 1.00 0.00 ? 42  A A P      1  
ATOM 1682   O OP1    . A A 1 53  ? 134.934 174.286 160.403 1.00 0.00 ? 42  A A OP1    1  
ATOM 1683   O OP2    . A A 1 53  ? 136.678 173.109 161.873 1.00 0.00 ? 42  A A OP2    1  
ATOM 1684   O "O5'"  . A A 1 53  ? 134.393 172.161 161.587 1.00 0.00 ? 42  A A "O5'"  1  
ATOM 1685   C "C5'"  . A A 1 53  ? 133.353 171.599 160.800 1.00 0.00 ? 42  A A "C5'"  1  
ATOM 1686   C "C4'"  . A A 1 53  ? 133.086 170.164 161.179 1.00 0.00 ? 42  A A "C4'"  1  
ATOM 1687   O "O4'"  . A A 1 53  ? 134.318 169.405 161.133 1.00 0.00 ? 42  A A "O4'"  1  
ATOM 1688   C "C3'"  . A A 1 53  ? 132.609 169.928 162.604 1.00 0.00 ? 42  A A "C3'"  1  
ATOM 1689   O "O3'"  . A A 1 53  ? 131.214 170.119 162.761 1.00 0.00 ? 42  A A "O3'"  1  
ATOM 1690   C "C2'"  . A A 1 53  ? 132.972 168.454 162.775 1.00 0.00 ? 42  A A "C2'"  1  
ATOM 1691   O "O2'"  . A A 1 53  ? 132.048 167.614 162.098 1.00 0.00 ? 42  A A "O2'"  1  
ATOM 1692   C "C1'"  . A A 1 53  ? 134.323 168.363 162.062 1.00 0.00 ? 42  A A "C1'"  1  
ATOM 1693   N N9     . A A 1 53  ? 135.452 168.620 162.976 1.00 0.00 ? 42  A A N9     1  
ATOM 1694   C C8     . A A 1 53  ? 136.172 169.780 163.123 1.00 0.00 ? 42  A A C8     1  
ATOM 1695   N N7     . A A 1 53  ? 137.123 169.702 164.021 1.00 0.00 ? 42  A A N7     1  
ATOM 1696   C C5     . A A 1 53  ? 137.022 168.403 164.500 1.00 0.00 ? 42  A A C5     1  
ATOM 1697   C C6     . A A 1 53  ? 137.749 167.693 165.472 1.00 0.00 ? 42  A A C6     1  
ATOM 1698   N N6     . A A 1 53  ? 138.763 168.215 166.166 1.00 0.00 ? 42  A A N6     1  
ATOM 1699   N N1     . A A 1 53  ? 137.394 166.413 165.712 1.00 0.00 ? 42  A A N1     1  
ATOM 1700   C C2     . A A 1 53  ? 136.377 165.888 165.016 1.00 0.00 ? 42  A A C2     1  
ATOM 1701   N N3     . A A 1 53  ? 135.619 166.454 164.079 1.00 0.00 ? 42  A A N3     1  
ATOM 1702   C C4     . A A 1 53  ? 135.997 167.726 163.866 1.00 0.00 ? 42  A A C4     1  
ATOM 1703   H "H5'"  . A A 1 53  ? 133.611 171.637 159.855 1.00 0.00 ? 42  A A "H5'"  1  
ATOM 1704   H "H5''" . A A 1 53  ? 132.535 172.122 160.929 1.00 0.00 ? 42  A A "H5''" 1  
ATOM 1705   H "H4'"  . A A 1 53  ? 132.435 169.774 160.558 1.00 0.00 ? 42  A A "H4'"  1  
ATOM 1706   H "H3'"  . A A 1 53  ? 133.085 170.479 163.260 1.00 0.00 ? 42  A A "H3'"  1  
ATOM 1707   H "H2'"  . A A 1 53  ? 133.057 168.212 163.721 1.00 0.00 ? 42  A A "H2'"  1  
ATOM 1708   H "HO2'" . A A 1 53  ? 132.286 166.679 162.265 1.00 0.00 ? 42  A A "HO2'" 1  
ATOM 1709   H "H1'"  . A A 1 53  ? 134.422 167.473 161.663 1.00 0.00 ? 42  A A "H1'"  1  
ATOM 1710   H H8     . A A 1 53  ? 135.992 170.592 162.603 1.00 0.00 ? 42  A A H8     1  
ATOM 1711   H H61    . A A 1 53  ? 139.233 167.670 166.832 1.00 0.00 ? 42  A A H61    1  
ATOM 1712   H H62    . A A 1 53  ? 139.039 169.142 166.009 1.00 0.00 ? 42  A A H62    1  
ATOM 1713   H H2     . A A 1 53  ? 136.159 164.956 165.228 1.00 0.00 ? 42  A A H2     1  
ATOM 1714   P P      . G A 1 54  ? 130.648 170.934 164.025 1.00 0.00 ? 43  G A P      1  
ATOM 1715   O OP1    . G A 1 54  ? 131.750 171.078 165.011 1.00 0.00 ? 43  G A OP1    1  
ATOM 1716   O OP2    . G A 1 54  ? 129.368 170.305 164.441 1.00 0.00 ? 43  G A OP2    1  
ATOM 1717   O "O5'"  . G A 1 54  ? 130.320 172.378 163.438 1.00 0.00 ? 43  G A "O5'"  1  
ATOM 1718   C "C5'"  . G A 1 54  ? 129.330 172.550 162.435 1.00 0.00 ? 43  G A "C5'"  1  
ATOM 1719   C "C4'"  . G A 1 54  ? 128.902 173.992 162.323 1.00 0.00 ? 43  G A "C4'"  1  
ATOM 1720   O "O4'"  . G A 1 54  ? 130.068 174.844 162.183 1.00 0.00 ? 43  G A "O4'"  1  
ATOM 1721   C "C3'"  . G A 1 54  ? 128.040 174.341 161.121 1.00 0.00 ? 43  G A "C3'"  1  
ATOM 1722   O "O3'"  . G A 1 54  ? 126.674 174.007 161.301 1.00 0.00 ? 43  G A "O3'"  1  
ATOM 1723   C "C2'"  . G A 1 54  ? 128.285 175.835 160.956 1.00 0.00 ? 43  G A "C2'"  1  
ATOM 1724   O "O2'"  . G A 1 54  ? 127.537 176.588 161.899 1.00 0.00 ? 43  G A "O2'"  1  
ATOM 1725   C "C1'"  . G A 1 54  ? 129.771 175.938 161.304 1.00 0.00 ? 43  G A "C1'"  1  
ATOM 1726   N N9     . G A 1 54  ? 130.627 175.892 160.104 1.00 0.00 ? 43  G A N9     1  
ATOM 1727   C C8     . G A 1 54  ? 131.422 174.850 159.688 1.00 0.00 ? 43  G A C8     1  
ATOM 1728   N N7     . G A 1 54  ? 132.069 175.106 158.583 1.00 0.00 ? 43  G A N7     1  
ATOM 1729   C C5     . G A 1 54  ? 131.675 176.394 158.248 1.00 0.00 ? 43  G A C5     1  
ATOM 1730   C C6     . G A 1 54  ? 132.044 177.209 157.146 1.00 0.00 ? 43  G A C6     1  
ATOM 1731   O O6     . G A 1 54  ? 132.817 176.946 156.218 1.00 0.00 ? 43  G A O6     1  
ATOM 1732   N N1     . G A 1 54  ? 131.412 178.448 157.190 1.00 0.00 ? 43  G A N1     1  
ATOM 1733   C C2     . G A 1 54  ? 130.535 178.852 158.168 1.00 0.00 ? 43  G A C2     1  
ATOM 1734   N N2     . G A 1 54  ? 130.026 180.086 158.040 1.00 0.00 ? 43  G A N2     1  
ATOM 1735   N N3     . G A 1 54  ? 130.184 178.101 159.201 1.00 0.00 ? 43  G A N3     1  
ATOM 1736   C C4     . G A 1 54  ? 130.787 176.894 159.175 1.00 0.00 ? 43  G A C4     1  
ATOM 1737   H "H5'"  . G A 1 54  ? 128.550 172.001 162.657 1.00 0.00 ? 43  G A "H5'"  1  
ATOM 1738   H "H5''" . G A 1 54  ? 129.693 172.257 161.573 1.00 0.00 ? 43  G A "H5''" 1  
ATOM 1739   H "H4'"  . G A 1 54  ? 128.422 174.246 163.141 1.00 0.00 ? 43  G A "H4'"  1  
ATOM 1740   H "H3'"  . G A 1 54  ? 128.382 173.872 160.333 1.00 0.00 ? 43  G A "H3'"  1  
ATOM 1741   H "H2'"  . G A 1 54  ? 128.111 176.128 160.037 1.00 0.00 ? 43  G A "H2'"  1  
ATOM 1742   H "HO2'" . G A 1 54  ? 126.799 176.039 162.233 1.00 0.00 ? 43  G A "HO2'" 1  
ATOM 1743   H "H1'"  . G A 1 54  ? 129.933 176.773 161.789 1.00 0.00 ? 43  G A "H1'"  1  
ATOM 1744   H H8     . G A 1 54  ? 131.497 174.002 160.173 1.00 0.00 ? 43  G A H8     1  
ATOM 1745   H H1     . G A 1 54  ? 131.609 179.078 156.466 1.00 0.00 ? 43  G A H1     1  
ATOM 1746   H H21    . G A 1 54  ? 130.282 180.647 157.279 1.00 0.00 ? 43  G A H21    1  
ATOM 1747   H H22    . G A 1 54  ? 129.396 180.428 158.708 1.00 0.00 ? 43  G A H22    1  
ATOM 1748   P P      . A A 1 55  ? 125.748 173.673 160.029 1.00 0.00 ? 44  A A P      1  
ATOM 1749   O OP1    . A A 1 55  ? 124.416 173.249 160.529 1.00 0.00 ? 44  A A OP1    1  
ATOM 1750   O OP2    . A A 1 55  ? 126.514 172.778 159.126 1.00 0.00 ? 44  A A OP2    1  
ATOM 1751   O "O5'"  . A A 1 55  ? 125.577 175.080 159.299 1.00 0.00 ? 44  A A "O5'"  1  
ATOM 1752   C "C5'"  . A A 1 55  ? 124.768 176.102 159.863 1.00 0.00 ? 44  A A "C5'"  1  
ATOM 1753   C "C4'"  . A A 1 55  ? 124.784 177.350 159.020 1.00 0.00 ? 44  A A "C4'"  1  
ATOM 1754   O "O4'"  . A A 1 55  ? 126.142 177.856 158.919 1.00 0.00 ? 44  A A "O4'"  1  
ATOM 1755   C "C3'"  . A A 1 55  ? 124.342 177.186 157.574 1.00 0.00 ? 44  A A "C3'"  1  
ATOM 1756   O "O3'"  . A A 1 55  ? 122.933 177.152 157.427 1.00 0.00 ? 44  A A "O3'"  1  
ATOM 1757   C "C2'"  . A A 1 55  ? 125.001 178.375 156.888 1.00 0.00 ? 44  A A "C2'"  1  
ATOM 1758   O "O2'"  . A A 1 55  ? 124.283 179.574 157.133 1.00 0.00 ? 44  A A "O2'"  1  
ATOM 1759   C "C1'"  . A A 1 55  ? 126.344 178.442 157.615 1.00 0.00 ? 44  A A "C1'"  1  
ATOM 1760   N N9     . A A 1 55  ? 127.413 177.740 156.878 1.00 0.00 ? 44  A A N9     1  
ATOM 1761   C C8     . A A 1 55  ? 127.966 176.516 157.156 1.00 0.00 ? 44  A A C8     1  
ATOM 1762   N N7     . A A 1 55  ? 128.904 176.155 156.315 1.00 0.00 ? 44  A A N7     1  
ATOM 1763   C C5     . A A 1 55  ? 128.971 177.214 155.420 1.00 0.00 ? 44  A A C5     1  
ATOM 1764   C C6     . A A 1 55  ? 129.770 177.445 154.286 1.00 0.00 ? 44  A A C6     1  
ATOM 1765   N N6     . A A 1 55  ? 130.691 176.589 153.842 1.00 0.00 ? 44  A A N6     1  
ATOM 1766   N N1     . A A 1 55  ? 129.587 178.603 153.615 1.00 0.00 ? 44  A A N1     1  
ATOM 1767   C C2     . A A 1 55  ? 128.662 179.465 154.060 1.00 0.00 ? 44  A A C2     1  
ATOM 1768   N N3     . A A 1 55  ? 127.851 179.358 155.109 1.00 0.00 ? 44  A A N3     1  
ATOM 1769   C C4     . A A 1 55  ? 128.058 178.197 155.754 1.00 0.00 ? 44  A A C4     1  
ATOM 1770   H "H5'"  . A A 1 55  ? 125.102 176.317 160.759 1.00 0.00 ? 44  A A "H5'"  1  
ATOM 1771   H "H5''" . A A 1 55  ? 123.846 175.776 159.935 1.00 0.00 ? 44  A A "H5''" 1  
ATOM 1772   H "H4'"  . A A 1 55  ? 124.223 178.029 159.447 1.00 0.00 ? 44  A A "H4'"  1  
ATOM 1773   H "H3'"  . A A 1 55  ? 124.723 176.356 157.213 1.00 0.00 ? 44  A A "H3'"  1  
ATOM 1774   H "H2'"  . A A 1 55  ? 125.121 178.216 155.927 1.00 0.00 ? 44  A A "H2'"  1  
ATOM 1775   H "HO2'" . A A 1 55  ? 124.715 180.310 156.653 1.00 0.00 ? 44  A A "HO2'" 1  
ATOM 1776   H "H1'"  . A A 1 55  ? 126.598 179.380 157.745 1.00 0.00 ? 44  A A "H1'"  1  
ATOM 1777   H H8     . A A 1 55  ? 127.687 175.961 157.916 1.00 0.00 ? 44  A A H8     1  
ATOM 1778   H H61    . A A 1 55  ? 131.219 176.807 153.045 1.00 0.00 ? 44  A A H61    1  
ATOM 1779   H H62    . A A 1 55  ? 130.844 175.743 154.313 1.00 0.00 ? 44  A A H62    1  
ATOM 1780   H H2     . A A 1 55  ? 128.568 180.288 153.537 1.00 0.00 ? 44  A A H2     1  
ATOM 1781   P P      . C A 1 56  ? 122.269 176.358 156.198 1.00 0.00 ? 45  C A P      1  
ATOM 1782   O OP1    . C A 1 56  ? 120.794 176.392 156.371 1.00 0.00 ? 45  C A OP1    1  
ATOM 1783   O OP2    . C A 1 56  ? 122.961 175.051 156.065 1.00 0.00 ? 45  C A OP2    1  
ATOM 1784   O "O5'"  . C A 1 56  ? 122.631 177.242 154.923 1.00 0.00 ? 45  C A "O5'"  1  
ATOM 1785   C "C5'"  . C A 1 56  ? 122.062 178.529 154.741 1.00 0.00 ? 45  C A "C5'"  1  
ATOM 1786   C "C4'"  . C A 1 56  ? 122.637 179.227 153.532 1.00 0.00 ? 45  C A "C4'"  1  
ATOM 1787   O "O4'"  . C A 1 56  ? 124.068 179.399 153.697 1.00 0.00 ? 45  C A "O4'"  1  
ATOM 1788   C "C3'"  . C A 1 56  ? 122.502 178.493 152.208 1.00 0.00 ? 45  C A "C3'"  1  
ATOM 1789   O "O3'"  . C A 1 56  ? 121.216 178.626 151.629 1.00 0.00 ? 45  C A "O3'"  1  
ATOM 1790   C "C2'"  . C A 1 56  ? 123.614 179.112 151.373 1.00 0.00 ? 45  C A "C2'"  1  
ATOM 1791   O "O2'"  . C A 1 56  ? 123.242 180.391 150.881 1.00 0.00 ? 45  C A "O2'"  1  
ATOM 1792   C "C1'"  . C A 1 56  ? 124.720 179.282 152.415 1.00 0.00 ? 45  C A "C1'"  1  
ATOM 1793   N N1     . C A 1 56  ? 125.682 178.152 152.406 1.00 0.00 ? 45  C A N1     1  
ATOM 1794   C C2     . C A 1 56  ? 126.663 178.123 151.406 1.00 0.00 ? 45  C A C2     1  
ATOM 1795   O O2     . C A 1 56  ? 126.696 179.032 150.561 1.00 0.00 ? 45  C A O2     1  
ATOM 1796   N N3     . C A 1 56  ? 127.553 177.105 151.375 1.00 0.00 ? 45  C A N3     1  
ATOM 1797   C C4     . C A 1 56  ? 127.495 176.139 152.292 1.00 0.00 ? 45  C A C4     1  
ATOM 1798   N N4     . C A 1 56  ? 128.394 175.153 152.223 1.00 0.00 ? 45  C A N4     1  
ATOM 1799   C C5     . C A 1 56  ? 126.512 176.140 153.321 1.00 0.00 ? 45  C A C5     1  
ATOM 1800   C C6     . C A 1 56  ? 125.638 177.153 153.342 1.00 0.00 ? 45  C A C6     1  
ATOM 1801   H "H5'"  . C A 1 56  ? 122.236 179.071 155.537 1.00 0.00 ? 45  C A "H5'"  1  
ATOM 1802   H "H5''" . C A 1 56  ? 121.092 178.435 154.623 1.00 0.00 ? 45  C A "H5''" 1  
ATOM 1803   H "H4'"  . C A 1 56  ? 122.220 180.110 153.450 1.00 0.00 ? 45  C A "H4'"  1  
ATOM 1804   H "H3'"  . C A 1 56  ? 122.696 177.542 152.345 1.00 0.00 ? 45  C A "H3'"  1  
ATOM 1805   H "H2'"  . C A 1 56  ? 123.896 178.514 150.647 1.00 0.00 ? 45  C A "H2'"  1  
ATOM 1806   H "HO2'" . C A 1 56  ? 123.965 180.740 150.321 1.00 0.00 ? 45  C A "HO2'" 1  
ATOM 1807   H "H1'"  . C A 1 56  ? 125.202 180.120 152.246 1.00 0.00 ? 45  C A "H1'"  1  
ATOM 1808   H H41    . C A 1 56  ? 129.069 175.155 151.513 1.00 0.00 ? 45  C A H41    1  
ATOM 1809   H H42    . C A 1 56  ? 128.378 174.429 152.882 1.00 0.00 ? 45  C A H42    1  
ATOM 1810   H H5     . C A 1 56  ? 126.478 175.426 153.992 1.00 0.00 ? 45  C A H5     1  
ATOM 1811   H H6     . C A 1 56  ? 124.953 177.173 154.043 1.00 0.00 ? 45  C A H6     1  
ATOM 1812   P P      . G A 1 57  ? 120.666 177.505 150.614 1.00 0.00 ? 46  G A P      1  
ATOM 1813   O OP1    . G A 1 57  ? 119.255 177.836 150.285 1.00 0.00 ? 46  G A OP1    1  
ATOM 1814   O OP2    . G A 1 57  ? 120.994 176.172 151.183 1.00 0.00 ? 46  G A OP2    1  
ATOM 1815   O "O5'"  . G A 1 57  ? 121.541 177.711 149.300 1.00 0.00 ? 46  G A "O5'"  1  
ATOM 1816   C "C5'"  . G A 1 57  ? 121.413 178.886 148.515 1.00 0.00 ? 46  G A "C5'"  1  
ATOM 1817   C "C4'"  . G A 1 57  ? 122.432 178.924 147.403 1.00 0.00 ? 46  G A "C4'"  1  
ATOM 1818   O "O4'"  . G A 1 57  ? 123.771 178.915 147.964 1.00 0.00 ? 46  G A "O4'"  1  
ATOM 1819   C "C3'"  . G A 1 57  ? 122.422 177.739 146.447 1.00 0.00 ? 46  G A "C3'"  1  
ATOM 1820   O "O3'"  . G A 1 57  ? 121.400 177.823 145.471 1.00 0.00 ? 46  G A "O3'"  1  
ATOM 1821   C "C2'"  . G A 1 57  ? 123.827 177.771 145.863 1.00 0.00 ? 46  G A "C2'"  1  
ATOM 1822   O "O2'"  . G A 1 57  ? 123.948 178.776 144.866 1.00 0.00 ? 46  G A "O2'"  1  
ATOM 1823   C "C1'"  . G A 1 57  ? 124.655 178.184 147.083 1.00 0.00 ? 46  G A "C1'"  1  
ATOM 1824   N N9     . G A 1 57  ? 125.252 177.021 147.767 1.00 0.00 ? 46  G A N9     1  
ATOM 1825   C C8     . G A 1 57  ? 124.846 176.453 148.949 1.00 0.00 ? 46  G A C8     1  
ATOM 1826   N N7     . G A 1 57  ? 125.576 175.430 149.306 1.00 0.00 ? 46  G A N7     1  
ATOM 1827   C C5     . G A 1 57  ? 126.520 175.316 148.297 1.00 0.00 ? 46  G A C5     1  
ATOM 1828   C C6     . G A 1 57  ? 127.581 174.388 148.131 1.00 0.00 ? 46  G A C6     1  
ATOM 1829   O O6     . G A 1 57  ? 127.908 173.451 148.871 1.00 0.00 ? 46  G A O6     1  
ATOM 1830   N N1     . G A 1 57  ? 128.298 174.630 146.964 1.00 0.00 ? 46  G A N1     1  
ATOM 1831   C C2     . G A 1 57  ? 128.030 175.636 146.068 1.00 0.00 ? 46  G A C2     1  
ATOM 1832   N N2     . G A 1 57  ? 128.834 175.713 144.998 1.00 0.00 ? 46  G A N2     1  
ATOM 1833   N N3     . G A 1 57  ? 127.045 176.508 146.212 1.00 0.00 ? 46  G A N3     1  
ATOM 1834   C C4     . G A 1 57  ? 126.335 176.289 147.338 1.00 0.00 ? 46  G A C4     1  
ATOM 1835   H "H5'"  . G A 1 57  ? 121.538 179.669 149.090 1.00 0.00 ? 46  G A "H5'"  1  
ATOM 1836   H "H5''" . G A 1 57  ? 120.513 178.914 148.126 1.00 0.00 ? 46  G A "H5''" 1  
ATOM 1837   H "H4'"  . G A 1 57  ? 122.310 179.748 146.887 1.00 0.00 ? 46  G A "H4'"  1  
ATOM 1838   H "H3'"  . G A 1 57  ? 122.310 176.913 146.962 1.00 0.00 ? 46  G A "H3'"  1  
ATOM 1839   H "H2'"  . G A 1 57  ? 124.099 176.892 145.528 1.00 0.00 ? 46  G A "H2'"  1  
ATOM 1840   H "HO2'" . G A 1 57  ? 123.056 179.011 144.540 1.00 0.00 ? 46  G A "HO2'" 1  
ATOM 1841   H "H1'"  . G A 1 57  ? 125.366 178.799 146.802 1.00 0.00 ? 46  G A "H1'"  1  
ATOM 1842   H H8     . G A 1 57  ? 124.087 176.782 149.474 1.00 0.00 ? 46  G A H8     1  
ATOM 1843   H H1     . G A 1 57  ? 129.054 174.037 146.767 1.00 0.00 ? 46  G A H1     1  
ATOM 1844   H H21    . G A 1 57  ? 129.567 175.072 144.885 1.00 0.00 ? 46  G A H21    1  
ATOM 1845   H H22    . G A 1 57  ? 128.691 176.410 144.326 1.00 0.00 ? 46  G A H22    1  
ATOM 1846   P P      . G A 1 58  ? 120.804 176.486 144.807 1.00 0.00 ? 47  G A P      1  
ATOM 1847   O OP1    . G A 1 58  ? 119.673 176.872 143.926 1.00 0.00 ? 47  G A OP1    1  
ATOM 1848   O OP2    . G A 1 58  ? 120.586 175.493 145.891 1.00 0.00 ? 47  G A OP2    1  
ATOM 1849   O "O5'"  . G A 1 58  ? 121.990 175.953 143.884 1.00 0.00 ? 47  G A "O5'"  1  
ATOM 1850   C "C5'"  . G A 1 58  ? 122.403 176.681 142.737 1.00 0.00 ? 47  G A "C5'"  1  
ATOM 1851   C "C4'"  . G A 1 58  ? 123.627 176.070 142.103 1.00 0.00 ? 47  G A "C4'"  1  
ATOM 1852   O "O4'"  . G A 1 58  ? 124.725 176.073 143.052 1.00 0.00 ? 47  G A "O4'"  1  
ATOM 1853   C "C3'"  . G A 1 58  ? 123.503 174.612 141.684 1.00 0.00 ? 47  G A "C3'"  1  
ATOM 1854   O "O3'"  . G A 1 58  ? 122.820 174.445 140.453 1.00 0.00 ? 47  G A "O3'"  1  
ATOM 1855   C "C2'"  . G A 1 58  ? 124.954 174.154 141.644 1.00 0.00 ? 47  G A "C2'"  1  
ATOM 1856   O "O2'"  . G A 1 58  ? 125.603 174.601 140.463 1.00 0.00 ? 47  G A "O2'"  1  
ATOM 1857   C "C1'"  . G A 1 58  ? 125.541 174.898 142.845 1.00 0.00 ? 47  G A "C1'"  1  
ATOM 1858   N N9     . G A 1 58  ? 125.585 174.055 144.054 1.00 0.00 ? 47  G A N9     1  
ATOM 1859   C C8     . G A 1 58  ? 124.757 174.125 145.148 1.00 0.00 ? 47  G A C8     1  
ATOM 1860   N N7     . G A 1 58  ? 125.042 173.242 146.068 1.00 0.00 ? 47  G A N7     1  
ATOM 1861   C C5     . G A 1 58  ? 126.125 172.546 145.549 1.00 0.00 ? 47  G A C5     1  
ATOM 1862   C C6     . G A 1 58  ? 126.871 171.469 146.093 1.00 0.00 ? 47  G A C6     1  
ATOM 1863   O O6     . G A 1 58  ? 126.718 170.897 147.178 1.00 0.00 ? 47  G A O6     1  
ATOM 1864   N N1     . G A 1 58  ? 127.887 171.062 145.232 1.00 0.00 ? 47  G A N1     1  
ATOM 1865   C C2     . G A 1 58  ? 128.152 171.622 144.006 1.00 0.00 ? 47  G A C2     1  
ATOM 1866   N N2     . G A 1 58  ? 129.176 171.094 143.320 1.00 0.00 ? 47  G A N2     1  
ATOM 1867   N N3     . G A 1 58  ? 127.465 172.626 143.488 1.00 0.00 ? 47  G A N3     1  
ATOM 1868   C C4     . G A 1 58  ? 126.473 173.035 144.306 1.00 0.00 ? 47  G A C4     1  
ATOM 1869   H "H5'"  . G A 1 58  ? 122.605 177.604 142.998 1.00 0.00 ? 47  G A "H5'"  1  
ATOM 1870   H "H5''" . G A 1 58  ? 121.672 176.688 142.082 1.00 0.00 ? 47  G A "H5''" 1  
ATOM 1871   H "H4'"  . G A 1 58  ? 123.880 176.605 141.324 1.00 0.00 ? 47  G A "H4'"  1  
ATOM 1872   H "H3'"  . G A 1 58  ? 123.030 174.116 142.384 1.00 0.00 ? 47  G A "H3'"  1  
ATOM 1873   H "H2'"  . G A 1 58  ? 125.027 173.183 141.752 1.00 0.00 ? 47  G A "H2'"  1  
ATOM 1874   H "HO2'" . G A 1 58  ? 124.927 174.822 139.791 1.00 0.00 ? 47  G A "HO2'" 1  
ATOM 1875   H "H1'"  . G A 1 58  ? 126.446 175.205 142.627 1.00 0.00 ? 47  G A "H1'"  1  
ATOM 1876   H H8     . G A 1 58  ? 124.027 174.771 145.232 1.00 0.00 ? 47  G A H8     1  
ATOM 1877   H H1     . G A 1 58  ? 128.457 170.321 145.527 1.00 0.00 ? 47  G A H1     1  
ATOM 1878   H H21    . G A 1 58  ? 129.691 170.349 143.697 1.00 0.00 ? 47  G A H21    1  
ATOM 1879   H H22    . G A 1 58  ? 129.413 171.451 142.438 1.00 0.00 ? 47  G A H22    1  
ATOM 1880   P P      . C A 1 59  ? 122.023 173.085 140.150 1.00 0.00 ? 48  C A P      1  
ATOM 1881   O OP1    . C A 1 59  ? 121.313 173.245 138.855 1.00 0.00 ? 48  C A OP1    1  
ATOM 1882   O OP2    . C A 1 59  ? 121.253 172.720 141.366 1.00 0.00 ? 48  C A OP2    1  
ATOM 1883   O "O5'"  . C A 1 59  ? 123.172 172.000 139.951 1.00 0.00 ? 48  C A "O5'"  1  
ATOM 1884   C "C5'"  . C A 1 59  ? 124.038 172.054 138.826 1.00 0.00 ? 48  C A "C5'"  1  
ATOM 1885   C "C4'"  . C A 1 59  ? 125.123 171.006 138.908 1.00 0.00 ? 48  C A "C4'"  1  
ATOM 1886   O "O4'"  . C A 1 59  ? 125.933 171.223 140.093 1.00 0.00 ? 48  C A "O4'"  1  
ATOM 1887   C "C3'"  . C A 1 59  ? 124.653 169.565 139.041 1.00 0.00 ? 48  C A "C3'"  1  
ATOM 1888   O "O3'"  . C A 1 59  ? 124.245 168.999 137.807 1.00 0.00 ? 48  C A "O3'"  1  
ATOM 1889   C "C2'"  . C A 1 59  ? 125.862 168.878 139.658 1.00 0.00 ? 48  C A "C2'"  1  
ATOM 1890   O "O2'"  . C A 1 59  ? 126.866 168.628 138.685 1.00 0.00 ? 48  C A "O2'"  1  
ATOM 1891   C "C1'"  . C A 1 59  ? 126.365 169.951 140.623 1.00 0.00 ? 48  C A "C1'"  1  
ATOM 1892   N N1     . C A 1 59  ? 125.862 169.748 142.004 1.00 0.00 ? 48  C A N1     1  
ATOM 1893   C C2     . C A 1 59  ? 126.486 168.781 142.804 1.00 0.00 ? 48  C A C2     1  
ATOM 1894   O O2     . C A 1 59  ? 127.433 168.129 142.338 1.00 0.00 ? 48  C A O2     1  
ATOM 1895   N N3     . C A 1 59  ? 126.048 168.575 144.066 1.00 0.00 ? 48  C A N3     1  
ATOM 1896   C C4     . C A 1 59  ? 125.030 169.288 144.545 1.00 0.00 ? 48  C A C4     1  
ATOM 1897   N N4     . C A 1 59  ? 124.630 169.048 145.796 1.00 0.00 ? 48  C A N4     1  
ATOM 1898   C C5     . C A 1 59  ? 124.372 170.276 143.759 1.00 0.00 ? 48  C A C5     1  
ATOM 1899   C C6     . C A 1 59  ? 124.815 170.473 142.510 1.00 0.00 ? 48  C A C6     1  
ATOM 1900   H "H5'"  . C A 1 59  ? 124.453 172.940 138.787 1.00 0.00 ? 48  C A "H5'"  1  
ATOM 1901   H "H5''" . C A 1 59  ? 123.514 171.909 138.012 1.00 0.00 ? 48  C A "H5''" 1  
ATOM 1902   H "H4'"  . C A 1 59  ? 125.694 171.082 138.115 1.00 0.00 ? 48  C A "H4'"  1  
ATOM 1903   H "H3'"  . C A 1 59  ? 123.905 169.528 139.674 1.00 0.00 ? 48  C A "H3'"  1  
ATOM 1904   H "H2'"  . C A 1 59  ? 125.608 168.059 140.133 1.00 0.00 ? 48  C A "H2'"  1  
ATOM 1905   H "HO2'" . C A 1 59  ? 126.460 168.652 137.794 1.00 0.00 ? 48  C A "HO2'" 1  
ATOM 1906   H "H1'"  . C A 1 59  ? 127.344 169.952 140.632 1.00 0.00 ? 48  C A "H1'"  1  
ATOM 1907   H H41    . C A 1 59  ? 125.083 168.368 146.334 1.00 0.00 ? 48  C A H41    1  
ATOM 1908   H H42    . C A 1 59  ? 123.883 169.557 146.177 1.00 0.00 ? 48  C A H42    1  
ATOM 1909   H H5     . C A 1 59  ? 123.623 170.795 144.119 1.00 0.00 ? 48  C A H5     1  
ATOM 1910   H H6     . C A 1 59  ? 124.376 171.148 141.954 1.00 0.00 ? 48  C A H6     1  
ATOM 1911   P P      . C A 1 60  ? 123.172 167.802 137.783 1.00 0.00 ? 49  C A P      1  
ATOM 1912   O OP1    . C A 1 60  ? 122.852 167.500 136.364 1.00 0.00 ? 49  C A OP1    1  
ATOM 1913   O OP2    . C A 1 60  ? 122.075 168.145 138.723 1.00 0.00 ? 49  C A OP2    1  
ATOM 1914   O "O5'"  . C A 1 60  ? 123.967 166.559 138.380 1.00 0.00 ? 49  C A "O5'"  1  
ATOM 1915   C "C5'"  . C A 1 60  ? 125.033 165.958 137.661 1.00 0.00 ? 49  C A "C5'"  1  
ATOM 1916   C "C4'"  . C A 1 60  ? 125.697 164.863 138.459 1.00 0.00 ? 49  C A "C4'"  1  
ATOM 1917   O "O4'"  . C A 1 60  ? 126.257 165.412 139.682 1.00 0.00 ? 49  C A "O4'"  1  
ATOM 1918   C "C3'"  . C A 1 60  ? 124.792 163.740 138.942 1.00 0.00 ? 49  C A "C3'"  1  
ATOM 1919   O "O3'"  . C A 1 60  ? 124.502 162.789 137.930 1.00 0.00 ? 49  C A "O3'"  1  
ATOM 1920   C "C2'"  . C A 1 60  ? 125.573 163.165 140.113 1.00 0.00 ? 49  C A "C2'"  1  
ATOM 1921   O "O2'"  . C A 1 60  ? 126.632 162.328 139.669 1.00 0.00 ? 49  C A "O2'"  1  
ATOM 1922   C "C1'"  . C A 1 60  ? 126.168 164.430 140.735 1.00 0.00 ? 49  C A "C1'"  1  
ATOM 1923   N N1     . C A 1 60  ? 125.351 164.940 141.865 1.00 0.00 ? 49  C A N1     1  
ATOM 1924   C C2     . C A 1 60  ? 125.467 164.309 143.108 1.00 0.00 ? 49  C A C2     1  
ATOM 1925   O O2     . C A 1 60  ? 126.242 163.348 143.230 1.00 0.00 ? 49  C A O2     1  
ATOM 1926   N N3     . C A 1 60  ? 124.733 164.755 144.153 1.00 0.00 ? 49  C A N3     1  
ATOM 1927   C C4     . C A 1 60  ? 123.908 165.790 143.998 1.00 0.00 ? 49  C A C4     1  
ATOM 1928   N N4     . C A 1 60  ? 123.205 166.196 145.057 1.00 0.00 ? 49  C A N4     1  
ATOM 1929   C C5     . C A 1 60  ? 123.767 166.453 142.746 1.00 0.00 ? 49  C A C5     1  
ATOM 1930   C C6     . C A 1 60  ? 124.498 166.003 141.719 1.00 0.00 ? 49  C A C6     1  
ATOM 1931   H "H5'"  . C A 1 60  ? 125.698 166.645 137.444 1.00 0.00 ? 49  C A "H5'"  1  
ATOM 1932   H "H5''" . C A 1 60  ? 124.681 165.578 136.828 1.00 0.00 ? 49  C A "H5''" 1  
ATOM 1933   H "H4'"  . C A 1 60  ? 126.424 164.479 137.923 1.00 0.00 ? 49  C A "H4'"  1  
ATOM 1934   H "H3'"  . C A 1 60  ? 123.953 164.123 139.272 1.00 0.00 ? 49  C A "H3'"  1  
ATOM 1935   H "H2'"  . C A 1 60  ? 124.983 162.699 140.747 1.00 0.00 ? 49  C A "H2'"  1  
ATOM 1936   H "HO2'" . C A 1 60  ? 126.449 162.043 138.750 1.00 0.00 ? 49  C A "HO2'" 1  
ATOM 1937   H "H1'"  . C A 1 60  ? 127.076 164.242 141.051 1.00 0.00 ? 49  C A "H1'"  1  
ATOM 1938   H H41    . C A 1 60  ? 123.305 165.737 145.918 1.00 0.00 ? 49  C A H41    1  
ATOM 1939   H H42    . C A 1 60  ? 122.588 166.954 144.975 1.00 0.00 ? 49  C A H42    1  
ATOM 1940   H H5     . C A 1 60  ? 123.157 167.214 142.641 1.00 0.00 ? 49  C A H5     1  
ATOM 1941   H H6     . C A 1 60  ? 124.414 166.447 140.849 1.00 0.00 ? 49  C A H6     1  
ATOM 1942   P P      . A A 1 61  ? 123.150 161.922 138.002 1.00 0.00 ? 50  A A P      1  
ATOM 1943   O OP1    . A A 1 61  ? 123.049 161.124 136.753 1.00 0.00 ? 50  A A OP1    1  
ATOM 1944   O OP2    . A A 1 61  ? 122.039 162.831 138.381 1.00 0.00 ? 50  A A OP2    1  
ATOM 1945   O "O5'"  . A A 1 61  ? 123.400 160.917 139.212 1.00 0.00 ? 50  A A "O5'"  1  
ATOM 1946   C "C5'"  . A A 1 61  ? 124.399 159.913 139.129 1.00 0.00 ? 50  A A "C5'"  1  
ATOM 1947   C "C4'"  . A A 1 61  ? 124.554 159.178 140.439 1.00 0.00 ? 50  A A "C4'"  1  
ATOM 1948   O "O4'"  . A A 1 61  ? 124.973 160.104 141.475 1.00 0.00 ? 50  A A "O4'"  1  
ATOM 1949   C "C3'"  . A A 1 61  ? 123.294 158.539 140.999 1.00 0.00 ? 50  A A "C3'"  1  
ATOM 1950   O "O3'"  . A A 1 61  ? 122.974 157.306 140.377 1.00 0.00 ? 50  A A "O3'"  1  
ATOM 1951   C "C2'"  . A A 1 61  ? 123.617 158.408 142.481 1.00 0.00 ? 50  A A "C2'"  1  
ATOM 1952   O "O2'"  . A A 1 61  ? 124.472 157.301 142.726 1.00 0.00 ? 50  A A "O2'"  1  
ATOM 1953   C "C1'"  . A A 1 61  ? 124.394 159.701 142.736 1.00 0.00 ? 50  A A "C1'"  1  
ATOM 1954   N N9     . A A 1 61  ? 123.536 160.765 143.291 1.00 0.00 ? 50  A A N9     1  
ATOM 1955   C C8     . A A 1 61  ? 123.026 161.862 142.644 1.00 0.00 ? 50  A A C8     1  
ATOM 1956   N N7     . A A 1 61  ? 122.292 162.635 143.407 1.00 0.00 ? 50  A A N7     1  
ATOM 1957   C C5     . A A 1 61  ? 122.319 162.000 144.643 1.00 0.00 ? 50  A A C5     1  
ATOM 1958   C C6     . A A 1 61  ? 121.732 162.317 145.882 1.00 0.00 ? 50  A A C6     1  
ATOM 1959   N N6     . A A 1 61  ? 120.972 163.395 146.087 1.00 0.00 ? 50  A A N6     1  
ATOM 1960   N N1     . A A 1 61  ? 121.954 161.477 146.914 1.00 0.00 ? 50  A A N1     1  
ATOM 1961   C C2     . A A 1 61  ? 122.716 160.395 146.709 1.00 0.00 ? 50  A A C2     1  
ATOM 1962   N N3     . A A 1 61  ? 123.320 159.992 145.592 1.00 0.00 ? 50  A A N3     1  
ATOM 1963   C C4     . A A 1 61  ? 123.080 160.849 144.585 1.00 0.00 ? 50  A A C4     1  
ATOM 1964   H "H5'"  . A A 1 61  ? 125.254 160.328 138.895 1.00 0.00 ? 50  A A "H5'"  1  
ATOM 1965   H "H5''" . A A 1 61  ? 124.154 159.273 138.430 1.00 0.00 ? 50  A A "H5''" 1  
ATOM 1966   H "H4'"  . A A 1 61  ? 125.241 158.485 140.333 1.00 0.00 ? 50  A A "H4'"  1  
ATOM 1967   H "H3'"  . A A 1 61  ? 122.541 159.159 140.888 1.00 0.00 ? 50  A A "H3'"  1  
ATOM 1968   H "H2'"  . A A 1 61  ? 122.802 158.367 143.023 1.00 0.00 ? 50  A A "H2'"  1  
ATOM 1969   H "HO2'" . A A 1 61  ? 124.417 156.682 141.970 1.00 0.00 ? 50  A A "HO2'" 1  
ATOM 1970   H "H1'"  . A A 1 61  ? 125.131 159.521 143.357 1.00 0.00 ? 50  A A "H1'"  1  
ATOM 1971   H H8     . A A 1 61  ? 123.196 162.054 141.698 1.00 0.00 ? 50  A A H8     1  
ATOM 1972   H H61    . A A 1 61  ? 120.590 163.562 146.974 1.00 0.00 ? 50  A A H61    1  
ATOM 1973   H H62    . A A 1 61  ? 120.796 164.020 145.352 1.00 0.00 ? 50  A A H62    1  
ATOM 1974   H H2     . A A 1 61  ? 122.846 159.817 147.490 1.00 0.00 ? 50  A A H2     1  
ATOM 1975   P P      . A A 1 62  ? 121.443 156.840 140.282 1.00 0.00 ? 51  A A P      1  
ATOM 1976   O OP1    . A A 1 62  ? 121.210 156.209 138.959 1.00 0.00 ? 51  A A OP1    1  
ATOM 1977   O OP2    . A A 1 62  ? 120.705 158.076 140.646 1.00 0.00 ? 51  A A OP2    1  
ATOM 1978   O "O5'"  . A A 1 62  ? 121.159 155.748 141.407 1.00 0.00 ? 51  A A "O5'"  1  
ATOM 1979   C "C5'"  . A A 1 62  ? 120.950 156.130 142.758 1.00 0.00 ? 51  A A "C5'"  1  
ATOM 1980   C "C4'"  . A A 1 62  ? 119.710 155.489 143.330 1.00 0.00 ? 51  A A "C4'"  1  
ATOM 1981   O "O4'"  . A A 1 62  ? 118.722 155.304 142.275 1.00 0.00 ? 51  A A "O4'"  1  
ATOM 1982   C "C3'"  . A A 1 62  ? 119.899 154.117 143.960 1.00 0.00 ? 51  A A "C3'"  1  
ATOM 1983   O "O3'"  . A A 1 62  ? 118.991 153.863 145.017 1.00 0.00 ? 51  A A "O3'"  1  
ATOM 1984   C "C2'"  . A A 1 62  ? 119.535 153.179 142.811 1.00 0.00 ? 51  A A "C2'"  1  
ATOM 1985   O "O2'"  . A A 1 62  ? 119.066 151.929 143.296 1.00 0.00 ? 51  A A "O2'"  1  
ATOM 1986   C "C1'"  . A A 1 62  ? 118.376 153.938 142.175 1.00 0.00 ? 51  A A "C1'"  1  
ATOM 1987   N N9     . A A 1 62  ? 118.208 153.602 140.748 1.00 0.00 ? 51  A A N9     1  
ATOM 1988   C C8     . A A 1 62  ? 118.909 154.098 139.676 1.00 0.00 ? 51  A A C8     1  
ATOM 1989   N N7     . A A 1 62  ? 118.529 153.606 138.523 1.00 0.00 ? 51  A A N7     1  
ATOM 1990   C C5     . A A 1 62  ? 117.509 152.726 138.856 1.00 0.00 ? 51  A A C5     1  
ATOM 1991   C C6     . A A 1 62  ? 116.690 151.886 138.080 1.00 0.00 ? 51  A A C6     1  
ATOM 1992   N N6     . A A 1 62  ? 116.776 151.792 136.751 1.00 0.00 ? 51  A A N6     1  
ATOM 1993   N N1     . A A 1 62  ? 115.770 151.136 138.723 1.00 0.00 ? 51  A A N1     1  
ATOM 1994   C C2     . A A 1 62  ? 115.684 151.229 140.056 1.00 0.00 ? 51  A A C2     1  
ATOM 1995   N N3     . A A 1 62  ? 116.395 151.981 140.894 1.00 0.00 ? 51  A A N3     1  
ATOM 1996   C C4     . A A 1 62  ? 117.302 152.714 140.223 1.00 0.00 ? 51  A A C4     1  
ATOM 1997   H "H5'"  . A A 1 62  ? 120.855 157.105 142.804 1.00 0.00 ? 51  A A "H5'"  1  
ATOM 1998   H "H5''" . A A 1 62  ? 121.725 155.860 143.292 1.00 0.00 ? 51  A A "H5''" 1  
ATOM 1999   H "H4'"  . A A 1 62  ? 119.334 156.096 144.000 1.00 0.00 ? 51  A A "H4'"  1  
ATOM 2000   H "H3'"  . A A 1 62  ? 120.814 153.974 144.281 1.00 0.00 ? 51  A A "H3'"  1  
ATOM 2001   H "H2'"  . A A 1 62  ? 120.283 153.069 142.186 1.00 0.00 ? 51  A A "H2'"  1  
ATOM 2002   H "HO2'" . A A 1 62  ? 119.434 151.776 144.191 1.00 0.00 ? 51  A A "HO2'" 1  
ATOM 2003   H "H1'"  . A A 1 62  ? 117.548 153.732 142.658 1.00 0.00 ? 51  A A "H1'"  1  
ATOM 2004   H H8     . A A 1 62  ? 119.627 154.760 139.765 1.00 0.00 ? 51  A A H8     1  
ATOM 2005   H H61    . A A 1 62  ? 116.177 151.189 136.263 1.00 0.00 ? 51  A A H61    1  
ATOM 2006   H H62    . A A 1 62  ? 117.436 152.327 136.263 1.00 0.00 ? 51  A A H62    1  
ATOM 2007   H H2     . A A 1 62  ? 115.001 150.665 140.474 1.00 0.00 ? 51  A A H2     1  
ATOM 2008   P P      . A A 1 63  ? 119.515 153.801 146.535 1.00 0.00 ? 52  A A P      1  
ATOM 2009   O OP1    . A A 1 63  ? 120.937 154.227 146.549 1.00 0.00 ? 52  A A OP1    1  
ATOM 2010   O OP2    . A A 1 63  ? 119.139 152.480 147.098 1.00 0.00 ? 52  A A OP2    1  
ATOM 2011   O "O5'"  . A A 1 63  ? 118.659 154.916 147.284 1.00 0.00 ? 52  A A "O5'"  1  
ATOM 2012   C "C5'"  . A A 1 63  ? 117.838 154.583 148.393 1.00 0.00 ? 52  A A "C5'"  1  
ATOM 2013   C "C4'"  . A A 1 63  ? 116.451 155.154 148.246 1.00 0.00 ? 52  A A "C4'"  1  
ATOM 2014   O "O4'"  . A A 1 63  ? 116.529 156.568 147.929 1.00 0.00 ? 52  A A "O4'"  1  
ATOM 2015   C "C3'"  . A A 1 63  ? 115.606 154.568 147.123 1.00 0.00 ? 52  A A "C3'"  1  
ATOM 2016   O "O3'"  . A A 1 63  ? 114.998 153.334 147.471 1.00 0.00 ? 52  A A "O3'"  1  
ATOM 2017   C "C2'"  . A A 1 63  ? 114.605 155.682 146.845 1.00 0.00 ? 52  A A "C2'"  1  
ATOM 2018   O "O2'"  . A A 1 63  ? 113.570 155.700 147.817 1.00 0.00 ? 52  A A "O2'"  1  
ATOM 2019   C "C1'"  . A A 1 63  ? 115.477 156.927 147.025 1.00 0.00 ? 52  A A "C1'"  1  
ATOM 2020   N N9     . A A 1 63  ? 116.029 157.409 145.745 1.00 0.00 ? 52  A A N9     1  
ATOM 2021   C C8     . A A 1 63  ? 117.314 157.290 145.281 1.00 0.00 ? 52  A A C8     1  
ATOM 2022   N N7     . A A 1 63  ? 117.503 157.822 144.099 1.00 0.00 ? 52  A A N7     1  
ATOM 2023   C C5     . A A 1 63  ? 116.254 158.326 143.758 1.00 0.00 ? 52  A A C5     1  
ATOM 2024   C C6     . A A 1 63  ? 115.787 159.011 142.622 1.00 0.00 ? 52  A A C6     1  
ATOM 2025   N N6     . A A 1 63  ? 116.555 159.318 141.575 1.00 0.00 ? 52  A A N6     1  
ATOM 2026   N N1     . A A 1 63  ? 114.485 159.371 142.600 1.00 0.00 ? 52  A A N1     1  
ATOM 2027   C C2     . A A 1 63  ? 113.714 159.062 143.649 1.00 0.00 ? 52  A A C2     1  
ATOM 2028   N N3     . A A 1 63  ? 114.038 158.423 144.770 1.00 0.00 ? 52  A A N3     1  
ATOM 2029   C C4     . A A 1 63  ? 115.337 158.077 144.762 1.00 0.00 ? 52  A A C4     1  
ATOM 2030   H "H5'"  . A A 1 63  ? 118.245 154.941 149.210 1.00 0.00 ? 52  A A "H5'"  1  
ATOM 2031   H "H5''" . A A 1 63  ? 117.780 153.609 148.467 1.00 0.00 ? 52  A A "H5''" 1  
ATOM 2032   H "H4'"  . A A 1 63  ? 115.970 155.044 149.093 1.00 0.00 ? 52  A A "H4'"  1  
ATOM 2033   H "H3'"  . A A 1 63  ? 116.167 154.438 146.331 1.00 0.00 ? 52  A A "H3'"  1  
ATOM 2034   H "H2'"  . A A 1 63  ? 114.247 155.624 145.934 1.00 0.00 ? 52  A A "H2'"  1  
ATOM 2035   H "HO2'" . A A 1 63  ? 113.532 154.826 148.260 1.00 0.00 ? 52  A A "HO2'" 1  
ATOM 2036   H "H1'"  . A A 1 63  ? 114.947 157.638 147.441 1.00 0.00 ? 52  A A "H1'"  1  
ATOM 2037   H H8     . A A 1 63  ? 118.029 156.848 145.789 1.00 0.00 ? 52  A A H8     1  
ATOM 2038   H H61    . A A 1 63  ? 116.171 159.799 140.813 1.00 0.00 ? 52  A A H61    1  
ATOM 2039   H H62    . A A 1 63  ? 117.502 159.067 141.572 1.00 0.00 ? 52  A A H62    1  
ATOM 2040   H H2     . A A 1 63  ? 112.777 159.347 143.581 1.00 0.00 ? 52  A A H2     1  
ATOM 2041   P P      . U A 1 64  ? 114.626 152.268 146.330 1.00 0.00 ? 53  U A P      1  
ATOM 2042   O OP1    . U A 1 64  ? 114.075 151.058 146.992 1.00 0.00 ? 53  U A OP1    1  
ATOM 2043   O OP2    . U A 1 64  ? 115.792 152.141 145.420 1.00 0.00 ? 53  U A OP2    1  
ATOM 2044   O "O5'"  . U A 1 64  ? 113.444 152.968 145.521 1.00 0.00 ? 53  U A "O5'"  1  
ATOM 2045   C "C5'"  . U A 1 64  ? 112.156 153.121 146.098 1.00 0.00 ? 53  U A "C5'"  1  
ATOM 2046   C "C4'"  . U A 1 64  ? 111.214 153.850 145.173 1.00 0.00 ? 53  U A "C4'"  1  
ATOM 2047   O "O4'"  . U A 1 64  ? 111.736 155.170 144.873 1.00 0.00 ? 53  U A "O4'"  1  
ATOM 2048   C "C3'"  . U A 1 64  ? 110.997 153.220 143.804 1.00 0.00 ? 53  U A "C3'"  1  
ATOM 2049   O "O3'"  . U A 1 64  ? 110.077 152.142 143.828 1.00 0.00 ? 53  U A "O3'"  1  
ATOM 2050   C "C2'"  . U A 1 64  ? 110.534 154.402 142.964 1.00 0.00 ? 53  U A "C2'"  1  
ATOM 2051   O "O2'"  . U A 1 64  ? 109.169 154.706 143.214 1.00 0.00 ? 53  U A "O2'"  1  
ATOM 2052   C "C1'"  . U A 1 64  ? 111.406 155.531 143.518 1.00 0.00 ? 53  U A "C1'"  1  
ATOM 2053   N N1     . U A 1 64  ? 112.629 155.745 142.710 1.00 0.00 ? 53  U A N1     1  
ATOM 2054   C C2     . U A 1 64  ? 112.485 156.430 141.517 1.00 0.00 ? 53  U A C2     1  
ATOM 2055   O O2     . U A 1 64  ? 111.414 156.854 141.118 1.00 0.00 ? 53  U A O2     1  
ATOM 2056   N N3     . U A 1 64  ? 113.645 156.606 140.803 1.00 0.00 ? 53  U A N3     1  
ATOM 2057   C C4     . U A 1 64  ? 114.908 156.175 141.146 1.00 0.00 ? 53  U A C4     1  
ATOM 2058   O O4     . U A 1 64  ? 115.854 156.411 140.394 1.00 0.00 ? 53  U A O4     1  
ATOM 2059   C C5     . U A 1 64  ? 114.981 155.473 142.391 1.00 0.00 ? 53  U A C5     1  
ATOM 2060   C C6     . U A 1 64  ? 113.867 155.289 143.110 1.00 0.00 ? 53  U A C6     1  
ATOM 2061   H "H5'"  . U A 1 64  ? 112.239 153.627 146.932 1.00 0.00 ? 53  U A "H5'"  1  
ATOM 2062   H "H5''" . U A 1 64  ? 111.786 152.234 146.296 1.00 0.00 ? 53  U A "H5''" 1  
ATOM 2063   H "H4'"  . U A 1 64  ? 110.345 153.946 145.616 1.00 0.00 ? 53  U A "H4'"  1  
ATOM 2064   H "H3'"  . U A 1 64  ? 111.859 152.900 143.458 1.00 0.00 ? 53  U A "H3'"  1  
ATOM 2065   H "H2'"  . U A 1 64  ? 110.703 154.254 142.009 1.00 0.00 ? 53  U A "H2'"  1  
ATOM 2066   H "HO2'" . U A 1 64  ? 108.892 155.434 142.620 1.00 0.00 ? 53  U A "HO2'" 1  
ATOM 2067   H "H1'"  . U A 1 64  ? 110.884 156.362 143.543 1.00 0.00 ? 53  U A "H1'"  1  
ATOM 2068   H H3     . U A 1 64  ? 113.565 157.090 139.953 1.00 0.00 ? 53  U A H3     1  
ATOM 2069   H H5     . U A 1 64  ? 115.841 155.132 142.715 1.00 0.00 ? 53  U A H5     1  
ATOM 2070   H H6     . U A 1 64  ? 113.943 154.807 143.957 1.00 0.00 ? 53  U A H6     1  
ATOM 2071   P P      . U A 1 65  ? 110.169 150.972 142.732 1.00 0.00 ? 54  U A P      1  
ATOM 2072   O OP1    . U A 1 65  ? 109.173 149.929 143.087 1.00 0.00 ? 54  U A OP1    1  
ATOM 2073   O OP2    . U A 1 65  ? 111.599 150.600 142.580 1.00 0.00 ? 54  U A OP2    1  
ATOM 2074   O "O5'"  . U A 1 65  ? 109.695 151.671 141.382 1.00 0.00 ? 54  U A "O5'"  1  
ATOM 2075   C "C5'"  . U A 1 65  ? 108.349 152.093 141.214 1.00 0.00 ? 54  U A "C5'"  1  
ATOM 2076   C "C4'"  . U A 1 65  ? 108.164 152.860 139.928 1.00 0.00 ? 54  U A "C4'"  1  
ATOM 2077   O "O4'"  . U A 1 65  ? 109.009 154.040 139.929 1.00 0.00 ? 54  U A "O4'"  1  
ATOM 2078   C "C3'"  . U A 1 65  ? 108.549 152.130 138.650 1.00 0.00 ? 54  U A "C3'"  1  
ATOM 2079   O "O3'"  . U A 1 65  ? 107.560 151.214 138.214 1.00 0.00 ? 54  U A "O3'"  1  
ATOM 2080   C "C2'"  . U A 1 65  ? 108.794 153.274 137.675 1.00 0.00 ? 54  U A "C2'"  1  
ATOM 2081   O "O2'"  . U A 1 65  ? 107.570 153.809 137.192 1.00 0.00 ? 54  U A "O2'"  1  
ATOM 2082   C "C1'"  . U A 1 65  ? 109.466 154.307 138.580 1.00 0.00 ? 54  U A "C1'"  1  
ATOM 2083   N N1     . U A 1 65  ? 110.946 154.256 138.491 1.00 0.00 ? 54  U A N1     1  
ATOM 2084   C C2     . U A 1 65  ? 111.532 154.850 137.390 1.00 0.00 ? 54  U A C2     1  
ATOM 2085   O O2     . U A 1 65  ? 110.893 155.403 136.512 1.00 0.00 ? 54  U A O2     1  
ATOM 2086   N N3     . U A 1 65  ? 112.903 154.778 137.349 1.00 0.00 ? 54  U A N3     1  
ATOM 2087   C C4     . U A 1 65  ? 113.732 154.185 138.277 1.00 0.00 ? 54  U A C4     1  
ATOM 2088   O O4     . U A 1 65  ? 114.952 154.203 138.099 1.00 0.00 ? 54  U A O4     1  
ATOM 2089   C C5     . U A 1 65  ? 113.055 153.591 139.390 1.00 0.00 ? 54  U A C5     1  
ATOM 2090   C C6     . U A 1 65  ? 111.721 153.647 139.455 1.00 0.00 ? 54  U A C6     1  
ATOM 2091   H "H5'"  . U A 1 65  ? 108.098 152.667 141.966 1.00 0.00 ? 54  U A "H5'"  1  
ATOM 2092   H "H5''" . U A 1 65  ? 107.766 151.306 141.203 1.00 0.00 ? 54  U A "H5''" 1  
ATOM 2093   H "H4'"  . U A 1 65  ? 107.228 153.143 139.861 1.00 0.00 ? 54  U A "H4'"  1  
ATOM 2094   H "H3'"  . U A 1 65  ? 109.392 151.649 138.796 1.00 0.00 ? 54  U A "H3'"  1  
ATOM 2095   H "H2'"  . U A 1 65  ? 109.385 153.002 136.942 1.00 0.00 ? 54  U A "H2'"  1  
ATOM 2096   H "HO2'" . U A 1 65  ? 106.859 153.149 137.325 1.00 0.00 ? 54  U A "HO2'" 1  
ATOM 2097   H "H1'"  . U A 1 65  ? 109.160 155.205 138.334 1.00 0.00 ? 54  U A "H1'"  1  
ATOM 2098   H H3     . U A 1 65  ? 113.339 155.194 136.578 1.00 0.00 ? 54  U A H3     1  
ATOM 2099   H H5     . U A 1 65  ? 113.567 153.147 140.099 1.00 0.00 ? 54  U A H5     1  
ATOM 2100   H H6     . U A 1 65  ? 111.283 153.232 140.225 1.00 0.00 ? 54  U A H6     1  
ATOM 2101   P P      . G A 1 66  ? 107.960 149.983 137.261 1.00 0.00 ? 55  G A P      1  
ATOM 2102   O OP1    . G A 1 66  ? 106.778 149.094 137.139 1.00 0.00 ? 55  G A OP1    1  
ATOM 2103   O OP2    . G A 1 66  ? 109.249 149.428 137.744 1.00 0.00 ? 55  G A OP2    1  
ATOM 2104   O "O5'"  . G A 1 66  ? 108.214 150.662 135.842 1.00 0.00 ? 55  G A "O5'"  1  
ATOM 2105   C "C5'"  . G A 1 66  ? 107.144 151.223 135.099 1.00 0.00 ? 55  G A "C5'"  1  
ATOM 2106   C "C4'"  . G A 1 66  ? 107.626 151.830 133.806 1.00 0.00 ? 55  G A "C4'"  1  
ATOM 2107   O "O4'"  . G A 1 66  ? 108.530 152.929 134.085 1.00 0.00 ? 55  G A "O4'"  1  
ATOM 2108   C "C3'"  . G A 1 66  ? 108.427 150.913 132.895 1.00 0.00 ? 55  G A "C3'"  1  
ATOM 2109   O "O3'"  . G A 1 66  ? 107.614 150.013 132.160 1.00 0.00 ? 55  G A "O3'"  1  
ATOM 2110   C "C2'"  . G A 1 66  ? 109.192 151.896 132.022 1.00 0.00 ? 55  G A "C2'"  1  
ATOM 2111   O "O2'"  . G A 1 66  ? 108.364 152.438 131.005 1.00 0.00 ? 55  G A "O2'"  1  
ATOM 2112   C "C1'"  . G A 1 66  ? 109.528 152.999 133.028 1.00 0.00 ? 55  G A "C1'"  1  
ATOM 2113   N N9     . G A 1 66  ? 110.895 152.865 133.565 1.00 0.00 ? 55  G A N9     1  
ATOM 2114   C C8     . G A 1 66  ? 111.260 152.392 134.802 1.00 0.00 ? 55  G A C8     1  
ATOM 2115   N N7     . G A 1 66  ? 112.551 152.393 134.991 1.00 0.00 ? 55  G A N7     1  
ATOM 2116   C C5     . G A 1 66  ? 113.072 152.896 133.808 1.00 0.00 ? 55  G A C5     1  
ATOM 2117   C C6     . G A 1 66  ? 114.417 153.131 133.420 1.00 0.00 ? 55  G A C6     1  
ATOM 2118   O O6     . G A 1 66  ? 115.451 152.932 134.068 1.00 0.00 ? 55  G A O6     1  
ATOM 2119   N N1     . G A 1 66  ? 114.497 153.651 132.131 1.00 0.00 ? 55  G A N1     1  
ATOM 2120   C C2     . G A 1 66  ? 113.421 153.911 131.319 1.00 0.00 ? 55  G A C2     1  
ATOM 2121   N N2     . G A 1 66  ? 113.698 154.412 130.107 1.00 0.00 ? 55  G A N2     1  
ATOM 2122   N N3     . G A 1 66  ? 112.163 153.697 131.668 1.00 0.00 ? 55  G A N3     1  
ATOM 2123   C C4     . G A 1 66  ? 112.063 153.193 132.916 1.00 0.00 ? 55  G A C4     1  
ATOM 2124   H "H5'"  . G A 1 66  ? 106.709 151.918 135.636 1.00 0.00 ? 55  G A "H5'"  1  
ATOM 2125   H "H5''" . G A 1 66  ? 106.490 150.519 134.899 1.00 0.00 ? 55  G A "H5''" 1  
ATOM 2126   H "H4'"  . G A 1 66  ? 106.852 152.174 133.309 1.00 0.00 ? 55  G A "H4'"  1  
ATOM 2127   H "H3'"  . G A 1 66  ? 109.065 150.400 133.436 1.00 0.00 ? 55  G A "H3'"  1  
ATOM 2128   H "H2'"  . G A 1 66  ? 110.007 151.492 131.650 1.00 0.00 ? 55  G A "H2'"  1  
ATOM 2129   H "HO2'" . G A 1 66  ? 108.895 153.037 130.443 1.00 0.00 ? 55  G A "HO2'" 1  
ATOM 2130   H "H1'"  . G A 1 66  ? 109.431 153.873 132.598 1.00 0.00 ? 55  G A "H1'"  1  
ATOM 2131   H H8     . G A 1 66  ? 110.618 152.085 135.473 1.00 0.00 ? 55  G A H8     1  
ATOM 2132   H H1     . G A 1 66  ? 115.389 153.843 131.778 1.00 0.00 ? 55  G A H1     1  
ATOM 2133   H H21    . G A 1 66  ? 114.626 154.572 129.840 1.00 0.00 ? 55  G A H21    1  
ATOM 2134   H H22    . G A 1 66  ? 112.969 154.618 129.483 1.00 0.00 ? 55  G A H22    1  
ATOM 2135   P P      . C A 1 67  ? 108.178 148.563 131.753 1.00 0.00 ? 56  C A P      1  
ATOM 2136   O OP1    . C A 1 67  ? 107.105 147.842 131.023 1.00 0.00 ? 56  C A OP1    1  
ATOM 2137   O OP2    . C A 1 67  ? 108.787 147.950 132.958 1.00 0.00 ? 56  C A OP2    1  
ATOM 2138   O "O5'"  . C A 1 67  ? 109.346 148.881 130.718 1.00 0.00 ? 56  C A "O5'"  1  
ATOM 2139   C "C5'"  . C A 1 67  ? 109.057 149.380 129.421 1.00 0.00 ? 56  C A "C5'"  1  
ATOM 2140   C "C4'"  . C A 1 67  ? 110.314 149.767 128.678 1.00 0.00 ? 56  C A "C4'"  1  
ATOM 2141   O "O4'"  . C A 1 67  ? 111.027 150.793 129.417 1.00 0.00 ? 56  C A "O4'"  1  
ATOM 2142   C "C3'"  . C A 1 67  ? 111.345 148.665 128.487 1.00 0.00 ? 56  C A "C3'"  1  
ATOM 2143   O "O3'"  . C A 1 67  ? 111.025 147.786 127.421 1.00 0.00 ? 56  C A "O3'"  1  
ATOM 2144   C "C2'"  . C A 1 67  ? 112.631 149.449 128.268 1.00 0.00 ? 56  C A "C2'"  1  
ATOM 2145   O "O2'"  . C A 1 67  ? 112.702 149.963 126.946 1.00 0.00 ? 56  C A "O2'"  1  
ATOM 2146   C "C1'"  . C A 1 67  ? 112.451 150.610 129.246 1.00 0.00 ? 56  C A "C1'"  1  
ATOM 2147   N N1     . C A 1 67  ? 113.115 150.361 130.549 1.00 0.00 ? 56  C A N1     1  
ATOM 2148   C C2     . C A 1 67  ? 114.504 150.522 130.630 1.00 0.00 ? 56  C A C2     1  
ATOM 2149   O O2     . C A 1 67  ? 115.134 150.868 129.619 1.00 0.00 ? 56  C A O2     1  
ATOM 2150   N N3     . C A 1 67  ? 115.134 150.301 131.807 1.00 0.00 ? 56  C A N3     1  
ATOM 2151   C C4     . C A 1 67  ? 114.435 149.929 132.879 1.00 0.00 ? 56  C A C4     1  
ATOM 2152   N N4     . C A 1 67  ? 115.099 149.721 134.019 1.00 0.00 ? 56  C A N4     1  
ATOM 2153   C C5     . C A 1 67  ? 113.024 149.755 132.830 1.00 0.00 ? 56  C A C5     1  
ATOM 2154   C C6     . C A 1 67  ? 112.410 149.979 131.661 1.00 0.00 ? 56  C A C6     1  
ATOM 2155   H "H5'"  . C A 1 67  ? 108.480 150.169 129.504 1.00 0.00 ? 56  C A "H5'"  1  
ATOM 2156   H "H5''" . C A 1 67  ? 108.585 148.691 128.910 1.00 0.00 ? 56  C A "H5''" 1  
ATOM 2157   H "H4'"  . C A 1 67  ? 110.064 150.126 127.801 1.00 0.00 ? 56  C A "H4'"  1  
ATOM 2158   H "H3'"  . C A 1 67  ? 111.420 148.149 129.318 1.00 0.00 ? 56  C A "H3'"  1  
ATOM 2159   H "H2'"  . C A 1 67  ? 113.422 148.912 128.492 1.00 0.00 ? 56  C A "H2'"  1  
ATOM 2160   H "HO2'" . C A 1 67  ? 112.091 149.455 126.373 1.00 0.00 ? 56  C A "HO2'" 1  
ATOM 2161   H "H1'"  . C A 1 67  ? 112.815 151.431 128.849 1.00 0.00 ? 56  C A "H1'"  1  
ATOM 2162   H H41    . C A 1 67  ? 116.072 149.840 134.048 1.00 0.00 ? 56  C A H41    1  
ATOM 2163   H H42    . C A 1 67  ? 114.613 149.447 134.824 1.00 0.00 ? 56  C A H42    1  
ATOM 2164   H H5     . C A 1 67  ? 112.517 149.482 133.624 1.00 0.00 ? 56  C A H5     1  
ATOM 2165   H H6     . C A 1 67  ? 111.440 149.863 131.606 1.00 0.00 ? 56  C A H6     1  
ATOM 2166   P P      . G A 1 68  ? 111.619 146.293 127.399 1.00 0.00 ? 57  G A P      1  
ATOM 2167   O OP1    . G A 1 68  ? 110.966 145.555 126.289 1.00 0.00 ? 57  G A OP1    1  
ATOM 2168   O OP2    . G A 1 68  ? 111.553 145.753 128.781 1.00 0.00 ? 57  G A OP2    1  
ATOM 2169   O "O5'"  . G A 1 68  ? 113.154 146.493 127.022 1.00 0.00 ? 57  G A "O5'"  1  
ATOM 2170   C "C5'"  . G A 1 68  ? 113.533 146.955 125.735 1.00 0.00 ? 57  G A "C5'"  1  
ATOM 2171   C "C4'"  . G A 1 68  ? 115.031 147.086 125.611 1.00 0.00 ? 57  G A "C4'"  1  
ATOM 2172   O "O4'"  . G A 1 68  ? 115.516 148.081 126.551 1.00 0.00 ? 57  G A "O4'"  1  
ATOM 2173   C "C3'"  . G A 1 68  ? 115.839 145.841 125.940 1.00 0.00 ? 57  G A "C3'"  1  
ATOM 2174   O "O3'"  . G A 1 68  ? 115.845 144.890 124.887 1.00 0.00 ? 57  G A "O3'"  1  
ATOM 2175   C "C2'"  . G A 1 68  ? 117.215 146.412 126.255 1.00 0.00 ? 57  G A "C2'"  1  
ATOM 2176   O "O2'"  . G A 1 68  ? 117.918 146.749 125.068 1.00 0.00 ? 57  G A "O2'"  1  
ATOM 2177   C "C1'"  . G A 1 68  ? 116.849 147.698 126.997 1.00 0.00 ? 57  G A "C1'"  1  
ATOM 2178   N N9     . G A 1 68  ? 116.900 147.528 128.462 1.00 0.00 ? 57  G A N9     1  
ATOM 2179   C C8     . G A 1 68  ? 115.835 147.444 129.327 1.00 0.00 ? 57  G A C8     1  
ATOM 2180   N N7     . G A 1 68  ? 116.197 147.295 130.572 1.00 0.00 ? 57  G A N7     1  
ATOM 2181   C C5     . G A 1 68  ? 117.583 147.280 130.528 1.00 0.00 ? 57  G A C5     1  
ATOM 2182   C C6     . G A 1 68  ? 118.536 147.143 131.572 1.00 0.00 ? 57  G A C6     1  
ATOM 2183   O O6     . G A 1 68  ? 118.334 147.008 132.785 1.00 0.00 ? 57  G A O6     1  
ATOM 2184   N N1     . G A 1 68  ? 119.839 147.179 131.086 1.00 0.00 ? 57  G A N1     1  
ATOM 2185   C C2     . G A 1 68  ? 120.182 147.327 129.763 1.00 0.00 ? 57  G A C2     1  
ATOM 2186   N N2     . G A 1 68  ? 121.496 147.337 129.488 1.00 0.00 ? 57  G A N2     1  
ATOM 2187   N N3     . G A 1 68  ? 119.306 147.454 128.781 1.00 0.00 ? 57  G A N3     1  
ATOM 2188   C C4     . G A 1 68  ? 118.032 147.421 129.232 1.00 0.00 ? 57  G A C4     1  
ATOM 2189   H "H5'"  . G A 1 68  ? 113.122 147.828 125.573 1.00 0.00 ? 57  G A "H5'"  1  
ATOM 2190   H "H5''" . G A 1 68  ? 113.212 146.322 125.059 1.00 0.00 ? 57  G A "H5''" 1  
ATOM 2191   H "H4'"  . G A 1 68  ? 115.249 147.377 124.701 1.00 0.00 ? 57  G A "H4'"  1  
ATOM 2192   H "H3'"  . G A 1 68  ? 115.473 145.424 126.747 1.00 0.00 ? 57  G A "H3'"  1  
ATOM 2193   H "H2'"  . G A 1 68  ? 117.735 145.805 126.825 1.00 0.00 ? 57  G A "H2'"  1  
ATOM 2194   H "HO2'" . G A 1 68  ? 118.810 147.077 125.308 1.00 0.00 ? 57  G A "HO2'" 1  
ATOM 2195   H "H1'"  . G A 1 68  ? 117.463 148.414 126.732 1.00 0.00 ? 57  G A "H1'"  1  
ATOM 2196   H H8     . G A 1 68  ? 114.899 147.492 129.039 1.00 0.00 ? 57  G A H8     1  
ATOM 2197   H H1     . G A 1 68  ? 120.565 147.093 131.738 1.00 0.00 ? 57  G A H1     1  
ATOM 2198   H H21    . G A 1 68  ? 122.151 147.243 130.211 1.00 0.00 ? 57  G A H21    1  
ATOM 2199   H H22    . G A 1 68  ? 121.801 147.440 128.562 1.00 0.00 ? 57  G A H22    1  
ATOM 2200   P P      . G A 1 69  ? 116.073 143.332 125.209 1.00 0.00 ? 58  G A P      1  
ATOM 2201   O OP1    . G A 1 69  ? 115.910 142.572 123.944 1.00 0.00 ? 58  G A OP1    1  
ATOM 2202   O OP2    . G A 1 69  ? 115.241 142.980 126.387 1.00 0.00 ? 58  G A OP2    1  
ATOM 2203   O "O5'"  . G A 1 69  ? 117.602 143.247 125.643 1.00 0.00 ? 58  G A "O5'"  1  
ATOM 2204   C "C5'"  . G A 1 69  ? 118.641 143.524 124.716 1.00 0.00 ? 58  G A "C5'"  1  
ATOM 2205   C "C4'"  . G A 1 69  ? 120.003 143.403 125.354 1.00 0.00 ? 58  G A "C4'"  1  
ATOM 2206   O "O4'"  . G A 1 69  ? 120.156 144.418 126.379 1.00 0.00 ? 58  G A "O4'"  1  
ATOM 2207   C "C3'"  . G A 1 69  ? 120.286 142.096 126.080 1.00 0.00 ? 58  G A "C3'"  1  
ATOM 2208   O "O3'"  . G A 1 69  ? 120.617 141.034 125.201 1.00 0.00 ? 58  G A "O3'"  1  
ATOM 2209   C "C2'"  . G A 1 69  ? 121.413 142.480 127.025 1.00 0.00 ? 58  G A "C2'"  1  
ATOM 2210   O "O2'"  . G A 1 69  ? 122.657 142.548 126.345 1.00 0.00 ? 58  G A "O2'"  1  
ATOM 2211   C "C1'"  . G A 1 69  ? 120.997 143.892 127.442 1.00 0.00 ? 58  G A "C1'"  1  
ATOM 2212   N N9     . G A 1 69  ? 120.292 143.904 128.737 1.00 0.00 ? 58  G A N9     1  
ATOM 2213   C C8     . G A 1 69  ? 118.945 144.079 128.950 1.00 0.00 ? 58  G A C8     1  
ATOM 2214   N N7     . G A 1 69  ? 118.615 144.042 130.211 1.00 0.00 ? 58  G A N7     1  
ATOM 2215   C C5     . G A 1 69  ? 119.816 143.831 130.874 1.00 0.00 ? 58  G A C5     1  
ATOM 2216   C C6     . G A 1 69  ? 120.091 143.701 132.260 1.00 0.00 ? 58  G A C6     1  
ATOM 2217   O O6     . G A 1 69  ? 119.303 143.749 133.210 1.00 0.00 ? 58  G A O6     1  
ATOM 2218   N N1     . G A 1 69  ? 121.447 143.496 132.496 1.00 0.00 ? 58  G A N1     1  
ATOM 2219   C C2     . G A 1 69  ? 122.415 143.425 131.525 1.00 0.00 ? 58  G A C2     1  
ATOM 2220   N N2     . G A 1 69  ? 123.671 143.222 131.948 1.00 0.00 ? 58  G A N2     1  
ATOM 2221   N N3     . G A 1 69  ? 122.172 143.545 130.228 1.00 0.00 ? 58  G A N3     1  
ATOM 2222   C C4     . G A 1 69  ? 120.861 143.743 129.979 1.00 0.00 ? 58  G A C4     1  
ATOM 2223   H "H5'"  . G A 1 69  ? 118.528 144.434 124.371 1.00 0.00 ? 58  G A "H5'"  1  
ATOM 2224   H "H5''" . G A 1 69  ? 118.580 142.891 123.968 1.00 0.00 ? 58  G A "H5''" 1  
ATOM 2225   H "H4'"  . G A 1 69  ? 120.688 143.539 124.666 1.00 0.00 ? 58  G A "H4'"  1  
ATOM 2226   H "H3'"  . G A 1 69  ? 119.498 141.843 126.606 1.00 0.00 ? 58  G A "H3'"  1  
ATOM 2227   H "H2'"  . G A 1 69  ? 121.455 141.877 127.799 1.00 0.00 ? 58  G A "H2'"  1  
ATOM 2228   H "HO2'" . G A 1 69  ? 123.360 142.787 126.986 1.00 0.00 ? 58  G A "HO2'" 1  
ATOM 2229   H "H1'"  . G A 1 69  ? 121.790 144.462 127.496 1.00 0.00 ? 58  G A "H1'"  1  
ATOM 2230   H H8     . G A 1 69  ? 118.297 144.216 128.227 1.00 0.00 ? 58  G A H8     1  
ATOM 2231   H H1     . G A 1 69  ? 121.732 143.396 133.428 1.00 0.00 ? 58  G A H1     1  
ATOM 2232   H H21    . G A 1 69  ? 123.859 143.134 132.906 1.00 0.00 ? 58  G A H21    1  
ATOM 2233   H H22    . G A 1 69  ? 124.403 143.162 131.300 1.00 0.00 ? 58  G A H22    1  
ATOM 2234   P P      . G A 1 70  ? 120.227 139.522 125.580 1.00 0.00 ? 59  G A P      1  
ATOM 2235   O OP1    . G A 1 70  ? 120.625 138.646 124.445 1.00 0.00 ? 59  G A OP1    1  
ATOM 2236   O OP2    . G A 1 70  ? 118.818 139.514 126.053 1.00 0.00 ? 59  G A OP2    1  
ATOM 2237   O "O5'"  . G A 1 70  ? 121.165 139.179 126.822 1.00 0.00 ? 59  G A "O5'"  1  
ATOM 2238   C "C5'"  . G A 1 70  ? 122.575 139.093 126.666 1.00 0.00 ? 59  G A "C5'"  1  
ATOM 2239   C "C4'"  . G A 1 70  ? 123.265 138.875 127.989 1.00 0.00 ? 59  G A "C4'"  1  
ATOM 2240   O "O4'"  . G A 1 70  ? 123.036 140.015 128.856 1.00 0.00 ? 59  G A "O4'"  1  
ATOM 2241   C "C3'"  . G A 1 70  ? 122.782 137.685 128.805 1.00 0.00 ? 59  G A "C3'"  1  
ATOM 2242   O "O3'"  . G A 1 70  ? 123.328 136.452 128.365 1.00 0.00 ? 59  G A "O3'"  1  
ATOM 2243   C "C2'"  . G A 1 70  ? 123.194 138.064 130.220 1.00 0.00 ? 59  G A "C2'"  1  
ATOM 2244   O "O2'"  . G A 1 70  ? 124.580 137.841 130.433 1.00 0.00 ? 59  G A "O2'"  1  
ATOM 2245   C "C1'"  . G A 1 70  ? 122.927 139.570 130.221 1.00 0.00 ? 59  G A "C1'"  1  
ATOM 2246   N N9     . G A 1 70  ? 121.602 139.900 130.779 1.00 0.00 ? 59  G A N9     1  
ATOM 2247   C C8     . G A 1 70  ? 120.490 140.320 130.087 1.00 0.00 ? 59  G A C8     1  
ATOM 2248   N N7     . G A 1 70  ? 119.459 140.536 130.857 1.00 0.00 ? 59  G A N7     1  
ATOM 2249   C C5     . G A 1 70  ? 119.914 140.239 132.135 1.00 0.00 ? 59  G A C5     1  
ATOM 2250   C C6     . G A 1 70  ? 119.243 140.287 133.383 1.00 0.00 ? 59  G A C6     1  
ATOM 2251   O O6     . G A 1 70  ? 118.074 140.609 133.618 1.00 0.00 ? 59  G A O6     1  
ATOM 2252   N N1     . G A 1 70  ? 120.079 139.904 134.428 1.00 0.00 ? 59  G A N1     1  
ATOM 2253   C C2     . G A 1 70  ? 121.393 139.526 134.289 1.00 0.00 ? 59  G A C2     1  
ATOM 2254   N N2     . G A 1 70  ? 122.039 139.190 135.416 1.00 0.00 ? 59  G A N2     1  
ATOM 2255   N N3     . G A 1 70  ? 122.030 139.479 133.131 1.00 0.00 ? 59  G A N3     1  
ATOM 2256   C C4     . G A 1 70  ? 121.236 139.845 132.103 1.00 0.00 ? 59  G A C4     1  
ATOM 2257   H "H5'"  . G A 1 70  ? 122.905 139.925 126.266 1.00 0.00 ? 59  G A "H5'"  1  
ATOM 2258   H "H5''" . G A 1 70  ? 122.785 138.344 126.068 1.00 0.00 ? 59  G A "H5''" 1  
ATOM 2259   H "H4'"  . G A 1 70  ? 124.228 138.782 127.833 1.00 0.00 ? 59  G A "H4'"  1  
ATOM 2260   H "H3'"  . G A 1 70  ? 121.805 137.638 128.758 1.00 0.00 ? 59  G A "H3'"  1  
ATOM 2261   H "H2'"  . G A 1 70  ? 122.646 137.603 130.891 1.00 0.00 ? 59  G A "H2'"  1  
ATOM 2262   H "HO2'" . G A 1 70  ? 124.908 137.209 129.759 1.00 0.00 ? 59  G A "HO2'" 1  
ATOM 2263   H "H1'"  . G A 1 70  ? 123.622 140.023 130.744 1.00 0.00 ? 59  G A "H1'"  1  
ATOM 2264   H H8     . G A 1 70  ? 120.474 140.447 129.116 1.00 0.00 ? 59  G A H8     1  
ATOM 2265   H H1     . G A 1 70  ? 119.700 139.906 135.332 1.00 0.00 ? 59  G A H1     1  
ATOM 2266   H H21    . G A 1 70  ? 121.574 139.223 136.280 1.00 0.00 ? 59  G A H21    1  
ATOM 2267   H H22    . G A 1 70  ? 122.979 138.913 135.379 1.00 0.00 ? 59  G A H22    1  
ATOM 2268   P P      . A A 1 71  ? 122.506 135.087 128.569 1.00 0.00 ? 60  A A P      1  
ATOM 2269   O OP1    . A A 1 71  ? 123.242 133.998 127.877 1.00 0.00 ? 60  A A OP1    1  
ATOM 2270   O OP2    . A A 1 71  ? 121.087 135.349 128.220 1.00 0.00 ? 60  A A OP2    1  
ATOM 2271   O "O5'"  . A A 1 71  ? 122.586 134.818 130.136 1.00 0.00 ? 60  A A "O5'"  1  
ATOM 2272   C "C5'"  . A A 1 71  ? 123.820 134.495 130.759 1.00 0.00 ? 60  A A "C5'"  1  
ATOM 2273   C "C4'"  . A A 1 71  ? 123.674 134.382 132.256 1.00 0.00 ? 60  A A "C4'"  1  
ATOM 2274   O "O4'"  . A A 1 71  ? 123.253 135.659 132.806 1.00 0.00 ? 60  A A "O4'"  1  
ATOM 2275   C "C3'"  . A A 1 71  ? 122.623 133.401 132.751 1.00 0.00 ? 60  A A "C3'"  1  
ATOM 2276   O "O3'"  . A A 1 71  ? 123.071 132.055 132.736 1.00 0.00 ? 60  A A "O3'"  1  
ATOM 2277   C "C2'"  . A A 1 71  ? 122.309 133.925 134.145 1.00 0.00 ? 60  A A "C2'"  1  
ATOM 2278   O "O2'"  . A A 1 71  ? 123.317 133.552 135.074 1.00 0.00 ? 60  A A "O2'"  1  
ATOM 2279   C "C1'"  . A A 1 71  ? 122.373 135.438 133.925 1.00 0.00 ? 60  A A "C1'"  1  
ATOM 2280   N N9     . A A 1 71  ? 121.041 136.016 133.671 1.00 0.00 ? 60  A A N9     1  
ATOM 2281   C C8     . A A 1 71  ? 120.516 136.433 132.473 1.00 0.00 ? 60  A A C8     1  
ATOM 2282   N N7     . A A 1 71  ? 119.298 136.908 132.566 1.00 0.00 ? 60  A A N7     1  
ATOM 2283   C C5     . A A 1 71  ? 119.001 136.799 133.918 1.00 0.00 ? 60  A A C5     1  
ATOM 2284   C C6     . A A 1 71  ? 117.858 137.134 134.667 1.00 0.00 ? 60  A A C6     1  
ATOM 2285   N N6     . A A 1 71  ? 116.756 137.668 134.136 1.00 0.00 ? 60  A A N6     1  
ATOM 2286   N N1     . A A 1 71  ? 117.885 136.896 135.995 1.00 0.00 ? 60  A A N1     1  
ATOM 2287   C C2     . A A 1 71  ? 118.990 136.358 136.528 1.00 0.00 ? 60  A A C2     1  
ATOM 2288   N N3     . A A 1 71  ? 120.126 136.002 135.929 1.00 0.00 ? 60  A A N3     1  
ATOM 2289   C C4     . A A 1 71  ? 120.064 136.251 134.608 1.00 0.00 ? 60  A A C4     1  
ATOM 2290   H "H5'"  . A A 1 71  ? 124.474 135.197 130.553 1.00 0.00 ? 60  A A "H5'"  1  
ATOM 2291   H "H5''" . A A 1 71  ? 124.146 133.643 130.404 1.00 0.00 ? 60  A A "H5''" 1  
ATOM 2292   H "H4'"  . A A 1 71  ? 124.541 134.141 132.642 1.00 0.00 ? 60  A A "H4'"  1  
ATOM 2293   H "H3'"  . A A 1 71  ? 121.821 133.479 132.191 1.00 0.00 ? 60  A A "H3'"  1  
ATOM 2294   H "H2'"  . A A 1 71  ? 121.419 133.643 134.444 1.00 0.00 ? 60  A A "H2'"  1  
ATOM 2295   H "HO2'" . A A 1 71  ? 123.818 132.791 134.714 1.00 0.00 ? 60  A A "HO2'" 1  
ATOM 2296   H "H1'"  . A A 1 71  ? 122.771 135.865 134.711 1.00 0.00 ? 60  A A "H1'"  1  
ATOM 2297   H H8     . A A 1 71  ? 121.004 136.379 131.625 1.00 0.00 ? 60  A A H8     1  
ATOM 2298   H H61    . A A 1 71  ? 115.989 137.880 134.709 1.00 0.00 ? 60  A A H61    1  
ATOM 2299   H H62    . A A 1 71  ? 116.712 137.850 133.174 1.00 0.00 ? 60  A A H62    1  
ATOM 2300   H H2     . A A 1 71  ? 118.961 136.207 137.496 1.00 0.00 ? 60  A A H2     1  
ATOM 2301   P P      . A A 1 72  ? 122.019 130.856 132.555 1.00 0.00 ? 61  A A P      1  
ATOM 2302   O OP1    . A A 1 72  ? 122.781 129.589 132.429 1.00 0.00 ? 61  A A OP1    1  
ATOM 2303   O OP2    . A A 1 72  ? 121.057 131.242 131.492 1.00 0.00 ? 61  A A OP2    1  
ATOM 2304   O "O5'"  . A A 1 72  ? 121.231 130.822 133.940 1.00 0.00 ? 61  A A "O5'"  1  
ATOM 2305   C "C5'"  . A A 1 72  ? 121.886 130.445 135.142 1.00 0.00 ? 61  A A "C5'"  1  
ATOM 2306   C "C4'"  . A A 1 72  ? 120.987 130.616 136.341 1.00 0.00 ? 61  A A "C4'"  1  
ATOM 2307   O "O4'"  . A A 1 72  ? 120.611 132.012 136.481 1.00 0.00 ? 61  A A "O4'"  1  
ATOM 2308   C "C3'"  . A A 1 72  ? 119.659 129.877 136.288 1.00 0.00 ? 61  A A "C3'"  1  
ATOM 2309   O "O3'"  . A A 1 72  ? 119.774 128.502 136.613 1.00 0.00 ? 61  A A "O3'"  1  
ATOM 2310   C "C2'"  . A A 1 72  ? 118.801 130.666 137.268 1.00 0.00 ? 61  A A "C2'"  1  
ATOM 2311   O "O2'"  . A A 1 72  ? 119.111 130.327 138.613 1.00 0.00 ? 61  A A "O2'"  1  
ATOM 2312   C "C1'"  . A A 1 72  ? 119.267 132.097 137.000 1.00 0.00 ? 61  A A "C1'"  1  
ATOM 2313   N N9     . A A 1 72  ? 118.376 132.804 136.058 1.00 0.00 ? 61  A A N9     1  
ATOM 2314   C C8     . A A 1 72  ? 118.600 133.082 134.732 1.00 0.00 ? 61  A A C8     1  
ATOM 2315   N N7     . A A 1 72  ? 117.616 133.728 134.155 1.00 0.00 ? 61  A A N7     1  
ATOM 2316   C C5     . A A 1 72  ? 116.683 133.887 135.170 1.00 0.00 ? 61  A A C5     1  
ATOM 2317   C C6     . A A 1 72  ? 115.416 134.495 135.203 1.00 0.00 ? 61  A A C6     1  
ATOM 2318   N N6     . A A 1 72  ? 114.845 135.078 134.146 1.00 0.00 ? 61  A A N6     1  
ATOM 2319   N N1     . A A 1 72  ? 114.742 134.483 136.374 1.00 0.00 ? 61  A A N1     1  
ATOM 2320   C C2     . A A 1 72  ? 115.312 133.896 137.434 1.00 0.00 ? 61  A A C2     1  
ATOM 2321   N N3     . A A 1 72  ? 116.494 133.293 137.528 1.00 0.00 ? 61  A A N3     1  
ATOM 2322   C C4     . A A 1 72  ? 117.138 133.323 136.348 1.00 0.00 ? 61  A A C4     1  
ATOM 2323   H "H5'"  . A A 1 72  ? 122.684 131.002 135.259 1.00 0.00 ? 61  A A "H5'"  1  
ATOM 2324   H "H5''" . A A 1 72  ? 122.159 129.507 135.079 1.00 0.00 ? 61  A A "H5''" 1  
ATOM 2325   H "H4'"  . A A 1 72  ? 121.474 130.336 137.146 1.00 0.00 ? 61  A A "H4'"  1  
ATOM 2326   H "H3'"  . A A 1 72  ? 119.277 129.964 135.389 1.00 0.00 ? 61  A A "H3'"  1  
ATOM 2327   H "H2'"  . A A 1 72  ? 117.846 130.558 137.079 1.00 0.00 ? 61  A A "H2'"  1  
ATOM 2328   H "HO2'" . A A 1 72  ? 119.699 131.012 138.989 1.00 0.00 ? 61  A A "HO2'" 1  
ATOM 2329   H "H1'"  . A A 1 72  ? 119.309 132.592 137.845 1.00 0.00 ? 61  A A "H1'"  1  
ATOM 2330   H H8     . A A 1 72  ? 119.418 132.820 134.260 1.00 0.00 ? 61  A A H8     1  
ATOM 2331   H H61    . A A 1 72  ? 113.959 135.488 134.230 1.00 0.00 ? 61  A A H61    1  
ATOM 2332   H H62    . A A 1 72  ? 115.315 135.101 133.286 1.00 0.00 ? 61  A A H62    1  
ATOM 2333   H H2     . A A 1 72  ? 114.783 133.915 138.261 1.00 0.00 ? 61  A A H2     1  
ATOM 2334   P P      . A A 1 73  ? 118.648 127.802 137.513 1.00 0.00 ? 62  A A P      1  
ATOM 2335   O OP1    . A A 1 73  ? 118.981 126.365 137.675 1.00 0.00 ? 62  A A OP1    1  
ATOM 2336   O OP2    . A A 1 73  ? 117.393 128.192 136.824 1.00 0.00 ? 62  A A OP2    1  
ATOM 2337   O "O5'"  . A A 1 73  ? 118.645 128.474 138.958 1.00 0.00 ? 62  A A "O5'"  1  
ATOM 2338   C "C5'"  . A A 1 73  ? 118.858 127.694 140.125 1.00 0.00 ? 62  A A "C5'"  1  
ATOM 2339   C "C4'"  . A A 1 73  ? 117.911 128.085 141.233 1.00 0.00 ? 62  A A "C4'"  1  
ATOM 2340   O "O4'"  . A A 1 73  ? 117.565 129.476 141.103 1.00 0.00 ? 62  A A "O4'"  1  
ATOM 2341   C "C3'"  . A A 1 73  ? 116.565 127.377 141.241 1.00 0.00 ? 62  A A "C3'"  1  
ATOM 2342   O "O3'"  . A A 1 73  ? 116.621 126.085 141.821 1.00 0.00 ? 62  A A "O3'"  1  
ATOM 2343   C "C2'"  . A A 1 73  ? 115.680 128.363 141.989 1.00 0.00 ? 62  A A "C2'"  1  
ATOM 2344   O "O2'"  . A A 1 73  ? 115.881 128.274 143.392 1.00 0.00 ? 62  A A "O2'"  1  
ATOM 2345   C "C1'"  . A A 1 73  ? 116.229 129.706 141.493 1.00 0.00 ? 62  A A "C1'"  1  
ATOM 2346   N N9     . A A 1 73  ? 115.503 130.200 140.307 1.00 0.00 ? 62  A A N9     1  
ATOM 2347   C C8     . A A 1 73  ? 115.942 130.248 139.007 1.00 0.00 ? 62  A A C8     1  
ATOM 2348   N N7     . A A 1 73  ? 115.064 130.742 138.171 1.00 0.00 ? 62  A A N7     1  
ATOM 2349   C C5     . A A 1 73  ? 113.971 131.040 138.973 1.00 0.00 ? 62  A A C5     1  
ATOM 2350   C C6     . A A 1 73  ? 112.710 131.594 138.688 1.00 0.00 ? 62  A A C6     1  
ATOM 2351   N N6     . A A 1 73  ? 112.321 131.959 137.464 1.00 0.00 ? 62  A A N6     1  
ATOM 2352   N N1     . A A 1 73  ? 111.850 131.760 139.716 1.00 0.00 ? 62  A A N1     1  
ATOM 2353   C C2     . A A 1 73  ? 112.239 131.393 140.944 1.00 0.00 ? 62  A A C2     1  
ATOM 2354   N N3     . A A 1 73  ? 113.396 130.863 141.336 1.00 0.00 ? 62  A A N3     1  
ATOM 2355   C C4     . A A 1 73  ? 114.227 130.711 140.290 1.00 0.00 ? 62  A A C4     1  
ATOM 2356   H "H5'"  . A A 1 73  ? 119.779 127.822 140.433 1.00 0.00 ? 62  A A "H5'"  1  
ATOM 2357   H "H5''" . A A 1 73  ? 118.722 126.748 139.908 1.00 0.00 ? 62  A A "H5''" 1  
ATOM 2358   H "H4'"  . A A 1 73  ? 118.350 127.942 142.098 1.00 0.00 ? 62  A A "H4'"  1  
ATOM 2359   H "H3'"  . A A 1 73  ? 116.241 127.301 140.319 1.00 0.00 ? 62  A A "H3'"  1  
ATOM 2360   H "H2'"  . A A 1 73  ? 114.736 128.252 141.749 1.00 0.00 ? 62  A A "H2'"  1  
ATOM 2361   H "HO2'" . A A 1 73  ? 115.283 128.907 143.840 1.00 0.00 ? 62  A A "HO2'" 1  
ATOM 2362   H "H1'"  . A A 1 73  ? 116.168 130.369 142.213 1.00 0.00 ? 62  A A "H1'"  1  
ATOM 2363   H H8     . A A 1 73  ? 116.831 129.940 138.731 1.00 0.00 ? 62  A A H8     1  
ATOM 2364   H H61    . A A 1 73  ? 111.428 132.339 137.327 1.00 0.00 ? 62  A A H61    1  
ATOM 2365   H H62    . A A 1 73  ? 112.928 131.848 136.703 1.00 0.00 ? 62  A A H62    1  
ATOM 2366   H H2     . A A 1 73  ? 111.578 131.534 141.654 1.00 0.00 ? 62  A A H2     1  
ATOM 2367   P P      . G A 1 74  ? 116.053 124.814 141.018 1.00 0.00 ? 63  G A P      1  
ATOM 2368   O OP1    . G A 1 74  ? 116.134 123.631 141.912 1.00 0.00 ? 63  G A OP1    1  
ATOM 2369   O OP2    . G A 1 74  ? 116.715 124.777 139.689 1.00 0.00 ? 63  G A OP2    1  
ATOM 2370   O "O5'"  . G A 1 74  ? 114.513 125.156 140.792 1.00 0.00 ? 63  G A "O5'"  1  
ATOM 2371   C "C5'"  . G A 1 74  ? 113.691 125.570 141.875 1.00 0.00 ? 63  G A "C5'"  1  
ATOM 2372   C "C4'"  . G A 1 74  ? 112.370 126.111 141.392 1.00 0.00 ? 63  G A "C4'"  1  
ATOM 2373   O "O4'"  . G A 1 74  ? 112.545 127.459 140.882 1.00 0.00 ? 63  G A "O4'"  1  
ATOM 2374   C "C3'"  . G A 1 74  ? 111.724 125.363 140.236 1.00 0.00 ? 63  G A "C3'"  1  
ATOM 2375   O "O3'"  . G A 1 74  ? 111.036 124.193 140.648 1.00 0.00 ? 63  G A "O3'"  1  
ATOM 2376   C "C2'"  . G A 1 74  ? 110.818 126.419 139.619 1.00 0.00 ? 63  G A "C2'"  1  
ATOM 2377   O "O2'"  . G A 1 74  ? 109.631 126.587 140.380 1.00 0.00 ? 63  G A "O2'"  1  
ATOM 2378   C "C1'"  . G A 1 74  ? 111.678 127.676 139.760 1.00 0.00 ? 63  G A "C1'"  1  
ATOM 2379   N N9     . G A 1 74  ? 112.458 127.955 138.537 1.00 0.00 ? 63  G A N9     1  
ATOM 2380   C C8     . G A 1 74  ? 113.812 127.807 138.365 1.00 0.00 ? 63  G A C8     1  
ATOM 2381   N N7     . G A 1 74  ? 114.216 128.136 137.166 1.00 0.00 ? 63  G A N7     1  
ATOM 2382   C C5     . G A 1 74  ? 113.056 128.523 136.508 1.00 0.00 ? 63  G A C5     1  
ATOM 2383   C C6     . G A 1 74  ? 112.864 128.981 135.180 1.00 0.00 ? 63  G A C6     1  
ATOM 2384   O O6     . G A 1 74  ? 113.707 129.143 134.291 1.00 0.00 ? 63  G A O6     1  
ATOM 2385   N N1     . G A 1 74  ? 111.526 129.265 134.924 1.00 0.00 ? 63  G A N1     1  
ATOM 2386   C C2     . G A 1 74  ? 110.503 129.125 135.830 1.00 0.00 ? 63  G A C2     1  
ATOM 2387   N N2     . G A 1 74  ? 109.276 129.450 135.399 1.00 0.00 ? 63  G A N2     1  
ATOM 2388   N N3     . G A 1 74  ? 110.670 128.699 137.073 1.00 0.00 ? 63  G A N3     1  
ATOM 2389   C C4     . G A 1 74  ? 111.961 128.417 137.340 1.00 0.00 ? 63  G A C4     1  
ATOM 2390   H "H5'"  . G A 1 74  ? 114.158 126.267 142.381 1.00 0.00 ? 63  G A "H5'"  1  
ATOM 2391   H "H5''" . G A 1 74  ? 113.528 124.804 142.463 1.00 0.00 ? 63  G A "H5''" 1  
ATOM 2392   H "H4'"  . G A 1 74  ? 111.743 126.135 142.144 1.00 0.00 ? 63  G A "H4'"  1  
ATOM 2393   H "H3'"  . G A 1 74  ? 112.417 125.116 139.586 1.00 0.00 ? 63  G A "H3'"  1  
ATOM 2394   H "H2'"  . G A 1 74  ? 110.623 126.221 138.678 1.00 0.00 ? 63  G A "H2'"  1  
ATOM 2395   H "HO2'" . G A 1 74  ? 109.493 125.792 140.935 1.00 0.00 ? 63  G A "HO2'" 1  
ATOM 2396   H "H1'"  . G A 1 74  ? 111.103 128.443 139.960 1.00 0.00 ? 63  G A "H1'"  1  
ATOM 2397   H H8     . G A 1 74  ? 114.415 127.490 139.067 1.00 0.00 ? 63  G A H8     1  
ATOM 2398   H H1     . G A 1 74  ? 111.297 129.589 134.028 1.00 0.00 ? 63  G A H1     1  
ATOM 2399   H H21    . G A 1 74  ? 109.143 129.765 134.480 1.00 0.00 ? 63  G A H21    1  
ATOM 2400   H H22    . G A 1 74  ? 108.507 129.370 136.001 1.00 0.00 ? 63  G A H22    1  
ATOM 2401   P P      . G A 1 75  ? 110.783 122.995 139.606 1.00 0.00 ? 64  G A P      1  
ATOM 2402   O OP1    . G A 1 75  ? 110.184 121.858 140.350 1.00 0.00 ? 64  G A OP1    1  
ATOM 2403   O OP2    . G A 1 75  ? 112.032 122.789 138.830 1.00 0.00 ? 64  G A OP2    1  
ATOM 2404   O "O5'"  . G A 1 75  ? 109.676 123.573 138.616 1.00 0.00 ? 64  G A "O5'"  1  
ATOM 2405   C "C5'"  . G A 1 75  ? 108.333 123.742 139.040 1.00 0.00 ? 64  G A "C5'"  1  
ATOM 2406   C "C4'"  . G A 1 75  ? 107.452 124.221 137.915 1.00 0.00 ? 64  G A "C4'"  1  
ATOM 2407   O "O4'"  . G A 1 75  ? 107.900 125.525 137.461 1.00 0.00 ? 64  G A "O4'"  1  
ATOM 2408   C "C3'"  . G A 1 75  ? 107.453 123.369 136.655 1.00 0.00 ? 64  G A "C3'"  1  
ATOM 2409   O "O3'"  . G A 1 75  ? 106.647 122.209 136.770 1.00 0.00 ? 64  G A "O3'"  1  
ATOM 2410   C "C2'"  . G A 1 75  ? 106.972 124.346 135.592 1.00 0.00 ? 64  G A "C2'"  1  
ATOM 2411   O "O2'"  . G A 1 75  ? 105.563 124.524 135.658 1.00 0.00 ? 64  G A "O2'"  1  
ATOM 2412   C "C1'"  . G A 1 75  ? 107.657 125.640 136.033 1.00 0.00 ? 64  G A "C1'"  1  
ATOM 2413   N N9     . G A 1 75  ? 108.907 125.887 135.293 1.00 0.00 ? 64  G A N9     1  
ATOM 2414   C C8     . G A 1 75  ? 110.192 125.737 135.758 1.00 0.00 ? 64  G A C8     1  
ATOM 2415   N N7     . G A 1 75  ? 111.099 126.032 134.865 1.00 0.00 ? 64  G A N7     1  
ATOM 2416   C C5     . G A 1 75  ? 110.370 126.399 133.745 1.00 0.00 ? 64  G A C5     1  
ATOM 2417   C C6     . G A 1 75  ? 110.807 126.822 132.461 1.00 0.00 ? 64  G A C6     1  
ATOM 2418   O O6     . G A 1 75  ? 111.963 126.961 132.048 1.00 0.00 ? 64  G A O6     1  
ATOM 2419   N N1     . G A 1 75  ? 109.734 127.099 131.620 1.00 0.00 ? 64  G A N1     1  
ATOM 2420   C C2     . G A 1 75  ? 108.410 126.982 131.967 1.00 0.00 ? 64  G A C2     1  
ATOM 2421   N N2     . G A 1 75  ? 107.516 127.292 131.016 1.00 0.00 ? 64  G A N2     1  
ATOM 2422   N N3     . G A 1 75  ? 107.990 126.589 133.158 1.00 0.00 ? 64  G A N3     1  
ATOM 2423   C C4     . G A 1 75  ? 109.016 126.316 133.991 1.00 0.00 ? 64  G A C4     1  
ATOM 2424   H "H5'"  . G A 1 75  ? 108.308 124.396 139.768 1.00 0.00 ? 64  G A "H5'"  1  
ATOM 2425   H "H5''" . G A 1 75  ? 107.993 122.883 139.370 1.00 0.00 ? 64  G A "H5''" 1  
ATOM 2426   H "H4'"  . G A 1 75  ? 106.532 124.298 138.245 1.00 0.00 ? 64  G A "H4'"  1  
ATOM 2427   H "H3'"  . G A 1 75  ? 108.375 123.102 136.451 1.00 0.00 ? 64  G A "H3'"  1  
ATOM 2428   H "H2'"  . G A 1 75  ? 107.262 124.076 134.696 1.00 0.00 ? 64  G A "H2'"  1  
ATOM 2429   H "HO2'" . G A 1 75  ? 105.288 125.146 134.952 1.00 0.00 ? 64  G A "HO2'" 1  
ATOM 2430   H "H1'"  . G A 1 75  ? 107.045 126.395 135.901 1.00 0.00 ? 64  G A "H1'"  1  
ATOM 2431   H H8     . G A 1 75  ? 110.407 125.438 136.665 1.00 0.00 ? 64  G A H8     1  
ATOM 2432   H H1     . G A 1 75  ? 109.941 127.399 130.711 1.00 0.00 ? 64  G A H1     1  
ATOM 2433   H H21    . G A 1 75  ? 107.818 127.585 130.131 1.00 0.00 ? 64  G A H21    1  
ATOM 2434   H H22    . G A 1 75  ? 106.557 127.228 131.206 1.00 0.00 ? 64  G A H22    1  
ATOM 2435   P P      . G A 1 76  ? 107.027 120.879 135.948 1.00 0.00 ? 65  G A P      1  
ATOM 2436   O OP1    . G A 1 76  ? 106.042 119.823 136.302 1.00 0.00 ? 65  G A OP1    1  
ATOM 2437   O OP2    . G A 1 76  ? 108.478 120.623 136.132 1.00 0.00 ? 65  G A OP2    1  
ATOM 2438   O "O5'"  . G A 1 76  ? 106.787 121.285 134.425 1.00 0.00 ? 65  G A "O5'"  1  
ATOM 2439   C "C5'"  . G A 1 76  ? 105.485 121.582 133.946 1.00 0.00 ? 65  G A "C5'"  1  
ATOM 2440   C "C4'"  . G A 1 76  ? 105.519 122.093 132.527 1.00 0.00 ? 65  G A "C4'"  1  
ATOM 2441   O "O4'"  . G A 1 76  ? 106.267 123.335 132.470 1.00 0.00 ? 65  G A "O4'"  1  
ATOM 2442   C "C3'"  . G A 1 76  ? 106.214 121.196 131.512 1.00 0.00 ? 65  G A "C3'"  1  
ATOM 2443   O "O3'"  . G A 1 76  ? 105.399 120.125 131.070 1.00 0.00 ? 65  G A "O3'"  1  
ATOM 2444   C "C2'"  . G A 1 76  ? 106.590 122.175 130.407 1.00 0.00 ? 65  G A "C2'"  1  
ATOM 2445   O "O2'"  . G A 1 76  ? 105.467 122.490 129.595 1.00 0.00 ? 65  G A "O2'"  1  
ATOM 2446   C "C1'"  . G A 1 76  ? 106.979 123.413 131.217 1.00 0.00 ? 65  G A "C1'"  1  
ATOM 2447   N N9     . G A 1 76  ? 108.435 123.500 131.433 1.00 0.00 ? 65  G A N9     1  
ATOM 2448   C C8     . G A 1 76  ? 109.120 123.238 132.595 1.00 0.00 ? 65  G A C8     1  
ATOM 2449   N N7     . G A 1 76  ? 110.410 123.404 132.480 1.00 0.00 ? 65  G A N7     1  
ATOM 2450   C C5     . G A 1 76  ? 110.587 123.799 131.162 1.00 0.00 ? 65  G A C5     1  
ATOM 2451   C C6     . G A 1 76  ? 111.773 124.123 130.452 1.00 0.00 ? 65  G A C6     1  
ATOM 2452   O O6     . G A 1 76  ? 112.940 124.124 130.859 1.00 0.00 ? 65  G A O6     1  
ATOM 2453   N N1     . G A 1 76  ? 111.501 124.470 129.131 1.00 0.00 ? 65  G A N1     1  
ATOM 2454   C C2     . G A 1 76  ? 110.248 124.503 128.566 1.00 0.00 ? 65  G A C2     1  
ATOM 2455   N N2     . G A 1 76  ? 110.187 124.864 127.276 1.00 0.00 ? 65  G A N2     1  
ATOM 2456   N N3     . G A 1 76  ? 109.136 124.203 129.218 1.00 0.00 ? 65  G A N3     1  
ATOM 2457   C C4     . G A 1 76  ? 109.379 123.863 130.502 1.00 0.00 ? 65  G A C4     1  
ATOM 2458   H "H5'"  . G A 1 76  ? 105.079 122.263 134.522 1.00 0.00 ? 65  G A "H5'"  1  
ATOM 2459   H "H5''" . G A 1 76  ? 104.939 120.769 133.980 1.00 0.00 ? 65  G A "H5''" 1  
ATOM 2460   H "H4'"  . G A 1 76  ? 104.601 122.260 132.228 1.00 0.00 ? 65  G A "H4'"  1  
ATOM 2461   H "H3'"  . G A 1 76  ? 107.033 120.834 131.911 1.00 0.00 ? 65  G A "H3'"  1  
ATOM 2462   H "H2'"  . G A 1 76  ? 107.342 121.845 129.874 1.00 0.00 ? 65  G A "H2'"  1  
ATOM 2463   H "HO2'" . G A 1 76  ? 104.788 121.791 129.706 1.00 0.00 ? 65  G A "HO2'" 1  
ATOM 2464   H "H1'"  . G A 1 76  ? 106.668 124.218 130.750 1.00 0.00 ? 65  G A "H1'"  1  
ATOM 2465   H H8     . G A 1 76  ? 108.686 122.958 133.427 1.00 0.00 ? 65  G A H8     1  
ATOM 2466   H H1     . G A 1 76  ? 112.262 124.709 128.563 1.00 0.00 ? 65  G A H1     1  
ATOM 2467   H H21    . G A 1 76  ? 111.005 125.087 126.787 1.00 0.00 ? 65  G A H21    1  
ATOM 2468   H H22    . G A 1 76  ? 109.319 124.905 126.821 1.00 0.00 ? 65  G A H22    1  
ATOM 2469   P P      . G A 1 77  ? 106.061 118.853 130.345 1.00 0.00 ? 66  G A P      1  
ATOM 2470   O OP1    . G A 1 77  ? 104.982 117.873 130.057 1.00 0.00 ? 66  G A OP1    1  
ATOM 2471   O OP2    . G A 1 77  ? 107.241 118.431 131.144 1.00 0.00 ? 66  G A OP2    1  
ATOM 2472   O "O5'"  . G A 1 77  ? 106.587 119.429 128.956 1.00 0.00 ? 66  G A "O5'"  1  
ATOM 2473   C "C5'"  . G A 1 77  ? 107.170 118.573 127.985 1.00 0.00 ? 66  G A "C5'"  1  
ATOM 2474   C "C4'"  . G A 1 77  ? 108.183 119.303 127.138 1.00 0.00 ? 66  G A "C4'"  1  
ATOM 2475   O "O4'"  . G A 1 77  ? 108.856 120.284 127.981 1.00 0.00 ? 66  G A "O4'"  1  
ATOM 2476   C "C3'"  . G A 1 77  ? 109.285 118.448 126.531 1.00 0.00 ? 66  G A "C3'"  1  
ATOM 2477   O "O3'"  . G A 1 77  ? 109.888 119.048 125.397 1.00 0.00 ? 66  G A "O3'"  1  
ATOM 2478   C "C2'"  . G A 1 77  ? 110.333 118.463 127.630 1.00 0.00 ? 66  G A "C2'"  1  
ATOM 2479   O "O2'"  . G A 1 77  ? 111.636 118.261 127.102 1.00 0.00 ? 66  G A "O2'"  1  
ATOM 2480   C "C1'"  . G A 1 77  ? 110.211 119.901 128.129 1.00 0.00 ? 66  G A "C1'"  1  
ATOM 2481   N N9     . G A 1 77  ? 110.514 120.018 129.567 1.00 0.00 ? 66  G A N9     1  
ATOM 2482   C C8     . G A 1 77  ? 109.686 119.707 130.619 1.00 0.00 ? 66  G A C8     1  
ATOM 2483   N N7     . G A 1 77  ? 110.236 119.917 131.785 1.00 0.00 ? 66  G A N7     1  
ATOM 2484   C C5     . G A 1 77  ? 111.503 120.395 131.485 1.00 0.00 ? 66  G A C5     1  
ATOM 2485   C C6     . G A 1 77  ? 112.562 120.795 132.342 1.00 0.00 ? 66  G A C6     1  
ATOM 2486   O O6     . G A 1 77  ? 112.589 120.808 133.578 1.00 0.00 ? 66  G A O6     1  
ATOM 2487   N N1     . G A 1 77  ? 113.675 121.215 131.620 1.00 0.00 ? 66  G A N1     1  
ATOM 2488   C C2     . G A 1 77  ? 113.761 121.245 130.250 1.00 0.00 ? 66  G A C2     1  
ATOM 2489   N N2     . G A 1 77  ? 114.920 121.682 129.735 1.00 0.00 ? 66  G A N2     1  
ATOM 2490   N N3     . G A 1 77  ? 112.782 120.875 129.440 1.00 0.00 ? 66  G A N3     1  
ATOM 2491   C C4     . G A 1 77  ? 111.692 120.463 130.121 1.00 0.00 ? 66  G A C4     1  
ATOM 2492   H "H5'"  . G A 1 77  ? 106.464 118.219 127.405 1.00 0.00 ? 66  G A "H5'"  1  
ATOM 2493   H "H5''" . G A 1 77  ? 107.612 117.826 128.442 1.00 0.00 ? 66  G A "H5''" 1  
ATOM 2494   H "H4'"  . G A 1 77  ? 107.715 119.760 126.408 1.00 0.00 ? 66  G A "H4'"  1  
ATOM 2495   H "H3'"  . G A 1 77  ? 108.954 117.535 126.410 1.00 0.00 ? 66  G A "H3'"  1  
ATOM 2496   H "H2'"  . G A 1 77  ? 110.123 117.816 128.335 1.00 0.00 ? 66  G A "H2'"  1  
ATOM 2497   H "HO2'" . G A 1 77  ? 112.291 118.348 127.826 1.00 0.00 ? 66  G A "HO2'" 1  
ATOM 2498   H "H1'"  . G A 1 77  ? 110.820 120.476 127.619 1.00 0.00 ? 66  G A "H1'"  1  
ATOM 2499   H H8     . G A 1 77  ? 108.776 119.363 130.507 1.00 0.00 ? 66  G A H8     1  
ATOM 2500   H H1     . G A 1 77  ? 114.457 121.511 132.131 1.00 0.00 ? 66  G A H1     1  
ATOM 2501   H H21    . G A 1 77  ? 115.649 121.958 130.328 1.00 0.00 ? 66  G A H21    1  
ATOM 2502   H H22    . G A 1 77  ? 115.038 121.725 128.763 1.00 0.00 ? 66  G A H22    1  
ATOM 2503   P P      . A A 1 78  ? 109.169 118.965 123.962 1.00 0.00 ? 67  A A P      1  
ATOM 2504   O OP1    . A A 1 78  ? 109.039 120.346 123.432 1.00 0.00 ? 67  A A OP1    1  
ATOM 2505   O OP2    . A A 1 78  ? 107.960 118.116 124.102 1.00 0.00 ? 67  A A OP2    1  
ATOM 2506   O "O5'"  . A A 1 78  ? 110.217 118.184 123.051 1.00 0.00 ? 67  A A "O5'"  1  
ATOM 2507   C "C5'"  . A A 1 78  ? 109.799 117.510 121.873 1.00 0.00 ? 67  A A "C5'"  1  
ATOM 2508   C "C4'"  . A A 1 78  ? 110.956 117.258 120.938 1.00 0.00 ? 67  A A "C4'"  1  
ATOM 2509   O "O4'"  . A A 1 78  ? 111.941 116.413 121.592 1.00 0.00 ? 67  A A "O4'"  1  
ATOM 2510   C "C3'"  . A A 1 78  ? 110.630 116.492 119.665 1.00 0.00 ? 67  A A "C3'"  1  
ATOM 2511   O "O3'"  . A A 1 78  ? 110.102 117.316 118.641 1.00 0.00 ? 67  A A "O3'"  1  
ATOM 2512   C "C2'"  . A A 1 78  ? 111.997 115.947 119.269 1.00 0.00 ? 67  A A "C2'"  1  
ATOM 2513   O "O2'"  . A A 1 78  ? 112.789 116.947 118.646 1.00 0.00 ? 67  A A "O2'"  1  
ATOM 2514   C "C1'"  . A A 1 78  ? 112.601 115.614 120.636 1.00 0.00 ? 67  A A "C1'"  1  
ATOM 2515   N N9     . A A 1 78  ? 112.418 114.194 120.994 1.00 0.00 ? 67  A A N9     1  
ATOM 2516   C C8     . A A 1 78  ? 111.758 113.676 122.081 1.00 0.00 ? 67  A A C8     1  
ATOM 2517   N N7     . A A 1 78  ? 111.765 112.367 122.128 1.00 0.00 ? 67  A A N7     1  
ATOM 2518   C C5     . A A 1 78  ? 112.478 111.996 120.996 1.00 0.00 ? 67  A A C5     1  
ATOM 2519   C C6     . A A 1 78  ? 112.839 110.742 120.473 1.00 0.00 ? 67  A A C6     1  
ATOM 2520   N N6     . A A 1 78  ? 112.516 109.580 121.045 1.00 0.00 ? 67  A A N6     1  
ATOM 2521   N N1     . A A 1 78  ? 113.552 110.721 119.326 1.00 0.00 ? 67  A A N1     1  
ATOM 2522   C C2     . A A 1 78  ? 113.876 111.887 118.751 1.00 0.00 ? 67  A A C2     1  
ATOM 2523   N N3     . A A 1 78  ? 113.596 113.126 119.146 1.00 0.00 ? 67  A A N3     1  
ATOM 2524   C C4     . A A 1 78  ? 112.886 113.112 120.289 1.00 0.00 ? 67  A A C4     1  
ATOM 2525   H "H5'"  . A A 1 78  ? 109.129 118.057 121.412 1.00 0.00 ? 67  A A "H5'"  1  
ATOM 2526   H "H5''" . A A 1 78  ? 109.396 116.652 122.121 1.00 0.00 ? 67  A A "H5''" 1  
ATOM 2527   H "H4'"  . A A 1 78  ? 111.372 118.116 120.711 1.00 0.00 ? 67  A A "H4'"  1  
ATOM 2528   H "H3'"  . A A 1 78  ? 110.033 115.745 119.883 1.00 0.00 ? 67  A A "H3'"  1  
ATOM 2529   H "H2'"  . A A 1 78  ? 111.916 115.146 118.709 1.00 0.00 ? 67  A A "H2'"  1  
ATOM 2530   H "HO2'" . A A 1 78  ? 113.645 116.554 118.378 1.00 0.00 ? 67  A A "HO2'" 1  
ATOM 2531   H "H1'"  . A A 1 78  ? 113.558 115.828 120.630 1.00 0.00 ? 67  A A "H1'"  1  
ATOM 2532   H H8     . A A 1 78  ? 111.321 114.234 122.758 1.00 0.00 ? 67  A A H8     1  
ATOM 2533   H H61    . A A 1 78  ? 112.796 108.736 120.632 1.00 0.00 ? 67  A A H61    1  
ATOM 2534   H H62    . A A 1 78  ? 111.999 109.570 121.877 1.00 0.00 ? 67  A A H62    1  
ATOM 2535   H H2     . A A 1 78  ? 114.393 111.817 117.921 1.00 0.00 ? 67  A A H2     1  
ATOM 2536   P P      . C A 1 79  ? 109.346 116.659 117.384 1.00 0.00 ? 68  C A P      1  
ATOM 2537   O OP1    . C A 1 79  ? 108.497 117.705 116.760 1.00 0.00 ? 68  C A OP1    1  
ATOM 2538   O OP2    . C A 1 79  ? 108.730 115.385 117.831 1.00 0.00 ? 68  C A OP2    1  
ATOM 2539   O "O5'"  . C A 1 79  ? 110.521 116.309 116.367 1.00 0.00 ? 68  C A "O5'"  1  
ATOM 2540   C "C5'"  . C A 1 79  ? 110.484 116.765 115.023 1.00 0.00 ? 68  C A "C5'"  1  
ATOM 2541   C "C4'"  . C A 1 79  ? 111.727 116.368 114.265 1.00 0.00 ? 68  C A "C4'"  1  
ATOM 2542   O "O4'"  . C A 1 79  ? 112.516 115.485 115.098 1.00 0.00 ? 68  C A "O4'"  1  
ATOM 2543   C "C3'"  . C A 1 79  ? 111.508 115.563 112.993 1.00 0.00 ? 68  C A "C3'"  1  
ATOM 2544   O "O3'"  . C A 1 79  ? 111.246 116.376 111.863 1.00 0.00 ? 68  C A "O3'"  1  
ATOM 2545   C "C2'"  . C A 1 79  ? 112.843 114.847 112.848 1.00 0.00 ? 68  C A "C2'"  1  
ATOM 2546   O "O2'"  . C A 1 79  ? 113.841 115.718 112.339 1.00 0.00 ? 68  C A "O2'"  1  
ATOM 2547   C "C1'"  . C A 1 79  ? 113.160 114.516 114.307 1.00 0.00 ? 68  C A "C1'"  1  
ATOM 2548   N N1     . C A 1 79  ? 112.650 113.181 114.705 1.00 0.00 ? 68  C A N1     1  
ATOM 2549   C C2     . C A 1 79  ? 113.367 112.047 114.301 1.00 0.00 ? 68  C A C2     1  
ATOM 2550   O O2     . C A 1 79  ? 114.398 112.191 113.625 1.00 0.00 ? 68  C A O2     1  
ATOM 2551   N N3     . C A 1 79  ? 112.924 110.818 114.651 1.00 0.00 ? 68  C A N3     1  
ATOM 2552   C C4     . C A 1 79  ? 111.813 110.690 115.377 1.00 0.00 ? 68  C A C4     1  
ATOM 2553   N N4     . C A 1 79  ? 111.414 109.458 115.700 1.00 0.00 ? 68  C A N4     1  
ATOM 2554   C C5     . C A 1 79  ? 111.062 111.822 115.803 1.00 0.00 ? 68  C A C5     1  
ATOM 2555   C C6     . C A 1 79  ? 111.511 113.033 115.452 1.00 0.00 ? 68  C A C6     1  
ATOM 2556   H "H5'"  . C A 1 79  ? 110.406 117.742 115.020 1.00 0.00 ? 68  C A "H5'"  1  
ATOM 2557   H "H5''" . C A 1 79  ? 109.701 116.380 114.577 1.00 0.00 ? 68  C A "H5''" 1  
ATOM 2558   H "H4'"  . C A 1 79  ? 112.244 117.175 114.063 1.00 0.00 ? 68  C A "H4'"  1  
ATOM 2559   H "H3'"  . C A 1 79  ? 110.799 114.904 113.146 1.00 0.00 ? 68  C A "H3'"  1  
ATOM 2560   H "H2'"  . C A 1 79  ? 112.757 114.037 112.303 1.00 0.00 ? 68  C A "H2'"  1  
ATOM 2561   H "HO2'" . C A 1 79  ? 114.691 115.234 112.284 1.00 0.00 ? 68  C A "HO2'" 1  
ATOM 2562   H "H1'"  . C A 1 79  ? 114.130 114.548 114.440 1.00 0.00 ? 68  C A "H1'"  1  
ATOM 2563   H H41    . C A 1 79  ? 111.933 108.681 115.404 1.00 0.00 ? 68  C A H41    1  
ATOM 2564   H H42    . C A 1 79  ? 110.601 109.330 116.232 1.00 0.00 ? 68  C A H42    1  
ATOM 2565   H H5     . C A 1 79  ? 110.247 111.718 116.337 1.00 0.00 ? 68  C A H5     1  
ATOM 2566   H H6     . C A 1 79  ? 111.008 113.824 115.735 1.00 0.00 ? 68  C A H6     1  
ATOM 2567   P P      . A A 1 80  ? 111.605 115.838 110.397 1.00 0.00 ? 69  A A P      1  
ATOM 2568   O OP1    . A A 1 80  ? 111.113 114.444 110.259 1.00 0.00 ? 69  A A OP1    1  
ATOM 2569   O OP2    . A A 1 80  ? 113.059 116.117 110.295 1.00 0.00 ? 69  A A OP2    1  
ATOM 2570   O "O5'"  . A A 1 80  ? 110.854 116.735 109.315 1.00 0.00 ? 69  A A "O5'"  1  
ATOM 2571   C "C5'"  . A A 1 80  ? 111.505 117.129 108.116 1.00 0.00 ? 69  A A "C5'"  1  
ATOM 2572   C "C4'"  . A A 1 80  ? 110.713 116.727 106.898 1.00 0.00 ? 69  A A "C4'"  1  
ATOM 2573   O "O4'"  . A A 1 80  ? 109.365 116.367 107.296 1.00 0.00 ? 69  A A "O4'"  1  
ATOM 2574   C "C3'"  . A A 1 80  ? 110.518 117.806 105.843 1.00 0.00 ? 69  A A "C3'"  1  
ATOM 2575   O "O3'"  . A A 1 80  ? 111.643 117.962 104.995 1.00 0.00 ? 69  A A "O3'"  1  
ATOM 2576   C "C2'"  . A A 1 80  ? 109.269 117.340 105.110 1.00 0.00 ? 69  A A "C2'"  1  
ATOM 2577   O "O2'"  . A A 1 80  ? 109.577 116.333 104.157 1.00 0.00 ? 69  A A "O2'"  1  
ATOM 2578   C "C1'"  . A A 1 80  ? 108.467 116.717 106.252 1.00 0.00 ? 69  A A "C1'"  1  
ATOM 2579   N N9     . A A 1 80  ? 107.444 117.640 106.780 1.00 0.00 ? 69  A A N9     1  
ATOM 2580   C C8     . A A 1 80  ? 107.379 118.202 108.031 1.00 0.00 ? 69  A A C8     1  
ATOM 2581   N N7     . A A 1 80  ? 106.344 118.986 108.205 1.00 0.00 ? 69  A A N7     1  
ATOM 2582   C C5     . A A 1 80  ? 105.680 118.937 106.987 1.00 0.00 ? 69  A A C5     1  
ATOM 2583   C C6     . A A 1 80  ? 104.504 119.553 106.523 1.00 0.00 ? 69  A A C6     1  
ATOM 2584   N N6     . A A 1 80  ? 103.757 120.374 107.264 1.00 0.00 ? 69  A A N6     1  
ATOM 2585   N N1     . A A 1 80  ? 104.117 119.294 105.256 1.00 0.00 ? 69  A A N1     1  
ATOM 2586   C C2     . A A 1 80  ? 104.866 118.471 104.511 1.00 0.00 ? 69  A A C2     1  
ATOM 2587   N N3     . A A 1 80  ? 105.990 117.833 104.834 1.00 0.00 ? 69  A A N3     1  
ATOM 2588   C C4     . A A 1 80  ? 106.347 118.112 106.100 1.00 0.00 ? 69  A A C4     1  
ATOM 2589   H "H5'"  . A A 1 80  ? 112.388 116.705 108.078 1.00 0.00 ? 69  A A "H5'"  1  
ATOM 2590   H "H5''" . A A 1 80  ? 111.618 118.102 108.118 1.00 0.00 ? 69  A A "H5''" 1  
ATOM 2591   H "H4'"  . A A 1 80  ? 111.138 115.949 106.480 1.00 0.00 ? 69  A A "H4'"  1  
ATOM 2592   H "H3'"  . A A 1 80  ? 110.331 118.659 106.289 1.00 0.00 ? 69  A A "H3'"  1  
ATOM 2593   H "H2'"  . A A 1 80  ? 108.790 118.092 104.703 1.00 0.00 ? 69  A A "H2'"  1  
ATOM 2594   H "HO2'" . A A 1 80  ? 110.520 116.412 103.904 1.00 0.00 ? 69  A A "HO2'" 1  
ATOM 2595   H "H1'"  . A A 1 80  ? 108.035 115.896 105.937 1.00 0.00 ? 69  A A "H1'"  1  
ATOM 2596   H H8     . A A 1 80  ? 108.046 118.033 108.730 1.00 0.00 ? 69  A A H8     1  
ATOM 2597   H H61    . A A 1 80  ? 102.946 120.774 106.886 1.00 0.00 ? 69  A A H61    1  
ATOM 2598   H H62    . A A 1 80  ? 104.018 120.576 108.187 1.00 0.00 ? 69  A A H62    1  
ATOM 2599   H H2     . A A 1 80  ? 104.542 118.316 103.599 1.00 0.00 ? 69  A A H2     1  
ATOM 2600   P P      . A A 1 81  ? 112.151 119.432 104.590 1.00 0.00 ? 70  A A P      1  
ATOM 2601   O OP1    . A A 1 81  ? 112.476 119.424 103.141 1.00 0.00 ? 70  A A OP1    1  
ATOM 2602   O OP2    . A A 1 81  ? 113.183 119.849 105.572 1.00 0.00 ? 70  A A OP2    1  
ATOM 2603   O "O5'"  . A A 1 81  ? 110.869 120.355 104.802 1.00 0.00 ? 70  A A "O5'"  1  
ATOM 2604   C "C5'"  . A A 1 81  ? 110.488 121.310 103.823 1.00 0.00 ? 70  A A "C5'"  1  
ATOM 2605   C "C4'"  . A A 1 81  ? 110.618 122.719 104.343 1.00 0.00 ? 70  A A "C4'"  1  
ATOM 2606   O "O4'"  . A A 1 81  ? 110.186 123.641 103.314 1.00 0.00 ? 70  A A "O4'"  1  
ATOM 2607   C "C3'"  . A A 1 81  ? 109.764 123.066 105.553 1.00 0.00 ? 70  A A "C3'"  1  
ATOM 2608   O "O3'"  . A A 1 81  ? 110.325 122.616 106.775 1.00 0.00 ? 70  A A "O3'"  1  
ATOM 2609   C "C2'"  . A A 1 81  ? 109.626 124.579 105.428 1.00 0.00 ? 70  A A "C2'"  1  
ATOM 2610   O "O2'"  . A A 1 81  ? 110.797 125.242 105.880 1.00 0.00 ? 70  A A "O2'"  1  
ATOM 2611   C "C1'"  . A A 1 81  ? 109.513 124.737 103.910 1.00 0.00 ? 70  A A "C1'"  1  
ATOM 2612   N N9     . A A 1 81  ? 108.110 124.754 103.455 1.00 0.00 ? 70  A A N9     1  
ATOM 2613   C C8     . A A 1 81  ? 107.488 123.875 102.602 1.00 0.00 ? 70  A A C8     1  
ATOM 2614   N N7     . A A 1 81  ? 106.226 124.152 102.386 1.00 0.00 ? 70  A A N7     1  
ATOM 2615   C C5     . A A 1 81  ? 105.999 125.290 103.148 1.00 0.00 ? 70  A A C5     1  
ATOM 2616   C C6     . A A 1 81  ? 104.855 126.083 103.350 1.00 0.00 ? 70  A A C6     1  
ATOM 2617   N N6     . A A 1 81  ? 103.675 125.838 102.778 1.00 0.00 ? 70  A A N6     1  
ATOM 2618   N N1     . A A 1 81  ? 104.967 127.149 104.172 1.00 0.00 ? 70  A A N1     1  
ATOM 2619   C C2     . A A 1 81  ? 106.151 127.395 104.747 1.00 0.00 ? 70  A A C2     1  
ATOM 2620   N N3     . A A 1 81  ? 107.295 126.725 104.635 1.00 0.00 ? 70  A A N3     1  
ATOM 2621   C C4     . A A 1 81  ? 107.151 125.671 103.812 1.00 0.00 ? 70  A A C4     1  
ATOM 2622   H "H5'"  . A A 1 81  ? 109.555 121.149 103.565 1.00 0.00 ? 70  A A "H5'"  1  
ATOM 2623   H "H5''" . A A 1 81  ? 111.059 121.206 103.034 1.00 0.00 ? 70  A A "H5''" 1  
ATOM 2624   H "H4'"  . A A 1 81  ? 111.557 122.903 104.555 1.00 0.00 ? 70  A A "H4'"  1  
ATOM 2625   H "H3'"  . A A 1 81  ? 108.877 122.664 105.440 1.00 0.00 ? 70  A A "H3'"  1  
ATOM 2626   H "H2'"  . A A 1 81  ? 108.823 124.905 105.886 1.00 0.00 ? 70  A A "H2'"  1  
ATOM 2627   H "HO2'" . A A 1 81  ? 110.612 126.202 105.953 1.00 0.00 ? 70  A A "HO2'" 1  
ATOM 2628   H "H1'"  . A A 1 81  ? 109.955 125.568 103.635 1.00 0.00 ? 70  A A "H1'"  1  
ATOM 2629   H H8     . A A 1 81  ? 107.946 123.111 102.193 1.00 0.00 ? 70  A A H8     1  
ATOM 2630   H H61    . A A 1 81  ? 102.912 126.427 102.956 1.00 0.00 ? 70  A A H61    1  
ATOM 2631   H H62    . A A 1 81  ? 103.570 125.070 102.178 1.00 0.00 ? 70  A A H62    1  
ATOM 2632   H H2     . A A 1 81  ? 106.178 128.180 105.333 1.00 0.00 ? 70  A A H2     1  
ATOM 2633   P P      . C A 1 82  ? 109.370 122.217 108.003 1.00 0.00 ? 71  C A P      1  
ATOM 2634   O OP1    . C A 1 82  ? 110.180 122.257 109.247 1.00 0.00 ? 71  C A OP1    1  
ATOM 2635   O OP2    . C A 1 82  ? 108.646 120.973 107.639 1.00 0.00 ? 71  C A OP2    1  
ATOM 2636   O "O5'"  . C A 1 82  ? 108.309 123.404 108.070 1.00 0.00 ? 71  C A "O5'"  1  
ATOM 2637   C "C5'"  . C A 1 82  ? 108.538 124.542 108.886 1.00 0.00 ? 71  C A "C5'"  1  
ATOM 2638   C "C4'"  . C A 1 82  ? 107.302 125.400 109.006 1.00 0.00 ? 71  C A "C4'"  1  
ATOM 2639   O "O4'"  . C A 1 82  ? 106.871 125.817 107.685 1.00 0.00 ? 71  C A "O4'"  1  
ATOM 2640   C "C3'"  . C A 1 82  ? 106.081 124.733 109.620 1.00 0.00 ? 71  C A "C3'"  1  
ATOM 2641   O "O3'"  . C A 1 82  ? 106.061 124.813 111.035 1.00 0.00 ? 71  C A "O3'"  1  
ATOM 2642   C "C2'"  . C A 1 82  ? 104.933 125.507 108.990 1.00 0.00 ? 71  C A "C2'"  1  
ATOM 2643   O "O2'"  . C A 1 82  ? 104.741 126.758 109.634 1.00 0.00 ? 71  C A "O2'"  1  
ATOM 2644   C "C1'"  . C A 1 82  ? 105.462 125.755 107.577 1.00 0.00 ? 71  C A "C1'"  1  
ATOM 2645   N N1     . C A 1 82  ? 105.098 124.663 106.640 1.00 0.00 ? 71  C A N1     1  
ATOM 2646   C C2     . C A 1 82  ? 103.803 124.647 106.107 1.00 0.00 ? 71  C A C2     1  
ATOM 2647   O O2     . C A 1 82  ? 103.003 125.538 106.432 1.00 0.00 ? 71  C A O2     1  
ATOM 2648   N N3     . C A 1 82  ? 103.447 123.663 105.250 1.00 0.00 ? 71  C A N3     1  
ATOM 2649   C C4     . C A 1 82  ? 104.324 122.717 104.917 1.00 0.00 ? 71  C A C4     1  
ATOM 2650   N N4     . C A 1 82  ? 103.928 121.765 104.068 1.00 0.00 ? 71  C A N4     1  
ATOM 2651   C C5     . C A 1 82  ? 105.648 122.704 105.441 1.00 0.00 ? 71  C A C5     1  
ATOM 2652   C C6     . C A 1 82  ? 105.989 123.683 106.287 1.00 0.00 ? 71  C A C6     1  
ATOM 2653   H "H5'"  . C A 1 82  ? 109.261 125.076 108.494 1.00 0.00 ? 71  C A "H5'"  1  
ATOM 2654   H "H5''" . C A 1 82  ? 108.809 124.245 109.780 1.00 0.00 ? 71  C A "H5''" 1  
ATOM 2655   H "H4'"  . C A 1 82  ? 107.523 126.199 109.528 1.00 0.00 ? 71  C A "H4'"  1  
ATOM 2656   H "H3'"  . C A 1 82  ? 106.037 123.792 109.351 1.00 0.00 ? 71  C A "H3'"  1  
ATOM 2657   H "H2'"  . C A 1 82  ? 104.109 124.977 108.974 1.00 0.00 ? 71  C A "H2'"  1  
ATOM 2658   H "HO2'" . C A 1 82  ? 104.938 127.478 109.000 1.00 0.00 ? 71  C A "HO2'" 1  
ATOM 2659   H "H1'"  . C A 1 82  ? 105.103 126.603 107.243 1.00 0.00 ? 71  C A "H1'"  1  
ATOM 2660   H H41    . C A 1 82  ? 103.016 121.777 103.710 1.00 0.00 ? 71  C A H41    1  
ATOM 2661   H H42    . C A 1 82  ? 104.550 121.056 103.804 1.00 0.00 ? 71  C A H42    1  
ATOM 2662   H H5     . C A 1 82  ? 106.286 122.004 105.190 1.00 0.00 ? 71  C A H5     1  
ATOM 2663   H H6     . C A 1 82  ? 106.896 123.692 106.659 1.00 0.00 ? 71  C A H6     1  
ATOM 2664   P P      . A A 1 83  ? 105.093 123.852 111.885 1.00 0.00 ? 72  A A P      1  
ATOM 2665   O OP1    . A A 1 83  ? 105.761 123.549 113.175 1.00 0.00 ? 72  A A OP1    1  
ATOM 2666   O OP2    . A A 1 83  ? 104.660 122.739 111.003 1.00 0.00 ? 72  A A OP2    1  
ATOM 2667   O "O5'"  . A A 1 83  ? 103.820 124.760 112.191 1.00 0.00 ? 72  A A "O5'"  1  
ATOM 2668   C "C5'"  . A A 1 83  ? 102.513 124.206 112.195 1.00 0.00 ? 72  A A "C5'"  1  
ATOM 2669   C "C4'"  . A A 1 83  ? 101.473 125.240 112.550 1.00 0.00 ? 72  A A "C4'"  1  
ATOM 2670   O "O4'"  . A A 1 83  ? 101.622 126.352 111.644 1.00 0.00 ? 72  A A "O4'"  1  
ATOM 2671   C "C3'"  . A A 1 83  ? 100.023 124.815 112.377 1.00 0.00 ? 72  A A "C3'"  1  
ATOM 2672   O "O3'"  . A A 1 83  ? 99.513  124.113 113.497 1.00 0.00 ? 72  A A "O3'"  1  
ATOM 2673   C "C2'"  . A A 1 83  ? 99.298  126.131 112.151 1.00 0.00 ? 72  A A "C2'"  1  
ATOM 2674   O "O2'"  . A A 1 83  ? 99.052  126.801 113.379 1.00 0.00 ? 72  A A "O2'"  1  
ATOM 2675   C "C1'"  . A A 1 83  ? 100.347 126.908 111.355 1.00 0.00 ? 72  A A "C1'"  1  
ATOM 2676   N N9     . A A 1 83  ? 100.109 126.834 109.901 1.00 0.00 ? 72  A A N9     1  
ATOM 2677   C C8     . A A 1 83  ? 100.891 126.228 108.948 1.00 0.00 ? 72  A A C8     1  
ATOM 2678   N N7     . A A 1 83  ? 100.415 126.330 107.732 1.00 0.00 ? 72  A A N7     1  
ATOM 2679   C C5     . A A 1 83  ? 99.240  127.052 107.893 1.00 0.00 ? 72  A A C5     1  
ATOM 2680   C C6     . A A 1 83  ? 98.268  127.495 106.979 1.00 0.00 ? 72  A A C6     1  
ATOM 2681   N N6     . A A 1 83  ? 98.327  127.265 105.665 1.00 0.00 ? 72  A A N6     1  
ATOM 2682   N N1     . A A 1 83  ? 97.218  128.191 107.466 1.00 0.00 ? 72  A A N1     1  
ATOM 2683   C C2     . A A 1 83  ? 97.158  128.422 108.784 1.00 0.00 ? 72  A A C2     1  
ATOM 2684   N N3     . A A 1 83  ? 98.009  128.058 109.742 1.00 0.00 ? 72  A A N3     1  
ATOM 2685   C C4     . A A 1 83  ? 99.040  127.368 109.224 1.00 0.00 ? 72  A A C4     1  
ATOM 2686   H "H5'"  . A A 1 83  ? 102.476 123.478 112.850 1.00 0.00 ? 72  A A "H5'"  1  
ATOM 2687   H "H5''" . A A 1 83  ? 102.314 123.845 111.306 1.00 0.00 ? 72  A A "H5''" 1  
ATOM 2688   H "H4'"  . A A 1 83  ? 101.603 125.557 113.469 1.00 0.00 ? 72  A A "H4'"  1  
ATOM 2689   H "H3'"  . A A 1 83  ? 99.945  124.249 111.580 1.00 0.00 ? 72  A A "H3'"  1  
ATOM 2690   H "H2'"  . A A 1 83  ? 98.474  126.003 111.636 1.00 0.00 ? 72  A A "H2'"  1  
ATOM 2691   H "HO2'" . A A 1 83  ? 98.314  127.433 113.255 1.00 0.00 ? 72  A A "HO2'" 1  
ATOM 2692   H "H1'"  . A A 1 83  ? 100.342 127.847 111.639 1.00 0.00 ? 72  A A "H1'"  1  
ATOM 2693   H H8     . A A 1 83  ? 101.728 125.762 109.158 1.00 0.00 ? 72  A A H8     1  
ATOM 2694   H H61    . A A 1 83  ? 97.618  127.599 105.077 1.00 0.00 ? 72  A A H61    1  
ATOM 2695   H H62    . A A 1 83  ? 99.080  126.762 105.289 1.00 0.00 ? 72  A A H62    1  
ATOM 2696   H H2     . A A 1 83  ? 96.377  128.931 109.087 1.00 0.00 ? 72  A A H2     1  
ATOM 2697   P P      . G A 1 84  ? 98.522  122.866 113.285 1.00 0.00 ? 73  G A P      1  
ATOM 2698   O OP1    . G A 1 84  ? 99.284  121.779 112.619 1.00 0.00 ? 73  G A OP1    1  
ATOM 2699   O OP2    . G A 1 84  ? 97.271  123.372 112.664 1.00 0.00 ? 73  G A OP2    1  
ATOM 2700   O "O5'"  . G A 1 84  ? 98.178  122.390 114.767 1.00 0.00 ? 73  G A "O5'"  1  
ATOM 2701   C "C5'"  . G A 1 84  ? 99.195  121.904 115.630 1.00 0.00 ? 73  G A "C5'"  1  
ATOM 2702   C "C4'"  . G A 1 84  ? 98.647  121.559 116.993 1.00 0.00 ? 73  G A "C4'"  1  
ATOM 2703   O "O4'"  . G A 1 84  ? 97.816  122.646 117.487 1.00 0.00 ? 73  G A "O4'"  1  
ATOM 2704   C "C3'"  . G A 1 84  ? 97.719  120.354 117.053 1.00 0.00 ? 73  G A "C3'"  1  
ATOM 2705   O "O3'"  . G A 1 84  ? 98.414  119.119 117.024 1.00 0.00 ? 73  G A "O3'"  1  
ATOM 2706   C "C2'"  . G A 1 84  ? 96.961  120.612 118.342 1.00 0.00 ? 73  G A "C2'"  1  
ATOM 2707   O "O2'"  . G A 1 84  ? 97.761  120.319 119.479 1.00 0.00 ? 73  G A "O2'"  1  
ATOM 2708   C "C1'"  . G A 1 84  ? 96.750  122.121 118.248 1.00 0.00 ? 73  G A "C1'"  1  
ATOM 2709   N N9     . G A 1 84  ? 95.477  122.464 117.587 1.00 0.00 ? 73  G A N9     1  
ATOM 2710   C C8     . G A 1 84  ? 95.284  122.772 116.262 1.00 0.00 ? 73  G A C8     1  
ATOM 2711   N N7     . G A 1 84  ? 94.038  123.034 115.971 1.00 0.00 ? 73  G A N7     1  
ATOM 2712   C C5     . G A 1 84  ? 93.367  122.891 117.177 1.00 0.00 ? 73  G A C5     1  
ATOM 2713   C C6     . G A 1 84  ? 91.991  123.047 117.488 1.00 0.00 ? 73  G A C6     1  
ATOM 2714   O O6     . G A 1 84  ? 91.062  123.355 116.734 1.00 0.00 ? 73  G A O6     1  
ATOM 2715   N N1     . G A 1 84  ? 91.740  122.807 118.835 1.00 0.00 ? 73  G A N1     1  
ATOM 2716   C C2     . G A 1 84  ? 92.690  122.460 119.765 1.00 0.00 ? 73  G A C2     1  
ATOM 2717   N N2     . G A 1 84  ? 92.253  122.269 121.019 1.00 0.00 ? 73  G A N2     1  
ATOM 2718   N N3     . G A 1 84  ? 93.975  122.311 119.488 1.00 0.00 ? 73  G A N3     1  
ATOM 2719   C C4     . G A 1 84  ? 94.240  122.539 118.185 1.00 0.00 ? 73  G A C4     1  
ATOM 2720   H "H5'"  . G A 1 84  ? 99.887  122.590 115.728 1.00 0.00 ? 73  G A "H5'"  1  
ATOM 2721   H "H5''" . G A 1 84  ? 99.595  121.101 115.233 1.00 0.00 ? 73  G A "H5''" 1  
ATOM 2722   H "H4'"  . G A 1 84  ? 99.394  121.416 117.611 1.00 0.00 ? 73  G A "H4'"  1  
ATOM 2723   H "H3'"  . G A 1 84  ? 97.089  120.386 116.304 1.00 0.00 ? 73  G A "H3'"  1  
ATOM 2724   H "H2'"  . G A 1 84  ? 96.110  120.125 118.362 1.00 0.00 ? 73  G A "H2'"  1  
ATOM 2725   H "HO2'" . G A 1 84  ? 97.311  119.636 120.018 1.00 0.00 ? 73  G A "HO2'" 1  
ATOM 2726   H "H1'"  . G A 1 84  ? 96.766  122.510 119.147 1.00 0.00 ? 73  G A "H1'"  1  
ATOM 2727   H H8     . G A 1 84  ? 96.007  122.793 115.601 1.00 0.00 ? 73  G A H8     1  
ATOM 2728   H H1     . G A 1 84  ? 90.813  122.892 119.143 1.00 0.00 ? 73  G A H1     1  
ATOM 2729   H H21    . G A 1 84  ? 91.303  122.377 121.232 1.00 0.00 ? 73  G A H21    1  
ATOM 2730   H H22    . G A 1 84  ? 92.886  122.019 121.725 1.00 0.00 ? 73  G A H22    1  
ATOM 2731   P P      . C A 1 85  ? 97.634  117.764 116.653 1.00 0.00 ? 74  C A P      1  
ATOM 2732   O OP1    . C A 1 85  ? 98.645  116.695 116.446 1.00 0.00 ? 74  C A OP1    1  
ATOM 2733   O OP2    . C A 1 85  ? 96.661  118.072 115.576 1.00 0.00 ? 74  C A OP2    1  
ATOM 2734   O "O5'"  . C A 1 85  ? 96.815  117.416 117.974 1.00 0.00 ? 74  C A "O5'"  1  
ATOM 2735   C "C5'"  . C A 1 85  ? 97.425  116.714 119.047 1.00 0.00 ? 74  C A "C5'"  1  
ATOM 2736   C "C4'"  . C A 1 85  ? 96.673  116.911 120.341 1.00 0.00 ? 74  C A "C4'"  1  
ATOM 2737   O "O4'"  . C A 1 85  ? 96.095  118.243 120.379 1.00 0.00 ? 74  C A "O4'"  1  
ATOM 2738   C "C3'"  . C A 1 85  ? 95.486  115.989 120.577 1.00 0.00 ? 74  C A "C3'"  1  
ATOM 2739   O "O3'"  . C A 1 85  ? 95.867  114.711 121.060 1.00 0.00 ? 74  C A "O3'"  1  
ATOM 2740   C "C2'"  . C A 1 85  ? 94.635  116.785 121.556 1.00 0.00 ? 74  C A "C2'"  1  
ATOM 2741   O "O2'"  . C A 1 85  ? 95.155  116.703 122.874 1.00 0.00 ? 74  C A "O2'"  1  
ATOM 2742   C "C1'"  . C A 1 85  ? 94.824  118.210 121.034 1.00 0.00 ? 74  C A "C1'"  1  
ATOM 2743   N N1     . C A 1 85  ? 93.743  118.616 120.102 1.00 0.00 ? 74  C A N1     1  
ATOM 2744   C C2     . C A 1 85  ? 92.501  118.970 120.639 1.00 0.00 ? 74  C A C2     1  
ATOM 2745   O O2     . C A 1 85  ? 92.338  118.934 121.868 1.00 0.00 ? 74  C A O2     1  
ATOM 2746   N N3     . C A 1 85  ? 91.497  119.344 119.810 1.00 0.00 ? 74  C A N3     1  
ATOM 2747   C C4     . C A 1 85  ? 91.696  119.374 118.493 1.00 0.00 ? 74  C A C4     1  
ATOM 2748   N N4     . C A 1 85  ? 90.680  119.750 117.715 1.00 0.00 ? 74  C A N4     1  
ATOM 2749   C C5     . C A 1 85  ? 92.949  119.020 117.915 1.00 0.00 ? 74  C A C5     1  
ATOM 2750   C C6     . C A 1 85  ? 93.933  118.653 118.744 1.00 0.00 ? 74  C A C6     1  
ATOM 2751   H "H5'"  . C A 1 85  ? 98.343  117.038 119.159 1.00 0.00 ? 74  C A "H5'"  1  
ATOM 2752   H "H5''" . C A 1 85  ? 97.446  115.759 118.833 1.00 0.00 ? 74  C A "H5''" 1  
ATOM 2753   H "H4'"  . C A 1 85  ? 97.301  116.817 121.087 1.00 0.00 ? 74  C A "H4'"  1  
ATOM 2754   H "H3'"  . C A 1 85  ? 94.991  115.881 119.737 1.00 0.00 ? 74  C A "H3'"  1  
ATOM 2755   H "H2'"  . C A 1 85  ? 93.696  116.511 121.519 1.00 0.00 ? 74  C A "H2'"  1  
ATOM 2756   H "HO2'" . C A 1 85  ? 95.741  115.919 122.937 1.00 0.00 ? 74  C A "HO2'" 1  
ATOM 2757   H "H1'"  . C A 1 85  ? 94.849  118.834 121.791 1.00 0.00 ? 74  C A "H1'"  1  
ATOM 2758   H H41    . C A 1 85  ? 89.817  119.992 118.114 1.00 0.00 ? 74  C A H41    1  
ATOM 2759   H H42    . C A 1 85  ? 90.794  119.782 116.741 1.00 0.00 ? 74  C A H42    1  
ATOM 2760   H H5     . C A 1 85  ? 93.085  119.046 116.946 1.00 0.00 ? 74  C A H5     1  
ATOM 2761   H H6     . C A 1 85  ? 94.801  118.405 118.366 1.00 0.00 ? 74  C A H6     1  
ATOM 2762   P P      . C A 1 86  ? 94.932  113.434 120.785 1.00 0.00 ? 75  C A P      1  
ATOM 2763   O OP1    . C A 1 86  ? 95.616  112.237 121.339 1.00 0.00 ? 75  C A OP1    1  
ATOM 2764   O OP2    . C A 1 86  ? 94.528  113.455 119.357 1.00 0.00 ? 75  C A OP2    1  
ATOM 2765   O "O5'"  . C A 1 86  ? 93.634  113.707 121.669 1.00 0.00 ? 75  C A "O5'"  1  
ATOM 2766   C "C5'"  . C A 1 86  ? 93.667  113.563 123.080 1.00 0.00 ? 75  C A "C5'"  1  
ATOM 2767   C "C4'"  . C A 1 86  ? 92.329  113.878 123.705 1.00 0.00 ? 75  C A "C4'"  1  
ATOM 2768   O "O4'"  . C A 1 86  ? 91.943  115.241 123.386 1.00 0.00 ? 75  C A "O4'"  1  
ATOM 2769   C "C3'"  . C A 1 86  ? 91.153  113.042 123.228 1.00 0.00 ? 75  C A "C3'"  1  
ATOM 2770   O "O3'"  . C A 1 86  ? 91.098  111.763 123.838 1.00 0.00 ? 75  C A "O3'"  1  
ATOM 2771   C "C2'"  . C A 1 86  ? 89.959  113.927 123.556 1.00 0.00 ? 75  C A "C2'"  1  
ATOM 2772   O "O2'"  . C A 1 86  ? 89.642  113.871 124.939 1.00 0.00 ? 75  C A "O2'"  1  
ATOM 2773   C "C1'"  . C A 1 86  ? 90.511  115.316 123.229 1.00 0.00 ? 75  C A "C1'"  1  
ATOM 2774   N N1     . C A 1 86  ? 90.146  115.759 121.861 1.00 0.00 ? 75  C A N1     1  
ATOM 2775   C C2     . C A 1 86  ? 88.846  116.227 121.637 1.00 0.00 ? 75  C A C2     1  
ATOM 2776   O O2     . C A 1 86  ? 88.042  116.255 122.583 1.00 0.00 ? 75  C A O2     1  
ATOM 2777   N N3     . C A 1 86  ? 88.488  116.636 120.399 1.00 0.00 ? 75  C A N3     1  
ATOM 2778   C C4     . C A 1 86  ? 89.369  116.596 119.402 1.00 0.00 ? 75  C A C4     1  
ATOM 2779   N N4     . C A 1 86  ? 88.972  117.011 118.195 1.00 0.00 ? 75  C A N4     1  
ATOM 2780   C C5     . C A 1 86  ? 90.701  116.127 119.596 1.00 0.00 ? 75  C A C5     1  
ATOM 2781   C C6     . C A 1 86  ? 91.043  115.723 120.825 1.00 0.00 ? 75  C A C6     1  
ATOM 2782   H "H5'"  . C A 1 86  ? 94.344  114.172 123.448 1.00 0.00 ? 75  C A "H5'"  1  
ATOM 2783   H "H5''" . C A 1 86  ? 93.913  112.641 123.301 1.00 0.00 ? 75  C A "H5''" 1  
ATOM 2784   H "H4'"  . C A 1 86  ? 92.408  113.792 124.678 1.00 0.00 ? 75  C A "H4'"  1  
ATOM 2785   H "H3'"  . C A 1 86  ? 91.210  112.930 122.255 1.00 0.00 ? 75  C A "H3'"  1  
ATOM 2786   H "H2'"  . C A 1 86  ? 89.185  113.709 122.997 1.00 0.00 ? 75  C A "H2'"  1  
ATOM 2787   H "HO2'" . C A 1 86  ? 90.030  113.060 125.323 1.00 0.00 ? 75  C A "HO2'" 1  
ATOM 2788   H "H1'"  . C A 1 86  ? 90.170  115.964 123.881 1.00 0.00 ? 75  C A "H1'"  1  
ATOM 2789   H H41    . C A 1 86  ? 88.056  117.334 118.065 1.00 0.00 ? 75  C A H41    1  
ATOM 2790   H H42    . C A 1 86  ? 89.597  116.994 117.442 1.00 0.00 ? 75  C A H42    1  
ATOM 2791   H H5     . C A 1 86  ? 91.342  116.101 118.855 1.00 0.00 ? 75  C A H5     1  
ATOM 2792   H H6     . C A 1 86  ? 91.953  115.399 120.978 1.00 0.00 ? 75  C A H6     1  
ATOM 2793   P P      . G A 1 87  ? 90.366  110.541 123.092 1.00 0.00 ? 76  G A P      1  
ATOM 2794   O OP1    . G A 1 87  ? 90.592  109.312 123.894 1.00 0.00 ? 76  G A OP1    1  
ATOM 2795   O OP2    . G A 1 87  ? 90.767  110.570 121.662 1.00 0.00 ? 76  G A OP2    1  
ATOM 2796   O "O5'"  . G A 1 87  ? 88.818  110.908 123.178 1.00 0.00 ? 76  G A "O5'"  1  
ATOM 2797   C "C5'"  . G A 1 87  ? 88.143  110.934 124.424 1.00 0.00 ? 76  G A "C5'"  1  
ATOM 2798   C "C4'"  . G A 1 87  ? 86.731  111.446 124.282 1.00 0.00 ? 76  G A "C4'"  1  
ATOM 2799   O "O4'"  . G A 1 87  ? 86.751  112.797 123.753 1.00 0.00 ? 76  G A "O4'"  1  
ATOM 2800   C "C3'"  . G A 1 87  ? 85.839  110.681 123.313 1.00 0.00 ? 76  G A "C3'"  1  
ATOM 2801   O "O3'"  . G A 1 87  ? 85.319  109.487 123.867 1.00 0.00 ? 76  G A "O3'"  1  
ATOM 2802   C "C2'"  . G A 1 87  ? 84.773  111.709 122.963 1.00 0.00 ? 76  G A "C2'"  1  
ATOM 2803   O "O2'"  . G A 1 87  ? 83.810  111.826 124.000 1.00 0.00 ? 76  G A "O2'"  1  
ATOM 2804   C "C1'"  . G A 1 87  ? 85.596  112.997 122.904 1.00 0.00 ? 76  G A "C1'"  1  
ATOM 2805   N N9     . G A 1 87  ? 86.003  113.333 121.525 1.00 0.00 ? 76  G A N9     1  
ATOM 2806   C C8     . G A 1 87  ? 87.250  113.195 120.969 1.00 0.00 ? 76  G A C8     1  
ATOM 2807   N N7     . G A 1 87  ? 87.303  113.581 119.722 1.00 0.00 ? 76  G A N7     1  
ATOM 2808   C C5     . G A 1 87  ? 86.011  113.998 119.439 1.00 0.00 ? 76  G A C5     1  
ATOM 2809   C C6     . G A 1 87  ? 85.455  114.520 118.241 1.00 0.00 ? 76  G A C6     1  
ATOM 2810   O O6     . G A 1 87  ? 86.015  114.725 117.158 1.00 0.00 ? 76  G A O6     1  
ATOM 2811   N N1     . G A 1 87  ? 84.103  114.815 118.388 1.00 0.00 ? 76  G A N1     1  
ATOM 2812   C C2     . G A 1 87  ? 83.377  114.631 119.541 1.00 0.00 ? 76  G A C2     1  
ATOM 2813   N N2     . G A 1 87  ? 82.082  114.975 119.490 1.00 0.00 ? 76  G A N2     1  
ATOM 2814   N N3     . G A 1 87  ? 83.883  114.146 120.663 1.00 0.00 ? 76  G A N3     1  
ATOM 2815   C C4     . G A 1 87  ? 85.195  113.852 120.540 1.00 0.00 ? 76  G A C4     1  
ATOM 2816   H "H5'"  . G A 1 87  ? 88.632  111.517 125.042 1.00 0.00 ? 76  G A "H5'"  1  
ATOM 2817   H "H5''" . G A 1 87  ? 88.117  110.027 124.795 1.00 0.00 ? 76  G A "H5''" 1  
ATOM 2818   H "H4'"  . G A 1 87  ? 86.306  111.457 125.165 1.00 0.00 ? 76  G A "H4'"  1  
ATOM 2819   H "H3'"  . G A 1 87  ? 86.353  110.464 122.508 1.00 0.00 ? 76  G A "H3'"  1  
ATOM 2820   H "H2'"  . G A 1 87  ? 84.354  111.512 122.099 1.00 0.00 ? 76  G A "H2'"  1  
ATOM 2821   H "HO2'" . G A 1 87  ? 83.843  111.023 124.559 1.00 0.00 ? 76  G A "HO2'" 1  
ATOM 2822   H "H1'"  . G A 1 87  ? 85.076  113.734 123.280 1.00 0.00 ? 76  G A "H1'"  1  
ATOM 2823   H H8     . G A 1 87  ? 88.025  112.845 121.456 1.00 0.00 ? 76  G A H8     1  
ATOM 2824   H H1     . G A 1 87  ? 83.634  115.182 117.610 1.00 0.00 ? 76  G A H1     1  
ATOM 2825   H H21    . G A 1 87  ? 81.700  115.335 118.662 1.00 0.00 ? 76  G A H21    1  
ATOM 2826   H H22    . G A 1 87  ? 81.515  114.866 120.282 1.00 0.00 ? 76  G A H22    1  
ATOM 2827   P P      . U A 1 88  ? 85.543  108.096 123.106 1.00 0.00 ? 77  U A P      1  
ATOM 2828   O OP1    . U A 1 88  ? 85.537  106.992 124.100 1.00 0.00 ? 77  U A OP1    1  
ATOM 2829   O OP2    . U A 1 88  ? 86.767  108.357 122.307 1.00 0.00 ? 77  U A OP2    1  
ATOM 2830   O "O5'"  . U A 1 88  ? 84.336  107.856 122.094 1.00 0.00 ? 77  U A "O5'"  1  
ATOM 2831   C "C5'"  . U A 1 88  ? 84.071  108.773 121.045 1.00 0.00 ? 77  U A "C5'"  1  
ATOM 2832   C "C4'"  . U A 1 88  ? 82.641  109.254 121.073 1.00 0.00 ? 77  U A "C4'"  1  
ATOM 2833   O "O4'"  . U A 1 88  ? 82.603  110.673 120.817 1.00 0.00 ? 77  U A "O4'"  1  
ATOM 2834   C "C3'"  . U A 1 88  ? 81.715  108.669 120.017 1.00 0.00 ? 77  U A "C3'"  1  
ATOM 2835   O "O3'"  . U A 1 88  ? 81.188  107.406 120.382 1.00 0.00 ? 77  U A "O3'"  1  
ATOM 2836   C "C2'"  . U A 1 88  ? 80.627  109.741 119.925 1.00 0.00 ? 77  U A "C2'"  1  
ATOM 2837   O "O2'"  . U A 1 88  ? 79.702  109.628 120.997 1.00 0.00 ? 77  U A "O2'"  1  
ATOM 2838   C "C1'"  . U A 1 88  ? 81.436  111.011 120.105 1.00 0.00 ? 77  U A "C1'"  1  
ATOM 2839   N N1     . U A 1 88  ? 81.860  111.596 118.810 1.00 0.00 ? 77  U A N1     1  
ATOM 2840   C C2     . U A 1 88  ? 80.895  112.251 118.068 1.00 0.00 ? 77  U A C2     1  
ATOM 2841   O O2     . U A 1 88  ? 79.737  112.363 118.431 1.00 0.00 ? 77  U A O2     1  
ATOM 2842   N N3     . U A 1 88  ? 81.333  112.777 116.877 1.00 0.00 ? 77  U A N3     1  
ATOM 2843   C C4     . U A 1 88  ? 82.610  112.717 116.361 1.00 0.00 ? 77  U A C4     1  
ATOM 2844   O O4     . U A 1 88  ? 82.847  113.241 115.271 1.00 0.00 ? 77  U A O4     1  
ATOM 2845   C C5     . U A 1 88  ? 83.555  112.024 117.183 1.00 0.00 ? 77  U A C5     1  
ATOM 2846   C C6     . U A 1 88  ? 83.156  111.504 118.348 1.00 0.00 ? 77  U A C6     1  
ATOM 2847   H "H5'"  . U A 1 88  ? 84.242  108.334 120.185 1.00 0.00 ? 77  U A "H5'"  1  
ATOM 2848   H "H5''" . U A 1 88  ? 84.668  109.545 121.135 1.00 0.00 ? 77  U A "H5''" 1  
ATOM 2849   H "H4'"  . U A 1 88  ? 82.259  109.081 121.959 1.00 0.00 ? 77  U A "H4'"  1  
ATOM 2850   H "H3'"  . U A 1 88  ? 82.176  108.588 119.156 1.00 0.00 ? 77  U A "H3'"  1  
ATOM 2851   H "H2'"  . U A 1 88  ? 80.178  109.723 119.055 1.00 0.00 ? 77  U A "H2'"  1  
ATOM 2852   H "HO2'" . U A 1 88  ? 79.001  110.306 120.886 1.00 0.00 ? 77  U A "HO2'" 1  
ATOM 2853   H "H1'"  . U A 1 88  ? 80.900  111.668 120.598 1.00 0.00 ? 77  U A "H1'"  1  
ATOM 2854   H H3     . U A 1 88  ? 80.665  113.246 116.335 1.00 0.00 ? 77  U A H3     1  
ATOM 2855   H H5     . U A 1 88  ? 84.487  111.934 116.894 1.00 0.00 ? 77  U A H5     1  
ATOM 2856   H H6     . U A 1 88  ? 83.821  111.034 118.891 1.00 0.00 ? 77  U A H6     1  
ATOM 2857   P P      . U A 1 89  ? 81.573  106.094 119.537 1.00 0.00 ? 78  U A P      1  
ATOM 2858   O OP1    . U A 1 89  ? 81.831  104.989 120.496 1.00 0.00 ? 78  U A OP1    1  
ATOM 2859   O OP2    . U A 1 89  ? 82.618  106.471 118.553 1.00 0.00 ? 78  U A OP2    1  
ATOM 2860   O "O5'"  . U A 1 89  ? 80.240  105.748 118.734 1.00 0.00 ? 78  U A "O5'"  1  
ATOM 2861   C "C5'"  . U A 1 89  ? 80.275  105.493 117.338 1.00 0.00 ? 78  U A "C5'"  1  
ATOM 2862   C "C4'"  . U A 1 89  ? 79.534  106.552 116.560 1.00 0.00 ? 78  U A "C4'"  1  
ATOM 2863   O "O4'"  . U A 1 89  ? 80.028  107.868 116.921 1.00 0.00 ? 78  U A "O4'"  1  
ATOM 2864   C "C3'"  . U A 1 89  ? 79.686  106.502 115.047 1.00 0.00 ? 78  U A "C3'"  1  
ATOM 2865   O "O3'"  . U A 1 89  ? 78.845  105.539 114.437 1.00 0.00 ? 78  U A "O3'"  1  
ATOM 2866   C "C2'"  . U A 1 89  ? 79.374  107.934 114.635 1.00 0.00 ? 78  U A "C2'"  1  
ATOM 2867   O "O2'"  . U A 1 89  ? 77.976  108.180 114.639 1.00 0.00 ? 78  U A "O2'"  1  
ATOM 2868   C "C1'"  . U A 1 89  ? 80.022  108.725 115.775 1.00 0.00 ? 78  U A "C1'"  1  
ATOM 2869   N N1     . U A 1 89  ? 81.401  109.159 115.444 1.00 0.00 ? 78  U A N1     1  
ATOM 2870   C C2     . U A 1 89  ? 81.537  110.236 114.587 1.00 0.00 ? 78  U A C2     1  
ATOM 2871   O O2     . U A 1 89  ? 80.586  110.827 114.105 1.00 0.00 ? 78  U A O2     1  
ATOM 2872   N N3     . U A 1 89  ? 82.831  110.602 114.311 1.00 0.00 ? 78  U A N3     1  
ATOM 2873   C C4     . U A 1 89  ? 83.982  110.016 114.793 1.00 0.00 ? 78  U A C4     1  
ATOM 2874   O O4     . U A 1 89  ? 85.077  110.461 114.452 1.00 0.00 ? 78  U A O4     1  
ATOM 2875   C C5     . U A 1 89  ? 83.765  108.909 115.675 1.00 0.00 ? 78  U A C5     1  
ATOM 2876   C C6     . U A 1 89  ? 82.514  108.531 115.961 1.00 0.00 ? 78  U A C6     1  
ATOM 2877   H "H5'"  . U A 1 89  ? 79.865  104.621 117.161 1.00 0.00 ? 78  U A "H5'"  1  
ATOM 2878   H "H5''" . U A 1 89  ? 81.210  105.472 117.041 1.00 0.00 ? 78  U A "H5''" 1  
ATOM 2879   H "H4'"  . U A 1 89  ? 78.582  106.499 116.784 1.00 0.00 ? 78  U A "H4'"  1  
ATOM 2880   H "H3'"  . U A 1 89  ? 80.620  106.301 114.825 1.00 0.00 ? 78  U A "H3'"  1  
ATOM 2881   H "H2'"  . U A 1 89  ? 79.779  108.156 113.771 1.00 0.00 ? 78  U A "H2'"  1  
ATOM 2882   H "HO2'" . U A 1 89  ? 77.811  109.097 114.337 1.00 0.00 ? 78  U A "HO2'" 1  
ATOM 2883   H "H1'"  . U A 1 89  ? 79.475  109.514 115.974 1.00 0.00 ? 78  U A "H1'"  1  
ATOM 2884   H H3     . U A 1 89  ? 82.950  111.363 113.706 1.00 0.00 ? 78  U A H3     1  
ATOM 2885   H H5     . U A 1 89  ? 84.527  108.432 116.065 1.00 0.00 ? 78  U A H5     1  
ATOM 2886   H H6     . U A 1 89  ? 82.393  107.772 116.565 1.00 0.00 ? 78  U A H6     1  
ATOM 2887   P P      . C A 1 90  ? 79.286  104.833 113.065 1.00 0.00 ? 79  C A P      1  
ATOM 2888   O OP1    . C A 1 90  ? 78.284  103.784 112.744 1.00 0.00 ? 79  C A OP1    1  
ATOM 2889   O OP2    . C A 1 90  ? 80.720  104.466 113.174 1.00 0.00 ? 79  C A OP2    1  
ATOM 2890   O "O5'"  . C A 1 90  ? 79.152  105.987 111.975 1.00 0.00 ? 79  C A "O5'"  1  
ATOM 2891   C "C5'"  . C A 1 90  ? 77.879  106.406 111.506 1.00 0.00 ? 79  C A "C5'"  1  
ATOM 2892   C "C4'"  . C A 1 90  ? 77.997  107.513 110.488 1.00 0.00 ? 79  C A "C4'"  1  
ATOM 2893   O "O4'"  . C A 1 90  ? 78.668  108.657 111.077 1.00 0.00 ? 79  C A "O4'"  1  
ATOM 2894   C "C3'"  . C A 1 90  ? 78.818  107.201 109.248 1.00 0.00 ? 79  C A "C3'"  1  
ATOM 2895   O "O3'"  . C A 1 90  ? 78.107  106.443 108.285 1.00 0.00 ? 79  C A "O3'"  1  
ATOM 2896   C "C2'"  . C A 1 90  ? 79.222  108.585 108.758 1.00 0.00 ? 79  C A "C2'"  1  
ATOM 2897   O "O2'"  . C A 1 90  ? 78.149  109.223 108.079 1.00 0.00 ? 79  C A "O2'"  1  
ATOM 2898   C "C1'"  . C A 1 90  ? 79.476  109.313 110.078 1.00 0.00 ? 79  C A "C1'"  1  
ATOM 2899   N N1     . C A 1 90  ? 80.909  109.297 110.465 1.00 0.00 ? 79  C A N1     1  
ATOM 2900   C C2     . C A 1 90  ? 81.780  110.184 109.821 1.00 0.00 ? 79  C A C2     1  
ATOM 2901   O O2     . C A 1 90  ? 81.333  110.952 108.954 1.00 0.00 ? 79  C A O2     1  
ATOM 2902   N N3     . C A 1 90  ? 83.092  110.190 110.154 1.00 0.00 ? 79  C A N3     1  
ATOM 2903   C C4     . C A 1 90  ? 83.547  109.358 111.089 1.00 0.00 ? 79  C A C4     1  
ATOM 2904   N N4     . C A 1 90  ? 84.848  109.397 111.385 1.00 0.00 ? 79  C A N4     1  
ATOM 2905   C C5     . C A 1 90  ? 82.687  108.442 111.763 1.00 0.00 ? 79  C A C5     1  
ATOM 2906   C C6     . C A 1 90  ? 81.391  108.446 111.424 1.00 0.00 ? 79  C A C6     1  
ATOM 2907   H "H5'"  . C A 1 90  ? 77.347  106.722 112.264 1.00 0.00 ? 79  C A "H5'"  1  
ATOM 2908   H "H5''" . C A 1 90  ? 77.425  105.641 111.095 1.00 0.00 ? 79  C A "H5''" 1  
ATOM 2909   H "H4'"  . C A 1 90  ? 77.096  107.784 110.211 1.00 0.00 ? 79  C A "H4'"  1  
ATOM 2910   H "H3'"  . C A 1 90  ? 79.624  106.708 109.513 1.00 0.00 ? 79  C A "H3'"  1  
ATOM 2911   H "H2'"  . C A 1 90  ? 80.033  108.551 108.207 1.00 0.00 ? 79  C A "H2'"  1  
ATOM 2912   H "HO2'" . C A 1 90  ? 77.506  108.543 107.793 1.00 0.00 ? 79  C A "HO2'" 1  
ATOM 2913   H "H1'"  . C A 1 90  ? 79.170  110.242 110.004 1.00 0.00 ? 79  C A "H1'"  1  
ATOM 2914   H H41    . C A 1 90  ? 85.436  110.028 110.920 1.00 0.00 ? 79  C A H41    1  
ATOM 2915   H H42    . C A 1 90  ? 85.214  108.798 112.069 1.00 0.00 ? 79  C A H42    1  
ATOM 2916   H H5     . C A 1 90  ? 83.031  107.833 112.448 1.00 0.00 ? 79  C A H5     1  
ATOM 2917   H H6     . C A 1 90  ? 80.784  107.825 111.876 1.00 0.00 ? 79  C A H6     1  
ATOM 2918   P P      . A A 1 91  ? 78.898  105.510 107.242 1.00 0.00 ? 80  A A P      1  
ATOM 2919   O OP1    . A A 1 91  ? 77.899  104.732 106.470 1.00 0.00 ? 80  A A OP1    1  
ATOM 2920   O OP2    . A A 1 91  ? 79.969  104.798 107.984 1.00 0.00 ? 80  A A OP2    1  
ATOM 2921   O "O5'"  . A A 1 91  ? 79.592  106.546 106.251 1.00 0.00 ? 80  A A "O5'"  1  
ATOM 2922   C "C5'"  . A A 1 91  ? 78.814  107.363 105.387 1.00 0.00 ? 80  A A "C5'"  1  
ATOM 2923   C "C4'"  . A A 1 91  ? 79.670  108.356 104.645 1.00 0.00 ? 80  A A "C4'"  1  
ATOM 2924   O "O4'"  . A A 1 91  ? 80.324  109.245 105.590 1.00 0.00 ? 80  A A "O4'"  1  
ATOM 2925   C "C3'"  . A A 1 91  ? 80.814  107.774 103.831 1.00 0.00 ? 80  A A "C3'"  1  
ATOM 2926   O "O3'"  . A A 1 91  ? 80.398  107.249 102.582 1.00 0.00 ? 80  A A "O3'"  1  
ATOM 2927   C "C2'"  . A A 1 91  ? 81.769  108.954 103.707 1.00 0.00 ? 80  A A "C2'"  1  
ATOM 2928   O "O2'"  . A A 1 91  ? 81.327  109.873 102.718 1.00 0.00 ? 80  A A "O2'"  1  
ATOM 2929   C "C1'"  . A A 1 91  ? 81.629  109.603 105.085 1.00 0.00 ? 80  A A "C1'"  1  
ATOM 2930   N N9     . A A 1 91  ? 82.695  109.177 106.011 1.00 0.00 ? 80  A A N9     1  
ATOM 2931   C C8     . A A 1 91  ? 82.607  108.273 107.040 1.00 0.00 ? 80  A A C8     1  
ATOM 2932   N N7     . A A 1 91  ? 83.730  108.099 107.690 1.00 0.00 ? 80  A A N7     1  
ATOM 2933   C C5     . A A 1 91  ? 84.622  108.944 107.046 1.00 0.00 ? 80  A A C5     1  
ATOM 2934   C C6     . A A 1 91  ? 85.984  109.225 107.257 1.00 0.00 ? 80  A A C6     1  
ATOM 2935   N N6     . A A 1 91  ? 86.716  108.655 108.218 1.00 0.00 ? 80  A A N6     1  
ATOM 2936   N N1     . A A 1 91  ? 86.575  110.120 106.438 1.00 0.00 ? 80  A A N1     1  
ATOM 2937   C C2     . A A 1 91  ? 85.841  110.690 105.473 1.00 0.00 ? 80  A A C2     1  
ATOM 2938   N N3     . A A 1 91  ? 84.556  110.510 105.177 1.00 0.00 ? 80  A A N3     1  
ATOM 2939   C C4     . A A 1 91  ? 83.998  109.614 106.009 1.00 0.00 ? 80  A A C4     1  
ATOM 2940   H "H5'"  . A A 1 91  ? 78.149  107.846 105.919 1.00 0.00 ? 80  A A "H5'"  1  
ATOM 2941   H "H5''" . A A 1 91  ? 78.350  106.792 104.739 1.00 0.00 ? 80  A A "H5''" 1  
ATOM 2942   H "H4'"  . A A 1 91  ? 79.098  108.886 104.052 1.00 0.00 ? 80  A A "H4'"  1  
ATOM 2943   H "H3'"  . A A 1 91  ? 81.251  107.063 104.348 1.00 0.00 ? 80  A A "H3'"  1  
ATOM 2944   H "H2'"  . A A 1 91  ? 82.689  108.657 103.542 1.00 0.00 ? 80  A A "H2'"  1  
ATOM 2945   H "HO2'" . A A 1 91  ? 80.702  109.417 102.115 1.00 0.00 ? 80  A A "HO2'" 1  
ATOM 2946   H "H1'"  . A A 1 91  ? 81.654  110.579 104.989 1.00 0.00 ? 80  A A "H1'"  1  
ATOM 2947   H H8     . A A 1 91  ? 81.778  107.799 107.268 1.00 0.00 ? 80  A A H8     1  
ATOM 2948   H H61    . A A 1 91  ? 87.662  108.891 108.316 1.00 0.00 ? 80  A A H61    1  
ATOM 2949   H H62    . A A 1 91  ? 86.308  108.004 108.824 1.00 0.00 ? 80  A A H62    1  
ATOM 2950   H H2     . A A 1 91  ? 86.318  111.332 104.906 1.00 0.00 ? 80  A A H2     1  
ATOM 2951   P P      . G A 1 92  ? 81.232  106.068 101.879 1.00 0.00 ? 81  G A P      1  
ATOM 2952   O OP1    . G A 1 92  ? 80.492  105.636 100.668 1.00 0.00 ? 81  G A OP1    1  
ATOM 2953   O OP2    . G A 1 92  ? 81.584  105.071 102.922 1.00 0.00 ? 81  G A OP2    1  
ATOM 2954   O "O5'"  . G A 1 92  ? 82.579  106.779 101.406 1.00 0.00 ? 81  G A "O5'"  1  
ATOM 2955   C "C5'"  . G A 1 92  ? 82.561  107.771 100.390 1.00 0.00 ? 81  G A "C5'"  1  
ATOM 2956   C "C4'"  . G A 1 92  ? 83.914  108.415 100.220 1.00 0.00 ? 81  G A "C4'"  1  
ATOM 2957   O "O4'"  . G A 1 92  ? 84.312  109.057 101.459 1.00 0.00 ? 81  G A "O4'"  1  
ATOM 2958   C "C3'"  . G A 1 92  ? 85.066  107.473 99.905  1.00 0.00 ? 81  G A "C3'"  1  
ATOM 2959   O "O3'"  . G A 1 92  ? 85.112  107.091 98.541  1.00 0.00 ? 81  G A "O3'"  1  
ATOM 2960   C "C2'"  . G A 1 92  ? 86.281  108.271 100.356 1.00 0.00 ? 81  G A "C2'"  1  
ATOM 2961   O "O2'"  . G A 1 92  ? 86.628  109.265 99.402  1.00 0.00 ? 81  G A "O2'"  1  
ATOM 2962   C "C1'"  . G A 1 92  ? 85.746  108.957 101.613 1.00 0.00 ? 81  G A "C1'"  1  
ATOM 2963   N N9     . G A 1 92  ? 86.104  108.221 102.842 1.00 0.00 ? 81  G A N9     1  
ATOM 2964   C C8     . G A 1 92  ? 85.281  107.441 103.615 1.00 0.00 ? 81  G A C8     1  
ATOM 2965   N N7     . G A 1 92  ? 85.885  106.919 104.646 1.00 0.00 ? 81  G A N7     1  
ATOM 2966   C C5     . G A 1 92  ? 87.190  107.380 104.548 1.00 0.00 ? 81  G A C5     1  
ATOM 2967   C C6     . G A 1 92  ? 88.314  107.147 105.384 1.00 0.00 ? 81  G A C6     1  
ATOM 2968   O O6     . G A 1 92  ? 88.381  106.461 106.411 1.00 0.00 ? 81  G A O6     1  
ATOM 2969   N N1     . G A 1 92  ? 89.446  107.811 104.918 1.00 0.00 ? 81  G A N1     1  
ATOM 2970   C C2     . G A 1 92  ? 89.491  108.597 103.794 1.00 0.00 ? 81  G A C2     1  
ATOM 2971   N N2     . G A 1 92  ? 90.676  109.154 103.504 1.00 0.00 ? 81  G A N2     1  
ATOM 2972   N N3     . G A 1 92  ? 88.451  108.823 103.007 1.00 0.00 ? 81  G A N3     1  
ATOM 2973   C C4     . G A 1 92  ? 87.343  108.188 103.440 1.00 0.00 ? 81  G A C4     1  
ATOM 2974   H "H5'"  . G A 1 92  ? 81.907  108.459 100.626 1.00 0.00 ? 81  G A "H5'"  1  
ATOM 2975   H "H5''" . G A 1 92  ? 82.295  107.354 99.541  1.00 0.00 ? 81  G A "H5''" 1  
ATOM 2976   H "H4'"  . G A 1 92  ? 83.857  109.093 99.516  1.00 0.00 ? 81  G A "H4'"  1  
ATOM 2977   H "H3'"  . G A 1 92  ? 84.987  106.670 100.461 1.00 0.00 ? 81  G A "H3'"  1  
ATOM 2978   H "H2'"  . G A 1 92  ? 87.040  107.687 100.563 1.00 0.00 ? 81  G A "H2'"  1  
ATOM 2979   H "HO2'" . G A 1 92  ? 86.232  109.029 98.537  1.00 0.00 ? 81  G A "HO2'" 1  
ATOM 2980   H "H1'"  . G A 1 92  ? 86.100  109.869 101.664 1.00 0.00 ? 81  G A "H1'"  1  
ATOM 2981   H H8     . G A 1 92  ? 84.333  107.292 103.415 1.00 0.00 ? 81  G A H8     1  
ATOM 2982   H H1     . G A 1 92  ? 90.273  107.707 105.435 1.00 0.00 ? 81  G A H1     1  
ATOM 2983   H H21    . G A 1 92  ? 91.451  108.993 104.081 1.00 0.00 ? 81  G A H21    1  
ATOM 2984   H H22    . G A 1 92  ? 90.769  109.727 102.712 1.00 0.00 ? 81  G A H22    1  
ATOM 2985   P P      . U A 1 93  ? 85.695  105.641 98.131  1.00 0.00 ? 82  U A P      1  
ATOM 2986   O OP1    . U A 1 93  ? 84.600  104.640 98.217  1.00 0.00 ? 82  U A OP1    1  
ATOM 2987   O OP2    . U A 1 93  ? 86.880  105.509 99.015  1.00 0.00 ? 82  U A OP2    1  
ATOM 2988   O "O5'"  . U A 1 93  ? 86.206  105.684 96.623  1.00 0.00 ? 82  U A "O5'"  1  
ATOM 2989   C "C5'"  . U A 1 93  ? 86.855  104.564 96.040  1.00 0.00 ? 82  U A "C5'"  1  
ATOM 2990   C "C4'"  . U A 1 93  ? 87.588  104.941 94.776  1.00 0.00 ? 82  U A "C4'"  1  
ATOM 2991   O "O4'"  . U A 1 93  ? 87.850  106.366 94.767  1.00 0.00 ? 82  U A "O4'"  1  
ATOM 2992   C "C3'"  . U A 1 93  ? 88.960  104.313 94.584  1.00 0.00 ? 82  U A "C3'"  1  
ATOM 2993   O "O3'"  . U A 1 93  ? 88.911  103.072 93.904  1.00 0.00 ? 82  U A "O3'"  1  
ATOM 2994   C "C2'"  . U A 1 93  ? 89.718  105.395 93.823  1.00 0.00 ? 82  U A "C2'"  1  
ATOM 2995   O "O2'"  . U A 1 93  ? 89.482  105.302 92.426  1.00 0.00 ? 82  U A "O2'"  1  
ATOM 2996   C "C1'"  . U A 1 93  ? 89.055  106.666 94.356  1.00 0.00 ? 82  U A "C1'"  1  
ATOM 2997   N N1     . U A 1 93  ? 89.900  107.365 95.354  1.00 0.00 ? 82  U A N1     1  
ATOM 2998   C C2     . U A 1 93  ? 91.000  106.681 95.839  1.00 0.00 ? 82  U A C2     1  
ATOM 2999   O O2     . U A 1 93  ? 91.292  105.553 95.483  1.00 0.00 ? 82  U A O2     1  
ATOM 3000   N N3     . U A 1 93  ? 91.753  107.368 96.760  1.00 0.00 ? 82  U A N3     1  
ATOM 3001   C C4     . U A 1 93  ? 91.525  108.640 97.238  1.00 0.00 ? 82  U A C4     1  
ATOM 3002   O O4     . U A 1 93  ? 92.297  109.121 98.069  1.00 0.00 ? 82  U A O4     1  
ATOM 3003   C C5     . U A 1 93  ? 90.370  109.287 96.692  1.00 0.00 ? 82  U A C5     1  
ATOM 3004   C C6     . U A 1 93  ? 89.620  108.642 95.793  1.00 0.00 ? 82  U A C6     1  
ATOM 3005   H "H5'"  . U A 1 93  ? 86.184  103.881 95.828  1.00 0.00 ? 82  U A "H5'"  1  
ATOM 3006   H "H5''" . U A 1 93  ? 87.496  104.195 96.682  1.00 0.00 ? 82  U A "H5''" 1  
ATOM 3007   H "H4'"  . U A 1 93  ? 87.027  104.718 94.004  1.00 0.00 ? 82  U A "H4'"  1  
ATOM 3008   H "H3'"  . U A 1 93  ? 89.380  104.183 95.459  1.00 0.00 ? 82  U A "H3'"  1  
ATOM 3009   H "H2'"  . U A 1 93  ? 90.675  105.376 94.031  1.00 0.00 ? 82  U A "H2'"  1  
ATOM 3010   H "HO2'" . U A 1 93  ? 90.003  105.994 91.967  1.00 0.00 ? 82  U A "HO2'" 1  
ATOM 3011   H "H1'"  . U A 1 93  ? 88.869  107.271 93.607  1.00 0.00 ? 82  U A "H1'"  1  
ATOM 3012   H H3     . U A 1 93  ? 92.537  106.901 97.117  1.00 0.00 ? 82  U A H3     1  
ATOM 3013   H H5     . U A 1 93  ? 90.133  110.194 96.975  1.00 0.00 ? 82  U A H5     1  
ATOM 3014   H H6     . U A 1 93  ? 88.835  109.105 95.435  1.00 0.00 ? 82  U A H6     1  
ATOM 3015   P P      . A A 1 94  ? 88.366  101.758 94.653  1.00 0.00 ? 83  A A P      1  
ATOM 3016   O OP1    . A A 1 94  ? 87.953  100.776 93.619  1.00 0.00 ? 83  A A OP1    1  
ATOM 3017   O OP2    . A A 1 94  ? 87.392  102.190 95.687  1.00 0.00 ? 83  A A OP2    1  
ATOM 3018   O "O5'"  . A A 1 94  ? 89.650  101.180 95.398  1.00 0.00 ? 83  A A "O5'"  1  
ATOM 3019   C "C5'"  . A A 1 94  ? 90.916  101.160 94.759  1.00 0.00 ? 83  A A "C5'"  1  
ATOM 3020   C "C4'"  . A A 1 94  ? 92.040  101.331 95.751  1.00 0.00 ? 83  A A "C4'"  1  
ATOM 3021   O "O4'"  . A A 1 94  ? 91.562  102.057 96.914  1.00 0.00 ? 83  A A "O4'"  1  
ATOM 3022   C "C3'"  . A A 1 94  ? 92.624  100.050 96.327  1.00 0.00 ? 83  A A "C3'"  1  
ATOM 3023   O "O3'"  . A A 1 94  ? 93.562  99.431  95.466  1.00 0.00 ? 83  A A "O3'"  1  
ATOM 3024   C "C2'"  . A A 1 94  ? 93.223  100.522 97.645  1.00 0.00 ? 83  A A "C2'"  1  
ATOM 3025   O "O2'"  . A A 1 94  ? 94.468  101.172 97.442  1.00 0.00 ? 83  A A "O2'"  1  
ATOM 3026   C "C1'"  . A A 1 94  ? 92.191  101.555 98.098  1.00 0.00 ? 83  A A "C1'"  1  
ATOM 3027   N N9     . A A 1 94  ? 91.193  100.980 99.019  1.00 0.00 ? 83  A A N9     1  
ATOM 3028   C C8     . A A 1 94  ? 89.887  100.652 98.751  1.00 0.00 ? 83  A A C8     1  
ATOM 3029   N N7     . A A 1 94  ? 89.246  100.155 99.780  1.00 0.00 ? 83  A A N7     1  
ATOM 3030   C C5     . A A 1 94  ? 90.193  100.156 100.795 1.00 0.00 ? 83  A A C5     1  
ATOM 3031   C C6     . A A 1 94  ? 90.139  99.751  102.141 1.00 0.00 ? 83  A A C6     1  
ATOM 3032   N N6     . A A 1 94  ? 89.047  99.245  102.718 1.00 0.00 ? 83  A A N6     1  
ATOM 3033   N N1     . A A 1 94  ? 91.259  99.886  102.881 1.00 0.00 ? 83  A A N1     1  
ATOM 3034   C C2     . A A 1 94  ? 92.355  100.394 102.303 1.00 0.00 ? 83  A A C2     1  
ATOM 3035   N N3     . A A 1 94  ? 92.528  100.809 101.051 1.00 0.00 ? 83  A A N3     1  
ATOM 3036   C C4     . A A 1 94  ? 91.394  100.662 100.340 1.00 0.00 ? 83  A A C4     1  
ATOM 3037   H "H5'"  . A A 1 94  ? 90.957  101.888 94.104  1.00 0.00 ? 83  A A "H5'"  1  
ATOM 3038   H "H5''" . A A 1 94  ? 91.029  100.305 94.295  1.00 0.00 ? 83  A A "H5''" 1  
ATOM 3039   H "H4'"  . A A 1 94  ? 92.760  101.846 95.329  1.00 0.00 ? 83  A A "H4'"  1  
ATOM 3040   H "H3'"  . A A 1 94  ? 91.895  99.421  96.515  1.00 0.00 ? 83  A A "H3'"  1  
ATOM 3041   H "H2'"  . A A 1 94  ? 93.298  99.786  98.290  1.00 0.00 ? 83  A A "H2'"  1  
ATOM 3042   H "HO2'" . A A 1 94  ? 94.829  100.908 96.570  1.00 0.00 ? 83  A A "HO2'" 1  
ATOM 3043   H "H1'"  . A A 1 94  ? 92.647  102.302 98.537  1.00 0.00 ? 83  A A "H1'"  1  
ATOM 3044   H H8     . A A 1 94  ? 89.473  100.776 97.871  1.00 0.00 ? 83  A A H8     1  
ATOM 3045   H H61    . A A 1 94  ? 89.070  98.981  103.663 1.00 0.00 ? 83  A A H61    1  
ATOM 3046   H H62    . A A 1 94  ? 88.221  99.138  102.200 1.00 0.00 ? 83  A A H62    1  
ATOM 3047   H H2     . A A 1 94  ? 93.140  100.469 102.885 1.00 0.00 ? 83  A A H2     1  
ATOM 3048   P P      . C A 1 95  ? 93.753  97.836  95.488  1.00 0.00 ? 84  C A P      1  
ATOM 3049   O OP1    . C A 1 95  ? 94.673  97.466  94.383  1.00 0.00 ? 84  C A OP1    1  
ATOM 3050   O OP2    . C A 1 95  ? 92.407  97.213  95.561  1.00 0.00 ? 84  C A OP2    1  
ATOM 3051   O "O5'"  . C A 1 95  ? 94.501  97.555  96.866  1.00 0.00 ? 84  C A "O5'"  1  
ATOM 3052   C "C5'"  . C A 1 95  ? 95.874  97.874  97.029  1.00 0.00 ? 84  C A "C5'"  1  
ATOM 3053   C "C4'"  . C A 1 95  ? 96.357  97.570  98.426  1.00 0.00 ? 84  C A "C4'"  1  
ATOM 3054   O "O4'"  . C A 1 95  ? 95.574  98.319  99.391  1.00 0.00 ? 84  C A "O4'"  1  
ATOM 3055   C "C3'"  . C A 1 95  ? 96.220  96.126  98.883  1.00 0.00 ? 84  C A "C3'"  1  
ATOM 3056   O "O3'"  . C A 1 95  ? 97.257  95.291  98.393  1.00 0.00 ? 84  C A "O3'"  1  
ATOM 3057   C "C2'"  . C A 1 95  ? 96.207  96.257  100.400 1.00 0.00 ? 84  C A "C2'"  1  
ATOM 3058   O "O2'"  . C A 1 95  ? 97.516  96.461  100.911 1.00 0.00 ? 84  C A "O2'"  1  
ATOM 3059   C "C1'"  . C A 1 95  ? 95.394  97.538  100.587 1.00 0.00 ? 84  C A "C1'"  1  
ATOM 3060   N N1     . C A 1 95  ? 93.957  97.262  100.832 1.00 0.00 ? 84  C A N1     1  
ATOM 3061   C C2     . C A 1 95  ? 93.570  96.832  102.107 1.00 0.00 ? 84  C A C2     1  
ATOM 3062   O O2     . C A 1 95  ? 94.433  96.694  102.988 1.00 0.00 ? 84  C A O2     1  
ATOM 3063   N N3     . C A 1 95  ? 92.267  96.575  102.357 1.00 0.00 ? 84  C A N3     1  
ATOM 3064   C C4     . C A 1 95  ? 91.358  96.729  101.395 1.00 0.00 ? 84  C A C4     1  
ATOM 3065   N N4     . C A 1 95  ? 90.082  96.463  101.687 1.00 0.00 ? 84  C A N4     1  
ATOM 3066   C C5     . C A 1 95  ? 91.717  97.166  100.088 1.00 0.00 ? 84  C A C5     1  
ATOM 3067   C C6     . C A 1 95  ? 93.011  97.418  99.852  1.00 0.00 ? 84  C A C6     1  
ATOM 3068   H "H5'"  . C A 1 95  ? 96.004  98.827  96.844  1.00 0.00 ? 84  C A "H5'"  1  
ATOM 3069   H "H5''" . C A 1 95  ? 96.402  97.351  96.388  1.00 0.00 ? 84  C A "H5''" 1  
ATOM 3070   H "H4'"  . C A 1 95  ? 97.297  97.842  98.502  1.00 0.00 ? 84  C A "H4'"  1  
ATOM 3071   H "H3'"  . C A 1 95  ? 95.356  95.774  98.582  1.00 0.00 ? 84  C A "H3'"  1  
ATOM 3072   H "H2'"  . C A 1 95  ? 95.769  95.488  100.822 1.00 0.00 ? 84  C A "H2'"  1  
ATOM 3073   H "HO2'" . C A 1 95  ? 98.169  96.162  100.244 1.00 0.00 ? 84  C A "HO2'" 1  
ATOM 3074   H "H1'"  . C A 1 95  ? 95.759  98.050  101.339 1.00 0.00 ? 84  C A "H1'"  1  
ATOM 3075   H H41    . C A 1 95  ? 89.838  96.163  102.587 1.00 0.00 ? 84  C A H41    1  
ATOM 3076   H H42    . C A 1 95  ? 89.391  96.566  101.001 1.00 0.00 ? 84  C A H42    1  
ATOM 3077   H H5     . C A 1 95  ? 91.042  97.276  99.387  1.00 0.00 ? 84  C A H5     1  
ATOM 3078   H H6     . C A 1 95  ? 93.278  97.719  98.959  1.00 0.00 ? 84  C A H6     1  
ATOM 3079   P P      . C A 1 96  ? 97.003  93.715  98.203  1.00 0.00 ? 85  C A P      1  
ATOM 3080   O OP1    . C A 1 96  ? 98.213  93.126  97.574  1.00 0.00 ? 85  C A OP1    1  
ATOM 3081   O OP2    . C A 1 96  ? 95.679  93.538  97.552  1.00 0.00 ? 85  C A OP2    1  
ATOM 3082   O "O5'"  . C A 1 96  ? 96.901  93.156  99.690  1.00 0.00 ? 85  C A "O5'"  1  
ATOM 3083   C "C5'"  . C A 1 96  ? 98.036  93.139  100.542 1.00 0.00 ? 85  C A "C5'"  1  
ATOM 3084   C "C4'"  . C A 1 96  ? 97.683  92.668  101.932 1.00 0.00 ? 85  C A "C4'"  1  
ATOM 3085   O "O4'"  . C A 1 96  ? 96.712  93.568  102.527 1.00 0.00 ? 85  C A "O4'"  1  
ATOM 3086   C "C3'"  . C A 1 96  ? 97.027  91.300  102.029 1.00 0.00 ? 85  C A "C3'"  1  
ATOM 3087   O "O3'"  . C A 1 96  ? 97.953  90.232  101.934 1.00 0.00 ? 85  C A "O3'"  1  
ATOM 3088   C "C2'"  . C A 1 96  ? 96.311  91.370  103.371 1.00 0.00 ? 85  C A "C2'"  1  
ATOM 3089   O "O2'"  . C A 1 96  ? 97.217  91.185  104.449 1.00 0.00 ? 85  C A "O2'"  1  
ATOM 3090   C "C1'"  . C A 1 96  ? 95.818  92.818  103.379 1.00 0.00 ? 85  C A "C1'"  1  
ATOM 3091   N N1     . C A 1 96  ? 94.413  92.937  102.918 1.00 0.00 ? 85  C A N1     1  
ATOM 3092   C C2     . C A 1 96  ? 93.389  92.596  103.809 1.00 0.00 ? 85  C A C2     1  
ATOM 3093   O O2     . C A 1 96  ? 93.683  92.205  104.950 1.00 0.00 ? 85  C A O2     1  
ATOM 3094   N N3     . C A 1 96  ? 92.098  92.696  103.414 1.00 0.00 ? 85  C A N3     1  
ATOM 3095   C C4     . C A 1 96  ? 91.809  93.117  102.183 1.00 0.00 ? 85  C A C4     1  
ATOM 3096   N N4     . C A 1 96  ? 90.522  93.202  101.835 1.00 0.00 ? 85  C A N4     1  
ATOM 3097   C C5     . C A 1 96  ? 92.826  93.472  101.252 1.00 0.00 ? 85  C A C5     1  
ATOM 3098   C C6     . C A 1 96  ? 94.098  93.368  101.656 1.00 0.00 ? 85  C A C6     1  
ATOM 3099   H "H5'"  . C A 1 96  ? 98.409  94.044  100.596 1.00 0.00 ? 85  C A "H5'"  1  
ATOM 3100   H "H5''" . C A 1 96  ? 98.711  92.538  100.164 1.00 0.00 ? 85  C A "H5''" 1  
ATOM 3101   H "H4'"  . C A 1 96  ? 98.495  92.671  102.482 1.00 0.00 ? 85  C A "H4'"  1  
ATOM 3102   H "H3'"  . C A 1 96  ? 96.361  91.211  101.316 1.00 0.00 ? 85  C A "H3'"  1  
ATOM 3103   H "H2'"  . C A 1 96  ? 95.563  90.737  103.414 1.00 0.00 ? 85  C A "H2'"  1  
ATOM 3104   H "HO2'" . C A 1 96  ? 96.792  90.628  105.132 1.00 0.00 ? 85  C A "HO2'" 1  
ATOM 3105   H "H1'"  . C A 1 96  ? 95.893  93.183  104.286 1.00 0.00 ? 85  C A "H1'"  1  
ATOM 3106   H H41    . C A 1 96  ? 89.824  92.956  102.479 1.00 0.00 ? 85  C A H41    1  
ATOM 3107   H H42    . C A 1 96  ? 90.276  93.508  100.939 1.00 0.00 ? 85  C A H42    1  
ATOM 3108   H H5     . C A 1 96  ? 92.603  93.780  100.350 1.00 0.00 ? 85  C A H5     1  
ATOM 3109   H H6     . C A 1 96  ? 94.814  93.608  101.030 1.00 0.00 ? 85  C A H6     1  
ATOM 3110   P P      . A A 1 97  ? 99.177  90.130  102.970 1.00 0.00 ? 86  A A P      1  
ATOM 3111   O OP1    . A A 1 97  ? 100.102 89.075  102.487 1.00 0.00 ? 86  A A OP1    1  
ATOM 3112   O OP2    . A A 1 97  ? 98.614  90.042  104.341 1.00 0.00 ? 86  A A OP2    1  
ATOM 3113   O "O5'"  . A A 1 97  ? 99.917  91.535  102.832 1.00 0.00 ? 86  A A "O5'"  1  
ATOM 3114   C "C5'"  . A A 1 97  ? 100.905 91.743  101.835 1.00 0.00 ? 86  A A "C5'"  1  
ATOM 3115   C "C4'"  . A A 1 97  ? 101.320 93.191  101.760 1.00 0.00 ? 86  A A "C4'"  1  
ATOM 3116   O "O4'"  . A A 1 97  ? 100.178 94.077  101.923 1.00 0.00 ? 86  A A "O4'"  1  
ATOM 3117   C "C3'"  . A A 1 97  ? 102.280 93.667  102.840 1.00 0.00 ? 86  A A "C3'"  1  
ATOM 3118   O "O3'"  . A A 1 97  ? 103.619 93.267  102.607 1.00 0.00 ? 86  A A "O3'"  1  
ATOM 3119   C "C2'"  . A A 1 97  ? 102.135 95.164  102.644 1.00 0.00 ? 86  A A "C2'"  1  
ATOM 3120   O "O2'"  . A A 1 97  ? 102.825 95.600  101.481 1.00 0.00 ? 86  A A "O2'"  1  
ATOM 3121   C "C1'"  . A A 1 97  ? 100.631 95.274  102.409 1.00 0.00 ? 86  A A "C1'"  1  
ATOM 3122   N N9     . A A 1 97  ? 99.898  95.603  103.646 1.00 0.00 ? 86  A A N9     1  
ATOM 3123   C C8     . A A 1 97  ? 99.428  94.739  104.604 1.00 0.00 ? 86  A A C8     1  
ATOM 3124   N N7     . A A 1 97  ? 98.811  95.334  105.596 1.00 0.00 ? 86  A A N7     1  
ATOM 3125   C C5     . A A 1 97  ? 98.880  96.682  105.269 1.00 0.00 ? 86  A A C5     1  
ATOM 3126   C C6     . A A 1 97  ? 98.409  97.838  105.917 1.00 0.00 ? 86  A A C6     1  
ATOM 3127   N N6     . A A 1 97  ? 97.750  97.820  107.078 1.00 0.00 ? 86  A A N6     1  
ATOM 3128   N N1     . A A 1 97  ? 98.643  99.029  105.324 1.00 0.00 ? 86  A A N1     1  
ATOM 3129   C C2     . A A 1 97  ? 99.304  99.047  104.160 1.00 0.00 ? 86  A A C2     1  
ATOM 3130   N N3     . A A 1 97  ? 99.795  98.030  103.455 1.00 0.00 ? 86  A A N3     1  
ATOM 3131   C C4     . A A 1 97  ? 99.546  96.861  104.072 1.00 0.00 ? 86  A A C4     1  
ATOM 3132   H "H5'"  . A A 1 97  ? 100.546 91.469  100.965 1.00 0.00 ? 86  A A "H5'"  1  
ATOM 3133   H "H5''" . A A 1 97  ? 101.691 91.196  102.042 1.00 0.00 ? 86  A A "H5''" 1  
ATOM 3134   H "H4'"  . A A 1 97  ? 101.717 93.362  100.880 1.00 0.00 ? 86  A A "H4'"  1  
ATOM 3135   H "H3'"  . A A 1 97  ? 101.934 93.400  103.717 1.00 0.00 ? 86  A A "H3'"  1  
ATOM 3136   H "H2'"  . A A 1 97  ? 102.416 95.659  103.441 1.00 0.00 ? 86  A A "H2'"  1  
ATOM 3137   H "HO2'" . A A 1 97  ? 103.428 96.332  101.726 1.00 0.00 ? 86  A A "HO2'" 1  
ATOM 3138   H "H1'"  . A A 1 97  ? 100.456 95.962  101.733 1.00 0.00 ? 86  A A "H1'"  1  
ATOM 3139   H H8     . A A 1 97  ? 99.543  93.767  104.552 1.00 0.00 ? 86  A A H8     1  
ATOM 3140   H H61    . A A 1 97  ? 97.446  98.660  107.481 1.00 0.00 ? 86  A A H61    1  
ATOM 3141   H H62    . A A 1 97  ? 97.569  96.968  107.526 1.00 0.00 ? 86  A A H62    1  
ATOM 3142   H H2     . A A 1 97  ? 99.448  99.936  103.772 1.00 0.00 ? 86  A A H2     1  
ATOM 3143   P P      . A A 1 98  ? 104.118 93.011  101.108 1.00 0.00 ? 87  A A P      1  
ATOM 3144   O OP1    . A A 1 98  ? 103.738 94.171  100.264 1.00 0.00 ? 87  A A OP1    1  
ATOM 3145   O OP2    . A A 1 98  ? 103.562 91.669  100.804 1.00 0.00 ? 87  A A OP2    1  
ATOM 3146   O "O5'"  . A A 1 98  ? 105.708 92.898  101.103 1.00 0.00 ? 87  A A "O5'"  1  
ATOM 3147   C "C5'"  . A A 1 98  ? 106.409 92.438  102.249 1.00 0.00 ? 87  A A "C5'"  1  
ATOM 3148   C "C4'"  . A A 1 98  ? 107.381 93.474  102.756 1.00 0.00 ? 87  A A "C4'"  1  
ATOM 3149   O "O4'"  . A A 1 98  ? 106.674 94.719  102.952 1.00 0.00 ? 87  A A "O4'"  1  
ATOM 3150   C "C3'"  . A A 1 98  ? 108.070 93.154  104.074 1.00 0.00 ? 87  A A "C3'"  1  
ATOM 3151   O "O3'"  . A A 1 98  ? 109.384 92.651  103.905 1.00 0.00 ? 87  A A "O3'"  1  
ATOM 3152   C "C2'"  . A A 1 98  ? 108.105 94.501  104.813 1.00 0.00 ? 87  A A "C2'"  1  
ATOM 3153   O "O2'"  . A A 1 98  ? 109.245 95.262  104.442 1.00 0.00 ? 87  A A "O2'"  1  
ATOM 3154   C "C1'"  . A A 1 98  ? 106.862 95.186  104.270 1.00 0.00 ? 87  A A "C1'"  1  
ATOM 3155   N N9     . A A 1 98  ? 105.662 94.878  105.072 1.00 0.00 ? 87  A A N9     1  
ATOM 3156   C C8     . A A 1 98  ? 105.357 93.705  105.718 1.00 0.00 ? 87  A A C8     1  
ATOM 3157   N N7     . A A 1 98  ? 104.212 93.734  106.353 1.00 0.00 ? 87  A A N7     1  
ATOM 3158   C C5     . A A 1 98  ? 103.728 95.012  106.109 1.00 0.00 ? 87  A A C5     1  
ATOM 3159   C C6     . A A 1 98  ? 102.551 95.671  106.506 1.00 0.00 ? 87  A A C6     1  
ATOM 3160   N N6     . A A 1 98  ? 101.608 95.109  107.266 1.00 0.00 ? 87  A A N6     1  
ATOM 3161   N N1     . A A 1 98  ? 102.373 96.944  106.092 1.00 0.00 ? 87  A A N1     1  
ATOM 3162   C C2     . A A 1 98  ? 103.319 97.509  105.330 1.00 0.00 ? 87  A A C2     1  
ATOM 3163   N N3     . A A 1 98  ? 104.465 96.993  104.892 1.00 0.00 ? 87  A A N3     1  
ATOM 3164   C C4     . A A 1 98  ? 104.612 95.727  105.322 1.00 0.00 ? 87  A A C4     1  
ATOM 3165   H "H5'"  . A A 1 98  ? 106.903 91.624  102.017 1.00 0.00 ? 87  A A "H5'"  1  
ATOM 3166   H "H5''" . A A 1 98  ? 105.765 92.230  102.957 1.00 0.00 ? 87  A A "H5''" 1  
ATOM 3167   H "H4'"  . A A 1 98  ? 108.064 93.621  102.069 1.00 0.00 ? 87  A A "H4'"  1  
ATOM 3168   H "H3'"  . A A 1 98  ? 107.536 92.498  104.571 1.00 0.00 ? 87  A A "H3'"  1  
ATOM 3169   H "H2'"  . A A 1 98  ? 108.049 94.380  105.784 1.00 0.00 ? 87  A A "H2'"  1  
ATOM 3170   H "HO2'" . A A 1 98  ? 109.249 96.099  104.952 1.00 0.00 ? 87  A A "HO2'" 1  
ATOM 3171   H "H1'"  . A A 1 98  ? 107.004 96.156  104.256 1.00 0.00 ? 87  A A "H1'"  1  
ATOM 3172   H H8     . A A 1 98  ? 105.943 92.919  105.706 1.00 0.00 ? 87  A A H8     1  
ATOM 3173   H H61    . A A 1 98  ? 100.808 95.619  107.511 1.00 0.00 ? 87  A A H61    1  
ATOM 3174   H H62    . A A 1 98  ? 101.715 94.187  107.578 1.00 0.00 ? 87  A A H62    1  
ATOM 3175   H H2     . A A 1 98  ? 103.142 98.433  105.056 1.00 0.00 ? 87  A A H2     1  
ATOM 3176   P P      . G A 1 99  ? 109.644 91.366  102.976 1.00 0.00 ? 88  G A P      1  
ATOM 3177   O OP1    . G A 1 99  ? 109.980 91.846  101.611 1.00 0.00 ? 88  G A OP1    1  
ATOM 3178   O OP2    . G A 1 99  ? 108.511 90.425  103.165 1.00 0.00 ? 88  G A OP2    1  
ATOM 3179   O "O5'"  . G A 1 99  ? 110.948 90.698  103.598 1.00 0.00 ? 88  G A "O5'"  1  
ATOM 3180   C "C5'"  . G A 1 99  ? 111.487 91.159  104.828 1.00 0.00 ? 88  G A "C5'"  1  
ATOM 3181   C "C4'"  . G A 1 99  ? 111.192 90.201  105.957 1.00 0.00 ? 88  G A "C4'"  1  
ATOM 3182   O "O4'"  . G A 1 99  ? 109.901 90.512  106.540 1.00 0.00 ? 88  G A "O4'"  1  
ATOM 3183   C "C3'"  . G A 1 99  ? 111.082 88.735  105.572 1.00 0.00 ? 88  G A "C3'"  1  
ATOM 3184   O "O3'"  . G A 1 99  ? 112.343 88.106  105.417 1.00 0.00 ? 88  G A "O3'"  1  
ATOM 3185   C "C2'"  . G A 1 99  ? 110.249 88.157  106.708 1.00 0.00 ? 88  G A "C2'"  1  
ATOM 3186   O "O2'"  . G A 1 99  ? 111.036 87.949  107.872 1.00 0.00 ? 88  G A "O2'"  1  
ATOM 3187   C "C1'"  . G A 1 99  ? 109.264 89.296  106.973 1.00 0.00 ? 88  G A "C1'"  1  
ATOM 3188   N N9     . G A 1 99  ? 107.985 89.100  106.266 1.00 0.00 ? 88  G A N9     1  
ATOM 3189   C C8     . G A 1 99  ? 107.523 89.795  105.173 1.00 0.00 ? 88  G A C8     1  
ATOM 3190   N N7     . G A 1 99  ? 106.349 89.394  104.767 1.00 0.00 ? 88  G A N7     1  
ATOM 3191   C C5     . G A 1 99  ? 106.014 88.371  105.643 1.00 0.00 ? 88  G A C5     1  
ATOM 3192   C C6     . G A 1 99  ? 104.858 87.552  105.700 1.00 0.00 ? 88  G A C6     1  
ATOM 3193   O O6     . G A 1 99  ? 103.864 87.569  104.965 1.00 0.00 ? 88  G A O6     1  
ATOM 3194   N N1     . G A 1 99  ? 104.928 86.638  106.747 1.00 0.00 ? 88  G A N1     1  
ATOM 3195   C C2     . G A 1 99  ? 105.978 86.525  107.626 1.00 0.00 ? 88  G A C2     1  
ATOM 3196   N N2     . G A 1 99  ? 105.863 85.582  108.573 1.00 0.00 ? 88  G A N2     1  
ATOM 3197   N N3     . G A 1 99  ? 107.062 87.282  107.583 1.00 0.00 ? 88  G A N3     1  
ATOM 3198   C C4     . G A 1 99  ? 107.014 88.176  106.573 1.00 0.00 ? 88  G A C4     1  
ATOM 3199   H "H5'"  . G A 1 99  ? 111.098 92.034  105.040 1.00 0.00 ? 88  G A "H5'"  1  
ATOM 3200   H "H5''" . G A 1 99  ? 112.458 91.256  104.735 1.00 0.00 ? 88  G A "H5''" 1  
ATOM 3201   H "H4'"  . G A 1 99  ? 111.884 90.301  106.645 1.00 0.00 ? 88  G A "H4'"  1  
ATOM 3202   H "H3'"  . G A 1 99  ? 110.581 88.657  104.736 1.00 0.00 ? 88  G A "H3'"  1  
ATOM 3203   H "H2'"  . G A 1 99  ? 109.786 87.338  106.433 1.00 0.00 ? 88  G A "H2'"  1  
ATOM 3204   H "HO2'" . G A 1 99  ? 111.980 87.913  107.616 1.00 0.00 ? 88  G A "HO2'" 1  
ATOM 3205   H "H1'"  . G A 1 99  ? 109.097 89.365  107.937 1.00 0.00 ? 88  G A "H1'"  1  
ATOM 3206   H H8     . G A 1 99  ? 108.023 90.520  104.744 1.00 0.00 ? 88  G A H8     1  
ATOM 3207   H H1     . G A 1 99  ? 104.170 86.028  106.866 1.00 0.00 ? 88  G A H1     1  
ATOM 3208   H H21    . G A 1 99  ? 105.063 85.017  108.610 1.00 0.00 ? 88  G A H21    1  
ATOM 3209   H H22    . G A 1 99  ? 106.581 85.455  109.227 1.00 0.00 ? 88  G A H22    1  
ATOM 3210   P P      . U A 1 100 ? 112.513 86.877  104.396 1.00 0.00 ? 89  U A P      1  
ATOM 3211   O OP1    . U A 1 100 ? 113.914 86.396  104.483 1.00 0.00 ? 89  U A OP1    1  
ATOM 3212   O OP2    . U A 1 100 ? 111.960 87.292  103.082 1.00 0.00 ? 89  U A OP2    1  
ATOM 3213   O "O5'"  . U A 1 100 ? 111.565 85.745  104.994 1.00 0.00 ? 89  U A "O5'"  1  
ATOM 3214   C "C5'"  . U A 1 100 ? 111.924 85.041  106.174 1.00 0.00 ? 89  U A "C5'"  1  
ATOM 3215   C "C4'"  . U A 1 100 ? 110.871 84.034  106.564 1.00 0.00 ? 89  U A "C4'"  1  
ATOM 3216   O "O4'"  . U A 1 100 ? 109.618 84.711  106.843 1.00 0.00 ? 89  U A "O4'"  1  
ATOM 3217   C "C3'"  . U A 1 100 ? 110.505 83.004  105.508 1.00 0.00 ? 89  U A "C3'"  1  
ATOM 3218   O "O3'"  . U A 1 100 ? 111.437 81.939  105.424 1.00 0.00 ? 89  U A "O3'"  1  
ATOM 3219   C "C2'"  . U A 1 100 ? 109.113 82.562  105.941 1.00 0.00 ? 89  U A "C2'"  1  
ATOM 3220   O "O2'"  . U A 1 100 ? 109.175 81.657  107.032 1.00 0.00 ? 89  U A "O2'"  1  
ATOM 3221   C "C1'"  . U A 1 100 ? 108.514 83.883  106.426 1.00 0.00 ? 89  U A "C1'"  1  
ATOM 3222   N N1     . U A 1 100 ? 107.710 84.557  105.376 1.00 0.00 ? 89  U A N1     1  
ATOM 3223   C C2     . U A 1 100 ? 106.442 84.063  105.139 1.00 0.00 ? 89  U A C2     1  
ATOM 3224   O O2     . U A 1 100 ? 105.971 83.119  105.747 1.00 0.00 ? 89  U A O2     1  
ATOM 3225   N N3     . U A 1 100 ? 105.737 84.719  104.158 1.00 0.00 ? 89  U A N3     1  
ATOM 3226   C C4     . U A 1 100 ? 106.160 85.793  103.405 1.00 0.00 ? 89  U A C4     1  
ATOM 3227   O O4     . U A 1 100 ? 105.405 86.273  102.559 1.00 0.00 ? 89  U A O4     1  
ATOM 3228   C C5     . U A 1 100 ? 107.482 86.250  103.706 1.00 0.00 ? 89  U A C5     1  
ATOM 3229   C C6     . U A 1 100 ? 108.191 85.632  104.656 1.00 0.00 ? 89  U A C6     1  
ATOM 3230   H "H5'"  . U A 1 100 ? 112.040 85.681  106.906 1.00 0.00 ? 89  U A "H5'"  1  
ATOM 3231   H "H5''" . U A 1 100 ? 112.771 84.572  106.021 1.00 0.00 ? 89  U A "H5''" 1  
ATOM 3232   H "H4'"  . U A 1 100 ? 111.164 83.565  107.374 1.00 0.00 ? 89  U A "H4'"  1  
ATOM 3233   H "H3'"  . U A 1 100 ? 110.444 83.445  104.634 1.00 0.00 ? 89  U A "H3'"  1  
ATOM 3234   H "H2'"  . U A 1 100 ? 108.602 82.192  105.190 1.00 0.00 ? 89  U A "H2'"  1  
ATOM 3235   H "HO2'" . U A 1 100 ? 108.267 81.371  107.262 1.00 0.00 ? 89  U A "HO2'" 1  
ATOM 3236   H "H1'"  . U A 1 100 ? 107.947 83.716  107.207 1.00 0.00 ? 89  U A "H1'"  1  
ATOM 3237   H H3     . U A 1 100 ? 104.833 84.384  103.973 1.00 0.00 ? 89  U A H3     1  
ATOM 3238   H H5     . U A 1 100 ? 107.864 87.010  103.219 1.00 0.00 ? 89  U A H5     1  
ATOM 3239   H H6     . U A 1 100 ? 109.094 85.960  104.843 1.00 0.00 ? 89  U A H6     1  
ATOM 3240   P P      . C A 1 101 ? 111.658 81.163  104.036 1.00 0.00 ? 90  C A P      1  
ATOM 3241   O OP1    . C A 1 101 ? 112.779 80.204  104.219 1.00 0.00 ? 90  C A OP1    1  
ATOM 3242   O OP2    . C A 1 101 ? 111.727 82.171  102.949 1.00 0.00 ? 90  C A OP2    1  
ATOM 3243   O "O5'"  . C A 1 101 ? 110.318 80.323  103.845 1.00 0.00 ? 90  C A "O5'"  1  
ATOM 3244   C "C5'"  . C A 1 101 ? 110.027 79.213  104.680 1.00 0.00 ? 90  C A "C5'"  1  
ATOM 3245   C "C4'"  . C A 1 101 ? 108.680 78.614  104.365 1.00 0.00 ? 90  C A "C4'"  1  
ATOM 3246   O "O4'"  . C A 1 101 ? 107.635 79.594  104.605 1.00 0.00 ? 90  C A "O4'"  1  
ATOM 3247   C "C3'"  . C A 1 101 ? 108.458 78.186  102.921 1.00 0.00 ? 90  C A "C3'"  1  
ATOM 3248   O "O3'"  . C A 1 101 ? 109.046 76.934  102.619 1.00 0.00 ? 90  C A "O3'"  1  
ATOM 3249   C "C2'"  . C A 1 101 ? 106.940 78.191  102.803 1.00 0.00 ? 90  C A "C2'"  1  
ATOM 3250   O "O2'"  . C A 1 101 ? 106.371 77.034  103.397 1.00 0.00 ? 90  C A "O2'"  1  
ATOM 3251   C "C1'"  . C A 1 101 ? 106.572 79.414  103.648 1.00 0.00 ? 90  C A "C1'"  1  
ATOM 3252   N N1     . C A 1 101 ? 106.386 80.632  102.822 1.00 0.00 ? 90  C A N1     1  
ATOM 3253   C C2     . C A 1 101 ? 105.182 80.786  102.124 1.00 0.00 ? 90  C A C2     1  
ATOM 3254   O O2     . C A 1 101 ? 104.313 79.903  102.213 1.00 0.00 ? 90  C A O2     1  
ATOM 3255   N N3     . C A 1 101 ? 104.987 81.890  101.364 1.00 0.00 ? 90  C A N3     1  
ATOM 3256   C C4     . C A 1 101 ? 105.936 82.820  101.284 1.00 0.00 ? 90  C A C4     1  
ATOM 3257   N N4     . C A 1 101 ? 105.700 83.892  100.522 1.00 0.00 ? 90  C A N4     1  
ATOM 3258   C C5     . C A 1 101 ? 107.171 82.695  101.980 1.00 0.00 ? 90  C A C5     1  
ATOM 3259   C C6     . C A 1 101 ? 107.354 81.601  102.728 1.00 0.00 ? 90  C A C6     1  
ATOM 3260   H "H5'"  . C A 1 101 ? 110.036 79.507  105.615 1.00 0.00 ? 90  C A "H5'"  1  
ATOM 3261   H "H5''" . C A 1 101 ? 110.719 78.528  104.553 1.00 0.00 ? 90  C A "H5''" 1  
ATOM 3262   H "H4'"  . C A 1 101 ? 108.531 77.843  104.950 1.00 0.00 ? 90  C A "H4'"  1  
ATOM 3263   H "H3'"  . C A 1 101 ? 108.827 78.869  102.323 1.00 0.00 ? 90  C A "H3'"  1  
ATOM 3264   H "H2'"  . C A 1 101 ? 106.651 78.300  101.872 1.00 0.00 ? 90  C A "H2'"  1  
ATOM 3265   H "HO2'" . C A 1 101 ? 105.401 77.054  103.272 1.00 0.00 ? 90  C A "HO2'" 1  
ATOM 3266   H "H1'"  . C A 1 101 ? 105.748 79.230  104.144 1.00 0.00 ? 90  C A "H1'"  1  
ATOM 3267   H H41    . C A 1 101 ? 104.848 83.975  100.044 1.00 0.00 ? 90  C A H41    1  
ATOM 3268   H H42    . C A 1 101 ? 106.378 84.595  100.442 1.00 0.00 ? 90  C A H42    1  
ATOM 3269   H H5     . C A 1 101 ? 107.863 83.384  101.915 1.00 0.00 ? 90  C A H5     1  
ATOM 3270   H H6     . C A 1 101 ? 108.195 81.495  103.216 1.00 0.00 ? 90  C A H6     1  
ATOM 3271   P P      . U A 1 102 ? 109.468 76.582  101.108 1.00 0.00 ? 91  U A P      1  
ATOM 3272   O OP1    . U A 1 102 ? 110.170 75.273  101.118 1.00 0.00 ? 91  U A OP1    1  
ATOM 3273   O OP2    . U A 1 102 ? 110.143 77.772  100.531 1.00 0.00 ? 91  U A OP2    1  
ATOM 3274   O "O5'"  . U A 1 102 ? 108.078 76.391  100.354 1.00 0.00 ? 91  U A "O5'"  1  
ATOM 3275   C "C5'"  . U A 1 102 ? 107.206 75.322  100.691 1.00 0.00 ? 91  U A "C5'"  1  
ATOM 3276   C "C4'"  . U A 1 102 ? 105.885 75.433  99.973  1.00 0.00 ? 91  U A "C4'"  1  
ATOM 3277   O "O4'"  . U A 1 102 ? 105.217 76.665  100.349 1.00 0.00 ? 91  U A "O4'"  1  
ATOM 3278   C "C3'"  . U A 1 102 ? 105.952 75.499  98.453  1.00 0.00 ? 91  U A "C3'"  1  
ATOM 3279   O "O3'"  . U A 1 102 ? 106.146 74.231  97.851  1.00 0.00 ? 91  U A "O3'"  1  
ATOM 3280   C "C2'"  . U A 1 102 ? 104.626 76.151  98.090  1.00 0.00 ? 91  U A "C2'"  1  
ATOM 3281   O "O2'"  . U A 1 102 ? 103.557 75.220  98.161  1.00 0.00 ? 91  U A "O2'"  1  
ATOM 3282   C "C1'"  . U A 1 102 ? 104.467 77.173  99.219  1.00 0.00 ? 91  U A "C1'"  1  
ATOM 3283   N N1     . U A 1 102 ? 104.941 78.522  98.825  1.00 0.00 ? 91  U A N1     1  
ATOM 3284   C C2     . U A 1 102 ? 104.091 79.285  98.044  1.00 0.00 ? 91  U A C2     1  
ATOM 3285   O O2     . U A 1 102 ? 102.995 78.897  97.680  1.00 0.00 ? 91  U A O2     1  
ATOM 3286   N N3     . U A 1 102 ? 104.568 80.526  97.707  1.00 0.00 ? 91  U A N3     1  
ATOM 3287   C C4     . U A 1 102 ? 105.784 81.074  98.057  1.00 0.00 ? 91  U A C4     1  
ATOM 3288   O O4     . U A 1 102 ? 106.071 82.209  97.673  1.00 0.00 ? 91  U A O4     1  
ATOM 3289   C C5     . U A 1 102 ? 106.611 80.229  98.865  1.00 0.00 ? 91  U A C5     1  
ATOM 3290   C C6     . U A 1 102 ? 106.168 79.013  99.211  1.00 0.00 ? 91  U A C6     1  
ATOM 3291   H "H5'"  . U A 1 102 ? 107.044 75.335  101.658 1.00 0.00 ? 91  U A "H5'"  1  
ATOM 3292   H "H5''" . U A 1 102 ? 107.631 74.474  100.449 1.00 0.00 ? 91  U A "H5''" 1  
ATOM 3293   H "H4'"  . U A 1 102 ? 105.320 74.676  100.230 1.00 0.00 ? 91  U A "H4'"  1  
ATOM 3294   H "H3'"  . U A 1 102 ? 106.685 76.096  98.189  1.00 0.00 ? 91  U A "H3'"  1  
ATOM 3295   H "H2'"  . U A 1 102 ? 104.667 76.590  97.214  1.00 0.00 ? 91  U A "H2'"  1  
ATOM 3296   H "HO2'" . U A 1 102 ? 103.918 74.311  98.111  1.00 0.00 ? 91  U A "HO2'" 1  
ATOM 3297   H "H1'"  . U A 1 102 ? 103.525 77.224  99.482  1.00 0.00 ? 91  U A "H1'"  1  
ATOM 3298   H H3     . U A 1 102 ? 103.984 81.085  97.154  1.00 0.00 ? 91  U A H3     1  
ATOM 3299   H H5     . U A 1 102 ? 107.492 80.538  99.163  1.00 0.00 ? 91  U A H5     1  
ATOM 3300   H H6     . U A 1 102 ? 106.753 78.455  99.763  1.00 0.00 ? 91  U A H6     1  
ATOM 3301   P P      . C A 1 103 ? 106.525 74.145  96.299  1.00 0.00 ? 92  C A P      1  
ATOM 3302   O OP1    . C A 1 103 ? 107.843 74.817  96.164  1.00 0.00 ? 92  C A OP1    1  
ATOM 3303   O OP2    . C A 1 103 ? 105.352 74.679  95.563  1.00 0.00 ? 92  C A OP2    1  
ATOM 3304   O "O5'"  . C A 1 103 ? 106.710 72.616  95.890  1.00 0.00 ? 92  C A "O5'"  1  
ATOM 3305   C "C5'"  . C A 1 103 ? 106.863 72.237  94.532  1.00 0.00 ? 92  C A "C5'"  1  
ATOM 3306   C "C4'"  . C A 1 103 ? 105.608 72.495  93.735  1.00 0.00 ? 92  C A "C4'"  1  
ATOM 3307   O "O4'"  . C A 1 103 ? 104.861 73.574  94.363  1.00 0.00 ? 92  C A "O4'"  1  
ATOM 3308   C "C3'"  . C A 1 103 ? 105.807 73.013  92.319  1.00 0.00 ? 92  C A "C3'"  1  
ATOM 3309   O "O3'"  . C A 1 103 ? 106.093 71.983  91.389  1.00 0.00 ? 92  C A "O3'"  1  
ATOM 3310   C "C2'"  . C A 1 103 ? 104.461 73.665  92.040  1.00 0.00 ? 92  C A "C2'"  1  
ATOM 3311   O "O2'"  . C A 1 103 ? 103.467 72.691  91.761  1.00 0.00 ? 92  C A "O2'"  1  
ATOM 3312   C "C1'"  . C A 1 103 ? 104.166 74.314  93.392  1.00 0.00 ? 92  C A "C1'"  1  
ATOM 3313   N N1     . C A 1 103 ? 104.634 75.721  93.457  1.00 0.00 ? 92  C A N1     1  
ATOM 3314   C C2     . C A 1 103 ? 103.757 76.732  93.047  1.00 0.00 ? 92  C A C2     1  
ATOM 3315   O O2     . C A 1 103 ? 102.623 76.426  92.647  1.00 0.00 ? 92  C A O2     1  
ATOM 3316   N N3     . C A 1 103 ? 104.160 78.024  93.096  1.00 0.00 ? 92  C A N3     1  
ATOM 3317   C C4     . C A 1 103 ? 105.382 78.326  93.530  1.00 0.00 ? 92  C A C4     1  
ATOM 3318   N N4     . C A 1 103 ? 105.736 79.614  93.561  1.00 0.00 ? 92  C A N4     1  
ATOM 3319   C C5     . C A 1 103 ? 106.299 77.322  93.952  1.00 0.00 ? 92  C A C5     1  
ATOM 3320   C C6     . C A 1 103 ? 105.889 76.048  93.901  1.00 0.00 ? 92  C A C6     1  
ATOM 3321   H "H5'"  . C A 1 103 ? 107.077 71.280  94.491  1.00 0.00 ? 92  C A "H5'"  1  
ATOM 3322   H "H5''" . C A 1 103 ? 107.602 72.747  94.139  1.00 0.00 ? 92  C A "H5''" 1  
ATOM 3323   H "H4'"  . C A 1 103 ? 105.062 71.681  93.734  1.00 0.00 ? 92  C A "H4'"  1  
ATOM 3324   H "H3'"  . C A 1 103 ? 106.508 73.698  92.322  1.00 0.00 ? 92  C A "H3'"  1  
ATOM 3325   H "H2'"  . C A 1 103 ? 104.529 74.331  91.325  1.00 0.00 ? 92  C A "H2'"  1  
ATOM 3326   H "HO2'" . C A 1 103 ? 102.897 73.016  91.033  1.00 0.00 ? 92  C A "HO2'" 1  
ATOM 3327   H "H1'"  . C A 1 103 ? 103.202 74.284  93.560  1.00 0.00 ? 92  C A "H1'"  1  
ATOM 3328   H H41    . C A 1 103 ? 105.104 80.302  93.269  1.00 0.00 ? 92  C A H41    1  
ATOM 3329   H H42    . C A 1 103 ? 106.628 79.869  93.875  1.00 0.00 ? 92  C A H42    1  
ATOM 3330   H H5     . C A 1 103 ? 107.195 77.553  94.271  1.00 0.00 ? 92  C A H5     1  
ATOM 3331   H H6     . C A 1 103 ? 106.504 75.342  94.186  1.00 0.00 ? 92  C A H6     1  
ATOM 3332   P P      . A A 1 104 ? 107.003 72.288  90.100  1.00 0.00 ? 93  A A P      1  
ATOM 3333   O OP1    . A A 1 104 ? 107.402 70.991  89.499  1.00 0.00 ? 93  A A OP1    1  
ATOM 3334   O OP2    . A A 1 104 ? 108.048 73.266  90.496  1.00 0.00 ? 93  A A OP2    1  
ATOM 3335   O "O5'"  . A A 1 104 ? 106.008 73.014  89.090  1.00 0.00 ? 93  A A "O5'"  1  
ATOM 3336   C "C5'"  . A A 1 104 ? 104.968 72.293  88.446  1.00 0.00 ? 93  A A "C5'"  1  
ATOM 3337   C "C4'"  . A A 1 104 ? 103.832 73.198  88.043  1.00 0.00 ? 93  A A "C4'"  1  
ATOM 3338   O "O4'"  . A A 1 104 ? 103.501 74.059  89.160  1.00 0.00 ? 93  A A "O4'"  1  
ATOM 3339   C "C3'"  . A A 1 104 ? 104.128 74.186  86.924  1.00 0.00 ? 93  A A "C3'"  1  
ATOM 3340   O "O3'"  . A A 1 104 ? 104.080 73.595  85.637  1.00 0.00 ? 93  A A "O3'"  1  
ATOM 3341   C "C2'"  . A A 1 104 ? 103.053 75.244  87.146  1.00 0.00 ? 93  A A "C2'"  1  
ATOM 3342   O "O2'"  . A A 1 104 ? 101.800 74.820  86.628  1.00 0.00 ? 93  A A "O2'"  1  
ATOM 3343   C "C1'"  . A A 1 104 ? 102.985 75.269  88.670  1.00 0.00 ? 93  A A "C1'"  1  
ATOM 3344   N N9     . A A 1 104 ? 103.727 76.410  89.242  1.00 0.00 ? 93  A A N9     1  
ATOM 3345   C C8     . A A 1 104 ? 105.030 76.441  89.671  1.00 0.00 ? 93  A A C8     1  
ATOM 3346   N N7     . A A 1 104 ? 105.407 77.608  90.131  1.00 0.00 ? 93  A A N7     1  
ATOM 3347   C C5     . A A 1 104 ? 104.275 78.401  89.997  1.00 0.00 ? 93  A A C5     1  
ATOM 3348   C C6     . A A 1 104 ? 104.022 79.748  90.308  1.00 0.00 ? 93  A A C6     1  
ATOM 3349   N N6     . A A 1 104 ? 104.929 80.570  90.839  1.00 0.00 ? 93  A A N6     1  
ATOM 3350   N N1     . A A 1 104 ? 102.787 80.230  90.051  1.00 0.00 ? 93  A A N1     1  
ATOM 3351   C C2     . A A 1 104 ? 101.875 79.407  89.516  1.00 0.00 ? 93  A A C2     1  
ATOM 3352   N N3     . A A 1 104 ? 101.995 78.124  89.181  1.00 0.00 ? 93  A A N3     1  
ATOM 3353   C C4     . A A 1 104 ? 103.234 77.676  89.451  1.00 0.00 ? 93  A A C4     1  
ATOM 3354   H "H5'"  . A A 1 104 ? 104.628 71.607  89.058  1.00 0.00 ? 93  A A "H5'"  1  
ATOM 3355   H "H5''" . A A 1 104 ? 105.328 71.856  87.647  1.00 0.00 ? 93  A A "H5''" 1  
ATOM 3356   H "H4'"  . A A 1 104 ? 103.053 72.649  87.814  1.00 0.00 ? 93  A A "H4'"  1  
ATOM 3357   H "H3'"  . A A 1 104 ? 105.013 74.584  87.074  1.00 0.00 ? 93  A A "H3'"  1  
ATOM 3358   H "H2'"  . A A 1 104 ? 103.323 76.112  86.778  1.00 0.00 ? 93  A A "H2'"  1  
ATOM 3359   H "HO2'" . A A 1 104 ? 101.137 75.524  86.780  1.00 0.00 ? 93  A A "HO2'" 1  
ATOM 3360   H "H1'"  . A A 1 104 ? 102.048 75.313  88.954  1.00 0.00 ? 93  A A "H1'"  1  
ATOM 3361   H H8     . A A 1 104 ? 105.624 75.663  89.635  1.00 0.00 ? 93  A A H8     1  
ATOM 3362   H H61    . A A 1 104 ? 104.693 81.501  91.033  1.00 0.00 ? 93  A A H61    1  
ATOM 3363   H H62    . A A 1 104 ? 105.832 80.242  91.034  1.00 0.00 ? 93  A A H62    1  
ATOM 3364   H H2     . A A 1 104 ? 100.995 79.805  89.349  1.00 0.00 ? 93  A A H2     1  
ATOM 3365   P P      . G A 1 105 ? 105.394 72.924  85.015  1.00 0.00 ? 94  G A P      1  
ATOM 3366   O OP1    . G A 1 105 ? 103.996 72.859  84.516  1.00 0.00 ? 94  G A OP1    1  
ATOM 3367   O OP2    . G A 1 105 ? 106.217 71.688  85.055  1.00 0.00 ? 94  G A OP2    1  
ATOM 3368   O "O5'"  . G A 1 105 ? 106.176 74.009  84.150  1.00 0.00 ? 94  G A "O5'"  1  
ATOM 3369   C "C5'"  . G A 1 105 ? 105.618 74.529  82.953  1.00 0.00 ? 94  G A "C5'"  1  
ATOM 3370   C "C4'"  . G A 1 105 ? 105.695 76.034  82.913  1.00 0.00 ? 94  G A "C4'"  1  
ATOM 3371   O "O4'"  . G A 1 105 ? 105.444 76.572  84.240  1.00 0.00 ? 94  G A "O4'"  1  
ATOM 3372   C "C3'"  . G A 1 105 ? 107.043 76.623  82.527  1.00 0.00 ? 94  G A "C3'"  1  
ATOM 3373   O "O3'"  . G A 1 105 ? 107.226 76.715  81.123  1.00 0.00 ? 94  G A "O3'"  1  
ATOM 3374   C "C2'"  . G A 1 105 ? 107.004 77.992  83.203  1.00 0.00 ? 94  G A "C2'"  1  
ATOM 3375   O "O2'"  . G A 1 105 ? 106.206 78.907  82.464  1.00 0.00 ? 94  G A "O2'"  1  
ATOM 3376   C "C1'"  . G A 1 105 ? 106.291 77.645  84.517  1.00 0.00 ? 94  G A "C1'"  1  
ATOM 3377   N N9     . G A 1 105 ? 107.234 77.201  85.559  1.00 0.00 ? 94  G A N9     1  
ATOM 3378   C C8     . G A 1 105 ? 107.224 76.004  86.238  1.00 0.00 ? 94  G A C8     1  
ATOM 3379   N N7     . G A 1 105 ? 108.191 75.900  87.108  1.00 0.00 ? 94  G A N7     1  
ATOM 3380   C C5     . G A 1 105 ? 108.883 77.097  86.998  1.00 0.00 ? 94  G A C5     1  
ATOM 3381   C C6     . G A 1 105 ? 110.033 77.561  87.691  1.00 0.00 ? 94  G A C6     1  
ATOM 3382   O O6     . G A 1 105 ? 110.687 76.985  88.568  1.00 0.00 ? 94  G A O6     1  
ATOM 3383   N N1     . G A 1 105 ? 110.405 78.834  87.271  1.00 0.00 ? 94  G A N1     1  
ATOM 3384   C C2     . G A 1 105 ? 109.756 79.567  86.307  1.00 0.00 ? 94  G A C2     1  
ATOM 3385   N N2     . G A 1 105 ? 110.265 80.777  86.036  1.00 0.00 ? 94  G A N2     1  
ATOM 3386   N N3     . G A 1 105 ? 108.684 79.146  85.654  1.00 0.00 ? 94  G A N3     1  
ATOM 3387   C C4     . G A 1 105 ? 108.307 77.912  86.047  1.00 0.00 ? 94  G A C4     1  
ATOM 3388   H "H5'"  . G A 1 105 ? 104.678 74.254  82.893  1.00 0.00 ? 94  G A "H5'"  1  
ATOM 3389   H "H5''" . G A 1 105 ? 106.107 74.162  82.187  1.00 0.00 ? 94  G A "H5''" 1  
ATOM 3390   H "H4'"  . G A 1 105 ? 105.012 76.374  82.297  1.00 0.00 ? 94  G A "H4'"  1  
ATOM 3391   H "H3'"  . G A 1 105 ? 107.766 76.087  82.911  1.00 0.00 ? 94  G A "H3'"  1  
ATOM 3392   H "H2'"  . G A 1 105 ? 107.907 78.341  83.360  1.00 0.00 ? 94  G A "H2'"  1  
ATOM 3393   H "HO2'" . G A 1 105 ? 106.118 78.582  81.544  1.00 0.00 ? 94  G A "HO2'" 1  
ATOM 3394   H "H1'"  . G A 1 105 ? 105.796 78.427  84.835  1.00 0.00 ? 94  G A "H1'"  1  
ATOM 3395   H H8     . G A 1 105 ? 106.557 75.304  86.085  1.00 0.00 ? 94  G A H8     1  
ATOM 3396   H H1     . G A 1 105 ? 111.190 79.236  87.695  1.00 0.00 ? 94  G A H1     1  
ATOM 3397   H H21    . G A 1 105 ? 111.058 81.098  86.515  1.00 0.00 ? 94  G A H21    1  
ATOM 3398   H H22    . G A 1 105 ? 109.845 81.346  85.357  1.00 0.00 ? 94  G A H22    1  
ATOM 3399   P P      . G A 1 106 ? 108.702 76.899  80.528  1.00 0.00 ? 95  G A P      1  
ATOM 3400   O OP1    . G A 1 106 ? 108.528 77.111  79.068  1.00 0.00 ? 95  G A OP1    1  
ATOM 3401   O OP2    . G A 1 106 ? 109.485 75.733  81.012  1.00 0.00 ? 95  G A OP2    1  
ATOM 3402   O "O5'"  . G A 1 106 ? 109.348 78.212  81.139  1.00 0.00 ? 95  G A "O5'"  1  
ATOM 3403   C "C5'"  . G A 1 106 ? 109.289 79.426  80.428  1.00 0.00 ? 95  G A "C5'"  1  
ATOM 3404   C "C4'"  . G A 1 106 ? 110.446 80.303  80.821  1.00 0.00 ? 95  G A "C4'"  1  
ATOM 3405   O "O4'"  . G A 1 106 ? 110.467 80.483  82.259  1.00 0.00 ? 95  G A "O4'"  1  
ATOM 3406   C "C3'"  . G A 1 106 ? 111.830 79.757  80.535  1.00 0.00 ? 95  G A "C3'"  1  
ATOM 3407   O "O3'"  . G A 1 106 ? 112.211 79.912  79.197  1.00 0.00 ? 95  G A "O3'"  1  
ATOM 3408   C "C2'"  . G A 1 106 ? 112.678 80.621  81.437  1.00 0.00 ? 95  G A "C2'"  1  
ATOM 3409   O "O2'"  . G A 1 106 ? 112.855 81.928  80.914  1.00 0.00 ? 95  G A "O2'"  1  
ATOM 3410   C "C1'"  . G A 1 106 ? 111.810 80.638  82.694  1.00 0.00 ? 95  G A "C1'"  1  
ATOM 3411   N N9     . G A 1 106 ? 112.135 79.553  83.617  1.00 0.00 ? 95  G A N9     1  
ATOM 3412   C C8     . G A 1 106 ? 111.440 78.390  83.817  1.00 0.00 ? 95  G A C8     1  
ATOM 3413   N N7     . G A 1 106 ? 111.981 77.621  84.724  1.00 0.00 ? 95  G A N7     1  
ATOM 3414   C C5     . G A 1 106 ? 113.104 78.326  85.145  1.00 0.00 ? 95  G A C5     1  
ATOM 3415   C C6     . G A 1 106 ? 114.091 78.005  86.126  1.00 0.00 ? 95  G A C6     1  
ATOM 3416   O O6     . G A 1 106 ? 114.174 77.018  86.854  1.00 0.00 ? 95  G A O6     1  
ATOM 3417   N N1     . G A 1 106 ? 115.051 78.996  86.219  1.00 0.00 ? 95  G A N1     1  
ATOM 3418   C C2     . G A 1 106 ? 115.060 80.140  85.486  1.00 0.00 ? 95  G A C2     1  
ATOM 3419   N N2     . G A 1 106 ? 116.060 80.963  85.720  1.00 0.00 ? 95  G A N2     1  
ATOM 3420   N N3     . G A 1 106 ? 114.154 80.460  84.585  1.00 0.00 ? 95  G A N3     1  
ATOM 3421   C C4     . G A 1 106 ? 113.211 79.513  84.464  1.00 0.00 ? 95  G A C4     1  
ATOM 3422   H "H5'"  . G A 1 106 ? 108.445 79.877  80.633  1.00 0.00 ? 95  G A "H5'"  1  
ATOM 3423   H "H5''" . G A 1 106 ? 109.326 79.236  79.467  1.00 0.00 ? 95  G A "H5''" 1  
ATOM 3424   H "H4'"  . G A 1 106 ? 110.339 81.180  80.395  1.00 0.00 ? 95  G A "H4'"  1  
ATOM 3425   H "H3'"  . G A 1 106 ? 111.854 78.806  80.767  1.00 0.00 ? 95  G A "H3'"  1  
ATOM 3426   H "H2'"  . G A 1 106 ? 113.539 80.199  81.637  1.00 0.00 ? 95  G A "H2'"  1  
ATOM 3427   H "HO2'" . G A 1 106 ? 112.673 81.913  79.952  1.00 0.00 ? 95  G A "HO2'" 1  
ATOM 3428   H "H1'"  . G A 1 106 ? 111.922 81.497  83.153  1.00 0.00 ? 95  G A "H1'"  1  
ATOM 3429   H H8     . G A 1 106 ? 110.623 78.156  83.332  1.00 0.00 ? 95  G A H8     1  
ATOM 3430   H H1     . G A 1 106 ? 115.778 78.861  86.861  1.00 0.00 ? 95  G A H1     1  
ATOM 3431   H H21    . G A 1 106 ? 116.739 80.736  86.387  1.00 0.00 ? 95  G A H21    1  
ATOM 3432   H H22    . G A 1 106 ? 116.126 81.807  85.224  1.00 0.00 ? 95  G A H22    1  
ATOM 3433   P P      . G A 1 107 ? 113.072 78.755  78.486  1.00 0.00 ? 96  G A P      1  
ATOM 3434   O OP1    . G A 1 107 ? 113.293 79.158  77.066  1.00 0.00 ? 96  G A OP1    1  
ATOM 3435   O OP2    . G A 1 107 ? 112.493 77.421  78.800  1.00 0.00 ? 96  G A OP2    1  
ATOM 3436   O "O5'"  . G A 1 107 ? 114.489 78.860  79.181  1.00 0.00 ? 96  G A "O5'"  1  
ATOM 3437   C "C5'"  . G A 1 107 ? 115.300 80.001  78.966  1.00 0.00 ? 96  G A "C5'"  1  
ATOM 3438   C "C4'"  . G A 1 107 ? 116.541 79.908  79.809  1.00 0.00 ? 96  G A "C4'"  1  
ATOM 3439   O "O4'"  . G A 1 107 ? 116.166 79.909  81.214  1.00 0.00 ? 96  G A "O4'"  1  
ATOM 3440   C "C3'"  . G A 1 107 ? 117.343 78.633  79.673  1.00 0.00 ? 96  G A "C3'"  1  
ATOM 3441   O "O3'"  . G A 1 107 ? 118.166 78.646  78.518  1.00 0.00 ? 96  G A "O3'"  1  
ATOM 3442   C "C2'"  . G A 1 107 ? 118.148 78.676  80.954  1.00 0.00 ? 96  G A "C2'"  1  
ATOM 3443   O "O2'"  . G A 1 107 ? 119.184 79.634  80.891  1.00 0.00 ? 96  G A "O2'"  1  
ATOM 3444   C "C1'"  . G A 1 107 ? 117.080 79.129  81.944  1.00 0.00 ? 96  G A "C1'"  1  
ATOM 3445   N N9     . G A 1 107 ? 116.361 77.994  82.492  1.00 0.00 ? 96  G A N9     1  
ATOM 3446   C C8     . G A 1 107 ? 115.193 77.456  82.040  1.00 0.00 ? 96  G A C8     1  
ATOM 3447   N N7     . G A 1 107 ? 114.818 76.416  82.724  1.00 0.00 ? 96  G A N7     1  
ATOM 3448   C C5     . G A 1 107 ? 115.806 76.267  83.689  1.00 0.00 ? 96  G A C5     1  
ATOM 3449   C C6     . G A 1 107 ? 115.958 75.297  84.728  1.00 0.00 ? 96  G A C6     1  
ATOM 3450   O O6     . G A 1 107 ? 115.230 74.341  85.025  1.00 0.00 ? 96  G A O6     1  
ATOM 3451   N N1     . G A 1 107 ? 117.108 75.528  85.473  1.00 0.00 ? 96  G A N1     1  
ATOM 3452   C C2     . G A 1 107 ? 117.987 76.550  85.263  1.00 0.00 ? 96  G A C2     1  
ATOM 3453   N N2     . G A 1 107 ? 119.028 76.609  86.097  1.00 0.00 ? 96  G A N2     1  
ATOM 3454   N N3     . G A 1 107 ? 117.855 77.451  84.308  1.00 0.00 ? 96  G A N3     1  
ATOM 3455   C C4     . G A 1 107 ? 116.752 77.244  83.561  1.00 0.00 ? 96  G A C4     1  
ATOM 3456   H "H5'"  . G A 1 107 ? 114.791 80.803  79.203  1.00 0.00 ? 96  G A "H5'"  1  
ATOM 3457   H "H5''" . G A 1 107 ? 115.542 80.047  78.018  1.00 0.00 ? 96  G A "H5''" 1  
ATOM 3458   H "H4'"  . G A 1 107 ? 117.108 80.688  79.627  1.00 0.00 ? 96  G A "H4'"  1  
ATOM 3459   H "H3'"  . G A 1 107 ? 116.732 77.871  79.634  1.00 0.00 ? 96  G A "H3'"  1  
ATOM 3460   H "H2'"  . G A 1 107 ? 118.494 77.790  81.190  1.00 0.00 ? 96  G A "H2'"  1  
ATOM 3461   H "HO2'" . G A 1 107 ? 119.984 79.265  81.320  1.00 0.00 ? 96  G A "HO2'" 1  
ATOM 3462   H "H1'"  . G A 1 107 ? 117.500 79.638  82.667  1.00 0.00 ? 96  G A "H1'"  1  
ATOM 3463   H H8     . G A 1 107 ? 114.688 77.810  81.279  1.00 0.00 ? 96  G A H8     1  
ATOM 3464   H H1     . G A 1 107 ? 117.302 74.906  86.205  1.00 0.00 ? 96  G A H1     1  
ATOM 3465   H H21    . G A 1 107 ? 119.128 75.942  86.808  1.00 0.00 ? 96  G A H21    1  
ATOM 3466   H H22    . G A 1 107 ? 119.694 77.323  86.001  1.00 0.00 ? 96  G A H22    1  
ATOM 3467   P P      . A A 1 108 ? 118.297 77.311  77.642  1.00 0.00 ? 97  A A P      1  
ATOM 3468   O OP1    . A A 1 108 ? 119.443 77.479  76.718  1.00 0.00 ? 97  A A OP1    1  
ATOM 3469   O OP2    . A A 1 108 ? 116.955 76.978  77.112  1.00 0.00 ? 97  A A OP2    1  
ATOM 3470   O "O5'"  . A A 1 108 ? 118.659 76.171  78.689  1.00 0.00 ? 97  A A "O5'"  1  
ATOM 3471   C "C5'"  . A A 1 108 ? 118.960 74.847  78.255  1.00 0.00 ? 97  A A "C5'"  1  
ATOM 3472   C "C4'"  . A A 1 108 ? 120.321 74.423  78.770  1.00 0.00 ? 97  A A "C4'"  1  
ATOM 3473   O "O4'"  . A A 1 108 ? 121.300 75.308  78.192  1.00 0.00 ? 97  A A "O4'"  1  
ATOM 3474   C "C3'"  . A A 1 108 ? 120.492 74.639  80.259  1.00 0.00 ? 97  A A "C3'"  1  
ATOM 3475   O "O3'"  . A A 1 108 ? 120.035 73.507  80.958  1.00 0.00 ? 97  A A "O3'"  1  
ATOM 3476   C "C2'"  . A A 1 108 ? 121.994 74.837  80.421  1.00 0.00 ? 97  A A "C2'"  1  
ATOM 3477   O "O2'"  . A A 1 108 ? 122.688 73.633  80.649  1.00 0.00 ? 97  A A "O2'"  1  
ATOM 3478   C "C1'"  . A A 1 108 ? 122.393 75.427  79.071  1.00 0.00 ? 97  A A "C1'"  1  
ATOM 3479   N N9     . A A 1 108 ? 122.762 76.834  79.080  1.00 0.00 ? 97  A A N9     1  
ATOM 3480   C C8     . A A 1 108 ? 122.120 77.821  78.389  1.00 0.00 ? 97  A A C8     1  
ATOM 3481   N N7     . A A 1 108 ? 122.668 79.007  78.516  1.00 0.00 ? 97  A A N7     1  
ATOM 3482   C C5     . A A 1 108 ? 123.740 78.783  79.363  1.00 0.00 ? 97  A A C5     1  
ATOM 3483   C C6     . A A 1 108 ? 124.714 79.638  79.885  1.00 0.00 ? 97  A A C6     1  
ATOM 3484   N N6     . A A 1 108 ? 124.771 80.955  79.624  1.00 0.00 ? 97  A A N6     1  
ATOM 3485   N N1     . A A 1 108 ? 125.645 79.098  80.695  1.00 0.00 ? 97  A A N1     1  
ATOM 3486   C C2     . A A 1 108 ? 125.585 77.789  80.960  1.00 0.00 ? 97  A A C2     1  
ATOM 3487   N N3     . A A 1 108 ? 124.711 76.874  80.534  1.00 0.00 ? 97  A A N3     1  
ATOM 3488   C C4     . A A 1 108 ? 123.806 77.446  79.727  1.00 0.00 ? 97  A A C4     1  
ATOM 3489   H "H5'"  . A A 1 108 ? 118.955 74.821  77.275  1.00 0.00 ? 97  A A "H5'"  1  
ATOM 3490   H "H5''" . A A 1 108 ? 118.274 74.234  78.595  1.00 0.00 ? 97  A A "H5''" 1  
ATOM 3491   H "H4'"  . A A 1 108 ? 120.495 73.501  78.486  1.00 0.00 ? 97  A A "H4'"  1  
ATOM 3492   H "H3'"  . A A 1 108 ? 119.994 75.438  80.527  1.00 0.00 ? 97  A A "H3'"  1  
ATOM 3493   H "H2'"  . A A 1 108 ? 122.197 75.491  81.123  1.00 0.00 ? 97  A A "H2'"  1  
ATOM 3494   H "HO2'" . A A 1 108 ? 122.055 72.957  80.972  1.00 0.00 ? 97  A A "HO2'" 1  
ATOM 3495   H "H1'"  . A A 1 108 ? 123.152 74.923  78.707  1.00 0.00 ? 97  A A "H1'"  1  
ATOM 3496   H H8     . A A 1 108 ? 121.325 77.655  77.837  1.00 0.00 ? 97  A A H8     1  
ATOM 3497   H H61    . A A 1 108 ? 125.481 81.501  80.017  1.00 0.00 ? 97  A A H61    1  
ATOM 3498   H H62    . A A 1 108 ? 124.104 81.367  79.035  1.00 0.00 ? 97  A A H62    1  
ATOM 3499   H H2     . A A 1 108 ? 126.288 77.452  81.557  1.00 0.00 ? 97  A A H2     1  
ATOM 3500   P P      . A A 1 109 ? 119.100 73.717  82.225  1.00 0.00 ? 98  A A P      1  
ATOM 3501   O OP1    . A A 1 109 ? 118.428 72.444  82.609  1.00 0.00 ? 98  A A OP1    1  
ATOM 3502   O OP2    . A A 1 109 ? 118.306 74.940  81.988  1.00 0.00 ? 98  A A OP2    1  
ATOM 3503   O "O5'"  . A A 1 109 ? 120.152 74.039  83.360  1.00 0.00 ? 98  A A "O5'"  1  
ATOM 3504   C "C5'"  . A A 1 109 ? 121.111 73.067  83.732  1.00 0.00 ? 98  A A "C5'"  1  
ATOM 3505   C "C4'"  . A A 1 109 ? 122.313 73.749  84.291  1.00 0.00 ? 98  A A "C4'"  1  
ATOM 3506   O "O4'"  . A A 1 109 ? 122.700 74.749  83.336  1.00 0.00 ? 98  A A "O4'"  1  
ATOM 3507   C "C3'"  . A A 1 109 ? 122.075 74.558  85.550  1.00 0.00 ? 98  A A "C3'"  1  
ATOM 3508   O "O3'"  . A A 1 109 ? 122.124 73.720  86.701  1.00 0.00 ? 98  A A "O3'"  1  
ATOM 3509   C "C2'"  . A A 1 109 ? 123.227 75.556  85.506  1.00 0.00 ? 98  A A "C2'"  1  
ATOM 3510   O "O2'"  . A A 1 109 ? 124.418 75.025  86.046  1.00 0.00 ? 98  A A "O2'"  1  
ATOM 3511   C "C1'"  . A A 1 109 ? 123.369 75.795  83.995  1.00 0.00 ? 98  A A "C1'"  1  
ATOM 3512   N N9     . A A 1 109 ? 122.756 77.031  83.525  1.00 0.00 ? 98  A A N9     1  
ATOM 3513   C C8     . A A 1 109 ? 121.479 77.165  83.048  1.00 0.00 ? 98  A A C8     1  
ATOM 3514   N N7     . A A 1 109 ? 121.177 78.392  82.694  1.00 0.00 ? 98  A A N7     1  
ATOM 3515   C C5     . A A 1 109 ? 122.336 79.110  82.951  1.00 0.00 ? 98  A A C5     1  
ATOM 3516   C C6     . A A 1 109 ? 122.667 80.460  82.798  1.00 0.00 ? 98  A A C6     1  
ATOM 3517   N N6     . A A 1 109 ? 121.842 81.378  82.328  1.00 0.00 ? 98  A A N6     1  
ATOM 3518   N N1     . A A 1 109 ? 123.899 80.842  83.149  1.00 0.00 ? 98  A A N1     1  
ATOM 3519   C C2     . A A 1 109 ? 124.747 79.929  83.624  1.00 0.00 ? 98  A A C2     1  
ATOM 3520   N N3     . A A 1 109 ? 124.557 78.635  83.819  1.00 0.00 ? 98  A A N3     1  
ATOM 3521   C C4     . A A 1 109 ? 123.318 78.282  83.459  1.00 0.00 ? 98  A A C4     1  
ATOM 3522   H "H5'"  . A A 1 109 ? 121.358 72.544  82.941  1.00 0.00 ? 98  A A "H5'"  1  
ATOM 3523   H "H5''" . A A 1 109 ? 120.721 72.467  84.401  1.00 0.00 ? 98  A A "H5''" 1  
ATOM 3524   H "H4'"  . A A 1 109 ? 123.029 73.088  84.406  1.00 0.00 ? 98  A A "H4'"  1  
ATOM 3525   H "H3'"  . A A 1 109 ? 121.202 74.999  85.487  1.00 0.00 ? 98  A A "H3'"  1  
ATOM 3526   H "H2'"  . A A 1 109 ? 122.987 76.400  85.940  1.00 0.00 ? 98  A A "H2'"  1  
ATOM 3527   H "HO2'" . A A 1 109 ? 125.122 75.704  85.992  1.00 0.00 ? 98  A A "HO2'" 1  
ATOM 3528   H "H1'"  . A A 1 109 ? 124.322 75.815  83.756  1.00 0.00 ? 98  A A "H1'"  1  
ATOM 3529   H H8     . A A 1 109 ? 120.846 76.418  82.983  1.00 0.00 ? 98  A A H8     1  
ATOM 3530   H H61    . A A 1 109 ? 122.138 82.307  82.246  1.00 0.00 ? 98  A A H61    1  
ATOM 3531   H H62    . A A 1 109 ? 120.932 81.128  82.060  1.00 0.00 ? 98  A A H62    1  
ATOM 3532   H H2     . A A 1 109 ? 125.635 80.265  83.861  1.00 0.00 ? 98  A A H2     1  
ATOM 3533   P P      . A A 1 110 ? 121.343 74.154  88.040  1.00 0.00 ? 99  A A P      1  
ATOM 3534   O OP1    . A A 1 110 ? 121.505 73.012  88.974  1.00 0.00 ? 99  A A OP1    1  
ATOM 3535   O OP2    . A A 1 110 ? 119.983 74.655  87.730  1.00 0.00 ? 99  A A OP2    1  
ATOM 3536   O "O5'"  . A A 1 110 ? 122.154 75.429  88.523  1.00 0.00 ? 99  A A "O5'"  1  
ATOM 3537   C "C5'"  . A A 1 110 ? 123.428 75.300  89.118  1.00 0.00 ? 99  A A "C5'"  1  
ATOM 3538   C "C4'"  . A A 1 110 ? 124.020 76.660  89.317  1.00 0.00 ? 99  A A "C4'"  1  
ATOM 3539   O "O4'"  . A A 1 110 ? 123.953 77.278  88.029  1.00 0.00 ? 99  A A "O4'"  1  
ATOM 3540   C "C3'"  . A A 1 110 ? 123.205 77.584  90.207  1.00 0.00 ? 99  A A "C3'"  1  
ATOM 3541   O "O3'"  . A A 1 110 ? 123.677 77.541  91.529  1.00 0.00 ? 99  A A "O3'"  1  
ATOM 3542   C "C2'"  . A A 1 110 ? 123.545 78.949  89.670  1.00 0.00 ? 99  A A "C2'"  1  
ATOM 3543   O "O2'"  . A A 1 110 ? 124.749 79.446  90.205  1.00 0.00 ? 99  A A "O2'"  1  
ATOM 3544   C "C1'"  . A A 1 110 ? 123.691 78.655  88.177  1.00 0.00 ? 99  A A "C1'"  1  
ATOM 3545   N N9     . A A 1 110 ? 122.493 78.975  87.395  1.00 0.00 ? 99  A A N9     1  
ATOM 3546   C C8     . A A 1 110 ? 121.330 78.258  87.265  1.00 0.00 ? 99  A A C8     1  
ATOM 3547   N N7     . A A 1 110 ? 120.452 78.833  86.477  1.00 0.00 ? 99  A A N7     1  
ATOM 3548   C C5     . A A 1 110 ? 121.080 79.997  86.064  1.00 0.00 ? 99  A A C5     1  
ATOM 3549   C C6     . A A 1 110 ? 120.684 81.032  85.208  1.00 0.00 ? 99  A A C6     1  
ATOM 3550   N N6     . A A 1 110 ? 119.508 81.077  84.589  1.00 0.00 ? 99  A A N6     1  
ATOM 3551   N N1     . A A 1 110 ? 121.550 82.041  85.002  1.00 0.00 ? 99  A A N1     1  
ATOM 3552   C C2     . A A 1 110 ? 122.731 82.009  85.626  1.00 0.00 ? 99  A A C2     1  
ATOM 3553   N N3     . A A 1 110 ? 123.215 81.089  86.450  1.00 0.00 ? 99  A A N3     1  
ATOM 3554   C C4     . A A 1 110 ? 122.331 80.098  86.625  1.00 0.00 ? 99  A A C4     1  
ATOM 3555   H "H5'"  . A A 1 110 ? 124.002 74.762  88.532  1.00 0.00 ? 99  A A "H5'"  1  
ATOM 3556   H "H5''" . A A 1 110 ? 123.335 74.841  89.979  1.00 0.00 ? 99  A A "H5''" 1  
ATOM 3557   H "H4'"  . A A 1 110 ? 124.947 76.561  89.616  1.00 0.00 ? 99  A A "H4'"  1  
ATOM 3558   H "H3'"  . A A 1 110 ? 122.262 77.315  90.172  1.00 0.00 ? 99  A A "H3'"  1  
ATOM 3559   H "H2'"  . A A 1 110 ? 122.809 79.583  89.806  1.00 0.00 ? 99  A A "H2'"  1  
ATOM 3560   H "HO2'" . A A 1 110 ? 125.469 79.308  89.554  1.00 0.00 ? 99  A A "HO2'" 1  
ATOM 3561   H "H1'"  . A A 1 110 ? 124.446 79.165  87.816  1.00 0.00 ? 99  A A "H1'"  1  
ATOM 3562   H H8     . A A 1 110 ? 121.169 77.405  87.716  1.00 0.00 ? 99  A A H8     1  
ATOM 3563   H H61    . A A 1 110 ? 119.293 81.830  84.000  1.00 0.00 ? 99  A A H61    1  
ATOM 3564   H H62    . A A 1 110 ? 118.858 80.355  84.719  1.00 0.00 ? 99  A A H62    1  
ATOM 3565   H H2     . A A 1 110 ? 123.322 82.769  85.451  1.00 0.00 ? 99  A A H2     1  
ATOM 3566   P P      . C A 1 111 ? 122.649 77.696  92.745  1.00 0.00 ? 100 C A P      1  
ATOM 3567   O OP1    . C A 1 111 ? 123.438 78.307  93.822  1.00 0.00 ? 100 C A OP1    1  
ATOM 3568   O OP2    . C A 1 111 ? 121.980 76.400  92.970  1.00 0.00 ? 100 C A OP2    1  
ATOM 3569   O "O5'"  . C A 1 111 ? 121.553 78.711  92.220  1.00 0.00 ? 100 C A "O5'"  1  
ATOM 3570   C "C5'"  . C A 1 111 ? 121.555 80.054  92.631  1.00 0.00 ? 100 C A "C5'"  1  
ATOM 3571   C "C4'"  . C A 1 111 ? 120.964 80.933  91.556  1.00 0.00 ? 100 C A "C4'"  1  
ATOM 3572   O "O4'"  . C A 1 111 ? 120.969 80.221  90.300  1.00 0.00 ? 100 C A "O4'"  1  
ATOM 3573   C "C3'"  . C A 1 111 ? 119.511 81.316  91.737  1.00 0.00 ? 100 C A "C3'"  1  
ATOM 3574   O "O3'"  . C A 1 111 ? 119.384 82.403  92.648  1.00 0.00 ? 100 C A "O3'"  1  
ATOM 3575   C "C2'"  . C A 1 111 ? 119.125 81.693  90.318  1.00 0.00 ? 100 C A "C2'"  1  
ATOM 3576   O "O2'"  . C A 1 111 ? 119.606 82.964  89.942  1.00 0.00 ? 100 C A "O2'"  1  
ATOM 3577   C "C1'"  . C A 1 111 ? 119.861 80.616  89.522  1.00 0.00 ? 100 C A "C1'"  1  
ATOM 3578   N N1     . C A 1 111 ? 119.013 79.439  89.291  1.00 0.00 ? 100 C A N1     1  
ATOM 3579   C C2     . C A 1 111 ? 117.960 79.561  88.421  1.00 0.00 ? 100 C A C2     1  
ATOM 3580   O O2     . C A 1 111 ? 117.796 80.622  87.851  1.00 0.00 ? 100 C A O2     1  
ATOM 3581   N N3     . C A 1 111 ? 117.139 78.522  88.217  1.00 0.00 ? 100 C A N3     1  
ATOM 3582   C C4     . C A 1 111 ? 117.366 77.380  88.841  1.00 0.00 ? 100 C A C4     1  
ATOM 3583   N N4     . C A 1 111 ? 116.539 76.380  88.614  1.00 0.00 ? 100 C A N4     1  
ATOM 3584   C C5     . C A 1 111 ? 118.454 77.213  89.732  1.00 0.00 ? 100 C A C5     1  
ATOM 3585   C C6     . C A 1 111 ? 119.247 78.260  89.924  1.00 0.00 ? 100 C A C6     1  
ATOM 3586   H "H5'"  . C A 1 111 ? 122.477 80.331  92.815  1.00 0.00 ? 100 C A "H5'"  1  
ATOM 3587   H "H5''" . C A 1 111 ? 121.027 80.137  93.451  1.00 0.00 ? 100 C A "H5''" 1  
ATOM 3588   H "H4'"  . C A 1 111 ? 121.516 81.739  91.470  1.00 0.00 ? 100 C A "H4'"  1  
ATOM 3589   H "H3'"  . C A 1 111 ? 119.010 80.541  92.064  1.00 0.00 ? 100 C A "H3'"  1  
ATOM 3590   H "H2'"  . C A 1 111 ? 118.158 81.634  90.180  1.00 0.00 ? 100 C A "H2'"  1  
ATOM 3591   H "HO2'" . C A 1 111 ? 119.813 83.481  90.748  1.00 0.00 ? 100 C A "HO2'" 1  
ATOM 3592   H "H1'"  . C A 1 111 ? 120.149 80.989  88.663  1.00 0.00 ? 100 C A "H1'"  1  
ATOM 3593   H H41    . C A 1 111 ? 115.786 76.499  88.000  1.00 0.00 ? 100 C A H41    1  
ATOM 3594   H H42    . C A 1 111 ? 116.679 75.521  89.062  1.00 0.00 ? 100 C A H42    1  
ATOM 3595   H H5     . C A 1 111 ? 118.613 76.358  90.183  1.00 0.00 ? 100 C A H5     1  
ATOM 3596   H H6     . C A 1 111 ? 120.009 78.171  90.535  1.00 0.00 ? 100 C A H6     1  
ATOM 3597   P P      . U A 1 112 ? 118.020 82.613  93.472  1.00 0.00 ? 101 U A P      1  
ATOM 3598   O OP1    . U A 1 112 ? 118.056 83.966  94.085  1.00 0.00 ? 101 U A OP1    1  
ATOM 3599   O OP2    . U A 1 112 ? 117.817 81.422  94.334  1.00 0.00 ? 101 U A OP2    1  
ATOM 3600   O "O5'"  . U A 1 112 ? 116.889 82.610  92.351  1.00 0.00 ? 101 U A "O5'"  1  
ATOM 3601   C "C5'"  . U A 1 112 ? 116.292 83.821  91.913  1.00 0.00 ? 101 U A "C5'"  1  
ATOM 3602   C "C4'"  . U A 1 112 ? 115.292 83.582  90.809  1.00 0.00 ? 101 U A "C4'"  1  
ATOM 3603   O "O4'"  . U A 1 112 ? 115.668 82.388  90.130  1.00 0.00 ? 101 U A "O4'"  1  
ATOM 3604   C "C3'"  . U A 1 112 ? 113.858 83.327  91.246  1.00 0.00 ? 101 U A "C3'"  1  
ATOM 3605   O "O3'"  . U A 1 112 ? 113.198 84.499  91.689  1.00 0.00 ? 101 U A "O3'"  1  
ATOM 3606   C "C2'"  . U A 1 112 ? 113.265 82.663  90.021  1.00 0.00 ? 101 U A "C2'"  1  
ATOM 3607   O "O2'"  . U A 1 112 ? 112.939 83.621  89.024  1.00 0.00 ? 101 U A "O2'"  1  
ATOM 3608   C "C1'"  . U A 1 112 ? 114.466 81.828  89.559  1.00 0.00 ? 101 U A "C1'"  1  
ATOM 3609   N N1     . U A 1 112 ? 114.307 80.389  89.880  1.00 0.00 ? 101 U A N1     1  
ATOM 3610   C C2     . U A 1 112 ? 113.302 79.703  89.222  1.00 0.00 ? 101 U A C2     1  
ATOM 3611   O O2     . U A 1 112 ? 112.562 80.226  88.408  1.00 0.00 ? 101 U A O2     1  
ATOM 3612   N N3     . U A 1 112 ? 113.193 78.374  89.551  1.00 0.00 ? 101 U A N3     1  
ATOM 3613   C C4     . U A 1 112 ? 113.967 77.673  90.451  1.00 0.00 ? 101 U A C4     1  
ATOM 3614   O O4     . U A 1 112 ? 113.743 76.476  90.638  1.00 0.00 ? 101 U A O4     1  
ATOM 3615   C C5     . U A 1 112 ? 114.986 78.446  91.093  1.00 0.00 ? 101 U A C5     1  
ATOM 3616   C C6     . U A 1 112 ? 115.116 79.742  90.791  1.00 0.00 ? 101 U A C6     1  
ATOM 3617   H "H5'"  . U A 1 112 ? 116.992 84.422  91.584  1.00 0.00 ? 101 U A "H5'"  1  
ATOM 3618   H "H5''" . U A 1 112 ? 115.836 84.245  92.670  1.00 0.00 ? 101 U A "H5''" 1  
ATOM 3619   H "H4'"  . U A 1 112 ? 115.320 84.339  90.188  1.00 0.00 ? 101 U A "H4'"  1  
ATOM 3620   H "H3'"  . U A 1 112 ? 113.856 82.690  91.990  1.00 0.00 ? 101 U A "H3'"  1  
ATOM 3621   H "H2'"  . U A 1 112 ? 112.494 82.105  90.253  1.00 0.00 ? 101 U A "H2'"  1  
ATOM 3622   H "HO2'" . U A 1 112 ? 112.722 84.473  89.458  1.00 0.00 ? 101 U A "HO2'" 1  
ATOM 3623   H "H1'"  . U A 1 112 ? 114.579 81.934  88.591  1.00 0.00 ? 101 U A "H1'"  1  
ATOM 3624   H H3     . U A 1 112 ? 112.487 77.869  89.096  1.00 0.00 ? 101 U A H3     1  
ATOM 3625   H H5     . U A 1 112 ? 115.584 78.029  91.747  1.00 0.00 ? 101 U A H5     1  
ATOM 3626   H H6     . U A 1 112 ? 115.820 80.250  91.244  1.00 0.00 ? 101 U A H6     1  
ATOM 3627   P P      . U A 1 113 ? 111.814 84.392  92.500  1.00 0.00 ? 102 U A P      1  
ATOM 3628   O OP1    . U A 1 113 ? 112.007 85.033  93.826  1.00 0.00 ? 102 U A OP1    1  
ATOM 3629   O OP2    . U A 1 113 ? 111.347 82.985  92.425  1.00 0.00 ? 102 U A OP2    1  
ATOM 3630   O "O5'"  . U A 1 113 ? 110.805 85.292  91.659  1.00 0.00 ? 102 U A "O5'"  1  
ATOM 3631   C "C5'"  . U A 1 113 ? 110.692 86.686  91.904  1.00 0.00 ? 102 U A "C5'"  1  
ATOM 3632   C "C4'"  . U A 1 113 ? 109.578 87.306  91.097  1.00 0.00 ? 102 U A "C4'"  1  
ATOM 3633   O "O4'"  . U A 1 113 ? 109.915 87.184  89.694  1.00 0.00 ? 102 U A "O4'"  1  
ATOM 3634   C "C3'"  . U A 1 113 ? 108.213 86.645  91.220  1.00 0.00 ? 102 U A "C3'"  1  
ATOM 3635   O "O3'"  . U A 1 113 ? 107.466 87.119  92.326  1.00 0.00 ? 102 U A "O3'"  1  
ATOM 3636   C "C2'"  . U A 1 113 ? 107.528 87.086  89.935  1.00 0.00 ? 102 U A "C2'"  1  
ATOM 3637   O "O2'"  . U A 1 113 ? 107.017 88.406  90.052  1.00 0.00 ? 102 U A "O2'"  1  
ATOM 3638   C "C1'"  . U A 1 113 ? 108.700 87.092  88.948  1.00 0.00 ? 102 U A "C1'"  1  
ATOM 3639   N N1     . U A 1 113 ? 108.715 85.885  88.086  1.00 0.00 ? 102 U A N1     1  
ATOM 3640   C C2     . U A 1 113 ? 107.754 85.806  87.095  1.00 0.00 ? 102 U A C2     1  
ATOM 3641   O O2     . U A 1 113 ? 106.916 86.671  86.909  1.00 0.00 ? 102 U A O2     1  
ATOM 3642   N N3     . U A 1 113 ? 107.807 84.672  86.321  1.00 0.00 ? 102 U A N3     1  
ATOM 3643   C C4     . U A 1 113 ? 108.702 83.630  86.434  1.00 0.00 ? 102 U A C4     1  
ATOM 3644   O O4     . U A 1 113 ? 108.619 82.675  85.660  1.00 0.00 ? 102 U A O4     1  
ATOM 3645   C C5     . U A 1 113 ? 109.667 83.780  87.480  1.00 0.00 ? 102 U A C5     1  
ATOM 3646   C C6     . U A 1 113 ? 109.639 84.875  88.247  1.00 0.00 ? 102 U A C6     1  
ATOM 3647   H "H5'"  . U A 1 113 ? 111.537 87.121  91.668  1.00 0.00 ? 102 U A "H5'"  1  
ATOM 3648   H "H5''" . U A 1 113 ? 110.513 86.830  92.857  1.00 0.00 ? 102 U A "H5''" 1  
ATOM 3649   H "H4'"  . U A 1 113 ? 109.503 88.252  91.337  1.00 0.00 ? 102 U A "H4'"  1  
ATOM 3650   H "H3'"  . U A 1 113 ? 108.324 85.672  91.209  1.00 0.00 ? 102 U A "H3'"  1  
ATOM 3651   H "H2'"  . U A 1 113 ? 106.833 86.452  89.663  1.00 0.00 ? 102 U A "H2'"  1  
ATOM 3652   H "HO2'" . U A 1 113 ? 106.584 88.657  89.209  1.00 0.00 ? 102 U A "HO2'" 1  
ATOM 3653   H "H1'"  . U A 1 113 ? 108.643 87.893  88.384  1.00 0.00 ? 102 U A "H1'"  1  
ATOM 3654   H H3     . U A 1 113 ? 107.135 84.595  85.613  1.00 0.00 ? 102 U A H3     1  
ATOM 3655   H H5     . U A 1 113 ? 110.343 83.087  87.632  1.00 0.00 ? 102 U A H5     1  
ATOM 3656   H H6     . U A 1 113 ? 110.309 84.954  88.957  1.00 0.00 ? 102 U A H6     1  
ATOM 3657   P P      . C A 1 114 ? 106.256 86.245  92.920  1.00 0.00 ? 103 C A P      1  
ATOM 3658   O OP1    . C A 1 114 ? 105.690 86.974  94.084  1.00 0.00 ? 103 C A OP1    1  
ATOM 3659   O OP2    . C A 1 114 ? 106.735 84.851  93.091  1.00 0.00 ? 103 C A OP2    1  
ATOM 3660   O "O5'"  . C A 1 114 ? 105.166 86.253  91.758  1.00 0.00 ? 103 C A "O5'"  1  
ATOM 3661   C "C5'"  . C A 1 114 ? 104.386 87.410  91.497  1.00 0.00 ? 103 C A "C5'"  1  
ATOM 3662   C "C4'"  . C A 1 114 ? 103.489 87.219  90.299  1.00 0.00 ? 103 C A "C4'"  1  
ATOM 3663   O "O4'"  . C A 1 114 ? 104.215 86.469  89.288  1.00 0.00 ? 103 C A "O4'"  1  
ATOM 3664   C "C3'"  . C A 1 114 ? 102.190 86.468  90.547  1.00 0.00 ? 103 C A "C3'"  1  
ATOM 3665   O "O3'"  . C A 1 114 ? 101.130 86.908  89.717  1.00 0.00 ? 103 C A "O3'"  1  
ATOM 3666   C "C2'"  . C A 1 114 ? 102.556 85.037  90.179  1.00 0.00 ? 103 C A "C2'"  1  
ATOM 3667   O "O2'"  . C A 1 114 ? 101.417 84.311  89.742  1.00 0.00 ? 103 C A "O2'"  1  
ATOM 3668   C "C1'"  . C A 1 114 ? 103.484 85.290  88.998  1.00 0.00 ? 103 C A "C1'"  1  
ATOM 3669   N N1     . C A 1 114 ? 104.469 84.195  88.811  1.00 0.00 ? 103 C A N1     1  
ATOM 3670   C C2     . C A 1 114 ? 104.320 83.348  87.707  1.00 0.00 ? 103 C A C2     1  
ATOM 3671   O O2     . C A 1 114 ? 103.376 83.534  86.923  1.00 0.00 ? 103 C A O2     1  
ATOM 3672   N N3     . C A 1 114 ? 105.204 82.343  87.513  1.00 0.00 ? 103 C A N3     1  
ATOM 3673   C C4     . C A 1 114 ? 106.209 82.163  88.370  1.00 0.00 ? 103 C A C4     1  
ATOM 3674   N N4     . C A 1 114 ? 107.058 81.158  88.140  1.00 0.00 ? 103 C A N4     1  
ATOM 3675   C C5     . C A 1 114 ? 106.388 83.007  89.503  1.00 0.00 ? 103 C A C5     1  
ATOM 3676   C C6     . C A 1 114 ? 105.508 83.999  89.683  1.00 0.00 ? 103 C A C6     1  
ATOM 3677   H "H5'"  . C A 1 114 ? 104.985 88.168  91.331  1.00 0.00 ? 103 C A "H5'"  1  
ATOM 3678   H "H5''" . C A 1 114 ? 103.833 87.606  92.282  1.00 0.00 ? 103 C A "H5''" 1  
ATOM 3679   H "H4'"  . C A 1 114 ? 103.248 88.099  89.942  1.00 0.00 ? 103 C A "H4'"  1  
ATOM 3680   H "H3'"  . C A 1 114 ? 101.972 86.506  91.502  1.00 0.00 ? 103 C A "H3'"  1  
ATOM 3681   H "H2'"  . C A 1 114 ? 103.014 84.584  90.916  1.00 0.00 ? 103 C A "H2'"  1  
ATOM 3682   H "HO2'" . C A 1 114 ? 101.492 83.384  90.049  1.00 0.00 ? 103 C A "HO2'" 1  
ATOM 3683   H "H1'"  . C A 1 114 ? 102.949 85.389  88.183  1.00 0.00 ? 103 C A "H1'"  1  
ATOM 3684   H H41    . C A 1 114 ? 106.931 80.579  87.359  1.00 0.00 ? 103 C A H41    1  
ATOM 3685   H H42    . C A 1 114 ? 107.807 81.001  88.751  1.00 0.00 ? 103 C A H42    1  
ATOM 3686   H H5     . C A 1 114 ? 107.131 82.868  90.127  1.00 0.00 ? 103 C A H5     1  
ATOM 3687   H H6     . C A 1 114 ? 105.614 84.590  90.456  1.00 0.00 ? 103 C A H6     1  
ATOM 3688   P P      . A A 1 115 ? 99.614  86.595  90.132  1.00 0.00 ? 104 A A P      1  
ATOM 3689   O OP1    . A A 1 115 ? 99.502  85.166  90.518  1.00 0.00 ? 104 A A OP1    1  
ATOM 3690   O OP2    . A A 1 115 ? 98.846  87.103  88.967  1.00 0.00 ? 104 A A OP2    1  
ATOM 3691   O "O5'"  . A A 1 115 ? 99.227  87.480  91.400  1.00 0.00 ? 104 A A "O5'"  1  
ATOM 3692   C "C5'"  . A A 1 115 ? 97.966  87.332  92.034  1.00 0.00 ? 104 A A "C5'"  1  
ATOM 3693   C "C4'"  . A A 1 115 ? 97.711  85.900  92.434  1.00 0.00 ? 104 A A "C4'"  1  
ATOM 3694   O "O4'"  . A A 1 115 ? 98.839  85.073  92.046  1.00 0.00 ? 104 A A "O4'"  1  
ATOM 3695   C "C3'"  . A A 1 115 ? 97.558  85.642  93.925  1.00 0.00 ? 104 A A "C3'"  1  
ATOM 3696   O "O3'"  . A A 1 115 ? 96.259  85.934  94.409  1.00 0.00 ? 104 A A "O3'"  1  
ATOM 3697   C "C2'"  . A A 1 115 ? 97.941  84.174  94.050  1.00 0.00 ? 104 A A "C2'"  1  
ATOM 3698   O "O2'"  . A A 1 115 ? 96.878  83.328  93.638  1.00 0.00 ? 104 A A "O2'"  1  
ATOM 3699   C "C1'"  . A A 1 115 ? 99.081  84.070  93.036  1.00 0.00 ? 104 A A "C1'"  1  
ATOM 3700   N N9     . A A 1 115 ? 100.402 84.286  93.659  1.00 0.00 ? 104 A A N9     1  
ATOM 3701   C C8     . A A 1 115 ? 101.193 85.406  93.592  1.00 0.00 ? 104 A A C8     1  
ATOM 3702   N N7     . A A 1 115 ? 102.318 85.298  94.252  1.00 0.00 ? 104 A A N7     1  
ATOM 3703   C C5     . A A 1 115 ? 102.266 84.020  94.793  1.00 0.00 ? 104 A A C5     1  
ATOM 3704   C C6     . A A 1 115 ? 103.162 83.297  95.601  1.00 0.00 ? 104 A A C6     1  
ATOM 3705   N N6     . A A 1 115 ? 104.331 83.779  96.026  1.00 0.00 ? 104 A A N6     1  
ATOM 3706   N N1     . A A 1 115 ? 102.805 82.046  95.966  1.00 0.00 ? 104 A A N1     1  
ATOM 3707   C C2     . A A 1 115 ? 101.630 81.562  95.542  1.00 0.00 ? 104 A A C2     1  
ATOM 3708   N N3     . A A 1 115 ? 100.707 82.145  94.779  1.00 0.00 ? 104 A A N3     1  
ATOM 3709   C C4     . A A 1 115 ? 101.091 83.386  94.435  1.00 0.00 ? 104 A A C4     1  
ATOM 3710   H "H5'"  . A A 1 115 ? 97.260  87.620  91.415  1.00 0.00 ? 104 A A "H5'"  1  
ATOM 3711   H "H5''" . A A 1 115 ? 97.940  87.897  92.832  1.00 0.00 ? 104 A A "H5''" 1  
ATOM 3712   H "H4'"  . A A 1 115 ? 96.907  85.579  91.973  1.00 0.00 ? 104 A A "H4'"  1  
ATOM 3713   H "H3'"  . A A 1 115 ? 98.213  86.186  94.414  1.00 0.00 ? 104 A A "H3'"  1  
ATOM 3714   H "H2'"  . A A 1 115 ? 98.246  83.957  94.957  1.00 0.00 ? 104 A A "H2'"  1  
ATOM 3715   H "HO2'" . A A 1 115 ? 96.040  83.832  93.667  1.00 0.00 ? 104 A A "HO2'" 1  
ATOM 3716   H "H1'"  . A A 1 115 ? 99.062  83.186  92.613  1.00 0.00 ? 104 A A "H1'"  1  
ATOM 3717   H H8     . A A 1 115 ? 100.940 86.211  93.093  1.00 0.00 ? 104 A A H8     1  
ATOM 3718   H H61    . A A 1 115 ? 104.912 83.226  96.589  1.00 0.00 ? 104 A A H61    1  
ATOM 3719   H H62    . A A 1 115 ? 104.609 84.683  95.773  1.00 0.00 ? 104 A A H62    1  
ATOM 3720   H H2     . A A 1 115 ? 101.421 80.651  95.835  1.00 0.00 ? 104 A A H2     1  
ATOM 3721   P P      . G A 1 116 ? 96.049  86.411  95.930  1.00 0.00 ? 105 G A P      1  
ATOM 3722   O OP1    . G A 1 116 ? 94.648  86.881  96.075  1.00 0.00 ? 105 G A OP1    1  
ATOM 3723   O OP2    . G A 1 116 ? 97.171  87.319  96.285  1.00 0.00 ? 105 G A OP2    1  
ATOM 3724   O "O5'"  . G A 1 116 ? 96.211  85.072  96.779  1.00 0.00 ? 105 G A "O5'"  1  
ATOM 3725   C "C5'"  . G A 1 116 ? 95.254  84.028  96.680  1.00 0.00 ? 105 G A "C5'"  1  
ATOM 3726   C "C4'"  . G A 1 116 ? 95.695  82.800  97.440  1.00 0.00 ? 105 G A "C4'"  1  
ATOM 3727   O "O4'"  . G A 1 116 ? 96.951  82.311  96.898  1.00 0.00 ? 105 G A "O4'"  1  
ATOM 3728   C "C3'"  . G A 1 116 ? 95.983  82.999  98.920  1.00 0.00 ? 105 G A "C3'"  1  
ATOM 3729   O "O3'"  . G A 1 116 ? 94.813  82.988  99.718  1.00 0.00 ? 105 G A "O3'"  1  
ATOM 3730   C "C2'"  . G A 1 116 ? 96.944  81.857  99.227  1.00 0.00 ? 105 G A "C2'"  1  
ATOM 3731   O "O2'"  . G A 1 116 ? 96.252  80.625  99.369  1.00 0.00 ? 105 G A "O2'"  1  
ATOM 3732   C "C1'"  . G A 1 116 ? 97.782  81.813  97.949  1.00 0.00 ? 105 G A "C1'"  1  
ATOM 3733   N N9     . G A 1 116 ? 99.011  82.621  98.061  1.00 0.00 ? 105 G A N9     1  
ATOM 3734   C C8     . G A 1 116 ? 99.262  83.840  97.479  1.00 0.00 ? 105 G A C8     1  
ATOM 3735   N N7     . G A 1 116 ? 100.444 84.312  97.761  1.00 0.00 ? 105 G A N7     1  
ATOM 3736   C C5     . G A 1 116 ? 101.010 83.347  98.582  1.00 0.00 ? 105 G A C5     1  
ATOM 3737   C C6     . G A 1 116 ? 102.284 83.303  99.206  1.00 0.00 ? 105 G A C6     1  
ATOM 3738   O O6     . G A 1 116 ? 103.197 84.135  99.155  1.00 0.00 ? 105 G A O6     1  
ATOM 3739   N N1     . G A 1 116 ? 102.450 82.139  99.951  1.00 0.00 ? 105 G A N1     1  
ATOM 3740   C C2     . G A 1 116 ? 101.511 81.146  100.082 1.00 0.00 ? 105 G A C2     1  
ATOM 3741   N N2     . G A 1 116 ? 101.854 80.099  100.846 1.00 0.00 ? 105 G A N2     1  
ATOM 3742   N N3     . G A 1 116 ? 100.320 81.175  99.505  1.00 0.00 ? 105 G A N3     1  
ATOM 3743   C C4     . G A 1 116 ? 100.139 82.295  98.777  1.00 0.00 ? 105 G A C4     1  
ATOM 3744   H "H5'"  . G A 1 116 ? 95.132  83.793  95.738  1.00 0.00 ? 105 G A "H5'"  1  
ATOM 3745   H "H5''" . G A 1 116 ? 94.401  84.340  97.045  1.00 0.00 ? 105 G A "H5''" 1  
ATOM 3746   H "H4'"  . G A 1 116 ? 95.011  82.103  97.341  1.00 0.00 ? 105 G A "H4'"  1  
ATOM 3747   H "H3'"  . G A 1 116 ? 96.449  83.851  99.044  1.00 0.00 ? 105 G A "H3'"  1  
ATOM 3748   H "H2'"  . G A 1 116 ? 97.497  82.055  100.011 1.00 0.00 ? 105 G A "H2'"  1  
ATOM 3749   H "HO2'" . G A 1 116 ? 96.891  79.927  99.618  1.00 0.00 ? 105 G A "HO2'" 1  
ATOM 3750   H "H1'"  . G A 1 116 ? 98.020  80.882  97.749  1.00 0.00 ? 105 G A "H1'"  1  
ATOM 3751   H H8     . G A 1 116 ? 98.618  84.308  96.907  1.00 0.00 ? 105 G A H8     1  
ATOM 3752   H H1     . G A 1 116 ? 103.303 82.024  100.420 1.00 0.00 ? 105 G A H1     1  
ATOM 3753   H H21    . G A 1 116 ? 102.734 80.070  101.276 1.00 0.00 ? 105 G A H21    1  
ATOM 3754   H H22    . G A 1 116 ? 101.225 79.358  100.975 1.00 0.00 ? 105 G A H22    1  
ATOM 3755   P P      . A A 1 117 ? 94.764  83.820  101.092 1.00 0.00 ? 106 A A P      1  
ATOM 3756   O OP1    . A A 1 117 ? 93.366  83.806  101.591 1.00 0.00 ? 106 A A OP1    1  
ATOM 3757   O OP2    . A A 1 117 ? 95.451  85.117  100.867 1.00 0.00 ? 106 A A OP2    1  
ATOM 3758   O "O5'"  . A A 1 117 ? 95.653  82.961  102.096 1.00 0.00 ? 106 A A "O5'"  1  
ATOM 3759   C "C5'"  . A A 1 117 ? 95.237  81.669  102.516 1.00 0.00 ? 106 A A "C5'"  1  
ATOM 3760   C "C4'"  . A A 1 117 ? 96.292  80.993  103.355 1.00 0.00 ? 106 A A "C4'"  1  
ATOM 3761   O "O4'"  . A A 1 117 ? 97.500  80.807  102.575 1.00 0.00 ? 106 A A "O4'"  1  
ATOM 3762   C "C3'"  . A A 1 117 ? 96.757  81.759  104.584 1.00 0.00 ? 106 A A "C3'"  1  
ATOM 3763   O "O3'"  . A A 1 117 ? 95.888  81.610  105.693 1.00 0.00 ? 106 A A "O3'"  1  
ATOM 3764   C "C2'"  . A A 1 117 ? 98.151  81.193  104.818 1.00 0.00 ? 106 A A "C2'"  1  
ATOM 3765   O "O2'"  . A A 1 117 ? 98.093  79.923  105.451 1.00 0.00 ? 106 A A "O2'"  1  
ATOM 3766   C "C1'"  . A A 1 117 ? 98.652  81.013  103.385 1.00 0.00 ? 106 A A "C1'"  1  
ATOM 3767   N N9     . A A 1 117 ? 99.418  82.182  102.912 1.00 0.00 ? 106 A A N9     1  
ATOM 3768   C C8     . A A 1 117 ? 99.003  83.174  102.059 1.00 0.00 ? 106 A A C8     1  
ATOM 3769   N N7     . A A 1 117 ? 99.916  84.085  101.825 1.00 0.00 ? 106 A A N7     1  
ATOM 3770   C C5     . A A 1 117 ? 101.006 83.668  102.576 1.00 0.00 ? 106 A A C5     1  
ATOM 3771   C C6     . A A 1 117 ? 102.292 84.202  102.756 1.00 0.00 ? 106 A A C6     1  
ATOM 3772   N N6     . A A 1 117 ? 102.716 85.325  102.170 1.00 0.00 ? 106 A A N6     1  
ATOM 3773   N N1     . A A 1 117 ? 103.141 83.539  103.571 1.00 0.00 ? 106 A A N1     1  
ATOM 3774   C C2     . A A 1 117 ? 102.716 82.414  104.159 1.00 0.00 ? 106 A A C2     1  
ATOM 3775   N N3     . A A 1 117 ? 101.532 81.812  104.066 1.00 0.00 ? 106 A A N3     1  
ATOM 3776   C C4     . A A 1 117 ? 100.713 82.497  103.251 1.00 0.00 ? 106 A A C4     1  
ATOM 3777   H "H5'"  . A A 1 117 ? 95.058  81.117  101.723 1.00 0.00 ? 106 A A "H5'"  1  
ATOM 3778   H "H5''" . A A 1 117 ? 94.414  81.751  103.039 1.00 0.00 ? 106 A A "H5''" 1  
ATOM 3779   H "H4'"  . A A 1 117 ? 95.958  80.114  103.637 1.00 0.00 ? 106 A A "H4'"  1  
ATOM 3780   H "H3'"  . A A 1 117 ? 96.831  82.710  104.361 1.00 0.00 ? 106 A A "H3'"  1  
ATOM 3781   H "H2'"  . A A 1 117 ? 98.714  81.821  105.318 1.00 0.00 ? 106 A A "H2'"  1  
ATOM 3782   H "HO2'" . A A 1 117 ? 99.002  79.621  105.647 1.00 0.00 ? 106 A A "HO2'" 1  
ATOM 3783   H "H1'"  . A A 1 117 ? 99.216  80.214  103.336 1.00 0.00 ? 106 A A "H1'"  1  
ATOM 3784   H H8     . A A 1 117 ? 98.107  83.197  101.661 1.00 0.00 ? 106 A A H8     1  
ATOM 3785   H H61    . A A 1 117 ? 103.626 85.650  102.335 1.00 0.00 ? 106 A A H61    1  
ATOM 3786   H H62    . A A 1 117 ? 102.118 85.823  101.575 1.00 0.00 ? 106 A A H62    1  
ATOM 3787   H H2     . A A 1 117 ? 103.369 81.970  104.738 1.00 0.00 ? 106 A A H2     1  
ATOM 3788   P P      . U A 1 118 ? 95.679  82.823  106.726 1.00 0.00 ? 107 U A P      1  
ATOM 3789   O OP1    . U A 1 118 ? 94.635  82.421  107.703 1.00 0.00 ? 107 U A OP1    1  
ATOM 3790   O OP2    . U A 1 118 ? 95.510  84.070  105.940 1.00 0.00 ? 107 U A OP2    1  
ATOM 3791   O "O5'"  . U A 1 118 ? 97.069  82.914  107.499 1.00 0.00 ? 107 U A "O5'"  1  
ATOM 3792   C "C5'"  . U A 1 118 ? 97.516  81.847  108.322 1.00 0.00 ? 107 U A "C5'"  1  
ATOM 3793   C "C4'"  . U A 1 118 ? 98.962  82.017  108.720 1.00 0.00 ? 107 U A "C4'"  1  
ATOM 3794   O "O4'"  . U A 1 118 ? 99.801  82.038  107.535 1.00 0.00 ? 107 U A "O4'"  1  
ATOM 3795   C "C3'"  . U A 1 118 ? 99.311  83.311  109.442 1.00 0.00 ? 107 U A "C3'"  1  
ATOM 3796   O "O3'"  . U A 1 118 ? 99.034  83.261  110.830 1.00 0.00 ? 107 U A "O3'"  1  
ATOM 3797   C "C2'"  . U A 1 118 ? 100.788 83.482  109.119 1.00 0.00 ? 107 U A "C2'"  1  
ATOM 3798   O "O2'"  . U A 1 118 ? 101.595 82.643  109.932 1.00 0.00 ? 107 U A "O2'"  1  
ATOM 3799   C "C1'"  . U A 1 118 ? 100.845 82.982  107.677 1.00 0.00 ? 107 U A "C1'"  1  
ATOM 3800   N N1     . U A 1 118 ? 100.693 84.081  106.691 1.00 0.00 ? 107 U A N1     1  
ATOM 3801   C C2     . U A 1 118 ? 101.796 84.881  106.465 1.00 0.00 ? 107 U A C2     1  
ATOM 3802   O O2     . U A 1 118 ? 102.865 84.720  107.029 1.00 0.00 ? 107 U A O2     1  
ATOM 3803   N N3     . U A 1 118 ? 101.608 85.885  105.546 1.00 0.00 ? 107 U A N3     1  
ATOM 3804   C C4     . U A 1 118 ? 100.456 86.166  104.846 1.00 0.00 ? 107 U A C4     1  
ATOM 3805   O O4     . U A 1 118 ? 100.446 87.109  104.051 1.00 0.00 ? 107 U A O4     1  
ATOM 3806   C C5     . U A 1 118 ? 99.355  85.296  105.130 1.00 0.00 ? 107 U A C5     1  
ATOM 3807   C C6     . U A 1 118 ? 99.510  84.310  106.020 1.00 0.00 ? 107 U A C6     1  
ATOM 3808   H "H5'"  . U A 1 118 ? 97.418  81.004  107.834 1.00 0.00 ? 107 U A "H5'"  1  
ATOM 3809   H "H5''" . U A 1 118 ? 96.966  81.815  109.132 1.00 0.00 ? 107 U A "H5''" 1  
ATOM 3810   H "H4'"  . U A 1 118 ? 99.224  81.260  109.283 1.00 0.00 ? 107 U A "H4'"  1  
ATOM 3811   H "H3'"  . U A 1 118 ? 98.807  84.049  109.039 1.00 0.00 ? 107 U A "H3'"  1  
ATOM 3812   H "H2'"  . U A 1 118 ? 101.064 84.422  109.184 1.00 0.00 ? 107 U A "H2'"  1  
ATOM 3813   H "HO2'" . U A 1 118 ? 101.084 82.379  110.724 1.00 0.00 ? 107 U A "HO2'" 1  
ATOM 3814   H "H1'"  . U A 1 118 ? 101.701 82.528  107.521 1.00 0.00 ? 107 U A "H1'"  1  
ATOM 3815   H H3     . U A 1 118 ? 102.380 86.465  105.370 1.00 0.00 ? 107 U A H3     1  
ATOM 3816   H H5     . U A 1 118 ? 98.496  85.424  104.677 1.00 0.00 ? 107 U A H5     1  
ATOM 3817   H H6     . U A 1 118 ? 98.743  83.731  106.199 1.00 0.00 ? 107 U A H6     1  
ATOM 3818   P P      . G A 1 119 ? 98.712  84.611  111.640 1.00 0.00 ? 108 G A P      1  
ATOM 3819   O OP1    . G A 1 119 ? 98.967  84.356  113.081 1.00 0.00 ? 108 G A OP1    1  
ATOM 3820   O OP2    . G A 1 119 ? 97.378  85.100  111.206 1.00 0.00 ? 108 G A OP2    1  
ATOM 3821   O "O5'"  . G A 1 119 ? 99.808  85.644  111.121 1.00 0.00 ? 108 G A "O5'"  1  
ATOM 3822   C "C5'"  . G A 1 119 ? 100.687 86.292  112.028 1.00 0.00 ? 108 G A "C5'"  1  
ATOM 3823   C "C4'"  . G A 1 119 ? 101.746 87.086  111.304 1.00 0.00 ? 108 G A "C4'"  1  
ATOM 3824   O "O4'"  . G A 1 119 ? 101.753 86.724  109.906 1.00 0.00 ? 108 G A "O4'"  1  
ATOM 3825   C "C3'"  . G A 1 119 ? 101.564 88.596  111.302 1.00 0.00 ? 108 G A "C3'"  1  
ATOM 3826   O "O3'"  . G A 1 119 ? 102.227 89.235  112.380 1.00 0.00 ? 108 G A "O3'"  1  
ATOM 3827   C "C2'"  . G A 1 119 ? 102.130 89.006  109.954 1.00 0.00 ? 108 G A "C2'"  1  
ATOM 3828   O "O2'"  . G A 1 119 ? 103.549 89.051  109.983 1.00 0.00 ? 108 G A "O2'"  1  
ATOM 3829   C "C1'"  . G A 1 119 ? 101.690 87.843  109.074 1.00 0.00 ? 108 G A "C1'"  1  
ATOM 3830   N N9     . G A 1 119 ? 100.296 87.988  108.617 1.00 0.00 ? 108 G A N9     1  
ATOM 3831   C C8     . G A 1 119 ? 99.291  87.054  108.700 1.00 0.00 ? 108 G A C8     1  
ATOM 3832   N N7     . G A 1 119 ? 98.157  87.474  108.208 1.00 0.00 ? 108 G A N7     1  
ATOM 3833   C C5     . G A 1 119 ? 98.428  88.763  107.773 1.00 0.00 ? 108 G A C5     1  
ATOM 3834   C C6     . G A 1 119 ? 97.584  89.720  107.152 1.00 0.00 ? 108 G A C6     1  
ATOM 3835   O O6     . G A 1 119 ? 96.390  89.614  106.851 1.00 0.00 ? 108 G A O6     1  
ATOM 3836   N N1     . G A 1 119 ? 98.266  90.902  106.877 1.00 0.00 ? 108 G A N1     1  
ATOM 3837   C C2     . G A 1 119 ? 99.589  91.135  107.164 1.00 0.00 ? 108 G A C2     1  
ATOM 3838   N N2     . G A 1 119 ? 100.069 92.340  106.822 1.00 0.00 ? 108 G A N2     1  
ATOM 3839   N N3     . G A 1 119 ? 100.386 90.251  107.742 1.00 0.00 ? 108 G A N3     1  
ATOM 3840   C C4     . G A 1 119 ? 99.744  89.097  108.018 1.00 0.00 ? 108 G A C4     1  
ATOM 3841   H "H5'"  . G A 1 119 ? 101.121 85.617  112.591 1.00 0.00 ? 108 G A "H5'"  1  
ATOM 3842   H "H5''" . G A 1 119 ? 100.168 86.897  112.599 1.00 0.00 ? 108 G A "H5''" 1  
ATOM 3843   H "H4'"  . G A 1 119 ? 102.621 86.875  111.692 1.00 0.00 ? 108 G A "H4'"  1  
ATOM 3844   H "H3'"  . G A 1 119 ? 100.607 88.804  111.322 1.00 0.00 ? 108 G A "H3'"  1  
ATOM 3845   H "H2'"  . G A 1 119 ? 101.746 89.853  109.645 1.00 0.00 ? 108 G A "H2'"  1  
ATOM 3846   H "HO2'" . G A 1 119 ? 103.845 89.202  110.905 1.00 0.00 ? 108 G A "HO2'" 1  
ATOM 3847   H "H1'"  . G A 1 119 ? 102.284 87.780  108.296 1.00 0.00 ? 108 G A "H1'"  1  
ATOM 3848   H H8     . G A 1 119 ? 99.413  86.163  109.089 1.00 0.00 ? 108 G A H8     1  
ATOM 3849   H H1     . G A 1 119 ? 97.761  91.623  106.446 1.00 0.00 ? 108 G A H1     1  
ATOM 3850   H H21    . G A 1 119 ? 99.485  92.999  106.393 1.00 0.00 ? 108 G A H21    1  
ATOM 3851   H H22    . G A 1 119 ? 101.007 92.562  107.002 1.00 0.00 ? 108 G A H22    1  
ATOM 3852   P P      . G A 1 120 ? 101.503 90.423  113.183 1.00 0.00 ? 109 G A P      1  
ATOM 3853   O OP1    . G A 1 120 ? 102.496 91.023  114.112 1.00 0.00 ? 109 G A OP1    1  
ATOM 3854   O OP2    . G A 1 120 ? 100.220 89.901  113.718 1.00 0.00 ? 109 G A OP2    1  
ATOM 3855   O "O5'"  . G A 1 120 ? 101.167 91.501  112.059 1.00 0.00 ? 109 G A "O5'"  1  
ATOM 3856   C "C5'"  . G A 1 120 ? 101.663 92.828  112.149 1.00 0.00 ? 109 G A "C5'"  1  
ATOM 3857   C "C4'"  . G A 1 120 ? 100.931 93.759  111.215 1.00 0.00 ? 109 G A "C4'"  1  
ATOM 3858   O "O4'"  . G A 1 120 ? 100.352 92.992  110.129 1.00 0.00 ? 109 G A "O4'"  1  
ATOM 3859   C "C3'"  . G A 1 120 ? 99.762  94.524  111.817 1.00 0.00 ? 109 G A "C3'"  1  
ATOM 3860   O "O3'"  . G A 1 120 ? 100.135 95.792  112.329 1.00 0.00 ? 109 G A "O3'"  1  
ATOM 3861   C "C2'"  . G A 1 120 ? 98.790  94.686  110.656 1.00 0.00 ? 109 G A "C2'"  1  
ATOM 3862   O "O2'"  . G A 1 120 ? 99.113  95.823  109.868 1.00 0.00 ? 109 G A "O2'"  1  
ATOM 3863   C "C1'"  . G A 1 120 ? 99.051  93.432  109.823 1.00 0.00 ? 109 G A "C1'"  1  
ATOM 3864   N N9     . G A 1 120 ? 98.104  92.346  110.142 1.00 0.00 ? 109 G A N9     1  
ATOM 3865   C C8     . G A 1 120 ? 98.325  91.265  110.961 1.00 0.00 ? 109 G A C8     1  
ATOM 3866   N N7     . G A 1 120 ? 97.294  90.468  111.049 1.00 0.00 ? 109 G A N7     1  
ATOM 3867   C C5     . G A 1 120 ? 96.334  91.059  110.240 1.00 0.00 ? 109 G A C5     1  
ATOM 3868   C C6     . G A 1 120 ? 95.007  90.654  109.941 1.00 0.00 ? 109 G A C6     1  
ATOM 3869   O O6     . G A 1 120 ? 94.397  89.657  110.345 1.00 0.00 ? 109 G A O6     1  
ATOM 3870   N N1     . G A 1 120 ? 94.382  91.545  109.075 1.00 0.00 ? 109 G A N1     1  
ATOM 3871   C C2     . G A 1 120 ? 94.958  92.682  108.562 1.00 0.00 ? 109 G A C2     1  
ATOM 3872   N N2     . G A 1 120 ? 94.194  93.418  107.741 1.00 0.00 ? 109 G A N2     1  
ATOM 3873   N N3     . G A 1 120 ? 96.193  93.071  108.833 1.00 0.00 ? 109 G A N3     1  
ATOM 3874   C C4     . G A 1 120 ? 96.818  92.219  109.673 1.00 0.00 ? 109 G A C4     1  
ATOM 3875   H "H5'"  . G A 1 120 ? 102.616 92.830  111.921 1.00 0.00 ? 109 G A "H5'"  1  
ATOM 3876   H "H5''" . G A 1 120 ? 101.555 93.148  113.070 1.00 0.00 ? 109 G A "H5''" 1  
ATOM 3877   H "H4'"  . G A 1 120 ? 101.569 94.405  110.847 1.00 0.00 ? 109 G A "H4'"  1  
ATOM 3878   H "H3'"  . G A 1 120 ? 99.335  93.971  112.503 1.00 0.00 ? 109 G A "H3'"  1  
ATOM 3879   H "H2'"  . G A 1 120 ? 97.860  94.713  110.966 1.00 0.00 ? 109 G A "H2'"  1  
ATOM 3880   H "HO2'" . G A 1 120 ? 99.535  96.498  110.440 1.00 0.00 ? 109 G A "HO2'" 1  
ATOM 3881   H "H1'"  . G A 1 120 ? 98.984  93.652  108.870 1.00 0.00 ? 109 G A "H1'"  1  
ATOM 3882   H H8     . G A 1 120 ? 99.170  91.106  111.431 1.00 0.00 ? 109 G A H8     1  
ATOM 3883   H H1     . G A 1 120 ? 93.459  91.345  108.812 1.00 0.00 ? 109 G A H1     1  
ATOM 3884   H H21    . G A 1 120 ? 93.278  93.137  107.535 1.00 0.00 ? 109 G A H21    1  
ATOM 3885   H H22    . G A 1 120 ? 94.552  94.240  107.345 1.00 0.00 ? 109 G A H22    1  
ATOM 3886   P P      . C A 1 121 ? 99.288  96.446  113.525 1.00 0.00 ? 110 C A P      1  
ATOM 3887   O OP1    . C A 1 121 ? 99.512  97.914  113.534 1.00 0.00 ? 110 C A OP1    1  
ATOM 3888   O OP2    . C A 1 121 ? 99.705  95.634  114.696 1.00 0.00 ? 110 C A OP2    1  
ATOM 3889   O "O5'"  . C A 1 121 ? 97.738  96.187  113.271 1.00 0.00 ? 110 C A "O5'"  1  
ATOM 3890   C "C5'"  . C A 1 121 ? 96.755  97.077  113.781 1.00 0.00 ? 110 C A "C5'"  1  
ATOM 3891   C "C4'"  . C A 1 121 ? 96.289  96.663  115.158 1.00 0.00 ? 110 C A "C4'"  1  
ATOM 3892   O "O4'"  . C A 1 121 ? 96.218  95.217  115.241 1.00 0.00 ? 110 C A "O4'"  1  
ATOM 3893   C "C3'"  . C A 1 121 ? 97.192  97.055  116.316 1.00 0.00 ? 110 C A "C3'"  1  
ATOM 3894   O "O3'"  . C A 1 121 ? 97.015  98.402  116.724 1.00 0.00 ? 110 C A "O3'"  1  
ATOM 3895   C "C2'"  . C A 1 121 ? 96.820  96.039  117.386 1.00 0.00 ? 110 C A "C2'"  1  
ATOM 3896   O "O2'"  . C A 1 121 ? 95.596  96.384  118.020 1.00 0.00 ? 110 C A "O2'"  1  
ATOM 3897   C "C1'"  . C A 1 121 ? 96.604  94.779  116.547 1.00 0.00 ? 110 C A "C1'"  1  
ATOM 3898   N N1     . C A 1 121 ? 97.823  93.934  116.476 1.00 0.00 ? 110 C A N1     1  
ATOM 3899   C C2     . C A 1 121 ? 98.150  93.148  117.587 1.00 0.00 ? 110 C A C2     1  
ATOM 3900   O O2     . C A 1 121 ? 97.420  93.179  118.590 1.00 0.00 ? 110 C A O2     1  
ATOM 3901   N N3     . C A 1 121 ? 99.256  92.368  117.549 1.00 0.00 ? 110 C A N3     1  
ATOM 3902   C C4     . C A 1 121 ? 100.025 92.354  116.460 1.00 0.00 ? 110 C A C4     1  
ATOM 3903   N N4     . C A 1 121 ? 101.106 91.569  116.468 1.00 0.00 ? 110 C A N4     1  
ATOM 3904   C C5     . C A 1 121 ? 99.720  93.142  115.316 1.00 0.00 ? 110 C A C5     1  
ATOM 3905   C C6     . C A 1 121 ? 98.621  93.909  115.365 1.00 0.00 ? 110 C A C6     1  
ATOM 3906   H "H5'"  . C A 1 121 ? 95.989  97.087  113.172 1.00 0.00 ? 110 C A "H5'"  1  
ATOM 3907   H "H5''" . C A 1 121 ? 97.137  97.978  113.831 1.00 0.00 ? 110 C A "H5''" 1  
ATOM 3908   H "H4'"  . C A 1 121 ? 95.395  97.034  115.310 1.00 0.00 ? 110 C A "H4'"  1  
ATOM 3909   H "H3'"  . C A 1 121 ? 98.126  96.919  116.056 1.00 0.00 ? 110 C A "H3'"  1  
ATOM 3910   H "H2'"  . C A 1 121 ? 97.542  95.918  118.036 1.00 0.00 ? 110 C A "H2'"  1  
ATOM 3911   H "HO2'" . C A 1 121 ? 95.417  97.335  117.874 1.00 0.00 ? 110 C A "HO2'" 1  
ATOM 3912   H "H1'"  . C A 1 121 ? 95.868  94.254  116.927 1.00 0.00 ? 110 C A "H1'"  1  
ATOM 3913   H H41    . C A 1 121 ? 101.314 91.029  117.258 1.00 0.00 ? 110 C A H41    1  
ATOM 3914   H H42    . C A 1 121 ? 101.692 91.536  115.683 1.00 0.00 ? 110 C A H42    1  
ATOM 3915   H H5     . C A 1 121 ? 100.292 93.124  114.520 1.00 0.00 ? 110 C A H5     1  
ATOM 3916   H H6     . C A 1 121 ? 98.396  94.458  114.587 1.00 0.00 ? 110 C A H6     1  
ATOM 3917   P P      . C A 1 122 ? 98.219  99.195  117.438 1.00 0.00 ? 111 C A P      1  
ATOM 3918   O OP1    . C A 1 122 ? 97.772  100.589 117.678 1.00 0.00 ? 111 C A OP1    1  
ATOM 3919   O OP2    . C A 1 122 ? 99.458  98.945  116.662 1.00 0.00 ? 111 C A OP2    1  
ATOM 3920   O "O5'"  . C A 1 122 ? 98.369  98.477  118.852 1.00 0.00 ? 111 C A "O5'"  1  
ATOM 3921   C "C5'"  . C A 1 122 ? 97.415  98.686  119.882 1.00 0.00 ? 111 C A "C5'"  1  
ATOM 3922   C "C4'"  . C A 1 122 ? 97.760  97.907  121.128 1.00 0.00 ? 111 C A "C4'"  1  
ATOM 3923   O "O4'"  . C A 1 122 ? 97.801  96.488  120.829 1.00 0.00 ? 111 C A "O4'"  1  
ATOM 3924   C "C3'"  . C A 1 122 ? 99.122  98.193  121.741 1.00 0.00 ? 111 C A "C3'"  1  
ATOM 3925   O "O3'"  . C A 1 122 ? 99.143  99.379  122.519 1.00 0.00 ? 111 C A "O3'"  1  
ATOM 3926   C "C2'"  . C A 1 122 ? 99.396  96.932  122.547 1.00 0.00 ? 111 C A "C2'"  1  
ATOM 3927   O "O2'"  . C A 1 122 ? 98.673  96.931  123.769 1.00 0.00 ? 111 C A "O2'"  1  
ATOM 3928   C "C1'"  . C A 1 122 ? 98.819  95.853  121.629 1.00 0.00 ? 111 C A "C1'"  1  
ATOM 3929   N N1     . C A 1 122 ? 99.858  95.231  120.770 1.00 0.00 ? 111 C A N1     1  
ATOM 3930   C C2     . C A 1 122 ? 100.713 94.282  121.340 1.00 0.00 ? 111 C A C2     1  
ATOM 3931   O O2     . C A 1 122 ? 100.580 93.989  122.540 1.00 0.00 ? 111 C A O2     1  
ATOM 3932   N N3     . C A 1 122 ? 101.668 93.699  120.578 1.00 0.00 ? 111 C A N3     1  
ATOM 3933   C C4     . C A 1 122 ? 101.789 94.030  119.292 1.00 0.00 ? 111 C A C4     1  
ATOM 3934   N N4     . C A 1 122 ? 102.746 93.431  118.578 1.00 0.00 ? 111 C A N4     1  
ATOM 3935   C C5     . C A 1 122 ? 100.936 94.993  118.682 1.00 0.00 ? 111 C A C5     1  
ATOM 3936   C C6     . C A 1 122 ? 99.995  95.560  119.445 1.00 0.00 ? 111 C A C6     1  
ATOM 3937   H "H5'"  . C A 1 122 ? 96.532  98.403  119.563 1.00 0.00 ? 111 C A "H5'"  1  
ATOM 3938   H "H5''" . C A 1 122 ? 97.385  99.640  120.100 1.00 0.00 ? 111 C A "H5''" 1  
ATOM 3939   H "H4'"  . C A 1 122 ? 97.068  98.069  121.803 1.00 0.00 ? 111 C A "H4'"  1  
ATOM 3940   H "H3'"  . C A 1 122 ? 99.788  98.269  121.026 1.00 0.00 ? 111 C A "H3'"  1  
ATOM 3941   H "H2'"  . C A 1 122 ? 100.357 96.800  122.695 1.00 0.00 ? 111 C A "H2'"  1  
ATOM 3942   H "HO2'" . C A 1 122 ? 98.412  97.849  123.985 1.00 0.00 ? 111 C A "HO2'" 1  
ATOM 3943   H "H1'"  . C A 1 122 ? 98.391  95.158  122.170 1.00 0.00 ? 111 C A "H1'"  1  
ATOM 3944   H H41    . C A 1 122 ? 103.332 92.770  119.003 1.00 0.00 ? 111 C A H41    1  
ATOM 3945   H H42    . C A 1 122 ? 102.861 93.652  117.632 1.00 0.00 ? 111 C A H42    1  
ATOM 3946   H H5     . C A 1 122 ? 101.033 95.228  117.736 1.00 0.00 ? 111 C A H5     1  
ATOM 3947   H H6     . C A 1 122 ? 99.398  96.224  119.044 1.00 0.00 ? 111 C A H6     1  
ATOM 3948   P P      . U A 1 123 ? 100.515 100.191 122.721 1.00 0.00 ? 112 U A P      1  
ATOM 3949   O OP1    . U A 1 123 ? 100.206 101.442 123.459 1.00 0.00 ? 112 U A OP1    1  
ATOM 3950   O OP2    . U A 1 123 ? 101.202 100.265 121.405 1.00 0.00 ? 112 U A OP2    1  
ATOM 3951   O "O5'"  . U A 1 123 ? 101.379 99.255  123.676 1.00 0.00 ? 112 U A "O5'"  1  
ATOM 3952   C "C5'"  . U A 1 123 ? 100.966 98.993  125.010 1.00 0.00 ? 112 U A "C5'"  1  
ATOM 3953   C "C4'"  . U A 1 123 ? 101.851 97.972  125.677 1.00 0.00 ? 112 U A "C4'"  1  
ATOM 3954   O "O4'"  . U A 1 123 ? 101.780 96.710  124.960 1.00 0.00 ? 112 U A "O4'"  1  
ATOM 3955   C "C3'"  . U A 1 123 ? 103.338 98.292  125.711 1.00 0.00 ? 112 U A "C3'"  1  
ATOM 3956   O "O3'"  . U A 1 123 ? 103.682 99.215  126.730 1.00 0.00 ? 112 U A "O3'"  1  
ATOM 3957   C "C2'"  . U A 1 123 ? 103.970 96.919  125.893 1.00 0.00 ? 112 U A "C2'"  1  
ATOM 3958   O "O2'"  . U A 1 123 ? 103.871 96.480  127.239 1.00 0.00 ? 112 U A "O2'"  1  
ATOM 3959   C "C1'"  . U A 1 123 ? 103.064 96.048  125.020 1.00 0.00 ? 112 U A "C1'"  1  
ATOM 3960   N N1     . U A 1 123 ? 103.624 95.839  123.662 1.00 0.00 ? 112 U A N1     1  
ATOM 3961   C C2     . U A 1 123 ? 104.633 94.905  123.534 1.00 0.00 ? 112 U A C2     1  
ATOM 3962   O O2     . U A 1 123 ? 105.070 94.262  124.473 1.00 0.00 ? 112 U A O2     1  
ATOM 3963   N N3     . U A 1 123 ? 105.120 94.745  122.259 1.00 0.00 ? 112 U A N3     1  
ATOM 3964   C C4     . U A 1 123 ? 104.711 95.408  121.122 1.00 0.00 ? 112 U A C4     1  
ATOM 3965   O O4     . U A 1 123 ? 105.250 95.152  120.045 1.00 0.00 ? 112 U A O4     1  
ATOM 3966   C C5     . U A 1 123 ? 103.662 96.361  121.331 1.00 0.00 ? 112 U A C5     1  
ATOM 3967   C C6     . U A 1 123 ? 103.170 96.535  122.561 1.00 0.00 ? 112 U A C6     1  
ATOM 3968   H "H5'"  . U A 1 123 ? 100.045 98.660  124.999 1.00 0.00 ? 112 U A "H5'"  1  
ATOM 3969   H "H5''" . U A 1 123 ? 100.999 99.828  125.524 1.00 0.00 ? 112 U A "H5''" 1  
ATOM 3970   H "H4'"  . U A 1 123 ? 101.538 97.830  126.594 1.00 0.00 ? 112 U A "H4'"  1  
ATOM 3971   H "H3'"  . U A 1 123 ? 103.609 98.656  124.842 1.00 0.00 ? 112 U A "H3'"  1  
ATOM 3972   H "H2'"  . U A 1 123 ? 104.897 96.903  125.572 1.00 0.00 ? 112 U A "H2'"  1  
ATOM 3973   H "HO2'" . U A 1 123 ? 103.715 97.255  127.818 1.00 0.00 ? 112 U A "HO2'" 1  
ATOM 3974   H "H1'"  . U A 1 123 ? 102.931 95.180  125.452 1.00 0.00 ? 112 U A "H1'"  1  
ATOM 3975   H H3     . U A 1 123 ? 105.837 94.085  122.147 1.00 0.00 ? 112 U A H3     1  
ATOM 3976   H H5     . U A 1 123 ? 103.308 96.876  120.577 1.00 0.00 ? 112 U A H5     1  
ATOM 3977   H H6     . U A 1 123 ? 102.453 97.193  122.678 1.00 0.00 ? 112 U A H6     1  
ATOM 3978   P P      . C A 1 124 ? 104.902 100.238 126.517 1.00 0.00 ? 113 C A P      1  
ATOM 3979   O OP1    . C A 1 124 ? 104.948 101.148 127.689 1.00 0.00 ? 113 C A OP1    1  
ATOM 3980   O OP2    . C A 1 124 ? 104.794 100.807 125.150 1.00 0.00 ? 113 C A OP2    1  
ATOM 3981   O "O5'"  . C A 1 124 ? 106.196 99.310  126.564 1.00 0.00 ? 113 C A "O5'"  1  
ATOM 3982   C "C5'"  . C A 1 124 ? 106.919 99.126  127.771 1.00 0.00 ? 113 C A "C5'"  1  
ATOM 3983   C "C4'"  . C A 1 124 ? 107.957 98.038  127.640 1.00 0.00 ? 113 C A "C4'"  1  
ATOM 3984   O "O4'"  . C A 1 124 ? 107.432 97.005  126.792 1.00 0.00 ? 113 C A "O4'"  1  
ATOM 3985   C "C3'"  . C A 1 124 ? 109.295 98.454  127.049 1.00 0.00 ? 113 C A "C3'"  1  
ATOM 3986   O "O3'"  . C A 1 124 ? 110.222 98.883  128.031 1.00 0.00 ? 113 C A "O3'"  1  
ATOM 3987   C "C2'"  . C A 1 124 ? 109.738 97.276  126.191 1.00 0.00 ? 113 C A "C2'"  1  
ATOM 3988   O "O2'"  . C A 1 124 ? 110.533 96.366  126.937 1.00 0.00 ? 113 C A "O2'"  1  
ATOM 3989   C "C1'"  . C A 1 124 ? 108.449 96.563  125.824 1.00 0.00 ? 113 C A "C1'"  1  
ATOM 3990   N N1     . C A 1 124 ? 107.991 96.897  124.452 1.00 0.00 ? 113 C A N1     1  
ATOM 3991   C C2     . C A 1 124 ? 108.493 96.145  123.383 1.00 0.00 ? 113 C A C2     1  
ATOM 3992   O O2     . C A 1 124 ? 109.300 95.231  123.610 1.00 0.00 ? 113 C A O2     1  
ATOM 3993   N N3     . C A 1 124 ? 108.092 96.429  122.122 1.00 0.00 ? 113 C A N3     1  
ATOM 3994   C C4     . C A 1 124 ? 107.224 97.417  121.904 1.00 0.00 ? 113 C A C4     1  
ATOM 3995   N N4     . C A 1 124 ? 106.856 97.661  120.644 1.00 0.00 ? 113 C A N4     1  
ATOM 3996   C C5     . C A 1 124 ? 106.696 98.200  122.969 1.00 0.00 ? 113 C A C5     1  
ATOM 3997   C C6     . C A 1 124 ? 107.099 97.909  124.212 1.00 0.00 ? 113 C A C6     1  
ATOM 3998   H "H5'"  . C A 1 124 ? 106.293 98.887  128.485 1.00 0.00 ? 113 C A "H5'"  1  
ATOM 3999   H "H5''" . C A 1 124 ? 107.366 99.966  128.007 1.00 0.00 ? 113 C A "H5''" 1  
ATOM 4000   H "H4'"  . C A 1 124 ? 108.140 97.668  128.529 1.00 0.00 ? 113 C A "H4'"  1  
ATOM 4001   H "H3'"  . C A 1 124 ? 109.161 99.224  126.458 1.00 0.00 ? 113 C A "H3'"  1  
ATOM 4002   H "H2'"  . C A 1 124 ? 110.196 97.577  125.379 1.00 0.00 ? 113 C A "H2'"  1  
ATOM 4003   H "HO2'" . C A 1 124 ? 110.849 95.655  126.341 1.00 0.00 ? 113 C A "HO2'" 1  
ATOM 4004   H "H1'"  . C A 1 124 ? 108.584 95.596  125.896 1.00 0.00 ? 113 C A "H1'"  1  
ATOM 4005   H H41    . C A 1 124 ? 107.223 97.121  119.913 1.00 0.00 ? 113 C A H41    1  
ATOM 4006   H H42    . C A 1 124 ? 106.220 98.381  120.450 1.00 0.00 ? 113 C A H42    1  
ATOM 4007   H H5     . C A 1 124 ? 106.058 98.924  122.799 1.00 0.00 ? 113 C A H5     1  
ATOM 4008   H H6     . C A 1 124 ? 106.747 98.436  124.958 1.00 0.00 ? 113 C A H6     1  
ATOM 4009   P P      . G A 1 125 ? 110.602 100.436 128.141 1.00 0.00 ? 114 G A P      1  
ATOM 4010   O OP1    . G A 1 125 ? 110.669 100.822 129.574 1.00 0.00 ? 114 G A OP1    1  
ATOM 4011   O OP2    . G A 1 125 ? 109.598 101.077 127.254 1.00 0.00 ? 114 G A OP2    1  
ATOM 4012   O "O5'"  . G A 1 125 ? 112.043 100.667 127.502 1.00 0.00 ? 114 G A "O5'"  1  
ATOM 4013   C "C5'"  . G A 1 125 ? 112.628 101.960 127.473 1.00 0.00 ? 114 G A "C5'"  1  
ATOM 4014   C "C4'"  . G A 1 125 ? 113.814 102.011 126.540 1.00 0.00 ? 114 G A "C4'"  1  
ATOM 4015   O "O4'"  . G A 1 125 ? 115.044 102.035 127.310 1.00 0.00 ? 114 G A "O4'"  1  
ATOM 4016   C "C3'"  . G A 1 125 ? 113.981 100.820 125.610 1.00 0.00 ? 114 G A "C3'"  1  
ATOM 4017   O "O3'"  . G A 1 125 ? 113.157 100.895 124.459 1.00 0.00 ? 114 G A "O3'"  1  
ATOM 4018   C "C2'"  . G A 1 125 ? 115.470 100.850 125.297 1.00 0.00 ? 114 G A "C2'"  1  
ATOM 4019   O "O2'"  . G A 1 125 ? 115.775 101.847 124.333 1.00 0.00 ? 114 G A "O2'"  1  
ATOM 4020   C "C1'"  . G A 1 125 ? 116.057 101.266 126.647 1.00 0.00 ? 114 G A "C1'"  1  
ATOM 4021   N N9     . G A 1 125 ? 116.448 100.104 127.466 1.00 0.00 ? 114 G A N9     1  
ATOM 4022   C C8     . G A 1 125 ? 115.814 99.625  128.587 1.00 0.00 ? 114 G A C8     1  
ATOM 4023   N N7     . G A 1 125 ? 116.400 98.576  129.099 1.00 0.00 ? 114 G A N7     1  
ATOM 4024   C C5     . G A 1 125 ? 117.487 98.348  128.266 1.00 0.00 ? 114 G A C5     1  
ATOM 4025   C C6     . G A 1 125 ? 118.490 97.346  128.317 1.00 0.00 ? 114 G A C6     1  
ATOM 4026   O O6     . G A 1 125 ? 118.623 96.430  129.135 1.00 0.00 ? 114 G A O6     1  
ATOM 4027   N N1     . G A 1 125 ? 119.404 97.484  127.277 1.00 0.00 ? 114 G A N1     1  
ATOM 4028   C C2     . G A 1 125 ? 119.359 98.458  126.310 1.00 0.00 ? 114 G A C2     1  
ATOM 4029   N N2     . G A 1 125 ? 120.331 98.427  125.386 1.00 0.00 ? 114 G A N2     1  
ATOM 4030   N N3     . G A 1 125 ? 118.429 99.398  126.252 1.00 0.00 ? 114 G A N3     1  
ATOM 4031   C C4     . G A 1 125 ? 117.531 99.284  127.252 1.00 0.00 ? 114 G A C4     1  
ATOM 4032   H "H5'"  . G A 1 125 ? 112.923 102.198 128.377 1.00 0.00 ? 114 G A "H5'"  1  
ATOM 4033   H "H5''" . G A 1 125 ? 111.958 102.609 127.174 1.00 0.00 ? 114 G A "H5''" 1  
ATOM 4034   H "H4'"  . G A 1 125 ? 113.759 102.829 126.002 1.00 0.00 ? 114 G A "H4'"  1  
ATOM 4035   H "H3'"  . G A 1 125 ? 113.774 99.997  126.100 1.00 0.00 ? 114 G A "H3'"  1  
ATOM 4036   H "H2'"  . G A 1 125 ? 115.799 99.968  125.022 1.00 0.00 ? 114 G A "H2'"  1  
ATOM 4037   H "HO2'" . G A 1 125 ? 114.959 102.082 123.845 1.00 0.00 ? 114 G A "HO2'" 1  
ATOM 4038   H "H1'"  . G A 1 125 ? 116.838 101.840 126.501 1.00 0.00 ? 114 G A "H1'"  1  
ATOM 4039   H H8     . G A 1 125 ? 115.006 100.027 128.964 1.00 0.00 ? 114 G A H8     1  
ATOM 4040   H H1     . G A 1 125 ? 120.136 96.832  127.232 1.00 0.00 ? 114 G A H1     1  
ATOM 4041   H H21    . G A 1 125 ? 121.023 97.735  125.423 1.00 0.00 ? 114 G A H21    1  
ATOM 4042   H H22    . G A 1 125 ? 120.350 99.098  124.673 1.00 0.00 ? 114 G A H22    1  
ATOM 4043   P P      . C A 1 126 ? 112.634 99.550  123.753 1.00 0.00 ? 115 C A P      1  
ATOM 4044   O OP1    . C A 1 126 ? 111.635 99.931  122.722 1.00 0.00 ? 115 C A OP1    1  
ATOM 4045   O OP2    . C A 1 126 ? 112.257 98.585  124.817 1.00 0.00 ? 115 C A OP2    1  
ATOM 4046   O "O5'"  . C A 1 126 ? 113.919 98.981  123.003 1.00 0.00 ? 115 C A "O5'"  1  
ATOM 4047   C "C5'"  . C A 1 126 ? 114.502 99.685  121.917 1.00 0.00 ? 115 C A "C5'"  1  
ATOM 4048   C "C4'"  . C A 1 126 ? 115.791 99.043  121.466 1.00 0.00 ? 115 C A "C4'"  1  
ATOM 4049   O "O4'"  . C A 1 126 ? 116.756 99.061  122.549 1.00 0.00 ? 115 C A "O4'"  1  
ATOM 4050   C "C3'"  . C A 1 126 ? 115.708 97.578  121.067 1.00 0.00 ? 115 C A "C3'"  1  
ATOM 4051   O "O3'"  . C A 1 126 ? 115.240 97.390  119.743 1.00 0.00 ? 115 C A "O3'"  1  
ATOM 4052   C "C2'"  . C A 1 126 ? 117.134 97.094  121.284 1.00 0.00 ? 115 C A "C2'"  1  
ATOM 4053   O "O2'"  . C A 1 126 ? 117.983 97.492  120.217 1.00 0.00 ? 115 C A "O2'"  1  
ATOM 4054   C "C1'"  . C A 1 126 ? 117.529 97.863  122.546 1.00 0.00 ? 115 C A "C1'"  1  
ATOM 4055   N N1     . C A 1 126 ? 117.284 97.079  123.782 1.00 0.00 ? 115 C A N1     1  
ATOM 4056   C C2     . C A 1 126 ? 118.187 96.062  124.115 1.00 0.00 ? 115 C A C2     1  
ATOM 4057   O O2     . C A 1 126 ? 119.158 95.846  123.372 1.00 0.00 ? 115 C A O2     1  
ATOM 4058   N N3     . C A 1 126 ? 117.988 95.334  125.238 1.00 0.00 ? 115 C A N3     1  
ATOM 4059   C C4     . C A 1 126 ? 116.938 95.584  126.019 1.00 0.00 ? 115 C A C4     1  
ATOM 4060   N N4     . C A 1 126 ? 116.780 94.841  127.116 1.00 0.00 ? 115 C A N4     1  
ATOM 4061   C C5     . C A 1 126 ? 116.001 96.611  125.708 1.00 0.00 ? 115 C A C5     1  
ATOM 4062   C C6     . C A 1 126 ? 116.210 97.326  124.596 1.00 0.00 ? 115 C A C6     1  
ATOM 4063   H "H5'"  . C A 1 126 ? 114.683 100.607 122.195 1.00 0.00 ? 115 C A "H5'"  1  
ATOM 4064   H "H5''" . C A 1 126 ? 113.871 99.695  121.167 1.00 0.00 ? 115 C A "H5''" 1  
ATOM 4065   H "H4'"  . C A 1 126 ? 116.150 99.557  120.711 1.00 0.00 ? 115 C A "H4'"  1  
ATOM 4066   H "H3'"  . C A 1 126 ? 115.111 97.110  121.688 1.00 0.00 ? 115 C A "H3'"  1  
ATOM 4067   H "H2'"  . C A 1 126 ? 117.167 96.124  121.429 1.00 0.00 ? 115 C A "H2'"  1  
ATOM 4068   H "HO2'" . C A 1 126 ? 118.873 97.109  120.357 1.00 0.00 ? 115 C A "HO2'" 1  
ATOM 4069   H "H1'"  . C A 1 126 ? 118.478 98.104  122.497 1.00 0.00 ? 115 C A "H1'"  1  
ATOM 4070   H H41    . C A 1 126 ? 117.426 94.135  127.326 1.00 0.00 ? 115 C A H41    1  
ATOM 4071   H H42    . C A 1 126 ? 116.018 95.000  127.710 1.00 0.00 ? 115 C A H42    1  
ATOM 4072   H H5     . C A 1 126 ? 115.232 96.788  126.289 1.00 0.00 ? 115 C A H5     1  
ATOM 4073   H H6     . C A 1 126 ? 115.576 98.036  124.366 1.00 0.00 ? 115 C A H6     1  
ATOM 4074   P P      . A A 1 127 ? 114.454 96.045  119.346 1.00 0.00 ? 116 A A P      1  
ATOM 4075   O OP1    . A A 1 127 ? 114.187 96.081  117.886 1.00 0.00 ? 116 A A OP1    1  
ATOM 4076   O OP2    . A A 1 127 ? 113.325 95.875  120.295 1.00 0.00 ? 116 A A OP2    1  
ATOM 4077   O "O5'"  . A A 1 127 ? 115.510 94.885  119.626 1.00 0.00 ? 116 A A "O5'"  1  
ATOM 4078   C "C5'"  . A A 1 127 ? 116.413 94.462  118.615 1.00 0.00 ? 116 A A "C5'"  1  
ATOM 4079   C "C4'"  . A A 1 127 ? 117.603 93.743  119.199 1.00 0.00 ? 116 A A "C4'"  1  
ATOM 4080   O "O4'"  . A A 1 127 ? 117.811 94.260  120.526 1.00 0.00 ? 116 A A "O4'"  1  
ATOM 4081   C "C3'"  . A A 1 127 ? 117.441 92.245  119.408 1.00 0.00 ? 116 A A "C3'"  1  
ATOM 4082   O "O3'"  . A A 1 127 ? 117.760 91.487  118.254 1.00 0.00 ? 116 A A "O3'"  1  
ATOM 4083   C "C2'"  . A A 1 127 ? 118.387 91.959  120.563 1.00 0.00 ? 116 A A "C2'"  1  
ATOM 4084   O "O2'"  . A A 1 127 ? 119.724 91.809  120.108 1.00 0.00 ? 116 A A "O2'"  1  
ATOM 4085   C "C1'"  . A A 1 127 ? 118.290 93.243  121.377 1.00 0.00 ? 116 A A "C1'"  1  
ATOM 4086   N N9     . A A 1 127 ? 117.384 93.100  122.533 1.00 0.00 ? 116 A A N9     1  
ATOM 4087   C C8     . A A 1 127 ? 116.275 93.852  122.834 1.00 0.00 ? 116 A A C8     1  
ATOM 4088   N N7     . A A 1 127 ? 115.670 93.484  123.936 1.00 0.00 ? 116 A A N7     1  
ATOM 4089   C C5     . A A 1 127 ? 116.431 92.416  124.392 1.00 0.00 ? 116 A A C5     1  
ATOM 4090   C C6     . A A 1 127 ? 116.315 91.584  125.520 1.00 0.00 ? 116 A A C6     1  
ATOM 4091   N N6     . A A 1 127 ? 115.346 91.703  126.431 1.00 0.00 ? 116 A A N6     1  
ATOM 4092   N N1     . A A 1 127 ? 117.240 90.614  125.683 1.00 0.00 ? 116 A A N1     1  
ATOM 4093   C C2     . A A 1 127 ? 118.212 90.494  124.769 1.00 0.00 ? 116 A A C2     1  
ATOM 4094   N N3     . A A 1 127 ? 118.426 91.214  123.670 1.00 0.00 ? 116 A A N3     1  
ATOM 4095   C C4     . A A 1 127 ? 117.489 92.170  123.538 1.00 0.00 ? 116 A A C4     1  
ATOM 4096   H "H5'"  . A A 1 127 ? 116.726 95.245  118.117 1.00 0.00 ? 116 A A "H5'"  1  
ATOM 4097   H "H5''" . A A 1 127 ? 115.945 93.859  118.000 1.00 0.00 ? 116 A A "H5''" 1  
ATOM 4098   H "H4'"  . A A 1 127 ? 118.388 93.923  118.641 1.00 0.00 ? 116 A A "H4'"  1  
ATOM 4099   H "H3'"  . A A 1 127 ? 116.522 92.057  119.695 1.00 0.00 ? 116 A A "H3'"  1  
ATOM 4100   H "H2'"  . A A 1 127 ? 118.092 91.185  121.086 1.00 0.00 ? 116 A A "H2'"  1  
ATOM 4101   H "HO2'" . A A 1 127 ? 119.712 91.537  119.167 1.00 0.00 ? 116 A A "HO2'" 1  
ATOM 4102   H "H1'"  . A A 1 127 ? 119.183 93.498  121.691 1.00 0.00 ? 116 A A "H1'"  1  
ATOM 4103   H H8     . A A 1 127 ? 115.965 94.596  122.276 1.00 0.00 ? 116 A A H8     1  
ATOM 4104   H H61    . A A 1 127 ? 115.317 91.092  127.198 1.00 0.00 ? 116 A A H61    1  
ATOM 4105   H H62    . A A 1 127 ? 114.665 92.400  126.334 1.00 0.00 ? 116 A A H62    1  
ATOM 4106   H H2     . A A 1 127 ? 118.857 89.774  124.933 1.00 0.00 ? 116 A A H2     1  
ATOM 4107   P P      . A A 1 128 ? 116.862 90.220  117.861 1.00 0.00 ? 117 A A P      1  
ATOM 4108   O OP1    . A A 1 128 ? 117.668 89.294  117.028 1.00 0.00 ? 117 A A OP1    1  
ATOM 4109   O OP2    . A A 1 128 ? 115.644 90.849  117.292 1.00 0.00 ? 117 A A OP2    1  
ATOM 4110   O "O5'"  . A A 1 128 ? 116.443 89.449  119.191 1.00 0.00 ? 117 A A "O5'"  1  
ATOM 4111   C "C5'"  . A A 1 128 ? 117.398 88.708  119.936 1.00 0.00 ? 117 A A "C5'"  1  
ATOM 4112   C "C4'"  . A A 1 128 ? 116.875 88.346  121.303 1.00 0.00 ? 117 A A "C4'"  1  
ATOM 4113   O "O4'"  . A A 1 128 ? 116.699 89.600  122.039 1.00 0.00 ? 117 A A "O4'"  1  
ATOM 4114   C "C3'"  . A A 1 128 ? 115.506 87.683  121.340 1.00 0.00 ? 117 A A "C3'"  1  
ATOM 4115   O "O3'"  . A A 1 128 ? 115.570 86.271  121.234 1.00 0.00 ? 117 A A "O3'"  1  
ATOM 4116   C "C2'"  . A A 1 128 ? 115.108 88.083  122.763 1.00 0.00 ? 117 A A "C2'"  1  
ATOM 4117   O "O2'"  . A A 1 128 ? 115.780 87.287  123.729 1.00 0.00 ? 117 A A "O2'"  1  
ATOM 4118   C "C1'"  . A A 1 128 ? 115.623 89.508  122.889 1.00 0.00 ? 117 A A "C1'"  1  
ATOM 4119   N N9     . A A 1 128 ? 114.634 90.499  122.425 1.00 0.00 ? 117 A A N9     1  
ATOM 4120   C C8     . A A 1 128 ? 114.464 90.990  121.154 1.00 0.00 ? 117 A A C8     1  
ATOM 4121   N N7     . A A 1 128 ? 113.496 91.867  121.052 1.00 0.00 ? 117 A A N7     1  
ATOM 4122   C C5     . A A 1 128 ? 112.993 91.961  122.343 1.00 0.00 ? 117 A A C5     1  
ATOM 4123   C C6     . A A 1 128 ? 111.953 92.724  122.901 1.00 0.00 ? 117 A A C6     1  
ATOM 4124   N N6     . A A 1 128 ? 111.199 93.573  122.199 1.00 0.00 ? 117 A A N6     1  
ATOM 4125   N N1     . A A 1 128 ? 111.709 92.583  124.222 1.00 0.00 ? 117 A A N1     1  
ATOM 4126   C C2     . A A 1 128 ? 112.464 91.731  124.926 1.00 0.00 ? 117 A A C2     1  
ATOM 4127   N N3     . A A 1 128 ? 113.469 90.960  124.515 1.00 0.00 ? 117 A A N3     1  
ATOM 4128   C C4     . A A 1 128 ? 113.685 91.123  123.198 1.00 0.00 ? 117 A A C4     1  
ATOM 4129   H "H5'"  . A A 1 128 ? 118.212 89.245  120.037 1.00 0.00 ? 117 A A "H5'"  1  
ATOM 4130   H "H5''" . A A 1 128 ? 117.617 87.886  119.449 1.00 0.00 ? 117 A A "H5''" 1  
ATOM 4131   H "H4'"  . A A 1 128 ? 117.512 87.782  121.790 1.00 0.00 ? 117 A A "H4'"  1  
ATOM 4132   H "H3'"  . A A 1 128 ? 114.861 88.025  120.685 1.00 0.00 ? 117 A A "H3'"  1  
ATOM 4133   H "H2'"  . A A 1 128 ? 114.136 88.059  122.885 1.00 0.00 ? 117 A A "H2'"  1  
ATOM 4134   H "HO2'" . A A 1 128 ? 115.506 87.574  124.624 1.00 0.00 ? 117 A A "HO2'" 1  
ATOM 4135   H "H1'"  . A A 1 128 ? 115.853 89.689  123.825 1.00 0.00 ? 117 A A "H1'"  1  
ATOM 4136   H H8     . A A 1 128 ? 115.015 90.711  120.394 1.00 0.00 ? 117 A A H8     1  
ATOM 4137   H H61    . A A 1 128 ? 110.487 94.079  122.644 1.00 0.00 ? 117 A A H61    1  
ATOM 4138   H H62    . A A 1 128 ? 111.358 93.692  121.240 1.00 0.00 ? 117 A A H62    1  
ATOM 4139   H H2     . A A 1 128 ? 112.247 91.665  125.880 1.00 0.00 ? 117 A A H2     1  
ATOM 4140   P P      . A A 1 129 ? 114.772 85.512  120.063 1.00 0.00 ? 118 A A P      1  
ATOM 4141   O OP1    . A A 1 129 ? 115.200 84.091  120.061 1.00 0.00 ? 118 A A OP1    1  
ATOM 4142   O OP2    . A A 1 129 ? 114.897 86.319  118.823 1.00 0.00 ? 118 A A OP2    1  
ATOM 4143   O "O5'"  . A A 1 129 ? 113.251 85.568  120.535 1.00 0.00 ? 118 A A "O5'"  1  
ATOM 4144   C "C5'"  . A A 1 129 ? 112.491 86.761  120.408 1.00 0.00 ? 118 A A "C5'"  1  
ATOM 4145   C "C4'"  . A A 1 129 ? 111.954 87.222  121.739 1.00 0.00 ? 118 A A "C4'"  1  
ATOM 4146   O "O4'"  . A A 1 129 ? 112.107 88.659  121.861 1.00 0.00 ? 118 A A "O4'"  1  
ATOM 4147   C "C3'"  . A A 1 129 ? 110.469 86.986  121.975 1.00 0.00 ? 118 A A "C3'"  1  
ATOM 4148   O "O3'"  . A A 1 129 ? 110.177 85.666  122.404 1.00 0.00 ? 118 A A "O3'"  1  
ATOM 4149   C "C2'"  . A A 1 129 ? 110.124 88.052  123.005 1.00 0.00 ? 118 A A "C2'"  1  
ATOM 4150   O "O2'"  . A A 1 129 ? 110.559 87.676  124.304 1.00 0.00 ? 118 A A "O2'"  1  
ATOM 4151   C "C1'"  . A A 1 129 ? 110.971 89.230  122.522 1.00 0.00 ? 118 A A "C1'"  1  
ATOM 4152   N N9     . A A 1 129 ? 110.227 90.107  121.598 1.00 0.00 ? 118 A A N9     1  
ATOM 4153   C C8     . A A 1 129 ? 110.350 90.193  120.232 1.00 0.00 ? 118 A A C8     1  
ATOM 4154   N N7     . A A 1 129 ? 109.547 91.071  119.685 1.00 0.00 ? 118 A A N7     1  
ATOM 4155   C C5     . A A 1 129 ? 108.847 91.600  120.760 1.00 0.00 ? 118 A A C5     1  
ATOM 4156   C C6     . A A 1 129 ? 107.846 92.582  120.846 1.00 0.00 ? 118 A A C6     1  
ATOM 4157   N N6     . A A 1 129 ? 107.351 93.232  119.789 1.00 0.00 ? 118 A A N6     1  
ATOM 4158   N N1     . A A 1 129 ? 107.359 92.878  122.070 1.00 0.00 ? 118 A A N1     1  
ATOM 4159   C C2     . A A 1 129 ? 107.854 92.226  123.132 1.00 0.00 ? 118 A A C2     1  
ATOM 4160   N N3     . A A 1 129 ? 108.795 91.286  123.179 1.00 0.00 ? 118 A A N3     1  
ATOM 4161   C C4     . A A 1 129 ? 109.256 91.016  121.944 1.00 0.00 ? 118 A A C4     1  
ATOM 4162   H "H5'"  . A A 1 129 ? 111.739 86.597  119.799 1.00 0.00 ? 118 A A "H5'"  1  
ATOM 4163   H "H5''" . A A 1 129 ? 113.058 87.464  120.032 1.00 0.00 ? 118 A A "H5''" 1  
ATOM 4164   H "H4'"  . A A 1 129 ? 112.460 86.785  122.454 1.00 0.00 ? 118 A A "H4'"  1  
ATOM 4165   H "H3'"  . A A 1 129 ? 109.977 87.171  121.147 1.00 0.00 ? 118 A A "H3'"  1  
ATOM 4166   H "H2'"  . A A 1 129 ? 109.167 88.271  122.993 1.00 0.00 ? 118 A A "H2'"  1  
ATOM 4167   H "HO2'" . A A 1 129 ? 110.695 86.706  124.327 1.00 0.00 ? 118 A A "HO2'" 1  
ATOM 4168   H "H1'"  . A A 1 129 ? 111.275 89.752  123.294 1.00 0.00 ? 118 A A "H1'"  1  
ATOM 4169   H H8     . A A 1 129 ? 110.979 89.646  119.715 1.00 0.00 ? 118 A A H8     1  
ATOM 4170   H H61    . A A 1 129 ? 106.651 93.908  119.912 1.00 0.00 ? 118 A A H61    1  
ATOM 4171   H H62    . A A 1 129 ? 107.690 93.033  118.891 1.00 0.00 ? 118 A A H62    1  
ATOM 4172   H H2     . A A 1 129 ? 107.469 92.479  123.997 1.00 0.00 ? 118 A A H2     1  
ATOM 4173   P P      . G A 1 130 ? 108.775 84.984  122.020 1.00 0.00 ? 119 G A P      1  
ATOM 4174   O OP1    . G A 1 130 ? 108.853 83.541  122.368 1.00 0.00 ? 119 G A OP1    1  
ATOM 4175   O OP2    . G A 1 130 ? 108.432 85.388  120.633 1.00 0.00 ? 119 G A OP2    1  
ATOM 4176   O "O5'"  . G A 1 130 ? 107.729 85.671  123.007 1.00 0.00 ? 119 G A "O5'"  1  
ATOM 4177   C "C5'"  . G A 1 130 ? 107.775 85.429  124.406 1.00 0.00 ? 119 G A "C5'"  1  
ATOM 4178   C "C4'"  . G A 1 130 ? 106.794 86.297  125.152 1.00 0.00 ? 119 G A "C4'"  1  
ATOM 4179   O "O4'"  . G A 1 130 ? 107.116 87.698  124.937 1.00 0.00 ? 119 G A "O4'"  1  
ATOM 4180   C "C3'"  . G A 1 130 ? 105.340 86.182  124.724 1.00 0.00 ? 119 G A "C3'"  1  
ATOM 4181   O "O3'"  . G A 1 130 ? 104.679 85.068  125.301 1.00 0.00 ? 119 G A "O3'"  1  
ATOM 4182   C "C2'"  . G A 1 130 ? 104.760 87.524  125.151 1.00 0.00 ? 119 G A "C2'"  1  
ATOM 4183   O "O2'"  . G A 1 130 ? 104.514 87.557  126.550 1.00 0.00 ? 119 G A "O2'"  1  
ATOM 4184   C "C1'"  . G A 1 130 ? 105.917 88.472  124.827 1.00 0.00 ? 119 G A "C1'"  1  
ATOM 4185   N N9     . G A 1 130 ? 105.796 89.052  123.477 1.00 0.00 ? 119 G A N9     1  
ATOM 4186   C C8     . G A 1 130 ? 106.551 88.750  122.370 1.00 0.00 ? 119 G A C8     1  
ATOM 4187   N N7     . G A 1 130 ? 106.209 89.432  121.312 1.00 0.00 ? 119 G A N7     1  
ATOM 4188   C C5     . G A 1 130 ? 105.165 90.237  121.744 1.00 0.00 ? 119 G A C5     1  
ATOM 4189   C C6     . G A 1 130 ? 104.387 91.193  121.041 1.00 0.00 ? 119 G A C6     1  
ATOM 4190   O O6     . G A 1 130 ? 104.471 91.530  119.854 1.00 0.00 ? 119 G A O6     1  
ATOM 4191   N N1     . G A 1 130 ? 103.431 91.780  121.862 1.00 0.00 ? 119 G A N1     1  
ATOM 4192   C C2     . G A 1 130 ? 103.245 91.486  123.191 1.00 0.00 ? 119 G A C2     1  
ATOM 4193   N N2     . G A 1 130 ? 102.267 92.158  123.819 1.00 0.00 ? 119 G A N2     1  
ATOM 4194   N N3     . G A 1 130 ? 103.961 90.597  123.859 1.00 0.00 ? 119 G A N3     1  
ATOM 4195   C C4     . G A 1 130 ? 104.896 90.014  123.079 1.00 0.00 ? 119 G A C4     1  
ATOM 4196   H "H5'"  . G A 1 130 ? 108.680 85.612  124.731 1.00 0.00 ? 119 G A "H5'"  1  
ATOM 4197   H "H5''" . G A 1 130 ? 107.560 84.487  124.573 1.00 0.00 ? 119 G A "H5''" 1  
ATOM 4198   H "H4'"  . G A 1 130 ? 106.860 86.098  126.110 1.00 0.00 ? 119 G A "H4'"  1  
ATOM 4199   H "H3'"  . G A 1 130 ? 105.296 86.111  123.747 1.00 0.00 ? 119 G A "H3'"  1  
ATOM 4200   H "H2'"  . G A 1 130 ? 103.956 87.749  124.637 1.00 0.00 ? 119 G A "H2'"  1  
ATOM 4201   H "HO2'" . G A 1 130 ? 104.461 86.640  126.887 1.00 0.00 ? 119 G A "HO2'" 1  
ATOM 4202   H "H1'"  . G A 1 130 ? 105.942 89.191  125.493 1.00 0.00 ? 119 G A "H1'"  1  
ATOM 4203   H H8     . G A 1 130 ? 107.273 88.088  122.374 1.00 0.00 ? 119 G A H8     1  
ATOM 4204   H H1     . G A 1 130 ? 102.845 92.455  121.460 1.00 0.00 ? 119 G A H1     1  
ATOM 4205   H H21    . G A 1 130 ? 101.732 92.818  123.330 1.00 0.00 ? 119 G A H21    1  
ATOM 4206   H H22    . G A 1 130 ? 102.089 91.991  124.769 1.00 0.00 ? 119 G A H22    1  
ATOM 4207   P P      . G A 1 131 ? 103.484 84.341  124.511 1.00 0.00 ? 120 G A P      1  
ATOM 4208   O OP1    . G A 1 131 ? 103.130 83.101  125.249 1.00 0.00 ? 120 G A OP1    1  
ATOM 4209   O OP2    . G A 1 131 ? 103.863 84.259  123.076 1.00 0.00 ? 120 G A OP2    1  
ATOM 4210   O "O5'"  . G A 1 131 ? 102.261 85.356  124.640 1.00 0.00 ? 120 G A "O5'"  1  
ATOM 4211   C "C5'"  . G A 1 131 ? 101.662 85.619  125.900 1.00 0.00 ? 120 G A "C5'"  1  
ATOM 4212   C "C4'"  . G A 1 131 ? 100.616 86.701  125.801 1.00 0.00 ? 120 G A "C4'"  1  
ATOM 4213   O "O4'"  . G A 1 131 ? 101.228 87.940  125.363 1.00 0.00 ? 120 G A "O4'"  1  
ATOM 4214   C "C3'"  . G A 1 131 ? 99.502  86.462  124.791 1.00 0.00 ? 120 G A "C3'"  1  
ATOM 4215   O "O3'"  . G A 1 131 ? 98.482  85.607  125.281 1.00 0.00 ? 120 G A "O3'"  1  
ATOM 4216   C "C2'"  . G A 1 131 ? 99.021  87.873  124.486 1.00 0.00 ? 120 G A "C2'"  1  
ATOM 4217   O "O2'"  . G A 1 131 ? 98.189  88.370  125.522 1.00 0.00 ? 120 G A "O2'"  1  
ATOM 4218   C "C1'"  . G A 1 131 ? 100.340 88.651  124.493 1.00 0.00 ? 120 G A "C1'"  1  
ATOM 4219   N N9     . G A 1 131 ? 100.914 88.782  123.142 1.00 0.00 ? 120 G A N9     1  
ATOM 4220   C C8     . G A 1 131 ? 102.027 88.146  122.646 1.00 0.00 ? 120 G A C8     1  
ATOM 4221   N N7     . G A 1 131 ? 102.292 88.465  121.408 1.00 0.00 ? 120 G A N7     1  
ATOM 4222   C C5     . G A 1 131 ? 101.295 89.366  121.065 1.00 0.00 ? 120 G A C5     1  
ATOM 4223   C C6     . G A 1 131 ? 101.058 90.056  119.847 1.00 0.00 ? 120 G A C6     1  
ATOM 4224   O O6     . G A 1 131 ? 101.706 90.005  118.794 1.00 0.00 ? 120 G A O6     1  
ATOM 4225   N N1     . G A 1 131 ? 99.935  90.873  119.931 1.00 0.00 ? 120 G A N1     1  
ATOM 4226   C C2     . G A 1 131 ? 99.140  91.010  121.043 1.00 0.00 ? 120 G A C2     1  
ATOM 4227   N N2     . G A 1 131 ? 98.100  91.847  120.932 1.00 0.00 ? 120 G A N2     1  
ATOM 4228   N N3     . G A 1 131 ? 99.351  90.373  122.184 1.00 0.00 ? 120 G A N3     1  
ATOM 4229   C C4     . G A 1 131 ? 100.437 89.572  122.123 1.00 0.00 ? 120 G A C4     1  
ATOM 4230   H "H5'"  . G A 1 131 ? 102.355 85.900  126.533 1.00 0.00 ? 120 G A "H5'"  1  
ATOM 4231   H "H5''" . G A 1 131 ? 101.244 84.796  126.233 1.00 0.00 ? 120 G A "H5''" 1  
ATOM 4232   H "H4'"  . G A 1 131 ? 100.216 86.836  126.685 1.00 0.00 ? 120 G A "H4'"  1  
ATOM 4233   H "H3'"  . G A 1 131 ? 99.886  86.071  123.977 1.00 0.00 ? 120 G A "H3'"  1  
ATOM 4234   H "H2'"  . G A 1 131 ? 98.583  87.923  123.612 1.00 0.00 ? 120 G A "H2'"  1  
ATOM 4235   H "HO2'" . G A 1 131 ? 97.843  87.617  126.043 1.00 0.00 ? 120 G A "HO2'" 1  
ATOM 4236   H "H1'"  . G A 1 131 ? 100.190 89.542  124.871 1.00 0.00 ? 120 G A "H1'"  1  
ATOM 4237   H H8     . G A 1 131 ? 102.568 87.516  123.167 1.00 0.00 ? 120 G A H8     1  
ATOM 4238   H H1     . G A 1 131 ? 99.696  91.390  119.134 1.00 0.00 ? 120 G A H1     1  
ATOM 4239   H H21    . G A 1 131 ? 97.937  92.323  120.090 1.00 0.00 ? 120 G A H21    1  
ATOM 4240   H H22    . G A 1 131 ? 97.498  91.986  121.694 1.00 0.00 ? 120 G A H22    1  
ATOM 4241   P P      . G A 1 132 ? 97.700  84.624  124.278 1.00 0.00 ? 121 G A P      1  
ATOM 4242   O OP1    . G A 1 132 ? 96.540  84.051  125.007 1.00 0.00 ? 121 G A OP1    1  
ATOM 4243   O OP2    . G A 1 132 ? 98.697  83.717  123.654 1.00 0.00 ? 121 G A OP2    1  
ATOM 4244   O "O5'"  . G A 1 132 ? 97.140  85.595  123.146 1.00 0.00 ? 121 G A "O5'"  1  
ATOM 4245   C "C5'"  . G A 1 132 ? 95.827  86.130  123.229 1.00 0.00 ? 121 G A "C5'"  1  
ATOM 4246   C "C4'"  . G A 1 132 ? 95.612  87.228  122.217 1.00 0.00 ? 121 G A "C4'"  1  
ATOM 4247   O "O4'"  . G A 1 132 ? 96.864  87.930  122.002 1.00 0.00 ? 121 G A "O4'"  1  
ATOM 4248   C "C3'"  . G A 1 132 ? 95.228  86.778  120.815 1.00 0.00 ? 121 G A "C3'"  1  
ATOM 4249   O "O3'"  . G A 1 132 ? 93.854  86.447  120.698 1.00 0.00 ? 121 G A "O3'"  1  
ATOM 4250   C "C2'"  . G A 1 132 ? 95.579  88.020  120.017 1.00 0.00 ? 121 G A "C2'"  1  
ATOM 4251   O "O2'"  . G A 1 132 ? 94.624  89.051  120.221 1.00 0.00 ? 121 G A "O2'"  1  
ATOM 4252   C "C1'"  . G A 1 132 ? 96.900  88.412  120.683 1.00 0.00 ? 121 G A "C1'"  1  
ATOM 4253   N N9     . G A 1 132 ? 98.066  87.845  119.980 1.00 0.00 ? 121 G A N9     1  
ATOM 4254   C C8     . G A 1 132 ? 98.917  86.867  120.435 1.00 0.00 ? 121 G A C8     1  
ATOM 4255   N N7     . G A 1 132 ? 99.863  86.572  119.585 1.00 0.00 ? 121 G A N7     1  
ATOM 4256   C C5     . G A 1 132 ? 99.622  87.405  118.501 1.00 0.00 ? 121 G A C5     1  
ATOM 4257   C C6     . G A 1 132 ? 100.317 87.538  117.271 1.00 0.00 ? 121 G A C6     1  
ATOM 4258   O O6     . G A 1 132 ? 101.319 86.926  116.883 1.00 0.00 ? 121 G A O6     1  
ATOM 4259   N N1     . G A 1 132 ? 99.734  88.503  116.455 1.00 0.00 ? 121 G A N1     1  
ATOM 4260   C C2     . G A 1 132 ? 98.624  89.243  116.779 1.00 0.00 ? 121 G A C2     1  
ATOM 4261   N N2     . G A 1 132 ? 98.208  90.127  115.859 1.00 0.00 ? 121 G A N2     1  
ATOM 4262   N N3     . G A 1 132 ? 97.967  89.128  117.921 1.00 0.00 ? 121 G A N3     1  
ATOM 4263   C C4     . G A 1 132 ? 98.516  88.197  118.729 1.00 0.00 ? 121 G A C4     1  
ATOM 4264   H "H5'"  . G A 1 132 ? 95.686  86.492  124.128 1.00 0.00 ? 121 G A "H5'"  1  
ATOM 4265   H "H5''" . G A 1 132 ? 95.179  85.414  123.066 1.00 0.00 ? 121 G A "H5''" 1  
ATOM 4266   H "H4'"  . G A 1 132 ? 94.946  87.856  122.567 1.00 0.00 ? 121 G A "H4'"  1  
ATOM 4267   H "H3'"  . G A 1 132 ? 95.805  86.034  120.547 1.00 0.00 ? 121 G A "H3'"  1  
ATOM 4268   H "H2'"  . G A 1 132 ? 95.695  87.815  119.066 1.00 0.00 ? 121 G A "H2'"  1  
ATOM 4269   H "HO2'" . G A 1 132 ? 94.857  89.818  119.656 1.00 0.00 ? 121 G A "HO2'" 1  
ATOM 4270   H "H1'"  . G A 1 132 ? 96.976  89.389  120.706 1.00 0.00 ? 121 G A "H1'"  1  
ATOM 4271   H H8     . G A 1 132 ? 98.825  86.435  121.309 1.00 0.00 ? 121 G A H8     1  
ATOM 4272   H H1     . G A 1 132 ? 100.149 88.664  115.582 1.00 0.00 ? 121 G A H1     1  
ATOM 4273   H H21    . G A 1 132 ? 98.690  90.218  115.011 1.00 0.00 ? 121 G A H21    1  
ATOM 4274   H H22    . G A 1 132 ? 97.421  90.684  116.035 1.00 0.00 ? 121 G A H22    1  
ATOM 4275   P P      . U A 1 133 ? 93.356  85.477  119.517 1.00 0.00 ? 122 U A P      1  
ATOM 4276   O OP1    . U A 1 133 ? 91.873  85.405  119.576 1.00 0.00 ? 122 U A OP1    1  
ATOM 4277   O OP2    . U A 1 133 ? 94.155  84.227  119.583 1.00 0.00 ? 122 U A OP2    1  
ATOM 4278   O "O5'"  . U A 1 133 ? 93.759  86.252  118.185 1.00 0.00 ? 122 U A "O5'"  1  
ATOM 4279   C "C5'"  . U A 1 133 ? 93.025  87.386  117.750 1.00 0.00 ? 122 U A "C5'"  1  
ATOM 4280   C "C4'"  . U A 1 133 ? 93.599  87.969  116.482 1.00 0.00 ? 122 U A "C4'"  1  
ATOM 4281   O "O4'"  . U A 1 133 ? 95.007  88.201  116.717 1.00 0.00 ? 122 U A "O4'"  1  
ATOM 4282   C "C3'"  . U A 1 133 ? 93.544  87.079  115.250 1.00 0.00 ? 122 U A "C3'"  1  
ATOM 4283   O "O3'"  . U A 1 133 ? 92.353  87.245  114.501 1.00 0.00 ? 122 U A "O3'"  1  
ATOM 4284   C "C2'"  . U A 1 133 ? 94.733  87.590  114.444 1.00 0.00 ? 122 U A "C2'"  1  
ATOM 4285   O "O2'"  . U A 1 133 ? 94.406  88.782  113.745 1.00 0.00 ? 122 U A "O2'"  1  
ATOM 4286   C "C1'"  . U A 1 133 ? 95.745  87.926  115.547 1.00 0.00 ? 122 U A "C1'"  1  
ATOM 4287   N N1     . U A 1 133 ? 96.663  86.797  115.831 1.00 0.00 ? 122 U A N1     1  
ATOM 4288   C C2     . U A 1 133 ? 97.710  86.598  114.950 1.00 0.00 ? 122 U A C2     1  
ATOM 4289   O O2     . U A 1 133 ? 97.900  87.300  113.972 1.00 0.00 ? 122 U A O2     1  
ATOM 4290   N N3     . U A 1 133 ? 98.534  85.542  115.253 1.00 0.00 ? 122 U A N3     1  
ATOM 4291   C C4     . U A 1 133 ? 98.423  84.681  116.324 1.00 0.00 ? 122 U A C4     1  
ATOM 4292   O O4     . U A 1 133 ? 99.247  83.775  116.460 1.00 0.00 ? 122 U A O4     1  
ATOM 4293   C C5     . U A 1 133 ? 97.317  84.947  117.193 1.00 0.00 ? 122 U A C5     1  
ATOM 4294   C C6     . U A 1 133 ? 96.500  85.970  116.922 1.00 0.00 ? 122 U A C6     1  
ATOM 4295   H "H5'"  . U A 1 133 ? 93.045  88.068  118.453 1.00 0.00 ? 122 U A "H5'"  1  
ATOM 4296   H "H5''" . U A 1 133 ? 92.095  87.122  117.587 1.00 0.00 ? 122 U A "H5''" 1  
ATOM 4297   H "H4'"  . U A 1 133 ? 93.145  88.815  116.290 1.00 0.00 ? 122 U A "H4'"  1  
ATOM 4298   H "H3'"  . U A 1 133 ? 93.706  86.150  115.515 1.00 0.00 ? 122 U A "H3'"  1  
ATOM 4299   H "H2'"  . U A 1 133 ? 95.081  86.900  113.841 1.00 0.00 ? 122 U A "H2'"  1  
ATOM 4300   H "HO2'" . U A 1 133 ? 95.155  89.024  113.160 1.00 0.00 ? 122 U A "HO2'" 1  
ATOM 4301   H "H1'"  . U A 1 133 ? 96.268  88.710  115.276 1.00 0.00 ? 122 U A "H1'"  1  
ATOM 4302   H H3     . U A 1 133 ? 99.282  85.383  114.641 1.00 0.00 ? 122 U A H3     1  
ATOM 4303   H H5     . U A 1 133 ? 97.162  84.385  117.981 1.00 0.00 ? 122 U A H5     1  
ATOM 4304   H H6     . U A 1 133 ? 95.750  86.131  117.531 1.00 0.00 ? 122 U A H6     1  
ATOM 4305   P P      . A A 1 134 ? 91.898  86.105  113.473 1.00 0.00 ? 123 A A P      1  
ATOM 4306   O OP1    . A A 1 134 ? 92.504  84.813  113.882 1.00 0.00 ? 123 A A OP1    1  
ATOM 4307   O OP2    . A A 1 134 ? 92.247  86.695  112.157 1.00 0.00 ? 123 A A OP2    1  
ATOM 4308   O "O5'"  . A A 1 134 ? 90.313  85.949  113.539 1.00 0.00 ? 123 A A "O5'"  1  
ATOM 4309   C "C5'"  . A A 1 134 ? 89.713  84.920  114.311 1.00 0.00 ? 123 A A "C5'"  1  
ATOM 4310   C "C4'"  . A A 1 134 ? 88.741  85.479  115.320 1.00 0.00 ? 123 A A "C4'"  1  
ATOM 4311   O "O4'"  . A A 1 134 ? 89.490  86.080  116.406 1.00 0.00 ? 123 A A "O4'"  1  
ATOM 4312   C "C3'"  . A A 1 134 ? 87.854  86.614  114.833 1.00 0.00 ? 123 A A "C3'"  1  
ATOM 4313   O "O3'"  . A A 1 134 ? 86.752  86.166  114.063 1.00 0.00 ? 123 A A "O3'"  1  
ATOM 4314   C "C2'"  . A A 1 134 ? 87.424  87.223  116.158 1.00 0.00 ? 123 A A "C2'"  1  
ATOM 4315   O "O2'"  . A A 1 134 ? 86.465  86.405  116.814 1.00 0.00 ? 123 A A "O2'"  1  
ATOM 4316   C "C1'"  . A A 1 134 ? 88.750  87.163  116.903 1.00 0.00 ? 123 A A "C1'"  1  
ATOM 4317   N N9     . A A 1 134 ? 89.530  88.407  116.751 1.00 0.00 ? 123 A A N9     1  
ATOM 4318   C C8     . A A 1 134 ? 90.278  88.807  115.671 1.00 0.00 ? 123 A A C8     1  
ATOM 4319   N N7     . A A 1 134 ? 90.860  89.969  115.833 1.00 0.00 ? 123 A A N7     1  
ATOM 4320   C C5     . A A 1 134 ? 90.469  90.363  117.106 1.00 0.00 ? 123 A A C5     1  
ATOM 4321   C C6     . A A 1 134 ? 90.751  91.508  117.872 1.00 0.00 ? 123 A A C6     1  
ATOM 4322   N N6     . A A 1 134 ? 91.524  92.510  117.448 1.00 0.00 ? 123 A A N6     1  
ATOM 4323   N N1     . A A 1 134 ? 90.203  91.591  119.103 1.00 0.00 ? 123 A A N1     1  
ATOM 4324   C C2     . A A 1 134 ? 89.426  90.586  119.529 1.00 0.00 ? 123 A A C2     1  
ATOM 4325   N N3     . A A 1 134 ? 89.089  89.461  118.903 1.00 0.00 ? 123 A A N3     1  
ATOM 4326   C C4     . A A 1 134 ? 89.649  89.410  117.682 1.00 0.00 ? 123 A A C4     1  
ATOM 4327   H "H5'"  . A A 1 134 ? 90.415  84.424  114.784 1.00 0.00 ? 123 A A "H5'"  1  
ATOM 4328   H "H5''" . A A 1 134 ? 89.237  84.307  113.713 1.00 0.00 ? 123 A A "H5''" 1  
ATOM 4329   H "H4'"  . A A 1 134 ? 88.174  84.763  115.675 1.00 0.00 ? 123 A A "H4'"  1  
ATOM 4330   H "H3'"  . A A 1 134 ? 88.361  87.274  114.315 1.00 0.00 ? 123 A A "H3'"  1  
ATOM 4331   H "H2'"  . A A 1 134 ? 87.101  88.141  116.044 1.00 0.00 ? 123 A A "H2'"  1  
ATOM 4332   H "HO2'" . A A 1 134 ? 86.210  86.829  117.659 1.00 0.00 ? 123 A A "HO2'" 1  
ATOM 4333   H "H1'"  . A A 1 134 ? 88.582  86.998  117.855 1.00 0.00 ? 123 A A "H1'"  1  
ATOM 4334   H H8     . A A 1 134 ? 90.369  88.272  114.854 1.00 0.00 ? 123 A A H8     1  
ATOM 4335   H H61    . A A 1 134 ? 91.684  93.285  118.028 1.00 0.00 ? 123 A A H61    1  
ATOM 4336   H H62    . A A 1 134 ? 91.932  92.472  116.558 1.00 0.00 ? 123 A A H62    1  
ATOM 4337   H H2     . A A 1 134 ? 89.054  90.695  120.429 1.00 0.00 ? 123 A A H2     1  
ATOM 4338   P P      . U A 1 135 ? 86.234  87.033  112.813 1.00 0.00 ? 124 U A P      1  
ATOM 4339   O OP1    . U A 1 135 ? 85.289  86.195  112.032 1.00 0.00 ? 124 U A OP1    1  
ATOM 4340   O OP2    . U A 1 135 ? 87.419  87.623  112.141 1.00 0.00 ? 124 U A OP2    1  
ATOM 4341   O "O5'"  . U A 1 135 ? 85.406  88.217  113.483 1.00 0.00 ? 124 U A "O5'"  1  
ATOM 4342   C "C5'"  . U A 1 135 ? 84.220  87.954  114.216 1.00 0.00 ? 124 U A "C5'"  1  
ATOM 4343   C "C4'"  . U A 1 135 ? 83.847  89.113  115.108 1.00 0.00 ? 124 U A "C4'"  1  
ATOM 4344   O "O4'"  . U A 1 135 ? 84.926  89.429  116.023 1.00 0.00 ? 124 U A "O4'"  1  
ATOM 4345   C "C3'"  . U A 1 135 ? 83.578  90.437  114.409 1.00 0.00 ? 124 U A "C3'"  1  
ATOM 4346   O "O3'"  . U A 1 135 ? 82.299  90.493  113.802 1.00 0.00 ? 124 U A "O3'"  1  
ATOM 4347   C "C2'"  . U A 1 135 ? 83.762  91.442  115.540 1.00 0.00 ? 124 U A "C2'"  1  
ATOM 4348   O "O2'"  . U A 1 135 ? 82.608  91.505  116.365 1.00 0.00 ? 124 U A "O2'"  1  
ATOM 4349   C "C1'"  . U A 1 135 ? 84.906  90.805  116.334 1.00 0.00 ? 124 U A "C1'"  1  
ATOM 4350   N N1     . U A 1 135 ? 86.223  91.395  115.995 1.00 0.00 ? 124 U A N1     1  
ATOM 4351   C C2     . U A 1 135 ? 86.612  92.519  116.701 1.00 0.00 ? 124 U A C2     1  
ATOM 4352   O O2     . U A 1 135 ? 85.927  93.029  117.571 1.00 0.00 ? 124 U A O2     1  
ATOM 4353   N N3     . U A 1 135 ? 87.838  93.030  116.353 1.00 0.00 ? 124 U A N3     1  
ATOM 4354   C C4     . U A 1 135 ? 88.699  92.545  115.392 1.00 0.00 ? 124 U A C4     1  
ATOM 4355   O O4     . U A 1 135 ? 89.771  93.120  115.196 1.00 0.00 ? 124 U A O4     1  
ATOM 4356   C C5     . U A 1 135 ? 88.232  91.381  114.703 1.00 0.00 ? 124 U A C5     1  
ATOM 4357   C C6     . U A 1 135 ? 87.042  90.862  115.022 1.00 0.00 ? 124 U A C6     1  
ATOM 4358   H "H5'"  . U A 1 135 ? 84.356  87.157  114.769 1.00 0.00 ? 124 U A "H5'"  1  
ATOM 4359   H "H5''" . U A 1 135 ? 83.486  87.786  113.588 1.00 0.00 ? 124 U A "H5''" 1  
ATOM 4360   H "H4'"  . U A 1 135 ? 83.053  88.860  115.623 1.00 0.00 ? 124 U A "H4'"  1  
ATOM 4361   H "H3'"  . U A 1 135 ? 84.264  90.594  113.728 1.00 0.00 ? 124 U A "H3'"  1  
ATOM 4362   H "H2'"  . U A 1 135 ? 84.012  92.325  115.198 1.00 0.00 ? 124 U A "H2'"  1  
ATOM 4363   H "HO2'" . U A 1 135 ? 81.854  91.840  115.834 1.00 0.00 ? 124 U A "HO2'" 1  
ATOM 4364   H "H1'"  . U A 1 135 ? 84.736  90.920  117.293 1.00 0.00 ? 124 U A "H1'"  1  
ATOM 4365   H H3     . U A 1 135 ? 88.132  93.827  116.841 1.00 0.00 ? 124 U A H3     1  
ATOM 4366   H H5     . U A 1 135 ? 88.781  90.968  114.004 1.00 0.00 ? 124 U A H5     1  
ATOM 4367   H H6     . U A 1 135 ? 86.745  90.066  114.535 1.00 0.00 ? 124 U A H6     1  
ATOM 4368   P P      . G A 1 136 ? 82.099  91.266  112.407 1.00 0.00 ? 125 G A P      1  
ATOM 4369   O OP1    . G A 1 136 ? 82.688  92.622  112.543 1.00 0.00 ? 125 G A OP1    1  
ATOM 4370   O OP2    . G A 1 136 ? 80.678  91.119  112.001 1.00 0.00 ? 125 G A OP2    1  
ATOM 4371   O "O5'"  . G A 1 136 ? 82.993  90.442  111.378 1.00 0.00 ? 125 G A "O5'"  1  
ATOM 4372   C "C5'"  . G A 1 136 ? 83.780  91.108  110.402 1.00 0.00 ? 125 G A "C5'"  1  
ATOM 4373   C "C4'"  . G A 1 136 ? 85.255  90.883  110.630 1.00 0.00 ? 125 G A "C4'"  1  
ATOM 4374   O "O4'"  . G A 1 136 ? 85.792  90.041  109.575 1.00 0.00 ? 125 G A "O4'"  1  
ATOM 4375   C "C3'"  . G A 1 136 ? 86.133  92.123  110.596 1.00 0.00 ? 125 G A "C3'"  1  
ATOM 4376   O "O3'"  . G A 1 136 ? 86.125  92.840  111.821 1.00 0.00 ? 125 G A "O3'"  1  
ATOM 4377   C "C2'"  . G A 1 136 ? 87.498  91.556  110.230 1.00 0.00 ? 125 G A "C2'"  1  
ATOM 4378   O "O2'"  . G A 1 136 ? 88.122  90.949  111.352 1.00 0.00 ? 125 G A "O2'"  1  
ATOM 4379   C "C1'"  . G A 1 136 ? 87.114  90.469  109.225 1.00 0.00 ? 125 G A "C1'"  1  
ATOM 4380   N N9     . G A 1 136 ? 87.140  90.962  107.835 1.00 0.00 ? 125 G A N9     1  
ATOM 4381   C C8     . G A 1 136 ? 86.062  91.232  107.026 1.00 0.00 ? 125 G A C8     1  
ATOM 4382   N N7     . G A 1 136 ? 86.402  91.658  105.841 1.00 0.00 ? 125 G A N7     1  
ATOM 4383   C C5     . G A 1 136 ? 87.789  91.672  105.866 1.00 0.00 ? 125 G A C5     1  
ATOM 4384   C C6     . G A 1 136 ? 88.725  92.044  104.864 1.00 0.00 ? 125 G A C6     1  
ATOM 4385   O O6     . G A 1 136 ? 88.502  92.447  103.718 1.00 0.00 ? 125 G A O6     1  
ATOM 4386   N N1     . G A 1 136 ? 90.036  91.907  105.311 1.00 0.00 ? 125 G A N1     1  
ATOM 4387   C C2     . G A 1 136 ? 90.401  91.469  106.560 1.00 0.00 ? 125 G A C2     1  
ATOM 4388   N N2     . G A 1 136 ? 91.717  91.404  106.806 1.00 0.00 ? 125 G A N2     1  
ATOM 4389   N N3     . G A 1 136 ? 89.541  91.119  107.503 1.00 0.00 ? 125 G A N3     1  
ATOM 4390   C C4     . G A 1 136 ? 88.263  91.247  107.090 1.00 0.00 ? 125 G A C4     1  
ATOM 4391   H "H5'"  . G A 1 136 ? 83.594  92.069  110.439 1.00 0.00 ? 125 G A "H5'"  1  
ATOM 4392   H "H5''" . G A 1 136 ? 83.539  90.771  109.512 1.00 0.00 ? 125 G A "H5''" 1  
ATOM 4393   H "H4'"  . G A 1 136 ? 85.376  90.429  111.491 1.00 0.00 ? 125 G A "H4'"  1  
ATOM 4394   H "H3'"  . G A 1 136 ? 85.826  92.715  109.878 1.00 0.00 ? 125 G A "H3'"  1  
ATOM 4395   H "H2'"  . G A 1 136 ? 88.071  92.237  109.820 1.00 0.00 ? 125 G A "H2'"  1  
ATOM 4396   H "HO2'" . G A 1 136 ? 89.077  91.166  111.344 1.00 0.00 ? 125 G A "HO2'" 1  
ATOM 4397   H "H1'"  . G A 1 136 ? 87.729  89.712  109.314 1.00 0.00 ? 125 G A "H1'"  1  
ATOM 4398   H H8     . G A 1 136 ? 85.131  91.114  107.311 1.00 0.00 ? 125 G A H8     1  
ATOM 4399   H H1     . G A 1 136 ? 90.750  92.142  104.683 1.00 0.00 ? 125 G A H1     1  
ATOM 4400   H H21    . G A 1 136 ? 92.362  91.661  106.114 1.00 0.00 ? 125 G A H21    1  
ATOM 4401   H H22    . G A 1 136 ? 92.040  91.100  107.682 1.00 0.00 ? 125 G A H22    1  
ATOM 4402   P P      . G A 1 137 ? 86.309  94.436  111.823 1.00 0.00 ? 126 G A P      1  
ATOM 4403   O OP1    . G A 1 137 ? 86.001  94.933  113.188 1.00 0.00 ? 126 G A OP1    1  
ATOM 4404   O OP2    . G A 1 137 ? 85.572  94.985  110.657 1.00 0.00 ? 126 G A OP2    1  
ATOM 4405   O "O5'"  . G A 1 137 ? 87.867  94.646  111.564 1.00 0.00 ? 126 G A "O5'"  1  
ATOM 4406   C "C5'"  . G A 1 137 ? 88.827  94.258  112.538 1.00 0.00 ? 126 G A "C5'"  1  
ATOM 4407   C "C4'"  . G A 1 137 ? 90.234  94.391  112.012 1.00 0.00 ? 126 G A "C4'"  1  
ATOM 4408   O "O4'"  . G A 1 137 ? 90.407  93.539  110.849 1.00 0.00 ? 126 G A "O4'"  1  
ATOM 4409   C "C3'"  . G A 1 137 ? 90.636  95.774  111.522 1.00 0.00 ? 126 G A "C3'"  1  
ATOM 4410   O "O3'"  . G A 1 137 ? 91.015  96.646  112.572 1.00 0.00 ? 126 G A "O3'"  1  
ATOM 4411   C "C2'"  . G A 1 137 ? 91.762  95.466  110.544 1.00 0.00 ? 126 G A "C2'"  1  
ATOM 4412   O "O2'"  . G A 1 137 ? 92.973  95.181  111.227 1.00 0.00 ? 126 G A "O2'"  1  
ATOM 4413   C "C1'"  . G A 1 137 ? 91.250  94.185  109.883 1.00 0.00 ? 126 G A "C1'"  1  
ATOM 4414   N N9     . G A 1 137 ? 90.509  94.462  108.638 1.00 0.00 ? 126 G A N9     1  
ATOM 4415   C C8     . G A 1 137 ? 89.153  94.360  108.437 1.00 0.00 ? 126 G A C8     1  
ATOM 4416   N N7     . G A 1 137 ? 88.789  94.670  107.223 1.00 0.00 ? 126 G A N7     1  
ATOM 4417   C C5     . G A 1 137 ? 89.977  94.995  106.580 1.00 0.00 ? 126 G A C5     1  
ATOM 4418   C C6     . G A 1 137 ? 90.217  95.412  105.246 1.00 0.00 ? 126 G A C6     1  
ATOM 4419   O O6     . G A 1 137 ? 89.399  95.579  104.334 1.00 0.00 ? 126 G A O6     1  
ATOM 4420   N N1     . G A 1 137 ? 91.570  95.636  105.013 1.00 0.00 ? 126 G A N1     1  
ATOM 4421   C C2     . G A 1 137 ? 92.566  95.483  105.947 1.00 0.00 ? 126 G A C2     1  
ATOM 4422   N N2     . G A 1 137 ? 93.815  95.749  105.536 1.00 0.00 ? 126 G A N2     1  
ATOM 4423   N N3     . G A 1 137 ? 92.356  95.095  107.196 1.00 0.00 ? 126 G A N3     1  
ATOM 4424   C C4     . G A 1 137 ? 91.047  94.872  107.440 1.00 0.00 ? 126 G A C4     1  
ATOM 4425   H "H5'"  . G A 1 137 ? 88.667  93.325  112.790 1.00 0.00 ? 126 G A "H5'"  1  
ATOM 4426   H "H5''" . G A 1 137 ? 88.725  94.825  113.330 1.00 0.00 ? 126 G A "H5''" 1  
ATOM 4427   H "H4'"  . G A 1 137 ? 90.862  94.108  112.710 1.00 0.00 ? 126 G A "H4'"  1  
ATOM 4428   H "H3'"  . G A 1 137 ? 89.885  96.172  111.030 1.00 0.00 ? 126 G A "H3'"  1  
ATOM 4429   H "H2'"  . G A 1 137 ? 91.875  96.187  109.889 1.00 0.00 ? 126 G A "H2'"  1  
ATOM 4430   H "HO2'" . G A 1 137 ? 92.920  95.544  112.134 1.00 0.00 ? 126 G A "HO2'" 1  
ATOM 4431   H "H1'"  . G A 1 137 ? 92.007  93.595  109.690 1.00 0.00 ? 126 G A "H1'"  1  
ATOM 4432   H H8     . G A 1 137 ? 88.523  94.083  109.133 1.00 0.00 ? 126 G A H8     1  
ATOM 4433   H H1     . G A 1 137 ? 91.830  95.928  104.115 1.00 0.00 ? 126 G A H1     1  
ATOM 4434   H H21    . G A 1 137 ? 93.978  96.037  104.613 1.00 0.00 ? 126 G A H21    1  
ATOM 4435   H H22    . G A 1 137 ? 94.566  95.655  106.159 1.00 0.00 ? 126 G A H22    1  
ATOM 4436   P P      . U A 1 138 ? 90.787  98.230  112.429 1.00 0.00 ? 127 U A P      1  
ATOM 4437   O OP1    . U A 1 138 ? 91.107  98.860  113.735 1.00 0.00 ? 127 U A OP1    1  
ATOM 4438   O OP2    . U A 1 138 ? 89.453  98.448  111.816 1.00 0.00 ? 127 U A OP2    1  
ATOM 4439   O "O5'"  . U A 1 138 ? 91.893  98.686  111.378 1.00 0.00 ? 127 U A "O5'"  1  
ATOM 4440   C "C5'"  . U A 1 138 ? 93.275  98.601  111.690 1.00 0.00 ? 127 U A "C5'"  1  
ATOM 4441   C "C4'"  . U A 1 138 ? 94.137  98.980  110.509 1.00 0.00 ? 127 U A "C4'"  1  
ATOM 4442   O "O4'"  . U A 1 138 ? 93.912  98.054  109.416 1.00 0.00 ? 127 U A "O4'"  1  
ATOM 4443   C "C3'"  . U A 1 138 ? 93.872  100.347 109.898 1.00 0.00 ? 127 U A "C3'"  1  
ATOM 4444   O "O3'"  . U A 1 138 ? 94.501  101.402 110.605 1.00 0.00 ? 127 U A "O3'"  1  
ATOM 4445   C "C2'"  . U A 1 138 ? 94.381  100.177 108.474 1.00 0.00 ? 127 U A "C2'"  1  
ATOM 4446   O "O2'"  . U A 1 138 ? 95.799  100.257 108.419 1.00 0.00 ? 127 U A "O2'"  1  
ATOM 4447   C "C1'"  . U A 1 138 ? 93.954  98.741  108.166 1.00 0.00 ? 127 U A "C1'"  1  
ATOM 4448   N N1     . U A 1 138 ? 92.633  98.681  107.494 1.00 0.00 ? 127 U A N1     1  
ATOM 4449   C C2     . U A 1 138 ? 92.591  99.008  106.152 1.00 0.00 ? 127 U A C2     1  
ATOM 4450   O O2     . U A 1 138 ? 93.578  99.336  105.516 1.00 0.00 ? 127 U A O2     1  
ATOM 4451   N N3     . U A 1 138 ? 91.348  98.936  105.571 1.00 0.00 ? 127 U A N3     1  
ATOM 4452   C C4     . U A 1 138 ? 90.167  98.580  106.184 1.00 0.00 ? 127 U A C4     1  
ATOM 4453   O O4     . U A 1 138 ? 89.124  98.565  105.524 1.00 0.00 ? 127 U A O4     1  
ATOM 4454   C C5     . U A 1 138 ? 90.284  98.253  107.571 1.00 0.00 ? 127 U A C5     1  
ATOM 4455   C C6     . U A 1 138 ? 91.482  98.314  108.161 1.00 0.00 ? 127 U A C6     1  
ATOM 4456   H "H5'"  . U A 1 138 ? 93.486  97.681  111.957 1.00 0.00 ? 127 U A "H5'"  1  
ATOM 4457   H "H5''" . U A 1 138 ? 93.473  99.205  112.435 1.00 0.00 ? 127 U A "H5''" 1  
ATOM 4458   H "H4'"  . U A 1 138 ? 95.077  98.930  110.781 1.00 0.00 ? 127 U A "H4'"  1  
ATOM 4459   H "H3'"  . U A 1 138 ? 92.904  100.508 109.876 1.00 0.00 ? 127 U A "H3'"  1  
ATOM 4460   H "H2'"  . U A 1 138 ? 93.960  100.816 107.861 1.00 0.00 ? 127 U A "H2'"  1  
ATOM 4461   H "HO2'" . U A 1 138 ? 96.123  100.711 109.223 1.00 0.00 ? 127 U A "HO2'" 1  
ATOM 4462   H "H1'"  . U A 1 138 ? 94.627  98.317  107.593 1.00 0.00 ? 127 U A "H1'"  1  
ATOM 4463   H H3     . U A 1 138 ? 91.298  99.165  104.621 1.00 0.00 ? 127 U A H3     1  
ATOM 4464   H H5     . U A 1 138 ? 89.493  97.988  108.086 1.00 0.00 ? 127 U A H5     1  
ATOM 4465   H H6     . U A 1 138 ? 91.537  98.087  109.112 1.00 0.00 ? 127 U A H6     1  
ATOM 4466   P P      . A A 1 139 ? 94.020  102.920 110.390 1.00 0.00 ? 128 A A P      1  
ATOM 4467   O OP1    . A A 1 139 ? 92.780  102.899 109.574 1.00 0.00 ? 128 A A OP1    1  
ATOM 4468   O OP2    . A A 1 139 ? 95.188  103.712 109.931 1.00 0.00 ? 128 A A OP2    1  
ATOM 4469   O "O5'"  . A A 1 139 ? 93.637  103.413 111.856 1.00 0.00 ? 128 A A "O5'"  1  
ATOM 4470   C "C5'"  . A A 1 139 ? 94.406  103.019 112.982 1.00 0.00 ? 128 A A "C5'"  1  
ATOM 4471   C "C4'"  . A A 1 139 ? 94.186  103.941 114.155 1.00 0.00 ? 128 A A "C4'"  1  
ATOM 4472   O "O4'"  . A A 1 139 ? 95.477  104.337 114.676 1.00 0.00 ? 128 A A "O4'"  1  
ATOM 4473   C "C3'"  . A A 1 139 ? 93.463  105.245 113.852 1.00 0.00 ? 128 A A "C3'"  1  
ATOM 4474   O "O3'"  . A A 1 139 ? 92.054  105.134 113.953 1.00 0.00 ? 128 A A "O3'"  1  
ATOM 4475   C "C2'"  . A A 1 139 ? 94.009  106.187 114.912 1.00 0.00 ? 128 A A "C2'"  1  
ATOM 4476   O "O2'"  . A A 1 139 ? 93.345  106.005 116.154 1.00 0.00 ? 128 A A "O2'"  1  
ATOM 4477   C "C1'"  . A A 1 139 ? 95.444  105.698 115.043 1.00 0.00 ? 128 A A "C1'"  1  
ATOM 4478   N N9     . A A 1 139 ? 96.368  106.445 114.168 1.00 0.00 ? 128 A A N9     1  
ATOM 4479   C C8     . A A 1 139 ? 96.951  106.021 112.999 1.00 0.00 ? 128 A A C8     1  
ATOM 4480   N N7     . A A 1 139 ? 97.730  106.915 112.442 1.00 0.00 ? 128 A A N7     1  
ATOM 4481   C C5     . A A 1 139 ? 97.656  108.002 113.302 1.00 0.00 ? 128 A A C5     1  
ATOM 4482   C C6     . A A 1 139 ? 98.257  109.273 113.275 1.00 0.00 ? 128 A A C6     1  
ATOM 4483   N N6     . A A 1 139 ? 99.085  109.681 112.310 1.00 0.00 ? 128 A A N6     1  
ATOM 4484   N N1     . A A 1 139 ? 97.975  110.123 114.286 1.00 0.00 ? 128 A A N1     1  
ATOM 4485   C C2     . A A 1 139 ? 97.144  109.715 115.254 1.00 0.00 ? 128 A A C2     1  
ATOM 4486   N N3     . A A 1 139 ? 96.519  108.548 115.389 1.00 0.00 ? 128 A A N3     1  
ATOM 4487   C C4     . A A 1 139 ? 96.821  107.726 114.368 1.00 0.00 ? 128 A A C4     1  
ATOM 4488   H "H5'"  . A A 1 139 ? 95.356  103.031 112.741 1.00 0.00 ? 128 A A "H5'"  1  
ATOM 4489   H "H5''" . A A 1 139 ? 94.154  102.108 113.240 1.00 0.00 ? 128 A A "H5''" 1  
ATOM 4490   H "H4'"  . A A 1 139 ? 93.686  103.460 114.847 1.00 0.00 ? 128 A A "H4'"  1  
ATOM 4491   H "H3'"  . A A 1 139 ? 93.738  105.567 112.968 1.00 0.00 ? 128 A A "H3'"  1  
ATOM 4492   H "H2'"  . A A 1 139 ? 93.974  107.121 114.615 1.00 0.00 ? 128 A A "H2'"  1  
ATOM 4493   H "HO2'" . A A 1 139 ? 93.703  106.644 116.804 1.00 0.00 ? 128 A A "HO2'" 1  
ATOM 4494   H "H1'"  . A A 1 139 ? 95.735  105.787 115.976 1.00 0.00 ? 128 A A "H1'"  1  
ATOM 4495   H H8     . A A 1 139 ? 96.797  105.131 112.615 1.00 0.00 ? 128 A A H8     1  
ATOM 4496   H H61    . A A 1 139 ? 99.474  110.580 112.346 1.00 0.00 ? 128 A A H61    1  
ATOM 4497   H H62    . A A 1 139 ? 99.304  109.081 111.567 1.00 0.00 ? 128 A A H62    1  
ATOM 4498   H H2     . A A 1 139 ? 96.972  110.369 115.964 1.00 0.00 ? 128 A A H2     1  
ATOM 4499   P P      . A A 1 140 ? 91.104  106.126 113.118 1.00 0.00 ? 129 A A P      1  
ATOM 4500   O OP1    . A A 1 140 ? 89.878  105.380 112.741 1.00 0.00 ? 129 A A OP1    1  
ATOM 4501   O OP2    . A A 1 140 ? 91.926  106.769 112.062 1.00 0.00 ? 129 A A OP2    1  
ATOM 4502   O "O5'"  . A A 1 140 ? 90.695  107.247 114.174 1.00 0.00 ? 129 A A "O5'"  1  
ATOM 4503   C "C5'"  . A A 1 140 ? 89.495  107.138 114.924 1.00 0.00 ? 129 A A "C5'"  1  
ATOM 4504   C "C4'"  . A A 1 140 ? 88.333  107.781 114.208 1.00 0.00 ? 129 A A "C4'"  1  
ATOM 4505   O "O4'"  . A A 1 140 ? 88.718  109.136 113.851 1.00 0.00 ? 129 A A "O4'"  1  
ATOM 4506   C "C3'"  . A A 1 140 ? 87.895  107.112 112.914 1.00 0.00 ? 129 A A "C3'"  1  
ATOM 4507   O "O3'"  . A A 1 140 ? 86.499  107.205 112.687 1.00 0.00 ? 129 A A "O3'"  1  
ATOM 4508   C "C2'"  . A A 1 140 ? 88.608  107.935 111.849 1.00 0.00 ? 129 A A "C2'"  1  
ATOM 4509   O "O2'"  . A A 1 140 ? 87.882  107.938 110.629 1.00 0.00 ? 129 A A "O2'"  1  
ATOM 4510   C "C1'"  . A A 1 140 ? 88.561  109.335 112.453 1.00 0.00 ? 129 A A "C1'"  1  
ATOM 4511   N N9     . A A 1 140 ? 89.659  110.190 111.963 1.00 0.00 ? 129 A A N9     1  
ATOM 4512   C C8     . A A 1 140 ? 90.932  109.811 111.614 1.00 0.00 ? 129 A A C8     1  
ATOM 4513   N N7     . A A 1 140 ? 91.687  110.804 111.212 1.00 0.00 ? 129 A A N7     1  
ATOM 4514   C C5     . A A 1 140 ? 90.855  111.912 111.301 1.00 0.00 ? 129 A A C5     1  
ATOM 4515   C C6     . A A 1 140 ? 91.059  113.274 111.017 1.00 0.00 ? 129 A A C6     1  
ATOM 4516   N N6     . A A 1 140 ? 92.212  113.772 110.565 1.00 0.00 ? 129 A A N6     1  
ATOM 4517   N N1     . A A 1 140 ? 90.023  114.118 111.214 1.00 0.00 ? 129 A A N1     1  
ATOM 4518   C C2     . A A 1 140 ? 88.866  113.620 111.666 1.00 0.00 ? 129 A A C2     1  
ATOM 4519   N N3     . A A 1 140 ? 88.553  112.361 111.969 1.00 0.00 ? 129 A A N3     1  
ATOM 4520   C C4     . A A 1 140 ? 89.604  111.548 111.762 1.00 0.00 ? 129 A A C4     1  
ATOM 4521   H "H5'"  . A A 1 140 ? 89.618  107.578 115.791 1.00 0.00 ? 129 A A "H5'"  1  
ATOM 4522   H "H5''" . A A 1 140 ? 89.294  106.191 115.072 1.00 0.00 ? 129 A A "H5''" 1  
ATOM 4523   H "H4'"  . A A 1 140 ? 87.561  107.803 114.812 1.00 0.00 ? 129 A A "H4'"  1  
ATOM 4524   H "H3'"  . A A 1 140 ? 88.241  106.195 112.892 1.00 0.00 ? 129 A A "H3'"  1  
ATOM 4525   H "H2'"  . A A 1 140 ? 89.532  107.633 111.722 1.00 0.00 ? 129 A A "H2'"  1  
ATOM 4526   H "HO2'" . A A 1 140 ? 88.400  108.420 109.951 1.00 0.00 ? 129 A A "HO2'" 1  
ATOM 4527   H "H1'"  . A A 1 140 ? 87.700  109.754 112.239 1.00 0.00 ? 129 A A "H1'"  1  
ATOM 4528   H H8     . A A 1 140 ? 91.247  108.884 111.661 1.00 0.00 ? 129 A A H8     1  
ATOM 4529   H H61    . A A 1 140 ? 92.294  114.732 110.385 1.00 0.00 ? 129 A A H61    1  
ATOM 4530   H H62    . A A 1 140 ? 92.977  113.178 110.415 1.00 0.00 ? 129 A A H62    1  
ATOM 4531   H H2     . A A 1 140 ? 88.147  114.274 111.793 1.00 0.00 ? 129 A A H2     1  
ATOM 4532   P P      . U A 1 141 ? 85.770  106.163 111.704 1.00 0.00 ? 130 U A P      1  
ATOM 4533   O OP1    . U A 1 141 ? 85.313  106.906 110.502 1.00 0.00 ? 130 U A OP1    1  
ATOM 4534   O OP2    . U A 1 141 ? 84.789  105.387 112.504 1.00 0.00 ? 130 U A OP2    1  
ATOM 4535   O "O5'"  . U A 1 141 ? 86.935  105.173 111.258 1.00 0.00 ? 130 U A "O5'"  1  
ATOM 4536   C "C5'"  . U A 1 141 ? 87.038  104.725 109.915 1.00 0.00 ? 130 U A "C5'"  1  
ATOM 4537   C "C4'"  . U A 1 141 ? 88.257  103.859 109.709 1.00 0.00 ? 130 U A "C4'"  1  
ATOM 4538   O "O4'"  . U A 1 141 ? 88.904  103.737 110.997 1.00 0.00 ? 130 U A "O4'"  1  
ATOM 4539   C "C3'"  . U A 1 141 ? 87.997  102.441 109.226 1.00 0.00 ? 130 U A "C3'"  1  
ATOM 4540   O "O3'"  . U A 1 141 ? 88.726  102.111 108.057 1.00 0.00 ? 130 U A "O3'"  1  
ATOM 4541   C "C2'"  . U A 1 141 ? 88.231  101.537 110.432 1.00 0.00 ? 130 U A "C2'"  1  
ATOM 4542   O "O2'"  . U A 1 141 ? 88.853  100.318 110.049 1.00 0.00 ? 130 U A "O2'"  1  
ATOM 4543   C "C1'"  . U A 1 141 ? 89.226  102.359 111.258 1.00 0.00 ? 130 U A "C1'"  1  
ATOM 4544   N N1     . U A 1 141 ? 89.097  102.102 112.713 1.00 0.00 ? 130 U A N1     1  
ATOM 4545   C C2     . U A 1 141 ? 90.267  101.910 113.425 1.00 0.00 ? 130 U A C2     1  
ATOM 4546   O O2     . U A 1 141 ? 91.372  101.946 112.913 1.00 0.00 ? 130 U A O2     1  
ATOM 4547   N N3     . U A 1 141 ? 90.099  101.676 114.768 1.00 0.00 ? 130 U A N3     1  
ATOM 4548   C C4     . U A 1 141 ? 88.908  101.613 115.459 1.00 0.00 ? 130 U A C4     1  
ATOM 4549   O O4     . U A 1 141 ? 88.922  101.392 116.671 1.00 0.00 ? 130 U A O4     1  
ATOM 4550   C C5     . U A 1 141 ? 87.740  101.821 114.658 1.00 0.00 ? 130 U A C5     1  
ATOM 4551   C C6     . U A 1 141 ? 87.874  102.052 113.348 1.00 0.00 ? 130 U A C6     1  
ATOM 4552   H "H5'"  . U A 1 141 ? 87.095  105.503 109.322 1.00 0.00 ? 130 U A "H5'"  1  
ATOM 4553   H "H5''" . U A 1 141 ? 86.237  104.208 109.689 1.00 0.00 ? 130 U A "H5''" 1  
ATOM 4554   H "H4'"  . U A 1 141 ? 88.852  104.301 109.068 1.00 0.00 ? 130 U A "H4'"  1  
ATOM 4555   H "H3'"  . U A 1 141 ? 87.055  102.354 108.971 1.00 0.00 ? 130 U A "H3'"  1  
ATOM 4556   H "H2'"  . U A 1 141 ? 87.402  101.379 110.929 1.00 0.00 ? 130 U A "H2'"  1  
ATOM 4557   H "HO2'" . U A 1 141 ? 88.982  99.762  110.846 1.00 0.00 ? 130 U A "HO2'" 1  
ATOM 4558   H "H1'"  . U A 1 141 ? 90.139  102.146 110.970 1.00 0.00 ? 130 U A "H1'"  1  
ATOM 4559   H H3     . U A 1 141 ? 90.915  101.537 115.292 1.00 0.00 ? 130 U A H3     1  
ATOM 4560   H H5     . U A 1 141 ? 86.850  101.794 115.067 1.00 0.00 ? 130 U A H5     1  
ATOM 4561   H H6     . U A 1 141 ? 87.060  102.190 112.822 1.00 0.00 ? 130 U A H6     1  
ATOM 4562   P P      . A A 1 142 ? 87.959  101.871 106.665 1.00 0.00 ? 131 A A P      1  
ATOM 4563   O OP1    . A A 1 142 ? 86.729  102.701 106.669 1.00 0.00 ? 131 A A OP1    1  
ATOM 4564   O OP2    . A A 1 142 ? 87.857  100.407 106.444 1.00 0.00 ? 131 A A OP2    1  
ATOM 4565   O "O5'"  . A A 1 142 ? 88.953  102.466 105.571 1.00 0.00 ? 131 A A "O5'"  1  
ATOM 4566   C "C5'"  . A A 1 142 ? 88.918  102.006 104.228 1.00 0.00 ? 131 A A "C5'"  1  
ATOM 4567   C "C4'"  . A A 1 142 ? 89.896  102.757 103.359 1.00 0.00 ? 131 A A "C4'"  1  
ATOM 4568   O "O4'"  . A A 1 142 ? 89.362  102.781 102.011 1.00 0.00 ? 131 A A "O4'"  1  
ATOM 4569   C "C3'"  . A A 1 142 ? 90.119  104.219 103.716 1.00 0.00 ? 131 A A "C3'"  1  
ATOM 4570   O "O3'"  . A A 1 142 ? 91.049  104.397 104.770 1.00 0.00 ? 131 A A "O3'"  1  
ATOM 4571   C "C2'"  . A A 1 142 ? 89.583  105.065 102.567 1.00 0.00 ? 131 A A "C2'"  1  
ATOM 4572   O "O2'"  . A A 1 142 ? 90.636  105.520 101.729 1.00 0.00 ? 131 A A "O2'"  1  
ATOM 4573   C "C1'"  . A A 1 142 ? 88.746  104.043 101.801 1.00 0.00 ? 131 A A "C1'"  1  
ATOM 4574   N N9     . A A 1 142 ? 87.343  104.022 102.254 1.00 0.00 ? 131 A A N9     1  
ATOM 4575   C C8     . A A 1 142 ? 86.208  103.954 101.484 1.00 0.00 ? 131 A A C8     1  
ATOM 4576   N N7     . A A 1 142 ? 85.097  103.953 102.178 1.00 0.00 ? 131 A A N7     1  
ATOM 4577   C C5     . A A 1 142 ? 85.528  104.025 103.496 1.00 0.00 ? 131 A A C5     1  
ATOM 4578   C C6     . A A 1 142 ? 84.835  104.061 104.719 1.00 0.00 ? 131 A A C6     1  
ATOM 4579   N N6     . A A 1 142 ? 83.504  104.026 104.817 1.00 0.00 ? 131 A A N6     1  
ATOM 4580   N N1     . A A 1 142 ? 85.564  104.134 105.853 1.00 0.00 ? 131 A A N1     1  
ATOM 4581   C C2     . A A 1 142 ? 86.899  104.168 105.756 1.00 0.00 ? 131 A A C2     1  
ATOM 4582   N N3     . A A 1 142 ? 87.664  104.141 104.667 1.00 0.00 ? 131 A A N3     1  
ATOM 4583   C C4     . A A 1 142 ? 86.908  104.068 103.557 1.00 0.00 ? 131 A A C4     1  
ATOM 4584   H "H5'"  . A A 1 142 ? 88.014  102.128 103.871 1.00 0.00 ? 131 A A "H5'"  1  
ATOM 4585   H "H5''" . A A 1 142 ? 89.142  101.052 104.210 1.00 0.00 ? 131 A A "H5''" 1  
ATOM 4586   H "H4'"  . A A 1 142 ? 90.756  102.287 103.370 1.00 0.00 ? 131 A A "H4'"  1  
ATOM 4587   H "H3'"  . A A 1 142 ? 89.582  104.442 104.506 1.00 0.00 ? 131 A A "H3'"  1  
ATOM 4588   H "H2'"  . A A 1 142 ? 89.032  105.807 102.893 1.00 0.00 ? 131 A A "H2'"  1  
ATOM 4589   H "HO2'" . A A 1 142 ? 91.485  105.433 102.209 1.00 0.00 ? 131 A A "HO2'" 1  
ATOM 4590   H "H1'"  . A A 1 142 ? 88.777  104.249 100.842 1.00 0.00 ? 131 A A "H1'"  1  
ATOM 4591   H H8     . A A 1 142 ? 86.227  103.910 100.505 1.00 0.00 ? 131 A A H8     1  
ATOM 4592   H H61    . A A 1 142 ? 83.076  104.054 105.698 1.00 0.00 ? 131 A A H61    1  
ATOM 4593   H H62    . A A 1 142 ? 82.954  103.974 104.007 1.00 0.00 ? 131 A A H62    1  
ATOM 4594   H H2     . A A 1 142 ? 87.382  104.221 106.608 1.00 0.00 ? 131 A A H2     1  
ATOM 4595   P P      . A A 1 143 ? 91.855  103.200 105.260 1.00 0.00 ? 132 A A P      1  
ATOM 4596   O OP1    . A A 1 143 ? 91.027  101.987 105.045 1.00 0.00 ? 132 A A OP1    1  
ATOM 4597   O OP2    . A A 1 143 ? 92.191  103.625 106.642 1.00 0.00 ? 132 A A OP2    1  
ATOM 4598   O "O5'"  . A A 1 143 ? 93.219  103.015 104.457 1.00 0.00 ? 132 A A "O5'"  1  
ATOM 4599   C "C5'"  . A A 1 143 ? 94.138  101.991 104.807 1.00 0.00 ? 132 A A "C5'"  1  
ATOM 4600   C "C4'"  . A A 1 143 ? 95.345  101.997 103.903 1.00 0.00 ? 132 A A "C4'"  1  
ATOM 4601   O "O4'"  . A A 1 143 ? 94.935  102.089 102.516 1.00 0.00 ? 132 A A "O4'"  1  
ATOM 4602   C "C3'"  . A A 1 143 ? 96.303  103.165 104.078 1.00 0.00 ? 132 A A "C3'"  1  
ATOM 4603   O "O3'"  . A A 1 143 ? 97.321  102.910 105.029 1.00 0.00 ? 132 A A "O3'"  1  
ATOM 4604   C "C2'"  . A A 1 143 ? 96.829  103.376 102.663 1.00 0.00 ? 132 A A "C2'"  1  
ATOM 4605   O "O2'"  . A A 1 143 ? 97.835  102.427 102.341 1.00 0.00 ? 132 A A "O2'"  1  
ATOM 4606   C "C1'"  . A A 1 143 ? 95.582  103.080 101.828 1.00 0.00 ? 132 A A "C1'"  1  
ATOM 4607   N N9     . A A 1 143 ? 94.663  104.232 101.773 1.00 0.00 ? 132 A A N9     1  
ATOM 4608   C C8     . A A 1 143 ? 94.042  104.867 102.820 1.00 0.00 ? 132 A A C8     1  
ATOM 4609   N N7     . A A 1 143 ? 93.279  105.867 102.454 1.00 0.00 ? 132 A A N7     1  
ATOM 4610   C C5     . A A 1 143 ? 93.406  105.894 101.071 1.00 0.00 ? 132 A A C5     1  
ATOM 4611   C C6     . A A 1 143 ? 92.844  106.724 100.085 1.00 0.00 ? 132 A A C6     1  
ATOM 4612   N N6     . A A 1 143 ? 92.009  107.730 100.351 1.00 0.00 ? 132 A A N6     1  
ATOM 4613   N N1     . A A 1 143 ? 93.176  106.483 98.798  1.00 0.00 ? 132 A A N1     1  
ATOM 4614   C C2     . A A 1 143 ? 94.015  105.474 98.530  1.00 0.00 ? 132 A A C2     1  
ATOM 4615   N N3     . A A 1 143 ? 94.605  104.626 99.369  1.00 0.00 ? 132 A A N3     1  
ATOM 4616   C C4     . A A 1 143 ? 94.255  104.893 100.640 1.00 0.00 ? 132 A A C4     1  
ATOM 4617   H "H5'"  . A A 1 143 ? 93.690  101.122 104.736 1.00 0.00 ? 132 A A "H5'"  1  
ATOM 4618   H "H5''" . A A 1 143 ? 94.430  102.125 105.732 1.00 0.00 ? 132 A A "H5''" 1  
ATOM 4619   H "H4'"  . A A 1 143 ? 95.838  101.160 104.037 1.00 0.00 ? 132 A A "H4'"  1  
ATOM 4620   H "H3'"  . A A 1 143 ? 95.798  103.959 104.353 1.00 0.00 ? 132 A A "H3'"  1  
ATOM 4621   H "H2'"  . A A 1 143 ? 97.139  104.296 102.528 1.00 0.00 ? 132 A A "H2'"  1  
ATOM 4622   H "HO2'" . A A 1 143 ? 98.298  102.162 103.163 1.00 0.00 ? 132 A A "HO2'" 1  
ATOM 4623   H "H1'"  . A A 1 143 ? 95.851  102.832 100.918 1.00 0.00 ? 132 A A "H1'"  1  
ATOM 4624   H H8     . A A 1 143 ? 94.158  104.598 103.755 1.00 0.00 ? 132 A A H8     1  
ATOM 4625   H H61    . A A 1 143 ? 91.649  108.275 99.620  1.00 0.00 ? 132 A A H61    1  
ATOM 4626   H H62    . A A 1 143 ? 91.754  107.924 101.277 1.00 0.00 ? 132 A A H62    1  
ATOM 4627   H H2     . A A 1 143 ? 94.223  105.341 97.581  1.00 0.00 ? 132 A A H2     1  
ATOM 4628   P P      . G A 1 144 ? 97.044  103.153 106.594 1.00 0.00 ? 133 G A P      1  
ATOM 4629   O OP1    . G A 1 144 ? 97.462  101.933 107.331 1.00 0.00 ? 133 G A OP1    1  
ATOM 4630   O OP2    . G A 1 144 ? 95.656  103.661 106.741 1.00 0.00 ? 133 G A OP2    1  
ATOM 4631   O "O5'"  . G A 1 144 ? 98.044  104.331 106.984 1.00 0.00 ? 133 G A "O5'"  1  
ATOM 4632   C "C5'"  . G A 1 144 ? 99.448  104.122 106.993 1.00 0.00 ? 133 G A "C5'"  1  
ATOM 4633   C "C4'"  . G A 1 144 ? 100.180 105.249 106.307 1.00 0.00 ? 133 G A "C4'"  1  
ATOM 4634   O "O4'"  . G A 1 144 ? 99.847  105.260 104.896 1.00 0.00 ? 133 G A "O4'"  1  
ATOM 4635   C "C3'"  . G A 1 144 ? 99.810  106.655 106.754 1.00 0.00 ? 133 G A "C3'"  1  
ATOM 4636   O "O3'"  . G A 1 144 ? 100.418 107.023 107.981 1.00 0.00 ? 133 G A "O3'"  1  
ATOM 4637   C "C2'"  . G A 1 144 ? 100.234 107.492 105.546 1.00 0.00 ? 133 G A "C2'"  1  
ATOM 4638   O "O2'"  . G A 1 144 ? 101.644 107.659 105.504 1.00 0.00 ? 133 G A "O2'"  1  
ATOM 4639   C "C1'"  . G A 1 144 ? 99.806  106.590 104.405 1.00 0.00 ? 133 G A "C1'"  1  
ATOM 4640   N N9     . G A 1 144 ? 98.429  106.874 103.959 1.00 0.00 ? 133 G A N9     1  
ATOM 4641   C C8     . G A 1 144 ? 97.274  106.268 104.389 1.00 0.00 ? 133 G A C8     1  
ATOM 4642   N N7     . G A 1 144 ? 96.202  106.734 103.807 1.00 0.00 ? 133 G A N7     1  
ATOM 4643   C C5     . G A 1 144 ? 96.678  107.708 102.940 1.00 0.00 ? 133 G A C5     1  
ATOM 4644   C C6     . G A 1 144 ? 95.982  108.558 102.042 1.00 0.00 ? 133 G A C6     1  
ATOM 4645   O O6     . G A 1 144 ? 94.767  108.622 101.826 1.00 0.00 ? 133 G A O6     1  
ATOM 4646   N N1     . G A 1 144 ? 96.853  109.397 101.352 1.00 0.00 ? 133 G A N1     1  
ATOM 4647   C C2     . G A 1 144 ? 98.218  109.417 101.508 1.00 0.00 ? 133 G A C2     1  
ATOM 4648   N N2     . G A 1 144 ? 98.890  110.298 100.754 1.00 0.00 ? 133 G A N2     1  
ATOM 4649   N N3     . G A 1 144 ? 98.878  108.629 102.342 1.00 0.00 ? 133 G A N3     1  
ATOM 4650   C C4     . G A 1 144 ? 98.051  107.807 103.021 1.00 0.00 ? 133 G A C4     1  
ATOM 4651   H "H5'"  . G A 1 144 ? 99.650  103.282 106.531 1.00 0.00 ? 133 G A "H5'"  1  
ATOM 4652   H "H5''" . G A 1 144 ? 99.757  104.059 107.921 1.00 0.00 ? 133 G A "H5''" 1  
ATOM 4653   H "H4'"  . G A 1 144 ? 101.147 105.126 106.412 1.00 0.00 ? 133 G A "H4'"  1  
ATOM 4654   H "H3'"  . G A 1 144 ? 98.837  106.717 106.846 1.00 0.00 ? 133 G A "H3'"  1  
ATOM 4655   H "H2'"  . G A 1 144 ? 99.766  108.353 105.522 1.00 0.00 ? 133 G A "H2'"  1  
ATOM 4656   H "HO2'" . G A 1 144 ? 101.876 108.222 104.736 1.00 0.00 ? 133 G A "HO2'" 1  
ATOM 4657   H "H1'"  . G A 1 144 ? 100.423 106.702 103.651 1.00 0.00 ? 133 G A "H1'"  1  
ATOM 4658   H H8     . G A 1 144 ? 97.255  105.558 105.063 1.00 0.00 ? 133 G A H8     1  
ATOM 4659   H H1     . G A 1 144 ? 96.460  110.022 100.707 1.00 0.00 ? 133 G A H1     1  
ATOM 4660   H H21    . G A 1 144 ? 98.409  110.885 100.134 1.00 0.00 ? 133 G A H21    1  
ATOM 4661   H H22    . G A 1 144 ? 99.867  110.357 100.822 1.00 0.00 ? 133 G A H22    1  
ATOM 4662   P P      . C A 1 145 ? 99.534  107.132 109.318 1.00 0.00 ? 134 C A P      1  
ATOM 4663   O OP1    . C A 1 145 ? 100.449 107.026 110.483 1.00 0.00 ? 134 C A OP1    1  
ATOM 4664   O OP2    . C A 1 145 ? 98.393  106.190 109.194 1.00 0.00 ? 134 C A OP2    1  
ATOM 4665   O "O5'"  . C A 1 145 ? 98.956  108.616 109.280 1.00 0.00 ? 134 C A "O5'"  1  
ATOM 4666   C "C5'"  . C A 1 145 ? 97.556  108.853 109.284 1.00 0.00 ? 134 C A "C5'"  1  
ATOM 4667   C "C4'"  . C A 1 145 ? 97.078  109.392 107.957 1.00 0.00 ? 134 C A "C4'"  1  
ATOM 4668   O "O4'"  . C A 1 145 ? 96.507  108.319 107.165 1.00 0.00 ? 134 C A "O4'"  1  
ATOM 4669   C "C3'"  . C A 1 145 ? 95.973  110.436 108.017 1.00 0.00 ? 134 C A "C3'"  1  
ATOM 4670   O "O3'"  . C A 1 145 ? 96.457  111.741 108.281 1.00 0.00 ? 134 C A "O3'"  1  
ATOM 4671   C "C2'"  . C A 1 145 ? 95.308  110.294 106.658 1.00 0.00 ? 134 C A "C2'"  1  
ATOM 4672   O "O2'"  . C A 1 145 ? 96.067  110.934 105.641 1.00 0.00 ? 134 C A "O2'"  1  
ATOM 4673   C "C1'"  . C A 1 145 ? 95.370  108.780 106.443 1.00 0.00 ? 134 C A "C1'"  1  
ATOM 4674   N N1     . C A 1 145 ? 94.144  108.092 106.916 1.00 0.00 ? 134 C A N1     1  
ATOM 4675   C C2     . C A 1 145 ? 93.000  108.145 106.109 1.00 0.00 ? 134 C A C2     1  
ATOM 4676   O O2     . C A 1 145 ? 93.045  108.757 105.032 1.00 0.00 ? 134 C A O2     1  
ATOM 4677   N N3     . C A 1 145 ? 91.868  107.525 106.518 1.00 0.00 ? 134 C A N3     1  
ATOM 4678   C C4     . C A 1 145 ? 91.847  106.871 107.680 1.00 0.00 ? 134 C A C4     1  
ATOM 4679   N N4     . C A 1 145 ? 90.707  106.275 108.042 1.00 0.00 ? 134 C A N4     1  
ATOM 4680   C C5     . C A 1 145 ? 92.992  106.802 108.521 1.00 0.00 ? 134 C A C5     1  
ATOM 4681   C C6     . C A 1 145 ? 94.106  107.417 108.107 1.00 0.00 ? 134 C A C6     1  
ATOM 4682   H "H5'"  . C A 1 145 ? 97.343  109.501 109.987 1.00 0.00 ? 134 C A "H5'"  1  
ATOM 4683   H "H5''" . C A 1 145 ? 97.091  108.011 109.473 1.00 0.00 ? 134 C A "H5''" 1  
ATOM 4684   H "H4'"  . C A 1 145 ? 97.845  109.771 107.477 1.00 0.00 ? 134 C A "H4'"  1  
ATOM 4685   H "H3'"  . C A 1 145 ? 95.330  110.186 108.716 1.00 0.00 ? 134 C A "H3'"  1  
ATOM 4686   H "H2'"  . C A 1 145 ? 94.382  110.614 106.674 1.00 0.00 ? 134 C A "H2'"  1  
ATOM 4687   H "HO2'" . C A 1 145 ? 96.668  111.587 106.056 1.00 0.00 ? 134 C A "HO2'" 1  
ATOM 4688   H "H1'"  . C A 1 145 ? 95.502  108.591 105.490 1.00 0.00 ? 134 C A "H1'"  1  
ATOM 4689   H H41    . C A 1 145 ? 89.921  106.327 107.459 1.00 0.00 ? 134 C A H41    1  
ATOM 4690   H H42    . C A 1 145 ? 90.658  105.787 108.889 1.00 0.00 ? 134 C A H42    1  
ATOM 4691   H H5     . C A 1 145 ? 92.965  106.319 109.374 1.00 0.00 ? 134 C A H5     1  
ATOM 4692   H H6     . C A 1 145 ? 94.904  107.380 108.673 1.00 0.00 ? 134 C A H6     1  
ATOM 4693   P P      . U A 1 146 ? 95.538  112.802 109.065 1.00 0.00 ? 135 U A P      1  
ATOM 4694   O OP1    . U A 1 146 ? 96.386  113.969 109.419 1.00 0.00 ? 135 U A OP1    1  
ATOM 4695   O OP2    . U A 1 146 ? 94.805  112.074 110.130 1.00 0.00 ? 135 U A OP2    1  
ATOM 4696   O "O5'"  . U A 1 146 ? 94.480  113.275 107.970 1.00 0.00 ? 135 U A "O5'"  1  
ATOM 4697   C "C5'"  . U A 1 146 ? 94.883  114.051 106.851 1.00 0.00 ? 135 U A "C5'"  1  
ATOM 4698   C "C4'"  . U A 1 146 ? 93.731  114.320 105.918 1.00 0.00 ? 135 U A "C4'"  1  
ATOM 4699   O "O4'"  . U A 1 146 ? 93.241  113.072 105.362 1.00 0.00 ? 135 U A "O4'"  1  
ATOM 4700   C "C3'"  . U A 1 146 ? 92.496  114.955 106.540 1.00 0.00 ? 135 U A "C3'"  1  
ATOM 4701   O "O3'"  . U A 1 146 ? 92.608  116.361 106.683 1.00 0.00 ? 135 U A "O3'"  1  
ATOM 4702   C "C2'"  . U A 1 146 ? 91.385  114.524 105.595 1.00 0.00 ? 135 U A "C2'"  1  
ATOM 4703   O "O2'"  . U A 1 146 ? 91.386  115.305 104.409 1.00 0.00 ? 135 U A "O2'"  1  
ATOM 4704   C "C1'"  . U A 1 146 ? 91.816  113.098 105.250 1.00 0.00 ? 135 U A "C1'"  1  
ATOM 4705   N N1     . U A 1 146 ? 91.216  112.093 106.160 1.00 0.00 ? 135 U A N1     1  
ATOM 4706   C C2     . U A 1 146 ? 89.902  111.732 105.921 1.00 0.00 ? 135 U A C2     1  
ATOM 4707   O O2     . U A 1 146 ? 89.238  112.200 105.011 1.00 0.00 ? 135 U A O2     1  
ATOM 4708   N N3     . U A 1 146 ? 89.388  110.798 106.789 1.00 0.00 ? 135 U A N3     1  
ATOM 4709   C C4     . U A 1 146 ? 90.037  110.201 107.848 1.00 0.00 ? 135 U A C4     1  
ATOM 4710   O O4     . U A 1 146 ? 89.435  109.377 108.537 1.00 0.00 ? 135 U A O4     1  
ATOM 4711   C C5     . U A 1 146 ? 91.392  110.623 108.033 1.00 0.00 ? 135 U A C5     1  
ATOM 4712   C C6     . U A 1 146 ? 91.918  111.528 107.203 1.00 0.00 ? 135 U A C6     1  
ATOM 4713   H "H5'"  . U A 1 146 ? 95.581  113.567 106.365 1.00 0.00 ? 135 U A "H5'"  1  
ATOM 4714   H "H5''" . U A 1 146 ? 95.244  114.906 107.169 1.00 0.00 ? 135 U A "H5''" 1  
ATOM 4715   H "H4'"  . U A 1 146 ? 94.047  114.893 105.187 1.00 0.00 ? 135 U A "H4'"  1  
ATOM 4716   H "H3'"  . U A 1 146 ? 92.338  114.555 107.423 1.00 0.00 ? 135 U A "H3'"  1  
ATOM 4717   H "H2'"  . U A 1 146 ? 90.510  114.536 106.036 1.00 0.00 ? 135 U A "H2'"  1  
ATOM 4718   H "HO2'" . U A 1 146 ? 91.872  116.140 104.575 1.00 0.00 ? 135 U A "HO2'" 1  
ATOM 4719   H "H1'"  . U A 1 146 ? 91.557  112.893 104.327 1.00 0.00 ? 135 U A "H1'"  1  
ATOM 4720   H H3     . U A 1 146 ? 88.458  110.529 106.637 1.00 0.00 ? 135 U A H3     1  
ATOM 4721   H H5     . U A 1 146 ? 91.929  110.248 108.762 1.00 0.00 ? 135 U A H5     1  
ATOM 4722   H H6     . U A 1 146 ? 92.847  111.801 107.352 1.00 0.00 ? 135 U A H6     1  
ATOM 4723   P P      . G A 1 147 ? 91.867  117.115 107.894 1.00 0.00 ? 136 G A P      1  
ATOM 4724   O OP1    . G A 1 147 ? 92.366  118.513 107.939 1.00 0.00 ? 136 G A OP1    1  
ATOM 4725   O OP2    . G A 1 147 ? 91.975  116.258 109.103 1.00 0.00 ? 136 G A OP2    1  
ATOM 4726   O "O5'"  . G A 1 147 ? 90.339  117.150 107.450 1.00 0.00 ? 136 G A "O5'"  1  
ATOM 4727   C "C5'"  . G A 1 147 ? 89.917  117.945 106.351 1.00 0.00 ? 136 G A "C5'"  1  
ATOM 4728   C "C4'"  . G A 1 147 ? 88.475  117.680 105.997 1.00 0.00 ? 136 G A "C4'"  1  
ATOM 4729   O "O4'"  . G A 1 147 ? 88.306  116.284 105.634 1.00 0.00 ? 136 G A "O4'"  1  
ATOM 4730   C "C3'"  . G A 1 147 ? 87.463  117.899 107.111 1.00 0.00 ? 136 G A "C3'"  1  
ATOM 4731   O "O3'"  . G A 1 147 ? 87.104  119.260 107.275 1.00 0.00 ? 136 G A "O3'"  1  
ATOM 4732   C "C2'"  . G A 1 147 ? 86.304  117.008 106.688 1.00 0.00 ? 136 G A "C2'"  1  
ATOM 4733   O "O2'"  . G A 1 147 ? 85.538  117.614 105.655 1.00 0.00 ? 136 G A "O2'"  1  
ATOM 4734   C "C1'"  . G A 1 147 ? 87.043  115.800 106.111 1.00 0.00 ? 136 G A "C1'"  1  
ATOM 4735   N N9     . G A 1 147 ? 87.233  114.735 107.114 1.00 0.00 ? 136 G A N9     1  
ATOM 4736   C C8     . G A 1 147 ? 88.403  114.390 107.750 1.00 0.00 ? 136 G A C8     1  
ATOM 4737   N N7     . G A 1 147 ? 88.257  113.401 108.589 1.00 0.00 ? 136 G A N7     1  
ATOM 4738   C C5     . G A 1 147 ? 86.911  113.073 108.505 1.00 0.00 ? 136 G A C5     1  
ATOM 4739   C C6     . G A 1 147 ? 86.163  112.077 109.184 1.00 0.00 ? 136 G A C6     1  
ATOM 4740   O O6     . G A 1 147 ? 86.555  111.258 110.024 1.00 0.00 ? 136 G A O6     1  
ATOM 4741   N N1     . G A 1 147 ? 84.827  112.086 108.797 1.00 0.00 ? 136 G A N1     1  
ATOM 4742   C C2     . G A 1 147 ? 84.279  112.947 107.876 1.00 0.00 ? 136 G A C2     1  
ATOM 4743   N N2     . G A 1 147 ? 82.968  112.803 107.637 1.00 0.00 ? 136 G A N2     1  
ATOM 4744   N N3     . G A 1 147 ? 84.964  113.879 107.238 1.00 0.00 ? 136 G A N3     1  
ATOM 4745   C C4     . G A 1 147 ? 86.265  113.887 107.598 1.00 0.00 ? 136 G A C4     1  
ATOM 4746   H "H5'"  . G A 1 147 ? 90.479  117.742 105.576 1.00 0.00 ? 136 G A "H5'"  1  
ATOM 4747   H "H5''" . G A 1 147 ? 90.021  118.891 106.584 1.00 0.00 ? 136 G A "H5''" 1  
ATOM 4748   H "H4'"  . G A 1 147 ? 88.229  118.241 105.231 1.00 0.00 ? 136 G A "H4'"  1  
ATOM 4749   H "H3'"  . G A 1 147 ? 87.835  117.562 107.954 1.00 0.00 ? 136 G A "H3'"  1  
ATOM 4750   H "H2'"  . G A 1 147 ? 85.745  116.756 107.452 1.00 0.00 ? 136 G A "H2'"  1  
ATOM 4751   H "HO2'" . G A 1 147 ? 84.774  117.039 105.447 1.00 0.00 ? 136 G A "HO2'" 1  
ATOM 4752   H "H1'"  . G A 1 147 ? 86.540  115.444 105.348 1.00 0.00 ? 136 G A "H1'"  1  
ATOM 4753   H H8     . G A 1 147 ? 89.257  114.839 107.590 1.00 0.00 ? 136 G A H8     1  
ATOM 4754   H H1     . G A 1 147 ? 84.231  111.430 109.217 1.00 0.00 ? 136 G A H1     1  
ATOM 4755   H H21    . G A 1 147 ? 82.451  112.115 108.105 1.00 0.00 ? 136 G A H21    1  
ATOM 4756   H H22    . G A 1 147 ? 82.522  113.388 106.988 1.00 0.00 ? 136 G A H22    1  
ATOM 4757   P P      . A A 1 148 ? 86.662  119.812 108.718 1.00 0.00 ? 137 A A P      1  
ATOM 4758   O OP1    . A A 1 148 ? 86.541  121.288 108.630 1.00 0.00 ? 137 A A OP1    1  
ATOM 4759   O OP2    . A A 1 148 ? 87.558  119.207 109.734 1.00 0.00 ? 137 A A OP2    1  
ATOM 4760   O "O5'"  . A A 1 148 ? 85.201  119.209 108.930 1.00 0.00 ? 137 A A "O5'"  1  
ATOM 4761   C "C5'"  . A A 1 148 ? 84.117  119.619 108.110 1.00 0.00 ? 137 A A "C5'"  1  
ATOM 4762   C "C4'"  . A A 1 148 ? 82.870  118.825 108.403 1.00 0.00 ? 137 A A "C4'"  1  
ATOM 4763   O "O4'"  . A A 1 148 ? 83.100  117.423 108.116 1.00 0.00 ? 137 A A "O4'"  1  
ATOM 4764   C "C3'"  . A A 1 148 ? 82.398  118.834 109.849 1.00 0.00 ? 137 A A "C3'"  1  
ATOM 4765   O "O3'"  . A A 1 148 ? 81.655  119.996 110.184 1.00 0.00 ? 137 A A "O3'"  1  
ATOM 4766   C "C2'"  . A A 1 148 ? 81.592  117.547 109.943 1.00 0.00 ? 137 A A "C2'"  1  
ATOM 4767   O "O2'"  . A A 1 148 ? 80.307  117.699 109.362 1.00 0.00 ? 137 A A "O2'"  1  
ATOM 4768   C "C1'"  . A A 1 148 ? 82.424  116.603 109.072 1.00 0.00 ? 137 A A "C1'"  1  
ATOM 4769   N N9     . A A 1 148 ? 83.387  115.818 109.867 1.00 0.00 ? 137 A A N9     1  
ATOM 4770   C C8     . A A 1 148 ? 84.747  115.985 109.951 1.00 0.00 ? 137 A A C8     1  
ATOM 4771   N N7     . A A 1 148 ? 85.338  115.125 110.744 1.00 0.00 ? 137 A A N7     1  
ATOM 4772   C C5     . A A 1 148 ? 84.298  114.338 111.216 1.00 0.00 ? 137 A A C5     1  
ATOM 4773   C C6     . A A 1 148 ? 84.262  113.242 112.096 1.00 0.00 ? 137 A A C6     1  
ATOM 4774   N N6     . A A 1 148 ? 85.346  112.732 112.686 1.00 0.00 ? 137 A A N6     1  
ATOM 4775   N N1     . A A 1 148 ? 83.061  112.682 112.354 1.00 0.00 ? 137 A A N1     1  
ATOM 4776   C C2     . A A 1 148 ? 81.974  113.192 111.764 1.00 0.00 ? 137 A A C2     1  
ATOM 4777   N N3     . A A 1 148 ? 81.879  114.218 110.919 1.00 0.00 ? 137 A A N3     1  
ATOM 4778   C C4     . A A 1 148 ? 83.091  114.752 110.683 1.00 0.00 ? 137 A A C4     1  
ATOM 4779   H "H5'"  . A A 1 148 ? 84.361  119.494 107.169 1.00 0.00 ? 137 A A "H5'"  1  
ATOM 4780   H "H5''" . A A 1 148 ? 83.937  120.571 108.269 1.00 0.00 ? 137 A A "H5''" 1  
ATOM 4781   H "H4'"  . A A 1 148 ? 82.144  119.153 107.832 1.00 0.00 ? 137 A A "H4'"  1  
ATOM 4782   H "H3'"  . A A 1 148 ? 83.177  118.771 110.441 1.00 0.00 ? 137 A A "H3'"  1  
ATOM 4783   H "H2'"  . A A 1 148 ? 81.536  117.224 110.869 1.00 0.00 ? 137 A A "H2'"  1  
ATOM 4784   H "HO2'" . A A 1 148 ? 80.089  118.653 109.315 1.00 0.00 ? 137 A A "HO2'" 1  
ATOM 4785   H "H1'"  . A A 1 148 ? 81.826  115.995 108.589 1.00 0.00 ? 137 A A "H1'"  1  
ATOM 4786   H H8     . A A 1 148 ? 85.232  116.685 109.464 1.00 0.00 ? 137 A A H8     1  
ATOM 4787   H H61    . A A 1 148 ? 85.259  111.967 113.292 1.00 0.00 ? 137 A A H61    1  
ATOM 4788   H H62    . A A 1 148 ? 86.228  113.122 112.513 1.00 0.00 ? 137 A A H62    1  
ATOM 4789   H H2     . A A 1 148 ? 81.127  112.752 111.985 1.00 0.00 ? 137 A A H2     1  
ATOM 4790   P P      . C A 1 149 ? 81.189  120.226 111.693 1.00 0.00 ? 138 C A P      1  
ATOM 4791   O OP1    . C A 1 149 ? 80.552  121.566 111.722 1.00 0.00 ? 138 C A OP1    1  
ATOM 4792   O OP2    . C A 1 149 ? 82.382  119.963 112.535 1.00 0.00 ? 138 C A OP2    1  
ATOM 4793   O "O5'"  . C A 1 149 ? 80.077  119.144 112.059 1.00 0.00 ? 138 C A "O5'"  1  
ATOM 4794   C "C5'"  . C A 1 149 ? 78.786  119.545 112.495 1.00 0.00 ? 138 C A "C5'"  1  
ATOM 4795   C "C4'"  . C A 1 149 ? 78.461  118.986 113.858 1.00 0.00 ? 138 C A "C4'"  1  
ATOM 4796   O "O4'"  . C A 1 149 ? 78.856  117.590 113.925 1.00 0.00 ? 138 C A "O4'"  1  
ATOM 4797   C "C3'"  . C A 1 149 ? 79.174  119.630 115.037 1.00 0.00 ? 138 C A "C3'"  1  
ATOM 4798   O "O3'"  . C A 1 149 ? 78.553  120.827 115.472 1.00 0.00 ? 138 C A "O3'"  1  
ATOM 4799   C "C2'"  . C A 1 149 ? 79.165  118.522 116.079 1.00 0.00 ? 138 C A "C2'"  1  
ATOM 4800   O "O2'"  . C A 1 149 ? 77.892  118.412 116.703 1.00 0.00 ? 138 C A "O2'"  1  
ATOM 4801   C "C1'"  . C A 1 149 ? 79.398  117.283 115.211 1.00 0.00 ? 138 C A "C1'"  1  
ATOM 4802   N N1     . C A 1 149 ? 80.839  116.945 115.090 1.00 0.00 ? 138 C A N1     1  
ATOM 4803   C C2     . C A 1 149 ? 81.457  116.285 116.157 1.00 0.00 ? 138 C A C2     1  
ATOM 4804   O O2     . C A 1 149 ? 80.791  116.007 117.167 1.00 0.00 ? 138 C A O2     1  
ATOM 4805   N N3     . C A 1 149 ? 82.769  115.965 116.073 1.00 0.00 ? 138 C A N3     1  
ATOM 4806   C C4     . C A 1 149 ? 83.463  116.275 114.978 1.00 0.00 ? 138 C A C4     1  
ATOM 4807   N N4     . C A 1 149 ? 84.755  115.938 114.937 1.00 0.00 ? 138 C A N4     1  
ATOM 4808   C C5     . C A 1 149 ? 82.862  116.946 113.876 1.00 0.00 ? 138 C A C5     1  
ATOM 4809   C C6     . C A 1 149 ? 81.564  117.257 113.971 1.00 0.00 ? 138 C A C6     1  
ATOM 4810   H "H5'"  . C A 1 149 ? 78.119  119.228 111.851 1.00 0.00 ? 138 C A "H5'"  1  
ATOM 4811   H "H5''" . C A 1 149 ? 78.754  120.524 112.535 1.00 0.00 ? 138 C A "H5''" 1  
ATOM 4812   H "H4'"  . C A 1 149 ? 77.494  119.049 114.000 1.00 0.00 ? 138 C A "H4'"  1  
ATOM 4813   H "H3'"  . C A 1 149 ? 80.102  119.822 114.784 1.00 0.00 ? 138 C A "H3'"  1  
ATOM 4814   H "H2'"  . C A 1 149 ? 79.881  118.638 116.736 1.00 0.00 ? 138 C A "H2'"  1  
ATOM 4815   H "HO2'" . C A 1 149 ? 77.400  119.249 116.574 1.00 0.00 ? 138 C A "HO2'" 1  
ATOM 4816   H "H1'"  . C A 1 149 ? 78.916  116.521 115.594 1.00 0.00 ? 138 C A "H1'"  1  
ATOM 4817   H H41    . C A 1 149 ? 85.166  115.478 115.700 1.00 0.00 ? 138 C A H41    1  
ATOM 4818   H H42    . C A 1 149 ? 85.292  116.154 114.147 1.00 0.00 ? 138 C A H42    1  
ATOM 4819   H H5     . C A 1 149 ? 83.381  117.171 113.074 1.00 0.00 ? 138 C A H5     1  
ATOM 4820   H H6     . C A 1 149 ? 81.132  117.717 113.222 1.00 0.00 ? 138 C A H6     1  
ATOM 4821   P P      . G A 1 150 ? 79.435  122.013 116.102 1.00 0.00 ? 139 G A P      1  
ATOM 4822   O OP1    . G A 1 150 ? 78.574  123.217 116.218 1.00 0.00 ? 139 G A OP1    1  
ATOM 4823   O OP2    . G A 1 150 ? 80.708  122.092 115.339 1.00 0.00 ? 139 G A OP2    1  
ATOM 4824   O "O5'"  . G A 1 150 ? 79.772  121.505 117.573 1.00 0.00 ? 139 G A "O5'"  1  
ATOM 4825   C "C5'"  . G A 1 150 ? 78.754  121.389 118.556 1.00 0.00 ? 139 G A "C5'"  1  
ATOM 4826   C "C4'"  . G A 1 150 ? 79.263  120.715 119.804 1.00 0.00 ? 139 G A "C4'"  1  
ATOM 4827   O "O4'"  . G A 1 150 ? 79.748  119.385 119.485 1.00 0.00 ? 139 G A "O4'"  1  
ATOM 4828   C "C3'"  . G A 1 150 ? 80.444  121.384 120.491 1.00 0.00 ? 139 G A "C3'"  1  
ATOM 4829   O "O3'"  . G A 1 150 ? 80.064  122.476 121.310 1.00 0.00 ? 139 G A "O3'"  1  
ATOM 4830   C "C2'"  . G A 1 150 ? 81.079  120.235 121.261 1.00 0.00 ? 139 G A "C2'"  1  
ATOM 4831   O "O2'"  . G A 1 150 ? 80.348  119.942 122.443 1.00 0.00 ? 139 G A "O2'"  1  
ATOM 4832   C "C1'"  . G A 1 150 ? 80.908  119.078 120.274 1.00 0.00 ? 139 G A "C1'"  1  
ATOM 4833   N N9     . G A 1 150 ? 82.092  118.906 119.412 1.00 0.00 ? 139 G A N9     1  
ATOM 4834   C C8     . G A 1 150 ? 82.199  119.209 118.076 1.00 0.00 ? 139 G A C8     1  
ATOM 4835   N N7     . G A 1 150 ? 83.377  118.945 117.580 1.00 0.00 ? 139 G A N7     1  
ATOM 4836   C C5     . G A 1 150 ? 84.093  118.434 118.655 1.00 0.00 ? 139 G A C5     1  
ATOM 4837   C C6     . G A 1 150 ? 85.432  117.972 118.729 1.00 0.00 ? 139 G A C6     1  
ATOM 4838   O O6     . G A 1 150 ? 86.281  117.920 117.832 1.00 0.00 ? 139 G A O6     1  
ATOM 4839   N N1     . G A 1 150 ? 85.754  117.541 120.013 1.00 0.00 ? 139 G A N1     1  
ATOM 4840   C C2     . G A 1 150 ? 84.898  117.551 121.086 1.00 0.00 ? 139 G A C2     1  
ATOM 4841   N N2     . G A 1 150 ? 85.390  117.093 122.246 1.00 0.00 ? 139 G A N2     1  
ATOM 4842   N N3     . G A 1 150 ? 83.646  117.979 121.029 1.00 0.00 ? 139 G A N3     1  
ATOM 4843   C C4     . G A 1 150 ? 83.315  118.403 119.793 1.00 0.00 ? 139 G A C4     1  
ATOM 4844   H "H5'"  . G A 1 150 ? 78.013  120.864 118.187 1.00 0.00 ? 139 G A "H5'"  1  
ATOM 4845   H "H5''" . G A 1 150 ? 78.428  122.285 118.785 1.00 0.00 ? 139 G A "H5''" 1  
ATOM 4846   H "H4'"  . G A 1 150 ? 78.525  120.639 120.448 1.00 0.00 ? 139 G A "H4'"  1  
ATOM 4847   H "H3'"  . G A 1 150 ? 81.077  121.699 119.808 1.00 0.00 ? 139 G A "H3'"  1  
ATOM 4848   H "H2'"  . G A 1 150 ? 82.025  120.407 121.452 1.00 0.00 ? 139 G A "H2'"  1  
ATOM 4849   H "HO2'" . G A 1 150 ? 79.799  120.717 122.681 1.00 0.00 ? 139 G A "HO2'" 1  
ATOM 4850   H "H1'"  . G A 1 150 ? 80.743  118.249 120.770 1.00 0.00 ? 139 G A "H1'"  1  
ATOM 4851   H H8     . G A 1 150 ? 81.465  119.587 117.546 1.00 0.00 ? 139 G A H8     1  
ATOM 4852   H H1     . G A 1 150 ? 86.663  117.201 120.160 1.00 0.00 ? 139 G A H1     1  
ATOM 4853   H H21    . G A 1 150 ? 86.315  116.774 122.297 1.00 0.00 ? 139 G A H21    1  
ATOM 4854   H H22    . G A 1 150 ? 84.826  117.076 123.048 1.00 0.00 ? 139 G A H22    1  
ATOM 4855   P P      . G A 1 151 ? 81.070  123.712 121.527 1.00 0.00 ? 140 G A P      1  
ATOM 4856   O OP1    . G A 1 151 ? 80.334  124.786 122.243 1.00 0.00 ? 140 G A OP1    1  
ATOM 4857   O OP2    . G A 1 151 ? 81.721  124.010 120.225 1.00 0.00 ? 140 G A OP2    1  
ATOM 4858   O "O5'"  . G A 1 151 ? 82.182  123.136 122.514 1.00 0.00 ? 140 G A "O5'"  1  
ATOM 4859   C "C5'"  . G A 1 151 ? 81.858  122.784 123.850 1.00 0.00 ? 140 G A "C5'"  1  
ATOM 4860   C "C4'"  . G A 1 151 ? 83.030  122.145 124.555 1.00 0.00 ? 140 G A "C4'"  1  
ATOM 4861   O "O4'"  . G A 1 151 ? 83.401  120.918 123.877 1.00 0.00 ? 140 G A "O4'"  1  
ATOM 4862   C "C3'"  . G A 1 151 ? 84.315  122.958 124.580 1.00 0.00 ? 140 G A "C3'"  1  
ATOM 4863   O "O3'"  . G A 1 151 ? 84.324  123.949 125.595 1.00 0.00 ? 140 G A "O3'"  1  
ATOM 4864   C "C2'"  . G A 1 151 ? 85.381  121.887 124.762 1.00 0.00 ? 140 G A "C2'"  1  
ATOM 4865   O "O2'"  . G A 1 151 ? 85.448  121.448 126.110 1.00 0.00 ? 140 G A "O2'"  1  
ATOM 4866   C "C1'"  . G A 1 151 ? 84.825  120.755 123.896 1.00 0.00 ? 140 G A "C1'"  1  
ATOM 4867   N N9     . G A 1 151 ? 85.378  120.775 122.530 1.00 0.00 ? 140 G A N9     1  
ATOM 4868   C C8     . G A 1 151 ? 84.726  121.125 121.373 1.00 0.00 ? 140 G A C8     1  
ATOM 4869   N N7     . G A 1 151 ? 85.480  121.043 120.312 1.00 0.00 ? 140 G A N7     1  
ATOM 4870   C C5     . G A 1 151 ? 86.709  120.615 120.796 1.00 0.00 ? 140 G A C5     1  
ATOM 4871   C C6     . G A 1 151 ? 87.923  120.349 120.114 1.00 0.00 ? 140 G A C6     1  
ATOM 4872   O O6     . G A 1 151 ? 88.165  120.440 118.905 1.00 0.00 ? 140 G A O6     1  
ATOM 4873   N N1     . G A 1 151 ? 88.921  119.931 120.991 1.00 0.00 ? 140 G A N1     1  
ATOM 4874   C C2     . G A 1 151 ? 88.773  119.793 122.348 1.00 0.00 ? 140 G A C2     1  
ATOM 4875   N N2     . G A 1 151 ? 89.852  119.381 123.027 1.00 0.00 ? 140 G A N2     1  
ATOM 4876   N N3     . G A 1 151 ? 87.643  120.039 122.995 1.00 0.00 ? 140 G A N3     1  
ATOM 4877   C C4     . G A 1 151 ? 86.662  120.443 122.164 1.00 0.00 ? 140 G A C4     1  
ATOM 4878   H "H5'"  . G A 1 151 ? 81.107  122.155 123.843 1.00 0.00 ? 140 G A "H5'"  1  
ATOM 4879   H "H5''" . G A 1 151 ? 81.592  123.591 124.338 1.00 0.00 ? 140 G A "H5''" 1  
ATOM 4880   H "H4'"  . G A 1 151 ? 82.769  121.935 125.476 1.00 0.00 ? 140 G A "H4'"  1  
ATOM 4881   H "H3'"  . G A 1 151 ? 84.440  123.389 123.708 1.00 0.00 ? 140 G A "H3'"  1  
ATOM 4882   H "H2'"  . G A 1 151 ? 86.254  122.190 124.435 1.00 0.00 ? 140 G A "H2'"  1  
ATOM 4883   H "HO2'" . G A 1 151 ? 85.041  122.124 126.688 1.00 0.00 ? 140 G A "HO2'" 1  
ATOM 4884   H "H1'"  . G A 1 151 ? 85.029  119.892 124.319 1.00 0.00 ? 140 G A "H1'"  1  
ATOM 4885   H H8     . G A 1 151 ? 83.787  121.408 121.346 1.00 0.00 ? 140 G A H8     1  
ATOM 4886   H H1     . G A 1 151 ? 89.799  119.724 120.605 1.00 0.00 ? 140 G A H1     1  
ATOM 4887   H H21    . G A 1 151 ? 90.691  119.195 122.555 1.00 0.00 ? 140 G A H21    1  
ATOM 4888   H H22    . G A 1 151 ? 89.805  119.262 123.999 1.00 0.00 ? 140 G A H22    1  
ATOM 4889   P P      . A A 1 152 ? 84.985  125.387 125.315 1.00 0.00 ? 141 A A P      1  
ATOM 4890   O OP1    . A A 1 152 ? 85.228  126.045 126.622 1.00 0.00 ? 141 A A OP1    1  
ATOM 4891   O OP2    . A A 1 152 ? 84.167  126.076 124.286 1.00 0.00 ? 141 A A OP2    1  
ATOM 4892   O "O5'"  . A A 1 152 ? 86.400  125.040 124.667 1.00 0.00 ? 141 A A "O5'"  1  
ATOM 4893   C "C5'"  . A A 1 152 ? 87.521  124.738 125.484 1.00 0.00 ? 141 A A "C5'"  1  
ATOM 4894   C "C4'"  . A A 1 152 ? 88.703  124.292 124.660 1.00 0.00 ? 141 A A "C4'"  1  
ATOM 4895   O "O4'"  . A A 1 152 ? 88.315  123.184 123.803 1.00 0.00 ? 141 A A "O4'"  1  
ATOM 4896   C "C3'"  . A A 1 152 ? 89.272  125.323 123.697 1.00 0.00 ? 141 A A "C3'"  1  
ATOM 4897   O "O3'"  . A A 1 152 ? 90.227  126.178 124.300 1.00 0.00 ? 141 A A "O3'"  1  
ATOM 4898   C "C2'"  . A A 1 152 ? 89.870  124.442 122.617 1.00 0.00 ? 141 A A "C2'"  1  
ATOM 4899   O "O2'"  . A A 1 152 ? 91.099  123.870 123.041 1.00 0.00 ? 141 A A "O2'"  1  
ATOM 4900   C "C1'"  . A A 1 152 ? 88.820  123.351 122.519 1.00 0.00 ? 141 A A "C1'"  1  
ATOM 4901   N N9     . A A 1 152 ? 87.707  123.729 121.628 1.00 0.00 ? 141 A A N9     1  
ATOM 4902   C C8     . A A 1 152 ? 86.480  124.236 121.978 1.00 0.00 ? 141 A A C8     1  
ATOM 4903   N N7     . A A 1 152 ? 85.696  124.476 120.956 1.00 0.00 ? 141 A A N7     1  
ATOM 4904   C C5     . A A 1 152 ? 86.457  124.101 119.857 1.00 0.00 ? 141 A A C5     1  
ATOM 4905   C C6     . A A 1 152 ? 86.194  124.109 118.476 1.00 0.00 ? 141 A A C6     1  
ATOM 4906   N N6     . A A 1 152 ? 85.044  124.526 117.943 1.00 0.00 ? 141 A A N6     1  
ATOM 4907   N N1     . A A 1 152 ? 87.167  123.669 117.649 1.00 0.00 ? 141 A A N1     1  
ATOM 4908   C C2     . A A 1 152 ? 88.322  123.250 118.182 1.00 0.00 ? 141 A A C2     1  
ATOM 4909   N N3     . A A 1 152 ? 88.686  123.194 119.461 1.00 0.00 ? 141 A A N3     1  
ATOM 4910   C C4     . A A 1 152 ? 87.697  123.639 120.257 1.00 0.00 ? 141 A A C4     1  
ATOM 4911   H "H5'"  . A A 1 152 ? 87.279  124.022 126.108 1.00 0.00 ? 141 A A "H5'"  1  
ATOM 4912   H "H5''" . A A 1 152 ? 87.770  125.536 125.994 1.00 0.00 ? 141 A A "H5''" 1  
ATOM 4913   H "H4'"  . A A 1 152 ? 89.416  123.994 125.263 1.00 0.00 ? 141 A A "H4'"  1  
ATOM 4914   H "H3'"  . A A 1 152 ? 88.536  125.849 123.317 1.00 0.00 ? 141 A A "H3'"  1  
ATOM 4915   H "H2'"  . A A 1 152 ? 89.968  124.927 121.771 1.00 0.00 ? 141 A A "H2'"  1  
ATOM 4916   H "HO2'" . A A 1 152 ? 91.479  124.425 123.753 1.00 0.00 ? 141 A A "HO2'" 1  
ATOM 4917   H "H1'"  . A A 1 152 ? 89.236  122.526 122.190 1.00 0.00 ? 141 A A "H1'"  1  
ATOM 4918   H H8     . A A 1 152 ? 86.215  124.405 122.907 1.00 0.00 ? 141 A A H8     1  
ATOM 4919   H H61    . A A 1 152 ? 84.919  124.509 116.971 1.00 0.00 ? 141 A A H61    1  
ATOM 4920   H H62    . A A 1 152 ? 84.323  124.850 118.524 1.00 0.00 ? 141 A A H62    1  
ATOM 4921   H H2     . A A 1 152 ? 88.995  122.941 117.539 1.00 0.00 ? 141 A A H2     1  
ATOM 4922   P P      . C A 1 153 ? 90.459  127.662 123.727 1.00 0.00 ? 142 C A P      1  
ATOM 4923   O OP1    . C A 1 153 ? 91.612  128.258 124.449 1.00 0.00 ? 142 C A OP1    1  
ATOM 4924   O OP2    . C A 1 153 ? 89.152  128.365 123.726 1.00 0.00 ? 142 C A OP2    1  
ATOM 4925   O "O5'"  . C A 1 153 ? 90.895  127.427 122.213 1.00 0.00 ? 142 C A "O5'"  1  
ATOM 4926   C "C5'"  . C A 1 153 ? 92.178  126.908 121.895 1.00 0.00 ? 142 C A "C5'"  1  
ATOM 4927   C "C4'"  . C A 1 153 ? 92.288  126.551 120.433 1.00 0.00 ? 142 C A "C4'"  1  
ATOM 4928   O "O4'"  . C A 1 153 ? 91.191  125.673 120.075 1.00 0.00 ? 142 C A "O4'"  1  
ATOM 4929   C "C3'"  . C A 1 153 ? 92.159  127.705 119.450 1.00 0.00 ? 142 C A "C3'"  1  
ATOM 4930   O "O3'"  . C A 1 153 ? 93.374  128.408 119.261 1.00 0.00 ? 142 C A "O3'"  1  
ATOM 4931   C "C2'"  . C A 1 153 ? 91.674  127.003 118.202 1.00 0.00 ? 142 C A "C2'"  1  
ATOM 4932   O "O2'"  . C A 1 153 ? 92.732  126.307 117.560 1.00 0.00 ? 142 C A "O2'"  1  
ATOM 4933   C "C1'"  . C A 1 153 ? 90.701  126.000 118.794 1.00 0.00 ? 142 C A "C1'"  1  
ATOM 4934   N N1     . C A 1 153 ? 89.338  126.563 118.951 1.00 0.00 ? 142 C A N1     1  
ATOM 4935   C C2     . C A 1 153 ? 88.533  126.685 117.812 1.00 0.00 ? 142 C A C2     1  
ATOM 4936   O O2     . C A 1 153 ? 88.981  126.324 116.712 1.00 0.00 ? 142 C A O2     1  
ATOM 4937   N N3     . C A 1 153 ? 87.285  127.195 117.928 1.00 0.00 ? 142 C A N3     1  
ATOM 4938   C C4     . C A 1 153 ? 86.828  127.577 119.120 1.00 0.00 ? 142 C A C4     1  
ATOM 4939   N N4     . C A 1 153 ? 85.591  128.075 119.187 1.00 0.00 ? 142 C A N4     1  
ATOM 4940   C C5     . C A 1 153 ? 87.621  127.466 120.297 1.00 0.00 ? 142 C A C5     1  
ATOM 4941   C C6     . C A 1 153 ? 88.853  126.959 120.170 1.00 0.00 ? 142 C A C6     1  
ATOM 4942   H "H5'"  . C A 1 153 ? 92.339  126.105 122.433 1.00 0.00 ? 142 C A "H5'"  1  
ATOM 4943   H "H5''" . C A 1 153 ? 92.857  127.581 122.112 1.00 0.00 ? 142 C A "H5''" 1  
ATOM 4944   H "H4'"  . C A 1 153 ? 93.136  126.085 120.285 1.00 0.00 ? 142 C A "H4'"  1  
ATOM 4945   H "H3'"  . C A 1 153 ? 91.465  128.321 119.765 1.00 0.00 ? 142 C A "H3'"  1  
ATOM 4946   H "H2'"  . C A 1 153 ? 91.227  127.626 117.592 1.00 0.00 ? 142 C A "H2'"  1  
ATOM 4947   H "HO2'" . C A 1 153 ? 92.417  125.974 116.694 1.00 0.00 ? 142 C A "HO2'" 1  
ATOM 4948   H "H1'"  . C A 1 153 ? 90.663  125.209 118.217 1.00 0.00 ? 142 C A "H1'"  1  
ATOM 4949   H H41    . C A 1 153 ? 85.048  128.150 118.374 1.00 0.00 ? 142 C A H41    1  
ATOM 4950   H H42    . C A 1 153 ? 85.226  128.364 120.049 1.00 0.00 ? 142 C A H42    1  
ATOM 4951   H H5     . C A 1 153 ? 87.276  127.749 121.170 1.00 0.00 ? 142 C A H5     1  
ATOM 4952   H H6     . C A 1 153 ? 89.414  126.875 120.969 1.00 0.00 ? 142 C A H6     1  
ATOM 4953   P P      . A A 1 154 ? 93.402  130.013 119.356 1.00 0.00 ? 143 A A P      1  
ATOM 4954   O OP1    . A A 1 154 ? 94.810  130.438 119.559 1.00 0.00 ? 143 A A OP1    1  
ATOM 4955   O OP2    . A A 1 154 ? 92.361  130.434 120.327 1.00 0.00 ? 143 A A OP2    1  
ATOM 4956   O "O5'"  . A A 1 154 ? 92.946  130.492 117.907 1.00 0.00 ? 143 A A "O5'"  1  
ATOM 4957   C "C5'"  . A A 1 154 ? 91.584  130.421 117.511 1.00 0.00 ? 143 A A "C5'"  1  
ATOM 4958   C "C4'"  . A A 1 154 ? 90.756  131.488 118.181 1.00 0.00 ? 143 A A "C4'"  1  
ATOM 4959   O "O4'"  . A A 1 154 ? 90.815  131.321 119.640 1.00 0.00 ? 143 A A "O4'"  1  
ATOM 4960   C "C3'"  . A A 1 154 ? 91.157  132.926 117.889 1.00 0.00 ? 143 A A "C3'"  1  
ATOM 4961   O "O3'"  . A A 1 154 ? 90.050  133.811 117.837 1.00 0.00 ? 143 A A "O3'"  1  
ATOM 4962   C "C2'"  . A A 1 154 ? 91.960  133.305 119.138 1.00 0.00 ? 143 A A "C2'"  1  
ATOM 4963   O "O2'"  . A A 1 154 ? 91.882  134.699 119.397 1.00 0.00 ? 143 A A "O2'"  1  
ATOM 4964   C "C1'"  . A A 1 154 ? 91.195  132.555 120.212 1.00 0.00 ? 143 A A "C1'"  1  
ATOM 4965   N N9     . A A 1 154 ? 92.033  132.266 121.392 1.00 0.00 ? 143 A A N9     1  
ATOM 4966   C C8     . A A 1 154 ? 93.403  132.201 121.459 1.00 0.00 ? 143 A A C8     1  
ATOM 4967   N N7     . A A 1 154 ? 93.861  131.922 122.654 1.00 0.00 ? 143 A A N7     1  
ATOM 4968   C C5     . A A 1 154 ? 92.715  131.793 123.428 1.00 0.00 ? 143 A A C5     1  
ATOM 4969   C C6     . A A 1 154 ? 92.520  131.500 124.789 1.00 0.00 ? 143 A A C6     1  
ATOM 4970   N N6     . A A 1 154 ? 93.516  131.275 125.648 1.00 0.00 ? 143 A A N6     1  
ATOM 4971   N N1     . A A 1 154 ? 91.250  131.446 125.244 1.00 0.00 ? 143 A A N1     1  
ATOM 4972   C C2     . A A 1 154 ? 90.249  131.671 124.383 1.00 0.00 ? 143 A A C2     1  
ATOM 4973   N N3     . A A 1 154 ? 90.307  131.955 123.083 1.00 0.00 ? 143 A A N3     1  
ATOM 4974   C C4     . A A 1 154 ? 91.583  132.003 122.663 1.00 0.00 ? 143 A A C4     1  
ATOM 4975   H "H5'"  . A A 1 154 ? 91.227  129.541 117.751 1.00 0.00 ? 143 A A "H5'"  1  
ATOM 4976   H "H5''" . A A 1 154 ? 91.527  130.535 116.539 1.00 0.00 ? 143 A A "H5''" 1  
ATOM 4977   H "H4'"  . A A 1 154 ? 89.825  131.398 117.888 1.00 0.00 ? 143 A A "H4'"  1  
ATOM 4978   H "H3'"  . A A 1 154 ? 91.749  132.943 117.108 1.00 0.00 ? 143 A A "H3'"  1  
ATOM 4979   H "H2'"  . A A 1 154 ? 92.889  132.998 119.074 1.00 0.00 ? 143 A A "H2'"  1  
ATOM 4980   H "HO2'" . A A 1 154 ? 92.367  134.896 120.226 1.00 0.00 ? 143 A A "HO2'" 1  
ATOM 4981   H "H1'"  . A A 1 154 ? 90.416  133.084 120.487 1.00 0.00 ? 143 A A "H1'"  1  
ATOM 4982   H H8     . A A 1 154 ? 93.985  132.351 120.684 1.00 0.00 ? 143 A A H8     1  
ATOM 4983   H H61    . A A 1 154 ? 93.318  131.075 126.587 1.00 0.00 ? 143 A A H61    1  
ATOM 4984   H H62    . A A 1 154 ? 94.446  131.309 125.341 1.00 0.00 ? 143 A A H62    1  
ATOM 4985   H H2     . A A 1 154 ? 89.347  131.620 124.763 1.00 0.00 ? 143 A A H2     1  
ATOM 4986   P P      . U A 1 155 ? 89.326  134.116 116.435 1.00 0.00 ? 144 U A P      1  
ATOM 4987   O OP1    . U A 1 155 ? 87.874  133.853 116.600 1.00 0.00 ? 144 U A OP1    1  
ATOM 4988   O OP2    . U A 1 155 ? 90.082  133.417 115.366 1.00 0.00 ? 144 U A OP2    1  
ATOM 4989   O "O5'"  . U A 1 155 ? 89.523  135.684 116.233 1.00 0.00 ? 144 U A "O5'"  1  
ATOM 4990   C "C5'"  . U A 1 155 ? 90.113  136.199 115.049 1.00 0.00 ? 144 U A "C5'"  1  
ATOM 4991   C "C4'"  . U A 1 155 ? 91.171  137.229 115.357 1.00 0.00 ? 144 U A "C4'"  1  
ATOM 4992   O "O4'"  . U A 1 155 ? 91.779  136.941 116.649 1.00 0.00 ? 144 U A "O4'"  1  
ATOM 4993   C "C3'"  . U A 1 155 ? 92.350  137.286 114.398 1.00 0.00 ? 144 U A "C3'"  1  
ATOM 4994   O "O3'"  . U A 1 155 ? 92.056  137.977 113.198 1.00 0.00 ? 144 U A "O3'"  1  
ATOM 4995   C "C2'"  . U A 1 155 ? 93.433  137.934 115.250 1.00 0.00 ? 144 U A "C2'"  1  
ATOM 4996   O "O2'"  . U A 1 155 ? 93.250  139.341 115.330 1.00 0.00 ? 144 U A "O2'"  1  
ATOM 4997   C "C1'"  . U A 1 155 ? 93.139  137.308 116.610 1.00 0.00 ? 144 U A "C1'"  1  
ATOM 4998   N N1     . U A 1 155 ? 93.982  136.117 116.875 1.00 0.00 ? 144 U A N1     1  
ATOM 4999   C C2     . U A 1 155 ? 95.197  136.330 117.500 1.00 0.00 ? 144 U A C2     1  
ATOM 5000   O O2     . U A 1 155 ? 95.589  137.435 117.834 1.00 0.00 ? 144 U A O2     1  
ATOM 5001   N N3     . U A 1 155 ? 95.942  135.199 117.726 1.00 0.00 ? 144 U A N3     1  
ATOM 5002   C C4     . U A 1 155 ? 95.608  133.903 117.398 1.00 0.00 ? 144 U A C4     1  
ATOM 5003   O O4     . U A 1 155 ? 96.389  132.990 117.667 1.00 0.00 ? 144 U A O4     1  
ATOM 5004   C C5     . U A 1 155 ? 94.337  133.758 116.754 1.00 0.00 ? 144 U A C5     1  
ATOM 5005   C C6     . U A 1 155 ? 93.590  134.842 116.523 1.00 0.00 ? 144 U A C6     1  
ATOM 5006   H "H5'"  . U A 1 155 ? 89.415  136.613 114.499 1.00 0.00 ? 144 U A "H5'"  1  
ATOM 5007   H "H5''" . U A 1 155 ? 90.521  135.463 114.549 1.00 0.00 ? 144 U A "H5''" 1  
ATOM 5008   H "H4'"  . U A 1 155 ? 90.750  138.113 115.395 1.00 0.00 ? 144 U A "H4'"  1  
ATOM 5009   H "H3'"  . U A 1 155 ? 92.625  136.373 114.171 1.00 0.00 ? 144 U A "H3'"  1  
ATOM 5010   H "H2'"  . U A 1 155 ? 94.329  137.703 114.928 1.00 0.00 ? 144 U A "H2'"  1  
ATOM 5011   H "HO2'" . U A 1 155 ? 93.979  139.727 115.861 1.00 0.00 ? 144 U A "HO2'" 1  
ATOM 5012   H "H1'"  . U A 1 155 ? 93.290  137.976 117.312 1.00 0.00 ? 144 U A "H1'"  1  
ATOM 5013   H H3     . U A 1 155 ? 96.807  135.328 118.168 1.00 0.00 ? 144 U A H3     1  
ATOM 5014   H H5     . U A 1 155 ? 94.018  132.871 116.486 1.00 0.00 ? 144 U A H5     1  
ATOM 5015   H H6     . U A 1 155 ? 92.726  134.717 116.081 1.00 0.00 ? 144 U A H6     1  
ATOM 5016   P P      . G A 1 156 ? 92.885  137.662 111.858 1.00 0.00 ? 145 G A P      1  
ATOM 5017   O OP1    . G A 1 156 ? 92.381  138.555 110.783 1.00 0.00 ? 145 G A OP1    1  
ATOM 5018   O OP2    . G A 1 156 ? 92.885  136.192 111.652 1.00 0.00 ? 145 G A OP2    1  
ATOM 5019   O "O5'"  . G A 1 156 ? 94.374  138.109 112.212 1.00 0.00 ? 145 G A "O5'"  1  
ATOM 5020   C "C5'"  . G A 1 156 ? 95.442  137.175 112.180 1.00 0.00 ? 145 G A "C5'"  1  
ATOM 5021   C "C4'"  . G A 1 156 ? 96.603  137.633 113.027 1.00 0.00 ? 145 G A "C4'"  1  
ATOM 5022   O "O4'"  . G A 1 156 ? 96.390  137.006 114.316 1.00 0.00 ? 145 G A "O4'"  1  
ATOM 5023   C "C3'"  . G A 1 156 ? 97.983  137.185 112.568 1.00 0.00 ? 145 G A "C3'"  1  
ATOM 5024   O "O3'"  . G A 1 156 ? 98.645  138.158 111.777 1.00 0.00 ? 145 G A "O3'"  1  
ATOM 5025   C "C2'"  . G A 1 156 ? 98.715  136.820 113.847 1.00 0.00 ? 145 G A "C2'"  1  
ATOM 5026   O "O2'"  . G A 1 156 ? 99.307  137.964 114.446 1.00 0.00 ? 145 G A "O2'"  1  
ATOM 5027   C "C1'"  . G A 1 156 ? 97.563  136.339 114.722 1.00 0.00 ? 145 G A "C1'"  1  
ATOM 5028   N N9     . G A 1 156 ? 97.343  134.886 114.601 1.00 0.00 ? 145 G A N9     1  
ATOM 5029   C C8     . G A 1 156 ? 96.354  134.251 113.888 1.00 0.00 ? 145 G A C8     1  
ATOM 5030   N N7     . G A 1 156 ? 96.415  132.950 113.972 1.00 0.00 ? 145 G A N7     1  
ATOM 5031   C C5     . G A 1 156 ? 97.510  132.710 114.790 1.00 0.00 ? 145 G A C5     1  
ATOM 5032   C C6     . G A 1 156 ? 98.071  131.487 115.240 1.00 0.00 ? 145 G A C6     1  
ATOM 5033   O O6     . G A 1 156 ? 97.698  130.333 114.998 1.00 0.00 ? 145 G A O6     1  
ATOM 5034   N N1     . G A 1 156 ? 99.179  131.700 116.054 1.00 0.00 ? 145 G A N1     1  
ATOM 5035   C C2     . G A 1 156 ? 99.685  132.932 116.391 1.00 0.00 ? 145 G A C2     1  
ATOM 5036   N N2     . G A 1 156 ? 100.763 132.935 117.189 1.00 0.00 ? 145 G A N2     1  
ATOM 5037   N N3     . G A 1 156 ? 99.171  134.079 115.978 1.00 0.00 ? 145 G A N3     1  
ATOM 5038   C C4     . G A 1 156 ? 98.094  133.894 115.186 1.00 0.00 ? 145 G A C4     1  
ATOM 5039   H "H5'"  . G A 1 156 ? 95.745  137.066 111.255 1.00 0.00 ? 145 G A "H5'"  1  
ATOM 5040   H "H5''" . G A 1 156 ? 95.122  136.312 112.515 1.00 0.00 ? 145 G A "H5''" 1  
ATOM 5041   H "H4'"  . G A 1 156 ? 96.578  138.611 113.099 1.00 0.00 ? 145 G A "H4'"  1  
ATOM 5042   H "H3'"  . G A 1 156 ? 97.893  136.375 112.025 1.00 0.00 ? 145 G A "H3'"  1  
ATOM 5043   H "H2'"  . G A 1 156 ? 99.373  136.109 113.694 1.00 0.00 ? 145 G A "H2'"  1  
ATOM 5044   H "HO2'" . G A 1 156 ? 99.794  137.687 115.250 1.00 0.00 ? 145 G A "HO2'" 1  
ATOM 5045   H "H1'"  . G A 1 156 ? 97.748  136.565 115.658 1.00 0.00 ? 145 G A "H1'"  1  
ATOM 5046   H H8     . G A 1 156 ? 95.672  134.726 113.370 1.00 0.00 ? 145 G A H8     1  
ATOM 5047   H H1     . G A 1 156 ? 99.633  130.909 116.413 1.00 0.00 ? 145 G A H1     1  
ATOM 5048   H H21    . G A 1 156 ? 101.149 132.089 117.499 1.00 0.00 ? 145 G A H21    1  
ATOM 5049   H H22    . G A 1 156 ? 101.167 133.785 117.463 1.00 0.00 ? 145 G A H22    1  
ATOM 5050   P P      . G A 1 157 ? 98.979  137.853 110.234 1.00 0.00 ? 146 G A P      1  
ATOM 5051   O OP1    . G A 1 157 ? 99.375  139.131 109.588 1.00 0.00 ? 146 G A OP1    1  
ATOM 5052   O OP2    . G A 1 157 ? 97.857  137.061 109.669 1.00 0.00 ? 146 G A OP2    1  
ATOM 5053   O "O5'"  . G A 1 157 ? 100.264 136.913 110.295 1.00 0.00 ? 146 G A "O5'"  1  
ATOM 5054   C "C5'"  . G A 1 157 ? 101.493 137.392 110.820 1.00 0.00 ? 146 G A "C5'"  1  
ATOM 5055   C "C4'"  . G A 1 157 ? 102.349 136.266 111.345 1.00 0.00 ? 146 G A "C4'"  1  
ATOM 5056   O "O4'"  . G A 1 157 ? 101.652 135.565 112.408 1.00 0.00 ? 146 G A "O4'"  1  
ATOM 5057   C "C3'"  . G A 1 157 ? 102.679 135.161 110.353 1.00 0.00 ? 146 G A "C3'"  1  
ATOM 5058   O "O3'"  . G A 1 157 ? 103.748 135.498 109.485 1.00 0.00 ? 146 G A "O3'"  1  
ATOM 5059   C "C2'"  . G A 1 157 ? 102.956 133.979 111.269 1.00 0.00 ? 146 G A "C2'"  1  
ATOM 5060   O "O2'"  . G A 1 157 ? 104.240 134.081 111.869 1.00 0.00 ? 146 G A "O2'"  1  
ATOM 5061   C "C1'"  . G A 1 157 ? 101.886 134.178 112.341 1.00 0.00 ? 146 G A "C1'"  1  
ATOM 5062   N N9     . G A 1 157 ? 100.612 133.528 111.983 1.00 0.00 ? 146 G A N9     1  
ATOM 5063   C C8     . G A 1 157 ? 99.572  134.072 111.268 1.00 0.00 ? 146 G A C8     1  
ATOM 5064   N N7     . G A 1 157 ? 98.571  133.250 111.109 1.00 0.00 ? 146 G A N7     1  
ATOM 5065   C C5     . G A 1 157 ? 98.973  132.091 111.758 1.00 0.00 ? 146 G A C5     1  
ATOM 5066   C C6     . G A 1 157 ? 98.305  130.850 111.923 1.00 0.00 ? 146 G A C6     1  
ATOM 5067   O O6     . G A 1 157 ? 97.186  130.518 111.515 1.00 0.00 ? 146 G A O6     1  
ATOM 5068   N N1     . G A 1 157 ? 99.074  129.946 112.650 1.00 0.00 ? 146 G A N1     1  
ATOM 5069   C C2     . G A 1 157 ? 100.326 130.202 113.152 1.00 0.00 ? 146 G A C2     1  
ATOM 5070   N N2     . G A 1 157 ? 100.912 129.202 113.828 1.00 0.00 ? 146 G A N2     1  
ATOM 5071   N N3     . G A 1 157 ? 100.960 131.354 113.006 1.00 0.00 ? 146 G A N3     1  
ATOM 5072   C C4     . G A 1 157 ? 100.231 132.246 112.303 1.00 0.00 ? 146 G A C4     1  
ATOM 5073   H "H5'"  . G A 1 157 ? 101.308 138.020 111.549 1.00 0.00 ? 146 G A "H5'"  1  
ATOM 5074   H "H5''" . G A 1 157 ? 101.982 137.862 110.111 1.00 0.00 ? 146 G A "H5''" 1  
ATOM 5075   H "H4'"  . G A 1 157 ? 103.180 136.641 111.706 1.00 0.00 ? 146 G A "H4'"  1  
ATOM 5076   H "H3'"  . G A 1 157 ? 101.888 134.970 109.809 1.00 0.00 ? 146 G A "H3'"  1  
ATOM 5077   H "H2'"  . G A 1 157 ? 102.842 133.126 110.800 1.00 0.00 ? 146 G A "H2'"  1  
ATOM 5078   H "HO2'" . G A 1 157 ? 104.844 134.545 111.252 1.00 0.00 ? 146 G A "HO2'" 1  
ATOM 5079   H "H1'"  . G A 1 157 ? 102.207 133.818 113.194 1.00 0.00 ? 146 G A "H1'"  1  
ATOM 5080   H H8     . G A 1 157 ? 99.580  134.986 110.913 1.00 0.00 ? 146 G A H8     1  
ATOM 5081   H H1     . G A 1 157 ? 98.691  129.059 112.813 1.00 0.00 ? 146 G A H1     1  
ATOM 5082   H H21    . G A 1 157 ? 100.449 128.346 113.941 1.00 0.00 ? 146 G A H21    1  
ATOM 5083   H H22    . G A 1 157 ? 101.806 129.327 114.210 1.00 0.00 ? 146 G A H22    1  
ATOM 5084   P P      . U A 1 158 ? 103.538 135.416 107.899 1.00 0.00 ? 147 U A P      1  
ATOM 5085   O OP1    . U A 1 158 ? 103.400 133.992 107.501 1.00 0.00 ? 147 U A OP1    1  
ATOM 5086   O OP2    . U A 1 158 ? 104.675 136.217 107.380 1.00 0.00 ? 147 U A OP2    1  
ATOM 5087   O "O5'"  . U A 1 158 ? 102.188 136.169 107.514 1.00 0.00 ? 147 U A "O5'"  1  
ATOM 5088   C "C5'"  . U A 1 158 ? 100.937 135.501 107.573 1.00 0.00 ? 147 U A "C5'"  1  
ATOM 5089   C "C4'"  . U A 1 158 ? 100.200 135.582 106.259 1.00 0.00 ? 147 U A "C4'"  1  
ATOM 5090   O "O4'"  . U A 1 158 ? 100.791 136.605 105.414 1.00 0.00 ? 147 U A "O4'"  1  
ATOM 5091   C "C3'"  . U A 1 158 ? 100.213 134.324 105.404 1.00 0.00 ? 147 U A "C3'"  1  
ATOM 5092   O "O3'"  . U A 1 158 ? 99.216  133.390 105.779 1.00 0.00 ? 147 U A "O3'"  1  
ATOM 5093   C "C2'"  . U A 1 158 ? 99.972  134.876 104.008 1.00 0.00 ? 147 U A "C2'"  1  
ATOM 5094   O "O2'"  . U A 1 158 ? 98.591  135.122 103.783 1.00 0.00 ? 147 U A "O2'"  1  
ATOM 5095   C "C1'"  . U A 1 158 ? 100.706 136.218 104.058 1.00 0.00 ? 147 U A "C1'"  1  
ATOM 5096   N N1     . U A 1 158 ? 102.084 136.126 103.517 1.00 0.00 ? 147 U A N1     1  
ATOM 5097   C C2     . U A 1 158 ? 102.215 135.924 102.155 1.00 0.00 ? 147 U A C2     1  
ATOM 5098   O O2     . U A 1 158 ? 101.262 135.822 101.403 1.00 0.00 ? 147 U A O2     1  
ATOM 5099   N N3     . U A 1 158 ? 103.508 135.847 101.700 1.00 0.00 ? 147 U A N3     1  
ATOM 5100   C C4     . U A 1 158 ? 104.661 135.947 102.449 1.00 0.00 ? 147 U A C4     1  
ATOM 5101   O O4     . U A 1 158 ? 105.755 135.854 101.890 1.00 0.00 ? 147 U A O4     1  
ATOM 5102   C C5     . U A 1 158 ? 104.449 136.155 103.849 1.00 0.00 ? 147 U A C5     1  
ATOM 5103   C C6     . U A 1 158 ? 103.200 136.236 104.319 1.00 0.00 ? 147 U A C6     1  
ATOM 5104   H "H5'"  . U A 1 158 ? 100.388 135.912 108.273 1.00 0.00 ? 147 U A "H5'"  1  
ATOM 5105   H "H5''" . U A 1 158 ? 101.088 134.559 107.796 1.00 0.00 ? 147 U A "H5''" 1  
ATOM 5106   H "H4'"  . U A 1 158 ? 99.270  135.829 106.444 1.00 0.00 ? 147 U A "H4'"  1  
ATOM 5107   H "H3'"  . U A 1 158 ? 101.091 133.891 105.447 1.00 0.00 ? 147 U A "H3'"  1  
ATOM 5108   H "H2'"  . U A 1 158 ? 100.352 134.291 103.320 1.00 0.00 ? 147 U A "H2'"  1  
ATOM 5109   H "HO2'" . U A 1 158 ? 98.474  135.476 102.877 1.00 0.00 ? 147 U A "HO2'" 1  
ATOM 5110   H "H1'"  . U A 1 158 ? 100.199 136.882 103.544 1.00 0.00 ? 147 U A "H1'"  1  
ATOM 5111   H H3     . U A 1 158 ? 103.624 135.703 100.738 1.00 0.00 ? 147 U A H3     1  
ATOM 5112   H H5     . U A 1 158 ? 105.213 136.239 104.457 1.00 0.00 ? 147 U A H5     1  
ATOM 5113   H H6     . U A 1 158 ? 103.081 136.378 105.280 1.00 0.00 ? 147 U A H6     1  
ATOM 5114   P P      . C A 1 159 ? 99.630  131.998 106.467 1.00 0.00 ? 148 C A P      1  
ATOM 5115   O OP1    . C A 1 159 ? 98.531  131.593 107.381 1.00 0.00 ? 148 C A OP1    1  
ATOM 5116   O OP2    . C A 1 159 ? 101.010 132.136 106.995 1.00 0.00 ? 148 C A OP2    1  
ATOM 5117   O "O5'"  . C A 1 159 ? 99.666  130.964 105.255 1.00 0.00 ? 148 C A "O5'"  1  
ATOM 5118   C "C5'"  . C A 1 159 ? 98.519  130.745 104.448 1.00 0.00 ? 148 C A "C5'"  1  
ATOM 5119   C "C4'"  . C A 1 159 ? 98.872  130.686 102.982 1.00 0.00 ? 148 C A "C4'"  1  
ATOM 5120   O "O4'"  . C A 1 159 ? 99.524  131.925 102.583 1.00 0.00 ? 148 C A "O4'"  1  
ATOM 5121   C "C3'"  . C A 1 159 ? 99.865  129.609 102.574 1.00 0.00 ? 148 C A "C3'"  1  
ATOM 5122   O "O3'"  . C A 1 159 ? 99.274  128.325 102.468 1.00 0.00 ? 148 C A "O3'"  1  
ATOM 5123   C "C2'"  . C A 1 159 ? 100.409 130.165 101.267 1.00 0.00 ? 148 C A "C2'"  1  
ATOM 5124   O "O2'"  . C A 1 159 ? 99.484  129.981 100.205 1.00 0.00 ? 148 C A "O2'"  1  
ATOM 5125   C "C1'"  . C A 1 159 ? 100.501 131.656 101.611 1.00 0.00 ? 148 C A "C1'"  1  
ATOM 5126   N N1     . C A 1 159 ? 101.833 132.029 102.147 1.00 0.00 ? 148 C A N1     1  
ATOM 5127   C C2     . C A 1 159 ? 102.854 132.335 101.238 1.00 0.00 ? 148 C A C2     1  
ATOM 5128   O O2     . C A 1 159 ? 102.617 132.284 100.021 1.00 0.00 ? 148 C A O2     1  
ATOM 5129   N N3     . C A 1 159 ? 104.078 132.679 101.701 1.00 0.00 ? 148 C A N3     1  
ATOM 5130   C C4     . C A 1 159 ? 104.307 132.725 103.013 1.00 0.00 ? 148 C A C4     1  
ATOM 5131   N N4     . C A 1 159 ? 105.530 133.070 103.424 1.00 0.00 ? 148 C A N4     1  
ATOM 5132   C C5     . C A 1 159 ? 103.291 132.420 103.962 1.00 0.00 ? 148 C A C5     1  
ATOM 5133   C C6     . C A 1 159 ? 102.084 132.082 103.493 1.00 0.00 ? 148 C A C6     1  
ATOM 5134   H "H5'"  . C A 1 159 ? 97.882  131.474 104.595 1.00 0.00 ? 148 C A "H5'"  1  
ATOM 5135   H "H5''" . C A 1 159 ? 98.102  129.898 104.710 1.00 0.00 ? 148 C A "H5''" 1  
ATOM 5136   H "H4'"  . C A 1 159 ? 98.051  130.575 102.459 1.00 0.00 ? 148 C A "H4'"  1  
ATOM 5137   H "H3'"  . C A 1 159 ? 100.595 129.573 103.226 1.00 0.00 ? 148 C A "H3'"  1  
ATOM 5138   H "H2'"  . C A 1 159 ? 101.286 129.784 101.053 1.00 0.00 ? 148 C A "H2'"  1  
ATOM 5139   H "HO2'" . C A 1 159 ? 99.917  129.472 99.489  1.00 0.00 ? 148 C A "HO2'" 1  
ATOM 5140   H "H1'"  . C A 1 159 ? 100.313 132.183 100.807 1.00 0.00 ? 148 C A "H1'"  1  
ATOM 5141   H H41    . C A 1 159 ? 106.227 133.278 102.767 1.00 0.00 ? 148 C A H41    1  
ATOM 5142   H H42    . C A 1 159 ? 105.730 133.113 104.382 1.00 0.00 ? 148 C A H42    1  
ATOM 5143   H H5     . C A 1 159 ? 103.469 132.457 104.926 1.00 0.00 ? 148 C A H5     1  
ATOM 5144   H H6     . C A 1 159 ? 101.372 131.868 104.130 1.00 0.00 ? 148 C A H6     1  
ATOM 5145   P P      . C A 1 160 ? 100.163 127.005 102.693 1.00 0.00 ? 149 C A P      1  
ATOM 5146   O OP1    . C A 1 160 ? 99.248  125.836 102.734 1.00 0.00 ? 149 C A OP1    1  
ATOM 5147   O OP2    . C A 1 160 ? 101.082 127.257 103.831 1.00 0.00 ? 149 C A OP2    1  
ATOM 5148   O "O5'"  . C A 1 160 ? 101.038 126.898 101.366 1.00 0.00 ? 149 C A "O5'"  1  
ATOM 5149   C "C5'"  . C A 1 160 ? 100.424 126.727 100.098 1.00 0.00 ? 149 C A "C5'"  1  
ATOM 5150   C "C4'"  . C A 1 160 ? 101.391 126.988 98.970  1.00 0.00 ? 149 C A "C4'"  1  
ATOM 5151   O "O4'"  . C A 1 160 ? 101.850 128.364 99.006  1.00 0.00 ? 149 C A "O4'"  1  
ATOM 5152   C "C3'"  . C A 1 160 ? 102.681 126.183 98.993  1.00 0.00 ? 149 C A "C3'"  1  
ATOM 5153   O "O3'"  . C A 1 160 ? 102.515 124.859 98.516  1.00 0.00 ? 149 C A "O3'"  1  
ATOM 5154   C "C2'"  . C A 1 160 ? 103.579 127.025 98.118  1.00 0.00 ? 149 C A "C2'"  1  
ATOM 5155   O "O2'"  . C A 1 160 ? 103.245 126.879 96.746  1.00 0.00 ? 149 C A "O2'"  1  
ATOM 5156   C "C1'"  . C A 1 160 ? 103.196 128.428 98.585  1.00 0.00 ? 149 C A "C1'"  1  
ATOM 5157   N N1     . C A 1 160 ? 104.038 128.896 99.715  1.00 0.00 ? 149 C A N1     1  
ATOM 5158   C C2     . C A 1 160 ? 105.292 129.446 99.425  1.00 0.00 ? 149 C A C2     1  
ATOM 5159   O O2     . C A 1 160 ? 105.661 129.525 98.243  1.00 0.00 ? 149 C A O2     1  
ATOM 5160   N N3     . C A 1 160 ? 106.079 129.880 100.436 1.00 0.00 ? 149 C A N3     1  
ATOM 5161   C C4     . C A 1 160 ? 105.660 129.783 101.698 1.00 0.00 ? 149 C A C4     1  
ATOM 5162   N N4     . C A 1 160 ? 106.471 130.224 102.663 1.00 0.00 ? 149 C A N4     1  
ATOM 5163   C C5     . C A 1 160 ? 104.391 129.228 102.025 1.00 0.00 ? 149 C A C5     1  
ATOM 5164   C C6     . C A 1 160 ? 103.621 128.803 101.016 1.00 0.00 ? 149 C A C6     1  
ATOM 5165   H "H5'"  . C A 1 160 ? 99.669  127.347 100.023 1.00 0.00 ? 149 C A "H5'"  1  
ATOM 5166   H "H5''" . C A 1 160 ? 100.091 125.808 100.027 1.00 0.00 ? 149 C A "H5''" 1  
ATOM 5167   H "H4'"  . C A 1 160 ? 100.932 126.826 98.120  1.00 0.00 ? 149 C A "H4'"  1  
ATOM 5168   H "H3'"  . C A 1 160 ? 103.050 126.153 99.900  1.00 0.00 ? 149 C A "H3'"  1  
ATOM 5169   H "H2'"  . C A 1 160 ? 104.525 126.831 98.283  1.00 0.00 ? 149 C A "H2'"  1  
ATOM 5170   H "HO2'" . C A 1 160 ? 103.861 127.418 96.207  1.00 0.00 ? 149 C A "HO2'" 1  
ATOM 5171   H "H1'"  . C A 1 160 ? 103.281 129.052 97.835  1.00 0.00 ? 149 C A "H1'"  1  
ATOM 5172   H H41    . C A 1 160 ? 107.344 130.605 102.434 1.00 0.00 ? 149 C A H41    1  
ATOM 5173   H H42    . C A 1 160 ? 106.191 130.167 103.601 1.00 0.00 ? 149 C A H42    1  
ATOM 5174   H H5     . C A 1 160 ? 104.091 129.162 102.956 1.00 0.00 ? 149 C A H5     1  
ATOM 5175   H H6     . C A 1 160 ? 102.744 128.418 101.221 1.00 0.00 ? 149 C A H6     1  
ATOM 5176   P P      . U A 1 161 ? 103.514 123.695 98.996  1.00 0.00 ? 150 U A P      1  
ATOM 5177   O OP1    . U A 1 161 ? 102.906 122.389 98.636  1.00 0.00 ? 150 U A OP1    1  
ATOM 5178   O OP2    . U A 1 161 ? 103.891 123.966 100.406 1.00 0.00 ? 150 U A OP2    1  
ATOM 5179   O "O5'"  . U A 1 161 ? 104.808 123.902 98.090  1.00 0.00 ? 150 U A "O5'"  1  
ATOM 5180   C "C5'"  . U A 1 161 ? 104.731 123.812 96.676  1.00 0.00 ? 150 U A "C5'"  1  
ATOM 5181   C "C4'"  . U A 1 161 ? 106.028 124.219 96.020  1.00 0.00 ? 150 U A "C4'"  1  
ATOM 5182   O "O4'"  . U A 1 161 ? 106.287 125.621 96.272  1.00 0.00 ? 150 U A "O4'"  1  
ATOM 5183   C "C3'"  . U A 1 161 ? 107.280 123.512 96.516  1.00 0.00 ? 150 U A "C3'"  1  
ATOM 5184   O "O3'"  . U A 1 161 ? 107.487 122.254 95.900  1.00 0.00 ? 150 U A "O3'"  1  
ATOM 5185   C "C2'"  . U A 1 161 ? 108.379 124.511 96.155  1.00 0.00 ? 150 U A "C2'"  1  
ATOM 5186   O "O2'"  . U A 1 161 ? 108.706 124.441 94.774  1.00 0.00 ? 150 U A "O2'"  1  
ATOM 5187   C "C1'"  . U A 1 161 ? 107.686 125.848 96.433  1.00 0.00 ? 150 U A "C1'"  1  
ATOM 5188   N N1     . U A 1 161 ? 107.930 126.332 97.814  1.00 0.00 ? 150 U A N1     1  
ATOM 5189   C C2     . U A 1 161 ? 109.104 127.026 98.041  1.00 0.00 ? 150 U A C2     1  
ATOM 5190   O O2     . U A 1 161 ? 109.924 127.251 97.168  1.00 0.00 ? 150 U A O2     1  
ATOM 5191   N N3     . U A 1 161 ? 109.286 127.455 99.333  1.00 0.00 ? 150 U A N3     1  
ATOM 5192   C C4     . U A 1 161 ? 108.435 127.264 100.401 1.00 0.00 ? 150 U A C4     1  
ATOM 5193   O O4     . U A 1 161 ? 108.743 127.712 101.507 1.00 0.00 ? 150 U A O4     1  
ATOM 5194   C C5     . U A 1 161 ? 107.241 126.538 100.091 1.00 0.00 ? 150 U A C5     1  
ATOM 5195   C C6     . U A 1 161 ? 107.038 126.110 98.841  1.00 0.00 ? 150 U A C6     1  
ATOM 5196   H "H5'"  . U A 1 161 ? 104.014 124.400 96.357  1.00 0.00 ? 150 U A "H5'"  1  
ATOM 5197   H "H5''" . U A 1 161 ? 104.523 122.888 96.425  1.00 0.00 ? 150 U A "H5''" 1  
ATOM 5198   H "H4'"  . U A 1 161 ? 105.949 124.082 95.053  1.00 0.00 ? 150 U A "H4'"  1  
ATOM 5199   H "H3'"  . U A 1 161 ? 107.244 123.392 97.487  1.00 0.00 ? 150 U A "H3'"  1  
ATOM 5200   H "H2'"  . U A 1 161 ? 109.171 124.394 96.721  1.00 0.00 ? 150 U A "H2'"  1  
ATOM 5201   H "HO2'" . U A 1 161 ? 109.636 124.145 94.681  1.00 0.00 ? 150 U A "HO2'" 1  
ATOM 5202   H "H1'"  . U A 1 161 ? 108.008 126.518 95.793  1.00 0.00 ? 150 U A "H1'"  1  
ATOM 5203   H H3     . U A 1 161 ? 110.112 127.949 99.516  1.00 0.00 ? 150 U A H3     1  
ATOM 5204   H H5     . U A 1 161 ? 106.579 126.357 100.791 1.00 0.00 ? 150 U A H5     1  
ATOM 5205   H H6     . U A 1 161 ? 106.214 125.615 98.656  1.00 0.00 ? 150 U A H6     1  
ATOM 5206   P P      . A A 1 162 ? 108.231 121.074 96.698  1.00 0.00 ? 151 A A P      1  
ATOM 5207   O OP1    . A A 1 162 ? 107.899 119.788 96.034  1.00 0.00 ? 151 A A OP1    1  
ATOM 5208   O OP2    . A A 1 162 ? 107.947 121.248 98.145  1.00 0.00 ? 151 A A OP2    1  
ATOM 5209   O "O5'"  . A A 1 162 ? 109.779 121.366 96.463  1.00 0.00 ? 151 A A "O5'"  1  
ATOM 5210   C "C5'"  . A A 1 162 ? 110.332 121.356 95.155  1.00 0.00 ? 151 A A "C5'"  1  
ATOM 5211   C "C4'"  . A A 1 162 ? 111.503 122.300 95.041  1.00 0.00 ? 151 A A "C4'"  1  
ATOM 5212   O "O4'"  . A A 1 162 ? 111.129 123.602 95.563  1.00 0.00 ? 151 A A "O4'"  1  
ATOM 5213   C "C3'"  . A A 1 162 ? 112.744 121.922 95.834  1.00 0.00 ? 151 A A "C3'"  1  
ATOM 5214   O "O3'"  . A A 1 162 ? 113.546 120.952 95.181  1.00 0.00 ? 151 A A "O3'"  1  
ATOM 5215   C "C2'"  . A A 1 162 ? 113.449 123.262 96.015  1.00 0.00 ? 151 A A "C2'"  1  
ATOM 5216   O "O2'"  . A A 1 162 ? 114.157 123.635 94.842  1.00 0.00 ? 151 A A "O2'"  1  
ATOM 5217   C "C1'"  . A A 1 162 ? 112.254 124.210 96.201  1.00 0.00 ? 151 A A "C1'"  1  
ATOM 5218   N N9     . A A 1 162 ? 111.944 124.443 97.624  1.00 0.00 ? 151 A A N9     1  
ATOM 5219   C C8     . A A 1 162 ? 111.079 123.740 98.426  1.00 0.00 ? 151 A A C8     1  
ATOM 5220   N N7     . A A 1 162 ? 111.016 124.187 99.656  1.00 0.00 ? 151 A A N7     1  
ATOM 5221   C C5     . A A 1 162 ? 111.900 125.258 99.666  1.00 0.00 ? 151 A A C5     1  
ATOM 5222   C C6     . A A 1 162 ? 112.287 126.157 100.676 1.00 0.00 ? 151 A A C6     1  
ATOM 5223   N N6     . A A 1 162 ? 111.815 126.117 101.924 1.00 0.00 ? 151 A A N6     1  
ATOM 5224   N N1     . A A 1 162 ? 113.189 127.110 100.357 1.00 0.00 ? 151 A A N1     1  
ATOM 5225   C C2     . A A 1 162 ? 113.664 127.150 99.105  1.00 0.00 ? 151 A A C2     1  
ATOM 5226   N N3     . A A 1 162 ? 113.377 126.363 98.071  1.00 0.00 ? 151 A A N3     1  
ATOM 5227   C C4     . A A 1 162 ? 112.478 125.426 98.422  1.00 0.00 ? 151 A A C4     1  
ATOM 5228   H "H5'"  . A A 1 162 ? 109.641 121.625 94.513  1.00 0.00 ? 151 A A "H5'"  1  
ATOM 5229   H "H5''" . A A 1 162 ? 110.631 120.448 94.940  1.00 0.00 ? 151 A A "H5''" 1  
ATOM 5230   H "H4'"  . A A 1 162 ? 111.747 122.394 94.096  1.00 0.00 ? 151 A A "H4'"  1  
ATOM 5231   H "H3'"  . A A 1 162 ? 112.474 121.577 96.711  1.00 0.00 ? 151 A A "H3'"  1  
ATOM 5232   H "H2'"  . A A 1 162 ? 114.031 123.259 96.804  1.00 0.00 ? 151 A A "H2'"  1  
ATOM 5233   H "HO2'" . A A 1 162 ? 114.595 124.498 94.994  1.00 0.00 ? 151 A A "HO2'" 1  
ATOM 5234   H "H1'"  . A A 1 162 ? 112.446 125.067 95.764  1.00 0.00 ? 151 A A "H1'"  1  
ATOM 5235   H H8     . A A 1 162 ? 110.557 122.974 98.108  1.00 0.00 ? 151 A A H8     1  
ATOM 5236   H H61    . A A 1 162 ? 112.123 126.772 102.586 1.00 0.00 ? 151 A A H61    1  
ATOM 5237   H H62    . A A 1 162 ? 111.159 125.435 102.178 1.00 0.00 ? 151 A A H62    1  
ATOM 5238   H H2     . A A 1 162 ? 114.316 127.860 98.925  1.00 0.00 ? 151 A A H2     1  
ATOM 5239   P P      . A A 1 163 ? 113.818 119.528 95.876  1.00 0.00 ? 152 A A P      1  
ATOM 5240   O OP1    . A A 1 163 ? 113.921 118.506 94.805  1.00 0.00 ? 152 A A OP1    1  
ATOM 5241   O OP2    . A A 1 163 ? 112.826 119.352 96.966  1.00 0.00 ? 152 A A OP2    1  
ATOM 5242   O "O5'"  . A A 1 163 ? 115.256 119.693 96.541  1.00 0.00 ? 152 A A "O5'"  1  
ATOM 5243   C "C5'"  . A A 1 163 ? 116.409 119.912 95.741  1.00 0.00 ? 152 A A "C5'"  1  
ATOM 5244   C "C4'"  . A A 1 163 ? 117.217 121.082 96.241  1.00 0.00 ? 152 A A "C4'"  1  
ATOM 5245   O "O4'"  . A A 1 163 ? 116.347 122.212 96.513  1.00 0.00 ? 152 A A "O4'"  1  
ATOM 5246   C "C3'"  . A A 1 163 ? 117.957 120.870 97.553  1.00 0.00 ? 152 A A "C3'"  1  
ATOM 5247   O "O3'"  . A A 1 163 ? 119.178 120.170 97.394  1.00 0.00 ? 152 A A "O3'"  1  
ATOM 5248   C "C2'"  . A A 1 163 ? 118.121 122.293 98.068  1.00 0.00 ? 152 A A "C2'"  1  
ATOM 5249   O "O2'"  . A A 1 163 ? 119.171 122.967 97.389  1.00 0.00 ? 152 A A "O2'"  1  
ATOM 5250   C "C1'"  . A A 1 163 ? 116.785 122.910 97.661  1.00 0.00 ? 152 A A "C1'"  1  
ATOM 5251   N N9     . A A 1 163 ? 115.770 122.790 98.725  1.00 0.00 ? 152 A A N9     1  
ATOM 5252   C C8     . A A 1 163 ? 114.706 121.925 98.783  1.00 0.00 ? 152 A A C8     1  
ATOM 5253   N N7     . A A 1 163 ? 113.975 122.057 99.863  1.00 0.00 ? 152 A A N7     1  
ATOM 5254   C C5     . A A 1 163 ? 114.600 123.080 100.564 1.00 0.00 ? 152 A A C5     1  
ATOM 5255   C C6     . A A 1 163 ? 114.313 123.697 101.795 1.00 0.00 ? 152 A A C6     1  
ATOM 5256   N N6     . A A 1 163 ? 113.280 123.359 102.570 1.00 0.00 ? 152 A A N6     1  
ATOM 5257   N N1     . A A 1 163 ? 115.135 124.686 102.208 1.00 0.00 ? 152 A A N1     1  
ATOM 5258   C C2     . A A 1 163 ? 116.172 125.025 101.432 1.00 0.00 ? 152 A A C2     1  
ATOM 5259   N N3     . A A 1 163 ? 116.544 124.520 100.257 1.00 0.00 ? 152 A A N3     1  
ATOM 5260   C C4     . A A 1 163 ? 115.707 123.539 99.875  1.00 0.00 ? 152 A A C4     1  
ATOM 5261   H "H5'"  . A A 1 163 ? 116.129 120.089 94.818  1.00 0.00 ? 152 A A "H5'"  1  
ATOM 5262   H "H5''" . A A 1 163 ? 116.967 119.107 95.756  1.00 0.00 ? 152 A A "H5''" 1  
ATOM 5263   H "H4'"  . A A 1 163 ? 117.864 121.336 95.550  1.00 0.00 ? 152 A A "H4'"  1  
ATOM 5264   H "H3'"  . A A 1 163 ? 117.380 120.374 98.172  1.00 0.00 ? 152 A A "H3'"  1  
ATOM 5265   H "H2'"  . A A 1 163 ? 118.246 122.311 99.040  1.00 0.00 ? 152 A A "H2'"  1  
ATOM 5266   H "HO2'" . A A 1 163 ? 119.259 123.870 97.758  1.00 0.00 ? 152 A A "HO2'" 1  
ATOM 5267   H "H1'"  . A A 1 163 ? 116.917 123.856 97.440  1.00 0.00 ? 152 A A "H1'"  1  
ATOM 5268   H H8     . A A 1 163 ? 114.510 121.268 98.082  1.00 0.00 ? 152 A A H8     1  
ATOM 5269   H H61    . A A 1 163 ? 113.131 123.826 103.418 1.00 0.00 ? 152 A A H61    1  
ATOM 5270   H H62    . A A 1 163 ? 112.670 122.645 102.290 1.00 0.00 ? 152 A A H62    1  
ATOM 5271   H H2     . A A 1 163 ? 116.737 125.748 101.777 1.00 0.00 ? 152 A A H2     1  
ATOM 5272   P P      . C A 1 164 ? 119.771 119.294 98.605  1.00 0.00 ? 153 C A P      1  
ATOM 5273   O OP1    . C A 1 164 ? 121.041 118.676 98.145  1.00 0.00 ? 153 C A OP1    1  
ATOM 5274   O OP2    . C A 1 164 ? 118.682 118.431 99.126  1.00 0.00 ? 153 C A OP2    1  
ATOM 5275   O "O5'"  . C A 1 164 ? 120.126 120.372 99.723  1.00 0.00 ? 153 C A "O5'"  1  
ATOM 5276   C "C5'"  . C A 1 164 ? 121.099 121.378 99.485  1.00 0.00 ? 153 C A "C5'"  1  
ATOM 5277   C "C4'"  . C A 1 164 ? 121.375 122.189 100.727 1.00 0.00 ? 153 C A "C4'"  1  
ATOM 5278   O "O4'"  . C A 1 164 ? 120.259 123.076 100.998 1.00 0.00 ? 153 C A "O4'"  1  
ATOM 5279   C "C3'"  . C A 1 164 ? 121.543 121.404 102.018 1.00 0.00 ? 153 C A "C3'"  1  
ATOM 5280   O "O3'"  . C A 1 164 ? 122.839 120.847 102.164 1.00 0.00 ? 153 C A "O3'"  1  
ATOM 5281   C "C2'"  . C A 1 164 ? 121.200 122.436 103.083 1.00 0.00 ? 153 C A "C2'"  1  
ATOM 5282   O "O2'"  . C A 1 164 ? 122.283 123.328 103.305 1.00 0.00 ? 153 C A "O2'"  1  
ATOM 5283   C "C1'"  . C A 1 164 ? 120.059 123.200 102.410 1.00 0.00 ? 153 C A "C1'"  1  
ATOM 5284   N N1     . C A 1 164 ? 118.724 122.674 102.796 1.00 0.00 ? 153 C A N1     1  
ATOM 5285   C C2     . C A 1 164 ? 118.217 123.015 104.055 1.00 0.00 ? 153 C A C2     1  
ATOM 5286   O O2     . C A 1 164 ? 118.891 123.737 104.806 1.00 0.00 ? 153 C A O2     1  
ATOM 5287   N N3     . C A 1 164 ? 117.003 122.550 104.433 1.00 0.00 ? 153 C A N3     1  
ATOM 5288   C C4     . C A 1 164 ? 116.300 121.775 103.608 1.00 0.00 ? 153 C A C4     1  
ATOM 5289   N N4     . C A 1 164 ? 115.106 121.340 104.021 1.00 0.00 ? 153 C A N4     1  
ATOM 5290   C C5     . C A 1 164 ? 116.788 121.411 102.321 1.00 0.00 ? 153 C A C5     1  
ATOM 5291   C C6     . C A 1 164 ? 117.989 121.878 101.958 1.00 0.00 ? 153 C A C6     1  
ATOM 5292   H "H5'"  . C A 1 164 ? 120.775 121.974 98.778  1.00 0.00 ? 153 C A "H5'"  1  
ATOM 5293   H "H5''" . C A 1 164 ? 121.930 120.953 99.189  1.00 0.00 ? 153 C A "H5''" 1  
ATOM 5294   H "H4'"  . C A 1 164 ? 122.180 122.729 100.577 1.00 0.00 ? 153 C A "H4'"  1  
ATOM 5295   H "H3'"  . C A 1 164 ? 120.880 120.683 102.045 1.00 0.00 ? 153 C A "H3'"  1  
ATOM 5296   H "H2'"  . C A 1 164 ? 120.904 122.010 103.915 1.00 0.00 ? 153 C A "H2'"  1  
ATOM 5297   H "HO2'" . C A 1 164 ? 123.108 122.915 102.979 1.00 0.00 ? 153 C A "HO2'" 1  
ATOM 5298   H "H1'"  . C A 1 164 ? 120.116 124.148 102.649 1.00 0.00 ? 153 C A "H1'"  1  
ATOM 5299   H H41    . C A 1 164 ? 114.774 121.592 104.909 1.00 0.00 ? 153 C A H41    1  
ATOM 5300   H H42    . C A 1 164 ? 114.565 120.769 103.439 1.00 0.00 ? 153 C A H42    1  
ATOM 5301   H H5     . C A 1 164 ? 116.262 120.841 101.721 1.00 0.00 ? 153 C A H5     1  
ATOM 5302   H H6     . C A 1 164 ? 118.343 121.639 101.078 1.00 0.00 ? 153 C A H6     1  
ATOM 5303   P P      . C A 1 165 ? 123.056 119.526 103.054 1.00 0.00 ? 154 C A P      1  
ATOM 5304   O OP1    . C A 1 165 ? 124.487 119.138 102.959 1.00 0.00 ? 154 C A OP1    1  
ATOM 5305   O OP2    . C A 1 165 ? 122.004 118.546 102.688 1.00 0.00 ? 154 C A OP2    1  
ATOM 5306   O "O5'"  . C A 1 165 ? 122.779 120.015 104.544 1.00 0.00 ? 154 C A "O5'"  1  
ATOM 5307   C "C5'"  . C A 1 165 ? 123.718 120.825 105.234 1.00 0.00 ? 154 C A "C5'"  1  
ATOM 5308   C "C4'"  . C A 1 165 ? 123.241 121.173 106.624 1.00 0.00 ? 154 C A "C4'"  1  
ATOM 5309   O "O4'"  . C A 1 165 ? 121.984 121.894 106.546 1.00 0.00 ? 154 C A "O4'"  1  
ATOM 5310   C "C3'"  . C A 1 165 ? 122.937 119.999 107.541 1.00 0.00 ? 154 C A "C3'"  1  
ATOM 5311   O "O3'"  . C A 1 165 ? 124.101 119.434 108.121 1.00 0.00 ? 154 C A "O3'"  1  
ATOM 5312   C "C2'"  . C A 1 165 ? 121.985 120.611 108.560 1.00 0.00 ? 154 C A "C2'"  1  
ATOM 5313   O "O2'"  . C A 1 165 ? 122.686 121.387 109.521 1.00 0.00 ? 154 C A "O2'"  1  
ATOM 5314   C "C1'"  . C A 1 165 ? 121.156 121.545 107.677 1.00 0.00 ? 154 C A "C1'"  1  
ATOM 5315   N N1     . C A 1 165 ? 119.885 120.922 107.233 1.00 0.00 ? 154 C A N1     1  
ATOM 5316   C C2     . C A 1 165 ? 118.825 120.849 108.146 1.00 0.00 ? 154 C A C2     1  
ATOM 5317   O O2     . C A 1 165 ? 118.980 121.303 109.291 1.00 0.00 ? 154 C A O2     1  
ATOM 5318   N N3     . C A 1 165 ? 117.655 120.285 107.767 1.00 0.00 ? 154 C A N3     1  
ATOM 5319   C C4     . C A 1 165 ? 117.515 119.803 106.532 1.00 0.00 ? 154 C A C4     1  
ATOM 5320   N N4     . C A 1 165 ? 116.343 119.255 106.202 1.00 0.00 ? 154 C A N4     1  
ATOM 5321   C C5     . C A 1 165 ? 118.573 119.861 105.580 1.00 0.00 ? 154 C A C5     1  
ATOM 5322   C C6     . C A 1 165 ? 119.725 120.423 105.967 1.00 0.00 ? 154 C A C6     1  
ATOM 5323   H "H5'"  . C A 1 165 ? 123.859 121.651 104.729 1.00 0.00 ? 154 C A "H5'"  1  
ATOM 5324   H "H5''" . C A 1 165 ? 124.568 120.340 105.301 1.00 0.00 ? 154 C A "H5''" 1  
ATOM 5325   H "H4'"  . C A 1 165 ? 123.910 121.747 107.051 1.00 0.00 ? 154 C A "H4'"  1  
ATOM 5326   H "H3'"  . C A 1 165 ? 122.462 119.308 107.034 1.00 0.00 ? 154 C A "H3'"  1  
ATOM 5327   H "H2'"  . C A 1 165 ? 121.423 119.928 108.983 1.00 0.00 ? 154 C A "H2'"  1  
ATOM 5328   H "HO2'" . C A 1 165 ? 123.626 121.114 109.526 1.00 0.00 ? 154 C A "HO2'" 1  
ATOM 5329   H "H1'"  . C A 1 165 ? 120.957 122.369 108.171 1.00 0.00 ? 154 C A "H1'"  1  
ATOM 5330   H H41    . C A 1 165 ? 115.618 119.217 106.860 1.00 0.00 ? 154 C A H41    1  
ATOM 5331   H H42    . C A 1 165 ? 116.209 118.893 105.302 1.00 0.00 ? 154 C A H42    1  
ATOM 5332   H H5     . C A 1 165 ? 118.461 119.506 104.675 1.00 0.00 ? 154 C A H5     1  
ATOM 5333   H H6     . C A 1 165 ? 120.465 120.472 105.327 1.00 0.00 ? 154 C A H6     1  
ATOM 5334   P P      . A A 1 166 ? 124.319 117.847 108.071 1.00 0.00 ? 155 A A P      1  
ATOM 5335   O OP1    . A A 1 166 ? 125.717 117.537 108.461 1.00 0.00 ? 155 A A OP1    1  
ATOM 5336   O OP2    . A A 1 166 ? 123.841 117.496 106.710 1.00 0.00 ? 155 A A OP2    1  
ATOM 5337   O "O5'"  . A A 1 166 ? 123.347 117.155 109.127 1.00 0.00 ? 155 A A "O5'"  1  
ATOM 5338   C "C5'"  . A A 1 166 ? 123.494 117.393 110.519 1.00 0.00 ? 155 A A "C5'"  1  
ATOM 5339   C "C4'"  . A A 1 166 ? 122.582 116.510 111.331 1.00 0.00 ? 155 A A "C4'"  1  
ATOM 5340   O "O4'"  . A A 1 166 ? 121.262 117.109 111.414 1.00 0.00 ? 155 A A "O4'"  1  
ATOM 5341   C "C3'"  . A A 1 166 ? 122.323 115.120 110.768 1.00 0.00 ? 155 A A "C3'"  1  
ATOM 5342   O "O3'"  . A A 1 166 ? 123.365 114.204 111.054 1.00 0.00 ? 155 A A "O3'"  1  
ATOM 5343   C "C2'"  . A A 1 166 ? 120.991 114.747 111.402 1.00 0.00 ? 155 A A "C2'"  1  
ATOM 5344   O "O2'"  . A A 1 166 ? 121.160 114.331 112.750 1.00 0.00 ? 155 A A "O2'"  1  
ATOM 5345   C "C1'"  . A A 1 166 ? 120.258 116.090 111.386 1.00 0.00 ? 155 A A "C1'"  1  
ATOM 5346   N N9     . A A 1 166 ? 119.394 116.238 110.200 1.00 0.00 ? 155 A A N9     1  
ATOM 5347   C C8     . A A 1 166 ? 119.616 117.006 109.084 1.00 0.00 ? 155 A A C8     1  
ATOM 5348   N N7     . A A 1 166 ? 118.660 116.931 108.192 1.00 0.00 ? 155 A A N7     1  
ATOM 5349   C C5     . A A 1 166 ? 117.744 116.053 108.758 1.00 0.00 ? 155 A A C5     1  
ATOM 5350   C C6     . A A 1 166 ? 116.507 115.557 108.311 1.00 0.00 ? 155 A A C6     1  
ATOM 5351   N N6     . A A 1 166 ? 115.957 115.886 107.141 1.00 0.00 ? 155 A A N6     1  
ATOM 5352   N N1     . A A 1 166 ? 115.846 114.699 109.118 1.00 0.00 ? 155 A A N1     1  
ATOM 5353   C C2     . A A 1 166 ? 116.399 114.368 110.292 1.00 0.00 ? 155 A A C2     1  
ATOM 5354   N N3     . A A 1 166 ? 117.552 114.768 110.821 1.00 0.00 ? 155 A A N3     1  
ATOM 5355   C C4     . A A 1 166 ? 118.184 115.620 109.994 1.00 0.00 ? 155 A A C4     1  
ATOM 5356   H "H5'"  . A A 1 166 ? 123.280 118.331 110.707 1.00 0.00 ? 155 A A "H5'"  1  
ATOM 5357   H "H5''" . A A 1 166 ? 124.423 117.220 110.777 1.00 0.00 ? 155 A A "H5''" 1  
ATOM 5358   H "H4'"  . A A 1 166 ? 122.949 116.421 112.236 1.00 0.00 ? 155 A A "H4'"  1  
ATOM 5359   H "H3'"  . A A 1 166 ? 122.209 115.185 109.797 1.00 0.00 ? 155 A A "H3'"  1  
ATOM 5360   H "H2'"  . A A 1 166 ? 120.515 114.074 110.871 1.00 0.00 ? 155 A A "H2'"  1  
ATOM 5361   H "HO2'" . A A 1 166 ? 122.093 114.068 112.889 1.00 0.00 ? 155 A A "HO2'" 1  
ATOM 5362   H "H1'"  . A A 1 166 ? 119.716 116.176 112.197 1.00 0.00 ? 155 A A "H1'"  1  
ATOM 5363   H H8     . A A 1 166 ? 120.417 117.560 108.964 1.00 0.00 ? 155 A A H8     1  
ATOM 5364   H H61    . A A 1 166 ? 115.089 115.507 106.882 1.00 0.00 ? 155 A A H61    1  
ATOM 5365   H H62    . A A 1 166 ? 116.417 116.507 106.538 1.00 0.00 ? 155 A A H62    1  
ATOM 5366   H H2     . A A 1 166 ? 115.879 113.741 110.839 1.00 0.00 ? 155 A A H2     1  
ATOM 5367   P P      . C A 1 167 ? 123.679 112.994 110.042 1.00 0.00 ? 156 C A P      1  
ATOM 5368   O OP1    . C A 1 167 ? 124.906 112.305 110.514 1.00 0.00 ? 156 C A OP1    1  
ATOM 5369   O OP2    . C A 1 167 ? 123.624 113.527 108.657 1.00 0.00 ? 156 C A OP2    1  
ATOM 5370   O "O5'"  . C A 1 167 ? 122.449 112.000 110.237 1.00 0.00 ? 156 C A "O5'"  1  
ATOM 5371   C "C5'"  . C A 1 167 ? 122.338 111.197 111.402 1.00 0.00 ? 156 C A "C5'"  1  
ATOM 5372   C "C4'"  . C A 1 167 ? 121.074 110.373 111.394 1.00 0.00 ? 156 C A "C4'"  1  
ATOM 5373   O "O4'"  . C A 1 167 ? 119.917 111.246 111.300 1.00 0.00 ? 156 C A "O4'"  1  
ATOM 5374   C "C3'"  . C A 1 167 ? 120.906 109.413 110.226 1.00 0.00 ? 156 C A "C3'"  1  
ATOM 5375   O "O3'"  . C A 1 167 ? 121.635 108.210 110.391 1.00 0.00 ? 156 C A "O3'"  1  
ATOM 5376   C "C2'"  . C A 1 167 ? 119.398 109.213 110.174 1.00 0.00 ? 156 C A "C2'"  1  
ATOM 5377   O "O2'"  . C A 1 167 ? 118.963 108.312 111.182 1.00 0.00 ? 156 C A "O2'"  1  
ATOM 5378   C "C1'"  . C A 1 167 ? 118.892 110.617 110.509 1.00 0.00 ? 156 C A "C1'"  1  
ATOM 5379   N N1     . C A 1 167 ? 118.592 111.413 109.294 1.00 0.00 ? 156 C A N1     1  
ATOM 5380   C C2     . C A 1 167 ? 117.402 111.151 108.604 1.00 0.00 ? 156 C A C2     1  
ATOM 5381   O O2     . C A 1 167 ? 116.640 110.267 109.025 1.00 0.00 ? 156 C A O2     1  
ATOM 5382   N N3     . C A 1 167 ? 117.104 111.862 107.494 1.00 0.00 ? 156 C A N3     1  
ATOM 5383   C C4     . C A 1 167 ? 117.939 112.806 107.062 1.00 0.00 ? 156 C A C4     1  
ATOM 5384   N N4     . C A 1 167 ? 117.604 113.484 105.961 1.00 0.00 ? 156 C A N4     1  
ATOM 5385   C C5     . C A 1 167 ? 119.157 113.097 107.739 1.00 0.00 ? 156 C A C5     1  
ATOM 5386   C C6     . C A 1 167 ? 119.441 112.387 108.838 1.00 0.00 ? 156 C A C6     1  
ATOM 5387   H "H5'"  . C A 1 167 ? 122.337 111.778 112.191 1.00 0.00 ? 156 C A "H5'"  1  
ATOM 5388   H "H5''" . C A 1 167 ? 123.112 110.596 111.450 1.00 0.00 ? 156 C A "H5''" 1  
ATOM 5389   H "H4'"  . C A 1 167 ? 121.021 109.867 112.232 1.00 0.00 ? 156 C A "H4'"  1  
ATOM 5390   H "H3'"  . C A 1 167 ? 121.199 109.856 109.402 1.00 0.00 ? 156 C A "H3'"  1  
ATOM 5391   H "H2'"  . C A 1 167 ? 119.104 108.930 109.283 1.00 0.00 ? 156 C A "H2'"  1  
ATOM 5392   H "HO2'" . C A 1 167 ? 117.999 108.169 111.087 1.00 0.00 ? 156 C A "HO2'" 1  
ATOM 5393   H "H1'"  . C A 1 167 ? 118.084 110.550 111.061 1.00 0.00 ? 156 C A "H1'"  1  
ATOM 5394   H H41    . C A 1 167 ? 116.767 113.281 105.497 1.00 0.00 ? 156 C A H41    1  
ATOM 5395   H H42    . C A 1 167 ? 118.198 114.184 105.618 1.00 0.00 ? 156 C A H42    1  
ATOM 5396   H H5     . C A 1 167 ? 119.766 113.794 107.414 1.00 0.00 ? 156 C A H5     1  
ATOM 5397   H H6     . C A 1 167 ? 120.274 112.572 109.319 1.00 0.00 ? 156 C A H6     1  
ATOM 5398   P P      . G A 1 168 ? 122.431 107.586 109.148 1.00 0.00 ? 157 G A P      1  
ATOM 5399   O OP1    . G A 1 168 ? 123.165 106.376 109.597 1.00 0.00 ? 157 G A OP1    1  
ATOM 5400   O OP2    . G A 1 168 ? 123.189 108.754 108.631 1.00 0.00 ? 157 G A OP2    1  
ATOM 5401   O "O5'"  . G A 1 168 ? 121.387 107.143 108.031 1.00 0.00 ? 157 G A "O5'"  1  
ATOM 5402   C "C5'"  . G A 1 168 ? 120.470 106.087 108.270 1.00 0.00 ? 157 G A "C5'"  1  
ATOM 5403   C "C4'"  . G A 1 168 ? 119.131 106.360 107.628 1.00 0.00 ? 157 G A "C4'"  1  
ATOM 5404   O "O4'"  . G A 1 168 ? 119.023 107.770 107.301 1.00 0.00 ? 157 G A "O4'"  1  
ATOM 5405   C "C3'"  . G A 1 168 ? 118.867 105.651 106.308 1.00 0.00 ? 157 G A "C3'"  1  
ATOM 5406   O "O3'"  . G A 1 168 ? 118.450 104.308 106.475 1.00 0.00 ? 157 G A "O3'"  1  
ATOM 5407   C "C2'"  . G A 1 168 ? 117.815 106.541 105.660 1.00 0.00 ? 157 G A "C2'"  1  
ATOM 5408   O "O2'"  . G A 1 168 ? 116.528 106.307 106.215 1.00 0.00 ? 157 G A "O2'"  1  
ATOM 5409   C "C1'"  . G A 1 168 ? 118.291 107.933 106.079 1.00 0.00 ? 157 G A "C1'"  1  
ATOM 5410   N N9     . G A 1 168 ? 119.133 108.565 105.046 1.00 0.00 ? 157 G A N9     1  
ATOM 5411   C C8     . G A 1 168 ? 120.492 108.762 105.089 1.00 0.00 ? 157 G A C8     1  
ATOM 5412   N N7     . G A 1 168 ? 120.959 109.353 104.021 1.00 0.00 ? 157 G A N7     1  
ATOM 5413   C C5     . G A 1 168 ? 119.841 109.557 103.225 1.00 0.00 ? 157 G A C5     1  
ATOM 5414   C C6     . G A 1 168 ? 119.721 110.156 101.945 1.00 0.00 ? 157 G A C6     1  
ATOM 5415   O O6     . G A 1 168 ? 120.609 110.641 101.234 1.00 0.00 ? 157 G A O6     1  
ATOM 5416   N N1     . G A 1 168 ? 118.402 110.159 101.502 1.00 0.00 ? 157 G A N1     1  
ATOM 5417   C C2     . G A 1 168 ? 117.334 109.651 102.201 1.00 0.00 ? 157 G A C2     1  
ATOM 5418   N N2     . G A 1 168 ? 116.134 109.745 101.607 1.00 0.00 ? 157 G A N2     1  
ATOM 5419   N N3     . G A 1 168 ? 117.432 109.090 103.395 1.00 0.00 ? 157 G A N3     1  
ATOM 5420   C C4     . G A 1 168 ? 118.705 109.077 103.843 1.00 0.00 ? 157 G A C4     1  
ATOM 5421   H "H5'"  . G A 1 168 ? 120.345 105.983 109.236 1.00 0.00 ? 157 G A "H5'"  1  
ATOM 5422   H "H5''" . G A 1 168 ? 120.836 105.255 107.903 1.00 0.00 ? 157 G A "H5''" 1  
ATOM 5423   H "H4'"  . G A 1 168 ? 118.422 106.126 108.263 1.00 0.00 ? 157 G A "H4'"  1  
ATOM 5424   H "H3'"  . G A 1 168 ? 119.683 105.671 105.763 1.00 0.00 ? 157 G A "H3'"  1  
ATOM 5425   H "H2'"  . G A 1 168 ? 117.811 106.441 104.685 1.00 0.00 ? 157 G A "H2'"  1  
ATOM 5426   H "HO2'" . G A 1 168 ? 116.523 105.431 106.651 1.00 0.00 ? 157 G A "HO2'" 1  
ATOM 5427   H "H1'"  . G A 1 168 ? 117.515 108.502 106.260 1.00 0.00 ? 157 G A "H1'"  1  
ATOM 5428   H H8     . G A 1 168 ? 121.056 108.489 105.842 1.00 0.00 ? 157 G A H8     1  
ATOM 5429   H H1     . G A 1 168 ? 118.222 110.554 100.623 1.00 0.00 ? 157 G A H1     1  
ATOM 5430   H H21    . G A 1 168 ? 116.054 110.158 100.723 1.00 0.00 ? 157 G A H21    1  
ATOM 5431   H H22    . G A 1 168 ? 115.336 109.399 102.060 1.00 0.00 ? 157 G A H22    1  
ATOM 5432   P P      . C A 1 169 ? 118.736 103.226 105.320 1.00 0.00 ? 158 C A P      1  
ATOM 5433   O OP1    . C A 1 169 ? 118.271 101.902 105.806 1.00 0.00 ? 158 C A OP1    1  
ATOM 5434   O OP2    . C A 1 169 ? 120.141 103.391 104.873 1.00 0.00 ? 158 C A OP2    1  
ATOM 5435   O "O5'"  . C A 1 169 ? 117.781 103.674 104.126 1.00 0.00 ? 158 C A "O5'"  1  
ATOM 5436   C "C5'"  . C A 1 169 ? 116.380 103.460 104.193 1.00 0.00 ? 158 C A "C5'"  1  
ATOM 5437   C "C4'"  . C A 1 169 ? 115.677 103.971 102.958 1.00 0.00 ? 158 C A "C4'"  1  
ATOM 5438   O "O4'"  . C A 1 169 ? 115.927 105.393 102.800 1.00 0.00 ? 158 C A "O4'"  1  
ATOM 5439   C "C3'"  . C A 1 169 ? 116.126 103.370 101.635 1.00 0.00 ? 158 C A "C3'"  1  
ATOM 5440   O "O3'"  . C A 1 169 ? 115.556 102.097 101.383 1.00 0.00 ? 158 C A "O3'"  1  
ATOM 5441   C "C2'"  . C A 1 169 ? 115.714 104.434 100.629 1.00 0.00 ? 158 C A "C2'"  1  
ATOM 5442   O "O2'"  . C A 1 169 ? 114.320 104.378 100.362 1.00 0.00 ? 158 C A "O2'"  1  
ATOM 5443   C "C1'"  . C A 1 169 ? 116.020 105.719 101.400 1.00 0.00 ? 158 C A "C1'"  1  
ATOM 5444   N N1     . C A 1 169 ? 117.360 106.267 101.071 1.00 0.00 ? 158 C A N1     1  
ATOM 5445   C C2     . C A 1 169 ? 117.512 106.973 99.872  1.00 0.00 ? 158 C A C2     1  
ATOM 5446   O O2     . C A 1 169 ? 116.530 107.118 99.124  1.00 0.00 ? 158 C A O2     1  
ATOM 5447   N N3     . C A 1 169 ? 118.722 107.484 99.547  1.00 0.00 ? 158 C A N3     1  
ATOM 5448   C C4     . C A 1 169 ? 119.759 107.315 100.366 1.00 0.00 ? 158 C A C4     1  
ATOM 5449   N N4     . C A 1 169 ? 120.934 107.837 100.005 1.00 0.00 ? 158 C A N4     1  
ATOM 5450   C C5     . C A 1 169 ? 119.639 106.602 101.591 1.00 0.00 ? 158 C A C5     1  
ATOM 5451   C C6     . C A 1 169 ? 118.437 106.102 101.902 1.00 0.00 ? 158 C A C6     1  
ATOM 5452   H "H5'"  . C A 1 169 ? 116.023 103.924 104.979 1.00 0.00 ? 158 C A "H5'"  1  
ATOM 5453   H "H5''" . C A 1 169 ? 116.207 102.498 104.284 1.00 0.00 ? 158 C A "H5''" 1  
ATOM 5454   H "H4'"  . C A 1 169 ? 114.713 103.828 103.061 1.00 0.00 ? 158 C A "H4'"  1  
ATOM 5455   H "H3'"  . C A 1 169 ? 117.104 103.290 101.633 1.00 0.00 ? 158 C A "H3'"  1  
ATOM 5456   H "H2'"  . C A 1 169 ? 116.242 104.376 99.805  1.00 0.00 ? 158 C A "H2'"  1  
ATOM 5457   H "HO2'" . C A 1 169 ? 113.981 103.496 100.617 1.00 0.00 ? 158 C A "HO2'" 1  
ATOM 5458   H "H1'"  . C A 1 169 ? 115.337 106.389 101.201 1.00 0.00 ? 158 C A "H1'"  1  
ATOM 5459   H H41    . C A 1 169 ? 121.015 108.328 99.160  1.00 0.00 ? 158 C A H41    1  
ATOM 5460   H H42    . C A 1 169 ? 121.716 107.731 100.584 1.00 0.00 ? 158 C A H42    1  
ATOM 5461   H H5     . C A 1 169 ? 120.407 106.483 102.187 1.00 0.00 ? 158 C A H5     1  
ATOM 5462   H H6     . C A 1 169 ? 118.332 105.608 102.741 1.00 0.00 ? 158 C A H6     1  
ATOM 5463   P P      . A A 1 170 ? 116.312 101.045 100.431 1.00 0.00 ? 159 A A P      1  
ATOM 5464   O OP1    . A A 1 170 ? 115.562 99.764  100.472 1.00 0.00 ? 159 A A OP1    1  
ATOM 5465   O OP2    . A A 1 170 ? 117.755 101.065 100.780 1.00 0.00 ? 159 A A OP2    1  
ATOM 5466   O "O5'"  . A A 1 170 ? 116.150 101.664 98.971  1.00 0.00 ? 159 A A "O5'"  1  
ATOM 5467   C "C5'"  . A A 1 170 ? 114.874 101.756 98.355  1.00 0.00 ? 159 A A "C5'"  1  
ATOM 5468   C "C4'"  . A A 1 170 ? 114.945 102.483 97.037  1.00 0.00 ? 159 A A "C4'"  1  
ATOM 5469   O "O4'"  . A A 1 170 ? 115.401 103.845 97.254  1.00 0.00 ? 159 A A "O4'"  1  
ATOM 5470   C "C3'"  . A A 1 170 ? 115.923 101.923 96.016  1.00 0.00 ? 159 A A "C3'"  1  
ATOM 5471   O "O3'"  . A A 1 170 ? 115.418 100.792 95.328  1.00 0.00 ? 159 A A "O3'"  1  
ATOM 5472   C "C2'"  . A A 1 170 ? 116.185 103.120 95.113  1.00 0.00 ? 159 A A "C2'"  1  
ATOM 5473   O "O2'"  . A A 1 170 ? 115.113 103.325 94.204  1.00 0.00 ? 159 A A "O2'"  1  
ATOM 5474   C "C1'"  . A A 1 170 ? 116.202 104.267 96.126  1.00 0.00 ? 159 A A "C1'"  1  
ATOM 5475   N N9     . A A 1 170 ? 117.572 104.616 96.546  1.00 0.00 ? 159 A A N9     1  
ATOM 5476   C C8     . A A 1 170 ? 118.198 104.305 97.729  1.00 0.00 ? 159 A A C8     1  
ATOM 5477   N N7     . A A 1 170 ? 119.425 104.757 97.813  1.00 0.00 ? 159 A A N7     1  
ATOM 5478   C C5     . A A 1 170 ? 119.622 105.411 96.603  1.00 0.00 ? 159 A A C5     1  
ATOM 5479   C C6     . A A 1 170 ? 120.724 106.104 96.073  1.00 0.00 ? 159 A A C6     1  
ATOM 5480   N N6     . A A 1 170 ? 121.882 106.262 96.717  1.00 0.00 ? 159 A A N6     1  
ATOM 5481   N N1     . A A 1 170 ? 120.592 106.638 94.839  1.00 0.00 ? 159 A A N1     1  
ATOM 5482   C C2     . A A 1 170 ? 119.431 106.479 94.191  1.00 0.00 ? 159 A A C2     1  
ATOM 5483   N N3     . A A 1 170 ? 118.327 105.850 94.586  1.00 0.00 ? 159 A A N3     1  
ATOM 5484   C C4     . A A 1 170 ? 118.491 105.330 95.816  1.00 0.00 ? 159 A A C4     1  
ATOM 5485   H "H5'"  . A A 1 170 ? 114.264 102.236 98.954  1.00 0.00 ? 159 A A "H5'"  1  
ATOM 5486   H "H5''" . A A 1 170 ? 114.525 100.851 98.203  1.00 0.00 ? 159 A A "H5''" 1  
ATOM 5487   H "H4'"  . A A 1 170 ? 114.050 102.509 96.638  1.00 0.00 ? 159 A A "H4'"  1  
ATOM 5488   H "H3'"  . A A 1 170 ? 116.756 101.678 96.470  1.00 0.00 ? 159 A A "H3'"  1  
ATOM 5489   H "H2'"  . A A 1 170 ? 117.044 103.041 94.649  1.00 0.00 ? 159 A A "H2'"  1  
ATOM 5490   H "HO2'" . A A 1 170 ? 114.598 102.495 94.126  1.00 0.00 ? 159 A A "HO2'" 1  
ATOM 5491   H "H1'"  . A A 1 170 ? 115.771 105.055 95.733  1.00 0.00 ? 159 A A "H1'"  1  
ATOM 5492   H H8     . A A 1 170 ? 117.766 103.793 98.444  1.00 0.00 ? 159 A A H8     1  
ATOM 5493   H H61    . A A 1 170 ? 122.615 106.758 96.294  1.00 0.00 ? 159 A A H61    1  
ATOM 5494   H H62    . A A 1 170 ? 121.999 105.885 97.614  1.00 0.00 ? 159 A A H62    1  
ATOM 5495   H H2     . A A 1 170 ? 119.389 106.885 93.299  1.00 0.00 ? 159 A A H2     1  
ATOM 5496   P P      . G A 1 171 ? 116.426 99.694  94.727  1.00 0.00 ? 160 G A P      1  
ATOM 5497   O OP1    . G A 1 171 ? 115.619 98.573  94.184  1.00 0.00 ? 160 G A OP1    1  
ATOM 5498   O OP2    . G A 1 171 ? 117.468 99.420  95.749  1.00 0.00 ? 160 G A OP2    1  
ATOM 5499   O "O5'"  . G A 1 171 ? 117.123 100.439 93.502  1.00 0.00 ? 160 G A "O5'"  1  
ATOM 5500   C "C5'"  . G A 1 171 ? 116.375 100.799 92.350  1.00 0.00 ? 160 G A "C5'"  1  
ATOM 5501   C "C4'"  . G A 1 171 ? 117.199 101.623 91.390  1.00 0.00 ? 160 G A "C4'"  1  
ATOM 5502   O "O4'"  . G A 1 171 ? 117.632 102.848 92.041  1.00 0.00 ? 160 G A "O4'"  1  
ATOM 5503   C "C3'"  . G A 1 171 ? 118.491 100.986 90.901  1.00 0.00 ? 160 G A "C3'"  1  
ATOM 5504   O "O3'"  . G A 1 171 ? 118.284 100.045 89.863  1.00 0.00 ? 160 G A "O3'"  1  
ATOM 5505   C "C2'"  . G A 1 171 ? 119.315 102.193 90.478  1.00 0.00 ? 160 G A "C2'"  1  
ATOM 5506   O "O2'"  . G A 1 171 ? 118.897 102.686 89.213  1.00 0.00 ? 160 G A "O2'"  1  
ATOM 5507   C "C1'"  . G A 1 171 ? 118.942 103.214 91.555  1.00 0.00 ? 160 G A "C1'"  1  
ATOM 5508   N N9     . G A 1 171 ? 119.932 103.255 92.648  1.00 0.00 ? 160 G A N9     1  
ATOM 5509   C C8     . G A 1 171 ? 119.800 102.731 93.910  1.00 0.00 ? 160 G A C8     1  
ATOM 5510   N N7     . G A 1 171 ? 120.850 102.929 94.660  1.00 0.00 ? 160 G A N7     1  
ATOM 5511   C C5     . G A 1 171 ? 121.730 103.624 93.843  1.00 0.00 ? 160 G A C5     1  
ATOM 5512   C C6     . G A 1 171 ? 123.036 104.112 94.105  1.00 0.00 ? 160 G A C6     1  
ATOM 5513   O O6     . G A 1 171 ? 123.697 104.026 95.147  1.00 0.00 ? 160 G A O6     1  
ATOM 5514   N N1     . G A 1 171 ? 123.572 104.761 92.996  1.00 0.00 ? 160 G A N1     1  
ATOM 5515   C C2     . G A 1 171 ? 122.934 104.917 91.789  1.00 0.00 ? 160 G A C2     1  
ATOM 5516   N N2     . G A 1 171 ? 123.615 105.572 90.837  1.00 0.00 ? 160 G A N2     1  
ATOM 5517   N N3     . G A 1 171 ? 121.717 104.466 91.533  1.00 0.00 ? 160 G A N3     1  
ATOM 5518   C C4     . G A 1 171 ? 121.179 103.834 92.597  1.00 0.00 ? 160 G A C4     1  
ATOM 5519   H "H5'"  . G A 1 171 ? 115.592 101.318 92.625  1.00 0.00 ? 160 G A "H5'"  1  
ATOM 5520   H "H5''" . G A 1 171 ? 116.074 99.984  91.894  1.00 0.00 ? 160 G A "H5''" 1  
ATOM 5521   H "H4'"  . G A 1 171 ? 116.644 101.856 90.615  1.00 0.00 ? 160 G A "H4'"  1  
ATOM 5522   H "H3'"  . G A 1 171 ? 118.935 100.544 91.656  1.00 0.00 ? 160 G A "H3'"  1  
ATOM 5523   H "H2'"  . G A 1 171 ? 120.275 101.994 90.489  1.00 0.00 ? 160 G A "H2'"  1  
ATOM 5524   H "HO2'" . G A 1 171 ? 119.462 103.444 88.962  1.00 0.00 ? 160 G A "HO2'" 1  
ATOM 5525   H "H1'"  . G A 1 171 ? 118.864 104.102 91.149  1.00 0.00 ? 160 G A "H1'"  1  
ATOM 5526   H H8     . G A 1 171 ? 118.998 102.261 94.218  1.00 0.00 ? 160 G A H8     1  
ATOM 5527   H H1     . G A 1 171 ? 124.476 105.132 93.086  1.00 0.00 ? 160 G A H1     1  
ATOM 5528   H H21    . G A 1 171 ? 124.516 105.909 91.019  1.00 0.00 ? 160 G A H21    1  
ATOM 5529   H H22    . G A 1 171 ? 123.210 105.715 89.956  1.00 0.00 ? 160 G A H22    1  
ATOM 5530   P P      . U A 1 172 ? 119.326 98.838  89.651  1.00 0.00 ? 161 U A P      1  
ATOM 5531   O OP1    . U A 1 172 ? 118.792 97.952  88.584  1.00 0.00 ? 161 U A OP1    1  
ATOM 5532   O OP2    . U A 1 172 ? 119.650 98.270  90.983  1.00 0.00 ? 161 U A OP2    1  
ATOM 5533   O "O5'"  . U A 1 172 ? 120.633 99.552  89.089  1.00 0.00 ? 161 U A "O5'"  1  
ATOM 5534   C "C5'"  . U A 1 172 ? 120.631 100.184 87.818  1.00 0.00 ? 161 U A "C5'"  1  
ATOM 5535   C "C4'"  . U A 1 172 ? 121.925 100.916 87.556  1.00 0.00 ? 161 U A "C4'"  1  
ATOM 5536   O "O4'"  . U A 1 172 ? 122.116 101.954 88.550  1.00 0.00 ? 161 U A "O4'"  1  
ATOM 5537   C "C3'"  . U A 1 172 ? 123.193 100.082 87.645  1.00 0.00 ? 161 U A "C3'"  1  
ATOM 5538   O "O3'"  . U A 1 172 ? 123.431 99.306  86.481  1.00 0.00 ? 161 U A "O3'"  1  
ATOM 5539   C "C2'"  . U A 1 172 ? 124.264 101.134 87.907  1.00 0.00 ? 161 U A "C2'"  1  
ATOM 5540   O "O2'"  . U A 1 172 ? 124.609 101.825 86.715  1.00 0.00 ? 161 U A "O2'"  1  
ATOM 5541   C "C1'"  . U A 1 172 ? 123.524 102.093 88.841  1.00 0.00 ? 161 U A "C1'"  1  
ATOM 5542   N N1     . U A 1 172 ? 123.807 101.817 90.270  1.00 0.00 ? 161 U A N1     1  
ATOM 5543   C C2     . U A 1 172 ? 125.012 102.267 90.775  1.00 0.00 ? 161 U A C2     1  
ATOM 5544   O O2     . U A 1 172 ? 125.832 102.869 90.101  1.00 0.00 ? 161 U A O2     1  
ATOM 5545   N N3     . U A 1 172 ? 125.230 101.990 92.101  1.00 0.00 ? 161 U A N3     1  
ATOM 5546   C C4     . U A 1 172 ? 124.385 101.319 92.961  1.00 0.00 ? 161 U A C4     1  
ATOM 5547   O O4     . U A 1 172 ? 124.726 101.146 94.131  1.00 0.00 ? 161 U A O4     1  
ATOM 5548   C C5     . U A 1 172 ? 123.157 100.882 92.370  1.00 0.00 ? 161 U A C5     1  
ATOM 5549   C C6     . U A 1 172 ? 122.919 101.141 91.080  1.00 0.00 ? 161 U A C6     1  
ATOM 5550   H "H5'"  . U A 1 172 ? 119.889 100.826 87.782  1.00 0.00 ? 161 U A "H5'"  1  
ATOM 5551   H "H5''" . U A 1 172 ? 120.501 99.506  87.122  1.00 0.00 ? 161 U A "H5''" 1  
ATOM 5552   H "H4'"  . U A 1 172 ? 121.880 101.329 86.669  1.00 0.00 ? 161 U A "H4'"  1  
ATOM 5553   H "H3'"  . U A 1 172 ? 123.133 99.486  88.422  1.00 0.00 ? 161 U A "H3'"  1  
ATOM 5554   H "H2'"  . U A 1 172 ? 125.051 100.745 88.343  1.00 0.00 ? 161 U A "H2'"  1  
ATOM 5555   H "HO2'" . U A 1 172 ? 124.340 101.287 85.944  1.00 0.00 ? 161 U A "HO2'" 1  
ATOM 5556   H "H1'"  . U A 1 172 ? 123.786 103.015 88.633  1.00 0.00 ? 161 U A "H1'"  1  
ATOM 5557   H H3     . U A 1 172 ? 126.079 102.298 92.478  1.00 0.00 ? 161 U A H3     1  
ATOM 5558   H H5     . U A 1 172 ? 122.495 100.400 92.908  1.00 0.00 ? 161 U A H5     1  
ATOM 5559   H H6     . U A 1 172 ? 122.071 100.832 90.700  1.00 0.00 ? 161 U A H6     1  
ATOM 5560   P P      . C A 1 173 ? 124.266 97.945  86.593  1.00 0.00 ? 162 C A P      1  
ATOM 5561   O OP1    . C A 1 173 ? 124.312 97.290  85.261  1.00 0.00 ? 162 C A OP1    1  
ATOM 5562   O OP2    . C A 1 173 ? 123.606 97.252  87.728  1.00 0.00 ? 162 C A OP2    1  
ATOM 5563   O "O5'"  . C A 1 173 ? 125.761 98.285  87.024  1.00 0.00 ? 162 C A "O5'"  1  
ATOM 5564   C "C5'"  . C A 1 173 ? 126.641 98.959  86.138  1.00 0.00 ? 162 C A "C5'"  1  
ATOM 5565   C "C4'"  . C A 1 173 ? 127.710 99.720  86.884  1.00 0.00 ? 162 C A "C4'"  1  
ATOM 5566   O "O4'"  . C A 1 173 ? 127.109 100.441 87.990  1.00 0.00 ? 162 C A "O4'"  1  
ATOM 5567   C "C3'"  . C A 1 173 ? 128.782 98.880  87.560  1.00 0.00 ? 162 C A "C3'"  1  
ATOM 5568   O "O3'"  . C A 1 173 ? 129.793 98.450  86.665  1.00 0.00 ? 162 C A "O3'"  1  
ATOM 5569   C "C2'"  . C A 1 173 ? 129.279 99.801  88.662  1.00 0.00 ? 162 C A "C2'"  1  
ATOM 5570   O "O2'"  . C A 1 173 ? 130.162 100.788 88.149  1.00 0.00 ? 162 C A "O2'"  1  
ATOM 5571   C "C1'"  . C A 1 173 ? 127.987 100.469 89.097  1.00 0.00 ? 162 C A "C1'"  1  
ATOM 5572   N N1     . C A 1 173 ? 127.361 99.785  90.256  1.00 0.00 ? 162 C A N1     1  
ATOM 5573   C C2     . C A 1 173 ? 127.913 99.990  91.527  1.00 0.00 ? 162 C A C2     1  
ATOM 5574   O O2     . C A 1 173 ? 128.901 100.731 91.646  1.00 0.00 ? 162 C A O2     1  
ATOM 5575   N N3     . C A 1 173 ? 127.361 99.378  92.599  1.00 0.00 ? 162 C A N3     1  
ATOM 5576   C C4     . C A 1 173 ? 126.300 98.587  92.444  1.00 0.00 ? 162 C A C4     1  
ATOM 5577   N N4     . C A 1 173 ? 125.789 98.003  93.532  1.00 0.00 ? 162 C A N4     1  
ATOM 5578   C C5     . C A 1 173 ? 125.717 98.357  91.167  1.00 0.00 ? 162 C A C5     1  
ATOM 5579   C C6     . C A 1 173 ? 126.270 98.968  90.113  1.00 0.00 ? 162 C A C6     1  
ATOM 5580   H "H5'"  . C A 1 173 ? 126.124 99.587  85.591  1.00 0.00 ? 162 C A "H5'"  1  
ATOM 5581   H "H5''" . C A 1 173 ? 127.069 98.301  85.551  1.00 0.00 ? 162 C A "H5''" 1  
ATOM 5582   H "H4'"  . C A 1 173 ? 128.142 100.358 86.279  1.00 0.00 ? 162 C A "H4'"  1  
ATOM 5583   H "H3'"  . C A 1 173 ? 128.361 98.095  87.970  1.00 0.00 ? 162 C A "H3'"  1  
ATOM 5584   H "H2'"  . C A 1 173 ? 129.687 99.295  89.394  1.00 0.00 ? 162 C A "H2'"  1  
ATOM 5585   H "HO2'" . C A 1 173 ? 130.898 100.918 88.781  1.00 0.00 ? 162 C A "HO2'" 1  
ATOM 5586   H "H1'"  . C A 1 173 ? 128.170 101.403 89.330  1.00 0.00 ? 162 C A "H1'"  1  
ATOM 5587   H H41    . C A 1 173 ? 126.194 98.163  94.410  1.00 0.00 ? 162 C A H41    1  
ATOM 5588   H H42    . C A 1 173 ? 125.009 97.416  93.451  1.00 0.00 ? 162 C A H42    1  
ATOM 5589   H H5     . C A 1 173 ? 124.936 97.773  91.063  1.00 0.00 ? 162 C A H5     1  
ATOM 5590   H H6     . C A 1 173 ? 125.883 98.823  89.225  1.00 0.00 ? 162 C A H6     1  
ATOM 5591   P P      . A A 1 174 ? 130.790 97.259  87.083  1.00 0.00 ? 163 A A P      1  
ATOM 5592   O OP1    . A A 1 174 ? 131.653 96.951  85.916  1.00 0.00 ? 163 A A OP1    1  
ATOM 5593   O OP2    . A A 1 174 ? 129.981 96.180  87.704  1.00 0.00 ? 163 A A OP2    1  
ATOM 5594   O "O5'"  . A A 1 174 ? 131.704 97.904  88.217  1.00 0.00 ? 163 A A "O5'"  1  
ATOM 5595   C "C5'"  . A A 1 174 ? 132.610 98.954  87.914  1.00 0.00 ? 163 A A "C5'"  1  
ATOM 5596   C "C4'"  . A A 1 174 ? 133.090 99.650  89.163  1.00 0.00 ? 163 A A "C4'"  1  
ATOM 5597   O "O4'"  . A A 1 174 ? 131.998 100.149 89.985  1.00 0.00 ? 163 A A "O4'"  1  
ATOM 5598   C "C3'"  . A A 1 174 ? 133.900 98.801  90.131  1.00 0.00 ? 163 A A "C3'"  1  
ATOM 5599   O "O3'"  . A A 1 174 ? 135.245 98.623  89.722  1.00 0.00 ? 163 A A "O3'"  1  
ATOM 5600   C "C2'"  . A A 1 174 ? 133.844 99.672  91.372  1.00 0.00 ? 163 A A "C2'"  1  
ATOM 5601   O "O2'"  . A A 1 174 ? 134.717 100.787 91.257  1.00 0.00 ? 163 A A "O2'"  1  
ATOM 5602   C "C1'"  . A A 1 174 ? 132.401 100.152 91.311  1.00 0.00 ? 163 A A "C1'"  1  
ATOM 5603   N N9     . A A 1 174 ? 131.498 99.304  92.113  1.00 0.00 ? 163 A A N9     1  
ATOM 5604   C C8     . A A 1 174 ? 130.803 98.192  91.707  1.00 0.00 ? 163 A A C8     1  
ATOM 5605   N N7     . A A 1 174 ? 130.079 97.647  92.653  1.00 0.00 ? 163 A A N7     1  
ATOM 5606   C C5     . A A 1 174 ? 130.312 98.455  93.758  1.00 0.00 ? 163 A A C5     1  
ATOM 5607   C C6     . A A 1 174 ? 129.836 98.413  95.080  1.00 0.00 ? 163 A A C6     1  
ATOM 5608   N N6     . A A 1 174 ? 128.991 97.484  95.533  1.00 0.00 ? 163 A A N6     1  
ATOM 5609   N N1     . A A 1 174 ? 130.264 99.368  95.934  1.00 0.00 ? 163 A A N1     1  
ATOM 5610   C C2     . A A 1 174 ? 131.112 100.300 95.480  1.00 0.00 ? 163 A A C2     1  
ATOM 5611   N N3     . A A 1 174 ? 131.629 100.445 94.262  1.00 0.00 ? 163 A A N3     1  
ATOM 5612   C C4     . A A 1 174 ? 131.185 99.479  93.439  1.00 0.00 ? 163 A A C4     1  
ATOM 5613   H "H5'"  . A A 1 174 ? 132.162 99.607  87.337  1.00 0.00 ? 163 A A "H5'"  1  
ATOM 5614   H "H5''" . A A 1 174 ? 133.382 98.584  87.438  1.00 0.00 ? 163 A A "H5''" 1  
ATOM 5615   H "H4'"  . A A 1 174 ? 133.641 100.404 88.866  1.00 0.00 ? 163 A A "H4'"  1  
ATOM 5616   H "H3'"  . A A 1 174 ? 133.497 97.923  90.302  1.00 0.00 ? 163 A A "H3'"  1  
ATOM 5617   H "H2'"  . A A 1 174 ? 134.022 99.153  92.184  1.00 0.00 ? 163 A A "H2'"  1  
ATOM 5618   H "HO2'" . A A 1 174 ? 134.654 101.325 92.073  1.00 0.00 ? 163 A A "HO2'" 1  
ATOM 5619   H "H1'"  . A A 1 174 ? 132.351 101.077 91.632  1.00 0.00 ? 163 A A "H1'"  1  
ATOM 5620   H H8     . A A 1 174 ? 130.845 97.837  90.794  1.00 0.00 ? 163 A A H8     1  
ATOM 5621   H H61    . A A 1 174 ? 128.693 97.506  96.467  1.00 0.00 ? 163 A A H61    1  
ATOM 5622   H H62    . A A 1 174 ? 128.666 96.781  94.932  1.00 0.00 ? 163 A A H62    1  
ATOM 5623   H H2     . A A 1 174 ? 131.392 100.970 96.139  1.00 0.00 ? 163 A A H2     1  
ATOM 5624   P P      . A A 1 175 ? 135.631 97.430  88.716  1.00 0.00 ? 164 A A P      1  
ATOM 5625   O OP1    . A A 1 175 ? 136.354 98.019  87.560  1.00 0.00 ? 164 A A OP1    1  
ATOM 5626   O OP2    . A A 1 175 ? 134.414 96.613  88.482  1.00 0.00 ? 164 A A OP2    1  
ATOM 5627   O "O5'"  . A A 1 175 ? 136.665 96.547  89.546  1.00 0.00 ? 164 A A "O5'"  1  
ATOM 5628   C "C5'"  . A A 1 175 ? 137.913 97.082  89.960  1.00 0.00 ? 164 A A "C5'"  1  
ATOM 5629   C "C4'"  . A A 1 175 ? 138.106 96.949  91.450  1.00 0.00 ? 164 A A "C4'"  1  
ATOM 5630   O "O4'"  . A A 1 175 ? 137.072 97.663  92.168  1.00 0.00 ? 164 A A "O4'"  1  
ATOM 5631   C "C3'"  . A A 1 175 ? 137.930 95.552  92.024  1.00 0.00 ? 164 A A "C3'"  1  
ATOM 5632   O "O3'"  . A A 1 175 ? 139.058 94.720  91.815  1.00 0.00 ? 164 A A "O3'"  1  
ATOM 5633   C "C2'"  . A A 1 175 ? 137.805 95.889  93.501  1.00 0.00 ? 164 A A "C2'"  1  
ATOM 5634   O "O2'"  . A A 1 175 ? 139.057 96.280  94.047  1.00 0.00 ? 164 A A "O2'"  1  
ATOM 5635   C "C1'"  . A A 1 175 ? 136.880 97.101  93.433  1.00 0.00 ? 164 A A "C1'"  1  
ATOM 5636   N N9     . A A 1 175 ? 135.458 96.722  93.539  1.00 0.00 ? 164 A A N9     1  
ATOM 5637   C C8     . A A 1 175 ? 134.590 96.407  92.523  1.00 0.00 ? 164 A A C8     1  
ATOM 5638   N N7     . A A 1 175 ? 133.382 96.110  92.934  1.00 0.00 ? 164 A A N7     1  
ATOM 5639   C C5     . A A 1 175 ? 133.458 96.238  94.314  1.00 0.00 ? 164 A A C5     1  
ATOM 5640   C C6     . A A 1 175 ? 132.508 96.059  95.335  1.00 0.00 ? 164 A A C6     1  
ATOM 5641   N N6     . A A 1 175 ? 131.243 95.697  95.115  1.00 0.00 ? 164 A A N6     1  
ATOM 5642   N N1     . A A 1 175 ? 132.908 96.267  96.608  1.00 0.00 ? 164 A A N1     1  
ATOM 5643   C C2     . A A 1 175 ? 134.178 96.630  96.831  1.00 0.00 ? 164 A A C2     1  
ATOM 5644   N N3     . A A 1 175 ? 135.161 96.829  95.956  1.00 0.00 ? 164 A A N3     1  
ATOM 5645   C C4     . A A 1 175 ? 134.731 96.614  94.700  1.00 0.00 ? 164 A A C4     1  
ATOM 5646   H "H5'"  . A A 1 175 ? 137.951 98.031  89.717  1.00 0.00 ? 164 A A "H5'"  1  
ATOM 5647   H "H5''" . A A 1 175 ? 138.635 96.606  89.501  1.00 0.00 ? 164 A A "H5''" 1  
ATOM 5648   H "H4'"  . A A 1 175 ? 138.991 97.286  91.701  1.00 0.00 ? 164 A A "H4'"  1  
ATOM 5649   H "H3'"  . A A 1 175 ? 137.127 95.092  91.698  1.00 0.00 ? 164 A A "H3'"  1  
ATOM 5650   H "H2'"  . A A 1 175 ? 137.404 95.150  94.005  1.00 0.00 ? 164 A A "H2'"  1  
ATOM 5651   H "HO2'" . A A 1 175 ? 138.938 96.489  94.997  1.00 0.00 ? 164 A A "HO2'" 1  
ATOM 5652   H "H1'"  . A A 1 175 ? 137.107 97.725  94.154  1.00 0.00 ? 164 A A "H1'"  1  
ATOM 5653   H H8     . A A 1 175 ? 134.850 96.404  91.578  1.00 0.00 ? 164 A A H8     1  
ATOM 5654   H H61    . A A 1 175 ? 130.625 95.588  95.868  1.00 0.00 ? 164 A A H61    1  
ATOM 5655   H H62    . A A 1 175 ? 130.930 95.541  94.199  1.00 0.00 ? 164 A A H62    1  
ATOM 5656   H H2     . A A 1 175 ? 134.418 96.768  97.771  1.00 0.00 ? 164 A A H2     1  
ATOM 5657   P P      . G A 1 176 ? 139.149 93.796  90.504  1.00 0.00 ? 165 G A P      1  
ATOM 5658   O OP1    . G A 1 176 ? 140.502 93.963  89.915  1.00 0.00 ? 165 G A OP1    1  
ATOM 5659   O OP2    . G A 1 176 ? 137.948 94.061  89.671  1.00 0.00 ? 165 G A OP2    1  
ATOM 5660   O "O5'"  . G A 1 176 ? 139.038 92.312  91.069  1.00 0.00 ? 165 G A "O5'"  1  
ATOM 5661   C "C5'"  . G A 1 176 ? 140.064 91.763  91.884  1.00 0.00 ? 165 G A "C5'"  1  
ATOM 5662   C "C4'"  . G A 1 176 ? 139.711 91.844  93.349  1.00 0.00 ? 165 G A "C4'"  1  
ATOM 5663   O "O4'"  . G A 1 176 ? 138.861 92.993  93.588  1.00 0.00 ? 165 G A "O4'"  1  
ATOM 5664   C "C3'"  . G A 1 176 ? 138.919 90.672  93.907  1.00 0.00 ? 165 G A "C3'"  1  
ATOM 5665   O "O3'"  . G A 1 176 ? 139.725 89.544  94.199  1.00 0.00 ? 165 G A "O3'"  1  
ATOM 5666   C "C2'"  . G A 1 176 ? 138.251 91.279  95.134  1.00 0.00 ? 165 G A "C2'"  1  
ATOM 5667   O "O2'"  . G A 1 176 ? 139.159 91.376  96.220  1.00 0.00 ? 165 G A "O2'"  1  
ATOM 5668   C "C1'"  . G A 1 176 ? 137.920 92.685  94.636  1.00 0.00 ? 165 G A "C1'"  1  
ATOM 5669   N N9     . G A 1 176 ? 136.537 92.789  94.137  1.00 0.00 ? 165 G A N9     1  
ATOM 5670   C C8     . G A 1 176 ? 136.129 92.911  92.831  1.00 0.00 ? 165 G A C8     1  
ATOM 5671   N N7     . G A 1 176 ? 134.832 92.982  92.700  1.00 0.00 ? 165 G A N7     1  
ATOM 5672   C C5     . G A 1 176 ? 134.353 92.900  94.001  1.00 0.00 ? 165 G A C5     1  
ATOM 5673   C C6     . G A 1 176 ? 133.022 92.918  94.491  1.00 0.00 ? 165 G A C6     1  
ATOM 5674   O O6     . G A 1 176 ? 131.966 93.018  93.855  1.00 0.00 ? 165 G A O6     1  
ATOM 5675   N N1     . G A 1 176 ? 132.986 92.809  95.879  1.00 0.00 ? 165 G A N1     1  
ATOM 5676   C C2     . G A 1 176 ? 134.088 92.694  96.690  1.00 0.00 ? 165 G A C2     1  
ATOM 5677   N N2     . G A 1 176 ? 133.852 92.599  98.006  1.00 0.00 ? 165 G A N2     1  
ATOM 5678   N N3     . G A 1 176 ? 135.334 92.674  96.244  1.00 0.00 ? 165 G A N3     1  
ATOM 5679   C C4     . G A 1 176 ? 135.391 92.779  94.900  1.00 0.00 ? 165 G A C4     1  
ATOM 5680   H "H5'"  . G A 1 176 ? 140.896 92.259  91.727  1.00 0.00 ? 165 G A "H5'"  1  
ATOM 5681   H "H5''" . G A 1 176 ? 140.199 90.825  91.638  1.00 0.00 ? 165 G A "H5''" 1  
ATOM 5682   H "H4'"  . G A 1 176 ? 140.537 91.946  93.868  1.00 0.00 ? 165 G A "H4'"  1  
ATOM 5683   H "H3'"  . G A 1 176 ? 138.228 90.413  93.262  1.00 0.00 ? 165 G A "H3'"  1  
ATOM 5684   H "H2'"  . G A 1 176 ? 137.440 90.787  95.383  1.00 0.00 ? 165 G A "H2'"  1  
ATOM 5685   H "HO2'" . G A 1 176 ? 139.906 90.759  96.069  1.00 0.00 ? 165 G A "HO2'" 1  
ATOM 5686   H "H1'"  . G A 1 176 ? 138.054 93.329  95.364  1.00 0.00 ? 165 G A "H1'"  1  
ATOM 5687   H H8     . G A 1 176 ? 136.749 92.946  92.073  1.00 0.00 ? 165 G A H8     1  
ATOM 5688   H H1     . G A 1 176 ? 132.105 92.814  96.308  1.00 0.00 ? 165 G A H1     1  
ATOM 5689   H H21    . G A 1 176 ? 132.933 92.612  98.344  1.00 0.00 ? 165 G A H21    1  
ATOM 5690   H H22    . G A 1 176 ? 134.601 92.513  98.633  1.00 0.00 ? 165 G A H22    1  
ATOM 5691   P P      . U A 1 177 ? 139.108 88.064  94.114  1.00 0.00 ? 166 U A P      1  
ATOM 5692   O OP1    . U A 1 177 ? 140.162 87.099  94.520  1.00 0.00 ? 166 U A OP1    1  
ATOM 5693   O OP2    . U A 1 177 ? 138.448 87.918  92.791  1.00 0.00 ? 166 U A OP2    1  
ATOM 5694   O "O5'"  . U A 1 177 ? 137.974 88.054  95.233  1.00 0.00 ? 166 U A "O5'"  1  
ATOM 5695   C "C5'"  . U A 1 177 ? 138.311 88.021  96.611  1.00 0.00 ? 166 U A "C5'"  1  
ATOM 5696   C "C4'"  . U A 1 177 ? 137.081 88.037  97.486  1.00 0.00 ? 166 U A "C4'"  1  
ATOM 5697   O "O4'"  . U A 1 177 ? 136.333 89.263  97.264  1.00 0.00 ? 166 U A "O4'"  1  
ATOM 5698   C "C3'"  . U A 1 177 ? 136.065 86.933  97.235  1.00 0.00 ? 166 U A "C3'"  1  
ATOM 5699   O "O3'"  . U A 1 177 ? 136.428 85.701  97.832  1.00 0.00 ? 166 U A "O3'"  1  
ATOM 5700   C "C2'"  . U A 1 177 ? 134.781 87.530  97.796  1.00 0.00 ? 166 U A "C2'"  1  
ATOM 5701   O "O2'"  . U A 1 177 ? 134.752 87.453  99.213  1.00 0.00 ? 166 U A "O2'"  1  
ATOM 5702   C "C1'"  . U A 1 177 ? 134.921 88.996  97.380  1.00 0.00 ? 166 U A "C1'"  1  
ATOM 5703   N N1     . U A 1 177 ? 134.217 89.291  96.108  1.00 0.00 ? 166 U A N1     1  
ATOM 5704   C C2     . U A 1 177 ? 132.843 89.433  96.165  1.00 0.00 ? 166 U A C2     1  
ATOM 5705   O O2     . U A 1 177 ? 132.205 89.329  97.199  1.00 0.00 ? 166 U A O2     1  
ATOM 5706   N N3     . U A 1 177 ? 132.236 89.705  94.964  1.00 0.00 ? 166 U A N3     1  
ATOM 5707   C C4     . U A 1 177 ? 132.847 89.845  93.736  1.00 0.00 ? 166 U A C4     1  
ATOM 5708   O O4     . U A 1 177 ? 132.161 90.091  92.743  1.00 0.00 ? 166 U A O4     1  
ATOM 5709   C C5     . U A 1 177 ? 134.269 89.686  93.752  1.00 0.00 ? 166 U A C5     1  
ATOM 5710   C C6     . U A 1 177 ? 134.886 89.422  94.909  1.00 0.00 ? 166 U A C6     1  
ATOM 5711   H "H5'"  . U A 1 177 ? 138.864 88.801  96.824  1.00 0.00 ? 166 U A "H5'"  1  
ATOM 5712   H "H5''" . U A 1 177 ? 138.822 87.206  96.797  1.00 0.00 ? 166 U A "H5''" 1  
ATOM 5713   H "H4'"  . U A 1 177 ? 137.361 88.004  98.425  1.00 0.00 ? 166 U A "H4'"  1  
ATOM 5714   H "H3'"  . U A 1 177 ? 135.963 86.805  96.269  1.00 0.00 ? 166 U A "H3'"  1  
ATOM 5715   H "H2'"  . U A 1 177 ? 133.987 87.118  97.393  1.00 0.00 ? 166 U A "H2'"  1  
ATOM 5716   H "HO2'" . U A 1 177 ? 135.386 86.768  99.508  1.00 0.00 ? 166 U A "HO2'" 1  
ATOM 5717   H "H1'"  . U A 1 177 ? 134.560 89.570  98.089  1.00 0.00 ? 166 U A "H1'"  1  
ATOM 5718   H H3     . U A 1 177 ? 131.261 89.809  94.980  1.00 0.00 ? 166 U A H3     1  
ATOM 5719   H H5     . U A 1 177 ? 134.785 89.769  92.925  1.00 0.00 ? 166 U A H5     1  
ATOM 5720   H H6     . U A 1 177 ? 135.860 89.314  94.896  1.00 0.00 ? 166 U A H6     1  
ATOM 5721   P P      . C A 1 178 ? 136.519 84.388  96.939  1.00 0.00 ? 167 C A P      1  
ATOM 5722   O OP1    . C A 1 178 ? 137.279 83.397  97.744  1.00 0.00 ? 167 C A OP1    1  
ATOM 5723   O OP2    . C A 1 178 ? 137.048 84.824  95.622  1.00 0.00 ? 167 C A OP2    1  
ATOM 5724   O "O5'"  . C A 1 178 ? 135.059 83.820  96.717  1.00 0.00 ? 167 C A "O5'"  1  
ATOM 5725   C "C5'"  . C A 1 178 ? 134.866 82.680  95.902  1.00 0.00 ? 167 C A "C5'"  1  
ATOM 5726   C "C4'"  . C A 1 178 ? 133.411 82.300  95.856  1.00 0.00 ? 167 C A "C4'"  1  
ATOM 5727   O "O4'"  . C A 1 178 ? 132.608 83.497  95.742  1.00 0.00 ? 167 C A "O4'"  1  
ATOM 5728   C "C3'"  . C A 1 178 ? 132.996 81.454  94.676  1.00 0.00 ? 167 C A "C3'"  1  
ATOM 5729   O "O3'"  . C A 1 178 ? 133.178 80.092  94.990  1.00 0.00 ? 167 C A "O3'"  1  
ATOM 5730   C "C2'"  . C A 1 178 ? 131.520 81.750  94.619  1.00 0.00 ? 167 C A "C2'"  1  
ATOM 5731   O "O2'"  . C A 1 178 ? 130.845 81.100  95.664  1.00 0.00 ? 167 C A "O2'"  1  
ATOM 5732   C "C1'"  . C A 1 178 ? 131.516 83.241  94.900  1.00 0.00 ? 167 C A "C1'"  1  
ATOM 5733   N N1     . C A 1 178 ? 131.690 84.039  93.700  1.00 0.00 ? 167 C A N1     1  
ATOM 5734   C C2     . C A 1 178 ? 130.585 84.420  93.011  1.00 0.00 ? 167 C A C2     1  
ATOM 5735   O O2     . C A 1 178 ? 129.493 84.064  93.423  1.00 0.00 ? 167 C A O2     1  
ATOM 5736   N N3     . C A 1 178 ? 130.714 85.170  91.899  1.00 0.00 ? 167 C A N3     1  
ATOM 5737   C C4     . C A 1 178 ? 131.919 85.530  91.487  1.00 0.00 ? 167 C A C4     1  
ATOM 5738   N N4     . C A 1 178 ? 132.013 86.276  90.397  1.00 0.00 ? 167 C A N4     1  
ATOM 5739   C C5     . C A 1 178 ? 133.085 85.138  92.184  1.00 0.00 ? 167 C A C5     1  
ATOM 5740   C C6     . C A 1 178 ? 132.926 84.399  93.278  1.00 0.00 ? 167 C A C6     1  
ATOM 5741   H "H5'"  . C A 1 178 ? 135.386 81.934  96.265  1.00 0.00 ? 167 C A "H5'"  1  
ATOM 5742   H "H5''" . C A 1 178 ? 135.181 82.878  94.996  1.00 0.00 ? 167 C A "H5''" 1  
ATOM 5743   H "H4'"  . C A 1 178 ? 133.178 81.836  96.686  1.00 0.00 ? 167 C A "H4'"  1  
ATOM 5744   H "H3'"  . C A 1 178 ? 133.526 81.708  93.893  1.00 0.00 ? 167 C A "H3'"  1  
ATOM 5745   H "H2'"  . C A 1 178 ? 131.141 81.526  93.743  1.00 0.00 ? 167 C A "H2'"  1  
ATOM 5746   H "HO2'" . C A 1 178 ? 131.401 80.364  95.994  1.00 0.00 ? 167 C A "HO2'" 1  
ATOM 5747   H "H1'"  . C A 1 178 ? 130.668 83.487  95.329  1.00 0.00 ? 167 C A "H1'"  1  
ATOM 5748   H H41    . C A 1 178 ? 131.202 86.548  89.917  1.00 0.00 ? 167 C A H41    1  
ATOM 5749   H H42    . C A 1 178 ? 132.892 86.556  90.071  1.00 0.00 ? 167 C A H42    1  
ATOM 5750   H H5     . C A 1 178 ? 133.976 85.406  91.875  1.00 0.00 ? 167 C A H5     1  
ATOM 5751   H H6     . C A 1 178 ? 133.720 84.116  93.777  1.00 0.00 ? 167 C A H6     1  
ATOM 5752   P P      . C A 1 179 ? 133.028 79.013  93.831  1.00 0.00 ? 168 C A P      1  
ATOM 5753   O OP1    . C A 1 179 ? 133.247 77.616  94.278  1.00 0.00 ? 168 C A OP1    1  
ATOM 5754   O OP2    . C A 1 179 ? 133.802 79.565  92.712  1.00 0.00 ? 168 C A OP2    1  
ATOM 5755   O "O5'"  . C A 1 179 ? 131.505 79.169  93.466  1.00 0.00 ? 168 C A "O5'"  1  
ATOM 5756   C "C5'"  . C A 1 179 ? 130.536 78.316  94.027  1.00 0.00 ? 168 C A "C5'"  1  
ATOM 5757   C "C4'"  . C A 1 179 ? 129.280 78.400  93.216  1.00 0.00 ? 168 C A "C4'"  1  
ATOM 5758   O "O4'"  . C A 1 179 ? 128.979 79.792  92.985  1.00 0.00 ? 168 C A "O4'"  1  
ATOM 5759   C "C3'"  . C A 1 179 ? 129.383 77.863  91.804  1.00 0.00 ? 168 C A "C3'"  1  
ATOM 5760   O "O3'"  . C A 1 179 ? 129.254 76.468  91.741  1.00 0.00 ? 168 C A "O3'"  1  
ATOM 5761   C "C2'"  . C A 1 179 ? 128.196 78.529  91.142  1.00 0.00 ? 168 C A "C2'"  1  
ATOM 5762   O "O2'"  . C A 1 179 ? 126.983 77.900  91.502  1.00 0.00 ? 168 C A "O2'"  1  
ATOM 5763   C "C1'"  . C A 1 179 ? 128.266 79.919  91.762  1.00 0.00 ? 168 C A "C1'"  1  
ATOM 5764   N N1     . C A 1 179 ? 128.969 80.860  90.899  1.00 0.00 ? 168 C A N1     1  
ATOM 5765   C C2     . C A 1 179 ? 128.267 81.479  89.888  1.00 0.00 ? 168 C A C2     1  
ATOM 5766   O O2     . C A 1 179 ? 127.073 81.217  89.744  1.00 0.00 ? 168 C A O2     1  
ATOM 5767   N N3     . C A 1 179 ? 128.901 82.354  89.089  1.00 0.00 ? 168 C A N3     1  
ATOM 5768   C C4     . C A 1 179 ? 130.193 82.608  89.275  1.00 0.00 ? 168 C A C4     1  
ATOM 5769   N N4     . C A 1 179 ? 130.787 83.477  88.455  1.00 0.00 ? 168 C A N4     1  
ATOM 5770   C C5     . C A 1 179 ? 130.932 81.987  90.307  1.00 0.00 ? 168 C A C5     1  
ATOM 5771   C C6     . C A 1 179 ? 130.285 81.126  91.088  1.00 0.00 ? 168 C A C6     1  
ATOM 5772   H "H5'"  . C A 1 179 ? 130.363 78.593  94.951  1.00 0.00 ? 168 C A "H5'"  1  
ATOM 5773   H "H5''" . C A 1 179 ? 130.879 77.398  94.026  1.00 0.00 ? 168 C A "H5''" 1  
ATOM 5774   H "H4'"  . C A 1 179 ? 128.550 77.985  93.722  1.00 0.00 ? 168 C A "H4'"  1  
ATOM 5775   H "H3'"  . C A 1 179 ? 130.248 78.126  91.422  1.00 0.00 ? 168 C A "H3'"  1  
ATOM 5776   H "H2'"  . C A 1 179 ? 128.304 78.571  90.171  1.00 0.00 ? 168 C A "H2'"  1  
ATOM 5777   H "HO2'" . C A 1 179 ? 126.241 78.355  91.056  1.00 0.00 ? 168 C A "HO2'" 1  
ATOM 5778   H "H1'"  . C A 1 179 ? 127.356 80.240  91.930  1.00 0.00 ? 168 C A "H1'"  1  
ATOM 5779   H H41    . C A 1 179 ? 130.270 83.906  87.742  1.00 0.00 ? 168 C A H41    1  
ATOM 5780   H H42    . C A 1 179 ? 131.736 83.684  88.569  1.00 0.00 ? 168 C A H42    1  
ATOM 5781   H H5     . C A 1 179 ? 131.882 82.187  90.443  1.00 0.00 ? 168 C A H5     1  
ATOM 5782   H H6     . C A 1 179 ? 130.774 80.682  91.811  1.00 0.00 ? 168 C A H6     1  
ATOM 5783   P P      . U A 1 180 ? 129.946 75.696  90.524  1.00 0.00 ? 169 U A P      1  
ATOM 5784   O OP1    . U A 1 180 ? 129.805 74.234  90.678  1.00 0.00 ? 169 U A OP1    1  
ATOM 5785   O OP2    . U A 1 180 ? 131.283 76.296  90.354  1.00 0.00 ? 169 U A OP2    1  
ATOM 5786   O "O5'"  . U A 1 180 ? 129.087 76.133  89.269  1.00 0.00 ? 169 U A "O5'"  1  
ATOM 5787   C "C5'"  . U A 1 180 ? 127.845 75.531  89.034  1.00 0.00 ? 169 U A "C5'"  1  
ATOM 5788   C "C4'"  . U A 1 180 ? 127.215 76.151  87.839  1.00 0.00 ? 169 U A "C4'"  1  
ATOM 5789   O "O4'"  . U A 1 180 ? 127.330 77.577  87.989  1.00 0.00 ? 169 U A "O4'"  1  
ATOM 5790   C "C3'"  . U A 1 180 ? 127.914 75.904  86.527  1.00 0.00 ? 169 U A "C3'"  1  
ATOM 5791   O "O3'"  . U A 1 180 ? 127.498 74.655  86.028  1.00 0.00 ? 169 U A "O3'"  1  
ATOM 5792   C "C2'"  . U A 1 180 ? 127.350 77.036  85.698  1.00 0.00 ? 169 U A "C2'"  1  
ATOM 5793   O "O2'"  . U A 1 180 ? 126.031 76.746  85.308  1.00 0.00 ? 169 U A "O2'"  1  
ATOM 5794   C "C1'"  . U A 1 180 ? 127.348 78.175  86.721  1.00 0.00 ? 169 U A "C1'"  1  
ATOM 5795   N N1     . U A 1 180 ? 128.540 79.015  86.647  1.00 0.00 ? 169 U A N1     1  
ATOM 5796   C C2     . U A 1 180 ? 128.626 79.888  85.616  1.00 0.00 ? 169 U A C2     1  
ATOM 5797   O O2     . U A 1 180 ? 127.758 80.003  84.783  1.00 0.00 ? 169 U A O2     1  
ATOM 5798   N N3     . U A 1 180 ? 129.763 80.633  85.580  1.00 0.00 ? 169 U A N3     1  
ATOM 5799   C C4     . U A 1 180 ? 130.801 80.590  86.462  1.00 0.00 ? 169 U A C4     1  
ATOM 5800   O O4     . U A 1 180 ? 131.786 81.313  86.280  1.00 0.00 ? 169 U A O4     1  
ATOM 5801   C C5     . U A 1 180 ? 130.631 79.660  87.512  1.00 0.00 ? 169 U A C5     1  
ATOM 5802   C C6     . U A 1 180 ? 129.524 78.921  87.568  1.00 0.00 ? 169 U A C6     1  
ATOM 5803   H "H5'"  . U A 1 180 ? 127.275 75.657  89.821  1.00 0.00 ? 169 U A "H5'"  1  
ATOM 5804   H "H5''" . U A 1 180 ? 127.977 74.571  88.885  1.00 0.00 ? 169 U A "H5''" 1  
ATOM 5805   H "H4'"  . U A 1 180 ? 126.271 75.890  87.810  1.00 0.00 ? 169 U A "H4'"  1  
ATOM 5806   H "H3'"  . U A 1 180 ? 128.883 75.930  86.669  1.00 0.00 ? 169 U A "H3'"  1  
ATOM 5807   H "H2'"  . U A 1 180 ? 127.927 77.240  84.932  1.00 0.00 ? 169 U A "H2'"  1  
ATOM 5808   H "HO2'" . U A 1 180 ? 125.684 77.491  84.773  1.00 0.00 ? 169 U A "HO2'" 1  
ATOM 5809   H "H1'"  . U A 1 180 ? 126.554 78.735  86.577  1.00 0.00 ? 169 U A "H1'"  1  
ATOM 5810   H H3     . U A 1 180 ? 129.846 81.269  84.840  1.00 0.00 ? 169 U A H3     1  
ATOM 5811   H H5     . U A 1 180 ? 131.322 79.561  88.203  1.00 0.00 ? 169 U A H5     1  
ATOM 5812   H H6     . U A 1 180 ? 129.435 78.283  88.307  1.00 0.00 ? 169 U A H6     1  
ATOM 5813   P P      . A A 1 181 ? 128.585 73.644  85.414  1.00 0.00 ? 170 A A P      1  
ATOM 5814   O OP1    . A A 1 181 ? 127.934 72.305  85.351  1.00 0.00 ? 170 A A OP1    1  
ATOM 5815   O OP2    . A A 1 181 ? 129.898 73.785  86.078  1.00 0.00 ? 170 A A OP2    1  
ATOM 5816   O "O5'"  . A A 1 181 ? 128.815 74.245  83.972  1.00 0.00 ? 170 A A "O5'"  1  
ATOM 5817   C "C5'"  . A A 1 181 ? 127.740 74.823  83.290  1.00 0.00 ? 170 A A "C5'"  1  
ATOM 5818   C "C4'"  . A A 1 181 ? 128.256 75.669  82.176  1.00 0.00 ? 170 A A "C4'"  1  
ATOM 5819   O "O4'"  . A A 1 181 ? 128.964 76.774  82.762  1.00 0.00 ? 170 A A "O4'"  1  
ATOM 5820   C "C3'"  . A A 1 181 ? 129.266 74.976  81.268  1.00 0.00 ? 170 A A "C3'"  1  
ATOM 5821   O "O3'"  . A A 1 181 ? 128.781 75.022  79.916  1.00 0.00 ? 170 A A "O3'"  1  
ATOM 5822   C "C2'"  . A A 1 181 ? 130.510 75.867  81.372  1.00 0.00 ? 170 A A "C2'"  1  
ATOM 5823   O "O2'"  . A A 1 181 ? 131.172 76.038  80.137  1.00 0.00 ? 170 A A "O2'"  1  
ATOM 5824   C "C1'"  . A A 1 181 ? 129.911 77.189  81.839  1.00 0.00 ? 170 A A "C1'"  1  
ATOM 5825   N N9     . A A 1 181 ? 130.852 78.042  82.537  1.00 0.00 ? 170 A A N9     1  
ATOM 5826   C C8     . A A 1 181 ? 131.353 77.838  83.777  1.00 0.00 ? 170 A A C8     1  
ATOM 5827   N N7     . A A 1 181 ? 132.194 78.759  84.160  1.00 0.00 ? 170 A A N7     1  
ATOM 5828   C C5     . A A 1 181 ? 132.245 79.633  83.083  1.00 0.00 ? 170 A A C5     1  
ATOM 5829   C C6     . A A 1 181 ? 132.956 80.815  82.860  1.00 0.00 ? 170 A A C6     1  
ATOM 5830   N N6     . A A 1 181 ? 133.800 81.368  83.739  1.00 0.00 ? 170 A A N6     1  
ATOM 5831   N N1     . A A 1 181 ? 132.778 81.431  81.680  1.00 0.00 ? 170 A A N1     1  
ATOM 5832   C C2     . A A 1 181 ? 131.946 80.898  80.803  1.00 0.00 ? 170 A A C2     1  
ATOM 5833   N N3     . A A 1 181 ? 131.218 79.799  80.896  1.00 0.00 ? 170 A A N3     1  
ATOM 5834   C C4     . A A 1 181 ? 131.417 79.203  82.080  1.00 0.00 ? 170 A A C4     1  
ATOM 5835   H "H5'"  . A A 1 181 ? 127.221 75.370  83.915  1.00 0.00 ? 170 A A "H5'"  1  
ATOM 5836   H "H5''" . A A 1 181 ? 127.166 74.113  82.937  1.00 0.00 ? 170 A A "H5''" 1  
ATOM 5837   H "H4'"  . A A 1 181 ? 127.497 75.999  81.650  1.00 0.00 ? 170 A A "H4'"  1  
ATOM 5838   H "H3'"  . A A 1 181 ? 129.386 74.050  81.569  1.00 0.00 ? 170 A A "H3'"  1  
ATOM 5839   H "H2'"  . A A 1 181 ? 131.131 75.539  82.056  1.00 0.00 ? 170 A A "H2'"  1  
ATOM 5840   H "HO2'" . A A 1 181 ? 130.919 76.905  79.756  1.00 0.00 ? 170 A A "HO2'" 1  
ATOM 5841   H "H1'"  . A A 1 181 ? 129.559 77.678  81.065  1.00 0.00 ? 170 A A "H1'"  1  
ATOM 5842   H H8     . A A 1 181 ? 131.109 77.070  84.339  1.00 0.00 ? 170 A A H8     1  
ATOM 5843   H H61    . A A 1 181 ? 134.264 82.201  83.515  1.00 0.00 ? 170 A A H61    1  
ATOM 5844   H H62    . A A 1 181 ? 133.950 80.943  84.609  1.00 0.00 ? 170 A A H62    1  
ATOM 5845   H H2     . A A 1 181 ? 131.854 81.390  79.959  1.00 0.00 ? 170 A A H2     1  
ATOM 5846   P P      . A A 1 182 ? 128.471 73.669  79.104  1.00 0.00 ? 171 A A P      1  
ATOM 5847   O OP1    . A A 1 182 ? 127.555 72.804  79.892  1.00 0.00 ? 171 A A OP1    1  
ATOM 5848   O OP2    . A A 1 182 ? 129.783 73.152  78.643  1.00 0.00 ? 171 A A OP2    1  
ATOM 5849   O "O5'"  . A A 1 182 ? 127.686 74.171  77.814  1.00 0.00 ? 171 A A "O5'"  1  
ATOM 5850   C "C5'"  . A A 1 182 ? 126.320 73.823  77.567  1.00 0.00 ? 171 A A "C5'"  1  
ATOM 5851   C "C4'"  . A A 1 182 ? 125.640 74.934  76.799  1.00 0.00 ? 171 A A "C4'"  1  
ATOM 5852   O "O4'"  . A A 1 182 ? 125.558 76.085  77.675  1.00 0.00 ? 171 A A "O4'"  1  
ATOM 5853   C "C3'"  . A A 1 182 ? 126.440 75.446  75.618  1.00 0.00 ? 171 A A "C3'"  1  
ATOM 5854   O "O3'"  . A A 1 182 ? 126.142 74.709  74.451  1.00 0.00 ? 171 A A "O3'"  1  
ATOM 5855   C "C2'"  . A A 1 182 ? 125.956 76.880  75.473  1.00 0.00 ? 171 A A "C2'"  1  
ATOM 5856   O "O2'"  . A A 1 182 ? 124.774 76.971  74.730  1.00 0.00 ? 171 A A "O2'"  1  
ATOM 5857   C "C1'"  . A A 1 182 ? 125.695 77.271  76.927  1.00 0.00 ? 171 A A "C1'"  1  
ATOM 5858   N N9     . A A 1 182 ? 126.784 78.021  77.509  1.00 0.00 ? 171 A A N9     1  
ATOM 5859   C C8     . A A 1 182 ? 127.599 77.623  78.508  1.00 0.00 ? 171 A A C8     1  
ATOM 5860   N N7     . A A 1 182 ? 128.518 78.499  78.815  1.00 0.00 ? 171 A A N7     1  
ATOM 5861   C C5     . A A 1 182 ? 128.277 79.551  77.952  1.00 0.00 ? 171 A A C5     1  
ATOM 5862   C C6     . A A 1 182 ? 128.902 80.790  77.763  1.00 0.00 ? 171 A A C6     1  
ATOM 5863   N N6     . A A 1 182 ? 129.946 81.201  78.450  1.00 0.00 ? 171 A A N6     1  
ATOM 5864   N N1     . A A 1 182 ? 128.412 81.611  76.823  1.00 0.00 ? 171 A A N1     1  
ATOM 5865   C C2     . A A 1 182 ? 127.354 81.208  76.112  1.00 0.00 ? 171 A A C2     1  
ATOM 5866   N N3     . A A 1 182 ? 126.680 80.054  76.190  1.00 0.00 ? 171 A A N3     1  
ATOM 5867   C C4     . A A 1 182 ? 127.203 79.268  77.145  1.00 0.00 ? 171 A A C4     1  
ATOM 5868   H "H5'"  . A A 1 182 ? 125.865 73.682  78.424  1.00 0.00 ? 171 A A "H5'"  1  
ATOM 5869   H "H5''" . A A 1 182 ? 126.289 72.992  77.052  1.00 0.00 ? 171 A A "H5''" 1  
ATOM 5870   H "H4'"  . A A 1 182 ? 124.742 74.641  76.546  1.00 0.00 ? 171 A A "H4'"  1  
ATOM 5871   H "H3'"  . A A 1 182 ? 127.397 75.381  75.826  1.00 0.00 ? 171 A A "H3'"  1  
ATOM 5872   H "H2'"  . A A 1 182 ? 126.653 77.457  75.098  1.00 0.00 ? 171 A A "H2'"  1  
ATOM 5873   H "HO2'" . A A 1 182 ? 124.670 76.157  74.194  1.00 0.00 ? 171 A A "HO2'" 1  
ATOM 5874   H "H1'"  . A A 1 182 ? 124.874 77.803  76.979  1.00 0.00 ? 171 A A "H1'"  1  
ATOM 5875   H H8     . A A 1 182 ? 127.513 76.756  78.959  1.00 0.00 ? 171 A A H8     1  
ATOM 5876   H H61    . A A 1 182 ? 130.334 82.082  78.267  1.00 0.00 ? 171 A A H61    1  
ATOM 5877   H H62    . A A 1 182 ? 130.332 80.629  79.145  1.00 0.00 ? 171 A A H62    1  
ATOM 5878   H H2     . A A 1 182 ? 127.027 81.842  75.441  1.00 0.00 ? 171 A A H2     1  
ATOM 5879   P P      . G A 1 183 ? 127.300 74.419  73.378  1.00 0.00 ? 172 G A P      1  
ATOM 5880   O OP1    . G A 1 183 ? 126.600 73.959  72.165  1.00 0.00 ? 172 G A OP1    1  
ATOM 5881   O OP2    . G A 1 183 ? 128.347 73.561  73.987  1.00 0.00 ? 172 G A OP2    1  
ATOM 5882   O "O5'"  . G A 1 183 ? 127.938 75.848  73.114  1.00 0.00 ? 172 G A "O5'"  1  
ATOM 5883   C "C5'"  . G A 1 183 ? 127.337 76.725  72.210  1.00 0.00 ? 172 G A "C5'"  1  
ATOM 5884   C "C4'"  . G A 1 183 ? 128.132 78.000  72.104  1.00 0.00 ? 172 G A "C4'"  1  
ATOM 5885   O "O4'"  . G A 1 183 ? 128.044 78.711  73.349  1.00 0.00 ? 172 G A "O4'"  1  
ATOM 5886   C "C3'"  . G A 1 183 ? 129.614 77.854  71.857  1.00 0.00 ? 172 G A "C3'"  1  
ATOM 5887   O "O3'"  . G A 1 183 ? 129.890 77.798  70.475  1.00 0.00 ? 172 G A "O3'"  1  
ATOM 5888   C "C2'"  . G A 1 183 ? 130.155 79.161  72.399  1.00 0.00 ? 172 G A "C2'"  1  
ATOM 5889   O "O2'"  . G A 1 183 ? 130.016 80.233  71.505  1.00 0.00 ? 172 G A "O2'"  1  
ATOM 5890   C "C1'"  . G A 1 183 ? 129.277 79.343  73.627  1.00 0.00 ? 172 G A "C1'"  1  
ATOM 5891   N N9     . G A 1 183 ? 129.873 78.681  74.786  1.00 0.00 ? 172 G A N9     1  
ATOM 5892   C C8     . G A 1 183 ? 129.515 77.476  75.345  1.00 0.00 ? 172 G A C8     1  
ATOM 5893   N N7     . G A 1 183 ? 130.274 77.136  76.357  1.00 0.00 ? 172 G A N7     1  
ATOM 5894   C C5     . G A 1 183 ? 131.172 78.178  76.469  1.00 0.00 ? 172 G A C5     1  
ATOM 5895   C C6     . G A 1 183 ? 132.204 78.348  77.354  1.00 0.00 ? 172 G A C6     1  
ATOM 5896   O O6     . G A 1 183 ? 132.576 77.593  78.251  1.00 0.00 ? 172 G A O6     1  
ATOM 5897   N N1     . G A 1 183 ? 132.861 79.547  77.131  1.00 0.00 ? 172 G A N1     1  
ATOM 5898   C C2     . G A 1 183 ? 132.541 80.454  76.156  1.00 0.00 ? 172 G A C2     1  
ATOM 5899   N N2     . G A 1 183 ? 133.291 81.550  76.082  1.00 0.00 ? 172 G A N2     1  
ATOM 5900   N N3     . G A 1 183 ? 131.568 80.295  75.312  1.00 0.00 ? 172 G A N3     1  
ATOM 5901   C C4     . G A 1 183 ? 130.926 79.143  75.521  1.00 0.00 ? 172 G A C4     1  
ATOM 5902   H "H5'"  . G A 1 183 ? 126.431 76.930  72.516  1.00 0.00 ? 172 G A "H5'"  1  
ATOM 5903   H "H5''" . G A 1 183 ? 127.289 76.295  71.331  1.00 0.00 ? 172 G A "H5''" 1  
ATOM 5904   H "H4'"  . G A 1 183 ? 127.754 78.553  71.388  1.00 0.00 ? 172 G A "H4'"  1  
ATOM 5905   H "H3'"  . G A 1 183 ? 129.935 77.042  72.298  1.00 0.00 ? 172 G A "H3'"  1  
ATOM 5906   H "H2'"  . G A 1 183 ? 131.087 79.070  72.688  1.00 0.00 ? 172 G A "H2'"  1  
ATOM 5907   H "HO2'" . G A 1 183 ? 129.896 79.881  70.599  1.00 0.00 ? 172 G A "HO2'" 1  
ATOM 5908   H "H1'"  . G A 1 183 ? 129.158 80.300  73.804  1.00 0.00 ? 172 G A "H1'"  1  
ATOM 5909   H H8     . G A 1 183 ? 128.774 76.925  75.019  1.00 0.00 ? 172 G A H8     1  
ATOM 5910   H H1     . G A 1 183 ? 133.616 79.761  77.720  1.00 0.00 ? 172 G A H1     1  
ATOM 5911   H H21    . G A 1 183 ? 134.030 81.685  76.714  1.00 0.00 ? 172 G A H21    1  
ATOM 5912   H H22    . G A 1 183 ? 133.107 82.226  75.398  1.00 0.00 ? 172 G A H22    1  
ATOM 5913   P P      . U A 1 184 ? 131.219 77.081  69.966  1.00 0.00 ? 173 U A P      1  
ATOM 5914   O OP1    . U A 1 184 ? 131.212 77.243  68.497  1.00 0.00 ? 173 U A OP1    1  
ATOM 5915   O OP2    . U A 1 184 ? 131.245 75.731  70.583  1.00 0.00 ? 173 U A OP2    1  
ATOM 5916   O "O5'"  . U A 1 184 ? 132.408 77.937  70.554  1.00 0.00 ? 173 U A "O5'"  1  
ATOM 5917   C "C5'"  . U A 1 184 ? 132.696 79.196  70.014  1.00 0.00 ? 173 U A "C5'"  1  
ATOM 5918   C "C4'"  . U A 1 184 ? 133.895 79.772  70.702  1.00 0.00 ? 173 U A "C4'"  1  
ATOM 5919   O "O4'"  . U A 1 184 ? 133.576 79.959  72.100  1.00 0.00 ? 173 U A "O4'"  1  
ATOM 5920   C "C3'"  . U A 1 184 ? 135.107 78.871  70.747  1.00 0.00 ? 173 U A "C3'"  1  
ATOM 5921   O "O3'"  . U A 1 184 ? 135.867 78.983  69.556  1.00 0.00 ? 173 U A "O3'"  1  
ATOM 5922   C "C2'"  . U A 1 184 ? 135.861 79.464  71.918  1.00 0.00 ? 173 U A "C2'"  1  
ATOM 5923   O "O2'"  . U A 1 184 ? 136.499 80.683  71.591  1.00 0.00 ? 173 U A "O2'"  1  
ATOM 5924   C "C1'"  . U A 1 184 ? 134.717 79.734  72.882  1.00 0.00 ? 173 U A "C1'"  1  
ATOM 5925   N N1     . U A 1 184 ? 134.432 78.612  73.772  1.00 0.00 ? 173 U A N1     1  
ATOM 5926   C C2     . U A 1 184 ? 135.163 78.522  74.932  1.00 0.00 ? 173 U A C2     1  
ATOM 5927   O O2     . U A 1 184 ? 136.028 79.332  75.230  1.00 0.00 ? 173 U A O2     1  
ATOM 5928   N N3     . U A 1 184 ? 134.851 77.463  75.740  1.00 0.00 ? 173 U A N3     1  
ATOM 5929   C C4     . U A 1 184 ? 133.897 76.515  75.519  1.00 0.00 ? 173 U A C4     1  
ATOM 5930   O O4     . U A 1 184 ? 133.678 75.676  76.386  1.00 0.00 ? 173 U A O4     1  
ATOM 5931   C C5     . U A 1 184 ? 133.192 76.666  74.295  1.00 0.00 ? 173 U A C5     1  
ATOM 5932   C C6     . U A 1 184 ? 133.485 77.691  73.480  1.00 0.00 ? 173 U A C6     1  
ATOM 5933   H "H5'"  . U A 1 184 ? 131.921 79.782  70.141  1.00 0.00 ? 173 U A "H5'"  1  
ATOM 5934   H "H5''" . U A 1 184 ? 132.872 79.100  69.056  1.00 0.00 ? 173 U A "H5''" 1  
ATOM 5935   H "H4'"  . U A 1 184 ? 134.107 80.638  70.297  1.00 0.00 ? 173 U A "H4'"  1  
ATOM 5936   H "H3'"  . U A 1 184 ? 134.814 77.944  70.876  1.00 0.00 ? 173 U A "H3'"  1  
ATOM 5937   H "H2'"  . U A 1 184 ? 136.501 78.824  72.295  1.00 0.00 ? 173 U A "H2'"  1  
ATOM 5938   H "HO2'" . U A 1 184 ? 137.382 80.706  72.016  1.00 0.00 ? 173 U A "HO2'" 1  
ATOM 5939   H "H1'"  . U A 1 184 ? 134.933 80.521  73.426  1.00 0.00 ? 173 U A "H1'"  1  
ATOM 5940   H H3     . U A 1 184 ? 135.368 77.377  76.568  1.00 0.00 ? 173 U A H3     1  
ATOM 5941   H H5     . U A 1 184 ? 132.497 76.022  74.046  1.00 0.00 ? 173 U A H5     1  
ATOM 5942   H H6     . U A 1 184 ? 132.983 77.766  72.643  1.00 0.00 ? 173 U A H6     1  
ATOM 5943   P P      . C A 1 185 ? 137.072 77.961  69.288  1.00 0.00 ? 174 C A P      1  
ATOM 5944   O OP1    . C A 1 185 ? 137.515 78.092  67.877  1.00 0.00 ? 174 C A OP1    1  
ATOM 5945   O OP2    . C A 1 185 ? 136.515 76.670  69.765  1.00 0.00 ? 174 C A OP2    1  
ATOM 5946   O "O5'"  . C A 1 185 ? 138.299 78.346  70.227  1.00 0.00 ? 174 C A "O5'"  1  
ATOM 5947   C "C5'"  . C A 1 185 ? 139.242 79.329  69.829  1.00 0.00 ? 174 C A "C5'"  1  
ATOM 5948   C "C4'"  . C A 1 185 ? 140.311 79.532  70.874  1.00 0.00 ? 174 C A "C4'"  1  
ATOM 5949   O "O4'"  . C A 1 185 ? 139.699 79.828  72.157  1.00 0.00 ? 174 C A "O4'"  1  
ATOM 5950   C "C3'"  . C A 1 185 ? 141.206 78.335  71.161  1.00 0.00 ? 174 C A "C3'"  1  
ATOM 5951   O "O3'"  . C A 1 185 ? 142.246 78.182  70.211  1.00 0.00 ? 174 C A "O3'"  1  
ATOM 5952   C "C2'"  . C A 1 185 ? 141.702 78.621  72.571  1.00 0.00 ? 174 C A "C2'"  1  
ATOM 5953   O "O2'"  . C A 1 185 ? 142.742 79.589  72.566  1.00 0.00 ? 174 C A "O2'"  1  
ATOM 5954   C "C1'"  . C A 1 185 ? 140.457 79.233  73.215  1.00 0.00 ? 174 C A "C1'"  1  
ATOM 5955   N N1     . C A 1 185 ? 139.641 78.224  73.935  1.00 0.00 ? 174 C A N1     1  
ATOM 5956   C C2     . C A 1 185 ? 140.079 77.790  75.192  1.00 0.00 ? 174 C A C2     1  
ATOM 5957   O O2     . C A 1 185 ? 141.127 78.257  75.663  1.00 0.00 ? 174 C A O2     1  
ATOM 5958   N N3     . C A 1 185 ? 139.353 76.871  75.869  1.00 0.00 ? 174 C A N3     1  
ATOM 5959   C C4     . C A 1 185 ? 138.232 76.384  75.342  1.00 0.00 ? 174 C A C4     1  
ATOM 5960   N N4     . C A 1 185 ? 137.548 75.478  76.047  1.00 0.00 ? 174 C A N4     1  
ATOM 5961   C C5     . C A 1 185 ? 137.759 76.804  74.066  1.00 0.00 ? 174 C A C5     1  
ATOM 5962   C C6     . C A 1 185 ? 138.484 77.714  73.406  1.00 0.00 ? 174 C A C6     1  
ATOM 5963   H "H5'"  . C A 1 185 ? 138.776 80.179  69.680  1.00 0.00 ? 174 C A "H5'"  1  
ATOM 5964   H "H5''" . C A 1 185 ? 139.664 79.045  68.992  1.00 0.00 ? 174 C A "H5''" 1  
ATOM 5965   H "H4'"  . C A 1 185 ? 140.871 80.292  70.610  1.00 0.00 ? 174 C A "H4'"  1  
ATOM 5966   H "H3'"  . C A 1 185 ? 140.659 77.521  71.172  1.00 0.00 ? 174 C A "H3'"  1  
ATOM 5967   H "H2'"  . C A 1 185 ? 141.975 77.798  73.030  1.00 0.00 ? 174 C A "H2'"  1  
ATOM 5968   H "HO2'" . C A 1 185 ? 143.134 79.631  71.670  1.00 0.00 ? 174 C A "HO2'" 1  
ATOM 5969   H "H1'"  . C A 1 185 ? 140.726 79.938  73.839  1.00 0.00 ? 174 C A "H1'"  1  
ATOM 5970   H H41    . C A 1 185 ? 137.876 75.191  76.925  1.00 0.00 ? 174 C A H41    1  
ATOM 5971   H H42    . C A 1 185 ? 136.718 75.102  75.687  1.00 0.00 ? 174 C A H42    1  
ATOM 5972   H H5     . C A 1 185 ? 136.931 76.441  73.687  1.00 0.00 ? 174 C A H5     1  
ATOM 5973   H H6     . C A 1 185 ? 138.176 78.017  72.527  1.00 0.00 ? 174 C A H6     1  
ATOM 5974   P P      . A A 1 186 ? 142.875 76.731  69.928  1.00 0.00 ? 175 A A P      1  
ATOM 5975   O OP1    . A A 1 186 ? 143.834 76.855  68.801  1.00 0.00 ? 175 A A OP1    1  
ATOM 5976   O OP2    . A A 1 186 ? 141.758 75.756  69.837  1.00 0.00 ? 175 A A OP2    1  
ATOM 5977   O "O5'"  . A A 1 186 ? 143.705 76.405  71.248  1.00 0.00 ? 175 A A "O5'"  1  
ATOM 5978   C "C5'"  . A A 1 186 ? 144.899 77.111  71.551  1.00 0.00 ? 175 A A "C5'"  1  
ATOM 5979   C "C4'"  . A A 1 186 ? 145.488 76.667  72.866  1.00 0.00 ? 175 A A "C4'"  1  
ATOM 5980   O "O4'"  . A A 1 186 ? 144.547 76.932  73.940  1.00 0.00 ? 175 A A "O4'"  1  
ATOM 5981   C "C3'"  . A A 1 186 ? 145.789 75.182  72.995  1.00 0.00 ? 175 A A "C3'"  1  
ATOM 5982   O "O3'"  . A A 1 186 ? 147.005 74.806  72.369  1.00 0.00 ? 175 A A "O3'"  1  
ATOM 5983   C "C2'"  . A A 1 186 ? 145.788 74.971  74.502  1.00 0.00 ? 175 A A "C2'"  1  
ATOM 5984   O "O2'"  . A A 1 186 ? 147.000 75.427  75.087  1.00 0.00 ? 175 A A "O2'"  1  
ATOM 5985   C "C1'"  . A A 1 186 ? 144.650 75.895  74.937  1.00 0.00 ? 175 A A "C1'"  1  
ATOM 5986   N N9     . A A 1 186 ? 143.373 75.172  75.082  1.00 0.00 ? 175 A A N9     1  
ATOM 5987   C C8     . A A 1 186 ? 142.291 75.188  74.235  1.00 0.00 ? 175 A A C8     1  
ATOM 5988   N N7     . A A 1 186 ? 141.294 74.438  74.635  1.00 0.00 ? 175 A A N7     1  
ATOM 5989   C C5     . A A 1 186 ? 141.747 73.891  75.828  1.00 0.00 ? 175 A A C5     1  
ATOM 5990   C C6     . A A 1 186 ? 141.157 73.006  76.748  1.00 0.00 ? 175 A A C6     1  
ATOM 5991   N N6     . A A 1 186 ? 139.933 72.496  76.603  1.00 0.00 ? 175 A A N6     1  
ATOM 5992   N N1     . A A 1 186 ? 141.878 72.657  77.836  1.00 0.00 ? 175 A A N1     1  
ATOM 5993   C C2     . A A 1 186 ? 143.108 73.168  77.981  1.00 0.00 ? 175 A A C2     1  
ATOM 5994   N N3     . A A 1 186 ? 143.769 74.008  77.186  1.00 0.00 ? 175 A A N3     1  
ATOM 5995   C C4     . A A 1 186 ? 143.025 74.333  76.115  1.00 0.00 ? 175 A A C4     1  
ATOM 5996   H "H5'"  . A A 1 186 ? 144.701 78.069  71.598  1.00 0.00 ? 175 A A "H5'"  1  
ATOM 5997   H "H5''" . A A 1 186 ? 145.552 76.955  70.838  1.00 0.00 ? 175 A A "H5''" 1  
ATOM 5998   H "H4'"  . A A 1 186 ? 146.311 77.173  73.032  1.00 0.00 ? 175 A A "H4'"  1  
ATOM 5999   H "H3'"  . A A 1 186 ? 145.053 74.669  72.599  1.00 0.00 ? 175 A A "H3'"  1  
ATOM 6000   H "H2'"  . A A 1 186 ? 145.602 74.038  74.735  1.00 0.00 ? 175 A A "H2'"  1  
ATOM 6001   H "HO2'" . A A 1 186 ? 147.688 75.480  74.393  1.00 0.00 ? 175 A A "HO2'" 1  
ATOM 6002   H "H1'"  . A A 1 186 ? 144.882 76.319  75.789  1.00 0.00 ? 175 A A "H1'"  1  
ATOM 6003   H H8     . A A 1 186 ? 142.269 75.712  73.406  1.00 0.00 ? 175 A A H8     1  
ATOM 6004   H H61    . A A 1 186 ? 139.574 71.883  77.279  1.00 0.00 ? 175 A A H61    1  
ATOM 6005   H H62    . A A 1 186 ? 139.392 72.734  75.822  1.00 0.00 ? 175 A A H62    1  
ATOM 6006   H H2     . A A 1 186 ? 143.589 72.884  78.787  1.00 0.00 ? 175 A A H2     1  
ATOM 6007   P P      . A A 1 187 ? 147.195 73.315  71.802  1.00 0.00 ? 176 A A P      1  
ATOM 6008   O OP1    . A A 1 187 ? 148.492 73.258  71.081  1.00 0.00 ? 176 A A OP1    1  
ATOM 6009   O OP2    . A A 1 187 ? 145.946 72.927  71.099  1.00 0.00 ? 176 A A OP2    1  
ATOM 6010   O "O5'"  . A A 1 187 ? 147.319 72.417  73.113  1.00 0.00 ? 176 A A "O5'"  1  
ATOM 6011   C "C5'"  . A A 1 187 ? 148.433 72.551  73.984  1.00 0.00 ? 176 A A "C5'"  1  
ATOM 6012   C "C4'"  . A A 1 187 ? 148.262 71.719  75.231  1.00 0.00 ? 176 A A "C4'"  1  
ATOM 6013   O "O4'"  . A A 1 187 ? 147.089 72.164  75.962  1.00 0.00 ? 176 A A "O4'"  1  
ATOM 6014   C "C3'"  . A A 1 187 ? 148.024 70.233  75.014  1.00 0.00 ? 176 A A "C3'"  1  
ATOM 6015   O "O3'"  . A A 1 187 ? 149.214 69.514  74.737  1.00 0.00 ? 176 A A "O3'"  1  
ATOM 6016   C "C2'"  . A A 1 187 ? 147.345 69.814  76.311  1.00 0.00 ? 176 A A "C2'"  1  
ATOM 6017   O "O2'"  . A A 1 187 ? 148.288 69.667  77.362  1.00 0.00 ? 176 A A "O2'"  1  
ATOM 6018   C "C1'"  . A A 1 187 ? 146.463 71.030  76.600  1.00 0.00 ? 176 A A "C1'"  1  
ATOM 6019   N N9     . A A 1 187 ? 145.080 70.840  76.124  1.00 0.00 ? 176 A A N9     1  
ATOM 6020   C C8     . A A 1 187 ? 144.491 71.383  75.009  1.00 0.00 ? 176 A A C8     1  
ATOM 6021   N N7     . A A 1 187 ? 143.239 71.027  74.848  1.00 0.00 ? 176 A A N7     1  
ATOM 6022   C C5     . A A 1 187 ? 142.988 70.193  75.929  1.00 0.00 ? 176 A A C5     1  
ATOM 6023   C C6     . A A 1 187 ? 141.840 69.488  76.335  1.00 0.00 ? 176 A A C6     1  
ATOM 6024   N N6     . A A 1 187 ? 140.684 69.513  75.669  1.00 0.00 ? 176 A A N6     1  
ATOM 6025   N N1     . A A 1 187 ? 141.923 68.748  77.461  1.00 0.00 ? 176 A A N1     1  
ATOM 6026   C C2     . A A 1 187 ? 143.084 68.724  78.129  1.00 0.00 ? 176 A A C2     1  
ATOM 6027   N N3     . A A 1 187 ? 144.230 69.342  77.848  1.00 0.00 ? 176 A A N3     1  
ATOM 6028   C C4     . A A 1 187 ? 144.113 70.070  76.723  1.00 0.00 ? 176 A A C4     1  
ATOM 6029   H "H5'"  . A A 1 187 ? 148.528 73.492  74.239  1.00 0.00 ? 176 A A "H5'"  1  
ATOM 6030   H "H5''" . A A 1 187 ? 149.243 72.263  73.515  1.00 0.00 ? 176 A A "H5''" 1  
ATOM 6031   H "H4'"  . A A 1 187 ? 149.054 71.834  75.798  1.00 0.00 ? 176 A A "H4'"  1  
ATOM 6032   H "H3'"  . A A 1 187 ? 147.397 70.113  74.270  1.00 0.00 ? 176 A A "H3'"  1  
ATOM 6033   H "H2'"  . A A 1 187 ? 146.808 69.002  76.189  1.00 0.00 ? 176 A A "H2'"  1  
ATOM 6034   H "HO2'" . A A 1 187 ? 147.824 69.355  78.167  1.00 0.00 ? 176 A A "HO2'" 1  
ATOM 6035   H "H1'"  . A A 1 187 ? 146.455 71.203  77.565  1.00 0.00 ? 176 A A "H1'"  1  
ATOM 6036   H H8     . A A 1 187 ? 144.961 71.981  74.392  1.00 0.00 ? 176 A A H8     1  
ATOM 6037   H H61    . A A 1 187 ? 139.916 69.000  76.002  1.00 0.00 ? 176 A A H61    1  
ATOM 6038   H H62    . A A 1 187 ? 140.600 70.043  74.850  1.00 0.00 ? 176 A A H62    1  
ATOM 6039   H H2     . A A 1 187 ? 143.092 68.171  78.937  1.00 0.00 ? 176 A A H2     1  
ATOM 6040   P P      . C A 1 188 ? 149.161 68.169  73.860  1.00 0.00 ? 177 C A P      1  
ATOM 6041   O OP1    . C A 1 188 ? 150.555 67.719  73.624  1.00 0.00 ? 177 C A OP1    1  
ATOM 6042   O OP2    . C A 1 188 ? 148.263 68.410  72.703  1.00 0.00 ? 177 C A OP2    1  
ATOM 6043   O "O5'"  . C A 1 188 ? 148.458 67.111  74.820  1.00 0.00 ? 177 C A "O5'"  1  
ATOM 6044   C "C5'"  . C A 1 188 ? 149.114 66.633  75.984  1.00 0.00 ? 177 C A "C5'"  1  
ATOM 6045   C "C4'"  . C A 1 188 ? 148.227 65.713  76.787  1.00 0.00 ? 177 C A "C4'"  1  
ATOM 6046   O "O4'"  . C A 1 188 ? 147.043 66.429  77.227  1.00 0.00 ? 177 C A "O4'"  1  
ATOM 6047   C "C3'"  . C A 1 188 ? 147.675 64.503  76.051  1.00 0.00 ? 177 C A "C3'"  1  
ATOM 6048   O "O3'"  . C A 1 188 ? 148.612 63.445  75.941  1.00 0.00 ? 177 C A "O3'"  1  
ATOM 6049   C "C2'"  . C A 1 188 ? 146.444 64.146  76.874  1.00 0.00 ? 177 C A "C2'"  1  
ATOM 6050   O "O2'"  . C A 1 188 ? 146.801 63.457  78.063  1.00 0.00 ? 177 C A "O2'"  1  
ATOM 6051   C "C1'"  . C A 1 188 ? 145.913 65.533  77.244  1.00 0.00 ? 177 C A "C1'"  1  
ATOM 6052   N N1     . C A 1 188 ? 144.851 65.995  76.317  1.00 0.00 ? 177 C A N1     1  
ATOM 6053   C C2     . C A 1 188 ? 143.557 65.484  76.479  1.00 0.00 ? 177 C A C2     1  
ATOM 6054   O O2     . C A 1 188 ? 143.338 64.666  77.385  1.00 0.00 ? 177 C A O2     1  
ATOM 6055   N N3     . C A 1 188 ? 142.570 65.890  75.647  1.00 0.00 ? 177 C A N3     1  
ATOM 6056   C C4     . C A 1 188 ? 142.832 66.770  74.680  1.00 0.00 ? 177 C A C4     1  
ATOM 6057   N N4     . C A 1 188 ? 141.827 67.144  73.884  1.00 0.00 ? 177 C A N4     1  
ATOM 6058   C C5     . C A 1 188 ? 144.135 67.308  74.489  1.00 0.00 ? 177 C A C5     1  
ATOM 6059   C C6     . C A 1 188 ? 145.103 66.900  75.319  1.00 0.00 ? 177 C A C6     1  
ATOM 6060   H "H5'"  . C A 1 188 ? 149.371 67.397  76.542  1.00 0.00 ? 177 C A "H5'"  1  
ATOM 6061   H "H5''" . C A 1 188 ? 149.922 66.145  75.718  1.00 0.00 ? 177 C A "H5''" 1  
ATOM 6062   H "H4'"  . C A 1 188 ? 148.722 65.407  77.576  1.00 0.00 ? 177 C A "H4'"  1  
ATOM 6063   H "H3'"  . C A 1 188 ? 147.391 64.775  75.152  1.00 0.00 ? 177 C A "H3'"  1  
ATOM 6064   H "H2'"  . C A 1 188 ? 145.791 63.643  76.344  1.00 0.00 ? 177 C A "H2'"  1  
ATOM 6065   H "HO2'" . C A 1 188 ? 145.986 63.214  78.547  1.00 0.00 ? 177 C A "HO2'" 1  
ATOM 6066   H "H1'"  . C A 1 188 ? 145.560 65.512  78.157  1.00 0.00 ? 177 C A "H1'"  1  
ATOM 6067   H H41    . C A 1 188 ? 140.931 66.770  74.019  1.00 0.00 ? 177 C A H41    1  
ATOM 6068   H H42    . C A 1 188 ? 141.987 67.789  73.165  1.00 0.00 ? 177 C A H42    1  
ATOM 6069   H H5     . C A 1 188 ? 144.317 67.955  73.776  1.00 0.00 ? 177 C A H5     1  
ATOM 6070   H H6     . C A 1 188 ? 146.007 67.259  75.203  1.00 0.00 ? 177 C A H6     1  
ATOM 6071   P P      . A A 1 189 ? 148.498 62.386  74.738  1.00 0.00 ? 178 A A P      1  
ATOM 6072   O OP1    . A A 1 189 ? 149.687 61.499  74.792  1.00 0.00 ? 178 A A OP1    1  
ATOM 6073   O OP2    . A A 1 189 ? 148.197 63.135  73.492  1.00 0.00 ? 178 A A OP2    1  
ATOM 6074   O "O5'"  . A A 1 189 ? 147.216 61.516  75.110  1.00 0.00 ? 178 A A "O5'"  1  
ATOM 6075   C "C5'"  . A A 1 189 ? 147.212 60.675  76.254  1.00 0.00 ? 178 A A "C5'"  1  
ATOM 6076   C "C4'"  . A A 1 189 ? 145.857 60.057  76.485  1.00 0.00 ? 178 A A "C4'"  1  
ATOM 6077   O "O4'"  . A A 1 189 ? 144.880 61.100  76.740  1.00 0.00 ? 178 A A "O4'"  1  
ATOM 6078   C "C3'"  . A A 1 189 ? 145.271 59.278  75.318  1.00 0.00 ? 178 A A "C3'"  1  
ATOM 6079   O "O3'"  . A A 1 189 ? 145.810 57.971  75.198  1.00 0.00 ? 178 A A "O3'"  1  
ATOM 6080   C "C2'"  . A A 1 189 ? 143.779 59.296  75.620  1.00 0.00 ? 178 A A "C2'"  1  
ATOM 6081   O "O2'"  . A A 1 189 ? 143.445 58.350  76.625  1.00 0.00 ? 178 A A "O2'"  1  
ATOM 6082   C "C1'"  . A A 1 189 ? 143.601 60.706  76.188  1.00 0.00 ? 178 A A "C1'"  1  
ATOM 6083   N N9     . A A 1 189 ? 143.141 61.663  75.164  1.00 0.00 ? 178 A A N9     1  
ATOM 6084   C C8     . A A 1 189 ? 143.878 62.618  74.510  1.00 0.00 ? 178 A A C8     1  
ATOM 6085   N N7     . A A 1 189 ? 143.186 63.322  73.648  1.00 0.00 ? 178 A A N7     1  
ATOM 6086   C C5     . A A 1 189 ? 141.905 62.796  73.741  1.00 0.00 ? 178 A A C5     1  
ATOM 6087   C C6     . A A 1 189 ? 140.703 63.110  73.084  1.00 0.00 ? 178 A A C6     1  
ATOM 6088   N N6     . A A 1 189 ? 140.589 64.071  72.164  1.00 0.00 ? 178 A A N6     1  
ATOM 6089   N N1     . A A 1 189 ? 139.605 62.394  73.408  1.00 0.00 ? 178 A A N1     1  
ATOM 6090   C C2     . A A 1 189 ? 139.716 61.429  74.330  1.00 0.00 ? 178 A A C2     1  
ATOM 6091   N N3     . A A 1 189 ? 140.790 61.042  75.016  1.00 0.00 ? 178 A A N3     1  
ATOM 6092   C C4     . A A 1 189 ? 141.864 61.774  74.670  1.00 0.00 ? 178 A A C4     1  
ATOM 6093   H "H5'"  . A A 1 189 ? 147.462 61.203  77.041  1.00 0.00 ? 178 A A "H5'"  1  
ATOM 6094   H "H5''" . A A 1 189 ? 147.872 59.961  76.129  1.00 0.00 ? 178 A A "H5''" 1  
ATOM 6095   H "H4'"  . A A 1 189 ? 145.904 59.468  77.267  1.00 0.00 ? 178 A A "H4'"  1  
ATOM 6096   H "H3'"  . A A 1 189 ? 145.435 59.770  74.487  1.00 0.00 ? 178 A A "H3'"  1  
ATOM 6097   H "H2'"  . A A 1 189 ? 143.246 59.167  74.808  1.00 0.00 ? 178 A A "H2'"  1  
ATOM 6098   H "HO2'" . A A 1 189 ? 144.156 57.680  76.682  1.00 0.00 ? 178 A A "HO2'" 1  
ATOM 6099   H "H1'"  . A A 1 189 ? 142.956 60.681  76.925  1.00 0.00 ? 178 A A "H1'"  1  
ATOM 6100   H H8     . A A 1 189 ? 144.835 62.761  74.671  1.00 0.00 ? 178 A A H8     1  
ATOM 6101   H H61    . A A 1 189 ? 139.723 64.244  71.739  1.00 0.00 ? 178 A A H61    1  
ATOM 6102   H H62    . A A 1 189 ? 141.373 64.604  71.913  1.00 0.00 ? 178 A A H62    1  
ATOM 6103   H H2     . A A 1 189 ? 138.891 60.939  74.529  1.00 0.00 ? 178 A A H2     1  
ATOM 6104   P P      . G A 1 190 ? 145.851 57.243  73.766  1.00 0.00 ? 179 G A P      1  
ATOM 6105   O OP1    . G A 1 190 ? 146.584 55.960  73.922  1.00 0.00 ? 179 G A OP1    1  
ATOM 6106   O OP2    . G A 1 190 ? 146.309 58.233  72.759  1.00 0.00 ? 179 G A OP2    1  
ATOM 6107   O "O5'"  . G A 1 190 ? 144.323 56.903  73.462  1.00 0.00 ? 179 G A "O5'"  1  
ATOM 6108   C "C5'"  . G A 1 190 ? 143.619 55.952  74.246  1.00 0.00 ? 179 G A "C5'"  1  
ATOM 6109   C "C4'"  . G A 1 190 ? 142.158 55.902  73.876  1.00 0.00 ? 179 G A "C4'"  1  
ATOM 6110   O "O4'"  . G A 1 190 ? 141.550 57.200  74.103  1.00 0.00 ? 179 G A "O4'"  1  
ATOM 6111   C "C3'"  . G A 1 190 ? 141.847 55.598  72.418  1.00 0.00 ? 179 G A "C3'"  1  
ATOM 6112   O "O3'"  . G A 1 190 ? 141.938 54.217  72.110  1.00 0.00 ? 179 G A "O3'"  1  
ATOM 6113   C "C2'"  . G A 1 190 ? 140.448 56.171  72.251  1.00 0.00 ? 179 G A "C2'"  1  
ATOM 6114   O "O2'"  . G A 1 190 ? 139.466 55.305  72.803  1.00 0.00 ? 179 G A "O2'"  1  
ATOM 6115   C "C1'"  . G A 1 190 ? 140.531 57.436  73.105  1.00 0.00 ? 179 G A "C1'"  1  
ATOM 6116   N N9     . G A 1 190 ? 140.831 58.634  72.299  1.00 0.00 ? 179 G A N9     1  
ATOM 6117   C C8     . G A 1 190 ? 142.028 59.305  72.220  1.00 0.00 ? 179 G A C8     1  
ATOM 6118   N N7     . G A 1 190 ? 141.987 60.334  71.419  1.00 0.00 ? 179 G A N7     1  
ATOM 6119   C C5     . G A 1 190 ? 140.685 60.344  70.939  1.00 0.00 ? 179 G A C5     1  
ATOM 6120   C C6     . G A 1 190 ? 140.048 61.229  70.031  1.00 0.00 ? 179 G A C6     1  
ATOM 6121   O O6     . G A 1 190 ? 140.522 62.212  69.452  1.00 0.00 ? 179 G A O6     1  
ATOM 6122   N N1     . G A 1 190 ? 138.718 60.875  69.819  1.00 0.00 ? 179 G A N1     1  
ATOM 6123   C C2     . G A 1 190 ? 138.083 59.807  70.406  1.00 0.00 ? 179 G A C2     1  
ATOM 6124   N N2     . G A 1 190 ? 136.795 59.625  70.077  1.00 0.00 ? 179 G A N2     1  
ATOM 6125   N N3     . G A 1 190 ? 138.667 58.976  71.253  1.00 0.00 ? 179 G A N3     1  
ATOM 6126   C C4     . G A 1 190 ? 139.959 59.301  71.473  1.00 0.00 ? 179 G A C4     1  
ATOM 6127   H "H5'"  . G A 1 190 ? 143.703 56.190  75.192  1.00 0.00 ? 179 G A "H5'"  1  
ATOM 6128   H "H5''" . G A 1 190 ? 144.016 55.066  74.104  1.00 0.00 ? 179 G A "H5''" 1  
ATOM 6129   H "H4'"  . G A 1 190 ? 141.711 55.239  74.442  1.00 0.00 ? 179 G A "H4'"  1  
ATOM 6130   H "H3'"  . G A 1 190 ? 142.468 56.096  71.848  1.00 0.00 ? 179 G A "H3'"  1  
ATOM 6131   H "H2'"  . G A 1 190 ? 140.256 56.385  71.313  1.00 0.00 ? 179 G A "H2'"  1  
ATOM 6132   H "HO2'" . G A 1 190 ? 138.578 55.691  72.652  1.00 0.00 ? 179 G A "HO2'" 1  
ATOM 6133   H "H1'"  . G A 1 190 ? 139.683 57.565  73.580  1.00 0.00 ? 179 G A "H1'"  1  
ATOM 6134   H H8     . G A 1 190 ? 142.831 59.037  72.715  1.00 0.00 ? 179 G A H8     1  
ATOM 6135   H H1     . G A 1 190 ? 138.196 61.431  69.204  1.00 0.00 ? 179 G A H1     1  
ATOM 6136   H H21    . G A 1 190 ? 136.356 60.237  69.450  1.00 0.00 ? 179 G A H21    1  
ATOM 6137   H H22    . G A 1 190 ? 136.292 58.879  70.465  1.00 0.00 ? 179 G A H22    1  
ATOM 6138   P P      . C A 1 191 ? 142.764 53.730  70.821  1.00 0.00 ? 180 C A P      1  
ATOM 6139   O OP1    . C A 1 191 ? 142.979 52.265  70.940  1.00 0.00 ? 180 C A OP1    1  
ATOM 6140   O OP2    . C A 1 191 ? 143.932 54.631  70.654  1.00 0.00 ? 180 C A OP2    1  
ATOM 6141   O "O5'"  . C A 1 191 ? 141.767 53.983  69.605  1.00 0.00 ? 180 C A "O5'"  1  
ATOM 6142   C "C5'"  . C A 1 191 ? 140.636 53.149  69.402  1.00 0.00 ? 180 C A "C5'"  1  
ATOM 6143   C "C4'"  . C A 1 191 ? 139.610 53.809  68.513  1.00 0.00 ? 180 C A "C4'"  1  
ATOM 6144   O "O4'"  . C A 1 191 ? 139.172 55.072  69.061  1.00 0.00 ? 180 C A "O4'"  1  
ATOM 6145   C "C3'"  . C A 1 191 ? 140.063 54.146  67.102  1.00 0.00 ? 180 C A "C3'"  1  
ATOM 6146   O "O3'"  . C A 1 191 ? 139.995 53.038  66.220  1.00 0.00 ? 180 C A "O3'"  1  
ATOM 6147   C "C2'"  . C A 1 191 ? 139.043 55.207  66.712  1.00 0.00 ? 180 C A "C2'"  1  
ATOM 6148   O "O2'"  . C A 1 191 ? 137.785 54.624  66.406  1.00 0.00 ? 180 C A "O2'"  1  
ATOM 6149   C "C1'"  . C A 1 191 ? 138.933 55.990  68.017  1.00 0.00 ? 180 C A "C1'"  1  
ATOM 6150   N N1     . C A 1 191 ? 139.926 57.089  68.100  1.00 0.00 ? 180 C A N1     1  
ATOM 6151   C C2     . C A 1 191 ? 139.661 58.278  67.410  1.00 0.00 ? 180 C A C2     1  
ATOM 6152   O O2     . C A 1 191 ? 138.612 58.377  66.754  1.00 0.00 ? 180 C A O2     1  
ATOM 6153   N N3     . C A 1 191 ? 140.550 59.296  67.469  1.00 0.00 ? 180 C A N3     1  
ATOM 6154   C C4     . C A 1 191 ? 141.669 59.164  68.180  1.00 0.00 ? 180 C A C4     1  
ATOM 6155   N N4     . C A 1 191 ? 142.518 60.195  68.210  1.00 0.00 ? 180 C A N4     1  
ATOM 6156   C C5     . C A 1 191 ? 141.969 57.969  68.892  1.00 0.00 ? 180 C A C5     1  
ATOM 6157   C C6     . C A 1 191 ? 141.081 56.969  68.827  1.00 0.00 ? 180 C A C6     1  
ATOM 6158   H "H5'"  . C A 1 191 ? 140.227 52.950  70.270  1.00 0.00 ? 180 C A "H5'"  1  
ATOM 6159   H "H5''" . C A 1 191 ? 140.928 52.312  68.985  1.00 0.00 ? 180 C A "H5''" 1  
ATOM 6160   H "H4'"  . C A 1 191 ? 138.829 53.220  68.444  1.00 0.00 ? 180 C A "H4'"  1  
ATOM 6161   H "H3'"  . C A 1 191 ? 140.957 54.544  67.136  1.00 0.00 ? 180 C A "H3'"  1  
ATOM 6162   H "H2'"  . C A 1 191 ? 139.371 55.766  65.978  1.00 0.00 ? 180 C A "H2'"  1  
ATOM 6163   H "HO2'" . C A 1 191 ? 137.928 53.720  66.056  1.00 0.00 ? 180 C A "HO2'" 1  
ATOM 6164   H "H1'"  . C A 1 191 ? 138.029 56.360  68.095  1.00 0.00 ? 180 C A "H1'"  1  
ATOM 6165   H H41    . C A 1 191 ? 142.309 61.017  67.718  1.00 0.00 ? 180 C A H41    1  
ATOM 6166   H H42    . C A 1 191 ? 143.350 60.130  68.724  1.00 0.00 ? 180 C A H42    1  
ATOM 6167   H H5     . C A 1 191 ? 142.795 57.881  69.413  1.00 0.00 ? 180 C A H5     1  
ATOM 6168   H H6     . C A 1 191 ? 141.269 56.138  69.310  1.00 0.00 ? 180 C A H6     1  
ATOM 6169   P P      . C A 1 192 ? 141.201 52.744  65.198  1.00 0.00 ? 181 C A P      1  
ATOM 6170   O OP1    . C A 1 192 ? 140.726 51.749  64.202  1.00 0.00 ? 181 C A OP1    1  
ATOM 6171   O OP2    . C A 1 192 ? 142.421 52.459  65.994  1.00 0.00 ? 181 C A OP2    1  
ATOM 6172   O "O5'"  . C A 1 192 ? 141.415 54.130  64.444  1.00 0.00 ? 181 C A "O5'"  1  
ATOM 6173   C "C5'"  . C A 1 192 ? 140.486 54.584  63.473  1.00 0.00 ? 181 C A "C5'"  1  
ATOM 6174   C "C4'"  . C A 1 192 ? 140.719 56.031  63.111  1.00 0.00 ? 181 C A "C4'"  1  
ATOM 6175   O "O4'"  . C A 1 192 ? 140.699 56.849  64.311  1.00 0.00 ? 181 C A "O4'"  1  
ATOM 6176   C "C3'"  . C A 1 192 ? 142.064 56.355  62.478  1.00 0.00 ? 181 C A "C3'"  1  
ATOM 6177   O "O3'"  . C A 1 192 ? 142.087 56.124  61.080  1.00 0.00 ? 181 C A "O3'"  1  
ATOM 6178   C "C2'"  . C A 1 192 ? 142.271 57.817  62.850  1.00 0.00 ? 181 C A "C2'"  1  
ATOM 6179   O "O2'"  . C A 1 192 ? 141.502 58.674  62.019  1.00 0.00 ? 181 C A "O2'"  1  
ATOM 6180   C "C1'"  . C A 1 192 ? 141.702 57.854  64.265  1.00 0.00 ? 181 C A "C1'"  1  
ATOM 6181   N N1     . C A 1 192 ? 142.722 57.524  65.292  1.00 0.00 ? 181 C A N1     1  
ATOM 6182   C C2     . C A 1 192 ? 143.631 58.520  65.671  1.00 0.00 ? 181 C A C2     1  
ATOM 6183   O O2     . C A 1 192 ? 143.558 59.640  65.142  1.00 0.00 ? 181 C A O2     1  
ATOM 6184   N N3     . C A 1 192 ? 144.570 58.245  66.605  1.00 0.00 ? 181 C A N3     1  
ATOM 6185   C C4     . C A 1 192 ? 144.627 57.033  67.158  1.00 0.00 ? 181 C A C4     1  
ATOM 6186   N N4     . C A 1 192 ? 145.571 56.807  68.075  1.00 0.00 ? 181 C A N4     1  
ATOM 6187   C C5     . C A 1 192 ? 143.719 56.000  66.794  1.00 0.00 ? 181 C A C5     1  
ATOM 6188   C C6     . C A 1 192 ? 142.793 56.284  65.870  1.00 0.00 ? 181 C A C6     1  
ATOM 6189   H "H5'"  . C A 1 192 ? 139.578 54.487  63.829  1.00 0.00 ? 181 C A "H5'"  1  
ATOM 6190   H "H5''" . C A 1 192 ? 140.574 54.035  62.666  1.00 0.00 ? 181 C A "H5''" 1  
ATOM 6191   H "H4'"  . C A 1 192 ? 140.001 56.327  62.514  1.00 0.00 ? 181 C A "H4'"  1  
ATOM 6192   H "H3'"  . C A 1 192 ? 142.761 55.816  62.907  1.00 0.00 ? 181 C A "H3'"  1  
ATOM 6193   H "H2'"  . C A 1 192 ? 143.221 58.058  62.838  1.00 0.00 ? 181 C A "H2'"  1  
ATOM 6194   H "HO2'" . C A 1 192 ? 141.508 59.577  62.398  1.00 0.00 ? 181 C A "HO2'" 1  
ATOM 6195   H "H1'"  . C A 1 192 ? 141.338 58.746  64.443  1.00 0.00 ? 181 C A "H1'"  1  
ATOM 6196   H H41    . C A 1 192 ? 146.195 57.521  68.322  1.00 0.00 ? 181 C A H41    1  
ATOM 6197   H H42    . C A 1 192 ? 145.639 55.927  68.500  1.00 0.00 ? 181 C A H42    1  
ATOM 6198   H H5     . C A 1 192 ? 143.768 55.112  67.207  1.00 0.00 ? 181 C A H5     1  
ATOM 6199   H H6     . C A 1 192 ? 142.159 55.586  65.606  1.00 0.00 ? 181 C A H6     1  
ATOM 6200   P P      . U A 1 193 ? 143.196 55.152  60.440  1.00 0.00 ? 182 U A P      1  
ATOM 6201   O OP1    . U A 1 193 ? 142.530 54.302  59.420  1.00 0.00 ? 182 U A OP1    1  
ATOM 6202   O OP2    . U A 1 193 ? 143.944 54.514  61.552  1.00 0.00 ? 182 U A OP2    1  
ATOM 6203   O "O5'"  . U A 1 193 ? 144.187 56.144  59.685  1.00 0.00 ? 182 U A "O5'"  1  
ATOM 6204   C "C5'"  . U A 1 193 ? 144.375 57.475  60.141  1.00 0.00 ? 182 U A "C5'"  1  
ATOM 6205   C "C4'"  . U A 1 193 ? 144.540 58.440  58.993  1.00 0.00 ? 182 U A "C4'"  1  
ATOM 6206   O "O4'"  . U A 1 193 ? 143.636 58.045  57.920  1.00 0.00 ? 182 U A "O4'"  1  
ATOM 6207   C "C3'"  . U A 1 193 ? 144.188 59.891  59.281  1.00 0.00 ? 182 U A "C3'"  1  
ATOM 6208   O "O3'"  . U A 1 193 ? 145.256 60.615  59.865  1.00 0.00 ? 182 U A "O3'"  1  
ATOM 6209   C "C2'"  . U A 1 193 ? 143.803 60.415  57.905  1.00 0.00 ? 182 U A "C2'"  1  
ATOM 6210   O "O2'"  . U A 1 193 ? 144.954 60.713  57.128  1.00 0.00 ? 182 U A "O2'"  1  
ATOM 6211   C "C1'"  . U A 1 193 ? 143.100 59.196  57.312  1.00 0.00 ? 182 U A "C1'"  1  
ATOM 6212   N N1     . U A 1 193 ? 141.637 59.216  57.556  1.00 0.00 ? 182 U A N1     1  
ATOM 6213   C C2     . U A 1 193 ? 140.876 60.049  56.757  1.00 0.00 ? 182 U A C2     1  
ATOM 6214   O O2     . U A 1 193 ? 141.352 60.750  55.882  1.00 0.00 ? 182 U A O2     1  
ATOM 6215   N N3     . U A 1 193 ? 139.527 60.035  57.019  1.00 0.00 ? 182 U A N3     1  
ATOM 6216   C C4     . U A 1 193 ? 138.874 59.289  57.977  1.00 0.00 ? 182 U A C4     1  
ATOM 6217   O O4     . U A 1 193 ? 137.651 59.387  58.089  1.00 0.00 ? 182 U A O4     1  
ATOM 6218   C C5     . U A 1 193 ? 139.725 58.450  58.764  1.00 0.00 ? 182 U A C5     1  
ATOM 6219   C C6     . U A 1 193 ? 141.041 58.444  58.530  1.00 0.00 ? 182 U A C6     1  
ATOM 6220   H "H5'"  . U A 1 193 ? 145.177 57.509  60.704  1.00 0.00 ? 182 U A "H5'"  1  
ATOM 6221   H "H5''" . U A 1 193 ? 143.598 57.744  60.674  1.00 0.00 ? 182 U A "H5''" 1  
ATOM 6222   H "H4'"  . U A 1 193 ? 145.465 58.396  58.673  1.00 0.00 ? 182 U A "H4'"  1  
ATOM 6223   H "H3'"  . U A 1 193 ? 143.402 59.923  59.866  1.00 0.00 ? 182 U A "H3'"  1  
ATOM 6224   H "H2'"  . U A 1 193 ? 143.200 61.184  57.970  1.00 0.00 ? 182 U A "H2'"  1  
ATOM 6225   H "HO2'" . U A 1 193 ? 144.669 61.078  56.263  1.00 0.00 ? 182 U A "HO2'" 1  
ATOM 6226   H "H1'"  . U A 1 193 ? 143.267 59.165  56.346  1.00 0.00 ? 182 U A "H1'"  1  
ATOM 6227   H H3     . U A 1 193 ? 138.970 60.619  56.464  1.00 0.00 ? 182 U A H3     1  
ATOM 6228   H H5     . U A 1 193 ? 139.344 57.884  59.469  1.00 0.00 ? 182 U A H5     1  
ATOM 6229   H H6     . U A 1 193 ? 141.601 57.862  59.084  1.00 0.00 ? 182 U A H6     1  
ATOM 6230   P P      . U A 1 194 ? 145.039 62.135  60.341  1.00 0.00 ? 183 U A P      1  
ATOM 6231   O OP1    . U A 1 194 ? 143.640 62.520  60.027  1.00 0.00 ? 183 U A OP1    1  
ATOM 6232   O OP2    . U A 1 194 ? 146.162 62.947  59.809  1.00 0.00 ? 183 U A OP2    1  
ATOM 6233   O "O5'"  . U A 1 194 ? 145.188 62.066  61.926  1.00 0.00 ? 183 U A "O5'"  1  
ATOM 6234   C "C5'"  . U A 1 194 ? 144.190 61.452  62.727  1.00 0.00 ? 183 U A "C5'"  1  
ATOM 6235   C "C4'"  . U A 1 194 ? 144.033 62.150  64.055  1.00 0.00 ? 183 U A "C4'"  1  
ATOM 6236   O "O4'"  . U A 1 194 ? 144.984 61.576  64.995  1.00 0.00 ? 183 U A "O4'"  1  
ATOM 6237   C "C3'"  . U A 1 194 ? 144.297 63.648  64.060  1.00 0.00 ? 183 U A "C3'"  1  
ATOM 6238   O "O3'"  . U A 1 194 ? 143.530 64.342  65.028  1.00 0.00 ? 183 U A "O3'"  1  
ATOM 6239   C "C2'"  . U A 1 194 ? 145.770 63.718  64.452  1.00 0.00 ? 183 U A "C2'"  1  
ATOM 6240   O "O2'"  . U A 1 194 ? 146.072 64.945  65.102  1.00 0.00 ? 183 U A "O2'"  1  
ATOM 6241   C "C1'"  . U A 1 194 ? 145.865 62.577  65.467  1.00 0.00 ? 183 U A "C1'"  1  
ATOM 6242   N N1     . U A 1 194 ? 147.228 61.995  65.533  1.00 0.00 ? 183 U A N1     1  
ATOM 6243   C C2     . U A 1 194 ? 147.976 62.267  66.663  1.00 0.00 ? 183 U A C2     1  
ATOM 6244   O O2     . U A 1 194 ? 147.566 62.951  67.584  1.00 0.00 ? 183 U A O2     1  
ATOM 6245   N N3     . U A 1 194 ? 149.230 61.707  66.680  1.00 0.00 ? 183 U A N3     1  
ATOM 6246   C C4     . U A 1 194 ? 149.802 60.919  65.704  1.00 0.00 ? 183 U A C4     1  
ATOM 6247   O O4     . U A 1 194 ? 150.945 60.489  65.868  1.00 0.00 ? 183 U A O4     1  
ATOM 6248   C C5     . U A 1 194 ? 148.970 60.680  64.565  1.00 0.00 ? 183 U A C5     1  
ATOM 6249   C C6     . U A 1 194 ? 147.745 61.212  64.522  1.00 0.00 ? 183 U A C6     1  
ATOM 6250   H "H5'"  . U A 1 194 ? 144.438 60.517  62.885  1.00 0.00 ? 183 U A "H5'"  1  
ATOM 6251   H "H5''" . U A 1 194 ? 143.335 61.479  62.249  1.00 0.00 ? 183 U A "H5''" 1  
ATOM 6252   H "H4'"  . U A 1 194 ? 143.122 62.004  64.383  1.00 0.00 ? 183 U A "H4'"  1  
ATOM 6253   H "H3'"  . U A 1 194 ? 144.189 63.997  63.152  1.00 0.00 ? 183 U A "H3'"  1  
ATOM 6254   H "H2'"  . U A 1 194 ? 146.355 63.564  63.680  1.00 0.00 ? 183 U A "H2'"  1  
ATOM 6255   H "HO2'" . U A 1 194 ? 147.000 65.191  64.904  1.00 0.00 ? 183 U A "HO2'" 1  
ATOM 6256   H "H1'"  . U A 1 194 ? 145.612 62.912  66.353  1.00 0.00 ? 183 U A "H1'"  1  
ATOM 6257   H H3     . U A 1 194 ? 149.777 61.887  67.472  1.00 0.00 ? 183 U A H3     1  
ATOM 6258   H H5     . U A 1 194 ? 149.297 60.129  63.822  1.00 0.00 ? 183 U A H5     1  
ATOM 6259   H H6     . U A 1 194 ? 147.196 61.034  63.732  1.00 0.00 ? 183 U A H6     1  
ATOM 6260   P P      . G A 1 195 ? 143.209 65.897  64.818  1.00 0.00 ? 184 G A P      1  
ATOM 6261   O OP1    . G A 1 195 ? 144.473 66.622  64.535  1.00 0.00 ? 184 G A OP1    1  
ATOM 6262   O OP2    . G A 1 195 ? 142.426 66.233  66.035  1.00 0.00 ? 184 G A OP2    1  
ATOM 6263   O "O5'"  . G A 1 195 ? 142.252 66.064  63.555  1.00 0.00 ? 184 G A "O5'"  1  
ATOM 6264   C "C5'"  . G A 1 195 ? 142.605 66.924  62.481  1.00 0.00 ? 184 G A "C5'"  1  
ATOM 6265   C "C4'"  . G A 1 195 ? 141.827 66.597  61.231  1.00 0.00 ? 184 G A "C4'"  1  
ATOM 6266   O "O4'"  . G A 1 195 ? 142.085 65.241  60.788  1.00 0.00 ? 184 G A "O4'"  1  
ATOM 6267   C "C3'"  . G A 1 195 ? 140.311 66.636  61.358  1.00 0.00 ? 184 G A "C3'"  1  
ATOM 6268   O "O3'"  . G A 1 195 ? 139.791 67.954  61.372  1.00 0.00 ? 184 G A "O3'"  1  
ATOM 6269   C "C2'"  . G A 1 195 ? 139.881 65.836  60.146  1.00 0.00 ? 184 G A "C2'"  1  
ATOM 6270   O "O2'"  . G A 1 195 ? 139.953 66.616  58.962  1.00 0.00 ? 184 G A "O2'"  1  
ATOM 6271   C "C1'"  . G A 1 195 ? 140.971 64.761  60.110  1.00 0.00 ? 184 G A "C1'"  1  
ATOM 6272   N N9     . G A 1 195 ? 140.529 63.500  60.735  1.00 0.00 ? 184 G A N9     1  
ATOM 6273   C C8     . G A 1 195 ? 141.136 62.826  61.767  1.00 0.00 ? 184 G A C8     1  
ATOM 6274   N N7     . G A 1 195 ? 140.508 61.732  62.105  1.00 0.00 ? 184 G A N7     1  
ATOM 6275   C C5     . G A 1 195 ? 139.420 61.681  61.245  1.00 0.00 ? 184 G A C5     1  
ATOM 6276   C C6     . G A 1 195 ? 138.379 60.723  61.136  1.00 0.00 ? 184 G A C6     1  
ATOM 6277   O O6     . G A 1 195 ? 138.205 59.695  61.800  1.00 0.00 ? 184 G A O6     1  
ATOM 6278   N N1     . G A 1 195 ? 137.479 61.057  60.129  1.00 0.00 ? 184 G A N1     1  
ATOM 6279   C C2     . G A 1 195 ? 137.568 62.170  59.329  1.00 0.00 ? 184 G A C2     1  
ATOM 6280   N N2     . G A 1 195 ? 136.603 62.322  58.410  1.00 0.00 ? 184 G A N2     1  
ATOM 6281   N N3     . G A 1 195 ? 138.534 63.070  59.420  1.00 0.00 ? 184 G A N3     1  
ATOM 6282   C C4     . G A 1 195 ? 139.418 62.765  60.393  1.00 0.00 ? 184 G A C4     1  
ATOM 6283   H "H5'"  . G A 1 195 ? 143.562 66.829  62.297  1.00 0.00 ? 184 G A "H5'"  1  
ATOM 6284   H "H5''" . G A 1 195 ? 142.420 67.851  62.740  1.00 0.00 ? 184 G A "H5''" 1  
ATOM 6285   H "H4'"  . G A 1 195 ? 142.104 67.225  60.531  1.00 0.00 ? 184 G A "H4'"  1  
ATOM 6286   H "H3'"  . G A 1 195 ? 140.027 66.170  62.171  1.00 0.00 ? 184 G A "H3'"  1  
ATOM 6287   H "H2'"  . G A 1 195 ? 138.991 65.446  60.271  1.00 0.00 ? 184 G A "H2'"  1  
ATOM 6288   H "HO2'" . G A 1 195 ? 139.885 67.564  59.199  1.00 0.00 ? 184 G A "HO2'" 1  
ATOM 6289   H "H1'"  . G A 1 195 ? 141.231 64.591  59.180  1.00 0.00 ? 184 G A "H1'"  1  
ATOM 6290   H H8     . G A 1 195 ? 141.956 63.133  62.205  1.00 0.00 ? 184 G A H8     1  
ATOM 6291   H H1     . G A 1 195 ? 136.724 60.450  59.980  1.00 0.00 ? 184 G A H1     1  
ATOM 6292   H H21    . G A 1 195 ? 135.885 61.660  58.336  1.00 0.00 ? 184 G A H21    1  
ATOM 6293   H H22    . G A 1 195 ? 136.615 63.098  57.810  1.00 0.00 ? 184 G A H22    1  
ATOM 6294   P P      . G A 1 196 ? 138.995 68.495  62.659  1.00 0.00 ? 185 G A P      1  
ATOM 6295   O OP1    . G A 1 196 ? 138.592 69.900  62.395  1.00 0.00 ? 185 G A OP1    1  
ATOM 6296   O OP2    . G A 1 196 ? 139.802 68.176  63.865  1.00 0.00 ? 185 G A OP2    1  
ATOM 6297   O "O5'"  . G A 1 196 ? 137.675 67.603  62.699  1.00 0.00 ? 185 G A "O5'"  1  
ATOM 6298   C "C5'"  . G A 1 196 ? 136.710 67.682  61.661  1.00 0.00 ? 185 G A "C5'"  1  
ATOM 6299   C "C4'"  . G A 1 196 ? 135.793 66.485  61.665  1.00 0.00 ? 185 G A "C4'"  1  
ATOM 6300   O "O4'"  . G A 1 196 ? 136.550 65.282  61.351  1.00 0.00 ? 185 G A "O4'"  1  
ATOM 6301   C "C3'"  . G A 1 196 ? 135.153 66.138  63.001  1.00 0.00 ? 185 G A "C3'"  1  
ATOM 6302   O "O3'"  . G A 1 196 ? 134.030 66.949  63.303  1.00 0.00 ? 185 G A "O3'"  1  
ATOM 6303   C "C2'"  . G A 1 196 ? 134.821 64.674  62.788  1.00 0.00 ? 185 G A "C2'"  1  
ATOM 6304   O "O2'"  . G A 1 196 ? 133.705 64.519  61.922  1.00 0.00 ? 185 G A "O2'"  1  
ATOM 6305   C "C1'"  . G A 1 196 ? 136.086 64.213  62.076  1.00 0.00 ? 185 G A "C1'"  1  
ATOM 6306   N N9     . G A 1 196 ? 137.148 63.830  63.025  1.00 0.00 ? 185 G A N9     1  
ATOM 6307   C C8     . G A 1 196 ? 138.223 64.589  63.421  1.00 0.00 ? 185 G A C8     1  
ATOM 6308   N N7     . G A 1 196 ? 138.998 63.977  64.275  1.00 0.00 ? 185 G A N7     1  
ATOM 6309   C C5     . G A 1 196 ? 138.398 62.739  64.455  1.00 0.00 ? 185 G A C5     1  
ATOM 6310   C C6     . G A 1 196 ? 138.782 61.642  65.269  1.00 0.00 ? 185 G A C6     1  
ATOM 6311   O O6     . G A 1 196 ? 139.761 61.543  66.018  1.00 0.00 ? 185 G A O6     1  
ATOM 6312   N N1     . G A 1 196 ? 137.890 60.580  65.152  1.00 0.00 ? 185 G A N1     1  
ATOM 6313   C C2     . G A 1 196 ? 136.771 60.574  64.355  1.00 0.00 ? 185 G A C2     1  
ATOM 6314   N N2     . G A 1 196 ? 136.031 59.456  64.375  1.00 0.00 ? 185 G A N2     1  
ATOM 6315   N N3     . G A 1 196 ? 136.403 61.590  63.592  1.00 0.00 ? 185 G A N3     1  
ATOM 6316   C C4     . G A 1 196 ? 137.256 62.632  63.691  1.00 0.00 ? 185 G A C4     1  
ATOM 6317   H "H5'"  . G A 1 196 ? 137.172 67.729  60.798  1.00 0.00 ? 185 G A "H5'"  1  
ATOM 6318   H "H5''" . G A 1 196 ? 136.176 68.495  61.782  1.00 0.00 ? 185 G A "H5''" 1  
ATOM 6319   H "H4'"  . G A 1 196 ? 135.086 66.610  60.997  1.00 0.00 ? 185 G A "H4'"  1  
ATOM 6320   H "H3'"  . G A 1 196 ? 135.807 66.212  63.726  1.00 0.00 ? 185 G A "H3'"  1  
ATOM 6321   H "H2'"  . G A 1 196 ? 134.686 64.208  63.640  1.00 0.00 ? 185 G A "H2'"  1  
ATOM 6322   H "HO2'" . G A 1 196 ? 133.117 65.298  62.017  1.00 0.00 ? 185 G A "HO2'" 1  
ATOM 6323   H "H1'"  . G A 1 196 ? 135.875 63.451  61.497  1.00 0.00 ? 185 G A "H1'"  1  
ATOM 6324   H H8     . G A 1 196 ? 138.392 65.498  63.095  1.00 0.00 ? 185 G A H8     1  
ATOM 6325   H H1     . G A 1 196 ? 138.075 59.776  65.680  1.00 0.00 ? 185 G A H1     1  
ATOM 6326   H H21    . G A 1 196 ? 136.297 58.699  64.938  1.00 0.00 ? 185 G A H21    1  
ATOM 6327   H H22    . G A 1 196 ? 135.221 59.394  63.826  1.00 0.00 ? 185 G A H22    1  
ATOM 6328   P P      . C A 1 197 ? 133.885 67.617  64.757  1.00 0.00 ? 186 C A P      1  
ATOM 6329   O OP1    . C A 1 197 ? 132.797 68.626  64.693  1.00 0.00 ? 186 C A OP1    1  
ATOM 6330   O OP2    . C A 1 197 ? 135.237 68.025  65.214  1.00 0.00 ? 186 C A OP2    1  
ATOM 6331   O "O5'"  . C A 1 197 ? 133.390 66.419  65.685  1.00 0.00 ? 186 C A "O5'"  1  
ATOM 6332   C "C5'"  . C A 1 197 ? 132.183 65.728  65.405  1.00 0.00 ? 186 C A "C5'"  1  
ATOM 6333   C "C4'"  . C A 1 197 ? 132.109 64.413  66.140  1.00 0.00 ? 186 C A "C4'"  1  
ATOM 6334   O "O4'"  . C A 1 197 ? 133.166 63.531  65.682  1.00 0.00 ? 186 C A "O4'"  1  
ATOM 6335   C "C3'"  . C A 1 197 ? 132.307 64.477  67.647  1.00 0.00 ? 186 C A "C3'"  1  
ATOM 6336   O "O3'"  . C A 1 197 ? 131.128 64.842  68.346  1.00 0.00 ? 186 C A "O3'"  1  
ATOM 6337   C "C2'"  . C A 1 197 ? 132.800 63.074  67.976  1.00 0.00 ? 186 C A "C2'"  1  
ATOM 6338   O "O2'"  . C A 1 197 ? 131.729 62.142  68.001  1.00 0.00 ? 186 C A "O2'"  1  
ATOM 6339   C "C1'"  . C A 1 197 ? 133.691 62.774  66.769  1.00 0.00 ? 186 C A "C1'"  1  
ATOM 6340   N N1     . C A 1 197 ? 135.111 63.135  67.014  1.00 0.00 ? 186 C A N1     1  
ATOM 6341   C C2     . C A 1 197 ? 135.891 62.272  67.793  1.00 0.00 ? 186 C A C2     1  
ATOM 6342   O O2     . C A 1 197 ? 135.377 61.242  68.255  1.00 0.00 ? 186 C A O2     1  
ATOM 6343   N N3     . C A 1 197 ? 137.188 62.578  68.031  1.00 0.00 ? 186 C A N3     1  
ATOM 6344   C C4     . C A 1 197 ? 137.714 63.693  67.523  1.00 0.00 ? 186 C A C4     1  
ATOM 6345   N N4     . C A 1 197 ? 138.998 63.953  67.783  1.00 0.00 ? 186 C A N4     1  
ATOM 6346   C C5     . C A 1 197 ? 136.947 64.589  66.728  1.00 0.00 ? 186 C A C5     1  
ATOM 6347   C C6     . C A 1 197 ? 135.667 64.276  66.498  1.00 0.00 ? 186 C A C6     1  
ATOM 6348   H "H5'"  . C A 1 197 ? 132.129 65.559  64.441  1.00 0.00 ? 186 C A "H5'"  1  
ATOM 6349   H "H5''" . C A 1 197 ? 131.425 66.288  65.673  1.00 0.00 ? 186 C A "H5''" 1  
ATOM 6350   H "H4'"  . C A 1 197 ? 131.243 63.996  65.951  1.00 0.00 ? 186 C A "H4'"  1  
ATOM 6351   H "H3'"  . C A 1 197 ? 133.016 65.122  67.853  1.00 0.00 ? 186 C A "H3'"  1  
ATOM 6352   H "H2'"  . C A 1 197 ? 133.314 63.061  68.813  1.00 0.00 ? 186 C A "H2'"  1  
ATOM 6353   H "HO2'" . C A 1 197 ? 130.887 62.626  68.120  1.00 0.00 ? 186 C A "HO2'" 1  
ATOM 6354   H "H1'"  . C A 1 197 ? 133.632 61.822  66.550  1.00 0.00 ? 186 C A "H1'"  1  
ATOM 6355   H H41    . C A 1 197 ? 139.523 63.333  68.332  1.00 0.00 ? 186 C A H41    1  
ATOM 6356   H H42    . C A 1 197 ? 139.416 64.764  67.426  1.00 0.00 ? 186 C A H42    1  
ATOM 6357   H H5     . C A 1 197 ? 137.345 65.406  66.359  1.00 0.00 ? 186 C A H5     1  
ATOM 6358   H H6     . C A 1 197 ? 135.123 64.882  65.953  1.00 0.00 ? 186 C A H6     1  
ATOM 6359   P P      . U A 1 198 ? 131.228 65.641  69.736  1.00 0.00 ? 187 U A P      1  
ATOM 6360   O OP1    . U A 1 198 ? 129.868 66.116  70.093  1.00 0.00 ? 187 U A OP1    1  
ATOM 6361   O OP2    . U A 1 198 ? 132.342 66.617  69.625  1.00 0.00 ? 187 U A OP2    1  
ATOM 6362   O "O5'"  . U A 1 198 ? 131.655 64.526  70.791  1.00 0.00 ? 187 U A "O5'"  1  
ATOM 6363   C "C5'"  . U A 1 198 ? 130.763 63.482  71.149  1.00 0.00 ? 187 U A "C5'"  1  
ATOM 6364   C "C4'"  . U A 1 198 ? 131.402 62.507  72.107  1.00 0.00 ? 187 U A "C4'"  1  
ATOM 6365   O "O4'"  . U A 1 198 ? 132.526 61.848  71.468  1.00 0.00 ? 187 U A "O4'"  1  
ATOM 6366   C "C3'"  . U A 1 198 ? 131.995 63.105  73.375  1.00 0.00 ? 187 U A "C3'"  1  
ATOM 6367   O "O3'"  . U A 1 198 ? 131.027 63.341  74.382  1.00 0.00 ? 187 U A "O3'"  1  
ATOM 6368   C "C2'"  . U A 1 198 ? 133.045 62.076  73.767  1.00 0.00 ? 187 U A "C2'"  1  
ATOM 6369   O "O2'"  . U A 1 198 ? 132.452 60.944  74.386  1.00 0.00 ? 187 U A "O2'"  1  
ATOM 6370   C "C1'"  . U A 1 198 ? 133.594 61.664  72.400  1.00 0.00 ? 187 U A "C1'"  1  
ATOM 6371   N N1     . U A 1 198 ? 134.764 62.480  71.993  1.00 0.00 ? 187 U A N1     1  
ATOM 6372   C C2     . U A 1 198 ? 135.985 62.157  72.557  1.00 0.00 ? 187 U A C2     1  
ATOM 6373   O O2     . U A 1 198 ? 136.130 61.248  73.355  1.00 0.00 ? 187 U A O2     1  
ATOM 6374   N N3     . U A 1 198 ? 137.039 62.938  72.152  1.00 0.00 ? 187 U A N3     1  
ATOM 6375   C C4     . U A 1 198 ? 137.000 63.988  71.260  1.00 0.00 ? 187 U A C4     1  
ATOM 6376   O O4     . U A 1 198 ? 138.038 64.597  70.997  1.00 0.00 ? 187 U A O4     1  
ATOM 6377   C C5     . U A 1 198 ? 135.705 64.266  70.718  1.00 0.00 ? 187 U A C5     1  
ATOM 6378   C C6     . U A 1 198 ? 134.662 63.520  71.093  1.00 0.00 ? 187 U A C6     1  
ATOM 6379   H "H5'"  . U A 1 198 ? 130.492 63.002  70.339  1.00 0.00 ? 187 U A "H5'"  1  
ATOM 6380   H "H5''" . U A 1 198 ? 129.969 63.870  71.571  1.00 0.00 ? 187 U A "H5''" 1  
ATOM 6381   H "H4'"  . U A 1 198 ? 130.737 61.833  72.358  1.00 0.00 ? 187 U A "H4'"  1  
ATOM 6382   H "H3'"  . U A 1 198 ? 132.442 63.949  73.154  1.00 0.00 ? 187 U A "H3'"  1  
ATOM 6383   H "H2'"  . U A 1 198 ? 133.744 62.471  74.329  1.00 0.00 ? 187 U A "H2'"  1  
ATOM 6384   H "HO2'" . U A 1 198 ? 131.563 61.190  74.716  1.00 0.00 ? 187 U A "HO2'" 1  
ATOM 6385   H "H1'"  . U A 1 198 ? 133.853 60.718  72.424  1.00 0.00 ? 187 U A "H1'"  1  
ATOM 6386   H H3     . U A 1 198 ? 137.913 62.726  72.539  1.00 0.00 ? 187 U A H3     1  
ATOM 6387   H H5     . U A 1 198 ? 135.586 64.995  70.074  1.00 0.00 ? 187 U A H5     1  
ATOM 6388   H H6     . U A 1 198 ? 133.786 63.730  70.710  1.00 0.00 ? 187 U A H6     1  
ATOM 6389   P P      . G A 1 199 ? 131.234 64.533  75.442  1.00 0.00 ? 188 G A P      1  
ATOM 6390   O OP1    . G A 1 199 ? 129.977 64.682  76.218  1.00 0.00 ? 188 G A OP1    1  
ATOM 6391   O OP2    . G A 1 199 ? 131.790 65.702  74.715  1.00 0.00 ? 188 G A OP2    1  
ATOM 6392   O "O5'"  . G A 1 199 ? 132.359 63.981  76.426  1.00 0.00 ? 188 G A "O5'"  1  
ATOM 6393   C "C5'"  . G A 1 199 ? 132.098 62.887  77.292  1.00 0.00 ? 188 G A "C5'"  1  
ATOM 6394   C "C4'"  . G A 1 199 ? 133.348 62.432  78.002  1.00 0.00 ? 188 G A "C4'"  1  
ATOM 6395   O "O4'"  . G A 1 199 ? 134.335 62.000  77.028  1.00 0.00 ? 188 G A "O4'"  1  
ATOM 6396   C "C3'"  . G A 1 199 ? 134.074 63.486  78.822  1.00 0.00 ? 188 G A "C3'"  1  
ATOM 6397   O "O3'"  . G A 1 199 ? 133.499 63.685  80.103  1.00 0.00 ? 188 G A "O3'"  1  
ATOM 6398   C "C2'"  . G A 1 199 ? 135.497 62.952  78.867  1.00 0.00 ? 188 G A "C2'"  1  
ATOM 6399   O "O2'"  . G A 1 199 ? 135.624 61.901  79.814  1.00 0.00 ? 188 G A "O2'"  1  
ATOM 6400   C "C1'"  . G A 1 199 ? 135.652 62.372  77.460  1.00 0.00 ? 188 G A "C1'"  1  
ATOM 6401   N N9     . G A 1 199 ? 136.258 63.339  76.524  1.00 0.00 ? 188 G A N9     1  
ATOM 6402   C C8     . G A 1 199 ? 135.627 64.027  75.517  1.00 0.00 ? 188 G A C8     1  
ATOM 6403   N N7     . G A 1 199 ? 136.431 64.815  74.853  1.00 0.00 ? 188 G A N7     1  
ATOM 6404   C C5     . G A 1 199 ? 137.666 64.635  75.458  1.00 0.00 ? 188 G A C5     1  
ATOM 6405   C C6     . G A 1 199 ? 138.924 65.225  75.173  1.00 0.00 ? 188 G A C6     1  
ATOM 6406   O O6     . G A 1 199 ? 139.208 66.050  74.297  1.00 0.00 ? 188 G A O6     1  
ATOM 6407   N N1     . G A 1 199 ? 139.916 64.759  76.032  1.00 0.00 ? 188 G A N1     1  
ATOM 6408   C C2     . G A 1 199 ? 139.721 63.846  77.038  1.00 0.00 ? 188 G A C2     1  
ATOM 6409   N N2     . G A 1 199 ? 140.801 63.521  77.764  1.00 0.00 ? 188 G A N2     1  
ATOM 6410   N N3     . G A 1 199 ? 138.552 63.289  77.315  1.00 0.00 ? 188 G A N3     1  
ATOM 6411   C C4     . G A 1 199 ? 137.577 63.727  76.492  1.00 0.00 ? 188 G A C4     1  
ATOM 6412   H "H5'"  . G A 1 199 ? 131.737 62.143  76.768  1.00 0.00 ? 188 G A "H5'"  1  
ATOM 6413   H "H5''" . G A 1 199 ? 131.432 63.159  77.959  1.00 0.00 ? 188 G A "H5''" 1  
ATOM 6414   H "H4'"  . G A 1 199 ? 133.124 61.675  78.585  1.00 0.00 ? 188 G A "H4'"  1  
ATOM 6415   H "H3'"  . G A 1 199 ? 134.066 64.336  78.331  1.00 0.00 ? 188 G A "H3'"  1  
ATOM 6416   H "H2'"  . G A 1 199 ? 136.147 63.668  79.032  1.00 0.00 ? 188 G A "H2'"  1  
ATOM 6417   H "HO2'" . G A 1 199 ? 136.561 61.617  79.852  1.00 0.00 ? 188 G A "HO2'" 1  
ATOM 6418   H "H1'"  . G A 1 199 ? 136.205 61.565  77.498  1.00 0.00 ? 188 G A "H1'"  1  
ATOM 6419   H H8     . G A 1 199 ? 134.673 63.939  75.315  1.00 0.00 ? 188 G A H8     1  
ATOM 6420   H H1     . G A 1 199 ? 140.821 65.113  75.908  1.00 0.00 ? 188 G A H1     1  
ATOM 6421   H H21    . G A 1 199 ? 141.669 63.928  77.566  1.00 0.00 ? 188 G A H21    1  
ATOM 6422   H H22    . G A 1 199 ? 140.721 62.873  78.497  1.00 0.00 ? 188 G A H22    1  
ATOM 6423   P P      . U A 1 200 ? 133.586 65.124  80.813  1.00 0.00 ? 189 U A P      1  
ATOM 6424   O OP1    . U A 1 200 ? 132.688 65.108  81.995  1.00 0.00 ? 189 U A OP1    1  
ATOM 6425   O OP2    . U A 1 200 ? 133.407 66.162  79.767  1.00 0.00 ? 189 U A OP2    1  
ATOM 6426   O "O5'"  . U A 1 200 ? 135.089 65.205  81.336  1.00 0.00 ? 189 U A "O5'"  1  
ATOM 6427   C "C5'"  . U A 1 200 ? 135.545 64.355  82.377  1.00 0.00 ? 189 U A "C5'"  1  
ATOM 6428   C "C4'"  . U A 1 200 ? 137.019 64.540  82.640  1.00 0.00 ? 189 U A "C4'"  1  
ATOM 6429   O "O4'"  . U A 1 200 ? 137.782 64.177  81.461  1.00 0.00 ? 189 U A "O4'"  1  
ATOM 6430   C "C3'"  . U A 1 200 ? 137.472 65.957  82.952  1.00 0.00 ? 189 U A "C3'"  1  
ATOM 6431   O "O3'"  . U A 1 200 ? 137.267 66.320  84.309  1.00 0.00 ? 189 U A "O3'"  1  
ATOM 6432   C "C2'"  . U A 1 200 ? 138.938 65.937  82.541  1.00 0.00 ? 189 U A "C2'"  1  
ATOM 6433   O "O2'"  . U A 1 200 ? 139.740 65.295  83.521  1.00 0.00 ? 189 U A "O2'"  1  
ATOM 6434   C "C1'"  . U A 1 200 ? 138.890 65.060  81.288  1.00 0.00 ? 189 U A "C1'"  1  
ATOM 6435   N N1     . U A 1 200 ? 138.722 65.858  80.049  1.00 0.00 ? 189 U A N1     1  
ATOM 6436   C C2     . U A 1 200 ? 139.842 66.505  79.560  1.00 0.00 ? 189 U A C2     1  
ATOM 6437   O O2     . U A 1 200 ? 140.934 66.445  80.097  1.00 0.00 ? 189 U A O2     1  
ATOM 6438   N N3     . U A 1 200 ? 139.640 67.231  78.412  1.00 0.00 ? 189 U A N3     1  
ATOM 6439   C C4     . U A 1 200 ? 138.459 67.375  77.715  1.00 0.00 ? 189 U A C4     1  
ATOM 6440   O O4     . U A 1 200 ? 138.439 68.065  76.695  1.00 0.00 ? 189 U A O4     1  
ATOM 6441   C C5     . U A 1 200 ? 137.343 66.677  78.279  1.00 0.00 ? 189 U A C5     1  
ATOM 6442   C C6     . U A 1 200 ? 137.513 65.963  79.396  1.00 0.00 ? 189 U A C6     1  
ATOM 6443   H "H5'"  . U A 1 200 ? 135.381 63.423  82.124  1.00 0.00 ? 189 U A "H5'"  1  
ATOM 6444   H "H5''" . U A 1 200 ? 135.047 64.556  83.197  1.00 0.00 ? 189 U A "H5''" 1  
ATOM 6445   H "H4'"  . U A 1 200 ? 137.281 63.953  83.382  1.00 0.00 ? 189 U A "H4'"  1  
ATOM 6446   H "H3'"  . U A 1 200 ? 136.986 66.584  82.376  1.00 0.00 ? 189 U A "H3'"  1  
ATOM 6447   H "H2'"  . U A 1 200 ? 139.267 66.838  82.336  1.00 0.00 ? 189 U A "H2'"  1  
ATOM 6448   H "HO2'" . U A 1 200 ? 140.680 65.347  83.249  1.00 0.00 ? 189 U A "HO2'" 1  
ATOM 6449   H "H1'"  . U A 1 200 ? 139.715 64.536  81.224  1.00 0.00 ? 189 U A "H1'"  1  
ATOM 6450   H H3     . U A 1 200 ? 140.421 67.699  78.048  1.00 0.00 ? 189 U A H3     1  
ATOM 6451   H H5     . U A 1 200 ? 136.464 66.723  77.849  1.00 0.00 ? 189 U A H5     1  
ATOM 6452   H H6     . U A 1 200 ? 136.734 65.496  79.763  1.00 0.00 ? 189 U A H6     1  
ATOM 6453   P P      . U A 1 201 ? 136.984 67.851  84.702  1.00 0.00 ? 190 U A P      1  
ATOM 6454   O OP1    . U A 1 201 ? 136.559 67.889  86.126  1.00 0.00 ? 190 U A OP1    1  
ATOM 6455   O OP2    . U A 1 201 ? 136.106 68.439  83.659  1.00 0.00 ? 190 U A OP2    1  
ATOM 6456   O "O5'"  . U A 1 201 ? 138.412 68.548  84.595  1.00 0.00 ? 190 U A "O5'"  1  
ATOM 6457   C "C5'"  . U A 1 201 ? 139.449 68.231  85.513  1.00 0.00 ? 190 U A "C5'"  1  
ATOM 6458   C "C4'"  . U A 1 201 ? 140.740 68.924  85.153  1.00 0.00 ? 190 U A "C4'"  1  
ATOM 6459   O "O4'"  . U A 1 201 ? 141.198 68.474  83.852  1.00 0.00 ? 190 U A "O4'"  1  
ATOM 6460   C "C3'"  . U A 1 201 ? 140.674 70.438  85.020  1.00 0.00 ? 190 U A "C3'"  1  
ATOM 6461   O "O3'"  . U A 1 201 ? 140.747 71.108  86.266  1.00 0.00 ? 190 U A "O3'"  1  
ATOM 6462   C "C2'"  . U A 1 201 ? 141.842 70.741  84.092  1.00 0.00 ? 190 U A "C2'"  1  
ATOM 6463   O "O2'"  . U A 1 201 ? 143.079 70.693  84.789  1.00 0.00 ? 190 U A "O2'"  1  
ATOM 6464   C "C1'"  . U A 1 201 ? 141.775 69.562  83.121  1.00 0.00 ? 190 U A "C1'"  1  
ATOM 6465   N N1     . U A 1 201 ? 140.957 69.866  81.922  1.00 0.00 ? 190 U A N1     1  
ATOM 6466   C C2     . U A 1 201 ? 141.545 70.634  80.935  1.00 0.00 ? 190 U A C2     1  
ATOM 6467   O O2     . U A 1 201 ? 142.685 71.059  81.013  1.00 0.00 ? 190 U A O2     1  
ATOM 6468   N N3     . U A 1 201 ? 140.750 70.892  79.845  1.00 0.00 ? 190 U A N3     1  
ATOM 6469   C C4     . U A 1 201 ? 139.454 70.469  79.642  1.00 0.00 ? 190 U A C4     1  
ATOM 6470   O O4     . U A 1 201 ? 138.871 70.785  78.605  1.00 0.00 ? 190 U A O4     1  
ATOM 6471   C C5     . U A 1 201 ? 138.910 69.679  80.705  1.00 0.00 ? 190 U A C5     1  
ATOM 6472   C C6     . U A 1 201 ? 139.662 69.412  81.778  1.00 0.00 ? 190 U A C6     1  
ATOM 6473   H "H5'"  . U A 1 201 ? 139.595 67.262  85.507  1.00 0.00 ? 190 U A "H5'"  1  
ATOM 6474   H "H5''" . U A 1 201 ? 139.176 68.509  86.410  1.00 0.00 ? 190 U A "H5''" 1  
ATOM 6475   H "H4'"  . U A 1 201 ? 141.416 68.694  85.826  1.00 0.00 ? 190 U A "H4'"  1  
ATOM 6476   H "H3'"  . U A 1 201 ? 139.838 70.685  84.572  1.00 0.00 ? 190 U A "H3'"  1  
ATOM 6477   H "H2'"  . U A 1 201 ? 141.721 71.595  83.628  1.00 0.00 ? 190 U A "H2'"  1  
ATOM 6478   H "HO2'" . U A 1 201 ? 143.801 70.940  84.175  1.00 0.00 ? 190 U A "HO2'" 1  
ATOM 6479   H "H1'"  . U A 1 201 ? 142.681 69.318  82.839  1.00 0.00 ? 190 U A "H1'"  1  
ATOM 6480   H H3     . U A 1 201 ? 141.149 71.435  79.134  1.00 0.00 ? 190 U A H3     1  
ATOM 6481   H H5     . U A 1 201 ? 137.994 69.334  80.645  1.00 0.00 ? 190 U A H5     1  
ATOM 6482   H H6     . U A 1 201 ? 139.267 68.870  82.491  1.00 0.00 ? 190 U A H6     1  
ATOM 6483   P P      . G A 1 202 ? 140.038 72.537  86.461  1.00 0.00 ? 191 G A P      1  
ATOM 6484   O OP1    . G A 1 202 ? 140.131 72.905  87.898  1.00 0.00 ? 191 G A OP1    1  
ATOM 6485   O OP2    . G A 1 202 ? 138.708 72.482  85.802  1.00 0.00 ? 191 G A OP2    1  
ATOM 6486   O "O5'"  . G A 1 202 ? 140.958 73.542  85.635  1.00 0.00 ? 191 G A "O5'"  1  
ATOM 6487   C "C5'"  . G A 1 202 ? 142.292 73.810  86.040  1.00 0.00 ? 191 G A "C5'"  1  
ATOM 6488   C "C4'"  . G A 1 202 ? 143.018 74.660  85.027  1.00 0.00 ? 191 G A "C4'"  1  
ATOM 6489   O "O4'"  . G A 1 202 ? 143.086 73.960  83.757  1.00 0.00 ? 191 G A "O4'"  1  
ATOM 6490   C "C3'"  . G A 1 202 ? 142.367 75.990  84.682  1.00 0.00 ? 191 G A "C3'"  1  
ATOM 6491   O "O3'"  . G A 1 202 ? 142.637 77.003  85.638  1.00 0.00 ? 191 G A "O3'"  1  
ATOM 6492   C "C2'"  . G A 1 202 ? 142.931 76.288  83.300  1.00 0.00 ? 191 G A "C2'"  1  
ATOM 6493   O "O2'"  . G A 1 202 ? 144.260 76.780  83.381  1.00 0.00 ? 191 G A "O2'"  1  
ATOM 6494   C "C1'"  . G A 1 202 ? 142.956 74.893  82.674  1.00 0.00 ? 191 G A "C1'"  1  
ATOM 6495   N N9     . G A 1 202 ? 141.744 74.620  81.877  1.00 0.00 ? 191 G A N9     1  
ATOM 6496   C C8     . G A 1 202 ? 140.716 73.766  82.193  1.00 0.00 ? 191 G A C8     1  
ATOM 6497   N N7     . G A 1 202 ? 139.777 73.734  81.286  1.00 0.00 ? 191 G A N7     1  
ATOM 6498   C C5     . G A 1 202 ? 140.212 74.623  80.312  1.00 0.00 ? 191 G A C5     1  
ATOM 6499   C C6     . G A 1 202 ? 139.611 75.009  79.087  1.00 0.00 ? 191 G A C6     1  
ATOM 6500   O O6     . G A 1 202 ? 138.540 74.629  78.601  1.00 0.00 ? 191 G A O6     1  
ATOM 6501   N N1     . G A 1 202 ? 140.392 75.935  78.402  1.00 0.00 ? 191 G A N1     1  
ATOM 6502   C C2     . G A 1 202 ? 141.596 76.430  78.842  1.00 0.00 ? 191 G A C2     1  
ATOM 6503   N N2     . G A 1 202 ? 142.203 77.319  78.042  1.00 0.00 ? 191 G A N2     1  
ATOM 6504   N N3     . G A 1 202 ? 142.166 76.078  79.981  1.00 0.00 ? 191 G A N3     1  
ATOM 6505   C C4     . G A 1 202 ? 141.424 75.178  80.662  1.00 0.00 ? 191 G A C4     1  
ATOM 6506   H "H5'"  . G A 1 202 ? 142.770 72.962  86.148  1.00 0.00 ? 191 G A "H5'"  1  
ATOM 6507   H "H5''" . G A 1 202 ? 142.275 74.281  86.900  1.00 0.00 ? 191 G A "H5''" 1  
ATOM 6508   H "H4'"  . G A 1 202 ? 143.930 74.826  85.348  1.00 0.00 ? 191 G A "H4'"  1  
ATOM 6509   H "H3'"  . G A 1 202 ? 141.396 75.865  84.612  1.00 0.00 ? 191 G A "H3'"  1  
ATOM 6510   H "H2'"  . G A 1 202 ? 142.349 76.897  82.797  1.00 0.00 ? 191 G A "H2'"  1  
ATOM 6511   H "HO2'" . G A 1 202 ? 144.576 76.999  82.479  1.00 0.00 ? 191 G A "HO2'" 1  
ATOM 6512   H "H1'"  . G A 1 202 ? 143.749 74.806  82.105  1.00 0.00 ? 191 G A "H1'"  1  
ATOM 6513   H H8     . G A 1 202 ? 140.689 73.232  83.015  1.00 0.00 ? 191 G A H8     1  
ATOM 6514   H H1     . G A 1 202 ? 140.054 76.261  77.542  1.00 0.00 ? 191 G A H1     1  
ATOM 6515   H H21    . G A 1 202 ? 141.786 77.585  77.196  1.00 0.00 ? 191 G A H21    1  
ATOM 6516   H H22    . G A 1 202 ? 143.064 77.706  78.303  1.00 0.00 ? 191 G A H22    1  
ATOM 6517   P P      . A A 1 203 ? 141.582 77.307  86.812  1.00 0.00 ? 192 A A P      1  
ATOM 6518   O OP1    . A A 1 203 ? 141.604 78.765  87.085  1.00 0.00 ? 192 A A OP1    1  
ATOM 6519   O OP2    . A A 1 203 ? 141.835 76.348  87.917  1.00 0.00 ? 192 A A OP2    1  
ATOM 6520   O "O5'"  . A A 1 203 ? 140.171 76.948  86.163  1.00 0.00 ? 192 A A "O5'"  1  
ATOM 6521   C "C5'"  . A A 1 203 ? 139.335 77.964  85.628  1.00 0.00 ? 192 A A "C5'"  1  
ATOM 6522   C "C4'"  . A A 1 203 ? 139.923 78.560  84.374  1.00 0.00 ? 192 A A "C4'"  1  
ATOM 6523   O "O4'"  . A A 1 203 ? 140.054 77.538  83.338  1.00 0.00 ? 192 A A "O4'"  1  
ATOM 6524   C "C3'"  . A A 1 203 ? 139.107 79.662  83.714  1.00 0.00 ? 192 A A "C3'"  1  
ATOM 6525   O "O3'"  . A A 1 203 ? 139.320 80.935  84.298  1.00 0.00 ? 192 A A "O3'"  1  
ATOM 6526   C "C2'"  . A A 1 203 ? 139.557 79.588  82.255  1.00 0.00 ? 192 A A "C2'"  1  
ATOM 6527   O "O2'"  . A A 1 203 ? 140.792 80.262  82.061  1.00 0.00 ? 192 A A "O2'"  1  
ATOM 6528   C "C1'"  . A A 1 203 ? 139.780 78.084  82.078  1.00 0.00 ? 192 A A "C1'"  1  
ATOM 6529   N N9     . A A 1 203 ? 138.579 77.401  81.559  1.00 0.00 ? 192 A A N9     1  
ATOM 6530   C C8     . A A 1 203 ? 137.751 76.528  82.222  1.00 0.00 ? 192 A A C8     1  
ATOM 6531   N N7     . A A 1 203 ? 136.759 76.083  81.491  1.00 0.00 ? 192 A A N7     1  
ATOM 6532   C C5     . A A 1 203 ? 136.945 76.703  80.263  1.00 0.00 ? 192 A A C5     1  
ATOM 6533   C C6     . A A 1 203 ? 136.228 76.647  79.055  1.00 0.00 ? 192 A A C6     1  
ATOM 6534   N N6     . A A 1 203 ? 135.131 75.906  78.879  1.00 0.00 ? 192 A A N6     1  
ATOM 6535   N N1     . A A 1 203 ? 136.680 77.388  78.021  1.00 0.00 ? 192 A A N1     1  
ATOM 6536   C C2     . A A 1 203 ? 137.780 78.132  78.196  1.00 0.00 ? 192 A A C2     1  
ATOM 6537   N N3     . A A 1 203 ? 138.539 78.267  79.282  1.00 0.00 ? 192 A A N3     1  
ATOM 6538   C C4     . A A 1 203 ? 138.062 77.518  80.292  1.00 0.00 ? 192 A A C4     1  
ATOM 6539   H "H5'"  . A A 1 203 ? 139.224 78.672  86.297  1.00 0.00 ? 192 A A "H5'"  1  
ATOM 6540   H "H5''" . A A 1 203 ? 138.458 77.581  85.420  1.00 0.00 ? 192 A A "H5''" 1  
ATOM 6541   H "H4'"  . A A 1 203 ? 140.813 78.916  84.578  1.00 0.00 ? 192 A A "H4'"  1  
ATOM 6542   H "H3'"  . A A 1 203 ? 138.155 79.433  83.766  1.00 0.00 ? 192 A A "H3'"  1  
ATOM 6543   H "H2'"  . A A 1 203 ? 138.862 79.920  81.648  1.00 0.00 ? 192 A A "H2'"  1  
ATOM 6544   H "HO2'" . A A 1 203 ? 141.048 80.193  81.118  1.00 0.00 ? 192 A A "HO2'" 1  
ATOM 6545   H "H1'"  . A A 1 203 ? 140.531 77.935  81.465  1.00 0.00 ? 192 A A "H1'"  1  
ATOM 6546   H H8     . A A 1 203 ? 137.889 76.264  83.156  1.00 0.00 ? 192 A A H8     1  
ATOM 6547   H H61    . A A 1 203 ? 134.673 75.908  78.013  1.00 0.00 ? 192 A A H61    1  
ATOM 6548   H H62    . A A 1 203 ? 134.785 75.360  79.616  1.00 0.00 ? 192 A A H62    1  
ATOM 6549   H H2     . A A 1 203 ? 138.066 78.651  77.415  1.00 0.00 ? 192 A A H2     1  
ATOM 6550   P P      . U A 1 204 ? 138.311 82.139  83.968  1.00 0.00 ? 193 U A P      1  
ATOM 6551   O OP1    . U A 1 204 ? 138.216 83.028  85.154  1.00 0.00 ? 193 U A OP1    1  
ATOM 6552   O OP2    . U A 1 204 ? 137.102 81.425  83.487  1.00 0.00 ? 193 U A OP2    1  
ATOM 6553   O "O5'"  . U A 1 204 ? 138.895 82.994  82.757  1.00 0.00 ? 193 U A "O5'"  1  
ATOM 6554   C "C5'"  . U A 1 204 ? 138.121 84.013  82.144  1.00 0.00 ? 193 U A "C5'"  1  
ATOM 6555   C "C4'"  . U A 1 204 ? 137.775 83.668  80.717  1.00 0.00 ? 193 U A "C4'"  1  
ATOM 6556   O "O4'"  . U A 1 204 ? 137.979 82.241  80.450  1.00 0.00 ? 193 U A "O4'"  1  
ATOM 6557   C "C3'"  . U A 1 204 ? 136.331 83.905  80.301  1.00 0.00 ? 193 U A "C3'"  1  
ATOM 6558   O "O3'"  . U A 1 204 ? 136.049 85.266  80.031  1.00 0.00 ? 193 U A "O3'"  1  
ATOM 6559   C "C2'"  . U A 1 204 ? 136.219 83.013  79.073  1.00 0.00 ? 193 U A "C2'"  1  
ATOM 6560   O "O2'"  . U A 1 204 ? 136.823 83.621  77.940  1.00 0.00 ? 193 U A "O2'"  1  
ATOM 6561   C "C1'"  . U A 1 204 ? 137.063 81.807  79.510  1.00 0.00 ? 193 U A "C1'"  1  
ATOM 6562   N N1     . U A 1 204 ? 136.236 80.724  80.096  1.00 0.00 ? 193 U A N1     1  
ATOM 6563   C C2     . U A 1 204 ? 135.384 80.049  79.241  1.00 0.00 ? 193 U A C2     1  
ATOM 6564   O O2     . U A 1 204 ? 135.293 80.306  78.053  1.00 0.00 ? 193 U A O2     1  
ATOM 6565   N N3     . U A 1 204 ? 134.639 79.055  79.826  1.00 0.00 ? 193 U A N3     1  
ATOM 6566   C C4     . U A 1 204 ? 134.655 78.674  81.151  1.00 0.00 ? 193 U A C4     1  
ATOM 6567   O O4     . U A 1 204 ? 133.922 77.758  81.525  1.00 0.00 ? 193 U A O4     1  
ATOM 6568   C C5     . U A 1 204 ? 135.559 79.416  81.975  1.00 0.00 ? 193 U A C5     1  
ATOM 6569   C C6     . U A 1 204 ? 136.298 80.388  81.431  1.00 0.00 ? 193 U A C6     1  
ATOM 6570   H "H5'"  . U A 1 204 ? 138.630 84.851  82.155  1.00 0.00 ? 193 U A "H5'"  1  
ATOM 6571   H "H5''" . U A 1 204 ? 137.292 84.136  82.652  1.00 0.00 ? 193 U A "H5''" 1  
ATOM 6572   H "H4'"  . U A 1 204 ? 138.362 84.189  80.131  1.00 0.00 ? 193 U A "H4'"  1  
ATOM 6573   H "H3'"  . U A 1 204 ? 135.717 83.580  80.991  1.00 0.00 ? 193 U A "H3'"  1  
ATOM 6574   H "H2'"  . U A 1 204 ? 135.289 82.761  78.896  1.00 0.00 ? 193 U A "H2'"  1  
ATOM 6575   H "HO2'" . U A 1 204 ? 136.762 84.595  78.029  1.00 0.00 ? 193 U A "HO2'" 1  
ATOM 6576   H "H1'"  . U A 1 204 ? 137.554 81.459  78.736  1.00 0.00 ? 193 U A "H1'"  1  
ATOM 6577   H H3     . U A 1 204 ? 134.029 78.564  79.238  1.00 0.00 ? 193 U A H3     1  
ATOM 6578   H H5     . U A 1 204 ? 135.637 79.211  82.931  1.00 0.00 ? 193 U A H5     1  
ATOM 6579   H H6     . U A 1 204 ? 136.908 80.881  82.017  1.00 0.00 ? 193 U A H6     1  
ATOM 6580   P P      . A A 1 205 ? 135.490 86.223  81.196  1.00 0.00 ? 194 A A P      1  
ATOM 6581   O OP1    . A A 1 205 ? 136.468 87.321  81.399  1.00 0.00 ? 194 A A OP1    1  
ATOM 6582   O OP2    . A A 1 205 ? 135.096 85.369  82.344  1.00 0.00 ? 194 A A OP2    1  
ATOM 6583   O "O5'"  . A A 1 205 ? 134.165 86.853  80.574  1.00 0.00 ? 194 A A "O5'"  1  
ATOM 6584   C "C5'"  . A A 1 205 ? 134.054 87.085  79.177  1.00 0.00 ? 194 A A "C5'"  1  
ATOM 6585   C "C4'"  . A A 1 205 ? 132.803 86.461  78.610  1.00 0.00 ? 194 A A "C4'"  1  
ATOM 6586   O "O4'"  . A A 1 205 ? 132.795 85.023  78.863  1.00 0.00 ? 194 A A "O4'"  1  
ATOM 6587   C "C3'"  . A A 1 205 ? 131.488 86.947  79.201  1.00 0.00 ? 194 A A "C3'"  1  
ATOM 6588   O "O3'"  . A A 1 205 ? 130.981 88.100  78.551  1.00 0.00 ? 194 A A "O3'"  1  
ATOM 6589   C "C2'"  . A A 1 205 ? 130.595 85.711  79.062  1.00 0.00 ? 194 A A "C2'"  1  
ATOM 6590   O "O2'"  . A A 1 205 ? 130.150 85.545  77.724  1.00 0.00 ? 194 A A "O2'"  1  
ATOM 6591   C "C1'"  . A A 1 205 ? 131.578 84.585  79.404  1.00 0.00 ? 194 A A "C1'"  1  
ATOM 6592   N N9     . A A 1 205 ? 131.791 84.454  80.858  1.00 0.00 ? 194 A A N9     1  
ATOM 6593   C C8     . A A 1 205 ? 132.845 84.923  81.602  1.00 0.00 ? 194 A A C8     1  
ATOM 6594   N N7     . A A 1 205 ? 132.753 84.650  82.880  1.00 0.00 ? 194 A A N7     1  
ATOM 6595   C C5     . A A 1 205 ? 131.556 83.955  82.986  1.00 0.00 ? 194 A A C5     1  
ATOM 6596   C C6     . A A 1 205 ? 130.886 83.385  84.083  1.00 0.00 ? 194 A A C6     1  
ATOM 6597   N N6     . A A 1 205 ? 131.345 83.430  85.336  1.00 0.00 ? 194 A A N6     1  
ATOM 6598   N N1     . A A 1 205 ? 129.711 82.761  83.847  1.00 0.00 ? 194 A A N1     1  
ATOM 6599   C C2     . A A 1 205 ? 129.250 82.717  82.591  1.00 0.00 ? 194 A A C2     1  
ATOM 6600   N N3     . A A 1 205 ? 129.788 83.214  81.479  1.00 0.00 ? 194 A A N3     1  
ATOM 6601   C C4     . A A 1 205 ? 130.954 83.827  81.749  1.00 0.00 ? 194 A A C4     1  
ATOM 6602   H "H5'"  . A A 1 205 ? 134.835 86.701  78.726  1.00 0.00 ? 194 A A "H5'"  1  
ATOM 6603   H "H5''" . A A 1 205 ? 134.033 88.050  79.013  1.00 0.00 ? 194 A A "H5''" 1  
ATOM 6604   H "H4'"  . A A 1 205 ? 132.791 86.615  77.642  1.00 0.00 ? 194 A A "H4'"  1  
ATOM 6605   H "H3'"  . A A 1 205 ? 131.613 87.143  80.153  1.00 0.00 ? 194 A A "H3'"  1  
ATOM 6606   H "H2'"  . A A 1 205 ? 129.846 85.737  79.694  1.00 0.00 ? 194 A A "H2'"  1  
ATOM 6607   H "HO2'" . A A 1 205 ? 130.087 86.426  77.298  1.00 0.00 ? 194 A A "HO2'" 1  
ATOM 6608   H "H1'"  . A A 1 205 ? 131.239 83.737  79.046  1.00 0.00 ? 194 A A "H1'"  1  
ATOM 6609   H H8     . A A 1 205 ? 133.598 85.416  81.213  1.00 0.00 ? 194 A A H8     1  
ATOM 6610   H H61    . A A 1 205 ? 130.833 83.014  86.061  1.00 0.00 ? 194 A A H61    1  
ATOM 6611   H H62    . A A 1 205 ? 132.195 83.876  85.531  1.00 0.00 ? 194 A A H62    1  
ATOM 6612   H H2     . A A 1 205 ? 128.394 82.253  82.474  1.00 0.00 ? 194 A A H2     1  
ATOM 6613   P P      . U A 1 206 ? 130.324 89.288  79.412  1.00 0.00 ? 195 U A P      1  
ATOM 6614   O OP1    . U A 1 206 ? 129.461 90.088  78.506  1.00 0.00 ? 195 U A OP1    1  
ATOM 6615   O OP2    . U A 1 206 ? 131.409 89.957  80.172  1.00 0.00 ? 195 U A OP2    1  
ATOM 6616   O "O5'"  . U A 1 206 ? 129.383 88.535  80.453  1.00 0.00 ? 195 U A "O5'"  1  
ATOM 6617   C "C5'"  . U A 1 206 ? 128.157 87.951  80.039  1.00 0.00 ? 195 U A "C5'"  1  
ATOM 6618   C "C4'"  . U A 1 206 ? 127.593 87.033  81.095  1.00 0.00 ? 195 U A "C4'"  1  
ATOM 6619   O "O4'"  . U A 1 206 ? 128.652 86.231  81.683  1.00 0.00 ? 195 U A "O4'"  1  
ATOM 6620   C "C3'"  . U A 1 206 ? 126.929 87.708  82.285  1.00 0.00 ? 195 U A "C3'"  1  
ATOM 6621   O "O3'"  . U A 1 206 ? 125.595 88.106  82.023  1.00 0.00 ? 195 U A "O3'"  1  
ATOM 6622   C "C2'"  . U A 1 206 ? 126.969 86.596  83.325  1.00 0.00 ? 195 U A "C2'"  1  
ATOM 6623   O "O2'"  . U A 1 206 ? 125.951 85.633  83.088  1.00 0.00 ? 195 U A "O2'"  1  
ATOM 6624   C "C1'"  . U A 1 206 ? 128.333 85.965  83.033  1.00 0.00 ? 195 U A "C1'"  1  
ATOM 6625   N N1     . U A 1 206 ? 129.403 86.510  83.903  1.00 0.00 ? 195 U A N1     1  
ATOM 6626   C C2     . U A 1 206 ? 129.392 86.126  85.231  1.00 0.00 ? 195 U A C2     1  
ATOM 6627   O O2     . U A 1 206 ? 128.555 85.375  85.700  1.00 0.00 ? 195 U A O2     1  
ATOM 6628   N N3     . U A 1 206 ? 130.401 86.655  85.998  1.00 0.00 ? 195 U A N3     1  
ATOM 6629   C C4     . U A 1 206 ? 131.399 87.510  85.585  1.00 0.00 ? 195 U A C4     1  
ATOM 6630   O O4     . U A 1 206 ? 132.238 87.900  86.399  1.00 0.00 ? 195 U A O4     1  
ATOM 6631   C C5     . U A 1 206 ? 131.348 87.863  84.199  1.00 0.00 ? 195 U A C5     1  
ATOM 6632   C C6     . U A 1 206 ? 130.377 87.362  83.428  1.00 0.00 ? 195 U A C6     1  
ATOM 6633   H "H5'"  . U A 1 206 ? 128.309 87.438  79.218  1.00 0.00 ? 195 U A "H5'"  1  
ATOM 6634   H "H5''" . U A 1 206 ? 127.509 88.663  79.856  1.00 0.00 ? 195 U A "H5''" 1  
ATOM 6635   H "H4'"  . U A 1 206 ? 126.945 86.434  80.669  1.00 0.00 ? 195 U A "H4'"  1  
ATOM 6636   H "H3'"  . U A 1 206 ? 127.440 88.485  82.595  1.00 0.00 ? 195 U A "H3'"  1  
ATOM 6637   H "H2'"  . U A 1 206 ? 126.924 86.953  84.236  1.00 0.00 ? 195 U A "H2'"  1  
ATOM 6638   H "HO2'" . U A 1 206 ? 126.069 84.885  83.710  1.00 0.00 ? 195 U A "HO2'" 1  
ATOM 6639   H "H1'"  . U A 1 206 ? 128.273 84.994  83.160  1.00 0.00 ? 195 U A "H1'"  1  
ATOM 6640   H H3     . U A 1 206 ? 130.411 86.396  86.943  1.00 0.00 ? 195 U A H3     1  
ATOM 6641   H H5     . U A 1 206 ? 132.020 88.467  83.818  1.00 0.00 ? 195 U A H5     1  
ATOM 6642   H H6     . U A 1 206 ? 130.363 87.620  82.484  1.00 0.00 ? 195 U A H6     1  
ATOM 6643   P P      . G A 1 207 ? 124.715 88.797  83.177  1.00 0.00 ? 196 G A P      1  
ATOM 6644   O OP1    . G A 1 207 ? 123.592 89.521  82.528  1.00 0.00 ? 196 G A OP1    1  
ATOM 6645   O OP2    . G A 1 207 ? 125.636 89.530  84.081  1.00 0.00 ? 196 G A OP2    1  
ATOM 6646   O "O5'"  . G A 1 207 ? 124.106 87.570  83.984  1.00 0.00 ? 196 G A "O5'"  1  
ATOM 6647   C "C5'"  . G A 1 207 ? 122.973 86.889  83.493  1.00 0.00 ? 196 G A "C5'"  1  
ATOM 6648   C "C4'"  . G A 1 207 ? 122.032 86.547  84.624  1.00 0.00 ? 196 G A "C4'"  1  
ATOM 6649   O "O4'"  . G A 1 207 ? 122.401 85.266  85.172  1.00 0.00 ? 196 G A "O4'"  1  
ATOM 6650   C "C3'"  . G A 1 207 ? 122.099 87.491  85.800  1.00 0.00 ? 196 G A "C3'"  1  
ATOM 6651   O "O3'"  . G A 1 207 ? 121.217 88.570  85.578  1.00 0.00 ? 196 G A "O3'"  1  
ATOM 6652   C "C2'"  . G A 1 207 ? 121.607 86.605  86.925  1.00 0.00 ? 196 G A "C2'"  1  
ATOM 6653   O "O2'"  . G A 1 207 ? 120.213 86.436  86.901  1.00 0.00 ? 196 G A "O2'"  1  
ATOM 6654   C "C1'"  . G A 1 207 ? 122.299 85.292  86.572  1.00 0.00 ? 196 G A "C1'"  1  
ATOM 6655   N N9     . G A 1 207 ? 123.667 85.180  87.070  1.00 0.00 ? 196 G A N9     1  
ATOM 6656   C C8     . G A 1 207 ? 124.829 85.310  86.341  1.00 0.00 ? 196 G A C8     1  
ATOM 6657   N N7     . G A 1 207 ? 125.905 85.136  87.057  1.00 0.00 ? 196 G A N7     1  
ATOM 6658   C C5     . G A 1 207 ? 125.420 84.892  88.334  1.00 0.00 ? 196 G A C5     1  
ATOM 6659   C C6     . G A 1 207 ? 126.103 84.649  89.537  1.00 0.00 ? 196 G A C6     1  
ATOM 6660   O O6     . G A 1 207 ? 127.327 84.614  89.751  1.00 0.00 ? 196 G A O6     1  
ATOM 6661   N N1     . G A 1 207 ? 125.221 84.445  90.585  1.00 0.00 ? 196 G A N1     1  
ATOM 6662   C C2     . G A 1 207 ? 123.868 84.482  90.491  1.00 0.00 ? 196 G A C2     1  
ATOM 6663   N N2     . G A 1 207 ? 123.197 84.278  91.610  1.00 0.00 ? 196 G A N2     1  
ATOM 6664   N N3     . G A 1 207 ? 123.218 84.716  89.385  1.00 0.00 ? 196 G A N3     1  
ATOM 6665   C C4     . G A 1 207 ? 124.046 84.912  88.351  1.00 0.00 ? 196 G A C4     1  
ATOM 6666   H "H5'"  . G A 1 207 ? 123.258 86.066  83.047  1.00 0.00 ? 196 G A "H5'"  1  
ATOM 6667   H "H5''" . G A 1 207 ? 122.512 87.461  82.845  1.00 0.00 ? 196 G A "H5''" 1  
ATOM 6668   H "H4'"  . G A 1 207 ? 121.119 86.498  84.273  1.00 0.00 ? 196 G A "H4'"  1  
ATOM 6669   H "H3'"  . G A 1 207 ? 123.020 87.806  85.909  1.00 0.00 ? 196 G A "H3'"  1  
ATOM 6670   H "H2'"  . G A 1 207 ? 121.909 86.932  87.799  1.00 0.00 ? 196 G A "H2'"  1  
ATOM 6671   H "HO2'" . G A 1 207 ? 119.813 87.160  86.375  1.00 0.00 ? 196 G A "HO2'" 1  
ATOM 6672   H "H1'"  . G A 1 207 ? 121.779 84.543  86.930  1.00 0.00 ? 196 G A "H1'"  1  
ATOM 6673   H H8     . G A 1 207 ? 124.844 85.502  85.380  1.00 0.00 ? 196 G A H8     1  
ATOM 6674   H H1     . G A 1 207 ? 125.611 84.258  91.464  1.00 0.00 ? 196 G A H1     1  
ATOM 6675   H H21    . G A 1 207 ? 123.678 84.102  92.445  1.00 0.00 ? 196 G A H21    1  
ATOM 6676   H H22    . G A 1 207 ? 122.217 84.301  91.603  1.00 0.00 ? 196 G A H22    1  
ATOM 6677   P P      . G A 1 208 ? 121.406 89.917  86.405  1.00 0.00 ? 197 G A P      1  
ATOM 6678   O OP1    . G A 1 208 ? 120.285 90.808  86.066  1.00 0.00 ? 197 G A OP1    1  
ATOM 6679   O OP2    . G A 1 208 ? 122.808 90.391  86.217  1.00 0.00 ? 197 G A OP2    1  
ATOM 6680   O "O5'"  . G A 1 208 ? 121.119 89.402  87.878  1.00 0.00 ? 197 G A "O5'"  1  
ATOM 6681   C "C5'"  . G A 1 208 ? 121.511 90.152  89.019  1.00 0.00 ? 197 G A "C5'"  1  
ATOM 6682   C "C4'"  . G A 1 208 ? 121.337 89.317  90.260  1.00 0.00 ? 197 G A "C4'"  1  
ATOM 6683   O "O4'"  . G A 1 208 ? 122.046 88.072  90.094  1.00 0.00 ? 197 G A "O4'"  1  
ATOM 6684   C "C3'"  . G A 1 208 ? 121.969 89.937  91.466  1.00 0.00 ? 197 G A "C3'"  1  
ATOM 6685   O "O3'"  . G A 1 208 ? 120.997 90.777  92.011  1.00 0.00 ? 197 G A "O3'"  1  
ATOM 6686   C "C2'"  . G A 1 208 ? 122.249 88.722  92.338  1.00 0.00 ? 197 G A "C2'"  1  
ATOM 6687   O "O2'"  . G A 1 208 ? 121.103 88.203  92.979  1.00 0.00 ? 197 G A "O2'"  1  
ATOM 6688   C "C1'"  . G A 1 208 ? 122.710 87.732  91.282  1.00 0.00 ? 197 G A "C1'"  1  
ATOM 6689   N N9     . G A 1 208 ? 124.125 87.847  90.992  1.00 0.00 ? 197 G A N9     1  
ATOM 6690   C C8     . G A 1 208 ? 124.686 88.191  89.790  1.00 0.00 ? 197 G A C8     1  
ATOM 6691   N N7     . G A 1 208 ? 125.988 88.174  89.817  1.00 0.00 ? 197 G A N7     1  
ATOM 6692   C C5     . G A 1 208 ? 126.300 87.806  91.122  1.00 0.00 ? 197 G A C5     1  
ATOM 6693   C C6     . G A 1 208 ? 127.541 87.614  91.741  1.00 0.00 ? 197 G A C6     1  
ATOM 6694   O O6     . G A 1 208 ? 128.658 87.714  91.255  1.00 0.00 ? 197 G A O6     1  
ATOM 6695   N N1     . G A 1 208 ? 127.401 87.258  93.067  1.00 0.00 ? 197 G A N1     1  
ATOM 6696   C C2     . G A 1 208 ? 126.211 87.094  93.712  1.00 0.00 ? 197 G A C2     1  
ATOM 6697   N N2     . G A 1 208 ? 126.275 86.745  94.982  1.00 0.00 ? 197 G A N2     1  
ATOM 6698   N N3     . G A 1 208 ? 125.043 87.258  93.150  1.00 0.00 ? 197 G A N3     1  
ATOM 6699   C C4     . G A 1 208 ? 125.159 87.615  91.858  1.00 0.00 ? 197 G A C4     1  
ATOM 6700   H "H5'"  . G A 1 208 ? 120.959 90.957  89.078  1.00 0.00 ? 197 G A "H5'"  1  
ATOM 6701   H "H5''" . G A 1 208 ? 122.452 90.412  88.920  1.00 0.00 ? 197 G A "H5''" 1  
ATOM 6702   H "H4'"  . G A 1 208 ? 120.384 89.132  90.387  1.00 0.00 ? 197 G A "H4'"  1  
ATOM 6703   H "H3'"  . G A 1 208 ? 122.778 90.414  91.196  1.00 0.00 ? 197 G A "H3'"  1  
ATOM 6704   H "H2'"  . G A 1 208 ? 122.951 88.908  92.997  1.00 0.00 ? 197 G A "H2'"  1  
ATOM 6705   H "HO2'" . G A 1 208 ? 120.408 88.895  93.001  1.00 0.00 ? 197 G A "HO2'" 1  
ATOM 6706   H "H1'"  . G A 1 208 ? 122.515 86.819  91.584  1.00 0.00 ? 197 G A "H1'"  1  
ATOM 6707   H H8     . G A 1 208 ? 124.165 88.417  88.991  1.00 0.00 ? 197 G A H8     1  
ATOM 6708   H H1     . G A 1 208 ? 128.221 87.110  93.582  1.00 0.00 ? 197 G A H1     1  
ATOM 6709   H H21    . G A 1 208 ? 127.144 86.618  95.415  1.00 0.00 ? 197 G A H21    1  
ATOM 6710   H H22    . G A 1 208 ? 125.450 86.610  95.495  1.00 0.00 ? 197 G A H22    1  
ATOM 6711   P P      . A A 1 209 ? 121.453 92.232  92.501  1.00 0.00 ? 198 A A P      1  
ATOM 6712   O OP1    . A A 1 209 ? 120.207 93.020  92.666  1.00 0.00 ? 198 A A OP1    1  
ATOM 6713   O OP2    . A A 1 209 ? 122.487 92.685  91.537  1.00 0.00 ? 198 A A OP2    1  
ATOM 6714   O "O5'"  . A A 1 209 ? 122.141 92.094  93.931  1.00 0.00 ? 198 A A "O5'"  1  
ATOM 6715   C "C5'"  . A A 1 209 ? 121.375 91.769  95.081  1.00 0.00 ? 198 A A "C5'"  1  
ATOM 6716   C "C4'"  . A A 1 209 ? 122.244 91.240  96.195  1.00 0.00 ? 198 A A "C4'"  1  
ATOM 6717   O "O4'"  . A A 1 209 ? 123.022 90.113  95.719  1.00 0.00 ? 198 A A "O4'"  1  
ATOM 6718   C "C3'"  . A A 1 209 ? 123.283 92.204  96.744  1.00 0.00 ? 198 A A "C3'"  1  
ATOM 6719   O "O3'"  . A A 1 209 ? 122.752 93.111  97.695  1.00 0.00 ? 198 A A "O3'"  1  
ATOM 6720   C "C2'"  . A A 1 209 ? 124.335 91.264  97.318  1.00 0.00 ? 198 A A "C2'"  1  
ATOM 6721   O "O2'"  . A A 1 209 ? 123.933 90.745  98.578  1.00 0.00 ? 198 A A "O2'"  1  
ATOM 6722   C "C1'"  . A A 1 209 ? 124.327 90.131  96.289  1.00 0.00 ? 198 A A "C1'"  1  
ATOM 6723   N N9     . A A 1 209 ? 125.347 90.322  95.242  1.00 0.00 ? 198 A A N9     1  
ATOM 6724   C C8     . A A 1 209 ? 125.166 90.756  93.953  1.00 0.00 ? 198 A A C8     1  
ATOM 6725   N N7     . A A 1 209 ? 126.273 90.824  93.256  1.00 0.00 ? 198 A A N7     1  
ATOM 6726   C C5     . A A 1 209 ? 127.253 90.410  94.146  1.00 0.00 ? 198 A A C5     1  
ATOM 6727   C C6     . A A 1 209 ? 128.645 90.256  94.020  1.00 0.00 ? 198 A A C6     1  
ATOM 6728   N N6     . A A 1 209 ? 129.318 90.521  92.898  1.00 0.00 ? 198 A A N6     1  
ATOM 6729   N N1     . A A 1 209 ? 129.330 89.823  95.099  1.00 0.00 ? 198 A A N1     1  
ATOM 6730   C C2     . A A 1 209 ? 128.654 89.558  96.225  1.00 0.00 ? 198 A A C2     1  
ATOM 6731   N N3     . A A 1 209 ? 127.350 89.661  96.465  1.00 0.00 ? 198 A A N3     1  
ATOM 6732   C C4     . A A 1 209 ? 126.697 90.096  95.374  1.00 0.00 ? 198 A A C4     1  
ATOM 6733   H "H5'"  . A A 1 209 ? 120.712 91.087  94.840  1.00 0.00 ? 198 A A "H5'"  1  
ATOM 6734   H "H5''" . A A 1 209 ? 120.909 92.572  95.391  1.00 0.00 ? 198 A A "H5''" 1  
ATOM 6735   H "H4'"  . A A 1 209 ? 121.668 90.942  96.930  1.00 0.00 ? 198 A A "H4'"  1  
ATOM 6736   H "H3'"  . A A 1 209 ? 123.677 92.710  96.002  1.00 0.00 ? 198 A A "H3'"  1  
ATOM 6737   H "H2'"  . A A 1 209 ? 125.214 91.696  97.366  1.00 0.00 ? 198 A A "H2'"  1  
ATOM 6738   H "HO2'" . A A 1 209 ? 124.659 90.204  98.947  1.00 0.00 ? 198 A A "HO2'" 1  
ATOM 6739   H "H1'"  . A A 1 209 ? 124.481 89.277  96.744  1.00 0.00 ? 198 A A "H1'"  1  
ATOM 6740   H H8     . A A 1 209 ? 124.286 90.992  93.587  1.00 0.00 ? 198 A A H8     1  
ATOM 6741   H H61    . A A 1 209 ? 130.290 90.396  92.870  1.00 0.00 ? 198 A A H61    1  
ATOM 6742   H H62    . A A 1 209 ? 128.841 90.838  92.102  1.00 0.00 ? 198 A A H62    1  
ATOM 6743   H H2     . A A 1 209 ? 129.200 89.246  96.978  1.00 0.00 ? 198 A A H2     1  
ATOM 6744   P P      . U A 1 210 ? 123.333 94.605  97.799  1.00 0.00 ? 199 U A P      1  
ATOM 6745   O OP1    . U A 1 210 ? 122.510 95.350  98.785  1.00 0.00 ? 199 U A OP1    1  
ATOM 6746   O OP2    . U A 1 210 ? 123.485 95.136  96.419  1.00 0.00 ? 199 U A OP2    1  
ATOM 6747   O "O5'"  . U A 1 210 ? 124.789 94.411  98.416  1.00 0.00 ? 199 U A "O5'"  1  
ATOM 6748   C "C5'"  . U A 1 210 ? 124.962 93.894  99.725  1.00 0.00 ? 199 U A "C5'"  1  
ATOM 6749   C "C4'"  . U A 1 210 ? 126.401 93.528  99.994  1.00 0.00 ? 199 U A "C4'"  1  
ATOM 6750   O "O4'"  . U A 1 210 ? 126.833 92.506  99.059  1.00 0.00 ? 199 U A "O4'"  1  
ATOM 6751   C "C3'"  . U A 1 210 ? 127.421 94.642  99.820  1.00 0.00 ? 199 U A "C3'"  1  
ATOM 6752   O "O3'"  . U A 1 210 ? 127.520 95.482  100.958 1.00 0.00 ? 199 U A "O3'"  1  
ATOM 6753   C "C2'"  . U A 1 210 ? 128.699 93.877  99.511  1.00 0.00 ? 199 U A "C2'"  1  
ATOM 6754   O "O2'"  . U A 1 210 ? 129.277 93.337  100.691 1.00 0.00 ? 199 U A "O2'"  1  
ATOM 6755   C "C1'"  . U A 1 210 ? 128.168 92.731  98.650  1.00 0.00 ? 199 U A "C1'"  1  
ATOM 6756   N N1     . U A 1 210 ? 128.224 93.043  97.201  1.00 0.00 ? 199 U A N1     1  
ATOM 6757   C C2     . U A 1 210 ? 129.456 92.948  96.582  1.00 0.00 ? 199 U A C2     1  
ATOM 6758   O O2     . U A 1 210 ? 130.473 92.622  97.170  1.00 0.00 ? 199 U A O2     1  
ATOM 6759   N N3     . U A 1 210 ? 129.460 93.244  95.242  1.00 0.00 ? 199 U A N3     1  
ATOM 6760   C C4     . U A 1 210 ? 128.382 93.623  94.470  1.00 0.00 ? 199 U A C4     1  
ATOM 6761   O O4     . U A 1 210 ? 128.548 93.859  93.272  1.00 0.00 ? 199 U A O4     1  
ATOM 6762   C C5     . U A 1 210 ? 127.138 93.701  95.176  1.00 0.00 ? 199 U A C5     1  
ATOM 6763   C C6     . U A 1 210 ? 127.107 93.415  96.483  1.00 0.00 ? 199 U A C6     1  
ATOM 6764   H "H5'"  . U A 1 210 ? 124.405 93.095  99.831  1.00 0.00 ? 199 U A "H5'"  1  
ATOM 6765   H "H5''" . U A 1 210 ? 124.678 94.570  100.376 1.00 0.00 ? 199 U A "H5''" 1  
ATOM 6766   H "H4'"  . U A 1 210 ? 126.469 93.175  100.907 1.00 0.00 ? 199 U A "H4'"  1  
ATOM 6767   H "H3'"  . U A 1 210 ? 127.174 95.185  99.041  1.00 0.00 ? 199 U A "H3'"  1  
ATOM 6768   H "H2'"  . U A 1 210 ? 129.339 94.432  99.015  1.00 0.00 ? 199 U A "H2'"  1  
ATOM 6769   H "HO2'" . U A 1 210 ? 128.928 93.823  101.466 1.00 0.00 ? 199 U A "HO2'" 1  
ATOM 6770   H "H1'"  . U A 1 210 ? 128.692 91.922  98.826  1.00 0.00 ? 199 U A "H1'"  1  
ATOM 6771   H H3     . U A 1 210 ? 130.323 93.183  94.783  1.00 0.00 ? 199 U A H3     1  
ATOM 6772   H H5     . U A 1 210 ? 126.320 93.961  94.707  1.00 0.00 ? 199 U A H5     1  
ATOM 6773   H H6     . U A 1 210 ? 126.245 93.478  96.942  1.00 0.00 ? 199 U A H6     1  
ATOM 6774   P P      . G A 1 211 ? 127.857 97.044  100.784 1.00 0.00 ? 200 G A P      1  
ATOM 6775   O OP1    . G A 1 211 ? 129.262 97.163  100.319 1.00 0.00 ? 200 G A OP1    1  
ATOM 6776   O OP2    . G A 1 211 ? 127.431 97.746  102.021 1.00 0.00 ? 200 G A OP2    1  
ATOM 6777   O "O5'"  . G A 1 211 ? 126.904 97.514  99.597  1.00 0.00 ? 200 G A "O5'"  1  
ATOM 6778   C "C5'"  . G A 1 211 ? 127.228 98.650  98.809  1.00 0.00 ? 200 G A "C5'"  1  
ATOM 6779   C "C4'"  . G A 1 211 ? 125.989 99.377  98.348  1.00 0.00 ? 200 G A "C4'"  1  
ATOM 6780   O "O4'"  . G A 1 211 ? 124.809 98.683  98.853  1.00 0.00 ? 200 G A "O4'"  1  
ATOM 6781   C "C3'"  . G A 1 211 ? 125.824 100.802 98.855  1.00 0.00 ? 200 G A "C3'"  1  
ATOM 6782   O "O3'"  . G A 1 211 ? 126.543 101.750 98.084  1.00 0.00 ? 200 G A "O3'"  1  
ATOM 6783   C "C2'"  . G A 1 211 ? 124.313 100.986 98.846  1.00 0.00 ? 200 G A "C2'"  1  
ATOM 6784   O "O2'"  . G A 1 211 ? 123.829 101.201 97.528  1.00 0.00 ? 200 G A "O2'"  1  
ATOM 6785   C "C1'"  . G A 1 211 ? 123.859 99.614  99.332  1.00 0.00 ? 200 G A "C1'"  1  
ATOM 6786   N N9     . G A 1 211 ? 123.816 99.533  100.805 1.00 0.00 ? 200 G A N9     1  
ATOM 6787   C C8     . G A 1 211 ? 124.463 98.625  101.607 1.00 0.00 ? 200 G A C8     1  
ATOM 6788   N N7     . G A 1 211 ? 124.230 98.805  102.879 1.00 0.00 ? 200 G A N7     1  
ATOM 6789   C C5     . G A 1 211 ? 123.378 99.899  102.919 1.00 0.00 ? 200 G A C5     1  
ATOM 6790   C C6     . G A 1 211 ? 122.784 100.562 104.025 1.00 0.00 ? 200 G A C6     1  
ATOM 6791   O O6     . G A 1 211 ? 122.897 100.304 105.229 1.00 0.00 ? 200 G A O6     1  
ATOM 6792   N N1     . G A 1 211 ? 121.986 101.627 103.617 1.00 0.00 ? 200 G A N1     1  
ATOM 6793   C C2     . G A 1 211 ? 121.786 102.007 102.312 1.00 0.00 ? 200 G A C2     1  
ATOM 6794   N N2     . G A 1 211 ? 120.981 103.062 102.116 1.00 0.00 ? 200 G A N2     1  
ATOM 6795   N N3     . G A 1 211 ? 122.333 101.398 101.273 1.00 0.00 ? 200 G A N3     1  
ATOM 6796   C C4     . G A 1 211 ? 123.112 100.361 101.648 1.00 0.00 ? 200 G A C4     1  
ATOM 6797   H "H5'"  . G A 1 211 ? 127.738 98.360  98.024  1.00 0.00 ? 200 G A "H5'"  1  
ATOM 6798   H "H5''" . G A 1 211 ? 127.779 99.261  99.340  1.00 0.00 ? 200 G A "H5''" 1  
ATOM 6799   H "H4'"  . G A 1 211 ? 125.967 99.378  97.368  1.00 0.00 ? 200 G A "H4'"  1  
ATOM 6800   H "H3'"  . G A 1 211 ? 126.147 100.854 99.778  1.00 0.00 ? 200 G A "H3'"  1  
ATOM 6801   H "H2'"  . G A 1 211 ? 124.034 101.700 99.456  1.00 0.00 ? 200 G A "H2'"  1  
ATOM 6802   H "HO2'" . G A 1 211 ? 122.860 101.342 97.563  1.00 0.00 ? 200 G A "HO2'" 1  
ATOM 6803   H "H1'"  . G A 1 211 ? 122.971 99.416  98.968  1.00 0.00 ? 200 G A "H1'"  1  
ATOM 6804   H H8     . G A 1 211 ? 125.041 97.913  101.261 1.00 0.00 ? 200 G A H8     1  
ATOM 6805   H H1     . G A 1 211 ? 121.534 102.144 104.315 1.00 0.00 ? 200 G A H1     1  
ATOM 6806   H H21    . G A 1 211 ? 120.572 103.518 102.880 1.00 0.00 ? 200 G A H21    1  
ATOM 6807   H H22    . G A 1 211 ? 120.801 103.378 101.205 1.00 0.00 ? 200 G A H22    1  
ATOM 6808   P P      . C A 1 212 ? 126.669 103.271 98.587  1.00 0.00 ? 201 C A P      1  
ATOM 6809   O OP1    . C A 1 212 ? 127.390 104.042 97.543  1.00 0.00 ? 201 C A OP1    1  
ATOM 6810   O OP2    . C A 1 212 ? 127.189 103.256 99.977  1.00 0.00 ? 201 C A OP2    1  
ATOM 6811   O "O5'"  . C A 1 212 ? 125.163 103.789 98.629  1.00 0.00 ? 201 C A "O5'"  1  
ATOM 6812   C "C5'"  . C A 1 212 ? 124.845 105.135 98.308  1.00 0.00 ? 201 C A "C5'"  1  
ATOM 6813   C "C4'"  . C A 1 212 ? 124.185 105.843 99.467  1.00 0.00 ? 201 C A "C4'"  1  
ATOM 6814   O "O4'"  . C A 1 212 ? 123.575 104.871 100.355 1.00 0.00 ? 201 C A "O4'"  1  
ATOM 6815   C "C3'"  . C A 1 212 ? 125.107 106.637 100.379 1.00 0.00 ? 201 C A "C3'"  1  
ATOM 6816   O "O3'"  . C A 1 212 ? 125.419 107.921 99.867  1.00 0.00 ? 201 C A "O3'"  1  
ATOM 6817   C "C2'"  . C A 1 212 ? 124.340 106.653 101.687 1.00 0.00 ? 201 C A "C2'"  1  
ATOM 6818   O "O2'"  . C A 1 212 ? 123.282 107.599 101.652 1.00 0.00 ? 201 C A "O2'"  1  
ATOM 6819   C "C1'"  . C A 1 212 ? 123.760 105.237 101.681 1.00 0.00 ? 201 C A "C1'"  1  
ATOM 6820   N N1     . C A 1 212 ? 124.662 104.256 102.334 1.00 0.00 ? 201 C A N1     1  
ATOM 6821   C C2     . C A 1 212 ? 124.711 104.225 103.733 1.00 0.00 ? 201 C A C2     1  
ATOM 6822   O O2     . C A 1 212 ? 124.004 105.012 104.381 1.00 0.00 ? 201 C A O2     1  
ATOM 6823   N N3     . C A 1 212 ? 125.524 103.339 104.353 1.00 0.00 ? 201 C A N3     1  
ATOM 6824   C C4     . C A 1 212 ? 126.274 102.504 103.633 1.00 0.00 ? 201 C A C4     1  
ATOM 6825   N N4     . C A 1 212 ? 127.062 101.647 104.288 1.00 0.00 ? 201 C A N4     1  
ATOM 6826   C C5     . C A 1 212 ? 126.248 102.510 102.210 1.00 0.00 ? 201 C A C5     1  
ATOM 6827   C C6     . C A 1 212 ? 125.438 103.390 101.608 1.00 0.00 ? 201 C A C6     1  
ATOM 6828   H "H5'"  . C A 1 212 ? 124.238 105.145 97.540  1.00 0.00 ? 201 C A "H5'"  1  
ATOM 6829   H "H5''" . C A 1 212 ? 125.669 105.610 98.072  1.00 0.00 ? 201 C A "H5''" 1  
ATOM 6830   H "H4'"  . C A 1 212 ? 123.488 106.436 99.118  1.00 0.00 ? 201 C A "H4'"  1  
ATOM 6831   H "H3'"  . C A 1 212 ? 125.943 106.143 100.504 1.00 0.00 ? 201 C A "H3'"  1  
ATOM 6832   H "H2'"  . C A 1 212 ? 124.936 106.803 102.449 1.00 0.00 ? 201 C A "H2'"  1  
ATOM 6833   H "HO2'" . C A 1 212 ? 123.555 108.364 101.104 1.00 0.00 ? 201 C A "HO2'" 1  
ATOM 6834   H "H1'"  . C A 1 212 ? 122.895 105.241 102.142 1.00 0.00 ? 201 C A "H1'"  1  
ATOM 6835   H H41    . C A 1 212 ? 127.078 101.647 105.268 1.00 0.00 ? 201 C A H41    1  
ATOM 6836   H H42    . C A 1 212 ? 127.625 101.021 103.788 1.00 0.00 ? 201 C A H42    1  
ATOM 6837   H H5     . C A 1 212 ? 126.802 101.892 101.690 1.00 0.00 ? 201 C A H5     1  
ATOM 6838   H H6     . C A 1 212 ? 125.406 103.410 100.630 1.00 0.00 ? 201 C A H6     1  
ATOM 6839   P P      . A A 1 213 ? 126.856 108.199 99.202  1.00 0.00 ? 202 A A P      1  
ATOM 6840   O OP1    . A A 1 213 ? 127.153 109.647 99.335  1.00 0.00 ? 202 A A OP1    1  
ATOM 6841   O OP2    . A A 1 213 ? 126.871 107.566 97.859  1.00 0.00 ? 202 A A OP2    1  
ATOM 6842   O "O5'"  . A A 1 213 ? 127.872 107.400 100.134 1.00 0.00 ? 202 A A "O5'"  1  
ATOM 6843   C "C5'"  . A A 1 213 ? 128.075 107.782 101.486 1.00 0.00 ? 202 A A "C5'"  1  
ATOM 6844   C "C4'"  . A A 1 213 ? 128.652 106.651 102.301 1.00 0.00 ? 202 A A "C4'"  1  
ATOM 6845   O "O4'"  . A A 1 213 ? 128.675 105.416 101.529 1.00 0.00 ? 202 A A "O4'"  1  
ATOM 6846   C "C3'"  . A A 1 213 ? 130.099 106.816 102.740 1.00 0.00 ? 202 A A "C3'"  1  
ATOM 6847   O "O3'"  . A A 1 213 ? 130.247 107.689 103.846 1.00 0.00 ? 202 A A "O3'"  1  
ATOM 6848   C "C2'"  . A A 1 213 ? 130.508 105.377 103.039 1.00 0.00 ? 202 A A "C2'"  1  
ATOM 6849   O "O2'"  . A A 1 213 ? 129.992 104.944 104.289 1.00 0.00 ? 202 A A "O2'"  1  
ATOM 6850   C "C1'"  . A A 1 213 ? 129.794 104.635 101.918 1.00 0.00 ? 202 A A "C1'"  1  
ATOM 6851   N N9     . A A 1 213 ? 130.666 104.424 100.747 1.00 0.00 ? 202 A A N9     1  
ATOM 6852   C C8     . A A 1 213 ? 130.904 105.286 99.705  1.00 0.00 ? 202 A A C8     1  
ATOM 6853   N N7     . A A 1 213 ? 131.732 104.814 98.807  1.00 0.00 ? 202 A A N7     1  
ATOM 6854   C C5     . A A 1 213 ? 132.063 103.555 99.288  1.00 0.00 ? 202 A A C5     1  
ATOM 6855   C C6     . A A 1 213 ? 132.904 102.542 98.793  1.00 0.00 ? 202 A A C6     1  
ATOM 6856   N N6     . A A 1 213 ? 133.594 102.644 97.655  1.00 0.00 ? 202 A A N6     1  
ATOM 6857   N N1     . A A 1 213 ? 133.014 101.407 99.516  1.00 0.00 ? 202 A A N1     1  
ATOM 6858   C C2     . A A 1 213 ? 132.322 101.305 100.658 1.00 0.00 ? 202 A A C2     1  
ATOM 6859   N N3     . A A 1 213 ? 131.501 102.185 101.226 1.00 0.00 ? 202 A A N3     1  
ATOM 6860   C C4     . A A 1 213 ? 131.414 103.302 100.482 1.00 0.00 ? 202 A A C4     1  
ATOM 6861   H "H5'"  . A A 1 213 ? 127.217 108.050 101.876 1.00 0.00 ? 202 A A "H5'"  1  
ATOM 6862   H "H5''" . A A 1 213 ? 128.691 108.543 101.516 1.00 0.00 ? 202 A A "H5''" 1  
ATOM 6863   H "H4'"  . A A 1 213 ? 128.091 106.512 103.092 1.00 0.00 ? 202 A A "H4'"  1  
ATOM 6864   H "H3'"  . A A 1 213 ? 130.628 107.152 101.986 1.00 0.00 ? 202 A A "H3'"  1  
ATOM 6865   H "H2'"  . A A 1 213 ? 131.480 105.262 102.987 1.00 0.00 ? 202 A A "H2'"  1  
ATOM 6866   H "HO2'" . A A 1 213 ? 130.256 104.013 104.437 1.00 0.00 ? 202 A A "HO2'" 1  
ATOM 6867   H "H1'"  . A A 1 213 ? 129.478 103.768 102.251 1.00 0.00 ? 202 A A "H1'"  1  
ATOM 6868   H H8     . A A 1 213 ? 130.492 106.174 99.640  1.00 0.00 ? 202 A A H8     1  
ATOM 6869   H H61    . A A 1 213 ? 134.165 101.903 97.360  1.00 0.00 ? 202 A A H61    1  
ATOM 6870   H H62    . A A 1 213 ? 133.530 103.458 97.113  1.00 0.00 ? 202 A A H62    1  
ATOM 6871   H H2     . A A 1 213 ? 132.436 100.461 101.145 1.00 0.00 ? 202 A A H2     1  
ATOM 6872   P P      . U A 1 214 ? 129.184 107.641 105.042 1.00 0.00 ? 203 U A P      1  
ATOM 6873   O OP1    . U A 1 214 ? 128.764 106.234 105.261 1.00 0.00 ? 203 U A OP1    1  
ATOM 6874   O OP2    . U A 1 214 ? 128.179 108.651 104.625 1.00 0.00 ? 203 U A OP2    1  
ATOM 6875   O "O5'"  . U A 1 214 ? 129.881 108.161 106.378 1.00 0.00 ? 203 U A "O5'"  1  
ATOM 6876   C "C5'"  . U A 1 214 ? 129.459 107.693 107.650 1.00 0.00 ? 203 U A "C5'"  1  
ATOM 6877   C "C4'"  . U A 1 214 ? 130.631 107.449 108.569 1.00 0.00 ? 203 U A "C4'"  1  
ATOM 6878   O "O4'"  . U A 1 214 ? 131.324 106.226 108.189 1.00 0.00 ? 203 U A "O4'"  1  
ATOM 6879   C "C3'"  . U A 1 214 ? 131.729 108.501 108.550 1.00 0.00 ? 203 U A "C3'"  1  
ATOM 6880   O "O3'"  . U A 1 214 ? 131.383 109.677 109.260 1.00 0.00 ? 203 U A "O3'"  1  
ATOM 6881   C "C2'"  . U A 1 214 ? 132.909 107.729 109.126 1.00 0.00 ? 203 U A "C2'"  1  
ATOM 6882   O "O2'"  . U A 1 214 ? 132.805 107.609 110.537 1.00 0.00 ? 203 U A "O2'"  1  
ATOM 6883   C "C1'"  . U A 1 214 ? 132.690 106.356 108.481 1.00 0.00 ? 203 U A "C1'"  1  
ATOM 6884   N N1     . U A 1 214 ? 133.493 106.179 107.247 1.00 0.00 ? 203 U A N1     1  
ATOM 6885   C C2     . U A 1 214 ? 134.853 105.979 107.404 1.00 0.00 ? 203 U A C2     1  
ATOM 6886   O O2     . U A 1 214 ? 135.399 105.942 108.492 1.00 0.00 ? 203 U A O2     1  
ATOM 6887   N N3     . U A 1 214 ? 135.556 105.819 106.235 1.00 0.00 ? 203 U A N3     1  
ATOM 6888   C C4     . U A 1 214 ? 135.053 105.840 104.952 1.00 0.00 ? 203 U A C4     1  
ATOM 6889   O O4     . U A 1 214 ? 135.818 105.681 103.999 1.00 0.00 ? 203 U A O4     1  
ATOM 6890   C C5     . U A 1 214 ? 133.640 106.052 104.867 1.00 0.00 ? 203 U A C5     1  
ATOM 6891   C C6     . U A 1 214 ? 132.930 106.209 105.989 1.00 0.00 ? 203 U A C6     1  
ATOM 6892   H "H5'"  . U A 1 214 ? 128.965 106.855 107.534 1.00 0.00 ? 203 U A "H5'"  1  
ATOM 6893   H "H5''" . U A 1 214 ? 128.868 108.360 108.057 1.00 0.00 ? 203 U A "H5''" 1  
ATOM 6894   H "H4'"  . U A 1 214 ? 130.298 107.356 109.486 1.00 0.00 ? 203 U A "H4'"  1  
ATOM 6895   H "H3'"  . U A 1 214 ? 131.938 108.736 107.622 1.00 0.00 ? 203 U A "H3'"  1  
ATOM 6896   H "H2'"  . U A 1 214 ? 133.763 108.126 108.858 1.00 0.00 ? 203 U A "H2'"  1  
ATOM 6897   H "HO2'" . U A 1 214 ? 133.589 107.125 110.875 1.00 0.00 ? 203 U A "HO2'" 1  
ATOM 6898   H "H1'"  . U A 1 214 ? 132.925 105.656 109.125 1.00 0.00 ? 203 U A "H1'"  1  
ATOM 6899   H H3     . U A 1 214 ? 136.521 105.676 106.323 1.00 0.00 ? 203 U A H3     1  
ATOM 6900   H H5     . U A 1 214 ? 133.197 106.080 103.993 1.00 0.00 ? 203 U A H5     1  
ATOM 6901   H H6     . U A 1 214 ? 131.966 106.353 105.904 1.00 0.00 ? 203 U A H6     1  
ATOM 6902   P P      . U A 1 215 ? 131.634 111.122 108.604 1.00 0.00 ? 204 U A P      1  
ATOM 6903   O OP1    . U A 1 215 ? 131.153 112.151 109.561 1.00 0.00 ? 204 U A OP1    1  
ATOM 6904   O OP2    . U A 1 215 ? 131.098 111.098 107.220 1.00 0.00 ? 204 U A OP2    1  
ATOM 6905   O "O5'"  . U A 1 215 ? 133.221 111.234 108.517 1.00 0.00 ? 204 U A "O5'"  1  
ATOM 6906   C "C5'"  . U A 1 215 ? 134.029 111.068 109.672 1.00 0.00 ? 204 U A "C5'"  1  
ATOM 6907   C "C4'"  . U A 1 215 ? 135.456 110.737 109.311 1.00 0.00 ? 204 U A "C4'"  1  
ATOM 6908   O "O4'"  . U A 1 215 ? 135.461 109.764 108.235 1.00 0.00 ? 204 U A "O4'"  1  
ATOM 6909   C "C3'"  . U A 1 215 ? 136.315 111.899 108.838 1.00 0.00 ? 204 U A "C3'"  1  
ATOM 6910   O "O3'"  . U A 1 215 ? 137.640 111.847 109.336 1.00 0.00 ? 204 U A "O3'"  1  
ATOM 6911   C "C2'"  . U A 1 215 ? 136.343 111.745 107.328 1.00 0.00 ? 204 U A "C2'"  1  
ATOM 6912   O "O2'"  . U A 1 215 ? 137.559 112.237 106.783 1.00 0.00 ? 204 U A "O2'"  1  
ATOM 6913   C "C1'"  . U A 1 215 ? 136.309 110.225 107.199 1.00 0.00 ? 204 U A "C1'"  1  
ATOM 6914   N N1     . U A 1 215 ? 135.756 109.783 105.896 1.00 0.00 ? 204 U A N1     1  
ATOM 6915   C C2     . U A 1 215 ? 136.561 108.980 105.110 1.00 0.00 ? 204 U A C2     1  
ATOM 6916   O O2     . U A 1 215 ? 137.681 108.631 105.441 1.00 0.00 ? 204 U A O2     1  
ATOM 6917   N N3     . U A 1 215 ? 136.008 108.594 103.913 1.00 0.00 ? 204 U A N3     1  
ATOM 6918   C C4     . U A 1 215 ? 134.759 108.922 103.430 1.00 0.00 ? 204 U A C4     1  
ATOM 6919   O O4     . U A 1 215 ? 134.405 108.496 102.330 1.00 0.00 ? 204 U A O4     1  
ATOM 6920   C C5     . U A 1 215 ? 133.982 109.754 104.297 1.00 0.00 ? 204 U A C5     1  
ATOM 6921   C C6     . U A 1 215 ? 134.496 110.143 105.469 1.00 0.00 ? 204 U A C6     1  
ATOM 6922   H "H5'"  . U A 1 215 ? 133.661 110.342 110.218 1.00 0.00 ? 204 U A "H5'"  1  
ATOM 6923   H "H5''" . U A 1 215 ? 134.016 111.898 110.193 1.00 0.00 ? 204 U A "H5''" 1  
ATOM 6924   H "H4'"  . U A 1 215 ? 135.882 110.324 110.090 1.00 0.00 ? 204 U A "H4'"  1  
ATOM 6925   H "H3'"  . U A 1 215 ? 135.906 112.749 109.102 1.00 0.00 ? 204 U A "H3'"  1  
ATOM 6926   H "H2'"  . U A 1 215 ? 135.563 112.165 106.909 1.00 0.00 ? 204 U A "H2'"  1  
ATOM 6927   H "HO2'" . U A 1 215 ? 137.517 112.179 105.805 1.00 0.00 ? 204 U A "HO2'" 1  
ATOM 6928   H "H1'"  . U A 1 215 ? 137.217 109.872 107.303 1.00 0.00 ? 204 U A "H1'"  1  
ATOM 6929   H H3     . U A 1 215 ? 136.562 108.025 103.340 1.00 0.00 ? 204 U A H3     1  
ATOM 6930   H H5     . U A 1 215 ? 133.081 110.036 104.034 1.00 0.00 ? 204 U A H5     1  
ATOM 6931   H H6     . U A 1 215 ? 133.945 110.713 106.044 1.00 0.00 ? 204 U A H6     1  
ATOM 6932   P P      . U A 1 216 ? 138.185 113.004 110.309 1.00 0.00 ? 205 U A P      1  
ATOM 6933   O OP1    . U A 1 216 ? 139.525 112.596 110.804 1.00 0.00 ? 205 U A OP1    1  
ATOM 6934   O OP2    . U A 1 216 ? 137.111 113.330 111.281 1.00 0.00 ? 205 U A OP2    1  
ATOM 6935   O "O5'"  . U A 1 216 ? 138.377 114.258 109.346 1.00 0.00 ? 205 U A "O5'"  1  
ATOM 6936   C "C5'"  . U A 1 216 ? 139.502 114.352 108.485 1.00 0.00 ? 205 U A "C5'"  1  
ATOM 6937   C "C4'"  . U A 1 216 ? 139.729 115.768 108.018 1.00 0.00 ? 205 U A "C4'"  1  
ATOM 6938   O "O4'"  . U A 1 216 ? 139.529 116.657 109.163 1.00 0.00 ? 205 U A "O4'"  1  
ATOM 6939   C "C3'"  . U A 1 216 ? 141.137 116.102 107.550 1.00 0.00 ? 205 U A "C3'"  1  
ATOM 6940   O "O3'"  . U A 1 216 ? 141.394 115.683 106.221 1.00 0.00 ? 205 U A "O3'"  1  
ATOM 6941   C "C2'"  . U A 1 216 ? 141.236 117.593 107.832 1.00 0.00 ? 205 U A "C2'"  1  
ATOM 6942   O "O2'"  . U A 1 216 ? 140.509 118.347 106.873 1.00 0.00 ? 205 U A "O2'"  1  
ATOM 6943   C "C1'"  . U A 1 216 ? 140.526 117.645 109.174 1.00 0.00 ? 205 U A "C1'"  1  
ATOM 6944   N N1     . U A 1 216 ? 141.446 117.384 110.307 1.00 0.00 ? 205 U A N1     1  
ATOM 6945   C C2     . U A 1 216 ? 142.068 118.478 110.880 1.00 0.00 ? 205 U A C2     1  
ATOM 6946   O O2     . U A 1 216 ? 141.890 119.621 110.496 1.00 0.00 ? 205 U A O2     1  
ATOM 6947   N N3     . U A 1 216 ? 142.910 118.189 111.926 1.00 0.00 ? 205 U A N3     1  
ATOM 6948   C C4     . U A 1 216 ? 143.190 116.945 112.448 1.00 0.00 ? 205 U A C4     1  
ATOM 6949   O O4     . U A 1 216 ? 143.974 116.849 113.394 1.00 0.00 ? 205 U A O4     1  
ATOM 6950   C C5     . U A 1 216 ? 142.512 115.860 111.806 1.00 0.00 ? 205 U A C5     1  
ATOM 6951   C C6     . U A 1 216 ? 141.685 116.113 110.786 1.00 0.00 ? 205 U A C6     1  
ATOM 6952   H "H5'"  . U A 1 216 ? 139.356 113.778 107.705 1.00 0.00 ? 205 U A "H5'"  1  
ATOM 6953   H "H5''" . U A 1 216 ? 140.298 114.043 108.965 1.00 0.00 ? 205 U A "H5''" 1  
ATOM 6954   H "H4'"  . U A 1 216 ? 139.096 116.010 107.311 1.00 0.00 ? 205 U A "H4'"  1  
ATOM 6955   H "H3'"  . U A 1 216 ? 141.761 115.650 108.155 1.00 0.00 ? 205 U A "H3'"  1  
ATOM 6956   H "H2'"  . U A 1 216 ? 142.169 117.886 107.892 1.00 0.00 ? 205 U A "H2'"  1  
ATOM 6957   H "HO2'" . U A 1 216 ? 140.615 119.302 107.070 1.00 0.00 ? 205 U A "HO2'" 1  
ATOM 6958   H "H1'"  . U A 1 216 ? 140.114 118.527 109.287 1.00 0.00 ? 205 U A "H1'"  1  
ATOM 6959   H H3     . U A 1 216 ? 143.361 118.951 112.346 1.00 0.00 ? 205 U A H3     1  
ATOM 6960   H H5     . U A 1 216 ? 142.652 114.940 112.113 1.00 0.00 ? 205 U A H5     1  
ATOM 6961   H H6     . U A 1 216 ? 141.234 115.354 110.364 1.00 0.00 ? 205 U A H6     1  
ATOM 6962   P P      . C A 1 217 ? 142.754 114.905 105.866 1.00 0.00 ? 206 C A P      1  
ATOM 6963   O OP1    . C A 1 217 ? 143.738 115.184 106.943 1.00 0.00 ? 206 C A OP1    1  
ATOM 6964   O OP2    . C A 1 217 ? 143.104 115.209 104.456 1.00 0.00 ? 206 C A OP2    1  
ATOM 6965   O "O5'"  . C A 1 217 ? 142.352 113.366 105.954 1.00 0.00 ? 206 C A "O5'"  1  
ATOM 6966   C "C5'"  . C A 1 217 ? 142.208 112.720 107.210 1.00 0.00 ? 206 C A "C5'"  1  
ATOM 6967   C "C4'"  . C A 1 217 ? 141.195 111.602 107.149 1.00 0.00 ? 206 C A "C4'"  1  
ATOM 6968   O "O4'"  . C A 1 217 ? 140.112 112.015 106.267 1.00 0.00 ? 206 C A "O4'"  1  
ATOM 6969   C "C3'"  . C A 1 217 ? 141.700 110.268 106.621 1.00 0.00 ? 206 C A "C3'"  1  
ATOM 6970   O "O3'"  . C A 1 217 ? 141.027 109.159 107.190 1.00 0.00 ? 206 C A "O3'"  1  
ATOM 6971   C "C2'"  . C A 1 217 ? 141.363 110.336 105.133 1.00 0.00 ? 206 C A "C2'"  1  
ATOM 6972   O "O2'"  . C A 1 217 ? 141.103 109.044 104.605 1.00 0.00 ? 206 C A "O2'"  1  
ATOM 6973   C "C1'"  . C A 1 217 ? 140.061 111.138 105.141 1.00 0.00 ? 206 C A "C1'"  1  
ATOM 6974   N N1     . C A 1 217 ? 139.912 111.983 103.931 1.00 0.00 ? 206 C A N1     1  
ATOM 6975   C C2     . C A 1 217 ? 139.028 111.561 102.930 1.00 0.00 ? 206 C A C2     1  
ATOM 6976   O O2     . C A 1 217 ? 138.401 110.501 103.082 1.00 0.00 ? 206 C A O2     1  
ATOM 6977   N N3     . C A 1 217 ? 138.873 112.314 101.816 1.00 0.00 ? 206 C A N3     1  
ATOM 6978   C C4     . C A 1 217 ? 139.559 113.448 101.676 1.00 0.00 ? 206 C A C4     1  
ATOM 6979   N N4     . C A 1 217 ? 139.374 114.158 100.561 1.00 0.00 ? 206 C A N4     1  
ATOM 6980   C C5     . C A 1 217 ? 140.465 113.904 102.675 1.00 0.00 ? 206 C A C5     1  
ATOM 6981   C C6     . C A 1 217 ? 140.609 113.152 103.773 1.00 0.00 ? 206 C A C6     1  
ATOM 6982   H "H5'"  . C A 1 217 ? 141.919 113.378 107.876 1.00 0.00 ? 206 C A "H5'"  1  
ATOM 6983   H "H5''" . C A 1 217 ? 143.075 112.351 107.480 1.00 0.00 ? 206 C A "H5''" 1  
ATOM 6984   H "H4'"  . C A 1 217 ? 140.817 111.467 108.042 1.00 0.00 ? 206 C A "H4'"  1  
ATOM 6985   H "H3'"  . C A 1 217 ? 142.664 110.170 106.768 1.00 0.00 ? 206 C A "H3'"  1  
ATOM 6986   H "H2'"  . C A 1 217 ? 142.063 110.800 104.628 1.00 0.00 ? 206 C A "H2'"  1  
ATOM 6987   H "HO2'" . C A 1 217 ? 140.752 109.135 103.695 1.00 0.00 ? 206 C A "HO2'" 1  
ATOM 6988   H "H1'"  . C A 1 217 ? 139.303 110.520 105.203 1.00 0.00 ? 206 C A "H1'"  1  
ATOM 6989   H H41    . C A 1 217 ? 138.750 113.841 99.875  1.00 0.00 ? 206 C A H41    1  
ATOM 6990   H H42    . C A 1 217 ? 139.863 114.997 100.428 1.00 0.00 ? 206 C A H42    1  
ATOM 6991   H H5     . C A 1 217 ? 140.964 114.740 102.563 1.00 0.00 ? 206 C A H5     1  
ATOM 6992   H H6     . C A 1 217 ? 141.228 113.449 104.471 1.00 0.00 ? 206 C A H6     1  
ATOM 6993   P P      . G A 1 218 ? 141.862 107.889 107.714 1.00 0.00 ? 207 G A P      1  
ATOM 6994   O OP1    . G A 1 218 ? 142.270 107.087 106.532 1.00 0.00 ? 207 G A OP1    1  
ATOM 6995   O OP2    . G A 1 218 ? 141.087 107.247 108.805 1.00 0.00 ? 207 G A OP2    1  
ATOM 6996   O "O5'"  . G A 1 218 ? 143.176 108.527 108.352 1.00 0.00 ? 207 G A "O5'"  1  
ATOM 6997   C "C5'"  . G A 1 218 ? 143.681 108.067 109.596 1.00 0.00 ? 207 G A "C5'"  1  
ATOM 6998   C "C4'"  . G A 1 218 ? 145.158 108.346 109.734 1.00 0.00 ? 207 G A "C4'"  1  
ATOM 6999   O "O4'"  . G A 1 218 ? 145.769 108.419 108.419 1.00 0.00 ? 207 G A "O4'"  1  
ATOM 7000   C "C3'"  . G A 1 218 ? 145.530 109.667 110.387 1.00 0.00 ? 207 G A "C3'"  1  
ATOM 7001   O "O3'"  . G A 1 218 ? 145.464 109.623 111.803 1.00 0.00 ? 207 G A "O3'"  1  
ATOM 7002   C "C2'"  . G A 1 218 ? 146.931 109.922 109.851 1.00 0.00 ? 207 G A "C2'"  1  
ATOM 7003   O "O2'"  . G A 1 218 ? 147.898 109.138 110.537 1.00 0.00 ? 207 G A "O2'"  1  
ATOM 7004   C "C1'"  . G A 1 218 ? 146.805 109.410 108.414 1.00 0.00 ? 207 G A "C1'"  1  
ATOM 7005   N N9     . G A 1 218 ? 146.484 110.494 107.465 1.00 0.00 ? 207 G A N9     1  
ATOM 7006   C C8     . G A 1 218 ? 145.282 110.726 106.842 1.00 0.00 ? 207 G A C8     1  
ATOM 7007   N N7     . G A 1 218 ? 145.305 111.764 106.052 1.00 0.00 ? 207 G A N7     1  
ATOM 7008   C C5     . G A 1 218 ? 146.600 112.248 106.159 1.00 0.00 ? 207 G A C5     1  
ATOM 7009   C C6     . G A 1 218 ? 147.222 113.362 105.534 1.00 0.00 ? 207 G A C6     1  
ATOM 7010   O O6     . G A 1 218 ? 146.733 114.167 104.735 1.00 0.00 ? 207 G A O6     1  
ATOM 7011   N N1     . G A 1 218 ? 148.553 113.492 105.925 1.00 0.00 ? 207 G A N1     1  
ATOM 7012   C C2     . G A 1 218 ? 149.201 112.660 106.803 1.00 0.00 ? 207 G A C2     1  
ATOM 7013   N N2     . G A 1 218 ? 150.487 112.948 107.057 1.00 0.00 ? 207 G A N2     1  
ATOM 7014   N N3     . G A 1 218 ? 148.634 111.620 107.393 1.00 0.00 ? 207 G A N3     1  
ATOM 7015   C C4     . G A 1 218 ? 147.343 111.475 107.027 1.00 0.00 ? 207 G A C4     1  
ATOM 7016   H "H5'"  . G A 1 218 ? 143.530 107.102 109.665 1.00 0.00 ? 207 G A "H5'"  1  
ATOM 7017   H "H5''" . G A 1 218 ? 143.202 108.519 110.323 1.00 0.00 ? 207 G A "H5''" 1  
ATOM 7018   H "H4'"  . G A 1 218 ? 145.572 107.615 110.237 1.00 0.00 ? 207 G A "H4'"  1  
ATOM 7019   H "H3'"  . G A 1 218 ? 144.930 110.369 110.060 1.00 0.00 ? 207 G A "H3'"  1  
ATOM 7020   H "H2'"  . G A 1 218 ? 147.157 110.877 109.872 1.00 0.00 ? 207 G A "H2'"  1  
ATOM 7021   H "HO2'" . G A 1 218 ? 147.525 108.851 111.394 1.00 0.00 ? 207 G A "HO2'" 1  
ATOM 7022   H "H1'"  . G A 1 218 ? 147.643 108.978 108.146 1.00 0.00 ? 207 G A "H1'"  1  
ATOM 7023   H H8     . G A 1 218 ? 144.488 110.169 106.977 1.00 0.00 ? 207 G A H8     1  
ATOM 7024   H H1     . G A 1 218 ? 149.061 114.235 105.542 1.00 0.00 ? 207 G A H1     1  
ATOM 7025   H H21    . G A 1 218 ? 150.912 113.716 106.626 1.00 0.00 ? 207 G A H21    1  
ATOM 7026   H H22    . G A 1 218 ? 151.001 112.390 107.677 1.00 0.00 ? 207 G A H22    1  
ATOM 7027   P P      . A A 1 219 ? 145.172 110.962 112.642 1.00 0.00 ? 208 A A P      1  
ATOM 7028   O OP1    . A A 1 219 ? 145.044 110.593 114.072 1.00 0.00 ? 208 A A OP1    1  
ATOM 7029   O OP2    . A A 1 219 ? 144.068 111.693 111.969 1.00 0.00 ? 208 A A OP2    1  
ATOM 7030   O "O5'"  . A A 1 219 ? 146.504 111.821 112.470 1.00 0.00 ? 208 A A "O5'"  1  
ATOM 7031   C "C5'"  . A A 1 219 ? 147.705 111.440 113.126 1.00 0.00 ? 208 A A "C5'"  1  
ATOM 7032   C "C4'"  . A A 1 219 ? 148.839 112.374 112.791 1.00 0.00 ? 208 A A "C4'"  1  
ATOM 7033   O "O4'"  . A A 1 219 ? 149.083 112.355 111.359 1.00 0.00 ? 208 A A "O4'"  1  
ATOM 7034   C "C3'"  . A A 1 219 ? 148.610 113.846 113.107 1.00 0.00 ? 208 A A "C3'"  1  
ATOM 7035   O "O3'"  . A A 1 219 ? 148.812 114.156 114.476 1.00 0.00 ? 208 A A "O3'"  1  
ATOM 7036   C "C2'"  . A A 1 219 ? 149.585 114.543 112.171 1.00 0.00 ? 208 A A "C2'"  1  
ATOM 7037   O "O2'"  . A A 1 219 ? 150.914 114.481 112.673 1.00 0.00 ? 208 A A "O2'"  1  
ATOM 7038   C "C1'"  . A A 1 219 ? 149.487 113.671 110.920 1.00 0.00 ? 208 A A "C1'"  1  
ATOM 7039   N N9     . A A 1 219 ? 148.536 114.216 109.934 1.00 0.00 ? 208 A A N9     1  
ATOM 7040   C C8     . A A 1 219 ? 147.268 113.775 109.649 1.00 0.00 ? 208 A A C8     1  
ATOM 7041   N N7     . A A 1 219 ? 146.663 114.469 108.717 1.00 0.00 ? 208 A A N7     1  
ATOM 7042   C C5     . A A 1 219 ? 147.594 115.432 108.362 1.00 0.00 ? 208 A A C5     1  
ATOM 7043   C C6     . A A 1 219 ? 147.566 116.478 107.423 1.00 0.00 ? 208 A A C6     1  
ATOM 7044   N N6     . A A 1 219 ? 146.519 116.741 106.636 1.00 0.00 ? 208 A A N6     1  
ATOM 7045   N N1     . A A 1 219 ? 148.664 117.259 107.316 1.00 0.00 ? 208 A A N1     1  
ATOM 7046   C C2     . A A 1 219 ? 149.716 116.997 108.104 1.00 0.00 ? 208 A A C2     1  
ATOM 7047   N N3     . A A 1 219 ? 149.862 116.047 109.023 1.00 0.00 ? 208 A A N3     1  
ATOM 7048   C C4     . A A 1 219 ? 148.754 115.289 109.103 1.00 0.00 ? 208 A A C4     1  
ATOM 7049   H "H5'"  . A A 1 219 ? 147.947 110.533 112.849 1.00 0.00 ? 208 A A "H5'"  1  
ATOM 7050   H "H5''" . A A 1 219 ? 147.558 111.453 114.094 1.00 0.00 ? 208 A A "H5''" 1  
ATOM 7051   H "H4'"  . A A 1 219 ? 149.648 112.073 113.254 1.00 0.00 ? 208 A A "H4'"  1  
ATOM 7052   H "H3'"  . A A 1 219 ? 147.694 114.090 112.854 1.00 0.00 ? 208 A A "H3'"  1  
ATOM 7053   H "H2'"  . A A 1 219 ? 149.310 115.466 111.986 1.00 0.00 ? 208 A A "H2'"  1  
ATOM 7054   H "HO2'" . A A 1 219 ? 150.883 114.297 113.633 1.00 0.00 ? 208 A A "HO2'" 1  
ATOM 7055   H "H1'"  . A A 1 219 ? 150.373 113.586 110.509 1.00 0.00 ? 208 A A "H1'"  1  
ATOM 7056   H H8     . A A 1 219 ? 146.851 113.011 110.104 1.00 0.00 ? 208 A A H8     1  
ATOM 7057   H H61    . A A 1 219 ? 146.557 117.484 106.001 1.00 0.00 ? 208 A A H61    1  
ATOM 7058   H H62    . A A 1 219 ? 145.712 116.186 106.696 1.00 0.00 ? 208 A A H62    1  
ATOM 7059   H H2     . A A 1 219 ? 150.485 117.594 107.986 1.00 0.00 ? 208 A A H2     1  
ATOM 7060   P P      . U A 1 220 ? 148.168 115.486 115.107 1.00 0.00 ? 209 U A P      1  
ATOM 7061   O OP1    . U A 1 220 ? 148.644 115.608 116.508 1.00 0.00 ? 209 U A OP1    1  
ATOM 7062   O OP2    . U A 1 220 ? 146.710 115.468 114.826 1.00 0.00 ? 209 U A OP2    1  
ATOM 7063   O "O5'"  . U A 1 220 ? 148.819 116.668 114.260 1.00 0.00 ? 209 U A "O5'"  1  
ATOM 7064   C "C5'"  . U A 1 220 ? 150.186 117.013 114.421 1.00 0.00 ? 209 U A "C5'"  1  
ATOM 7065   C "C4'"  . U A 1 220 ? 150.588 118.141 113.503 1.00 0.00 ? 209 U A "C4'"  1  
ATOM 7066   O "O4'"  . U A 1 220 ? 150.208 117.811 112.149 1.00 0.00 ? 209 U A "O4'"  1  
ATOM 7067   C "C3'"  . U A 1 220 ? 149.907 119.479 113.746 1.00 0.00 ? 209 U A "C3'"  1  
ATOM 7068   O "O3'"  . U A 1 220 ? 150.492 120.214 114.806 1.00 0.00 ? 209 U A "O3'"  1  
ATOM 7069   C "C2'"  . U A 1 220 ? 150.038 120.170 112.393 1.00 0.00 ? 209 U A "C2'"  1  
ATOM 7070   O "O2'"  . U A 1 220 ? 151.326 120.746 112.233 1.00 0.00 ? 209 U A "O2'"  1  
ATOM 7071   C "C1'"  . U A 1 220 ? 149.898 118.997 111.445 1.00 0.00 ? 209 U A "C1'"  1  
ATOM 7072   N N1     . U A 1 220 ? 148.529 118.884 110.887 1.00 0.00 ? 209 U A N1     1  
ATOM 7073   C C2     . U A 1 220 ? 148.189 119.755 109.868 1.00 0.00 ? 209 U A C2     1  
ATOM 7074   O O2     . U A 1 220 ? 148.957 120.590 109.422 1.00 0.00 ? 209 U A O2     1  
ATOM 7075   N N3     . U A 1 220 ? 146.913 119.613 109.382 1.00 0.00 ? 209 U A N3     1  
ATOM 7076   C C4     . U A 1 220 ? 145.958 118.711 109.801 1.00 0.00 ? 209 U A C4     1  
ATOM 7077   O O4     . U A 1 220 ? 144.850 118.709 109.263 1.00 0.00 ? 209 U A O4     1  
ATOM 7078   C C5     . U A 1 220 ? 146.380 117.843 110.858 1.00 0.00 ? 209 U A C5     1  
ATOM 7079   C C6     . U A 1 220 ? 147.618 117.958 111.349 1.00 0.00 ? 209 U A C6     1  
ATOM 7080   H "H5'"  . U A 1 220 ? 150.739 116.228 114.224 1.00 0.00 ? 209 U A "H5'"  1  
ATOM 7081   H "H5''" . U A 1 220 ? 150.340 117.288 115.349 1.00 0.00 ? 209 U A "H5''" 1  
ATOM 7082   H "H4'"  . U A 1 220 ? 151.560 118.252 113.546 1.00 0.00 ? 209 U A "H4'"  1  
ATOM 7083   H "H3'"  . U A 1 220 ? 148.958 119.328 113.936 1.00 0.00 ? 209 U A "H3'"  1  
ATOM 7084   H "H2'"  . U A 1 220 ? 149.327 120.830 112.257 1.00 0.00 ? 209 U A "H2'"  1  
ATOM 7085   H "HO2'" . U A 1 220 ? 151.374 121.183 111.356 1.00 0.00 ? 209 U A "HO2'" 1  
ATOM 7086   H "H1'"  . U A 1 220 ? 150.541 119.097 110.711 1.00 0.00 ? 209 U A "H1'"  1  
ATOM 7087   H H3     . U A 1 220 ? 146.651 120.221 108.659 1.00 0.00 ? 209 U A H3     1  
ATOM 7088   H H5     . U A 1 220 ? 145.765 117.169 111.218 1.00 0.00 ? 209 U A H5     1  
ATOM 7089   H H6     . U A 1 220 ? 147.882 117.353 112.072 1.00 0.00 ? 209 U A H6     1  
ATOM 7090   P P      . C A 1 221 ? 149.681 121.423 115.475 1.00 0.00 ? 210 C A P      1  
ATOM 7091   O OP1    . C A 1 221 ? 149.692 121.261 116.951 1.00 0.00 ? 210 C A OP1    1  
ATOM 7092   O OP2    . C A 1 221 ? 148.390 121.390 114.743 1.00 0.00 ? 210 C A OP2    1  
ATOM 7093   O "O5'"  . C A 1 221 ? 150.412 122.796 115.126 1.00 0.00 ? 210 C A "O5'"  1  
ATOM 7094   C "C5'"  . C A 1 221 ? 149.876 124.037 115.558 1.00 0.00 ? 210 C A "C5'"  1  
ATOM 7095   C "C4'"  . C A 1 221 ? 149.592 124.957 114.394 1.00 0.00 ? 210 C A "C4'"  1  
ATOM 7096   O "O4'"  . C A 1 221 ? 149.513 124.189 113.165 1.00 0.00 ? 210 C A "O4'"  1  
ATOM 7097   C "C3'"  . C A 1 221 ? 148.273 125.711 114.443 1.00 0.00 ? 210 C A "C3'"  1  
ATOM 7098   O "O3'"  . C A 1 221 ? 148.325 126.865 115.266 1.00 0.00 ? 210 C A "O3'"  1  
ATOM 7099   C "C2'"  . C A 1 221 ? 148.013 126.020 112.976 1.00 0.00 ? 210 C A "C2'"  1  
ATOM 7100   O "O2'"  . C A 1 221 ? 148.800 127.115 112.531 1.00 0.00 ? 210 C A "O2'"  1  
ATOM 7101   C "C1'"  . C A 1 221 ? 148.515 124.742 112.302 1.00 0.00 ? 210 C A "C1'"  1  
ATOM 7102   N N1     . C A 1 221 ? 147.425 123.764 112.066 1.00 0.00 ? 210 C A N1     1  
ATOM 7103   C C2     . C A 1 221 ? 146.549 123.990 110.997 1.00 0.00 ? 210 C A C2     1  
ATOM 7104   O O2     . C A 1 221 ? 146.707 124.993 110.286 1.00 0.00 ? 210 C A O2     1  
ATOM 7105   N N3     . C A 1 221 ? 145.547 123.114 110.760 1.00 0.00 ? 210 C A N3     1  
ATOM 7106   C C4     . C A 1 221 ? 145.398 122.043 111.539 1.00 0.00 ? 210 C A C4     1  
ATOM 7107   N N4     . C A 1 221 ? 144.395 121.204 111.268 1.00 0.00 ? 210 C A N4     1  
ATOM 7108   C C5     . C A 1 221 ? 146.271 121.785 112.633 1.00 0.00 ? 210 C A C5     1  
ATOM 7109   C C6     . C A 1 221 ? 147.259 122.658 112.858 1.00 0.00 ? 210 C A C6     1  
ATOM 7110   H "H5'"  . C A 1 221 ? 150.518 124.470 116.159 1.00 0.00 ? 210 C A "H5'"  1  
ATOM 7111   H "H5''" . C A 1 221 ? 149.043 123.873 116.045 1.00 0.00 ? 210 C A "H5''" 1  
ATOM 7112   H "H4'"  . C A 1 221 ? 150.326 125.602 114.318 1.00 0.00 ? 210 C A "H4'"  1  
ATOM 7113   H "H3'"  . C A 1 221 ? 147.571 125.112 114.774 1.00 0.00 ? 210 C A "H3'"  1  
ATOM 7114   H "H2'"  . C A 1 221 ? 147.059 126.165 112.802 1.00 0.00 ? 210 C A "H2'"  1  
ATOM 7115   H "HO2'" . C A 1 221 ? 149.093 127.633 113.310 1.00 0.00 ? 210 C A "HO2'" 1  
ATOM 7116   H "H1'"  . C A 1 221 ? 148.938 124.969 111.446 1.00 0.00 ? 210 C A "H1'"  1  
ATOM 7117   H H41    . C A 1 221 ? 143.795 121.385 110.515 1.00 0.00 ? 210 C A H41    1  
ATOM 7118   H H42    . C A 1 221 ? 144.258 120.407 111.823 1.00 0.00 ? 210 C A H42    1  
ATOM 7119   H H5     . C A 1 221 ? 146.154 120.994 113.201 1.00 0.00 ? 210 C A H5     1  
ATOM 7120   H H6     . C A 1 221 ? 147.871 122.498 113.606 1.00 0.00 ? 210 C A H6     1  
ATOM 7121   P P      . C A 1 222 ? 146.986 127.427 115.956 1.00 0.00 ? 211 C A P      1  
ATOM 7122   O OP1    . C A 1 222 ? 147.359 128.583 116.810 1.00 0.00 ? 211 C A OP1    1  
ATOM 7123   O OP2    . C A 1 222 ? 146.258 126.278 116.553 1.00 0.00 ? 211 C A OP2    1  
ATOM 7124   O "O5'"  . C A 1 222 ? 146.123 127.976 114.735 1.00 0.00 ? 211 C A "O5'"  1  
ATOM 7125   C "C5'"  . C A 1 222 ? 146.473 129.186 114.082 1.00 0.00 ? 211 C A "C5'"  1  
ATOM 7126   C "C4'"  . C A 1 222 ? 145.511 129.516 112.965 1.00 0.00 ? 211 C A "C4'"  1  
ATOM 7127   O "O4'"  . C A 1 222 ? 145.516 128.452 111.980 1.00 0.00 ? 211 C A "O4'"  1  
ATOM 7128   C "C3'"  . C A 1 222 ? 144.049 129.647 113.360 1.00 0.00 ? 211 C A "C3'"  1  
ATOM 7129   O "O3'"  . C A 1 222 ? 143.742 130.902 113.947 1.00 0.00 ? 211 C A "O3'"  1  
ATOM 7130   C "C2'"  . C A 1 222 ? 143.326 129.396 112.044 1.00 0.00 ? 211 C A "C2'"  1  
ATOM 7131   O "O2'"  . C A 1 222 ? 143.364 130.543 111.207 1.00 0.00 ? 211 C A "O2'"  1  
ATOM 7132   C "C1'"  . C A 1 222 ? 144.194 128.300 111.424 1.00 0.00 ? 211 C A "C1'"  1  
ATOM 7133   N N1     . C A 1 222 ? 143.661 126.940 111.691 1.00 0.00 ? 211 C A N1     1  
ATOM 7134   C C2     . C A 1 222 ? 142.570 126.493 110.936 1.00 0.00 ? 211 C A C2     1  
ATOM 7135   O O2     . C A 1 222 ? 142.083 127.240 110.074 1.00 0.00 ? 211 C A O2     1  
ATOM 7136   N N3     . C A 1 222 ? 142.064 125.259 111.160 1.00 0.00 ? 211 C A N3     1  
ATOM 7137   C C4     . C A 1 222 ? 142.605 124.475 112.093 1.00 0.00 ? 211 C A C4     1  
ATOM 7138   N N4     . C A 1 222 ? 142.074 123.264 112.280 1.00 0.00 ? 211 C A N4     1  
ATOM 7139   C C5     . C A 1 222 ? 143.714 124.900 112.879 1.00 0.00 ? 211 C A C5     1  
ATOM 7140   C C6     . C A 1 222 ? 144.206 126.124 112.648 1.00 0.00 ? 211 C A C6     1  
ATOM 7141   H "H5'"  . C A 1 222 ? 147.376 129.100 113.708 1.00 0.00 ? 211 C A "H5'"  1  
ATOM 7142   H "H5''" . C A 1 222 ? 146.467 129.917 114.734 1.00 0.00 ? 211 C A "H5''" 1  
ATOM 7143   H "H4'"  . C A 1 222 ? 145.800 130.349 112.535 1.00 0.00 ? 211 C A "H4'"  1  
ATOM 7144   H "H3'"  . C A 1 222 ? 143.822 128.932 113.992 1.00 0.00 ? 211 C A "H3'"  1  
ATOM 7145   H "H2'"  . C A 1 222 ? 142.407 129.085 112.192 1.00 0.00 ? 211 C A "H2'"  1  
ATOM 7146   H "HO2'" . C A 1 222 ? 143.555 131.332 111.756 1.00 0.00 ? 211 C A "HO2'" 1  
ATOM 7147   H "H1'"  . C A 1 222 ? 144.253 128.439 110.457 1.00 0.00 ? 211 C A "H1'"  1  
ATOM 7148   H H41    . C A 1 222 ? 141.309 122.975 111.736 1.00 0.00 ? 211 C A H41    1  
ATOM 7149   H H42    . C A 1 222 ? 142.449 122.665 112.958 1.00 0.00 ? 211 C A H42    1  
ATOM 7150   H H5     . C A 1 222 ? 144.105 124.317 113.562 1.00 0.00 ? 211 C A H5     1  
ATOM 7151   H H6     . C A 1 222 ? 144.967 126.434 113.177 1.00 0.00 ? 211 C A H6     1  
ATOM 7152   P P      . A A 1 223 ? 142.502 131.038 114.961 1.00 0.00 ? 212 A A P      1  
ATOM 7153   O OP1    . A A 1 223 ? 142.518 132.411 115.525 1.00 0.00 ? 212 A A OP1    1  
ATOM 7154   O OP2    . A A 1 223 ? 142.525 129.869 115.875 1.00 0.00 ? 212 A A OP2    1  
ATOM 7155   O "O5'"  . A A 1 223 ? 141.221 130.904 114.024 1.00 0.00 ? 212 A A "O5'"  1  
ATOM 7156   C "C5'"  . A A 1 223 ? 140.920 131.897 113.055 1.00 0.00 ? 212 A A "C5'"  1  
ATOM 7157   C "C4'"  . A A 1 223 ? 139.730 131.510 112.214 1.00 0.00 ? 212 A A "C4'"  1  
ATOM 7158   O "O4'"  . A A 1 223 ? 140.022 130.293 111.480 1.00 0.00 ? 212 A A "O4'"  1  
ATOM 7159   C "C3'"  . A A 1 223 ? 138.453 131.186 112.976 1.00 0.00 ? 212 A A "C3'"  1  
ATOM 7160   O "O3'"  . A A 1 223 ? 137.745 132.343 113.391 1.00 0.00 ? 212 A A "O3'"  1  
ATOM 7161   C "C2'"  . A A 1 223 ? 137.686 130.323 111.983 1.00 0.00 ? 212 A A "C2'"  1  
ATOM 7162   O "O2'"  . A A 1 223 ? 137.067 131.119 110.980 1.00 0.00 ? 212 A A "O2'"  1  
ATOM 7163   C "C1'"  . A A 1 223 ? 138.815 129.512 111.347 1.00 0.00 ? 212 A A "C1'"  1  
ATOM 7164   N N9     . A A 1 223 ? 138.973 128.189 111.981 1.00 0.00 ? 212 A A N9     1  
ATOM 7165   C C8     . A A 1 223 ? 139.938 127.789 112.871 1.00 0.00 ? 212 A A C8     1  
ATOM 7166   N N7     . A A 1 223 ? 139.815 126.544 113.261 1.00 0.00 ? 212 A A N7     1  
ATOM 7167   C C5     . A A 1 223 ? 138.693 126.092 112.580 1.00 0.00 ? 212 A A C5     1  
ATOM 7168   C C6     . A A 1 223 ? 138.033 124.849 112.560 1.00 0.00 ? 212 A A C6     1  
ATOM 7169   N N6     . A A 1 223 ? 138.428 123.791 113.272 1.00 0.00 ? 212 A A N6     1  
ATOM 7170   N N1     . A A 1 223 ? 136.942 124.730 111.776 1.00 0.00 ? 212 A A N1     1  
ATOM 7171   C C2     . A A 1 223 ? 136.544 125.791 111.062 1.00 0.00 ? 212 A A C2     1  
ATOM 7172   N N3     . A A 1 223 ? 137.079 127.009 110.997 1.00 0.00 ? 212 A A N3     1  
ATOM 7173   C C4     . A A 1 223 ? 138.163 127.094 111.790 1.00 0.00 ? 212 A A C4     1  
ATOM 7174   H "H5'"  . A A 1 223 ? 141.698 132.021 112.470 1.00 0.00 ? 212 A A "H5'"  1  
ATOM 7175   H "H5''" . A A 1 223 ? 140.728 132.743 113.512 1.00 0.00 ? 212 A A "H5''" 1  
ATOM 7176   H "H4'"  . A A 1 223 ? 139.544 132.231 111.576 1.00 0.00 ? 212 A A "H4'"  1  
ATOM 7177   H "H3'"  . A A 1 223 ? 138.677 130.646 113.762 1.00 0.00 ? 212 A A "H3'"  1  
ATOM 7178   H "H2'"  . A A 1 223 ? 137.037 129.744 112.436 1.00 0.00 ? 212 A A "H2'"  1  
ATOM 7179   H "HO2'" . A A 1 223 ? 136.992 132.040 111.305 1.00 0.00 ? 212 A A "HO2'" 1  
ATOM 7180   H "H1'"  . A A 1 223 ? 138.634 129.396 110.391 1.00 0.00 ? 212 A A "H1'"  1  
ATOM 7181   H H8     . A A 1 223 ? 140.653 128.380 113.186 1.00 0.00 ? 212 A A H8     1  
ATOM 7182   H H61    . A A 1 223 ? 137.927 122.949 113.216 1.00 0.00 ? 212 A A H61    1  
ATOM 7183   H H62    . A A 1 223 ? 139.218 123.853 113.847 1.00 0.00 ? 212 A A H62    1  
ATOM 7184   H H2     . A A 1 223 ? 135.747 125.652 110.509 1.00 0.00 ? 212 A A H2     1  
ATOM 7185   P P      . A A 1 224 ? 136.806 132.290 114.694 1.00 0.00 ? 213 A A P      1  
ATOM 7186   O OP1    . A A 1 224 ? 136.312 133.664 114.959 1.00 0.00 ? 213 A A OP1    1  
ATOM 7187   O OP2    . A A 1 224 ? 137.536 131.554 115.756 1.00 0.00 ? 213 A A OP2    1  
ATOM 7188   O "O5'"  . A A 1 224 ? 135.566 131.399 114.239 1.00 0.00 ? 213 A A "O5'"  1  
ATOM 7189   C "C5'"  . A A 1 224 ? 134.663 131.860 113.246 1.00 0.00 ? 213 A A "C5'"  1  
ATOM 7190   C "C4'"  . A A 1 224 ? 133.669 130.792 112.864 1.00 0.00 ? 213 A A "C4'"  1  
ATOM 7191   O "O4'"  . A A 1 224 ? 134.368 129.644 112.316 1.00 0.00 ? 213 A A "O4'"  1  
ATOM 7192   C "C3'"  . A A 1 224 ? 132.838 130.215 114.000 1.00 0.00 ? 213 A A "C3'"  1  
ATOM 7193   O "O3'"  . A A 1 224 ? 131.754 131.051 114.372 1.00 0.00 ? 213 A A "O3'"  1  
ATOM 7194   C "C2'"  . A A 1 224 ? 132.408 128.867 113.446 1.00 0.00 ? 213 A A "C2'"  1  
ATOM 7195   O "O2'"  . A A 1 224 ? 131.334 129.005 112.528 1.00 0.00 ? 213 A A "O2'"  1  
ATOM 7196   C "C1'"  . A A 1 224 ? 133.662 128.436 112.683 1.00 0.00 ? 213 A A "C1'"  1  
ATOM 7197   N N9     . A A 1 224 ? 134.517 127.538 113.480 1.00 0.00 ? 213 A A N9     1  
ATOM 7198   C C8     . A A 1 224 ? 135.693 127.839 114.123 1.00 0.00 ? 213 A A C8     1  
ATOM 7199   N N7     . A A 1 224 ? 136.225 126.825 114.754 1.00 0.00 ? 213 A A N7     1  
ATOM 7200   C C5     . A A 1 224 ? 135.344 125.780 114.513 1.00 0.00 ? 213 A A C5     1  
ATOM 7201   C C6     . A A 1 224 ? 135.343 124.431 114.908 1.00 0.00 ? 213 A A C6     1  
ATOM 7202   N N6     . A A 1 224 ? 136.295 123.881 115.663 1.00 0.00 ? 213 A A N6     1  
ATOM 7203   N N1     . A A 1 224 ? 134.314 123.658 114.496 1.00 0.00 ? 213 A A N1     1  
ATOM 7204   C C2     . A A 1 224 ? 133.360 124.209 113.739 1.00 0.00 ? 213 A A C2     1  
ATOM 7205   N N3     . A A 1 224 ? 133.251 125.463 113.304 1.00 0.00 ? 213 A A N3     1  
ATOM 7206   C C4     . A A 1 224 ? 134.288 126.206 113.729 1.00 0.00 ? 213 A A C4     1  
ATOM 7207   H "H5'"  . A A 1 224 ? 135.171 132.124 112.450 1.00 0.00 ? 213 A A "H5'"  1  
ATOM 7208   H "H5''" . A A 1 224 ? 134.180 132.639 113.587 1.00 0.00 ? 213 A A "H5''" 1  
ATOM 7209   H "H4'"  . A A 1 224 ? 133.065 131.153 112.181 1.00 0.00 ? 213 A A "H4'"  1  
ATOM 7210   H "H3'"  . A A 1 224 ? 133.416 130.073 114.779 1.00 0.00 ? 213 A A "H3'"  1  
ATOM 7211   H "H2'"  . A A 1 224 ? 132.191 128.234 114.163 1.00 0.00 ? 213 A A "H2'"  1  
ATOM 7212   H "HO2'" . A A 1 224 ? 130.892 129.866 112.679 1.00 0.00 ? 213 A A "HO2'" 1  
ATOM 7213   H "H1'"  . A A 1 224 ? 133.399 127.986 111.853 1.00 0.00 ? 213 A A "H1'"  1  
ATOM 7214   H H8     . A A 1 224 ? 136.094 128.735 114.110 1.00 0.00 ? 213 A A H8     1  
ATOM 7215   H H61    . A A 1 224 ? 136.239 122.933 115.907 1.00 0.00 ? 213 A A H61    1  
ATOM 7216   H H62    . A A 1 224 ? 137.050 124.422 115.973 1.00 0.00 ? 213 A A H62    1  
ATOM 7217   H H2     . A A 1 224 ? 132.638 123.606 113.466 1.00 0.00 ? 213 A A H2     1  
ATOM 7218   P P      . C A 1 225 ? 131.183 131.010 115.875 1.00 0.00 ? 214 C A P      1  
ATOM 7219   O OP1    . C A 1 225 ? 130.153 132.073 116.004 1.00 0.00 ? 214 C A OP1    1  
ATOM 7220   O OP2    . C A 1 225 ? 132.338 130.992 116.807 1.00 0.00 ? 214 C A OP2    1  
ATOM 7221   O "O5'"  . C A 1 225 ? 130.448 129.599 115.972 1.00 0.00 ? 214 C A "O5'"  1  
ATOM 7222   C "C5'"  . C A 1 225 ? 129.268 129.340 115.230 1.00 0.00 ? 214 C A "C5'"  1  
ATOM 7223   C "C4'"  . C A 1 225 ? 128.822 127.904 115.376 1.00 0.00 ? 214 C A "C4'"  1  
ATOM 7224   O "O4'"  . C A 1 225 ? 129.857 127.013 114.883 1.00 0.00 ? 214 C A "O4'"  1  
ATOM 7225   C "C3'"  . C A 1 225 ? 128.566 127.424 116.796 1.00 0.00 ? 214 C A "C3'"  1  
ATOM 7226   O "O3'"  . C A 1 225 ? 127.307 127.834 117.301 1.00 0.00 ? 214 C A "O3'"  1  
ATOM 7227   C "C2'"  . C A 1 225 ? 128.711 125.913 116.666 1.00 0.00 ? 214 C A "C2'"  1  
ATOM 7228   O "O2'"  . C A 1 225 ? 127.549 125.331 116.090 1.00 0.00 ? 214 C A "O2'"  1  
ATOM 7229   C "C1'"  . C A 1 225 ? 129.866 125.802 115.671 1.00 0.00 ? 214 C A "C1'"  1  
ATOM 7230   N N1     . C A 1 225 ? 131.174 125.612 116.343 1.00 0.00 ? 214 C A N1     1  
ATOM 7231   C C2     . C A 1 225 ? 131.494 124.336 116.829 1.00 0.00 ? 214 C A C2     1  
ATOM 7232   O O2     . C A 1 225 ? 130.680 123.412 116.683 1.00 0.00 ? 214 C A O2     1  
ATOM 7233   N N3     . C A 1 225 ? 132.680 124.135 117.447 1.00 0.00 ? 214 C A N3     1  
ATOM 7234   C C4     . C A 1 225 ? 133.536 125.145 117.591 1.00 0.00 ? 214 C A C4     1  
ATOM 7235   N N4     . C A 1 225 ? 134.696 124.900 118.207 1.00 0.00 ? 214 C A N4     1  
ATOM 7236   C C5     . C A 1 225 ? 133.244 126.453 117.111 1.00 0.00 ? 214 C A C5     1  
ATOM 7237   C C6     . C A 1 225 ? 132.067 126.639 116.499 1.00 0.00 ? 214 C A C6     1  
ATOM 7238   H "H5'"  . C A 1 225 ? 129.439 129.527 114.283 1.00 0.00 ? 214 C A "H5'"  1  
ATOM 7239   H "H5''" . C A 1 225 ? 128.553 129.928 115.549 1.00 0.00 ? 214 C A "H5''" 1  
ATOM 7240   H "H4'"  . C A 1 225 ? 128.011 127.771 114.843 1.00 0.00 ? 214 C A "H4'"  1  
ATOM 7241   H "H3'"  . C A 1 225 ? 129.274 127.764 117.383 1.00 0.00 ? 214 C A "H3'"  1  
ATOM 7242   H "H2'"  . C A 1 225 ? 128.937 125.499 117.525 1.00 0.00 ? 214 C A "H2'"  1  
ATOM 7243   H "HO2'" . C A 1 225 ? 126.799 125.951 116.194 1.00 0.00 ? 214 C A "HO2'" 1  
ATOM 7244   H "H1'"  . C A 1 225 ? 129.703 125.050 115.063 1.00 0.00 ? 214 C A "H1'"  1  
ATOM 7245   H H41    . C A 1 225 ? 134.895 123.999 118.538 1.00 0.00 ? 214 C A H41    1  
ATOM 7246   H H42    . C A 1 225 ? 135.347 125.622 118.330 1.00 0.00 ? 214 C A H42    1  
ATOM 7247   H H5     . C A 1 225 ? 133.880 127.190 117.220 1.00 0.00 ? 214 C A H5     1  
ATOM 7248   H H6     . C A 1 225 ? 131.846 127.532 116.161 1.00 0.00 ? 214 C A H6     1  
ATOM 7249   P P      . C A 1 226 ? 127.086 127.998 118.885 1.00 0.00 ? 215 C A P      1  
ATOM 7250   O OP1    . C A 1 226 ? 125.723 128.545 119.104 1.00 0.00 ? 215 C A OP1    1  
ATOM 7251   O OP2    . C A 1 226 ? 128.261 128.714 119.442 1.00 0.00 ? 215 C A OP2    1  
ATOM 7252   O "O5'"  . C A 1 226 ? 127.113 126.504 119.437 1.00 0.00 ? 215 C A "O5'"  1  
ATOM 7253   C "C5'"  . C A 1 226 ? 126.072 125.591 119.120 1.00 0.00 ? 215 C A "C5'"  1  
ATOM 7254   C "C4'"  . C A 1 226 ? 126.362 124.210 119.652 1.00 0.00 ? 215 C A "C4'"  1  
ATOM 7255   O "O4'"  . C A 1 226 ? 127.582 123.697 119.058 1.00 0.00 ? 215 C A "O4'"  1  
ATOM 7256   C "C3'"  . C A 1 226 ? 126.609 124.105 121.149 1.00 0.00 ? 215 C A "C3'"  1  
ATOM 7257   O "O3'"  . C A 1 226 ? 125.413 124.120 121.911 1.00 0.00 ? 215 C A "O3'"  1  
ATOM 7258   C "C2'"  . C A 1 226 ? 127.393 122.806 121.269 1.00 0.00 ? 215 C A "C2'"  1  
ATOM 7259   O "O2'"  . C A 1 226 ? 126.537 121.677 121.173 1.00 0.00 ? 215 C A "O2'"  1  
ATOM 7260   C "C1'"  . C A 1 226 ? 128.275 122.868 120.020 1.00 0.00 ? 215 C A "C1'"  1  
ATOM 7261   N N1     . C A 1 226 ? 129.628 123.399 120.311 1.00 0.00 ? 215 C A N1     1  
ATOM 7262   C C2     . C A 1 226 ? 130.565 122.547 120.909 1.00 0.00 ? 215 C A C2     1  
ATOM 7263   O O2     . C A 1 226 ? 130.239 121.380 121.176 1.00 0.00 ? 215 C A O2     1  
ATOM 7264   N N3     . C A 1 226 ? 131.806 123.008 121.185 1.00 0.00 ? 215 C A N3     1  
ATOM 7265   C C4     . C A 1 226 ? 132.132 124.265 120.887 1.00 0.00 ? 215 C A C4     1  
ATOM 7266   N N4     . C A 1 226 ? 133.370 124.677 121.177 1.00 0.00 ? 215 C A N4     1  
ATOM 7267   C C5     . C A 1 226 ? 131.204 125.157 120.280 1.00 0.00 ? 215 C A C5     1  
ATOM 7268   C C6     . C A 1 226 ? 129.980 124.690 120.012 1.00 0.00 ? 215 C A C6     1  
ATOM 7269   H "H5'"  . C A 1 226 ? 125.973 125.544 118.147 1.00 0.00 ? 215 C A "H5'"  1  
ATOM 7270   H "H5''" . C A 1 226 ? 125.236 125.915 119.512 1.00 0.00 ? 215 C A "H5''" 1  
ATOM 7271   H "H4'"  . C A 1 226 ? 125.619 123.617 119.412 1.00 0.00 ? 215 C A "H4'"  1  
ATOM 7272   H "H3'"  . C A 1 226 ? 127.181 124.851 121.434 1.00 0.00 ? 215 C A "H3'"  1  
ATOM 7273   H "H2'"  . C A 1 226 ? 127.932 122.784 122.086 1.00 0.00 ? 215 C A "H2'"  1  
ATOM 7274   H "HO2'" . C A 1 226 ? 125.620 121.953 121.369 1.00 0.00 ? 215 C A "HO2'" 1  
ATOM 7275   H "H1'"  . C A 1 226 ? 128.357 121.970 119.633 1.00 0.00 ? 215 C A "H1'"  1  
ATOM 7276   H H41    . C A 1 226 ? 134.005 124.060 121.596 1.00 0.00 ? 215 C A H41    1  
ATOM 7277   H H42    . C A 1 226 ? 133.641 125.596 120.971 1.00 0.00 ? 215 C A H42    1  
ATOM 7278   H H5     . C A 1 226 ? 131.455 126.081 120.066 1.00 0.00 ? 215 C A H5     1  
ATOM 7279   H H6     . C A 1 226 ? 129.325 125.288 119.594 1.00 0.00 ? 215 C A H6     1  
ATOM 7280   P P      . G A 1 227 ? 125.461 124.445 123.485 1.00 0.00 ? 216 G A P      1  
ATOM 7281   O OP1    . G A 1 227 ? 124.161 124.039 124.079 1.00 0.00 ? 216 G A OP1    1  
ATOM 7282   O OP2    . G A 1 227 ? 125.941 125.840 123.652 1.00 0.00 ? 216 G A OP2    1  
ATOM 7283   O "O5'"  . G A 1 227 ? 126.586 123.466 124.047 1.00 0.00 ? 216 G A "O5'"  1  
ATOM 7284   C "C5'"  . G A 1 227 ? 126.333 122.077 124.201 1.00 0.00 ? 216 G A "C5'"  1  
ATOM 7285   C "C4'"  . G A 1 227 ? 127.516 121.362 124.806 1.00 0.00 ? 216 G A "C4'"  1  
ATOM 7286   O "O4'"  . G A 1 227 ? 128.750 121.888 124.260 1.00 0.00 ? 216 G A "O4'"  1  
ATOM 7287   C "C3'"  . G A 1 227 ? 127.694 121.520 126.309 1.00 0.00 ? 216 G A "C3'"  1  
ATOM 7288   O "O3'"  . G A 1 227 ? 126.979 120.550 127.056 1.00 0.00 ? 216 G A "O3'"  1  
ATOM 7289   C "C2'"  . G A 1 227 ? 129.199 121.403 126.467 1.00 0.00 ? 216 G A "C2'"  1  
ATOM 7290   O "O2'"  . G A 1 227 ? 129.623 120.051 126.379 1.00 0.00 ? 216 G A "O2'"  1  
ATOM 7291   C "C1'"  . G A 1 227 ? 129.681 122.162 125.232 1.00 0.00 ? 216 G A "C1'"  1  
ATOM 7292   N N9     . G A 1 227 ? 129.689 123.622 125.445 1.00 0.00 ? 216 G A N9     1  
ATOM 7293   C C8     . G A 1 227 ? 129.130 124.583 124.639 1.00 0.00 ? 216 G A C8     1  
ATOM 7294   N N7     . G A 1 227 ? 129.303 125.796 125.090 1.00 0.00 ? 216 G A N7     1  
ATOM 7295   C C5     . G A 1 227 ? 130.019 125.626 126.266 1.00 0.00 ? 216 G A C5     1  
ATOM 7296   C C6     . G A 1 227 ? 130.497 126.583 127.199 1.00 0.00 ? 216 G A C6     1  
ATOM 7297   O O6     . G A 1 227 ? 130.380 127.813 127.168 1.00 0.00 ? 216 G A O6     1  
ATOM 7298   N N1     . G A 1 227 ? 131.176 125.978 128.252 1.00 0.00 ? 216 G A N1     1  
ATOM 7299   C C2     . G A 1 227 ? 131.368 124.625 128.393 1.00 0.00 ? 216 G A C2     1  
ATOM 7300   N N2     . G A 1 227 ? 132.049 124.230 129.479 1.00 0.00 ? 216 G A N2     1  
ATOM 7301   N N3     . G A 1 227 ? 130.928 123.723 127.531 1.00 0.00 ? 216 G A N3     1  
ATOM 7302   C C4     . G A 1 227 ? 130.266 124.289 126.501 1.00 0.00 ? 216 G A C4     1  
ATOM 7303   H "H5'"  . G A 1 227 ? 126.139 121.688 123.323 1.00 0.00 ? 216 G A "H5'"  1  
ATOM 7304   H "H5''" . G A 1 227 ? 125.554 121.957 124.784 1.00 0.00 ? 216 G A "H5''" 1  
ATOM 7305   H "H4'"  . G A 1 227 ? 127.456 120.409 124.587 1.00 0.00 ? 216 G A "H4'"  1  
ATOM 7306   H "H3'"  . G A 1 227 ? 127.410 122.419 126.574 1.00 0.00 ? 216 G A "H3'"  1  
ATOM 7307   H "H2'"  . G A 1 227 ? 129.507 121.827 127.296 1.00 0.00 ? 216 G A "H2'"  1  
ATOM 7308   H "HO2'" . G A 1 227 ? 128.876 119.465 126.625 1.00 0.00 ? 216 G A "HO2'" 1  
ATOM 7309   H "H1'"  . G A 1 227 ? 130.583 121.861 124.996 1.00 0.00 ? 216 G A "H1'"  1  
ATOM 7310   H H8     . G A 1 227 ? 128.651 124.381 123.808 1.00 0.00 ? 216 G A H8     1  
ATOM 7311   H H1     . G A 1 227 ? 131.543 126.564 128.947 1.00 0.00 ? 216 G A H1     1  
ATOM 7312   H H21    . G A 1 227 ? 132.379 124.892 130.121 1.00 0.00 ? 216 G A H21    1  
ATOM 7313   H H22    . G A 1 227 ? 132.217 123.276 129.631 1.00 0.00 ? 216 G A H22    1  
ATOM 7314   P P      . A A 1 228 ? 125.693 120.980 127.918 1.00 0.00 ? 217 A A P      1  
ATOM 7315   O OP1    . A A 1 228 ? 124.648 119.942 127.736 1.00 0.00 ? 217 A A OP1    1  
ATOM 7316   O OP2    . A A 1 228 ? 125.383 122.397 127.604 1.00 0.00 ? 217 A A OP2    1  
ATOM 7317   O "O5'"  . A A 1 228 ? 126.200 120.910 129.427 1.00 0.00 ? 217 A A "O5'"  1  
ATOM 7318   C "C5'"  . A A 1 228 ? 125.283 120.738 130.497 1.00 0.00 ? 217 A A "C5'"  1  
ATOM 7319   C "C4'"  . A A 1 228 ? 125.976 120.793 131.835 1.00 0.00 ? 217 A A "C4'"  1  
ATOM 7320   O "O4'"  . A A 1 228 ? 126.998 119.763 131.852 1.00 0.00 ? 217 A A "O4'"  1  
ATOM 7321   C "C3'"  . A A 1 228 ? 126.745 122.070 132.137 1.00 0.00 ? 217 A A "C3'"  1  
ATOM 7322   O "O3'"  . A A 1 228 ? 125.927 123.096 132.672 1.00 0.00 ? 217 A A "O3'"  1  
ATOM 7323   C "C2'"  . A A 1 228 ? 127.818 121.572 133.083 1.00 0.00 ? 217 A A "C2'"  1  
ATOM 7324   O "O2'"  . A A 1 228 ? 127.289 121.330 134.379 1.00 0.00 ? 217 A A "O2'"  1  
ATOM 7325   C "C1'"  . A A 1 228 ? 128.167 120.250 132.420 1.00 0.00 ? 217 A A "C1'"  1  
ATOM 7326   N N9     . A A 1 228 ? 129.172 120.412 131.352 1.00 0.00 ? 217 A A N9     1  
ATOM 7327   C C8     . A A 1 228 ? 128.965 120.429 129.995 1.00 0.00 ? 217 A A C8     1  
ATOM 7328   N N7     . A A 1 228 ? 130.061 120.591 129.296 1.00 0.00 ? 217 A A N7     1  
ATOM 7329   C C5     . A A 1 228 ? 131.059 120.687 130.257 1.00 0.00 ? 217 A A C5     1  
ATOM 7330   C C6     . A A 1 228 ? 132.450 120.866 130.164 1.00 0.00 ? 217 A A C6     1  
ATOM 7331   N N6     . A A 1 228 ? 133.105 120.987 129.007 1.00 0.00 ? 217 A A N6     1  
ATOM 7332   N N1     . A A 1 228 ? 133.155 120.919 131.314 1.00 0.00 ? 217 A A N1     1  
ATOM 7333   C C2     . A A 1 228 ? 132.499 120.799 132.475 1.00 0.00 ? 217 A A C2     1  
ATOM 7334   N N3     . A A 1 228 ? 131.196 120.627 132.691 1.00 0.00 ? 217 A A N3     1  
ATOM 7335   C C4     . A A 1 228 ? 130.524 120.579 131.527 1.00 0.00 ? 217 A A C4     1  
ATOM 7336   H "H5'"  . A A 1 228 ? 124.839 119.869 130.402 1.00 0.00 ? 217 A A "H5'"  1  
ATOM 7337   H "H5''" . A A 1 228 ? 124.608 121.447 130.457 1.00 0.00 ? 217 A A "H5''" 1  
ATOM 7338   H "H4'"  . A A 1 228 ? 125.318 120.619 132.541 1.00 0.00 ? 217 A A "H4'"  1  
ATOM 7339   H "H3'"  . A A 1 228 ? 127.164 122.395 131.313 1.00 0.00 ? 217 A A "H3'"  1  
ATOM 7340   H "H2'"  . A A 1 228 ? 128.584 122.184 133.111 1.00 0.00 ? 217 A A "H2'"  1  
ATOM 7341   H "HO2'" . A A 1 228 ? 126.945 120.413 134.416 1.00 0.00 ? 217 A A "HO2'" 1  
ATOM 7342   H "H1'"  . A A 1 228 ? 128.507 119.627 133.097 1.00 0.00 ? 217 A A "H1'"  1  
ATOM 7343   H H8     . A A 1 228 ? 128.080 120.330 129.586 1.00 0.00 ? 217 A A H8     1  
ATOM 7344   H H61    . A A 1 228 ? 134.078 121.110 129.005 1.00 0.00 ? 217 A A H61    1  
ATOM 7345   H H62    . A A 1 228 ? 132.614 120.951 128.159 1.00 0.00 ? 217 A A H62    1  
ATOM 7346   H H2     . A A 1 228 ? 133.056 120.844 133.280 1.00 0.00 ? 217 A A H2     1  
ATOM 7347   P P      . G A 1 229 ? 125.579 124.394 131.790 1.00 0.00 ? 218 G A P      1  
ATOM 7348   O OP1    . G A 1 229 ? 126.372 124.325 130.536 1.00 0.00 ? 218 G A OP1    1  
ATOM 7349   O OP2    . G A 1 229 ? 125.690 125.588 132.665 1.00 0.00 ? 218 G A OP2    1  
ATOM 7350   O "O5'"  . G A 1 229 ? 124.043 124.202 131.411 1.00 0.00 ? 218 G A "O5'"  1  
ATOM 7351   C "C5'"  . G A 1 229 ? 123.028 124.927 132.090 1.00 0.00 ? 218 G A "C5'"  1  
ATOM 7352   C "C4'"  . G A 1 229 ? 121.722 124.173 132.104 1.00 0.00 ? 218 G A "C4'"  1  
ATOM 7353   O "O4'"  . G A 1 229 ? 120.960 124.557 133.280 1.00 0.00 ? 218 G A "O4'"  1  
ATOM 7354   C "C3'"  . G A 1 229 ? 120.777 124.453 130.945 1.00 0.00 ? 218 G A "C3'"  1  
ATOM 7355   O "O3'"  . G A 1 229 ? 121.067 123.678 129.794 1.00 0.00 ? 218 G A "O3'"  1  
ATOM 7356   C "C2'"  . G A 1 229 ? 119.413 124.128 131.538 1.00 0.00 ? 218 G A "C2'"  1  
ATOM 7357   O "O2'"  . G A 1 229 ? 119.194 122.726 131.587 1.00 0.00 ? 218 G A "O2'"  1  
ATOM 7358   C "C1'"  . G A 1 229 ? 119.583 124.662 132.960 1.00 0.00 ? 218 G A "C1'"  1  
ATOM 7359   N N9     . G A 1 229 ? 119.176 126.075 133.075 1.00 0.00 ? 218 G A N9     1  
ATOM 7360   C C8     . G A 1 229 ? 119.998 127.172 133.174 1.00 0.00 ? 218 G A C8     1  
ATOM 7361   N N7     . G A 1 229 ? 119.344 128.298 133.264 1.00 0.00 ? 218 G A N7     1  
ATOM 7362   C C5     . G A 1 229 ? 118.009 127.923 133.221 1.00 0.00 ? 218 G A C5     1  
ATOM 7363   C C6     . G A 1 229 ? 116.830 128.712 133.277 1.00 0.00 ? 218 G A C6     1  
ATOM 7364   O O6     . G A 1 229 ? 116.729 129.940 133.380 1.00 0.00 ? 218 G A O6     1  
ATOM 7365   N N1     . G A 1 229 ? 115.684 127.926 133.202 1.00 0.00 ? 218 G A N1     1  
ATOM 7366   C C2     . G A 1 229 ? 115.672 126.558 133.086 1.00 0.00 ? 218 G A C2     1  
ATOM 7367   N N2     . G A 1 229 ? 114.465 125.975 133.027 1.00 0.00 ? 218 G A N2     1  
ATOM 7368   N N3     . G A 1 229 ? 116.763 125.811 133.033 1.00 0.00 ? 218 G A N3     1  
ATOM 7369   C C4     . G A 1 229 ? 117.887 126.554 133.105 1.00 0.00 ? 218 G A C4     1  
ATOM 7370   H "H5'"  . G A 1 229 ? 122.896 125.788 131.641 1.00 0.00 ? 218 G A "H5'"  1  
ATOM 7371   H "H5''" . G A 1 229 ? 123.315 125.089 133.013 1.00 0.00 ? 218 G A "H5''" 1  
ATOM 7372   H "H4'"  . G A 1 229 ? 121.911 123.212 132.143 1.00 0.00 ? 218 G A "H4'"  1  
ATOM 7373   H "H3'"  . G A 1 229 ? 120.811 125.407 130.726 1.00 0.00 ? 218 G A "H3'"  1  
ATOM 7374   H "H2'"  . G A 1 229 ? 118.694 124.591 131.059 1.00 0.00 ? 218 G A "H2'"  1  
ATOM 7375   H "HO2'" . G A 1 229 ? 118.309 122.555 131.973 1.00 0.00 ? 218 G A "HO2'" 1  
ATOM 7376   H "H1'"  . G A 1 229 ? 119.052 124.118 133.578 1.00 0.00 ? 218 G A "H1'"  1  
ATOM 7377   H H8     . G A 1 229 ? 120.977 127.115 133.178 1.00 0.00 ? 218 G A H8     1  
ATOM 7378   H H1     . G A 1 229 ? 114.820 128.387 133.233 1.00 0.00 ? 218 G A H1     1  
ATOM 7379   H H21    . G A 1 229 ? 113.653 126.521 133.066 1.00 0.00 ? 218 G A H21    1  
ATOM 7380   H H22    . G A 1 229 ? 114.395 125.001 132.945 1.00 0.00 ? 218 G A H22    1  
ATOM 7381   P P      . G A 1 230 ? 120.004 123.603 128.600 1.00 0.00 ? 219 G A P      1  
ATOM 7382   O OP1    . G A 1 230 ? 119.413 124.950 128.388 1.00 0.00 ? 219 G A OP1    1  
ATOM 7383   O OP2    . G A 1 230 ? 119.131 122.475 129.013 1.00 0.00 ? 219 G A OP2    1  
ATOM 7384   O "O5'"  . G A 1 230 ? 120.755 123.180 127.260 1.00 0.00 ? 219 G A "O5'"  1  
ATOM 7385   C "C5'"  . G A 1 230 ? 120.936 124.109 126.201 1.00 0.00 ? 219 G A "C5'"  1  
ATOM 7386   C "C4'"  . G A 1 230 ? 120.117 123.735 124.990 1.00 0.00 ? 219 G A "C4'"  1  
ATOM 7387   O "O4'"  . G A 1 230 ? 119.325 122.541 125.230 1.00 0.00 ? 219 G A "O4'"  1  
ATOM 7388   C "C3'"  . G A 1 230 ? 119.084 124.758 124.542 1.00 0.00 ? 219 G A "C3'"  1  
ATOM 7389   O "O3'"  . G A 1 230 ? 119.659 125.867 123.872 1.00 0.00 ? 219 G A "O3'"  1  
ATOM 7390   C "C2'"  . G A 1 230 ? 118.169 123.912 123.670 1.00 0.00 ? 219 G A "C2'"  1  
ATOM 7391   O "O2'"  . G A 1 230 ? 118.729 123.708 122.381 1.00 0.00 ? 219 G A "O2'"  1  
ATOM 7392   C "C1'"  . G A 1 230 ? 118.178 122.590 124.436 1.00 0.00 ? 219 G A "C1'"  1  
ATOM 7393   N N9     . G A 1 230 ? 116.987 122.435 125.292 1.00 0.00 ? 219 G A N9     1  
ATOM 7394   C C8     . G A 1 230 ? 116.959 122.259 126.655 1.00 0.00 ? 219 G A C8     1  
ATOM 7395   N N7     . G A 1 230 ? 115.750 122.151 127.134 1.00 0.00 ? 219 G A N7     1  
ATOM 7396   C C5     . G A 1 230 ? 114.929 122.263 126.022 1.00 0.00 ? 219 G A C5     1  
ATOM 7397   C C6     . G A 1 230 ? 113.514 122.225 125.915 1.00 0.00 ? 219 G A C6     1  
ATOM 7398   O O6     . G A 1 230 ? 112.678 122.077 126.814 1.00 0.00 ? 219 G A O6     1  
ATOM 7399   N N1     . G A 1 230 ? 113.095 122.378 124.597 1.00 0.00 ? 219 G A N1     1  
ATOM 7400   C C2     . G A 1 230 ? 113.929 122.548 123.519 1.00 0.00 ? 219 G A C2     1  
ATOM 7401   N N2     . G A 1 230 ? 113.336 122.679 122.323 1.00 0.00 ? 219 G A N2     1  
ATOM 7402   N N3     . G A 1 230 ? 115.248 122.586 123.605 1.00 0.00 ? 219 G A N3     1  
ATOM 7403   C C4     . G A 1 230 ? 115.676 122.439 124.876 1.00 0.00 ? 219 G A C4     1  
ATOM 7404   H "H5'"  . G A 1 230 ? 121.884 124.130 125.952 1.00 0.00 ? 219 G A "H5'"  1  
ATOM 7405   H "H5''" . G A 1 230 ? 120.667 125.000 126.508 1.00 0.00 ? 219 G A "H5''" 1  
ATOM 7406   H "H4'"  . G A 1 230 ? 120.739 123.567 124.252 1.00 0.00 ? 219 G A "H4'"  1  
ATOM 7407   H "H3'"  . G A 1 230 ? 118.577 125.078 125.316 1.00 0.00 ? 219 G A "H3'"  1  
ATOM 7408   H "H2'"  . G A 1 230 ? 117.268 124.294 123.618 1.00 0.00 ? 219 G A "H2'"  1  
ATOM 7409   H "HO2'" . G A 1 230 ? 118.068 123.258 121.814 1.00 0.00 ? 219 G A "HO2'" 1  
ATOM 7410   H "H1'"  . G A 1 230 ? 118.223 121.845 123.801 1.00 0.00 ? 219 G A "H1'"  1  
ATOM 7411   H H8     . G A 1 230 ? 117.765 122.218 127.211 1.00 0.00 ? 219 G A H8     1  
ATOM 7412   H H1     . G A 1 230 ? 112.130 122.363 124.427 1.00 0.00 ? 219 G A H1     1  
ATOM 7413   H H21    . G A 1 230 ? 112.360 122.652 122.251 1.00 0.00 ? 219 G A H21    1  
ATOM 7414   H H22    . G A 1 230 ? 113.881 122.803 121.517 1.00 0.00 ? 219 G A H22    1  
ATOM 7415   P P      . C A 1 231 ? 119.484 127.349 124.468 1.00 0.00 ? 220 C A P      1  
ATOM 7416   O OP1    . C A 1 231 ? 120.357 128.264 123.689 1.00 0.00 ? 220 C A OP1    1  
ATOM 7417   O OP2    . C A 1 231 ? 119.634 127.273 125.943 1.00 0.00 ? 220 C A OP2    1  
ATOM 7418   O "O5'"  . C A 1 231 ? 117.968 127.720 124.144 1.00 0.00 ? 220 C A "O5'"  1  
ATOM 7419   C "C5'"  . C A 1 231 ? 117.494 127.750 122.806 1.00 0.00 ? 220 C A "C5'"  1  
ATOM 7420   C "C4'"  . C A 1 231 ? 116.001 127.542 122.739 1.00 0.00 ? 220 C A "C4'"  1  
ATOM 7421   O "O4'"  . C A 1 231 ? 115.664 126.219 123.234 1.00 0.00 ? 220 C A "O4'"  1  
ATOM 7422   C "C3'"  . C A 1 231 ? 115.155 128.481 123.587 1.00 0.00 ? 220 C A "C3'"  1  
ATOM 7423   O "O3'"  . C A 1 231 ? 114.935 129.738 122.969 1.00 0.00 ? 220 C A "O3'"  1  
ATOM 7424   C "C2'"  . C A 1 231 ? 113.883 127.676 123.805 1.00 0.00 ? 220 C A "C2'"  1  
ATOM 7425   O "O2'"  . C A 1 231 ? 113.043 127.716 122.659 1.00 0.00 ? 220 C A "O2'"  1  
ATOM 7426   C "C1'"  . C A 1 231 ? 114.439 126.260 123.962 1.00 0.00 ? 220 C A "C1'"  1  
ATOM 7427   N N1     . C A 1 231 ? 114.690 125.906 125.381 1.00 0.00 ? 220 C A N1     1  
ATOM 7428   C C2     . C A 1 231 ? 113.597 125.527 126.174 1.00 0.00 ? 220 C A C2     1  
ATOM 7429   O O2     . C A 1 231 ? 112.464 125.498 125.671 1.00 0.00 ? 220 C A O2     1  
ATOM 7430   N N3     . C A 1 231 ? 113.799 125.199 127.471 1.00 0.00 ? 220 C A N3     1  
ATOM 7431   C C4     . C A 1 231 ? 115.025 125.240 127.988 1.00 0.00 ? 220 C A C4     1  
ATOM 7432   N N4     . C A 1 231 ? 115.177 124.908 129.273 1.00 0.00 ? 220 C A N4     1  
ATOM 7433   C C5     . C A 1 231 ? 116.155 125.621 127.209 1.00 0.00 ? 220 C A C5     1  
ATOM 7434   C C6     . C A 1 231 ? 115.946 125.940 125.927 1.00 0.00 ? 220 C A C6     1  
ATOM 7435   H "H5'"  . C A 1 231 ? 117.940 127.041 122.294 1.00 0.00 ? 220 C A "H5'"  1  
ATOM 7436   H "H5''" . C A 1 231 ? 117.714 128.618 122.408 1.00 0.00 ? 220 C A "H5''" 1  
ATOM 7437   H "H4'"  . C A 1 231 ? 115.716 127.615 121.805 1.00 0.00 ? 220 C A "H4'"  1  
ATOM 7438   H "H3'"  . C A 1 231 ? 115.597 128.620 124.450 1.00 0.00 ? 220 C A "H3'"  1  
ATOM 7439   H "H2'"  . C A 1 231 ? 113.407 127.964 124.612 1.00 0.00 ? 220 C A "H2'"  1  
ATOM 7440   H "HO2'" . C A 1 231 ? 113.291 128.486 122.109 1.00 0.00 ? 220 C A "HO2'" 1  
ATOM 7441   H "H1'"  . C A 1 231 ? 113.810 125.616 123.574 1.00 0.00 ? 220 C A "H1'"  1  
ATOM 7442   H H41    . C A 1 231 ? 114.395 124.646 129.807 1.00 0.00 ? 220 C A H41    1  
ATOM 7443   H H42    . C A 1 231 ? 116.066 124.926 129.683 1.00 0.00 ? 220 C A H42    1  
ATOM 7444   H H5     . C A 1 231 ? 117.054 125.646 127.600 1.00 0.00 ? 220 C A H5     1  
ATOM 7445   H H6     . C A 1 231 ? 116.709 126.208 125.376 1.00 0.00 ? 220 C A H6     1  
ATOM 7446   P P      . U A 1 232 ? 114.772 131.061 123.865 1.00 0.00 ? 221 U A P      1  
ATOM 7447   O OP1    . U A 1 232 ? 114.710 132.230 122.951 1.00 0.00 ? 221 U A OP1    1  
ATOM 7448   O OP2    . U A 1 232 ? 115.798 131.019 124.938 1.00 0.00 ? 221 U A OP2    1  
ATOM 7449   O "O5'"  . U A 1 232 ? 113.341 130.892 124.546 1.00 0.00 ? 221 U A "O5'"  1  
ATOM 7450   C "C5'"  . U A 1 232 ? 112.156 130.902 123.765 1.00 0.00 ? 221 U A "C5'"  1  
ATOM 7451   C "C4'"  . U A 1 232 ? 110.956 130.463 124.568 1.00 0.00 ? 221 U A "C4'"  1  
ATOM 7452   O "O4'"  . U A 1 232 ? 111.159 129.115 125.064 1.00 0.00 ? 221 U A "O4'"  1  
ATOM 7453   C "C3'"  . U A 1 232 ? 110.651 131.276 125.817 1.00 0.00 ? 221 U A "C3'"  1  
ATOM 7454   O "O3'"  . U A 1 232 ? 109.919 132.459 125.544 1.00 0.00 ? 221 U A "O3'"  1  
ATOM 7455   C "C2'"  . U A 1 232 ? 109.901 130.279 126.687 1.00 0.00 ? 221 U A "C2'"  1  
ATOM 7456   O "O2'"  . U A 1 232 ? 108.554 130.135 126.263 1.00 0.00 ? 221 U A "O2'"  1  
ATOM 7457   C "C1'"  . U A 1 232 ? 110.656 128.982 126.386 1.00 0.00 ? 221 U A "C1'"  1  
ATOM 7458   N N1     . U A 1 232 ? 111.763 128.742 127.345 1.00 0.00 ? 221 U A N1     1  
ATOM 7459   C C2     . U A 1 232 ? 111.424 128.223 128.580 1.00 0.00 ? 221 U A C2     1  
ATOM 7460   O O2     . U A 1 232 ? 110.278 127.960 128.902 1.00 0.00 ? 221 U A O2     1  
ATOM 7461   N N3     . U A 1 232 ? 112.480 128.016 129.434 1.00 0.00 ? 221 U A N3     1  
ATOM 7462   C C4     . U A 1 232 ? 113.812 128.269 129.186 1.00 0.00 ? 221 U A C4     1  
ATOM 7463   O O4     . U A 1 232 ? 114.648 128.027 130.061 1.00 0.00 ? 221 U A O4     1  
ATOM 7464   C C5     . U A 1 232 ? 114.087 128.806 127.888 1.00 0.00 ? 221 U A C5     1  
ATOM 7465   C C6     . U A 1 232 ? 113.078 129.015 127.037 1.00 0.00 ? 221 U A C6     1  
ATOM 7466   H "H5'"  . U A 1 232 ? 112.270 130.295 123.003 1.00 0.00 ? 221 U A "H5'"  1  
ATOM 7467   H "H5''" . U A 1 232 ? 112.001 131.809 123.430 1.00 0.00 ? 221 U A "H5''" 1  
ATOM 7468   H "H4'"  . U A 1 232 ? 110.168 130.472 123.984 1.00 0.00 ? 221 U A "H4'"  1  
ATOM 7469   H "H3'"  . U A 1 232 ? 111.494 131.515 126.258 1.00 0.00 ? 221 U A "H3'"  1  
ATOM 7470   H "H2'"  . U A 1 232 ? 109.958 130.514 127.636 1.00 0.00 ? 221 U A "H2'"  1  
ATOM 7471   H "HO2'" . U A 1 232 ? 108.302 130.916 125.727 1.00 0.00 ? 221 U A "HO2'" 1  
ATOM 7472   H "H1'"  . U A 1 232 ? 110.032 128.227 126.417 1.00 0.00 ? 221 U A "H1'"  1  
ATOM 7473   H H3     . U A 1 232 ? 112.262 127.646 130.316 1.00 0.00 ? 221 U A H3     1  
ATOM 7474   H H5     . U A 1 232 ? 115.008 129.015 127.627 1.00 0.00 ? 221 U A H5     1  
ATOM 7475   H H6     . U A 1 232 ? 113.293 129.384 126.156 1.00 0.00 ? 221 U A H6     1  
ATOM 7476   P P      . C A 1 233 ? 110.145 133.776 126.434 1.00 0.00 ? 222 C A P      1  
ATOM 7477   O OP1    . C A 1 233 ? 109.573 134.931 125.699 1.00 0.00 ? 222 C A OP1    1  
ATOM 7478   O OP2    . C A 1 233 ? 111.569 133.807 126.855 1.00 0.00 ? 222 C A OP2    1  
ATOM 7479   O "O5'"  . C A 1 233 ? 109.253 133.526 127.730 1.00 0.00 ? 222 C A "O5'"  1  
ATOM 7480   C "C5'"  . C A 1 233 ? 107.835 133.556 127.656 1.00 0.00 ? 222 C A "C5'"  1  
ATOM 7481   C "C4'"  . C A 1 233 ? 107.199 133.023 128.916 1.00 0.00 ? 222 C A "C4'"  1  
ATOM 7482   O "O4'"  . C A 1 233 ? 107.632 131.656 129.149 1.00 0.00 ? 222 C A "O4'"  1  
ATOM 7483   C "C3'"  . C A 1 233 ? 107.557 133.748 130.206 1.00 0.00 ? 222 C A "C3'"  1  
ATOM 7484   O "O3'"  . C A 1 233 ? 106.784 134.918 130.416 1.00 0.00 ? 222 C A "O3'"  1  
ATOM 7485   C "C2'"  . C A 1 233 ? 107.337 132.675 131.263 1.00 0.00 ? 222 C A "C2'"  1  
ATOM 7486   O "O2'"  . C A 1 233 ? 105.957 132.511 131.553 1.00 0.00 ? 222 C A "O2'"  1  
ATOM 7487   C "C1'"  . C A 1 233 ? 107.845 131.425 130.537 1.00 0.00 ? 222 C A "C1'"  1  
ATOM 7488   N N1     . C A 1 233 ? 109.275 131.152 130.820 1.00 0.00 ? 222 C A N1     1  
ATOM 7489   C C2     . C A 1 233 ? 109.607 130.534 132.032 1.00 0.00 ? 222 C A C2     1  
ATOM 7490   O O2     . C A 1 233 ? 108.703 130.239 132.829 1.00 0.00 ? 222 C A O2     1  
ATOM 7491   N N3     . C A 1 233 ? 110.905 130.273 132.313 1.00 0.00 ? 222 C A N3     1  
ATOM 7492   C C4     . C A 1 233 ? 111.857 130.601 131.442 1.00 0.00 ? 222 C A C4     1  
ATOM 7493   N N4     . C A 1 233 ? 113.123 130.325 131.763 1.00 0.00 ? 222 C A N4     1  
ATOM 7494   C C5     . C A 1 233 ? 111.553 131.232 130.202 1.00 0.00 ? 222 C A C5     1  
ATOM 7495   C C6     . C A 1 233 ? 110.266 131.483 129.933 1.00 0.00 ? 222 C A C6     1  
ATOM 7496   H "H5'"  . C A 1 233 ? 107.543 133.011 126.895 1.00 0.00 ? 222 C A "H5'"  1  
ATOM 7497   H "H5''" . C A 1 233 ? 107.542 134.481 127.517 1.00 0.00 ? 222 C A "H5''" 1  
ATOM 7498   H "H4'"  . C A 1 233 ? 106.226 133.034 128.806 1.00 0.00 ? 222 C A "H4'"  1  
ATOM 7499   H "H3'"  . C A 1 233 ? 108.507 133.989 130.185 1.00 0.00 ? 222 C A "H3'"  1  
ATOM 7500   H "H2'"  . C A 1 233 ? 107.860 132.854 132.072 1.00 0.00 ? 222 C A "H2'"  1  
ATOM 7501   H "HO2'" . C A 1 233 ? 105.475 133.314 131.265 1.00 0.00 ? 222 C A "HO2'" 1  
ATOM 7502   H "H1'"  . C A 1 233 ? 107.307 130.653 130.807 1.00 0.00 ? 222 C A "H1'"  1  
ATOM 7503   H H41    . C A 1 233 ? 113.328 129.892 132.620 1.00 0.00 ? 222 C A H41    1  
ATOM 7504   H H42    . C A 1 233 ? 113.846 130.554 131.142 1.00 0.00 ? 222 C A H42    1  
ATOM 7505   H H5     . C A 1 233 ? 112.260 131.468 129.567 1.00 0.00 ? 222 C A H5     1  
ATOM 7506   H H6     . C A 1 233 ? 110.034 131.915 129.085 1.00 0.00 ? 222 C A H6     1  
ATOM 7507   P P      . A A 1 234 ? 107.487 136.245 130.971 1.00 0.00 ? 223 A A P      1  
ATOM 7508   O OP1    . A A 1 234 ? 106.471 137.320 131.087 1.00 0.00 ? 223 A A OP1    1  
ATOM 7509   O OP2    . A A 1 234 ? 108.635 136.416 130.046 1.00 0.00 ? 223 A A OP2    1  
ATOM 7510   O "O5'"  . A A 1 234 ? 108.068 135.955 132.427 1.00 0.00 ? 223 A A "O5'"  1  
ATOM 7511   C "C5'"  . A A 1 234 ? 107.549 136.627 133.565 1.00 0.00 ? 223 A A "C5'"  1  
ATOM 7512   C "C4'"  . A A 1 234 ? 106.526 135.785 134.287 1.00 0.00 ? 223 A A "C4'"  1  
ATOM 7513   O "O4'"  . A A 1 234 ? 106.963 134.399 134.317 1.00 0.00 ? 223 A A "O4'"  1  
ATOM 7514   C "C3'"  . A A 1 234 ? 106.304 136.117 135.754 1.00 0.00 ? 223 A A "C3'"  1  
ATOM 7515   O "O3'"  . A A 1 234 ? 105.464 137.242 135.948 1.00 0.00 ? 223 A A "O3'"  1  
ATOM 7516   C "C2'"  . A A 1 234 ? 105.627 134.842 136.249 1.00 0.00 ? 223 A A "C2'"  1  
ATOM 7517   O "O2'"  . A A 1 234 ? 104.255 134.813 135.884 1.00 0.00 ? 223 A A "O2'"  1  
ATOM 7518   C "C1'"  . A A 1 234 ? 106.379 133.774 135.450 1.00 0.00 ? 223 A A "C1'"  1  
ATOM 7519   N N9     . A A 1 234 ? 107.409 133.096 136.260 1.00 0.00 ? 223 A A N9     1  
ATOM 7520   C C8     . A A 1 234 ? 108.772 133.249 136.193 1.00 0.00 ? 223 A A C8     1  
ATOM 7521   N N7     . A A 1 234 ? 109.430 132.505 137.048 1.00 0.00 ? 223 A A N7     1  
ATOM 7522   C C5     . A A 1 234 ? 108.433 131.814 137.723 1.00 0.00 ? 223 A A C5     1  
ATOM 7523   C C6     . A A 1 234 ? 108.475 130.861 138.757 1.00 0.00 ? 223 A A C6     1  
ATOM 7524   N N6     . A A 1 234 ? 109.606 130.423 139.314 1.00 0.00 ? 223 A A N6     1  
ATOM 7525   N N1     . A A 1 234 ? 107.300 130.368 139.205 1.00 0.00 ? 223 A A N1     1  
ATOM 7526   C C2     . A A 1 234 ? 106.165 130.807 138.646 1.00 0.00 ? 223 A A C2     1  
ATOM 7527   N N3     . A A 1 234 ? 105.998 131.697 137.671 1.00 0.00 ? 223 A A N3     1  
ATOM 7528   C C4     . A A 1 234 ? 107.184 132.168 137.248 1.00 0.00 ? 223 A A C4     1  
ATOM 7529   H "H5'"  . A A 1 234 ? 107.128 137.465 133.278 1.00 0.00 ? 223 A A "H5'"  1  
ATOM 7530   H "H5''" . A A 1 234 ? 108.284 136.833 134.179 1.00 0.00 ? 223 A A "H5''" 1  
ATOM 7531   H "H4'"  . A A 1 234 ? 105.668 135.844 133.815 1.00 0.00 ? 223 A A "H4'"  1  
ATOM 7532   H "H3'"  . A A 1 234 ? 107.150 136.263 136.228 1.00 0.00 ? 223 A A "H3'"  1  
ATOM 7533   H "H2'"  . A A 1 234 ? 105.749 134.722 137.214 1.00 0.00 ? 223 A A "H2'"  1  
ATOM 7534   H "HO2'" . A A 1 234 ? 103.848 133.997 136.241 1.00 0.00 ? 223 A A "HO2'" 1  
ATOM 7535   H "H1'"  . A A 1 234 ? 105.741 133.111 135.110 1.00 0.00 ? 223 A A "H1'"  1  
ATOM 7536   H H8     . A A 1 234 ? 109.212 133.860 135.565 1.00 0.00 ? 223 A A H8     1  
ATOM 7537   H H61    . A A 1 234 ? 109.572 129.757 140.033 1.00 0.00 ? 223 A A H61    1  
ATOM 7538   H H62    . A A 1 234 ? 110.470 130.766 139.005 1.00 0.00 ? 223 A A H62    1  
ATOM 7539   H H2     . A A 1 234 ? 105.341 130.418 139.007 1.00 0.00 ? 223 A A H2     1  
ATOM 7540   P P      . U A 1 235 ? 105.959 138.473 136.855 1.00 0.00 ? 224 U A P      1  
ATOM 7541   O OP1    . U A 1 235 ? 104.798 139.368 137.089 1.00 0.00 ? 224 U A OP1    1  
ATOM 7542   O OP2    . U A 1 235 ? 107.198 139.022 136.248 1.00 0.00 ? 224 U A OP2    1  
ATOM 7543   O "O5'"  . U A 1 235 ? 106.348 137.796 138.243 1.00 0.00 ? 224 U A "O5'"  1  
ATOM 7544   C "C5'"  . U A 1 235 ? 107.063 138.517 139.233 1.00 0.00 ? 224 U A "C5'"  1  
ATOM 7545   C "C4'"  . U A 1 235 ? 108.038 137.635 139.972 1.00 0.00 ? 224 U A "C4'"  1  
ATOM 7546   O "O4'"  . U A 1 235 ? 108.293 136.429 139.205 1.00 0.00 ? 224 U A "O4'"  1  
ATOM 7547   C "C3'"  . U A 1 235 ? 109.423 138.220 140.210 1.00 0.00 ? 224 U A "C3'"  1  
ATOM 7548   O "O3'"  . U A 1 235 ? 109.475 139.082 141.334 1.00 0.00 ? 224 U A "O3'"  1  
ATOM 7549   C "C2'"  . U A 1 235 ? 110.289 136.977 140.353 1.00 0.00 ? 224 U A "C2'"  1  
ATOM 7550   O "O2'"  . U A 1 235 ? 110.142 136.393 141.640 1.00 0.00 ? 224 U A "O2'"  1  
ATOM 7551   C "C1'"  . U A 1 235 ? 109.662 136.047 139.313 1.00 0.00 ? 224 U A "C1'"  1  
ATOM 7552   N N1     . U A 1 235 ? 110.327 136.149 137.993 1.00 0.00 ? 224 U A N1     1  
ATOM 7553   C C2     . U A 1 235 ? 111.546 135.509 137.850 1.00 0.00 ? 224 U A C2     1  
ATOM 7554   O O2     . U A 1 235 ? 112.076 134.879 138.749 1.00 0.00 ? 224 U A O2     1  
ATOM 7555   N N3     . U A 1 235 ? 112.126 135.631 136.611 1.00 0.00 ? 224 U A N3     1  
ATOM 7556   C C4     . U A 1 235 ? 111.627 136.313 135.522 1.00 0.00 ? 224 U A C4     1  
ATOM 7557   O O4     . U A 1 235 ? 112.273 136.331 134.472 1.00 0.00 ? 224 U A O4     1  
ATOM 7558   C C5     . U A 1 235 ? 110.365 136.949 135.743 1.00 0.00 ? 224 U A C5     1  
ATOM 7559   C C6     . U A 1 235 ? 109.776 136.846 136.938 1.00 0.00 ? 224 U A C6     1  
ATOM 7560   H "H5'"  . U A 1 235 ? 106.425 138.896 139.874 1.00 0.00 ? 224 U A "H5'"  1  
ATOM 7561   H "H5''" . U A 1 235 ? 107.557 139.247 138.803 1.00 0.00 ? 224 U A "H5''" 1  
ATOM 7562   H "H4'"  . U A 1 235 ? 107.646 137.388 140.835 1.00 0.00 ? 224 U A "H4'"  1  
ATOM 7563   H "H3'"  . U A 1 235 ? 109.704 138.716 139.411 1.00 0.00 ? 224 U A "H3'"  1  
ATOM 7564   H "H2'"  . U A 1 235 ? 111.229 137.165 140.146 1.00 0.00 ? 224 U A "H2'"  1  
ATOM 7565   H "HO2'" . U A 1 235 ? 109.782 137.064 142.256 1.00 0.00 ? 224 U A "HO2'" 1  
ATOM 7566   H "H1'"  . U A 1 235 ? 109.715 135.121 139.629 1.00 0.00 ? 224 U A "H1'"  1  
ATOM 7567   H H3     . U A 1 235 ? 112.990 135.184 136.489 1.00 0.00 ? 224 U A H3     1  
ATOM 7568   H H5     . U A 1 235 ? 109.935 137.456 135.022 1.00 0.00 ? 224 U A H5     1  
ATOM 7569   H H6     . U A 1 235 ? 108.913 137.292 137.065 1.00 0.00 ? 224 U A H6     1  
ATOM 7570   P P      . U A 1 236 ? 110.520 140.303 141.371 1.00 0.00 ? 225 U A P      1  
ATOM 7571   O OP1    . U A 1 236 ? 110.196 141.150 142.548 1.00 0.00 ? 225 U A OP1    1  
ATOM 7572   O OP2    . U A 1 236 ? 110.564 140.911 140.016 1.00 0.00 ? 225 U A OP2    1  
ATOM 7573   O "O5'"  . U A 1 236 ? 111.923 139.600 141.642 1.00 0.00 ? 225 U A "O5'"  1  
ATOM 7574   C "C5'"  . U A 1 236 ? 112.192 138.961 142.882 1.00 0.00 ? 225 U A "C5'"  1  
ATOM 7575   C "C4'"  . U A 1 236 ? 113.528 138.260 142.869 1.00 0.00 ? 225 U A "C4'"  1  
ATOM 7576   O "O4'"  . U A 1 236 ? 113.529 137.215 141.863 1.00 0.00 ? 225 U A "O4'"  1  
ATOM 7577   C "C3'"  . U A 1 236 ? 114.733 139.119 142.513 1.00 0.00 ? 225 U A "C3'"  1  
ATOM 7578   O "O3'"  . U A 1 236 ? 115.218 139.877 143.608 1.00 0.00 ? 225 U A "O3'"  1  
ATOM 7579   C "C2'"  . U A 1 236 ? 115.729 138.094 141.991 1.00 0.00 ? 225 U A "C2'"  1  
ATOM 7580   O "O2'"  . U A 1 236 ? 116.349 137.388 143.056 1.00 0.00 ? 225 U A "O2'"  1  
ATOM 7581   C "C1'"  . U A 1 236 ? 114.810 137.138 141.231 1.00 0.00 ? 225 U A "C1'"  1  
ATOM 7582   N N1     . U A 1 236 ? 114.701 137.484 139.792 1.00 0.00 ? 225 U A N1     1  
ATOM 7583   C C2     . U A 1 236 ? 115.754 137.118 138.974 1.00 0.00 ? 225 U A C2     1  
ATOM 7584   O O2     . U A 1 236 ? 116.743 136.535 139.381 1.00 0.00 ? 225 U A O2     1  
ATOM 7585   N N3     . U A 1 236 ? 115.608 137.460 137.652 1.00 0.00 ? 225 U A N3     1  
ATOM 7586   C C4     . U A 1 236 ? 114.543 138.117 137.075 1.00 0.00 ? 225 U A C4     1  
ATOM 7587   O O4     . U A 1 236 ? 114.561 138.354 135.865 1.00 0.00 ? 225 U A O4     1  
ATOM 7588   C C5     . U A 1 236 ? 113.493 138.463 137.982 1.00 0.00 ? 225 U A C5     1  
ATOM 7589   C C6     . U A 1 236 ? 113.607 138.142 139.274 1.00 0.00 ? 225 U A C6     1  
ATOM 7590   H "H5'"  . U A 1 236 ? 111.489 138.302 143.062 1.00 0.00 ? 225 U A "H5'"  1  
ATOM 7591   H "H5''" . U A 1 236 ? 112.192 139.633 143.594 1.00 0.00 ? 225 U A "H5''" 1  
ATOM 7592   H "H4'"  . U A 1 236 ? 113.678 137.856 143.750 1.00 0.00 ? 225 U A "H4'"  1  
ATOM 7593   H "H3'"  . U A 1 236 ? 114.488 139.729 141.785 1.00 0.00 ? 225 U A "H3'"  1  
ATOM 7594   H "H2'"  . U A 1 236 ? 116.390 138.505 141.395 1.00 0.00 ? 225 U A "H2'"  1  
ATOM 7595   H "HO2'" . U A 1 236 ? 117.006 136.763 142.685 1.00 0.00 ? 225 U A "HO2'" 1  
ATOM 7596   H "H1'"  . U A 1 236 ? 115.152 136.222 141.316 1.00 0.00 ? 225 U A "H1'"  1  
ATOM 7597   H H3     . U A 1 236 ? 116.344 137.211 137.054 1.00 0.00 ? 225 U A H3     1  
ATOM 7598   H H5     . U A 1 236 ? 112.694 138.932 137.657 1.00 0.00 ? 225 U A H5     1  
ATOM 7599   H H6     . U A 1 236 ? 112.874 138.391 139.874 1.00 0.00 ? 225 U A H6     1  
ATOM 7600   P P      . C A 1 237 ? 115.950 141.284 143.361 1.00 0.00 ? 226 C A P      1  
ATOM 7601   O OP1    . C A 1 237 ? 116.161 141.933 144.678 1.00 0.00 ? 226 C A OP1    1  
ATOM 7602   O OP2    . C A 1 237 ? 115.208 142.007 142.296 1.00 0.00 ? 226 C A OP2    1  
ATOM 7603   O "O5'"  . C A 1 237 ? 117.377 140.879 142.777 1.00 0.00 ? 226 C A "O5'"  1  
ATOM 7604   C "C5'"  . C A 1 237 ? 118.326 140.196 143.584 1.00 0.00 ? 226 C A "C5'"  1  
ATOM 7605   C "C4'"  . C A 1 237 ? 119.565 139.835 142.799 1.00 0.00 ? 226 C A "C4'"  1  
ATOM 7606   O "O4'"  . C A 1 237 ? 119.223 138.909 141.738 1.00 0.00 ? 226 C A "O4'"  1  
ATOM 7607   C "C3'"  . C A 1 237 ? 120.260 140.981 142.083 1.00 0.00 ? 226 C A "C3'"  1  
ATOM 7608   O "O3'"  . C A 1 237 ? 121.099 141.743 142.937 1.00 0.00 ? 226 C A "O3'"  1  
ATOM 7609   C "C2'"  . C A 1 237 ? 121.012 140.269 140.967 1.00 0.00 ? 226 C A "C2'"  1  
ATOM 7610   O "O2'"  . C A 1 237 ? 122.197 139.655 141.455 1.00 0.00 ? 226 C A "O2'"  1  
ATOM 7611   C "C1'"  . C A 1 237 ? 120.014 139.179 140.575 1.00 0.00 ? 226 C A "C1'"  1  
ATOM 7612   N N1     . C A 1 237 ? 119.146 139.591 139.444 1.00 0.00 ? 226 C A N1     1  
ATOM 7613   C C2     . C A 1 237 ? 119.675 139.542 138.149 1.00 0.00 ? 226 C A C2     1  
ATOM 7614   O O2     . C A 1 237 ? 120.844 139.163 137.986 1.00 0.00 ? 226 C A O2     1  
ATOM 7615   N N3     . C A 1 237 ? 118.905 139.913 137.100 1.00 0.00 ? 226 C A N3     1  
ATOM 7616   C C4     . C A 1 237 ? 117.651 140.318 137.302 1.00 0.00 ? 226 C A C4     1  
ATOM 7617   N N4     . C A 1 237 ? 116.928 140.672 136.236 1.00 0.00 ? 226 C A N4     1  
ATOM 7618   C C5     . C A 1 237 ? 117.083 140.377 138.606 1.00 0.00 ? 226 C A C5     1  
ATOM 7619   C C6     . C A 1 237 ? 117.856 140.010 139.636 1.00 0.00 ? 226 C A C6     1  
ATOM 7620   H "H5'"  . C A 1 237 ? 117.917 139.375 143.931 1.00 0.00 ? 226 C A "H5'"  1  
ATOM 7621   H "H5''" . C A 1 237 ? 118.578 140.771 144.335 1.00 0.00 ? 226 C A "H5''" 1  
ATOM 7622   H "H4'"  . C A 1 237 ? 120.205 139.405 143.406 1.00 0.00 ? 226 C A "H4'"  1  
ATOM 7623   H "H3'"  . C A 1 237 ? 119.583 141.572 141.687 1.00 0.00 ? 226 C A "H3'"  1  
ATOM 7624   H "H2'"  . C A 1 237 ? 121.198 140.871 140.216 1.00 0.00 ? 226 C A "H2'"  1  
ATOM 7625   H "HO2'" . C A 1 237 ? 122.664 139.226 140.709 1.00 0.00 ? 226 C A "HO2'" 1  
ATOM 7626   H "H1'"  . C A 1 237 ? 120.499 138.363 140.332 1.00 0.00 ? 226 C A "H1'"  1  
ATOM 7627   H H41    . C A 1 237 ? 117.322 140.631 135.340 1.00 0.00 ? 226 C A H41    1  
ATOM 7628   H H42    . C A 1 237 ? 116.003 140.975 136.352 1.00 0.00 ? 226 C A H42    1  
ATOM 7629   H H5     . C A 1 237 ? 116.161 140.676 138.743 1.00 0.00 ? 226 C A H5     1  
ATOM 7630   H H6     . C A 1 237 ? 117.483 140.044 140.541 1.00 0.00 ? 226 C A H6     1  
ATOM 7631   P P      . U A 1 238 ? 121.300 143.316 142.678 1.00 0.00 ? 227 U A P      1  
ATOM 7632   O OP1    . U A 1 238 ? 122.106 143.866 143.799 1.00 0.00 ? 227 U A OP1    1  
ATOM 7633   O OP2    . U A 1 238 ? 119.972 143.905 142.373 1.00 0.00 ? 227 U A OP2    1  
ATOM 7634   O "O5'"  . U A 1 238 ? 122.185 143.378 141.356 1.00 0.00 ? 227 U A "O5'"  1  
ATOM 7635   C "C5'"  . U A 1 238 ? 123.517 142.891 141.345 1.00 0.00 ? 227 U A "C5'"  1  
ATOM 7636   C "C4'"  . U A 1 238 ? 124.122 142.957 139.964 1.00 0.00 ? 227 U A "C4'"  1  
ATOM 7637   O "O4'"  . U A 1 238 ? 123.398 142.079 139.063 1.00 0.00 ? 227 U A "O4'"  1  
ATOM 7638   C "C3'"  . U A 1 238 ? 124.078 144.313 139.276 1.00 0.00 ? 227 U A "C3'"  1  
ATOM 7639   O "O3'"  . U A 1 238 ? 125.123 145.177 139.687 1.00 0.00 ? 227 U A "O3'"  1  
ATOM 7640   C "C2'"  . U A 1 238 ? 124.138 143.938 137.801 1.00 0.00 ? 227 U A "C2'"  1  
ATOM 7641   O "O2'"  . U A 1 238 ? 125.463 143.616 137.405 1.00 0.00 ? 227 U A "O2'"  1  
ATOM 7642   C "C1'"  . U A 1 238 ? 123.289 142.665 137.776 1.00 0.00 ? 227 U A "C1'"  1  
ATOM 7643   N N1     . U A 1 238 ? 121.866 142.944 137.471 1.00 0.00 ? 227 U A N1     1  
ATOM 7644   C C2     . U A 1 238 ? 121.531 143.144 136.146 1.00 0.00 ? 227 U A C2     1  
ATOM 7645   O O2     . U A 1 238 ? 122.346 143.100 135.239 1.00 0.00 ? 227 U A O2     1  
ATOM 7646   N N3     . U A 1 238 ? 120.203 143.399 135.912 1.00 0.00 ? 227 U A N3     1  
ATOM 7647   C C4     . U A 1 238 ? 119.193 143.476 136.847 1.00 0.00 ? 227 U A C4     1  
ATOM 7648   O O4     . U A 1 238 ? 118.043 143.715 136.477 1.00 0.00 ? 227 U A O4     1  
ATOM 7649   C C5     . U A 1 238 ? 119.613 143.259 138.199 1.00 0.00 ? 227 U A C5     1  
ATOM 7650   C C6     . U A 1 238 ? 120.900 143.006 138.452 1.00 0.00 ? 227 U A C6     1  
ATOM 7651   H "H5'"  . U A 1 238 ? 123.519 141.960 141.651 1.00 0.00 ? 227 U A "H5'"  1  
ATOM 7652   H "H5''" . U A 1 238 ? 124.060 143.430 141.957 1.00 0.00 ? 227 U A "H5''" 1  
ATOM 7653   H "H4'"  . U A 1 238 ? 125.056 142.659 140.018 1.00 0.00 ? 227 U A "H4'"  1  
ATOM 7654   H "H3'"  . U A 1 238 ? 123.216 144.738 139.463 1.00 0.00 ? 227 U A "H3'"  1  
ATOM 7655   H "H2'"  . U A 1 238 ? 123.751 144.638 137.236 1.00 0.00 ? 227 U A "H2'"  1  
ATOM 7656   H "HO2'" . U A 1 238 ? 125.632 143.989 136.514 1.00 0.00 ? 227 U A "HO2'" 1  
ATOM 7657   H "H1'"  . U A 1 238 ? 123.647 142.049 137.103 1.00 0.00 ? 227 U A "H1'"  1  
ATOM 7658   H H3     . U A 1 238 ? 119.944 143.544 134.977 1.00 0.00 ? 227 U A H3     1  
ATOM 7659   H H5     . U A 1 238 ? 118.959 143.293 138.929 1.00 0.00 ? 227 U A H5     1  
ATOM 7660   H H6     . U A 1 238 ? 121.162 142.862 139.386 1.00 0.00 ? 227 U A H6     1  
ATOM 7661   P P      . U A 1 239 ? 124.894 146.768 139.720 1.00 0.00 ? 228 U A P      1  
ATOM 7662   O OP1    . U A 1 239 ? 126.032 147.382 140.449 1.00 0.00 ? 228 U A OP1    1  
ATOM 7663   O OP2    . U A 1 239 ? 123.506 147.018 140.181 1.00 0.00 ? 228 U A OP2    1  
ATOM 7664   O "O5'"  . U A 1 239 ? 124.992 147.205 138.192 1.00 0.00 ? 228 U A "O5'"  1  
ATOM 7665   C "C5'"  . U A 1 239 ? 126.218 147.104 137.483 1.00 0.00 ? 228 U A "C5'"  1  
ATOM 7666   C "C4'"  . U A 1 239 ? 126.011 147.218 135.993 1.00 0.00 ? 228 U A "C4'"  1  
ATOM 7667   O "O4'"  . U A 1 239 ? 125.094 146.187 135.541 1.00 0.00 ? 228 U A "O4'"  1  
ATOM 7668   C "C3'"  . U A 1 239 ? 125.383 148.512 135.499 1.00 0.00 ? 228 U A "C3'"  1  
ATOM 7669   O "O3'"  . U A 1 239 ? 126.324 149.561 135.348 1.00 0.00 ? 228 U A "O3'"  1  
ATOM 7670   C "C2'"  . U A 1 239 ? 124.729 148.087 134.192 1.00 0.00 ? 228 U A "C2'"  1  
ATOM 7671   O "O2'"  . U A 1 239 ? 125.689 147.965 133.151 1.00 0.00 ? 228 U A "O2'"  1  
ATOM 7672   C "C1'"  . U A 1 239 ? 124.207 146.695 134.551 1.00 0.00 ? 228 U A "C1'"  1  
ATOM 7673   N N1     . U A 1 239 ? 122.812 146.729 135.050 1.00 0.00 ? 228 U A N1     1  
ATOM 7674   C C2     . U A 1 239 ? 121.806 146.809 134.105 1.00 0.00 ? 228 U A C2     1  
ATOM 7675   O O2     . U A 1 239 ? 122.019 146.851 132.906 1.00 0.00 ? 228 U A O2     1  
ATOM 7676   N N3     . U A 1 239 ? 120.529 146.837 134.612 1.00 0.00 ? 228 U A N3     1  
ATOM 7677   C C4     . U A 1 239 ? 120.162 146.796 135.941 1.00 0.00 ? 228 U A C4     1  
ATOM 7678   O O4     . U A 1 239 ? 118.967 146.830 136.240 1.00 0.00 ? 228 U A O4     1  
ATOM 7679   C C5     . U A 1 239 ? 121.254 146.713 136.861 1.00 0.00 ? 228 U A C5     1  
ATOM 7680   C C6     . U A 1 239 ? 122.506 146.683 136.394 1.00 0.00 ? 228 U A C6     1  
ATOM 7681   H "H5'"  . U A 1 239 ? 126.634 146.240 137.683 1.00 0.00 ? 228 U A "H5'"  1  
ATOM 7682   H "H5''" . U A 1 239 ? 126.816 147.824 137.777 1.00 0.00 ? 228 U A "H5''" 1  
ATOM 7683   H "H4'"  . U A 1 239 ? 126.874 147.094 135.546 1.00 0.00 ? 228 U A "H4'"  1  
ATOM 7684   H "H3'"  . U A 1 239 ? 124.687 148.792 136.129 1.00 0.00 ? 228 U A "H3'"  1  
ATOM 7685   H "H2'"  . U A 1 239 ? 123.998 148.690 133.942 1.00 0.00 ? 228 U A "H2'"  1  
ATOM 7686   H "HO2'" . U A 1 239 ? 126.490 148.474 133.395 1.00 0.00 ? 228 U A "HO2'" 1  
ATOM 7687   H "H1'"  . U A 1 239 ? 124.254 146.115 133.762 1.00 0.00 ? 228 U A "H1'"  1  
ATOM 7688   H H3     . U A 1 239 ? 119.802 146.894 133.960 1.00 0.00 ? 228 U A H3     1  
ATOM 7689   H H5     . U A 1 239 ? 121.086 146.678 137.827 1.00 0.00 ? 228 U A H5     1  
ATOM 7690   H H6     . U A 1 239 ? 123.237 146.627 137.044 1.00 0.00 ? 228 U A H6     1  
ATOM 7691   P P      . G A 1 240 ? 125.861 151.092 135.504 1.00 0.00 ? 229 G A P      1  
ATOM 7692   O OP1    . G A 1 240 ? 127.078 151.927 135.673 1.00 0.00 ? 229 G A OP1    1  
ATOM 7693   O OP2    . G A 1 240 ? 124.786 151.146 136.528 1.00 0.00 ? 229 G A OP2    1  
ATOM 7694   O "O5'"  . G A 1 240 ? 125.216 151.446 134.092 1.00 0.00 ? 229 G A "O5'"  1  
ATOM 7695   C "C5'"  . G A 1 240 ? 126.023 151.569 132.931 1.00 0.00 ? 229 G A "C5'"  1  
ATOM 7696   C "C4'"  . G A 1 240 ? 125.182 151.737 131.687 1.00 0.00 ? 229 G A "C4'"  1  
ATOM 7697   O "O4'"  . G A 1 240 ? 124.313 150.586 131.524 1.00 0.00 ? 229 G A "O4'"  1  
ATOM 7698   C "C3'"  . G A 1 240 ? 124.234 152.924 131.676 1.00 0.00 ? 229 G A "C3'"  1  
ATOM 7699   O "O3'"  . G A 1 240 ? 124.869 154.139 131.315 1.00 0.00 ? 229 G A "O3'"  1  
ATOM 7700   C "C2'"  . G A 1 240 ? 123.158 152.481 130.696 1.00 0.00 ? 229 G A "C2'"  1  
ATOM 7701   O "O2'"  . G A 1 240 ? 123.595 152.624 129.351 1.00 0.00 ? 229 G A "O2'"  1  
ATOM 7702   C "C1'"  . G A 1 240 ? 123.040 150.992 131.023 1.00 0.00 ? 229 G A "C1'"  1  
ATOM 7703   N N9     . G A 1 240 ? 121.984 150.722 132.019 1.00 0.00 ? 229 G A N9     1  
ATOM 7704   C C8     . G A 1 240 ? 122.149 150.461 133.356 1.00 0.00 ? 229 G A C8     1  
ATOM 7705   N N7     . G A 1 240 ? 121.021 150.262 133.985 1.00 0.00 ? 229 G A N7     1  
ATOM 7706   C C5     . G A 1 240 ? 120.053 150.403 133.002 1.00 0.00 ? 229 G A C5     1  
ATOM 7707   C C6     . G A 1 240 ? 118.640 150.300 133.084 1.00 0.00 ? 229 G A C6     1  
ATOM 7708   O O6     . G A 1 240 ? 117.941 150.055 134.073 1.00 0.00 ? 229 G A O6     1  
ATOM 7709   N N1     . G A 1 240 ? 118.039 150.515 131.846 1.00 0.00 ? 229 G A N1     1  
ATOM 7710   C C2     . G A 1 240 ? 118.711 150.795 130.680 1.00 0.00 ? 229 G A C2     1  
ATOM 7711   N N2     . G A 1 240 ? 117.956 150.971 129.586 1.00 0.00 ? 229 G A N2     1  
ATOM 7712   N N3     . G A 1 240 ? 120.026 150.895 130.593 1.00 0.00 ? 229 G A N3     1  
ATOM 7713   C C4     . G A 1 240 ? 120.631 150.688 131.782 1.00 0.00 ? 229 G A C4     1  
ATOM 7714   H "H5'"  . G A 1 240 ? 126.575 150.768 132.838 1.00 0.00 ? 229 G A "H5'"  1  
ATOM 7715   H "H5''" . G A 1 240 ? 126.606 152.351 133.030 1.00 0.00 ? 229 G A "H5''" 1  
ATOM 7716   H "H4'"  . G A 1 240 ? 125.778 151.799 130.910 1.00 0.00 ? 229 G A "H4'"  1  
ATOM 7717   H "H3'"  . G A 1 240 ? 123.834 153.024 132.566 1.00 0.00 ? 229 G A "H3'"  1  
ATOM 7718   H "H2'"  . G A 1 240 ? 122.312 152.951 130.852 1.00 0.00 ? 229 G A "H2'"  1  
ATOM 7719   H "HO2'" . G A 1 240 ? 122.865 152.373 128.749 1.00 0.00 ? 229 G A "HO2'" 1  
ATOM 7720   H "H1'"  . G A 1 240 ? 122.851 150.491 130.202 1.00 0.00 ? 229 G A "H1'"  1  
ATOM 7721   H H8     . G A 1 240 ? 123.024 150.425 133.796 1.00 0.00 ? 229 G A H8     1  
ATOM 7722   H H1     . G A 1 240 ? 117.061 150.463 131.805 1.00 0.00 ? 229 G A H1     1  
ATOM 7723   H H21    . G A 1 240 ? 116.981 150.900 129.644 1.00 0.00 ? 229 G A H21    1  
ATOM 7724   H H22    . G A 1 240 ? 118.381 151.174 128.726 1.00 0.00 ? 229 G A H22    1  
ATOM 7725   P P      . U A 1 241 ? 124.381 155.530 131.959 1.00 0.00 ? 230 U A P      1  
ATOM 7726   O OP1    . U A 1 241 ? 125.337 156.587 131.546 1.00 0.00 ? 230 U A OP1    1  
ATOM 7727   O OP2    . U A 1 241 ? 124.120 155.298 133.403 1.00 0.00 ? 230 U A OP2    1  
ATOM 7728   O "O5'"  . U A 1 241 ? 122.987 155.816 131.247 1.00 0.00 ? 230 U A "O5'"  1  
ATOM 7729   C "C5'"  . U A 1 241 ? 122.924 156.115 129.860 1.00 0.00 ? 230 U A "C5'"  1  
ATOM 7730   C "C4'"  . U A 1 241 ? 121.503 156.136 129.358 1.00 0.00 ? 230 U A "C4'"  1  
ATOM 7731   O "O4'"  . U A 1 241 ? 120.894 154.830 129.535 1.00 0.00 ? 230 U A "O4'"  1  
ATOM 7732   C "C3'"  . U A 1 241 ? 120.553 157.087 130.073 1.00 0.00 ? 230 U A "C3'"  1  
ATOM 7733   O "O3'"  . U A 1 241 ? 120.637 158.418 129.593 1.00 0.00 ? 230 U A "O3'"  1  
ATOM 7734   C "C2'"  . U A 1 241 ? 119.197 156.437 129.841 1.00 0.00 ? 230 U A "C2'"  1  
ATOM 7735   O "O2'"  . U A 1 241 ? 118.716 156.700 128.530 1.00 0.00 ? 230 U A "O2'"  1  
ATOM 7736   C "C1'"  . U A 1 241 ? 119.544 154.952 129.952 1.00 0.00 ? 230 U A "C1'"  1  
ATOM 7737   N N1     . U A 1 241 ? 119.390 154.440 131.336 1.00 0.00 ? 230 U A N1     1  
ATOM 7738   C C2     . U A 1 241 ? 118.110 154.124 131.751 1.00 0.00 ? 230 U A C2     1  
ATOM 7739   O O2     . U A 1 241 ? 117.129 154.246 131.037 1.00 0.00 ? 230 U A O2     1  
ATOM 7740   N N3     . U A 1 241 ? 118.014 153.653 133.037 1.00 0.00 ? 230 U A N3     1  
ATOM 7741   C C4     . U A 1 241 ? 119.044 153.471 133.935 1.00 0.00 ? 230 U A C4     1  
ATOM 7742   O O4     . U A 1 241 ? 118.795 153.037 135.060 1.00 0.00 ? 230 U A O4     1  
ATOM 7743   C C5     . U A 1 241 ? 120.340 153.819 133.437 1.00 0.00 ? 230 U A C5     1  
ATOM 7744   C C6     . U A 1 241 ? 120.462 154.279 132.187 1.00 0.00 ? 230 U A C6     1  
ATOM 7745   H "H5'"  . U A 1 241 ? 123.428 155.434 129.364 1.00 0.00 ? 230 U A "H5'"  1  
ATOM 7746   H "H5''" . U A 1 241 ? 123.331 156.992 129.703 1.00 0.00 ? 230 U A "H5''" 1  
ATOM 7747   H "H4'"  . U A 1 241 ? 121.512 156.358 128.401 1.00 0.00 ? 230 U A "H4'"  1  
ATOM 7748   H "H3'"  . U A 1 241 ? 120.752 157.078 131.033 1.00 0.00 ? 230 U A "H3'"  1  
ATOM 7749   H "H2'"  . U A 1 241 ? 118.547 156.705 130.525 1.00 0.00 ? 230 U A "H2'"  1  
ATOM 7750   H "HO2'" . U A 1 241 ? 119.181 157.484 128.170 1.00 0.00 ? 230 U A "HO2'" 1  
ATOM 7751   H "H1'"  . U A 1 241 ? 118.969 154.436 129.350 1.00 0.00 ? 230 U A "H1'"  1  
ATOM 7752   H H3     . U A 1 241 ? 117.114 153.424 133.351 1.00 0.00 ? 230 U A H3     1  
ATOM 7753   H H5     . U A 1 241 ? 121.130 153.720 134.008 1.00 0.00 ? 230 U A H5     1  
ATOM 7754   H H6     . U A 1 241 ? 121.358 154.512 131.870 1.00 0.00 ? 230 U A H6     1  
ATOM 7755   P P      . A A 1 242 ? 120.365 159.653 130.586 1.00 0.00 ? 231 A A P      1  
ATOM 7756   O OP1    . A A 1 242 ? 120.946 160.873 129.971 1.00 0.00 ? 231 A A OP1    1  
ATOM 7757   O OP2    . A A 1 242 ? 120.786 159.248 131.951 1.00 0.00 ? 231 A A OP2    1  
ATOM 7758   O "O5'"  . A A 1 242 ? 118.779 159.808 130.584 1.00 0.00 ? 231 A A "O5'"  1  
ATOM 7759   C "C5'"  . A A 1 242 ? 118.097 160.312 129.447 1.00 0.00 ? 231 A A "C5'"  1  
ATOM 7760   C "C4'"  . A A 1 242 ? 116.605 160.124 129.567 1.00 0.00 ? 231 A A "C4'"  1  
ATOM 7761   O "O4'"  . A A 1 242 ? 116.299 158.716 129.733 1.00 0.00 ? 231 A A "O4'"  1  
ATOM 7762   C "C3'"  . A A 1 242 ? 115.943 160.791 130.761 1.00 0.00 ? 231 A A "C3'"  1  
ATOM 7763   O "O3'"  . A A 1 242 ? 115.649 162.160 130.540 1.00 0.00 ? 231 A A "O3'"  1  
ATOM 7764   C "C2'"  . A A 1 242 ? 114.706 159.929 130.980 1.00 0.00 ? 231 A A "C2'"  1  
ATOM 7765   O "O2'"  . A A 1 242 ? 113.691 160.234 130.036 1.00 0.00 ? 231 A A "O2'"  1  
ATOM 7766   C "C1'"  . A A 1 242 ? 115.255 158.532 130.685 1.00 0.00 ? 231 A A "C1'"  1  
ATOM 7767   N N9     . A A 1 242 ? 115.769 157.868 131.900 1.00 0.00 ? 231 A A N9     1  
ATOM 7768   C C8     . A A 1 242 ? 117.073 157.753 132.311 1.00 0.00 ? 231 A A C8     1  
ATOM 7769   N N7     . A A 1 242 ? 117.217 157.104 133.440 1.00 0.00 ? 231 A A N7     1  
ATOM 7770   C C5     . A A 1 242 ? 115.917 156.770 133.799 1.00 0.00 ? 231 A A C5     1  
ATOM 7771   C C6     . A A 1 242 ? 115.388 156.074 134.899 1.00 0.00 ? 231 A A C6     1  
ATOM 7772   N N6     . A A 1 242 ? 116.135 155.567 135.883 1.00 0.00 ? 231 A A N6     1  
ATOM 7773   N N1     . A A 1 242 ? 114.048 155.912 134.957 1.00 0.00 ? 231 A A N1     1  
ATOM 7774   C C2     . A A 1 242 ? 113.299 156.419 133.970 1.00 0.00 ? 231 A A C2     1  
ATOM 7775   N N3     . A A 1 242 ? 113.678 157.091 132.885 1.00 0.00 ? 231 A A N3     1  
ATOM 7776   C C4     . A A 1 242 ? 115.016 157.235 132.860 1.00 0.00 ? 231 A A C4     1  
ATOM 7777   H "H5'"  . A A 1 242 ? 118.415 159.841 128.647 1.00 0.00 ? 231 A A "H5'"  1  
ATOM 7778   H "H5''" . A A 1 242 ? 118.293 161.268 129.353 1.00 0.00 ? 231 A A "H5''" 1  
ATOM 7779   H "H4'"  . A A 1 242 ? 116.177 160.448 128.745 1.00 0.00 ? 231 A A "H4'"  1  
ATOM 7780   H "H3'"  . A A 1 242 ? 116.531 160.711 131.541 1.00 0.00 ? 231 A A "H3'"  1  
ATOM 7781   H "H2'"  . A A 1 242 ? 114.378 159.998 131.901 1.00 0.00 ? 231 A A "H2'"  1  
ATOM 7782   H "HO2'" . A A 1 242 ? 113.862 161.124 129.660 1.00 0.00 ? 231 A A "HO2'" 1  
ATOM 7783   H "H1'"  . A A 1 242 ? 114.547 157.981 130.289 1.00 0.00 ? 231 A A "H1'"  1  
ATOM 7784   H H8     . A A 1 242 ? 117.828 158.121 131.805 1.00 0.00 ? 231 A A H8     1  
ATOM 7785   H H61    . A A 1 242 ? 115.708 155.090 136.626 1.00 0.00 ? 231 A A H61    1  
ATOM 7786   H H62    . A A 1 242 ? 117.108 155.671 135.864 1.00 0.00 ? 231 A A H62    1  
ATOM 7787   H H2     . A A 1 242 ? 112.333 156.275 134.060 1.00 0.00 ? 231 A A H2     1  
ATOM 7788   P P      . A A 1 243 ? 115.590 163.184 131.777 1.00 0.00 ? 232 A A P      1  
ATOM 7789   O OP1    . A A 1 243 ? 115.444 164.557 131.231 1.00 0.00 ? 232 A A OP1    1  
ATOM 7790   O OP2    . A A 1 243 ? 116.720 162.872 132.686 1.00 0.00 ? 232 A A OP2    1  
ATOM 7791   O "O5'"  . A A 1 243 ? 114.235 162.805 132.527 1.00 0.00 ? 232 A A "O5'"  1  
ATOM 7792   C "C5'"  . A A 1 243 ? 112.975 163.020 131.908 1.00 0.00 ? 232 A A "C5'"  1  
ATOM 7793   C "C4'"  . A A 1 243 ? 111.853 162.408 132.711 1.00 0.00 ? 232 A A "C4'"  1  
ATOM 7794   O "O4'"  . A A 1 243 ? 112.059 160.978 132.832 1.00 0.00 ? 232 A A "O4'"  1  
ATOM 7795   C "C3'"  . A A 1 243 ? 111.725 162.888 134.149 1.00 0.00 ? 232 A A "C3'"  1  
ATOM 7796   O "O3'"  . A A 1 243 ? 111.033 164.121 134.263 1.00 0.00 ? 232 A A "O3'"  1  
ATOM 7797   C "C2'"  . A A 1 243 ? 111.015 161.725 134.824 1.00 0.00 ? 232 A A "C2'"  1  
ATOM 7798   O "O2'"  . A A 1 243 ? 109.622 161.728 134.529 1.00 0.00 ? 232 A A "O2'"  1  
ATOM 7799   C "C1'"  . A A 1 243 ? 111.663 160.526 134.131 1.00 0.00 ? 232 A A "C1'"  1  
ATOM 7800   N N9     . A A 1 243 ? 112.825 160.012 134.879 1.00 0.00 ? 232 A A N9     1  
ATOM 7801   C C8     . A A 1 243 ? 114.156 160.164 134.579 1.00 0.00 ? 232 A A C8     1  
ATOM 7802   N N7     . A A 1 243 ? 114.961 159.590 135.439 1.00 0.00 ? 232 A A N7     1  
ATOM 7803   C C5     . A A 1 243 ? 114.102 159.021 136.370 1.00 0.00 ? 232 A A C5     1  
ATOM 7804   C C6     . A A 1 243 ? 114.333 158.268 137.534 1.00 0.00 ? 232 A A C6     1  
ATOM 7805   N N6     . A A 1 243 ? 115.547 157.947 137.981 1.00 0.00 ? 232 A A N6     1  
ATOM 7806   N N1     . A A 1 243 ? 113.255 157.852 138.236 1.00 0.00 ? 232 A A N1     1  
ATOM 7807   C C2     . A A 1 243 ? 112.034 158.174 137.789 1.00 0.00 ? 232 A A C2     1  
ATOM 7808   N N3     . A A 1 243 ? 111.692 158.873 136.711 1.00 0.00 ? 232 A A N3     1  
ATOM 7809   C C4     . A A 1 243 ? 112.785 159.274 136.036 1.00 0.00 ? 232 A A C4     1  
ATOM 7810   H "H5'"  . A A 1 243 ? 112.985 162.617 131.014 1.00 0.00 ? 232 A A "H5'"  1  
ATOM 7811   H "H5''" . A A 1 243 ? 112.821 163.982 131.823 1.00 0.00 ? 232 A A "H5''" 1  
ATOM 7812   H "H4'"  . A A 1 243 ? 111.007 162.572 132.245 1.00 0.00 ? 232 A A "H4'"  1  
ATOM 7813   H "H3'"  . A A 1 243 ? 112.620 162.986 134.536 1.00 0.00 ? 232 A A "H3'"  1  
ATOM 7814   H "H2'"  . A A 1 243 ? 111.180 161.711 135.790 1.00 0.00 ? 232 A A "H2'"  1  
ATOM 7815   H "HO2'" . A A 1 243 ? 109.187 161.016 135.041 1.00 0.00 ? 232 A A "HO2'" 1  
ATOM 7816   H "H1'"  . A A 1 243 ? 111.000 159.811 134.025 1.00 0.00 ? 232 A A "H1'"  1  
ATOM 7817   H H8     . A A 1 243 ? 114.477 160.657 133.795 1.00 0.00 ? 232 A A H8     1  
ATOM 7818   H H61    . A A 1 243 ? 115.647 157.419 138.801 1.00 0.00 ? 232 A A H61    1  
ATOM 7819   H H62    . A A 1 243 ? 116.344 158.239 137.488 1.00 0.00 ? 232 A A H62    1  
ATOM 7820   H H2     . A A 1 243 ? 111.288 157.847 138.336 1.00 0.00 ? 232 A A H2     1  
ATOM 7821   P P      . U A 1 244 ? 111.377 165.132 135.463 1.00 0.00 ? 233 U A P      1  
ATOM 7822   O OP1    . U A 1 244 ? 110.635 166.397 135.224 1.00 0.00 ? 233 U A OP1    1  
ATOM 7823   O OP2    . U A 1 244 ? 112.851 165.164 135.628 1.00 0.00 ? 233 U A OP2    1  
ATOM 7824   O "O5'"  . U A 1 244 ? 110.750 164.430 136.747 1.00 0.00 ? 233 U A "O5'"  1  
ATOM 7825   C "C5'"  . U A 1 244 ? 109.347 164.269 136.883 1.00 0.00 ? 233 U A "C5'"  1  
ATOM 7826   C "C4'"  . U A 1 244 ? 108.990 163.493 138.125 1.00 0.00 ? 233 U A "C4'"  1  
ATOM 7827   O "O4'"  . U A 1 244 ? 109.530 162.148 138.041 1.00 0.00 ? 233 U A "O4'"  1  
ATOM 7828   C "C3'"  . U A 1 244 ? 109.544 164.034 139.436 1.00 0.00 ? 233 U A "C3'"  1  
ATOM 7829   O "O3'"  . U A 1 244 ? 108.773 165.098 139.967 1.00 0.00 ? 233 U A "O3'"  1  
ATOM 7830   C "C2'"  . U A 1 244 ? 109.569 162.796 140.321 1.00 0.00 ? 233 U A "C2'"  1  
ATOM 7831   O "O2'"  . U A 1 244 ? 108.273 162.490 140.818 1.00 0.00 ? 233 U A "O2'"  1  
ATOM 7832   C "C1'"  . U A 1 244 ? 109.985 161.714 139.323 1.00 0.00 ? 233 U A "C1'"  1  
ATOM 7833   N N1     . U A 1 244 ? 111.452 161.501 139.304 1.00 0.00 ? 233 U A N1     1  
ATOM 7834   C C2     . U A 1 244 ? 111.999 160.779 140.349 1.00 0.00 ? 233 U A C2     1  
ATOM 7835   O O2     . U A 1 244 ? 111.332 160.322 141.261 1.00 0.00 ? 233 U A O2     1  
ATOM 7836   N N3     . U A 1 244 ? 113.359 160.606 140.291 1.00 0.00 ? 233 U A N3     1  
ATOM 7837   C C4     . U A 1 244 ? 114.215 161.072 139.315 1.00 0.00 ? 233 U A C4     1  
ATOM 7838   O O4     . U A 1 244 ? 115.421 160.832 139.404 1.00 0.00 ? 233 U A O4     1  
ATOM 7839   C C5     . U A 1 244 ? 113.582 161.810 138.264 1.00 0.00 ? 233 U A C5     1  
ATOM 7840   C C6     . U A 1 244 ? 112.256 161.993 138.298 1.00 0.00 ? 233 U A C6     1  
ATOM 7841   H "H5'"  . U A 1 244 ? 109.004 163.791 136.098 1.00 0.00 ? 233 U A "H5'"  1  
ATOM 7842   H "H5''" . U A 1 244 ? 108.926 165.153 136.927 1.00 0.00 ? 233 U A "H5''" 1  
ATOM 7843   H "H4'"  . U A 1 244 ? 108.013 163.441 138.193 1.00 0.00 ? 233 U A "H4'"  1  
ATOM 7844   H "H3'"  . U A 1 244 ? 110.463 164.343 139.293 1.00 0.00 ? 233 U A "H3'"  1  
ATOM 7845   H "H2'"  . U A 1 244 ? 110.225 162.886 141.046 1.00 0.00 ? 233 U A "H2'"  1  
ATOM 7846   H "HO2'" . U A 1 244 ? 108.341 161.740 141.443 1.00 0.00 ? 233 U A "HO2'" 1  
ATOM 7847   H "H1'"  . U A 1 244 ? 109.539 160.873 139.550 1.00 0.00 ? 233 U A "H1'"  1  
ATOM 7848   H H3     . U A 1 244 ? 113.766 160.096 141.021 1.00 0.00 ? 233 U A H3     1  
ATOM 7849   H H5     . U A 1 244 ? 114.114 162.177 137.530 1.00 0.00 ? 233 U A H5     1  
ATOM 7850   H H6     . U A 1 244 ? 111.848 162.502 137.569 1.00 0.00 ? 233 U A H6     1  
ATOM 7851   P P      . U A 1 245 ? 109.494 166.417 140.532 1.00 0.00 ? 234 U A P      1  
ATOM 7852   O OP1    . U A 1 245 ? 108.542 167.110 141.437 1.00 0.00 ? 234 U A OP1    1  
ATOM 7853   O OP2    . U A 1 245 ? 110.078 167.150 139.381 1.00 0.00 ? 234 U A OP2    1  
ATOM 7854   O "O5'"  . U A 1 245 ? 110.692 165.852 141.416 1.00 0.00 ? 234 U A "O5'"  1  
ATOM 7855   C "C5'"  . U A 1 245 ? 112.011 166.355 141.264 1.00 0.00 ? 234 U A "C5'"  1  
ATOM 7856   C "C4'"  . U A 1 245 ? 112.992 165.619 142.143 1.00 0.00 ? 234 U A "C4'"  1  
ATOM 7857   O "O4'"  . U A 1 245 ? 113.395 164.393 141.498 1.00 0.00 ? 234 U A "O4'"  1  
ATOM 7858   C "C3'"  . U A 1 245 ? 114.307 166.331 142.423 1.00 0.00 ? 234 U A "C3'"  1  
ATOM 7859   O "O3'"  . U A 1 245 ? 114.206 167.295 143.456 1.00 0.00 ? 234 U A "O3'"  1  
ATOM 7860   C "C2'"  . U A 1 245 ? 115.218 165.165 142.812 1.00 0.00 ? 234 U A "C2'"  1  
ATOM 7861   O "O2'"  . U A 1 245 ? 114.987 164.756 144.152 1.00 0.00 ? 234 U A "O2'"  1  
ATOM 7862   C "C1'"  . U A 1 245 ? 114.735 164.076 141.875 1.00 0.00 ? 234 U A "C1'"  1  
ATOM 7863   N N1     . U A 1 245 ? 115.583 163.959 140.663 1.00 0.00 ? 234 U A N1     1  
ATOM 7864   C C2     . U A 1 245 ? 116.753 163.232 140.780 1.00 0.00 ? 234 U A C2     1  
ATOM 7865   O O2     . U A 1 245 ? 117.103 162.695 141.817 1.00 0.00 ? 234 U A O2     1  
ATOM 7866   N N3     . U A 1 245 ? 117.505 163.150 139.634 1.00 0.00 ? 234 U A N3     1  
ATOM 7867   C C4     . U A 1 245 ? 117.216 163.710 138.408 1.00 0.00 ? 234 U A C4     1  
ATOM 7868   O O4     . U A 1 245 ? 117.997 163.547 137.469 1.00 0.00 ? 234 U A O4     1  
ATOM 7869   C C5     . U A 1 245 ? 115.990 164.448 138.361 1.00 0.00 ? 234 U A C5     1  
ATOM 7870   C C6     . U A 1 245 ? 115.238 164.542 139.462 1.00 0.00 ? 234 U A C6     1  
ATOM 7871   H "H5'"  . U A 1 245 ? 112.020 167.306 141.502 1.00 0.00 ? 234 U A "H5'"  1  
ATOM 7872   H "H5''" . U A 1 245 ? 112.285 166.257 140.329 1.00 0.00 ? 234 U A "H5''" 1  
ATOM 7873   H "H4'"  . U A 1 245 ? 112.555 165.404 142.993 1.00 0.00 ? 234 U A "H4'"  1  
ATOM 7874   H "H3'"  . U A 1 245 ? 114.636 166.738 141.594 1.00 0.00 ? 234 U A "H3'"  1  
ATOM 7875   H "H2'"  . U A 1 245 ? 116.162 165.379 142.657 1.00 0.00 ? 234 U A "H2'"  1  
ATOM 7876   H "HO2'" . U A 1 245 ? 114.159 164.233 144.188 1.00 0.00 ? 234 U A "HO2'" 1  
ATOM 7877   H "H1'"  . U A 1 245 ? 114.731 163.219 142.351 1.00 0.00 ? 234 U A "H1'"  1  
ATOM 7878   H H3     . U A 1 245 ? 118.339 162.639 139.695 1.00 0.00 ? 234 U A H3     1  
ATOM 7879   H H5     . U A 1 245 ? 115.705 164.879 137.529 1.00 0.00 ? 234 U A H5     1  
ATOM 7880   H H6     . U A 1 245 ? 114.405 165.053 139.405 1.00 0.00 ? 234 U A H6     1  
ATOM 7881   P P      . C A 1 246 ? 115.524 167.770 144.234 1.00 0.00 ? 235 C A P      1  
ATOM 7882   O OP1    . C A 1 246 ? 115.266 169.086 144.872 1.00 0.00 ? 235 C A OP1    1  
ATOM 7883   O OP2    . C A 1 246 ? 116.574 167.656 143.190 1.00 0.00 ? 235 C A OP2    1  
ATOM 7884   O "O5'"  . C A 1 246 ? 115.856 166.721 145.385 1.00 0.00 ? 235 C A "O5'"  1  
ATOM 7885   C "C5'"  . C A 1 246 ? 115.484 166.974 146.732 1.00 0.00 ? 235 C A "C5'"  1  
ATOM 7886   C "C4'"  . C A 1 246 ? 114.670 165.840 147.307 1.00 0.00 ? 235 C A "C4'"  1  
ATOM 7887   O "O4'"  . C A 1 246 ? 114.529 164.787 146.320 1.00 0.00 ? 235 C A "O4'"  1  
ATOM 7888   C "C3'"  . C A 1 246 ? 115.261 165.140 148.521 1.00 0.00 ? 235 C A "C3'"  1  
ATOM 7889   O "O3'"  . C A 1 246 ? 114.985 165.816 149.736 1.00 0.00 ? 235 C A "O3'"  1  
ATOM 7890   C "C2'"  . C A 1 246 ? 114.603 163.760 148.462 1.00 0.00 ? 235 C A "C2'"  1  
ATOM 7891   O "O2'"  . C A 1 246 ? 113.286 163.794 148.992 1.00 0.00 ? 235 C A "O2'"  1  
ATOM 7892   C "C1'"  . C A 1 246 ? 114.526 163.522 146.950 1.00 0.00 ? 235 C A "C1'"  1  
ATOM 7893   N N1     . C A 1 246 ? 115.683 162.744 146.442 1.00 0.00 ? 235 C A N1     1  
ATOM 7894   C C2     . C A 1 246 ? 115.668 161.352 146.598 1.00 0.00 ? 235 C A C2     1  
ATOM 7895   O O2     . C A 1 246 ? 114.697 160.815 147.153 1.00 0.00 ? 235 C A O2     1  
ATOM 7896   N N3     . C A 1 246 ? 116.710 160.620 146.144 1.00 0.00 ? 235 C A N3     1  
ATOM 7897   C C4     . C A 1 246 ? 117.742 161.221 145.552 1.00 0.00 ? 235 C A C4     1  
ATOM 7898   N N4     . C A 1 246 ? 118.748 160.458 145.118 1.00 0.00 ? 235 C A N4     1  
ATOM 7899   C C5     . C A 1 246 ? 117.787 162.633 145.378 1.00 0.00 ? 235 C A C5     1  
ATOM 7900   C C6     . C A 1 246 ? 116.750 163.348 145.831 1.00 0.00 ? 235 C A C6     1  
ATOM 7901   H "H5'"  . C A 1 246 ? 114.954 167.797 146.767 1.00 0.00 ? 235 C A "H5'"  1  
ATOM 7902   H "H5''" . C A 1 246 ? 116.294 167.091 147.270 1.00 0.00 ? 235 C A "H5''" 1  
ATOM 7903   H "H4'"  . C A 1 246 ? 113.780 166.176 147.537 1.00 0.00 ? 235 C A "H4'"  1  
ATOM 7904   H "H3'"  . C A 1 246 ? 116.231 165.050 148.418 1.00 0.00 ? 235 C A "H3'"  1  
ATOM 7905   H "H2'"  . C A 1 246 ? 115.154 163.081 148.904 1.00 0.00 ? 235 C A "H2'"  1  
ATOM 7906   H "HO2'" . C A 1 246 ? 113.211 164.549 149.612 1.00 0.00 ? 235 C A "HO2'" 1  
ATOM 7907   H "H1'"  . C A 1 246 ? 113.695 163.046 146.741 1.00 0.00 ? 235 C A "H1'"  1  
ATOM 7908   H H41    . C A 1 246 ? 118.714 159.486 145.240 1.00 0.00 ? 235 C A H41    1  
ATOM 7909   H H42    . C A 1 246 ? 119.521 160.870 144.679 1.00 0.00 ? 235 C A H42    1  
ATOM 7910   H H5     . C A 1 246 ? 118.550 163.067 144.941 1.00 0.00 ? 235 C A H5     1  
ATOM 7911   H H6     . C A 1 246 ? 116.763 164.321 145.721 1.00 0.00 ? 235 C A H6     1  
ATOM 7912   P P      . A A 1 247 ? 116.149 166.029 150.825 1.00 0.00 ? 236 A A P      1  
ATOM 7913   O OP1    . A A 1 247 ? 115.708 167.087 151.768 1.00 0.00 ? 236 A A OP1    1  
ATOM 7914   O OP2    . A A 1 247 ? 117.435 166.182 150.099 1.00 0.00 ? 236 A A OP2    1  
ATOM 7915   O "O5'"  . A A 1 247 ? 116.193 164.648 151.618 1.00 0.00 ? 236 A A "O5'"  1  
ATOM 7916   C "C5'"  . A A 1 247 ? 115.368 164.433 152.753 1.00 0.00 ? 236 A A "C5'"  1  
ATOM 7917   C "C4'"  . A A 1 247 ? 115.483 163.017 153.261 1.00 0.00 ? 236 A A "C4'"  1  
ATOM 7918   O "O4'"  . A A 1 247 ? 115.163 162.071 152.201 1.00 0.00 ? 236 A A "O4'"  1  
ATOM 7919   C "C3'"  . A A 1 247 ? 116.862 162.589 153.738 1.00 0.00 ? 236 A A "C3'"  1  
ATOM 7920   O "O3'"  . A A 1 247 ? 117.158 163.035 155.050 1.00 0.00 ? 236 A A "O3'"  1  
ATOM 7921   C "C2'"  . A A 1 247 ? 116.793 161.070 153.599 1.00 0.00 ? 236 A A "C2'"  1  
ATOM 7922   O "O2'"  . A A 1 247 ? 116.098 160.483 154.690 1.00 0.00 ? 236 A A "O2'"  1  
ATOM 7923   C "C1'"  . A A 1 247 ? 115.946 160.918 152.330 1.00 0.00 ? 236 A A "C1'"  1  
ATOM 7924   N N9     . A A 1 247 ? 116.778 160.774 151.120 1.00 0.00 ? 236 A A N9     1  
ATOM 7925   C C8     . A A 1 247 ? 117.018 161.710 150.144 1.00 0.00 ? 236 A A C8     1  
ATOM 7926   N N7     . A A 1 247 ? 117.804 161.285 149.186 1.00 0.00 ? 236 A A N7     1  
ATOM 7927   C C5     . A A 1 247 ? 118.103 159.980 149.555 1.00 0.00 ? 236 A A C5     1  
ATOM 7928   C C6     . A A 1 247 ? 118.894 158.984 148.955 1.00 0.00 ? 236 A A C6     1  
ATOM 7929   N N6     . A A 1 247 ? 119.556 159.155 147.809 1.00 0.00 ? 236 A A N6     1  
ATOM 7930   N N1     . A A 1 247 ? 118.983 157.791 149.581 1.00 0.00 ? 236 A A N1     1  
ATOM 7931   C C2     . A A 1 247 ? 118.319 157.619 150.731 1.00 0.00 ? 236 A A C2     1  
ATOM 7932   N N3     . A A 1 247 ? 117.545 158.477 151.393 1.00 0.00 ? 236 A A N3     1  
ATOM 7933   C C4     . A A 1 247 ? 117.478 159.653 150.744 1.00 0.00 ? 236 A A C4     1  
ATOM 7934   H "H5'"  . A A 1 247 ? 114.435 164.610 152.509 1.00 0.00 ? 236 A A "H5'"  1  
ATOM 7935   H "H5''" . A A 1 247 ? 115.635 165.050 153.465 1.00 0.00 ? 236 A A "H5''" 1  
ATOM 7936   H "H4'"  . A A 1 247 ? 114.843 162.901 153.995 1.00 0.00 ? 236 A A "H4'"  1  
ATOM 7937   H "H3'"  . A A 1 247 ? 117.542 162.934 153.121 1.00 0.00 ? 236 A A "H3'"  1  
ATOM 7938   H "H2'"  . A A 1 247 ? 117.684 160.679 153.483 1.00 0.00 ? 236 A A "H2'"  1  
ATOM 7939   H "HO2'" . A A 1 247 ? 116.096 159.510 154.580 1.00 0.00 ? 236 A A "HO2'" 1  
ATOM 7940   H "H1'"  . A A 1 247 ? 115.362 160.135 152.420 1.00 0.00 ? 236 A A "H1'"  1  
ATOM 7941   H H8     . A A 1 247 ? 116.637 162.613 150.163 1.00 0.00 ? 236 A A H8     1  
ATOM 7942   H H61    . A A 1 247 ? 120.092 158.422 147.439 1.00 0.00 ? 236 A A H61    1  
ATOM 7943   H H62    . A A 1 247 ? 119.506 160.012 147.337 1.00 0.00 ? 236 A A H62    1  
ATOM 7944   H H2     . A A 1 247 ? 118.416 156.735 151.145 1.00 0.00 ? 236 A A H2     1  
ATOM 7945   P P      . U A 1 248 ? 118.367 164.063 155.301 1.00 0.00 ? 237 U A P      1  
ATOM 7946   O OP1    . U A 1 248 ? 118.376 164.421 156.742 1.00 0.00 ? 237 U A OP1    1  
ATOM 7947   O OP2    . U A 1 248 ? 118.276 165.136 154.279 1.00 0.00 ? 237 U A OP2    1  
ATOM 7948   O "O5'"  . U A 1 248 ? 119.673 163.203 154.998 1.00 0.00 ? 237 U A "O5'"  1  
ATOM 7949   C "C5'"  . U A 1 248 ? 120.065 162.143 155.855 1.00 0.00 ? 237 U A "C5'"  1  
ATOM 7950   C "C4'"  . U A 1 248 ? 120.839 161.084 155.114 1.00 0.00 ? 237 U A "C4'"  1  
ATOM 7951   O "O4'"  . U A 1 248 ? 120.080 160.627 153.967 1.00 0.00 ? 237 U A "O4'"  1  
ATOM 7952   C "C3'"  . U A 1 248 ? 122.174 161.520 154.525 1.00 0.00 ? 237 U A "C3'"  1  
ATOM 7953   O "O3'"  . U A 1 248 ? 123.227 161.510 155.475 1.00 0.00 ? 237 U A "O3'"  1  
ATOM 7954   C "C2'"  . U A 1 248 ? 122.371 160.530 153.384 1.00 0.00 ? 237 U A "C2'"  1  
ATOM 7955   O "O2'"  . U A 1 248 ? 122.811 159.269 153.865 1.00 0.00 ? 237 U A "O2'"  1  
ATOM 7956   C "C1'"  . U A 1 248 ? 120.943 160.390 152.854 1.00 0.00 ? 237 U A "C1'"  1  
ATOM 7957   N N1     . U A 1 248 ? 120.649 161.358 151.769 1.00 0.00 ? 237 U A N1     1  
ATOM 7958   C C2     . U A 1 248 ? 121.142 161.065 150.511 1.00 0.00 ? 237 U A C2     1  
ATOM 7959   O O2     . U A 1 248 ? 121.793 160.064 150.266 1.00 0.00 ? 237 U A O2     1  
ATOM 7960   N N3     . U A 1 248 ? 120.843 161.987 149.539 1.00 0.00 ? 237 U A N3     1  
ATOM 7961   C C4     . U A 1 248 ? 120.119 163.151 149.692 1.00 0.00 ? 237 U A C4     1  
ATOM 7962   O O4     . U A 1 248 ? 119.936 163.881 148.717 1.00 0.00 ? 237 U A O4     1  
ATOM 7963   C C5     . U A 1 248 ? 119.641 163.390 151.020 1.00 0.00 ? 237 U A C5     1  
ATOM 7964   C C6     . U A 1 248 ? 119.915 162.507 151.986 1.00 0.00 ? 237 U A C6     1  
ATOM 7965   H "H5'"  . U A 1 248 ? 119.263 161.737 156.248 1.00 0.00 ? 237 U A "H5'"  1  
ATOM 7966   H "H5''" . U A 1 248 ? 120.623 162.504 156.574 1.00 0.00 ? 237 U A "H5''" 1  
ATOM 7967   H "H4'"  . U A 1 248 ? 120.992 160.328 155.718 1.00 0.00 ? 237 U A "H4'"  1  
ATOM 7968   H "H3'"  . U A 1 248 ? 122.083 162.422 154.156 1.00 0.00 ? 237 U A "H3'"  1  
ATOM 7969   H "H2'"  . U A 1 248 ? 122.975 160.889 152.699 1.00 0.00 ? 237 U A "H2'"  1  
ATOM 7970   H "HO2'" . U A 1 248 ? 123.195 159.385 154.760 1.00 0.00 ? 237 U A "HO2'" 1  
ATOM 7971   H "H1'"  . U A 1 248 ? 120.809 159.478 152.519 1.00 0.00 ? 237 U A "H1'"  1  
ATOM 7972   H H3     . U A 1 248 ? 121.183 161.800 148.641 1.00 0.00 ? 237 U A H3     1  
ATOM 7973   H H5     . U A 1 248 ? 119.116 164.194 151.217 1.00 0.00 ? 237 U A H5     1  
ATOM 7974   H H6     . U A 1 248 ? 119.578 162.692 152.885 1.00 0.00 ? 237 U A H6     1  
ATOM 7975   P P      . G A 1 249 ? 124.456 162.536 155.329 1.00 0.00 ? 238 G A P      1  
ATOM 7976   O OP1    . G A 1 249 ? 125.259 162.471 156.577 1.00 0.00 ? 238 G A OP1    1  
ATOM 7977   O OP2    . G A 1 249 ? 123.916 163.840 154.873 1.00 0.00 ? 238 G A OP2    1  
ATOM 7978   O "O5'"  . G A 1 249 ? 125.332 161.924 154.146 1.00 0.00 ? 238 G A "O5'"  1  
ATOM 7979   C "C5'"  . G A 1 249 ? 126.029 160.699 154.314 1.00 0.00 ? 238 G A "C5'"  1  
ATOM 7980   C "C4'"  . G A 1 249 ? 126.650 160.233 153.020 1.00 0.00 ? 238 G A "C4'"  1  
ATOM 7981   O "O4'"  . G A 1 249 ? 125.615 160.033 152.022 1.00 0.00 ? 238 G A "O4'"  1  
ATOM 7982   C "C3'"  . G A 1 249 ? 127.620 161.200 152.360 1.00 0.00 ? 238 G A "C3'"  1  
ATOM 7983   O "O3'"  . G A 1 249 ? 128.921 161.153 152.922 1.00 0.00 ? 238 G A "O3'"  1  
ATOM 7984   C "C2'"  . G A 1 249 ? 127.571 160.775 150.899 1.00 0.00 ? 238 G A "C2'"  1  
ATOM 7985   O "O2'"  . G A 1 249 ? 128.341 159.604 150.677 1.00 0.00 ? 238 G A "O2'"  1  
ATOM 7986   C "C1'"  . G A 1 249 ? 126.088 160.436 150.729 1.00 0.00 ? 238 G A "C1'"  1  
ATOM 7987   N N9     . G A 1 249 ? 125.308 161.582 150.228 1.00 0.00 ? 238 G A N9     1  
ATOM 7988   C C8     . G A 1 249 ? 124.433 162.367 150.937 1.00 0.00 ? 238 G A C8     1  
ATOM 7989   N N7     . G A 1 249 ? 123.889 163.310 150.219 1.00 0.00 ? 238 G A N7     1  
ATOM 7990   C C5     . G A 1 249 ? 124.439 163.140 148.956 1.00 0.00 ? 238 G A C5     1  
ATOM 7991   C C6     . G A 1 249 ? 124.232 163.868 147.756 1.00 0.00 ? 238 G A C6     1  
ATOM 7992   O O6     . G A 1 249 ? 123.493 164.841 147.563 1.00 0.00 ? 238 G A O6     1  
ATOM 7993   N N1     . G A 1 249 ? 124.992 163.356 146.708 1.00 0.00 ? 238 G A N1     1  
ATOM 7994   C C2     . G A 1 249 ? 125.843 162.282 146.802 1.00 0.00 ? 238 G A C2     1  
ATOM 7995   N N2     . G A 1 249 ? 126.491 161.938 145.678 1.00 0.00 ? 238 G A N2     1  
ATOM 7996   N N3     . G A 1 249 ? 126.046 161.597 147.915 1.00 0.00 ? 238 G A N3     1  
ATOM 7997   C C4     . G A 1 249 ? 125.318 162.078 148.944 1.00 0.00 ? 238 G A C4     1  
ATOM 7998   H "H5'"  . G A 1 249 ? 125.402 160.015 154.632 1.00 0.00 ? 238 G A "H5'"  1  
ATOM 7999   H "H5''" . G A 1 249 ? 126.736 160.821 154.981 1.00 0.00 ? 238 G A "H5''" 1  
ATOM 8000   H "H4'"  . G A 1 249 ? 127.110 159.381 153.177 1.00 0.00 ? 238 G A "H4'"  1  
ATOM 8001   H "H3'"  . G A 1 249 ? 127.269 162.113 152.440 1.00 0.00 ? 238 G A "H3'"  1  
ATOM 8002   H "H2'"  . G A 1 249 ? 127.839 161.505 150.302 1.00 0.00 ? 238 G A "H2'"  1  
ATOM 8003   H "HO2'" . G A 1 249 ? 128.984 159.500 151.409 1.00 0.00 ? 238 G A "HO2'" 1  
ATOM 8004   H "H1'"  . G A 1 249 ? 125.997 159.680 150.111 1.00 0.00 ? 238 G A "H1'"  1  
ATOM 8005   H H8     . G A 1 249 ? 124.235 162.233 151.888 1.00 0.00 ? 238 G A H8     1  
ATOM 8006   H H1     . G A 1 249 ? 124.911 163.799 145.836 1.00 0.00 ? 238 G A H1     1  
ATOM 8007   H H21    . G A 1 249 ? 126.348 162.441 144.853 1.00 0.00 ? 238 G A H21    1  
ATOM 8008   H H22    . G A 1 249 ? 127.114 161.178 145.688 1.00 0.00 ? 238 G A H22    1  
ATOM 8009   P P      . G A 1 250 ? 129.843 162.470 152.935 1.00 0.00 ? 239 G A P      1  
ATOM 8010   O OP1    . G A 1 250 ? 131.019 162.196 153.797 1.00 0.00 ? 239 G A OP1    1  
ATOM 8011   O OP2    . G A 1 250 ? 128.974 163.637 153.226 1.00 0.00 ? 239 G A OP2    1  
ATOM 8012   O "O5'"  . G A 1 250 ? 130.352 162.599 151.430 1.00 0.00 ? 239 G A "O5'"  1  
ATOM 8013   C "C5'"  . G A 1 250 ? 131.242 161.641 150.877 1.00 0.00 ? 239 G A "C5'"  1  
ATOM 8014   C "C4'"  . G A 1 250 ? 131.481 161.889 149.408 1.00 0.00 ? 239 G A "C4'"  1  
ATOM 8015   O "O4'"  . G A 1 250 ? 130.229 161.780 148.682 1.00 0.00 ? 239 G A "O4'"  1  
ATOM 8016   C "C3'"  . G A 1 250 ? 132.003 163.270 149.040 1.00 0.00 ? 239 G A "C3'"  1  
ATOM 8017   O "O3'"  . G A 1 250 ? 133.403 163.398 149.219 1.00 0.00 ? 239 G A "O3'"  1  
ATOM 8018   C "C2'"  . G A 1 250 ? 131.555 163.420 147.594 1.00 0.00 ? 239 G A "C2'"  1  
ATOM 8019   O "O2'"  . G A 1 250 ? 132.400 162.693 146.714 1.00 0.00 ? 239 G A "O2'"  1  
ATOM 8020   C "C1'"  . G A 1 250 ? 130.180 162.749 147.629 1.00 0.00 ? 239 G A "C1'"  1  
ATOM 8021   N N9     . G A 1 250 ? 129.095 163.720 147.862 1.00 0.00 ? 239 G A N9     1  
ATOM 8022   C C8     . G A 1 250 ? 128.370 163.895 149.017 1.00 0.00 ? 239 G A C8     1  
ATOM 8023   N N7     . G A 1 250 ? 127.470 164.837 148.920 1.00 0.00 ? 239 G A N7     1  
ATOM 8024   C C5     . G A 1 250 ? 127.607 165.310 147.624 1.00 0.00 ? 239 G A C5     1  
ATOM 8025   C C6     . G A 1 250 ? 126.902 166.334 146.939 1.00 0.00 ? 239 G A C6     1  
ATOM 8026   O O6     . G A 1 250 ? 125.984 167.050 147.358 1.00 0.00 ? 239 G A O6     1  
ATOM 8027   N N1     . G A 1 250 ? 127.361 166.490 145.635 1.00 0.00 ? 239 G A N1     1  
ATOM 8028   C C2     . G A 1 250 ? 128.372 165.757 145.062 1.00 0.00 ? 239 G A C2     1  
ATOM 8029   N N2     . G A 1 250 ? 128.675 166.054 143.790 1.00 0.00 ? 239 G A N2     1  
ATOM 8030   N N3     . G A 1 250 ? 129.037 164.799 145.689 1.00 0.00 ? 239 G A N3     1  
ATOM 8031   C C4     . G A 1 250 ? 128.606 164.631 146.956 1.00 0.00 ? 239 G A C4     1  
ATOM 8032   H "H5'"  . G A 1 250 ? 130.863 160.745 150.994 1.00 0.00 ? 239 G A "H5'"  1  
ATOM 8033   H "H5''" . G A 1 250 ? 132.099 161.688 151.353 1.00 0.00 ? 239 G A "H5''" 1  
ATOM 8034   H "H4'"  . G A 1 250 ? 132.105 161.214 149.071 1.00 0.00 ? 239 G A "H4'"  1  
ATOM 8035   H "H3'"  . G A 1 250 ? 131.547 163.942 149.590 1.00 0.00 ? 239 G A "H3'"  1  
ATOM 8036   H "H2'"  . G A 1 250 ? 131.486 164.364 147.336 1.00 0.00 ? 239 G A "H2'"  1  
ATOM 8037   H "HO2'" . G A 1 250 ? 132.104 162.842 145.793 1.00 0.00 ? 239 G A "HO2'" 1  
ATOM 8038   H "H1'"  . G A 1 250 ? 130.024 162.281 146.783 1.00 0.00 ? 239 G A "H1'"  1  
ATOM 8039   H H8     . G A 1 250 ? 128.514 163.369 149.831 1.00 0.00 ? 239 G A H8     1  
ATOM 8040   H H1     . G A 1 250 ? 126.931 167.177 145.086 1.00 0.00 ? 239 G A H1     1  
ATOM 8041   H H21    . G A 1 250 ? 128.186 166.760 143.319 1.00 0.00 ? 239 G A H21    1  
ATOM 8042   H H22    . G A 1 250 ? 129.389 165.561 143.329 1.00 0.00 ? 239 G A H22    1  
ATOM 8043   P P      . C A 1 251 ? 134.043 164.827 149.574 1.00 0.00 ? 240 C A P      1  
ATOM 8044   O OP1    . C A 1 251 ? 135.464 164.613 149.952 1.00 0.00 ? 240 C A OP1    1  
ATOM 8045   O OP2    . C A 1 251 ? 133.131 165.520 150.520 1.00 0.00 ? 240 C A OP2    1  
ATOM 8046   O "O5'"  . C A 1 251 ? 134.016 165.619 148.193 1.00 0.00 ? 240 C A "O5'"  1  
ATOM 8047   C "C5'"  . C A 1 251 ? 134.825 165.209 147.101 1.00 0.00 ? 240 C A "C5'"  1  
ATOM 8048   C "C4'"  . C A 1 251 ? 134.526 166.009 145.855 1.00 0.00 ? 240 C A "C4'"  1  
ATOM 8049   O "O4'"  . C A 1 251 ? 133.144 165.815 145.464 1.00 0.00 ? 240 C A "O4'"  1  
ATOM 8050   C "C3'"  . C A 1 251 ? 134.671 167.518 145.976 1.00 0.00 ? 240 C A "C3'"  1  
ATOM 8051   O "O3'"  . C A 1 251 ? 136.011 167.961 145.837 1.00 0.00 ? 240 C A "O3'"  1  
ATOM 8052   C "C2'"  . C A 1 251 ? 133.741 168.028 144.885 1.00 0.00 ? 240 C A "C2'"  1  
ATOM 8053   O "O2'"  . C A 1 251 ? 134.344 167.921 143.602 1.00 0.00 ? 240 C A "O2'"  1  
ATOM 8054   C "C1'"  . C A 1 251 ? 132.586 167.030 144.976 1.00 0.00 ? 240 C A "C1'"  1  
ATOM 8055   N N1     . C A 1 251 ? 131.504 167.501 145.874 1.00 0.00 ? 240 C A N1     1  
ATOM 8056   C C2     . C A 1 251 ? 130.608 168.462 145.391 1.00 0.00 ? 240 C A C2     1  
ATOM 8057   O O2     . C A 1 251 ? 130.745 168.891 144.233 1.00 0.00 ? 240 C A O2     1  
ATOM 8058   N N3     . C A 1 251 ? 129.612 168.910 146.188 1.00 0.00 ? 240 C A N3     1  
ATOM 8059   C C4     . C A 1 251 ? 129.487 168.435 147.428 1.00 0.00 ? 240 C A C4     1  
ATOM 8060   N N4     . C A 1 251 ? 128.488 168.905 148.182 1.00 0.00 ? 240 C A N4     1  
ATOM 8061   C C5     . C A 1 251 ? 130.380 167.458 147.951 1.00 0.00 ? 240 C A C5     1  
ATOM 8062   C C6     . C A 1 251 ? 131.361 167.022 147.150 1.00 0.00 ? 240 C A C6     1  
ATOM 8063   H "H5'"  . C A 1 251 ? 134.660 164.261 146.920 1.00 0.00 ? 240 C A "H5'"  1  
ATOM 8064   H "H5''" . C A 1 251 ? 135.768 165.330 147.340 1.00 0.00 ? 240 C A "H5''" 1  
ATOM 8065   H "H4'"  . C A 1 251 ? 135.110 165.691 145.132 1.00 0.00 ? 240 C A "H4'"  1  
ATOM 8066   H "H3'"  . C A 1 251 ? 134.327 167.804 146.849 1.00 0.00 ? 240 C A "H3'"  1  
ATOM 8067   H "H2'"  . C A 1 251 ? 133.440 168.944 145.068 1.00 0.00 ? 240 C A "H2'"  1  
ATOM 8068   H "HO2'" . C A 1 251 ? 133.736 168.295 142.932 1.00 0.00 ? 240 C A "HO2'" 1  
ATOM 8069   H "H1'"  . C A 1 251 ? 132.219 166.873 144.080 1.00 0.00 ? 240 C A "H1'"  1  
ATOM 8070   H H41    . C A 1 251 ? 127.875 169.576 147.818 1.00 0.00 ? 240 C A H41    1  
ATOM 8071   H H42    . C A 1 251 ? 128.370 168.575 149.096 1.00 0.00 ? 240 C A H42    1  
ATOM 8072   H H5     . C A 1 251 ? 130.280 167.114 148.863 1.00 0.00 ? 240 C A H5     1  
ATOM 8073   H H6     . C A 1 251 ? 131.986 166.352 147.491 1.00 0.00 ? 240 C A H6     1  
ATOM 8074   P P      . C A 1 252 ? 136.507 169.284 146.600 1.00 0.00 ? 241 C A P      1  
ATOM 8075   O OP1    . C A 1 252 ? 137.985 169.357 146.477 1.00 0.00 ? 241 C A OP1    1  
ATOM 8076   O OP2    . C A 1 252 ? 135.882 169.302 147.947 1.00 0.00 ? 241 C A OP2    1  
ATOM 8077   O "O5'"  . C A 1 252 ? 135.882 170.477 145.749 1.00 0.00 ? 241 C A "O5'"  1  
ATOM 8078   C "C5'"  . C A 1 252 ? 136.331 170.745 144.430 1.00 0.00 ? 241 C A "C5'"  1  
ATOM 8079   C "C4'"  . C A 1 252 ? 135.517 171.834 143.774 1.00 0.00 ? 241 C A "C4'"  1  
ATOM 8080   O "O4'"  . C A 1 252 ? 134.132 171.415 143.662 1.00 0.00 ? 241 C A "O4'"  1  
ATOM 8081   C "C3'"  . C A 1 252 ? 135.443 173.159 144.519 1.00 0.00 ? 241 C A "C3'"  1  
ATOM 8082   O "O3'"  . C A 1 252 ? 136.577 173.981 144.301 1.00 0.00 ? 241 C A "O3'"  1  
ATOM 8083   C "C2'"  . C A 1 252 ? 134.143 173.757 144.004 1.00 0.00 ? 241 C A "C2'"  1  
ATOM 8084   O "O2'"  . C A 1 252 ? 134.312 174.317 142.709 1.00 0.00 ? 241 C A "O2'"  1  
ATOM 8085   C "C1'"  . C A 1 252 ? 133.255 172.518 143.899 1.00 0.00 ? 241 C A "C1'"  1  
ATOM 8086   N N1     . C A 1 252 ? 132.462 172.287 145.130 1.00 0.00 ? 241 C A N1     1  
ATOM 8087   C C2     . C A 1 252 ? 131.312 173.062 145.336 1.00 0.00 ? 241 C A C2     1  
ATOM 8088   O O2     . C A 1 252 ? 130.998 173.912 144.490 1.00 0.00 ? 241 C A O2     1  
ATOM 8089   N N3     . C A 1 252 ? 130.571 172.871 146.451 1.00 0.00 ? 241 C A N3     1  
ATOM 8090   C C4     . C A 1 252 ? 130.933 171.949 147.345 1.00 0.00 ? 241 C A C4     1  
ATOM 8091   N N4     . C A 1 252 ? 130.170 171.798 148.429 1.00 0.00 ? 241 C A N4     1  
ATOM 8092   C C5     . C A 1 252 ? 132.093 171.148 147.164 1.00 0.00 ? 241 C A C5     1  
ATOM 8093   C C6     . C A 1 252 ? 132.820 171.344 146.057 1.00 0.00 ? 241 C A C6     1  
ATOM 8094   H "H5'"  . C A 1 252 ? 136.260 169.927 143.895 1.00 0.00 ? 241 C A "H5'"  1  
ATOM 8095   H "H5''" . C A 1 252 ? 137.270 171.025 144.462 1.00 0.00 ? 241 C A "H5''" 1  
ATOM 8096   H "H4'"  . C A 1 252 ? 135.875 171.996 142.874 1.00 0.00 ? 241 C A "H4'"  1  
ATOM 8097   H "H3'"  . C A 1 252 ? 135.357 172.981 145.480 1.00 0.00 ? 241 C A "H3'"  1  
ATOM 8098   H "H2'"  . C A 1 252 ? 133.773 174.412 144.635 1.00 0.00 ? 241 C A "H2'"  1  
ATOM 8099   H "HO2'" . C A 1 252 ? 135.265 174.487 142.555 1.00 0.00 ? 241 C A "HO2'" 1  
ATOM 8100   H "H1'"  . C A 1 252 ? 132.649 172.616 143.135 1.00 0.00 ? 241 C A "H1'"  1  
ATOM 8101   H H41    . C A 1 252 ? 129.371 172.353 148.550 1.00 0.00 ? 241 C A H41    1  
ATOM 8102   H H42    . C A 1 252 ? 130.408 171.127 149.105 1.00 0.00 ? 241 C A H42    1  
ATOM 8103   H H5     . C A 1 252 ? 132.351 170.472 147.827 1.00 0.00 ? 241 C A H5     1  
ATOM 8104   H H6     . C A 1 252 ? 133.622 170.801 145.915 1.00 0.00 ? 241 C A H6     1  
ATOM 8105   P P      . G A 1 253 ? 137.083 174.981 145.451 1.00 0.00 ? 242 G A P      1  
ATOM 8106   O OP1    . G A 1 253 ? 138.411 175.510 145.050 1.00 0.00 ? 242 G A OP1    1  
ATOM 8107   O OP2    . G A 1 253 ? 136.931 174.295 146.758 1.00 0.00 ? 242 G A OP2    1  
ATOM 8108   O "O5'"  . G A 1 253 ? 136.040 176.185 145.402 1.00 0.00 ? 242 G A "O5'"  1  
ATOM 8109   C "C5'"  . G A 1 253 ? 135.990 177.063 144.287 1.00 0.00 ? 242 G A "C5'"  1  
ATOM 8110   C "C4'"  . G A 1 253 ? 134.824 178.015 144.382 1.00 0.00 ? 242 G A "C4'"  1  
ATOM 8111   O "O4'"  . G A 1 253 ? 133.581 177.268 144.413 1.00 0.00 ? 242 G A "O4'"  1  
ATOM 8112   C "C3'"  . G A 1 253 ? 134.768 178.877 145.634 1.00 0.00 ? 242 G A "C3'"  1  
ATOM 8113   O "O3'"  . G A 1 253 ? 135.609 180.018 145.560 1.00 0.00 ? 242 G A "O3'"  1  
ATOM 8114   C "C2'"  . G A 1 253 ? 133.288 179.218 145.738 1.00 0.00 ? 242 G A "C2'"  1  
ATOM 8115   O "O2'"  . G A 1 253 ? 132.929 180.242 144.822 1.00 0.00 ? 242 G A "O2'"  1  
ATOM 8116   C "C1'"  . G A 1 253 ? 132.643 177.904 145.291 1.00 0.00 ? 242 G A "C1'"  1  
ATOM 8117   N N9     . G A 1 253 ? 132.321 177.027 146.432 1.00 0.00 ? 242 G A N9     1  
ATOM 8118   C C8     . G A 1 253 ? 132.976 175.881 146.812 1.00 0.00 ? 242 G A C8     1  
ATOM 8119   N N7     . G A 1 253 ? 132.456 175.316 147.867 1.00 0.00 ? 242 G A N7     1  
ATOM 8120   C C5     . G A 1 253 ? 131.393 176.142 148.209 1.00 0.00 ? 242 G A C5     1  
ATOM 8121   C C6     . G A 1 253 ? 130.457 176.043 149.271 1.00 0.00 ? 242 G A C6     1  
ATOM 8122   O O6     . G A 1 253 ? 130.377 175.177 150.149 1.00 0.00 ? 242 G A O6     1  
ATOM 8123   N N1     . G A 1 253 ? 129.543 177.093 149.248 1.00 0.00 ? 242 G A N1     1  
ATOM 8124   C C2     . G A 1 253 ? 129.533 178.109 148.323 1.00 0.00 ? 242 G A C2     1  
ATOM 8125   N N2     . G A 1 253 ? 128.572 179.034 148.465 1.00 0.00 ? 242 G A N2     1  
ATOM 8126   N N3     . G A 1 253 ? 130.401 178.211 147.329 1.00 0.00 ? 242 G A N3     1  
ATOM 8127   C C4     . G A 1 253 ? 131.296 177.203 147.333 1.00 0.00 ? 242 G A C4     1  
ATOM 8128   H "H5'"  . G A 1 253 ? 135.906 176.534 143.466 1.00 0.00 ? 242 G A "H5'"  1  
ATOM 8129   H "H5''" . G A 1 253 ? 136.824 177.580 144.249 1.00 0.00 ? 242 G A "H5''" 1  
ATOM 8130   H "H4'"  . G A 1 253 ? 134.828 178.600 143.596 1.00 0.00 ? 242 G A "H4'"  1  
ATOM 8131   H "H3'"  . G A 1 253 ? 135.029 178.337 146.409 1.00 0.00 ? 242 G A "H3'"  1  
ATOM 8132   H "H2'"  . G A 1 253 ? 133.035 179.448 146.657 1.00 0.00 ? 242 G A "H2'"  1  
ATOM 8133   H "HO2'" . G A 1 253 ? 131.985 180.469 144.952 1.00 0.00 ? 242 G A "HO2'" 1  
ATOM 8134   H "H1'"  . G A 1 253 ? 131.825 178.098 144.787 1.00 0.00 ? 242 G A "H1'"  1  
ATOM 8135   H H8     . G A 1 253 ? 133.755 175.521 146.337 1.00 0.00 ? 242 G A H8     1  
ATOM 8136   H H1     . G A 1 253 ? 128.857 177.106 149.946 1.00 0.00 ? 242 G A H1     1  
ATOM 8137   H H21    . G A 1 253 ? 127.927 178.963 149.199 1.00 0.00 ? 242 G A H21    1  
ATOM 8138   H H22    . G A 1 253 ? 128.515 179.783 147.835 1.00 0.00 ? 242 G A H22    1  
ATOM 8139   P P      . U A 1 254 ? 136.251 180.634 146.898 1.00 0.00 ? 243 U A P      1  
ATOM 8140   O OP1    . U A 1 254 ? 137.280 181.628 146.499 1.00 0.00 ? 243 U A OP1    1  
ATOM 8141   O OP2    . U A 1 254 ? 136.627 179.507 147.790 1.00 0.00 ? 243 U A OP2    1  
ATOM 8142   O "O5'"  . U A 1 254 ? 135.044 181.421 147.578 1.00 0.00 ? 243 U A "O5'"  1  
ATOM 8143   C "C5'"  . U A 1 254 ? 134.498 182.582 146.974 1.00 0.00 ? 243 U A "C5'"  1  
ATOM 8144   C "C4'"  . U A 1 254 ? 133.304 183.098 147.740 1.00 0.00 ? 243 U A "C4'"  1  
ATOM 8145   O "O4'"  . U A 1 254 ? 132.248 182.102 147.735 1.00 0.00 ? 243 U A "O4'"  1  
ATOM 8146   C "C3'"  . U A 1 254 ? 133.529 183.395 149.214 1.00 0.00 ? 243 U A "C3'"  1  
ATOM 8147   O "O3'"  . U A 1 254 ? 134.115 184.666 149.440 1.00 0.00 ? 243 U A "O3'"  1  
ATOM 8148   C "C2'"  . U A 1 254 ? 132.130 183.255 149.798 1.00 0.00 ? 243 U A "C2'"  1  
ATOM 8149   O "O2'"  . U A 1 254 ? 131.340 184.404 149.528 1.00 0.00 ? 243 U A "O2'"  1  
ATOM 8150   C "C1'"  . U A 1 254 ? 131.581 182.075 148.995 1.00 0.00 ? 243 U A "C1'"  1  
ATOM 8151   N N1     . U A 1 254 ? 131.815 180.777 149.671 1.00 0.00 ? 243 U A N1     1  
ATOM 8152   C C2     . U A 1 254 ? 130.974 180.448 150.717 1.00 0.00 ? 243 U A C2     1  
ATOM 8153   O O2     . U A 1 254 ? 130.069 181.172 151.094 1.00 0.00 ? 243 U A O2     1  
ATOM 8154   N N3     . U A 1 254 ? 131.229 179.237 151.312 1.00 0.00 ? 243 U A N3     1  
ATOM 8155   C C4     . U A 1 254 ? 132.217 178.338 150.979 1.00 0.00 ? 243 U A C4     1  
ATOM 8156   O O4     . U A 1 254 ? 132.318 177.285 151.611 1.00 0.00 ? 243 U A O4     1  
ATOM 8157   C C5     . U A 1 254 ? 133.049 178.741 149.885 1.00 0.00 ? 243 U A C5     1  
ATOM 8158   C C6     . U A 1 254 ? 132.823 179.915 149.287 1.00 0.00 ? 243 U A C6     1  
ATOM 8159   H "H5'"  . U A 1 254 ? 134.221 182.367 146.059 1.00 0.00 ? 243 U A "H5'"  1  
ATOM 8160   H "H5''" . U A 1 254 ? 135.184 183.280 146.946 1.00 0.00 ? 243 U A "H5''" 1  
ATOM 8161   H "H4'"  . U A 1 254 ? 132.976 183.911 147.298 1.00 0.00 ? 243 U A "H4'"  1  
ATOM 8162   H "H3'"  . U A 1 254 ? 134.107 182.702 149.596 1.00 0.00 ? 243 U A "H3'"  1  
ATOM 8163   H "H2'"  . U A 1 254 ? 132.161 183.052 150.757 1.00 0.00 ? 243 U A "H2'"  1  
ATOM 8164   H "HO2'" . U A 1 254 ? 130.475 184.309 149.976 1.00 0.00 ? 243 U A "HO2'" 1  
ATOM 8165   H "H1'"  . U A 1 254 ? 130.618 182.197 148.854 1.00 0.00 ? 243 U A "H1'"  1  
ATOM 8166   H H3     . U A 1 254 ? 130.643 178.986 152.058 1.00 0.00 ? 243 U A H3     1  
ATOM 8167   H H5     . U A 1 254 ? 133.777 178.163 149.579 1.00 0.00 ? 243 U A H5     1  
ATOM 8168   H H6     . U A 1 254 ? 133.407 180.170 148.544 1.00 0.00 ? 243 U A H6     1  
ATOM 8169   P P      . C A 1 255 ? 135.063 184.905 150.715 1.00 0.00 ? 244 C A P      1  
ATOM 8170   O OP1    . C A 1 255 ? 135.678 186.249 150.587 1.00 0.00 ? 244 C A OP1    1  
ATOM 8171   O OP2    . C A 1 255 ? 135.934 183.711 150.873 1.00 0.00 ? 244 C A OP2    1  
ATOM 8172   O "O5'"  . C A 1 255 ? 134.052 184.942 151.946 1.00 0.00 ? 244 C A "O5'"  1  
ATOM 8173   C "C5'"  . C A 1 255 ? 133.103 185.990 152.080 1.00 0.00 ? 244 C A "C5'"  1  
ATOM 8174   C "C4'"  . C A 1 255 ? 132.134 185.724 153.207 1.00 0.00 ? 244 C A "C4'"  1  
ATOM 8175   O "O4'"  . C A 1 255 ? 131.394 184.504 152.946 1.00 0.00 ? 244 C A "O4'"  1  
ATOM 8176   C "C3'"  . C A 1 255 ? 132.749 185.497 154.580 1.00 0.00 ? 244 C A "C3'"  1  
ATOM 8177   O "O3'"  . C A 1 255 ? 133.087 186.703 155.243 1.00 0.00 ? 244 C A "O3'"  1  
ATOM 8178   C "C2'"  . C A 1 255 ? 131.678 184.686 155.294 1.00 0.00 ? 244 C A "C2'"  1  
ATOM 8179   O "O2'"  . C A 1 255 ? 130.616 185.517 155.742 1.00 0.00 ? 244 C A "O2'"  1  
ATOM 8180   C "C1'"  . C A 1 255 ? 131.166 183.792 154.163 1.00 0.00 ? 244 C A "C1'"  1  
ATOM 8181   N N1     . C A 1 255 ? 131.848 182.474 154.137 1.00 0.00 ? 244 C A N1     1  
ATOM 8182   C C2     . C A 1 255 ? 131.465 181.509 155.077 1.00 0.00 ? 244 C A C2     1  
ATOM 8183   O O2     . C A 1 255 ? 130.577 181.780 155.898 1.00 0.00 ? 244 C A O2     1  
ATOM 8184   N N3     . C A 1 255 ? 132.070 180.298 155.073 1.00 0.00 ? 244 C A N3     1  
ATOM 8185   C C4     . C A 1 255 ? 133.024 180.029 154.178 1.00 0.00 ? 244 C A C4     1  
ATOM 8186   N N4     . C A 1 255 ? 133.592 178.822 154.213 1.00 0.00 ? 244 C A N4     1  
ATOM 8187   C C5     . C A 1 255 ? 133.434 180.990 153.211 1.00 0.00 ? 244 C A C5     1  
ATOM 8188   C C6     . C A 1 255 ? 132.829 182.183 153.225 1.00 0.00 ? 244 C A C6     1  
ATOM 8189   H "H5'"  . C A 1 255 ? 132.600 186.076 151.242 1.00 0.00 ? 244 C A "H5'"  1  
ATOM 8190   H "H5''" . C A 1 255 ? 133.575 186.828 152.258 1.00 0.00 ? 244 C A "H5''" 1  
ATOM 8191   H "H4'"  . C A 1 255 ? 131.504 186.473 153.263 1.00 0.00 ? 244 C A "H4'"  1  
ATOM 8192   H "H3'"  . C A 1 255 ? 133.556 184.946 154.484 1.00 0.00 ? 244 C A "H3'"  1  
ATOM 8193   H "H2'"  . C A 1 255 ? 132.056 184.155 156.027 1.00 0.00 ? 244 C A "H2'"  1  
ATOM 8194   H "HO2'" . C A 1 255 ? 129.978 184.973 156.252 1.00 0.00 ? 244 C A "HO2'" 1  
ATOM 8195   H "H1'"  . C A 1 255 ? 130.203 183.656 154.265 1.00 0.00 ? 244 C A "H1'"  1  
ATOM 8196   H H41    . C A 1 255 ? 133.306 178.163 154.881 1.00 0.00 ? 244 C A H41    1  
ATOM 8197   H H42    . C A 1 255 ? 134.293 178.593 153.569 1.00 0.00 ? 244 C A H42    1  
ATOM 8198   H H5     . C A 1 255 ? 134.136 180.781 152.558 1.00 0.00 ? 244 C A H5     1  
ATOM 8199   H H6     . C A 1 255 ? 133.097 182.855 152.566 1.00 0.00 ? 244 C A H6     1  
ATOM 8200   P P      . G A 1 256 ? 134.614 187.002 155.649 1.00 0.00 ? 245 G A P      1  
ATOM 8201   O OP1    . G A 1 256 ? 134.614 188.058 156.694 1.00 0.00 ? 245 G A OP1    1  
ATOM 8202   O OP2    . G A 1 256 ? 135.390 187.206 154.400 1.00 0.00 ? 245 G A OP2    1  
ATOM 8203   O "O5'"  . G A 1 256 ? 135.108 185.644 156.321 1.00 0.00 ? 245 G A "O5'"  1  
ATOM 8204   C "C5'"  . G A 1 256 ? 134.422 185.090 157.433 1.00 0.00 ? 245 G A "C5'"  1  
ATOM 8205   C "C4'"  . G A 1 256 ? 134.903 183.693 157.741 1.00 0.00 ? 245 G A "C4'"  1  
ATOM 8206   O "O4'"  . G A 1 256 ? 134.951 182.890 156.530 1.00 0.00 ? 245 G A "O4'"  1  
ATOM 8207   C "C3'"  . G A 1 256 ? 136.316 183.581 158.295 1.00 0.00 ? 245 G A "C3'"  1  
ATOM 8208   O "O3'"  . G A 1 256 ? 136.402 183.927 159.667 1.00 0.00 ? 245 G A "O3'"  1  
ATOM 8209   C "C2'"  . G A 1 256 ? 136.653 182.129 158.002 1.00 0.00 ? 245 G A "C2'"  1  
ATOM 8210   O "O2'"  . G A 1 256 ? 136.109 181.265 158.989 1.00 0.00 ? 245 G A "O2'"  1  
ATOM 8211   C "C1'"  . G A 1 256 ? 135.908 181.923 156.685 1.00 0.00 ? 245 G A "C1'"  1  
ATOM 8212   N N9     . G A 1 256 ? 136.823 181.889 155.529 1.00 0.00 ? 245 G A N9     1  
ATOM 8213   C C8     . G A 1 256 ? 137.258 182.956 154.781 1.00 0.00 ? 245 G A C8     1  
ATOM 8214   N N7     . G A 1 256 ? 138.066 182.612 153.815 1.00 0.00 ? 245 G A N7     1  
ATOM 8215   C C5     . G A 1 256 ? 138.171 181.233 153.932 1.00 0.00 ? 245 G A C5     1  
ATOM 8216   C C6     . G A 1 256 ? 138.911 180.299 153.161 1.00 0.00 ? 245 G A C6     1  
ATOM 8217   O O6     . G A 1 256 ? 139.645 180.513 152.189 1.00 0.00 ? 245 G A O6     1  
ATOM 8218   N N1     . G A 1 256 ? 138.733 178.999 153.622 1.00 0.00 ? 245 G A N1     1  
ATOM 8219   C C2     . G A 1 256 ? 137.946 178.641 154.690 1.00 0.00 ? 245 G A C2     1  
ATOM 8220   N N2     . G A 1 256 ? 137.900 177.334 154.985 1.00 0.00 ? 245 G A N2     1  
ATOM 8221   N N3     . G A 1 256 ? 137.251 179.502 155.416 1.00 0.00 ? 245 G A N3     1  
ATOM 8222   C C4     . G A 1 256 ? 137.410 180.771 154.984 1.00 0.00 ? 245 G A C4     1  
ATOM 8223   H "H5'"  . G A 1 256 ? 133.462 185.061 157.236 1.00 0.00 ? 245 G A "H5'"  1  
ATOM 8224   H "H5''" . G A 1 256 ? 134.570 185.660 158.217 1.00 0.00 ? 245 G A "H5''" 1  
ATOM 8225   H "H4'"  . G A 1 256 ? 134.277 183.273 158.369 1.00 0.00 ? 245 G A "H4'"  1  
ATOM 8226   H "H3'"  . G A 1 256 ? 136.910 184.163 157.778 1.00 0.00 ? 245 G A "H3'"  1  
ATOM 8227   H "H2'"  . G A 1 256 ? 137.619 181.998 157.898 1.00 0.00 ? 245 G A "H2'"  1  
ATOM 8228   H "HO2'" . G A 1 256 ? 136.793 180.615 159.256 1.00 0.00 ? 245 G A "HO2'" 1  
ATOM 8229   H "H1'"  . G A 1 256 ? 135.401 181.085 156.725 1.00 0.00 ? 245 G A "H1'"  1  
ATOM 8230   H H8     . G A 1 256 ? 136.989 183.883 154.954 1.00 0.00 ? 245 G A H8     1  
ATOM 8231   H H1     . G A 1 256 ? 139.208 178.284 153.149 1.00 0.00 ? 245 G A H1     1  
ATOM 8232   H H21    . G A 1 256 ? 138.412 176.690 154.452 1.00 0.00 ? 245 G A H21    1  
ATOM 8233   H H22    . G A 1 256 ? 137.354 177.020 155.736 1.00 0.00 ? 245 G A H22    1  
ATOM 8234   P P      . G A 1 257 ? 135.349 183.300 160.733 1.00 0.00 ? 246 G A P      1  
ATOM 8235   O OP1    . G A 1 257 ? 136.072 182.975 161.990 1.00 0.00 ? 246 G A OP1    1  
ATOM 8236   O OP2    . G A 1 257 ? 134.713 182.210 159.950 1.00 0.00 ? 246 G A OP2    1  
ATOM 8237   O "O5'"  . G A 1 257 ? 134.229 184.380 161.075 1.00 0.00 ? 246 G A "O5'"  1  
ATOM 8238   C "C5'"  . G A 1 257 ? 133.568 184.372 162.332 1.00 0.00 ? 246 G A "C5'"  1  
ATOM 8239   C "C4'"  . G A 1 257 ? 132.474 183.334 162.376 1.00 0.00 ? 246 G A "C4'"  1  
ATOM 8240   O "O4'"  . G A 1 257 ? 132.312 182.732 161.067 1.00 0.00 ? 246 G A "O4'"  1  
ATOM 8241   C "C3'"  . G A 1 257 ? 132.707 182.158 163.312 1.00 0.00 ? 246 G A "C3'"  1  
ATOM 8242   O "O3'"  . G A 1 257 ? 132.396 182.455 164.663 1.00 0.00 ? 246 G A "O3'"  1  
ATOM 8243   C "C2'"  . G A 1 257 ? 131.776 181.099 162.738 1.00 0.00 ? 246 G A "C2'"  1  
ATOM 8244   O "O2'"  . G A 1 257 ? 130.442 181.285 163.189 1.00 0.00 ? 246 G A "O2'"  1  
ATOM 8245   C "C1'"  . G A 1 257 ? 131.850 181.422 161.243 1.00 0.00 ? 246 G A "C1'"  1  
ATOM 8246   N N9     . G A 1 257 ? 132.731 180.490 160.516 1.00 0.00 ? 246 G A N9     1  
ATOM 8247   C C8     . G A 1 257 ? 133.505 180.765 159.414 1.00 0.00 ? 246 G A C8     1  
ATOM 8248   N N7     . G A 1 257 ? 134.180 179.732 158.990 1.00 0.00 ? 246 G A N7     1  
ATOM 8249   C C5     . G A 1 257 ? 133.832 178.712 159.863 1.00 0.00 ? 246 G A C5     1  
ATOM 8250   C C6     . G A 1 257 ? 134.248 177.356 159.907 1.00 0.00 ? 246 G A C6     1  
ATOM 8251   O O6     . G A 1 257 ? 135.033 176.767 159.155 1.00 0.00 ? 246 G A O6     1  
ATOM 8252   N N1     . G A 1 257 ? 133.649 176.669 160.958 1.00 0.00 ? 246 G A N1     1  
ATOM 8253   C C2     . G A 1 257 ? 132.764 177.216 161.855 1.00 0.00 ? 246 G A C2     1  
ATOM 8254   N N2     . G A 1 257 ? 132.291 176.393 162.803 1.00 0.00 ? 246 G A N2     1  
ATOM 8255   N N3     . G A 1 257 ? 132.368 178.478 161.825 1.00 0.00 ? 246 G A N3     1  
ATOM 8256   C C4     . G A 1 257 ? 132.938 179.163 160.812 1.00 0.00 ? 246 G A C4     1  
ATOM 8257   H "H5'"  . G A 1 257 ? 133.177 185.255 162.494 1.00 0.00 ? 246 G A "H5'"  1  
ATOM 8258   H "H5''" . G A 1 257 ? 134.222 184.178 163.036 1.00 0.00 ? 246 G A "H5''" 1  
ATOM 8259   H "H4'"  . G A 1 257 ? 131.635 183.776 162.624 1.00 0.00 ? 246 G A "H4'"  1  
ATOM 8260   H "H3'"  . G A 1 257 ? 133.637 181.854 163.257 1.00 0.00 ? 246 G A "H3'"  1  
ATOM 8261   H "H2'"  . G A 1 257 ? 132.100 180.193 162.928 1.00 0.00 ? 246 G A "H2'"  1  
ATOM 8262   H "HO2'" . G A 1 257 ? 129.877 180.575 162.819 1.00 0.00 ? 246 G A "HO2'" 1  
ATOM 8263   H "H1'"  . G A 1 257 ? 130.949 181.389 160.857 1.00 0.00 ? 246 G A "H1'"  1  
ATOM 8264   H H8     . G A 1 257 ? 133.546 181.647 158.989 1.00 0.00 ? 246 G A H8     1  
ATOM 8265   H H1     . G A 1 257 ? 133.878 175.722 161.066 1.00 0.00 ? 246 G A H1     1  
ATOM 8266   H H21    . G A 1 257 ? 132.580 175.458 162.832 1.00 0.00 ? 246 G A H21    1  
ATOM 8267   H H22    . G A 1 257 ? 131.656 176.729 163.470 1.00 0.00 ? 246 G A H22    1  
ATOM 8268   P P      . G A 1 258 ? 133.556 182.468 165.775 1.00 0.00 ? 247 G A P      1  
ATOM 8269   O OP1    . G A 1 258 ? 132.922 182.686 167.100 1.00 0.00 ? 247 G A OP1    1  
ATOM 8270   O OP2    . G A 1 258 ? 134.626 183.389 165.313 1.00 0.00 ? 247 G A OP2    1  
ATOM 8271   O "O5'"  . G A 1 258 ? 134.136 180.985 165.744 1.00 0.00 ? 247 G A "O5'"  1  
ATOM 8272   C "C5'"  . G A 1 258 ? 133.514 179.944 166.482 1.00 0.00 ? 247 G A "C5'"  1  
ATOM 8273   C "C4'"  . G A 1 258 ? 134.007 178.586 166.047 1.00 0.00 ? 247 G A "C4'"  1  
ATOM 8274   O "O4'"  . G A 1 258 ? 133.797 178.420 164.619 1.00 0.00 ? 247 G A "O4'"  1  
ATOM 8275   C "C3'"  . G A 1 258 ? 135.493 178.321 166.237 1.00 0.00 ? 247 G A "C3'"  1  
ATOM 8276   O "O3'"  . G A 1 258 ? 135.828 177.978 167.572 1.00 0.00 ? 247 G A "O3'"  1  
ATOM 8277   C "C2'"  . G A 1 258 ? 135.764 177.210 165.234 1.00 0.00 ? 247 G A "C2'"  1  
ATOM 8278   O "O2'"  . G A 1 258 ? 135.326 175.953 165.726 1.00 0.00 ? 247 G A "O2'"  1  
ATOM 8279   C "C1'"  . G A 1 258 ? 134.865 177.625 164.068 1.00 0.00 ? 247 G A "C1'"  1  
ATOM 8280   N N9     . G A 1 258 ? 135.599 178.396 163.046 1.00 0.00 ? 247 G A N9     1  
ATOM 8281   C C8     . G A 1 258 ? 135.499 179.742 162.788 1.00 0.00 ? 247 G A C8     1  
ATOM 8282   N N7     . G A 1 258 ? 136.280 180.138 161.820 1.00 0.00 ? 247 G A N7     1  
ATOM 8283   C C5     . G A 1 258 ? 136.935 178.985 161.412 1.00 0.00 ? 247 G A C5     1  
ATOM 8284   C C6     . G A 1 258 ? 137.906 178.787 160.397 1.00 0.00 ? 247 G A C6     1  
ATOM 8285   O O6     . G A 1 258 ? 138.395 179.623 159.627 1.00 0.00 ? 247 G A O6     1  
ATOM 8286   N N1     . G A 1 258 ? 138.305 177.457 160.321 1.00 0.00 ? 247 G A N1     1  
ATOM 8287   C C2     . G A 1 258 ? 137.831 176.444 161.118 1.00 0.00 ? 247 G A C2     1  
ATOM 8288   N N2     . G A 1 258 ? 138.339 175.223 160.896 1.00 0.00 ? 247 G A N2     1  
ATOM 8289   N N3     . G A 1 258 ? 136.928 176.614 162.068 1.00 0.00 ? 247 G A N3     1  
ATOM 8290   C C4     . G A 1 258 ? 136.526 177.899 162.161 1.00 0.00 ? 247 G A C4     1  
ATOM 8291   H "H5'"  . G A 1 258 ? 132.545 179.990 166.347 1.00 0.00 ? 247 G A "H5'"  1  
ATOM 8292   H "H5''" . G A 1 258 ? 133.709 180.067 167.436 1.00 0.00 ? 247 G A "H5''" 1  
ATOM 8293   H "H4'"  . G A 1 258 ? 133.497 177.896 166.525 1.00 0.00 ? 247 G A "H4'"  1  
ATOM 8294   H "H3'"  . G A 1 258 ? 135.997 179.121 165.975 1.00 0.00 ? 247 G A "H3'"  1  
ATOM 8295   H "H2'"  . G A 1 258 ? 136.707 177.189 164.967 1.00 0.00 ? 247 G A "H2'"  1  
ATOM 8296   H "HO2'" . G A 1 258 ? 135.242 176.004 166.701 1.00 0.00 ? 247 G A "HO2'" 1  
ATOM 8297   H "H1'"  . G A 1 258 ? 134.475 176.827 163.655 1.00 0.00 ? 247 G A "H1'"  1  
ATOM 8298   H H8     . G A 1 258 ? 134.905 180.344 163.281 1.00 0.00 ? 247 G A H8     1  
ATOM 8299   H H1     . G A 1 258 ? 138.976 177.227 159.645 1.00 0.00 ? 247 G A H1     1  
ATOM 8300   H H21    . G A 1 258 ? 139.009 175.088 160.194 1.00 0.00 ? 247 G A H21    1  
ATOM 8301   H H22    . G A 1 258 ? 138.040 174.461 161.434 1.00 0.00 ? 247 G A H22    1  
ATOM 8302   P P      . G A 1 259 ? 137.270 178.362 168.166 1.00 0.00 ? 248 G A P      1  
ATOM 8303   O OP1    . G A 1 259 ? 137.333 177.884 169.571 1.00 0.00 ? 248 G A OP1    1  
ATOM 8304   O OP2    . G A 1 259 ? 137.526 179.793 167.865 1.00 0.00 ? 248 G A OP2    1  
ATOM 8305   O "O5'"  . G A 1 259 ? 138.287 177.489 167.303 1.00 0.00 ? 248 G A "O5'"  1  
ATOM 8306   C "C5'"  . G A 1 259 ? 138.398 176.088 167.504 1.00 0.00 ? 248 G A "C5'"  1  
ATOM 8307   C "C4'"  . G A 1 259 ? 139.400 175.469 166.562 1.00 0.00 ? 248 G A "C4'"  1  
ATOM 8308   O "O4'"  . G A 1 259 ? 138.975 175.676 165.190 1.00 0.00 ? 248 G A "O4'"  1  
ATOM 8309   C "C3'"  . G A 1 259 ? 140.805 176.051 166.606 1.00 0.00 ? 248 G A "C3'"  1  
ATOM 8310   O "O3'"  . G A 1 259 ? 141.576 175.558 167.689 1.00 0.00 ? 248 G A "O3'"  1  
ATOM 8311   C "C2'"  . G A 1 259 ? 141.363 175.679 165.241 1.00 0.00 ? 248 G A "C2'"  1  
ATOM 8312   O "O2'"  . G A 1 259 ? 141.761 174.316 165.200 1.00 0.00 ? 248 G A "O2'"  1  
ATOM 8313   C "C1'"  . G A 1 259 ? 140.134 175.864 164.348 1.00 0.00 ? 248 G A "C1'"  1  
ATOM 8314   N N9     . G A 1 259 ? 140.110 177.192 163.704 1.00 0.00 ? 248 G A N9     1  
ATOM 8315   C C8     . G A 1 259 ? 139.309 178.260 164.025 1.00 0.00 ? 248 G A C8     1  
ATOM 8316   N N7     . G A 1 259 ? 139.517 179.306 163.272 1.00 0.00 ? 248 G A N7     1  
ATOM 8317   C C5     . G A 1 259 ? 140.518 178.903 162.398 1.00 0.00 ? 248 G A C5     1  
ATOM 8318   C C6     . G A 1 259 ? 141.160 179.610 161.350 1.00 0.00 ? 248 G A C6     1  
ATOM 8319   O O6     . G A 1 259 ? 140.966 180.771 160.970 1.00 0.00 ? 248 G A O6     1  
ATOM 8320   N N1     . G A 1 259 ? 142.118 178.825 160.713 1.00 0.00 ? 248 G A N1     1  
ATOM 8321   C C2     . G A 1 259 ? 142.420 177.526 161.044 1.00 0.00 ? 248 G A C2     1  
ATOM 8322   N N2     . G A 1 259 ? 143.376 176.933 160.314 1.00 0.00 ? 248 G A N2     1  
ATOM 8323   N N3     . G A 1 259 ? 141.828 176.857 162.019 1.00 0.00 ? 248 G A N3     1  
ATOM 8324   C C4     . G A 1 259 ? 140.895 177.601 162.650 1.00 0.00 ? 248 G A C4     1  
ATOM 8325   H "H5'"  . G A 1 259 ? 137.521 175.674 167.355 1.00 0.00 ? 248 G A "H5'"  1  
ATOM 8326   H "H5''" . G A 1 259 ? 138.679 175.919 168.426 1.00 0.00 ? 248 G A "H5''" 1  
ATOM 8327   H "H4'"  . G A 1 259 ? 139.450 174.506 166.737 1.00 0.00 ? 248 G A "H4'"  1  
ATOM 8328   H "H3'"  . G A 1 259 ? 140.747 177.027 166.675 1.00 0.00 ? 248 G A "H3'"  1  
ATOM 8329   H "H2'"  . G A 1 259 ? 142.092 176.279 164.974 1.00 0.00 ? 248 G A "H2'"  1  
ATOM 8330   H "HO2'" . G A 1 259 ? 141.893 173.994 166.116 1.00 0.00 ? 248 G A "HO2'" 1  
ATOM 8331   H "H1'"  . G A 1 259 ? 140.122 175.166 163.661 1.00 0.00 ? 248 G A "H1'"  1  
ATOM 8332   H H8     . G A 1 259 ? 138.648 178.240 164.749 1.00 0.00 ? 248 G A H8     1  
ATOM 8333   H H1     . G A 1 259 ? 142.614 179.233 159.972 1.00 0.00 ? 248 G A H1     1  
ATOM 8334   H H21    . G A 1 259 ? 143.817 177.422 159.590 1.00 0.00 ? 248 G A H21    1  
ATOM 8335   H H22    . G A 1 259 ? 143.633 176.007 160.505 1.00 0.00 ? 248 G A H22    1  
ATOM 8336   P P      . A A 1 260 ? 142.752 176.453 168.320 1.00 0.00 ? 249 A A P      1  
ATOM 8337   O OP1    . A A 1 260 ? 143.271 175.753 169.521 1.00 0.00 ? 249 A A OP1    1  
ATOM 8338   O OP2    . A A 1 260 ? 142.254 177.845 168.439 1.00 0.00 ? 249 A A OP2    1  
ATOM 8339   O "O5'"  . A A 1 260 ? 143.891 176.432 167.205 1.00 0.00 ? 249 A A "O5'"  1  
ATOM 8340   C "C5'"  . A A 1 260 ? 144.581 175.231 166.892 1.00 0.00 ? 249 A A "C5'"  1  
ATOM 8341   C "C4'"  . A A 1 260 ? 145.533 175.425 165.738 1.00 0.00 ? 249 A A "C4'"  1  
ATOM 8342   O "O4'"  . A A 1 260 ? 144.791 175.790 164.545 1.00 0.00 ? 249 A A "O4'"  1  
ATOM 8343   C "C3'"  . A A 1 260 ? 146.555 176.541 165.895 1.00 0.00 ? 249 A A "C3'"  1  
ATOM 8344   O "O3'"  . A A 1 260 ? 147.662 176.170 166.699 1.00 0.00 ? 249 A A "O3'"  1  
ATOM 8345   C "C2'"  . A A 1 260 ? 146.926 176.858 164.453 1.00 0.00 ? 249 A A "C2'"  1  
ATOM 8346   O "O2'"  . A A 1 260 ? 147.828 175.895 163.930 1.00 0.00 ? 249 A A "O2'"  1  
ATOM 8347   C "C1'"  . A A 1 260 ? 145.575 176.706 163.751 1.00 0.00 ? 249 A A "C1'"  1  
ATOM 8348   N N9     . A A 1 260 ? 144.882 178.000 163.590 1.00 0.00 ? 249 A A N9     1  
ATOM 8349   C C8     . A A 1 260 ? 143.823 178.485 164.317 1.00 0.00 ? 249 A A C8     1  
ATOM 8350   N N7     . A A 1 260 ? 143.423 179.673 163.937 1.00 0.00 ? 249 A A N7     1  
ATOM 8351   C C5     . A A 1 260 ? 144.276 179.992 162.889 1.00 0.00 ? 249 A A C5     1  
ATOM 8352   C C6     . A A 1 260 ? 144.373 181.122 162.057 1.00 0.00 ? 249 A A C6     1  
ATOM 8353   N N6     . A A 1 260 ? 143.571 182.184 162.154 1.00 0.00 ? 249 A A N6     1  
ATOM 8354   N N1     . A A 1 260 ? 145.335 181.123 161.109 1.00 0.00 ? 249 A A N1     1  
ATOM 8355   C C2     . A A 1 260 ? 146.140 180.059 161.010 1.00 0.00 ? 249 A A C2     1  
ATOM 8356   N N3     . A A 1 260 ? 146.147 178.941 161.732 1.00 0.00 ? 249 A A N3     1  
ATOM 8357   C C4     . A A 1 260 ? 145.179 178.970 162.667 1.00 0.00 ? 249 A A C4     1  
ATOM 8358   H "H5'"  . A A 1 260 ? 143.929 174.540 166.655 1.00 0.00 ? 249 A A "H5'"  1  
ATOM 8359   H "H5''" . A A 1 260 ? 145.088 174.937 167.677 1.00 0.00 ? 249 A A "H5''" 1  
ATOM 8360   H "H4'"  . A A 1 260 ? 146.007 174.583 165.572 1.00 0.00 ? 249 A A "H4'"  1  
ATOM 8361   H "H3'"  . A A 1 260 ? 146.117 177.324 166.294 1.00 0.00 ? 249 A A "H3'"  1  
ATOM 8362   H "H2'"  . A A 1 260 ? 147.274 177.771 164.364 1.00 0.00 ? 249 A A "H2'"  1  
ATOM 8363   H "HO2'" . A A 1 260 ? 148.264 175.429 164.674 1.00 0.00 ? 249 A A "HO2'" 1  
ATOM 8364   H "H1'"  . A A 1 260 ? 145.709 176.297 162.872 1.00 0.00 ? 249 A A "H1'"  1  
ATOM 8365   H H8     . A A 1 260 ? 143.406 177.991 165.052 1.00 0.00 ? 249 A A H8     1  
ATOM 8366   H H61    . A A 1 260 ? 143.687 182.944 161.545 1.00 0.00 ? 249 A A H61    1  
ATOM 8367   H H62    . A A 1 260 ? 142.868 182.207 162.835 1.00 0.00 ? 249 A A H62    1  
ATOM 8368   H H2     . A A 1 260 ? 146.820 180.110 160.308 1.00 0.00 ? 249 A A H2     1  
ATOM 8369   P P      . G A 1 261 ? 148.483 177.288 167.511 1.00 0.00 ? 250 G A P      1  
ATOM 8370   O OP1    . G A 1 261 ? 149.486 176.597 168.360 1.00 0.00 ? 250 G A OP1    1  
ATOM 8371   O OP2    . G A 1 261 ? 147.502 178.212 168.137 1.00 0.00 ? 250 G A OP2    1  
ATOM 8372   O "O5'"  . G A 1 261 ? 149.265 178.092 166.378 1.00 0.00 ? 250 G A "O5'"  1  
ATOM 8373   C "C5'"  . G A 1 261 ? 150.299 177.473 165.628 1.00 0.00 ? 250 G A "C5'"  1  
ATOM 8374   C "C4'"  . G A 1 261 ? 150.799 178.374 164.527 1.00 0.00 ? 250 G A "C4'"  1  
ATOM 8375   O "O4'"  . G A 1 261 ? 149.715 178.675 163.608 1.00 0.00 ? 250 G A "O4'"  1  
ATOM 8376   C "C3'"  . G A 1 261 ? 151.307 179.741 164.960 1.00 0.00 ? 250 G A "C3'"  1  
ATOM 8377   O "O3'"  . G A 1 261 ? 152.624 179.702 165.482 1.00 0.00 ? 250 G A "O3'"  1  
ATOM 8378   C "C2'"  . G A 1 261 ? 151.179 180.562 163.685 1.00 0.00 ? 250 G A "C2'"  1  
ATOM 8379   O "O2'"  . G A 1 261 ? 152.240 180.283 162.784 1.00 0.00 ? 250 G A "O2'"  1  
ATOM 8380   C "C1'"  . G A 1 261 ? 149.873 180.018 163.101 1.00 0.00 ? 250 G A "C1'"  1  
ATOM 8381   N N9     . G A 1 261 ? 148.716 180.864 163.447 1.00 0.00 ? 250 G A N9     1  
ATOM 8382   C C8     . G A 1 261 ? 147.740 180.597 164.377 1.00 0.00 ? 250 G A C8     1  
ATOM 8383   N N7     . G A 1 261 ? 146.839 181.538 164.461 1.00 0.00 ? 250 G A N7     1  
ATOM 8384   C C5     . G A 1 261 ? 147.243 182.484 163.530 1.00 0.00 ? 250 G A C5     1  
ATOM 8385   C C6     . G A 1 261 ? 146.661 183.727 163.169 1.00 0.00 ? 250 G A C6     1  
ATOM 8386   O O6     . G A 1 261 ? 145.636 184.256 163.616 1.00 0.00 ? 250 G A O6     1  
ATOM 8387   N N1     . G A 1 261 ? 147.396 184.368 162.179 1.00 0.00 ? 250 G A N1     1  
ATOM 8388   C C2     . G A 1 261 ? 148.547 183.879 161.607 1.00 0.00 ? 250 G A C2     1  
ATOM 8389   N N2     . G A 1 261 ? 149.116 184.645 160.664 1.00 0.00 ? 250 G A N2     1  
ATOM 8390   N N3     . G A 1 261 ? 149.097 182.722 161.934 1.00 0.00 ? 250 G A N3     1  
ATOM 8391   C C4     . G A 1 261 ? 148.399 182.084 162.895 1.00 0.00 ? 250 G A C4     1  
ATOM 8392   H "H5'"  . G A 1 261 ? 149.957 176.645 165.235 1.00 0.00 ? 250 G A "H5'"  1  
ATOM 8393   H "H5''" . G A 1 261 ? 151.045 177.259 166.230 1.00 0.00 ? 250 G A "H5''" 1  
ATOM 8394   H "H4'"  . G A 1 261 ? 151.511 177.912 164.037 1.00 0.00 ? 250 G A "H4'"  1  
ATOM 8395   H "H3'"  . G A 1 261 ? 150.703 180.108 165.639 1.00 0.00 ? 250 G A "H3'"  1  
ATOM 8396   H "H2'"  . G A 1 261 ? 151.112 181.521 163.880 1.00 0.00 ? 250 G A "H2'"  1  
ATOM 8397   H "HO2'" . G A 1 261 ? 152.983 179.881 163.279 1.00 0.00 ? 250 G A "HO2'" 1  
ATOM 8398   H "H1'"  . G A 1 261 ? 149.954 179.956 162.126 1.00 0.00 ? 250 G A "H1'"  1  
ATOM 8399   H H8     . G A 1 261 ? 147.721 179.783 164.925 1.00 0.00 ? 250 G A H8     1  
ATOM 8400   H H1     . G A 1 261 ? 147.067 185.238 161.866 1.00 0.00 ? 250 G A H1     1  
ATOM 8401   H H21    . G A 1 261 ? 148.711 185.502 160.416 1.00 0.00 ? 250 G A H21    1  
ATOM 8402   H H22    . G A 1 261 ? 149.936 184.347 160.222 1.00 0.00 ? 250 G A H22    1  
ATOM 8403   P P      . G A 1 262 ? 153.110 180.820 166.532 1.00 0.00 ? 251 G A P      1  
ATOM 8404   O OP1    . G A 1 262 ? 154.473 180.454 166.995 1.00 0.00 ? 251 G A OP1    1  
ATOM 8405   O OP2    . G A 1 262 ? 152.024 181.019 167.526 1.00 0.00 ? 251 G A OP2    1  
ATOM 8406   O "O5'"  . G A 1 262 ? 153.225 182.148 165.657 1.00 0.00 ? 251 G A "O5'"  1  
ATOM 8407   C "C5'"  . G A 1 262 ? 154.210 182.267 164.641 1.00 0.00 ? 251 G A "C5'"  1  
ATOM 8408   C "C4'"  . G A 1 262 ? 154.045 183.546 163.858 1.00 0.00 ? 251 G A "C4'"  1  
ATOM 8409   O "O4'"  . G A 1 262 ? 152.742 183.563 163.216 1.00 0.00 ? 251 G A "O4'"  1  
ATOM 8410   C "C3'"  . G A 1 262 ? 154.075 184.834 164.667 1.00 0.00 ? 251 G A "C3'"  1  
ATOM 8411   O "O3'"  . G A 1 262 ? 155.391 185.243 165.004 1.00 0.00 ? 251 G A "O3'"  1  
ATOM 8412   C "C2'"  . G A 1 262 ? 153.343 185.814 163.761 1.00 0.00 ? 251 G A "C2'"  1  
ATOM 8413   O "O2'"  . G A 1 262 ? 154.183 186.270 162.710 1.00 0.00 ? 251 G A "O2'"  1  
ATOM 8414   C "C1'"  . G A 1 262 ? 152.248 184.923 163.171 1.00 0.00 ? 251 G A "C1'"  1  
ATOM 8415   N N9     . G A 1 262 ? 150.974 185.052 163.900 1.00 0.00 ? 251 G A N9     1  
ATOM 8416   C C8     . G A 1 262 ? 150.424 184.156 164.783 1.00 0.00 ? 251 G A C8     1  
ATOM 8417   N N7     . G A 1 262 ? 149.279 184.549 165.272 1.00 0.00 ? 251 G A N7     1  
ATOM 8418   C C5     . G A 1 262 ? 149.057 185.781 164.676 1.00 0.00 ? 251 G A C5     1  
ATOM 8419   C C6     . G A 1 262 ? 147.978 186.690 164.817 1.00 0.00 ? 251 G A C6     1  
ATOM 8420   O O6     . G A 1 262 ? 146.966 186.582 165.521 1.00 0.00 ? 251 G A O6     1  
ATOM 8421   N N1     . G A 1 262 ? 148.154 187.823 164.027 1.00 0.00 ? 251 G A N1     1  
ATOM 8422   C C2     . G A 1 262 ? 149.233 188.053 163.207 1.00 0.00 ? 251 G A C2     1  
ATOM 8423   N N2     . G A 1 262 ? 149.225 189.206 162.524 1.00 0.00 ? 251 G A N2     1  
ATOM 8424   N N3     . G A 1 262 ? 150.247 187.215 163.069 1.00 0.00 ? 251 G A N3     1  
ATOM 8425   C C4     . G A 1 262 ? 150.094 186.107 163.825 1.00 0.00 ? 251 G A C4     1  
ATOM 8426   H "H5'"  . G A 1 262 ? 154.134 181.505 164.030 1.00 0.00 ? 251 G A "H5'"  1  
ATOM 8427   H "H5''" . G A 1 262 ? 155.097 182.257 165.055 1.00 0.00 ? 251 G A "H5''" 1  
ATOM 8428   H "H4'"  . G A 1 262 ? 154.739 183.586 163.168 1.00 0.00 ? 251 G A "H4'"  1  
ATOM 8429   H "H3'"  . G A 1 262 ? 153.557 184.709 165.490 1.00 0.00 ? 251 G A "H3'"  1  
ATOM 8430   H "H2'"  . G A 1 262 ? 152.963 186.558 164.271 1.00 0.00 ? 251 G A "H2'"  1  
ATOM 8431   H "HO2'" . G A 1 262 ? 155.116 186.121 162.961 1.00 0.00 ? 251 G A "HO2'" 1  
ATOM 8432   H "H1'"  . G A 1 262 ? 152.111 185.156 162.229 1.00 0.00 ? 251 G A "H1'"  1  
ATOM 8433   H H8     . G A 1 262 ? 150.848 183.305 165.023 1.00 0.00 ? 251 G A H8     1  
ATOM 8434   H H1     . G A 1 262 ? 147.455 188.507 164.062 1.00 0.00 ? 251 G A H1     1  
ATOM 8435   H H21    . G A 1 262 ? 148.478 189.833 162.622 1.00 0.00 ? 251 G A H21    1  
ATOM 8436   H H22    . G A 1 262 ? 149.970 189.424 161.922 1.00 0.00 ? 251 G A H22    1  
ATOM 8437   P P      . C A 1 263 ? 155.649 186.120 166.325 1.00 0.00 ? 252 C A P      1  
ATOM 8438   O OP1    . C A 1 263 ? 157.115 186.289 166.485 1.00 0.00 ? 252 C A OP1    1  
ATOM 8439   O OP2    . C A 1 263 ? 154.853 185.532 167.432 1.00 0.00 ? 252 C A OP2    1  
ATOM 8440   O "O5'"  . C A 1 263 ? 155.026 187.544 165.971 1.00 0.00 ? 252 C A "O5'"  1  
ATOM 8441   C "C5'"  . C A 1 263 ? 155.620 188.376 164.987 1.00 0.00 ? 252 C A "C5'"  1  
ATOM 8442   C "C4'"  . C A 1 263 ? 154.804 189.623 164.745 1.00 0.00 ? 252 C A "C4'"  1  
ATOM 8443   O "O4'"  . C A 1 263 ? 153.483 189.262 164.263 1.00 0.00 ? 252 C A "O4'"  1  
ATOM 8444   C "C3'"  . C A 1 263 ? 154.528 190.489 165.963 1.00 0.00 ? 252 C A "C3'"  1  
ATOM 8445   O "O3'"  . C A 1 263 ? 155.622 191.316 166.314 1.00 0.00 ? 252 C A "O3'"  1  
ATOM 8446   C "C2'"  . C A 1 263 ? 153.285 191.266 165.545 1.00 0.00 ? 252 C A "C2'"  1  
ATOM 8447   O "O2'"  . C A 1 263 ? 153.614 192.330 164.665 1.00 0.00 ? 252 C A "O2'"  1  
ATOM 8448   C "C1'"  . C A 1 263 ? 152.509 190.202 164.766 1.00 0.00 ? 252 C A "C1'"  1  
ATOM 8449   N N1     . C A 1 263 ? 151.494 189.520 165.606 1.00 0.00 ? 252 C A N1     1  
ATOM 8450   C C2     . C A 1 263 ? 150.281 190.178 165.849 1.00 0.00 ? 252 C A C2     1  
ATOM 8451   O O2     . C A 1 263 ? 150.095 191.302 165.361 1.00 0.00 ? 252 C A O2     1  
ATOM 8452   N N3     . C A 1 263 ? 149.337 189.577 166.611 1.00 0.00 ? 252 C A N3     1  
ATOM 8453   C C4     . C A 1 263 ? 149.564 188.368 167.124 1.00 0.00 ? 252 C A C4     1  
ATOM 8454   N N4     . C A 1 263 ? 148.603 187.815 167.869 1.00 0.00 ? 252 C A N4     1  
ATOM 8455   C C5     . C A 1 263 ? 150.786 187.672 166.894 1.00 0.00 ? 252 C A C5     1  
ATOM 8456   C C6     . C A 1 263 ? 151.710 188.275 166.140 1.00 0.00 ? 252 C A C6     1  
ATOM 8457   H "H5'"  . C A 1 263 ? 155.695 187.875 164.148 1.00 0.00 ? 252 C A "H5'"  1  
ATOM 8458   H "H5''" . C A 1 263 ? 156.517 188.636 165.287 1.00 0.00 ? 252 C A "H5''" 1  
ATOM 8459   H "H4'"  . C A 1 263 ? 155.252 190.167 164.064 1.00 0.00 ? 252 C A "H4'"  1  
ATOM 8460   H "H3'"  . C A 1 263 ? 154.305 189.913 166.725 1.00 0.00 ? 252 C A "H3'"  1  
ATOM 8461   H "H2'"  . C A 1 263 ? 152.779 191.582 166.323 1.00 0.00 ? 252 C A "H2'"  1  
ATOM 8462   H "HO2'" . C A 1 263 ? 154.566 192.544 164.762 1.00 0.00 ? 252 C A "HO2'" 1  
ATOM 8463   H "H1'"  . C A 1 263 ? 152.069 190.618 163.996 1.00 0.00 ? 252 C A "H1'"  1  
ATOM 8464   H H41    . C A 1 263 ? 147.765 188.294 168.023 1.00 0.00 ? 252 C A H41    1  
ATOM 8465   H H42    . C A 1 263 ? 148.739 186.926 168.259 1.00 0.00 ? 252 C A H42    1  
ATOM 8466   H H5     . C A 1 263 ? 150.942 186.784 167.277 1.00 0.00 ? 252 C A H5     1  
ATOM 8467   H H6     . C A 1 263 ? 152.557 187.814 165.971 1.00 0.00 ? 252 C A H6     1  
ATOM 8468   P P      . A A 1 264 ? 155.805 191.817 167.833 1.00 0.00 ? 253 A A P      1  
ATOM 8469   O OP1    . A A 1 264 ? 157.103 192.532 167.929 1.00 0.00 ? 253 A A OP1    1  
ATOM 8470   O OP2    . A A 1 264 ? 155.532 190.666 168.731 1.00 0.00 ? 253 A A OP2    1  
ATOM 8471   O "O5'"  . A A 1 264 ? 154.638 192.883 168.030 1.00 0.00 ? 253 A A "O5'"  1  
ATOM 8472   C "C5'"  . A A 1 264 ? 154.635 194.104 167.304 1.00 0.00 ? 253 A A "C5'"  1  
ATOM 8473   C "C4'"  . A A 1 264 ? 153.368 194.886 167.537 1.00 0.00 ? 253 A A "C4'"  1  
ATOM 8474   O "O4'"  . A A 1 264 ? 152.225 194.121 167.070 1.00 0.00 ? 253 A A "O4'"  1  
ATOM 8475   C "C3'"  . A A 1 264 ? 153.035 195.201 168.988 1.00 0.00 ? 253 A A "C3'"  1  
ATOM 8476   O "O3'"  . A A 1 264 ? 153.772 196.296 169.500 1.00 0.00 ? 253 A A "O3'"  1  
ATOM 8477   C "C2'"  . A A 1 264 ? 151.535 195.440 168.941 1.00 0.00 ? 253 A A "C2'"  1  
ATOM 8478   O "O2'"  . A A 1 264 ? 151.235 196.732 168.431 1.00 0.00 ? 253 A A "O2'"  1  
ATOM 8479   C "C1'"  . A A 1 264 ? 151.089 194.391 167.922 1.00 0.00 ? 253 A A "C1'"  1  
ATOM 8480   N N9     . A A 1 264 ? 150.604 193.158 168.569 1.00 0.00 ? 253 A A N9     1  
ATOM 8481   C C8     . A A 1 264 ? 151.258 191.956 168.694 1.00 0.00 ? 253 A A C8     1  
ATOM 8482   N N7     . A A 1 264 ? 150.567 191.040 169.325 1.00 0.00 ? 253 A A N7     1  
ATOM 8483   C C5     . A A 1 264 ? 149.375 191.680 169.637 1.00 0.00 ? 253 A A C5     1  
ATOM 8484   C C6     . A A 1 264 ? 148.215 191.250 170.308 1.00 0.00 ? 253 A A C6     1  
ATOM 8485   N N6     . A A 1 264 ? 148.062 190.022 170.807 1.00 0.00 ? 253 A A N6     1  
ATOM 8486   N N1     . A A 1 264 ? 147.207 192.136 170.453 1.00 0.00 ? 253 A A N1     1  
ATOM 8487   C C2     . A A 1 264 ? 147.361 193.370 169.955 1.00 0.00 ? 253 A A C2     1  
ATOM 8488   N N3     . A A 1 264 ? 148.400 193.891 169.306 1.00 0.00 ? 253 A A N3     1  
ATOM 8489   C C4     . A A 1 264 ? 149.385 192.984 169.179 1.00 0.00 ? 253 A A C4     1  
ATOM 8490   H "H5'"  . A A 1 264 ? 154.717 193.906 166.345 1.00 0.00 ? 253 A A "H5'"  1  
ATOM 8491   H "H5''" . A A 1 264 ? 155.401 194.645 167.584 1.00 0.00 ? 253 A A "H5''" 1  
ATOM 8492   H "H4'"  . A A 1 264 ? 153.415 195.726 167.034 1.00 0.00 ? 253 A A "H4'"  1  
ATOM 8493   H "H3'"  . A A 1 264 ? 153.216 194.407 169.537 1.00 0.00 ? 253 A A "H3'"  1  
ATOM 8494   H "H2'"  . A A 1 264 ? 151.117 195.291 169.815 1.00 0.00 ? 253 A A "H2'"  1  
ATOM 8495   H "HO2'" . A A 1 264 ? 152.027 197.303 168.518 1.00 0.00 ? 253 A A "HO2'" 1  
ATOM 8496   H "H1'"  . A A 1 264 ? 150.377 194.763 167.357 1.00 0.00 ? 253 A A "H1'"  1  
ATOM 8497   H H8     . A A 1 264 ? 152.160 191.799 168.343 1.00 0.00 ? 253 A A H8     1  
ATOM 8498   H H61    . A A 1 264 ? 147.231 189.779 171.264 1.00 0.00 ? 253 A A H61    1  
ATOM 8499   H H62    . A A 1 264 ? 148.782 189.360 170.713 1.00 0.00 ? 253 A A H62    1  
ATOM 8500   H H2     . A A 1 264 ? 146.600 193.975 170.087 1.00 0.00 ? 253 A A H2     1  
ATOM 8501   P P      . C A 1 265 ? 154.099 196.389 171.071 1.00 0.00 ? 254 C A P      1  
ATOM 8502   O OP1    . C A 1 265 ? 154.986 197.558 171.289 1.00 0.00 ? 254 C A OP1    1  
ATOM 8503   O OP2    . C A 1 265 ? 154.530 195.045 171.531 1.00 0.00 ? 254 C A OP2    1  
ATOM 8504   O "O5'"  . C A 1 265 ? 152.688 196.710 171.740 1.00 0.00 ? 254 C A "O5'"  1  
ATOM 8505   C "C5'"  . C A 1 265 ? 152.054 197.964 171.537 1.00 0.00 ? 254 C A "C5'"  1  
ATOM 8506   C "C4'"  . C A 1 265 ? 150.681 198.001 172.162 1.00 0.00 ? 254 C A "C4'"  1  
ATOM 8507   O "O4'"  . C A 1 265 ? 149.843 196.974 171.570 1.00 0.00 ? 254 C A "O4'"  1  
ATOM 8508   C "C3'"  . C A 1 265 ? 150.612 197.718 173.654 1.00 0.00 ? 254 C A "C3'"  1  
ATOM 8509   O "O3'"  . C A 1 265 ? 150.966 198.838 174.448 1.00 0.00 ? 254 C A "O3'"  1  
ATOM 8510   C "C2'"  . C A 1 265 ? 149.172 197.266 173.842 1.00 0.00 ? 254 C A "C2'"  1  
ATOM 8511   O "O2'"  . C A 1 265 ? 148.281 198.372 173.853 1.00 0.00 ? 254 C A "O2'"  1  
ATOM 8512   C "C1'"  . C A 1 265 ? 148.939 196.453 172.567 1.00 0.00 ? 254 C A "C1'"  1  
ATOM 8513   N N1     . C A 1 265 ? 149.158 194.999 172.777 1.00 0.00 ? 254 C A N1     1  
ATOM 8514   C C2     . C A 1 265 ? 148.152 194.261 173.414 1.00 0.00 ? 254 C A C2     1  
ATOM 8515   O O2     . C A 1 265 ? 147.117 194.838 173.780 1.00 0.00 ? 254 C A O2     1  
ATOM 8516   N N3     . C A 1 265 ? 148.326 192.936 173.617 1.00 0.00 ? 254 C A N3     1  
ATOM 8517   C C4     . C A 1 265 ? 149.449 192.339 173.214 1.00 0.00 ? 254 C A C4     1  
ATOM 8518   N N4     . C A 1 265 ? 149.576 191.029 173.436 1.00 0.00 ? 254 C A N4     1  
ATOM 8519   C C5     . C A 1 265 ? 150.489 193.062 172.565 1.00 0.00 ? 254 C A C5     1  
ATOM 8520   C C6     . C A 1 265 ? 150.305 194.373 172.367 1.00 0.00 ? 254 C A C6     1  
ATOM 8521   H "H5'"  . C A 1 265 ? 151.974 198.130 170.575 1.00 0.00 ? 254 C A "H5'"  1  
ATOM 8522   H "H5''" . C A 1 265 ? 152.606 198.670 171.939 1.00 0.00 ? 254 C A "H5''" 1  
ATOM 8523   H "H4'"  . C A 1 265 ? 150.277 198.878 171.986 1.00 0.00 ? 254 C A "H4'"  1  
ATOM 8524   H "H3'"  . C A 1 265 ? 151.213 196.972 173.867 1.00 0.00 ? 254 C A "H3'"  1  
ATOM 8525   H "H2'"  . C A 1 265 ? 149.071 196.710 174.644 1.00 0.00 ? 254 C A "H2'"  1  
ATOM 8526   H "HO2'" . C A 1 265 ? 148.786 199.187 174.057 1.00 0.00 ? 254 C A "HO2'" 1  
ATOM 8527   H "H1'"  . C A 1 265 ? 148.025 196.600 172.249 1.00 0.00 ? 254 C A "H1'"  1  
ATOM 8528   H H41    . C A 1 265 ? 148.857 190.535 173.884 1.00 0.00 ? 254 C A H41    1  
ATOM 8529   H H42    . C A 1 265 ? 150.389 190.562 173.152 1.00 0.00 ? 254 C A H42    1  
ATOM 8530   H H5     . C A 1 265 ? 151.310 192.614 172.273 1.00 0.00 ? 254 C A H5     1  
ATOM 8531   H H6     . C A 1 265 ? 151.009 194.888 171.924 1.00 0.00 ? 254 C A H6     1  
ATOM 8532   P P      . U A 1 266 ? 151.919 198.653 175.729 1.00 0.00 ? 255 U A P      1  
ATOM 8533   O OP1    . U A 1 266 ? 152.008 199.960 176.428 1.00 0.00 ? 255 U A OP1    1  
ATOM 8534   O OP2    . U A 1 266 ? 153.160 197.972 175.283 1.00 0.00 ? 255 U A OP2    1  
ATOM 8535   O "O5'"  . U A 1 266 ? 151.114 197.646 176.665 1.00 0.00 ? 255 U A "O5'"  1  
ATOM 8536   C "C5'"  . U A 1 266 ? 149.897 198.039 177.282 1.00 0.00 ? 255 U A "C5'"  1  
ATOM 8537   C "C4'"  . U A 1 266 ? 149.114 196.848 177.777 1.00 0.00 ? 255 U A "C4'"  1  
ATOM 8538   O "O4'"  . U A 1 266 ? 148.908 195.888 176.706 1.00 0.00 ? 255 U A "O4'"  1  
ATOM 8539   C "C3'"  . U A 1 266 ? 149.784 196.005 178.851 1.00 0.00 ? 255 U A "C3'"  1  
ATOM 8540   O "O3'"  . U A 1 266 ? 149.676 196.568 180.146 1.00 0.00 ? 255 U A "O3'"  1  
ATOM 8541   C "C2'"  . U A 1 266 ? 148.970 194.718 178.745 1.00 0.00 ? 255 U A "C2'"  1  
ATOM 8542   O "O2'"  . U A 1 266 ? 147.681 194.876 179.322 1.00 0.00 ? 255 U A "O2'"  1  
ATOM 8543   C "C1'"  . U A 1 266 ? 148.831 194.588 177.227 1.00 0.00 ? 255 U A "C1'"  1  
ATOM 8544   N N1     . U A 1 266 ? 149.928 193.789 176.628 1.00 0.00 ? 255 U A N1     1  
ATOM 8545   C C2     . U A 1 266 ? 149.788 192.414 176.643 1.00 0.00 ? 255 U A C2     1  
ATOM 8546   O O2     . U A 1 266 ? 148.818 191.849 177.117 1.00 0.00 ? 255 U A O2     1  
ATOM 8547   N N3     . U A 1 266 ? 150.827 191.716 176.077 1.00 0.00 ? 255 U A N3     1  
ATOM 8548   C C4     . U A 1 266 ? 151.970 192.240 175.512 1.00 0.00 ? 255 U A C4     1  
ATOM 8549   O O4     . U A 1 266 ? 152.817 191.477 175.044 1.00 0.00 ? 255 U A O4     1  
ATOM 8550   C C5     . U A 1 266 ? 152.047 193.669 175.532 1.00 0.00 ? 255 U A C5     1  
ATOM 8551   C C6     . U A 1 266 ? 151.049 194.373 176.075 1.00 0.00 ? 255 U A C6     1  
ATOM 8552   H "H5'"  . U A 1 266 ? 149.353 198.530 176.631 1.00 0.00 ? 255 U A "H5'"  1  
ATOM 8553   H "H5''" . U A 1 266 ? 150.097 198.627 178.040 1.00 0.00 ? 255 U A "H5''" 1  
ATOM 8554   H "H4'"  . U A 1 266 ? 148.238 197.154 178.092 1.00 0.00 ? 255 U A "H4'"  1  
ATOM 8555   H "H3'"  . U A 1 266 ? 150.713 195.832 178.592 1.00 0.00 ? 255 U A "H3'"  1  
ATOM 8556   H "H2'"  . U A 1 266 ? 149.449 193.957 179.133 1.00 0.00 ? 255 U A "H2'"  1  
ATOM 8557   H "HO2'" . U A 1 266 ? 147.128 194.102 179.085 1.00 0.00 ? 255 U A "HO2'" 1  
ATOM 8558   H "H1'"  . U A 1 266 ? 147.971 194.167 177.016 1.00 0.00 ? 255 U A "H1'"  1  
ATOM 8559   H H3     . U A 1 266 ? 150.748 190.740 176.077 1.00 0.00 ? 255 U A H3     1  
ATOM 8560   H H5     . U A 1 266 ? 152.825 194.126 175.150 1.00 0.00 ? 255 U A H5     1  
ATOM 8561   H H6     . U A 1 266 ? 151.125 195.349 176.078 1.00 0.00 ? 255 U A H6     1  
ATOM 8562   P P      . U A 1 267 ? 150.646 196.073 181.327 1.00 0.00 ? 256 U A P      1  
ATOM 8563   O OP1    . U A 1 267 ? 150.478 196.997 182.478 1.00 0.00 ? 256 U A OP1    1  
ATOM 8564   O OP2    . U A 1 267 ? 151.997 195.856 180.752 1.00 0.00 ? 256 U A OP2    1  
ATOM 8565   O "O5'"  . U A 1 267 ? 150.053 194.655 181.744 1.00 0.00 ? 256 U A "O5'"  1  
ATOM 8566   C "C5'"  . U A 1 267 ? 150.907 193.604 182.171 1.00 0.00 ? 256 U A "C5'"  1  
ATOM 8567   C "C4'"  . U A 1 267 ? 150.585 192.306 181.474 1.00 0.00 ? 256 U A "C4'"  1  
ATOM 8568   O "O4'"  . U A 1 267 ? 150.854 192.403 180.061 1.00 0.00 ? 256 U A "O4'"  1  
ATOM 8569   C "C3'"  . U A 1 267 ? 151.422 191.102 181.877 1.00 0.00 ? 256 U A "C3'"  1  
ATOM 8570   O "O3'"  . U A 1 267 ? 151.076 190.588 183.151 1.00 0.00 ? 256 U A "O3'"  1  
ATOM 8571   C "C2'"  . U A 1 267 ? 151.173 190.157 180.732 1.00 0.00 ? 256 U A "C2'"  1  
ATOM 8572   O "O2'"  . U A 1 267 ? 149.895 189.545 180.838 1.00 0.00 ? 256 U A "O2'"  1  
ATOM 8573   C "C1'"  . U A 1 267 ? 151.172 191.132 179.551 1.00 0.00 ? 256 U A "C1'"  1  
ATOM 8574   N N1     . U A 1 267 ? 152.496 191.216 178.889 1.00 0.00 ? 256 U A N1     1  
ATOM 8575   C C2     . U A 1 267 ? 152.842 190.185 178.036 1.00 0.00 ? 256 U A C2     1  
ATOM 8576   O O2     . U A 1 267 ? 152.114 189.233 177.814 1.00 0.00 ? 256 U A O2     1  
ATOM 8577   N N3     . U A 1 267 ? 154.076 190.306 177.446 1.00 0.00 ? 256 U A N3     1  
ATOM 8578   C C4     . U A 1 267 ? 154.983 191.330 177.617 1.00 0.00 ? 256 U A C4     1  
ATOM 8579   O O4     . U A 1 267 ? 156.056 191.294 177.013 1.00 0.00 ? 256 U A O4     1  
ATOM 8580   C C5     . U A 1 267 ? 154.558 192.361 178.513 1.00 0.00 ? 256 U A C5     1  
ATOM 8581   C C6     . U A 1 267 ? 153.361 192.270 179.101 1.00 0.00 ? 256 U A C6     1  
ATOM 8582   H "H5'"  . U A 1 267 ? 150.802 193.481 183.138 1.00 0.00 ? 256 U A "H5'"  1  
ATOM 8583   H "H5''" . U A 1 267 ? 151.836 193.848 181.978 1.00 0.00 ? 256 U A "H5''" 1  
ATOM 8584   H "H4'"  . U A 1 267 ? 149.632 192.110 181.594 1.00 0.00 ? 256 U A "H4'"  1  
ATOM 8585   H "H3'"  . U A 1 267 ? 152.368 191.357 181.888 1.00 0.00 ? 256 U A "H3'"  1  
ATOM 8586   H "H2'"  . U A 1 267 ? 151.888 189.491 180.653 1.00 0.00 ? 256 U A "H2'"  1  
ATOM 8587   H "HO2'" . U A 1 267 ? 149.227 190.127 180.418 1.00 0.00 ? 256 U A "HO2'" 1  
ATOM 8588   H "H1'"  . U A 1 267 ? 150.499 190.846 178.897 1.00 0.00 ? 256 U A "H1'"  1  
ATOM 8589   H H3     . U A 1 267 ? 154.340 189.585 176.837 1.00 0.00 ? 256 U A H3     1  
ATOM 8590   H H5     . U A 1 267 ? 155.140 193.129 178.693 1.00 0.00 ? 256 U A H5     1  
ATOM 8591   H H6     . U A 1 267 ? 153.093 192.988 179.710 1.00 0.00 ? 256 U A H6     1  
ATOM 8592   P P      . C A 1 268 ? 151.825 189.286 183.713 1.00 0.00 ? 257 C A P      1  
ATOM 8593   O OP1    . C A 1 268 ? 151.497 189.118 185.151 1.00 0.00 ? 257 C A OP1    1  
ATOM 8594   O OP2    . C A 1 268 ? 153.232 189.522 183.304 1.00 0.00 ? 257 C A OP2    1  
ATOM 8595   O "O5'"  . C A 1 268 ? 151.293 188.002 182.934 1.00 0.00 ? 257 C A "O5'"  1  
ATOM 8596   C "C5'"  . C A 1 268 ? 151.532 186.695 183.433 1.00 0.00 ? 257 C A "C5'"  1  
ATOM 8597   C "C4'"  . C A 1 268 ? 150.244 185.984 183.771 1.00 0.00 ? 257 C A "C4'"  1  
ATOM 8598   O "O4'"  . C A 1 268 ? 149.484 186.838 184.662 1.00 0.00 ? 257 C A "O4'"  1  
ATOM 8599   C "C3'"  . C A 1 268 ? 149.283 185.753 182.615 1.00 0.00 ? 257 C A "C3'"  1  
ATOM 8600   O "O3'"  . C A 1 268 ? 149.668 184.672 181.784 1.00 0.00 ? 257 C A "O3'"  1  
ATOM 8601   C "C2'"  . C A 1 268 ? 147.966 185.572 183.346 1.00 0.00 ? 257 C A "C2'"  1  
ATOM 8602   O "O2'"  . C A 1 268 ? 147.878 184.284 183.938 1.00 0.00 ? 257 C A "O2'"  1  
ATOM 8603   C "C1'"  . C A 1 268 ? 148.102 186.630 184.449 1.00 0.00 ? 257 C A "C1'"  1  
ATOM 8604   N N1     . C A 1 268 ? 147.473 187.920 184.074 1.00 0.00 ? 257 C A N1     1  
ATOM 8605   C C2     . C A 1 268 ? 146.084 188.045 184.204 1.00 0.00 ? 257 C A C2     1  
ATOM 8606   O O2     . C A 1 268 ? 145.426 187.082 184.626 1.00 0.00 ? 257 C A O2     1  
ATOM 8607   N N3     . C A 1 268 ? 145.485 189.211 183.869 1.00 0.00 ? 257 C A N3     1  
ATOM 8608   C C4     . C A 1 268 ? 146.215 190.231 183.418 1.00 0.00 ? 257 C A C4     1  
ATOM 8609   N N4     . C A 1 268 ? 145.581 191.363 183.100 1.00 0.00 ? 257 C A N4     1  
ATOM 8610   C C5     . C A 1 268 ? 147.628 190.136 183.273 1.00 0.00 ? 257 C A C5     1  
ATOM 8611   C C6     . C A 1 268 ? 148.209 188.978 183.609 1.00 0.00 ? 257 C A C6     1  
ATOM 8612   H "H5'"  . C A 1 268 ? 152.084 186.758 184.240 1.00 0.00 ? 257 C A "H5'"  1  
ATOM 8613   H "H5''" . C A 1 268 ? 152.014 186.178 182.755 1.00 0.00 ? 257 C A "H5''" 1  
ATOM 8614   H "H4'"  . C A 1 268 ? 150.419 185.128 184.214 1.00 0.00 ? 257 C A "H4'"  1  
ATOM 8615   H "H3'"  . C A 1 268 ? 149.223 186.568 182.075 1.00 0.00 ? 257 C A "H3'"  1  
ATOM 8616   H "H2'"  . C A 1 268 ? 147.203 185.754 182.759 1.00 0.00 ? 257 C A "H2'"  1  
ATOM 8617   H "HO2'" . C A 1 268 ? 147.006 184.193 184.376 1.00 0.00 ? 257 C A "HO2'" 1  
ATOM 8618   H "H1'"  . C A 1 268 ? 147.690 186.292 185.271 1.00 0.00 ? 257 C A "H1'"  1  
ATOM 8619   H H41    . C A 1 268 ? 144.608 191.424 183.200 1.00 0.00 ? 257 C A H41    1  
ATOM 8620   H H42    . C A 1 268 ? 146.089 192.131 182.766 1.00 0.00 ? 257 C A H42    1  
ATOM 8621   H H5     . C A 1 268 ? 148.156 190.892 182.941 1.00 0.00 ? 257 C A H5     1  
ATOM 8622   H H6     . C A 1 268 ? 149.180 188.892 183.516 1.00 0.00 ? 257 C A H6     1  
ATOM 8623   P P      . G A 1 269 ? 149.056 184.531 180.305 1.00 0.00 ? 258 G A P      1  
ATOM 8624   O OP1    . G A 1 269 ? 149.794 183.452 179.601 1.00 0.00 ? 258 G A OP1    1  
ATOM 8625   O OP2    . G A 1 269 ? 148.989 185.888 179.704 1.00 0.00 ? 258 G A OP2    1  
ATOM 8626   O "O5'"  . G A 1 269 ? 147.564 184.028 180.551 1.00 0.00 ? 258 G A "O5'"  1  
ATOM 8627   C "C5'"  . G A 1 269 ? 146.526 184.349 179.637 1.00 0.00 ? 258 G A "C5'"  1  
ATOM 8628   C "C4'"  . G A 1 269 ? 145.454 185.187 180.289 1.00 0.00 ? 258 G A "C4'"  1  
ATOM 8629   O "O4'"  . G A 1 269 ? 146.029 186.397 180.839 1.00 0.00 ? 258 G A "O4'"  1  
ATOM 8630   C "C3'"  . G A 1 269 ? 144.375 185.728 179.363 1.00 0.00 ? 258 G A "C3'"  1  
ATOM 8631   O "O3'"  . G A 1 269 ? 143.351 184.785 179.095 1.00 0.00 ? 258 G A "O3'"  1  
ATOM 8632   C "C2'"  . G A 1 269 ? 143.799 186.864 180.196 1.00 0.00 ? 258 G A "C2'"  1  
ATOM 8633   O "O2'"  . G A 1 269 ? 142.919 186.374 181.197 1.00 0.00 ? 258 G A "O2'"  1  
ATOM 8634   C "C1'"  . G A 1 269 ? 145.058 187.413 180.866 1.00 0.00 ? 258 G A "C1'"  1  
ATOM 8635   N N9     . G A 1 269 ? 145.598 188.587 180.156 1.00 0.00 ? 258 G A N9     1  
ATOM 8636   C C8     . G A 1 269 ? 146.784 188.669 179.467 1.00 0.00 ? 258 G A C8     1  
ATOM 8637   N N7     . G A 1 269 ? 146.992 189.846 178.942 1.00 0.00 ? 258 G A N7     1  
ATOM 8638   C C5     . G A 1 269 ? 145.877 190.587 179.305 1.00 0.00 ? 258 G A C5     1  
ATOM 8639   C C6     . G A 1 269 ? 145.537 191.935 179.024 1.00 0.00 ? 258 G A C6     1  
ATOM 8640   O O6     . G A 1 269 ? 146.176 192.772 178.377 1.00 0.00 ? 258 G A O6     1  
ATOM 8641   N N1     . G A 1 269 ? 144.312 192.283 179.586 1.00 0.00 ? 258 G A N1     1  
ATOM 8642   C C2     . G A 1 269 ? 143.515 191.441 180.323 1.00 0.00 ? 258 G A C2     1  
ATOM 8643   N N2     . G A 1 269 ? 142.366 191.959 180.783 1.00 0.00 ? 258 G A N2     1  
ATOM 8644   N N3     . G A 1 269 ? 143.821 190.182 180.592 1.00 0.00 ? 258 G A N3     1  
ATOM 8645   C C4     . G A 1 269 ? 145.006 189.824 180.055 1.00 0.00 ? 258 G A C4     1  
ATOM 8646   H "H5'"  . G A 1 269 ? 146.125 183.520 179.303 1.00 0.00 ? 258 G A "H5'"  1  
ATOM 8647   H "H5''" . G A 1 269 ? 146.907 184.847 178.883 1.00 0.00 ? 258 G A "H5''" 1  
ATOM 8648   H "H4'"  . G A 1 269 ? 145.028 184.670 181.005 1.00 0.00 ? 258 G A "H4'"  1  
ATOM 8649   H "H3'"  . G A 1 269 ? 144.740 186.055 178.515 1.00 0.00 ? 258 G A "H3'"  1  
ATOM 8650   H "H2'"  . G A 1 269 ? 143.368 187.540 179.633 1.00 0.00 ? 258 G A "H2'"  1  
ATOM 8651   H "HO2'" . G A 1 269 ? 142.582 187.128 181.724 1.00 0.00 ? 258 G A "HO2'" 1  
ATOM 8652   H "H1'"  . G A 1 269 ? 144.854 187.657 181.793 1.00 0.00 ? 258 G A "H1'"  1  
ATOM 8653   H H8     . G A 1 269 ? 147.411 187.921 179.378 1.00 0.00 ? 258 G A H8     1  
ATOM 8654   H H1     . G A 1 269 ? 143.995 193.199 179.444 1.00 0.00 ? 258 G A H1     1  
ATOM 8655   H H21    . G A 1 269 ? 142.133 192.890 180.588 1.00 0.00 ? 258 G A H21    1  
ATOM 8656   H H22    . G A 1 269 ? 141.757 191.405 181.315 1.00 0.00 ? 258 G A H22    1  
ATOM 8657   P P      . G A 1 270 ? 142.302 185.048 177.906 1.00 0.00 ? 259 G A P      1  
ATOM 8658   O OP1    . G A 1 270 ? 141.503 183.810 177.714 1.00 0.00 ? 259 G A OP1    1  
ATOM 8659   O OP2    . G A 1 270 ? 143.044 185.628 176.758 1.00 0.00 ? 259 G A OP2    1  
ATOM 8660   O "O5'"  . G A 1 270 ? 141.335 186.173 178.487 1.00 0.00 ? 259 G A "O5'"  1  
ATOM 8661   C "C5'"  . G A 1 270 ? 140.251 186.671 177.719 1.00 0.00 ? 259 G A "C5'"  1  
ATOM 8662   C "C4'"  . G A 1 270 ? 140.316 188.172 177.572 1.00 0.00 ? 259 G A "C4'"  1  
ATOM 8663   O "O4'"  . G A 1 270 ? 141.545 188.670 178.165 1.00 0.00 ? 259 G A "O4'"  1  
ATOM 8664   C "C3'"  . G A 1 270 ? 140.353 188.702 176.147 1.00 0.00 ? 259 G A "C3'"  1  
ATOM 8665   O "O3'"  . G A 1 270 ? 139.070 188.766 175.546 1.00 0.00 ? 259 G A "O3'"  1  
ATOM 8666   C "C2'"  . G A 1 270 ? 141.018 190.061 176.315 1.00 0.00 ? 259 G A "C2'"  1  
ATOM 8667   O "O2'"  . G A 1 270 ? 140.102 191.024 176.819 1.00 0.00 ? 259 G A "O2'"  1  
ATOM 8668   C "C1'"  . G A 1 270 ? 142.061 189.758 177.390 1.00 0.00 ? 259 G A "C1'"  1  
ATOM 8669   N N9     . G A 1 270 ? 143.372 189.410 176.811 1.00 0.00 ? 259 G A N9     1  
ATOM 8670   C C8     . G A 1 270 ? 143.958 188.168 176.765 1.00 0.00 ? 259 G A C8     1  
ATOM 8671   N N7     . G A 1 270 ? 145.128 188.172 176.187 1.00 0.00 ? 259 G A N7     1  
ATOM 8672   C C5     . G A 1 270 ? 145.327 189.498 175.827 1.00 0.00 ? 259 G A C5     1  
ATOM 8673   C C6     . G A 1 270 ? 146.419 190.116 175.165 1.00 0.00 ? 259 G A C6     1  
ATOM 8674   O O6     . G A 1 270 ? 147.463 189.598 174.751 1.00 0.00 ? 259 G A O6     1  
ATOM 8675   N N1     . G A 1 270 ? 146.212 191.482 175.000 1.00 0.00 ? 259 G A N1     1  
ATOM 8676   C C2     . G A 1 270 ? 145.095 192.166 175.418 1.00 0.00 ? 259 G A C2     1  
ATOM 8677   N N2     . G A 1 270 ? 145.078 193.483 175.169 1.00 0.00 ? 259 G A N2     1  
ATOM 8678   N N3     . G A 1 270 ? 144.071 191.602 176.036 1.00 0.00 ? 259 G A N3     1  
ATOM 8679   C C4     . G A 1 270 ? 144.254 190.274 176.206 1.00 0.00 ? 259 G A C4     1  
ATOM 8680   H "H5'"  . G A 1 270 ? 139.410 186.428 178.157 1.00 0.00 ? 259 G A "H5'"  1  
ATOM 8681   H "H5''" . G A 1 270 ? 140.277 186.261 176.829 1.00 0.00 ? 259 G A "H5''" 1  
ATOM 8682   H "H4'"  . G A 1 270 ? 139.552 188.570 178.039 1.00 0.00 ? 259 G A "H4'"  1  
ATOM 8683   H "H3'"  . G A 1 270 ? 140.932 188.127 175.604 1.00 0.00 ? 259 G A "H3'"  1  
ATOM 8684   H "H2'"  . G A 1 270 ? 141.438 190.362 175.481 1.00 0.00 ? 259 G A "H2'"  1  
ATOM 8685   H "HO2'" . G A 1 270 ? 139.189 190.711 176.653 1.00 0.00 ? 259 G A "HO2'" 1  
ATOM 8686   H "H1'"  . G A 1 270 ? 142.161 190.539 177.977 1.00 0.00 ? 259 G A "H1'"  1  
ATOM 8687   H H8     . G A 1 270 ? 143.541 187.360 177.131 1.00 0.00 ? 259 G A H8     1  
ATOM 8688   H H1     . G A 1 270 ? 146.916 191.994 174.551 1.00 0.00 ? 259 G A H1     1  
ATOM 8689   H H21    . G A 1 270 ? 145.832 193.910 174.711 1.00 0.00 ? 259 G A H21    1  
ATOM 8690   H H22    . G A 1 270 ? 144.306 194.023 175.444 1.00 0.00 ? 259 G A H22    1  
ATOM 8691   P P      . U A 1 271 ? 138.913 188.582 173.959 1.00 0.00 ? 260 U A P      1  
ATOM 8692   O OP1    . U A 1 271 ? 137.465 188.420 173.655 1.00 0.00 ? 260 U A OP1    1  
ATOM 8693   O OP2    . U A 1 271 ? 139.875 187.540 173.519 1.00 0.00 ? 260 U A OP2    1  
ATOM 8694   O "O5'"  . U A 1 271 ? 139.388 189.978 173.360 1.00 0.00 ? 260 U A "O5'"  1  
ATOM 8695   C "C5'"  . U A 1 271 ? 138.637 191.161 173.579 1.00 0.00 ? 260 U A "C5'"  1  
ATOM 8696   C "C4'"  . U A 1 271 ? 139.308 192.369 172.976 1.00 0.00 ? 260 U A "C4'"  1  
ATOM 8697   O "O4'"  . U A 1 271 ? 140.591 192.597 173.620 1.00 0.00 ? 260 U A "O4'"  1  
ATOM 8698   C "C3'"  . U A 1 271 ? 139.650 192.275 171.496 1.00 0.00 ? 260 U A "C3'"  1  
ATOM 8699   O "O3'"  . U A 1 271 ? 138.549 192.569 170.653 1.00 0.00 ? 260 U A "O3'"  1  
ATOM 8700   C "C2'"  . U A 1 271 ? 140.802 193.260 171.357 1.00 0.00 ? 260 U A "C2'"  1  
ATOM 8701   O "O2'"  . U A 1 271 ? 140.335 194.601 171.329 1.00 0.00 ? 260 U A "O2'"  1  
ATOM 8702   C "C1'"  . U A 1 271 ? 141.560 193.028 172.665 1.00 0.00 ? 260 U A "C1'"  1  
ATOM 8703   N N1     . U A 1 271 ? 142.620 191.997 172.527 1.00 0.00 ? 260 U A N1     1  
ATOM 8704   C C2     . U A 1 271 ? 143.802 192.386 171.922 1.00 0.00 ? 260 U A C2     1  
ATOM 8705   O O2     . U A 1 271 ? 143.999 193.515 171.511 1.00 0.00 ? 260 U A O2     1  
ATOM 8706   N N3     . U A 1 271 ? 144.752 191.401 171.817 1.00 0.00 ? 260 U A N3     1  
ATOM 8707   C C4     . U A 1 271 ? 144.645 190.093 172.242 1.00 0.00 ? 260 U A C4     1  
ATOM 8708   O O4     . U A 1 271 ? 145.594 189.325 172.073 1.00 0.00 ? 260 U A O4     1  
ATOM 8709   C C5     . U A 1 271 ? 143.397 189.765 172.855 1.00 0.00 ? 260 U A C5     1  
ATOM 8710   C C6     . U A 1 271 ? 142.454 190.704 172.973 1.00 0.00 ? 260 U A C6     1  
ATOM 8711   H "H5'"  . U A 1 271 ? 138.536 191.301 174.544 1.00 0.00 ? 260 U A "H5'"  1  
ATOM 8712   H "H5''" . U A 1 271 ? 137.749 191.055 173.176 1.00 0.00 ? 260 U A "H5''" 1  
ATOM 8713   H "H4'"  . U A 1 271 ? 138.735 193.151 173.120 1.00 0.00 ? 260 U A "H4'"  1  
ATOM 8714   H "H3'"  . U A 1 271 ? 139.975 191.373 171.296 1.00 0.00 ? 260 U A "H3'"  1  
ATOM 8715   H "H2'"  . U A 1 271 ? 141.361 193.054 170.578 1.00 0.00 ? 260 U A "H2'"  1  
ATOM 8716   H "HO2'" . U A 1 271 ? 139.388 194.603 171.084 1.00 0.00 ? 260 U A "HO2'" 1  
ATOM 8717   H "H1'"  . U A 1 271 ? 141.967 193.869 172.962 1.00 0.00 ? 260 U A "H1'"  1  
ATOM 8718   H H3     . U A 1 271 ? 145.597 191.655 171.391 1.00 0.00 ? 260 U A H3     1  
ATOM 8719   H H5     . U A 1 271 ? 143.237 188.856 173.189 1.00 0.00 ? 260 U A H5     1  
ATOM 8720   H H6     . U A 1 271 ? 141.608 190.455 173.397 1.00 0.00 ? 260 U A H6     1  
ATOM 8721   P P      . G A 1 272 ? 138.443 191.897 169.197 1.00 0.00 ? 261 G A P      1  
ATOM 8722   O OP1    . G A 1 272 ? 137.100 192.209 168.644 1.00 0.00 ? 261 G A OP1    1  
ATOM 8723   O OP2    . G A 1 272 ? 138.878 190.483 169.309 1.00 0.00 ? 261 G A OP2    1  
ATOM 8724   O "O5'"  . G A 1 272 ? 139.525 192.680 168.329 1.00 0.00 ? 261 G A "O5'"  1  
ATOM 8725   C "C5'"  . G A 1 272 ? 139.353 194.052 168.012 1.00 0.00 ? 261 G A "C5'"  1  
ATOM 8726   C "C4'"  . G A 1 272 ? 140.572 194.622 167.330 1.00 0.00 ? 261 G A "C4'"  1  
ATOM 8727   O "O4'"  . G A 1 272 ? 141.723 194.518 168.211 1.00 0.00 ? 261 G A "O4'"  1  
ATOM 8728   C "C3'"  . G A 1 272 ? 141.017 193.918 166.057 1.00 0.00 ? 261 G A "C3'"  1  
ATOM 8729   O "O3'"  . G A 1 272 ? 140.272 194.312 164.917 1.00 0.00 ? 261 G A "O3'"  1  
ATOM 8730   C "C2'"  . G A 1 272 ? 142.493 194.274 165.978 1.00 0.00 ? 261 G A "C2'"  1  
ATOM 8731   O "O2'"  . G A 1 272 ? 142.679 195.599 165.501 1.00 0.00 ? 261 G A "O2'"  1  
ATOM 8732   C "C1'"  . G A 1 272 ? 142.902 194.215 167.452 1.00 0.00 ? 261 G A "C1'"  1  
ATOM 8733   N N9     . G A 1 272 ? 143.443 192.896 167.824 1.00 0.00 ? 261 G A N9     1  
ATOM 8734   C C8     . G A 1 272 ? 142.825 191.926 168.576 1.00 0.00 ? 261 G A C8     1  
ATOM 8735   N N7     . G A 1 272 ? 143.560 190.858 168.741 1.00 0.00 ? 261 G A N7     1  
ATOM 8736   C C5     . G A 1 272 ? 144.733 191.140 168.055 1.00 0.00 ? 261 G A C5     1  
ATOM 8737   C C6     . G A 1 272 ? 145.905 190.359 167.879 1.00 0.00 ? 261 G A C6     1  
ATOM 8738   O O6     . G A 1 272 ? 146.147 189.224 168.306 1.00 0.00 ? 261 G A O6     1  
ATOM 8739   N N1     . G A 1 272 ? 146.858 191.028 167.114 1.00 0.00 ? 261 G A N1     1  
ATOM 8740   C C2     . G A 1 272 ? 146.701 192.288 166.587 1.00 0.00 ? 261 G A C2     1  
ATOM 8741   N N2     . G A 1 272 ? 147.733 192.766 165.875 1.00 0.00 ? 261 G A N2     1  
ATOM 8742   N N3     . G A 1 272 ? 145.615 193.025 166.746 1.00 0.00 ? 261 G A N3     1  
ATOM 8743   C C4     . G A 1 272 ? 144.678 192.393 167.485 1.00 0.00 ? 261 G A C4     1  
ATOM 8744   H "H5'"  . G A 1 272 ? 139.185 194.553 168.838 1.00 0.00 ? 261 G A "H5'"  1  
ATOM 8745   H "H5''" . G A 1 272 ? 138.580 194.147 167.417 1.00 0.00 ? 261 G A "H5''" 1  
ATOM 8746   H "H4'"  . G A 1 272 ? 140.410 195.567 167.129 1.00 0.00 ? 261 G A "H4'"  1  
ATOM 8747   H "H3'"  . G A 1 272 ? 140.926 192.948 166.178 1.00 0.00 ? 261 G A "H3'"  1  
ATOM 8748   H "H2'"  . G A 1 272 ? 142.993 193.622 165.441 1.00 0.00 ? 261 G A "H2'"  1  
ATOM 8749   H "HO2'" . G A 1 272 ? 141.871 195.887 165.030 1.00 0.00 ? 261 G A "HO2'" 1  
ATOM 8750   H "H1'"  . G A 1 272 ? 143.571 194.908 167.632 1.00 0.00 ? 261 G A "H1'"  1  
ATOM 8751   H H8     . G A 1 272 ? 141.927 192.023 168.950 1.00 0.00 ? 261 G A H8     1  
ATOM 8752   H H1     . G A 1 272 ? 147.702 190.563 166.940 1.00 0.00 ? 261 G A H1     1  
ATOM 8753   H H21    . G A 1 272 ? 148.541 192.226 165.753 1.00 0.00 ? 261 G A H21    1  
ATOM 8754   H H22    . G A 1 272 ? 147.678 193.660 165.475 1.00 0.00 ? 261 G A H22    1  
ATOM 8755   P P      . C A 1 273 ? 140.064 193.291 163.696 1.00 0.00 ? 262 C A P      1  
ATOM 8756   O OP1    . C A 1 273 ? 139.053 193.874 162.776 1.00 0.00 ? 262 C A OP1    1  
ATOM 8757   O OP2    . C A 1 273 ? 139.845 191.937 164.259 1.00 0.00 ? 262 C A OP2    1  
ATOM 8758   O "O5'"  . C A 1 273 ? 141.469 193.291 162.945 1.00 0.00 ? 262 C A "O5'"  1  
ATOM 8759   C "C5'"  . C A 1 273 ? 141.932 194.449 162.265 1.00 0.00 ? 262 C A "C5'"  1  
ATOM 8760   C "C4'"  . C A 1 273 ? 143.338 194.266 161.750 1.00 0.00 ? 262 C A "C4'"  1  
ATOM 8761   O "O4'"  . C A 1 273 ? 144.242 194.022 162.859 1.00 0.00 ? 262 C A "O4'"  1  
ATOM 8762   C "C3'"  . C A 1 273 ? 143.565 193.084 160.821 1.00 0.00 ? 262 C A "C3'"  1  
ATOM 8763   O "O3'"  . C A 1 273 ? 143.197 193.356 159.477 1.00 0.00 ? 262 C A "O3'"  1  
ATOM 8764   C "C2'"  . C A 1 273 ? 145.047 192.798 161.002 1.00 0.00 ? 262 C A "C2'"  1  
ATOM 8765   O "O2'"  . C A 1 273 ? 145.845 193.717 160.272 1.00 0.00 ? 262 C A "O2'"  1  
ATOM 8766   C "C1'"  . C A 1 273 ? 145.229 193.061 162.499 1.00 0.00 ? 262 C A "C1'"  1  
ATOM 8767   N N1     . C A 1 273 ? 145.067 191.830 163.312 1.00 0.00 ? 262 C A N1     1  
ATOM 8768   C C2     . C A 1 273 ? 146.133 190.924 163.367 1.00 0.00 ? 262 C A C2     1  
ATOM 8769   O O2     . C A 1 273 ? 147.173 191.174 162.737 1.00 0.00 ? 262 C A O2     1  
ATOM 8770   N N3     . C A 1 273 ? 146.012 189.795 164.102 1.00 0.00 ? 262 C A N3     1  
ATOM 8771   C C4     . C A 1 273 ? 144.883 189.550 164.766 1.00 0.00 ? 262 C A C4     1  
ATOM 8772   N N4     . C A 1 273 ? 144.808 188.422 165.478 1.00 0.00 ? 262 C A N4     1  
ATOM 8773   C C5     . C A 1 273 ? 143.780 190.448 164.731 1.00 0.00 ? 262 C A C5     1  
ATOM 8774   C C6     . C A 1 273 ? 143.912 191.564 164.002 1.00 0.00 ? 262 C A C6     1  
ATOM 8775   H "H5'"  . C A 1 273 ? 141.913 195.211 162.881 1.00 0.00 ? 262 C A "H5'"  1  
ATOM 8776   H "H5''" . C A 1 273 ? 141.337 194.634 161.509 1.00 0.00 ? 262 C A "H5''" 1  
ATOM 8777   H "H4'"  . C A 1 273 ? 143.612 195.088 161.292 1.00 0.00 ? 262 C A "H4'"  1  
ATOM 8778   H "H3'"  . C A 1 273 ? 143.048 192.317 161.145 1.00 0.00 ? 262 C A "H3'"  1  
ATOM 8779   H "H2'"  . C A 1 273 ? 145.265 191.869 160.775 1.00 0.00 ? 262 C A "H2'"  1  
ATOM 8780   H "HO2'" . C A 1 273 ? 145.300 194.127 159.570 1.00 0.00 ? 262 C A "HO2'" 1  
ATOM 8781   H "H1'"  . C A 1 273 ? 146.118 193.439 162.658 1.00 0.00 ? 262 C A "H1'"  1  
ATOM 8782   H H41    . C A 1 273 ? 145.570 187.804 165.499 1.00 0.00 ? 262 C A H41    1  
ATOM 8783   H H42    . C A 1 273 ? 143.992 188.211 165.978 1.00 0.00 ? 262 C A H42    1  
ATOM 8784   H H5     . C A 1 273 ? 142.955 190.259 165.223 1.00 0.00 ? 262 C A H5     1  
ATOM 8785   H H6     . C A 1 273 ? 143.165 192.195 163.964 1.00 0.00 ? 262 C A H6     1  
ATOM 8786   P P      . C A 1 274 ? 142.660 192.175 158.532 1.00 0.00 ? 263 C A P      1  
ATOM 8787   O OP1    . C A 1 274 ? 142.134 192.789 157.285 1.00 0.00 ? 263 C A OP1    1  
ATOM 8788   O OP2    . C A 1 274 ? 141.780 191.298 159.345 1.00 0.00 ? 263 C A OP2    1  
ATOM 8789   O "O5'"  . C A 1 274 ? 143.971 191.350 158.159 1.00 0.00 ? 263 C A "O5'"  1  
ATOM 8790   C "C5'"  . C A 1 274 ? 144.981 191.917 157.340 1.00 0.00 ? 263 C A "C5'"  1  
ATOM 8791   C "C4'"  . C A 1 274 ? 146.189 191.019 157.240 1.00 0.00 ? 263 C A "C4'"  1  
ATOM 8792   O "O4'"  . C A 1 274 ? 146.769 190.824 158.555 1.00 0.00 ? 263 C A "O4'"  1  
ATOM 8793   C "C3'"  . C A 1 274 ? 145.931 189.605 156.737 1.00 0.00 ? 263 C A "C3'"  1  
ATOM 8794   O "O3'"  . C A 1 274 ? 145.847 189.527 155.323 1.00 0.00 ? 263 C A "O3'"  1  
ATOM 8795   C "C2'"  . C A 1 274 ? 147.098 188.826 157.324 1.00 0.00 ? 263 C A "C2'"  1  
ATOM 8796   O "O2'"  . C A 1 274 ? 148.287 189.038 156.577 1.00 0.00 ? 263 C A "O2'"  1  
ATOM 8797   C "C1'"  . C A 1 274 ? 147.249 189.488 158.695 1.00 0.00 ? 263 C A "C1'"  1  
ATOM 8798   N N1     . C A 1 274 ? 146.489 188.776 159.751 1.00 0.00 ? 263 C A N1     1  
ATOM 8799   C C2     . C A 1 274 ? 147.027 187.597 160.280 1.00 0.00 ? 263 C A C2     1  
ATOM 8800   O O2     . C A 1 274 ? 148.118 187.186 159.851 1.00 0.00 ? 263 C A O2     1  
ATOM 8801   N N3     . C A 1 274 ? 146.353 186.928 161.243 1.00 0.00 ? 263 C A N3     1  
ATOM 8802   C C4     . C A 1 274 ? 145.186 187.391 161.685 1.00 0.00 ? 263 C A C4     1  
ATOM 8803   N N4     . C A 1 274 ? 144.556 186.699 162.637 1.00 0.00 ? 263 C A N4     1  
ATOM 8804   C C5     . C A 1 274 ? 144.611 188.586 161.169 1.00 0.00 ? 263 C A C5     1  
ATOM 8805   C C6     . C A 1 274 ? 145.286 189.239 160.215 1.00 0.00 ? 263 C A C6     1  
ATOM 8806   H "H5'"  . C A 1 274 ? 145.254 192.778 157.721 1.00 0.00 ? 263 C A "H5'"  1  
ATOM 8807   H "H5''" . C A 1 274 ? 144.619 192.067 156.442 1.00 0.00 ? 263 C A "H5''" 1  
ATOM 8808   H "H4'"  . C A 1 274 ? 146.850 191.446 156.657 1.00 0.00 ? 263 C A "H4'"  1  
ATOM 8809   H "H3'"  . C A 1 274 ? 145.097 189.273 157.127 1.00 0.00 ? 263 C A "H3'"  1  
ATOM 8810   H "H2'"  . C A 1 274 ? 146.888 187.872 157.409 1.00 0.00 ? 263 C A "H2'"  1  
ATOM 8811   H "HO2'" . C A 1 274 ? 148.051 189.368 155.686 1.00 0.00 ? 263 C A "HO2'" 1  
ATOM 8812   H "H1'"  . C A 1 274 ? 148.197 189.516 158.942 1.00 0.00 ? 263 C A "H1'"  1  
ATOM 8813   H H41    . C A 1 274 ? 144.956 185.876 162.991 1.00 0.00 ? 263 C A H41    1  
ATOM 8814   H H42    . C A 1 274 ? 143.695 187.013 162.983 1.00 0.00 ? 263 C A H42    1  
ATOM 8815   H H5     . C A 1 274 ? 143.750 188.920 161.500 1.00 0.00 ? 263 C A H5     1  
ATOM 8816   H H6     . C A 1 274 ? 144.906 190.064 159.847 1.00 0.00 ? 263 C A H6     1  
ATOM 8817   P P      . U A 1 275 ? 144.939 188.398 154.630 1.00 0.00 ? 264 U A P      1  
ATOM 8818   O OP1    . U A 1 275 ? 144.858 188.701 153.179 1.00 0.00 ? 264 U A OP1    1  
ATOM 8819   O OP2    . U A 1 275 ? 143.689 188.263 155.423 1.00 0.00 ? 264 U A OP2    1  
ATOM 8820   O "O5'"  . U A 1 275 ? 145.784 187.061 154.807 1.00 0.00 ? 264 U A "O5'"  1  
ATOM 8821   C "C5'"  . U A 1 275 ? 147.019 186.882 154.129 1.00 0.00 ? 264 U A "C5'"  1  
ATOM 8822   C "C4'"  . U A 1 275 ? 147.685 185.586 154.517 1.00 0.00 ? 264 U A "C4'"  1  
ATOM 8823   O "O4'"  . U A 1 275 ? 148.015 185.603 155.930 1.00 0.00 ? 264 U A "O4'"  1  
ATOM 8824   C "C3'"  . U A 1 275 ? 146.850 184.325 154.347 1.00 0.00 ? 264 U A "C3'"  1  
ATOM 8825   O "O3'"  . U A 1 275 ? 146.846 183.836 153.016 1.00 0.00 ? 264 U A "O3'"  1  
ATOM 8826   C "C2'"  . U A 1 275 ? 147.484 183.369 155.347 1.00 0.00 ? 264 U A "C2'"  1  
ATOM 8827   O "O2'"  . U A 1 275 ? 148.694 182.822 154.841 1.00 0.00 ? 264 U A "O2'"  1  
ATOM 8828   C "C1'"  . U A 1 275 ? 147.812 184.313 156.505 1.00 0.00 ? 264 U A "C1'"  1  
ATOM 8829   N N1     . U A 1 275 ? 146.728 184.362 157.515 1.00 0.00 ? 264 U A N1     1  
ATOM 8830   C C2     . U A 1 275 ? 146.653 183.312 158.411 1.00 0.00 ? 264 U A C2     1  
ATOM 8831   O O2     . U A 1 275 ? 147.428 182.371 158.401 1.00 0.00 ? 264 U A O2     1  
ATOM 8832   N N3     . U A 1 275 ? 145.635 183.399 159.329 1.00 0.00 ? 264 U A N3     1  
ATOM 8833   C C4     . U A 1 275 ? 144.701 184.409 159.441 1.00 0.00 ? 264 U A C4     1  
ATOM 8834   O O4     . U A 1 275 ? 143.842 184.343 160.323 1.00 0.00 ? 264 U A O4     1  
ATOM 8835   C C5     . U A 1 275 ? 144.841 185.461 158.481 1.00 0.00 ? 264 U A C5     1  
ATOM 8836   C C6     . U A 1 275 ? 145.823 185.401 157.577 1.00 0.00 ? 264 U A C6     1  
ATOM 8837   H "H5'"  . U A 1 275 ? 147.614 187.627 154.351 1.00 0.00 ? 264 U A "H5'"  1  
ATOM 8838   H "H5''" . U A 1 275 ? 146.854 186.880 153.161 1.00 0.00 ? 264 U A "H5''" 1  
ATOM 8839   H "H4'"  . U A 1 275 ? 148.510 185.490 153.996 1.00 0.00 ? 264 U A "H4'"  1  
ATOM 8840   H "H3'"  . U A 1 275 ? 145.926 184.511 154.623 1.00 0.00 ? 264 U A "H3'"  1  
ATOM 8841   H "H2'"  . U A 1 275 ? 146.858 182.667 155.623 1.00 0.00 ? 264 U A "H2'"  1  
ATOM 8842   H "HO2'" . U A 1 275 ? 148.701 182.914 153.863 1.00 0.00 ? 264 U A "HO2'" 1  
ATOM 8843   H "H1'"  . U A 1 275 ? 148.644 184.023 156.937 1.00 0.00 ? 264 U A "H1'"  1  
ATOM 8844   H H3     . U A 1 275 ? 145.563 182.665 159.973 1.00 0.00 ? 264 U A H3     1  
ATOM 8845   H H5     . U A 1 275 ? 144.220 186.220 158.487 1.00 0.00 ? 264 U A H5     1  
ATOM 8846   H H6     . U A 1 275 ? 145.898 186.133 156.931 1.00 0.00 ? 264 U A H6     1  
ATOM 8847   P P      . C A 1 276 ? 145.579 183.025 152.455 1.00 0.00 ? 265 C A P      1  
ATOM 8848   O OP1    . C A 1 276 ? 145.770 182.827 150.996 1.00 0.00 ? 265 C A OP1    1  
ATOM 8849   O OP2    . C A 1 276 ? 144.347 183.693 152.949 1.00 0.00 ? 265 C A OP2    1  
ATOM 8850   O "O5'"  . C A 1 276 ? 145.685 181.602 153.163 1.00 0.00 ? 265 C A "O5'"  1  
ATOM 8851   C "C5'"  . C A 1 276 ? 146.750 180.713 152.859 1.00 0.00 ? 265 C A "C5'"  1  
ATOM 8852   C "C4'"  . C A 1 276 ? 146.729 179.493 153.746 1.00 0.00 ? 265 C A "C4'"  1  
ATOM 8853   O "O4'"  . C A 1 276 ? 146.901 179.888 155.133 1.00 0.00 ? 265 C A "O4'"  1  
ATOM 8854   C "C3'"  . C A 1 276 ? 145.438 178.690 153.748 1.00 0.00 ? 265 C A "C3'"  1  
ATOM 8855   O "O3'"  . C A 1 276 ? 145.333 177.804 152.648 1.00 0.00 ? 265 C A "O3'"  1  
ATOM 8856   C "C2'"  . C A 1 276 ? 145.490 177.982 155.096 1.00 0.00 ? 265 C A "C2'"  1  
ATOM 8857   O "O2'"  . C A 1 276 ? 146.362 176.863 155.058 1.00 0.00 ? 265 C A "O2'"  1  
ATOM 8858   C "C1'"  . C A 1 276 ? 146.108 179.064 155.984 1.00 0.00 ? 265 C A "C1'"  1  
ATOM 8859   N N1     . C A 1 276 ? 145.081 179.876 156.682 1.00 0.00 ? 265 C A N1     1  
ATOM 8860   C C2     . C A 1 276 ? 144.460 179.333 157.813 1.00 0.00 ? 265 C A C2     1  
ATOM 8861   O O2     . C A 1 276 ? 144.783 178.198 158.197 1.00 0.00 ? 265 C A O2     1  
ATOM 8862   N N3     . C A 1 276 ? 143.520 180.053 158.468 1.00 0.00 ? 265 C A N3     1  
ATOM 8863   C C4     . C A 1 276 ? 143.190 181.270 158.037 1.00 0.00 ? 265 C A C4     1  
ATOM 8864   N N4     . C A 1 276 ? 142.258 181.944 158.714 1.00 0.00 ? 265 C A N4     1  
ATOM 8865   C C5     . C A 1 276 ? 143.803 181.850 156.890 1.00 0.00 ? 265 C A C5     1  
ATOM 8866   C C6     . C A 1 276 ? 144.731 181.129 156.250 1.00 0.00 ? 265 C A C6     1  
ATOM 8867   H "H5'"  . C A 1 276 ? 147.603 181.184 152.981 1.00 0.00 ? 265 C A "H5'"  1  
ATOM 8868   H "H5''" . C A 1 276 ? 146.672 180.430 151.924 1.00 0.00 ? 265 C A "H5''" 1  
ATOM 8869   H "H4'"  . C A 1 276 ? 147.469 178.904 153.488 1.00 0.00 ? 265 C A "H4'"  1  
ATOM 8870   H "H3'"  . C A 1 276 ? 144.675 179.305 153.739 1.00 0.00 ? 265 C A "H3'"  1  
ATOM 8871   H "H2'"  . C A 1 276 ? 144.592 177.734 155.407 1.00 0.00 ? 265 C A "H2'"  1  
ATOM 8872   H "HO2'" . C A 1 276 ? 146.493 176.592 154.125 1.00 0.00 ? 265 C A "HO2'" 1  
ATOM 8873   H "H1'"  . C A 1 276 ? 146.695 178.644 156.647 1.00 0.00 ? 265 C A "H1'"  1  
ATOM 8874   H H41    . C A 1 276 ? 141.838 181.541 159.504 1.00 0.00 ? 265 C A H41    1  
ATOM 8875   H H42    . C A 1 276 ? 141.994 182.841 158.421 1.00 0.00 ? 265 C A H42    1  
ATOM 8876   H H5     . C A 1 276 ? 143.553 182.747 156.580 1.00 0.00 ? 265 C A H5     1  
ATOM 8877   H H6     . C A 1 276 ? 145.164 181.510 155.460 1.00 0.00 ? 265 C A H6     1  
ATOM 8878   P P      . U A 1 277 ? 143.899 177.484 152.001 1.00 0.00 ? 266 U A P      1  
ATOM 8879   O OP1    . U A 1 277 ? 144.114 176.642 150.796 1.00 0.00 ? 266 U A OP1    1  
ATOM 8880   O OP2    . U A 1 277 ? 143.154 178.762 151.878 1.00 0.00 ? 266 U A OP2    1  
ATOM 8881   O "O5'"  . U A 1 277 ? 143.171 176.592 153.102 1.00 0.00 ? 266 U A "O5'"  1  
ATOM 8882   C "C5'"  . U A 1 277 ? 143.677 175.316 153.456 1.00 0.00 ? 266 U A "C5'"  1  
ATOM 8883   C "C4'"  . U A 1 277 ? 143.032 174.791 154.716 1.00 0.00 ? 266 U A "C4'"  1  
ATOM 8884   O "O4'"  . U A 1 277 ? 143.281 175.704 155.816 1.00 0.00 ? 266 U A "O4'"  1  
ATOM 8885   C "C3'"  . U A 1 277 ? 141.517 174.652 154.685 1.00 0.00 ? 266 U A "C3'"  1  
ATOM 8886   O "O3'"  . U A 1 277 ? 141.084 173.453 154.068 1.00 0.00 ? 266 U A "O3'"  1  
ATOM 8887   C "C2'"  . U A 1 277 ? 141.146 174.750 156.157 1.00 0.00 ? 266 U A "C2'"  1  
ATOM 8888   O "O2'"  . U A 1 277 ? 141.389 173.526 156.835 1.00 0.00 ? 266 U A "O2'"  1  
ATOM 8889   C "C1'"  . U A 1 277 ? 142.141 175.799 156.655 1.00 0.00 ? 266 U A "C1'"  1  
ATOM 8890   N N1     . U A 1 277 ? 141.580 177.172 156.619 1.00 0.00 ? 266 U A N1     1  
ATOM 8891   C C2     . U A 1 277 ? 140.696 177.517 157.625 1.00 0.00 ? 266 U A C2     1  
ATOM 8892   O O2     . U A 1 277 ? 140.369 176.752 158.517 1.00 0.00 ? 266 U A O2     1  
ATOM 8893   N N3     . U A 1 277 ? 140.201 178.795 157.552 1.00 0.00 ? 266 U A N3     1  
ATOM 8894   C C4     . U A 1 277 ? 140.491 179.747 156.598 1.00 0.00 ? 266 U A C4     1  
ATOM 8895   O O4     . U A 1 277 ? 139.962 180.857 156.670 1.00 0.00 ? 266 U A O4     1  
ATOM 8896   C C5     . U A 1 277 ? 141.414 179.318 155.590 1.00 0.00 ? 266 U A C5     1  
ATOM 8897   C C6     . U A 1 277 ? 141.911 178.080 155.636 1.00 0.00 ? 266 U A C6     1  
ATOM 8898   H "H5'"  . U A 1 277 ? 144.645 175.384 153.600 1.00 0.00 ? 266 U A "H5'"  1  
ATOM 8899   H "H5''" . U A 1 277 ? 143.506 174.687 152.726 1.00 0.00 ? 266 U A "H5''" 1  
ATOM 8900   H "H4'"  . U A 1 277 ? 143.426 173.919 154.930 1.00 0.00 ? 266 U A "H4'"  1  
ATOM 8901   H "H3'"  . U A 1 277 ? 141.134 175.416 154.206 1.00 0.00 ? 266 U A "H3'"  1  
ATOM 8902   H "H2'"  . U A 1 277 ? 140.219 175.052 156.276 1.00 0.00 ? 266 U A "H2'"  1  
ATOM 8903   H "HO2'" . U A 1 277 ? 141.436 172.801 156.177 1.00 0.00 ? 266 U A "HO2'" 1  
ATOM 8904   H "H1'"  . U A 1 277 ? 142.410 175.584 157.573 1.00 0.00 ? 266 U A "H1'"  1  
ATOM 8905   H H3     . U A 1 277 ? 139.572 179.061 158.256 1.00 0.00 ? 266 U A H3     1  
ATOM 8906   H H5     . U A 1 277 ? 141.678 179.932 154.870 1.00 0.00 ? 266 U A H5     1  
ATOM 8907   H H6     . U A 1 277 ? 142.538 177.811 154.935 1.00 0.00 ? 266 U A H6     1  
ATOM 8908   P P      . G A 1 278 ? 140.740 173.428 152.499 1.00 0.00 ? 267 G A P      1  
ATOM 8909   O OP1    . G A 1 278 ? 141.380 174.611 151.868 1.00 0.00 ? 267 G A OP1    1  
ATOM 8910   O OP2    . G A 1 278 ? 139.277 173.219 152.352 1.00 0.00 ? 267 G A OP2    1  
ATOM 8911   O "O5'"  . G A 1 278 ? 141.481 172.123 151.962 1.00 0.00 ? 267 G A "O5'"  1  
ATOM 8912   C "C5'"  . G A 1 278 ? 142.890 171.986 152.074 1.00 0.00 ? 267 G A "C5'"  1  
ATOM 8913   C "C4'"  . G A 1 278 ? 143.274 170.623 152.593 1.00 0.00 ? 267 G A "C4'"  1  
ATOM 8914   O "O4'"  . G A 1 278 ? 142.858 170.399 153.967 1.00 0.00 ? 267 G A "O4'"  1  
ATOM 8915   C "C3'"  . G A 1 278 ? 142.634 169.436 151.890 1.00 0.00 ? 267 G A "C3'"  1  
ATOM 8916   O "O3'"  . G A 1 278 ? 143.245 169.135 150.646 1.00 0.00 ? 267 G A "O3'"  1  
ATOM 8917   C "C2'"  . G A 1 278 ? 142.963 168.322 152.884 1.00 0.00 ? 267 G A "C2'"  1  
ATOM 8918   O "O2'"  . G A 1 278 ? 144.318 167.911 152.768 1.00 0.00 ? 267 G A "O2'"  1  
ATOM 8919   C "C1'"  . G A 1 278 ? 142.783 169.017 154.217 1.00 0.00 ? 267 G A "C1'"  1  
ATOM 8920   N N9     . G A 1 278 ? 141.464 168.737 154.816 1.00 0.00 ? 267 G A N9     1  
ATOM 8921   C C8     . G A 1 278 ? 140.365 169.561 154.827 1.00 0.00 ? 267 G A C8     1  
ATOM 8922   N N7     . G A 1 278 ? 139.336 169.036 155.437 1.00 0.00 ? 267 G A N7     1  
ATOM 8923   C C5     . G A 1 278 ? 139.783 167.790 155.852 1.00 0.00 ? 267 G A C5     1  
ATOM 8924   C C6     . G A 1 278 ? 139.111 166.763 156.565 1.00 0.00 ? 267 G A C6     1  
ATOM 8925   O O6     . G A 1 278 ? 137.949 166.750 156.985 1.00 0.00 ? 267 G A O6     1  
ATOM 8926   N N1     . G A 1 278 ? 139.937 165.663 156.779 1.00 0.00 ? 267 G A N1     1  
ATOM 8927   C C2     . G A 1 278 ? 141.241 165.563 156.360 1.00 0.00 ? 267 G A C2     1  
ATOM 8928   N N2     . G A 1 278 ? 141.877 164.421 156.661 1.00 0.00 ? 267 G A N2     1  
ATOM 8929   N N3     . G A 1 278 ? 141.879 166.513 155.695 1.00 0.00 ? 267 G A N3     1  
ATOM 8930   C C4     . G A 1 278 ? 141.095 167.589 155.477 1.00 0.00 ? 267 G A C4     1  
ATOM 8931   H "H5'"  . G A 1 278 ? 143.230 172.670 152.688 1.00 0.00 ? 267 G A "H5'"  1  
ATOM 8932   H "H5''" . G A 1 278 ? 143.295 172.119 151.192 1.00 0.00 ? 267 G A "H5''" 1  
ATOM 8933   H "H4'"  . G A 1 278 ? 144.251 170.538 152.568 1.00 0.00 ? 267 G A "H4'"  1  
ATOM 8934   H "H3'"  . G A 1 278 ? 141.666 169.573 151.845 1.00 0.00 ? 267 G A "H3'"  1  
ATOM 8935   H "H2'"  . G A 1 278 ? 142.346 167.566 152.795 1.00 0.00 ? 267 G A "H2'"  1  
ATOM 8936   H "HO2'" . G A 1 278 ? 144.632 168.100 151.859 1.00 0.00 ? 267 G A "HO2'" 1  
ATOM 8937   H "H1'"  . G A 1 278 ? 143.489 168.729 154.833 1.00 0.00 ? 267 G A "H1'"  1  
ATOM 8938   H H8     . G A 1 278 ? 140.352 170.452 154.420 1.00 0.00 ? 267 G A H8     1  
ATOM 8939   H H1     . G A 1 278 ? 139.556 164.902 157.265 1.00 0.00 ? 267 G A H1     1  
ATOM 8940   H H21    . G A 1 278 ? 141.412 163.713 157.153 1.00 0.00 ? 267 G A H21    1  
ATOM 8941   H H22    . G A 1 278 ? 142.810 164.293 156.388 1.00 0.00 ? 267 G A H22    1  
ATOM 8942   P P      . A A 1 279 ? 142.506 168.168 149.597 1.00 0.00 ? 268 A A P      1  
ATOM 8943   O OP1    . A A 1 279 ? 142.664 168.752 148.242 1.00 0.00 ? 268 A A OP1    1  
ATOM 8944   O OP2    . A A 1 279 ? 141.146 167.878 150.117 1.00 0.00 ? 268 A A OP2    1  
ATOM 8945   O "O5'"  . A A 1 279 ? 143.352 166.819 149.654 1.00 0.00 ? 268 A A "O5'"  1  
ATOM 8946   C "C5'"  . A A 1 279 ? 142.863 165.626 149.059 1.00 0.00 ? 268 A A "C5'"  1  
ATOM 8947   C "C4'"  . A A 1 279 ? 143.065 164.434 149.960 1.00 0.00 ? 268 A A "C4'"  1  
ATOM 8948   O "O4'"  . A A 1 279 ? 142.839 164.786 151.348 1.00 0.00 ? 268 A A "O4'"  1  
ATOM 8949   C "C3'"  . A A 1 279 ? 142.094 163.279 149.768 1.00 0.00 ? 268 A A "C3'"  1  
ATOM 8950   O "O3'"  . A A 1 279 ? 142.360 162.520 148.601 1.00 0.00 ? 268 A A "O3'"  1  
ATOM 8951   C "C2'"  . A A 1 279 ? 142.341 162.503 151.054 1.00 0.00 ? 268 A A "C2'"  1  
ATOM 8952   O "O2'"  . A A 1 279 ? 143.545 161.753 150.980 1.00 0.00 ? 268 A A "O2'"  1  
ATOM 8953   C "C1'"  . A A 1 279 ? 142.526 163.628 152.076 1.00 0.00 ? 268 A A "C1'"  1  
ATOM 8954   N N9     . A A 1 279 ? 141.295 163.885 152.848 1.00 0.00 ? 268 A A N9     1  
ATOM 8955   C C8     . A A 1 279 ? 140.442 164.957 152.744 1.00 0.00 ? 268 A A C8     1  
ATOM 8956   N N7     . A A 1 279 ? 139.426 164.905 153.570 1.00 0.00 ? 268 A A N7     1  
ATOM 8957   C C5     . A A 1 279 ? 139.622 163.720 154.266 1.00 0.00 ? 268 A A C5     1  
ATOM 8958   C C6     . A A 1 279 ? 138.890 163.090 155.287 1.00 0.00 ? 268 A A C6     1  
ATOM 8959   N N6     . A A 1 279 ? 137.765 163.586 155.806 1.00 0.00 ? 268 A A N6     1  
ATOM 8960   N N1     . A A 1 279 ? 139.359 161.916 155.763 1.00 0.00 ? 268 A A N1     1  
ATOM 8961   C C2     . A A 1 279 ? 140.488 161.417 155.243 1.00 0.00 ? 268 A A C2     1  
ATOM 8962   N N3     . A A 1 279 ? 141.263 161.916 154.283 1.00 0.00 ? 268 A A N3     1  
ATOM 8963   C C4     . A A 1 279 ? 140.769 163.082 153.831 1.00 0.00 ? 268 A A C4     1  
ATOM 8964   H "H5'"  . A A 1 279 ? 143.337 165.472 148.215 1.00 0.00 ? 268 A A "H5'"  1  
ATOM 8965   H "H5''" . A A 1 279 ? 141.907 165.728 148.874 1.00 0.00 ? 268 A A "H5''" 1  
ATOM 8966   H "H4'"  . A A 1 279 ? 143.990 164.120 149.869 1.00 0.00 ? 268 A A "H4'"  1  
ATOM 8967   H "H3'"  . A A 1 279 ? 141.178 163.628 149.755 1.00 0.00 ? 268 A A "H3'"  1  
ATOM 8968   H "H2'"  . A A 1 279 ? 141.574 161.937 151.285 1.00 0.00 ? 268 A A "H2'"  1  
ATOM 8969   H "HO2'" . A A 1 279 ? 143.702 161.493 150.049 1.00 0.00 ? 268 A A "HO2'" 1  
ATOM 8970   H "H1'"  . A A 1 279 ? 143.254 163.394 152.690 1.00 0.00 ? 268 A A "H1'"  1  
ATOM 8971   H H8     . A A 1 279 ? 140.580 165.692 152.110 1.00 0.00 ? 268 A A H8     1  
ATOM 8972   H H61    . A A 1 279 ? 137.298 163.100 156.518 1.00 0.00 ? 268 A A H61    1  
ATOM 8973   H H62    . A A 1 279 ? 137.406 164.436 155.477 1.00 0.00 ? 268 A A H62    1  
ATOM 8974   H H2     . A A 1 279 ? 140.785 160.564 155.623 1.00 0.00 ? 268 A A H2     1  
ATOM 8975   P P      . U A 1 280 ? 141.154 161.820 147.801 1.00 0.00 ? 269 U A P      1  
ATOM 8976   O OP1    . U A 1 280 ? 141.720 161.173 146.590 1.00 0.00 ? 269 U A OP1    1  
ATOM 8977   O OP2    . U A 1 280 ? 140.060 162.812 147.660 1.00 0.00 ? 269 U A OP2    1  
ATOM 8978   O "O5'"  . U A 1 280 ? 140.655 160.671 148.785 1.00 0.00 ? 269 U A "O5'"  1  
ATOM 8979   C "C5'"  . U A 1 280 ? 141.534 159.640 149.209 1.00 0.00 ? 269 U A "C5'"  1  
ATOM 8980   C "C4'"  . U A 1 280 ? 140.911 158.783 150.283 1.00 0.00 ? 269 U A "C4'"  1  
ATOM 8981   O "O4'"  . U A 1 280 ? 140.393 159.672 151.324 1.00 0.00 ? 269 U A "O4'"  1  
ATOM 8982   C "C3'"  . U A 1 280 ? 139.766 157.884 149.844 1.00 0.00 ? 269 U A "C3'"  1  
ATOM 8983   O "O3'"  . U A 1 280 ? 139.839 156.583 150.398 1.00 0.00 ? 269 U A "O3'"  1  
ATOM 8984   C "C2'"  . U A 1 280 ? 138.522 158.594 150.380 1.00 0.00 ? 269 U A "C2'"  1  
ATOM 8985   O "O2'"  . U A 1 280 ? 137.522 157.661 150.763 1.00 0.00 ? 269 U A "O2'"  1  
ATOM 8986   C "C1'"  . U A 1 280 ? 139.060 159.282 151.642 1.00 0.00 ? 269 U A "C1'"  1  
ATOM 8987   N N1     . U A 1 280 ? 138.277 160.489 152.002 1.00 0.00 ? 269 U A N1     1  
ATOM 8988   C C2     . U A 1 280 ? 137.468 160.405 153.120 1.00 0.00 ? 269 U A C2     1  
ATOM 8989   O O2     . U A 1 280 ? 137.379 159.400 153.804 1.00 0.00 ? 269 U A O2     1  
ATOM 8990   N N3     . U A 1 280 ? 136.763 161.546 153.416 1.00 0.00 ? 269 U A N3     1  
ATOM 8991   C C4     . U A 1 280 ? 136.780 162.737 152.723 1.00 0.00 ? 269 U A C4     1  
ATOM 8992   O O4     . U A 1 280 ? 136.085 163.676 153.116 1.00 0.00 ? 269 U A O4     1  
ATOM 8993   C C5     . U A 1 280 ? 137.639 162.751 151.578 1.00 0.00 ? 269 U A C5     1  
ATOM 8994   C C6     . U A 1 280 ? 138.338 161.654 151.268 1.00 0.00 ? 269 U A C6     1  
ATOM 8995   H "H5'"  . U A 1 280 ? 142.355 160.044 149.559 1.00 0.00 ? 269 U A "H5'"  1  
ATOM 8996   H "H5''" . U A 1 280 ? 141.758 159.075 148.440 1.00 0.00 ? 269 U A "H5''" 1  
ATOM 8997   H "H4'"  . U A 1 280 ? 141.600 158.198 150.660 1.00 0.00 ? 269 U A "H4'"  1  
ATOM 8998   H "H3'"  . U A 1 280 ? 139.720 157.874 148.865 1.00 0.00 ? 269 U A "H3'"  1  
ATOM 8999   H "H2'"  . U A 1 280 ? 138.179 159.251 149.739 1.00 0.00 ? 269 U A "H2'"  1  
ATOM 9000   H "HO2'" . U A 1 280 ? 136.742 158.150 151.101 1.00 0.00 ? 269 U A "HO2'" 1  
ATOM 9001   H "H1'"  . U A 1 280 ? 139.040 158.647 152.389 1.00 0.00 ? 269 U A "H1'"  1  
ATOM 9002   H H3     . U A 1 280 ? 136.183 161.508 154.204 1.00 0.00 ? 269 U A H3     1  
ATOM 9003   H H5     . U A 1 280 ? 137.714 163.558 151.026 1.00 0.00 ? 269 U A H5     1  
ATOM 9004   H H6     . U A 1 280 ? 138.918 161.688 150.480 1.00 0.00 ? 269 U A H6     1  
ATOM 9005   P P      . A A 1 281 ? 140.812 155.480 149.750 1.00 0.00 ? 270 A A P      1  
ATOM 9006   O OP1    . A A 1 281 ? 142.051 156.165 149.303 1.00 0.00 ? 270 A A OP1    1  
ATOM 9007   O OP2    . A A 1 281 ? 140.022 154.684 148.778 1.00 0.00 ? 270 A A OP2    1  
ATOM 9008   O "O5'"  . A A 1 281 ? 141.187 154.531 150.973 1.00 0.00 ? 270 A A "O5'"  1  
ATOM 9009   C "C5'"  . A A 1 281 ? 142.416 154.687 151.667 1.00 0.00 ? 270 A A "C5'"  1  
ATOM 9010   C "C4'"  . A A 1 281 ? 143.192 153.394 151.718 1.00 0.00 ? 270 A A "C4'"  1  
ATOM 9011   O "O4'"  . A A 1 281 ? 142.474 152.368 152.455 1.00 0.00 ? 270 A A "O4'"  1  
ATOM 9012   C "C3'"  . A A 1 281 ? 143.482 152.737 150.377 1.00 0.00 ? 270 A A "C3'"  1  
ATOM 9013   O "O3'"  . A A 1 281 ? 144.555 153.347 149.681 1.00 0.00 ? 270 A A "O3'"  1  
ATOM 9014   C "C2'"  . A A 1 281 ? 143.746 151.298 150.793 1.00 0.00 ? 270 A A "C2'"  1  
ATOM 9015   O "O2'"  . A A 1 281 ? 145.035 151.157 151.371 1.00 0.00 ? 270 A A "O2'"  1  
ATOM 9016   C "C1'"  . A A 1 281 ? 142.683 151.115 151.878 1.00 0.00 ? 270 A A "C1'"  1  
ATOM 9017   N N9     . A A 1 281 ? 141.396 150.654 151.324 1.00 0.00 ? 270 A A N9     1  
ATOM 9018   C C8     . A A 1 281 ? 140.239 151.376 151.162 1.00 0.00 ? 270 A A C8     1  
ATOM 9019   N N7     . A A 1 281 ? 139.255 150.688 150.639 1.00 0.00 ? 270 A A N7     1  
ATOM 9020   C C5     . A A 1 281 ? 139.799 149.426 150.442 1.00 0.00 ? 270 A A C5     1  
ATOM 9021   C C6     . A A 1 281 ? 139.265 148.236 149.917 1.00 0.00 ? 270 A A C6     1  
ATOM 9022   N N6     . A A 1 281 ? 138.011 148.119 149.475 1.00 0.00 ? 270 A A N6     1  
ATOM 9023   N N1     . A A 1 281 ? 140.074 147.156 149.860 1.00 0.00 ? 270 A A N1     1  
ATOM 9024   C C2     . A A 1 281 ? 141.332 147.272 150.303 1.00 0.00 ? 270 A A C2     1  
ATOM 9025   N N3     . A A 1 281 ? 141.948 148.335 150.817 1.00 0.00 ? 270 A A N3     1  
ATOM 9026   C C4     . A A 1 281 ? 141.116 149.391 150.859 1.00 0.00 ? 270 A A C4     1  
ATOM 9027   H "H5'"  . A A 1 281 ? 142.232 154.985 152.582 1.00 0.00 ? 270 A A "H5'"  1  
ATOM 9028   H "H5''" . A A 1 281 ? 142.956 155.366 151.213 1.00 0.00 ? 270 A A "H5''" 1  
ATOM 9029   H "H4'"  . A A 1 281 ? 144.045 153.554 152.173 1.00 0.00 ? 270 A A "H4'"  1  
ATOM 9030   H "H3'"  . A A 1 281 ? 142.676 152.774 149.819 1.00 0.00 ? 270 A A "H3'"  1  
ATOM 9031   H "H2'"  . A A 1 281 ? 143.612 150.678 150.045 1.00 0.00 ? 270 A A "H2'"  1  
ATOM 9032   H "HO2'" . A A 1 281 ? 145.233 150.203 151.477 1.00 0.00 ? 270 A A "HO2'" 1  
ATOM 9033   H "H1'"  . A A 1 281 ? 143.003 150.468 152.542 1.00 0.00 ? 270 A A "H1'"  1  
ATOM 9034   H H8     . A A 1 281 ? 140.157 152.320 151.415 1.00 0.00 ? 270 A A H8     1  
ATOM 9035   H H61    . A A 1 281 ? 137.694 147.262 149.120 1.00 0.00 ? 270 A A H61    1  
ATOM 9036   H H62    . A A 1 281 ? 137.406 148.889 149.507 1.00 0.00 ? 270 A A H62    1  
ATOM 9037   H H2     . A A 1 281 ? 141.877 146.460 150.240 1.00 0.00 ? 270 A A H2     1  
ATOM 9038   P P      . A A 1 282 ? 144.536 153.426 148.076 1.00 0.00 ? 271 A A P      1  
ATOM 9039   O OP1    . A A 1 282 ? 145.744 154.168 147.637 1.00 0.00 ? 271 A A OP1    1  
ATOM 9040   O OP2    . A A 1 282 ? 143.192 153.896 147.655 1.00 0.00 ? 271 A A OP2    1  
ATOM 9041   O "O5'"  . A A 1 282 ? 144.694 151.909 147.614 1.00 0.00 ? 271 A A "O5'"  1  
ATOM 9042   C "C5'"  . A A 1 282 ? 145.919 151.216 147.796 1.00 0.00 ? 271 A A "C5'"  1  
ATOM 9043   C "C4'"  . A A 1 282 ? 145.782 149.751 147.463 1.00 0.00 ? 271 A A "C4'"  1  
ATOM 9044   O "O4'"  . A A 1 282 ? 144.719 149.168 148.260 1.00 0.00 ? 271 A A "O4'"  1  
ATOM 9045   C "C3'"  . A A 1 282 ? 145.380 149.427 146.032 1.00 0.00 ? 271 A A "C3'"  1  
ATOM 9046   O "O3'"  . A A 1 282 ? 146.481 149.396 145.141 1.00 0.00 ? 271 A A "O3'"  1  
ATOM 9047   C "C2'"  . A A 1 282 ? 144.771 148.046 146.192 1.00 0.00 ? 271 A A "C2'"  1  
ATOM 9048   O "O2'"  . A A 1 282 ? 145.776 147.052 146.327 1.00 0.00 ? 271 A A "O2'"  1  
ATOM 9049   C "C1'"  . A A 1 282 ? 144.040 148.209 147.526 1.00 0.00 ? 271 A A "C1'"  1  
ATOM 9050   N N9     . A A 1 282 ? 142.651 148.673 147.345 1.00 0.00 ? 271 A A N9     1  
ATOM 9051   C C8     . A A 1 282 ? 142.148 149.933 147.558 1.00 0.00 ? 271 A A C8     1  
ATOM 9052   N N7     . A A 1 282 ? 140.866 150.039 147.309 1.00 0.00 ? 271 A A N7     1  
ATOM 9053   C C5     . A A 1 282 ? 140.498 148.763 146.905 1.00 0.00 ? 271 A A C5     1  
ATOM 9054   C C6     . A A 1 282 ? 139.268 148.214 146.502 1.00 0.00 ? 271 A A C6     1  
ATOM 9055   N N6     . A A 1 282 ? 138.132 148.913 146.435 1.00 0.00 ? 271 A A N6     1  
ATOM 9056   N N1     . A A 1 282 ? 139.243 146.907 146.164 1.00 0.00 ? 271 A A N1     1  
ATOM 9057   C C2     . A A 1 282 ? 140.382 146.206 146.230 1.00 0.00 ? 271 A A C2     1  
ATOM 9058   N N3     . A A 1 282 ? 141.598 146.608 146.593 1.00 0.00 ? 271 A A N3     1  
ATOM 9059   C C4     . A A 1 282 ? 141.588 147.912 146.923 1.00 0.00 ? 271 A A C4     1  
ATOM 9060   H "H5'"  . A A 1 282 ? 146.202 151.306 148.730 1.00 0.00 ? 271 A A "H5'"  1  
ATOM 9061   H "H5''" . A A 1 282 ? 146.602 151.613 147.216 1.00 0.00 ? 271 A A "H5''" 1  
ATOM 9062   H "H4'"  . A A 1 282 ? 146.625 149.298 147.674 1.00 0.00 ? 271 A A "H4'"  1  
ATOM 9063   H "H3'"  . A A 1 282 ? 144.689 150.058 145.741 1.00 0.00 ? 271 A A "H3'"  1  
ATOM 9064   H "H2'"  . A A 1 282 ? 144.151 147.840 145.461 1.00 0.00 ? 271 A A "H2'"  1  
ATOM 9065   H "HO2'" . A A 1 282 ? 146.606 147.382 145.925 1.00 0.00 ? 271 A A "HO2'" 1  
ATOM 9066   H "H1'"  . A A 1 282 ? 144.038 147.353 148.003 1.00 0.00 ? 271 A A "H1'"  1  
ATOM 9067   H H8     . A A 1 282 ? 142.697 150.684 147.867 1.00 0.00 ? 271 A A H8     1  
ATOM 9068   H H61    . A A 1 282 ? 137.304 148.475 146.146 1.00 0.00 ? 271 A A H61    1  
ATOM 9069   H H62    . A A 1 282 ? 138.126 149.863 146.676 1.00 0.00 ? 271 A A H62    1  
ATOM 9070   H H2     . A A 1 282 ? 140.311 145.262 145.974 1.00 0.00 ? 271 A A H2     1  
ATOM 9071   P P      . C A 1 283 ? 146.788 150.656 144.191 1.00 0.00 ? 272 C A P      1  
ATOM 9072   O OP1    . C A 1 283 ? 148.177 150.522 143.683 1.00 0.00 ? 272 C A OP1    1  
ATOM 9073   O OP2    . C A 1 283 ? 146.389 151.888 144.917 1.00 0.00 ? 272 C A OP2    1  
ATOM 9074   O "O5'"  . C A 1 283 ? 145.794 150.464 142.962 1.00 0.00 ? 272 C A "O5'"  1  
ATOM 9075   C "C5'"  . C A 1 283 ? 145.820 149.279 142.180 1.00 0.00 ? 272 C A "C5'"  1  
ATOM 9076   C "C4'"  . C A 1 283 ? 144.497 148.554 142.222 1.00 0.00 ? 272 C A "C4'"  1  
ATOM 9077   O "O4'"  . C A 1 283 ? 143.885 148.760 143.517 1.00 0.00 ? 272 C A "O4'"  1  
ATOM 9078   C "C3'"  . C A 1 283 ? 143.441 149.030 141.237 1.00 0.00 ? 272 C A "C3'"  1  
ATOM 9079   O "O3'"  . C A 1 283 ? 143.590 148.459 139.949 1.00 0.00 ? 272 C A "O3'"  1  
ATOM 9080   C "C2'"  . C A 1 283 ? 142.138 148.643 141.920 1.00 0.00 ? 272 C A "C2'"  1  
ATOM 9081   O "O2'"  . C A 1 283 ? 141.847 147.266 141.730 1.00 0.00 ? 272 C A "O2'"  1  
ATOM 9082   C "C1'"  . C A 1 283 ? 142.484 148.881 143.385 1.00 0.00 ? 272 C A "C1'"  1  
ATOM 9083   N N1     . C A 1 283 ? 142.061 150.225 143.852 1.00 0.00 ? 272 C A N1     1  
ATOM 9084   C C2     . C A 1 283 ? 140.705 150.437 144.130 1.00 0.00 ? 272 C A C2     1  
ATOM 9085   O O2     . C A 1 283 ? 139.902 149.503 143.979 1.00 0.00 ? 272 C A O2     1  
ATOM 9086   N N3     . C A 1 283 ? 140.294 151.653 144.558 1.00 0.00 ? 272 C A N3     1  
ATOM 9087   C C4     . C A 1 283 ? 141.176 152.640 144.712 1.00 0.00 ? 272 C A C4     1  
ATOM 9088   N N4     . C A 1 283 ? 140.724 153.823 145.136 1.00 0.00 ? 272 C A N4     1  
ATOM 9089   C C5     . C A 1 283 ? 142.560 152.457 144.437 1.00 0.00 ? 272 C A C5     1  
ATOM 9090   C C6     . C A 1 283 ? 142.956 151.250 144.016 1.00 0.00 ? 272 C A C6     1  
ATOM 9091   H "H5'"  . C A 1 283 ? 146.521 148.686 142.524 1.00 0.00 ? 272 C A "H5'"  1  
ATOM 9092   H "H5''" . C A 1 283 ? 146.026 149.514 141.252 1.00 0.00 ? 272 C A "H5''" 1  
ATOM 9093   H "H4'"  . C A 1 283 ? 144.658 147.597 142.090 1.00 0.00 ? 272 C A "H4'"  1  
ATOM 9094   H "H3'"  . C A 1 283 ? 143.483 150.006 141.165 1.00 0.00 ? 272 C A "H3'"  1  
ATOM 9095   H "H2'"  . C A 1 283 ? 141.397 149.213 141.627 1.00 0.00 ? 272 C A "H2'"  1  
ATOM 9096   H "HO2'" . C A 1 283 ? 142.199 146.757 142.490 1.00 0.00 ? 272 C A "HO2'" 1  
ATOM 9097   H "H1'"  . C A 1 283 ? 142.051 148.195 143.934 1.00 0.00 ? 272 C A "H1'"  1  
ATOM 9098   H H41    . C A 1 283 ? 139.770 153.945 145.323 1.00 0.00 ? 272 C A H41    1  
ATOM 9099   H H42    . C A 1 283 ? 141.348 154.569 145.259 1.00 0.00 ? 272 C A H42    1  
ATOM 9100   H H5     . C A 1 283 ? 143.202 153.189 144.555 1.00 0.00 ? 272 C A H5     1  
ATOM 9101   H H6     . C A 1 283 ? 143.905 151.105 143.822 1.00 0.00 ? 272 C A H6     1  
ATOM 9102   P P      . A A 1 284 ? 142.855 149.122 138.681 1.00 0.00 ? 273 A A P      1  
ATOM 9103   O OP1    . A A 1 284 ? 143.332 148.429 137.458 1.00 0.00 ? 273 A A OP1    1  
ATOM 9104   O OP2    . A A 1 284 ? 142.991 150.596 138.790 1.00 0.00 ? 273 A A OP2    1  
ATOM 9105   O "O5'"  . A A 1 284 ? 141.319 148.752 138.890 1.00 0.00 ? 273 A A "O5'"  1  
ATOM 9106   C "C5'"  . A A 1 284 ? 140.889 147.399 138.892 1.00 0.00 ? 273 A A "C5'"  1  
ATOM 9107   C "C4'"  . A A 1 284 ? 139.540 147.248 139.549 1.00 0.00 ? 273 A A "C4'"  1  
ATOM 9108   O "O4'"  . A A 1 284 ? 139.587 147.848 140.882 1.00 0.00 ? 273 A A "O4'"  1  
ATOM 9109   C "C3'"  . A A 1 284 ? 138.380 147.953 138.862 1.00 0.00 ? 273 A A "C3'"  1  
ATOM 9110   O "O3'"  . A A 1 284 ? 137.807 147.188 137.816 1.00 0.00 ? 273 A A "O3'"  1  
ATOM 9111   C "C2'"  . A A 1 284 ? 137.425 148.177 140.027 1.00 0.00 ? 273 A A "C2'"  1  
ATOM 9112   O "O2'"  . A A 1 284 ? 136.735 146.983 140.364 1.00 0.00 ? 273 A A "O2'"  1  
ATOM 9113   C "C1'"  . A A 1 284 ? 138.403 148.524 141.153 1.00 0.00 ? 273 A A "C1'"  1  
ATOM 9114   N N9     . A A 1 284 ? 138.673 149.972 141.229 1.00 0.00 ? 273 A A N9     1  
ATOM 9115   C C8     . A A 1 284 ? 139.611 150.694 140.532 1.00 0.00 ? 273 A A C8     1  
ATOM 9116   N N7     . A A 1 284 ? 139.611 151.973 140.816 1.00 0.00 ? 273 A A N7     1  
ATOM 9117   C C5     . A A 1 284 ? 138.606 152.104 141.764 1.00 0.00 ? 273 A A C5     1  
ATOM 9118   C C6     . A A 1 284 ? 138.107 153.214 142.468 1.00 0.00 ? 273 A A C6     1  
ATOM 9119   N N6     . A A 1 284 ? 138.573 154.456 142.318 1.00 0.00 ? 273 A A N6     1  
ATOM 9120   N N1     . A A 1 284 ? 137.099 153.003 143.342 1.00 0.00 ? 273 A A N1     1  
ATOM 9121   C C2     . A A 1 284 ? 136.631 151.758 143.493 1.00 0.00 ? 273 A A C2     1  
ATOM 9122   N N3     . A A 1 284 ? 137.017 150.635 142.890 1.00 0.00 ? 273 A A N3     1  
ATOM 9123   C C4     . A A 1 284 ? 138.020 150.880 142.027 1.00 0.00 ? 273 A A C4     1  
ATOM 9124   H "H5'"  . A A 1 284 ? 141.544 146.856 139.378 1.00 0.00 ? 273 A A "H5'"  1  
ATOM 9125   H "H5''" . A A 1 284 ? 140.832 147.079 137.968 1.00 0.00 ? 273 A A "H5''" 1  
ATOM 9126   H "H4'"  . A A 1 284 ? 139.332 146.293 139.631 1.00 0.00 ? 273 A A "H4'"  1  
ATOM 9127   H "H3'"  . A A 1 284 ? 138.688 148.819 138.520 1.00 0.00 ? 273 A A "H3'"  1  
ATOM 9128   H "H2'"  . A A 1 284 ? 136.807 148.916 139.847 1.00 0.00 ? 273 A A "H2'"  1  
ATOM 9129   H "HO2'" . A A 1 284 ? 136.110 147.171 141.095 1.00 0.00 ? 273 A A "HO2'" 1  
ATOM 9130   H "H1'"  . A A 1 284 ? 138.037 148.215 142.009 1.00 0.00 ? 273 A A "H1'"  1  
ATOM 9131   H H8     . A A 1 284 ? 140.223 150.290 139.882 1.00 0.00 ? 273 A A H8     1  
ATOM 9132   H H61    . A A 1 284 ? 138.184 155.191 142.838 1.00 0.00 ? 273 A A H61    1  
ATOM 9133   H H62    . A A 1 284 ? 139.304 154.634 141.690 1.00 0.00 ? 273 A A H62    1  
ATOM 9134   H H2     . A A 1 284 ? 135.900 151.658 144.139 1.00 0.00 ? 273 A A H2     1  
ATOM 9135   P P      . A A 1 285 ? 138.460 147.211 136.347 1.00 0.00 ? 274 A A P      1  
ATOM 9136   O OP1    . A A 1 285 ? 139.199 148.489 136.192 1.00 0.00 ? 274 A A OP1    1  
ATOM 9137   O OP2    . A A 1 285 ? 137.404 146.850 135.368 1.00 0.00 ? 274 A A OP2    1  
ATOM 9138   O "O5'"  . A A 1 285 ? 139.526 146.027 136.381 1.00 0.00 ? 274 A A "O5'"  1  
ATOM 9139   C "C5'"  . A A 1 285 ? 139.236 144.769 135.790 1.00 0.00 ? 274 A A "C5'"  1  
ATOM 9140   C "C4'"  . A A 1 285 ? 140.048 143.662 136.416 1.00 0.00 ? 274 A A "C4'"  1  
ATOM 9141   O "O4'"  . A A 1 285 ? 140.043 143.797 137.850 1.00 0.00 ? 274 A A "O4'"  1  
ATOM 9142   C "C3'"  . A A 1 285 ? 139.544 142.247 136.175 1.00 0.00 ? 274 A A "C3'"  1  
ATOM 9143   O "O3'"  . A A 1 285 ? 139.928 141.729 134.913 1.00 0.00 ? 274 A A "O3'"  1  
ATOM 9144   C "C2'"  . A A 1 285 ? 140.112 141.471 137.372 1.00 0.00 ? 274 A A "C2'"  1  
ATOM 9145   O "O2'"  . A A 1 285 ? 141.460 141.086 137.143 1.00 0.00 ? 274 A A "O2'"  1  
ATOM 9146   C "C1'"  . A A 1 285 ? 140.084 142.530 138.475 1.00 0.00 ? 274 A A "C1'"  1  
ATOM 9147   N N9     . A A 1 285 ? 138.892 142.405 139.335 1.00 0.00 ? 274 A A N9     1  
ATOM 9148   C C8     . A A 1 285 ? 138.102 143.411 139.833 1.00 0.00 ? 274 A A C8     1  
ATOM 9149   N N7     . A A 1 285 ? 137.107 142.985 140.572 1.00 0.00 ? 274 A A N7     1  
ATOM 9150   C C5     . A A 1 285 ? 137.251 141.604 140.560 1.00 0.00 ? 274 A A C5     1  
ATOM 9151   C C6     . A A 1 285 ? 136.510 140.570 141.158 1.00 0.00 ? 274 A A C6     1  
ATOM 9152   N N6     . A A 1 285 ? 135.430 140.775 141.915 1.00 0.00 ? 274 A A N6     1  
ATOM 9153   N N1     . A A 1 285 ? 136.920 139.301 140.948 1.00 0.00 ? 274 A A N1     1  
ATOM 9154   C C2     . A A 1 285 ? 138.003 139.094 140.187 1.00 0.00 ? 274 A A C2     1  
ATOM 9155   N N3     . A A 1 285 ? 138.781 139.982 139.573 1.00 0.00 ? 274 A A N3     1  
ATOM 9156   C C4     . A A 1 285 ? 138.346 141.234 139.801 1.00 0.00 ? 274 A A C4     1  
ATOM 9157   H "H5'"  . A A 1 285 ? 139.438 144.811 134.832 1.00 0.00 ? 274 A A "H5'"  1  
ATOM 9158   H "H5''" . A A 1 285 ? 138.283 144.572 135.907 1.00 0.00 ? 274 A A "H5''" 1  
ATOM 9159   H "H4'"  . A A 1 285 ? 140.972 143.727 136.095 1.00 0.00 ? 274 A A "H4'"  1  
ATOM 9160   H "H3'"  . A A 1 285 ? 138.565 142.241 136.229 1.00 0.00 ? 274 A A "H3'"  1  
ATOM 9161   H "H2'"  . A A 1 285 ? 139.549 140.703 137.602 1.00 0.00 ? 274 A A "H2'"  1  
ATOM 9162   H "HO2'" . A A 1 285 ? 141.816 140.674 137.957 1.00 0.00 ? 274 A A "HO2'" 1  
ATOM 9163   H "H1'"  . A A 1 285 ? 140.893 142.450 139.024 1.00 0.00 ? 274 A A "H1'"  1  
ATOM 9164   H H8     . A A 1 285 ? 138.266 144.361 139.653 1.00 0.00 ? 274 A A H8     1  
ATOM 9165   H H61    . A A 1 285 ? 134.954 140.012 142.306 1.00 0.00 ? 274 A A H61    1  
ATOM 9166   H H62    . A A 1 285 ? 135.114 141.687 142.082 1.00 0.00 ? 274 A A H62    1  
ATOM 9167   H H2     . A A 1 285 ? 138.259 138.155 140.066 1.00 0.00 ? 274 A A H2     1  
ATOM 9168   P P      . C A 1 286 ? 138.818 141.140 133.911 1.00 0.00 ? 275 C A P      1  
ATOM 9169   O OP1    . C A 1 286 ? 139.446 140.977 132.575 1.00 0.00 ? 275 C A OP1    1  
ATOM 9170   O OP2    . C A 1 286 ? 137.590 141.963 134.048 1.00 0.00 ? 275 C A OP2    1  
ATOM 9171   O "O5'"  . C A 1 286 ? 138.507 139.689 134.488 1.00 0.00 ? 275 C A "O5'"  1  
ATOM 9172   C "C5'"  . C A 1 286 ? 139.380 138.599 134.232 1.00 0.00 ? 275 C A "C5'"  1  
ATOM 9173   C "C4'"  . C A 1 286 ? 138.631 137.396 133.711 1.00 0.00 ? 275 C A "C4'"  1  
ATOM 9174   O "O4'"  . C A 1 286 ? 139.589 136.406 133.287 1.00 0.00 ? 275 C A "O4'"  1  
ATOM 9175   C "C3'"  . C A 1 286 ? 137.718 136.694 134.704 1.00 0.00 ? 275 C A "C3'"  1  
ATOM 9176   O "O3'"  . C A 1 286 ? 136.567 136.134 134.096 1.00 0.00 ? 275 C A "O3'"  1  
ATOM 9177   C "C2'"  . C A 1 286 ? 138.590 135.560 135.210 1.00 0.00 ? 275 C A "C2'"  1  
ATOM 9178   O "O2'"  . C A 1 286 ? 137.804 134.455 135.633 1.00 0.00 ? 275 C A "O2'"  1  
ATOM 9179   C "C1'"  . C A 1 286 ? 139.344 135.176 133.954 1.00 0.00 ? 275 C A "C1'"  1  
ATOM 9180   N N1     . C A 1 286 ? 140.631 134.501 134.253 1.00 0.00 ? 275 C A N1     1  
ATOM 9181   C C2     . C A 1 286 ? 140.677 133.102 134.198 1.00 0.00 ? 275 C A C2     1  
ATOM 9182   O O2     . C A 1 286 ? 139.648 132.473 133.904 1.00 0.00 ? 275 C A O2     1  
ATOM 9183   N N3     . C A 1 286 ? 141.838 132.462 134.466 1.00 0.00 ? 275 C A N3     1  
ATOM 9184   C C4     . C A 1 286 ? 142.928 133.160 134.780 1.00 0.00 ? 275 C A C4     1  
ATOM 9185   N N4     . C A 1 286 ? 144.052 132.486 135.037 1.00 0.00 ? 275 C A N4     1  
ATOM 9186   C C5     . C A 1 286 ? 142.915 134.582 134.845 1.00 0.00 ? 275 C A C5     1  
ATOM 9187   C C6     . C A 1 286 ? 141.761 135.205 134.577 1.00 0.00 ? 275 C A C6     1  
ATOM 9188   H "H5'"  . C A 1 286 ? 139.839 138.355 135.062 1.00 0.00 ? 275 C A "H5'"  1  
ATOM 9189   H "H5''" . C A 1 286 ? 140.046 138.873 133.567 1.00 0.00 ? 275 C A "H5''" 1  
ATOM 9190   H "H4'"  . C A 1 286 ? 138.086 137.671 132.946 1.00 0.00 ? 275 C A "H4'"  1  
ATOM 9191   H "H3'"  . C A 1 286 ? 137.520 137.302 135.447 1.00 0.00 ? 275 C A "H3'"  1  
ATOM 9192   H "H2'"  . C A 1 286 ? 139.198 135.863 135.915 1.00 0.00 ? 275 C A "H2'"  1  
ATOM 9193   H "HO2'" . C A 1 286 ? 138.397 133.722 135.897 1.00 0.00 ? 275 C A "HO2'" 1  
ATOM 9194   H "H1'"  . C A 1 286 ? 138.784 134.584 133.410 1.00 0.00 ? 275 C A "H1'"  1  
ATOM 9195   H H41    . C A 1 286 ? 144.058 131.507 134.992 1.00 0.00 ? 275 C A H41    1  
ATOM 9196   H H42    . C A 1 286 ? 144.871 132.971 135.271 1.00 0.00 ? 275 C A H42    1  
ATOM 9197   H H5     . C A 1 286 ? 143.723 135.087 135.077 1.00 0.00 ? 275 C A H5     1  
ATOM 9198   H H6     . C A 1 286 ? 141.731 136.183 134.616 1.00 0.00 ? 275 C A H6     1  
ATOM 9199   P P      . U A 1 287 ? 135.194 136.969 134.041 1.00 0.00 ? 276 U A P      1  
ATOM 9200   O OP1    . U A 1 287 ? 134.161 136.114 133.404 1.00 0.00 ? 276 U A OP1    1  
ATOM 9201   O OP2    . U A 1 287 ? 135.493 138.307 133.472 1.00 0.00 ? 276 U A OP2    1  
ATOM 9202   O "O5'"  . U A 1 287 ? 134.799 137.161 135.572 1.00 0.00 ? 276 U A "O5'"  1  
ATOM 9203   C "C5'"  . U A 1 287 ? 134.521 136.042 136.400 1.00 0.00 ? 276 U A "C5'"  1  
ATOM 9204   C "C4'"  . U A 1 287 ? 133.543 136.388 137.495 1.00 0.00 ? 276 U A "C4'"  1  
ATOM 9205   O "O4'"  . U A 1 287 ? 134.111 137.468 138.289 1.00 0.00 ? 276 U A "O4'"  1  
ATOM 9206   C "C3'"  . U A 1 287 ? 132.171 136.863 137.043 1.00 0.00 ? 276 U A "C3'"  1  
ATOM 9207   O "O3'"  . U A 1 287 ? 131.139 136.521 137.950 1.00 0.00 ? 276 U A "O3'"  1  
ATOM 9208   C "C2'"  . U A 1 287 ? 132.318 138.379 137.025 1.00 0.00 ? 276 U A "C2'"  1  
ATOM 9209   O "O2'"  . U A 1 287 ? 131.084 139.018 137.319 1.00 0.00 ? 276 U A "O2'"  1  
ATOM 9210   C "C1'"  . U A 1 287 ? 133.280 138.622 138.181 1.00 0.00 ? 276 U A "C1'"  1  
ATOM 9211   N N1     . U A 1 287 ? 134.146 139.804 137.952 1.00 0.00 ? 276 U A N1     1  
ATOM 9212   C C2     . U A 1 287 ? 133.842 140.955 138.655 1.00 0.00 ? 276 U A C2     1  
ATOM 9213   O O2     . U A 1 287 ? 132.910 141.031 139.436 1.00 0.00 ? 276 U A O2     1  
ATOM 9214   N N3     . U A 1 287 ? 134.671 142.022 138.412 1.00 0.00 ? 276 U A N3     1  
ATOM 9215   C C4     . U A 1 287 ? 135.751 142.059 137.556 1.00 0.00 ? 276 U A C4     1  
ATOM 9216   O O4     . U A 1 287 ? 136.401 143.100 137.445 1.00 0.00 ? 276 U A O4     1  
ATOM 9217   C C5     . U A 1 287 ? 136.007 140.832 136.863 1.00 0.00 ? 276 U A C5     1  
ATOM 9218   C C6     . U A 1 287 ? 135.216 139.777 137.082 1.00 0.00 ? 276 U A C6     1  
ATOM 9219   H "H5'"  . U A 1 287 ? 135.357 135.729 136.806 1.00 0.00 ? 276 U A "H5'"  1  
ATOM 9220   H "H5''" . U A 1 287 ? 134.144 135.323 135.851 1.00 0.00 ? 276 U A "H5''" 1  
ATOM 9221   H "H4'"  . U A 1 287 ? 133.410 135.599 138.061 1.00 0.00 ? 276 U A "H4'"  1  
ATOM 9222   H "H3'"  . U A 1 287 ? 132.007 136.552 136.128 1.00 0.00 ? 276 U A "H3'"  1  
ATOM 9223   H "H2'"  . U A 1 287 ? 132.696 138.693 136.178 1.00 0.00 ? 276 U A "H2'"  1  
ATOM 9224   H "HO2'" . U A 1 287 ? 131.214 139.990 137.296 1.00 0.00 ? 276 U A "HO2'" 1  
ATOM 9225   H "H1'"  . U A 1 287 ? 132.766 138.751 139.007 1.00 0.00 ? 276 U A "H1'"  1  
ATOM 9226   H H3     . U A 1 287 ? 134.472 142.849 138.899 1.00 0.00 ? 276 U A H3     1  
ATOM 9227   H H5     . U A 1 287 ? 136.756 140.767 136.235 1.00 0.00 ? 276 U A H5     1  
ATOM 9228   H H6     . U A 1 287 ? 135.411 138.950 136.596 1.00 0.00 ? 276 U A H6     1  
ATOM 9229   P P      . U A 1 288 ? 129.634 136.315 137.425 1.00 0.00 ? 277 U A P      1  
ATOM 9230   O OP1    . U A 1 288 ? 129.688 135.500 136.184 1.00 0.00 ? 277 U A OP1    1  
ATOM 9231   O OP2    . U A 1 288 ? 128.970 137.642 137.403 1.00 0.00 ? 277 U A OP2    1  
ATOM 9232   O "O5'"  . U A 1 288 ? 128.946 135.437 138.562 1.00 0.00 ? 277 U A "O5'"  1  
ATOM 9233   C "C5'"  . U A 1 288 ? 129.223 134.049 138.680 1.00 0.00 ? 277 U A "C5'"  1  
ATOM 9234   C "C4'"  . U A 1 288 ? 128.031 133.287 139.206 1.00 0.00 ? 277 U A "C4'"  1  
ATOM 9235   O "O4'"  . U A 1 288 ? 127.340 134.089 140.186 1.00 0.00 ? 277 U A "O4'"  1  
ATOM 9236   C "C3'"  . U A 1 288 ? 126.956 132.939 138.188 1.00 0.00 ? 277 U A "C3'"  1  
ATOM 9237   O "O3'"  . U A 1 288 ? 127.233 131.747 137.475 1.00 0.00 ? 277 U A "O3'"  1  
ATOM 9238   C "C2'"  . U A 1 288 ? 125.709 132.799 139.045 1.00 0.00 ? 277 U A "C2'"  1  
ATOM 9239   O "O2'"  . U A 1 288 ? 125.655 131.525 139.670 1.00 0.00 ? 277 U A "O2'"  1  
ATOM 9240   C "C1'"  . U A 1 288 ? 125.940 133.861 140.116 1.00 0.00 ? 277 U A "C1'"  1  
ATOM 9241   N N1     . U A 1 288 ? 125.286 135.149 139.782 1.00 0.00 ? 277 U A N1     1  
ATOM 9242   C C2     . U A 1 288 ? 123.919 135.231 139.974 1.00 0.00 ? 277 U A C2     1  
ATOM 9243   O O2     . U A 1 288 ? 123.250 134.306 140.398 1.00 0.00 ? 277 U A O2     1  
ATOM 9244   N N3     . U A 1 288 ? 123.358 136.442 139.651 1.00 0.00 ? 277 U A N3     1  
ATOM 9245   C C4     . U A 1 288 ? 124.007 137.558 139.166 1.00 0.00 ? 277 U A C4     1  
ATOM 9246   O O4     . U A 1 288 ? 123.358 138.576 138.922 1.00 0.00 ? 277 U A O4     1  
ATOM 9247   C C5     . U A 1 288 ? 125.419 137.400 138.993 1.00 0.00 ? 277 U A C5     1  
ATOM 9248   C C6     . U A 1 288 ? 125.992 136.231 139.300 1.00 0.00 ? 277 U A C6     1  
ATOM 9249   H "H5'"  . U A 1 288 ? 129.977 133.925 139.294 1.00 0.00 ? 277 U A "H5'"  1  
ATOM 9250   H "H5''" . U A 1 288 ? 129.465 133.695 137.800 1.00 0.00 ? 277 U A "H5''" 1  
ATOM 9251   H "H4'"  . U A 1 288 ? 128.346 132.463 139.632 1.00 0.00 ? 277 U A "H4'"  1  
ATOM 9252   H "H3'"  . U A 1 288 ? 126.835 133.694 137.575 1.00 0.00 ? 277 U A "H3'"  1  
ATOM 9253   H "H2'"  . U A 1 288 ? 124.897 132.985 138.530 1.00 0.00 ? 277 U A "H2'"  1  
ATOM 9254   H "HO2'" . U A 1 288 ? 124.826 131.459 140.190 1.00 0.00 ? 277 U A "HO2'" 1  
ATOM 9255   H "H1'"  . U A 1 288 ? 125.595 133.534 140.974 1.00 0.00 ? 277 U A "H1'"  1  
ATOM 9256   H H3     . U A 1 288 ? 122.390 136.522 139.780 1.00 0.00 ? 277 U A H3     1  
ATOM 9257   H H5     . U A 1 288 ? 125.960 138.142 138.652 1.00 0.00 ? 277 U A H5     1  
ATOM 9258   H H6     . U A 1 288 ? 126.959 136.148 139.171 1.00 0.00 ? 277 U A H6     1  
ATOM 9259   P P      . G A 1 289 ? 127.888 131.828 136.017 1.00 0.00 ? 278 G A P      1  
ATOM 9260   O OP1    . G A 1 289 ? 129.367 131.842 136.146 1.00 0.00 ? 278 G A OP1    1  
ATOM 9261   O OP2    . G A 1 289 ? 127.192 132.994 135.415 1.00 0.00 ? 278 G A OP2    1  
ATOM 9262   O "O5'"  . G A 1 289 ? 127.478 130.529 135.190 1.00 0.00 ? 278 G A "O5'"  1  
ATOM 9263   C "C5'"  . G A 1 289 ? 128.452 129.782 134.477 1.00 0.00 ? 278 G A "C5'"  1  
ATOM 9264   C "C4'"  . G A 1 289 ? 129.366 130.679 133.681 1.00 0.00 ? 278 G A "C4'"  1  
ATOM 9265   O "O4'"  . G A 1 289 ? 129.855 131.759 134.534 1.00 0.00 ? 278 G A "O4'"  1  
ATOM 9266   C "C3'"  . G A 1 289 ? 130.650 130.042 133.171 1.00 0.00 ? 278 G A "C3'"  1  
ATOM 9267   O "O3'"  . G A 1 289 ? 130.470 129.328 131.959 1.00 0.00 ? 278 G A "O3'"  1  
ATOM 9268   C "C2'"  . G A 1 289 ? 131.498 131.273 132.920 1.00 0.00 ? 278 G A "C2'"  1  
ATOM 9269   O "O2'"  . G A 1 289 ? 131.086 131.952 131.742 1.00 0.00 ? 278 G A "O2'"  1  
ATOM 9270   C "C1'"  . G A 1 289 ? 131.141 132.110 134.134 1.00 0.00 ? 278 G A "C1'"  1  
ATOM 9271   N N9     . G A 1 289 ? 132.070 131.885 135.257 1.00 0.00 ? 278 G A N9     1  
ATOM 9272   C C8     . G A 1 289 ? 131.775 131.342 136.484 1.00 0.00 ? 278 G A C8     1  
ATOM 9273   N N7     . G A 1 289 ? 132.810 131.270 137.277 1.00 0.00 ? 278 G A N7     1  
ATOM 9274   C C5     . G A 1 289 ? 133.852 131.798 136.528 1.00 0.00 ? 278 G A C5     1  
ATOM 9275   C C6     . G A 1 289 ? 135.221 131.981 136.857 1.00 0.00 ? 278 G A C6     1  
ATOM 9276   O O6     . G A 1 289 ? 135.803 131.704 137.912 1.00 0.00 ? 278 G A O6     1  
ATOM 9277   N N1     . G A 1 289 ? 135.929 132.552 135.804 1.00 0.00 ? 278 G A N1     1  
ATOM 9278   C C2     . G A 1 289 ? 135.391 132.901 134.589 1.00 0.00 ? 278 G A C2     1  
ATOM 9279   N N2     . G A 1 289 ? 136.236 133.439 133.696 1.00 0.00 ? 278 G A N2     1  
ATOM 9280   N N3     . G A 1 289 ? 134.118 132.735 134.270 1.00 0.00 ? 278 G A N3     1  
ATOM 9281   C C4     . G A 1 289 ? 133.413 132.182 135.279 1.00 0.00 ? 278 G A C4     1  
ATOM 9282   H "H5'"  . G A 1 289 ? 127.998 129.164 133.866 1.00 0.00 ? 278 G A "H5'"  1  
ATOM 9283   H "H5''" . G A 1 289 ? 128.987 129.264 135.114 1.00 0.00 ? 278 G A "H5''" 1  
ATOM 9284   H "H4'"  . G A 1 289 ? 128.877 131.061 132.921 1.00 0.00 ? 278 G A "H4'"  1  
ATOM 9285   H "H3'"  . G A 1 289 ? 131.069 129.453 133.831 1.00 0.00 ? 278 G A "H3'"  1  
ATOM 9286   H "H2'"  . G A 1 289 ? 132.453 131.053 132.897 1.00 0.00 ? 278 G A "H2'"  1  
ATOM 9287   H "HO2'" . G A 1 289 ? 130.704 131.302 131.117 1.00 0.00 ? 278 G A "HO2'" 1  
ATOM 9288   H "H1'"  . G A 1 289 ? 131.147 133.059 133.890 1.00 0.00 ? 278 G A "H1'"  1  
ATOM 9289   H H8     . G A 1 289 ? 130.879 131.039 136.740 1.00 0.00 ? 278 G A H8     1  
ATOM 9290   H H1     . G A 1 289 ? 136.886 132.716 135.941 1.00 0.00 ? 278 G A H1     1  
ATOM 9291   H H21    . G A 1 289 ? 137.180 133.565 133.925 1.00 0.00 ? 278 G A H21    1  
ATOM 9292   H H22    . G A 1 289 ? 135.908 133.708 132.812 1.00 0.00 ? 278 G A H22    1  
ATOM 9293   P P      . A A 1 290 ? 131.007 127.819 131.824 1.00 0.00 ? 279 A A P      1  
ATOM 9294   O OP1    . A A 1 290 ? 130.630 127.315 130.480 1.00 0.00 ? 279 A A OP1    1  
ATOM 9295   O OP2    . A A 1 290 ? 130.586 127.070 133.034 1.00 0.00 ? 279 A A OP2    1  
ATOM 9296   O "O5'"  . A A 1 290 ? 132.593 127.970 131.866 1.00 0.00 ? 279 A A "O5'"  1  
ATOM 9297   C "C5'"  . A A 1 290 ? 133.324 128.318 130.700 1.00 0.00 ? 279 A A "C5'"  1  
ATOM 9298   C "C4'"  . A A 1 290 ? 133.542 129.807 130.605 1.00 0.00 ? 279 A A "C4'"  1  
ATOM 9299   O "O4'"  . A A 1 290 ? 134.514 130.216 131.607 1.00 0.00 ? 279 A A "O4'"  1  
ATOM 9300   C "C3'"  . A A 1 290 ? 134.102 130.317 129.286 1.00 0.00 ? 279 A A "C3'"  1  
ATOM 9301   O "O3'"  . A A 1 290 ? 133.104 130.514 128.299 1.00 0.00 ? 279 A A "O3'"  1  
ATOM 9302   C "C2'"  . A A 1 290 ? 134.846 131.591 129.673 1.00 0.00 ? 279 A A "C2'"  1  
ATOM 9303   O "O2'"  . A A 1 290 ? 133.960 132.698 129.763 1.00 0.00 ? 279 A A "O2'"  1  
ATOM 9304   C "C1'"  . A A 1 290 ? 135.344 131.240 131.076 1.00 0.00 ? 279 A A "C1'"  1  
ATOM 9305   N N9     . A A 1 290 ? 136.754 130.805 131.072 1.00 0.00 ? 279 A A N9     1  
ATOM 9306   C C8     . A A 1 290 ? 137.246 129.538 131.265 1.00 0.00 ? 279 A A C8     1  
ATOM 9307   N N7     . A A 1 290 ? 138.553 129.463 131.204 1.00 0.00 ? 279 A A N7     1  
ATOM 9308   C C5     . A A 1 290 ? 138.949 130.770 130.953 1.00 0.00 ? 279 A A C5     1  
ATOM 9309   C C6     . A A 1 290 ? 140.214 131.359 130.780 1.00 0.00 ? 279 A A C6     1  
ATOM 9310   N N6     . A A 1 290 ? 141.361 130.679 130.833 1.00 0.00 ? 279 A A N6     1  
ATOM 9311   N N1     . A A 1 290 ? 140.261 132.688 130.545 1.00 0.00 ? 279 A A N1     1  
ATOM 9312   C C2     . A A 1 290 ? 139.111 133.371 130.490 1.00 0.00 ? 279 A A C2     1  
ATOM 9313   N N3     . A A 1 290 ? 137.863 132.931 130.638 1.00 0.00 ? 279 A A N3     1  
ATOM 9314   C C4     . A A 1 290 ? 137.851 131.606 130.869 1.00 0.00 ? 279 A A C4     1  
ATOM 9315   H "H5'"  . A A 1 290 ? 132.827 128.017 129.910 1.00 0.00 ? 279 A A "H5'"  1  
ATOM 9316   H "H5''" . A A 1 290 ? 134.194 127.868 130.720 1.00 0.00 ? 279 A A "H5''" 1  
ATOM 9317   H "H4'"  . A A 1 290 ? 132.694 130.264 130.788 1.00 0.00 ? 279 A A "H4'"  1  
ATOM 9318   H "H3'"  . A A 1 290 ? 134.749 129.657 128.961 1.00 0.00 ? 279 A A "H3'"  1  
ATOM 9319   H "H2'"  . A A 1 290 ? 135.592 131.771 129.063 1.00 0.00 ? 279 A A "H2'"  1  
ATOM 9320   H "HO2'" . A A 1 290 ? 134.474 133.499 129.994 1.00 0.00 ? 279 A A "HO2'" 1  
ATOM 9321   H "H1'"  . A A 1 290 ? 135.245 132.020 131.661 1.00 0.00 ? 279 A A "H1'"  1  
ATOM 9322   H H8     . A A 1 290 ? 136.673 128.760 131.433 1.00 0.00 ? 279 A A H8     1  
ATOM 9323   H H61    . A A 1 290 ? 142.214 131.145 130.704 1.00 0.00 ? 279 A A H61    1  
ATOM 9324   H H62    . A A 1 290 ? 141.352 129.714 131.003 1.00 0.00 ? 279 A A H62    1  
ATOM 9325   H H2     . A A 1 290 ? 139.200 134.332 130.317 1.00 0.00 ? 279 A A H2     1  
ATOM 9326   P P      . A A 1 291 ? 133.408 130.161 126.761 1.00 0.00 ? 280 A A P      1  
ATOM 9327   O OP1    . A A 1 291 ? 132.177 130.425 125.976 1.00 0.00 ? 280 A A OP1    1  
ATOM 9328   O OP2    . A A 1 291 ? 134.035 128.816 126.713 1.00 0.00 ? 280 A A OP2    1  
ATOM 9329   O "O5'"  . A A 1 291 ? 134.507 131.232 126.331 1.00 0.00 ? 280 A A "O5'"  1  
ATOM 9330   C "C5'"  . A A 1 291 ? 134.151 132.585 126.091 1.00 0.00 ? 280 A A "C5'"  1  
ATOM 9331   C "C4'"  . A A 1 291 ? 135.362 133.432 125.792 1.00 0.00 ? 280 A A "C4'"  1  
ATOM 9332   O "O4'"  . A A 1 291 ? 136.319 133.441 126.887 1.00 0.00 ? 280 A A "O4'"  1  
ATOM 9333   C "C3'"  . A A 1 291 ? 136.220 132.980 124.619 1.00 0.00 ? 280 A A "C3'"  1  
ATOM 9334   O "O3'"  . A A 1 291 ? 135.645 133.287 123.361 1.00 0.00 ? 280 A A "O3'"  1  
ATOM 9335   C "C2'"  . A A 1 291 ? 137.488 133.785 124.867 1.00 0.00 ? 280 A A "C2'"  1  
ATOM 9336   O "O2'"  . A A 1 291 ? 137.314 135.146 124.500 1.00 0.00 ? 280 A A "O2'"  1  
ATOM 9337   C "C1'"  . A A 1 291 ? 137.604 133.685 126.390 1.00 0.00 ? 280 A A "C1'"  1  
ATOM 9338   N N9     . A A 1 291 ? 138.468 132.566 126.810 1.00 0.00 ? 280 A A N9     1  
ATOM 9339   C C8     . A A 1 291 ? 138.104 131.421 127.474 1.00 0.00 ? 280 A A C8     1  
ATOM 9340   N N7     . A A 1 291 ? 139.102 130.606 127.710 1.00 0.00 ? 280 A A N7     1  
ATOM 9341   C C5     . A A 1 291 ? 140.200 131.257 127.164 1.00 0.00 ? 280 A A C5     1  
ATOM 9342   C C6     . A A 1 291 ? 141.561 130.916 127.087 1.00 0.00 ? 280 A A C6     1  
ATOM 9343   N N6     . A A 1 291 ? 142.070 129.784 127.579 1.00 0.00 ? 280 A A N6     1  
ATOM 9344   N N1     . A A 1 291 ? 142.394 131.787 126.477 1.00 0.00 ? 280 A A N1     1  
ATOM 9345   C C2     . A A 1 291 ? 141.884 132.922 125.982 1.00 0.00 ? 280 A A C2     1  
ATOM 9346   N N3     . A A 1 291 ? 140.625 133.354 125.994 1.00 0.00 ? 280 A A N3     1  
ATOM 9347   C C4     . A A 1 291 ? 139.823 132.465 126.607 1.00 0.00 ? 280 A A C4     1  
ATOM 9348   H "H5'"  . A A 1 291 ? 133.699 132.943 126.884 1.00 0.00 ? 280 A A "H5'"  1  
ATOM 9349   H "H5''" . A A 1 291 ? 133.537 132.625 125.329 1.00 0.00 ? 280 A A "H5''" 1  
ATOM 9350   H "H4'"  . A A 1 291 ? 135.046 134.344 125.620 1.00 0.00 ? 280 A A "H4'"  1  
ATOM 9351   H "H3'"  . A A 1 291 ? 136.416 132.020 124.658 1.00 0.00 ? 280 A A "H3'"  1  
ATOM 9352   H "H2'"  . A A 1 291 ? 138.262 133.384 124.418 1.00 0.00 ? 280 A A "H2'"  1  
ATOM 9353   H "HO2'" . A A 1 291 ? 138.160 135.622 124.633 1.00 0.00 ? 280 A A "HO2'" 1  
ATOM 9354   H "H1'"  . A A 1 291 ? 137.963 134.526 126.745 1.00 0.00 ? 280 A A "H1'"  1  
ATOM 9355   H H8     . A A 1 291 ? 137.181 131.230 127.747 1.00 0.00 ? 280 A A H8     1  
ATOM 9356   H H61    . A A 1 291 ? 143.029 129.601 127.495 1.00 0.00 ? 280 A A H61    1  
ATOM 9357   H H62    . A A 1 291 ? 141.485 129.137 128.026 1.00 0.00 ? 280 A A H62    1  
ATOM 9358   H H2     . A A 1 291 ? 142.530 133.520 125.549 1.00 0.00 ? 280 A A H2     1  
ATOM 9359   P P      . A A 1 292 ? 135.291 132.109 122.326 1.00 0.00 ? 281 A A P      1  
ATOM 9360   O OP1    . A A 1 292 ? 134.178 132.574 121.462 1.00 0.00 ? 281 A A OP1    1  
ATOM 9361   O OP2    . A A 1 292 ? 135.146 130.848 123.096 1.00 0.00 ? 281 A A OP2    1  
ATOM 9362   O "O5'"  . A A 1 292 ? 136.598 131.985 121.423 1.00 0.00 ? 281 A A "O5'"  1  
ATOM 9363   C "C5'"  . A A 1 292 ? 137.890 131.944 122.012 1.00 0.00 ? 281 A A "C5'"  1  
ATOM 9364   C "C4'"  . A A 1 292 ? 138.728 130.833 121.431 1.00 0.00 ? 281 A A "C4'"  1  
ATOM 9365   O "O4'"  . A A 1 292 ? 139.849 130.537 122.307 1.00 0.00 ? 281 A A "O4'"  1  
ATOM 9366   C "C3'"  . A A 1 292 ? 138.044 129.480 121.299 1.00 0.00 ? 281 A A "C3'"  1  
ATOM 9367   O "O3'"  . A A 1 292 ? 137.170 129.407 120.187 1.00 0.00 ? 281 A A "O3'"  1  
ATOM 9368   C "C2'"  . A A 1 292 ? 139.246 128.537 121.219 1.00 0.00 ? 281 A A "C2'"  1  
ATOM 9369   O "O2'"  . A A 1 292 ? 139.816 128.537 119.918 1.00 0.00 ? 281 A A "O2'"  1  
ATOM 9370   C "C1'"  . A A 1 292 ? 140.231 129.199 122.189 1.00 0.00 ? 281 A A "C1'"  1  
ATOM 9371   N N9     . A A 1 292 ? 140.165 128.607 123.539 1.00 0.00 ? 281 A A N9     1  
ATOM 9372   C C8     . A A 1 292 ? 141.145 127.915 124.207 1.00 0.00 ? 281 A A C8     1  
ATOM 9373   N N7     . A A 1 292 ? 140.787 127.510 125.400 1.00 0.00 ? 281 A A N7     1  
ATOM 9374   C C5     . A A 1 292 ? 139.482 127.966 125.529 1.00 0.00 ? 281 A A C5     1  
ATOM 9375   C C6     . A A 1 292 ? 138.540 127.861 126.567 1.00 0.00 ? 281 A A C6     1  
ATOM 9376   N N6     . A A 1 292 ? 138.779 127.239 127.724 1.00 0.00 ? 281 A A N6     1  
ATOM 9377   N N1     . A A 1 292 ? 137.328 128.427 126.376 1.00 0.00 ? 281 A A N1     1  
ATOM 9378   C C2     . A A 1 292 ? 137.088 129.052 125.217 1.00 0.00 ? 281 A A C2     1  
ATOM 9379   N N3     . A A 1 292 ? 137.891 129.216 124.167 1.00 0.00 ? 281 A A N3     1  
ATOM 9380   C C4     . A A 1 292 ? 139.087 128.643 124.390 1.00 0.00 ? 281 A A C4     1  
ATOM 9381   H "H5'"  . A A 1 292 ? 137.797 131.803 122.977 1.00 0.00 ? 281 A A "H5'"  1  
ATOM 9382   H "H5''" . A A 1 292 ? 138.341 132.800 121.856 1.00 0.00 ? 281 A A "H5''" 1  
ATOM 9383   H "H4'"  . A A 1 292 ? 139.062 131.106 120.551 1.00 0.00 ? 281 A A "H4'"  1  
ATOM 9384   H "H3'"  . A A 1 292 ? 137.541 129.280 122.117 1.00 0.00 ? 281 A A "H3'"  1  
ATOM 9385   H "H2'"  . A A 1 292 ? 139.012 127.631 121.514 1.00 0.00 ? 281 A A "H2'"  1  
ATOM 9386   H "HO2'" . A A 1 292 ? 140.562 127.903 119.897 1.00 0.00 ? 281 A A "HO2'" 1  
ATOM 9387   H "H1'"  . A A 1 292 ? 141.143 129.110 121.839 1.00 0.00 ? 281 A A "H1'"  1  
ATOM 9388   H H8     . A A 1 292 ? 142.032 127.740 123.826 1.00 0.00 ? 281 A A H8     1  
ATOM 9389   H H61    . A A 1 292 ? 138.082 127.198 128.411 1.00 0.00 ? 281 A A H61    1  
ATOM 9390   H H62    . A A 1 292 ? 139.651 126.821 127.885 1.00 0.00 ? 281 A A H62    1  
ATOM 9391   H H2     . A A 1 292 ? 136.194 129.445 125.128 1.00 0.00 ? 281 A A H2     1  
ATOM 9392   P P      . U A 1 293 ? 135.931 128.383 120.199 1.00 0.00 ? 282 U A P      1  
ATOM 9393   O OP1    . U A 1 293 ? 136.153 127.379 119.128 1.00 0.00 ? 282 U A OP1    1  
ATOM 9394   O OP2    . U A 1 293 ? 134.678 129.179 120.210 1.00 0.00 ? 282 U A OP2    1  
ATOM 9395   O "O5'"  . U A 1 293 ? 136.058 127.643 121.604 1.00 0.00 ? 282 U A "O5'"  1  
ATOM 9396   C "C5'"  . U A 1 293 ? 136.549 126.314 121.686 1.00 0.00 ? 282 U A "C5'"  1  
ATOM 9397   C "C4'"  . U A 1 293 ? 137.256 126.061 122.995 1.00 0.00 ? 282 U A "C4'"  1  
ATOM 9398   O "O4'"  . U A 1 293 ? 136.254 126.114 124.036 1.00 0.00 ? 282 U A "O4'"  1  
ATOM 9399   C "C3'"  . U A 1 293 ? 137.902 124.693 123.155 1.00 0.00 ? 282 U A "C3'"  1  
ATOM 9400   O "O3'"  . U A 1 293 ? 139.252 124.664 122.726 1.00 0.00 ? 282 U A "O3'"  1  
ATOM 9401   C "C2'"  . U A 1 293 ? 137.889 124.471 124.661 1.00 0.00 ? 282 U A "C2'"  1  
ATOM 9402   O "O2'"  . U A 1 293 ? 139.013 125.079 125.281 1.00 0.00 ? 282 U A "O2'"  1  
ATOM 9403   C "C1'"  . U A 1 293 ? 136.629 125.224 125.090 1.00 0.00 ? 282 U A "C1'"  1  
ATOM 9404   N N1     . U A 1 293 ? 135.497 124.310 125.376 1.00 0.00 ? 282 U A N1     1  
ATOM 9405   C C2     . U A 1 293 ? 135.618 123.481 126.476 1.00 0.00 ? 282 U A C2     1  
ATOM 9406   O O2     . U A 1 293 ? 136.597 123.476 127.201 1.00 0.00 ? 282 U A O2     1  
ATOM 9407   N N3     . U A 1 293 ? 134.546 122.652 126.702 1.00 0.00 ? 282 U A N3     1  
ATOM 9408   C C4     . U A 1 293 ? 133.389 122.567 125.957 1.00 0.00 ? 282 U A C4     1  
ATOM 9409   O O4     . U A 1 293 ? 132.514 121.767 126.290 1.00 0.00 ? 282 U A O4     1  
ATOM 9410   C C5     . U A 1 293 ? 133.334 123.453 124.834 1.00 0.00 ? 282 U A C5     1  
ATOM 9411   C C6     . U A 1 293 ? 134.363 124.272 124.592 1.00 0.00 ? 282 U A C6     1  
ATOM 9412   H "H5'"  . U A 1 293 ? 137.177 126.159 120.949 1.00 0.00 ? 282 U A "H5'"  1  
ATOM 9413   H "H5''" . U A 1 293 ? 135.799 125.689 121.604 1.00 0.00 ? 282 U A "H5''" 1  
ATOM 9414   H "H4'"  . U A 1 293 ? 137.929 126.751 123.173 1.00 0.00 ? 282 U A "H4'"  1  
ATOM 9415   H "H3'"  . U A 1 293 ? 137.398 124.002 122.677 1.00 0.00 ? 282 U A "H3'"  1  
ATOM 9416   H "H2'"  . U A 1 293 ? 137.824 123.519 124.884 1.00 0.00 ? 282 U A "H2'"  1  
ATOM 9417   H "HO2'" . U A 1 293 ? 139.740 125.147 124.626 1.00 0.00 ? 282 U A "HO2'" 1  
ATOM 9418   H "H1'"  . U A 1 293 ? 136.827 125.756 125.890 1.00 0.00 ? 282 U A "H1'"  1  
ATOM 9419   H H3     . U A 1 293 ? 134.612 122.056 127.476 1.00 0.00 ? 282 U A H3     1  
ATOM 9420   H H5     . U A 1 293 ? 132.548 123.461 124.249 1.00 0.00 ? 282 U A H5     1  
ATOM 9421   H H6     . U A 1 293 ? 134.302 124.868 123.818 1.00 0.00 ? 282 U A H6     1  
ATOM 9422   P P      . A A 1 294 ? 139.667 123.832 121.415 1.00 0.00 ? 283 A A P      1  
ATOM 9423   O OP1    . A A 1 294 ? 139.991 124.800 120.338 1.00 0.00 ? 283 A A OP1    1  
ATOM 9424   O OP2    . A A 1 294 ? 138.631 122.794 121.182 1.00 0.00 ? 283 A A OP2    1  
ATOM 9425   O "O5'"  . A A 1 294 ? 141.015 123.095 121.838 1.00 0.00 ? 283 A A "O5'"  1  
ATOM 9426   C "C5'"  . A A 1 294 ? 141.035 122.177 122.921 1.00 0.00 ? 283 A A "C5'"  1  
ATOM 9427   C "C4'"  . A A 1 294 ? 142.297 122.308 123.736 1.00 0.00 ? 283 A A "C4'"  1  
ATOM 9428   O "O4'"  . A A 1 294 ? 143.423 122.466 122.845 1.00 0.00 ? 283 A A "O4'"  1  
ATOM 9429   C "C3'"  . A A 1 294 ? 142.354 123.490 124.692 1.00 0.00 ? 283 A A "C3'"  1  
ATOM 9430   O "O3'"  . A A 1 294 ? 142.633 123.109 126.028 1.00 0.00 ? 283 A A "O3'"  1  
ATOM 9431   C "C2'"  . A A 1 294 ? 143.305 124.513 124.062 1.00 0.00 ? 283 A A "C2'"  1  
ATOM 9432   O "O2'"  . A A 1 294 ? 144.061 125.193 125.054 1.00 0.00 ? 283 A A "O2'"  1  
ATOM 9433   C "C1'"  . A A 1 294 ? 144.234 123.606 123.264 1.00 0.00 ? 283 A A "C1'"  1  
ATOM 9434   N N9     . A A 1 294 ? 144.793 124.286 122.080 1.00 0.00 ? 283 A A N9     1  
ATOM 9435   C C8     . A A 1 294 ? 144.112 124.927 121.074 1.00 0.00 ? 283 A A C8     1  
ATOM 9436   N N7     . A A 1 294 ? 144.889 125.438 120.152 1.00 0.00 ? 283 A A N7     1  
ATOM 9437   C C5     . A A 1 294 ? 146.170 125.113 120.578 1.00 0.00 ? 283 A A C5     1  
ATOM 9438   C C6     . A A 1 294 ? 147.442 125.368 120.035 1.00 0.00 ? 283 A A C6     1  
ATOM 9439   N N6     . A A 1 294 ? 147.640 126.040 118.899 1.00 0.00 ? 283 A A N6     1  
ATOM 9440   N N1     . A A 1 294 ? 148.516 124.906 120.709 1.00 0.00 ? 283 A A N1     1  
ATOM 9441   C C2     . A A 1 294 ? 148.318 124.232 121.850 1.00 0.00 ? 283 A A C2     1  
ATOM 9442   N N3     . A A 1 294 ? 147.174 123.929 122.459 1.00 0.00 ? 283 A A N3     1  
ATOM 9443   C C4     . A A 1 294 ? 146.125 124.404 121.764 1.00 0.00 ? 283 A A C4     1  
ATOM 9444   H "H5'"  . A A 1 294 ? 140.976 121.264 122.568 1.00 0.00 ? 283 A A "H5'"  1  
ATOM 9445   H "H5''" . A A 1 294 ? 140.262 122.346 123.499 1.00 0.00 ? 283 A A "H5''" 1  
ATOM 9446   H "H4'"  . A A 1 294 ? 142.425 121.481 124.246 1.00 0.00 ? 283 A A "H4'"  1  
ATOM 9447   H "H3'"  . A A 1 294 ? 141.448 123.860 124.647 1.00 0.00 ? 283 A A "H3'"  1  
ATOM 9448   H "H2'"  . A A 1 294 ? 142.824 125.138 123.479 1.00 0.00 ? 283 A A "H2'"  1  
ATOM 9449   H "HO2'" . A A 1 294 ? 144.655 125.837 124.615 1.00 0.00 ? 283 A A "HO2'" 1  
ATOM 9450   H "H1'"  . A A 1 294 ? 144.966 123.300 123.841 1.00 0.00 ? 283 A A "H1'"  1  
ATOM 9451   H H8     . A A 1 294 ? 143.134 124.995 121.049 1.00 0.00 ? 283 A A H8     1  
ATOM 9452   H H61    . A A 1 294 ? 148.552 126.187 118.570 1.00 0.00 ? 283 A A H61    1  
ATOM 9453   H H62    . A A 1 294 ? 146.876 126.385 118.393 1.00 0.00 ? 283 A A H62    1  
ATOM 9454   H H2     . A A 1 294 ? 149.130 123.918 122.300 1.00 0.00 ? 283 A A H2     1  
ATOM 9455   P P      . A A 1 295 ? 141.713 123.648 127.231 1.00 0.00 ? 284 A A P      1  
ATOM 9456   O OP1    . A A 1 295 ? 140.502 124.270 126.641 1.00 0.00 ? 284 A A OP1    1  
ATOM 9457   O OP2    . A A 1 295 ? 142.572 124.439 128.148 1.00 0.00 ? 284 A A OP2    1  
ATOM 9458   O "O5'"  . A A 1 295 ? 141.265 122.325 127.997 1.00 0.00 ? 284 A A "O5'"  1  
ATOM 9459   C "C5'"  . A A 1 295 ? 140.240 121.493 127.475 1.00 0.00 ? 284 A A "C5'"  1  
ATOM 9460   C "C4'"  . A A 1 295 ? 140.189 120.164 128.186 1.00 0.00 ? 284 A A "C4'"  1  
ATOM 9461   O "O4'"  . A A 1 295 ? 139.119 120.201 129.161 1.00 0.00 ? 284 A A "O4'"  1  
ATOM 9462   C "C3'"  . A A 1 295 ? 139.848 118.958 127.324 1.00 0.00 ? 284 A A "C3'"  1  
ATOM 9463   O "O3'"  . A A 1 295 ? 140.982 118.384 126.699 1.00 0.00 ? 284 A A "O3'"  1  
ATOM 9464   C "C2'"  . A A 1 295 ? 139.229 118.022 128.348 1.00 0.00 ? 284 A A "C2'"  1  
ATOM 9465   O "O2'"  . A A 1 295 ? 140.221 117.450 129.188 1.00 0.00 ? 284 A A "O2'"  1  
ATOM 9466   C "C1'"  . A A 1 295 ? 138.390 119.016 129.152 1.00 0.00 ? 284 A A "C1'"  1  
ATOM 9467   N N9     . A A 1 295 ? 137.101 119.312 128.499 1.00 0.00 ? 284 A A N9     1  
ATOM 9468   C C8     . A A 1 295 ? 136.610 120.535 128.116 1.00 0.00 ? 284 A A C8     1  
ATOM 9469   N N7     . A A 1 295 ? 135.427 120.479 127.556 1.00 0.00 ? 284 A A N7     1  
ATOM 9470   C C5     . A A 1 295 ? 135.117 119.126 127.570 1.00 0.00 ? 284 A A C5     1  
ATOM 9471   C C6     . A A 1 295 ? 133.995 118.406 127.120 1.00 0.00 ? 284 A A C6     1  
ATOM 9472   N N6     . A A 1 295 ? 132.934 118.975 126.542 1.00 0.00 ? 284 A A N6     1  
ATOM 9473   N N1     . A A 1 295 ? 134.001 117.066 127.283 1.00 0.00 ? 284 A A N1     1  
ATOM 9474   C C2     . A A 1 295 ? 135.066 116.495 127.862 1.00 0.00 ? 284 A A C2     1  
ATOM 9475   N N3     . A A 1 295 ? 136.177 117.063 128.326 1.00 0.00 ? 284 A A N3     1  
ATOM 9476   C C4     . A A 1 295 ? 136.139 118.396 128.147 1.00 0.00 ? 284 A A C4     1  
ATOM 9477   H "H5'"  . A A 1 295 ? 140.407 121.338 126.521 1.00 0.00 ? 284 A A "H5'"  1  
ATOM 9478   H "H5''" . A A 1 295 ? 139.377 121.944 127.579 1.00 0.00 ? 284 A A "H5''" 1  
ATOM 9479   H "H4'"  . A A 1 295 ? 141.038 119.993 128.647 1.00 0.00 ? 284 A A "H4'"  1  
ATOM 9480   H "H3'"  . A A 1 295 ? 139.185 119.188 126.638 1.00 0.00 ? 284 A A "H3'"  1  
ATOM 9481   H "H2'"  . A A 1 295 ? 138.675 117.336 127.920 1.00 0.00 ? 284 A A "H2'"  1  
ATOM 9482   H "HO2'" . A A 1 295 ? 141.080 117.457 128.716 1.00 0.00 ? 284 A A "HO2'" 1  
ATOM 9483   H "H1'"  . A A 1 295 ? 138.226 118.653 130.049 1.00 0.00 ? 284 A A "H1'"  1  
ATOM 9484   H H8     . A A 1 295 ? 137.099 121.375 128.250 1.00 0.00 ? 284 A A H8     1  
ATOM 9485   H H61    . A A 1 295 ? 132.181 118.420 126.249 1.00 0.00 ? 284 A A H61    1  
ATOM 9486   H H62    . A A 1 295 ? 132.907 119.945 126.413 1.00 0.00 ? 284 A A H62    1  
ATOM 9487   H H2     . A A 1 295 ? 135.020 115.520 127.957 1.00 0.00 ? 284 A A H2     1  
ATOM 9488   P P      . G A 1 296 ? 141.208 118.558 125.117 1.00 0.00 ? 285 G A P      1  
ATOM 9489   O OP1    . G A 1 296 ? 142.516 117.946 124.768 1.00 0.00 ? 285 G A OP1    1  
ATOM 9490   O OP2    . G A 1 296 ? 140.946 119.978 124.769 1.00 0.00 ? 285 G A OP2    1  
ATOM 9491   O "O5'"  . G A 1 296 ? 140.058 117.669 124.463 1.00 0.00 ? 285 G A "O5'"  1  
ATOM 9492   C "C5'"  . G A 1 296 ? 139.708 116.409 125.015 1.00 0.00 ? 285 G A "C5'"  1  
ATOM 9493   C "C4'"  . G A 1 296 ? 138.246 116.101 124.809 1.00 0.00 ? 285 G A "C4'"  1  
ATOM 9494   O "O4'"  . G A 1 296 ? 137.435 117.109 125.467 1.00 0.00 ? 285 G A "O4'"  1  
ATOM 9495   C "C3'"  . G A 1 296 ? 137.758 116.115 123.368 1.00 0.00 ? 285 G A "C3'"  1  
ATOM 9496   O "O3'"  . G A 1 296 ? 138.035 114.908 122.678 1.00 0.00 ? 285 G A "O3'"  1  
ATOM 9497   C "C2'"  . G A 1 296 ? 136.270 116.404 123.524 1.00 0.00 ? 285 G A "C2'"  1  
ATOM 9498   O "O2'"  . G A 1 296 ? 135.560 115.241 123.922 1.00 0.00 ? 285 G A "O2'"  1  
ATOM 9499   C "C1'"  . G A 1 296 ? 136.274 117.404 124.681 1.00 0.00 ? 285 G A "C1'"  1  
ATOM 9500   N N9     . G A 1 296 ? 136.313 118.800 124.209 1.00 0.00 ? 285 G A N9     1  
ATOM 9501   C C8     . G A 1 296 ? 137.379 119.665 124.260 1.00 0.00 ? 285 G A C8     1  
ATOM 9502   N N7     . G A 1 296 ? 137.110 120.842 123.762 1.00 0.00 ? 285 G A N7     1  
ATOM 9503   C C5     . G A 1 296 ? 135.786 120.748 123.357 1.00 0.00 ? 285 G A C5     1  
ATOM 9504   C C6     . G A 1 296 ? 134.942 121.711 122.744 1.00 0.00 ? 285 G A C6     1  
ATOM 9505   O O6     . G A 1 296 ? 135.205 122.875 122.426 1.00 0.00 ? 285 G A O6     1  
ATOM 9506   N N1     . G A 1 296 ? 133.670 121.197 122.502 1.00 0.00 ? 285 G A N1     1  
ATOM 9507   C C2     . G A 1 296 ? 133.264 119.922 122.811 1.00 0.00 ? 285 G A C2     1  
ATOM 9508   N N2     . G A 1 296 ? 131.997 119.611 122.500 1.00 0.00 ? 285 G A N2     1  
ATOM 9509   N N3     . G A 1 296 ? 134.040 119.017 123.383 1.00 0.00 ? 285 G A N3     1  
ATOM 9510   C C4     . G A 1 296 ? 135.279 119.493 123.626 1.00 0.00 ? 285 G A C4     1  
ATOM 9511   H "H5'"  . G A 1 296 ? 139.901 116.416 125.977 1.00 0.00 ? 285 G A "H5'"  1  
ATOM 9512   H "H5''" . G A 1 296 ? 140.246 115.710 124.586 1.00 0.00 ? 285 G A "H5''" 1  
ATOM 9513   H "H4'"  . G A 1 296 ? 138.046 115.226 125.202 1.00 0.00 ? 285 G A "H4'"  1  
ATOM 9514   H "H3'"  . G A 1 296 ? 138.182 116.862 122.893 1.00 0.00 ? 285 G A "H3'"  1  
ATOM 9515   H "H2'"  . G A 1 296 ? 135.894 116.798 122.710 1.00 0.00 ? 285 G A "H2'"  1  
ATOM 9516   H "HO2'" . G A 1 296 ? 136.097 114.448 123.707 1.00 0.00 ? 285 G A "HO2'" 1  
ATOM 9517   H "H1'"  . G A 1 296 ? 135.476 117.267 125.231 1.00 0.00 ? 285 G A "H1'"  1  
ATOM 9518   H H8     . G A 1 296 ? 138.253 119.426 124.632 1.00 0.00 ? 285 G A H8     1  
ATOM 9519   H H1     . G A 1 296 ? 133.017 121.792 122.080 1.00 0.00 ? 285 G A H1     1  
ATOM 9520   H H21    . G A 1 296 ? 131.415 120.275 122.076 1.00 0.00 ? 285 G A H21    1  
ATOM 9521   H H22    . G A 1 296 ? 131.650 118.714 122.697 1.00 0.00 ? 285 G A H22    1  
ATOM 9522   P P      . G A 1 297 ? 138.315 114.930 121.096 1.00 0.00 ? 286 G A P      1  
ATOM 9523   O OP1    . G A 1 297 ? 138.831 113.592 120.702 1.00 0.00 ? 286 G A OP1    1  
ATOM 9524   O OP2    . G A 1 297 ? 139.108 116.144 120.786 1.00 0.00 ? 286 G A OP2    1  
ATOM 9525   O "O5'"  . G A 1 297 ? 136.869 115.108 120.452 1.00 0.00 ? 286 G A "O5'"  1  
ATOM 9526   C "C5'"  . G A 1 297 ? 135.896 114.077 120.542 1.00 0.00 ? 286 G A "C5'"  1  
ATOM 9527   C "C4'"  . G A 1 297 ? 134.565 114.521 119.990 1.00 0.00 ? 286 G A "C4'"  1  
ATOM 9528   O "O4'"  . G A 1 297 ? 134.068 115.652 120.752 1.00 0.00 ? 286 G A "O4'"  1  
ATOM 9529   C "C3'"  . G A 1 297 ? 134.571 115.016 118.552 1.00 0.00 ? 286 G A "C3'"  1  
ATOM 9530   O "O3'"  . G A 1 297 ? 134.536 113.964 117.603 1.00 0.00 ? 286 G A "O3'"  1  
ATOM 9531   C "C2'"  . G A 1 297 ? 133.346 115.918 118.507 1.00 0.00 ? 286 G A "C2'"  1  
ATOM 9532   O "O2'"  . G A 1 297 ? 132.149 115.160 118.408 1.00 0.00 ? 286 G A "O2'"  1  
ATOM 9533   C "C1'"  . G A 1 297 ? 133.401 116.579 119.886 1.00 0.00 ? 286 G A "C1'"  1  
ATOM 9534   N N9     . G A 1 297 ? 134.116 117.867 119.857 1.00 0.00 ? 286 G A N9     1  
ATOM 9535   C C8     . G A 1 297 ? 135.371 118.135 120.349 1.00 0.00 ? 286 G A C8     1  
ATOM 9536   N N7     . G A 1 297 ? 135.737 119.375 120.177 1.00 0.00 ? 286 G A N7     1  
ATOM 9537   C C5     . G A 1 297 ? 134.659 119.964 119.530 1.00 0.00 ? 286 G A C5     1  
ATOM 9538   C C6     . G A 1 297 ? 134.475 121.299 119.082 1.00 0.00 ? 286 G A C6     1  
ATOM 9539   O O6     . G A 1 297 ? 135.250 122.256 119.170 1.00 0.00 ? 286 G A O6     1  
ATOM 9540   N N1     . G A 1 297 ? 133.232 121.467 118.476 1.00 0.00 ? 286 G A N1     1  
ATOM 9541   C C2     . G A 1 297 ? 132.291 120.479 118.321 1.00 0.00 ? 286 G A C2     1  
ATOM 9542   N N2     . G A 1 297 ? 131.151 120.834 117.711 1.00 0.00 ? 286 G A N2     1  
ATOM 9543   N N3     . G A 1 297 ? 132.452 119.233 118.733 1.00 0.00 ? 286 G A N3     1  
ATOM 9544   C C4     . G A 1 297 ? 133.653 119.047 119.324 1.00 0.00 ? 286 G A C4     1  
ATOM 9545   H "H5'"  . G A 1 297 ? 135.784 113.826 121.482 1.00 0.00 ? 286 G A "H5'"  1  
ATOM 9546   H "H5''" . G A 1 297 ? 136.209 113.297 120.038 1.00 0.00 ? 286 G A "H5''" 1  
ATOM 9547   H "H4'"  . G A 1 297 ? 133.927 113.780 120.068 1.00 0.00 ? 286 G A "H4'"  1  
ATOM 9548   H "H3'"  . G A 1 297 ? 135.373 115.558 118.401 1.00 0.00 ? 286 G A "H3'"  1  
ATOM 9549   H "H2'"  . G A 1 297 ? 133.413 116.583 117.789 1.00 0.00 ? 286 G A "H2'"  1  
ATOM 9550   H "HO2'" . G A 1 297 ? 132.365 114.265 118.072 1.00 0.00 ? 286 G A "HO2'" 1  
ATOM 9551   H "H1'"  . G A 1 297 ? 132.490 116.717 120.218 1.00 0.00 ? 286 G A "H1'"  1  
ATOM 9552   H H8     . G A 1 297 ? 135.935 117.462 120.787 1.00 0.00 ? 286 G A H8     1  
ATOM 9553   H H1     . G A 1 297 ? 133.016 122.359 118.134 1.00 0.00 ? 286 G A H1     1  
ATOM 9554   H H21    . G A 1 297 ? 131.024 121.755 117.401 1.00 0.00 ? 286 G A H21    1  
ATOM 9555   H H22    . G A 1 297 ? 130.441 120.171 117.571 1.00 0.00 ? 286 G A H22    1  
ATOM 9556   P P      . U A 1 298 ? 135.227 114.152 116.164 1.00 0.00 ? 287 U A P      1  
ATOM 9557   O OP1    . U A 1 298 ? 135.265 112.826 115.495 1.00 0.00 ? 287 U A OP1    1  
ATOM 9558   O OP2    . U A 1 298 ? 136.487 114.914 116.356 1.00 0.00 ? 287 U A OP2    1  
ATOM 9559   O "O5'"  . U A 1 298 ? 134.206 115.078 115.365 1.00 0.00 ? 287 U A "O5'"  1  
ATOM 9560   C "C5'"  . U A 1 298 ? 132.921 114.599 114.996 1.00 0.00 ? 287 U A "C5'"  1  
ATOM 9561   C "C4'"  . U A 1 298 ? 132.095 115.676 114.338 1.00 0.00 ? 287 U A "C4'"  1  
ATOM 9562   O "O4'"  . U A 1 298 ? 131.869 116.767 115.269 1.00 0.00 ? 287 U A "O4'"  1  
ATOM 9563   C "C3'"  . U A 1 298 ? 132.714 116.349 113.124 1.00 0.00 ? 287 U A "C3'"  1  
ATOM 9564   O "O3'"  . U A 1 298 ? 132.546 115.603 111.930 1.00 0.00 ? 287 U A "O3'"  1  
ATOM 9565   C "C2'"  . U A 1 298 ? 132.016 117.702 113.099 1.00 0.00 ? 287 U A "C2'"  1  
ATOM 9566   O "O2'"  . U A 1 298 ? 130.704 117.595 112.567 1.00 0.00 ? 287 U A "O2'"  1  
ATOM 9567   C "C1'"  . U A 1 298 ? 131.921 118.021 114.593 1.00 0.00 ? 287 U A "C1'"  1  
ATOM 9568   N N1     . U A 1 298 ? 133.080 118.812 115.073 1.00 0.00 ? 287 U A N1     1  
ATOM 9569   C C2     . U A 1 298 ? 133.088 120.164 114.777 1.00 0.00 ? 287 U A C2     1  
ATOM 9570   O O2     . U A 1 298 ? 132.197 120.713 114.152 1.00 0.00 ? 287 U A O2     1  
ATOM 9571   N N3     . U A 1 298 ? 134.180 120.855 115.242 1.00 0.00 ? 287 U A N3     1  
ATOM 9572   C C4     . U A 1 298 ? 135.244 120.349 115.955 1.00 0.00 ? 287 U A C4     1  
ATOM 9573   O O4     . U A 1 298 ? 136.154 121.103 116.303 1.00 0.00 ? 287 U A O4     1  
ATOM 9574   C C5     . U A 1 298 ? 135.168 118.944 116.225 1.00 0.00 ? 287 U A C5     1  
ATOM 9575   C C6     . U A 1 298 ? 134.117 118.246 115.786 1.00 0.00 ? 287 U A C6     1  
ATOM 9576   H "H5'"  . U A 1 298 ? 132.455 114.286 115.799 1.00 0.00 ? 287 U A "H5'"  1  
ATOM 9577   H "H5''" . U A 1 298 ? 133.025 113.853 114.373 1.00 0.00 ? 287 U A "H5''" 1  
ATOM 9578   H "H4'"  . U A 1 298 ? 131.229 115.294 114.081 1.00 0.00 ? 287 U A "H4'"  1  
ATOM 9579   H "H3'"  . U A 1 298 ? 133.673 116.486 113.284 1.00 0.00 ? 287 U A "H3'"  1  
ATOM 9580   H "H2'"  . U A 1 298 ? 132.549 118.372 112.622 1.00 0.00 ? 287 U A "H2'"  1  
ATOM 9581   H "HO2'" . U A 1 298 ? 130.636 116.771 112.044 1.00 0.00 ? 287 U A "HO2'" 1  
ATOM 9582   H "H1'"  . U A 1 298 ? 131.096 118.521 114.767 1.00 0.00 ? 287 U A "H1'"  1  
ATOM 9583   H H3     . U A 1 298 ? 134.204 121.814 115.043 1.00 0.00 ? 287 U A H3     1  
ATOM 9584   H H5     . U A 1 298 ? 135.881 118.499 116.728 1.00 0.00 ? 287 U A H5     1  
ATOM 9585   H H6     . U A 1 298 ? 134.089 117.287 115.981 1.00 0.00 ? 287 U A H6     1  
ATOM 9586   P P      . U A 1 299 ? 133.644 115.689 110.760 1.00 0.00 ? 288 U A P      1  
ATOM 9587   O OP1    . U A 1 299 ? 133.358 114.611 109.778 1.00 0.00 ? 288 U A OP1    1  
ATOM 9588   O OP2    . U A 1 299 ? 134.985 115.767 111.393 1.00 0.00 ? 288 U A OP2    1  
ATOM 9589   O "O5'"  . U A 1 299 ? 133.349 117.088 110.056 1.00 0.00 ? 288 U A "O5'"  1  
ATOM 9590   C "C5'"  . U A 1 299 ? 132.162 117.288 109.302 1.00 0.00 ? 288 U A "C5'"  1  
ATOM 9591   C "C4'"  . U A 1 299 ? 132.045 118.712 108.814 1.00 0.00 ? 288 U A "C4'"  1  
ATOM 9592   O "O4'"  . U A 1 299 ? 131.966 119.616 109.946 1.00 0.00 ? 288 U A "O4'"  1  
ATOM 9593   C "C3'"  . U A 1 299 ? 133.218 119.240 108.002 1.00 0.00 ? 288 U A "C3'"  1  
ATOM 9594   O "O3'"  . U A 1 299 ? 133.166 118.853 106.640 1.00 0.00 ? 288 U A "O3'"  1  
ATOM 9595   C "C2'"  . U A 1 299 ? 133.120 120.744 108.216 1.00 0.00 ? 288 U A "C2'"  1  
ATOM 9596   O "O2'"  . U A 1 299 ? 132.098 121.312 107.409 1.00 0.00 ? 288 U A "O2'"  1  
ATOM 9597   C "C1'"  . U A 1 299 ? 132.694 120.816 109.682 1.00 0.00 ? 288 U A "C1'"  1  
ATOM 9598   N N1     . U A 1 299 ? 133.854 120.912 110.600 1.00 0.00 ? 288 U A N1     1  
ATOM 9599   C C2     . U A 1 299 ? 134.453 122.152 110.733 1.00 0.00 ? 288 U A C2     1  
ATOM 9600   O O2     . U A 1 299 ? 134.072 123.142 110.136 1.00 0.00 ? 288 U A O2     1  
ATOM 9601   N N3     . U A 1 299 ? 135.523 122.193 111.595 1.00 0.00 ? 288 U A N3     1  
ATOM 9602   C C4     . U A 1 299 ? 136.046 121.145 112.321 1.00 0.00 ? 288 U A C4     1  
ATOM 9603   O O4     . U A 1 299 ? 137.016 121.343 113.055 1.00 0.00 ? 288 U A O4     1  
ATOM 9604   C C5     . U A 1 299 ? 135.375 119.894 112.135 1.00 0.00 ? 288 U A C5     1  
ATOM 9605   C C6     . U A 1 299 ? 134.331 119.825 111.303 1.00 0.00 ? 288 U A C6     1  
ATOM 9606   H "H5'"  . U A 1 299 ? 131.387 117.080 109.865 1.00 0.00 ? 288 U A "H5'"  1  
ATOM 9607   H "H5''" . U A 1 299 ? 132.168 116.687 108.529 1.00 0.00 ? 288 U A "H5''" 1  
ATOM 9608   H "H4'"  . U A 1 299 ? 131.228 118.796 108.281 1.00 0.00 ? 288 U A "H4'"  1  
ATOM 9609   H "H3'"  . U A 1 299 ? 134.056 118.915 108.396 1.00 0.00 ? 288 U A "H3'"  1  
ATOM 9610   H "H2'"  . U A 1 299 ? 133.984 121.185 108.070 1.00 0.00 ? 288 U A "H2'"  1  
ATOM 9611   H "HO2'" . U A 1 299 ? 131.895 120.699 106.672 1.00 0.00 ? 288 U A "HO2'" 1  
ATOM 9612   H "H1'"  . U A 1 299 ? 132.113 121.595 109.814 1.00 0.00 ? 288 U A "H1'"  1  
ATOM 9613   H H3     . U A 1 299 ? 135.962 123.062 111.702 1.00 0.00 ? 288 U A H3     1  
ATOM 9614   H H5     . U A 1 299 ? 135.680 119.094 112.614 1.00 0.00 ? 288 U A H5     1  
ATOM 9615   H H6     . U A 1 299 ? 133.890 118.958 111.192 1.00 0.00 ? 288 U A H6     1  
ATOM 9616   P P      . G A 1 300 ? 134.524 118.645 105.804 1.00 0.00 ? 289 G A P      1  
ATOM 9617   O OP1    . G A 1 300 ? 134.174 118.021 104.503 1.00 0.00 ? 289 G A OP1    1  
ATOM 9618   O OP2    . G A 1 300 ? 135.515 117.984 106.693 1.00 0.00 ? 289 G A OP2    1  
ATOM 9619   O "O5'"  . G A 1 300 ? 135.031 120.129 105.517 1.00 0.00 ? 289 G A "O5'"  1  
ATOM 9620   C "C5'"  . G A 1 300 ? 134.307 120.991 104.654 1.00 0.00 ? 289 G A "C5'"  1  
ATOM 9621   C "C4'"  . G A 1 300 ? 134.870 122.391 104.669 1.00 0.00 ? 289 G A "C4'"  1  
ATOM 9622   O "O4'"  . G A 1 300 ? 134.792 122.937 106.012 1.00 0.00 ? 289 G A "O4'"  1  
ATOM 9623   C "C3'"  . G A 1 300 ? 136.340 122.525 104.301 1.00 0.00 ? 289 G A "C3'"  1  
ATOM 9624   O "O3'"  . G A 1 300 ? 136.562 122.523 102.901 1.00 0.00 ? 289 G A "O3'"  1  
ATOM 9625   C "C2'"  . G A 1 300 ? 136.736 123.827 104.980 1.00 0.00 ? 289 G A "C2'"  1  
ATOM 9626   O "O2'"  . G A 1 300 ? 136.280 124.953 104.241 1.00 0.00 ? 289 G A "O2'"  1  
ATOM 9627   C "C1'"  . G A 1 300 ? 135.948 123.741 106.289 1.00 0.00 ? 289 G A "C1'"  1  
ATOM 9628   N N9     . G A 1 300 ? 136.746 123.147 107.379 1.00 0.00 ? 289 G A N9     1  
ATOM 9629   C C8     . G A 1 300 ? 136.602 121.897 107.927 1.00 0.00 ? 289 G A C8     1  
ATOM 9630   N N7     . G A 1 300 ? 137.459 121.652 108.882 1.00 0.00 ? 289 G A N7     1  
ATOM 9631   C C5     . G A 1 300 ? 138.216 122.811 108.969 1.00 0.00 ? 289 G A C5     1  
ATOM 9632   C C6     . G A 1 300 ? 139.299 123.142 109.825 1.00 0.00 ? 289 G A C6     1  
ATOM 9633   O O6     . G A 1 300 ? 139.823 122.452 110.704 1.00 0.00 ? 289 G A O6     1  
ATOM 9634   N N1     . G A 1 300 ? 139.776 124.426 109.576 1.00 0.00 ? 289 G A N1     1  
ATOM 9635   C C2     . G A 1 300 ? 139.275 125.284 108.625 1.00 0.00 ? 289 G A C2     1  
ATOM 9636   N N2     . G A 1 300 ? 139.869 126.481 108.534 1.00 0.00 ? 289 G A N2     1  
ATOM 9637   N N3     . G A 1 300 ? 138.267 124.987 107.822 1.00 0.00 ? 289 G A N3     1  
ATOM 9638   C C4     . G A 1 300 ? 137.789 123.745 108.047 1.00 0.00 ? 289 G A C4     1  
ATOM 9639   H "H5'"  . G A 1 300 ? 133.371 121.020 104.937 1.00 0.00 ? 289 G A "H5'"  1  
ATOM 9640   H "H5''" . G A 1 300 ? 134.351 120.640 103.739 1.00 0.00 ? 289 G A "H5''" 1  
ATOM 9641   H "H4'"  . G A 1 300 ? 134.339 122.954 104.066 1.00 0.00 ? 289 G A "H4'"  1  
ATOM 9642   H "H3'"  . G A 1 300 ? 136.841 121.787 104.706 1.00 0.00 ? 289 G A "H3'"  1  
ATOM 9643   H "H2'"  . G A 1 300 ? 137.702 123.869 105.145 1.00 0.00 ? 289 G A "H2'"  1  
ATOM 9644   H "HO2'" . G A 1 300 ? 136.099 124.676 103.321 1.00 0.00 ? 289 G A "HO2'" 1  
ATOM 9645   H "H1'"  . G A 1 300 ? 135.653 124.636 106.552 1.00 0.00 ? 289 G A "H1'"  1  
ATOM 9646   H H8     . G A 1 300 ? 135.926 121.250 107.635 1.00 0.00 ? 289 G A H8     1  
ATOM 9647   H H1     . G A 1 300 ? 140.526 124.740 110.121 1.00 0.00 ? 289 G A H1     1  
ATOM 9648   H H21    . G A 1 300 ? 140.616 126.709 109.125 1.00 0.00 ? 289 G A H21    1  
ATOM 9649   H H22    . G A 1 300 ? 139.554 127.135 107.874 1.00 0.00 ? 289 G A H22    1  
ATOM 9650   P P      . G A 1 301 ? 137.935 121.940 102.302 1.00 0.00 ? 290 G A P      1  
ATOM 9651   O OP1    . G A 1 301 ? 137.803 121.873 100.825 1.00 0.00 ? 290 G A OP1    1  
ATOM 9652   O OP2    . G A 1 301 ? 138.289 120.718 103.067 1.00 0.00 ? 290 G A OP2    1  
ATOM 9653   O "O5'"  . G A 1 301 ? 139.012 123.065 102.646 1.00 0.00 ? 290 G A "O5'"  1  
ATOM 9654   C "C5'"  . G A 1 301 ? 138.948 124.347 102.039 1.00 0.00 ? 290 G A "C5'"  1  
ATOM 9655   C "C4'"  . G A 1 301 ? 139.987 125.283 102.607 1.00 0.00 ? 290 G A "C4'"  1  
ATOM 9656   O "O4'"  . G A 1 301 ? 139.748 125.481 104.023 1.00 0.00 ? 290 G A "O4'"  1  
ATOM 9657   C "C3'"  . G A 1 301 ? 141.428 124.801 102.539 1.00 0.00 ? 290 G A "C3'"  1  
ATOM 9658   O "O3'"  . G A 1 301 ? 142.023 125.012 101.267 1.00 0.00 ? 290 G A "O3'"  1  
ATOM 9659   C "C2'"  . G A 1 301 ? 142.093 125.582 103.662 1.00 0.00 ? 290 G A "C2'"  1  
ATOM 9660   O "O2'"  . G A 1 301 ? 142.358 126.921 103.272 1.00 0.00 ? 290 G A "O2'"  1  
ATOM 9661   C "C1'"  . G A 1 301 ? 140.996 125.580 104.726 1.00 0.00 ? 290 G A "C1'"  1  
ATOM 9662   N N9     . G A 1 301 ? 141.150 124.474 105.687 1.00 0.00 ? 290 G A N9     1  
ATOM 9663   C C8     . G A 1 301 ? 140.374 123.345 105.791 1.00 0.00 ? 290 G A C8     1  
ATOM 9664   N N7     . G A 1 301 ? 140.761 122.542 106.743 1.00 0.00 ? 290 G A N7     1  
ATOM 9665   C C5     . G A 1 301 ? 141.860 123.175 107.303 1.00 0.00 ? 290 G A C5     1  
ATOM 9666   C C6     . G A 1 301 ? 142.701 122.781 108.375 1.00 0.00 ? 290 G A C6     1  
ATOM 9667   O O6     . G A 1 301 ? 142.639 121.760 109.069 1.00 0.00 ? 290 G A O6     1  
ATOM 9668   N N1     . G A 1 301 ? 143.699 123.721 108.617 1.00 0.00 ? 290 G A N1     1  
ATOM 9669   C C2     . G A 1 301 ? 143.869 124.890 107.913 1.00 0.00 ? 290 G A C2     1  
ATOM 9670   N N2     . G A 1 301 ? 144.890 125.669 108.293 1.00 0.00 ? 290 G A N2     1  
ATOM 9671   N N3     . G A 1 301 ? 143.091 125.268 106.912 1.00 0.00 ? 290 G A N3     1  
ATOM 9672   C C4     . G A 1 301 ? 142.115 124.370 106.661 1.00 0.00 ? 290 G A C4     1  
ATOM 9673   H "H5'"  . G A 1 301 ? 138.058 124.728 102.188 1.00 0.00 ? 290 G A "H5'"  1  
ATOM 9674   H "H5''" . G A 1 301 ? 139.096 124.252 101.074 1.00 0.00 ? 290 G A "H5''" 1  
ATOM 9675   H "H4'"  . G A 1 301 ? 139.919 126.146 102.148 1.00 0.00 ? 290 G A "H4'"  1  
ATOM 9676   H "H3'"  . G A 1 301 ? 141.458 123.844 102.751 1.00 0.00 ? 290 G A "H3'"  1  
ATOM 9677   H "H2'"  . G A 1 301 ? 142.903 125.131 103.983 1.00 0.00 ? 290 G A "H2'"  1  
ATOM 9678   H "HO2'" . G A 1 301 ? 142.357 126.976 102.295 1.00 0.00 ? 290 G A "HO2'" 1  
ATOM 9679   H "H1'"  . G A 1 301 ? 141.005 126.435 105.205 1.00 0.00 ? 290 G A "H1'"  1  
ATOM 9680   H H8     . G A 1 301 ? 139.607 123.163 105.210 1.00 0.00 ? 290 G A H8     1  
ATOM 9681   H H1     . G A 1 301 ? 144.330 123.532 109.342 1.00 0.00 ? 290 G A H1     1  
ATOM 9682   H H21    . G A 1 301 ? 145.470 125.398 109.034 1.00 0.00 ? 290 G A H21    1  
ATOM 9683   H H22    . G A 1 301 ? 145.059 126.517 107.827 1.00 0.00 ? 290 G A H22    1  
ATOM 9684   P P      . C A 1 302 ? 143.176 124.023 100.740 1.00 0.00 ? 291 C A P      1  
ATOM 9685   O OP1    . C A 1 302 ? 143.601 124.488 99.395  1.00 0.00 ? 291 C A OP1    1  
ATOM 9686   O OP2    . C A 1 302 ? 142.703 122.628 100.919 1.00 0.00 ? 291 C A OP2    1  
ATOM 9687   O "O5'"  . C A 1 302 ? 144.384 124.268 101.749 1.00 0.00 ? 291 C A "O5'"  1  
ATOM 9688   C "C5'"  . C A 1 302 ? 145.031 125.530 101.821 1.00 0.00 ? 291 C A "C5'"  1  
ATOM 9689   C "C4'"  . C A 1 302 ? 146.154 125.523 102.830 1.00 0.00 ? 291 C A "C4'"  1  
ATOM 9690   O "O4'"  . C A 1 302 ? 145.611 125.317 104.157 1.00 0.00 ? 291 C A "O4'"  1  
ATOM 9691   C "C3'"  . C A 1 302 ? 147.185 124.415 102.678 1.00 0.00 ? 291 C A "C3'"  1  
ATOM 9692   O "O3'"  . C A 1 302 ? 148.153 124.694 101.682 1.00 0.00 ? 291 C A "O3'"  1  
ATOM 9693   C "C2'"  . C A 1 302 ? 147.767 124.312 104.085 1.00 0.00 ? 291 C A "C2'"  1  
ATOM 9694   O "O2'"  . C A 1 302 ? 148.731 125.328 104.320 1.00 0.00 ? 291 C A "O2'"  1  
ATOM 9695   C "C1'"  . C A 1 302 ? 146.536 124.586 104.942 1.00 0.00 ? 291 C A "C1'"  1  
ATOM 9696   N N1     . C A 1 302 ? 145.884 123.338 105.409 1.00 0.00 ? 291 C A N1     1  
ATOM 9697   C C2     . C A 1 302 ? 146.387 122.714 106.558 1.00 0.00 ? 291 C A C2     1  
ATOM 9698   O O2     . C A 1 302 ? 147.355 123.220 107.147 1.00 0.00 ? 291 C A O2     1  
ATOM 9699   N N3     . C A 1 302 ? 145.810 121.575 107.004 1.00 0.00 ? 291 C A N3     1  
ATOM 9700   C C4     . C A 1 302 ? 144.772 121.052 106.353 1.00 0.00 ? 291 C A C4     1  
ATOM 9701   N N4     . C A 1 302 ? 144.235 119.926 106.831 1.00 0.00 ? 291 C A N4     1  
ATOM 9702   C C5     . C A 1 302 ? 144.238 121.660 105.182 1.00 0.00 ? 291 C A C5     1  
ATOM 9703   C C6     . C A 1 302 ? 144.815 122.788 104.750 1.00 0.00 ? 291 C A C6     1  
ATOM 9704   H "H5'"  . C A 1 302 ? 144.374 126.210 102.078 1.00 0.00 ? 291 C A "H5'"  1  
ATOM 9705   H "H5''" . C A 1 302 ? 145.395 125.753 100.939 1.00 0.00 ? 291 C A "H5''" 1  
ATOM 9706   H "H4'"  . C A 1 302 ? 146.608 126.391 102.801 1.00 0.00 ? 291 C A "H4'"  1  
ATOM 9707   H "H3'"  . C A 1 302 ? 146.728 123.577 102.457 1.00 0.00 ? 291 C A "H3'"  1  
ATOM 9708   H "H2'"  . C A 1 302 ? 148.132 123.419 104.257 1.00 0.00 ? 291 C A "H2'"  1  
ATOM 9709   H "HO2'" . C A 1 302 ? 149.623 124.974 104.124 1.00 0.00 ? 291 C A "HO2'" 1  
ATOM 9710   H "H1'"  . C A 1 302 ? 146.796 125.127 105.716 1.00 0.00 ? 291 C A "H1'"  1  
ATOM 9711   H H41    . C A 1 302 ? 144.606 119.510 107.637 1.00 0.00 ? 291 C A H41    1  
ATOM 9712   H H42    . C A 1 302 ? 143.471 119.517 106.375 1.00 0.00 ? 291 C A H42    1  
ATOM 9713   H H5     . C A 1 302 ? 143.473 121.269 104.711 1.00 0.00 ? 291 C A H5     1  
ATOM 9714   H H6     . C A 1 302 ? 144.462 123.222 103.946 1.00 0.00 ? 291 C A H6     1  
ATOM 9715   P P      . U A 1 303 ? 148.452 123.613 100.540 1.00 0.00 ? 292 U A P      1  
ATOM 9716   O OP1    . U A 1 303 ? 148.630 124.314 99.243  1.00 0.00 ? 292 U A OP1    1  
ATOM 9717   O OP2    . U A 1 303 ? 147.335 122.649 100.706 1.00 0.00 ? 292 U A OP2    1  
ATOM 9718   O "O5'"  . U A 1 303 ? 149.813 122.856 100.882 1.00 0.00 ? 292 U A "O5'"  1  
ATOM 9719   C "C5'"  . U A 1 303 ? 151.015 123.580 101.102 1.00 0.00 ? 292 U A "C5'"  1  
ATOM 9720   C "C4'"  . U A 1 303 ? 151.809 123.005 102.250 1.00 0.00 ? 292 U A "C4'"  1  
ATOM 9721   O "O4'"  . U A 1 303 ? 151.022 123.054 103.468 1.00 0.00 ? 292 U A "O4'"  1  
ATOM 9722   C "C3'"  . U A 1 303 ? 152.208 121.544 102.122 1.00 0.00 ? 292 U A "C3'"  1  
ATOM 9723   O "O3'"  . U A 1 303 ? 153.373 121.354 101.336 1.00 0.00 ? 292 U A "O3'"  1  
ATOM 9724   C "C2'"  . U A 1 303 ? 152.381 121.120 103.575 1.00 0.00 ? 292 U A "C2'"  1  
ATOM 9725   O "O2'"  . U A 1 303 ? 153.618 121.575 104.104 1.00 0.00 ? 292 U A "O2'"  1  
ATOM 9726   C "C1'"  . U A 1 303 ? 151.239 121.884 104.252 1.00 0.00 ? 292 U A "C1'"  1  
ATOM 9727   N N1     . U A 1 303 ? 149.996 121.080 104.334 1.00 0.00 ? 292 U A N1     1  
ATOM 9728   C C2     . U A 1 303 ? 149.932 120.119 105.324 1.00 0.00 ? 292 U A C2     1  
ATOM 9729   O O2     . U A 1 303 ? 150.838 119.911 106.111 1.00 0.00 ? 292 U A O2     1  
ATOM 9730   N N3     . U A 1 303 ? 148.762 119.401 105.364 1.00 0.00 ? 292 U A N3     1  
ATOM 9731   C C4     . U A 1 303 ? 147.670 119.541 104.532 1.00 0.00 ? 292 U A C4     1  
ATOM 9732   O O4     . U A 1 303 ? 146.689 118.818 104.695 1.00 0.00 ? 292 U A O4     1  
ATOM 9733   C C5     . U A 1 303 ? 147.808 120.557 103.532 1.00 0.00 ? 292 U A C5     1  
ATOM 9734   C C6     . U A 1 303 ? 148.938 121.272 103.472 1.00 0.00 ? 292 U A C6     1  
ATOM 9735   H "H5'"  . U A 1 303 ? 150.792 124.513 101.303 1.00 0.00 ? 292 U A "H5'"  1  
ATOM 9736   H "H5''" . U A 1 303 ? 151.560 123.548 100.290 1.00 0.00 ? 292 U A "H5''" 1  
ATOM 9737   H "H4'"  . U A 1 303 ? 152.618 123.547 102.372 1.00 0.00 ? 292 U A "H4'"  1  
ATOM 9738   H "H3'"  . U A 1 303 ? 151.467 121.040 101.726 1.00 0.00 ? 292 U A "H3'"  1  
ATOM 9739   H "H2'"  . U A 1 303 ? 152.274 120.151 103.680 1.00 0.00 ? 292 U A "H2'"  1  
ATOM 9740   H "HO2'" . U A 1 303 ? 154.226 121.777 103.362 1.00 0.00 ? 292 U A "HO2'" 1  
ATOM 9741   H "H1'"  . U A 1 303 ? 151.517 122.147 105.155 1.00 0.00 ? 292 U A "H1'"  1  
ATOM 9742   H H3     . U A 1 303 ? 148.695 118.713 106.056 1.00 0.00 ? 292 U A H3     1  
ATOM 9743   H H5     . U A 1 303 ? 147.081 120.728 102.899 1.00 0.00 ? 292 U A H5     1  
ATOM 9744   H H6     . U A 1 303 ? 149.007 121.958 102.780 1.00 0.00 ? 292 U A H6     1  
ATOM 9745   P P      . C A 1 304 ? 153.567 120.000 100.494 1.00 0.00 ? 293 C A P      1  
ATOM 9746   O OP1    . C A 1 304 ? 154.762 120.164 99.628  1.00 0.00 ? 293 C A OP1    1  
ATOM 9747   O OP2    . C A 1 304 ? 152.262 119.645 99.882  1.00 0.00 ? 293 C A OP2    1  
ATOM 9748   O "O5'"  . C A 1 304 ? 153.908 118.906 101.600 1.00 0.00 ? 293 C A "O5'"  1  
ATOM 9749   C "C5'"  . C A 1 304 ? 155.116 118.971 102.342 1.00 0.00 ? 293 C A "C5'"  1  
ATOM 9750   C "C4'"  . C A 1 304 ? 155.143 117.947 103.452 1.00 0.00 ? 293 C A "C4'"  1  
ATOM 9751   O "O4'"  . C A 1 304 ? 154.052 118.195 104.378 1.00 0.00 ? 293 C A "O4'"  1  
ATOM 9752   C "C3'"  . C A 1 304 ? 154.948 116.497 103.032 1.00 0.00 ? 293 C A "C3'"  1  
ATOM 9753   O "O3'"  . C A 1 304 ? 156.138 115.899 102.544 1.00 0.00 ? 293 C A "O3'"  1  
ATOM 9754   C "C2'"  . C A 1 304 ? 154.420 115.852 104.304 1.00 0.00 ? 293 C A "C2'"  1  
ATOM 9755   O "O2'"  . C A 1 304 ? 155.466 115.603 105.232 1.00 0.00 ? 293 C A "O2'"  1  
ATOM 9756   C "C1'"  . C A 1 304 ? 153.521 116.957 104.857 1.00 0.00 ? 293 C A "C1'"  1  
ATOM 9757   N N1     . C A 1 304 ? 152.106 116.796 104.436 1.00 0.00 ? 293 C A N1     1  
ATOM 9758   C C2     . C A 1 304 ? 151.325 115.833 105.085 1.00 0.00 ? 293 C A C2     1  
ATOM 9759   O O2     . C A 1 304 ? 151.832 115.147 105.985 1.00 0.00 ? 293 C A O2     1  
ATOM 9760   N N3     . C A 1 304 ? 150.033 115.667 104.720 1.00 0.00 ? 293 C A N3     1  
ATOM 9761   C C4     . C A 1 304 ? 149.509 116.416 103.749 1.00 0.00 ? 293 C A C4     1  
ATOM 9762   N N4     . C A 1 304 ? 148.231 116.219 103.425 1.00 0.00 ? 293 C A N4     1  
ATOM 9763   C C5     . C A 1 304 ? 150.278 117.405 103.071 1.00 0.00 ? 293 C A C5     1  
ATOM 9764   C C6     . C A 1 304 ? 151.555 117.560 103.442 1.00 0.00 ? 293 C A C6     1  
ATOM 9765   H "H5'"  . C A 1 304 ? 155.204 119.865 102.732 1.00 0.00 ? 293 C A "H5'"  1  
ATOM 9766   H "H5''" . C A 1 304 ? 155.869 118.806 101.741 1.00 0.00 ? 293 C A "H5''" 1  
ATOM 9767   H "H4'"  . C A 1 304 ? 155.994 118.027 103.934 1.00 0.00 ? 293 C A "H4'"  1  
ATOM 9768   H "H3'"  . C A 1 304 ? 154.258 116.454 102.338 1.00 0.00 ? 293 C A "H3'"  1  
ATOM 9769   H "H2'"  . C A 1 304 ? 153.908 115.038 104.109 1.00 0.00 ? 293 C A "H2'"  1  
ATOM 9770   H "HO2'" . C A 1 304 ? 156.322 115.596 104.755 1.00 0.00 ? 293 C A "HO2'" 1  
ATOM 9771   H "H1'"  . C A 1 304 ? 153.569 116.959 105.836 1.00 0.00 ? 293 C A "H1'"  1  
ATOM 9772   H H41    . C A 1 304 ? 147.704 115.537 103.894 1.00 0.00 ? 293 C A H41    1  
ATOM 9773   H H42    . C A 1 304 ? 147.817 116.754 102.716 1.00 0.00 ? 293 C A H42    1  
ATOM 9774   H H5     . C A 1 304 ? 149.884 117.952 102.359 1.00 0.00 ? 293 C A H5     1  
ATOM 9775   H H6     . C A 1 304 ? 152.099 118.235 102.984 1.00 0.00 ? 293 C A H6     1  
ATOM 9776   P P      . A A 1 305 ? 156.064 114.737 101.436 1.00 0.00 ? 294 A A P      1  
ATOM 9777   O OP1    . A A 1 305 ? 157.451 114.322 101.111 1.00 0.00 ? 294 A A OP1    1  
ATOM 9778   O OP2    . A A 1 305 ? 155.161 115.195 100.350 1.00 0.00 ? 294 A A OP2    1  
ATOM 9779   O "O5'"  . A A 1 305 ? 155.351 113.529 102.192 1.00 0.00 ? 294 A A "O5'"  1  
ATOM 9780   C "C5'"  . A A 1 305 ? 155.989 112.870 103.276 1.00 0.00 ? 294 A A "C5'"  1  
ATOM 9781   C "C4'"  . A A 1 305 ? 155.024 111.998 104.040 1.00 0.00 ? 294 A A "C4'"  1  
ATOM 9782   O "O4'"  . A A 1 305 ? 153.875 112.784 104.466 1.00 0.00 ? 294 A A "O4'"  1  
ATOM 9783   C "C3'"  . A A 1 305 ? 154.412 110.842 103.263 1.00 0.00 ? 294 A A "C3'"  1  
ATOM 9784   O "O3'"  . A A 1 305 ? 155.273 109.720 103.168 1.00 0.00 ? 294 A A "O3'"  1  
ATOM 9785   C "C2'"  . A A 1 305 ? 153.141 110.555 104.043 1.00 0.00 ? 294 A A "C2'"  1  
ATOM 9786   O "O2'"  . A A 1 305 ? 153.417 109.810 105.221 1.00 0.00 ? 294 A A "O2'"  1  
ATOM 9787   C "C1'"  . A A 1 305 ? 152.708 111.966 104.435 1.00 0.00 ? 294 A A "C1'"  1  
ATOM 9788   N N9     . A A 1 305 ? 151.706 112.518 103.504 1.00 0.00 ? 294 A A N9     1  
ATOM 9789   C C8     . A A 1 305 ? 151.845 113.583 102.648 1.00 0.00 ? 294 A A C8     1  
ATOM 9790   N N7     . A A 1 305 ? 150.771 113.838 101.942 1.00 0.00 ? 294 A A N7     1  
ATOM 9791   C C5     . A A 1 305 ? 149.862 112.875 102.361 1.00 0.00 ? 294 A A C5     1  
ATOM 9792   C C6     . A A 1 305 ? 148.531 112.605 101.992 1.00 0.00 ? 294 A A C6     1  
ATOM 9793   N N6     . A A 1 305 ? 147.859 113.309 101.080 1.00 0.00 ? 294 A A N6     1  
ATOM 9794   N N1     . A A 1 305 ? 147.909 111.573 102.601 1.00 0.00 ? 294 A A N1     1  
ATOM 9795   C C2     . A A 1 305 ? 148.583 110.866 103.516 1.00 0.00 ? 294 A A C2     1  
ATOM 9796   N N3     . A A 1 305 ? 149.833 111.023 103.947 1.00 0.00 ? 294 A A N3     1  
ATOM 9797   C C4     . A A 1 305 ? 150.425 112.057 103.322 1.00 0.00 ? 294 A A C4     1  
ATOM 9798   H "H5'"  . A A 1 305 ? 156.362 113.542 103.885 1.00 0.00 ? 294 A A "H5'"  1  
ATOM 9799   H "H5''" . A A 1 305 ? 156.717 112.314 102.930 1.00 0.00 ? 294 A A "H5''" 1  
ATOM 9800   H "H4'"  . A A 1 305 ? 155.477 111.642 104.833 1.00 0.00 ? 294 A A "H4'"  1  
ATOM 9801   H "H3'"  . A A 1 305 ? 154.173 111.149 102.363 1.00 0.00 ? 294 A A "H3'"  1  
ATOM 9802   H "H2'"  . A A 1 305 ? 152.468 110.113 103.484 1.00 0.00 ? 294 A A "H2'"  1  
ATOM 9803   H "HO2'" . A A 1 305 ? 152.571 109.593 105.666 1.00 0.00 ? 294 A A "HO2'" 1  
ATOM 9804   H "H1'"  . A A 1 305 ? 152.339 111.954 105.343 1.00 0.00 ? 294 A A "H1'"  1  
ATOM 9805   H H8     . A A 1 305 ? 152.671 114.105 102.572 1.00 0.00 ? 294 A A H8     1  
ATOM 9806   H H61    . A A 1 305 ? 146.932 113.073 100.864 1.00 0.00 ? 294 A A H61    1  
ATOM 9807   H H62    . A A 1 305 ? 148.290 114.062 100.625 1.00 0.00 ? 294 A A H62    1  
ATOM 9808   H H2     . A A 1 305 ? 148.086 110.128 103.928 1.00 0.00 ? 294 A A H2     1  
ATOM 9809   P P      . A A 1 306 ? 155.226 108.773 101.870 1.00 0.00 ? 295 A A P      1  
ATOM 9810   O OP1    . A A 1 306 ? 155.972 107.528 102.182 1.00 0.00 ? 295 A A OP1    1  
ATOM 9811   O OP2    . A A 1 306 ? 155.617 109.588 100.693 1.00 0.00 ? 295 A A OP2    1  
ATOM 9812   O "O5'"  . A A 1 306 ? 153.684 108.401 101.721 1.00 0.00 ? 295 A A "O5'"  1  
ATOM 9813   C "C5'"  . A A 1 306 ? 153.069 107.475 102.604 1.00 0.00 ? 295 A A "C5'"  1  
ATOM 9814   C "C4'"  . A A 1 306 ? 151.807 106.900 102.013 1.00 0.00 ? 295 A A "C4'"  1  
ATOM 9815   O "O4'"  . A A 1 306 ? 150.754 107.896 102.040 1.00 0.00 ? 295 A A "O4'"  1  
ATOM 9816   C "C3'"  . A A 1 306 ? 151.887 106.472 100.555 1.00 0.00 ? 295 A A "C3'"  1  
ATOM 9817   O "O3'"  . A A 1 306 ? 152.455 105.186 100.385 1.00 0.00 ? 295 A A "O3'"  1  
ATOM 9818   C "C2'"  . A A 1 306 ? 150.430 106.527 100.108 1.00 0.00 ? 295 A A "C2'"  1  
ATOM 9819   O "O2'"  . A A 1 306 ? 149.726 105.359 100.503 1.00 0.00 ? 295 A A "O2'"  1  
ATOM 9820   C "C1'"  . A A 1 306 ? 149.907 107.717 100.914 1.00 0.00 ? 295 A A "C1'"  1  
ATOM 9821   N N9     . A A 1 306 ? 149.891 108.962 100.122 1.00 0.00 ? 295 A A N9     1  
ATOM 9822   C C8     . A A 1 306 ? 150.680 110.074 100.280 1.00 0.00 ? 295 A A C8     1  
ATOM 9823   N N7     . A A 1 306 ? 150.430 111.027 99.417  1.00 0.00 ? 295 A A N7     1  
ATOM 9824   C C5     . A A 1 306 ? 149.406 110.508 98.635  1.00 0.00 ? 295 A A C5     1  
ATOM 9825   C C6     . A A 1 306 ? 148.692 111.029 97.542  1.00 0.00 ? 295 A A C6     1  
ATOM 9826   N N6     . A A 1 306 ? 148.911 112.240 97.024  1.00 0.00 ? 295 A A N6     1  
ATOM 9827   N N1     . A A 1 306 ? 147.733 110.254 96.991  1.00 0.00 ? 295 A A N1     1  
ATOM 9828   C C2     . A A 1 306 ? 147.513 109.039 97.510  1.00 0.00 ? 295 A A C2     1  
ATOM 9829   N N3     . A A 1 306 ? 148.117 108.440 98.534  1.00 0.00 ? 295 A A N3     1  
ATOM 9830   C C4     . A A 1 306 ? 149.065 109.237 99.059  1.00 0.00 ? 295 A A C4     1  
ATOM 9831   H "H5'"  . A A 1 306 ? 152.850 107.930 103.444 1.00 0.00 ? 295 A A "H5'"  1  
ATOM 9832   H "H5''" . A A 1 306 ? 153.696 106.745 102.791 1.00 0.00 ? 295 A A "H5''" 1  
ATOM 9833   H "H4'"  . A A 1 306 ? 151.528 106.128 102.549 1.00 0.00 ? 295 A A "H4'"  1  
ATOM 9834   H "H3'"  . A A 1 306 ? 152.400 107.139 100.052 1.00 0.00 ? 295 A A "H3'"  1  
ATOM 9835   H "H2'"  . A A 1 306 ? 150.356 106.688 99.144  1.00 0.00 ? 295 A A "H2'"  1  
ATOM 9836   H "HO2'" . A A 1 306 ? 149.410 104.892 99.702  1.00 0.00 ? 295 A A "HO2'" 1  
ATOM 9837   H "H1'"  . A A 1 306 ? 149.001 107.522 101.233 1.00 0.00 ? 295 A A "H1'"  1  
ATOM 9838   H H8     . A A 1 306 ? 151.368 110.148 100.975 1.00 0.00 ? 295 A A H8     1  
ATOM 9839   H H61    . A A 1 306 ? 148.380 112.549 96.260  1.00 0.00 ? 295 A A H61    1  
ATOM 9840   H H62    . A A 1 306 ? 149.601 112.820 97.407  1.00 0.00 ? 295 A A H62    1  
ATOM 9841   H H2     . A A 1 306 ? 146.807 108.517 97.074  1.00 0.00 ? 295 A A H2     1  
ATOM 9842   P P      . C A 1 307 ? 152.386 104.470 98.952  1.00 0.00 ? 296 C A P      1  
ATOM 9843   O OP1    . C A 1 307 ? 153.426 103.412 98.885  1.00 0.00 ? 296 C A OP1    1  
ATOM 9844   O OP2    . C A 1 307 ? 152.449 105.619 98.014  1.00 0.00 ? 296 C A OP2    1  
ATOM 9845   O "O5'"  . C A 1 307 ? 150.964 103.773 98.785  1.00 0.00 ? 296 C A "O5'"  1  
ATOM 9846   C "C5'"  . C A 1 307 ? 150.725 102.843 97.738  1.00 0.00 ? 296 C A "C5'"  1  
ATOM 9847   C "C4'"  . C A 1 307 ? 149.545 103.249 96.889  1.00 0.00 ? 296 C A "C4'"  1  
ATOM 9848   O "O4'"  . C A 1 307 ? 149.050 104.545 97.315  1.00 0.00 ? 296 C A "O4'"  1  
ATOM 9849   C "C3'"  . C A 1 307 ? 149.819 103.431 95.404  1.00 0.00 ? 296 C A "C3'"  1  
ATOM 9850   O "O3'"  . C A 1 307 ? 149.836 102.207 94.689  1.00 0.00 ? 296 C A "O3'"  1  
ATOM 9851   C "C2'"  . C A 1 307 ? 148.706 104.375 94.971  1.00 0.00 ? 296 C A "C2'"  1  
ATOM 9852   O "O2'"  . C A 1 307 ? 147.476 103.683 94.820  1.00 0.00 ? 296 C A "O2'"  1  
ATOM 9853   C "C1'"  . C A 1 307 ? 148.609 105.305 96.184  1.00 0.00 ? 296 C A "C1'"  1  
ATOM 9854   N N1     . C A 1 307 ? 149.423 106.533 96.018  1.00 0.00 ? 296 C A N1     1  
ATOM 9855   C C2     . C A 1 307 ? 148.937 107.546 95.180  1.00 0.00 ? 296 C A C2     1  
ATOM 9856   O O2     . C A 1 307 ? 147.847 107.388 94.608  1.00 0.00 ? 296 C A O2     1  
ATOM 9857   N N3     . C A 1 307 ? 149.659 108.676 95.013  1.00 0.00 ? 296 C A N3     1  
ATOM 9858   C C4     . C A 1 307 ? 150.825 108.824 95.640  1.00 0.00 ? 296 C A C4     1  
ATOM 9859   N N4     . C A 1 307 ? 151.505 109.958 95.445  1.00 0.00 ? 296 C A N4     1  
ATOM 9860   C C5     . C A 1 307 ? 151.350 107.814 96.496  1.00 0.00 ? 296 C A C5     1  
ATOM 9861   C C6     . C A 1 307 ? 150.624 106.699 96.655  1.00 0.00 ? 296 C A C6     1  
ATOM 9862   H "H5'"  . C A 1 307 ? 150.548 101.961 98.129  1.00 0.00 ? 296 C A "H5'"  1  
ATOM 9863   H "H5''" . C A 1 307 ? 151.522 102.786 97.171  1.00 0.00 ? 296 C A "H5''" 1  
ATOM 9864   H "H4'"  . C A 1 307 ? 148.832 102.586 97.001  1.00 0.00 ? 296 C A "H4'"  1  
ATOM 9865   H "H3'"  . C A 1 307 ? 150.683 103.881 95.290  1.00 0.00 ? 296 C A "H3'"  1  
ATOM 9866   H "H2'"  . C A 1 307 ? 148.947 104.869 94.160  1.00 0.00 ? 296 C A "H2'"  1  
ATOM 9867   H "HO2'" . C A 1 307 ? 147.659 102.727 94.710  1.00 0.00 ? 296 C A "HO2'" 1  
ATOM 9868   H "H1'"  . C A 1 307 ? 147.673 105.553 96.327  1.00 0.00 ? 296 C A "H1'"  1  
ATOM 9869   H H41    . C A 1 307 ? 151.141 110.649 94.854  1.00 0.00 ? 296 C A H41    1  
ATOM 9870   H H42    . C A 1 307 ? 152.365 110.096 95.892  1.00 0.00 ? 296 C A H42    1  
ATOM 9871   H H5     . C A 1 307 ? 152.208 107.931 96.954  1.00 0.00 ? 296 C A H5     1  
ATOM 9872   H H6     . C A 1 307 ? 150.966 105.992 97.240  1.00 0.00 ? 296 C A H6     1  
ATOM 9873   P P      . G A 1 308 ? 150.596 102.106 93.275  1.00 0.00 ? 297 G A P      1  
ATOM 9874   O OP1    . G A 1 308 ? 150.597 100.682 92.853  1.00 0.00 ? 297 G A OP1    1  
ATOM 9875   O OP2    . G A 1 308 ? 151.880 102.841 93.390  1.00 0.00 ? 297 G A OP2    1  
ATOM 9876   O "O5'"  . G A 1 308 ? 149.654 102.914 92.274  1.00 0.00 ? 297 G A "O5'"  1  
ATOM 9877   C "C5'"  . G A 1 308 ? 148.389 102.400 91.887  1.00 0.00 ? 297 G A "C5'"  1  
ATOM 9878   C "C4'"  . G A 1 308 ? 147.704 103.303 90.891  1.00 0.00 ? 297 G A "C4'"  1  
ATOM 9879   O "O4'"  . G A 1 308 ? 147.473 104.605 91.489  1.00 0.00 ? 297 G A "O4'"  1  
ATOM 9880   C "C3'"  . G A 1 308 ? 148.484 103.610 89.623  1.00 0.00 ? 297 G A "C3'"  1  
ATOM 9881   O "O3'"  . G A 1 308 ? 148.441 102.556 88.675  1.00 0.00 ? 297 G A "O3'"  1  
ATOM 9882   C "C2'"  . G A 1 308 ? 147.832 104.897 89.134  1.00 0.00 ? 297 G A "C2'"  1  
ATOM 9883   O "O2'"  . G A 1 308 ? 146.592 104.634 88.493  1.00 0.00 ? 297 G A "O2'"  1  
ATOM 9884   C "C1'"  . G A 1 308 ? 147.565 105.623 90.453  1.00 0.00 ? 297 G A "C1'"  1  
ATOM 9885   N N9     . G A 1 308 ? 148.617 106.608 90.766  1.00 0.00 ? 297 G A N9     1  
ATOM 9886   C C8     . G A 1 308 ? 149.596 106.504 91.729  1.00 0.00 ? 297 G A C8     1  
ATOM 9887   N N7     . G A 1 308 ? 150.386 107.542 91.769  1.00 0.00 ? 297 G A N7     1  
ATOM 9888   C C5     . G A 1 308 ? 149.905 108.382 90.776  1.00 0.00 ? 297 G A C5     1  
ATOM 9889   C C6     . G A 1 308 ? 150.357 109.657 90.348  1.00 0.00 ? 297 G A C6     1  
ATOM 9890   O O6     . G A 1 308 ? 151.308 110.321 90.781  1.00 0.00 ? 297 G A O6     1  
ATOM 9891   N N1     . G A 1 308 ? 149.581 110.157 89.308  1.00 0.00 ? 297 G A N1     1  
ATOM 9892   C C2     . G A 1 308 ? 148.503 109.512 88.749  1.00 0.00 ? 297 G A C2     1  
ATOM 9893   N N2     . G A 1 308 ? 147.878 110.155 87.753  1.00 0.00 ? 297 G A N2     1  
ATOM 9894   N N3     . G A 1 308 ? 148.072 108.322 89.137  1.00 0.00 ? 297 G A N3     1  
ATOM 9895   C C4     . G A 1 308 ? 148.813 107.821 90.147  1.00 0.00 ? 297 G A C4     1  
ATOM 9896   H "H5'"  . G A 1 308 ? 147.823 102.311 92.680  1.00 0.00 ? 297 G A "H5'"  1  
ATOM 9897   H "H5''" . G A 1 308 ? 148.514 101.515 91.483  1.00 0.00 ? 297 G A "H5''" 1  
ATOM 9898   H "H4'"  . G A 1 308 ? 146.841 102.908 90.645  1.00 0.00 ? 297 G A "H4'"  1  
ATOM 9899   H "H3'"  . G A 1 308 ? 149.420 103.794 89.854  1.00 0.00 ? 297 G A "H3'"  1  
ATOM 9900   H "H2'"  . G A 1 308 ? 148.436 105.409 88.557  1.00 0.00 ? 297 G A "H2'"  1  
ATOM 9901   H "HO2'" . G A 1 308 ? 146.566 103.696 88.219  1.00 0.00 ? 297 G A "HO2'" 1  
ATOM 9902   H "H1'"  . G A 1 308 ? 146.698 106.075 90.406  1.00 0.00 ? 297 G A "H1'"  1  
ATOM 9903   H H8     . G A 1 308 ? 149.689 105.732 92.321  1.00 0.00 ? 297 G A H8     1  
ATOM 9904   H H1     . G A 1 308 ? 149.821 111.036 88.950  1.00 0.00 ? 297 G A H1     1  
ATOM 9905   H H21    . G A 1 308 ? 148.192 111.034 87.459  1.00 0.00 ? 297 G A H21    1  
ATOM 9906   H H22    . G A 1 308 ? 147.103 109.743 87.315  1.00 0.00 ? 297 G A H22    1  
ATOM 9907   P P      . G A 1 309 ? 149.674 102.323 87.670  1.00 0.00 ? 298 G A P      1  
ATOM 9908   O OP1    . G A 1 309 ? 149.371 101.128 86.842  1.00 0.00 ? 298 G A OP1    1  
ATOM 9909   O OP2    . G A 1 309 ? 150.928 102.367 88.463  1.00 0.00 ? 298 G A OP2    1  
ATOM 9910   O "O5'"  . G A 1 309 ? 149.643 103.602 86.720  1.00 0.00 ? 298 G A "O5'"  1  
ATOM 9911   C "C5'"  . G A 1 309 ? 148.559 103.824 85.829  1.00 0.00 ? 298 G A "C5'"  1  
ATOM 9912   C "C4'"  . G A 1 309 ? 148.673 105.162 85.143  1.00 0.00 ? 298 G A "C4'"  1  
ATOM 9913   O "O4'"  . G A 1 309 ? 148.624 106.228 86.128  1.00 0.00 ? 298 G A "O4'"  1  
ATOM 9914   C "C3'"  . G A 1 309 ? 149.968 105.419 84.387  1.00 0.00 ? 298 G A "C3'"  1  
ATOM 9915   O "O3'"  . G A 1 309 ? 149.994 104.802 83.110  1.00 0.00 ? 298 G A "O3'"  1  
ATOM 9916   C "C2'"  . G A 1 309 ? 150.029 106.937 84.335  1.00 0.00 ? 298 G A "C2'"  1  
ATOM 9917   O "O2'"  . G A 1 309 ? 149.163 107.454 83.334  1.00 0.00 ? 298 G A "O2'"  1  
ATOM 9918   C "C1'"  . G A 1 309 ? 149.476 107.311 85.710  1.00 0.00 ? 298 G A "C1'"  1  
ATOM 9919   N N9     . G A 1 309 ? 150.549 107.553 86.694  1.00 0.00 ? 298 G A N9     1  
ATOM 9920   C C8     . G A 1 309 ? 150.927 106.734 87.731  1.00 0.00 ? 298 G A C8     1  
ATOM 9921   N N7     . G A 1 309 ? 151.911 107.219 88.435  1.00 0.00 ? 298 G A N7     1  
ATOM 9922   C C5     . G A 1 309 ? 152.204 108.431 87.828  1.00 0.00 ? 298 G A C5     1  
ATOM 9923   C C6     . G A 1 309 ? 153.183 109.408 88.149  1.00 0.00 ? 298 G A C6     1  
ATOM 9924   O O6     . G A 1 309 ? 154.014 109.393 89.064  1.00 0.00 ? 298 G A O6     1  
ATOM 9925   N N1     . G A 1 309 ? 153.135 110.487 87.274  1.00 0.00 ? 298 G A N1     1  
ATOM 9926   C C2     . G A 1 309 ? 152.258 110.613 86.223  1.00 0.00 ? 298 G A C2     1  
ATOM 9927   N N2     . G A 1 309 ? 152.365 111.731 85.489  1.00 0.00 ? 298 G A N2     1  
ATOM 9928   N N3     . G A 1 309 ? 151.342 109.712 85.914  1.00 0.00 ? 298 G A N3     1  
ATOM 9929   C C4     . G A 1 309 ? 151.372 108.653 86.752  1.00 0.00 ? 298 G A C4     1  
ATOM 9930   H "H5'"  . G A 1 309 ? 147.721 103.795 86.336  1.00 0.00 ? 298 G A "H5'"  1  
ATOM 9931   H "H5''" . G A 1 309 ? 148.551 103.117 85.154  1.00 0.00 ? 298 G A "H5''" 1  
ATOM 9932   H "H4'"  . G A 1 309 ? 147.919 105.267 84.526  1.00 0.00 ? 298 G A "H4'"  1  
ATOM 9933   H "H3'"  . G A 1 309 ? 150.721 105.084 84.920  1.00 0.00 ? 298 G A "H3'"  1  
ATOM 9934   H "H2'"  . G A 1 309 ? 150.949 107.258 84.219  1.00 0.00 ? 298 G A "H2'"  1  
ATOM 9935   H "HO2'" . G A 1 309 ? 148.960 106.744 82.690  1.00 0.00 ? 298 G A "HO2'" 1  
ATOM 9936   H "H1'"  . G A 1 309 ? 148.920 108.114 85.631  1.00 0.00 ? 298 G A "H1'"  1  
ATOM 9937   H H8     . G A 1 309 ? 150.499 105.873 87.922  1.00 0.00 ? 298 G A H8     1  
ATOM 9938   H H1     . G A 1 309 ? 153.777 111.214 87.418  1.00 0.00 ? 298 G A H1     1  
ATOM 9939   H H21    . G A 1 309 ? 153.040 112.404 85.710  1.00 0.00 ? 298 G A H21    1  
ATOM 9940   H H22    . G A 1 309 ? 151.766 111.875 84.725  1.00 0.00 ? 298 G A H22    1  
ATOM 9941   P P      . C A 1 310 ? 151.393 104.345 82.464  1.00 0.00 ? 299 C A P      1  
ATOM 9942   O OP1    . C A 1 310 ? 151.100 103.615 81.203  1.00 0.00 ? 299 C A OP1    1  
ATOM 9943   O OP2    . C A 1 310 ? 152.196 103.686 83.523  1.00 0.00 ? 299 C A OP2    1  
ATOM 9944   O "O5'"  . C A 1 310 ? 152.110 105.716 82.083  1.00 0.00 ? 299 C A "O5'"  1  
ATOM 9945   C "C5'"  . C A 1 310 ? 151.599 106.544 81.048  1.00 0.00 ? 299 C A "C5'"  1  
ATOM 9946   C "C4'"  . C A 1 310 ? 152.374 107.834 80.933  1.00 0.00 ? 299 C A "C4'"  1  
ATOM 9947   O "O4'"  . C A 1 310 ? 152.273 108.584 82.171  1.00 0.00 ? 299 C A "O4'"  1  
ATOM 9948   C "C3'"  . C A 1 310 ? 153.872 107.697 80.705  1.00 0.00 ? 299 C A "C3'"  1  
ATOM 9949   O "O3'"  . C A 1 310 ? 154.205 107.421 79.356  1.00 0.00 ? 299 C A "O3'"  1  
ATOM 9950   C "C2'"  . C A 1 310 ? 154.407 109.031 81.207  1.00 0.00 ? 299 C A "C2'"  1  
ATOM 9951   O "O2'"  . C A 1 310 ? 154.199 110.062 80.253  1.00 0.00 ? 299 C A "O2'"  1  
ATOM 9952   C "C1'"  . C A 1 310 ? 153.506 109.285 82.417  1.00 0.00 ? 299 C A "C1'"  1  
ATOM 9953   N N1     . C A 1 310 ? 154.128 108.836 83.687  1.00 0.00 ? 299 C A N1     1  
ATOM 9954   C C2     . C A 1 310 ? 155.109 109.646 84.269  1.00 0.00 ? 299 C A C2     1  
ATOM 9955   O O2     . C A 1 310 ? 155.432 110.705 83.711  1.00 0.00 ? 299 C A O2     1  
ATOM 9956   N N3     . C A 1 310 ? 155.693 109.259 85.428  1.00 0.00 ? 299 C A N3     1  
ATOM 9957   C C4     . C A 1 310 ? 155.329 108.115 86.009  1.00 0.00 ? 299 C A C4     1  
ATOM 9958   N N4     . C A 1 310 ? 155.930 107.774 87.153  1.00 0.00 ? 299 C A N4     1  
ATOM 9959   C C5     . C A 1 310 ? 154.334 107.270 85.443  1.00 0.00 ? 299 C A C5     1  
ATOM 9960   C C6     . C A 1 310 ? 153.764 107.663 84.296  1.00 0.00 ? 299 C A C6     1  
ATOM 9961   H "H5'"  . C A 1 310 ? 150.661 106.752 81.240  1.00 0.00 ? 299 C A "H5'"  1  
ATOM 9962   H "H5''" . C A 1 310 ? 151.652 106.062 80.197  1.00 0.00 ? 299 C A "H5''" 1  
ATOM 9963   H "H4'"  . C A 1 310 ? 151.989 108.369 80.205  1.00 0.00 ? 299 C A "H4'"  1  
ATOM 9964   H "H3'"  . C A 1 310 ? 154.218 106.979 81.277  1.00 0.00 ? 299 C A "H3'"  1  
ATOM 9965   H "H2'"  . C A 1 310 ? 155.349 108.965 81.471  1.00 0.00 ? 299 C A "H2'"  1  
ATOM 9966   H "HO2'" . C A 1 310 ? 154.056 109.657 79.373  1.00 0.00 ? 299 C A "HO2'" 1  
ATOM 9967   H "H1'"  . C A 1 310 ? 153.302 110.242 82.476  1.00 0.00 ? 299 C A "H1'"  1  
ATOM 9968   H H41    . C A 1 310 ? 156.616 108.357 87.537  1.00 0.00 ? 299 C A H41    1  
ATOM 9969   H H42    . C A 1 310 ? 155.686 106.938 87.603  1.00 0.00 ? 299 C A H42    1  
ATOM 9970   H H5     . C A 1 310 ? 154.072 106.431 85.878  1.00 0.00 ? 299 C A H5     1  
ATOM 9971   H H6     . C A 1 310 ? 153.077 107.095 83.892  1.00 0.00 ? 299 C A H6     1  
ATOM 9972   P P      . G A 1 311 ? 155.571 106.653 79.001  1.00 0.00 ? 300 G A P      1  
ATOM 9973   O OP1    . G A 1 311 ? 155.581 106.381 77.541  1.00 0.00 ? 300 G A OP1    1  
ATOM 9974   O OP2    . G A 1 311 ? 155.727 105.528 79.958  1.00 0.00 ? 300 G A OP2    1  
ATOM 9975   O "O5'"  . G A 1 311 ? 156.709 107.724 79.310  1.00 0.00 ? 300 G A "O5'"  1  
ATOM 9976   C "C5'"  . G A 1 311 ? 156.834 108.901 78.524  1.00 0.00 ? 300 G A "C5'"  1  
ATOM 9977   C "C4'"  . G A 1 311 ? 157.891 109.824 79.075  1.00 0.00 ? 300 G A "C4'"  1  
ATOM 9978   O "O4'"  . G A 1 311 ? 157.532 110.236 80.419  1.00 0.00 ? 300 G A "O4'"  1  
ATOM 9979   C "C3'"  . G A 1 311 ? 159.283 109.229 79.230  1.00 0.00 ? 300 G A "C3'"  1  
ATOM 9980   O "O3'"  . G A 1 311 ? 160.005 109.182 78.010  1.00 0.00 ? 300 G A "O3'"  1  
ATOM 9981   C "C2'"  . G A 1 311 ? 159.916 110.132 80.281  1.00 0.00 ? 300 G A "C2'"  1  
ATOM 9982   O "O2'"  . G A 1 311 ? 160.337 111.363 79.713  1.00 0.00 ? 300 G A "O2'"  1  
ATOM 9983   C "C1'"  . G A 1 311 ? 158.732 110.392 81.211  1.00 0.00 ? 300 G A "C1'"  1  
ATOM 9984   N N9     . G A 1 311 ? 158.730 109.483 82.373  1.00 0.00 ? 300 G A N9     1  
ATOM 9985   C C8     . G A 1 311 ? 157.908 108.403 82.581  1.00 0.00 ? 300 G A C8     1  
ATOM 9986   N N7     . G A 1 311 ? 158.144 107.789 83.711  1.00 0.00 ? 300 G A N7     1  
ATOM 9987   C C5     . G A 1 311 ? 159.183 108.510 84.283  1.00 0.00 ? 300 G A C5     1  
ATOM 9988   C C6     . G A 1 311 ? 159.866 108.318 85.512  1.00 0.00 ? 300 G A C6     1  
ATOM 9989   O O6     . G A 1 311 ? 159.682 107.446 86.368  1.00 0.00 ? 300 G A O6     1  
ATOM 9990   N N1     . G A 1 311 ? 160.855 109.280 85.703  1.00 0.00 ? 300 G A N1     1  
ATOM 9991   C C2     . G A 1 311 ? 161.149 110.292 84.823  1.00 0.00 ? 300 G A C2     1  
ATOM 9992   N N2     . G A 1 311 ? 162.139 111.123 85.184  1.00 0.00 ? 300 G A N2     1  
ATOM 9993   N N3     . G A 1 311 ? 160.520 110.481 83.676  1.00 0.00 ? 300 G A N3     1  
ATOM 9994   C C4     . G A 1 311 ? 159.557 109.559 83.471  1.00 0.00 ? 300 G A C4     1  
ATOM 9995   H "H5'"  . G A 1 311 ? 155.975 109.371 78.512  1.00 0.00 ? 300 G A "H5'"  1  
ATOM 9996   H "H5''" . G A 1 311 ? 157.074 108.651 77.608  1.00 0.00 ? 300 G A "H5''" 1  
ATOM 9997   H "H4'"  . G A 1 311 ? 157.947 110.619 78.504  1.00 0.00 ? 300 G A "H4'"  1  
ATOM 9998   H "H3'"  . G A 1 311 ? 159.206 108.320 79.592  1.00 0.00 ? 300 G A "H3'"  1  
ATOM 9999   H "H2'"  . G A 1 311 ? 160.648 109.679 80.748  1.00 0.00 ? 300 G A "H2'"  1  
ATOM 10000  H "HO2'" . G A 1 311 ? 160.430 111.254 78.743  1.00 0.00 ? 300 G A "HO2'" 1  
ATOM 10001  H "H1'"  . G A 1 311 ? 158.760 111.321 81.521  1.00 0.00 ? 300 G A "H1'"  1  
ATOM 10002  H H8     . G A 1 311 ? 157.216 108.119 81.948  1.00 0.00 ? 300 G A H8     1  
ATOM 10003  H H1     . G A 1 311 ? 161.380 109.225 86.529  1.00 0.00 ? 300 G A H1     1  
ATOM 10004  H H21    . G A 1 311 ? 162.610 110.991 86.032  1.00 0.00 ? 300 G A H21    1  
ATOM 10005  H H22    . G A 1 311 ? 162.394 111.867 84.595  1.00 0.00 ? 300 G A H22    1  
ATOM 10006  P P      . C A 1 312 ? 161.132 108.062 77.783  1.00 0.00 ? 301 C A P      1  
ATOM 10007  O OP1    . C A 1 312 ? 161.625 108.181 76.385  1.00 0.00 ? 301 C A OP1    1  
ATOM 10008  O OP2    . C A 1 312 ? 160.598 106.764 78.263  1.00 0.00 ? 301 C A OP2    1  
ATOM 10009  O "O5'"  . C A 1 312 ? 162.315 108.499 78.758  1.00 0.00 ? 301 C A "O5'"  1  
ATOM 10010  C "C5'"  . C A 1 312 ? 163.071 109.674 78.507  1.00 0.00 ? 301 C A "C5'"  1  
ATOM 10011  C "C4'"  . C A 1 312 ? 164.053 109.952 79.617  1.00 0.00 ? 301 C A "C4'"  1  
ATOM 10012  O "O4'"  . C A 1 312 ? 163.347 110.139 80.870  1.00 0.00 ? 301 C A "O4'"  1  
ATOM 10013  C "C3'"  . C A 1 312 ? 165.053 108.844 79.921  1.00 0.00 ? 301 C A "C3'"  1  
ATOM 10014  O "O3'"  . C A 1 312 ? 166.139 108.812 79.010  1.00 0.00 ? 301 C A "O3'"  1  
ATOM 10015  C "C2'"  . C A 1 312 ? 165.465 109.153 81.353  1.00 0.00 ? 301 C A "C2'"  1  
ATOM 10016  O "O2'"  . C A 1 312 ? 166.399 110.221 81.403  1.00 0.00 ? 301 C A "O2'"  1  
ATOM 10017  C "C1'"  . C A 1 312 ? 164.141 109.623 81.957  1.00 0.00 ? 301 C A "C1'"  1  
ATOM 10018  N N1     . C A 1 312 ? 163.425 108.531 82.664  1.00 0.00 ? 301 C A N1     1  
ATOM 10019  C C2     . C A 1 312 ? 163.855 108.178 83.948  1.00 0.00 ? 301 C A C2     1  
ATOM 10020  O O2     . C A 1 312 ? 164.813 108.778 84.455  1.00 0.00 ? 301 C A O2     1  
ATOM 10021  N N3     . C A 1 312 ? 163.219 107.187 84.614  1.00 0.00 ? 301 C A N3     1  
ATOM 10022  C C4     . C A 1 312 ? 162.192 106.554 84.049  1.00 0.00 ? 301 C A C4     1  
ATOM 10023  N N4     . C A 1 312 ? 161.593 105.582 84.741  1.00 0.00 ? 301 C A N4     1  
ATOM 10024  C C5     . C A 1 312 ? 161.731 106.889 82.745  1.00 0.00 ? 301 C A C5     1  
ATOM 10025  C C6     . C A 1 312 ? 162.367 107.873 82.095  1.00 0.00 ? 301 C A C6     1  
ATOM 10026  H "H5'"  . C A 1 312 ? 162.461 110.436 78.423  1.00 0.00 ? 301 C A "H5'"  1  
ATOM 10027  H "H5''" . C A 1 312 ? 163.562 109.564 77.666  1.00 0.00 ? 301 C A "H5''" 1  
ATOM 10028  H "H4'"  . C A 1 312 ? 164.546 110.773 79.406  1.00 0.00 ? 301 C A "H4'"  1  
ATOM 10029  H "H3'"  . C A 1 312 ? 164.592 107.980 79.900  1.00 0.00 ? 301 C A "H3'"  1  
ATOM 10030  H "H2'"  . C A 1 312 ? 165.804 108.353 81.811  1.00 0.00 ? 301 C A "H2'"  1  
ATOM 10031  H "HO2'" . C A 1 312 ? 166.818 110.320 80.523  1.00 0.00 ? 301 C A "HO2'" 1  
ATOM 10032  H "H1'"  . C A 1 312 ? 164.311 110.358 82.583  1.00 0.00 ? 301 C A "H1'"  1  
ATOM 10033  H H41    . C A 1 312 ? 161.914 105.353 85.638  1.00 0.00 ? 301 C A H41    1  
ATOM 10034  H H42    . C A 1 312 ? 160.835 105.098 84.354  1.00 0.00 ? 301 C A H42    1  
ATOM 10035  H H5     . C A 1 312 ? 160.973 106.419 82.338  1.00 0.00 ? 301 C A H5     1  
ATOM 10036  H H6     . C A 1 312 ? 162.065 108.118 81.197  1.00 0.00 ? 301 C A H6     1  
ATOM 10037  P P      . G A 1 313 ? 166.937 107.442 78.752  1.00 0.00 ? 302 G A P      1  
ATOM 10038  O OP1    . G A 1 313 ? 167.923 107.679 77.667  1.00 0.00 ? 302 G A OP1    1  
ATOM 10039  O OP2    . G A 1 313 ? 165.941 106.350 78.610  1.00 0.00 ? 302 G A OP2    1  
ATOM 10040  O "O5'"  . G A 1 313 ? 167.743 107.201 80.106  1.00 0.00 ? 302 G A "O5'"  1  
ATOM 10041  C "C5'"  . G A 1 313 ? 168.794 108.074 80.491  1.00 0.00 ? 302 G A "C5'"  1  
ATOM 10042  C "C4'"  . G A 1 313 ? 169.310 107.744 81.870  1.00 0.00 ? 302 G A "C4'"  1  
ATOM 10043  O "O4'"  . G A 1 313 ? 168.240 107.885 82.842  1.00 0.00 ? 302 G A "O4'"  1  
ATOM 10044  C "C3'"  . G A 1 313 ? 169.810 106.322 82.072  1.00 0.00 ? 302 G A "C3'"  1  
ATOM 10045  O "O3'"  . G A 1 313 ? 171.116 106.115 81.565  1.00 0.00 ? 302 G A "O3'"  1  
ATOM 10046  C "C2'"  . G A 1 313 ? 169.705 106.144 83.582  1.00 0.00 ? 302 G A "C2'"  1  
ATOM 10047  O "O2'"  . G A 1 313 ? 170.782 106.782 84.251  1.00 0.00 ? 302 G A "O2'"  1  
ATOM 10048  C "C1'"  . G A 1 313 ? 168.412 106.901 83.887  1.00 0.00 ? 302 G A "C1'"  1  
ATOM 10049  N N9     . G A 1 313 ? 167.248 106.000 83.976  1.00 0.00 ? 302 G A N9     1  
ATOM 10050  C C8     . G A 1 313 ? 166.253 105.835 83.043  1.00 0.00 ? 302 G A C8     1  
ATOM 10051  N N7     . G A 1 313 ? 165.349 104.962 83.404  1.00 0.00 ? 302 G A N7     1  
ATOM 10052  C C5     . G A 1 313 ? 165.775 104.524 84.651  1.00 0.00 ? 302 G A C5     1  
ATOM 10053  C C6     . G A 1 313 ? 165.204 103.574 85.535  1.00 0.00 ? 302 G A C6     1  
ATOM 10054  O O6     . G A 1 313 ? 164.171 102.909 85.390  1.00 0.00 ? 302 G A O6     1  
ATOM 10055  N N1     . G A 1 313 ? 165.962 103.429 86.692  1.00 0.00 ? 302 G A N1     1  
ATOM 10056  C C2     . G A 1 313 ? 167.124 104.112 86.964  1.00 0.00 ? 302 G A C2     1  
ATOM 10057  N N2     . G A 1 313 ? 167.715 103.838 88.137  1.00 0.00 ? 302 G A N2     1  
ATOM 10058  N N3     . G A 1 313 ? 167.668 105.000 86.147  1.00 0.00 ? 302 G A N3     1  
ATOM 10059  C C4     . G A 1 313 ? 166.946 105.155 85.018  1.00 0.00 ? 302 G A C4     1  
ATOM 10060  H "H5'"  . G A 1 313 ? 168.463 108.996 80.487  1.00 0.00 ? 302 G A "H5'"  1  
ATOM 10061  H "H5''" . G A 1 313 ? 169.530 107.995 79.848  1.00 0.00 ? 302 G A "H5''" 1  
ATOM 10062  H "H4'"  . G A 1 313 ? 170.030 108.368 82.099  1.00 0.00 ? 302 G A "H4'"  1  
ATOM 10063  H "H3'"  . G A 1 313 ? 169.192 105.699 81.634  1.00 0.00 ? 302 G A "H3'"  1  
ATOM 10064  H "H2'"  . G A 1 313 ? 169.633 105.198 83.828  1.00 0.00 ? 302 G A "H2'"  1  
ATOM 10065  H "HO2'" . G A 1 313 ? 171.516 106.920 83.617  1.00 0.00 ? 302 G A "HO2'" 1  
ATOM 10066  H "H1'"  . G A 1 313 ? 168.512 107.388 84.732  1.00 0.00 ? 302 G A "H1'"  1  
ATOM 10067  H H8     . G A 1 313 ? 166.219 106.323 82.194  1.00 0.00 ? 302 G A H8     1  
ATOM 10068  H H1     . G A 1 313 ? 165.642 102.791 87.365  1.00 0.00 ? 302 G A H1     1  
ATOM 10069  H H21    . G A 1 313 ? 167.318 103.182 88.747  1.00 0.00 ? 302 G A H21    1  
ATOM 10070  H H22    . G A 1 313 ? 168.546 104.293 88.384  1.00 0.00 ? 302 G A H22    1  
ATOM 10071  P P      . U A 1 314 ? 171.545 104.659 81.049  1.00 0.00 ? 303 U A P      1  
ATOM 10072  O OP1    . U A 1 314 ? 171.848 104.728 79.597  1.00 0.00 ? 303 U A OP1    1  
ATOM 10073  O OP2    . U A 1 314 ? 170.428 103.805 81.526  1.00 0.00 ? 303 U A OP2    1  
ATOM 10074  O "O5'"  . U A 1 314 ? 172.870 104.207 81.809  1.00 0.00 ? 303 U A "O5'"  1  
ATOM 10075  C "C5'"  . U A 1 314 ? 173.000 102.893 82.331  1.00 0.00 ? 303 U A "C5'"  1  
ATOM 10076  C "C4'"  . U A 1 314 ? 173.092 102.898 83.837  1.00 0.00 ? 303 U A "C4'"  1  
ATOM 10077  O "O4'"  . U A 1 314 ? 171.893 103.500 84.373  1.00 0.00 ? 303 U A "O4'"  1  
ATOM 10078  C "C3'"  . U A 1 314 ? 173.090 101.536 84.514  1.00 0.00 ? 303 U A "C3'"  1  
ATOM 10079  O "O3'"  . U A 1 314 ? 174.379 100.954 84.591  1.00 0.00 ? 303 U A "O3'"  1  
ATOM 10080  C "C2'"  . U A 1 314 ? 172.575 101.831 85.911  1.00 0.00 ? 303 U A "C2'"  1  
ATOM 10081  O "O2'"  . U A 1 314 ? 173.583 102.424 86.716  1.00 0.00 ? 303 U A "O2'"  1  
ATOM 10082  C "C1'"  . U A 1 314 ? 171.508 102.861 85.581  1.00 0.00 ? 303 U A "C1'"  1  
ATOM 10083  N N1     . U A 1 314 ? 170.175 102.244 85.372  1.00 0.00 ? 303 U A N1     1  
ATOM 10084  C C2     . U A 1 314 ? 169.544 101.716 86.483  1.00 0.00 ? 303 U A C2     1  
ATOM 10085  O O2     . U A 1 314 ? 170.031 101.739 87.600  1.00 0.00 ? 303 U A O2     1  
ATOM 10086  N N3     . U A 1 314 ? 168.313 101.156 86.242  1.00 0.00 ? 303 U A N3     1  
ATOM 10087  C C4     . U A 1 314 ? 167.661 101.070 85.030  1.00 0.00 ? 303 U A C4     1  
ATOM 10088  O O4     . U A 1 314 ? 166.553 100.534 84.977  1.00 0.00 ? 303 U A O4     1  
ATOM 10089  C C5     . U A 1 314 ? 168.374 101.637 83.926  1.00 0.00 ? 303 U A C5     1  
ATOM 10090  C C6     . U A 1 314 ? 169.573 102.190 84.133  1.00 0.00 ? 303 U A C6     1  
ATOM 10091  H "H5'"  . U A 1 314 ? 173.810 102.482 81.963  1.00 0.00 ? 303 U A "H5'"  1  
ATOM 10092  H "H5''" . U A 1 314 ? 172.222 102.363 82.061  1.00 0.00 ? 303 U A "H5''" 1  
ATOM 10093  H "H4'"  . U A 1 314 ? 173.877 103.400 84.139  1.00 0.00 ? 303 U A "H4'"  1  
ATOM 10094  H "H3'"  . U A 1 314 ? 172.489 100.925 84.039  1.00 0.00 ? 303 U A "H3'"  1  
ATOM 10095  H "H2'"  . U A 1 314 ? 172.200 101.029 86.332  1.00 0.00 ? 303 U A "H2'"  1  
ATOM 10096  H "HO2'" . U A 1 314 ? 174.461 102.115 86.409  1.00 0.00 ? 303 U A "HO2'" 1  
ATOM 10097  H "H1'"  . U A 1 314 ? 171.453 103.514 86.311  1.00 0.00 ? 303 U A "H1'"  1  
ATOM 10098  H H3     . U A 1 314 ? 167.848 100.776 87.016  1.00 0.00 ? 303 U A H3     1  
ATOM 10099  H H5     . U A 1 314 ? 167.984 101.621 83.027  1.00 0.00 ? 303 U A H5     1  
ATOM 10100  H H6     . U A 1 314 ? 170.041 102.570 83.361  1.00 0.00 ? 303 U A H6     1  
ATOM 10101  P P      . G A 1 315 ? 174.830 99.843  83.522  1.00 0.00 ? 304 G A P      1  
ATOM 10102  O OP1    . G A 1 315 ? 176.131 100.264 82.941  1.00 0.00 ? 304 G A OP1    1  
ATOM 10103  O OP2    . G A 1 315 ? 173.679 99.574  82.623  1.00 0.00 ? 304 G A OP2    1  
ATOM 10104  O "O5'"  . G A 1 315 ? 175.083 98.540  84.402  1.00 0.00 ? 304 G A "O5'"  1  
ATOM 10105  C "C5'"  . G A 1 315 ? 176.060 98.537  85.433  1.00 0.00 ? 304 G A "C5'"  1  
ATOM 10106  C "C4'"  . G A 1 315 ? 175.555 97.838  86.673  1.00 0.00 ? 304 G A "C4'"  1  
ATOM 10107  O "O4'"  . G A 1 315 ? 174.476 98.608  87.264  1.00 0.00 ? 304 G A "O4'"  1  
ATOM 10108  C "C3'"  . G A 1 315 ? 174.954 96.457  86.462  1.00 0.00 ? 304 G A "C3'"  1  
ATOM 10109  O "O3'"  . G A 1 315 ? 175.934 95.439  86.332  1.00 0.00 ? 304 G A "O3'"  1  
ATOM 10110  C "C2'"  . G A 1 315 ? 174.060 96.293  87.683  1.00 0.00 ? 304 G A "C2'"  1  
ATOM 10111  O "O2'"  . G A 1 315 ? 174.821 95.949  88.834  1.00 0.00 ? 304 G A "O2'"  1  
ATOM 10112  C "C1'"  . G A 1 315 ? 173.515 97.711  87.854  1.00 0.00 ? 304 G A "C1'"  1  
ATOM 10113  N N9     . G A 1 315 ? 172.196 97.879  87.213  1.00 0.00 ? 304 G A N9     1  
ATOM 10114  C C8     . G A 1 315 ? 171.914 98.574  86.061  1.00 0.00 ? 304 G A C8     1  
ATOM 10115  N N7     . G A 1 315 ? 170.650 98.546  85.743  1.00 0.00 ? 304 G A N7     1  
ATOM 10116  C C5     . G A 1 315 ? 170.060 97.784  86.740  1.00 0.00 ? 304 G A C5     1  
ATOM 10117  C C6     . G A 1 315 ? 168.704 97.405  86.930  1.00 0.00 ? 304 G A C6     1  
ATOM 10118  O O6     . G A 1 315 ? 167.724 97.677  86.230  1.00 0.00 ? 304 G A O6     1  
ATOM 10119  N N1     . G A 1 315 ? 168.544 96.632  88.076  1.00 0.00 ? 304 G A N1     1  
ATOM 10120  C C2     . G A 1 315 ? 169.557 96.268  88.930  1.00 0.00 ? 304 G A C2     1  
ATOM 10121  N N2     . G A 1 315 ? 169.205 95.519  89.983  1.00 0.00 ? 304 G A N2     1  
ATOM 10122  N N3     . G A 1 315 ? 170.823 96.615  88.765  1.00 0.00 ? 304 G A N3     1  
ATOM 10123  C C4     . G A 1 315 ? 171.000 97.366  87.656  1.00 0.00 ? 304 G A C4     1  
ATOM 10124  H "H5'"  . G A 1 315 ? 176.290 99.462  85.660  1.00 0.00 ? 304 G A "H5'"  1  
ATOM 10125  H "H5''" . G A 1 315 ? 176.863 98.077  85.113  1.00 0.00 ? 304 G A "H5''" 1  
ATOM 10126  H "H4'"  . G A 1 315 ? 176.288 97.770  87.320  1.00 0.00 ? 304 G A "H4'"  1  
ATOM 10127  H "H3'"  . G A 1 315 ? 174.397 96.468  85.656  1.00 0.00 ? 304 G A "H3'"  1  
ATOM 10128  H "H2'"  . G A 1 315 ? 173.341 95.648  87.519  1.00 0.00 ? 304 G A "H2'"  1  
ATOM 10129  H "HO2'" . G A 1 315 ? 175.682 95.584  88.548  1.00 0.00 ? 304 G A "HO2'" 1  
ATOM 10130  H "H1'"  . G A 1 315 ? 173.442 97.920  88.808  1.00 0.00 ? 304 G A "H1'"  1  
ATOM 10131  H H8     . G A 1 315 ? 172.594 99.045  85.534  1.00 0.00 ? 304 G A H8     1  
ATOM 10132  H H1     . G A 1 315 ? 167.639 96.324  88.287  1.00 0.00 ? 304 G A H1     1  
ATOM 10133  H H21    . G A 1 315 ? 168.271 95.256  90.113  1.00 0.00 ? 304 G A H21    1  
ATOM 10134  H H22    . G A 1 315 ? 169.885 95.228  90.628  1.00 0.00 ? 304 G A H22    1  
ATOM 10135  P P      . A A 1 316 ? 175.653 94.164  85.395  1.00 0.00 ? 305 A A P      1  
ATOM 10136  O OP1    . A A 1 316 ? 176.861 93.302  85.418  1.00 0.00 ? 305 A A OP1    1  
ATOM 10137  O OP2    . A A 1 316 ? 175.127 94.654  84.097  1.00 0.00 ? 305 A A OP2    1  
ATOM 10138  O "O5'"  . A A 1 316 ? 174.479 93.388  86.141  1.00 0.00 ? 305 A A "O5'"  1  
ATOM 10139  C "C5'"  . A A 1 316 ? 174.719 92.702  87.363  1.00 0.00 ? 305 A A "C5'"  1  
ATOM 10140  C "C4'"  . A A 1 316 ? 173.453 92.096  87.916  1.00 0.00 ? 305 A A "C4'"  1  
ATOM 10141  O "O4'"  . A A 1 316 ? 172.500 93.149  88.223  1.00 0.00 ? 305 A A "O4'"  1  
ATOM 10142  C "C3'"  . A A 1 316 ? 172.692 91.168  86.982  1.00 0.00 ? 305 A A "C3'"  1  
ATOM 10143  O "O3'"  . A A 1 316 ? 173.244 89.864  86.929  1.00 0.00 ? 305 A A "O3'"  1  
ATOM 10144  C "C2'"  . A A 1 316 ? 171.280 91.212  87.548  1.00 0.00 ? 305 A A "C2'"  1  
ATOM 10145  O "O2'"  . A A 1 316 ? 171.163 90.396  88.704  1.00 0.00 ? 305 A A "O2'"  1  
ATOM 10146  C "C1'"  . A A 1 316 ? 171.164 92.680  87.962  1.00 0.00 ? 305 A A "C1'"  1  
ATOM 10147  N N9     . A A 1 316 ? 170.507 93.498  86.925  1.00 0.00 ? 305 A A N9     1  
ATOM 10148  C C8     . A A 1 316 ? 171.088 94.389  86.057  1.00 0.00 ? 305 A A C8     1  
ATOM 10149  N N7     . A A 1 316 ? 170.240 94.969  85.245  1.00 0.00 ? 305 A A N7     1  
ATOM 10150  C C5     . A A 1 316 ? 169.013 94.424  85.601  1.00 0.00 ? 305 A A C5     1  
ATOM 10151  C C6     . A A 1 316 ? 167.709 94.628  85.116  1.00 0.00 ? 305 A A C6     1  
ATOM 10152  N N6     . A A 1 316 ? 167.413 95.470  84.125  1.00 0.00 ? 305 A A N6     1  
ATOM 10153  N N1     . A A 1 316 ? 166.709 93.926  85.690  1.00 0.00 ? 305 A A N1     1  
ATOM 10154  C C2     . A A 1 316 ? 167.007 93.081  86.685  1.00 0.00 ? 305 A A C2     1  
ATOM 10155  N N3     . A A 1 316 ? 168.190 92.804  87.228  1.00 0.00 ? 305 A A N3     1  
ATOM 10156  C C4     . A A 1 316 ? 169.165 93.519  86.634  1.00 0.00 ? 305 A A C4     1  
ATOM 10157  H "H5'"  . A A 1 316 ? 175.086 93.332  88.016  1.00 0.00 ? 305 A A "H5'"  1  
ATOM 10158  H "H5''" . A A 1 316 ? 175.371 91.988  87.204  1.00 0.00 ? 305 A A "H5''" 1  
ATOM 10159  H "H4'"  . A A 1 316 ? 173.668 91.612  88.740  1.00 0.00 ? 305 A A "H4'"  1  
ATOM 10160  H "H3'"  . A A 1 316 ? 172.688 91.553  86.080  1.00 0.00 ? 305 A A "H3'"  1  
ATOM 10161  H "H2'"  . A A 1 316 ? 170.613 90.976  86.870  1.00 0.00 ? 305 A A "H2'"  1  
ATOM 10162  H "HO2'" . A A 1 316 ? 171.894 89.744  88.711  1.00 0.00 ? 305 A A "HO2'" 1  
ATOM 10163  H "H1'"  . A A 1 316 ? 170.657 92.745  88.798  1.00 0.00 ? 305 A A "H1'"  1  
ATOM 10164  H H8     . A A 1 316 ? 172.051 94.575  86.046  1.00 0.00 ? 305 A A H8     1  
ATOM 10165  H H61    . A A 1 316 ? 166.483 95.570  83.827  1.00 0.00 ? 305 A A H61    1  
ATOM 10166  H H62    . A A 1 316 ? 168.122 95.989  83.691  1.00 0.00 ? 305 A A H62    1  
ATOM 10167  H H2     . A A 1 316 ? 166.243 92.596  87.066  1.00 0.00 ? 305 A A H2     1  
ATOM 10168  P P      . C A 1 317 ? 173.685 89.229  85.520  1.00 0.00 ? 306 C A P      1  
ATOM 10169  O OP1    . C A 1 317 ? 174.741 88.218  85.782  1.00 0.00 ? 306 C A OP1    1  
ATOM 10170  O OP2    . C A 1 317 ? 173.955 90.343  84.577  1.00 0.00 ? 306 C A OP2    1  
ATOM 10171  O "O5'"  . C A 1 317 ? 172.383 88.462  85.018  1.00 0.00 ? 306 C A "O5'"  1  
ATOM 10172  C "C5'"  . C A 1 317 ? 171.983 87.236  85.613  1.00 0.00 ? 306 C A "C5'"  1  
ATOM 10173  C "C4'"  . C A 1 317 ? 170.501 86.997  85.454  1.00 0.00 ? 306 C A "C4'"  1  
ATOM 10174  O "O4'"  . C A 1 317 ? 169.762 88.123  85.998  1.00 0.00 ? 306 C A "O4'"  1  
ATOM 10175  C "C3'"  . C A 1 317 ? 169.989 86.889  84.026  1.00 0.00 ? 306 C A "C3'"  1  
ATOM 10176  O "O3'"  . C A 1 317 ? 170.189 85.604  83.463  1.00 0.00 ? 306 C A "O3'"  1  
ATOM 10177  C "C2'"  . C A 1 317 ? 168.527 87.253  84.189  1.00 0.00 ? 306 C A "C2'"  1  
ATOM 10178  O "O2'"  . C A 1 317 ? 167.789 86.178  84.752  1.00 0.00 ? 306 C A "O2'"  1  
ATOM 10179  C "C1'"  . C A 1 317 ? 168.634 88.383  85.206  1.00 0.00 ? 306 C A "C1'"  1  
ATOM 10180  N N1     . C A 1 317 ? 168.808 89.708  84.560  1.00 0.00 ? 306 C A N1     1  
ATOM 10181  C C2     . C A 1 317 ? 167.674 90.352  84.049  1.00 0.00 ? 306 C A C2     1  
ATOM 10182  O O2     . C A 1 317 ? 166.567 89.801  84.150  1.00 0.00 ? 306 C A O2     1  
ATOM 10183  N N3     . C A 1 317 ? 167.805 91.561  83.455  1.00 0.00 ? 306 C A N3     1  
ATOM 10184  C C4     . C A 1 317 ? 169.006 92.131  83.359  1.00 0.00 ? 306 C A C4     1  
ATOM 10185  N N4     . C A 1 317 ? 169.087 93.324  82.765  1.00 0.00 ? 306 C A N4     1  
ATOM 10186  C C5     . C A 1 317 ? 170.177 91.502  83.867  1.00 0.00 ? 306 C A C5     1  
ATOM 10187  C C6     . C A 1 317 ? 170.035 90.307  84.453  1.00 0.00 ? 306 C A C6     1  
ATOM 10188  H "H5'"  . C A 1 317 ? 172.203 87.258  86.568  1.00 0.00 ? 306 C A "H5'"  1  
ATOM 10189  H "H5''" . C A 1 317 ? 172.473 86.501  85.189  1.00 0.00 ? 306 C A "H5''" 1  
ATOM 10190  H "H4'"  . C A 1 317 ? 170.258 86.187  85.949  1.00 0.00 ? 306 C A "H4'"  1  
ATOM 10191  H "H3'"  . C A 1 317 ? 170.432 87.565  83.472  1.00 0.00 ? 306 C A "H3'"  1  
ATOM 10192  H "H2'"  . C A 1 317 ? 168.137 87.556  83.343  1.00 0.00 ? 306 C A "H2'"  1  
ATOM 10193  H "HO2'" . C A 1 317 ? 166.852 86.447  84.843  1.00 0.00 ? 306 C A "HO2'" 1  
ATOM 10194  H "H1'"  . C A 1 317 ? 167.827 88.394  85.761  1.00 0.00 ? 306 C A "H1'"  1  
ATOM 10195  H H41    . C A 1 317 ? 168.278 93.754  82.416  1.00 0.00 ? 306 C A H41    1  
ATOM 10196  H H42    . C A 1 317 ? 169.955 93.770  82.679  1.00 0.00 ? 306 C A H42    1  
ATOM 10197  H H5     . C A 1 317 ? 171.056 91.930  83.792  1.00 0.00 ? 306 C A H5     1  
ATOM 10198  H H6     . C A 1 317 ? 170.829 89.858  84.810  1.00 0.00 ? 306 C A H6     1  
ATOM 10199  P P      . A A 1 318 ? 170.775 85.456  81.973  1.00 0.00 ? 307 A A P      1  
ATOM 10200  O OP1    . A A 1 318 ? 170.821 84.011  81.638  1.00 0.00 ? 307 A A OP1    1  
ATOM 10201  O OP2    . A A 1 318 ? 172.012 86.271  81.883  1.00 0.00 ? 307 A A OP2    1  
ATOM 10202  O "O5'"  . A A 1 318 ? 169.667 86.140  81.054  1.00 0.00 ? 307 A A "O5'"  1  
ATOM 10203  C "C5'"  . A A 1 318 ? 168.345 85.624  81.000  1.00 0.00 ? 307 A A "C5'"  1  
ATOM 10204  C "C4'"  . A A 1 318 ? 167.381 86.630  80.422  1.00 0.00 ? 307 A A "C4'"  1  
ATOM 10205  O "O4'"  . A A 1 318 ? 167.396 87.837  81.228  1.00 0.00 ? 307 A A "O4'"  1  
ATOM 10206  C "C3'"  . A A 1 318 ? 167.690 87.118  79.015  1.00 0.00 ? 307 A A "C3'"  1  
ATOM 10207  O "O3'"  . A A 1 318 ? 167.203 86.248  78.007  1.00 0.00 ? 307 A A "O3'"  1  
ATOM 10208  C "C2'"  . A A 1 318 ? 167.050 88.498  78.994  1.00 0.00 ? 307 A A "C2'"  1  
ATOM 10209  O "O2'"  . A A 1 318 ? 165.645 88.412  78.805  1.00 0.00 ? 307 A A "O2'"  1  
ATOM 10210  C "C1'"  . A A 1 318 ? 167.333 88.981  80.416  1.00 0.00 ? 307 A A "C1'"  1  
ATOM 10211  N N9     . A A 1 318 ? 168.617 89.702  80.514  1.00 0.00 ? 307 A A N9     1  
ATOM 10212  C C8     . A A 1 318 ? 169.842 89.199  80.878  1.00 0.00 ? 307 A A C8     1  
ATOM 10213  N N7     . A A 1 318 ? 170.802 90.090  80.871  1.00 0.00 ? 307 A A N7     1  
ATOM 10214  C C5     . A A 1 318 ? 170.168 91.260  80.476  1.00 0.00 ? 307 A A C5     1  
ATOM 10215  C C6     . A A 1 318 ? 170.637 92.570  80.275  1.00 0.00 ? 307 A A C6     1  
ATOM 10216  N N6     . A A 1 318 ? 171.909 92.936  80.450  1.00 0.00 ? 307 A A N6     1  
ATOM 10217  N N1     . A A 1 318 ? 169.744 93.503  79.880  1.00 0.00 ? 307 A A N1     1  
ATOM 10218  C C2     . A A 1 318 ? 168.469 93.137  79.703  1.00 0.00 ? 307 A A C2     1  
ATOM 10219  N N3     . A A 1 318 ? 167.908 91.940  79.861  1.00 0.00 ? 307 A A N3     1  
ATOM 10220  C C4     . A A 1 318 ? 168.822 91.035  80.253  1.00 0.00 ? 307 A A C4     1  
ATOM 10221  H "H5'"  . A A 1 318 ? 168.056 85.389  81.906  1.00 0.00 ? 307 A A "H5'"  1  
ATOM 10222  H "H5''" . A A 1 318 ? 168.338 84.818  80.443  1.00 0.00 ? 307 A A "H5''" 1  
ATOM 10223  H "H4'"  . A A 1 318 ? 166.479 86.248  80.435  1.00 0.00 ? 307 A A "H4'"  1  
ATOM 10224  H "H3'"  . A A 1 318 ? 168.660 87.213  78.913  1.00 0.00 ? 307 A A "H3'"  1  
ATOM 10225  H "H2'"  . A A 1 318 ? 167.472 89.080  78.327  1.00 0.00 ? 307 A A "H2'"  1  
ATOM 10226  H "HO2'" . A A 1 318 ? 165.433 87.552  78.387  1.00 0.00 ? 307 A A "HO2'" 1  
ATOM 10227  H "H1'"  . A A 1 318 ? 166.605 89.568  80.712  1.00 0.00 ? 307 A A "H1'"  1  
ATOM 10228  H H8     . A A 1 318 ? 169.984 88.260  81.121  1.00 0.00 ? 307 A A H8     1  
ATOM 10229  H H61    . A A 1 318 ? 172.177 93.866  80.294  1.00 0.00 ? 307 A A H61    1  
ATOM 10230  H H62    . A A 1 318 ? 172.574 92.276  80.736  1.00 0.00 ? 307 A A H62    1  
ATOM 10231  H H2     . A A 1 318 ? 167.861 93.851  79.417  1.00 0.00 ? 307 A A H2     1  
ATOM 10232  P P      . G A 1 319 ? 167.934 86.181  76.577  1.00 0.00 ? 308 G A P      1  
ATOM 10233  O OP1    . G A 1 319 ? 167.281 85.113  75.777  1.00 0.00 ? 308 G A OP1    1  
ATOM 10234  O OP2    . G A 1 319 ? 169.399 86.129  76.812  1.00 0.00 ? 308 G A OP2    1  
ATOM 10235  O "O5'"  . G A 1 319 ? 167.591 87.582  75.901  1.00 0.00 ? 308 G A "O5'"  1  
ATOM 10236  C "C5'"  . G A 1 319 ? 166.251 87.935  75.594  1.00 0.00 ? 308 G A "C5'"  1  
ATOM 10237  C "C4'"  . G A 1 319 ? 166.114 89.414  75.329  1.00 0.00 ? 308 G A "C4'"  1  
ATOM 10238  O "O4'"  . G A 1 319 ? 166.539 90.146  76.488  1.00 0.00 ? 308 G A "O4'"  1  
ATOM 10239  C "C3'"  . G A 1 319 ? 167.013 89.983  74.242  1.00 0.00 ? 308 G A "C3'"  1  
ATOM 10240  O "O3'"  . G A 1 319 ? 166.510 89.762  72.935  1.00 0.00 ? 308 G A "O3'"  1  
ATOM 10241  C "C2'"  . G A 1 319 ? 167.083 91.451  74.610  1.00 0.00 ? 308 G A "C2'"  1  
ATOM 10242  O "O2'"  . G A 1 319 ? 165.856 92.111  74.332  1.00 0.00 ? 308 G A "O2'"  1  
ATOM 10243  C "C1'"  . G A 1 319 ? 167.267 91.279  76.090  1.00 0.00 ? 308 G A "C1'"  1  
ATOM 10244  N N9     . G A 1 319 ? 168.686 91.110  76.456  1.00 0.00 ? 308 G A N9     1  
ATOM 10245  C C8     . G A 1 319 ? 169.363 89.928  76.638  1.00 0.00 ? 308 G A C8     1  
ATOM 10246  N N7     . G A 1 319 ? 170.616 90.099  76.962  1.00 0.00 ? 308 G A N7     1  
ATOM 10247  C C5     . G A 1 319 ? 170.778 91.477  76.994  1.00 0.00 ? 308 G A C5     1  
ATOM 10248  C C6     . G A 1 319 ? 171.924 92.261  77.284  1.00 0.00 ? 308 G A C6     1  
ATOM 10249  O O6     . G A 1 319 ? 173.063 91.882  77.581  1.00 0.00 ? 308 G A O6     1  
ATOM 10250  N N1     . G A 1 319 ? 171.647 93.623  77.205  1.00 0.00 ? 308 G A N1     1  
ATOM 10251  C C2     . G A 1 319 ? 170.424 94.161  76.886  1.00 0.00 ? 308 G A C2     1  
ATOM 10252  N N2     . G A 1 319 ? 170.352 95.500  76.859  1.00 0.00 ? 308 G A N2     1  
ATOM 10253  N N3     . G A 1 319 ? 169.348 93.441  76.613  1.00 0.00 ? 308 G A N3     1  
ATOM 10254  C C4     . G A 1 319 ? 169.596 92.116  76.685  1.00 0.00 ? 308 G A C4     1  
ATOM 10255  H "H5'"  . G A 1 319 ? 165.675 87.690  76.348  1.00 0.00 ? 308 G A "H5'"  1  
ATOM 10256  H "H5''" . G A 1 319 ? 165.964 87.439  74.798  1.00 0.00 ? 308 G A "H5''" 1  
ATOM 10257  H "H4'"  . G A 1 319 ? 165.172 89.618  75.148  1.00 0.00 ? 308 G A "H4'"  1  
ATOM 10258  H "H3'"  . G A 1 319 ? 167.906 89.589  74.324  1.00 0.00 ? 308 G A "H3'"  1  
ATOM 10259  H "H2'"  . G A 1 319 ? 167.841 91.895  74.175  1.00 0.00 ? 308 G A "H2'"  1  
ATOM 10260  H "HO2'" . G A 1 319 ? 165.947 93.061  74.554  1.00 0.00 ? 308 G A "HO2'" 1  
ATOM 10261  H "H1'"  . G A 1 319 ? 166.900 92.058  76.557  1.00 0.00 ? 308 G A "H1'"  1  
ATOM 10262  H H8     . G A 1 319 ? 168.948 89.047  76.537  1.00 0.00 ? 308 G A H8     1  
ATOM 10263  H H1     . G A 1 319 ? 172.382 94.243  77.391  1.00 0.00 ? 308 G A H1     1  
ATOM 10264  H H21    . G A 1 319 ? 171.144 96.040  77.060  1.00 0.00 ? 308 G A H21    1  
ATOM 10265  H H22    . G A 1 319 ? 169.504 95.941  76.638  1.00 0.00 ? 308 G A H22    1  
ATOM 10266  P P      . A A 1 320 ? 167.442 89.084  71.815  1.00 0.00 ? 309 A A P      1  
ATOM 10267  O OP1    . A A 1 320 ? 166.674 89.032  70.547  1.00 0.00 ? 309 A A OP1    1  
ATOM 10268  O OP2    . A A 1 320 ? 168.009 87.835  72.383  1.00 0.00 ? 309 A A OP2    1  
ATOM 10269  O "O5'"  . A A 1 320 ? 168.635 90.124  71.627  1.00 0.00 ? 309 A A "O5'"  1  
ATOM 10270  C "C5'"  . A A 1 320 ? 169.754 90.116  72.501  1.00 0.00 ? 309 A A "C5'"  1  
ATOM 10271  C "C4'"  . A A 1 320 ? 170.924 90.863  71.911  1.00 0.00 ? 309 A A "C4'"  1  
ATOM 10272  O "O4'"  . A A 1 320 ? 171.469 90.106  70.792  1.00 0.00 ? 309 A A "O4'"  1  
ATOM 10273  C "C3'"  . A A 1 320 ? 170.624 92.253  71.371  1.00 0.00 ? 309 A A "C3'"  1  
ATOM 10274  O "O3'"  . A A 1 320 ? 171.735 93.129  71.447  1.00 0.00 ? 309 A A "O3'"  1  
ATOM 10275  C "C2'"  . A A 1 320 ? 170.350 91.982  69.889  1.00 0.00 ? 309 A A "C2'"  1  
ATOM 10276  O "O2'"  . A A 1 320 ? 170.667 93.114  69.092  1.00 0.00 ? 309 A A "O2'"  1  
ATOM 10277  C "C1'"  . A A 1 320 ? 171.351 90.875  69.602  1.00 0.00 ? 309 A A "C1'"  1  
ATOM 10278  N N9     . A A 1 320 ? 170.891 89.974  68.528  1.00 0.00 ? 309 A A N9     1  
ATOM 10279  C C8     . A A 1 320 ? 169.684 89.327  68.429  1.00 0.00 ? 309 A A C8     1  
ATOM 10280  N N7     . A A 1 320 ? 169.566 88.590  67.352  1.00 0.00 ? 309 A A N7     1  
ATOM 10281  C C5     . A A 1 320 ? 170.777 88.762  66.697  1.00 0.00 ? 309 A A C5     1  
ATOM 10282  C C6     . A A 1 320 ? 171.284 88.244  65.491  1.00 0.00 ? 309 A A C6     1  
ATOM 10283  N N6     . A A 1 320 ? 170.603 87.414  64.698  1.00 0.00 ? 309 A A N6     1  
ATOM 10284  N N1     . A A 1 320 ? 172.529 88.614  65.123  1.00 0.00 ? 309 A A N1     1  
ATOM 10285  C C2     . A A 1 320 ? 173.213 89.447  65.918  1.00 0.00 ? 309 A A C2     1  
ATOM 10286  N N3     . A A 1 320 ? 172.845 89.999  67.073  1.00 0.00 ? 309 A A N3     1  
ATOM 10287  C C4     . A A 1 320 ? 171.602 89.612  67.410  1.00 0.00 ? 309 A A C4     1  
ATOM 10288  H "H5'"  . A A 1 320 ? 170.021 89.188  72.672  1.00 0.00 ? 309 A A "H5'"  1  
ATOM 10289  H "H5''" . A A 1 320 ? 169.501 90.536  73.349  1.00 0.00 ? 309 A A "H5''" 1  
ATOM 10290  H "H4'"  . A A 1 320 ? 171.616 90.962  72.598  1.00 0.00 ? 309 A A "H4'"  1  
ATOM 10291  H "H3'"  . A A 1 320 ? 169.805 92.591  71.791  1.00 0.00 ? 309 A A "H3'"  1  
ATOM 10292  H "H2'"  . A A 1 320 ? 169.429 91.681  69.743  1.00 0.00 ? 309 A A "H2'"  1  
ATOM 10293  H "HO2'" . A A 1 320 ? 170.501 92.897  68.151  1.00 0.00 ? 309 A A "HO2'" 1  
ATOM 10294  H "H1'"  . A A 1 320 ? 172.212 91.271  69.348  1.00 0.00 ? 309 A A "H1'"  1  
ATOM 10295  H H8     . A A 1 320 ? 168.975 89.409  69.101  1.00 0.00 ? 309 A A H8     1  
ATOM 10296  H H61    . A A 1 320 ? 171.010 87.086  63.869  1.00 0.00 ? 309 A A H61    1  
ATOM 10297  H H62    . A A 1 320 ? 169.698 87.132  64.945  1.00 0.00 ? 309 A A H62    1  
ATOM 10298  H H2     . A A 1 320 ? 174.111 89.685  65.606  1.00 0.00 ? 309 A A H2     1  
ATOM 10299  P P      . C A 1 321 ? 171.832 94.185  72.646  1.00 0.00 ? 310 C A P      1  
ATOM 10300  O OP1    . C A 1 321 ? 173.082 94.973  72.501  1.00 0.00 ? 310 C A OP1    1  
ATOM 10301  O OP2    . C A 1 321 ? 171.639 93.330  73.845  1.00 0.00 ? 310 C A OP2    1  
ATOM 10302  O "O5'"  . C A 1 321 ? 170.601 95.192  72.556  1.00 0.00 ? 310 C A "O5'"  1  
ATOM 10303  C "C5'"  . C A 1 321 ? 170.110 95.849  73.714  1.00 0.00 ? 310 C A "C5'"  1  
ATOM 10304  C "C4'"  . C A 1 321 ? 169.057 96.874  73.368  1.00 0.00 ? 310 C A "C4'"  1  
ATOM 10305  O "O4'"  . C A 1 321 ? 168.345 96.416  72.186  1.00 0.00 ? 310 C A "O4'"  1  
ATOM 10306  C "C3'"  . C A 1 321 ? 167.999 97.132  74.430  1.00 0.00 ? 310 C A "C3'"  1  
ATOM 10307  O "O3'"  . C A 1 321 ? 167.473 98.447  74.379  1.00 0.00 ? 310 C A "O3'"  1  
ATOM 10308  C "C2'"  . C A 1 321 ? 166.875 96.188  74.019  1.00 0.00 ? 310 C A "C2'"  1  
ATOM 10309  O "O2'"  . C A 1 321 ? 165.610 96.684  74.431  1.00 0.00 ? 310 C A "O2'"  1  
ATOM 10310  C "C1'"  . C A 1 321 ? 166.971 96.262  72.493  1.00 0.00 ? 310 C A "C1'"  1  
ATOM 10311  N N1     . C A 1 321 ? 166.510 95.013  71.838  1.00 0.00 ? 310 C A N1     1  
ATOM 10312  C C2     . C A 1 321 ? 165.227 94.991  71.277  1.00 0.00 ? 310 C A C2     1  
ATOM 10313  O O2     . C A 1 321 ? 164.519 96.007  71.343  1.00 0.00 ? 310 C A O2     1  
ATOM 10314  N N3     . C A 1 321 ? 164.783 93.865  70.673  1.00 0.00 ? 310 C A N3     1  
ATOM 10315  C C4     . C A 1 321 ? 165.563 92.786  70.615  1.00 0.00 ? 310 C A C4     1  
ATOM 10316  N N4     . C A 1 321 ? 165.083 91.697  70.010  1.00 0.00 ? 310 C A N4     1  
ATOM 10317  C C5     . C A 1 321 ? 166.871 92.776  71.176  1.00 0.00 ? 310 C A C5     1  
ATOM 10318  C C6     . C A 1 321 ? 167.301 93.896  71.769  1.00 0.00 ? 310 C A C6     1  
ATOM 10319  H "H5'"  . C A 1 321 ? 170.854 96.297  74.168  1.00 0.00 ? 310 C A "H5'"  1  
ATOM 10320  H "H5''" . C A 1 321 ? 169.721 95.183  74.318  1.00 0.00 ? 310 C A "H5''" 1  
ATOM 10321  H "H4'"  . C A 1 321 ? 169.495 97.721  73.146  1.00 0.00 ? 310 C A "H4'"  1  
ATOM 10322  H "H3'"  . C A 1 321 ? 168.327 96.952  75.336  1.00 0.00 ? 310 C A "H3'"  1  
ATOM 10323  H "H2'"  . C A 1 321 ? 167.032 95.279  74.347  1.00 0.00 ? 310 C A "H2'"  1  
ATOM 10324  H "HO2'" . C A 1 321 ? 164.907 96.097  74.082  1.00 0.00 ? 310 C A "HO2'" 1  
ATOM 10325  H "H1'"  . C A 1 321 ? 166.433 97.016  72.173  1.00 0.00 ? 310 C A "H1'"  1  
ATOM 10326  H H41    . C A 1 321 ? 164.181 91.707  69.625  1.00 0.00 ? 310 C A H41    1  
ATOM 10327  H H42    . C A 1 321 ? 165.632 90.887  69.950  1.00 0.00 ? 310 C A H42    1  
ATOM 10328  H H5     . C A 1 321 ? 167.438 91.978  71.128  1.00 0.00 ? 310 C A H5     1  
ATOM 10329  H H6     . C A 1 321 ? 168.198 93.909  72.161  1.00 0.00 ? 310 C A H6     1  
ATOM 10330  P P      . A A 1 322 ? 166.885 99.135  75.707  1.00 0.00 ? 311 A A P      1  
ATOM 10331  O OP1    . A A 1 322 ? 167.370 100.537 75.752  1.00 0.00 ? 311 A A OP1    1  
ATOM 10332  O OP2    . A A 1 322 ? 167.153 98.228  76.851  1.00 0.00 ? 311 A A OP2    1  
ATOM 10333  O "O5'"  . A A 1 322 ? 165.311 99.165  75.461  1.00 0.00 ? 311 A A "O5'"  1  
ATOM 10334  C "C5'"  . A A 1 322 ? 164.402 99.077  76.547  1.00 0.00 ? 311 A A "C5'"  1  
ATOM 10335  C "C4'"  . A A 1 322 ? 163.254 98.149  76.236  1.00 0.00 ? 311 A A "C4'"  1  
ATOM 10336  O "O4'"  . A A 1 322 ? 163.814 96.917  75.627  1.00 0.00 ? 311 A A "O4'"  1  
ATOM 10337  C "C3'"  . A A 1 322 ? 162.501 97.594  77.436  1.00 0.00 ? 311 A A "C3'"  1  
ATOM 10338  O "O3'"  . A A 1 322 ? 161.545 98.501  77.958  1.00 0.00 ? 311 A A "O3'"  1  
ATOM 10339  C "C2'"  . A A 1 322 ? 161.844 96.390  76.806  1.00 0.00 ? 311 A A "C2'"  1  
ATOM 10340  O "O2'"  . A A 1 322 ? 160.790 96.775  75.934  1.00 0.00 ? 311 A A "O2'"  1  
ATOM 10341  C "C1'"  . A A 1 322 ? 163.007 95.847  75.991  1.00 0.00 ? 311 A A "C1'"  1  
ATOM 10342  N N9     . A A 1 322 ? 163.808 94.869  76.749  1.00 0.00 ? 311 A A N9     1  
ATOM 10343  C C8     . A A 1 322 ? 165.071 95.029  77.263  1.00 0.00 ? 311 A A C8     1  
ATOM 10344  N N7     . A A 1 322 ? 165.524 93.973  77.893  1.00 0.00 ? 311 A A N7     1  
ATOM 10345  C C5     . A A 1 322 ? 164.490 93.053  77.787  1.00 0.00 ? 311 A A C5     1  
ATOM 10346  C C6     . A A 1 322 ? 164.345 91.732  78.247  1.00 0.00 ? 311 A A C6     1  
ATOM 10347  N N6     . A A 1 322 ? 165.285 91.083  78.938  1.00 0.00 ? 311 A A N6     1  
ATOM 10348  N N1     . A A 1 322 ? 163.188 91.094  77.972  1.00 0.00 ? 311 A A N1     1  
ATOM 10349  C C2     . A A 1 322 ? 162.244 91.746  77.280  1.00 0.00 ? 311 A A C2     1  
ATOM 10350  N N3     . A A 1 322 ? 162.263 92.985  76.794  1.00 0.00 ? 311 A A N3     1  
ATOM 10351  C C4     . A A 1 322 ? 163.427 93.592  77.085  1.00 0.00 ? 311 A A C4     1  
ATOM 10352  H "H5'"  . A A 1 322 ? 164.047 99.970  76.740  1.00 0.00 ? 311 A A "H5'"  1  
ATOM 10353  H "H5''" . A A 1 322 ? 164.877 98.745  77.337  1.00 0.00 ? 311 A A "H5''" 1  
ATOM 10354  H "H4'"  . A A 1 322 ? 162.612 98.562  75.622  1.00 0.00 ? 311 A A "H4'"  1  
ATOM 10355  H "H3'"  . A A 1 322 ? 163.102 97.311  78.156  1.00 0.00 ? 311 A A "H3'"  1  
ATOM 10356  H "H2'"  . A A 1 322 ? 161.539 95.751  77.484  1.00 0.00 ? 311 A A "H2'"  1  
ATOM 10357  H "HO2'" . A A 1 322 ? 160.383 95.970  75.552  1.00 0.00 ? 311 A A "HO2'" 1  
ATOM 10358  H "H1'"  . A A 1 322 ? 162.664 95.426  75.174  1.00 0.00 ? 311 A A "H1'"  1  
ATOM 10359  H H8     . A A 1 322 ? 165.587 95.858  77.169  1.00 0.00 ? 311 A A H8     1  
ATOM 10360  H H61    . A A 1 322 ? 165.127 90.161  79.233  1.00 0.00 ? 311 A A H61    1  
ATOM 10361  H H62    . A A 1 322 ? 166.133 91.526  79.149  1.00 0.00 ? 311 A A H62    1  
ATOM 10362  H H2     . A A 1 322 ? 161.424 91.238  77.107  1.00 0.00 ? 311 A A H2     1  
ATOM 10363  P P      . A A 1 323 ? 161.289 98.580  79.543  1.00 0.00 ? 312 A A P      1  
ATOM 10364  O OP1    . A A 1 323 ? 160.315 99.671  79.798  1.00 0.00 ? 312 A A OP1    1  
ATOM 10365  O OP2    . A A 1 323 ? 162.609 98.601  80.222  1.00 0.00 ? 312 A A OP2    1  
ATOM 10366  O "O5'"  . A A 1 323 ? 160.581 97.195  79.888  1.00 0.00 ? 312 A A "O5'"  1  
ATOM 10367  C "C5'"  . A A 1 323 ? 159.282 96.898  79.396  1.00 0.00 ? 312 A A "C5'"  1  
ATOM 10368  C "C4'"  . A A 1 323 ? 158.904 95.463  79.662  1.00 0.00 ? 312 A A "C4'"  1  
ATOM 10369  O "O4'"  . A A 1 323 ? 159.862 94.562  79.028  1.00 0.00 ? 312 A A "O4'"  1  
ATOM 10370  C "C3'"  . A A 1 323 ? 158.902 95.032  81.121  1.00 0.00 ? 312 A A "C3'"  1  
ATOM 10371  O "O3'"  . A A 1 323 ? 157.695 95.351  81.791  1.00 0.00 ? 312 A A "O3'"  1  
ATOM 10372  C "C2'"  . A A 1 323 ? 159.176 93.530  81.015  1.00 0.00 ? 312 A A "C2'"  1  
ATOM 10373  O "O2'"  . A A 1 323 ? 158.002 92.816  80.656  1.00 0.00 ? 312 A A "O2'"  1  
ATOM 10374  C "C1'"  . A A 1 323 ? 160.166 93.482  79.845  1.00 0.00 ? 312 A A "C1'"  1  
ATOM 10375  N N9     . A A 1 323 ? 161.563 93.641  80.292  1.00 0.00 ? 312 A A N9     1  
ATOM 10376  C C8     . A A 1 323 ? 162.388 94.725  80.115  1.00 0.00 ? 312 A A C8     1  
ATOM 10377  N N7     . A A 1 323 ? 163.583 94.569  80.627  1.00 0.00 ? 312 A A N7     1  
ATOM 10378  C C5     . A A 1 323 ? 163.545 93.296  81.180  1.00 0.00 ? 312 A A C5     1  
ATOM 10379  C C6     . A A 1 323 ? 164.503 92.534  81.873  1.00 0.00 ? 312 A A C6     1  
ATOM 10380  N N6     . A A 1 323 ? 165.738 92.965  82.139  1.00 0.00 ? 312 A A N6     1  
ATOM 10381  N N1     . A A 1 323 ? 164.144 91.301  82.289  1.00 0.00 ? 312 A A N1     1  
ATOM 10382  C C2     . A A 1 323 ? 162.905 90.869  82.022  1.00 0.00 ? 312 A A C2     1  
ATOM 10383  N N3     . A A 1 323 ? 161.917 91.490  81.380  1.00 0.00 ? 312 A A N3     1  
ATOM 10384  C C4     . A A 1 323 ? 162.307 92.714  80.981  1.00 0.00 ? 312 A A C4     1  
ATOM 10385  H "H5'"  . A A 1 323 ? 159.261 97.061  78.430  1.00 0.00 ? 312 A A "H5'"  1  
ATOM 10386  H "H5''" . A A 1 323 ? 158.632 97.487  79.833  1.00 0.00 ? 312 A A "H5''" 1  
ATOM 10387  H "H4'"  . A A 1 323 ? 158.014 95.301  79.282  1.00 0.00 ? 312 A A "H4'"  1  
ATOM 10388  H "H3'"  . A A 1 323 ? 159.651 95.460  81.587  1.00 0.00 ? 312 A A "H3'"  1  
ATOM 10389  H "H2'"  . A A 1 323 ? 159.577 93.179  81.838  1.00 0.00 ? 312 A A "H2'"  1  
ATOM 10390  H "HO2'" . A A 1 323 ? 157.219 93.299  80.995  1.00 0.00 ? 312 A A "HO2'" 1  
ATOM 10391  H "H1'"  . A A 1 323 ? 160.070 92.629  79.371  1.00 0.00 ? 312 A A "H1'"  1  
ATOM 10392  H H8     . A A 1 323 ? 162.108 95.541  79.648  1.00 0.00 ? 312 A A H8     1  
ATOM 10393  H H61    . A A 1 323 ? 166.363 92.388  82.627  1.00 0.00 ? 312 A A H61    1  
ATOM 10394  H H62    . A A 1 323 ? 166.021 93.856  81.847  1.00 0.00 ? 312 A A H62    1  
ATOM 10395  H H2     . A A 1 323 ? 162.695 89.968  82.346  1.00 0.00 ? 312 A A H2     1  
ATOM 10396  P P      . U A 1 324 ? 157.703 96.386  83.021  1.00 0.00 ? 313 U A P      1  
ATOM 10397  O OP1    . U A 1 324 ? 156.295 96.742  83.333  1.00 0.00 ? 313 U A OP1    1  
ATOM 10398  O OP2    . U A 1 324 ? 158.681 97.459  82.711  1.00 0.00 ? 313 U A OP2    1  
ATOM 10399  O "O5'"  . U A 1 324 ? 158.277 95.532  84.239  1.00 0.00 ? 313 U A "O5'"  1  
ATOM 10400  C "C5'"  . U A 1 324 ? 157.558 94.421  84.753  1.00 0.00 ? 313 U A "C5'"  1  
ATOM 10401  C "C4'"  . U A 1 324 ? 158.408 93.587  85.679  1.00 0.00 ? 313 U A "C4'"  1  
ATOM 10402  O "O4'"  . U A 1 324 ? 159.466 92.936  84.928  1.00 0.00 ? 313 U A "O4'"  1  
ATOM 10403  C "C3'"  . U A 1 324 ? 159.147 94.342  86.774  1.00 0.00 ? 313 U A "C3'"  1  
ATOM 10404  O "O3'"  . U A 1 324 ? 158.331 94.618  87.902  1.00 0.00 ? 313 U A "O3'"  1  
ATOM 10405  C "C2'"  . U A 1 324 ? 160.321 93.423  87.081  1.00 0.00 ? 313 U A "C2'"  1  
ATOM 10406  O "O2'"  . U A 1 324 ? 159.919 92.331  87.898  1.00 0.00 ? 313 U A "O2'"  1  
ATOM 10407  C "C1'"  . U A 1 324 ? 160.668 92.899  85.686  1.00 0.00 ? 313 U A "C1'"  1  
ATOM 10408  N N1     . U A 1 324 ? 161.718 93.711  85.029  1.00 0.00 ? 313 U A N1     1  
ATOM 10409  C C2     . U A 1 324 ? 163.024 93.496  85.429  1.00 0.00 ? 313 U A C2     1  
ATOM 10410  O O2     . U A 1 324 ? 163.335 92.684  86.283  1.00 0.00 ? 313 U A O2     1  
ATOM 10411  N N3     . U A 1 324 ? 163.964 94.270  84.791  1.00 0.00 ? 313 U A N3     1  
ATOM 10412  C C4     . U A 1 324 ? 163.737 95.217  83.815  1.00 0.00 ? 313 U A C4     1  
ATOM 10413  O O4     . U A 1 324 ? 164.691 95.833  83.336  1.00 0.00 ? 313 U A O4     1  
ATOM 10414  C C5     . U A 1 324 ? 162.363 95.384  83.451  1.00 0.00 ? 313 U A C5     1  
ATOM 10415  C C6     . U A 1 324 ? 161.428 94.644  84.054  1.00 0.00 ? 313 U A C6     1  
ATOM 10416  H "H5'"  . U A 1 324 ? 157.255 93.863  84.007  1.00 0.00 ? 313 U A "H5'"  1  
ATOM 10417  H "H5''" . U A 1 324 ? 156.775 94.747  85.245  1.00 0.00 ? 313 U A "H5''" 1  
ATOM 10418  H "H4'"  . U A 1 324 ? 157.842 92.902  86.092  1.00 0.00 ? 313 U A "H4'"  1  
ATOM 10419  H "H3'"  . U A 1 324 ? 159.487 95.186  86.409  1.00 0.00 ? 313 U A "H3'"  1  
ATOM 10420  H "H2'"  . U A 1 324 ? 161.070 93.914  87.476  1.00 0.00 ? 313 U A "H2'"  1  
ATOM 10421  H "HO2'" . U A 1 324 ? 159.078 92.560  88.346  1.00 0.00 ? 313 U A "HO2'" 1  
ATOM 10422  H "H1'"  . U A 1 324 ? 160.973 91.969  85.754  1.00 0.00 ? 313 U A "H1'"  1  
ATOM 10423  H H3     . U A 1 324 ? 164.894 94.135  85.059  1.00 0.00 ? 313 U A H3     1  
ATOM 10424  H H5     . U A 1 324 ? 162.110 96.036  82.763  1.00 0.00 ? 313 U A H5     1  
ATOM 10425  H H6     . U A 1 324 ? 160.494 94.777  83.791  1.00 0.00 ? 313 U A H6     1  
ATOM 10426  P P      . U A 1 325 ? 158.568 95.956  88.761  1.00 0.00 ? 314 U A P      1  
ATOM 10427  O OP1    . U A 1 325 ? 157.514 96.022  89.807  1.00 0.00 ? 314 U A OP1    1  
ATOM 10428  O OP2    . U A 1 325 ? 158.733 97.088  87.816  1.00 0.00 ? 314 U A OP2    1  
ATOM 10429  O "O5'"  . U A 1 325 ? 159.965 95.707  89.484  1.00 0.00 ? 314 U A "O5'"  1  
ATOM 10430  C "C5'"  . U A 1 325 ? 160.118 94.665  90.435  1.00 0.00 ? 314 U A "C5'"  1  
ATOM 10431  C "C4'"  . U A 1 325 ? 161.571 94.421  90.762  1.00 0.00 ? 314 U A "C4'"  1  
ATOM 10432  O "O4'"  . U A 1 325 ? 162.293 94.050  89.558  1.00 0.00 ? 314 U A "O4'"  1  
ATOM 10433  C "C3'"  . U A 1 325 ? 162.344 95.609  91.308  1.00 0.00 ? 314 U A "C3'"  1  
ATOM 10434  O "O3'"  . U A 1 325 ? 162.158 95.801  92.700  1.00 0.00 ? 314 U A "O3'"  1  
ATOM 10435  C "C2'"  . U A 1 325 ? 163.780 95.277  90.926  1.00 0.00 ? 314 U A "C2'"  1  
ATOM 10436  O "O2'"  . U A 1 325 ? 164.342 94.319  91.812  1.00 0.00 ? 314 U A "O2'"  1  
ATOM 10437  C "C1'"  . U A 1 325 ? 163.589 94.627  89.554  1.00 0.00 ? 314 U A "C1'"  1  
ATOM 10438  N N1     . U A 1 325 ? 163.725 95.603  88.446  1.00 0.00 ? 314 U A N1     1  
ATOM 10439  C C2     . U A 1 325 ? 165.006 95.981  88.093  1.00 0.00 ? 314 U A C2     1  
ATOM 10440  O O2     . U A 1 325 ? 166.004 95.551  88.648  1.00 0.00 ? 314 U A O2     1  
ATOM 10441  N N3     . U A 1 325 ? 165.087 96.885  87.062  1.00 0.00 ? 314 U A N3     1  
ATOM 10442  C C4     . U A 1 325 ? 164.036 97.441  86.361  1.00 0.00 ? 314 U A C4     1  
ATOM 10443  O O4     . U A 1 325 ? 164.271 98.244  85.457  1.00 0.00 ? 314 U A O4     1  
ATOM 10444  C C5     . U A 1 325 ? 162.740 97.004  86.781  1.00 0.00 ? 314 U A C5     1  
ATOM 10445  C C6     . U A 1 325 ? 162.634 96.123  87.781  1.00 0.00 ? 314 U A C6     1  
ATOM 10446  H "H5'"  . U A 1 325 ? 159.731 93.841  90.073  1.00 0.00 ? 314 U A "H5'"  1  
ATOM 10447  H "H5''" . U A 1 325 ? 159.643 94.907  91.257  1.00 0.00 ? 314 U A "H5''" 1  
ATOM 10448  H "H4'"  . U A 1 325 ? 161.627 93.683  91.407  1.00 0.00 ? 314 U A "H4'"  1  
ATOM 10449  H "H3'"  . U A 1 325 ? 162.066 96.420  90.833  1.00 0.00 ? 314 U A "H3'"  1  
ATOM 10450  H "H2'"  . U A 1 325 ? 164.333 96.082  90.865  1.00 0.00 ? 314 U A "H2'"  1  
ATOM 10451  H "HO2'" . U A 1 325 ? 163.826 94.314  92.645  1.00 0.00 ? 314 U A "HO2'" 1  
ATOM 10452  H "H1'"  . U A 1 325 ? 164.245 93.911  89.436  1.00 0.00 ? 314 U A "H1'"  1  
ATOM 10453  H H3     . U A 1 325 ? 165.986 97.167  86.798  1.00 0.00 ? 314 U A H3     1  
ATOM 10454  H H5     . U A 1 325 ? 161.936 97.347  86.336  1.00 0.00 ? 314 U A H5     1  
ATOM 10455  H H6     . U A 1 325 ? 161.735 95.841  88.049  1.00 0.00 ? 314 U A H6     1  
ATOM 10456  P P      . C A 1 326 ? 161.841 97.264  93.271  1.00 0.00 ? 315 C A P      1  
ATOM 10457  O OP1    . C A 1 326 ? 161.467 97.071  94.693  1.00 0.00 ? 315 C A OP1    1  
ATOM 10458  O OP2    . C A 1 326 ? 160.866 97.867  92.331  1.00 0.00 ? 315 C A OP2    1  
ATOM 10459  O "O5'"  . C A 1 326 ? 163.174 98.137  93.226  1.00 0.00 ? 315 C A "O5'"  1  
ATOM 10460  C "C5'"  . C A 1 326 ? 163.633 98.828  94.380  1.00 0.00 ? 315 C A "C5'"  1  
ATOM 10461  C "C4'"  . C A 1 326 ? 164.852 99.665  94.078  1.00 0.00 ? 315 C A "C4'"  1  
ATOM 10462  O "O4'"  . C A 1 326 ? 165.436 99.252  92.817  1.00 0.00 ? 315 C A "O4'"  1  
ATOM 10463  C "C3'"  . C A 1 326 ? 164.614 101.157 93.907  1.00 0.00 ? 315 C A "C3'"  1  
ATOM 10464  O "O3'"  . C A 1 326 ? 164.544 101.854 95.140  1.00 0.00 ? 315 C A "O3'"  1  
ATOM 10465  C "C2'"  . C A 1 326 ? 165.785 101.582 93.032  1.00 0.00 ? 315 C A "C2'"  1  
ATOM 10466  O "O2'"  . C A 1 326 ? 166.981 101.697 93.792  1.00 0.00 ? 315 C A "O2'"  1  
ATOM 10467  C "C1'"  . C A 1 326 ? 165.913 100.384 92.090  1.00 0.00 ? 315 C A "C1'"  1  
ATOM 10468  N N1     . C A 1 326 ? 165.123 100.562 90.845  1.00 0.00 ? 315 C A N1     1  
ATOM 10469  C C2     . C A 1 326 ? 165.647 101.382 89.837  1.00 0.00 ? 315 C A C2     1  
ATOM 10470  O O2     . C A 1 326 ? 166.746 101.932 90.015  1.00 0.00 ? 315 C A O2     1  
ATOM 10471  N N3     . C A 1 326 ? 164.949 101.561 88.693  1.00 0.00 ? 315 C A N3     1  
ATOM 10472  C C4     . C A 1 326 ? 163.771 100.958 88.529  1.00 0.00 ? 315 C A C4     1  
ATOM 10473  N N4     . C A 1 326 ? 163.117 101.165 87.382  1.00 0.00 ? 315 C A N4     1  
ATOM 10474  C C5     . C A 1 326 ? 163.211 100.120 89.533  1.00 0.00 ? 315 C A C5     1  
ATOM 10475  C C6     . C A 1 326 ? 163.910 99.950  90.660  1.00 0.00 ? 315 C A C6     1  
ATOM 10476  H "H5'"  . C A 1 326 ? 163.857 98.174  95.074  1.00 0.00 ? 315 C A "H5'"  1  
ATOM 10477  H "H5''" . C A 1 326 ? 162.917 99.411  94.707  1.00 0.00 ? 315 C A "H5''" 1  
ATOM 10478  H "H4'"  . C A 1 326 ? 165.509 99.528  94.794  1.00 0.00 ? 315 C A "H4'"  1  
ATOM 10479  H "H3'"  . C A 1 326 ? 163.780 101.294 93.413  1.00 0.00 ? 315 C A "H3'"  1  
ATOM 10480  H "H2'"  . C A 1 326 ? 165.588 102.406 92.541  1.00 0.00 ? 315 C A "H2'"  1  
ATOM 10481  H "HO2'" . C A 1 326 ? 166.749 101.796 94.739  1.00 0.00 ? 315 C A "HO2'" 1  
ATOM 10482  H "H1'"  . C A 1 326 ? 166.855 100.248 91.860  1.00 0.00 ? 315 C A "H1'"  1  
ATOM 10483  H H41    . C A 1 326 ? 163.506 101.743 86.693  1.00 0.00 ? 315 C A H41    1  
ATOM 10484  H H42    . C A 1 326 ? 162.250 100.736 87.230  1.00 0.00 ? 315 C A H42    1  
ATOM 10485  H H5     . C A 1 326 ? 162.345 99.681  89.402  1.00 0.00 ? 315 C A H5     1  
ATOM 10486  H H6     . C A 1 326 ? 163.542 99.377  91.363  1.00 0.00 ? 315 C A H6     1  
ATOM 10487  P P      . G A 1 327 ? 163.628 103.167 95.276  1.00 0.00 ? 316 G A P      1  
ATOM 10488  O OP1    . G A 1 327 ? 163.548 103.524 96.715  1.00 0.00 ? 316 G A OP1    1  
ATOM 10489  O OP2    . G A 1 327 ? 162.381 102.937 94.505  1.00 0.00 ? 316 G A OP2    1  
ATOM 10490  O "O5'"  . G A 1 327 ? 164.467 104.300 94.534  1.00 0.00 ? 316 G A "O5'"  1  
ATOM 10491  C "C5'"  . G A 1 327 ? 165.692 104.773 95.071  1.00 0.00 ? 316 G A "C5'"  1  
ATOM 10492  C "C4'"  . G A 1 327 ? 166.391 105.710 94.117  1.00 0.00 ? 316 G A "C4'"  1  
ATOM 10493  O "O4'"  . G A 1 327 ? 166.679 105.019 92.872  1.00 0.00 ? 316 G A "O4'"  1  
ATOM 10494  C "C3'"  . G A 1 327 ? 165.601 106.935 93.689  1.00 0.00 ? 316 G A "C3'"  1  
ATOM 10495  O "O3'"  . G A 1 327 ? 165.642 107.984 94.642  1.00 0.00 ? 316 G A "O3'"  1  
ATOM 10496  C "C2'"  . G A 1 327 ? 166.246 107.298 92.358  1.00 0.00 ? 316 G A "C2'"  1  
ATOM 10497  O "O2'"  . G A 1 327 ? 167.484 107.965 92.550  1.00 0.00 ? 316 G A "O2'"  1  
ATOM 10498  C "C1'"  . G A 1 327 ? 166.515 105.914 91.763  1.00 0.00 ? 316 G A "C1'"  1  
ATOM 10499  N N9     . G A 1 327 ? 165.418 105.461 90.889  1.00 0.00 ? 316 G A N9     1  
ATOM 10500  C C8     . G A 1 327 ? 164.481 104.496 91.163  1.00 0.00 ? 316 G A C8     1  
ATOM 10501  N N7     . G A 1 327 ? 163.629 104.313 90.188  1.00 0.00 ? 316 G A N7     1  
ATOM 10502  C C5     . G A 1 327 ? 164.029 105.213 89.212  1.00 0.00 ? 316 G A C5     1  
ATOM 10503  C C6     . G A 1 327 ? 163.488 105.478 87.927  1.00 0.00 ? 316 G A C6     1  
ATOM 10504  O O6     . G A 1 327 ? 162.515 104.948 87.379  1.00 0.00 ? 316 G A O6     1  
ATOM 10505  N N1     . G A 1 327 ? 164.200 106.470 87.264  1.00 0.00 ? 316 G A N1     1  
ATOM 10506  C C2     . G A 1 327 ? 165.294 107.131 87.773  1.00 0.00 ? 316 G A C2     1  
ATOM 10507  N N2     . G A 1 327 ? 165.848 108.060 86.983  1.00 0.00 ? 316 G A N2     1  
ATOM 10508  N N3     . G A 1 327 ? 165.808 106.894 88.969  1.00 0.00 ? 316 G A N3     1  
ATOM 10509  C C4     . G A 1 327 ? 165.131 105.931 89.629  1.00 0.00 ? 316 G A C4     1  
ATOM 10510  H "H5'"  . G A 1 327 ? 166.275 104.007 95.253  1.00 0.00 ? 316 G A "H5'"  1  
ATOM 10511  H "H5''" . G A 1 327 ? 165.512 105.245 95.912  1.00 0.00 ? 316 G A "H5''" 1  
ATOM 10512  H "H4'"  . G A 1 327 ? 167.236 106.003 94.522  1.00 0.00 ? 316 G A "H4'"  1  
ATOM 10513  H "H3'"  . G A 1 327 ? 164.666 106.679 93.532  1.00 0.00 ? 316 G A "H3'"  1  
ATOM 10514  H "H2'"  . G A 1 327 ? 165.638 107.817 91.793  1.00 0.00 ? 316 G A "H2'"  1  
ATOM 10515  H "HO2'" . G A 1 327 ? 167.511 108.331 93.458  1.00 0.00 ? 316 G A "HO2'" 1  
ATOM 10516  H "H1'"  . G A 1 327 ? 167.351 105.935 91.252  1.00 0.00 ? 316 G A "H1'"  1  
ATOM 10517  H H8     . G A 1 327 ? 164.452 103.991 92.003  1.00 0.00 ? 316 G A H8     1  
ATOM 10518  H H1     . G A 1 327 ? 163.897 106.720 86.368  1.00 0.00 ? 316 G A H1     1  
ATOM 10519  H H21    . G A 1 327 ? 165.473 108.241 86.096  1.00 0.00 ? 316 G A H21    1  
ATOM 10520  H H22    . G A 1 327 ? 166.632 108.563 87.292  1.00 0.00 ? 316 G A H22    1  
ATOM 10521  P P      . C A 1 328 ? 164.400 108.994 94.786  1.00 0.00 ? 317 C A P      1  
ATOM 10522  O OP1    . C A 1 328 ? 164.596 109.791 96.024  1.00 0.00 ? 317 C A OP1    1  
ATOM 10523  O OP2    . C A 1 328 ? 163.148 108.214 94.607  1.00 0.00 ? 317 C A OP2    1  
ATOM 10524  O "O5'"  . C A 1 328 ? 164.553 109.973 93.539  1.00 0.00 ? 317 C A "O5'"  1  
ATOM 10525  C "C5'"  . C A 1 328 ? 165.639 110.882 93.457  1.00 0.00 ? 317 C A "C5'"  1  
ATOM 10526  C "C4'"  . C A 1 328 ? 165.656 111.611 92.136  1.00 0.00 ? 317 C A "C4'"  1  
ATOM 10527  O "O4'"  . C A 1 328 ? 165.822 110.661 91.049  1.00 0.00 ? 317 C A "O4'"  1  
ATOM 10528  C "C3'"  . C A 1 328 ? 164.391 112.370 91.771  1.00 0.00 ? 317 C A "C3'"  1  
ATOM 10529  O "O3'"  . C A 1 328 ? 164.316 113.649 92.379  1.00 0.00 ? 317 C A "O3'"  1  
ATOM 10530  C "C2'"  . C A 1 328 ? 164.458 112.422 90.252  1.00 0.00 ? 317 C A "C2'"  1  
ATOM 10531  O "O2'"  . C A 1 328 ? 165.370 113.416 89.806  1.00 0.00 ? 317 C A "O2'"  1  
ATOM 10532  C "C1'"  . C A 1 328 ? 165.030 111.041 89.925  1.00 0.00 ? 317 C A "C1'"  1  
ATOM 10533  N N1     . C A 1 328 ? 163.967 110.032 89.686  1.00 0.00 ? 317 C A N1     1  
ATOM 10534  C C2     . C A 1 328 ? 163.317 110.035 88.445  1.00 0.00 ? 317 C A C2     1  
ATOM 10535  O O2     . C A 1 328 ? 163.646 110.873 87.591  1.00 0.00 ? 317 C A O2     1  
ATOM 10536  N N3     . C A 1 328 ? 162.347 109.124 88.200  1.00 0.00 ? 317 C A N3     1  
ATOM 10537  C C4     . C A 1 328 ? 162.013 108.237 89.136  1.00 0.00 ? 317 C A C4     1  
ATOM 10538  N N4     . C A 1 328 ? 161.048 107.357 88.849  1.00 0.00 ? 317 C A N4     1  
ATOM 10539  C C5     . C A 1 328 ? 162.652 108.207 90.406  1.00 0.00 ? 317 C A C5     1  
ATOM 10540  C C6     . C A 1 328 ? 163.614 109.112 90.637  1.00 0.00 ? 317 C A C6     1  
ATOM 10541  H "H5'"  . C A 1 328 ? 166.479 110.390 93.560  1.00 0.00 ? 317 C A "H5'"  1  
ATOM 10542  H "H5''" . C A 1 328 ? 165.562 111.540 94.181  1.00 0.00 ? 317 C A "H5''" 1  
ATOM 10543  H "H4'"  . C A 1 328 ? 166.414 112.235 92.129  1.00 0.00 ? 317 C A "H4'"  1  
ATOM 10544  H "H3'"  . C A 1 328 ? 163.609 111.843 92.040  1.00 0.00 ? 317 C A "H3'"  1  
ATOM 10545  H "H2'"  . C A 1 328 ? 163.567 112.542 89.854  1.00 0.00 ? 317 C A "H2'"  1  
ATOM 10546  H "HO2'" . C A 1 328 ? 165.518 114.059 90.529  1.00 0.00 ? 317 C A "HO2'" 1  
ATOM 10547  H "H1'"  . C A 1 328 ? 165.603 111.104 89.134  1.00 0.00 ? 317 C A "H1'"  1  
ATOM 10548  H H41    . C A 1 328 ? 160.609 107.380 87.974  1.00 0.00 ? 317 C A H41    1  
ATOM 10549  H H42    . C A 1 328 ? 160.779 106.692 89.515  1.00 0.00 ? 317 C A H42    1  
ATOM 10550  H H5     . C A 1 328 ? 162.401 107.550 91.087  1.00 0.00 ? 317 C A H5     1  
ATOM 10551  H H6     . C A 1 328 ? 164.067 109.108 91.505  1.00 0.00 ? 317 C A H6     1  
ATOM 10552  P P      . G A 1 329 ? 162.890 114.285 92.754  1.00 0.00 ? 318 G A P      1  
ATOM 10553  O OP1    . G A 1 329 ? 163.128 115.506 93.568  1.00 0.00 ? 318 G A OP1    1  
ATOM 10554  O OP2    . G A 1 329 ? 162.030 113.202 93.291  1.00 0.00 ? 318 G A OP2    1  
ATOM 10555  O "O5'"  . G A 1 329 ? 162.289 114.742 91.350  1.00 0.00 ? 318 G A "O5'"  1  
ATOM 10556  C "C5'"  . G A 1 329 ? 162.883 115.799 90.611  1.00 0.00 ? 318 G A "C5'"  1  
ATOM 10557  C "C4'"  . G A 1 329 ? 162.248 115.952 89.252  1.00 0.00 ? 318 G A "C4'"  1  
ATOM 10558  O "O4'"  . G A 1 329 ? 162.431 114.732 88.486  1.00 0.00 ? 318 G A "O4'"  1  
ATOM 10559  C "C3'"  . G A 1 329 ? 160.743 116.175 89.239  1.00 0.00 ? 318 G A "C3'"  1  
ATOM 10560  O "O3'"  . G A 1 329 ? 160.382 117.522 89.487  1.00 0.00 ? 318 G A "O3'"  1  
ATOM 10561  C "C2'"  . G A 1 329 ? 160.346 115.683 87.855  1.00 0.00 ? 318 G A "C2'"  1  
ATOM 10562  O "O2'"  . G A 1 329 ? 160.658 116.643 86.856  1.00 0.00 ? 318 G A "O2'"  1  
ATOM 10563  C "C1'"  . G A 1 329 ? 161.267 114.473 87.685  1.00 0.00 ? 318 G A "C1'"  1  
ATOM 10564  N N9     . G A 1 329 ? 160.615 113.216 88.096  1.00 0.00 ? 318 G A N9     1  
ATOM 10565  C C8     . G A 1 329 ? 160.871 112.477 89.226  1.00 0.00 ? 318 G A C8     1  
ATOM 10566  N N7     . G A 1 329 ? 160.131 111.405 89.316  1.00 0.00 ? 318 G A N7     1  
ATOM 10567  C C5     . G A 1 329 ? 159.337 111.439 88.178  1.00 0.00 ? 318 G A C5     1  
ATOM 10568  C C6     . G A 1 329 ? 158.336 110.539 87.728  1.00 0.00 ? 318 G A C6     1  
ATOM 10569  O O6     . G A 1 329 ? 157.937 109.499 88.263  1.00 0.00 ? 318 G A O6     1  
ATOM 10570  N N1     . G A 1 329 ? 157.780 110.952 86.521  1.00 0.00 ? 318 G A N1     1  
ATOM 10571  C C2     . G A 1 329 ? 158.140 112.086 85.835  1.00 0.00 ? 318 G A C2     1  
ATOM 10572  N N2     . G A 1 329 ? 157.490 112.318 84.685  1.00 0.00 ? 318 G A N2     1  
ATOM 10573  N N3     . G A 1 329 ? 159.073 112.932 86.242  1.00 0.00 ? 318 G A N3     1  
ATOM 10574  C C4     . G A 1 329 ? 159.623 112.549 87.414  1.00 0.00 ? 318 G A C4     1  
ATOM 10575  H "H5'"  . G A 1 329 ? 163.839 115.615 90.500  1.00 0.00 ? 318 G A "H5'"  1  
ATOM 10576  H "H5''" . G A 1 329 ? 162.776 116.638 91.110  1.00 0.00 ? 318 G A "H5''" 1  
ATOM 10577  H "H4'"  . G A 1 329 ? 162.683 116.693 88.780  1.00 0.00 ? 318 G A "H4'"  1  
ATOM 10578  H "H3'"  . G A 1 329 ? 160.327 115.601 89.916  1.00 0.00 ? 318 G A "H3'"  1  
ATOM 10579  H "H2'"  . G A 1 329 ? 159.401 115.420 87.824  1.00 0.00 ? 318 G A "H2'"  1  
ATOM 10580  H "HO2'" . G A 1 329 ? 160.760 117.521 87.277  1.00 0.00 ? 318 G A "HO2'" 1  
ATOM 10581  H "H1'"  . G A 1 329 ? 161.548 114.406 86.749  1.00 0.00 ? 318 G A "H1'"  1  
ATOM 10582  H H8     . G A 1 329 ? 161.540 112.727 89.897  1.00 0.00 ? 318 G A H8     1  
ATOM 10583  H H1     . G A 1 329 ? 157.078 110.390 86.131  1.00 0.00 ? 318 G A H1     1  
ATOM 10584  H H21    . G A 1 329 ? 156.800 111.696 84.375  1.00 0.00 ? 318 G A H21    1  
ATOM 10585  H H22    . G A 1 329 ? 157.705 113.112 84.151  1.00 0.00 ? 318 G A H22    1  
ATOM 10586  P P      . C A 1 330 ? 158.979 117.866 90.192  1.00 0.00 ? 319 C A P      1  
ATOM 10587  O OP1    . C A 1 330 ? 158.976 119.310 90.534  1.00 0.00 ? 319 C A OP1    1  
ATOM 10588  O OP2    . C A 1 330 ? 158.743 116.859 91.259  1.00 0.00 ? 319 C A OP2    1  
ATOM 10589  O "O5'"  . C A 1 330 ? 157.902 117.629 89.043  1.00 0.00 ? 319 C A "O5'"  1  
ATOM 10590  C "C5'"  . C A 1 330 ? 157.860 118.468 87.899  1.00 0.00 ? 319 C A "C5'"  1  
ATOM 10591  C "C4'"  . C A 1 330 ? 156.803 118.021 86.919  1.00 0.00 ? 319 C A "C4'"  1  
ATOM 10592  O "O4'"  . C A 1 330 ? 157.122 116.698 86.416  1.00 0.00 ? 319 C A "O4'"  1  
ATOM 10593  C "C3'"  . C A 1 330 ? 155.393 117.877 87.474  1.00 0.00 ? 319 C A "C3'"  1  
ATOM 10594  O "O3'"  . C A 1 330 ? 154.697 119.108 87.546  1.00 0.00 ? 319 C A "O3'"  1  
ATOM 10595  C "C2'"  . C A 1 330 ? 154.762 116.875 86.518  1.00 0.00 ? 319 C A "C2'"  1  
ATOM 10596  O "O2'"  . C A 1 330 ? 154.380 117.495 85.298  1.00 0.00 ? 319 C A "O2'"  1  
ATOM 10597  C "C1'"  . C A 1 330 ? 155.933 115.930 86.248  1.00 0.00 ? 319 C A "C1'"  1  
ATOM 10598  N N1     . C A 1 330 ? 155.945 114.770 87.176  1.00 0.00 ? 319 C A N1     1  
ATOM 10599  C C2     . C A 1 330 ? 155.063 113.711 86.926  1.00 0.00 ? 319 C A C2     1  
ATOM 10600  O O2     . C A 1 330 ? 154.304 113.771 85.947  1.00 0.00 ? 319 C A O2     1  
ATOM 10601  N N3     . C A 1 330 ? 155.053 112.640 87.754  1.00 0.00 ? 319 C A N3     1  
ATOM 10602  C C4     . C A 1 330 ? 155.879 112.599 88.801  1.00 0.00 ? 319 C A C4     1  
ATOM 10603  N N4     . C A 1 330 ? 155.835 111.524 89.591  1.00 0.00 ? 319 C A N4     1  
ATOM 10604  C C5     . C A 1 330 ? 156.786 113.660 89.082  1.00 0.00 ? 319 C A C5     1  
ATOM 10605  C C6     . C A 1 330 ? 156.787 114.712 88.254  1.00 0.00 ? 319 C A C6     1  
ATOM 10606  H "H5'"  . C A 1 330 ? 158.735 118.447 87.456  1.00 0.00 ? 319 C A "H5'"  1  
ATOM 10607  H "H5''" . C A 1 330 ? 157.666 119.386 88.182  1.00 0.00 ? 319 C A "H5''" 1  
ATOM 10608  H "H4'"  . C A 1 330 ? 156.784 118.651 86.168  1.00 0.00 ? 319 C A "H4'"  1  
ATOM 10609  H "H3'"  . C A 1 330 ? 155.440 117.481 88.369  1.00 0.00 ? 319 C A "H3'"  1  
ATOM 10610  H "H2'"  . C A 1 330 ? 154.009 116.403 86.935  1.00 0.00 ? 319 C A "H2'"  1  
ATOM 10611  H "HO2'" . C A 1 330 ? 154.305 118.461 85.443  1.00 0.00 ? 319 C A "HO2'" 1  
ATOM 10612  H "H1'"  . C A 1 330 ? 155.886 115.605 85.326  1.00 0.00 ? 319 C A "H1'"  1  
ATOM 10613  H H41    . C A 1 330 ? 155.209 110.797 89.395  1.00 0.00 ? 319 C A H41    1  
ATOM 10614  H H42    . C A 1 330 ? 156.430 111.464 90.367  1.00 0.00 ? 319 C A H42    1  
ATOM 10615  H H5     . C A 1 330 ? 157.391 113.620 89.854  1.00 0.00 ? 319 C A H5     1  
ATOM 10616  H H6     . C A 1 330 ? 157.405 115.451 88.430  1.00 0.00 ? 319 C A H6     1  
ATOM 10617  P P      . U A 1 331 ? 153.630 119.365 88.720  1.00 0.00 ? 320 U A P      1  
ATOM 10618  O OP1    . U A 1 331 ? 153.195 120.784 88.646  1.00 0.00 ? 320 U A OP1    1  
ATOM 10619  O OP2    . U A 1 331 ? 154.200 118.838 89.985  1.00 0.00 ? 320 U A OP2    1  
ATOM 10620  O "O5'"  . U A 1 331 ? 152.389 118.448 88.318  1.00 0.00 ? 320 U A "O5'"  1  
ATOM 10621  C "C5'"  . U A 1 331 ? 151.624 118.726 87.158  1.00 0.00 ? 320 U A "C5'"  1  
ATOM 10622  C "C4'"  . U A 1 331 ? 150.661 117.608 86.844  1.00 0.00 ? 320 U A "C4'"  1  
ATOM 10623  O "O4'"  . U A 1 331 ? 151.393 116.378 86.602  1.00 0.00 ? 320 U A "O4'"  1  
ATOM 10624  C "C3'"  . U A 1 331 ? 149.677 117.241 87.946  1.00 0.00 ? 320 U A "C3'"  1  
ATOM 10625  O "O3'"  . U A 1 331 ? 148.542 118.090 87.979  1.00 0.00 ? 320 U A "O3'"  1  
ATOM 10626  C "C2'"  . U A 1 331 ? 149.347 115.791 87.627  1.00 0.00 ? 320 U A "C2'"  1  
ATOM 10627  O "O2'"  . U A 1 331 ? 148.427 115.696 86.551  1.00 0.00 ? 320 U A "O2'"  1  
ATOM 10628  C "C1'"  . U A 1 331 ? 150.707 115.262 87.168  1.00 0.00 ? 320 U A "C1'"  1  
ATOM 10629  N N1     . U A 1 331 ? 151.492 114.682 88.282  1.00 0.00 ? 320 U A N1     1  
ATOM 10630  C C2     . U A 1 331 ? 151.154 113.405 88.696  1.00 0.00 ? 320 U A C2     1  
ATOM 10631  O O2     . U A 1 331 ? 150.255 112.758 88.189  1.00 0.00 ? 320 U A O2     1  
ATOM 10632  N N3     . U A 1 331 ? 151.908 112.911 89.732  1.00 0.00 ? 320 U A N3     1  
ATOM 10633  C C4     . U A 1 331 ? 152.945 113.543 90.383  1.00 0.00 ? 320 U A C4     1  
ATOM 10634  O O4     . U A 1 331 ? 153.527 112.963 91.301  1.00 0.00 ? 320 U A O4     1  
ATOM 10635  C C5     . U A 1 331 ? 153.239 114.859 89.902  1.00 0.00 ? 320 U A C5     1  
ATOM 10636  C C6     . U A 1 331 ? 152.520 115.367 88.895  1.00 0.00 ? 320 U A C6     1  
ATOM 10637  H "H5'"  . U A 1 331 ? 152.229 118.848 86.396  1.00 0.00 ? 320 U A "H5'"  1  
ATOM 10638  H "H5''" . U A 1 331 ? 151.117 119.554 87.298  1.00 0.00 ? 320 U A "H5''" 1  
ATOM 10639  H "H4'"  . U A 1 331 ? 150.159 117.843 86.036  1.00 0.00 ? 320 U A "H4'"  1  
ATOM 10640  H "H3'"  . U A 1 331 ? 150.134 117.284 88.811  1.00 0.00 ? 320 U A "H3'"  1  
ATOM 10641  H "H2'"  . U A 1 331 ? 149.027 115.312 88.423  1.00 0.00 ? 320 U A "H2'"  1  
ATOM 10642  H "HO2'" . U A 1 331 ? 147.960 116.552 86.452  1.00 0.00 ? 320 U A "HO2'" 1  
ATOM 10643  H "H1'"  . U A 1 331 ? 150.574 114.579 86.478  1.00 0.00 ? 320 U A "H1'"  1  
ATOM 10644  H H3     . U A 1 331 ? 151.685 112.008 90.041  1.00 0.00 ? 320 U A H3     1  
ATOM 10645  H H5     . U A 1 331 ? 153.961 115.383 90.308  1.00 0.00 ? 320 U A H5     1  
ATOM 10646  H H6     . U A 1 331 ? 152.741 116.268 88.586  1.00 0.00 ? 320 U A H6     1  
ATOM 10647  P P      . G A 1 332 ? 147.783 118.375 89.366  1.00 0.00 ? 321 G A P      1  
ATOM 10648  O OP1    . G A 1 332 ? 146.880 119.537 89.169  1.00 0.00 ? 321 G A OP1    1  
ATOM 10649  O OP2    . G A 1 332 ? 148.801 118.410 90.447  1.00 0.00 ? 321 G A OP2    1  
ATOM 10650  O "O5'"  . G A 1 332 ? 146.880 117.082 89.585  1.00 0.00 ? 321 G A "O5'"  1  
ATOM 10651  C "C5'"  . G A 1 332 ? 145.768 116.818 88.741  1.00 0.00 ? 321 G A "C5'"  1  
ATOM 10652  C "C4'"  . G A 1 332 ? 145.220 115.429 88.966  1.00 0.00 ? 321 G A "C4'"  1  
ATOM 10653  O "O4'"  . G A 1 332 ? 146.264 114.447 88.740  1.00 0.00 ? 321 G A "O4'"  1  
ATOM 10654  C "C3'"  . G A 1 332 ? 144.722 115.127 90.370  1.00 0.00 ? 321 G A "C3'"  1  
ATOM 10655  O "O3'"  . G A 1 332 ? 143.409 115.608 90.608  1.00 0.00 ? 321 G A "O3'"  1  
ATOM 10656  C "C2'"  . G A 1 332 ? 144.840 113.611 90.444  1.00 0.00 ? 321 G A "C2'"  1  
ATOM 10657  O "O2'"  . G A 1 332 ? 143.774 112.975 89.755  1.00 0.00 ? 321 G A "O2'"  1  
ATOM 10658  C "C1'"  . G A 1 332 ? 146.142 113.368 89.679  1.00 0.00 ? 321 G A "C1'"  1  
ATOM 10659  N N9     . G A 1 332 ? 147.309 113.296 90.576  1.00 0.00 ? 321 G A N9     1  
ATOM 10660  C C8     . G A 1 332 ? 148.289 114.245 90.740  1.00 0.00 ? 321 G A C8     1  
ATOM 10661  N N7     . G A 1 332 ? 149.201 113.896 91.609  1.00 0.00 ? 321 G A N7     1  
ATOM 10662  C C5     . G A 1 332 ? 148.797 112.643 92.046  1.00 0.00 ? 321 G A C5     1  
ATOM 10663  C C6     . G A 1 332 ? 149.387 111.765 92.990  1.00 0.00 ? 321 G A C6     1  
ATOM 10664  O O6     . G A 1 332 ? 150.418 111.925 93.653  1.00 0.00 ? 321 G A O6     1  
ATOM 10665  N N1     . G A 1 332 ? 148.648 110.594 93.132  1.00 0.00 ? 321 G A N1     1  
ATOM 10666  C C2     . G A 1 332 ? 147.491 110.304 92.453  1.00 0.00 ? 321 G A C2     1  
ATOM 10667  N N2     . G A 1 332 ? 146.919 109.121 92.726  1.00 0.00 ? 321 G A N2     1  
ATOM 10668  N N3     . G A 1 332 ? 146.930 111.115 91.568  1.00 0.00 ? 321 G A N3     1  
ATOM 10669  C C4     . G A 1 332 ? 147.631 112.257 91.417  1.00 0.00 ? 321 G A C4     1  
ATOM 10670  H "H5'"  . G A 1 332 ? 146.048 116.904 87.807  1.00 0.00 ? 321 G A "H5'"  1  
ATOM 10671  H "H5''" . G A 1 332 ? 145.064 117.473 88.925  1.00 0.00 ? 321 G A "H5''" 1  
ATOM 10672  H "H4'"  . G A 1 332 ? 144.491 115.270 88.329  1.00 0.00 ? 321 G A "H4'"  1  
ATOM 10673  H "H3'"  . G A 1 332 ? 145.335 115.528 91.022  1.00 0.00 ? 321 G A "H3'"  1  
ATOM 10674  H "H2'"  . G A 1 332 ? 144.909 113.301 91.373  1.00 0.00 ? 321 G A "H2'"  1  
ATOM 10675  H "HO2'" . G A 1 332 ? 143.842 112.008 89.886  1.00 0.00 ? 321 G A "HO2'" 1  
ATOM 10676  H "H1'"  . G A 1 332 ? 146.069 112.533 89.170  1.00 0.00 ? 321 G A "H1'"  1  
ATOM 10677  H H8     . G A 1 332 ? 148.307 115.096 90.254  1.00 0.00 ? 321 G A H8     1  
ATOM 10678  H H1     . G A 1 332 ? 148.982 109.924 93.768  1.00 0.00 ? 321 G A H1     1  
ATOM 10679  H H21    . G A 1 332 ? 147.328 108.516 93.379  1.00 0.00 ? 321 G A H21    1  
ATOM 10680  H H22    . G A 1 332 ? 146.090 108.861 92.271  1.00 0.00 ? 321 G A H22    1  
ATOM 10681  P P      . G A 1 333 ? 142.456 114.835 91.638  1.00 0.00 ? 322 G A P      1  
ATOM 10682  O OP1    . G A 1 333 ? 142.002 113.562 91.021  1.00 0.00 ? 322 G A OP1    1  
ATOM 10683  O OP2    . G A 1 333 ? 141.457 115.874 91.996  1.00 0.00 ? 322 G A OP2    1  
ATOM 10684  O "O5'"  . G A 1 333 ? 143.288 114.477 92.949  1.00 0.00 ? 322 G A "O5'"  1  
ATOM 10685  C "C5'"  . G A 1 333 ? 142.630 114.123 94.156  1.00 0.00 ? 322 G A "C5'"  1  
ATOM 10686  C "C4'"  . G A 1 333 ? 142.373 112.638 94.232  1.00 0.00 ? 322 G A "C4'"  1  
ATOM 10687  O "O4'"  . G A 1 333 ? 143.624 111.951 94.489  1.00 0.00 ? 322 G A "O4'"  1  
ATOM 10688  C "C3'"  . G A 1 333 ? 141.452 112.176 95.351  1.00 0.00 ? 322 G A "C3'"  1  
ATOM 10689  O "O3'"  . G A 1 333 ? 140.079 112.264 95.010  1.00 0.00 ? 322 G A "O3'"  1  
ATOM 10690  C "C2'"  . G A 1 333 ? 141.928 110.755 95.620  1.00 0.00 ? 322 G A "C2'"  1  
ATOM 10691  O "O2'"  . G A 1 333 ? 141.403 109.846 94.664  1.00 0.00 ? 322 G A "O2'"  1  
ATOM 10692  C "C1'"  . G A 1 333 ? 143.437 110.895 95.399  1.00 0.00 ? 322 G A "C1'"  1  
ATOM 10693  N N9     . G A 1 333 ? 144.149 111.257 96.639  1.00 0.00 ? 322 G A N9     1  
ATOM 10694  C C8     . G A 1 333 ? 144.660 112.488 96.975  1.00 0.00 ? 322 G A C8     1  
ATOM 10695  N N7     . G A 1 333 ? 145.240 112.501 98.145  1.00 0.00 ? 322 G A N7     1  
ATOM 10696  C C5     . G A 1 333 ? 145.104 111.201 98.610  1.00 0.00 ? 322 G A C5     1  
ATOM 10697  C C6     . G A 1 333 ? 145.535 110.609 99.826  1.00 0.00 ? 322 G A C6     1  
ATOM 10698  O O6     . G A 1 333 ? 146.145 111.134 100.764 1.00 0.00 ? 322 G A O6     1  
ATOM 10699  N N1     . G A 1 333 ? 145.190 109.262 99.891  1.00 0.00 ? 322 G A N1     1  
ATOM 10700  C C2     . G A 1 333 ? 144.515 108.573 98.913  1.00 0.00 ? 322 G A C2     1  
ATOM 10701  N N2     . G A 1 333 ? 144.272 107.277 99.159  1.00 0.00 ? 322 G A N2     1  
ATOM 10702  N N3     . G A 1 333 ? 144.107 109.113 97.776  1.00 0.00 ? 322 G A N3     1  
ATOM 10703  C C4     . G A 1 333 ? 144.433 110.420 97.693  1.00 0.00 ? 322 G A C4     1  
ATOM 10704  H "H5'"  . G A 1 333 ? 141.775 114.598 94.206  1.00 0.00 ? 322 G A "H5'"  1  
ATOM 10705  H "H5''" . G A 1 333 ? 143.189 114.390 94.915  1.00 0.00 ? 322 G A "H5''" 1  
ATOM 10706  H "H4'"  . G A 1 333 ? 142.013 112.327 93.375  1.00 0.00 ? 322 G A "H4'"  1  
ATOM 10707  H "H3'"  . G A 1 333 ? 141.620 112.726 96.144  1.00 0.00 ? 322 G A "H3'"  1  
ATOM 10708  H "H2'"  . G A 1 333 ? 141.724 110.475 96.537  1.00 0.00 ? 322 G A "H2'"  1  
ATOM 10709  H "HO2'" . G A 1 333 ? 141.695 108.939 94.892  1.00 0.00 ? 322 G A "HO2'" 1  
ATOM 10710  H "H1'"  . G A 1 333 ? 143.796 110.051 95.052  1.00 0.00 ? 322 G A "H1'"  1  
ATOM 10711  H H8     . G A 1 333 ? 144.597 113.276 96.397  1.00 0.00 ? 322 G A H8     1  
ATOM 10712  H H1     . G A 1 333 ? 145.449 108.770 100.698 1.00 0.00 ? 322 G A H1     1  
ATOM 10713  H H21    . G A 1 333 ? 144.570 106.870 99.998  1.00 0.00 ? 322 G A H21    1  
ATOM 10714  H H22    . G A 1 333 ? 143.793 106.734 98.497  1.00 0.00 ? 322 G A H22    1  
ATOM 10715  P P      . A A 1 334 ? 138.991 112.648 96.128  1.00 0.00 ? 323 A A P      1  
ATOM 10716  O OP1    . A A 1 334 ? 137.715 112.965 95.440  1.00 0.00 ? 323 A A OP1    1  
ATOM 10717  O OP2    . A A 1 334 ? 139.603 113.649 97.039  1.00 0.00 ? 323 A A OP2    1  
ATOM 10718  O "O5'"  . A A 1 334 ? 138.787 111.297 96.948  1.00 0.00 ? 323 A A "O5'"  1  
ATOM 10719  C "C5'"  . A A 1 334 ? 138.466 110.084 96.284  1.00 0.00 ? 323 A A "C5'"  1  
ATOM 10720  C "C4'"  . A A 1 334 ? 138.287 108.948 97.261  1.00 0.00 ? 323 A A "C4'"  1  
ATOM 10721  O "O4'"  . A A 1 334 ? 139.532 108.791 98.011  1.00 0.00 ? 323 A A "O4'"  1  
ATOM 10722  C "C3'"  . A A 1 334 ? 137.188 109.127 98.297  1.00 0.00 ? 323 A A "C3'"  1  
ATOM 10723  O "O3'"  . A A 1 334 ? 136.621 107.900 98.722  1.00 0.00 ? 323 A A "O3'"  1  
ATOM 10724  C "C2'"  . A A 1 334 ? 137.953 109.675 99.493  1.00 0.00 ? 323 A A "C2'"  1  
ATOM 10725  O "O2'"  . A A 1 334 ? 137.302 109.353 100.713 1.00 0.00 ? 323 A A "O2'"  1  
ATOM 10726  C "C1'"  . A A 1 334 ? 139.252 108.880 99.390  1.00 0.00 ? 323 A A "C1'"  1  
ATOM 10727  N N9     . A A 1 334 ? 140.384 109.579 100.027 1.00 0.00 ? 323 A A N9     1  
ATOM 10728  C C8     . A A 1 334 ? 140.764 110.889 99.869  1.00 0.00 ? 323 A A C8     1  
ATOM 10729  N N7     . A A 1 334 ? 141.818 111.223 100.572 1.00 0.00 ? 323 A A N7     1  
ATOM 10730  C C5     . A A 1 334 ? 142.156 110.053 101.239 1.00 0.00 ? 323 A A C5     1  
ATOM 10731  C C6     . A A 1 334 ? 143.187 109.744 102.145 1.00 0.00 ? 323 A A C6     1  
ATOM 10732  N N6     . A A 1 334 ? 144.103 110.625 102.552 1.00 0.00 ? 323 A A N6     1  
ATOM 10733  N N1     . A A 1 334 ? 143.243 108.483 102.625 1.00 0.00 ? 323 A A N1     1  
ATOM 10734  C C2     . A A 1 334 ? 142.324 107.599 102.217 1.00 0.00 ? 323 A A C2     1  
ATOM 10735  N N3     . A A 1 334 ? 141.310 107.770 101.372 1.00 0.00 ? 323 A A N3     1  
ATOM 10736  C C4     . A A 1 334 ? 141.281 109.034 100.913 1.00 0.00 ? 323 A A C4     1  
ATOM 10737  H "H5'"  . A A 1 334 ? 139.189 109.858 95.662  1.00 0.00 ? 323 A A "H5'"  1  
ATOM 10738  H "H5''" . A A 1 334 ? 137.636 110.205 95.779  1.00 0.00 ? 323 A A "H5''" 1  
ATOM 10739  H "H4'"  . A A 1 334 ? 138.124 108.118 96.766  1.00 0.00 ? 323 A A "H4'"  1  
ATOM 10740  H "H3'"  . A A 1 334 ? 136.471 109.725 97.997  1.00 0.00 ? 323 A A "H3'"  1  
ATOM 10741  H "H2'"  . A A 1 334 ? 138.110 110.639 99.408  1.00 0.00 ? 323 A A "H2'"  1  
ATOM 10742  H "HO2'" . A A 1 334 ? 137.817 109.727 101.457 1.00 0.00 ? 323 A A "HO2'" 1  
ATOM 10743  H "H1'"  . A A 1 334 ? 139.131 108.002 99.812  1.00 0.00 ? 323 A A "H1'"  1  
ATOM 10744  H H8     . A A 1 334 ? 140.290 111.517 99.284  1.00 0.00 ? 323 A A H8     1  
ATOM 10745  H H61    . A A 1 334 ? 144.799 110.350 103.186 1.00 0.00 ? 323 A A H61    1  
ATOM 10746  H H62    . A A 1 334 ? 144.082 111.545 102.217 1.00 0.00 ? 323 A A H62    1  
ATOM 10747  H H2     . A A 1 334 ? 142.409 106.698 102.595 1.00 0.00 ? 323 A A H2     1  
ATOM 10748  P P      . A A 1 335 ? 135.027 107.755 98.871  1.00 0.00 ? 324 A A P      1  
ATOM 10749  O OP1    . A A 1 335 ? 134.487 109.058 99.332  1.00 0.00 ? 324 A A OP1    1  
ATOM 10750  O OP2    . A A 1 335 ? 134.749 106.526 99.656  1.00 0.00 ? 324 A A OP2    1  
ATOM 10751  O "O5'"  . A A 1 335 ? 134.521 107.511 97.379  1.00 0.00 ? 324 A A "O5'"  1  
ATOM 10752  C "C5'"  . A A 1 335 ? 134.244 106.200 96.911  1.00 0.00 ? 324 A A "C5'"  1  
ATOM 10753  C "C4'"  . A A 1 335 ? 133.882 106.201 95.447  1.00 0.00 ? 324 A A "C4'"  1  
ATOM 10754  O "O4'"  . A A 1 335 ? 133.547 104.855 95.020  1.00 0.00 ? 324 A A "O4'"  1  
ATOM 10755  C "C3'"  . A A 1 335 ? 132.664 107.027 95.060  1.00 0.00 ? 324 A A "C3'"  1  
ATOM 10756  O "O3'"  . A A 1 335 ? 132.954 108.407 94.910  1.00 0.00 ? 324 A A "O3'"  1  
ATOM 10757  C "C2'"  . A A 1 335 ? 132.203 106.358 93.775  1.00 0.00 ? 324 A A "C2'"  1  
ATOM 10758  O "O2'"  . A A 1 335 ? 133.012 106.747 92.672  1.00 0.00 ? 324 A A "O2'"  1  
ATOM 10759  C "C1'"  . A A 1 335 ? 132.466 104.883 94.085  1.00 0.00 ? 324 A A "C1'"  1  
ATOM 10760  N N9     . A A 1 335 ? 131.280 104.212 94.649  1.00 0.00 ? 324 A A N9     1  
ATOM 10761  C C8     . A A 1 335 ? 131.044 103.871 95.957  1.00 0.00 ? 324 A A C8     1  
ATOM 10762  N N7     . A A 1 335 ? 129.891 103.281 96.152  1.00 0.00 ? 324 A A N7     1  
ATOM 10763  C C5     . A A 1 335 ? 129.325 103.233 94.885  1.00 0.00 ? 324 A A C5     1  
ATOM 10764  C C6     . A A 1 335 ? 128.101 102.726 94.412  1.00 0.00 ? 324 A A C6     1  
ATOM 10765  N N6     . A A 1 335 ? 127.187 102.150 95.196  1.00 0.00 ? 324 A A N6     1  
ATOM 10766  N N1     . A A 1 335 ? 127.843 102.836 93.090  1.00 0.00 ? 324 A A N1     1  
ATOM 10767  C C2     . A A 1 335 ? 128.760 103.415 92.306  1.00 0.00 ? 324 A A C2     1  
ATOM 10768  N N3     . A A 1 335 ? 129.945 103.929 92.632  1.00 0.00 ? 324 A A N3     1  
ATOM 10769  C C4     . A A 1 335 ? 130.170 103.803 93.950  1.00 0.00 ? 324 A A C4     1  
ATOM 10770  H "H5'"  . A A 1 335 ? 133.498 105.826 97.425  1.00 0.00 ? 324 A A "H5'"  1  
ATOM 10771  H "H5''" . A A 1 335 ? 135.036 105.637 97.045  1.00 0.00 ? 324 A A "H5''" 1  
ATOM 10772  H "H4'"  . A A 1 335 ? 134.654 106.517 94.932  1.00 0.00 ? 324 A A "H4'"  1  
ATOM 10773  H "H3'"  . A A 1 335 ? 131.971 106.916 95.746  1.00 0.00 ? 324 A A "H3'"  1  
ATOM 10774  H "H2'"  . A A 1 335 ? 131.253 106.523 93.602  1.00 0.00 ? 324 A A "H2'"  1  
ATOM 10775  H "HO2'" . A A 1 335 ? 132.662 106.330 91.858  1.00 0.00 ? 324 A A "HO2'" 1  
ATOM 10776  H "H1'"  . A A 1 335 ? 132.744 104.422 93.267  1.00 0.00 ? 324 A A "H1'"  1  
ATOM 10777  H H8     . A A 1 335 ? 131.682 104.049 96.681  1.00 0.00 ? 324 A A H8     1  
ATOM 10778  H H61    . A A 1 335 ? 126.351 101.816 94.807  1.00 0.00 ? 324 A A H61    1  
ATOM 10779  H H62    . A A 1 335 ? 127.353 102.060 96.157  1.00 0.00 ? 324 A A H62    1  
ATOM 10780  H H2     . A A 1 335 ? 128.525 103.470 91.354  1.00 0.00 ? 324 A A H2     1  
ATOM 10781  P P      . C A 1 336 ? 131.824 109.507 95.221  1.00 0.00 ? 325 C A P      1  
ATOM 10782  O OP1    . C A 1 336 ? 132.473 110.843 95.229  1.00 0.00 ? 325 C A OP1    1  
ATOM 10783  O OP2    . C A 1 336 ? 131.057 109.059 96.411  1.00 0.00 ? 325 C A OP2    1  
ATOM 10784  O "O5'"  . C A 1 336 ? 130.859 109.435 93.955  1.00 0.00 ? 325 C A "O5'"  1  
ATOM 10785  C "C5'"  . C A 1 336 ? 131.305 109.851 92.673  1.00 0.00 ? 325 C A "C5'"  1  
ATOM 10786  C "C4'"  . C A 1 336 ? 130.280 109.560 91.605  1.00 0.00 ? 325 C A "C4'"  1  
ATOM 10787  O "O4'"  . C A 1 336 ? 130.033 108.132 91.532  1.00 0.00 ? 325 C A "O4'"  1  
ATOM 10788  C "C3'"  . C A 1 336 ? 128.902 110.167 91.817  1.00 0.00 ? 325 C A "C3'"  1  
ATOM 10789  O "O3'"  . C A 1 336 ? 128.822 111.521 91.409  1.00 0.00 ? 325 C A "O3'"  1  
ATOM 10790  C "C2'"  . C A 1 336 ? 128.002 109.234 91.016  1.00 0.00 ? 325 C A "C2'"  1  
ATOM 10791  O "O2'"  . C A 1 336 ? 128.080 109.511 89.626  1.00 0.00 ? 325 C A "O2'"  1  
ATOM 10792  C "C1'"  . C A 1 336 ? 128.652 107.875 91.290  1.00 0.00 ? 325 C A "C1'"  1  
ATOM 10793  N N1     . C A 1 336 ? 128.045 107.184 92.454  1.00 0.00 ? 325 C A N1     1  
ATOM 10794  C C2     . C A 1 336 ? 126.812 106.545 92.280  1.00 0.00 ? 325 C A C2     1  
ATOM 10795  O O2     . C A 1 336 ? 126.266 106.574 91.164  1.00 0.00 ? 325 C A O2     1  
ATOM 10796  N N3     . C A 1 336 ? 126.238 105.907 93.325  1.00 0.00 ? 325 C A N3     1  
ATOM 10797  C C4     . C A 1 336 ? 126.844 105.889 94.511  1.00 0.00 ? 325 C A C4     1  
ATOM 10798  N N4     . C A 1 336 ? 126.240 105.249 95.514  1.00 0.00 ? 325 C A N4     1  
ATOM 10799  C C5     . C A 1 336 ? 128.095 106.532 94.722  1.00 0.00 ? 325 C A C5     1  
ATOM 10800  C C6     . C A 1 336 ? 128.657 107.158 93.679  1.00 0.00 ? 325 C A C6     1  
ATOM 10801  H "H5'"  . C A 1 336 ? 132.136 109.377 92.456  1.00 0.00 ? 325 C A "H5'"  1  
ATOM 10802  H "H5''" . C A 1 336 ? 131.483 110.814 92.692  1.00 0.00 ? 325 C A "H5''" 1  
ATOM 10803  H "H4'"  . C A 1 336 ? 130.631 109.866 90.742  1.00 0.00 ? 325 C A "H4'"  1  
ATOM 10804  H "H3'"  . C A 1 336 ? 128.666 110.102 92.766  1.00 0.00 ? 325 C A "H3'"  1  
ATOM 10805  H "H2'"  . C A 1 336 ? 127.078 109.260 91.340  1.00 0.00 ? 325 C A "H2'"  1  
ATOM 10806  H "HO2'" . C A 1 336 ? 127.462 108.918 89.147  1.00 0.00 ? 325 C A "HO2'" 1  
ATOM 10807  H "H1'"  . C A 1 336 ? 128.567 107.308 90.494  1.00 0.00 ? 325 C A "H1'"  1  
ATOM 10808  H H41    . C A 1 336 ? 125.376 104.808 95.365  1.00 0.00 ? 325 C A H41    1  
ATOM 10809  H H42    . C A 1 336 ? 126.660 105.218 96.398  1.00 0.00 ? 325 C A H42    1  
ATOM 10810  H H5     . C A 1 336 ? 128.535 106.513 95.599  1.00 0.00 ? 325 C A H5     1  
ATOM 10811  H H6     . C A 1 336 ? 129.519 107.605 93.805  1.00 0.00 ? 325 C A H6     1  
ATOM 10812  P P      . U A 1 337 ? 127.813 112.530 92.147  1.00 0.00 ? 326 U A P      1  
ATOM 10813  O OP1    . U A 1 337 ? 128.133 113.911 91.701  1.00 0.00 ? 326 U A OP1    1  
ATOM 10814  O OP2    . U A 1 337 ? 127.819 112.207 93.596  1.00 0.00 ? 326 U A OP2    1  
ATOM 10815  O "O5'"  . U A 1 337 ? 126.383 112.140 91.562  1.00 0.00 ? 326 U A "O5'"  1  
ATOM 10816  C "C5'"  . U A 1 337 ? 126.058 112.393 90.204  1.00 0.00 ? 326 U A "C5'"  1  
ATOM 10817  C "C4'"  . U A 1 337 ? 124.686 111.874 89.853  1.00 0.00 ? 326 U A "C4'"  1  
ATOM 10818  O "O4'"  . U A 1 337 ? 124.654 110.432 89.996  1.00 0.00 ? 326 U A "O4'"  1  
ATOM 10819  C "C3'"  . U A 1 337 ? 123.541 112.360 90.729  1.00 0.00 ? 326 U A "C3'"  1  
ATOM 10820  O "O3'"  . U A 1 337 ? 123.063 113.641 90.358  1.00 0.00 ? 326 U A "O3'"  1  
ATOM 10821  C "C2'"  . U A 1 337 ? 122.508 111.253 90.570  1.00 0.00 ? 326 U A "C2'"  1  
ATOM 10822  O "O2'"  . U A 1 337 ? 121.823 111.362 89.333  1.00 0.00 ? 326 U A "O2'"  1  
ATOM 10823  C "C1'"  . U A 1 337 ? 123.398 110.009 90.537  1.00 0.00 ? 326 U A "C1'"  1  
ATOM 10824  N N1     . U A 1 337 ? 123.595 109.419 91.883  1.00 0.00 ? 326 U A N1     1  
ATOM 10825  C C2     . U A 1 337 ? 122.567 108.650 92.391  1.00 0.00 ? 326 U A C2     1  
ATOM 10826  O O2     . U A 1 337 ? 121.530 108.441 91.786  1.00 0.00 ? 326 U A O2     1  
ATOM 10827  N N3     . U A 1 337 ? 122.793 108.124 93.639  1.00 0.00 ? 326 U A N3     1  
ATOM 10828  C C4     . U A 1 337 ? 123.919 108.289 94.419  1.00 0.00 ? 326 U A C4     1  
ATOM 10829  O O4     . U A 1 337 ? 123.972 107.752 95.527  1.00 0.00 ? 326 U A O4     1  
ATOM 10830  C C5     . U A 1 337 ? 124.941 109.098 93.829  1.00 0.00 ? 326 U A C5     1  
ATOM 10831  C C6     . U A 1 337 ? 124.747 109.620 92.615  1.00 0.00 ? 326 U A C6     1  
ATOM 10832  H "H5'"  . U A 1 337 ? 126.721 111.956 89.628  1.00 0.00 ? 326 U A "H5'"  1  
ATOM 10833  H "H5''" . U A 1 337 ? 126.084 113.362 90.042  1.00 0.00 ? 326 U A "H5''" 1  
ATOM 10834  H "H4'"  . U A 1 337 ? 124.492 112.107 88.920  1.00 0.00 ? 326 U A "H4'"  1  
ATOM 10835  H "H3'"  . U A 1 337 ? 123.840 112.387 91.663  1.00 0.00 ? 326 U A "H3'"  1  
ATOM 10836  H "H2'"  . U A 1 337 ? 121.888 111.227 91.328  1.00 0.00 ? 326 U A "H2'"  1  
ATOM 10837  H "HO2'" . U A 1 337 ? 121.140 110.661 89.282  1.00 0.00 ? 326 U A "HO2'" 1  
ATOM 10838  H "H1'"  . U A 1 337 ? 122.998 109.337 89.947  1.00 0.00 ? 326 U A "H1'"  1  
ATOM 10839  H H3     . U A 1 337 ? 122.076 107.576 94.020  1.00 0.00 ? 326 U A H3     1  
ATOM 10840  H H5     . U A 1 337 ? 125.777 109.268 94.313  1.00 0.00 ? 326 U A H5     1  
ATOM 10841  H H6     . U A 1 337 ? 125.461 110.171 92.233  1.00 0.00 ? 326 U A H6     1  
ATOM 10842  P P      . G A 1 338 ? 122.440 114.625 91.464  1.00 0.00 ? 327 G A P      1  
ATOM 10843  O OP1    . G A 1 338 ? 122.245 115.958 90.838  1.00 0.00 ? 327 G A OP1    1  
ATOM 10844  O OP2    . G A 1 338 ? 123.256 114.506 92.698  1.00 0.00 ? 327 G A OP2    1  
ATOM 10845  O "O5'"  . G A 1 338 ? 121.002 114.009 91.763  1.00 0.00 ? 327 G A "O5'"  1  
ATOM 10846  C "C5'"  . G A 1 338 ? 119.982 114.021 90.775  1.00 0.00 ? 327 G A "C5'"  1  
ATOM 10847  C "C4'"  . G A 1 338 ? 118.779 113.220 91.210  1.00 0.00 ? 327 G A "C4'"  1  
ATOM 10848  O "O4'"  . G A 1 338 ? 119.166 111.840 91.442  1.00 0.00 ? 327 G A "O4'"  1  
ATOM 10849  C "C3'"  . G A 1 338 ? 118.130 113.648 92.517  1.00 0.00 ? 327 G A "C3'"  1  
ATOM 10850  O "O3'"  . G A 1 338 ? 117.254 114.753 92.363  1.00 0.00 ? 327 G A "O3'"  1  
ATOM 10851  C "C2'"  . G A 1 338 ? 117.429 112.376 92.971  1.00 0.00 ? 327 G A "C2'"  1  
ATOM 10852  O "O2'"  . G A 1 338 ? 116.222 112.164 92.253  1.00 0.00 ? 327 G A "O2'"  1  
ATOM 10853  C "C1'"  . G A 1 338 ? 118.444 111.306 92.561  1.00 0.00 ? 327 G A "C1'"  1  
ATOM 10854  N N9     . G A 1 338 ? 119.360 110.957 93.664  1.00 0.00 ? 327 G A N9     1  
ATOM 10855  C C8     . G A 1 338 ? 120.688 111.297 93.779  1.00 0.00 ? 327 G A C8     1  
ATOM 10856  N N7     . G A 1 338 ? 121.239 110.841 94.872  1.00 0.00 ? 327 G A N7     1  
ATOM 10857  C C5     . G A 1 338 ? 120.214 110.163 95.518  1.00 0.00 ? 327 G A C5     1  
ATOM 10858  C C6     . G A 1 338 ? 120.211 109.460 96.749  1.00 0.00 ? 327 G A C6     1  
ATOM 10859  O O6     . G A 1 338 ? 121.144 109.291 97.543  1.00 0.00 ? 327 G A O6     1  
ATOM 10860  N N1     . G A 1 338 ? 118.958 108.919 97.028  1.00 0.00 ? 327 G A N1     1  
ATOM 10861  C C2     . G A 1 338 ? 117.851 109.041 96.224  1.00 0.00 ? 327 G A C2     1  
ATOM 10862  N N2     . G A 1 338 ? 116.730 108.448 96.663  1.00 0.00 ? 327 G A N2     1  
ATOM 10863  N N3     . G A 1 338 ? 117.842 109.693 95.073  1.00 0.00 ? 327 G A N3     1  
ATOM 10864  C C4     . G A 1 338 ? 119.047 110.226 94.784  1.00 0.00 ? 327 G A C4     1  
ATOM 10865  H "H5'"  . G A 1 338 ? 120.336 113.642 89.944  1.00 0.00 ? 327 G A "H5'"  1  
ATOM 10866  H "H5''" . G A 1 338 ? 119.707 114.948 90.612  1.00 0.00 ? 327 G A "H5''" 1  
ATOM 10867  H "H4'"  . G A 1 338 ? 118.107 113.246 90.497  1.00 0.00 ? 327 G A "H4'"  1  
ATOM 10868  H "H3'"  . G A 1 338 ? 118.828 113.878 93.163  1.00 0.00 ? 327 G A "H3'"  1  
ATOM 10869  H "H2'"  . G A 1 338 ? 117.279 112.374 93.939  1.00 0.00 ? 327 G A "H2'"  1  
ATOM 10870  H "HO2'" . G A 1 338 ? 115.766 111.378 92.616  1.00 0.00 ? 327 G A "HO2'" 1  
ATOM 10871  H "H1'"  . G A 1 338 ? 117.967 110.502 92.265  1.00 0.00 ? 327 G A "H1'"  1  
ATOM 10872  H H8     . G A 1 338 ? 121.170 111.825 93.110  1.00 0.00 ? 327 G A H8     1  
ATOM 10873  H H1     . G A 1 338 ? 118.863 108.414 97.863  1.00 0.00 ? 327 G A H1     1  
ATOM 10874  H H21    . G A 1 338 ? 116.729 107.964 97.514  1.00 0.00 ? 327 G A H21    1  
ATOM 10875  H H22    . G A 1 338 ? 115.909 108.502 96.131  1.00 0.00 ? 327 G A H22    1  
ATOM 10876  P P      . C A 1 339 ? 117.034 115.781 93.579  1.00 0.00 ? 328 C A P      1  
ATOM 10877  O OP1    . C A 1 339 ? 116.256 116.939 93.068  1.00 0.00 ? 328 C A OP1    1  
ATOM 10878  O OP2    . C A 1 339 ? 118.347 116.014 94.231  1.00 0.00 ? 328 C A OP2    1  
ATOM 10879  O "O5'"  . C A 1 339 ? 116.110 114.980 94.600  1.00 0.00 ? 328 C A "O5'"  1  
ATOM 10880  C "C5'"  . C A 1 339 ? 114.778 114.629 94.258  1.00 0.00 ? 328 C A "C5'"  1  
ATOM 10881  C "C4'"  . C A 1 339 ? 114.148 113.745 95.307  1.00 0.00 ? 328 C A "C4'"  1  
ATOM 10882  O "O4'"  . C A 1 339 ? 114.896 112.508 95.424  1.00 0.00 ? 328 C A "O4'"  1  
ATOM 10883  C "C3'"  . C A 1 339 ? 114.123 114.299 96.723  1.00 0.00 ? 328 C A "C3'"  1  
ATOM 10884  O "O3'"  . C A 1 339 ? 113.052 115.200 96.947  1.00 0.00 ? 328 C A "O3'"  1  
ATOM 10885  C "C2'"  . C A 1 339 ? 114.048 113.038 97.571  1.00 0.00 ? 328 C A "C2'"  1  
ATOM 10886  O "O2'"  . C A 1 339 ? 112.728 112.509 97.593  1.00 0.00 ? 328 C A "O2'"  1  
ATOM 10887  C "C1'"  . C A 1 339 ? 114.950 112.085 96.786  1.00 0.00 ? 328 C A "C1'"  1  
ATOM 10888  N N1     . C A 1 339 ? 116.349 112.099 97.282  1.00 0.00 ? 328 C A N1     1  
ATOM 10889  C C2     . C A 1 339 ? 116.642 111.405 98.463  1.00 0.00 ? 328 C A C2     1  
ATOM 10890  O O2     . C A 1 339 ? 115.731 110.809 99.056  1.00 0.00 ? 328 C A O2     1  
ATOM 10891  N N3     . C A 1 339 ? 117.910 111.401 98.936  1.00 0.00 ? 328 C A N3     1  
ATOM 10892  C C4     . C A 1 339 ? 118.869 112.050 98.281  1.00 0.00 ? 328 C A C4     1  
ATOM 10893  N N4     . C A 1 339 ? 120.105 112.019 98.785  1.00 0.00 ? 328 C A N4     1  
ATOM 10894  C C5     . C A 1 339 ? 118.605 112.766 97.077  1.00 0.00 ? 328 C A C5     1  
ATOM 10895  C C6     . C A 1 339 ? 117.348 112.763 96.617  1.00 0.00 ? 328 C A C6     1  
ATOM 10896  H "H5'"  . C A 1 339 ? 114.784 114.152 93.400  1.00 0.00 ? 328 C A "H5'"  1  
ATOM 10897  H "H5''" . C A 1 339 ? 114.245 115.446 94.166  1.00 0.00 ? 328 C A "H5''" 1  
ATOM 10898  H "H4'"  . C A 1 339 ? 113.230 113.538 95.032  1.00 0.00 ? 328 C A "H4'"  1  
ATOM 10899  H "H3'"  . C A 1 339 ? 114.972 114.757 96.903  1.00 0.00 ? 328 C A "H3'"  1  
ATOM 10900  H "H2'"  . C A 1 339 ? 114.391 113.191 98.478  1.00 0.00 ? 328 C A "H2'"  1  
ATOM 10901  H "HO2'" . C A 1 339 ? 112.673 111.765 96.958  1.00 0.00 ? 328 C A "HO2'" 1  
ATOM 10902  H "H1'"  . C A 1 339 ? 114.595 111.176 96.844  1.00 0.00 ? 328 C A "H1'"  1  
ATOM 10903  H H41    . C A 1 339 ? 120.284 111.528 99.613  1.00 0.00 ? 328 C A H41    1  
ATOM 10904  H H42    . C A 1 339 ? 120.833 112.487 98.326  1.00 0.00 ? 328 C A H42    1  
ATOM 10905  H H5     . C A 1 339 ? 119.319 113.242 96.602  1.00 0.00 ? 328 C A H5     1  
ATOM 10906  H H6     . C A 1 339 ? 117.146 113.248 95.792  1.00 0.00 ? 328 C A H6     1  
ATOM 10907  P P      . A A 1 340 ? 112.435 115.372 98.422  1.00 0.00 ? 329 A A P      1  
ATOM 10908  O OP1    . A A 1 340 ? 111.353 116.385 98.353  1.00 0.00 ? 329 A A OP1    1  
ATOM 10909  O OP2    . A A 1 340 ? 113.560 115.562 99.371  1.00 0.00 ? 329 A A OP2    1  
ATOM 10910  O "O5'"  . A A 1 340 ? 111.767 113.957 98.727  1.00 0.00 ? 329 A A "O5'"  1  
ATOM 10911  C "C5'"  . A A 1 340 ? 110.424 113.689 98.351  1.00 0.00 ? 329 A A "C5'"  1  
ATOM 10912  C "C4'"  . A A 1 340 ? 110.098 112.222 98.472  1.00 0.00 ? 329 A A "C4'"  1  
ATOM 10913  O "O4'"  . A A 1 340 ? 111.256 111.355 98.470  1.00 0.00 ? 329 A A "O4'"  1  
ATOM 10914  C "C3'"  . A A 1 340 ? 109.412 111.794 99.760  1.00 0.00 ? 329 A A "C3'"  1  
ATOM 10915  O "O3'"  . A A 1 340 ? 108.092 112.295 99.879  1.00 0.00 ? 329 A A "O3'"  1  
ATOM 10916  C "C2'"  . A A 1 340 ? 109.451 110.301 99.501  1.00 0.00 ? 329 A A "C2'"  1  
ATOM 10917  O "O2'"  . A A 1 340 ? 108.528 109.930 98.488  1.00 0.00 ? 329 A A "O2'"  1  
ATOM 10918  C "C1'"  . A A 1 340 ? 110.867 110.125 98.970  1.00 0.00 ? 329 A A "C1'"  1  
ATOM 10919  N N9     . A A 1 340 ? 111.811 109.718 100.028 1.00 0.00 ? 329 A A N9     1  
ATOM 10920  C C8     . A A 1 340 ? 112.901 110.408 100.498 1.00 0.00 ? 329 A A C8     1  
ATOM 10921  N N7     . A A 1 340 ? 113.552 109.785 101.450 1.00 0.00 ? 329 A A N7     1  
ATOM 10922  C C5     . A A 1 340 ? 112.842 108.604 101.619 1.00 0.00 ? 329 A A C5     1  
ATOM 10923  C C6     . A A 1 340 ? 113.021 107.507 102.481 1.00 0.00 ? 329 A A C6     1  
ATOM 10924  N N6     . A A 1 340 ? 114.012 107.419 103.372 1.00 0.00 ? 329 A A N6     1  
ATOM 10925  N N1     . A A 1 340 ? 112.136 106.491 102.396 1.00 0.00 ? 329 A A N1     1  
ATOM 10926  C C2     . A A 1 340 ? 111.142 106.578 101.503 1.00 0.00 ? 329 A A C2     1  
ATOM 10927  N N3     . A A 1 340 ? 110.870 107.555 100.640 1.00 0.00 ? 329 A A N3     1  
ATOM 10928  C C4     . A A 1 340 ? 111.768 108.550 100.751 1.00 0.00 ? 329 A A C4     1  
ATOM 10929  H "H5'"  . A A 1 340 ? 110.289 113.971 97.422  1.00 0.00 ? 329 A A "H5'"  1  
ATOM 10930  H "H5''" . A A 1 340 ? 109.821 114.200 98.930  1.00 0.00 ? 329 A A "H5''" 1  
ATOM 10931  H "H4'"  . A A 1 340 ? 109.545 111.956 97.707  1.00 0.00 ? 329 A A "H4'"  1  
ATOM 10932  H "H3'"  . A A 1 340 ? 109.978 112.040 100.523 1.00 0.00 ? 329 A A "H3'"  1  
ATOM 10933  H "H2'"  . A A 1 340 ? 109.310 109.789 100.326 1.00 0.00 ? 329 A A "H2'"  1  
ATOM 10934  H "HO2'" . A A 1 340 ? 108.557 108.958 98.371  1.00 0.00 ? 329 A A "HO2'" 1  
ATOM 10935  H "H1'"  . A A 1 340 ? 110.866 109.452 98.257  1.00 0.00 ? 329 A A "H1'"  1  
ATOM 10936  H H8     . A A 1 340 ? 113.168 111.286 100.153 1.00 0.00 ? 329 A A H8     1  
ATOM 10937  H H61    . A A 1 340 ? 114.085 106.628 103.946 1.00 0.00 ? 329 A A H61    1  
ATOM 10938  H H62    . A A 1 340 ? 114.666 108.145 103.451 1.00 0.00 ? 329 A A H62    1  
ATOM 10939  H H2     . A A 1 340 ? 110.528 105.815 101.481 1.00 0.00 ? 329 A A H2     1  
ATOM 10940  P P      . G A 1 341 ? 107.639 113.025 101.230 1.00 0.00 ? 330 G A P      1  
ATOM 10941  O OP1    . G A 1 341 ? 106.175 113.273 101.185 1.00 0.00 ? 330 G A OP1    1  
ATOM 10942  O OP2    . G A 1 341 ? 108.576 114.174 101.306 1.00 0.00 ? 330 G A OP2    1  
ATOM 10943  O "O5'"  . G A 1 341 ? 107.938 112.063 102.465 1.00 0.00 ? 330 G A "O5'"  1  
ATOM 10944  C "C5'"  . G A 1 341 ? 107.352 110.772 102.542 1.00 0.00 ? 330 G A "C5'"  1  
ATOM 10945  C "C4'"  . G A 1 341 ? 107.952 109.957 103.659 1.00 0.00 ? 330 G A "C4'"  1  
ATOM 10946  O "O4'"  . G A 1 341 ? 109.272 109.492 103.275 1.00 0.00 ? 330 G A "O4'"  1  
ATOM 10947  C "C3'"  . G A 1 341 ? 108.187 110.693 104.970 1.00 0.00 ? 330 G A "C3'"  1  
ATOM 10948  O "O3'"  . G A 1 341 ? 107.016 110.797 105.763 1.00 0.00 ? 330 G A "O3'"  1  
ATOM 10949  C "C2'"  . G A 1 341 ? 109.293 109.872 105.618 1.00 0.00 ? 330 G A "C2'"  1  
ATOM 10950  O "O2'"  . G A 1 341 ? 108.781 108.679 106.192 1.00 0.00 ? 330 G A "O2'"  1  
ATOM 10951  C "C1'"  . G A 1 341 ? 110.153 109.511 104.406 1.00 0.00 ? 330 G A "C1'"  1  
ATOM 10952  N N9     . G A 1 341 ? 111.255 110.471 104.201 1.00 0.00 ? 330 G A N9     1  
ATOM 10953  C C8     . G A 1 341 ? 111.361 111.414 103.208 1.00 0.00 ? 330 G A C8     1  
ATOM 10954  N N7     . G A 1 341 ? 112.455 112.121 103.286 1.00 0.00 ? 330 G A N7     1  
ATOM 10955  C C5     . G A 1 341 ? 113.113 111.614 104.399 1.00 0.00 ? 330 G A C5     1  
ATOM 10956  C C6     . G A 1 341 ? 114.352 111.984 104.981 1.00 0.00 ? 330 G A C6     1  
ATOM 10957  O O6     . G A 1 341 ? 115.143 112.862 104.618 1.00 0.00 ? 330 G A O6     1  
ATOM 10958  N N1     . G A 1 341 ? 114.643 111.211 106.102 1.00 0.00 ? 330 G A N1     1  
ATOM 10959  C C2     . G A 1 341 ? 113.842 110.211 106.599 1.00 0.00 ? 330 G A C2     1  
ATOM 10960  N N2     . G A 1 341 ? 114.292 109.576 107.691 1.00 0.00 ? 330 G A N2     1  
ATOM 10961  N N3     . G A 1 341 ? 112.685 109.857 106.065 1.00 0.00 ? 330 G A N3     1  
ATOM 10962  C C4     . G A 1 341 ? 112.385 110.596 104.976 1.00 0.00 ? 330 G A C4     1  
ATOM 10963  H "H5'"  . G A 1 341 ? 107.496 110.305 101.692 1.00 0.00 ? 330 G A "H5'"  1  
ATOM 10964  H "H5''" . G A 1 341 ? 106.388 110.868 102.695 1.00 0.00 ? 330 G A "H5''" 1  
ATOM 10965  H "H4'"  . G A 1 341 ? 107.379 109.181 103.830 1.00 0.00 ? 330 G A "H4'"  1  
ATOM 10966  H "H3'"  . G A 1 341 ? 108.525 111.592 104.778 1.00 0.00 ? 330 G A "H3'"  1  
ATOM 10967  H "H2'"  . G A 1 341 ? 109.798 110.402 106.272 1.00 0.00 ? 330 G A "H2'"  1  
ATOM 10968  H "HO2'" . G A 1 341 ? 107.817 108.781 106.334 1.00 0.00 ? 330 G A "HO2'" 1  
ATOM 10969  H "H1'"  . G A 1 341 ? 110.523 108.612 104.527 1.00 0.00 ? 330 G A "H1'"  1  
ATOM 10970  H H8     . G A 1 341 ? 110.685 111.543 102.511 1.00 0.00 ? 330 G A H8     1  
ATOM 10971  H H1     . G A 1 341 ? 115.483 111.397 106.572 1.00 0.00 ? 330 G A H1     1  
ATOM 10972  H H21    . G A 1 341 ? 115.149 109.833 108.093 1.00 0.00 ? 330 G A H21    1  
ATOM 10973  H H22    . G A 1 341 ? 113.765 108.853 108.090 1.00 0.00 ? 330 G A H22    1  
ATOM 10974  P P      . U A 1 342 ? 106.820 112.050 106.750 1.00 0.00 ? 331 U A P      1  
ATOM 10975  O OP1    . U A 1 342 ? 105.443 111.985 107.307 1.00 0.00 ? 331 U A OP1    1  
ATOM 10976  O OP2    . U A 1 342 ? 107.266 113.272 106.037 1.00 0.00 ? 331 U A OP2    1  
ATOM 10977  O "O5'"  . U A 1 342 ? 107.844 111.770 107.937 1.00 0.00 ? 331 U A "O5'"  1  
ATOM 10978  C "C5'"  . U A 1 342 ? 107.668 110.661 108.806 1.00 0.00 ? 331 U A "C5'"  1  
ATOM 10979  C "C4'"  . U A 1 342 ? 108.814 110.529 109.780 1.00 0.00 ? 331 U A "C4'"  1  
ATOM 10980  O "O4'"  . U A 1 342 ? 110.049 110.286 109.060 1.00 0.00 ? 331 U A "O4'"  1  
ATOM 10981  C "C3'"  . U A 1 342 ? 109.116 111.754 110.629 1.00 0.00 ? 331 U A "C3'"  1  
ATOM 10982  O "O3'"  . U A 1 342 ? 108.265 111.871 111.757 1.00 0.00 ? 331 U A "O3'"  1  
ATOM 10983  C "C2'"  . U A 1 342 ? 110.582 111.557 110.990 1.00 0.00 ? 331 U A "C2'"  1  
ATOM 10984  O "O2'"  . U A 1 342 ? 110.732 110.606 112.033 1.00 0.00 ? 331 U A "O2'"  1  
ATOM 10985  C "C1'"  . U A 1 342 ? 111.135 110.963 109.693 1.00 0.00 ? 331 U A "C1'"  1  
ATOM 10986  N N1     . U A 1 342 ? 111.696 112.000 108.794 1.00 0.00 ? 331 U A N1     1  
ATOM 10987  C C2     . U A 1 342 ? 112.938 112.513 109.120 1.00 0.00 ? 331 U A C2     1  
ATOM 10988  O O2     . U A 1 342 ? 113.572 112.152 110.096 1.00 0.00 ? 331 U A O2     1  
ATOM 10989  N N3     . U A 1 342 ? 113.419 113.469 108.259 1.00 0.00 ? 331 U A N3     1  
ATOM 10990  C C4     . U A 1 342 ? 112.797 113.957 107.129 1.00 0.00 ? 331 U A C4     1  
ATOM 10991  O O4     . U A 1 342 ? 113.361 114.823 106.456 1.00 0.00 ? 331 U A O4     1  
ATOM 10992  C C5     . U A 1 342 ? 111.517 113.381 106.854 1.00 0.00 ? 331 U A C5     1  
ATOM 10993  C C6     . U A 1 342 ? 111.027 112.446 107.674 1.00 0.00 ? 331 U A C6     1  
ATOM 10994  H "H5'"  . U A 1 342 ? 107.608 109.842 108.271 1.00 0.00 ? 331 U A "H5'"  1  
ATOM 10995  H "H5''" . U A 1 342 ? 106.835 110.777 109.308 1.00 0.00 ? 331 U A "H5''" 1  
ATOM 10996  H "H4'"  . U A 1 342 ? 108.636 109.770 110.373 1.00 0.00 ? 331 U A "H4'"  1  
ATOM 10997  H "H3'"  . U A 1 342 ? 109.028 112.559 110.076 1.00 0.00 ? 331 U A "H3'"  1  
ATOM 10998  H "H2'"  . U A 1 342 ? 111.017 112.408 111.207 1.00 0.00 ? 331 U A "H2'"  1  
ATOM 10999  H "HO2'" . U A 1 342 ? 111.678 110.549 112.279 1.00 0.00 ? 331 U A "HO2'" 1  
ATOM 11000  H "H1'"  . U A 1 342 ? 111.834 110.309 109.907 1.00 0.00 ? 331 U A "H1'"  1  
ATOM 11001  H H3     . U A 1 342 ? 114.296 113.847 108.472 1.00 0.00 ? 331 U A H3     1  
ATOM 11002  H H5     . U A 1 342 ? 111.004 113.668 106.069 1.00 0.00 ? 331 U A H5     1  
ATOM 11003  H H6     . U A 1 342 ? 110.148 112.069 107.465 1.00 0.00 ? 331 U A H6     1  
ATOM 11004  P P      . C A 1 343 ? 107.170 113.040 111.806 1.00 0.00 ? 332 C A P      1  
ATOM 11005  O OP1    . C A 1 343 ? 106.613 113.128 113.180 1.00 0.00 ? 332 C A OP1    1  
ATOM 11006  O OP2    . C A 1 343 ? 106.275 112.692 110.674 1.00 0.00 ? 332 C A OP2    1  
ATOM 11007  O "O5'"  . C A 1 343 ? 107.874 114.428 111.471 1.00 0.00 ? 332 C A "O5'"  1  
ATOM 11008  C "C5'"  . C A 1 343 ? 107.205 115.422 110.710 1.00 0.00 ? 332 C A "C5'"  1  
ATOM 11009  C "C4'"  . C A 1 343 ? 107.114 116.730 111.457 1.00 0.00 ? 332 C A "C4'"  1  
ATOM 11010  O "O4'"  . C A 1 343 ? 105.706 116.986 111.757 1.00 0.00 ? 332 C A "O4'"  1  
ATOM 11011  C "C3'"  . C A 1 343 ? 107.847 116.794 112.787 1.00 0.00 ? 332 C A "C3'"  1  
ATOM 11012  O "O3'"  . C A 1 343 ? 108.319 118.094 113.096 1.00 0.00 ? 332 C A "O3'"  1  
ATOM 11013  C "C2'"  . C A 1 343 ? 106.741 116.424 113.775 1.00 0.00 ? 332 C A "C2'"  1  
ATOM 11014  O "O2'"  . C A 1 343 ? 106.991 116.976 115.059 1.00 0.00 ? 332 C A "O2'"  1  
ATOM 11015  C "C1'"  . C A 1 343 ? 105.538 117.133 113.148 1.00 0.00 ? 332 C A "C1'"  1  
ATOM 11016  N N1     . C A 1 343 ? 104.249 116.514 113.545 1.00 0.00 ? 332 C A N1     1  
ATOM 11017  C C2     . C A 1 343 ? 103.378 117.254 114.354 1.00 0.00 ? 332 C A C2     1  
ATOM 11018  O O2     . C A 1 343 ? 103.706 118.396 114.713 1.00 0.00 ? 332 C A O2     1  
ATOM 11019  N N3     . C A 1 343 ? 102.196 116.713 114.731 1.00 0.00 ? 332 C A N3     1  
ATOM 11020  C C4     . C A 1 343 ? 101.867 115.485 114.332 1.00 0.00 ? 332 C A C4     1  
ATOM 11021  N N4     . C A 1 343 ? 100.691 114.992 114.728 1.00 0.00 ? 332 C A N4     1  
ATOM 11022  C C5     . C A 1 343 ? 102.730 114.707 113.510 1.00 0.00 ? 332 C A C5     1  
ATOM 11023  C C6     . C A 1 343 ? 103.896 115.253 113.143 1.00 0.00 ? 332 C A C6     1  
ATOM 11024  H "H5'"  . C A 1 343 ? 106.299 115.108 110.502 1.00 0.00 ? 332 C A "H5'"  1  
ATOM 11025  H "H5''" . C A 1 343 ? 107.693 115.565 109.872 1.00 0.00 ? 332 C A "H5''" 1  
ATOM 11026  H "H4'"  . C A 1 343 ? 107.436 117.455 110.882 1.00 0.00 ? 332 C A "H4'"  1  
ATOM 11027  H "H3'"  . C A 1 343 ? 108.595 116.163 112.831 1.00 0.00 ? 332 C A "H3'"  1  
ATOM 11028  H "H2'"  . C A 1 343 ? 106.608 115.455 113.817 1.00 0.00 ? 332 C A "H2'"  1  
ATOM 11029  H "HO2'" . C A 1 343 ? 106.700 116.339 115.743 1.00 0.00 ? 332 C A "HO2'" 1  
ATOM 11030  H "H1'"  . C A 1 343 ? 105.544 118.075 113.416 1.00 0.00 ? 332 C A "H1'"  1  
ATOM 11031  H H41    . C A 1 343 ? 100.099 115.530 115.295 1.00 0.00 ? 332 C A H41    1  
ATOM 11032  H H42    . C A 1 343 ? 100.420 114.092 114.452 1.00 0.00 ? 332 C A H42    1  
ATOM 11033  H H5     . C A 1 343 ? 102.479 113.804 113.222 1.00 0.00 ? 332 C A H5     1  
ATOM 11034  H H6     . C A 1 343 ? 104.504 114.733 112.578 1.00 0.00 ? 332 C A H6     1  
ATOM 11035  P P      . G A 1 344 ? 108.017 119.321 112.102 1.00 0.00 ? 333 G A P      1  
ATOM 11036  O OP1    . G A 1 344 ? 106.544 119.460 111.977 1.00 0.00 ? 333 G A OP1    1  
ATOM 11037  O OP2    . G A 1 344 ? 108.844 119.137 110.882 1.00 0.00 ? 333 G A OP2    1  
ATOM 11038  O "O5'"  . G A 1 344 ? 108.568 120.596 112.884 1.00 0.00 ? 333 G A "O5'"  1  
ATOM 11039  C "C5'"  . G A 1 344 ? 108.828 120.541 114.278 1.00 0.00 ? 333 G A "C5'"  1  
ATOM 11040  C "C4'"  . G A 1 344 ? 110.244 120.955 114.593 1.00 0.00 ? 333 G A "C4'"  1  
ATOM 11041  O "O4'"  . G A 1 344 ? 111.156 119.874 114.273 1.00 0.00 ? 333 G A "O4'"  1  
ATOM 11042  C "C3'"  . G A 1 344 ? 110.783 122.141 113.808 1.00 0.00 ? 333 G A "C3'"  1  
ATOM 11043  O "O3'"  . G A 1 344 ? 110.375 123.391 114.340 1.00 0.00 ? 333 G A "O3'"  1  
ATOM 11044  C "C2'"  . G A 1 344 ? 112.288 121.918 113.861 1.00 0.00 ? 333 G A "C2'"  1  
ATOM 11045  O "O2'"  . G A 1 344 ? 112.823 122.301 115.120 1.00 0.00 ? 333 G A "O2'"  1  
ATOM 11046  C "C1'"  . G A 1 344 ? 112.375 120.396 113.727 1.00 0.00 ? 333 G A "C1'"  1  
ATOM 11047  N N9     . G A 1 344 ? 112.542 119.971 112.325 1.00 0.00 ? 333 G A N9     1  
ATOM 11048  C C8     . G A 1 344 ? 111.604 119.366 111.522 1.00 0.00 ? 333 G A C8     1  
ATOM 11049  N N7     . G A 1 344 ? 112.048 119.105 110.322 1.00 0.00 ? 333 G A N7     1  
ATOM 11050  C C5     . G A 1 344 ? 113.357 119.565 110.333 1.00 0.00 ? 333 G A C5     1  
ATOM 11051  C C6     . G A 1 344 ? 114.344 119.555 109.313 1.00 0.00 ? 333 G A C6     1  
ATOM 11052  O O6     . G A 1 344 ? 114.252 119.124 108.157 1.00 0.00 ? 333 G A O6     1  
ATOM 11053  N N1     . G A 1 344 ? 115.538 120.120 109.749 1.00 0.00 ? 333 G A N1     1  
ATOM 11054  C C2     . G A 1 344 ? 115.756 120.631 111.005 1.00 0.00 ? 333 G A C2     1  
ATOM 11055  N N2     . G A 1 344 ? 116.977 121.138 111.238 1.00 0.00 ? 333 G A N2     1  
ATOM 11056  N N3     . G A 1 344 ? 114.845 120.647 111.965 1.00 0.00 ? 333 G A N3     1  
ATOM 11057  C C4     . G A 1 344 ? 113.679 120.102 111.562 1.00 0.00 ? 333 G A C4     1  
ATOM 11058  H "H5'"  . G A 1 344 ? 108.684 119.627 114.595 1.00 0.00 ? 333 G A "H5'"  1  
ATOM 11059  H "H5''" . G A 1 344 ? 108.207 121.142 114.743 1.00 0.00 ? 333 G A "H5''" 1  
ATOM 11060  H "H4'"  . G A 1 344 ? 110.309 121.155 115.552 1.00 0.00 ? 333 G A "H4'"  1  
ATOM 11061  H "H3'"  . G A 1 344 ? 110.481 122.074 112.878 1.00 0.00 ? 333 G A "H3'"  1  
ATOM 11062  H "H2'"  . G A 1 344 ? 112.745 122.369 113.120 1.00 0.00 ? 333 G A "H2'"  1  
ATOM 11063  H "HO2'" . G A 1 344 ? 112.195 122.909 115.562 1.00 0.00 ? 333 G A "HO2'" 1  
ATOM 11064  H "H1'"  . G A 1 344 ? 113.127 120.065 114.262 1.00 0.00 ? 333 G A "H1'"  1  
ATOM 11065  H H8     . G A 1 344 ? 110.696 119.153 111.820 1.00 0.00 ? 333 G A H8     1  
ATOM 11066  H H1     . G A 1 344 ? 116.279 120.158 109.108 1.00 0.00 ? 333 G A H1     1  
ATOM 11067  H H21    . G A 1 344 ? 117.656 121.130 110.532 1.00 0.00 ? 333 G A H21    1  
ATOM 11068  H H22    . G A 1 344 ? 117.190 121.516 112.118 1.00 0.00 ? 333 G A H22    1  
ATOM 11069  P P      . G A 1 345 ? 110.186 124.657 113.369 1.00 0.00 ? 334 G A P      1  
ATOM 11070  O OP1    . G A 1 345 ? 109.561 125.752 114.156 1.00 0.00 ? 334 G A OP1    1  
ATOM 11071  O OP2    . G A 1 345 ? 109.535 124.187 112.120 1.00 0.00 ? 334 G A OP2    1  
ATOM 11072  O "O5'"  . G A 1 345 ? 111.676 125.096 113.013 1.00 0.00 ? 334 G A "O5'"  1  
ATOM 11073  C "C5'"  . G A 1 345 ? 112.541 125.618 114.011 1.00 0.00 ? 334 G A "C5'"  1  
ATOM 11074  C "C4'"  . G A 1 345 ? 113.932 125.844 113.476 1.00 0.00 ? 334 G A "C4'"  1  
ATOM 11075  O "O4'"  . G A 1 345 ? 114.505 124.583 113.047 1.00 0.00 ? 334 G A "O4'"  1  
ATOM 11076  C "C3'"  . G A 1 345 ? 114.038 126.736 112.248 1.00 0.00 ? 334 G A "C3'"  1  
ATOM 11077  O "O3'"  . G A 1 345 ? 114.003 128.119 112.563 1.00 0.00 ? 334 G A "O3'"  1  
ATOM 11078  C "C2'"  . G A 1 345 ? 115.352 126.286 111.623 1.00 0.00 ? 334 G A "C2'"  1  
ATOM 11079  O "O2'"  . G A 1 345 ? 116.465 126.835 112.311 1.00 0.00 ? 334 G A "O2'"  1  
ATOM 11080  C "C1'"  . G A 1 345 ? 115.306 124.777 111.873 1.00 0.00 ? 334 G A "C1'"  1  
ATOM 11081  N N9     . G A 1 345 ? 114.749 124.040 110.725 1.00 0.00 ? 334 G A N9     1  
ATOM 11082  C C8     . G A 1 345 ? 113.524 123.423 110.647 1.00 0.00 ? 334 G A C8     1  
ATOM 11083  N N7     . G A 1 345 ? 113.311 122.847 109.495 1.00 0.00 ? 334 G A N7     1  
ATOM 11084  C C5     . G A 1 345 ? 114.465 123.099 108.766 1.00 0.00 ? 334 G A C5     1  
ATOM 11085  C C6     . G A 1 345 ? 114.817 122.725 107.444 1.00 0.00 ? 334 G A C6     1  
ATOM 11086  O O6     . G A 1 345 ? 114.158 122.074 106.625 1.00 0.00 ? 334 G A O6     1  
ATOM 11087  N N1     . G A 1 345 ? 116.083 123.188 107.101 1.00 0.00 ? 334 G A N1     1  
ATOM 11088  C C2     . G A 1 345 ? 116.906 123.919 107.923 1.00 0.00 ? 334 G A C2     1  
ATOM 11089  N N2     . G A 1 345 ? 118.093 124.276 107.413 1.00 0.00 ? 334 G A N2     1  
ATOM 11090  N N3     . G A 1 345 ? 116.589 124.274 109.157 1.00 0.00 ? 334 G A N3     1  
ATOM 11091  C C4     . G A 1 345 ? 115.363 123.834 109.511 1.00 0.00 ? 334 G A C4     1  
ATOM 11092  H "H5'"  . G A 1 345 ? 112.584 124.988 114.760 1.00 0.00 ? 334 G A "H5'"  1  
ATOM 11093  H "H5''" . G A 1 345 ? 112.179 126.472 114.334 1.00 0.00 ? 334 G A "H5''" 1  
ATOM 11094  H "H4'"  . G A 1 345 ? 114.490 126.221 114.190 1.00 0.00 ? 334 G A "H4'"  1  
ATOM 11095  H "H3'"  . G A 1 345 ? 113.303 126.527 111.634 1.00 0.00 ? 334 G A "H3'"  1  
ATOM 11096  H "H2'"  . G A 1 345 ? 115.381 126.488 110.664 1.00 0.00 ? 334 G A "H2'"  1  
ATOM 11097  H "HO2'" . G A 1 345 ? 117.145 127.099 111.657 1.00 0.00 ? 334 G A "HO2'" 1  
ATOM 11098  H "H1'"  . G A 1 345 ? 116.211 124.451 112.064 1.00 0.00 ? 334 G A "H1'"  1  
ATOM 11099  H H8     . G A 1 345 ? 112.876 123.415 111.381 1.00 0.00 ? 334 G A H8     1  
ATOM 11100  H H1     . G A 1 345 ? 116.412 122.976 106.202 1.00 0.00 ? 334 G A H1     1  
ATOM 11101  H H21    .