data_6WLO
# 
_entry.id   6WLO 
# 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.329 
_audit_conform.dict_location   http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic 
# 
loop_
_database_2.database_id 
_database_2.database_code 
PDB   6WLO         
WWPDB D_1000248532 
EMDB  EMD-21836    
# 
loop_
_pdbx_database_related.db_name 
_pdbx_database_related.details 
_pdbx_database_related.db_id 
_pdbx_database_related.content_type 
PDB  'hc16 ligase product' 6WLN      unspecified            
EMDB .                     EMD-21836 'associated EM volume' 
EMDB .                     EMD-21831 'other EM volume'      
EMDB .                     EMD-21832 'other EM volume'      
EMDB .                     EMD-21833 'other EM volume'      
EMDB .                     EMD-21834 'other EM volume'      
EMDB .                     EMD-21835 'other EM volume'      
EMDB .                     EMD-21838 'other EM volume'      
EMDB .                     EMD-21839 'other EM volume'      
EMDB .                     EMD-21840 'other EM volume'      
EMDB .                     EMD-21841 'other EM volume'      
EMDB .                     EMD-21842 'other EM volume'      
# 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.status_code_sf                  ? 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.entry_id                        6WLO 
_pdbx_database_status.recvd_initial_deposition_date   2020-04-20 
_pdbx_database_status.SG_entry                        N 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.status_code_nmr_data            ? 
_pdbx_database_status.methods_development_category    ? 
_pdbx_database_status.pdb_format_compatible           Y 
# 
loop_
_audit_author.name 
_audit_author.pdbx_ordinal 
_audit_author.identifier_ORCID 
'Kappel, K.'      1  0000-0002-2129-199X 
'Zhang, K.'       2  ?                   
'Su, Z.'          3  ?                   
'Watkins, A.M.'   4  ?                   
'Kladwang, W.'    5  ?                   
'Li, S.'          6  ?                   
'Pintilie, G.'    7  ?                   
'Topkar, V.V.'    8  ?                   
'Rangan, R.'      9  ?                   
'Zheludev, I.N.'  10 ?                   
'Yesselman, J.D.' 11 ?                   
'Chiu, W.'        12 ?                   
'Das, R.'         13 ?                   
# 
_citation.abstract                  ? 
_citation.abstract_id_CAS           ? 
_citation.book_id_ISBN              ? 
_citation.book_publisher            ? 
_citation.book_publisher_city       ? 
_citation.book_title                ? 
_citation.coordinate_linkage        ? 
_citation.country                   US 
_citation.database_id_Medline       ? 
_citation.details                   ? 
_citation.id                        primary 
_citation.journal_abbrev            Nat.Methods 
_citation.journal_id_ASTM           ? 
_citation.journal_id_CSD            ? 
_citation.journal_id_ISSN           1548-7105 
_citation.journal_full              ? 
_citation.journal_issue             ? 
_citation.journal_volume            17 
_citation.language                  ? 
_citation.page_first                699 
_citation.page_last                 707 
_citation.title                     'Accelerated cryo-EM-guided determination of three-dimensional RNA-only structures.' 
_citation.year                      2020 
_citation.database_id_CSD           ? 
_citation.pdbx_database_id_DOI      10.1038/s41592-020-0878-9 
_citation.pdbx_database_id_PubMed   32616928 
_citation.unpublished_flag          ? 
# 
loop_
_citation_author.citation_id 
_citation_author.name 
_citation_author.ordinal 
_citation_author.identifier_ORCID 
primary 'Kappel, K.'      1  ? 
primary 'Zhang, K.'       2  ? 
primary 'Su, Z.'          3  ? 
primary 'Watkins, A.M.'   4  ? 
primary 'Kladwang, W.'    5  ? 
primary 'Li, S.'          6  ? 
primary 'Pintilie, G.'    7  ? 
primary 'Topkar, V.V.'    8  ? 
primary 'Rangan, R.'      9  ? 
primary 'Zheludev, I.N.'  10 ? 
primary 'Yesselman, J.D.' 11 ? 
primary 'Chiu, W.'        12 ? 
primary 'Das, R.'         13 ? 
# 
_entity.id                         1 
_entity.type                       polymer 
_entity.src_method                 syn 
_entity.pdbx_description           'RNA (338-MER)' 
_entity.formula_weight             109298.711 
_entity.pdbx_number_of_molecules   1 
_entity.pdbx_ec                    ? 
_entity.pdbx_mutation              ? 
_entity.pdbx_fragment              ? 
_entity.details                    ? 
# 
_entity_poly.entity_id                      1 
_entity_poly.type                           polyribonucleotide 
_entity_poly.nstd_linkage                   no 
_entity_poly.nstd_monomer                   no 
_entity_poly.pdbx_seq_one_letter_code       
;GGUAGACUCGCAGGAAGUCUACCGAGUAAGAGAAAGAGGAAAGACGGCCAAAUUGCGGGAAAGGGGACAACAGCCGUUCA
GUACCAAGUCUCAGGGAAACUUCAGAUGGCCUCGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCACGCAG
UCAAGUCCUAAGUCAACAGCCUUGGCUGUUGAUAUGGAUGCAUUUCGAUCCAACCGAGGCUCAUUCUUGUAAUUCAUGGC
CGUCGGGGAGGCACUUCGGUGCCUCUGAUAACAACUUGAAAUAAGGUUGGCUCAACGGCGCGUGACAGACAAUUCGCGCU
GGAACUGCAGUCGGACCU
;
_entity_poly.pdbx_seq_one_letter_code_can   
;GGUAGACUCGCAGGAAGUCUACCGAGUAAGAGAAAGAGGAAAGACGGCCAAAUUGCGGGAAAGGGGACAACAGCCGUUCA
GUACCAAGUCUCAGGGAAACUUCAGAUGGCCUCGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCACGCAG
UCAAGUCCUAAGUCAACAGCCUUGGCUGUUGAUAUGGAUGCAUUUCGAUCCAACCGAGGCUCAUUCUUGUAAUUCAUGGC
CGUCGGGGAGGCACUUCGGUGCCUCUGAUAACAACUUGAAAUAAGGUUGGCUCAACGGCGCGUGACAGACAAUUCGCGCU
GGAACUGCAGUCGGACCU
;
_entity_poly.pdbx_strand_id                 A 
_entity_poly.pdbx_target_identifier         ? 
# 
loop_
_entity_poly_seq.entity_id 
_entity_poly_seq.num 
_entity_poly_seq.mon_id 
_entity_poly_seq.hetero 
1 1   G n 
1 2   G n 
1 3   U n 
1 4   A n 
1 5   G n 
1 6   A n 
1 7   C n 
1 8   U n 
1 9   C n 
1 10  G n 
1 11  C n 
1 12  A n 
1 13  G n 
1 14  G n 
1 15  A n 
1 16  A n 
1 17  G n 
1 18  U n 
1 19  C n 
1 20  U n 
1 21  A n 
1 22  C n 
1 23  C n 
1 24  G n 
1 25  A n 
1 26  G n 
1 27  U n 
1 28  A n 
1 29  A n 
1 30  G n 
1 31  A n 
1 32  G n 
1 33  A n 
1 34  A n 
1 35  A n 
1 36  G n 
1 37  A n 
1 38  G n 
1 39  G n 
1 40  A n 
1 41  A n 
1 42  A n 
1 43  G n 
1 44  A n 
1 45  C n 
1 46  G n 
1 47  G n 
1 48  C n 
1 49  C n 
1 50  A n 
1 51  A n 
1 52  A n 
1 53  U n 
1 54  U n 
1 55  G n 
1 56  C n 
1 57  G n 
1 58  G n 
1 59  G n 
1 60  A n 
1 61  A n 
1 62  A n 
1 63  G n 
1 64  G n 
1 65  G n 
1 66  G n 
1 67  A n 
1 68  C n 
1 69  A n 
1 70  A n 
1 71  C n 
1 72  A n 
1 73  G n 
1 74  C n 
1 75  C n 
1 76  G n 
1 77  U n 
1 78  U n 
1 79  C n 
1 80  A n 
1 81  G n 
1 82  U n 
1 83  A n 
1 84  C n 
1 85  C n 
1 86  A n 
1 87  A n 
1 88  G n 
1 89  U n 
1 90  C n 
1 91  U n 
1 92  C n 
1 93  A n 
1 94  G n 
1 95  G n 
1 96  G n 
1 97  A n 
1 98  A n 
1 99  A n 
1 100 C n 
1 101 U n 
1 102 U n 
1 103 C n 
1 104 A n 
1 105 G n 
1 106 A n 
1 107 U n 
1 108 G n 
1 109 G n 
1 110 C n 
1 111 C n 
1 112 U n 
1 113 C n 
1 114 G n 
1 115 C n 
1 116 A n 
1 117 A n 
1 118 A n 
1 119 G n 
1 120 G n 
1 121 G n 
1 122 U n 
1 123 A n 
1 124 U n 
1 125 G n 
1 126 G n 
1 127 U n 
1 128 A n 
1 129 A n 
1 130 U n 
1 131 A n 
1 132 A n 
1 133 G n 
1 134 C n 
1 135 U n 
1 136 G n 
1 137 A n 
1 138 C n 
1 139 G n 
1 140 G n 
1 141 A n 
1 142 C n 
1 143 A n 
1 144 U n 
1 145 G n 
1 146 G n 
1 147 U n 
1 148 C n 
1 149 C n 
1 150 U n 
1 151 A n 
1 152 A n 
1 153 C n 
1 154 C n 
1 155 A n 
1 156 C n 
1 157 G n 
1 158 C n 
1 159 A n 
1 160 G n 
1 161 U n 
1 162 C n 
1 163 A n 
1 164 A n 
1 165 G n 
1 166 U n 
1 167 C n 
1 168 C n 
1 169 U n 
1 170 A n 
1 171 A n 
1 172 G n 
1 173 U n 
1 174 C n 
1 175 A n 
1 176 A n 
1 177 C n 
1 178 A n 
1 179 G n 
1 180 C n 
1 181 C n 
1 182 U n 
1 183 U n 
1 184 G n 
1 185 G n 
1 186 C n 
1 187 U n 
1 188 G n 
1 189 U n 
1 190 U n 
1 191 G n 
1 192 A n 
1 193 U n 
1 194 A n 
1 195 U n 
1 196 G n 
1 197 G n 
1 198 A n 
1 199 U n 
1 200 G n 
1 201 C n 
1 202 A n 
1 203 U n 
1 204 U n 
1 205 U n 
1 206 C n 
1 207 G n 
1 208 A n 
1 209 U n 
1 210 C n 
1 211 C n 
1 212 A n 
1 213 A n 
1 214 C n 
1 215 C n 
1 216 G n 
1 217 A n 
1 218 G n 
1 219 G n 
1 220 C n 
1 221 U n 
1 222 C n 
1 223 A n 
1 224 U n 
1 225 U n 
1 226 C n 
1 227 U n 
1 228 U n 
1 229 G n 
1 230 U n 
1 231 A n 
1 232 A n 
1 233 U n 
1 234 U n 
1 235 C n 
1 236 A n 
1 237 U n 
1 238 G n 
1 239 G n 
1 240 C n 
1 241 C n 
1 242 G n 
1 243 U n 
1 244 C n 
1 245 G n 
1 246 G n 
1 247 G n 
1 248 G n 
1 249 A n 
1 250 G n 
1 251 G n 
1 252 C n 
1 253 A n 
1 254 C n 
1 255 U n 
1 256 U n 
1 257 C n 
1 258 G n 
1 259 G n 
1 260 U n 
1 261 G n 
1 262 C n 
1 263 C n 
1 264 U n 
1 265 C n 
1 266 U n 
1 267 G n 
1 268 A n 
1 269 U n 
1 270 A n 
1 271 A n 
1 272 C n 
1 273 A n 
1 274 A n 
1 275 C n 
1 276 U n 
1 277 U n 
1 278 G n 
1 279 A n 
1 280 A n 
1 281 A n 
1 282 U n 
1 283 A n 
1 284 A n 
1 285 G n 
1 286 G n 
1 287 U n 
1 288 U n 
1 289 G n 
1 290 G n 
1 291 C n 
1 292 U n 
1 293 C n 
1 294 A n 
1 295 A n 
1 296 C n 
1 297 G n 
1 298 G n 
1 299 C n 
1 300 G n 
1 301 C n 
1 302 G n 
1 303 U n 
1 304 G n 
1 305 A n 
1 306 C n 
1 307 A n 
1 308 G n 
1 309 A n 
1 310 C n 
1 311 A n 
1 312 A n 
1 313 U n 
1 314 U n 
1 315 C n 
1 316 G n 
1 317 C n 
1 318 G n 
1 319 C n 
1 320 U n 
1 321 G n 
1 322 G n 
1 323 A n 
1 324 A n 
1 325 C n 
1 326 U n 
1 327 G n 
1 328 C n 
1 329 A n 
1 330 G n 
1 331 U n 
1 332 C n 
1 333 G n 
1 334 G n 
1 335 A n 
1 336 C n 
1 337 C n 
1 338 U n 
# 
_pdbx_entity_src_syn.entity_id              1 
_pdbx_entity_src_syn.pdbx_src_id            1 
_pdbx_entity_src_syn.pdbx_alt_source_flag   sample 
_pdbx_entity_src_syn.pdbx_beg_seq_num       1 
_pdbx_entity_src_syn.pdbx_end_seq_num       338 
_pdbx_entity_src_syn.organism_scientific    'synthetic construct' 
_pdbx_entity_src_syn.organism_common_name   ? 
_pdbx_entity_src_syn.ncbi_taxonomy_id       32630 
_pdbx_entity_src_syn.details                ? 
# 
_struct_ref.id                         1 
_struct_ref.db_name                    PDB 
_struct_ref.db_code                    6WLO 
_struct_ref.pdbx_db_accession          6WLO 
_struct_ref.pdbx_db_isoform            ? 
_struct_ref.entity_id                  1 
_struct_ref.pdbx_seq_one_letter_code   ? 
_struct_ref.pdbx_align_begin           1 
# 
_struct_ref_seq.align_id                      1 
_struct_ref_seq.ref_id                        1 
_struct_ref_seq.pdbx_PDB_id_code              6WLO 
_struct_ref_seq.pdbx_strand_id                A 
_struct_ref_seq.seq_align_beg                 1 
_struct_ref_seq.pdbx_seq_align_beg_ins_code   ? 
_struct_ref_seq.seq_align_end                 338 
_struct_ref_seq.pdbx_seq_align_end_ins_code   ? 
_struct_ref_seq.pdbx_db_accession             6WLO 
_struct_ref_seq.db_align_beg                  1 
_struct_ref_seq.pdbx_db_align_beg_ins_code    ? 
_struct_ref_seq.db_align_end                  338 
_struct_ref_seq.pdbx_db_align_end_ins_code    ? 
_struct_ref_seq.pdbx_auth_seq_align_beg       1 
_struct_ref_seq.pdbx_auth_seq_align_end       338 
# 
loop_
_chem_comp.id 
_chem_comp.type 
_chem_comp.mon_nstd_flag 
_chem_comp.name 
_chem_comp.pdbx_synonyms 
_chem_comp.formula 
_chem_comp.formula_weight 
A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O8 P'  323.197 
G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 
U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE"   ? 'C9 H13 N2 O9 P'  324.181 
# 
_exptl.absorpt_coefficient_mu     ? 
_exptl.absorpt_correction_T_max   ? 
_exptl.absorpt_correction_T_min   ? 
_exptl.absorpt_correction_type    ? 
_exptl.absorpt_process_details    ? 
_exptl.entry_id                   6WLO 
_exptl.crystals_number            ? 
_exptl.details                    ? 
_exptl.method                     'ELECTRON MICROSCOPY' 
_exptl.method_details             ? 
# 
_struct.entry_id                     6WLO 
_struct.title                        'hc16 ligase models, 11.0 Angstrom resolution' 
_struct.pdbx_descriptor              'RNA (338-MER)' 
_struct.pdbx_model_details           ? 
_struct.pdbx_formula_weight          ? 
_struct.pdbx_formula_weight_method   ? 
_struct.pdbx_model_type_details      ? 
_struct.pdbx_CASP_flag               N 
# 
_struct_keywords.entry_id        6WLO 
_struct_keywords.text            'ribozyme, RNA' 
_struct_keywords.pdbx_keywords   RNA 
# 
_struct_asym.id                            A 
_struct_asym.pdbx_blank_PDB_chainid_flag   N 
_struct_asym.pdbx_modified                 N 
_struct_asym.entity_id                     1 
_struct_asym.details                       ? 
# 
loop_
_struct_conn.id 
_struct_conn.conn_type_id 
_struct_conn.pdbx_leaving_atom_flag 
_struct_conn.pdbx_PDB_id 
_struct_conn.ptnr1_label_asym_id 
_struct_conn.ptnr1_label_comp_id 
_struct_conn.ptnr1_label_seq_id 
_struct_conn.ptnr1_label_atom_id 
_struct_conn.pdbx_ptnr1_label_alt_id 
_struct_conn.pdbx_ptnr1_PDB_ins_code 
_struct_conn.pdbx_ptnr1_standard_comp_id 
_struct_conn.ptnr1_symmetry 
_struct_conn.ptnr2_label_asym_id 
_struct_conn.ptnr2_label_comp_id 
_struct_conn.ptnr2_label_seq_id 
_struct_conn.ptnr2_label_atom_id 
_struct_conn.pdbx_ptnr2_label_alt_id 
_struct_conn.pdbx_ptnr2_PDB_ins_code 
_struct_conn.ptnr1_auth_asym_id 
_struct_conn.ptnr1_auth_comp_id 
_struct_conn.ptnr1_auth_seq_id 
_struct_conn.ptnr2_auth_asym_id 
_struct_conn.ptnr2_auth_comp_id 
_struct_conn.ptnr2_auth_seq_id 
_struct_conn.ptnr2_symmetry 
_struct_conn.pdbx_ptnr3_label_atom_id 
_struct_conn.pdbx_ptnr3_label_seq_id 
_struct_conn.pdbx_ptnr3_label_comp_id 
_struct_conn.pdbx_ptnr3_label_asym_id 
_struct_conn.pdbx_ptnr3_label_alt_id 
_struct_conn.pdbx_ptnr3_PDB_ins_code 
_struct_conn.details 
_struct_conn.pdbx_dist_value 
_struct_conn.pdbx_value_order 
hydrog1   hydrog ? ? A G 1   N1 ? ? ? 1_555 A C 23  N3 ? ? A G 1   A C 23  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog2   hydrog ? ? A G 1   N2 ? ? ? 1_555 A C 23  O2 ? ? A G 1   A C 23  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog3   hydrog ? ? A G 1   O6 ? ? ? 1_555 A C 23  N4 ? ? A G 1   A C 23  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog4   hydrog ? ? A G 2   N1 ? ? ? 1_555 A C 22  N3 ? ? A G 2   A C 22  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog5   hydrog ? ? A G 2   N2 ? ? ? 1_555 A C 22  O2 ? ? A G 2   A C 22  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog6   hydrog ? ? A G 2   O6 ? ? ? 1_555 A C 22  N4 ? ? A G 2   A C 22  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog7   hydrog ? ? A U 3   N3 ? ? ? 1_555 A A 21  N1 ? ? A U 3   A A 21  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog8   hydrog ? ? A U 3   O4 ? ? ? 1_555 A A 21  N6 ? ? A U 3   A A 21  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog9   hydrog ? ? A A 4   N1 ? ? ? 1_555 A U 20  N3 ? ? A A 4   A U 20  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog10  hydrog ? ? A A 4   N6 ? ? ? 1_555 A U 20  O4 ? ? A A 4   A U 20  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog11  hydrog ? ? A G 5   N1 ? ? ? 1_555 A C 19  N3 ? ? A G 5   A C 19  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog12  hydrog ? ? A G 5   N2 ? ? ? 1_555 A C 19  O2 ? ? A G 5   A C 19  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog13  hydrog ? ? A G 5   O6 ? ? ? 1_555 A C 19  N4 ? ? A G 5   A C 19  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog14  hydrog ? ? A A 6   N1 ? ? ? 1_555 A U 18  N3 ? ? A A 6   A U 18  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog15  hydrog ? ? A A 6   N6 ? ? ? 1_555 A U 18  O4 ? ? A A 6   A U 18  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog16  hydrog ? ? A C 7   N3 ? ? ? 1_555 A G 17  N1 ? ? A C 7   A G 17  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog17  hydrog ? ? A C 7   N4 ? ? ? 1_555 A G 17  O6 ? ? A C 7   A G 17  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog18  hydrog ? ? A C 7   O2 ? ? ? 1_555 A G 17  N2 ? ? A C 7   A G 17  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog19  hydrog ? ? A U 8   N3 ? ? ? 1_555 A A 16  N1 ? ? A U 8   A A 16  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog20  hydrog ? ? A U 8   O4 ? ? ? 1_555 A A 16  N6 ? ? A U 8   A A 16  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog21  hydrog ? ? A C 9   N4 ? ? ? 1_555 A A 15  N1 ? ? A C 9   A A 15  1_555 ? ? ? ? ? ? 'C-A MISPAIR'           ? ? 
hydrog22  hydrog ? ? A G 10  N1 ? ? ? 1_555 A C 115 N3 ? ? A G 10  A C 115 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog23  hydrog ? ? A G 10  N2 ? ? ? 1_555 A C 115 O2 ? ? A G 10  A C 115 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog24  hydrog ? ? A G 10  O6 ? ? ? 1_555 A C 115 N4 ? ? A G 10  A C 115 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog25  hydrog ? ? A C 11  N3 ? ? ? 1_555 A G 114 N1 ? ? A C 11  A G 114 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog26  hydrog ? ? A C 11  N4 ? ? ? 1_555 A G 114 O6 ? ? A C 11  A G 114 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog27  hydrog ? ? A C 11  O2 ? ? ? 1_555 A G 114 N2 ? ? A C 11  A G 114 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog28  hydrog ? ? A G 13  N2 ? ? ? 1_555 A C 113 N3 ? ? A G 13  A C 113 1_555 ? ? ? ? ? ? 'G-C PAIR'              ? ? 
hydrog29  hydrog ? ? A G 14  N3 ? ? ? 1_555 A C 113 N4 ? ? A G 14  A C 113 1_555 ? ? ? ? ? ? 'G-C PAIR'              ? ? 
hydrog30  hydrog ? ? A A 25  N6 ? ? ? 1_555 A A 31  N7 ? ? A A 25  A A 31  1_555 ? ? ? ? ? ? TYPE_2_PAIR             ? ? 
hydrog31  hydrog ? ? A A 25  N7 ? ? ? 1_555 A A 31  N6 ? ? A A 25  A A 31  1_555 ? ? ? ? ? ? TYPE_2_PAIR             ? ? 
hydrog32  hydrog ? ? A A 34  N6 ? ? ? 1_555 A U 277 O2 ? ? A A 34  A U 277 1_555 ? ? ? ? ? ? 'A-U PAIR'              ? ? 
hydrog33  hydrog ? ? A G 38  N7 ? ? ? 1_555 A A 271 N6 ? ? A G 38  A A 271 1_555 ? ? ? ? ? ? 'G-A MISPAIR'           ? ? 
hydrog34  hydrog ? ? A G 38  O6 ? ? ? 1_555 A C 272 N4 ? ? A G 38  A C 272 1_555 ? ? ? ? ? ? 'G-C PAIR'              ? ? 
hydrog35  hydrog ? ? A A 40  N6 ? ? ? 1_555 A A 268 N7 ? ? A A 40  A A 268 1_555 ? ? ? ? ? ? 'A-A MISPAIR'           ? ? 
hydrog36  hydrog ? ? A A 42  N1 ? ? ? 1_555 A G 245 N1 ? ? A A 42  A G 245 1_555 ? ? ? ? ? ? TYPE_8_PAIR             ? ? 
hydrog37  hydrog ? ? A A 42  N6 ? ? ? 1_555 A G 245 O6 ? ? A A 42  A G 245 1_555 ? ? ? ? ? ? TYPE_8_PAIR             ? ? 
hydrog38  hydrog ? ? A G 43  N1 ? ? ? 1_555 A C 244 N3 ? ? A G 43  A C 244 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog39  hydrog ? ? A G 43  N2 ? ? ? 1_555 A C 244 O2 ? ? A G 43  A C 244 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog40  hydrog ? ? A G 43  O6 ? ? ? 1_555 A C 244 N4 ? ? A G 43  A C 244 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog41  hydrog ? ? A A 44  N1 ? ? ? 1_555 A U 243 N3 ? ? A A 44  A U 243 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog42  hydrog ? ? A A 44  N6 ? ? ? 1_555 A U 243 O4 ? ? A A 44  A U 243 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog43  hydrog ? ? A C 45  N3 ? ? ? 1_555 A G 242 N1 ? ? A C 45  A G 242 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog44  hydrog ? ? A C 45  N4 ? ? ? 1_555 A G 242 O6 ? ? A C 45  A G 242 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog45  hydrog ? ? A C 45  O2 ? ? ? 1_555 A G 242 N2 ? ? A C 45  A G 242 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog46  hydrog ? ? A G 46  N1 ? ? ? 1_555 A C 241 N3 ? ? A G 46  A C 241 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog47  hydrog ? ? A G 46  N2 ? ? ? 1_555 A C 241 O2 ? ? A G 46  A C 241 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog48  hydrog ? ? A G 46  O6 ? ? ? 1_555 A C 241 N4 ? ? A G 46  A C 241 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog49  hydrog ? ? A G 47  N1 ? ? ? 1_555 A C 240 N3 ? ? A G 47  A C 240 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog50  hydrog ? ? A G 47  N2 ? ? ? 1_555 A C 240 O2 ? ? A G 47  A C 240 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog51  hydrog ? ? A G 47  O6 ? ? ? 1_555 A C 240 N4 ? ? A G 47  A C 240 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog52  hydrog ? ? A C 48  N3 ? ? ? 1_555 A G 239 N1 ? ? A C 48  A G 239 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog53  hydrog ? ? A C 48  N4 ? ? ? 1_555 A G 239 O6 ? ? A C 48  A G 239 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog54  hydrog ? ? A C 48  O2 ? ? ? 1_555 A G 239 N2 ? ? A C 48  A G 239 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog55  hydrog ? ? A C 49  N4 ? ? ? 1_555 A C 235 O2 ? ? A C 49  A C 235 1_555 ? ? ? ? ? ? 'C-C MISPAIR'           ? ? 
hydrog56  hydrog ? ? A C 49  N3 ? ? ? 1_555 A G 238 N1 ? ? A C 49  A G 238 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog57  hydrog ? ? A C 49  N4 ? ? ? 1_555 A G 238 O6 ? ? A C 49  A G 238 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog58  hydrog ? ? A C 49  O2 ? ? ? 1_555 A G 238 N2 ? ? A C 49  A G 238 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog59  hydrog ? ? A A 50  N6 ? ? ? 1_555 A C 235 O2 ? ? A A 50  A C 235 1_555 ? ? ? ? ? ? 'A-C MISPAIR'           ? ? 
hydrog60  hydrog ? ? A A 50  N1 ? ? ? 1_555 A U 237 N3 ? ? A A 50  A U 237 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog61  hydrog ? ? A A 50  N6 ? ? ? 1_555 A U 237 O4 ? ? A A 50  A U 237 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog62  hydrog ? ? A A 52  N1 ? ? ? 1_555 A U 233 N3 ? ? A A 52  A U 233 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog63  hydrog ? ? A A 52  N6 ? ? ? 1_555 A U 233 O4 ? ? A A 52  A U 233 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog64  hydrog ? ? A U 53  N3 ? ? ? 1_555 A A 232 N1 ? ? A U 53  A A 232 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog65  hydrog ? ? A U 53  O4 ? ? ? 1_555 A A 232 N6 ? ? A U 53  A A 232 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog66  hydrog ? ? A U 54  N3 ? ? ? 1_555 A A 231 N1 ? ? A U 54  A A 231 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog67  hydrog ? ? A U 54  O4 ? ? ? 1_555 A A 231 N6 ? ? A U 54  A A 231 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog68  hydrog ? ? A G 55  N1 ? ? ? 1_555 A U 230 O2 ? ? A G 55  A U 230 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog69  hydrog ? ? A G 55  O6 ? ? ? 1_555 A U 230 N3 ? ? A G 55  A U 230 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog70  hydrog ? ? A C 56  N3 ? ? ? 1_555 A G 229 N1 ? ? A C 56  A G 229 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog71  hydrog ? ? A C 56  N4 ? ? ? 1_555 A G 229 O6 ? ? A C 56  A G 229 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog72  hydrog ? ? A C 56  O2 ? ? ? 1_555 A G 229 N2 ? ? A C 56  A G 229 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog73  hydrog ? ? A G 57  N1 ? ? ? 1_555 A U 228 O2 ? ? A G 57  A U 228 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog74  hydrog ? ? A G 57  O6 ? ? ? 1_555 A U 228 N3 ? ? A G 57  A U 228 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog75  hydrog ? ? A G 58  N1 ? ? ? 1_555 A U 227 O2 ? ? A G 58  A U 227 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog76  hydrog ? ? A G 58  O6 ? ? ? 1_555 A U 227 N3 ? ? A G 58  A U 227 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog77  hydrog ? ? A G 59  N1 ? ? ? 1_555 A C 226 N3 ? ? A G 59  A C 226 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog78  hydrog ? ? A G 59  N2 ? ? ? 1_555 A C 226 O2 ? ? A G 59  A C 226 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog79  hydrog ? ? A G 59  O6 ? ? ? 1_555 A C 226 N4 ? ? A G 59  A C 226 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog80  hydrog ? ? A A 60  N1 ? ? ? 1_555 A U 225 N3 ? ? A A 60  A U 225 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog81  hydrog ? ? A A 60  N6 ? ? ? 1_555 A U 225 O4 ? ? A A 60  A U 225 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog82  hydrog ? ? A A 61  N1 ? ? ? 1_555 A U 224 N3 ? ? A A 61  A U 224 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog83  hydrog ? ? A A 61  N6 ? ? ? 1_555 A U 224 O4 ? ? A A 61  A U 224 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog84  hydrog ? ? A A 62  N6 ? ? ? 1_555 A A 223 N1 ? ? A A 62  A A 223 1_555 ? ? ? ? ? ? 'A-A MISPAIR'           ? ? 
hydrog85  hydrog ? ? A A 62  N6 ? ? ? 1_555 A U 224 O2 ? ? A A 62  A U 224 1_555 ? ? ? ? ? ? 'A-U PAIR'              ? ? 
hydrog86  hydrog ? ? A G 63  N1 ? ? ? 1_555 A C 222 N3 ? ? A G 63  A C 222 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog87  hydrog ? ? A G 63  N2 ? ? ? 1_555 A C 222 O2 ? ? A G 63  A C 222 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog88  hydrog ? ? A G 63  O6 ? ? ? 1_555 A C 222 N4 ? ? A G 63  A C 222 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog89  hydrog ? ? A G 64  N1 ? ? ? 1_555 A U 221 O2 ? ? A G 64  A U 221 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog90  hydrog ? ? A G 64  O6 ? ? ? 1_555 A U 221 N3 ? ? A G 64  A U 221 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog91  hydrog ? ? A G 65  N1 ? ? ? 1_555 A C 220 N3 ? ? A G 65  A C 220 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog92  hydrog ? ? A G 65  N2 ? ? ? 1_555 A C 220 O2 ? ? A G 65  A C 220 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog93  hydrog ? ? A G 65  O6 ? ? ? 1_555 A C 220 N4 ? ? A G 65  A C 220 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog94  hydrog ? ? A G 66  N1 ? ? ? 1_555 A G 218 O6 ? ? A G 66  A G 218 1_555 ? ? ? ? ? ? 'G-G MISPAIR'           ? ? 
hydrog95  hydrog ? ? A G 66  N2 ? ? ? 1_555 A G 219 O6 ? ? A G 66  A G 219 1_555 ? ? ? ? ? ? 'G-G MISPAIR'           ? ? 
hydrog96  hydrog ? ? A C 74  N3 ? ? ? 1_555 A G 140 N1 ? ? A C 74  A G 140 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog97  hydrog ? ? A C 74  N4 ? ? ? 1_555 A G 140 O6 ? ? A C 74  A G 140 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog98  hydrog ? ? A C 74  O2 ? ? ? 1_555 A G 140 N2 ? ? A C 74  A G 140 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog99  hydrog ? ? A C 75  N3 ? ? ? 1_555 A G 139 N1 ? ? A C 75  A G 139 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog100 hydrog ? ? A C 75  N4 ? ? ? 1_555 A G 139 O6 ? ? A C 75  A G 139 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog101 hydrog ? ? A C 75  O2 ? ? ? 1_555 A G 139 N2 ? ? A C 75  A G 139 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog102 hydrog ? ? A G 76  N1 ? ? ? 1_555 A C 138 N3 ? ? A G 76  A C 138 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog103 hydrog ? ? A G 76  N2 ? ? ? 1_555 A C 138 O2 ? ? A G 76  A C 138 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog104 hydrog ? ? A G 76  O6 ? ? ? 1_555 A C 138 N4 ? ? A G 76  A C 138 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog105 hydrog ? ? A U 78  N3 ? ? ? 1_555 A A 137 N1 ? ? A U 78  A A 137 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog106 hydrog ? ? A U 78  O4 ? ? ? 1_555 A A 137 N6 ? ? A U 78  A A 137 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog107 hydrog ? ? A C 79  N3 ? ? ? 1_555 A G 136 N1 ? ? A C 79  A G 136 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog108 hydrog ? ? A C 79  N4 ? ? ? 1_555 A G 136 O6 ? ? A C 79  A G 136 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog109 hydrog ? ? A C 79  O2 ? ? ? 1_555 A G 136 N2 ? ? A C 79  A G 136 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog110 hydrog ? ? A A 80  N1 ? ? ? 1_555 A U 135 N3 ? ? A A 80  A U 135 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog111 hydrog ? ? A A 80  N6 ? ? ? 1_555 A U 135 O4 ? ? A A 80  A U 135 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog112 hydrog ? ? A G 81  N1 ? ? ? 1_555 A C 134 N3 ? ? A G 81  A C 134 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog113 hydrog ? ? A G 81  N2 ? ? ? 1_555 A C 134 O2 ? ? A G 81  A C 134 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog114 hydrog ? ? A G 81  O6 ? ? ? 1_555 A C 134 N4 ? ? A G 81  A C 134 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog115 hydrog ? ? A U 82  N3 ? ? ? 1_555 A A 132 N1 ? ? A U 82  A A 132 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog116 hydrog ? ? A U 82  O4 ? ? ? 1_555 A A 132 N6 ? ? A U 82  A A 132 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog117 hydrog ? ? A A 83  N1 ? ? ? 1_555 A U 127 N3 ? ? A A 83  A U 127 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog118 hydrog ? ? A A 83  N6 ? ? ? 1_555 A U 127 O4 ? ? A A 83  A U 127 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog119 hydrog ? ? A C 84  N3 ? ? ? 1_555 A G 126 N1 ? ? A C 84  A G 126 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog120 hydrog ? ? A C 84  N4 ? ? ? 1_555 A G 126 O6 ? ? A C 84  A G 126 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog121 hydrog ? ? A C 84  O2 ? ? ? 1_555 A G 126 N2 ? ? A C 84  A G 126 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog122 hydrog ? ? A C 85  N3 ? ? ? 1_555 A G 125 N1 ? ? A C 85  A G 125 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog123 hydrog ? ? A C 85  N4 ? ? ? 1_555 A G 125 O6 ? ? A C 85  A G 125 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog124 hydrog ? ? A C 85  O2 ? ? ? 1_555 A G 125 N2 ? ? A C 85  A G 125 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog125 hydrog ? ? A C 85  N4 ? ? ? 1_555 A U 130 O4 ? ? A C 85  A U 130 1_555 ? ? ? ? ? ? 'C-U MISPAIR'           ? ? 
hydrog126 hydrog ? ? A G 88  N1 ? ? ? 1_555 A U 107 O2 ? ? A G 88  A U 107 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog127 hydrog ? ? A G 88  O6 ? ? ? 1_555 A U 107 N3 ? ? A G 88  A U 107 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog128 hydrog ? ? A U 89  N3 ? ? ? 1_555 A A 106 N1 ? ? A U 89  A A 106 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog129 hydrog ? ? A U 89  O4 ? ? ? 1_555 A A 106 N6 ? ? A U 89  A A 106 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog130 hydrog ? ? A C 90  N3 ? ? ? 1_555 A G 105 N1 ? ? A C 90  A G 105 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog131 hydrog ? ? A C 90  N4 ? ? ? 1_555 A G 105 O6 ? ? A C 90  A G 105 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog132 hydrog ? ? A C 90  O2 ? ? ? 1_555 A G 105 N2 ? ? A C 90  A G 105 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog133 hydrog ? ? A U 91  N3 ? ? ? 1_555 A A 104 N1 ? ? A U 91  A A 104 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog134 hydrog ? ? A U 91  O4 ? ? ? 1_555 A A 104 N6 ? ? A U 91  A A 104 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog135 hydrog ? ? A C 92  N3 ? ? ? 1_555 A C 103 N4 ? ? A C 92  A C 103 1_555 ? ? ? ? ? ? 'C-C MISPAIR'           ? ? 
hydrog136 hydrog ? ? A G 94  N1 ? ? ? 1_555 A U 101 O2 ? ? A G 94  A U 101 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog137 hydrog ? ? A G 94  O6 ? ? ? 1_555 A U 101 N3 ? ? A G 94  A U 101 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog138 hydrog ? ? A G 95  N1 ? ? ? 1_555 A C 100 N3 ? ? A G 95  A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog139 hydrog ? ? A G 95  N2 ? ? ? 1_555 A C 100 O2 ? ? A G 95  A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog140 hydrog ? ? A G 95  O6 ? ? ? 1_555 A C 100 N4 ? ? A G 95  A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog141 hydrog ? ? A G 96  N2 ? ? ? 1_555 A A 99  N7 ? ? A G 96  A A 99  1_555 ? ? ? ? ? ? 'G-A MISPAIR'           ? ? 
hydrog142 hydrog ? ? A A 97  N1 ? ? ? 1_555 A A 194 N6 ? ? A A 97  A A 194 1_555 ? ? ? ? ? ? TYPE_1_PAIR             ? ? 
hydrog143 hydrog ? ? A A 97  N6 ? ? ? 1_555 A A 194 N1 ? ? A A 97  A A 194 1_555 ? ? ? ? ? ? TYPE_1_PAIR             ? ? 
hydrog144 hydrog ? ? A A 99  N3 ? ? ? 1_555 A G 196 N2 ? ? A A 99  A G 196 1_555 ? ? ? ? ? ? 'A-G MISPAIR'           ? ? 
hydrog145 hydrog ? ? A C 110 N3 ? ? ? 1_555 A G 120 N1 ? ? A C 110 A G 120 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog146 hydrog ? ? A C 110 N4 ? ? ? 1_555 A G 120 O6 ? ? A C 110 A G 120 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog147 hydrog ? ? A C 110 O2 ? ? ? 1_555 A G 120 N2 ? ? A C 110 A G 120 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog148 hydrog ? ? A C 111 N3 ? ? ? 1_555 A G 119 N1 ? ? A C 111 A G 119 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog149 hydrog ? ? A C 111 N4 ? ? ? 1_555 A G 119 O6 ? ? A C 111 A G 119 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog150 hydrog ? ? A C 111 O2 ? ? ? 1_555 A G 119 N2 ? ? A C 111 A G 119 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog151 hydrog ? ? A U 112 N3 ? ? ? 1_555 A A 118 N1 ? ? A U 112 A A 118 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog152 hydrog ? ? A U 112 O4 ? ? ? 1_555 A A 118 N6 ? ? A U 112 A A 118 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog153 hydrog ? ? A A 116 N1 ? ? ? 1_555 A U 122 N3 ? ? A A 116 A U 122 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? 
hydrog154 hydrog ? ? A A 116 N6 ? ? ? 1_555 A U 122 O2 ? ? A A 116 A U 122 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? 
hydrog155 hydrog ? ? A U 127 O4 ? ? ? 1_555 A A 131 N6 ? ? A U 127 A A 131 1_555 ? ? ? ? ? ? 'U-A PAIR'              ? ? 
hydrog156 hydrog ? ? A C 149 O2 ? ? ? 1_555 A U 338 N3 ? ? A C 149 A U 338 1_555 ? ? ? ? ? ? 'C-U MISPAIR'           ? ? 
hydrog157 hydrog ? ? A U 150 O2 ? ? ? 1_555 A C 336 N4 ? ? A U 150 A C 336 1_555 ? ? ? ? ? ? 'U-C MISPAIR'           ? ? 
hydrog158 hydrog ? ? A C 153 N4 ? ? ? 1_555 A A 329 N7 ? ? A C 153 A A 329 1_555 ? ? ? ? ? ? 'C-A MISPAIR'           ? ? 
hydrog159 hydrog ? ? A C 153 N3 ? ? ? 1_555 A G 334 N1 ? ? A C 153 A G 334 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog160 hydrog ? ? A C 153 N4 ? ? ? 1_555 A G 334 O6 ? ? A C 153 A G 334 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog161 hydrog ? ? A C 153 O2 ? ? ? 1_555 A G 334 N2 ? ? A C 153 A G 334 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog162 hydrog ? ? A C 154 N3 ? ? ? 1_555 A G 333 N1 ? ? A C 154 A G 333 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog163 hydrog ? ? A C 154 N4 ? ? ? 1_555 A G 333 O6 ? ? A C 154 A G 333 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog164 hydrog ? ? A C 154 O2 ? ? ? 1_555 A G 333 N2 ? ? A C 154 A G 333 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog165 hydrog ? ? A A 155 N1 ? ? ? 1_555 A U 331 N3 ? ? A A 155 A U 331 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog166 hydrog ? ? A A 155 N6 ? ? ? 1_555 A U 331 O4 ? ? A A 155 A U 331 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog167 hydrog ? ? A C 156 N3 ? ? ? 1_555 A G 330 N1 ? ? A C 156 A G 330 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog168 hydrog ? ? A C 156 N4 ? ? ? 1_555 A G 330 O6 ? ? A C 156 A G 330 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog169 hydrog ? ? A C 156 O2 ? ? ? 1_555 A G 330 N2 ? ? A C 156 A G 330 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog170 hydrog ? ? A G 157 N1 ? ? ? 1_555 A C 328 N3 ? ? A G 157 A C 328 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog171 hydrog ? ? A G 157 N2 ? ? ? 1_555 A C 328 O2 ? ? A G 157 A C 328 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog172 hydrog ? ? A G 157 O6 ? ? ? 1_555 A C 328 N4 ? ? A G 157 A C 328 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog173 hydrog ? ? A C 158 N3 ? ? ? 1_555 A G 327 N1 ? ? A C 158 A G 327 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog174 hydrog ? ? A C 158 N4 ? ? ? 1_555 A G 327 O6 ? ? A C 158 A G 327 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog175 hydrog ? ? A C 158 O2 ? ? ? 1_555 A G 327 N2 ? ? A C 158 A G 327 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog176 hydrog ? ? A A 159 N1 ? ? ? 1_555 A U 326 N3 ? ? A A 159 A U 326 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog177 hydrog ? ? A A 159 N6 ? ? ? 1_555 A U 326 O4 ? ? A A 159 A U 326 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog178 hydrog ? ? A G 160 N1 ? ? ? 1_555 A C 325 N3 ? ? A G 160 A C 325 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog179 hydrog ? ? A G 160 N2 ? ? ? 1_555 A C 325 O2 ? ? A G 160 A C 325 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog180 hydrog ? ? A G 160 O6 ? ? ? 1_555 A C 325 N4 ? ? A G 160 A C 325 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog181 hydrog ? ? A U 161 N3 ? ? ? 1_555 A A 324 N1 ? ? A U 161 A A 324 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog182 hydrog ? ? A U 161 O4 ? ? ? 1_555 A A 324 N6 ? ? A U 161 A A 324 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog183 hydrog ? ? A A 163 N1 ? ? ? 1_555 A U 204 N3 ? ? A A 163 A U 204 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog184 hydrog ? ? A A 163 N6 ? ? ? 1_555 A U 204 O4 ? ? A A 163 A U 204 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog185 hydrog ? ? A G 165 N1 ? ? ? 1_555 A U 199 O2 ? ? A G 165 A U 199 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog186 hydrog ? ? A G 165 O6 ? ? ? 1_555 A U 199 N3 ? ? A G 165 A U 199 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog187 hydrog ? ? A U 166 N3 ? ? ? 1_555 A A 198 N1 ? ? A U 166 A A 198 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog188 hydrog ? ? A U 166 O4 ? ? ? 1_555 A A 198 N6 ? ? A U 166 A A 198 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog189 hydrog ? ? A C 167 N3 ? ? ? 1_555 A G 197 N1 ? ? A C 167 A G 197 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog190 hydrog ? ? A C 167 N4 ? ? ? 1_555 A G 197 O6 ? ? A C 167 A G 197 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog191 hydrog ? ? A C 167 O2 ? ? ? 1_555 A G 197 N2 ? ? A C 167 A G 197 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog192 hydrog ? ? A C 168 N3 ? ? ? 1_555 A G 196 N1 ? ? A C 168 A G 196 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog193 hydrog ? ? A C 168 N4 ? ? ? 1_555 A G 196 O6 ? ? A C 168 A G 196 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog194 hydrog ? ? A C 168 O2 ? ? ? 1_555 A G 196 N2 ? ? A C 168 A G 196 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog195 hydrog ? ? A U 169 N3 ? ? ? 1_555 A A 194 N7 ? ? A U 169 A A 194 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN'    ? ? 
hydrog196 hydrog ? ? A U 169 O2 ? ? ? 1_555 A A 194 N6 ? ? A U 169 A A 194 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN'    ? ? 
hydrog197 hydrog ? ? A A 171 N1 ? ? ? 1_555 A U 195 N3 ? ? A A 171 A U 195 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog198 hydrog ? ? A A 171 N6 ? ? ? 1_555 A U 195 O4 ? ? A A 171 A U 195 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog199 hydrog ? ? A G 172 N1 ? ? ? 1_555 A U 193 O2 ? ? A G 172 A U 193 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog200 hydrog ? ? A G 172 O6 ? ? ? 1_555 A U 193 N3 ? ? A G 172 A U 193 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog201 hydrog ? ? A G 172 N2 ? ? ? 1_555 A U 195 O4 ? ? A G 172 A U 195 1_555 ? ? ? ? ? ? 'G-U MISPAIR'           ? ? 
hydrog202 hydrog ? ? A U 173 N3 ? ? ? 1_555 A A 192 N1 ? ? A U 173 A A 192 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog203 hydrog ? ? A U 173 O4 ? ? ? 1_555 A A 192 N6 ? ? A U 173 A A 192 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog204 hydrog ? ? A C 174 N3 ? ? ? 1_555 A G 191 N1 ? ? A C 174 A G 191 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog205 hydrog ? ? A C 174 N4 ? ? ? 1_555 A G 191 O6 ? ? A C 174 A G 191 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog206 hydrog ? ? A C 174 O2 ? ? ? 1_555 A G 191 N2 ? ? A C 174 A G 191 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog207 hydrog ? ? A A 175 N1 ? ? ? 1_555 A U 190 N3 ? ? A A 175 A U 190 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog208 hydrog ? ? A A 175 N6 ? ? ? 1_555 A U 190 O4 ? ? A A 175 A U 190 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog209 hydrog ? ? A A 176 N1 ? ? ? 1_555 A U 189 N3 ? ? A A 176 A U 189 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog210 hydrog ? ? A A 176 N6 ? ? ? 1_555 A U 189 O4 ? ? A A 176 A U 189 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog211 hydrog ? ? A C 177 N3 ? ? ? 1_555 A G 188 N1 ? ? A C 177 A G 188 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog212 hydrog ? ? A C 177 N4 ? ? ? 1_555 A G 188 O6 ? ? A C 177 A G 188 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog213 hydrog ? ? A C 177 O2 ? ? ? 1_555 A G 188 N2 ? ? A C 177 A G 188 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog214 hydrog ? ? A A 178 N1 ? ? ? 1_555 A U 187 N3 ? ? A A 178 A U 187 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog215 hydrog ? ? A A 178 N6 ? ? ? 1_555 A U 187 O4 ? ? A A 178 A U 187 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog216 hydrog ? ? A G 179 N1 ? ? ? 1_555 A C 186 N3 ? ? A G 179 A C 186 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog217 hydrog ? ? A G 179 N2 ? ? ? 1_555 A C 186 O2 ? ? A G 179 A C 186 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog218 hydrog ? ? A G 179 O6 ? ? ? 1_555 A C 186 N4 ? ? A G 179 A C 186 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog219 hydrog ? ? A C 180 O2 ? ? ? 1_555 A G 185 N1 ? ? A C 180 A G 185 1_555 ? ? ? ? ? ? 'C-G PAIR'              ? ? 
hydrog220 hydrog ? ? A U 203 N3 ? ? ? 1_555 A A 323 N1 ? ? A U 203 A A 323 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? 
hydrog221 hydrog ? ? A U 203 O2 ? ? ? 1_555 A A 323 N6 ? ? A U 203 A A 323 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? 
hydrog222 hydrog ? ? A U 204 N3 ? ? ? 1_555 A A 324 N7 ? ? A U 204 A A 324 1_555 ? ? ? ? ? ? HOOGSTEEN               ? ? 
hydrog223 hydrog ? ? A U 204 O4 ? ? ? 1_555 A A 324 N6 ? ? A U 204 A A 324 1_555 ? ? ? ? ? ? HOOGSTEEN               ? ? 
hydrog224 hydrog ? ? A C 206 N4 ? ? ? 1_555 A A 294 N1 ? ? A C 206 A A 294 1_555 ? ? ? ? ? ? 'C-A MISPAIR'           ? ? 
hydrog225 hydrog ? ? A C 206 N4 ? ? ? 1_555 A G 322 N3 ? ? A C 206 A G 322 1_555 ? ? ? ? ? ? 'C-G PAIR'              ? ? 
hydrog226 hydrog ? ? A G 207 N1 ? ? ? 1_555 A C 293 N3 ? ? A G 207 A C 293 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog227 hydrog ? ? A G 207 N2 ? ? ? 1_555 A C 293 O2 ? ? A G 207 A C 293 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog228 hydrog ? ? A G 207 O6 ? ? ? 1_555 A C 293 N4 ? ? A G 207 A C 293 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog229 hydrog ? ? A A 208 N1 ? ? ? 1_555 A U 292 N3 ? ? A A 208 A U 292 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog230 hydrog ? ? A A 208 N6 ? ? ? 1_555 A U 292 O4 ? ? A A 208 A U 292 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog231 hydrog ? ? A U 209 O2 ? ? ? 1_555 A C 291 N4 ? ? A U 209 A C 291 1_555 ? ? ? ? ? ? 'U-C MISPAIR'           ? ? 
hydrog232 hydrog ? ? A C 210 N3 ? ? ? 1_555 A G 290 N1 ? ? A C 210 A G 290 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog233 hydrog ? ? A C 210 N4 ? ? ? 1_555 A G 290 O6 ? ? A C 210 A G 290 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog234 hydrog ? ? A C 210 O2 ? ? ? 1_555 A G 290 N2 ? ? A C 210 A G 290 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog235 hydrog ? ? A C 211 N3 ? ? ? 1_555 A G 289 N1 ? ? A C 211 A G 289 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog236 hydrog ? ? A C 211 N4 ? ? ? 1_555 A G 289 O6 ? ? A C 211 A G 289 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog237 hydrog ? ? A C 211 O2 ? ? ? 1_555 A G 289 N2 ? ? A C 211 A G 289 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog238 hydrog ? ? A A 212 N1 ? ? ? 1_555 A U 288 N3 ? ? A A 212 A U 288 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog239 hydrog ? ? A A 212 N6 ? ? ? 1_555 A U 288 O4 ? ? A A 212 A U 288 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog240 hydrog ? ? A A 213 N1 ? ? ? 1_555 A U 287 N3 ? ? A A 213 A U 287 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog241 hydrog ? ? A A 213 N6 ? ? ? 1_555 A U 287 O4 ? ? A A 213 A U 287 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog242 hydrog ? ? A C 214 N3 ? ? ? 1_555 A G 286 N1 ? ? A C 214 A G 286 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog243 hydrog ? ? A C 214 N4 ? ? ? 1_555 A G 286 O6 ? ? A C 214 A G 286 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog244 hydrog ? ? A C 214 O2 ? ? ? 1_555 A G 286 N2 ? ? A C 214 A G 286 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog245 hydrog ? ? A C 215 N3 ? ? ? 1_555 A G 285 N1 ? ? A C 215 A G 285 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog246 hydrog ? ? A C 215 N4 ? ? ? 1_555 A G 285 O6 ? ? A C 215 A G 285 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog247 hydrog ? ? A C 215 O2 ? ? ? 1_555 A G 285 N2 ? ? A C 215 A G 285 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog248 hydrog ? ? A G 247 N1 ? ? ? 1_555 A U 266 O2 ? ? A G 247 A U 266 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog249 hydrog ? ? A G 247 O6 ? ? ? 1_555 A U 266 N3 ? ? A G 247 A U 266 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog250 hydrog ? ? A G 248 N1 ? ? ? 1_555 A C 265 N3 ? ? A G 248 A C 265 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog251 hydrog ? ? A G 248 N2 ? ? ? 1_555 A C 265 O2 ? ? A G 248 A C 265 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog252 hydrog ? ? A G 248 O6 ? ? ? 1_555 A C 265 N4 ? ? A G 248 A C 265 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog253 hydrog ? ? A A 249 N1 ? ? ? 1_555 A U 264 N3 ? ? A A 249 A U 264 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog254 hydrog ? ? A A 249 N6 ? ? ? 1_555 A U 264 O4 ? ? A A 249 A U 264 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog255 hydrog ? ? A G 250 N1 ? ? ? 1_555 A C 263 N3 ? ? A G 250 A C 263 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog256 hydrog ? ? A G 250 N2 ? ? ? 1_555 A C 263 O2 ? ? A G 250 A C 263 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog257 hydrog ? ? A G 250 O6 ? ? ? 1_555 A C 263 N4 ? ? A G 250 A C 263 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog258 hydrog ? ? A G 251 N1 ? ? ? 1_555 A C 262 N3 ? ? A G 251 A C 262 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog259 hydrog ? ? A G 251 N2 ? ? ? 1_555 A C 262 O2 ? ? A G 251 A C 262 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog260 hydrog ? ? A G 251 O6 ? ? ? 1_555 A C 262 N4 ? ? A G 251 A C 262 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog261 hydrog ? ? A C 252 N3 ? ? ? 1_555 A G 261 N1 ? ? A C 252 A G 261 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog262 hydrog ? ? A C 252 N4 ? ? ? 1_555 A G 261 O6 ? ? A C 252 A G 261 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog263 hydrog ? ? A C 252 O2 ? ? ? 1_555 A G 261 N2 ? ? A C 252 A G 261 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog264 hydrog ? ? A A 253 N1 ? ? ? 1_555 A U 260 N3 ? ? A A 253 A U 260 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog265 hydrog ? ? A A 253 N6 ? ? ? 1_555 A U 260 O4 ? ? A A 253 A U 260 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog266 hydrog ? ? A C 254 N3 ? ? ? 1_555 A G 259 N1 ? ? A C 254 A G 259 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog267 hydrog ? ? A C 254 N4 ? ? ? 1_555 A G 259 O6 ? ? A C 254 A G 259 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog268 hydrog ? ? A C 254 O2 ? ? ? 1_555 A G 259 N2 ? ? A C 254 A G 259 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog269 hydrog ? ? A A 295 N6 ? ? ? 1_555 A G 322 N3 ? ? A A 295 A G 322 1_555 ? ? ? ? ? ? TYPE_11_PAIR            ? ? 
hydrog270 hydrog ? ? A A 295 N7 ? ? ? 1_555 A G 322 N2 ? ? A A 295 A G 322 1_555 ? ? ? ? ? ? TYPE_11_PAIR            ? ? 
hydrog271 hydrog ? ? A C 296 N3 ? ? ? 1_555 A G 321 N1 ? ? A C 296 A G 321 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog272 hydrog ? ? A C 296 N4 ? ? ? 1_555 A G 321 O6 ? ? A C 296 A G 321 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog273 hydrog ? ? A C 296 O2 ? ? ? 1_555 A G 321 N2 ? ? A C 296 A G 321 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog274 hydrog ? ? A G 297 N1 ? ? ? 1_555 A U 320 O2 ? ? A G 297 A U 320 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog275 hydrog ? ? A G 297 O6 ? ? ? 1_555 A U 320 N3 ? ? A G 297 A U 320 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog276 hydrog ? ? A G 298 N1 ? ? ? 1_555 A C 319 N3 ? ? A G 298 A C 319 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog277 hydrog ? ? A G 298 N2 ? ? ? 1_555 A C 319 O2 ? ? A G 298 A C 319 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog278 hydrog ? ? A G 298 O6 ? ? ? 1_555 A C 319 N4 ? ? A G 298 A C 319 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog279 hydrog ? ? A C 299 N3 ? ? ? 1_555 A G 318 N1 ? ? A C 299 A G 318 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog280 hydrog ? ? A C 299 N4 ? ? ? 1_555 A G 318 O6 ? ? A C 299 A G 318 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog281 hydrog ? ? A C 299 O2 ? ? ? 1_555 A G 318 N2 ? ? A C 299 A G 318 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog282 hydrog ? ? A G 300 N1 ? ? ? 1_555 A C 317 N3 ? ? A G 300 A C 317 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog283 hydrog ? ? A G 300 N2 ? ? ? 1_555 A C 317 O2 ? ? A G 300 A C 317 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog284 hydrog ? ? A G 300 O6 ? ? ? 1_555 A C 317 N4 ? ? A G 300 A C 317 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog285 hydrog ? ? A C 301 N3 ? ? ? 1_555 A G 316 N1 ? ? A C 301 A G 316 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog286 hydrog ? ? A C 301 N4 ? ? ? 1_555 A G 316 O6 ? ? A C 301 A G 316 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog287 hydrog ? ? A C 301 O2 ? ? ? 1_555 A G 316 N2 ? ? A C 301 A G 316 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog288 hydrog ? ? A G 302 N1 ? ? ? 1_555 A C 315 N3 ? ? A G 302 A C 315 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog289 hydrog ? ? A G 302 N2 ? ? ? 1_555 A C 315 O2 ? ? A G 302 A C 315 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog290 hydrog ? ? A G 302 O6 ? ? ? 1_555 A C 315 N4 ? ? A G 302 A C 315 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog291 hydrog ? ? A G 304 N1 ? ? ? 1_555 A U 314 O2 ? ? A G 304 A U 314 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog292 hydrog ? ? A G 304 O6 ? ? ? 1_555 A U 314 N3 ? ? A G 304 A U 314 1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog293 hydrog ? ? A A 305 N1 ? ? ? 1_555 A U 313 N3 ? ? A A 305 A U 313 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog294 hydrog ? ? A A 305 N6 ? ? ? 1_555 A U 313 O4 ? ? A A 305 A U 313 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog295 hydrog ? ? A C 306 N3 ? ? ? 1_555 A A 312 N6 ? ? A C 306 A A 312 1_555 ? ? ? ? ? ? 'C-A MISPAIR'           ? ? 
hydrog296 hydrog ? ? A A 307 N3 ? ? ? 1_555 A A 311 N6 ? ? A A 307 A A 311 1_555 ? ? ? ? ? ? 'A-A MISPAIR'           ? ? 
# 
_struct_conn_type.id          hydrog 
_struct_conn_type.criteria    ? 
_struct_conn_type.reference   ? 
# 
_atom_sites.entry_id                    6WLO 
_atom_sites.Cartn_transf_matrix[1][1]   ? 
_atom_sites.Cartn_transf_matrix[1][2]   ? 
_atom_sites.Cartn_transf_matrix[1][3]   ? 
_atom_sites.Cartn_transf_matrix[2][1]   ? 
_atom_sites.Cartn_transf_matrix[2][2]   ? 
_atom_sites.Cartn_transf_matrix[2][3]   ? 
_atom_sites.Cartn_transf_matrix[3][1]   ? 
_atom_sites.Cartn_transf_matrix[3][2]   ? 
_atom_sites.Cartn_transf_matrix[3][3]   ? 
_atom_sites.Cartn_transf_vector[1]      ? 
_atom_sites.Cartn_transf_vector[2]      ? 
_atom_sites.Cartn_transf_vector[3]      ? 
_atom_sites.fract_transf_matrix[1][1]   1.000000 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   1.000000 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   1.000000 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
_atom_sites.solution_primary            ? 
_atom_sites.solution_secondary          ? 
_atom_sites.solution_hydrogens          ? 
_atom_sites.special_details             ? 
# 
loop_
_atom_type.symbol 
C 
H 
N 
O 
P 
# 
loop_
_atom_site.group_PDB 
_atom_site.id 
_atom_site.type_symbol 
_atom_site.label_atom_id 
_atom_site.label_alt_id 
_atom_site.label_comp_id 
_atom_site.label_asym_id 
_atom_site.label_entity_id 
_atom_site.label_seq_id 
_atom_site.pdbx_PDB_ins_code 
_atom_site.Cartn_x 
_atom_site.Cartn_y 
_atom_site.Cartn_z 
_atom_site.occupancy 
_atom_site.B_iso_or_equiv 
_atom_site.pdbx_formal_charge 
_atom_site.auth_seq_id 
_atom_site.auth_comp_id 
_atom_site.auth_asym_id 
_atom_site.auth_atom_id 
_atom_site.pdbx_PDB_model_num 
ATOM 1      C "C5'"  . G A 1 1   ? 135.386 120.983 103.402 1.00 0.00 ? 1   G A "C5'"  1  
ATOM 2      C "C4'"  . G A 1 1   ? 134.348 120.027 103.937 1.00 0.00 ? 1   G A "C4'"  1  
ATOM 3      O "O4'"  . G A 1 1   ? 134.805 118.660 103.765 1.00 0.00 ? 1   G A "O4'"  1  
ATOM 4      C "C3'"  . G A 1 1   ? 134.050 120.132 105.425 1.00 0.00 ? 1   G A "C3'"  1  
ATOM 5      O "O3'"  . G A 1 1   ? 133.158 121.188 105.739 1.00 0.00 ? 1   G A "O3'"  1  
ATOM 6      C "C2'"  . G A 1 1   ? 133.502 118.751 105.753 1.00 0.00 ? 1   G A "C2'"  1  
ATOM 7      O "O2'"  . G A 1 1   ? 132.150 118.622 105.336 1.00 0.00 ? 1   G A "O2'"  1  
ATOM 8      C "C1'"  . G A 1 1   ? 134.379 117.857 104.875 1.00 0.00 ? 1   G A "C1'"  1  
ATOM 9      N N9     . G A 1 1   ? 135.539 117.324 105.612 1.00 0.00 ? 1   G A N9     1  
ATOM 10     C C8     . G A 1 1   ? 136.854 117.702 105.480 1.00 0.00 ? 1   G A C8     1  
ATOM 11     N N7     . G A 1 1   ? 137.660 117.044 106.271 1.00 0.00 ? 1   G A N7     1  
ATOM 12     C C5     . G A 1 1   ? 136.826 116.181 106.967 1.00 0.00 ? 1   G A C5     1  
ATOM 13     C C6     . G A 1 1   ? 137.128 115.221 107.968 1.00 0.00 ? 1   G A C6     1  
ATOM 14     O O6     . G A 1 1   ? 138.229 114.932 108.451 1.00 0.00 ? 1   G A O6     1  
ATOM 15     N N1     . G A 1 1   ? 135.985 114.560 108.407 1.00 0.00 ? 1   G A N1     1  
ATOM 16     C C2     . G A 1 1   ? 134.713 114.797 107.945 1.00 0.00 ? 1   G A C2     1  
ATOM 17     N N2     . G A 1 1   ? 133.734 114.058 108.491 1.00 0.00 ? 1   G A N2     1  
ATOM 18     N N3     . G A 1 1   ? 134.417 115.688 107.013 1.00 0.00 ? 1   G A N3     1  
ATOM 19     C C4     . G A 1 1   ? 135.516 116.340 106.574 1.00 0.00 ? 1   G A C4     1  
ATOM 20     H "H4'"  . G A 1 1   ? 133.514 120.147 103.436 1.00 0.00 ? 1   G A "H4'"  1  
ATOM 21     H "H3'"  . G A 1 1   ? 134.890 120.267 105.914 1.00 0.00 ? 1   G A "H3'"  1  
ATOM 22     H "H2'"  . G A 1 1   ? 133.609 118.536 106.704 1.00 0.00 ? 1   G A "H2'"  1  
ATOM 23     H "HO2'" . G A 1 1   ? 131.652 118.126 106.018 1.00 0.00 ? 1   G A "HO2'" 1  
ATOM 24     H "H1'"  . G A 1 1   ? 133.842 117.116 104.528 1.00 0.00 ? 1   G A "H1'"  1  
ATOM 25     H H8     . G A 1 1   ? 137.158 118.393 104.856 1.00 0.00 ? 1   G A H8     1  
ATOM 26     H H1     . G A 1 1   ? 136.097 113.876 109.099 1.00 0.00 ? 1   G A H1     1  
ATOM 27     H H21    . G A 1 1   ? 133.945 113.397 109.181 1.00 0.00 ? 1   G A H21    1  
ATOM 28     H H22    . G A 1 1   ? 132.807 114.182 108.200 1.00 0.00 ? 1   G A H22    1  
ATOM 29     P P      . G A 1 2   ? 133.187 121.864 107.195 1.00 0.00 ? 2   G A P      1  
ATOM 30     O OP1    . G A 1 2   ? 132.210 122.983 107.204 1.00 0.00 ? 2   G A OP1    1  
ATOM 31     O OP2    . G A 1 2   ? 134.603 122.125 107.554 1.00 0.00 ? 2   G A OP2    1  
ATOM 32     O "O5'"  . G A 1 2   ? 132.635 120.724 108.161 1.00 0.00 ? 2   G A "O5'"  1  
ATOM 33     C "C5'"  . G A 1 2   ? 131.265 120.355 108.147 1.00 0.00 ? 2   G A "C5'"  1  
ATOM 34     C "C4'"  . G A 1 2   ? 130.985 119.221 109.105 1.00 0.00 ? 2   G A "C4'"  1  
ATOM 35     O "O4'"  . G A 1 2   ? 131.790 118.067 108.748 1.00 0.00 ? 2   G A "O4'"  1  
ATOM 36     C "C3'"  . G A 1 2   ? 131.330 119.480 110.563 1.00 0.00 ? 2   G A "C3'"  1  
ATOM 37     O "O3'"  . G A 1 2   ? 130.346 120.245 111.238 1.00 0.00 ? 2   G A "O3'"  1  
ATOM 38     C "C2'"  . G A 1 2   ? 131.495 118.072 111.119 1.00 0.00 ? 2   G A "C2'"  1  
ATOM 39     O "O2'"  . G A 1 2   ? 130.236 117.462 111.360 1.00 0.00 ? 2   G A "O2'"  1  
ATOM 40     C "C1'"  . G A 1 2   ? 132.174 117.359 109.948 1.00 0.00 ? 2   G A "C1'"  1  
ATOM 41     N N9     . G A 1 2   ? 133.640 117.314 110.099 1.00 0.00 ? 2   G A N9     1  
ATOM 42     C C8     . G A 1 2   ? 134.571 118.060 109.419 1.00 0.00 ? 2   G A C8     1  
ATOM 43     N N7     . G A 1 2   ? 135.800 117.797 109.772 1.00 0.00 ? 2   G A N7     1  
ATOM 44     C C5     . G A 1 2   ? 135.674 116.815 110.743 1.00 0.00 ? 2   G A C5     1  
ATOM 45     C C6     . G A 1 2   ? 136.667 116.134 111.497 1.00 0.00 ? 2   G A C6     1  
ATOM 46     O O6     . G A 1 2   ? 137.893 116.267 111.451 1.00 0.00 ? 2   G A O6     1  
ATOM 47     N N1     . G A 1 2   ? 136.099 115.212 112.374 1.00 0.00 ? 2   G A N1     1  
ATOM 48     C C2     . G A 1 2   ? 134.753 114.977 112.510 1.00 0.00 ? 2   G A C2     1  
ATOM 49     N N2     . G A 1 2   ? 134.401 114.049 113.412 1.00 0.00 ? 2   G A N2     1  
ATOM 50     N N3     . G A 1 2   ? 133.819 115.606 111.816 1.00 0.00 ? 2   G A N3     1  
ATOM 51     C C4     . G A 1 2   ? 134.348 116.505 110.958 1.00 0.00 ? 2   G A C4     1  
ATOM 52     H "H5'"  . G A 1 2   ? 131.017 120.076 107.240 1.00 0.00 ? 2   G A "H5'"  1  
ATOM 53     H "H5''" . G A 1 2   ? 130.723 121.130 108.403 1.00 0.00 ? 2   G A "H5''" 1  
ATOM 54     H "H4'"  . G A 1 2   ? 130.037 118.979 109.038 1.00 0.00 ? 2   G A "H4'"  1  
ATOM 55     H "H3'"  . G A 1 2   ? 132.190 119.946 110.612 1.00 0.00 ? 2   G A "H3'"  1  
ATOM 56     H "H2'"  . G A 1 2   ? 132.062 118.065 111.918 1.00 0.00 ? 2   G A "H2'"  1  
ATOM 57     H "HO2'" . G A 1 2   ? 129.551 118.159 111.426 1.00 0.00 ? 2   G A "HO2'" 1  
ATOM 58     H "H1'"  . G A 1 2   ? 131.825 116.447 109.874 1.00 0.00 ? 2   G A "H1'"  1  
ATOM 59     H H8     . G A 1 2   ? 134.337 118.726 108.739 1.00 0.00 ? 2   G A H8     1  
ATOM 60     H H1     . G A 1 2   ? 136.712 114.693 112.936 1.00 0.00 ? 2   G A H1     1  
ATOM 61     H H21    . G A 1 2   ? 135.086 113.580 113.931 1.00 0.00 ? 2   G A H21    1  
ATOM 62     H H22    . G A 1 2   ? 133.453 113.839 113.552 1.00 0.00 ? 2   G A H22    1  
ATOM 63     P P      . U A 1 3   ? 130.755 121.150 112.502 1.00 0.00 ? 3   U A P      1  
ATOM 64     O OP1    . U A 1 3   ? 129.558 121.921 112.923 1.00 0.00 ? 3   U A OP1    1  
ATOM 65     O OP2    . U A 1 3   ? 132.011 121.869 112.163 1.00 0.00 ? 3   U A OP2    1  
ATOM 66     O "O5'"  . U A 1 3   ? 131.086 120.090 113.643 1.00 0.00 ? 3   U A "O5'"  1  
ATOM 67     C "C5'"  . U A 1 3   ? 130.071 119.261 114.184 1.00 0.00 ? 3   U A "C5'"  1  
ATOM 68     C "C4'"  . U A 1 3   ? 130.631 118.265 115.173 1.00 0.00 ? 3   U A "C4'"  1  
ATOM 69     O "O4'"  . U A 1 3   ? 131.573 117.384 114.507 1.00 0.00 ? 3   U A "O4'"  1  
ATOM 70     C "C3'"  . U A 1 3   ? 131.425 118.849 116.333 1.00 0.00 ? 3   U A "C3'"  1  
ATOM 71     O "O3'"  . U A 1 3   ? 130.601 119.363 117.365 1.00 0.00 ? 3   U A "O3'"  1  
ATOM 72     C "C2'"  . U A 1 3   ? 132.288 117.673 116.767 1.00 0.00 ? 3   U A "C2'"  1  
ATOM 73     O "O2'"  . U A 1 3   ? 131.541 116.743 117.539 1.00 0.00 ? 3   U A "O2'"  1  
ATOM 74     C "C1'"  . U A 1 3   ? 132.636 117.035 115.421 1.00 0.00 ? 3   U A "C1'"  1  
ATOM 75     N N1     . U A 1 3   ? 133.947 117.491 114.903 1.00 0.00 ? 3   U A N1     1  
ATOM 76     C C2     . U A 1 3   ? 135.076 116.906 115.447 1.00 0.00 ? 3   U A C2     1  
ATOM 77     O O2     . U A 1 3   ? 135.033 116.051 116.314 1.00 0.00 ? 3   U A O2     1  
ATOM 78     N N3     . U A 1 3   ? 136.269 117.360 114.938 1.00 0.00 ? 3   U A N3     1  
ATOM 79     C C4     . U A 1 3   ? 136.449 118.317 113.963 1.00 0.00 ? 3   U A C4     1  
ATOM 80     O O4     . U A 1 3   ? 137.591 118.616 113.612 1.00 0.00 ? 3   U A O4     1  
ATOM 81     C C5     . U A 1 3   ? 135.237 118.876 113.446 1.00 0.00 ? 3   U A C5     1  
ATOM 82     C C6     . U A 1 3   ? 134.063 118.454 113.923 1.00 0.00 ? 3   U A C6     1  
ATOM 83     H "H5'"  . U A 1 3   ? 129.634 118.772 113.455 1.00 0.00 ? 3   U A "H5'"  1  
ATOM 84     H "H5''" . U A 1 3   ? 129.407 119.819 114.637 1.00 0.00 ? 3   U A "H5''" 1  
ATOM 85     H "H4'"  . U A 1 3   ? 129.894 117.728 115.531 1.00 0.00 ? 3   U A "H4'"  1  
ATOM 86     H "H3'"  . U A 1 3   ? 132.004 119.564 115.995 1.00 0.00 ? 3   U A "H3'"  1  
ATOM 87     H "H2'"  . U A 1 3   ? 133.093 117.971 117.238 1.00 0.00 ? 3   U A "H2'"  1  
ATOM 88     H "HO2'" . U A 1 3   ? 130.747 117.188 117.893 1.00 0.00 ? 3   U A "HO2'" 1  
ATOM 89     H "H1'"  . U A 1 3   ? 132.647 116.059 115.516 1.00 0.00 ? 3   U A "H1'"  1  
ATOM 90     H H3     . U A 1 3   ? 137.083 116.958 115.310 1.00 0.00 ? 3   U A H3     1  
ATOM 91     H H5     . U A 1 3   ? 135.270 119.564 112.749 1.00 0.00 ? 3   U A H5     1  
ATOM 92     H H6     . U A 1 3   ? 133.247 118.853 113.553 1.00 0.00 ? 3   U A H6     1  
ATOM 93     P P      . A A 1 4   ? 131.128 120.559 118.299 1.00 0.00 ? 4   A A P      1  
ATOM 94     O OP1    . A A 1 4   ? 130.010 120.979 119.181 1.00 0.00 ? 4   A A OP1    1  
ATOM 95     O OP2    . A A 1 4   ? 131.796 121.562 117.431 1.00 0.00 ? 4   A A OP2    1  
ATOM 96     O "O5'"  . A A 1 4   ? 132.242 119.874 119.209 1.00 0.00 ? 4   A A "O5'"  1  
ATOM 97     C "C5'"  . A A 1 4   ? 131.893 118.904 120.186 1.00 0.00 ? 4   A A "C5'"  1  
ATOM 98     C "C4'"  . A A 1 4   ? 133.115 118.302 120.831 1.00 0.00 ? 4   A A "C4'"  1  
ATOM 99     O "O4'"  . A A 1 4   ? 133.903 117.600 119.832 1.00 0.00 ? 4   A A "O4'"  1  
ATOM 100    C "C3'"  . A A 1 4   ? 134.095 119.287 121.451 1.00 0.00 ? 4   A A "C3'"  1  
ATOM 101    O "O3'"  . A A 1 4   ? 133.684 119.749 122.727 1.00 0.00 ? 4   A A "O3'"  1  
ATOM 102    C "C2'"  . A A 1 4   ? 135.392 118.491 121.479 1.00 0.00 ? 4   A A "C2'"  1  
ATOM 103    O "O2'"  . A A 1 4   ? 135.405 117.563 122.555 1.00 0.00 ? 4   A A "O2'"  1  
ATOM 104    C "C1'"  . A A 1 4   ? 135.307 117.722 120.160 1.00 0.00 ? 4   A A "C1'"  1  
ATOM 105    N N9     . A A 1 4   ? 136.054 118.390 119.076 1.00 0.00 ? 4   A A N9     1  
ATOM 106    C C8     . A A 1 4   ? 135.549 119.148 118.050 1.00 0.00 ? 4   A A C8     1  
ATOM 107    N N7     . A A 1 4   ? 136.467 119.611 117.236 1.00 0.00 ? 4   A A N7     1  
ATOM 108    C C5     . A A 1 4   ? 137.656 119.127 117.766 1.00 0.00 ? 4   A A C5     1  
ATOM 109    C C6     . A A 1 4   ? 138.997 119.268 117.365 1.00 0.00 ? 4   A A C6     1  
ATOM 110    N N6     . A A 1 4   ? 139.379 119.965 116.294 1.00 0.00 ? 4   A A N6     1  
ATOM 111    N N1     . A A 1 4   ? 139.942 118.657 118.111 1.00 0.00 ? 4   A A N1     1  
ATOM 112    C C2     . A A 1 4   ? 139.558 117.958 119.187 1.00 0.00 ? 4   A A C2     1  
ATOM 113    N N3     . A A 1 4   ? 138.330 117.755 119.665 1.00 0.00 ? 4   A A N3     1  
ATOM 114    C C4     . A A 1 4   ? 137.415 118.375 118.900 1.00 0.00 ? 4   A A C4     1  
ATOM 115    H "H5'"  . A A 1 4   ? 131.374 118.192 119.758 1.00 0.00 ? 4   A A "H5'"  1  
ATOM 116    H "H5''" . A A 1 4   ? 131.343 119.329 120.877 1.00 0.00 ? 4   A A "H5''" 1  
ATOM 117    H "H4'"  . A A 1 4   ? 132.831 117.664 121.518 1.00 0.00 ? 4   A A "H4'"  1  
ATOM 118    H "H3'"  . A A 1 4   ? 134.204 120.055 120.851 1.00 0.00 ? 4   A A "H3'"  1  
ATOM 119    H "H2'"  . A A 1 4   ? 136.177 119.081 121.499 1.00 0.00 ? 4   A A "H2'"  1  
ATOM 120    H "HO2'" . A A 1 4   ? 134.746 117.840 123.224 1.00 0.00 ? 4   A A "HO2'" 1  
ATOM 121    H "H1'"  . A A 1 4   ? 135.660 116.814 120.288 1.00 0.00 ? 4   A A "H1'"  1  
ATOM 122    H H8     . A A 1 4   ? 134.591 119.324 117.932 1.00 0.00 ? 4   A A H8     1  
ATOM 123    H H61    . A A 1 4   ? 140.332 120.025 116.065 1.00 0.00 ? 4   A A H61    1  
ATOM 124    H H62    . A A 1 4   ? 138.713 120.415 115.736 1.00 0.00 ? 4   A A H62    1  
ATOM 125    H H2     . A A 1 4   ? 140.282 117.537 119.696 1.00 0.00 ? 4   A A H2     1  
ATOM 126    P P      . G A 1 5   ? 134.175 121.183 123.264 1.00 0.00 ? 5   G A P      1  
ATOM 127    O OP1    . G A 1 5   ? 133.488 121.452 124.553 1.00 0.00 ? 5   G A OP1    1  
ATOM 128    O OP2    . G A 1 5   ? 134.056 122.157 122.150 1.00 0.00 ? 5   G A OP2    1  
ATOM 129    O "O5'"  . G A 1 5   ? 135.725 120.970 123.569 1.00 0.00 ? 5   G A "O5'"  1  
ATOM 130    C "C5'"  . G A 1 5   ? 136.152 120.118 124.622 1.00 0.00 ? 5   G A "C5'"  1  
ATOM 131    C "C4'"  . G A 1 5   ? 137.653 119.964 124.636 1.00 0.00 ? 5   G A "C4'"  1  
ATOM 132    O "O4'"  . G A 1 5   ? 138.096 119.367 123.389 1.00 0.00 ? 5   G A "O4'"  1  
ATOM 133    C "C3'"  . G A 1 5   ? 138.456 121.251 124.740 1.00 0.00 ? 5   G A "C3'"  1  
ATOM 134    O "O3'"  . G A 1 5   ? 138.527 121.756 126.063 1.00 0.00 ? 5   G A "O3'"  1  
ATOM 135    C "C2'"  . G A 1 5   ? 139.806 120.846 124.167 1.00 0.00 ? 5   G A "C2'"  1  
ATOM 136    O "O2'"  . G A 1 5   ? 140.569 120.112 125.114 1.00 0.00 ? 5   G A "O2'"  1  
ATOM 137    C "C1'"  . G A 1 5   ? 139.388 119.910 123.032 1.00 0.00 ? 5   G A "C1'"  1  
ATOM 138    N N9     . G A 1 5   ? 139.341 120.603 121.730 1.00 0.00 ? 5   G A N9     1  
ATOM 139    C C8     . G A 1 5   ? 138.220 121.018 121.050 1.00 0.00 ? 5   G A C8     1  
ATOM 140    N N7     . G A 1 5   ? 138.496 121.604 119.916 1.00 0.00 ? 5   G A N7     1  
ATOM 141    C C5     . G A 1 5   ? 139.882 121.572 119.842 1.00 0.00 ? 5   G A C5     1  
ATOM 142    C C6     . G A 1 5   ? 140.761 122.059 118.840 1.00 0.00 ? 5   G A C6     1  
ATOM 143    O O6     . G A 1 5   ? 140.478 122.633 117.783 1.00 0.00 ? 5   G A O6     1  
ATOM 144    N N1     . G A 1 5   ? 142.092 121.819 119.164 1.00 0.00 ? 5   G A N1     1  
ATOM 145    C C2     . G A 1 5   ? 142.524 121.191 120.308 1.00 0.00 ? 5   G A C2     1  
ATOM 146    N N2     . G A 1 5   ? 143.850 121.050 120.444 1.00 0.00 ? 5   G A N2     1  
ATOM 147    N N3     . G A 1 5   ? 141.716 120.733 121.250 1.00 0.00 ? 5   G A N3     1  
ATOM 148    C C4     . G A 1 5   ? 140.419 120.958 120.955 1.00 0.00 ? 5   G A C4     1  
ATOM 149    H "H5'"  . G A 1 5   ? 135.739 119.237 124.509 1.00 0.00 ? 5   G A "H5'"  1  
ATOM 150    H "H5''" . G A 1 5   ? 135.861 120.498 125.478 1.00 0.00 ? 5   G A "H5''" 1  
ATOM 151    H "H4'"  . G A 1 5   ? 137.901 119.372 125.378 1.00 0.00 ? 5   G A "H4'"  1  
ATOM 152    H "H3'"  . G A 1 5   ? 138.051 121.930 124.158 1.00 0.00 ? 5   G A "H3'"  1  
ATOM 153    H "H2'"  . G A 1 5   ? 140.301 121.621 123.827 1.00 0.00 ? 5   G A "H2'"  1  
ATOM 154    H "HO2'" . G A 1 5   ? 140.222 120.289 126.010 1.00 0.00 ? 5   G A "HO2'" 1  
ATOM 155    H "H1'"  . G A 1 5   ? 140.014 119.159 122.980 1.00 0.00 ? 5   G A "H1'"  1  
ATOM 156    H H8     . G A 1 5   ? 137.307 120.889 121.382 1.00 0.00 ? 5   G A H8     1  
ATOM 157    H H1     . G A 1 5   ? 142.772 122.121 118.528 1.00 0.00 ? 5   G A H1     1  
ATOM 158    H H21    . G A 1 5   ? 144.456 121.387 119.751 1.00 0.00 ? 5   G A H21    1  
ATOM 159    H H22    . G A 1 5   ? 144.218 120.611 121.240 1.00 0.00 ? 5   G A H22    1  
ATOM 160    P P      . A A 1 6   ? 138.731 123.328 126.316 1.00 0.00 ? 6   A A P      1  
ATOM 161    O OP1    . A A 1 6   ? 138.619 123.579 127.775 1.00 0.00 ? 6   A A OP1    1  
ATOM 162    O OP2    . A A 1 6   ? 137.850 124.065 125.375 1.00 0.00 ? 6   A A OP2    1  
ATOM 163    O "O5'"  . A A 1 6   ? 140.242 123.596 125.884 1.00 0.00 ? 6   A A "O5'"  1  
ATOM 164    C "C5'"  . A A 1 6   ? 141.321 123.033 126.618 1.00 0.00 ? 6   A A "C5'"  1  
ATOM 165    C "C4'"  . A A 1 6   ? 142.646 123.299 125.951 1.00 0.00 ? 6   A A "C4'"  1  
ATOM 166    O "O4'"  . A A 1 6   ? 142.669 122.681 124.639 1.00 0.00 ? 6   A A "O4'"  1  
ATOM 167    C "C3'"  . A A 1 6   ? 142.971 124.760 125.679 1.00 0.00 ? 6   A A "C3'"  1  
ATOM 168    O "O3'"  . A A 1 6   ? 143.448 125.446 126.824 1.00 0.00 ? 6   A A "O3'"  1  
ATOM 169    C "C2'"  . A A 1 6   ? 143.992 124.667 124.553 1.00 0.00 ? 6   A A "C2'"  1  
ATOM 170    O "O2'"  . A A 1 6   ? 145.275 124.314 125.048 1.00 0.00 ? 6   A A "O2'"  1  
ATOM 171    C "C1'"  . A A 1 6   ? 143.437 123.501 123.733 1.00 0.00 ? 6   A A "C1'"  1  
ATOM 172    N N9     . A A 1 6   ? 142.612 123.963 122.599 1.00 0.00 ? 6   A A N9     1  
ATOM 173    C C8     . A A 1 6   ? 141.244 123.972 122.499 1.00 0.00 ? 6   A A C8     1  
ATOM 174    N N7     . A A 1 6   ? 140.799 124.444 121.362 1.00 0.00 ? 6   A A N7     1  
ATOM 175    C C5     . A A 1 6   ? 141.954 124.767 120.661 1.00 0.00 ? 6   A A C5     1  
ATOM 176    C C6     . A A 1 6   ? 142.164 125.310 119.383 1.00 0.00 ? 6   A A C6     1  
ATOM 177    N N6     . A A 1 6   ? 141.177 125.643 118.548 1.00 0.00 ? 6   A A N6     1  
ATOM 178    N N1     . A A 1 6   ? 143.439 125.510 118.988 1.00 0.00 ? 6   A A N1     1  
ATOM 179    C C2     . A A 1 6   ? 144.430 125.177 119.826 1.00 0.00 ? 6   A A C2     1  
ATOM 180    N N3     . A A 1 6   ? 144.358 124.660 121.049 1.00 0.00 ? 6   A A N3     1  
ATOM 181    C C4     . A A 1 6   ? 143.076 124.476 121.413 1.00 0.00 ? 6   A A C4     1  
ATOM 182    H "H5'"  . A A 1 6   ? 141.187 122.063 126.689 1.00 0.00 ? 6   A A "H5'"  1  
ATOM 183    H "H5''" . A A 1 6   ? 141.331 123.419 127.519 1.00 0.00 ? 6   A A "H5''" 1  
ATOM 184    H "H4'"  . A A 1 6   ? 143.359 122.913 126.499 1.00 0.00 ? 6   A A "H4'"  1  
ATOM 185    H "H3'"  . A A 1 6   ? 142.167 125.213 125.346 1.00 0.00 ? 6   A A "H3'"  1  
ATOM 186    H "H2'"  . A A 1 6   ? 144.023 125.493 124.026 1.00 0.00 ? 6   A A "H2'"  1  
ATOM 187    H "HO2'" . A A 1 6   ? 145.907 124.279 124.301 1.00 0.00 ? 6   A A "HO2'" 1  
ATOM 188    H "H1'"  . A A 1 6   ? 144.181 122.958 123.397 1.00 0.00 ? 6   A A "H1'"  1  
ATOM 189    H H8     . A A 1 6   ? 140.652 123.655 123.216 1.00 0.00 ? 6   A A H8     1  
ATOM 190    H H61    . A A 1 6   ? 141.386 126.020 117.667 1.00 0.00 ? 6   A A H61    1  
ATOM 191    H H62    . A A 1 6   ? 140.244 125.509 118.812 1.00 0.00 ? 6   A A H62    1  
ATOM 192    H H2     . A A 1 6   ? 145.337 125.342 119.490 1.00 0.00 ? 6   A A H2     1  
ATOM 193    P P      . C A 1 7   ? 143.215 127.029 126.973 1.00 0.00 ? 7   C A P      1  
ATOM 194    O OP1    . C A 1 7   ? 143.694 127.437 128.319 1.00 0.00 ? 7   C A OP1    1  
ATOM 195    O OP2    . C A 1 7   ? 141.819 127.328 126.570 1.00 0.00 ? 7   C A OP2    1  
ATOM 196    O "O5'"  . C A 1 7   ? 144.192 127.666 125.888 1.00 0.00 ? 7   C A "O5'"  1  
ATOM 197    C "C5'"  . C A 1 7   ? 145.601 127.601 126.044 1.00 0.00 ? 7   C A "C5'"  1  
ATOM 198    C "C4'"  . C A 1 7   ? 146.322 128.161 124.844 1.00 0.00 ? 7   C A "C4'"  1  
ATOM 199    O "O4'"  . C A 1 7   ? 145.973 127.396 123.659 1.00 0.00 ? 7   C A "O4'"  1  
ATOM 200    C "C3'"  . C A 1 7   ? 145.987 129.595 124.469 1.00 0.00 ? 7   C A "C3'"  1  
ATOM 201    O "O3'"  . C A 1 7   ? 146.660 130.550 125.272 1.00 0.00 ? 7   C A "O3'"  1  
ATOM 202    C "C2'"  . C A 1 7   ? 146.376 129.654 122.996 1.00 0.00 ? 7   C A "C2'"  1  
ATOM 203    O "O2'"  . C A 1 7   ? 147.782 129.777 122.840 1.00 0.00 ? 7   C A "O2'"  1  
ATOM 204    C "C1'"  . C A 1 7   ? 145.939 128.268 122.511 1.00 0.00 ? 7   C A "C1'"  1  
ATOM 205    N N1     . C A 1 7   ? 144.590 128.287 121.894 1.00 0.00 ? 7   C A N1     1  
ATOM 206    C C2     . C A 1 7   ? 144.467 128.763 120.585 1.00 0.00 ? 7   C A C2     1  
ATOM 207    O O2     . C A 1 7   ? 145.477 129.156 119.982 1.00 0.00 ? 7   C A O2     1  
ATOM 208    N N3     . C A 1 7   ? 143.247 128.792 119.997 1.00 0.00 ? 7   C A N3     1  
ATOM 209    C C4     . C A 1 7   ? 142.175 128.365 120.666 1.00 0.00 ? 7   C A C4     1  
ATOM 210    N N4     . C A 1 7   ? 140.992 128.411 120.047 1.00 0.00 ? 7   C A N4     1  
ATOM 211    C C5     . C A 1 7   ? 142.270 127.876 121.999 1.00 0.00 ? 7   C A C5     1  
ATOM 212    C C6     . C A 1 7   ? 143.480 127.853 122.569 1.00 0.00 ? 7   C A C6     1  
ATOM 213    H "H5'"  . C A 1 7   ? 145.865 126.666 126.170 1.00 0.00 ? 7   C A "H5'"  1  
ATOM 214    H "H5''" . C A 1 7   ? 145.857 128.116 126.838 1.00 0.00 ? 7   C A "H5''" 1  
ATOM 215    H "H4'"  . C A 1 7   ? 147.289 128.090 124.994 1.00 0.00 ? 7   C A "H4'"  1  
ATOM 216    H "H3'"  . C A 1 7   ? 145.020 129.732 124.549 1.00 0.00 ? 7   C A "H3'"  1  
ATOM 217    H "H2'"  . C A 1 7   ? 145.895 130.366 122.525 1.00 0.00 ? 7   C A "H2'"  1  
ATOM 218    H "HO2'" . C A 1 7   ? 148.168 130.114 123.676 1.00 0.00 ? 7   C A "HO2'" 1  
ATOM 219    H "H1'"  . C A 1 7   ? 146.591 127.933 121.862 1.00 0.00 ? 7   C A "H1'"  1  
ATOM 220    H H41    . C A 1 7   ? 140.932 128.749 119.129 1.00 0.00 ? 7   C A H41    1  
ATOM 221    H H42    . C A 1 7   ? 140.184 128.104 120.511 1.00 0.00 ? 7   C A H42    1  
ATOM 222    H H5     . C A 1 7   ? 141.475 127.562 122.482 1.00 0.00 ? 7   C A H5     1  
ATOM 223    H H6     . C A 1 7   ? 143.565 127.520 123.485 1.00 0.00 ? 7   C A H6     1  
ATOM 224    P P      . U A 1 8   ? 146.030 132.014 125.487 1.00 0.00 ? 8   U A P      1  
ATOM 225    O OP1    . U A 1 8   ? 146.874 132.738 126.470 1.00 0.00 ? 8   U A OP1    1  
ATOM 226    O OP2    . U A 1 8   ? 144.576 131.855 125.742 1.00 0.00 ? 8   U A OP2    1  
ATOM 227    O "O5'"  . U A 1 8   ? 146.206 132.720 124.070 1.00 0.00 ? 8   U A "O5'"  1  
ATOM 228    C "C5'"  . U A 1 8   ? 147.497 133.009 123.554 1.00 0.00 ? 8   U A "C5'"  1  
ATOM 229    C "C4'"  . U A 1 8   ? 147.427 133.548 122.147 1.00 0.00 ? 8   U A "C4'"  1  
ATOM 230    O "O4'"  . U A 1 8   ? 146.836 132.558 121.265 1.00 0.00 ? 8   U A "O4'"  1  
ATOM 231    C "C3'"  . U A 1 8   ? 146.561 134.783 121.945 1.00 0.00 ? 8   U A "C3'"  1  
ATOM 232    O "O3'"  . U A 1 8   ? 147.204 135.982 122.345 1.00 0.00 ? 8   U A "O3'"  1  
ATOM 233    C "C2'"  . U A 1 8   ? 146.244 134.727 120.458 1.00 0.00 ? 8   U A "C2'"  1  
ATOM 234    O "O2'"  . U A 1 8   ? 147.342 135.178 119.680 1.00 0.00 ? 8   U A "O2'"  1  
ATOM 235    C "C1'"  . U A 1 8   ? 146.064 133.223 120.241 1.00 0.00 ? 8   U A "C1'"  1  
ATOM 236    N N1     . U A 1 8   ? 144.640 132.814 120.300 1.00 0.00 ? 8   U A N1     1  
ATOM 237    C C2     . U A 1 8   ? 143.867 133.057 119.180 1.00 0.00 ? 8   U A C2     1  
ATOM 238    O O2     . U A 1 8   ? 144.304 133.585 118.171 1.00 0.00 ? 8   U A O2     1  
ATOM 239    N N3     . U A 1 8   ? 142.557 132.659 119.279 1.00 0.00 ? 8   U A N3     1  
ATOM 240    C C4     . U A 1 8   ? 141.949 132.059 120.360 1.00 0.00 ? 8   U A C4     1  
ATOM 241    O O4     . U A 1 8   ? 140.755 131.761 120.295 1.00 0.00 ? 8   U A O4     1  
ATOM 242    C C5     . U A 1 8   ? 142.810 131.836 121.483 1.00 0.00 ? 8   U A C5     1  
ATOM 243    C C6     . U A 1 8   ? 144.092 132.212 121.413 1.00 0.00 ? 8   U A C6     1  
ATOM 244    H "H5'"  . U A 1 8   ? 148.031 132.186 123.555 1.00 0.00 ? 8   U A "H5'"  1  
ATOM 245    H "H5''" . U A 1 8   ? 147.932 133.671 124.129 1.00 0.00 ? 8   U A "H5''" 1  
ATOM 246    H "H4'"  . U A 1 8   ? 148.337 133.745 121.839 1.00 0.00 ? 8   U A "H4'"  1  
ATOM 247    H "H3'"  . U A 1 8   ? 145.730 134.679 122.454 1.00 0.00 ? 8   U A "H3'"  1  
ATOM 248    H "H2'"  . U A 1 8   ? 145.425 135.220 120.246 1.00 0.00 ? 8   U A "H2'"  1  
ATOM 249    H "HO2'" . U A 1 8   ? 147.935 135.717 120.244 1.00 0.00 ? 8   U A "HO2'" 1  
ATOM 250    H "H1'"  . U A 1 8   ? 146.437 132.973 119.370 1.00 0.00 ? 8   U A "H1'"  1  
ATOM 251    H H3     . U A 1 8   ? 141.990 132.824 118.494 1.00 0.00 ? 8   U A H3     1  
ATOM 252    H H5     . U A 1 8   ? 142.462 131.412 122.294 1.00 0.00 ? 8   U A H5     1  
ATOM 253    H H6     . U A 1 8   ? 144.659 132.051 122.193 1.00 0.00 ? 8   U A H6     1  
ATOM 254    P P      . C A 1 9   ? 146.352 137.180 122.993 1.00 0.00 ? 9   C A P      1  
ATOM 255    O OP1    . C A 1 9   ? 147.300 138.245 123.408 1.00 0.00 ? 9   C A OP1    1  
ATOM 256    O OP2    . C A 1 9   ? 145.423 136.596 123.993 1.00 0.00 ? 9   C A OP2    1  
ATOM 257    O "O5'"  . C A 1 9   ? 145.485 137.739 121.780 1.00 0.00 ? 9   C A "O5'"  1  
ATOM 258    C "C5'"  . C A 1 9   ? 146.071 138.563 120.783 1.00 0.00 ? 9   C A "C5'"  1  
ATOM 259    C "C4'"  . C A 1 9   ? 145.052 139.018 119.767 1.00 0.00 ? 9   C A "C4'"  1  
ATOM 260    O "O4'"  . C A 1 9   ? 144.525 137.834 119.114 1.00 0.00 ? 9   C A "O4'"  1  
ATOM 261    C "C3'"  . C A 1 9   ? 143.802 139.682 120.322 1.00 0.00 ? 9   C A "C3'"  1  
ATOM 262    O "O3'"  . C A 1 9   ? 144.033 141.007 120.769 1.00 0.00 ? 9   C A "O3'"  1  
ATOM 263    C "C2'"  . C A 1 9   ? 142.825 139.521 119.167 1.00 0.00 ? 9   C A "C2'"  1  
ATOM 264    O "O2'"  . C A 1 9   ? 143.072 140.478 118.147 1.00 0.00 ? 9   C A "O2'"  1  
ATOM 265    C "C1'"  . C A 1 9   ? 143.207 138.130 118.659 1.00 0.00 ? 9   C A "C1'"  1  
ATOM 266    N N1     . C A 1 9   ? 142.248 137.087 119.099 1.00 0.00 ? 9   C A N1     1  
ATOM 267    C C2     . C A 1 9   ? 141.052 136.940 118.385 1.00 0.00 ? 9   C A C2     1  
ATOM 268    O O2     . C A 1 9   ? 140.830 137.681 117.414 1.00 0.00 ? 9   C A O2     1  
ATOM 269    N N3     . C A 1 9   ? 140.160 135.996 118.765 1.00 0.00 ? 9   C A N3     1  
ATOM 270    C C4     . C A 1 9   ? 140.422 135.213 119.811 1.00 0.00 ? 9   C A C4     1  
ATOM 271    N N4     . C A 1 9   ? 139.513 134.295 120.150 1.00 0.00 ? 9   C A N4     1  
ATOM 272    C C5     . C A 1 9   ? 141.627 135.337 120.558 1.00 0.00 ? 9   C A C5     1  
ATOM 273    C C6     . C A 1 9   ? 142.502 136.274 120.172 1.00 0.00 ? 9   C A C6     1  
ATOM 274    H "H5'"  . C A 1 9   ? 146.775 138.059 120.326 1.00 0.00 ? 9   C A "H5'"  1  
ATOM 275    H "H5''" . C A 1 9   ? 146.467 139.350 121.212 1.00 0.00 ? 9   C A "H5''" 1  
ATOM 276    H "H4'"  . C A 1 9   ? 145.497 139.592 119.109 1.00 0.00 ? 9   C A "H4'"  1  
ATOM 277    H "H3'"  . C A 1 9   ? 143.480 139.172 121.094 1.00 0.00 ? 9   C A "H3'"  1  
ATOM 278    H "H2'"  . C A 1 9   ? 141.896 139.553 119.476 1.00 0.00 ? 9   C A "H2'"  1  
ATOM 279    H "HO2'" . C A 1 9   ? 142.413 140.360 117.431 1.00 0.00 ? 9   C A "HO2'" 1  
ATOM 280    H "H1'"  . C A 1 9   ? 143.248 138.145 117.680 1.00 0.00 ? 9   C A "H1'"  1  
ATOM 281    H H41    . C A 1 9   ? 138.684 134.213 119.634 1.00 0.00 ? 9   C A H41    1  
ATOM 282    H H42    . C A 1 9   ? 139.675 133.704 120.914 1.00 0.00 ? 9   C A H42    1  
ATOM 283    H H5     . C A 1 9   ? 141.811 134.757 121.326 1.00 0.00 ? 9   C A H5     1  
ATOM 284    H H6     . C A 1 9   ? 143.338 136.375 120.673 1.00 0.00 ? 9   C A H6     1  
ATOM 285    P P      . G A 1 10  ? 142.866 141.802 121.531 1.00 0.00 ? 10  G A P      1  
ATOM 286    O OP1    . G A 1 10  ? 141.835 142.216 120.545 1.00 0.00 ? 10  G A OP1    1  
ATOM 287    O OP2    . G A 1 10  ? 143.619 142.836 122.285 1.00 0.00 ? 10  G A OP2    1  
ATOM 288    O "O5'"  . G A 1 10  ? 142.173 140.830 122.587 1.00 0.00 ? 10  G A "O5'"  1  
ATOM 289    C "C5'"  . G A 1 10  ? 141.009 140.093 122.245 1.00 0.00 ? 10  G A "C5'"  1  
ATOM 290    C "C4'"  . G A 1 10  ? 140.034 140.030 123.396 1.00 0.00 ? 10  G A "C4'"  1  
ATOM 291    O "O4'"  . G A 1 10  ? 139.220 141.231 123.414 1.00 0.00 ? 10  G A "O4'"  1  
ATOM 292    C "C3'"  . G A 1 10  ? 139.023 138.895 123.355 1.00 0.00 ? 10  G A "C3'"  1  
ATOM 293    O "O3'"  . G A 1 10  ? 139.554 137.663 123.810 1.00 0.00 ? 10  G A "O3'"  1  
ATOM 294    C "C2'"  . G A 1 10  ? 137.891 139.429 124.220 1.00 0.00 ? 10  G A "C2'"  1  
ATOM 295    O "O2'"  . G A 1 10  ? 138.195 139.306 125.602 1.00 0.00 ? 10  G A "O2'"  1  
ATOM 296    C "C1'"  . G A 1 10  ? 137.888 140.911 123.842 1.00 0.00 ? 10  G A "C1'"  1  
ATOM 297    N N9     . G A 1 10  ? 136.913 141.212 122.778 1.00 0.00 ? 10  G A N9     1  
ATOM 298    C C8     . G A 1 10  ? 137.181 141.510 121.463 1.00 0.00 ? 10  G A C8     1  
ATOM 299    N N7     . G A 1 10  ? 136.105 141.731 120.758 1.00 0.00 ? 10  G A N7     1  
ATOM 300    C C5     . G A 1 10  ? 135.063 141.569 121.659 1.00 0.00 ? 10  G A C5     1  
ATOM 301    C C6     . G A 1 10  ? 133.660 141.681 121.474 1.00 0.00 ? 10  G A C6     1  
ATOM 302    O O6     . G A 1 10  ? 133.039 141.958 120.441 1.00 0.00 ? 10  G A O6     1  
ATOM 303    N N1     . G A 1 10  ? 132.966 141.436 122.656 1.00 0.00 ? 10  G A N1     1  
ATOM 304    C C2     . G A 1 10  ? 133.545 141.121 123.860 1.00 0.00 ? 10  G A C2     1  
ATOM 305    N N2     . G A 1 10  ? 132.709 140.919 124.889 1.00 0.00 ? 10  G A N2     1  
ATOM 306    N N3     . G A 1 10  ? 134.851 141.014 124.045 1.00 0.00 ? 10  G A N3     1  
ATOM 307    C C4     . G A 1 10  ? 135.544 141.248 122.910 1.00 0.00 ? 10  G A C4     1  
ATOM 308    H "H5'"  . G A 1 10  ? 141.268 139.182 121.994 1.00 0.00 ? 10  G A "H5'"  1  
ATOM 309    H "H5''" . G A 1 10  ? 140.571 140.523 121.480 1.00 0.00 ? 10  G A "H5''" 1  
ATOM 310    H "H4'"  . G A 1 10  ? 140.539 139.977 124.235 1.00 0.00 ? 10  G A "H4'"  1  
ATOM 311    H "H3'"  . G A 1 10  ? 138.701 138.787 122.434 1.00 0.00 ? 10  G A "H3'"  1  
ATOM 312    H "H2'"  . G A 1 10  ? 137.036 139.001 123.997 1.00 0.00 ? 10  G A "H2'"  1  
ATOM 313    H "HO2'" . G A 1 10  ? 138.899 138.634 125.715 1.00 0.00 ? 10  G A "HO2'" 1  
ATOM 314    H "H1'"  . G A 1 10  ? 137.684 141.449 124.634 1.00 0.00 ? 10  G A "H1'"  1  
ATOM 315    H H8     . G A 1 10  ? 138.086 141.554 121.093 1.00 0.00 ? 10  G A H8     1  
ATOM 316    H H1     . G A 1 10  ? 131.988 141.493 122.623 1.00 0.00 ? 10  G A H1     1  
ATOM 317    H H21    . G A 1 10  ? 131.742 140.996 124.760 1.00 0.00 ? 10  G A H21    1  
ATOM 318    H H22    . G A 1 10  ? 133.067 140.691 125.774 1.00 0.00 ? 10  G A H22    1  
ATOM 319    P P      . C A 1 11  ? 138.945 136.275 123.274 1.00 0.00 ? 11  C A P      1  
ATOM 320    O OP1    . C A 1 11  ? 139.749 135.167 123.849 1.00 0.00 ? 11  C A OP1    1  
ATOM 321    O OP2    . C A 1 11  ? 138.789 136.378 121.801 1.00 0.00 ? 11  C A OP2    1  
ATOM 322    O "O5'"  . C A 1 11  ? 137.490 136.216 123.921 1.00 0.00 ? 11  C A "O5'"  1  
ATOM 323    C "C5'"  . C A 1 11  ? 137.319 135.945 125.305 1.00 0.00 ? 11  C A "C5'"  1  
ATOM 324    C "C4'"  . C A 1 11  ? 135.863 135.973 125.701 1.00 0.00 ? 11  C A "C4'"  1  
ATOM 325    O "O4'"  . C A 1 11  ? 135.292 137.272 125.399 1.00 0.00 ? 11  C A "O4'"  1  
ATOM 326    C "C3'"  . C A 1 11  ? 134.951 134.993 124.976 1.00 0.00 ? 11  C A "C3'"  1  
ATOM 327    O "O3'"  . C A 1 11  ? 135.028 133.677 125.495 1.00 0.00 ? 11  C A "O3'"  1  
ATOM 328    C "C2'"  . C A 1 11  ? 133.582 135.635 125.134 1.00 0.00 ? 11  C A "C2'"  1  
ATOM 329    O "O2'"  . C A 1 11  ? 133.053 135.410 126.433 1.00 0.00 ? 11  C A "O2'"  1  
ATOM 330    C "C1'"  . C A 1 11  ? 133.920 137.119 124.985 1.00 0.00 ? 11  C A "C1'"  1  
ATOM 331    N N1     . C A 1 11  ? 133.719 137.607 123.599 1.00 0.00 ? 11  C A N1     1  
ATOM 332    C C2     . C A 1 11  ? 132.412 137.874 123.170 1.00 0.00 ? 11  C A C2     1  
ATOM 333    O O2     . C A 1 11  ? 131.469 137.695 123.956 1.00 0.00 ? 11  C A O2     1  
ATOM 334    N N3     . C A 1 11  ? 132.201 138.320 121.912 1.00 0.00 ? 11  C A N3     1  
ATOM 335    C C4     . C A 1 11  ? 133.231 138.503 121.086 1.00 0.00 ? 11  C A C4     1  
ATOM 336    N N4     . C A 1 11  ? 132.975 138.945 119.852 1.00 0.00 ? 11  C A N4     1  
ATOM 337    C C5     . C A 1 11  ? 134.571 138.240 121.490 1.00 0.00 ? 11  C A C5     1  
ATOM 338    C C6     . C A 1 11  ? 134.767 137.800 122.740 1.00 0.00 ? 11  C A C6     1  
ATOM 339    H "H5'"  . C A 1 11  ? 137.805 136.620 125.824 1.00 0.00 ? 11  C A "H5'"  1  
ATOM 340    H "H5''" . C A 1 11  ? 137.689 135.061 125.505 1.00 0.00 ? 11  C A "H5''" 1  
ATOM 341    H "H4'"  . C A 1 11  ? 135.796 135.814 126.667 1.00 0.00 ? 11  C A "H4'"  1  
ATOM 342    H "H3'"  . C A 1 11  ? 135.191 134.978 124.024 1.00 0.00 ? 11  C A "H3'"  1  
ATOM 343    H "H2'"  . C A 1 11  ? 132.961 135.336 124.435 1.00 0.00 ? 11  C A "H2'"  1  
ATOM 344    H "HO2'" . C A 1 11  ? 133.197 136.213 126.978 1.00 0.00 ? 11  C A "HO2'" 1  
ATOM 345    H "H1'"  . C A 1 11  ? 133.362 137.643 125.598 1.00 0.00 ? 11  C A "H1'"  1  
ATOM 346    H H41    . C A 1 11  ? 132.053 139.123 119.577 1.00 0.00 ? 11  C A H41    1  
ATOM 347    H H42    . C A 1 11  ? 133.712 139.089 119.222 1.00 0.00 ? 11  C A H42    1  
ATOM 348    H H5     . C A 1 11  ? 135.323 138.379 120.877 1.00 0.00 ? 11  C A H5     1  
ATOM 349    H H6     . C A 1 11  ? 135.682 137.615 123.035 1.00 0.00 ? 11  C A H6     1  
ATOM 350    P P      . A A 1 12  ? 134.301 132.463 124.732 1.00 0.00 ? 12  A A P      1  
ATOM 351    O OP1    . A A 1 12  ? 134.814 131.190 125.297 1.00 0.00 ? 12  A A OP1    1  
ATOM 352    O OP2    . A A 1 12  ? 134.402 132.712 123.272 1.00 0.00 ? 12  A A OP2    1  
ATOM 353    O "O5'"  . A A 1 12  ? 132.770 132.607 125.151 1.00 0.00 ? 12  A A "O5'"  1  
ATOM 354    C "C5'"  . A A 1 12  ? 132.015 131.475 125.554 1.00 0.00 ? 12  A A "C5'"  1  
ATOM 355    C "C4'"  . A A 1 12  ? 131.192 131.767 126.784 1.00 0.00 ? 12  A A "C4'"  1  
ATOM 356    O "O4'"  . A A 1 12  ? 132.045 131.767 127.964 1.00 0.00 ? 12  A A "O4'"  1  
ATOM 357    C "C3'"  . A A 1 12  ? 130.514 133.128 126.825 1.00 0.00 ? 12  A A "C3'"  1  
ATOM 358    O "O3'"  . A A 1 12  ? 129.342 133.188 126.031 1.00 0.00 ? 12  A A "O3'"  1  
ATOM 359    C "C2'"  . A A 1 12  ? 130.293 133.338 128.318 1.00 0.00 ? 12  A A "C2'"  1  
ATOM 360    O "O2'"  . A A 1 12  ? 129.181 132.586 128.784 1.00 0.00 ? 12  A A "O2'"  1  
ATOM 361    C "C1'"  . A A 1 12  ? 131.582 132.737 128.876 1.00 0.00 ? 12  A A "C1'"  1  
ATOM 362    N N9     . A A 1 12  ? 132.629 133.757 129.076 1.00 0.00 ? 12  A A N9     1  
ATOM 363    C C8     . A A 1 12  ? 133.922 133.741 128.615 1.00 0.00 ? 12  A A C8     1  
ATOM 364    N N7     . A A 1 12  ? 134.619 134.796 128.957 1.00 0.00 ? 12  A A N7     1  
ATOM 365    C C5     . A A 1 12  ? 133.725 135.561 129.694 1.00 0.00 ? 12  A A C5     1  
ATOM 366    C C6     . A A 1 12  ? 133.849 136.803 130.341 1.00 0.00 ? 12  A A C6     1  
ATOM 367    N N6     . A A 1 12  ? 134.972 137.525 130.349 1.00 0.00 ? 12  A A N6     1  
ATOM 368    N N1     . A A 1 12  ? 132.767 137.286 130.988 1.00 0.00 ? 12  A A N1     1  
ATOM 369    C C2     . A A 1 12  ? 131.639 136.563 130.981 1.00 0.00 ? 12  A A C2     1  
ATOM 370    N N3     . A A 1 12  ? 131.400 135.385 130.410 1.00 0.00 ? 12  A A N3     1  
ATOM 371    C C4     . A A 1 12  ? 132.496 134.933 129.775 1.00 0.00 ? 12  A A C4     1  
ATOM 372    H "H5'"  . A A 1 12  ? 132.627 130.734 125.748 1.00 0.00 ? 12  A A "H5'"  1  
ATOM 373    H "H5''" . A A 1 12  ? 131.417 131.211 124.824 1.00 0.00 ? 12  A A "H5''" 1  
ATOM 374    H "H4'"  . A A 1 12  ? 130.512 131.068 126.884 1.00 0.00 ? 12  A A "H4'"  1  
ATOM 375    H "H3'"  . A A 1 12  ? 131.138 133.808 126.494 1.00 0.00 ? 12  A A "H3'"  1  
ATOM 376    H "H2'"  . A A 1 12  ? 130.207 134.289 128.538 1.00 0.00 ? 12  A A "H2'"  1  
ATOM 377    H "HO2'" . A A 1 12  ? 129.065 132.751 129.743 1.00 0.00 ? 12  A A "HO2'" 1  
ATOM 378    H "H1'"  . A A 1 12  ? 131.392 132.293 129.730 1.00 0.00 ? 12  A A "H1'"  1  
ATOM 379    H H8     . A A 1 12  ? 134.291 133.007 128.079 1.00 0.00 ? 12  A A H8     1  
ATOM 380    H H61    . A A 1 12  ? 134.999 138.385 130.818 1.00 0.00 ? 12  A A H61    1  
ATOM 381    H H62    . A A 1 12  ? 135.771 137.194 129.886 1.00 0.00 ? 12  A A H62    1  
ATOM 382    H H2     . A A 1 12  ? 130.883 136.958 131.464 1.00 0.00 ? 12  A A H2     1  
ATOM 383    P P      . G A 1 13  ? 128.403 131.896 125.903 1.00 0.00 ? 13  G A P      1  
ATOM 384    O OP1    . G A 1 13  ? 127.134 132.281 125.234 1.00 0.00 ? 13  G A OP1    1  
ATOM 385    O OP2    . G A 1 13  ? 128.372 131.379 127.294 1.00 0.00 ? 13  G A OP2    1  
ATOM 386    O "O5'"  . G A 1 13  ? 129.131 130.811 124.990 1.00 0.00 ? 13  G A "O5'"  1  
ATOM 387    C "C5'"  . G A 1 13  ? 128.442 129.654 124.542 1.00 0.00 ? 13  G A "C5'"  1  
ATOM 388    C "C4'"  . G A 1 13  ? 127.380 130.000 123.527 1.00 0.00 ? 13  G A "C4'"  1  
ATOM 389    O "O4'"  . G A 1 13  ? 126.980 131.383 123.697 1.00 0.00 ? 13  G A "O4'"  1  
ATOM 390    C "C3'"  . G A 1 13  ? 127.798 129.910 122.067 1.00 0.00 ? 13  G A "C3'"  1  
ATOM 391    O "O3'"  . G A 1 13  ? 127.667 128.604 121.533 1.00 0.00 ? 13  G A "O3'"  1  
ATOM 392    C "C2'"  . G A 1 13  ? 126.879 130.915 121.387 1.00 0.00 ? 13  G A "C2'"  1  
ATOM 393    O "O2'"  . G A 1 13  ? 125.581 130.374 121.191 1.00 0.00 ? 13  G A "O2'"  1  
ATOM 394    C "C1'"  . G A 1 13  ? 126.800 132.021 122.438 1.00 0.00 ? 13  G A "C1'"  1  
ATOM 395    N N9     . G A 1 13  ? 127.867 133.026 122.268 1.00 0.00 ? 13  G A N9     1  
ATOM 396    C C8     . G A 1 13  ? 129.013 133.156 123.014 1.00 0.00 ? 13  G A C8     1  
ATOM 397    N N7     . G A 1 13  ? 129.770 134.146 122.625 1.00 0.00 ? 13  G A N7     1  
ATOM 398    C C5     . G A 1 13  ? 129.082 134.703 121.556 1.00 0.00 ? 13  G A C5     1  
ATOM 399    C C6     . G A 1 13  ? 129.411 135.807 120.726 1.00 0.00 ? 13  G A C6     1  
ATOM 400    O O6     . G A 1 13  ? 130.408 136.536 120.774 1.00 0.00 ? 13  G A O6     1  
ATOM 401    N N1     . G A 1 13  ? 128.433 136.032 119.762 1.00 0.00 ? 13  G A N1     1  
ATOM 402    C C2     . G A 1 13  ? 127.287 135.290 119.613 1.00 0.00 ? 13  G A C2     1  
ATOM 403    N N2     . G A 1 13  ? 126.462 135.660 118.622 1.00 0.00 ? 13  G A N2     1  
ATOM 404    N N3     . G A 1 13  ? 126.969 134.259 120.380 1.00 0.00 ? 13  G A N3     1  
ATOM 405    C C4     . G A 1 13  ? 127.906 134.024 121.323 1.00 0.00 ? 13  G A C4     1  
ATOM 406    H "H5'"  . G A 1 13  ? 128.019 129.216 125.309 1.00 0.00 ? 13  G A "H5'"  1  
ATOM 407    H "H5''" . G A 1 13  ? 129.085 129.036 124.135 1.00 0.00 ? 13  G A "H5''" 1  
ATOM 408    H "H4'"  . G A 1 13  ? 126.600 129.425 123.670 1.00 0.00 ? 13  G A "H4'"  1  
ATOM 409    H "H3'"  . G A 1 13  ? 128.729 130.201 121.977 1.00 0.00 ? 13  G A "H3'"  1  
ATOM 410    H "H2'"  . G A 1 13  ? 127.266 131.245 120.549 1.00 0.00 ? 13  G A "H2'"  1  
ATOM 411    H "HO2'" . G A 1 13  ? 125.018 131.046 120.752 1.00 0.00 ? 13  G A "HO2'" 1  
ATOM 412    H "H1'"  . G A 1 13  ? 125.926 132.460 122.384 1.00 0.00 ? 13  G A "H1'"  1  
ATOM 413    H H8     . G A 1 13  ? 129.240 132.567 123.764 1.00 0.00 ? 13  G A H8     1  
ATOM 414    H H1     . G A 1 13  ? 128.576 136.777 119.142 1.00 0.00 ? 13  G A H1     1  
ATOM 415    H H21    . G A 1 13  ? 126.690 136.423 118.051 1.00 0.00 ? 13  G A H21    1  
ATOM 416    H H22    . G A 1 13  ? 125.628 135.168 118.469 1.00 0.00 ? 13  G A H22    1  
ATOM 417    P P      . G A 1 14  ? 128.808 128.004 120.574 1.00 0.00 ? 14  G A P      1  
ATOM 418    O OP1    . G A 1 14  ? 128.278 126.769 119.943 1.00 0.00 ? 14  G A OP1    1  
ATOM 419    O OP2    . G A 1 14  ? 130.075 127.949 121.347 1.00 0.00 ? 14  G A OP2    1  
ATOM 420    O "O5'"  . G A 1 14  ? 128.973 129.107 119.435 1.00 0.00 ? 14  G A "O5'"  1  
ATOM 421    C "C5'"  . G A 1 14  ? 127.946 129.328 118.480 1.00 0.00 ? 14  G A "C5'"  1  
ATOM 422    C "C4'"  . G A 1 14  ? 128.186 130.589 117.689 1.00 0.00 ? 14  G A "C4'"  1  
ATOM 423    O "O4'"  . G A 1 14  ? 128.302 131.700 118.619 1.00 0.00 ? 14  G A "O4'"  1  
ATOM 424    C "C3'"  . G A 1 14  ? 129.490 130.649 116.907 1.00 0.00 ? 14  G A "C3'"  1  
ATOM 425    O "O3'"  . G A 1 14  ? 129.404 130.021 115.640 1.00 0.00 ? 14  G A "O3'"  1  
ATOM 426    C "C2'"  . G A 1 14  ? 129.657 132.147 116.733 1.00 0.00 ? 14  G A "C2'"  1  
ATOM 427    O "O2'"  . G A 1 14  ? 128.769 132.653 115.747 1.00 0.00 ? 14  G A "O2'"  1  
ATOM 428    C "C1'"  . G A 1 14  ? 129.219 132.633 118.110 1.00 0.00 ? 14  G A "C1'"  1  
ATOM 429    N N9     . G A 1 14  ? 130.357 132.776 119.037 1.00 0.00 ? 14  G A N9     1  
ATOM 430    C C8     . G A 1 14  ? 130.723 131.916 120.044 1.00 0.00 ? 14  G A C8     1  
ATOM 431    N N7     . G A 1 14  ? 131.779 132.312 120.700 1.00 0.00 ? 14  G A N7     1  
ATOM 432    C C5     . G A 1 14  ? 132.134 133.507 120.089 1.00 0.00 ? 14  G A C5     1  
ATOM 433    C C6     . G A 1 14  ? 133.202 134.399 120.365 1.00 0.00 ? 14  G A C6     1  
ATOM 434    O O6     . G A 1 14  ? 134.076 134.309 121.235 1.00 0.00 ? 14  G A O6     1  
ATOM 435    N N1     . G A 1 14  ? 133.193 135.492 119.504 1.00 0.00 ? 14  G A N1     1  
ATOM 436    C C2     . G A 1 14  ? 132.275 135.700 118.503 1.00 0.00 ? 14  G A C2     1  
ATOM 437    N N2     . G A 1 14  ? 132.431 136.814 117.774 1.00 0.00 ? 14  G A N2     1  
ATOM 438    N N3     . G A 1 14  ? 131.275 134.875 118.235 1.00 0.00 ? 14  G A N3     1  
ATOM 439    C C4     . G A 1 14  ? 131.266 133.808 119.060 1.00 0.00 ? 14  G A C4     1  
ATOM 440    H "H5'"  . G A 1 14  ? 127.087 129.400 118.945 1.00 0.00 ? 14  G A "H5'"  1  
ATOM 441    H "H5''" . G A 1 14  ? 127.912 128.565 117.865 1.00 0.00 ? 14  G A "H5''" 1  
ATOM 442    H "H4'"  . G A 1 14  ? 127.440 130.758 117.076 1.00 0.00 ? 14  G A "H4'"  1  
ATOM 443    H "H3'"  . G A 1 14  ? 130.243 130.267 117.404 1.00 0.00 ? 14  G A "H3'"  1  
ATOM 444    H "H2'"  . G A 1 14  ? 130.588 132.385 116.539 1.00 0.00 ? 14  G A "H2'"  1  
ATOM 445    H "HO2'" . G A 1 14  ? 128.913 133.618 115.652 1.00 0.00 ? 14  G A "HO2'" 1  
ATOM 446    H "H1'"  . G A 1 14  ? 128.759 133.494 118.021 1.00 0.00 ? 14  G A "H1'"  1  
ATOM 447    H H8     . G A 1 14  ? 130.240 131.088 120.250 1.00 0.00 ? 14  G A H8     1  
ATOM 448    H H1     . G A 1 14  ? 133.897 136.164 119.621 1.00 0.00 ? 14  G A H1     1  
ATOM 449    H H21    . G A 1 14  ? 133.169 137.430 117.966 1.00 0.00 ? 14  G A H21    1  
ATOM 450    H H22    . G A 1 14  ? 131.806 137.015 117.046 1.00 0.00 ? 14  G A H22    1  
ATOM 451    P P      . A A 1 15  ? 130.731 129.464 114.923 1.00 0.00 ? 15  A A P      1  
ATOM 452    O OP1    . A A 1 15  ? 130.325 128.785 113.667 1.00 0.00 ? 15  A A OP1    1  
ATOM 453    O OP2    . A A 1 15  ? 131.523 128.722 115.935 1.00 0.00 ? 15  A A OP2    1  
ATOM 454    O "O5'"  . A A 1 15  ? 131.539 130.781 114.533 1.00 0.00 ? 15  A A "O5'"  1  
ATOM 455    C "C5'"  . A A 1 15  ? 130.989 131.736 113.639 1.00 0.00 ? 15  A A "C5'"  1  
ATOM 456    C "C4'"  . A A 1 15  ? 131.772 133.025 113.653 1.00 0.00 ? 15  A A "C4'"  1  
ATOM 457    O "O4'"  . A A 1 15  ? 131.810 133.572 114.999 1.00 0.00 ? 15  A A "O4'"  1  
ATOM 458    C "C3'"  . A A 1 15  ? 133.241 132.916 113.273 1.00 0.00 ? 15  A A "C3'"  1  
ATOM 459    O "O3'"  . A A 1 15  ? 133.452 132.897 111.872 1.00 0.00 ? 15  A A "O3'"  1  
ATOM 460    C "C2'"  . A A 1 15  ? 133.785 134.197 113.885 1.00 0.00 ? 15  A A "C2'"  1  
ATOM 461    O "O2'"  . A A 1 15  ? 133.430 135.331 113.105 1.00 0.00 ? 15  A A "O2'"  1  
ATOM 462    C "C1'"  . A A 1 15  ? 133.017 134.236 115.206 1.00 0.00 ? 15  A A "C1'"  1  
ATOM 463    N N9     . A A 1 15  ? 133.739 133.541 116.288 1.00 0.00 ? 15  A A N9     1  
ATOM 464    C C8     . A A 1 15  ? 133.526 132.272 116.767 1.00 0.00 ? 15  A A C8     1  
ATOM 465    N N7     . A A 1 15  ? 134.333 131.932 117.741 1.00 0.00 ? 15  A A N7     1  
ATOM 466    C C5     . A A 1 15  ? 135.133 133.053 117.917 1.00 0.00 ? 15  A A C5     1  
ATOM 467    C C6     . A A 1 15  ? 136.190 133.332 118.802 1.00 0.00 ? 15  A A C6     1  
ATOM 468    N N6     . A A 1 15  ? 136.642 132.467 119.712 1.00 0.00 ? 15  A A N6     1  
ATOM 469    N N1     . A A 1 15  ? 136.776 134.546 118.717 1.00 0.00 ? 15  A A N1     1  
ATOM 470    C C2     . A A 1 15  ? 136.323 135.415 117.803 1.00 0.00 ? 15  A A C2     1  
ATOM 471    N N3     . A A 1 15  ? 135.339 135.268 116.919 1.00 0.00 ? 15  A A N3     1  
ATOM 472    C C4     . A A 1 15  ? 134.779 134.051 117.029 1.00 0.00 ? 15  A A C4     1  
ATOM 473    H "H5'"  . A A 1 15  ? 130.063 131.923 113.900 1.00 0.00 ? 15  A A "H5'"  1  
ATOM 474    H "H5''" . A A 1 15  ? 130.996 131.367 112.731 1.00 0.00 ? 15  A A "H5''" 1  
ATOM 475    H "H4'"  . A A 1 15  ? 131.337 133.668 113.055 1.00 0.00 ? 15  A A "H4'"  1  
ATOM 476    H "H3'"  . A A 1 15  ? 133.675 132.133 113.673 1.00 0.00 ? 15  A A "H3'"  1  
ATOM 477    H "H2'"  . A A 1 15  ? 134.753 134.144 114.029 1.00 0.00 ? 15  A A "H2'"  1  
ATOM 478    H "HO2'" . A A 1 15  ? 133.204 135.036 112.199 1.00 0.00 ? 15  A A "HO2'" 1  
ATOM 479    H "H1'"  . A A 1 15  ? 132.859 135.168 115.464 1.00 0.00 ? 15  A A "H1'"  1  
ATOM 480    H H8     . A A 1 15  ? 132.834 131.675 116.413 1.00 0.00 ? 15  A A H8     1  
ATOM 481    H H61    . A A 1 15  ? 137.384 132.719 120.302 1.00 0.00 ? 15  A A H61    1  
ATOM 482    H H62    . A A 1 15  ? 136.233 131.581 119.792 1.00 0.00 ? 15  A A H62    1  
ATOM 483    H H2     . A A 1 15  ? 136.782 136.281 117.782 1.00 0.00 ? 15  A A H2     1  
ATOM 484    P P      . A A 1 16  ? 134.421 131.796 111.215 1.00 0.00 ? 16  A A P      1  
ATOM 485    O OP1    . A A 1 16  ? 134.010 131.605 109.802 1.00 0.00 ? 16  A A OP1    1  
ATOM 486    O OP2    . A A 1 16  ? 134.474 130.627 112.129 1.00 0.00 ? 16  A A OP2    1  
ATOM 487    O "O5'"  . A A 1 16  ? 135.855 132.492 111.222 1.00 0.00 ? 16  A A "O5'"  1  
ATOM 488    C "C5'"  . A A 1 16  ? 136.139 133.586 110.363 1.00 0.00 ? 16  A A "C5'"  1  
ATOM 489    C "C4'"  . A A 1 16  ? 137.555 134.075 110.541 1.00 0.00 ? 16  A A "C4'"  1  
ATOM 490    O "O4'"  . A A 1 16  ? 137.656 134.862 111.756 1.00 0.00 ? 16  A A "O4'"  1  
ATOM 491    C "C3'"  . A A 1 16  ? 138.616 132.998 110.706 1.00 0.00 ? 16  A A "C3'"  1  
ATOM 492    O "O3'"  . A A 1 16  ? 139.041 132.444 109.473 1.00 0.00 ? 16  A A "O3'"  1  
ATOM 493    C "C2'"  . A A 1 16  ? 139.717 133.731 111.460 1.00 0.00 ? 16  A A "C2'"  1  
ATOM 494    O "O2'"  . A A 1 16  ? 140.473 134.562 110.588 1.00 0.00 ? 16  A A "O2'"  1  
ATOM 495    C "C1'"  . A A 1 16  ? 138.904 134.614 112.405 1.00 0.00 ? 16  A A "C1'"  1  
ATOM 496    N N9     . A A 1 16  ? 138.672 133.962 113.710 1.00 0.00 ? 16  A A N9     1  
ATOM 497    C C8     . A A 1 16  ? 137.518 133.369 114.162 1.00 0.00 ? 16  A A C8     1  
ATOM 498    N N7     . A A 1 16  ? 137.618 132.873 115.370 1.00 0.00 ? 16  A A N7     1  
ATOM 499    C C5     . A A 1 16  ? 138.927 133.159 115.740 1.00 0.00 ? 16  A A C5     1  
ATOM 500    C C6     . A A 1 16  ? 139.659 132.896 116.913 1.00 0.00 ? 16  A A C6     1  
ATOM 501    N N6     . A A 1 16  ? 139.157 132.258 117.973 1.00 0.00 ? 16  A A N6     1  
ATOM 502    N N1     . A A 1 16  ? 140.942 133.316 116.958 1.00 0.00 ? 16  A A N1     1  
ATOM 503    C C2     . A A 1 16  ? 141.447 133.955 115.896 1.00 0.00 ? 16  A A C2     1  
ATOM 504    N N3     . A A 1 16  ? 140.859 134.259 114.741 1.00 0.00 ? 16  A A N3     1  
ATOM 505    C C4     . A A 1 16  ? 139.585 133.828 114.727 1.00 0.00 ? 16  A A C4     1  
ATOM 506    H "H5'"  . A A 1 16  ? 135.520 134.319 110.563 1.00 0.00 ? 16  A A "H5'"  1  
ATOM 507    H "H5''" . A A 1 16  ? 136.012 133.304 109.434 1.00 0.00 ? 16  A A "H5''" 1  
ATOM 508    H "H4'"  . A A 1 16  ? 137.793 134.639 109.776 1.00 0.00 ? 16  A A "H4'"  1  
ATOM 509    H "H3'"  . A A 1 16  ? 138.261 132.282 111.273 1.00 0.00 ? 16  A A "H3'"  1  
ATOM 510    H "H2'"  . A A 1 16  ? 140.291 133.105 111.953 1.00 0.00 ? 16  A A "H2'"  1  
ATOM 511    H "HO2'" . A A 1 16  ? 140.345 134.256 109.668 1.00 0.00 ? 16  A A "HO2'" 1  
ATOM 512    H "H1'"  . A A 1 16  ? 139.375 135.462 112.546 1.00 0.00 ? 16  A A "H1'"  1  
ATOM 513    H H8     . A A 1 16  ? 136.696 133.321 113.631 1.00 0.00 ? 16  A A H8     1  
ATOM 514    H H61    . A A 1 16  ? 139.716 132.104 118.763 1.00 0.00 ? 16  A A H61    1  
ATOM 515    H H62    . A A 1 16  ? 138.228 131.945 117.960 1.00 0.00 ? 16  A A H62    1  
ATOM 516    H H2     . A A 1 16  ? 142.382 134.237 115.979 1.00 0.00 ? 16  A A H2     1  
ATOM 517    P P      . G A 1 17  ? 139.550 130.920 109.402 1.00 0.00 ? 17  G A P      1  
ATOM 518    O OP1    . G A 1 17  ? 139.708 130.555 107.972 1.00 0.00 ? 17  G A OP1    1  
ATOM 519    O OP2    . G A 1 17  ? 138.672 130.104 110.277 1.00 0.00 ? 17  G A OP2    1  
ATOM 520    O "O5'"  . G A 1 17  ? 140.999 130.968 110.062 1.00 0.00 ? 17  G A "O5'"  1  
ATOM 521    C "C5'"  . G A 1 17  ? 142.069 131.649 109.425 1.00 0.00 ? 17  G A "C5'"  1  
ATOM 522    C "C4'"  . G A 1 17  ? 143.297 131.698 110.301 1.00 0.00 ? 17  G A "C4'"  1  
ATOM 523    O "O4'"  . G A 1 17  ? 142.993 132.404 111.532 1.00 0.00 ? 17  G A "O4'"  1  
ATOM 524    C "C3'"  . G A 1 17  ? 143.836 130.353 110.769 1.00 0.00 ? 17  G A "C3'"  1  
ATOM 525    O "O3'"  . G A 1 17  ? 144.638 129.710 109.793 1.00 0.00 ? 17  G A "O3'"  1  
ATOM 526    C "C2'"  . G A 1 17  ? 144.596 130.726 112.034 1.00 0.00 ? 17  G A "C2'"  1  
ATOM 527    O "O2'"  . G A 1 17  ? 145.857 131.305 111.729 1.00 0.00 ? 17  G A "O2'"  1  
ATOM 528    C "C1'"  . G A 1 17  ? 143.685 131.799 112.633 1.00 0.00 ? 17  G A "C1'"  1  
ATOM 529    N N9     . G A 1 17  ? 142.731 131.242 113.607 1.00 0.00 ? 17  G A N9     1  
ATOM 530    C C8     . G A 1 17  ? 141.379 131.061 113.439 1.00 0.00 ? 17  G A C8     1  
ATOM 531    N N7     . G A 1 17  ? 140.794 130.542 114.484 1.00 0.00 ? 17  G A N7     1  
ATOM 532    C C5     . G A 1 17  ? 141.823 130.373 115.401 1.00 0.00 ? 17  G A C5     1  
ATOM 533    C C6     . G A 1 17  ? 141.802 129.848 116.720 1.00 0.00 ? 17  G A C6     1  
ATOM 534    O O6     . G A 1 17  ? 140.835 129.420 117.361 1.00 0.00 ? 17  G A O6     1  
ATOM 535    N N1     . G A 1 17  ? 143.067 129.856 117.296 1.00 0.00 ? 17  G A N1     1  
ATOM 536    C C2     . G A 1 17  ? 144.211 130.307 116.680 1.00 0.00 ? 17  G A C2     1  
ATOM 537    N N2     . G A 1 17  ? 145.341 130.231 117.398 1.00 0.00 ? 17  G A N2     1  
ATOM 538    N N3     . G A 1 17  ? 144.244 130.795 115.452 1.00 0.00 ? 17  G A N3     1  
ATOM 539    C C4     . G A 1 17  ? 143.024 130.797 114.877 1.00 0.00 ? 17  G A C4     1  
ATOM 540    H "H5'"  . G A 1 17  ? 141.788 132.562 109.217 1.00 0.00 ? 17  G A "H5'"  1  
ATOM 541    H "H5''" . G A 1 17  ? 142.291 131.186 108.588 1.00 0.00 ? 17  G A "H5''" 1  
ATOM 542    H "H4'"  . G A 1 17  ? 144.008 132.177 109.824 1.00 0.00 ? 17  G A "H4'"  1  
ATOM 543    H "H3'"  . G A 1 17  ? 143.085 129.769 111.005 1.00 0.00 ? 17  G A "H3'"  1  
ATOM 544    H "H2'"  . G A 1 17  ? 144.685 129.957 112.639 1.00 0.00 ? 17  G A "H2'"  1  
ATOM 545    H "HO2'" . G A 1 17  ? 146.331 131.491 112.566 1.00 0.00 ? 17  G A "HO2'" 1  
ATOM 546    H "H1'"  . G A 1 17  ? 144.233 132.485 113.068 1.00 0.00 ? 17  G A "H1'"  1  
ATOM 547    H H8     . G A 1 17  ? 140.901 131.295 112.615 1.00 0.00 ? 17  G A H8     1  
ATOM 548    H H1     . G A 1 17  ? 143.150 129.512 118.210 1.00 0.00 ? 17  G A H1     1  
ATOM 549    H H21    . G A 1 17  ? 145.325 129.872 118.309 1.00 0.00 ? 17  G A H21    1  
ATOM 550    H H22    . G A 1 17  ? 146.188 130.540 117.010 1.00 0.00 ? 17  G A H22    1  
ATOM 551    P P      . U A 1 18  ? 144.709 128.106 109.740 1.00 0.00 ? 18  U A P      1  
ATOM 552    O OP1    . U A 1 18  ? 145.392 127.717 108.480 1.00 0.00 ? 18  U A OP1    1  
ATOM 553    O OP2    . U A 1 18  ? 143.353 127.576 110.031 1.00 0.00 ? 18  U A OP2    1  
ATOM 554    O "O5'"  . U A 1 18  ? 145.661 127.721 110.955 1.00 0.00 ? 18  U A "O5'"  1  
ATOM 555    C "C5'"  . U A 1 18  ? 147.037 128.065 110.944 1.00 0.00 ? 18  U A "C5'"  1  
ATOM 556    C "C4'"  . U A 1 18  ? 147.726 127.669 112.226 1.00 0.00 ? 18  U A "C4'"  1  
ATOM 557    O "O4'"  . U A 1 18  ? 147.146 128.393 113.343 1.00 0.00 ? 18  U A "O4'"  1  
ATOM 558    C "C3'"  . U A 1 18  ? 147.601 126.207 112.628 1.00 0.00 ? 18  U A "C3'"  1  
ATOM 559    O "O3'"  . U A 1 18  ? 148.535 125.369 111.969 1.00 0.00 ? 18  U A "O3'"  1  
ATOM 560    C "C2'"  . U A 1 18  ? 147.786 126.260 114.138 1.00 0.00 ? 18  U A "C2'"  1  
ATOM 561    O "O2'"  . U A 1 18  ? 149.158 126.398 114.483 1.00 0.00 ? 18  U A "O2'"  1  
ATOM 562    C "C1'"  . U A 1 18  ? 147.053 127.556 114.490 1.00 0.00 ? 18  U A "C1'"  1  
ATOM 563    N N1     . U A 1 18  ? 145.631 127.320 114.837 1.00 0.00 ? 18  U A N1     1  
ATOM 564    C C2     . U A 1 18  ? 145.362 126.839 116.105 1.00 0.00 ? 18  U A C2     1  
ATOM 565    O O2     . U A 1 18  ? 146.233 126.606 116.927 1.00 0.00 ? 18  U A O2     1  
ATOM 566    N N3     . U A 1 18  ? 144.033 126.637 116.381 1.00 0.00 ? 18  U A N3     1  
ATOM 567    C C4     . U A 1 18  ? 142.964 126.862 115.540 1.00 0.00 ? 18  U A C4     1  
ATOM 568    O O4     . U A 1 18  ? 141.822 126.629 115.938 1.00 0.00 ? 18  U A O4     1  
ATOM 569    C C5     . U A 1 18  ? 143.316 127.362 114.245 1.00 0.00 ? 18  U A C5     1  
ATOM 570    C C6     . U A 1 18  ? 144.604 127.568 113.948 1.00 0.00 ? 18  U A C6     1  
ATOM 571    H "H5'"  . U A 1 18  ? 147.122 129.035 110.824 1.00 0.00 ? 18  U A "H5'"  1  
ATOM 572    H "H5''" . U A 1 18  ? 147.475 127.611 110.192 1.00 0.00 ? 18  U A "H5''" 1  
ATOM 573    H "H4'"  . U A 1 18  ? 148.675 127.898 112.158 1.00 0.00 ? 18  U A "H4'"  1  
ATOM 574    H "H3'"  . U A 1 18  ? 146.693 125.894 112.427 1.00 0.00 ? 18  U A "H3'"  1  
ATOM 575    H "H2'"  . U A 1 18  ? 147.376 125.487 114.579 1.00 0.00 ? 18  U A "H2'"  1  
ATOM 576    H "HO2'" . U A 1 18  ? 149.243 126.390 115.459 1.00 0.00 ? 18  U A "HO2'" 1  
ATOM 577    H "H1'"  . U A 1 18  ? 147.504 127.989 115.246 1.00 0.00 ? 18  U A "H1'"  1  
ATOM 578    H H3     . U A 1 18  ? 143.821 126.295 117.274 1.00 0.00 ? 18  U A H3     1  
ATOM 579    H H5     . U A 1 18  ? 142.620 127.549 113.582 1.00 0.00 ? 18  U A H5     1  
ATOM 580    H H6     . U A 1 18  ? 144.819 127.909 113.057 1.00 0.00 ? 18  U A H6     1  
ATOM 581    P P      . C A 1 19  ? 148.175 123.832 111.670 1.00 0.00 ? 19  C A P      1  
ATOM 582    O OP1    . C A 1 19  ? 149.234 123.275 110.792 1.00 0.00 ? 19  C A OP1    1  
ATOM 583    O OP2    . C A 1 19  ? 146.755 123.765 111.244 1.00 0.00 ? 19  C A OP2    1  
ATOM 584    O "O5'"  . C A 1 19  ? 148.296 123.125 113.094 1.00 0.00 ? 19  C A "O5'"  1  
ATOM 585    C "C5'"  . C A 1 19  ? 149.553 122.989 113.737 1.00 0.00 ? 19  C A "C5'"  1  
ATOM 586    C "C4'"  . C A 1 19  ? 149.410 122.425 115.129 1.00 0.00 ? 19  C A "C4'"  1  
ATOM 587    O "O4'"  . C A 1 19  ? 148.614 123.323 115.946 1.00 0.00 ? 19  C A "O4'"  1  
ATOM 588    C "C3'"  . C A 1 19  ? 148.688 121.090 115.240 1.00 0.00 ? 19  C A "C3'"  1  
ATOM 589    O "O3'"  . C A 1 19  ? 149.525 119.982 114.957 1.00 0.00 ? 19  C A "O3'"  1  
ATOM 590    C "C2'"  . C A 1 19  ? 148.168 121.110 116.671 1.00 0.00 ? 19  C A "C2'"  1  
ATOM 591    O "O2'"  . C A 1 19  ? 149.198 120.801 117.598 1.00 0.00 ? 19  C A "O2'"  1  
ATOM 592    C "C1'"  . C A 1 19  ? 147.780 122.581 116.833 1.00 0.00 ? 19  C A "C1'"  1  
ATOM 593    N N1     . C A 1 19  ? 146.350 122.823 116.518 1.00 0.00 ? 19  C A N1     1  
ATOM 594    C C2     . C A 1 19  ? 145.390 122.485 117.480 1.00 0.00 ? 19  C A C2     1  
ATOM 595    O O2     . C A 1 19  ? 145.759 121.997 118.558 1.00 0.00 ? 19  C A O2     1  
ATOM 596    N N3     . C A 1 19  ? 144.078 122.696 117.216 1.00 0.00 ? 19  C A N3     1  
ATOM 597    C C4     . C A 1 19  ? 143.708 123.222 116.050 1.00 0.00 ? 19  C A C4     1  
ATOM 598    N N4     . C A 1 19  ? 142.405 123.414 115.836 1.00 0.00 ? 19  C A N4     1  
ATOM 599    C C5     . C A 1 19  ? 144.658 123.577 115.052 1.00 0.00 ? 19  C A C5     1  
ATOM 600    C C6     . C A 1 19  ? 145.952 123.364 115.324 1.00 0.00 ? 19  C A C6     1  
ATOM 601    H "H5'"  . C A 1 19  ? 149.979 123.869 113.791 1.00 0.00 ? 19  C A "H5'"  1  
ATOM 602    H "H5''" . C A 1 19  ? 150.119 122.389 113.208 1.00 0.00 ? 19  C A "H5''" 1  
ATOM 603    H "H4'"  . C A 1 19  ? 150.300 122.336 115.527 1.00 0.00 ? 19  C A "H4'"  1  
ATOM 604    H "H3'"  . C A 1 19  ? 147.926 121.083 114.623 1.00 0.00 ? 19  C A "H3'"  1  
ATOM 605    H "H2'"  . C A 1 19  ? 147.392 120.520 116.781 1.00 0.00 ? 19  C A "H2'"  1  
ATOM 606    H "HO2'" . C A 1 19  ? 148.818 120.780 118.500 1.00 0.00 ? 19  C A "HO2'" 1  
ATOM 607    H "H1'"  . C A 1 19  ? 147.960 122.867 117.753 1.00 0.00 ? 19  C A "H1'"  1  
ATOM 608    H H41    . C A 1 19  ? 141.753 123.168 116.526 1.00 0.00 ? 19  C A H41    1  
ATOM 609    H H42    . C A 1 19  ? 142.099 123.799 114.989 1.00 0.00 ? 19  C A H42    1  
ATOM 610    H H5     . C A 1 19  ? 144.376 123.965 114.197 1.00 0.00 ? 19  C A H5     1  
ATOM 611    H H6     . C A 1 19  ? 146.622 123.601 114.648 1.00 0.00 ? 19  C A H6     1  
ATOM 612    P P      . U A 1 20  ? 148.902 118.640 114.327 1.00 0.00 ? 20  U A P      1  
ATOM 613    O OP1    . U A 1 20  ? 150.027 117.771 113.894 1.00 0.00 ? 20  U A OP1    1  
ATOM 614    O OP2    . U A 1 20  ? 147.857 119.031 113.350 1.00 0.00 ? 20  U A OP2    1  
ATOM 615    O "O5'"  . U A 1 20  ? 148.184 117.936 115.564 1.00 0.00 ? 20  U A "O5'"  1  
ATOM 616    C "C5'"  . U A 1 20  ? 148.939 117.400 116.639 1.00 0.00 ? 20  U A "C5'"  1  
ATOM 617    C "C4'"  . U A 1 20  ? 148.046 116.857 117.730 1.00 0.00 ? 20  U A "C4'"  1  
ATOM 618    O "O4'"  . U A 1 20  ? 147.260 117.933 118.304 1.00 0.00 ? 20  U A "O4'"  1  
ATOM 619    C "C3'"  . U A 1 20  ? 147.013 115.829 117.300 1.00 0.00 ? 20  U A "C3'"  1  
ATOM 620    O "O3'"  . U A 1 20  ? 147.546 114.518 117.194 1.00 0.00 ? 20  U A "O3'"  1  
ATOM 621    C "C2'"  . U A 1 20  ? 145.942 115.966 118.372 1.00 0.00 ? 20  U A "C2'"  1  
ATOM 622    O "O2'"  . U A 1 20  ? 146.325 115.310 119.573 1.00 0.00 ? 20  U A "O2'"  1  
ATOM 623    C "C1'"  . U A 1 20  ? 145.944 117.479 118.611 1.00 0.00 ? 20  U A "C1'"  1  
ATOM 624    N N1     . U A 1 20  ? 144.949 118.182 117.765 1.00 0.00 ? 20  U A N1     1  
ATOM 625    C C2     . U A 1 20  ? 143.631 118.144 118.175 1.00 0.00 ? 20  U A C2     1  
ATOM 626    O O2     . U A 1 20  ? 143.264 117.566 119.184 1.00 0.00 ? 20  U A O2     1  
ATOM 627    N N3     . U A 1 20  ? 142.747 118.809 117.361 1.00 0.00 ? 20  U A N3     1  
ATOM 628    C C4     . U A 1 20  ? 143.040 119.495 116.202 1.00 0.00 ? 20  U A C4     1  
ATOM 629    O O4     . U A 1 20  ? 142.130 120.042 115.578 1.00 0.00 ? 20  U A O4     1  
ATOM 630    C C5     . U A 1 20  ? 144.423 119.492 115.839 1.00 0.00 ? 20  U A C5     1  
ATOM 631    C C6     . U A 1 20  ? 145.305 118.853 116.614 1.00 0.00 ? 20  U A C6     1  
ATOM 632    H "H5'"  . U A 1 20  ? 149.507 118.105 117.013 1.00 0.00 ? 20  U A "H5'"  1  
ATOM 633    H "H5''" . U A 1 20  ? 149.507 116.677 116.302 1.00 0.00 ? 20  U A "H5''" 1  
ATOM 634    H "H4'"  . U A 1 20  ? 148.612 116.466 118.431 1.00 0.00 ? 20  U A "H4'"  1  
ATOM 635    H "H3'"  . U A 1 20  ? 146.637 116.094 116.435 1.00 0.00 ? 20  U A "H3'"  1  
ATOM 636    H "H2'"  . U A 1 20  ? 145.070 115.655 118.051 1.00 0.00 ? 20  U A "H2'"  1  
ATOM 637    H "HO2'" . U A 1 20  ? 147.023 114.653 119.370 1.00 0.00 ? 20  U A "HO2'" 1  
ATOM 638    H "H1'"  . U A 1 20  ? 145.751 117.659 119.556 1.00 0.00 ? 20  U A "H1'"  1  
ATOM 639    H H3     . U A 1 20  ? 141.807 118.793 117.635 1.00 0.00 ? 20  U A H3     1  
ATOM 640    H H5     . U A 1 20  ? 144.722 119.957 115.029 1.00 0.00 ? 20  U A H5     1  
ATOM 641    H H6     . U A 1 20  ? 146.246 118.866 116.343 1.00 0.00 ? 20  U A H6     1  
ATOM 642    P P      . A A 1 21  ? 146.929 113.476 116.138 1.00 0.00 ? 21  A A P      1  
ATOM 643    O OP1    . A A 1 21  ? 147.834 112.302 116.066 1.00 0.00 ? 21  A A OP1    1  
ATOM 644    O OP2    . A A 1 21  ? 146.593 114.222 114.898 1.00 0.00 ? 21  A A OP2    1  
ATOM 645    O "O5'"  . A A 1 21  ? 145.564 113.006 116.812 1.00 0.00 ? 21  A A "O5'"  1  
ATOM 646    C "C5'"  . A A 1 21  ? 145.569 112.216 117.992 1.00 0.00 ? 21  A A "C5'"  1  
ATOM 647    C "C4'"  . A A 1 21  ? 144.177 112.037 118.544 1.00 0.00 ? 21  A A "C4'"  1  
ATOM 648    O "O4'"  . A A 1 21  ? 143.616 113.329 118.896 1.00 0.00 ? 21  A A "O4'"  1  
ATOM 649    C "C3'"  . A A 1 21  ? 143.153 111.439 117.592 1.00 0.00 ? 21  A A "C3'"  1  
ATOM 650    O "O3'"  . A A 1 21  ? 143.225 110.023 117.520 1.00 0.00 ? 21  A A "O3'"  1  
ATOM 651    C "C2'"  . A A 1 21  ? 141.836 111.954 118.153 1.00 0.00 ? 21  A A "C2'"  1  
ATOM 652    O "O2'"  . A A 1 21  ? 141.438 111.216 119.299 1.00 0.00 ? 21  A A "O2'"  1  
ATOM 653    C "C1'"  . A A 1 21  ? 142.222 113.369 118.582 1.00 0.00 ? 21  A A "C1'"  1  
ATOM 654    N N9     . A A 1 21  ? 141.955 114.365 117.527 1.00 0.00 ? 21  A A N9     1  
ATOM 655    C C8     . A A 1 21  ? 142.858 114.962 116.683 1.00 0.00 ? 21  A A C8     1  
ATOM 656    N N7     . A A 1 21  ? 142.317 115.810 115.845 1.00 0.00 ? 21  A A N7     1  
ATOM 657    C C5     . A A 1 21  ? 140.966 115.769 116.154 1.00 0.00 ? 21  A A C5     1  
ATOM 658    C C6     . A A 1 21  ? 139.850 116.442 115.625 1.00 0.00 ? 21  A A C6     1  
ATOM 659    N N6     . A A 1 21  ? 139.924 117.325 114.626 1.00 0.00 ? 21  A A N6     1  
ATOM 660    N N1     . A A 1 21  ? 138.639 116.174 116.161 1.00 0.00 ? 21  A A N1     1  
ATOM 661    C C2     . A A 1 21  ? 138.565 115.288 117.162 1.00 0.00 ? 21  A A C2     1  
ATOM 662    N N3     . A A 1 21  ? 139.539 114.592 117.745 1.00 0.00 ? 21  A A N3     1  
ATOM 663    C C4     . A A 1 21  ? 140.728 114.883 117.189 1.00 0.00 ? 21  A A C4     1  
ATOM 664    H "H5'"  . A A 1 21  ? 146.126 112.656 118.669 1.00 0.00 ? 21  A A "H5'"  1  
ATOM 665    H "H5''" . A A 1 21  ? 145.946 111.337 117.787 1.00 0.00 ? 21  A A "H5''" 1  
ATOM 666    H "H4'"  . A A 1 21  ? 144.223 111.481 119.350 1.00 0.00 ? 21  A A "H4'"  1  
ATOM 667    H "H3'"  . A A 1 21  ? 143.289 111.812 116.695 1.00 0.00 ? 21  A A "H3'"  1  
ATOM 668    H "H2'"  . A A 1 21  ? 141.134 111.966 117.467 1.00 0.00 ? 21  A A "H2'"  1  
ATOM 669    H "HO2'" . A A 1 21  ? 140.560 111.534 119.595 1.00 0.00 ? 21  A A "HO2'" 1  
ATOM 670    H "H1'"  . A A 1 21  ? 141.723 113.611 119.391 1.00 0.00 ? 21  A A "H1'"  1  
ATOM 671    H H8     . A A 1 21  ? 143.819 114.772 116.706 1.00 0.00 ? 21  A A H8     1  
ATOM 672    H H61    . A A 1 21  ? 139.110 117.764 114.298 1.00 0.00 ? 21  A A H61    1  
ATOM 673    H H62    . A A 1 21  ? 140.792 117.536 114.222 1.00 0.00 ? 21  A A H62    1  
ATOM 674    H H2     . A A 1 21  ? 137.664 115.129 117.515 1.00 0.00 ? 21  A A H2     1  
ATOM 675    P P      . C A 1 22  ? 142.820 109.262 116.163 1.00 0.00 ? 22  C A P      1  
ATOM 676    O OP1    . C A 1 22  ? 143.235 107.841 116.293 1.00 0.00 ? 22  C A OP1    1  
ATOM 677    O OP2    . C A 1 22  ? 143.312 110.068 115.018 1.00 0.00 ? 22  C A OP2    1  
ATOM 678    O "O5'"  . C A 1 22  ? 141.227 109.310 116.155 1.00 0.00 ? 22  C A "O5'"  1  
ATOM 679    C "C5'"  . C A 1 22  ? 140.470 108.589 117.113 1.00 0.00 ? 22  C A "C5'"  1  
ATOM 680    C "C4'"  . C A 1 22  ? 139.001 108.913 117.022 1.00 0.00 ? 22  C A "C4'"  1  
ATOM 681    O "O4'"  . C A 1 22  ? 138.790 110.327 117.271 1.00 0.00 ? 22  C A "O4'"  1  
ATOM 682    C "C3'"  . C A 1 22  ? 138.343 108.674 115.669 1.00 0.00 ? 22  C A "C3'"  1  
ATOM 683    O "O3'"  . C A 1 22  ? 137.970 107.323 115.465 1.00 0.00 ? 22  C A "O3'"  1  
ATOM 684    C "C2'"  . C A 1 22  ? 137.164 109.637 115.698 1.00 0.00 ? 22  C A "C2'"  1  
ATOM 685    O "O2'"  . C A 1 22  ? 136.097 109.120 116.480 1.00 0.00 ? 22  C A "O2'"  1  
ATOM 686    C "C1'"  . C A 1 22  ? 137.772 110.841 116.419 1.00 0.00 ? 22  C A "C1'"  1  
ATOM 687    N N1     . C A 1 22  ? 138.342 111.834 115.476 1.00 0.00 ? 22  C A N1     1  
ATOM 688    C C2     . C A 1 22  ? 137.463 112.696 114.805 1.00 0.00 ? 22  C A C2     1  
ATOM 689    O O2     . C A 1 22  ? 136.245 112.603 115.018 1.00 0.00 ? 22  C A O2     1  
ATOM 690    N N3     . C A 1 22  ? 137.957 113.610 113.940 1.00 0.00 ? 22  C A N3     1  
ATOM 691    C C4     . C A 1 22  ? 139.272 113.687 113.729 1.00 0.00 ? 22  C A C4     1  
ATOM 692    N N4     . C A 1 22  ? 139.712 114.607 112.866 1.00 0.00 ? 22  C A N4     1  
ATOM 693    C C5     . C A 1 22  ? 140.189 112.827 114.392 1.00 0.00 ? 22  C A C5     1  
ATOM 694    C C6     . C A 1 22  ? 139.689 111.927 115.247 1.00 0.00 ? 22  C A C6     1  
ATOM 695    H "H5'"  . C A 1 22  ? 140.793 108.814 118.012 1.00 0.00 ? 22  C A "H5'"  1  
ATOM 696    H "H5''" . C A 1 22  ? 140.597 107.628 116.963 1.00 0.00 ? 22  C A "H5''" 1  
ATOM 697    H "H4'"  . C A 1 22  ? 138.521 108.394 117.703 1.00 0.00 ? 22  C A "H4'"  1  
ATOM 698    H "H3'"  . C A 1 22  ? 138.962 108.947 114.960 1.00 0.00 ? 22  C A "H3'"  1  
ATOM 699    H "H2'"  . C A 1 22  ? 136.872 109.872 114.792 1.00 0.00 ? 22  C A "H2'"  1  
ATOM 700    H "HO2'" . C A 1 22  ? 136.206 108.150 116.566 1.00 0.00 ? 22  C A "HO2'" 1  
ATOM 701    H "H1'"  . C A 1 22  ? 137.083 111.273 116.968 1.00 0.00 ? 22  C A "H1'"  1  
ATOM 702    H H41    . C A 1 22  ? 139.079 115.197 112.409 1.00 0.00 ? 22  C A H41    1  
ATOM 703    H H42    . C A 1 22  ? 140.673 114.689 112.689 1.00 0.00 ? 22  C A H42    1  
ATOM 704    H H5     . C A 1 22  ? 141.154 112.894 114.230 1.00 0.00 ? 22  C A H5     1  
ATOM 705    H H6     . C A 1 22  ? 140.306 111.326 115.714 1.00 0.00 ? 22  C A H6     1  
ATOM 706    P P      . C A 1 23  ? 137.955 106.703 113.984 1.00 0.00 ? 23  C A P      1  
ATOM 707    O OP1    . C A 1 23  ? 137.724 105.239 114.100 1.00 0.00 ? 23  C A OP1    1  
ATOM 708    O OP2    . C A 1 23  ? 139.156 107.201 113.265 1.00 0.00 ? 23  C A OP2    1  
ATOM 709    O "O5'"  . C A 1 23  ? 136.668 107.352 113.308 1.00 0.00 ? 23  C A "O5'"  1  
ATOM 710    C "C5'"  . C A 1 23  ? 135.362 107.038 113.768 1.00 0.00 ? 23  C A "C5'"  1  
ATOM 711    C "C4'"  . C A 1 23  ? 134.312 107.880 113.087 1.00 0.00 ? 23  C A "C4'"  1  
ATOM 712    O "O4'"  . C A 1 23  ? 134.535 109.282 113.384 1.00 0.00 ? 23  C A "O4'"  1  
ATOM 713    C "C3'"  . C A 1 23  ? 134.289 107.820 111.566 1.00 0.00 ? 23  C A "C3'"  1  
ATOM 714    O "O3'"  . C A 1 23  ? 133.604 106.687 111.067 1.00 0.00 ? 23  C A "O3'"  1  
ATOM 715    C "C2'"  . C A 1 23  ? 133.635 109.144 111.195 1.00 0.00 ? 23  C A "C2'"  1  
ATOM 716    O "O2'"  . C A 1 23  ? 132.225 109.090 111.368 1.00 0.00 ? 23  C A "O2'"  1  
ATOM 717    C "C1'"  . C A 1 23  ? 134.229 110.085 112.244 1.00 0.00 ? 23  C A "C1'"  1  
ATOM 718    N N1     . C A 1 23  ? 135.442 110.782 111.753 1.00 0.00 ? 23  C A N1     1  
ATOM 719    C C2     . C A 1 23  ? 135.282 111.859 110.872 1.00 0.00 ? 23  C A C2     1  
ATOM 720    O O2     . C A 1 23  ? 134.137 112.196 110.530 1.00 0.00 ? 23  C A O2     1  
ATOM 721    N N3     . C A 1 23  ? 136.372 112.511 110.409 1.00 0.00 ? 23  C A N3     1  
ATOM 722    C C4     . C A 1 23  ? 137.590 112.131 110.792 1.00 0.00 ? 23  C A C4     1  
ATOM 723    N N4     . C A 1 23  ? 138.638 112.803 110.311 1.00 0.00 ? 23  C A N4     1  
ATOM 724    C C5     . C A 1 23  ? 137.789 111.040 111.684 1.00 0.00 ? 23  C A C5     1  
ATOM 725    C C6     . C A 1 23  ? 136.703 110.402 112.138 1.00 0.00 ? 23  C A C6     1  
ATOM 726    H "H5'"  . C A 1 23  ? 135.321 107.194 114.735 1.00 0.00 ? 23  C A "H5'"  1  
ATOM 727    H "H5''" . C A 1 23  ? 135.182 106.093 113.590 1.00 0.00 ? 23  C A "H5''" 1  
ATOM 728    H "H4'"  . C A 1 23  ? 133.430 107.618 113.429 1.00 0.00 ? 23  C A "H4'"  1  
ATOM 729    H "H3'"  . C A 1 23  ? 135.211 107.816 111.232 1.00 0.00 ? 23  C A "H3'"  1  
ATOM 730    H "H2'"  . C A 1 23  ? 133.878 109.422 110.286 1.00 0.00 ? 23  C A "H2'"  1  
ATOM 731    H "HO2'" . C A 1 23  ? 131.940 108.153 111.378 1.00 0.00 ? 23  C A "HO2'" 1  
ATOM 732    H "H1'"  . C A 1 23  ? 133.557 110.750 112.505 1.00 0.00 ? 23  C A "H1'"  1  
ATOM 733    H H41    . C A 1 23  ? 138.498 113.554 109.694 1.00 0.00 ? 23  C A H41    1  
ATOM 734    H H42    . C A 1 23  ? 139.548 112.548 110.571 1.00 0.00 ? 23  C A H42    1  
ATOM 735    H H5     . C A 1 23  ? 138.689 110.767 111.963 1.00 0.00 ? 23  C A H5     1  
ATOM 736    H H6     . C A 1 23  ? 136.818 109.651 112.755 1.00 0.00 ? 23  C A H6     1  
ATOM 737    P P      . G A 1 24  ? 134.413 105.344 110.712 1.00 0.00 ? 24  G A P      1  
ATOM 738    O OP1    . G A 1 24  ? 133.512 104.187 110.951 1.00 0.00 ? 24  G A OP1    1  
ATOM 739    O OP2    . G A 1 24  ? 135.728 105.405 111.398 1.00 0.00 ? 24  G A OP2    1  
ATOM 740    O "O5'"  . G A 1 24  ? 134.670 105.452 109.143 1.00 0.00 ? 24  G A "O5'"  1  
ATOM 741    C "C5'"  . G A 1 24  ? 135.416 106.530 108.599 1.00 0.00 ? 24  G A "C5'"  1  
ATOM 742    C "C4'"  . G A 1 24  ? 136.759 106.072 108.086 1.00 0.00 ? 24  G A "C4'"  1  
ATOM 743    O "O4'"  . G A 1 24  ? 137.097 106.999 107.012 1.00 0.00 ? 24  G A "O4'"  1  
ATOM 744    C "C3'"  . G A 1 24  ? 137.911 106.143 109.076 1.00 0.00 ? 24  G A "C3'"  1  
ATOM 745    O "O3'"  . G A 1 24  ? 139.019 105.346 108.694 1.00 0.00 ? 24  G A "O3'"  1  
ATOM 746    C "C2'"  . G A 1 24  ? 138.342 107.595 108.916 1.00 0.00 ? 24  G A "C2'"  1  
ATOM 747    O "O2'"  . G A 1 24  ? 139.690 107.780 109.324 1.00 0.00 ? 24  G A "O2'"  1  
ATOM 748    C "C1'"  . G A 1 24  ? 138.245 107.745 107.396 1.00 0.00 ? 24  G A "C1'"  1  
ATOM 749    N N9     . G A 1 24  ? 138.060 109.150 106.987 1.00 0.00 ? 24  G A N9     1  
ATOM 750    C C8     . G A 1 24  ? 139.007 109.994 106.459 1.00 0.00 ? 24  G A C8     1  
ATOM 751    N N7     . G A 1 24  ? 138.543 111.185 106.195 1.00 0.00 ? 24  G A N7     1  
ATOM 752    C C5     . G A 1 24  ? 137.209 111.125 106.571 1.00 0.00 ? 24  G A C5     1  
ATOM 753    C C6     . G A 1 24  ? 136.193 112.115 106.519 1.00 0.00 ? 24  G A C6     1  
ATOM 754    O O6     . G A 1 24  ? 136.275 113.281 106.117 1.00 0.00 ? 24  G A O6     1  
ATOM 755    N N1     . G A 1 24  ? 134.981 111.631 107.000 1.00 0.00 ? 24  G A N1     1  
ATOM 756    C C2     . G A 1 24  ? 134.771 110.358 107.471 1.00 0.00 ? 24  G A C2     1  
ATOM 757    N N2     . G A 1 24  ? 133.529 110.077 107.894 1.00 0.00 ? 24  G A N2     1  
ATOM 758    N N3     . G A 1 24  ? 135.709 109.426 107.525 1.00 0.00 ? 24  G A N3     1  
ATOM 759    C C4     . G A 1 24  ? 136.894 109.876 107.062 1.00 0.00 ? 24  G A C4     1  
ATOM 760    H "H5'"  . G A 1 24  ? 135.553 107.207 109.293 1.00 0.00 ? 24  G A "H5'"  1  
ATOM 761    H "H5''" . G A 1 24  ? 134.910 106.928 107.860 1.00 0.00 ? 24  G A "H5''" 1  
ATOM 762    H "H4'"  . G A 1 24  ? 136.673 105.156 107.746 1.00 0.00 ? 24  G A "H4'"  1  
ATOM 763    H "H3'"  . G A 1 24  ? 137.567 105.998 109.981 1.00 0.00 ? 24  G A "H3'"  1  
ATOM 764    H "H2'"  . G A 1 24  ? 137.734 108.204 109.384 1.00 0.00 ? 24  G A "H2'"  1  
ATOM 765    H "HO2'" . G A 1 24  ? 139.957 107.029 109.894 1.00 0.00 ? 24  G A "HO2'" 1  
ATOM 766    H "H1'"  . G A 1 24  ? 139.057 107.388 106.979 1.00 0.00 ? 24  G A "H1'"  1  
ATOM 767    H H8     . G A 1 24  ? 139.937 109.730 106.297 1.00 0.00 ? 24  G A H8     1  
ATOM 768    H H1     . G A 1 24  ? 134.219 112.248 107.003 1.00 0.00 ? 24  G A H1     1  
ATOM 769    H H21    . G A 1 24  ? 132.830 110.761 107.857 1.00 0.00 ? 24  G A H21    1  
ATOM 770    H H22    . G A 1 24  ? 133.321 109.183 108.241 1.00 0.00 ? 24  G A H22    1  
ATOM 771    P P      . A A 1 25  ? 139.337 103.978 109.476 1.00 0.00 ? 25  A A P      1  
ATOM 772    O OP1    . A A 1 25  ? 138.048 103.301 109.763 1.00 0.00 ? 25  A A OP1    1  
ATOM 773    O OP2    . A A 1 25  ? 140.267 104.290 110.590 1.00 0.00 ? 25  A A OP2    1  
ATOM 774    O "O5'"  . A A 1 25  ? 140.128 103.099 108.408 1.00 0.00 ? 25  A A "O5'"  1  
ATOM 775    C "C5'"  . A A 1 25  ? 139.434 102.255 107.501 1.00 0.00 ? 25  A A "C5'"  1  
ATOM 776    C "C4'"  . A A 1 25  ? 140.167 100.955 107.282 1.00 0.00 ? 25  A A "C4'"  1  
ATOM 777    O "O4'"  . A A 1 25  ? 139.332 100.070 106.516 1.00 0.00 ? 25  A A "O4'"  1  
ATOM 778    C "C3'"  . A A 1 25  ? 141.466 101.045 106.496 1.00 0.00 ? 25  A A "C3'"  1  
ATOM 779    O "O3'"  . A A 1 25  ? 142.586 101.354 107.307 1.00 0.00 ? 25  A A "O3'"  1  
ATOM 780    C "C2'"  . A A 1 25  ? 141.587 99.651  105.888 1.00 0.00 ? 25  A A "C2'"  1  
ATOM 781    O "O2'"  . A A 1 25  ? 142.134 98.729  106.819 1.00 0.00 ? 25  A A "O2'"  1  
ATOM 782    C "C1'"  . A A 1 25  ? 140.117 99.275  105.632 1.00 0.00 ? 25  A A "C1'"  1  
ATOM 783    N N9     . A A 1 25  ? 139.699 99.576  104.250 1.00 0.00 ? 25  A A N9     1  
ATOM 784    C C8     . A A 1 25  ? 139.188 100.752 103.760 1.00 0.00 ? 25  A A C8     1  
ATOM 785    N N7     . A A 1 25  ? 138.908 100.714 102.480 1.00 0.00 ? 25  A A N7     1  
ATOM 786    C C5     . A A 1 25  ? 139.258 99.426  102.101 1.00 0.00 ? 25  A A C5     1  
ATOM 787    C C6     . A A 1 25  ? 139.202 98.754  100.867 1.00 0.00 ? 25  A A C6     1  
ATOM 788    N N6     . A A 1 25  ? 138.755 99.312  99.739  1.00 0.00 ? 25  A A N6     1  
ATOM 789    N N1     . A A 1 25  ? 139.628 97.473  100.829 1.00 0.00 ? 25  A A N1     1  
ATOM 790    C C2     . A A 1 25  ? 140.077 96.912  101.960 1.00 0.00 ? 25  A A C2     1  
ATOM 791    N N3     . A A 1 25  ? 140.177 97.440  103.178 1.00 0.00 ? 25  A A N3     1  
ATOM 792    C C4     . A A 1 25  ? 139.747 98.714  103.180 1.00 0.00 ? 25  A A C4     1  
ATOM 793    H "H5'"  . A A 1 25  ? 139.340 102.717 106.641 1.00 0.00 ? 25  A A "H5'"  1  
ATOM 794    H "H5''" . A A 1 25  ? 138.543 102.063 107.859 1.00 0.00 ? 25  A A "H5''" 1  
ATOM 795    H "H4'"  . A A 1 25  ? 140.358 100.548 108.154 1.00 0.00 ? 25  A A "H4'"  1  
ATOM 796    H "H3'"  . A A 1 25  ? 141.360 101.701 105.774 1.00 0.00 ? 25  A A "H3'"  1  
ATOM 797    H "H2'"  . A A 1 25  ? 142.096 99.667  105.050 1.00 0.00 ? 25  A A "H2'"  1  
ATOM 798    H "HO2'" . A A 1 25  ? 142.227 97.856  106.385 1.00 0.00 ? 25  A A "HO2'" 1  
ATOM 799    H "H1'"  . A A 1 25  ? 139.990 98.319  105.811 1.00 0.00 ? 25  A A "H1'"  1  
ATOM 800    H H8     . A A 1 25  ? 139.046 101.547 104.315 1.00 0.00 ? 25  A A H8     1  
ATOM 801    H H61    . A A 1 25  ? 138.740 98.792  98.908  1.00 0.00 ? 25  A A H61    1  
ATOM 802    H H62    . A A 1 25  ? 138.441 100.240 99.743  1.00 0.00 ? 25  A A H62    1  
ATOM 803    H H2     . A A 1 25  ? 140.374 95.982  101.879 1.00 0.00 ? 25  A A H2     1  
ATOM 804    P P      . G A 1 26  ? 143.877 102.064 106.666 1.00 0.00 ? 26  G A P      1  
ATOM 805    O OP1    . G A 1 26  ? 143.592 102.332 105.233 1.00 0.00 ? 26  G A OP1    1  
ATOM 806    O OP2    . G A 1 26  ? 145.073 101.267 107.040 1.00 0.00 ? 26  G A OP2    1  
ATOM 807    O "O5'"  . G A 1 26  ? 143.963 103.465 107.421 1.00 0.00 ? 26  G A "O5'"  1  
ATOM 808    C "C5'"  . G A 1 26  ? 144.337 104.645 106.727 1.00 0.00 ? 26  G A "C5'"  1  
ATOM 809    C "C4'"  . G A 1 26  ? 143.143 105.522 106.442 1.00 0.00 ? 26  G A "C4'"  1  
ATOM 810    O "O4'"  . G A 1 26  ? 142.902 106.341 107.633 1.00 0.00 ? 26  G A "O4'"  1  
ATOM 811    C "C3'"  . G A 1 26  ? 143.301 106.514 105.299 1.00 0.00 ? 26  G A "C3'"  1  
ATOM 812    O "O3'"  . G A 1 26  ? 142.066 106.871 104.702 1.00 0.00 ? 26  G A "O3'"  1  
ATOM 813    C "C2'"  . G A 1 26  ? 143.845 107.737 106.027 1.00 0.00 ? 26  G A "C2'"  1  
ATOM 814    O "O2'"  . G A 1 26  ? 143.546 108.933 105.320 1.00 0.00 ? 26  G A "O2'"  1  
ATOM 815    C "C1'"  . G A 1 26  ? 143.020 107.692 107.315 1.00 0.00 ? 26  G A "C1'"  1  
ATOM 816    N N9     . G A 1 26  ? 143.706 108.359 108.438 1.00 0.00 ? 26  G A N9     1  
ATOM 817    C C8     . G A 1 26  ? 145.031 108.716 108.509 1.00 0.00 ? 26  G A C8     1  
ATOM 818    N N7     . G A 1 26  ? 145.348 109.293 109.636 1.00 0.00 ? 26  G A N7     1  
ATOM 819    C C5     . G A 1 26  ? 144.161 109.319 110.354 1.00 0.00 ? 26  G A C5     1  
ATOM 820    C C6     . G A 1 26  ? 143.880 109.825 111.650 1.00 0.00 ? 26  G A C6     1  
ATOM 821    O O6     . G A 1 26  ? 144.653 110.368 112.448 1.00 0.00 ? 26  G A O6     1  
ATOM 822    N N1     . G A 1 26  ? 142.543 109.647 111.992 1.00 0.00 ? 26  G A N1     1  
ATOM 823    C C2     . G A 1 26  ? 141.596 109.059 111.189 1.00 0.00 ? 26  G A C2     1  
ATOM 824    N N2     . G A 1 26  ? 140.356 108.977 111.694 1.00 0.00 ? 26  G A N2     1  
ATOM 825    N N3     . G A 1 26  ? 141.844 108.583 109.980 1.00 0.00 ? 26  G A N3     1  
ATOM 826    C C4     . G A 1 26  ? 143.137 108.746 109.629 1.00 0.00 ? 26  G A C4     1  
ATOM 827    H "H5'"  . G A 1 26  ? 144.762 104.398 105.880 1.00 0.00 ? 26  G A "H5'"  1  
ATOM 828    H "H5''" . G A 1 26  ? 144.979 105.147 107.273 1.00 0.00 ? 26  G A "H5''" 1  
ATOM 829    H "H4'"  . G A 1 26  ? 142.365 104.952 106.265 1.00 0.00 ? 26  G A "H4'"  1  
ATOM 830    H "H3'"  . G A 1 26  ? 143.976 106.178 104.674 1.00 0.00 ? 26  G A "H3'"  1  
ATOM 831    H "H2'"  . G A 1 26  ? 144.805 107.652 106.206 1.00 0.00 ? 26  G A "H2'"  1  
ATOM 832    H "HO2'" . G A 1 26  ? 143.913 109.696 105.814 1.00 0.00 ? 26  G A "HO2'" 1  
ATOM 833    H "H1'"  . G A 1 26  ? 142.152 108.121 107.162 1.00 0.00 ? 26  G A "H1'"  1  
ATOM 834    H H8     . G A 1 26  ? 145.674 108.554 107.787 1.00 0.00 ? 26  G A H8     1  
ATOM 835    H H1     . G A 1 26  ? 142.257 109.967 112.873 1.00 0.00 ? 26  G A H1     1  
ATOM 836    H H21    . G A 1 26  ? 140.164 109.327 112.589 1.00 0.00 ? 26  G A H21    1  
ATOM 837    H H22    . G A 1 26  ? 139.638 108.567 111.166 1.00 0.00 ? 26  G A H22    1  
ATOM 838    P P      . U A 1 27  ? 141.618 106.202 103.311 1.00 0.00 ? 27  U A P      1  
ATOM 839    O OP1    . U A 1 27  ? 141.581 104.729 103.499 1.00 0.00 ? 27  U A OP1    1  
ATOM 840    O OP2    . U A 1 27  ? 142.456 106.783 102.232 1.00 0.00 ? 27  U A OP2    1  
ATOM 841    O "O5'"  . U A 1 27  ? 140.123 106.710 103.103 1.00 0.00 ? 27  U A "O5'"  1  
ATOM 842    C "C5'"  . U A 1 27  ? 139.088 106.317 103.992 1.00 0.00 ? 27  U A "C5'"  1  
ATOM 843    C "C4'"  . U A 1 27  ? 137.911 107.259 103.927 1.00 0.00 ? 27  U A "C4'"  1  
ATOM 844    O "O4'"  . U A 1 27  ? 138.347 108.618 104.140 1.00 0.00 ? 27  U A "O4'"  1  
ATOM 845    C "C3'"  . U A 1 27  ? 137.188 107.337 102.591 1.00 0.00 ? 27  U A "C3'"  1  
ATOM 846    O "O3'"  . U A 1 27  ? 136.278 106.271 102.390 1.00 0.00 ? 27  U A "O3'"  1  
ATOM 847    C "C2'"  . U A 1 27  ? 136.465 108.674 102.701 1.00 0.00 ? 27  U A "C2'"  1  
ATOM 848    O "O2'"  . U A 1 27  ? 135.280 108.556 103.474 1.00 0.00 ? 27  U A "O2'"  1  
ATOM 849    C "C1'"  . U A 1 27  ? 137.480 109.518 103.478 1.00 0.00 ? 27  U A "C1'"  1  
ATOM 850    N N1     . U A 1 27  ? 138.304 110.369 102.586 1.00 0.00 ? 27  U A N1     1  
ATOM 851    C C2     . U A 1 27  ? 137.726 111.533 102.114 1.00 0.00 ? 27  U A C2     1  
ATOM 852    O O2     . U A 1 27  ? 136.592 111.876 102.399 1.00 0.00 ? 27  U A O2     1  
ATOM 853    N N3     . U A 1 27  ? 138.526 112.290 101.293 1.00 0.00 ? 27  U A N3     1  
ATOM 854    C C4     . U A 1 27  ? 139.817 112.008 100.901 1.00 0.00 ? 27  U A C4     1  
ATOM 855    O O4     . U A 1 27  ? 140.406 112.792 100.154 1.00 0.00 ? 27  U A O4     1  
ATOM 856    C C5     . U A 1 27  ? 140.350 110.789 101.427 1.00 0.00 ? 27  U A C5     1  
ATOM 857    C C6     . U A 1 27  ? 139.593 110.034 102.230 1.00 0.00 ? 27  U A C6     1  
ATOM 858    H "H5'"  . U A 1 27  ? 139.440 106.309 104.907 1.00 0.00 ? 27  U A "H5'"  1  
ATOM 859    H "H5''" . U A 1 27  ? 138.789 105.415 103.755 1.00 0.00 ? 27  U A "H5''" 1  
ATOM 860    H "H4'"  . U A 1 27  ? 137.276 107.019 104.633 1.00 0.00 ? 27  U A "H4'"  1  
ATOM 861    H "H3'"  . U A 1 27  ? 137.848 107.385 101.869 1.00 0.00 ? 27  U A "H3'"  1  
ATOM 862    H "H2'"  . U A 1 27  ? 136.285 109.058 101.818 1.00 0.00 ? 27  U A "H2'"  1  
ATOM 863    H "HO2'" . U A 1 27  ? 134.958 107.631 103.427 1.00 0.00 ? 27  U A "HO2'" 1  
ATOM 864    H "H1'"  . U A 1 27  ? 137.003 110.086 104.119 1.00 0.00 ? 27  U A "H1'"  1  
ATOM 865    H H3     . U A 1 27  ? 138.135 113.119 100.947 1.00 0.00 ? 27  U A H3     1  
ATOM 866    H H5     . U A 1 27  ? 141.262 110.510 101.201 1.00 0.00 ? 27  U A H5     1  
ATOM 867    H H6     . U A 1 27  ? 139.980 109.204 102.576 1.00 0.00 ? 27  U A H6     1  
ATOM 868    P P      . A A 1 28  ? 136.263 105.470 100.997 1.00 0.00 ? 28  A A P      1  
ATOM 869    O OP1    . A A 1 28  ? 137.618 105.562 100.399 1.00 0.00 ? 28  A A OP1    1  
ATOM 870    O OP2    . A A 1 28  ? 135.084 105.925 100.218 1.00 0.00 ? 28  A A OP2    1  
ATOM 871    O "O5'"  . A A 1 28  ? 136.015 103.956 101.426 1.00 0.00 ? 28  A A "O5'"  1  
ATOM 872    C "C5'"  . A A 1 28  ? 136.883 103.306 102.343 1.00 0.00 ? 28  A A "C5'"  1  
ATOM 873    C "C4'"  . A A 1 28  ? 136.114 102.626 103.448 1.00 0.00 ? 28  A A "C4'"  1  
ATOM 874    O "O4'"  . A A 1 28  ? 135.394 103.630 104.199 1.00 0.00 ? 28  A A "O4'"  1  
ATOM 875    C "C3'"  . A A 1 28  ? 135.015 101.672 103.005 1.00 0.00 ? 28  A A "C3'"  1  
ATOM 876    O "O3'"  . A A 1 28  ? 135.501 100.386 102.664 1.00 0.00 ? 28  A A "O3'"  1  
ATOM 877    C "C2'"  . A A 1 28  ? 134.142 101.621 104.261 1.00 0.00 ? 28  A A "C2'"  1  
ATOM 878    O "O2'"  . A A 1 28  ? 134.706 100.767 105.246 1.00 0.00 ? 28  A A "O2'"  1  
ATOM 879    C "C1'"  . A A 1 28  ? 134.232 103.068 104.743 1.00 0.00 ? 28  A A "C1'"  1  
ATOM 880    N N9     . A A 1 28  ? 133.066 103.868 104.325 1.00 0.00 ? 28  A A N9     1  
ATOM 881    C C8     . A A 1 28  ? 133.055 105.013 103.567 1.00 0.00 ? 28  A A C8     1  
ATOM 882    N N7     . A A 1 28  ? 131.856 105.498 103.359 1.00 0.00 ? 28  A A N7     1  
ATOM 883    C C5     . A A 1 28  ? 131.019 104.614 104.026 1.00 0.00 ? 28  A A C5     1  
ATOM 884    C C6     . A A 1 28  ? 129.623 104.571 104.188 1.00 0.00 ? 28  A A C6     1  
ATOM 885    N N6     . A A 1 28  ? 128.789 105.475 103.668 1.00 0.00 ? 28  A A N6     1  
ATOM 886    N N1     . A A 1 28  ? 129.105 103.555 104.911 1.00 0.00 ? 28  A A N1     1  
ATOM 887    C C2     . A A 1 28  ? 129.941 102.647 105.433 1.00 0.00 ? 28  A A C2     1  
ATOM 888    N N3     . A A 1 28  ? 131.268 102.581 105.350 1.00 0.00 ? 28  A A N3     1  
ATOM 889    C C4     . A A 1 28  ? 131.751 103.605 104.624 1.00 0.00 ? 28  A A C4     1  
ATOM 890    H "H5'"  . A A 1 28  ? 137.487 103.970 102.737 1.00 0.00 ? 28  A A "H5'"  1  
ATOM 891    H "H5''" . A A 1 28  ? 137.414 102.637 101.864 1.00 0.00 ? 28  A A "H5''" 1  
ATOM 892    H "H4'"  . A A 1 28  ? 136.747 102.167 104.039 1.00 0.00 ? 28  A A "H4'"  1  
ATOM 893    H "H3'"  . A A 1 28  ? 134.511 102.081 102.270 1.00 0.00 ? 28  A A "H3'"  1  
ATOM 894    H "H2'"  . A A 1 28  ? 133.219 101.369 104.047 1.00 0.00 ? 28  A A "H2'"  1  
ATOM 895    H "HO2'" . A A 1 28  ? 133.987 100.258 105.675 1.00 0.00 ? 28  A A "HO2'" 1  
ATOM 896    H "H1'"  . A A 1 28  ? 134.304 103.082 105.721 1.00 0.00 ? 28  A A "H1'"  1  
ATOM 897    H H8     . A A 1 28  ? 133.869 105.429 103.213 1.00 0.00 ? 28  A A H8     1  
ATOM 898    H H61    . A A 1 28  ? 127.823 105.392 103.816 1.00 0.00 ? 28  A A H61    1  
ATOM 899    H H62    . A A 1 28  ? 129.141 106.221 103.141 1.00 0.00 ? 28  A A H62    1  
ATOM 900    H H2     . A A 1 28  ? 129.515 101.930 105.948 1.00 0.00 ? 28  A A H2     1  
ATOM 901    P P      . A A 1 29  ? 135.186 99.761  101.217 1.00 0.00 ? 29  A A P      1  
ATOM 902    O OP1    . A A 1 29  ? 135.771 98.398  101.167 1.00 0.00 ? 29  A A OP1    1  
ATOM 903    O OP2    . A A 1 29  ? 135.569 100.762 100.190 1.00 0.00 ? 29  A A OP2    1  
ATOM 904    O "O5'"  . A A 1 29  ? 133.599 99.618  101.197 1.00 0.00 ? 29  A A "O5'"  1  
ATOM 905    C "C5'"  . A A 1 29  ? 132.933 98.760  102.111 1.00 0.00 ? 29  A A "C5'"  1  
ATOM 906    C "C4'"  . A A 1 29  ? 131.448 99.022  102.135 1.00 0.00 ? 29  A A "C4'"  1  
ATOM 907    O "O4'"  . A A 1 29  ? 131.174 100.320 102.727 1.00 0.00 ? 29  A A "O4'"  1  
ATOM 908    C "C3'"  . A A 1 29  ? 130.759 99.083  100.780 1.00 0.00 ? 29  A A "C3'"  1  
ATOM 909    O "O3'"  . A A 1 29  ? 130.446 97.804  100.258 1.00 0.00 ? 29  A A "O3'"  1  
ATOM 910    C "C2'"  . A A 1 29  ? 129.537 99.932  101.076 1.00 0.00 ? 29  A A "C2'"  1  
ATOM 911    O "O2'"  . A A 1 29  ? 128.531 99.173  101.732 1.00 0.00 ? 29  A A "O2'"  1  
ATOM 912    C "C1'"  . A A 1 29  ? 130.115 100.953 102.060 1.00 0.00 ? 29  A A "C1'"  1  
ATOM 913    N N9     . A A 1 29  ? 130.663 102.138 101.373 1.00 0.00 ? 29  A A N9     1  
ATOM 914    C C8     . A A 1 29  ? 131.966 102.379 101.013 1.00 0.00 ? 29  A A C8     1  
ATOM 915    N N7     . A A 1 29  ? 132.145 103.529 100.412 1.00 0.00 ? 29  A A N7     1  
ATOM 916    C C5     . A A 1 29  ? 130.873 104.085 100.372 1.00 0.00 ? 29  A A C5     1  
ATOM 917    C C6     . A A 1 29  ? 130.387 105.302 99.862  1.00 0.00 ? 29  A A C6     1  
ATOM 918    N N6     . A A 1 29  ? 131.157 106.216 99.267  1.00 0.00 ? 29  A A N6     1  
ATOM 919    N N1     . A A 1 29  ? 129.065 105.551 99.984  1.00 0.00 ? 29  A A N1     1  
ATOM 920    C C2     . A A 1 29  ? 128.292 104.634 100.579 1.00 0.00 ? 29  A A C2     1  
ATOM 921    N N3     . A A 1 29  ? 128.631 103.456 101.098 1.00 0.00 ? 29  A A N3     1  
ATOM 922    C C4     . A A 1 29  ? 129.952 103.239 100.960 1.00 0.00 ? 29  A A C4     1  
ATOM 923    H "H5'"  . A A 1 29  ? 133.297 98.905  103.009 1.00 0.00 ? 29  A A "H5'"  1  
ATOM 924    H "H5''" . A A 1 29  ? 133.090 97.829  101.850 1.00 0.00 ? 29  A A "H5''" 1  
ATOM 925    H "H4'"  . A A 1 29  ? 131.013 98.331  102.677 1.00 0.00 ? 29  A A "H4'"  1  
ATOM 926    H "H3'"  . A A 1 29  ? 131.337 99.561  100.147 1.00 0.00 ? 29  A A "H3'"  1  
ATOM 927    H "H2'"  . A A 1 29  ? 129.196 100.365 100.266 1.00 0.00 ? 29  A A "H2'"  1  
ATOM 928    H "HO2'" . A A 1 29  ? 127.751 99.746  101.887 1.00 0.00 ? 29  A A "HO2'" 1  
ATOM 929    H "H1'"  . A A 1 29  ? 129.416 101.233 102.688 1.00 0.00 ? 29  A A "H1'"  1  
ATOM 930    H H8     . A A 1 29  ? 132.695 101.748 101.189 1.00 0.00 ? 29  A A H8     1  
ATOM 931    H H61    . A A 1 29  ? 130.761 107.047 98.931  1.00 0.00 ? 29  A A H61    1  
ATOM 932    H H62    . A A 1 29  ? 132.119 106.057 99.168  1.00 0.00 ? 29  A A H62    1  
ATOM 933    H H2     . A A 1 29  ? 127.341 104.863 100.642 1.00 0.00 ? 29  A A H2     1  
ATOM 934    P P      . G A 1 30  ? 130.049 97.638  98.710  1.00 0.00 ? 30  G A P      1  
ATOM 935    O OP1    . G A 1 30  ? 128.742 98.310  98.494  1.00 0.00 ? 30  G A OP1    1  
ATOM 936    O OP2    . G A 1 30  ? 130.206 96.206  98.346  1.00 0.00 ? 30  G A OP2    1  
ATOM 937    O "O5'"  . G A 1 30  ? 131.164 98.469  97.933  1.00 0.00 ? 30  G A "O5'"  1  
ATOM 938    C "C5'"  . G A 1 30  ? 132.541 98.155  98.080  1.00 0.00 ? 30  G A "C5'"  1  
ATOM 939    C "C4'"  . G A 1 30  ? 133.317 98.465  96.823  1.00 0.00 ? 30  G A "C4'"  1  
ATOM 940    O "O4'"  . G A 1 30  ? 132.562 99.409  96.009  1.00 0.00 ? 30  G A "O4'"  1  
ATOM 941    C "C3'"  . G A 1 30  ? 134.688 99.093  97.023  1.00 0.00 ? 30  G A "C3'"  1  
ATOM 942    O "O3'"  . G A 1 30  ? 135.590 98.799  95.969  1.00 0.00 ? 30  G A "O3'"  1  
ATOM 943    C "C2'"  . G A 1 30  ? 134.366 100.586 96.965  1.00 0.00 ? 30  G A "C2'"  1  
ATOM 944    O "O2'"  . G A 1 30  ? 135.492 101.341 96.541  1.00 0.00 ? 30  G A "O2'"  1  
ATOM 945    C "C1'"  . G A 1 30  ? 133.304 100.593 95.865  1.00 0.00 ? 30  G A "C1'"  1  
ATOM 946    N N9     . G A 1 30  ? 132.369 101.726 96.003  1.00 0.00 ? 30  G A N9     1  
ATOM 947    C C8     . G A 1 30  ? 131.850 102.239 97.167  1.00 0.00 ? 30  G A C8     1  
ATOM 948    N N7     . G A 1 30  ? 131.044 103.247 96.970  1.00 0.00 ? 30  G A N7     1  
ATOM 949    C C5     . G A 1 30  ? 131.029 103.410 95.593  1.00 0.00 ? 30  G A C5     1  
ATOM 950    C C6     . G A 1 30  ? 130.335 104.348 94.785  1.00 0.00 ? 30  G A C6     1  
ATOM 951    O O6     . G A 1 30  ? 129.568 105.250 95.139  1.00 0.00 ? 30  G A O6     1  
ATOM 952    N N1     . G A 1 30  ? 130.604 104.159 93.433  1.00 0.00 ? 30  G A N1     1  
ATOM 953    C C2     . G A 1 30  ? 131.437 103.192 92.922  1.00 0.00 ? 30  G A C2     1  
ATOM 954    N N2     . G A 1 30  ? 131.572 103.167 91.588  1.00 0.00 ? 30  G A N2     1  
ATOM 955    N N3     . G A 1 30  ? 132.090 102.313 93.664  1.00 0.00 ? 30  G A N3     1  
ATOM 956    C C4     . G A 1 30  ? 131.842 102.479 94.980  1.00 0.00 ? 30  G A C4     1  
ATOM 957    H "H5'"  . G A 1 30  ? 132.632 97.202  98.285  1.00 0.00 ? 30  G A "H5'"  1  
ATOM 958    H "H5''" . G A 1 30  ? 132.911 98.679  98.821  1.00 0.00 ? 30  G A "H5''" 1  
ATOM 959    H "H4'"  . G A 1 30  ? 133.444 97.635  96.317  1.00 0.00 ? 30  G A "H4'"  1  
ATOM 960    H "H3'"  . G A 1 30  ? 135.018 98.867  97.916  1.00 0.00 ? 30  G A "H3'"  1  
ATOM 961    H "H2'"  . G A 1 30  ? 134.012 100.911 97.820  1.00 0.00 ? 30  G A "H2'"  1  
ATOM 962    H "HO2'" . G A 1 30  ? 135.532 102.172 97.058  1.00 0.00 ? 30  G A "HO2'" 1  
ATOM 963    H "H1'"  . G A 1 30  ? 133.741 100.636 94.989  1.00 0.00 ? 30  G A "H1'"  1  
ATOM 964    H H8     . G A 1 30  ? 132.062 101.885 98.056  1.00 0.00 ? 30  G A H8     1  
ATOM 965    H H1     . G A 1 30  ? 130.166 104.763 92.798  1.00 0.00 ? 30  G A H1     1  
ATOM 966    H H21    . G A 1 30  ? 131.092 103.815 91.032  1.00 0.00 ? 30  G A H21    1  
ATOM 967    H H22    . G A 1 30  ? 132.153 102.499 91.167  1.00 0.00 ? 30  G A H22    1  
ATOM 968    P P      . A A 1 31  ? 137.127 98.460  96.293  1.00 0.00 ? 31  A A P      1  
ATOM 969    O OP1    . A A 1 31  ? 137.541 97.327  95.429  1.00 0.00 ? 31  A A OP1    1  
ATOM 970    O OP2    . A A 1 31  ? 137.273 98.352  97.767  1.00 0.00 ? 31  A A OP2    1  
ATOM 971    O "O5'"  . A A 1 31  ? 137.916 99.759  95.815  1.00 0.00 ? 31  A A "O5'"  1  
ATOM 972    C "C5'"  . A A 1 31  ? 137.672 100.332 94.539  1.00 0.00 ? 31  A A "C5'"  1  
ATOM 973    C "C4'"  . A A 1 31  ? 138.222 101.733 94.445  1.00 0.00 ? 31  A A "C4'"  1  
ATOM 974    O "O4'"  . A A 1 31  ? 137.591 102.594 95.437  1.00 0.00 ? 31  A A "O4'"  1  
ATOM 975    C "C3'"  . A A 1 31  ? 139.712 101.884 94.714  1.00 0.00 ? 31  A A "C3'"  1  
ATOM 976    O "O3'"  . A A 1 31  ? 140.514 101.559 93.592  1.00 0.00 ? 31  A A "O3'"  1  
ATOM 977    C "C2'"  . A A 1 31  ? 139.820 103.340 95.134  1.00 0.00 ? 31  A A "C2'"  1  
ATOM 978    O "O2'"  . A A 1 31  ? 139.754 104.206 94.011  1.00 0.00 ? 31  A A "O2'"  1  
ATOM 979    C "C1'"  . A A 1 31  ? 138.544 103.496 95.967  1.00 0.00 ? 31  A A "C1'"  1  
ATOM 980    N N9     . A A 1 31  ? 138.761 103.157 97.386  1.00 0.00 ? 31  A A N9     1  
ATOM 981    C C8     . A A 1 31  ? 138.180 102.146 98.111  1.00 0.00 ? 31  A A C8     1  
ATOM 982    N N7     . A A 1 31  ? 138.575 102.095 99.359  1.00 0.00 ? 31  A A N7     1  
ATOM 983    C C5     . A A 1 31  ? 139.480 103.143 99.464  1.00 0.00 ? 31  A A C5     1  
ATOM 984    C C6     . A A 1 31  ? 140.252 103.623 100.537 1.00 0.00 ? 31  A A C6     1  
ATOM 985    N N6     . A A 1 31  ? 140.237 103.086 101.759 1.00 0.00 ? 31  A A N6     1  
ATOM 986    N N1     . A A 1 31  ? 141.052 104.687 100.308 1.00 0.00 ? 31  A A N1     1  
ATOM 987    C C2     . A A 1 31  ? 141.068 105.226 99.082  1.00 0.00 ? 31  A A C2     1  
ATOM 988    N N3     . A A 1 31  ? 140.388 104.865 97.996  1.00 0.00 ? 31  A A N3     1  
ATOM 989    C C4     . A A 1 31  ? 139.603 103.805 98.257  1.00 0.00 ? 31  A A C4     1  
ATOM 990    H "H5'"  . A A 1 31  ? 136.705 100.357 94.379  1.00 0.00 ? 31  A A "H5'"  1  
ATOM 991    H "H5''" . A A 1 31  ? 138.095 99.776  93.852  1.00 0.00 ? 31  A A "H5''" 1  
ATOM 992    H "H4'"  . A A 1 31  ? 138.030 102.090 93.553  1.00 0.00 ? 31  A A "H4'"  1  
ATOM 993    H "H3'"  . A A 1 31  ? 139.962 101.311 95.470  1.00 0.00 ? 31  A A "H3'"  1  
ATOM 994    H "H2'"  . A A 1 31  ? 140.625 103.500 95.670  1.00 0.00 ? 31  A A "H2'"  1  
ATOM 995    H "HO2'" . A A 1 31  ? 139.826 105.134 94.319  1.00 0.00 ? 31  A A "HO2'" 1  
ATOM 996    H "H1'"  . A A 1 31  ? 138.220 104.419 95.898  1.00 0.00 ? 31  A A "H1'"  1  
ATOM 997    H H8     . A A 1 31  ? 137.528 101.520 97.730  1.00 0.00 ? 31  A A H8     1  
ATOM 998    H H61    . A A 1 31  ? 140.798 103.465 102.468 1.00 0.00 ? 31  A A H61    1  
ATOM 999    H H62    . A A 1 31  ? 139.664 102.314 101.948 1.00 0.00 ? 31  A A H62    1  
ATOM 1000   H H2     . A A 1 31  ? 141.665 105.996 98.969  1.00 0.00 ? 31  A A H2     1  
ATOM 1001   P P      . G A 1 32  ? 141.819 100.638 93.771  1.00 0.00 ? 32  G A P      1  
ATOM 1002   O OP1    . G A 1 32  ? 142.501 100.545 92.455  1.00 0.00 ? 32  G A OP1    1  
ATOM 1003   O OP2    . G A 1 32  ? 141.412 99.396  94.477  1.00 0.00 ? 32  G A OP2    1  
ATOM 1004   O "O5'"  . G A 1 32  ? 142.752 101.479 94.752  1.00 0.00 ? 32  G A "O5'"  1  
ATOM 1005   C "C5'"  . G A 1 32  ? 143.380 102.675 94.313  1.00 0.00 ? 32  G A "C5'"  1  
ATOM 1006   C "C4'"  . G A 1 32  ? 144.185 103.315 95.417  1.00 0.00 ? 32  G A "C4'"  1  
ATOM 1007   O "O4'"  . G A 1 32  ? 143.335 103.637 96.547  1.00 0.00 ? 32  G A "O4'"  1  
ATOM 1008   C "C3'"  . G A 1 32  ? 145.292 102.461 96.017  1.00 0.00 ? 32  G A "C3'"  1  
ATOM 1009   O "O3'"  . G A 1 32  ? 146.472 102.452 95.232  1.00 0.00 ? 32  G A "O3'"  1  
ATOM 1010   C "C2'"  . G A 1 32  ? 145.498 103.085 97.398  1.00 0.00 ? 32  G A "C2'"  1  
ATOM 1011   O "O2'"  . G A 1 32  ? 146.323 104.239 97.324  1.00 0.00 ? 32  G A "O2'"  1  
ATOM 1012   C "C1'"  . G A 1 32  ? 144.079 103.512 97.751  1.00 0.00 ? 32  G A "C1'"  1  
ATOM 1013   N N9     . G A 1 32  ? 143.415 102.549 98.649  1.00 0.00 ? 32  G A N9     1  
ATOM 1014   C C8     . G A 1 32  ? 142.404 101.675 98.330  1.00 0.00 ? 32  G A C8     1  
ATOM 1015   N N7     . G A 1 32  ? 142.018 100.944 99.341  1.00 0.00 ? 32  G A N7     1  
ATOM 1016   C C5     . G A 1 32  ? 142.824 101.359 100.391 1.00 0.00 ? 32  G A C5     1  
ATOM 1017   C C6     . G A 1 32  ? 142.870 100.927 101.742 1.00 0.00 ? 32  G A C6     1  
ATOM 1018   O O6     . G A 1 32  ? 142.183 100.062 102.297 1.00 0.00 ? 32  G A O6     1  
ATOM 1019   N N1     . G A 1 32  ? 143.838 101.614 102.468 1.00 0.00 ? 32  G A N1     1  
ATOM 1020   C C2     . G A 1 32  ? 144.658 102.592 101.960 1.00 0.00 ? 32  G A C2     1  
ATOM 1021   N N2     . G A 1 32  ? 145.531 103.141 102.818 1.00 0.00 ? 32  G A N2     1  
ATOM 1022   N N3     . G A 1 32  ? 144.625 103.004 100.704 1.00 0.00 ? 32  G A N3     1  
ATOM 1023   C C4     . G A 1 32  ? 143.693 102.349 99.981  1.00 0.00 ? 32  G A C4     1  
ATOM 1024   H "H5'"  . G A 1 32  ? 142.693 103.305 94.012  1.00 0.00 ? 32  G A "H5'"  1  
ATOM 1025   H "H5''" . G A 1 32  ? 143.975 102.467 93.562  1.00 0.00 ? 32  G A "H5''" 1  
ATOM 1026   H "H4'"  . G A 1 32  ? 144.582 104.145 95.079  1.00 0.00 ? 32  G A "H4'"  1  
ATOM 1027   H "H3'"  . G A 1 32  ? 144.966 101.544 96.129  1.00 0.00 ? 32  G A "H3'"  1  
ATOM 1028   H "H2'"  . G A 1 32  ? 145.845 102.431 98.040  1.00 0.00 ? 32  G A "H2'"  1  
ATOM 1029   H "HO2'" . G A 1 32  ? 146.457 104.593 98.228  1.00 0.00 ? 32  G A "HO2'" 1  
ATOM 1030   H "H1'"  . G A 1 32  ? 144.100 104.395 98.177  1.00 0.00 ? 32  G A "H1'"  1  
ATOM 1031   H H8     . G A 1 32  ? 142.010 101.607 97.435  1.00 0.00 ? 32  G A H8     1  
ATOM 1032   H H1     . G A 1 32  ? 143.941 101.381 103.414 1.00 0.00 ? 32  G A H1     1  
ATOM 1033   H H21    . G A 1 32  ? 145.561 102.841 103.750 1.00 0.00 ? 32  G A H21    1  
ATOM 1034   H H22    . G A 1 32  ? 146.142 103.845 102.512 1.00 0.00 ? 32  G A H22    1  
ATOM 1035   P P      . A A 1 33  ? 147.006 101.078 94.592  1.00 0.00 ? 33  A A P      1  
ATOM 1036   O OP1    . A A 1 33  ? 148.144 101.399 93.696  1.00 0.00 ? 33  A A OP1    1  
ATOM 1037   O OP2    . A A 1 33  ? 145.837 100.335 94.056  1.00 0.00 ? 33  A A OP2    1  
ATOM 1038   O "O5'"  . A A 1 33  ? 147.574 100.267 95.840  1.00 0.00 ? 33  A A "O5'"  1  
ATOM 1039   C "C5'"  . A A 1 33  ? 148.745 100.697 96.517  1.00 0.00 ? 33  A A "C5'"  1  
ATOM 1040   C "C4'"  . A A 1 33  ? 148.815 100.137 97.915  1.00 0.00 ? 33  A A "C4'"  1  
ATOM 1041   O "O4'"  . A A 1 33  ? 147.674 100.570 98.685  1.00 0.00 ? 33  A A "O4'"  1  
ATOM 1042   C "C3'"  . A A 1 33  ? 148.748 98.621  98.031  1.00 0.00 ? 33  A A "C3'"  1  
ATOM 1043   O "O3'"  . A A 1 33  ? 149.988 97.989  97.765  1.00 0.00 ? 33  A A "O3'"  1  
ATOM 1044   C "C2'"  . A A 1 33  ? 148.253 98.432  99.447  1.00 0.00 ? 33  A A "C2'"  1  
ATOM 1045   O "O2'"  . A A 1 33  ? 149.294 98.644  100.389 1.00 0.00 ? 33  A A "O2'"  1  
ATOM 1046   C "C1'"  . A A 1 33  ? 147.249 99.562  99.546  1.00 0.00 ? 33  A A "C1'"  1  
ATOM 1047   N N9     . A A 1 33  ? 145.896 99.142  99.135  1.00 0.00 ? 33  A A N9     1  
ATOM 1048   C C8     . A A 1 33  ? 145.272 99.365  97.932  1.00 0.00 ? 33  A A C8     1  
ATOM 1049   N N7     . A A 1 33  ? 144.062 98.866  97.863  1.00 0.00 ? 33  A A N7     1  
ATOM 1050   C C5     . A A 1 33  ? 143.876 98.273  99.105  1.00 0.00 ? 33  A A C5     1  
ATOM 1051   C C6     . A A 1 33  ? 142.795 97.570  99.666  1.00 0.00 ? 33  A A C6     1  
ATOM 1052   N N6     . A A 1 33  ? 141.650 97.336  99.022  1.00 0.00 ? 33  A A N6     1  
ATOM 1053   N N1     . A A 1 33  ? 142.932 97.110  100.928 1.00 0.00 ? 33  A A N1     1  
ATOM 1054   C C2     . A A 1 33  ? 144.081 97.344  101.575 1.00 0.00 ? 33  A A C2     1  
ATOM 1055   N N3     . A A 1 33  ? 145.167 97.990  101.155 1.00 0.00 ? 33  A A N3     1  
ATOM 1056   C C4     . A A 1 33  ? 144.997 98.435  99.897  1.00 0.00 ? 33  A A C4     1  
ATOM 1057   H "H5'"  . A A 1 33  ? 148.746 101.676 96.565  1.00 0.00 ? 33  A A "H5'"  1  
ATOM 1058   H "H5''" . A A 1 33  ? 149.532 100.401 96.015  1.00 0.00 ? 33  A A "H5''" 1  
ATOM 1059   H "H4'"  . A A 1 33  ? 149.630 100.466 98.349  1.00 0.00 ? 33  A A "H4'"  1  
ATOM 1060   H "H3'"  . A A 1 33  ? 148.074 98.281  97.405  1.00 0.00 ? 33  A A "H3'"  1  
ATOM 1061   H "H2'"  . A A 1 33  ? 147.828 97.556  99.565  1.00 0.00 ? 33  A A "H2'"  1  
ATOM 1062   H "HO2'" . A A 1 33  ? 148.940 98.505  101.292 1.00 0.00 ? 33  A A "HO2'" 1  
ATOM 1063   H "H1'"  . A A 1 33  ? 147.221 99.893  100.469 1.00 0.00 ? 33  A A "H1'"  1  
ATOM 1064   H H8     . A A 1 33  ? 145.692 99.853  97.193  1.00 0.00 ? 33  A A H8     1  
ATOM 1065   H H61    . A A 1 33  ? 140.930 96.840  99.466  1.00 0.00 ? 33  A A H61    1  
ATOM 1066   H H62    . A A 1 33  ? 141.527 97.661  98.105  1.00 0.00 ? 33  A A H62    1  
ATOM 1067   H H2     . A A 1 33  ? 144.130 96.989  102.488 1.00 0.00 ? 33  A A H2     1  
ATOM 1068   P P      . A A 1 34  ? 150.096 96.880  96.607  1.00 0.00 ? 34  A A P      1  
ATOM 1069   O OP1    . A A 1 34  ? 151.495 96.386  96.573  1.00 0.00 ? 34  A A OP1    1  
ATOM 1070   O OP2    . A A 1 34  ? 149.484 97.439  95.375  1.00 0.00 ? 34  A A OP2    1  
ATOM 1071   O "O5'"  . A A 1 34  ? 149.166 95.693  97.123  1.00 0.00 ? 34  A A "O5'"  1  
ATOM 1072   C "C5'"  . A A 1 34  ? 149.494 94.969  98.299  1.00 0.00 ? 34  A A "C5'"  1  
ATOM 1073   C "C4'"  . A A 1 34  ? 148.354 94.087  98.744  1.00 0.00 ? 34  A A "C4'"  1  
ATOM 1074   O "O4'"  . A A 1 34  ? 147.203 94.927  99.054  1.00 0.00 ? 34  A A "O4'"  1  
ATOM 1075   C "C3'"  . A A 1 34  ? 147.842 93.090  97.716  1.00 0.00 ? 34  A A "C3'"  1  
ATOM 1076   O "O3'"  . A A 1 34  ? 148.531 91.852  97.752  1.00 0.00 ? 34  A A "O3'"  1  
ATOM 1077   C "C2'"  . A A 1 34  ? 146.363 92.961  98.065  1.00 0.00 ? 34  A A "C2'"  1  
ATOM 1078   O "O2'"  . A A 1 34  ? 146.167 92.067  99.151  1.00 0.00 ? 34  A A "O2'"  1  
ATOM 1079   C "C1'"  . A A 1 34  ? 146.029 94.380  98.527  1.00 0.00 ? 34  A A "C1'"  1  
ATOM 1080   N N9     . A A 1 34  ? 145.574 95.234  97.414  1.00 0.00 ? 34  A A N9     1  
ATOM 1081   C C8     . A A 1 34  ? 146.337 96.019  96.585  1.00 0.00 ? 34  A A C8     1  
ATOM 1082   N N7     . A A 1 34  ? 145.642 96.667  95.683  1.00 0.00 ? 34  A A N7     1  
ATOM 1083   C C5     . A A 1 34  ? 144.331 96.284  95.934  1.00 0.00 ? 34  A A C5     1  
ATOM 1084   C C6     . A A 1 34  ? 143.112 96.623  95.322  1.00 0.00 ? 34  A A C6     1  
ATOM 1085   N N6     . A A 1 34  ? 143.010 97.460  94.287  1.00 0.00 ? 34  A A N6     1  
ATOM 1086   N N1     . A A 1 34  ? 141.985 96.065  95.814  1.00 0.00 ? 34  A A N1     1  
ATOM 1087   C C2     . A A 1 34  ? 142.086 95.225  96.852  1.00 0.00 ? 34  A A C2     1  
ATOM 1088   N N3     . A A 1 34  ? 143.173 94.829  97.512  1.00 0.00 ? 34  A A N3     1  
ATOM 1089   C C4     . A A 1 34  ? 144.275 95.401  96.996  1.00 0.00 ? 34  A A C4     1  
ATOM 1090   H "H5'"  . A A 1 34  ? 149.706 95.602  99.017  1.00 0.00 ? 34  A A "H5'"  1  
ATOM 1091   H "H5''" . A A 1 34  ? 150.280 94.411  98.124  1.00 0.00 ? 34  A A "H5''" 1  
ATOM 1092   H "H4'"  . A A 1 34  ? 148.626 93.598  99.548  1.00 0.00 ? 34  A A "H4'"  1  
ATOM 1093   H "H3'"  . A A 1 34  ? 147.922 93.482  96.820  1.00 0.00 ? 34  A A "H3'"  1  
ATOM 1094   H "H2'"  . A A 1 34  ? 145.830 92.706  97.283  1.00 0.00 ? 34  A A "H2'"  1  
ATOM 1095   H "HO2'" . A A 1 34  ? 145.209 92.009  99.347  1.00 0.00 ? 34  A A "HO2'" 1  
ATOM 1096   H "H1'"  . A A 1 34  ? 145.333 94.343  99.216  1.00 0.00 ? 34  A A "H1'"  1  
ATOM 1097   H H8     . A A 1 34  ? 147.312 96.088  96.661  1.00 0.00 ? 34  A A H8     1  
ATOM 1098   H H61    . A A 1 34  ? 142.131 97.659  93.902  1.00 0.00 ? 34  A A H61    1  
ATOM 1099   H H62    . A A 1 34  ? 143.814 97.877  93.913  1.00 0.00 ? 34  A A H62    1  
ATOM 1100   H H2     . A A 1 34  ? 141.239 94.848  97.172  1.00 0.00 ? 34  A A H2     1  
ATOM 1101   P P      . A A 1 35  ? 149.661 91.524  96.658  1.00 0.00 ? 35  A A P      1  
ATOM 1102   O OP1    . A A 1 35  ? 150.229 90.188  96.969  1.00 0.00 ? 35  A A OP1    1  
ATOM 1103   O OP2    . A A 1 35  ? 150.561 92.700  96.560  1.00 0.00 ? 35  A A OP2    1  
ATOM 1104   O "O5'"  . A A 1 35  ? 148.850 91.409  95.291  1.00 0.00 ? 35  A A "O5'"  1  
ATOM 1105   C "C5'"  . A A 1 35  ? 148.317 90.165  94.862  1.00 0.00 ? 35  A A "C5'"  1  
ATOM 1106   C "C4'"  . A A 1 35  ? 147.650 90.284  93.514  1.00 0.00 ? 35  A A "C4'"  1  
ATOM 1107   O "O4'"  . A A 1 35  ? 146.662 91.350  93.510  1.00 0.00 ? 35  A A "O4'"  1  
ATOM 1108   C "C3'"  . A A 1 35  ? 148.560 90.640  92.348  1.00 0.00 ? 35  A A "C3'"  1  
ATOM 1109   O "O3'"  . A A 1 35  ? 149.270 89.525  91.838  1.00 0.00 ? 35  A A "O3'"  1  
ATOM 1110   C "C2'"  . A A 1 35  ? 147.533 91.178  91.360  1.00 0.00 ? 35  A A "C2'"  1  
ATOM 1111   O "O2'"  . A A 1 35  ? 146.748 90.129  90.811  1.00 0.00 ? 35  A A "O2'"  1  
ATOM 1112   C "C1'"  . A A 1 35  ? 146.674 92.022  92.299  1.00 0.00 ? 35  A A "C1'"  1  
ATOM 1113   N N9     . A A 1 35  ? 147.250 93.361  92.526  1.00 0.00 ? 35  A A N9     1  
ATOM 1114   C C8     . A A 1 35  ? 147.642 93.921  93.717  1.00 0.00 ? 35  A A C8     1  
ATOM 1115   N N7     . A A 1 35  ? 148.119 95.135  93.598  1.00 0.00 ? 35  A A N7     1  
ATOM 1116   C C5     . A A 1 35  ? 148.036 95.394  92.236  1.00 0.00 ? 35  A A C5     1  
ATOM 1117   C C6     . A A 1 35  ? 148.384 96.516  91.462  1.00 0.00 ? 35  A A C6     1  
ATOM 1118   N N6     . A A 1 35  ? 148.908 97.632  91.972  1.00 0.00 ? 35  A A N6     1  
ATOM 1119   N N1     . A A 1 35  ? 148.173 96.449  90.130  1.00 0.00 ? 35  A A N1     1  
ATOM 1120   C C2     . A A 1 35  ? 147.647 95.329  89.619  1.00 0.00 ? 35  A A C2     1  
ATOM 1121   N N3     . A A 1 35  ? 147.280 94.211  90.242  1.00 0.00 ? 35  A A N3     1  
ATOM 1122   C C4     . A A 1 35  ? 147.503 94.310  91.565  1.00 0.00 ? 35  A A C4     1  
ATOM 1123   H "H5'"  . A A 1 35  ? 147.658 89.857  95.518  1.00 0.00 ? 35  A A "H5'"  1  
ATOM 1124   H "H5''" . A A 1 35  ? 149.041 89.509  94.804  1.00 0.00 ? 35  A A "H5''" 1  
ATOM 1125   H "H4'"  . A A 1 35  ? 147.194 89.440  93.311  1.00 0.00 ? 35  A A "H4'"  1  
ATOM 1126   H "H3'"  . A A 1 35  ? 149.170 91.357  92.624  1.00 0.00 ? 35  A A "H3'"  1  
ATOM 1127   H "H2'"  . A A 1 35  ? 147.956 91.719  90.661  1.00 0.00 ? 35  A A "H2'"  1  
ATOM 1128   H "HO2'" . A A 1 35  ? 147.260 89.294  90.850  1.00 0.00 ? 35  A A "HO2'" 1  
ATOM 1129   H "H1'"  . A A 1 35  ? 145.773 92.112  91.924  1.00 0.00 ? 35  A A "H1'"  1  
ATOM 1130   H H8     . A A 1 35  ? 147.572 93.455  94.577  1.00 0.00 ? 35  A A H8     1  
ATOM 1131   H H61    . A A 1 35  ? 149.131 98.383  91.381  1.00 0.00 ? 35  A A H61    1  
ATOM 1132   H H62    . A A 1 35  ? 149.070 97.703  92.935  1.00 0.00 ? 35  A A H62    1  
ATOM 1133   H H2     . A A 1 35  ? 147.514 95.332  88.647  1.00 0.00 ? 35  A A H2     1  
ATOM 1134   P P      . G A 1 36  ? 149.576 88.192  92.776  1.00 0.00 ? 36  G A P      1  
ATOM 1135   O OP1    . G A 1 36  ? 150.069 87.101  91.897  1.00 0.00 ? 36  G A OP1    1  
ATOM 1136   O OP2    . G A 1 36  ? 148.291 88.026  93.502  1.00 0.00 ? 36  G A OP2    1  
ATOM 1137   O "O5'"  . G A 1 36  ? 150.710 88.512  93.848  1.00 0.00 ? 36  G A "O5'"  1  
ATOM 1138   C "C5'"  . G A 1 36  ? 151.854 87.679  93.970  1.00 0.00 ? 36  G A "C5'"  1  
ATOM 1139   C "C4'"  . G A 1 36  ? 151.520 86.375  94.651  1.00 0.00 ? 36  G A "C4'"  1  
ATOM 1140   O "O4'"  . G A 1 36  ? 150.082 86.150  94.612  1.00 0.00 ? 36  G A "O4'"  1  
ATOM 1141   C "C3'"  . G A 1 36  ? 152.112 85.123  94.023  1.00 0.00 ? 36  G A "C3'"  1  
ATOM 1142   O "O3'"  . G A 1 36  ? 153.466 84.910  94.383  1.00 0.00 ? 36  G A "O3'"  1  
ATOM 1143   C "C2'"  . G A 1 36  ? 151.167 84.028  94.520  1.00 0.00 ? 36  G A "C2'"  1  
ATOM 1144   O "O2'"  . G A 1 36  ? 151.472 83.652  95.855  1.00 0.00 ? 36  G A "O2'"  1  
ATOM 1145   C "C1'"  . G A 1 36  ? 149.821 84.757  94.504  1.00 0.00 ? 36  G A "C1'"  1  
ATOM 1146   N N9     . G A 1 36  ? 149.065 84.501  93.263  1.00 0.00 ? 36  G A N9     1  
ATOM 1147   C C8     . G A 1 36  ? 149.240 85.107  92.043  1.00 0.00 ? 36  G A C8     1  
ATOM 1148   N N7     . G A 1 36  ? 148.416 84.670  91.129  1.00 0.00 ? 36  G A N7     1  
ATOM 1149   C C5     . G A 1 36  ? 147.651 83.717  91.786  1.00 0.00 ? 36  G A C5     1  
ATOM 1150   C C6     . G A 1 36  ? 146.592 82.900  91.309  1.00 0.00 ? 36  G A C6     1  
ATOM 1151   O O6     . G A 1 36  ? 146.104 82.856  90.174  1.00 0.00 ? 36  G A O6     1  
ATOM 1152   N N1     . G A 1 36  ? 146.093 82.072  92.310  1.00 0.00 ? 36  G A N1     1  
ATOM 1153   C C2     . G A 1 36  ? 146.554 82.033  93.604  1.00 0.00 ? 36  G A C2     1  
ATOM 1154   N N2     . G A 1 36  ? 145.945 81.166  94.427  1.00 0.00 ? 36  G A N2     1  
ATOM 1155   N N3     . G A 1 36  ? 147.539 82.789  94.060  1.00 0.00 ? 36  G A N3     1  
ATOM 1156   C C4     . G A 1 36  ? 148.038 83.600  93.104  1.00 0.00 ? 36  G A C4     1  
ATOM 1157   H "H5'"  . G A 1 36  ? 152.537 88.147  94.493  1.00 0.00 ? 36  G A "H5'"  1  
ATOM 1158   H "H5''" . G A 1 36  ? 152.209 87.491  93.076  1.00 0.00 ? 36  G A "H5''" 1  
ATOM 1159   H "H4'"  . G A 1 36  ? 151.806 86.427  95.587  1.00 0.00 ? 36  G A "H4'"  1  
ATOM 1160   H "H3'"  . G A 1 36  ? 152.045 85.185  93.048  1.00 0.00 ? 36  G A "H3'"  1  
ATOM 1161   H "H2'"  . G A 1 36  ? 151.163 83.255  93.917  1.00 0.00 ? 36  G A "H2'"  1  
ATOM 1162   H "HO2'" . G A 1 36  ? 150.864 82.935  96.132  1.00 0.00 ? 36  G A "HO2'" 1  
ATOM 1163   H "H1'"  . G A 1 36  ? 149.287 84.474  95.276  1.00 0.00 ? 36  G A "H1'"  1  
ATOM 1164   H H8     . G A 1 36  ? 149.914 85.798  91.874  1.00 0.00 ? 36  G A H8     1  
ATOM 1165   H H1     . G A 1 36  ? 145.357 81.471  92.072  1.00 0.00 ? 36  G A H1     1  
ATOM 1166   H H21    . G A 1 36  ? 145.214 80.604  94.096  1.00 0.00 ? 36  G A H21    1  
ATOM 1167   H H22    . G A 1 36  ? 146.231 81.095  95.362  1.00 0.00 ? 36  G A H22    1  
ATOM 1168   P P      . A A 1 37  ? 154.400 83.958  93.486  1.00 0.00 ? 37  A A P      1  
ATOM 1169   O OP1    . A A 1 37  ? 154.094 82.549  93.838  1.00 0.00 ? 37  A A OP1    1  
ATOM 1170   O OP2    . A A 1 37  ? 155.795 84.455  93.588  1.00 0.00 ? 37  A A OP2    1  
ATOM 1171   O "O5'"  . A A 1 37  ? 153.894 84.215  91.996  1.00 0.00 ? 37  A A "O5'"  1  
ATOM 1172   C "C5'"  . A A 1 37  ? 154.775 84.072  90.892  1.00 0.00 ? 37  A A "C5'"  1  
ATOM 1173   C "C4'"  . A A 1 37  ? 154.032 83.700  89.634  1.00 0.00 ? 37  A A "C4'"  1  
ATOM 1174   O "O4'"  . A A 1 37  ? 153.357 82.425  89.851  1.00 0.00 ? 37  A A "O4'"  1  
ATOM 1175   C "C3'"  . A A 1 37  ? 152.948 84.669  89.188  1.00 0.00 ? 37  A A "C3'"  1  
ATOM 1176   O "O3'"  . A A 1 37  ? 152.735 84.657  87.787  1.00 0.00 ? 37  A A "O3'"  1  
ATOM 1177   C "C2'"  . A A 1 37  ? 151.694 84.071  89.822  1.00 0.00 ? 37  A A "C2'"  1  
ATOM 1178   O "O2'"  . A A 1 37  ? 150.531 84.411  89.082  1.00 0.00 ? 37  A A "O2'"  1  
ATOM 1179   C "C1'"  . A A 1 37  ? 151.978 82.583  89.660  1.00 0.00 ? 37  A A "C1'"  1  
ATOM 1180   N N9     . A A 1 37  ? 151.315 81.774  90.700  1.00 0.00 ? 37  A A N9     1  
ATOM 1181   C C8     . A A 1 37  ? 151.769 81.488  91.964  1.00 0.00 ? 37  A A C8     1  
ATOM 1182   N N7     . A A 1 37  ? 150.952 80.739  92.662  1.00 0.00 ? 37  A A N7     1  
ATOM 1183   C C5     . A A 1 37  ? 149.886 80.515  91.800  1.00 0.00 ? 37  A A C5     1  
ATOM 1184   C C6     . A A 1 37  ? 148.689 79.790  91.942  1.00 0.00 ? 37  A A C6     1  
ATOM 1185   N N6     . A A 1 37  ? 148.350 79.131  93.052  1.00 0.00 ? 37  A A N6     1  
ATOM 1186   N N1     . A A 1 37  ? 147.841 79.767  90.891  1.00 0.00 ? 37  A A N1     1  
ATOM 1187   C C2     . A A 1 37  ? 148.181 80.429  89.777  1.00 0.00 ? 37  A A C2     1  
ATOM 1188   N N3     . A A 1 37  ? 149.275 81.143  89.524  1.00 0.00 ? 37  A A N3     1  
ATOM 1189   C C4     . A A 1 37  ? 150.097 81.147  90.589  1.00 0.00 ? 37  A A C4     1  
ATOM 1190   H "H5'"  . A A 1 37  ? 155.431 83.372  91.095  1.00 0.00 ? 37  A A "H5'"  1  
ATOM 1191   H "H5''" . A A 1 37  ? 155.247 84.918  90.747  1.00 0.00 ? 37  A A "H5''" 1  
ATOM 1192   H "H4'"  . A A 1 37  ? 154.675 83.586  88.904  1.00 0.00 ? 37  A A "H4'"  1  
ATOM 1193   H "H3'"  . A A 1 37  ? 153.117 85.590  89.479  1.00 0.00 ? 37  A A "H3'"  1  
ATOM 1194   H "H2'"  . A A 1 37  ? 151.612 84.325  90.765  1.00 0.00 ? 37  A A "H2'"  1  
ATOM 1195   H "HO2'" . A A 1 37  ? 149.751 84.353  89.672  1.00 0.00 ? 37  A A "HO2'" 1  
ATOM 1196   H "H1'"  . A A 1 37  ? 151.675 82.288  88.774  1.00 0.00 ? 37  A A "H1'"  1  
ATOM 1197   H H8     . A A 1 37  ? 152.625 81.815  92.312  1.00 0.00 ? 37  A A H8     1  
ATOM 1198   H H61    . A A 1 37  ? 147.501 78.643  93.091  1.00 0.00 ? 37  A A H61    1  
ATOM 1199   H H62    . A A 1 37  ? 148.950 79.134  93.827  1.00 0.00 ? 37  A A H62    1  
ATOM 1200   H H2     . A A 1 37  ? 147.531 80.380  89.045  1.00 0.00 ? 37  A A H2     1  
ATOM 1201   P P      . G A 1 38  ? 152.422 86.025  87.006  1.00 0.00 ? 38  G A P      1  
ATOM 1202   O OP1    . G A 1 38  ? 153.122 87.129  87.712  1.00 0.00 ? 38  G A OP1    1  
ATOM 1203   O OP2    . G A 1 38  ? 150.955 86.106  86.789  1.00 0.00 ? 38  G A OP2    1  
ATOM 1204   O "O5'"  . G A 1 38  ? 153.120 85.828  85.587  1.00 0.00 ? 38  G A "O5'"  1  
ATOM 1205   C "C5'"  . G A 1 38  ? 154.534 85.828  85.464  1.00 0.00 ? 38  G A "C5'"  1  
ATOM 1206   C "C4'"  . G A 1 38  ? 154.965 85.817  84.018  1.00 0.00 ? 38  G A "C4'"  1  
ATOM 1207   O "O4'"  . G A 1 38  ? 154.595 84.546  83.416  1.00 0.00 ? 38  G A "O4'"  1  
ATOM 1208   C "C3'"  . G A 1 38  ? 154.316 86.860  83.121  1.00 0.00 ? 38  G A "C3'"  1  
ATOM 1209   O "O3'"  . G A 1 38  ? 154.944 88.128  83.201  1.00 0.00 ? 38  G A "O3'"  1  
ATOM 1210   C "C2'"  . G A 1 38  ? 154.414 86.222  81.742  1.00 0.00 ? 38  G A "C2'"  1  
ATOM 1211   O "O2'"  . G A 1 38  ? 155.715 86.380  81.193  1.00 0.00 ? 38  G A "O2'"  1  
ATOM 1212   C "C1'"  . G A 1 38  ? 154.191 84.748  82.076  1.00 0.00 ? 38  G A "C1'"  1  
ATOM 1213   N N9     . G A 1 38  ? 152.774 84.357  81.947  1.00 0.00 ? 38  G A N9     1  
ATOM 1214   C C8     . G A 1 38  ? 151.944 83.896  82.940  1.00 0.00 ? 38  G A C8     1  
ATOM 1215   N N7     . G A 1 38  ? 150.738 83.630  82.519  1.00 0.00 ? 38  G A N7     1  
ATOM 1216   C C5     . G A 1 38  ? 150.772 83.934  81.166  1.00 0.00 ? 38  G A C5     1  
ATOM 1217   C C6     . G A 1 38  ? 149.756 83.849  80.179  1.00 0.00 ? 38  G A C6     1  
ATOM 1218   O O6     . G A 1 38  ? 148.585 83.474  80.309  1.00 0.00 ? 38  G A O6     1  
ATOM 1219   N N1     . G A 1 38  ? 150.218 84.256  78.931  1.00 0.00 ? 38  G A N1     1  
ATOM 1220   C C2     . G A 1 38  ? 151.494 84.691  78.666  1.00 0.00 ? 38  G A C2     1  
ATOM 1221   N N2     . G A 1 38  ? 151.752 85.042  77.398  1.00 0.00 ? 38  G A N2     1  
ATOM 1222   N N3     . G A 1 38  ? 152.450 84.775  79.577  1.00 0.00 ? 38  G A N3     1  
ATOM 1223   C C4     . G A 1 38  ? 152.021 84.384  80.796  1.00 0.00 ? 38  G A C4     1  
ATOM 1224   H "H5'"  . G A 1 38  ? 154.895 85.034  85.911  1.00 0.00 ? 38  G A "H5'"  1  
ATOM 1225   H "H5''" . G A 1 38  ? 154.893 86.630  85.899  1.00 0.00 ? 38  G A "H5''" 1  
ATOM 1226   H "H4'"  . G A 1 38  ? 155.939 85.919  83.970  1.00 0.00 ? 38  G A "H4'"  1  
ATOM 1227   H "H3'"  . G A 1 38  ? 153.372 86.953  83.366  1.00 0.00 ? 38  G A "H3'"  1  
ATOM 1228   H "H2'"  . G A 1 38  ? 153.722 86.563  81.138  1.00 0.00 ? 38  G A "H2'"  1  
ATOM 1229   H "HO2'" . G A 1 38  ? 156.150 87.148  81.620  1.00 0.00 ? 38  G A "HO2'" 1  
ATOM 1230   H "H1'"  . G A 1 38  ? 154.738 84.192  81.483  1.00 0.00 ? 38  G A "H1'"  1  
ATOM 1231   H H8     . G A 1 38  ? 152.229 83.778  83.870  1.00 0.00 ? 38  G A H8     1  
ATOM 1232   H H1     . G A 1 38  ? 149.583 84.230  78.185  1.00 0.00 ? 38  G A H1     1  
ATOM 1233   H H21    . G A 1 38  ? 151.050 84.983  76.717  1.00 0.00 ? 38  G A H21    1  
ATOM 1234   H H22    . G A 1 38  ? 152.646 85.360  77.150  1.00 0.00 ? 38  G A H22    1  
ATOM 1235   P P      . G A 1 39  ? 154.188 89.439  82.659  1.00 0.00 ? 39  G A P      1  
ATOM 1236   O OP1    . G A 1 39  ? 154.945 90.630  83.121  1.00 0.00 ? 39  G A OP1    1  
ATOM 1237   O OP2    . G A 1 39  ? 152.747 89.309  82.993  1.00 0.00 ? 39  G A OP2    1  
ATOM 1238   O "O5'"  . G A 1 39  ? 154.338 89.344  81.076  1.00 0.00 ? 39  G A "O5'"  1  
ATOM 1239   C "C5'"  . G A 1 39  ? 154.677 90.488  80.306  1.00 0.00 ? 39  G A "C5'"  1  
ATOM 1240   C "C4'"  . G A 1 39  ? 154.999 90.120  78.879  1.00 0.00 ? 39  G A "C4'"  1  
ATOM 1241   O "O4'"  . G A 1 39  ? 156.100 89.204  78.680  1.00 0.00 ? 39  G A "O4'"  1  
ATOM 1242   C "C3'"  . G A 1 39  ? 153.873 89.470  78.087  1.00 0.00 ? 39  G A "C3'"  1  
ATOM 1243   O "O3'"  . G A 1 39  ? 152.826 90.372  77.772  1.00 0.00 ? 39  G A "O3'"  1  
ATOM 1244   C "C2'"  . G A 1 39  ? 154.627 89.036  76.836  1.00 0.00 ? 39  G A "C2'"  1  
ATOM 1245   O "O2'"  . G A 1 39  ? 154.842 90.131  75.957  1.00 0.00 ? 39  G A "O2'"  1  
ATOM 1246   C "C1'"  . G A 1 39  ? 155.965 88.602  77.426  1.00 0.00 ? 39  G A "C1'"  1  
ATOM 1247   N N9     . G A 1 39  ? 156.060 87.138  77.572  1.00 0.00 ? 39  G A N9     1  
ATOM 1248   C C8     . G A 1 39  ? 155.340 86.339  78.427  1.00 0.00 ? 39  G A C8     1  
ATOM 1249   N N7     . G A 1 39  ? 155.647 85.073  78.328  1.00 0.00 ? 39  G A N7     1  
ATOM 1250   C C5     . G A 1 39  ? 156.628 85.034  77.348  1.00 0.00 ? 39  G A C5     1  
ATOM 1251   C C6     . G A 1 39  ? 157.344 83.934  76.808  1.00 0.00 ? 39  G A C6     1  
ATOM 1252   O O6     . G A 1 39  ? 157.251 82.736  77.099  1.00 0.00 ? 39  G A O6     1  
ATOM 1253   N N1     . G A 1 39  ? 158.249 84.341  75.832  1.00 0.00 ? 39  G A N1     1  
ATOM 1254   C C2     . G A 1 39  ? 158.439 85.639  75.426  1.00 0.00 ? 39  G A C2     1  
ATOM 1255   N N2     . G A 1 39  ? 159.359 85.835  74.469  1.00 0.00 ? 39  G A N2     1  
ATOM 1256   N N3     . G A 1 39  ? 157.779 86.673  75.921  1.00 0.00 ? 39  G A N3     1  
ATOM 1257   C C4     . G A 1 39  ? 156.895 86.299  76.870  1.00 0.00 ? 39  G A C4     1  
ATOM 1258   H "H5'"  . G A 1 39  ? 155.457 90.924  80.707  1.00 0.00 ? 39  G A "H5'"  1  
ATOM 1259   H "H5''" . G A 1 39  ? 153.923 91.114  80.313  1.00 0.00 ? 39  G A "H5''" 1  
ATOM 1260   H "H4'"  . G A 1 39  ? 155.216 90.985  78.471  1.00 0.00 ? 39  G A "H4'"  1  
ATOM 1261   H "H3'"  . G A 1 39  ? 153.498 88.691  78.546  1.00 0.00 ? 39  G A "H3'"  1  
ATOM 1262   H "H2'"  . G A 1 39  ? 154.175 88.292  76.384  1.00 0.00 ? 39  G A "H2'"  1  
ATOM 1263   H "HO2'" . G A 1 39  ? 154.426 89.933  75.092  1.00 0.00 ? 39  G A "HO2'" 1  
ATOM 1264   H "H1'"  . G A 1 39  ? 156.694 88.921  76.853  1.00 0.00 ? 39  G A "H1'"  1  
ATOM 1265   H H8     . G A 1 39  ? 154.666 86.682  79.049  1.00 0.00 ? 39  G A H8     1  
ATOM 1266   H H1     . G A 1 39  ? 158.790 83.646  75.402  1.00 0.00 ? 39  G A H1     1  
ATOM 1267   H H21    . G A 1 39  ? 159.852 85.074  74.097  1.00 0.00 ? 39  G A H21    1  
ATOM 1268   H H22    . G A 1 39  ? 159.538 86.741  74.140  1.00 0.00 ? 39  G A H22    1  
ATOM 1269   P P      . A A 1 40  ? 151.373 89.814  77.372  1.00 0.00 ? 40  A A P      1  
ATOM 1270   O OP1    . A A 1 40  ? 150.398 90.924  77.515  1.00 0.00 ? 40  A A OP1    1  
ATOM 1271   O OP2    . A A 1 40  ? 151.151 88.542  78.106  1.00 0.00 ? 40  A A OP2    1  
ATOM 1272   O "O5'"  . A A 1 40  ? 151.506 89.470  75.822  1.00 0.00 ? 40  A A "O5'"  1  
ATOM 1273   C "C5'"  . A A 1 40  ? 151.591 90.503  74.851  1.00 0.00 ? 40  A A "C5'"  1  
ATOM 1274   C "C4'"  . A A 1 40  ? 152.056 89.974  73.518  1.00 0.00 ? 40  A A "C4'"  1  
ATOM 1275   O "O4'"  . A A 1 40  ? 153.362 89.361  73.621  1.00 0.00 ? 40  A A "O4'"  1  
ATOM 1276   C "C3'"  . A A 1 40  ? 151.201 88.878  72.900  1.00 0.00 ? 40  A A "C3'"  1  
ATOM 1277   O "O3'"  . A A 1 40  ? 150.050 89.378  72.242  1.00 0.00 ? 40  A A "O3'"  1  
ATOM 1278   C "C2'"  . A A 1 40  ? 152.183 88.213  71.953  1.00 0.00 ? 40  A A "C2'"  1  
ATOM 1279   O "O2'"  . A A 1 40  ? 152.383 88.996  70.785  1.00 0.00 ? 40  A A "O2'"  1  
ATOM 1280   C "C1'"  . A A 1 40  ? 153.453 88.230  72.786  1.00 0.00 ? 40  A A "C1'"  1  
ATOM 1281   N N9     . A A 1 40  ? 153.577 87.031  73.636  1.00 0.00 ? 40  A A N9     1  
ATOM 1282   C C8     . A A 1 40  ? 152.824 86.691  74.733  1.00 0.00 ? 40  A A C8     1  
ATOM 1283   N N7     . A A 1 40  ? 153.175 85.555  75.284  1.00 0.00 ? 40  A A N7     1  
ATOM 1284   C C5     . A A 1 40  ? 154.231 85.116  74.497  1.00 0.00 ? 40  A A C5     1  
ATOM 1285   C C6     . A A 1 40  ? 155.044 83.970  74.557  1.00 0.00 ? 40  A A C6     1  
ATOM 1286   N N6     . A A 1 40  ? 154.912 83.016  75.482  1.00 0.00 ? 40  A A N6     1  
ATOM 1287   N N1     . A A 1 40  ? 156.008 83.834  73.622  1.00 0.00 ? 40  A A N1     1  
ATOM 1288   C C2     . A A 1 40  ? 156.140 84.790  72.693  1.00 0.00 ? 40  A A C2     1  
ATOM 1289   N N3     . A A 1 40  ? 155.440 85.910  72.534  1.00 0.00 ? 40  A A N3     1  
ATOM 1290   C C4     . A A 1 40  ? 154.489 86.015  73.479  1.00 0.00 ? 40  A A C4     1  
ATOM 1291   H "H5'"  . A A 1 40  ? 152.225 91.184  75.163  1.00 0.00 ? 40  A A "H5'"  1  
ATOM 1292   H "H5''" . A A 1 40  ? 150.709 90.915  74.742  1.00 0.00 ? 40  A A "H5''" 1  
ATOM 1293   H "H4'"  . A A 1 40  ? 152.102 90.729  72.895  1.00 0.00 ? 40  A A "H4'"  1  
ATOM 1294   H "H3'"  . A A 1 40  ? 150.924 88.235  73.587  1.00 0.00 ? 40  A A "H3'"  1  
ATOM 1295   H "H2'"  . A A 1 40  ? 151.908 87.298  71.735  1.00 0.00 ? 40  A A "H2'"  1  
ATOM 1296   H "HO2'" . A A 1 40  ? 151.593 89.556  70.639  1.00 0.00 ? 40  A A "HO2'" 1  
ATOM 1297   H "H1'"  . A A 1 40  ? 154.231 88.292  72.193  1.00 0.00 ? 40  A A "H1'"  1  
ATOM 1298   H H8     . A A 1 40  ? 152.091 87.247  75.072  1.00 0.00 ? 40  A A H8     1  
ATOM 1299   H H61    . A A 1 40  ? 155.509 82.239  75.473  1.00 0.00 ? 40  A A H61    1  
ATOM 1300   H H62    . A A 1 40  ? 154.219 83.094  76.171  1.00 0.00 ? 40  A A H62    1  
ATOM 1301   H H2     . A A 1 40  ? 156.855 84.643  72.038  1.00 0.00 ? 40  A A H2     1  
ATOM 1302   P P      . A A 1 41  ? 148.621 88.677  72.468  1.00 0.00 ? 41  A A P      1  
ATOM 1303   O OP1    . A A 1 41  ? 147.797 88.911  71.257  1.00 0.00 ? 41  A A OP1    1  
ATOM 1304   O OP2    . A A 1 41  ? 148.110 89.095  73.797  1.00 0.00 ? 41  A A OP2    1  
ATOM 1305   O "O5'"  . A A 1 41  ? 148.962 87.122  72.539  1.00 0.00 ? 41  A A "O5'"  1  
ATOM 1306   C "C5'"  . A A 1 41  ? 148.246 86.182  71.753  1.00 0.00 ? 41  A A "C5'"  1  
ATOM 1307   C "C4'"  . A A 1 41  ? 148.883 85.991  70.400  1.00 0.00 ? 41  A A "C4'"  1  
ATOM 1308   O "O4'"  . A A 1 41  ? 150.295 85.737  70.595  1.00 0.00 ? 41  A A "O4'"  1  
ATOM 1309   C "C3'"  . A A 1 41  ? 148.345 84.839  69.565  1.00 0.00 ? 41  A A "C3'"  1  
ATOM 1310   O "O3'"  . A A 1 41  ? 148.236 85.154  68.188  1.00 0.00 ? 41  A A "O3'"  1  
ATOM 1311   C "C2'"  . A A 1 41  ? 149.389 83.731  69.785  1.00 0.00 ? 41  A A "C2'"  1  
ATOM 1312   O "O2'"  . A A 1 41  ? 149.524 82.914  68.631  1.00 0.00 ? 41  A A "O2'"  1  
ATOM 1313   C "C1'"  . A A 1 41  ? 150.695 84.520  69.972  1.00 0.00 ? 41  A A "C1'"  1  
ATOM 1314   N N9     . A A 1 41  ? 151.647 83.818  70.854  1.00 0.00 ? 41  A A N9     1  
ATOM 1315   C C8     . A A 1 41  ? 151.549 83.612  72.208  1.00 0.00 ? 41  A A C8     1  
ATOM 1316   N N7     . A A 1 41  ? 152.559 82.950  72.716  1.00 0.00 ? 41  A A N7     1  
ATOM 1317   C C5     . A A 1 41  ? 153.379 82.703  71.623  1.00 0.00 ? 41  A A C5     1  
ATOM 1318   C C6     . A A 1 41  ? 154.612 82.039  71.494  1.00 0.00 ? 41  A A C6     1  
ATOM 1319   N N6     . A A 1 41  ? 155.261 81.479  72.517  1.00 0.00 ? 41  A A N6     1  
ATOM 1320   N N1     . A A 1 41  ? 155.162 81.968  70.263  1.00 0.00 ? 41  A A N1     1  
ATOM 1321   C C2     . A A 1 41  ? 154.511 82.530  69.236  1.00 0.00 ? 41  A A C2     1  
ATOM 1322   N N3     . A A 1 41  ? 153.349 83.180  69.231  1.00 0.00 ? 41  A A N3     1  
ATOM 1323   C C4     . A A 1 41  ? 152.828 83.231  70.470  1.00 0.00 ? 41  A A C4     1  
ATOM 1324   H "H5'"  . A A 1 41  ? 147.327 86.500  71.632  1.00 0.00 ? 41  A A "H5'"  1  
ATOM 1325   H "H5''" . A A 1 41  ? 148.226 85.321  72.221  1.00 0.00 ? 41  A A "H5''" 1  
ATOM 1326   H "H4'"  . A A 1 41  ? 148.796 86.822  69.886  1.00 0.00 ? 41  A A "H4'"  1  
ATOM 1327   H "H3'"  . A A 1 41  ? 147.468 84.558  69.901  1.00 0.00 ? 41  A A "H3'"  1  
ATOM 1328   H "H2'"  . A A 1 41  ? 149.187 83.201  70.584  1.00 0.00 ? 41  A A "H2'"  1  
ATOM 1329   H "HO2'" . A A 1 41  ? 148.725 83.017  68.074  1.00 0.00 ? 41  A A "HO2'" 1  
ATOM 1330   H "H1'"  . A A 1 41  ? 151.111 84.673  69.097  1.00 0.00 ? 41  A A "H1'"  1  
ATOM 1331   H H8     . A A 1 41  ? 150.794 83.931  72.745  1.00 0.00 ? 41  A A H8     1  
ATOM 1332   H H61    . A A 1 41  ? 156.119 81.030  72.366  1.00 0.00 ? 41  A A H61    1  
ATOM 1333   H H62    . A A 1 41  ? 154.881 81.518  73.420  1.00 0.00 ? 41  A A H62    1  
ATOM 1334   H H2     . A A 1 41  ? 154.953 82.451  68.364  1.00 0.00 ? 41  A A H2     1  
ATOM 1335   P P      . A A 1 42  ? 146.969 85.981  67.646  1.00 0.00 ? 42  A A P      1  
ATOM 1336   O OP1    . A A 1 42  ? 146.781 87.163  68.524  1.00 0.00 ? 42  A A OP1    1  
ATOM 1337   O OP2    . A A 1 42  ? 145.849 85.027  67.448  1.00 0.00 ? 42  A A OP2    1  
ATOM 1338   O "O5'"  . A A 1 42  ? 147.432 86.500  66.213  1.00 0.00 ? 42  A A "O5'"  1  
ATOM 1339   C "C5'"  . A A 1 42  ? 148.613 87.275  66.065  1.00 0.00 ? 42  A A "C5'"  1  
ATOM 1340   C "C4'"  . A A 1 42  ? 149.249 87.063  64.714  1.00 0.00 ? 42  A A "C4'"  1  
ATOM 1341   O "O4'"  . A A 1 42  ? 149.666 85.682  64.593  1.00 0.00 ? 42  A A "O4'"  1  
ATOM 1342   C "C3'"  . A A 1 42  ? 148.344 87.272  63.510  1.00 0.00 ? 42  A A "C3'"  1  
ATOM 1343   O "O3'"  . A A 1 42  ? 148.203 88.636  63.151  1.00 0.00 ? 42  A A "O3'"  1  
ATOM 1344   C "C2'"  . A A 1 42  ? 149.023 86.435  62.438  1.00 0.00 ? 42  A A "C2'"  1  
ATOM 1345   O "O2'"  . A A 1 42  ? 150.155 87.105  61.902  1.00 0.00 ? 42  A A "O2'"  1  
ATOM 1346   C "C1'"  . A A 1 42  ? 149.489 85.239  63.261  1.00 0.00 ? 42  A A "C1'"  1  
ATOM 1347   N N9     . A A 1 42  ? 148.505 84.140  63.251  1.00 0.00 ? 42  A A N9     1  
ATOM 1348   C C8     . A A 1 42  ? 147.872 83.564  64.325  1.00 0.00 ? 42  A A C8     1  
ATOM 1349   N N7     . A A 1 42  ? 147.045 82.601  63.997  1.00 0.00 ? 42  A A N7     1  
ATOM 1350   C C5     . A A 1 42  ? 147.139 82.539  62.613  1.00 0.00 ? 42  A A C5     1  
ATOM 1351   C C6     . A A 1 42  ? 146.511 81.721  61.657  1.00 0.00 ? 42  A A C6     1  
ATOM 1352   N N6     . A A 1 42  ? 145.625 80.770  61.964  1.00 0.00 ? 42  A A N6     1  
ATOM 1353   N N1     . A A 1 42  ? 146.826 81.916  60.359  1.00 0.00 ? 42  A A N1     1  
ATOM 1354   C C2     . A A 1 42  ? 147.714 82.870  60.051  1.00 0.00 ? 42  A A C2     1  
ATOM 1355   N N3     . A A 1 42  ? 148.371 83.701  60.858  1.00 0.00 ? 42  A A N3     1  
ATOM 1356   C C4     . A A 1 42  ? 148.034 83.481  62.141  1.00 0.00 ? 42  A A C4     1  
ATOM 1357   H "H5'"  . A A 1 42  ? 149.253 87.020  66.763  1.00 0.00 ? 42  A A "H5'"  1  
ATOM 1358   H "H5''" . A A 1 42  ? 148.390 88.223  66.168  1.00 0.00 ? 42  A A "H5''" 1  
ATOM 1359   H "H4'"  . A A 1 42  ? 150.033 87.644  64.625  1.00 0.00 ? 42  A A "H4'"  1  
ATOM 1360   H "H3'"  . A A 1 42  ? 147.458 86.897  63.699  1.00 0.00 ? 42  A A "H3'"  1  
ATOM 1361   H "H2'"  . A A 1 42  ? 148.392 86.169  61.736  1.00 0.00 ? 42  A A "H2'"  1  
ATOM 1362   H "HO2'" . A A 1 42  ? 150.566 86.537  61.217  1.00 0.00 ? 42  A A "HO2'" 1  
ATOM 1363   H "H1'"  . A A 1 42  ? 150.345 84.915  62.909  1.00 0.00 ? 42  A A "H1'"  1  
ATOM 1364   H H8     . A A 1 42  ? 148.024 83.846  65.251  1.00 0.00 ? 42  A A H8     1  
ATOM 1365   H H61    . A A 1 42  ? 145.220 80.231  61.253  1.00 0.00 ? 42  A A H61    1  
ATOM 1366   H H62    . A A 1 42  ? 145.381 80.610  62.899  1.00 0.00 ? 42  A A H62    1  
ATOM 1367   H H2     . A A 1 42  ? 147.909 82.971  59.095  1.00 0.00 ? 42  A A H2     1  
ATOM 1368   P P      . G A 1 43  ? 146.781 89.200  62.659  1.00 0.00 ? 43  G A P      1  
ATOM 1369   O OP1    . G A 1 43  ? 146.889 90.676  62.535  1.00 0.00 ? 43  G A OP1    1  
ATOM 1370   O OP2    . G A 1 43  ? 145.728 88.611  63.525  1.00 0.00 ? 43  G A OP2    1  
ATOM 1371   O "O5'"  . G A 1 43  ? 146.611 88.594  61.196  1.00 0.00 ? 43  G A "O5'"  1  
ATOM 1372   C "C5'"  . G A 1 43  ? 147.459 89.006  60.134  1.00 0.00 ? 43  G A "C5'"  1  
ATOM 1373   C "C4'"  . G A 1 43  ? 147.019 88.418  58.815  1.00 0.00 ? 43  G A "C4'"  1  
ATOM 1374   O "O4'"  . G A 1 43  ? 147.239 86.985  58.817  1.00 0.00 ? 43  G A "O4'"  1  
ATOM 1375   C "C3'"  . G A 1 43  ? 145.546 88.567  58.476  1.00 0.00 ? 43  G A "C3'"  1  
ATOM 1376   O "O3'"  . G A 1 43  ? 145.222 89.845  57.952  1.00 0.00 ? 43  G A "O3'"  1  
ATOM 1377   C "C2'"  . G A 1 43  ? 145.311 87.426  57.494  1.00 0.00 ? 43  G A "C2'"  1  
ATOM 1378   O "O2'"  . G A 1 43  ? 145.796 87.755  56.201  1.00 0.00 ? 43  G A "O2'"  1  
ATOM 1379   C "C1'"  . G A 1 43  ? 146.191 86.327  58.091  1.00 0.00 ? 43  G A "C1'"  1  
ATOM 1380   N N9     . G A 1 43  ? 145.428 85.426  58.975  1.00 0.00 ? 43  G A N9     1  
ATOM 1381   C C8     . G A 1 43  ? 145.479 85.366  60.348  1.00 0.00 ? 43  G A C8     1  
ATOM 1382   N N7     . G A 1 43  ? 144.687 84.461  60.853  1.00 0.00 ? 43  G A N7     1  
ATOM 1383   C C5     . G A 1 43  ? 144.075 83.886  59.748  1.00 0.00 ? 43  G A C5     1  
ATOM 1384   C C6     . G A 1 43  ? 143.113 82.848  59.667  1.00 0.00 ? 43  G A C6     1  
ATOM 1385   O O6     . G A 1 43  ? 142.593 82.205  60.586  1.00 0.00 ? 43  G A O6     1  
ATOM 1386   N N1     . G A 1 43  ? 142.760 82.574  58.348  1.00 0.00 ? 43  G A N1     1  
ATOM 1387   C C2     . G A 1 43  ? 143.270 83.221  57.248  1.00 0.00 ? 43  G A C2     1  
ATOM 1388   N N2     . G A 1 43  ? 142.808 82.816  56.053  1.00 0.00 ? 43  G A N2     1  
ATOM 1389   N N3     . G A 1 43  ? 144.168 84.191  57.309  1.00 0.00 ? 43  G A N3     1  
ATOM 1390   C C4     . G A 1 43  ? 144.522 84.470  58.582  1.00 0.00 ? 43  G A C4     1  
ATOM 1391   H "H5'"  . G A 1 43  ? 148.375 88.716  60.324  1.00 0.00 ? 43  G A "H5'"  1  
ATOM 1392   H "H5''" . G A 1 43  ? 147.439 89.984  60.071  1.00 0.00 ? 43  G A "H5''" 1  
ATOM 1393   H "H4'"  . G A 1 43  ? 147.553 88.819  58.095  1.00 0.00 ? 43  G A "H4'"  1  
ATOM 1394   H "H3'"  . G A 1 43  ? 145.013 88.410  59.285  1.00 0.00 ? 43  G A "H3'"  1  
ATOM 1395   H "H2'"  . G A 1 43  ? 144.369 87.159  57.473  1.00 0.00 ? 43  G A "H2'"  1  
ATOM 1396   H "HO2'" . G A 1 43  ? 145.882 88.728  56.129  1.00 0.00 ? 43  G A "HO2'" 1  
ATOM 1397   H "H1'"  . G A 1 43  ? 146.598 85.808  57.368  1.00 0.00 ? 43  G A "H1'"  1  
ATOM 1398   H H8     . G A 1 43  ? 146.053 85.945  60.892  1.00 0.00 ? 43  G A H8     1  
ATOM 1399   H H1     . G A 1 43  ? 142.101 81.868  58.195  1.00 0.00 ? 43  G A H1     1  
ATOM 1400   H H21    . G A 1 43  ? 142.144 82.100  55.999  1.00 0.00 ? 43  G A H21    1  
ATOM 1401   H H22    . G A 1 43  ? 143.136 83.241  55.234  1.00 0.00 ? 43  G A H22    1  
ATOM 1402   P P      . A A 1 44  ? 143.743 90.444  58.135  1.00 0.00 ? 44  A A P      1  
ATOM 1403   O OP1    . A A 1 44  ? 143.735 91.825  57.594  1.00 0.00 ? 44  A A OP1    1  
ATOM 1404   O OP2    . A A 1 44  ? 143.319 90.201  59.536  1.00 0.00 ? 44  A A OP2    1  
ATOM 1405   O "O5'"  . A A 1 44  ? 142.839 89.537  57.184  1.00 0.00 ? 44  A A "O5'"  1  
ATOM 1406   C "C5'"  . A A 1 44  ? 142.922 89.655  55.771  1.00 0.00 ? 44  A A "C5'"  1  
ATOM 1407   C "C4'"  . A A 1 44  ? 142.008 88.676  55.079  1.00 0.00 ? 44  A A "C4'"  1  
ATOM 1408   O "O4'"  . A A 1 44  ? 142.379 87.319  55.439  1.00 0.00 ? 44  A A "O4'"  1  
ATOM 1409   C "C3'"  . A A 1 44  ? 140.534 88.766  55.443  1.00 0.00 ? 44  A A "C3'"  1  
ATOM 1410   O "O3'"  . A A 1 44  ? 139.860 89.813  54.768  1.00 0.00 ? 44  A A "O3'"  1  
ATOM 1411   C "C2'"  . A A 1 44  ? 140.020 87.377  55.090  1.00 0.00 ? 44  A A "C2'"  1  
ATOM 1412   O "O2'"  . A A 1 44  ? 139.824 87.241  53.690  1.00 0.00 ? 44  A A "O2'"  1  
ATOM 1413   C "C1'"  . A A 1 44  ? 141.196 86.498  55.517  1.00 0.00 ? 44  A A "C1'"  1  
ATOM 1414   N N9     . A A 1 44  ? 141.016 85.947  56.874  1.00 0.00 ? 44  A A N9     1  
ATOM 1415   C C8     . A A 1 44  ? 141.631 86.347  58.034  1.00 0.00 ? 44  A A C8     1  
ATOM 1416   N N7     . A A 1 44  ? 141.265 85.662  59.090  1.00 0.00 ? 44  A A N7     1  
ATOM 1417   C C5     . A A 1 44  ? 140.346 84.748  58.591  1.00 0.00 ? 44  A A C5     1  
ATOM 1418   C C6     . A A 1 44  ? 139.591 83.734  59.205  1.00 0.00 ? 44  A A C6     1  
ATOM 1419   N N6     . A A 1 44  ? 139.641 83.460  60.510  1.00 0.00 ? 44  A A N6     1  
ATOM 1420   N N1     . A A 1 44  ? 138.768 83.004  58.422  1.00 0.00 ? 44  A A N1     1  
ATOM 1421   C C2     . A A 1 44  ? 138.715 83.277  57.113  1.00 0.00 ? 44  A A C2     1  
ATOM 1422   N N3     . A A 1 44  ? 139.374 84.204  56.421  1.00 0.00 ? 44  A A N3     1  
ATOM 1423   C C4     . A A 1 44  ? 140.183 84.913  57.228  1.00 0.00 ? 44  A A C4     1  
ATOM 1424   H "H5'"  . A A 1 44  ? 143.844 89.484  55.489  1.00 0.00 ? 44  A A "H5'"  1  
ATOM 1425   H "H5''" . A A 1 44  ? 142.671 90.565  55.512  1.00 0.00 ? 44  A A "H5''" 1  
ATOM 1426   H "H4'"  . A A 1 44  ? 142.102 88.784  54.111  1.00 0.00 ? 44  A A "H4'"  1  
ATOM 1427   H "H3'"  . A A 1 44  ? 140.451 88.902  56.412  1.00 0.00 ? 44  A A "H3'"  1  
ATOM 1428   H "H2'"  . A A 1 44  ? 139.207 87.156  55.593  1.00 0.00 ? 44  A A "H2'"  1  
ATOM 1429   H "HO2'" . A A 1 44  ? 139.463 86.351  53.504  1.00 0.00 ? 44  A A "HO2'" 1  
ATOM 1430   H "H1'"  . A A 1 44  ? 141.302 85.761  54.876  1.00 0.00 ? 44  A A "H1'"  1  
ATOM 1431   H H8     . A A 1 44  ? 142.285 87.077  58.071  1.00 0.00 ? 44  A A H8     1  
ATOM 1432   H H61    . A A 1 44  ? 139.090 82.738  60.879  1.00 0.00 ? 44  A A H61    1  
ATOM 1433   H H62    . A A 1 44  ? 140.233 83.975  61.098  1.00 0.00 ? 44  A A H62    1  
ATOM 1434   H H2     . A A 1 44  ? 138.102 82.720  56.589  1.00 0.00 ? 44  A A H2     1  
ATOM 1435   P P      . C A 1 45  ? 138.574 90.508  55.436  1.00 0.00 ? 45  C A P      1  
ATOM 1436   O OP1    . C A 1 45  ? 138.160 91.640  54.569  1.00 0.00 ? 45  C A OP1    1  
ATOM 1437   O OP2    . C A 1 45  ? 138.875 90.755  56.868  1.00 0.00 ? 45  C A OP2    1  
ATOM 1438   O "O5'"  . C A 1 45  ? 137.442 89.390  55.355  1.00 0.00 ? 45  C A "O5'"  1  
ATOM 1439   C "C5'"  . C A 1 45  ? 136.904 88.986  54.107  1.00 0.00 ? 45  C A "C5'"  1  
ATOM 1440   C "C4'"  . C A 1 45  ? 135.937 87.838  54.262  1.00 0.00 ? 45  C A "C4'"  1  
ATOM 1441   O "O4'"  . C A 1 45  ? 136.618 86.693  54.836  1.00 0.00 ? 45  C A "O4'"  1  
ATOM 1442   C "C3'"  . C A 1 45  ? 134.759 88.073  55.194  1.00 0.00 ? 45  C A "C3'"  1  
ATOM 1443   O "O3'"  . C A 1 45  ? 133.716 88.823  54.597  1.00 0.00 ? 45  C A "O3'"  1  
ATOM 1444   C "C2'"  . C A 1 45  ? 134.350 86.657  55.577  1.00 0.00 ? 45  C A "C2'"  1  
ATOM 1445   O "O2'"  . C A 1 45  ? 133.605 86.038  54.541  1.00 0.00 ? 45  C A "O2'"  1  
ATOM 1446   C "C1'"  . C A 1 45  ? 135.711 85.967  55.692  1.00 0.00 ? 45  C A "C1'"  1  
ATOM 1447   N N1     . C A 1 45  ? 136.209 85.934  57.090  1.00 0.00 ? 45  C A N1     1  
ATOM 1448   C C2     . C A 1 45  ? 135.676 84.976  57.961  1.00 0.00 ? 45  C A C2     1  
ATOM 1449   O O2     . C A 1 45  ? 134.808 84.193  57.546  1.00 0.00 ? 45  C A O2     1  
ATOM 1450   N N3     . C A 1 45  ? 136.113 84.923  59.241  1.00 0.00 ? 45  C A N3     1  
ATOM 1451   C C4     . C A 1 45  ? 137.046 85.776  59.664  1.00 0.00 ? 45  C A C4     1  
ATOM 1452   N N4     . C A 1 45  ? 137.445 85.686  60.936  1.00 0.00 ? 45  C A N4     1  
ATOM 1453   C C5     . C A 1 45  ? 137.607 86.760  58.805  1.00 0.00 ? 45  C A C5     1  
ATOM 1454   C C6     . C A 1 45  ? 137.167 86.803  57.541  1.00 0.00 ? 45  C A C6     1  
ATOM 1455   H "H5'"  . C A 1 45  ? 137.635 88.712  53.515  1.00 0.00 ? 45  C A "H5'"  1  
ATOM 1456   H "H5''" . C A 1 45  ? 136.433 89.746  53.701  1.00 0.00 ? 45  C A "H5''" 1  
ATOM 1457   H "H4'"  . C A 1 45  ? 135.594 87.592  53.376  1.00 0.00 ? 45  C A "H4'"  1  
ATOM 1458   H "H3'"  . C A 1 45  ? 135.074 88.544  55.997  1.00 0.00 ? 45  C A "H3'"  1  
ATOM 1459   H "H2'"  . C A 1 45  ? 133.868 86.640  56.431  1.00 0.00 ? 45  C A "H2'"  1  
ATOM 1460   H "HO2'" . C A 1 45  ? 133.330 85.145  54.834  1.00 0.00 ? 45  C A "HO2'" 1  
ATOM 1461   H "H1'"  . C A 1 45  ? 135.642 85.053  55.350  1.00 0.00 ? 45  C A "H1'"  1  
ATOM 1462   H H41    . C A 1 45  ? 137.057 85.007  61.527  1.00 0.00 ? 45  C A H41    1  
ATOM 1463   H H42    . C A 1 45  ? 138.129 86.299  61.278  1.00 0.00 ? 45  C A H42    1  
ATOM 1464   H H5     . C A 1 45  ? 138.293 87.383  59.126  1.00 0.00 ? 45  C A H5     1  
ATOM 1465   H H6     . C A 1 45  ? 137.543 87.474  56.933  1.00 0.00 ? 45  C A H6     1  
ATOM 1466   P P      . G A 1 46  ? 132.712 89.685  55.509  1.00 0.00 ? 46  G A P      1  
ATOM 1467   O OP1    . G A 1 46  ? 131.826 90.466  54.608  1.00 0.00 ? 46  G A OP1    1  
ATOM 1468   O OP2    . G A 1 46  ? 133.518 90.390  56.539  1.00 0.00 ? 46  G A OP2    1  
ATOM 1469   O "O5'"  . G A 1 46  ? 131.822 88.585  56.243  1.00 0.00 ? 46  G A "O5'"  1  
ATOM 1470   C "C5'"  . G A 1 46  ? 130.914 87.775  55.514  1.00 0.00 ? 46  G A "C5'"  1  
ATOM 1471   C "C4'"  . G A 1 46  ? 130.286 86.720  56.391  1.00 0.00 ? 46  G A "C4'"  1  
ATOM 1472   O "O4'"  . G A 1 46  ? 131.316 85.850  56.927  1.00 0.00 ? 46  G A "O4'"  1  
ATOM 1473   C "C3'"  . G A 1 46  ? 129.549 87.225  57.620  1.00 0.00 ? 46  G A "C3'"  1  
ATOM 1474   O "O3'"  . G A 1 46  ? 128.252 87.714  57.331  1.00 0.00 ? 46  G A "O3'"  1  
ATOM 1475   C "C2'"  . G A 1 46  ? 129.554 86.009  58.534  1.00 0.00 ? 46  G A "C2'"  1  
ATOM 1476   O "O2'"  . G A 1 46  ? 128.568 85.065  58.140  1.00 0.00 ? 46  G A "O2'"  1  
ATOM 1477   C "C1'"  . G A 1 46  ? 130.940 85.423  58.257  1.00 0.00 ? 46  G A "C1'"  1  
ATOM 1478   N N9     . G A 1 46  ? 131.935 85.847  59.258  1.00 0.00 ? 46  G A N9     1  
ATOM 1479   C C8     . G A 1 46  ? 132.928 86.784  59.099  1.00 0.00 ? 46  G A C8     1  
ATOM 1480   N N7     . G A 1 46  ? 133.656 86.946  60.171  1.00 0.00 ? 46  G A N7     1  
ATOM 1481   C C5     . G A 1 46  ? 133.111 86.064  61.093  1.00 0.00 ? 46  G A C5     1  
ATOM 1482   C C6     . G A 1 46  ? 133.480 85.795  62.437  1.00 0.00 ? 46  G A C6     1  
ATOM 1483   O O6     . G A 1 46  ? 134.394 86.299  63.100  1.00 0.00 ? 46  G A O6     1  
ATOM 1484   N N1     . G A 1 46  ? 132.659 84.827  63.010  1.00 0.00 ? 46  G A N1     1  
ATOM 1485   C C2     . G A 1 46  ? 131.617 84.200  62.374  1.00 0.00 ? 46  G A C2     1  
ATOM 1486   N N2     . G A 1 46  ? 130.940 83.292  63.091  1.00 0.00 ? 46  G A N2     1  
ATOM 1487   N N3     . G A 1 46  ? 131.263 84.443  61.122  1.00 0.00 ? 46  G A N3     1  
ATOM 1488   C C4     . G A 1 46  ? 132.048 85.378  60.546  1.00 0.00 ? 46  G A C4     1  
ATOM 1489   H "H5'"  . G A 1 46  ? 131.394 87.338  54.781  1.00 0.00 ? 46  G A "H5'"  1  
ATOM 1490   H "H5''" . G A 1 46  ? 130.208 88.343  55.140  1.00 0.00 ? 46  G A "H5''" 1  
ATOM 1491   H "H4'"  . G A 1 46  ? 129.668 86.184  55.848  1.00 0.00 ? 46  G A "H4'"  1  
ATOM 1492   H "H3'"  . G A 1 46  ? 130.074 87.941  58.039  1.00 0.00 ? 46  G A "H3'"  1  
ATOM 1493   H "H2'"  . G A 1 46  ? 129.456 86.263  59.476  1.00 0.00 ? 46  G A "H2'"  1  
ATOM 1494   H "HO2'" . G A 1 46  ? 127.897 85.515  57.588  1.00 0.00 ? 46  G A "HO2'" 1  
ATOM 1495   H "H1'"  . G A 1 46  ? 130.883 84.442  58.246  1.00 0.00 ? 46  G A "H1'"  1  
ATOM 1496   H H8     . G A 1 46  ? 133.076 87.279  58.267  1.00 0.00 ? 46  G A H8     1  
ATOM 1497   H H1     . G A 1 46  ? 132.841 84.576  63.939  1.00 0.00 ? 46  G A H1     1  
ATOM 1498   H H21    . G A 1 46  ? 131.195 83.107  64.019  1.00 0.00 ? 46  G A H21    1  
ATOM 1499   H H22    . G A 1 46  ? 130.186 82.812  62.691  1.00 0.00 ? 46  G A H22    1  
ATOM 1500   P P      . G A 1 47  ? 127.573 88.824  58.275  1.00 0.00 ? 47  G A P      1  
ATOM 1501   O OP1    . G A 1 47  ? 126.285 89.228  57.658  1.00 0.00 ? 47  G A OP1    1  
ATOM 1502   O OP2    . G A 1 47  ? 128.600 89.854  58.580  1.00 0.00 ? 47  G A OP2    1  
ATOM 1503   O "O5'"  . G A 1 47  ? 127.250 88.037  59.622  1.00 0.00 ? 47  G A "O5'"  1  
ATOM 1504   C "C5'"  . G A 1 47  ? 126.275 87.006  59.648  1.00 0.00 ? 47  G A "C5'"  1  
ATOM 1505   C "C4'"  . G A 1 47  ? 126.239 86.309  60.984  1.00 0.00 ? 47  G A "C4'"  1  
ATOM 1506   O "O4'"  . G A 1 47  ? 127.531 85.704  61.257  1.00 0.00 ? 47  G A "O4'"  1  
ATOM 1507   C "C3'"  . G A 1 47  ? 125.982 87.195  62.193  1.00 0.00 ? 47  G A "C3'"  1  
ATOM 1508   O "O3'"  . G A 1 47  ? 124.612 87.519  62.362  1.00 0.00 ? 47  G A "O3'"  1  
ATOM 1509   C "C2'"  . G A 1 47  ? 126.560 86.373  63.337  1.00 0.00 ? 47  G A "C2'"  1  
ATOM 1510   O "O2'"  . G A 1 47  ? 125.676 85.329  63.721  1.00 0.00 ? 47  G A "O2'"  1  
ATOM 1511   C "C1'"  . G A 1 47  ? 127.796 85.761  62.677  1.00 0.00 ? 47  G A "C1'"  1  
ATOM 1512   N N9     . G A 1 47  ? 129.020 86.532  62.964  1.00 0.00 ? 47  G A N9     1  
ATOM 1513   C C8     . G A 1 47  ? 129.692 87.374  62.111  1.00 0.00 ? 47  G A C8     1  
ATOM 1514   N N7     . G A 1 47  ? 130.748 87.918  62.652  1.00 0.00 ? 47  G A N7     1  
ATOM 1515   C C5     . G A 1 47  ? 130.775 87.406  63.942  1.00 0.00 ? 47  G A C5     1  
ATOM 1516   C C6     . G A 1 47  ? 131.688 87.633  65.004  1.00 0.00 ? 47  G A C6     1  
ATOM 1517   O O6     . G A 1 47  ? 132.691 88.359  65.014  1.00 0.00 ? 47  G A O6     1  
ATOM 1518   N N1     . G A 1 47  ? 131.343 86.913  66.143  1.00 0.00 ? 47  G A N1     1  
ATOM 1519   C C2     . G A 1 47  ? 130.257 86.079  66.248  1.00 0.00 ? 47  G A C2     1  
ATOM 1520   N N2     . G A 1 47  ? 130.087 85.467  67.429  1.00 0.00 ? 47  G A N2     1  
ATOM 1521   N N3     . G A 1 47  ? 129.398 85.857  65.266  1.00 0.00 ? 47  G A N3     1  
ATOM 1522   C C4     . G A 1 47  ? 129.714 86.549  64.151  1.00 0.00 ? 47  G A C4     1  
ATOM 1523   H "H5'"  . G A 1 47  ? 126.480 86.351  58.949  1.00 0.00 ? 47  G A "H5'"  1  
ATOM 1524   H "H5''" . G A 1 47  ? 125.392 87.397  59.467  1.00 0.00 ? 47  G A "H5''" 1  
ATOM 1525   H "H4'"  . G A 1 47  ? 125.559 85.603  60.956  1.00 0.00 ? 47  G A "H4'"  1  
ATOM 1526   H "H3'"  . G A 1 47  ? 126.499 88.022  62.101  1.00 0.00 ? 47  G A "H3'"  1  
ATOM 1527   H "H2'"  . G A 1 47  ? 126.804 86.940  64.099  1.00 0.00 ? 47  G A "H2'"  1  
ATOM 1528   H "HO2'" . G A 1 47  ? 124.774 85.543  63.407  1.00 0.00 ? 47  G A "HO2'" 1  
ATOM 1529   H "H1'"  . G A 1 47  ? 127.909 84.839  62.990  1.00 0.00 ? 47  G A "H1'"  1  
ATOM 1530   H H8     . G A 1 47  ? 129.410 87.547  61.192  1.00 0.00 ? 47  G A H8     1  
ATOM 1531   H H1     . G A 1 47  ? 131.921 87.008  66.929  1.00 0.00 ? 47  G A H1     1  
ATOM 1532   H H21    . G A 1 47  ? 130.720 85.626  68.160  1.00 0.00 ? 47  G A H21    1  
ATOM 1533   H H22    . G A 1 47  ? 129.330 84.861  67.564  1.00 0.00 ? 47  G A H22    1  
ATOM 1534   P P      . C A 1 48  ? 124.190 88.883  63.099  1.00 0.00 ? 48  C A P      1  
ATOM 1535   O OP1    . C A 1 48  ? 122.712 89.010  63.018  1.00 0.00 ? 48  C A OP1    1  
ATOM 1536   O OP2    . C A 1 48  ? 125.048 89.975  62.578  1.00 0.00 ? 48  C A OP2    1  
ATOM 1537   O "O5'"  . C A 1 48  ? 124.579 88.633  64.623  1.00 0.00 ? 48  C A "O5'"  1  
ATOM 1538   C "C5'"  . C A 1 48  ? 123.880 87.681  65.410  1.00 0.00 ? 48  C A "C5'"  1  
ATOM 1539   C "C4'"  . C A 1 48  ? 124.498 87.525  66.779  1.00 0.00 ? 48  C A "C4'"  1  
ATOM 1540   O "O4'"  . C A 1 48  ? 125.868 87.065  66.653  1.00 0.00 ? 48  C A "O4'"  1  
ATOM 1541   C "C3'"  . C A 1 48  ? 124.610 88.794  67.610  1.00 0.00 ? 48  C A "C3'"  1  
ATOM 1542   O "O3'"  . C A 1 48  ? 123.390 89.155  68.239  1.00 0.00 ? 48  C A "O3'"  1  
ATOM 1543   C "C2'"  . C A 1 48  ? 125.723 88.452  68.590  1.00 0.00 ? 48  C A "C2'"  1  
ATOM 1544   O "O2'"  . C A 1 48  ? 125.250 87.617  69.638  1.00 0.00 ? 48  C A "O2'"  1  
ATOM 1545   C "C1'"  . C A 1 48  ? 126.671 87.645  67.703  1.00 0.00 ? 48  C A "C1'"  1  
ATOM 1546   N N1     . C A 1 48  ? 127.766 88.477  67.143  1.00 0.00 ? 48  C A N1     1  
ATOM 1547   C C2     . C A 1 48  ? 128.852 88.789  67.971  1.00 0.00 ? 48  C A C2     1  
ATOM 1548   O O2     . C A 1 48  ? 128.868 88.363  69.136  1.00 0.00 ? 48  C A O2     1  
ATOM 1549   N N3     . C A 1 48  ? 129.863 89.545  67.487  1.00 0.00 ? 48  C A N3     1  
ATOM 1550   C C4     . C A 1 48  ? 129.821 89.991  66.232  1.00 0.00 ? 48  C A C4     1  
ATOM 1551   N N4     . C A 1 48  ? 130.842 90.735  65.797  1.00 0.00 ? 48  C A N4     1  
ATOM 1552   C C5     . C A 1 48  ? 128.732 89.693  65.366  1.00 0.00 ? 48  C A C5     1  
ATOM 1553   C C6     . C A 1 48  ? 127.738 88.940  65.856  1.00 0.00 ? 48  C A C6     1  
ATOM 1554   H "H5'"  . C A 1 48  ? 123.898 86.815  64.951  1.00 0.00 ? 48  C A "H5'"  1  
ATOM 1555   H "H5''" . C A 1 48  ? 122.949 87.970  65.510  1.00 0.00 ? 48  C A "H5''" 1  
ATOM 1556   H "H4'"  . C A 1 48  ? 123.982 86.859  67.282  1.00 0.00 ? 48  C A "H4'"  1  
ATOM 1557   H "H3'"  . C A 1 48  ? 124.904 89.531  67.034  1.00 0.00 ? 48  C A "H3'"  1  
ATOM 1558   H "H2'"  . C A 1 48  ? 126.157 89.258  68.939  1.00 0.00 ? 48  C A "H2'"  1  
ATOM 1559   H "HO2'" . C A 1 48  ? 124.274 87.696  69.694  1.00 0.00 ? 48  C A "HO2'" 1  
ATOM 1560   H "H1'"  . C A 1 48  ? 127.057 86.909  68.223  1.00 0.00 ? 48  C A "H1'"  1  
ATOM 1561   H H41    . C A 1 48  ? 131.591 90.939  66.395  1.00 0.00 ? 48  C A H41    1  
ATOM 1562   H H42    . C A 1 48  ? 130.841 91.077  64.879  1.00 0.00 ? 48  C A H42    1  
ATOM 1563   H H5     . C A 1 48  ? 128.712 90.024  64.444  1.00 0.00 ? 48  C A H5     1  
ATOM 1564   H H6     . C A 1 48  ? 126.979 88.726  65.276  1.00 0.00 ? 48  C A H6     1  
ATOM 1565   P P      . C A 1 49  ? 123.096 90.692  68.610  1.00 0.00 ? 49  C A P      1  
ATOM 1566   O OP1    . C A 1 49  ? 121.711 90.780  69.139  1.00 0.00 ? 49  C A OP1    1  
ATOM 1567   O OP2    . C A 1 49  ? 123.494 91.531  67.452  1.00 0.00 ? 49  C A OP2    1  
ATOM 1568   O "O5'"  . C A 1 49  ? 124.099 90.997  69.809  1.00 0.00 ? 49  C A "O5'"  1  
ATOM 1569   C "C5'"  . C A 1 49  ? 123.923 90.391  71.081  1.00 0.00 ? 49  C A "C5'"  1  
ATOM 1570   C "C4'"  . C A 1 49  ? 125.042 90.751  72.029  1.00 0.00 ? 49  C A "C4'"  1  
ATOM 1571   O "O4'"  . C A 1 49  ? 126.309 90.283  71.499  1.00 0.00 ? 49  C A "O4'"  1  
ATOM 1572   C "C3'"  . C A 1 49  ? 125.266 92.236  72.267  1.00 0.00 ? 49  C A "C3'"  1  
ATOM 1573   O "O3'"  . C A 1 49  ? 124.343 92.797  73.184  1.00 0.00 ? 49  C A "O3'"  1  
ATOM 1574   C "C2'"  . C A 1 49  ? 126.709 92.279  72.749  1.00 0.00 ? 49  C A "C2'"  1  
ATOM 1575   O "O2'"  . C A 1 49  ? 126.811 91.889  74.112  1.00 0.00 ? 49  C A "O2'"  1  
ATOM 1576   C "C1'"  . C A 1 49  ? 127.356 91.203  71.874  1.00 0.00 ? 49  C A "C1'"  1  
ATOM 1577   N N1     . C A 1 49  ? 128.013 91.776  70.673  1.00 0.00 ? 49  C A N1     1  
ATOM 1578   C C2     . C A 1 49  ? 129.271 92.372  70.822  1.00 0.00 ? 49  C A C2     1  
ATOM 1579   O O2     . C A 1 49  ? 129.796 92.406  71.945  1.00 0.00 ? 49  C A O2     1  
ATOM 1580   N N3     . C A 1 49  ? 129.892 92.898  69.741  1.00 0.00 ? 49  C A N3     1  
ATOM 1581   C C4     . C A 1 49  ? 129.307 92.849  68.545  1.00 0.00 ? 49  C A C4     1  
ATOM 1582   N N4     . C A 1 49  ? 129.956 93.382  67.507  1.00 0.00 ? 49  C A N4     1  
ATOM 1583   C C5     . C A 1 49  ? 128.028 92.251  68.359  1.00 0.00 ? 49  C A C5     1  
ATOM 1584   C C6     . C A 1 49  ? 127.424 91.732  69.437  1.00 0.00 ? 49  C A C6     1  
ATOM 1585   H "H5'"  . C A 1 49  ? 123.899 89.417  70.969  1.00 0.00 ? 49  C A "H5'"  1  
ATOM 1586   H "H5''" . C A 1 49  ? 123.072 90.692  71.462  1.00 0.00 ? 49  C A "H5''" 1  
ATOM 1587   H "H4'"  . C A 1 49  ? 124.877 90.313  72.891  1.00 0.00 ? 49  C A "H4'"  1  
ATOM 1588   H "H3'"  . C A 1 49  ? 125.199 92.713  71.413  1.00 0.00 ? 49  C A "H3'"  1  
ATOM 1589   H "H2'"  . C A 1 49  ? 127.116 93.160  72.593  1.00 0.00 ? 49  C A "H2'"  1  
ATOM 1590   H "HO2'" . C A 1 49  ? 125.933 91.984  74.536  1.00 0.00 ? 49  C A "HO2'" 1  
ATOM 1591   H "H1'"  . C A 1 49  ? 128.019 90.709  72.402  1.00 0.00 ? 49  C A "H1'"  1  
ATOM 1592   H H41    . C A 1 49  ? 130.835 93.792  67.638  1.00 0.00 ? 49  C A H41    1  
ATOM 1593   H H42    . C A 1 49  ? 129.552 93.361  66.615  1.00 0.00 ? 49  C A H42    1  
ATOM 1594   H H5     . C A 1 49  ? 127.607 92.218  67.476  1.00 0.00 ? 49  C A H5     1  
ATOM 1595   H H6     . C A 1 49  ? 126.544 91.314  69.329  1.00 0.00 ? 49  C A H6     1  
ATOM 1596   P P      . A A 1 50  ? 123.989 94.366  73.118  1.00 0.00 ? 50  A A P      1  
ATOM 1597   O OP1    . A A 1 50  ? 122.905 94.632  74.096  1.00 0.00 ? 50  A A OP1    1  
ATOM 1598   O OP2    . A A 1 50  ? 123.801 94.734  71.694  1.00 0.00 ? 50  A A OP2    1  
ATOM 1599   O "O5'"  . A A 1 50  ? 125.314 95.080  73.642  1.00 0.00 ? 50  A A "O5'"  1  
ATOM 1600   C "C5'"  . A A 1 50  ? 125.743 94.923  74.985  1.00 0.00 ? 50  A A "C5'"  1  
ATOM 1601   C "C4'"  . A A 1 50  ? 127.089 95.570  75.215  1.00 0.00 ? 50  A A "C4'"  1  
ATOM 1602   O "O4'"  . A A 1 50  ? 128.087 94.932  74.376  1.00 0.00 ? 50  A A "O4'"  1  
ATOM 1603   C "C3'"  . A A 1 50  ? 127.190 97.044  74.860  1.00 0.00 ? 50  A A "C3'"  1  
ATOM 1604   O "O3'"  . A A 1 50  ? 126.645 97.893  75.855  1.00 0.00 ? 50  A A "O3'"  1  
ATOM 1605   C "C2'"  . A A 1 50  ? 128.686 97.232  74.651  1.00 0.00 ? 50  A A "C2'"  1  
ATOM 1606   O "O2'"  . A A 1 50  ? 129.373 97.326  75.890  1.00 0.00 ? 50  A A "O2'"  1  
ATOM 1607   C "C1'"  . A A 1 50  ? 129.066 95.917  73.970  1.00 0.00 ? 50  A A "C1'"  1  
ATOM 1608   N N9     . A A 1 50  ? 129.115 96.042  72.501  1.00 0.00 ? 50  A A N9     1  
ATOM 1609   C C8     . A A 1 50  ? 128.196 95.598  71.584  1.00 0.00 ? 50  A A C8     1  
ATOM 1610   N N7     . A A 1 50  ? 128.519 95.860  70.342  1.00 0.00 ? 50  A A N7     1  
ATOM 1611   C C5     . A A 1 50  ? 129.736 96.523  70.447  1.00 0.00 ? 50  A A C5     1  
ATOM 1612   C C6     . A A 1 50  ? 130.603 97.065  69.483  1.00 0.00 ? 50  A A C6     1  
ATOM 1613   N N6     . A A 1 50  ? 130.369 97.026  68.169  1.00 0.00 ? 50  A A N6     1  
ATOM 1614   N N1     . A A 1 50  ? 131.736 97.659  69.921  1.00 0.00 ? 50  A A N1     1  
ATOM 1615   C C2     . A A 1 50  ? 131.970 97.700  71.238  1.00 0.00 ? 50  A A C2     1  
ATOM 1616   N N3     . A A 1 50  ? 131.231 97.227  72.240  1.00 0.00 ? 50  A A N3     1  
ATOM 1617   C C4     . A A 1 50  ? 130.114 96.642  71.771  1.00 0.00 ? 50  A A C4     1  
ATOM 1618   H "H5'"  . A A 1 50  ? 125.809 93.968  75.192  1.00 0.00 ? 50  A A "H5'"  1  
ATOM 1619   H "H5''" . A A 1 50  ? 125.086 95.336  75.583  1.00 0.00 ? 50  A A "H5''" 1  
ATOM 1620   H "H4'"  . A A 1 50  ? 127.340 95.451  76.155  1.00 0.00 ? 50  A A "H4'"  1  
ATOM 1621   H "H3'"  . A A 1 50  ? 126.725 97.203  74.011  1.00 0.00 ? 50  A A "H3'"  1  
ATOM 1622   H "H2'"  . A A 1 50  ? 128.874 98.002  74.071  1.00 0.00 ? 50  A A "H2'"  1  
ATOM 1623   H "HO2'" . A A 1 50  ? 130.067 98.013  75.819  1.00 0.00 ? 50  A A "HO2'" 1  
ATOM 1624   H "H1'"  . A A 1 50  ? 129.939 95.618  74.301  1.00 0.00 ? 50  A A "H1'"  1  
ATOM 1625   H H8     . A A 1 50  ? 127.373 95.128  71.835  1.00 0.00 ? 50  A A H8     1  
ATOM 1626   H H61    . A A 1 50  ? 131.014 97.423  67.546  1.00 0.00 ? 50  A A H61    1  
ATOM 1627   H H62    . A A 1 50  ? 129.555 96.601  67.829  1.00 0.00 ? 50  A A H62    1  
ATOM 1628   H H2     . A A 1 50  ? 132.803 98.141  71.503  1.00 0.00 ? 50  A A H2     1  
ATOM 1629   P P      . A A 1 51  ? 126.976 99.461  75.829  1.00 0.00 ? 51  A A P      1  
ATOM 1630   O OP1    . A A 1 51  ? 126.053 100.167 76.752  1.00 0.00 ? 51  A A OP1    1  
ATOM 1631   O OP2    . A A 1 51  ? 126.946 99.775  74.378  1.00 0.00 ? 51  A A OP2    1  
ATOM 1632   O "O5'"  . A A 1 51  ? 128.465 99.687  76.351  1.00 0.00 ? 51  A A "O5'"  1  
ATOM 1633   C "C5'"  . A A 1 51  ? 129.109 100.942 76.195  1.00 0.00 ? 51  A A "C5'"  1  
ATOM 1634   C "C4'"  . A A 1 51  ? 130.523 100.782 75.696  1.00 0.00 ? 51  A A "C4'"  1  
ATOM 1635   O "O4'"  . A A 1 51  ? 130.557 99.793  74.635  1.00 0.00 ? 51  A A "O4'"  1  
ATOM 1636   C "C3'"  . A A 1 51  ? 131.156 102.017 75.074  1.00 0.00 ? 51  A A "C3'"  1  
ATOM 1637   O "O3'"  . A A 1 51  ? 131.686 102.913 76.036  1.00 0.00 ? 51  A A "O3'"  1  
ATOM 1638   C "C2'"  . A A 1 51  ? 132.209 101.424 74.149  1.00 0.00 ? 51  A A "C2'"  1  
ATOM 1639   O "O2'"  . A A 1 51  ? 133.380 101.063 74.866  1.00 0.00 ? 51  A A "O2'"  1  
ATOM 1640   C "C1'"  . A A 1 51  ? 131.505 100.154 73.671  1.00 0.00 ? 51  A A "C1'"  1  
ATOM 1641   N N9     . A A 1 51  ? 130.833 100.347 72.372  1.00 0.00 ? 51  A A N9     1  
ATOM 1642   C C8     . A A 1 51  ? 129.539 100.034 72.036  1.00 0.00 ? 51  A A C8     1  
ATOM 1643   N N7     . A A 1 51  ? 129.229 100.324 70.797  1.00 0.00 ? 51  A A N7     1  
ATOM 1644   C C5     . A A 1 51  ? 130.398 100.865 70.279  1.00 0.00 ? 51  A A C5     1  
ATOM 1645   C C6     . A A 1 51  ? 130.727 101.371 69.009  1.00 0.00 ? 51  A A C6     1  
ATOM 1646   N N6     . A A 1 51  ? 129.870 101.417 67.986  1.00 0.00 ? 51  A A N6     1  
ATOM 1647   N N1     . A A 1 51  ? 131.981 101.835 68.823  1.00 0.00 ? 51  A A N1     1  
ATOM 1648   C C2     . A A 1 51  ? 132.841 101.790 69.849  1.00 0.00 ? 51  A A C2     1  
ATOM 1649   N N3     . A A 1 51  ? 132.650 101.339 71.087  1.00 0.00 ? 51  A A N3     1  
ATOM 1650   C C4     . A A 1 51  ? 131.393 100.885 71.239  1.00 0.00 ? 51  A A C4     1  
ATOM 1651   H "H5'"  . A A 1 51  ? 129.126 101.403 77.060  1.00 0.00 ? 51  A A "H5'"  1  
ATOM 1652   H "H5''" . A A 1 51  ? 128.603 101.485 75.555  1.00 0.00 ? 51  A A "H5''" 1  
ATOM 1653   H "H4'"  . A A 1 51  ? 131.088 100.474 76.435  1.00 0.00 ? 51  A A "H4'"  1  
ATOM 1654   H "H3'"  . A A 1 51  ? 130.483 102.486 74.536  1.00 0.00 ? 51  A A "H3'"  1  
ATOM 1655   H "H2'"  . A A 1 51  ? 132.411 102.026 73.402  1.00 0.00 ? 51  A A "H2'"  1  
ATOM 1656   H "HO2'" . A A 1 51  ? 134.051 100.730 74.234  1.00 0.00 ? 51  A A "HO2'" 1  
ATOM 1657   H "H1'"  . A A 1 51  ? 132.159 99.427  73.596  1.00 0.00 ? 51  A A "H1'"  1  
ATOM 1658   H H8     . A A 1 51  ? 128.904 99.631  72.666  1.00 0.00 ? 51  A A H8     1  
ATOM 1659   H H61    . A A 1 51  ? 130.158 101.781 67.123  1.00 0.00 ? 51  A A H61    1  
ATOM 1660   H H62    . A A 1 51  ? 128.955 101.085 68.098  1.00 0.00 ? 51  A A H62    1  
ATOM 1661   H H2     . A A 1 51  ? 133.738 102.139 69.662  1.00 0.00 ? 51  A A H2     1  
ATOM 1662   P P      . A A 1 52  ? 132.235 104.353 75.582  1.00 0.00 ? 52  A A P      1  
ATOM 1663   O OP1    . A A 1 52  ? 133.715 104.337 75.690  1.00 0.00 ? 52  A A OP1    1  
ATOM 1664   O OP2    . A A 1 52  ? 131.457 105.391 76.305  1.00 0.00 ? 52  A A OP2    1  
ATOM 1665   O "O5'"  . A A 1 52  ? 131.855 104.441 74.037  1.00 0.00 ? 52  A A "O5'"  1  
ATOM 1666   C "C5'"  . A A 1 52  ? 132.606 105.249 73.146  1.00 0.00 ? 52  A A "C5'"  1  
ATOM 1667   C "C4'"  . A A 1 52  ? 131.728 105.868 72.085  1.00 0.00 ? 52  A A "C4'"  1  
ATOM 1668   O "O4'"  . A A 1 52  ? 131.132 104.822 71.270  1.00 0.00 ? 52  A A "O4'"  1  
ATOM 1669   C "C3'"  . A A 1 52  ? 130.537 106.668 72.589  1.00 0.00 ? 52  A A "C3'"  1  
ATOM 1670   O "O3'"  . A A 1 52  ? 130.884 107.986 72.987  1.00 0.00 ? 52  A A "O3'"  1  
ATOM 1671   C "C2'"  . A A 1 52  ? 129.580 106.620 71.409  1.00 0.00 ? 52  A A "C2'"  1  
ATOM 1672   O "O2'"  . A A 1 52  ? 129.960 107.541 70.398  1.00 0.00 ? 52  A A "O2'"  1  
ATOM 1673   C "C1'"  . A A 1 52  ? 129.801 105.197 70.893  1.00 0.00 ? 52  A A "C1'"  1  
ATOM 1674   N N9     . A A 1 52  ? 128.816 104.247 71.442  1.00 0.00 ? 52  A A N9     1  
ATOM 1675   C C8     . A A 1 52  ? 129.008 103.298 72.415  1.00 0.00 ? 52  A A C8     1  
ATOM 1676   N N7     . A A 1 52  ? 127.936 102.599 72.694  1.00 0.00 ? 52  A A N7     1  
ATOM 1677   C C5     . A A 1 52  ? 126.968 103.122 71.845  1.00 0.00 ? 52  A A C5     1  
ATOM 1678   C C6     . A A 1 52  ? 125.612 102.811 71.651  1.00 0.00 ? 52  A A C6     1  
ATOM 1679   N N6     . A A 1 52  ? 124.966 101.860 72.325  1.00 0.00 ? 52  A A N6     1  
ATOM 1680   N N1     . A A 1 52  ? 124.931 103.522 70.727  1.00 0.00 ? 52  A A N1     1  
ATOM 1681   C C2     . A A 1 52  ? 125.577 104.481 70.050  1.00 0.00 ? 52  A A C2     1  
ATOM 1682   N N3     . A A 1 52  ? 126.848 104.865 70.143  1.00 0.00 ? 52  A A N3     1  
ATOM 1683   C C4     . A A 1 52  ? 127.497 104.137 71.070  1.00 0.00 ? 52  A A C4     1  
ATOM 1684   H "H5'"  . A A 1 52  ? 133.289 104.698 72.711  1.00 0.00 ? 52  A A "H5'"  1  
ATOM 1685   H "H5''" . A A 1 52  ? 133.046 105.962 73.651  1.00 0.00 ? 52  A A "H5''" 1  
ATOM 1686   H "H4'"  . A A 1 52  ? 132.277 106.442 71.513  1.00 0.00 ? 52  A A "H4'"  1  
ATOM 1687   H "H3'"  . A A 1 52  ? 130.132 106.200 73.349  1.00 0.00 ? 52  A A "H3'"  1  
ATOM 1688   H "H2'"  . A A 1 52  ? 128.651 106.758 71.693  1.00 0.00 ? 52  A A "H2'"  1  
ATOM 1689   H "HO2'" . A A 1 52  ? 129.283 107.537 69.690  1.00 0.00 ? 52  A A "HO2'" 1  
ATOM 1690   H "H1'"  . A A 1 52  ? 129.749 105.192 69.915  1.00 0.00 ? 52  A A "H1'"  1  
ATOM 1691   H H8     . A A 1 52  ? 129.871 103.156 72.863  1.00 0.00 ? 52  A A H8     1  
ATOM 1692   H H61    . A A 1 52  ? 124.017 101.687 72.145  1.00 0.00 ? 52  A A H61    1  
ATOM 1693   H H62    . A A 1 52  ? 125.440 101.329 72.999  1.00 0.00 ? 52  A A H62    1  
ATOM 1694   H H2     . A A 1 52  ? 125.039 104.968 69.391  1.00 0.00 ? 52  A A H2     1  
ATOM 1695   P P      . U A 1 53  ? 130.003 108.753 74.089  1.00 0.00 ? 53  U A P      1  
ATOM 1696   O OP1    . U A 1 53  ? 130.639 110.071 74.351  1.00 0.00 ? 53  U A OP1    1  
ATOM 1697   O OP2    . U A 1 53  ? 129.760 107.819 75.218  1.00 0.00 ? 53  U A OP2    1  
ATOM 1698   O "O5'"  . U A 1 53  ? 128.612 109.014 73.358  1.00 0.00 ? 53  U A "O5'"  1  
ATOM 1699   C "C5'"  . U A 1 53  ? 128.508 109.961 72.305  1.00 0.00 ? 53  U A "C5'"  1  
ATOM 1700   C "C4'"  . U A 1 53  ? 127.114 110.008 71.732  1.00 0.00 ? 53  U A "C4'"  1  
ATOM 1701   O "O4'"  . U A 1 53  ? 126.750 108.704 71.207  1.00 0.00 ? 53  U A "O4'"  1  
ATOM 1702   C "C3'"  . U A 1 53  ? 125.996 110.333 72.713  1.00 0.00 ? 53  U A "C3'"  1  
ATOM 1703   O "O3'"  . U A 1 53  ? 125.887 111.721 72.987  1.00 0.00 ? 53  U A "O3'"  1  
ATOM 1704   C "C2'"  . U A 1 53  ? 124.771 109.748 72.028  1.00 0.00 ? 53  U A "C2'"  1  
ATOM 1705   O "O2'"  . U A 1 53  ? 124.313 110.591 70.981  1.00 0.00 ? 53  U A "O2'"  1  
ATOM 1706   C "C1'"  . U A 1 53  ? 125.345 108.467 71.417  1.00 0.00 ? 53  U A "C1'"  1  
ATOM 1707   N N1     . U A 1 53  ? 125.128 107.283 72.285  1.00 0.00 ? 53  U A N1     1  
ATOM 1708   C C2     . U A 1 53  ? 123.863 106.726 72.285  1.00 0.00 ? 53  U A C2     1  
ATOM 1709   O O2     . U A 1 53  ? 122.943 107.160 71.613  1.00 0.00 ? 53  U A O2     1  
ATOM 1710   N N3     . U A 1 53  ? 123.710 105.631 73.101  1.00 0.00 ? 53  U A N3     1  
ATOM 1711   C C4     . U A 1 53  ? 124.667 105.052 73.905  1.00 0.00 ? 53  U A C4     1  
ATOM 1712   O O4     . U A 1 53  ? 124.372 104.068 74.585  1.00 0.00 ? 53  U A O4     1  
ATOM 1713   C C5     . U A 1 53  ? 125.951 105.682 73.853  1.00 0.00 ? 53  U A C5     1  
ATOM 1714   C C6     . U A 1 53  ? 126.130 106.747 73.066  1.00 0.00 ? 53  U A C6     1  
ATOM 1715   H "H5'"  . U A 1 53  ? 129.138 109.719 71.594  1.00 0.00 ? 53  U A "H5'"  1  
ATOM 1716   H "H5''" . U A 1 53  ? 128.741 110.850 72.649  1.00 0.00 ? 53  U A "H5''" 1  
ATOM 1717   H "H4'"  . U A 1 53  ? 127.093 110.661 71.001  1.00 0.00 ? 53  U A "H4'"  1  
ATOM 1718   H "H3'"  . U A 1 53  ? 126.154 109.851 73.553  1.00 0.00 ? 53  U A "H3'"  1  
ATOM 1719   H "H2'"  . U A 1 53  ? 124.058 109.547 72.671  1.00 0.00 ? 53  U A "H2'"  1  
ATOM 1720   H "HO2'" . U A 1 53  ? 123.494 110.211 70.599  1.00 0.00 ? 53  U A "HO2'" 1  
ATOM 1721   H "H1'"  . U A 1 53  ? 124.930 108.308 70.543  1.00 0.00 ? 53  U A "H1'"  1  
ATOM 1722   H H3     . U A 1 53  ? 122.820 105.221 73.118  1.00 0.00 ? 53  U A H3     1  
ATOM 1723   H H5     . U A 1 53  ? 126.694 105.334 74.391  1.00 0.00 ? 53  U A H5     1  
ATOM 1724   H H6     . U A 1 53  ? 127.017 107.161 73.048  1.00 0.00 ? 53  U A H6     1  
ATOM 1725   P P      . U A 1 54  ? 125.277 112.224 74.386  1.00 0.00 ? 54  U A P      1  
ATOM 1726   O OP1    . U A 1 54  ? 125.408 113.701 74.440  1.00 0.00 ? 54  U A OP1    1  
ATOM 1727   O OP2    . U A 1 54  ? 125.863 111.392 75.467  1.00 0.00 ? 54  U A OP2    1  
ATOM 1728   O "O5'"  . U A 1 54  ? 123.727 111.870 74.279  1.00 0.00 ? 54  U A "O5'"  1  
ATOM 1729   C "C5'"  . U A 1 54  ? 122.887 112.549 73.355  1.00 0.00 ? 54  U A "C5'"  1  
ATOM 1730   C "C4'"  . U A 1 54  ? 121.501 111.950 73.320  1.00 0.00 ? 54  U A "C4'"  1  
ATOM 1731   O "O4'"  . U A 1 54  ? 121.575 110.557 72.923  1.00 0.00 ? 54  U A "O4'"  1  
ATOM 1732   C "C3'"  . U A 1 54  ? 120.751 111.916 74.643  1.00 0.00 ? 54  U A "C3'"  1  
ATOM 1733   O "O3'"  . U A 1 54  ? 120.173 113.166 74.984  1.00 0.00 ? 54  U A "O3'"  1  
ATOM 1734   C "C2'"  . U A 1 54  ? 119.729 110.812 74.417  1.00 0.00 ? 54  U A "C2'"  1  
ATOM 1735   O "O2'"  . U A 1 54  ? 118.642 111.271 73.626  1.00 0.00 ? 54  U A "O2'"  1  
ATOM 1736   C "C1'"  . U A 1 54  ? 120.542 109.804 73.606  1.00 0.00 ? 54  U A "C1'"  1  
ATOM 1737   N N1     . U A 1 54  ? 121.125 108.738 74.455  1.00 0.00 ? 54  U A N1     1  
ATOM 1738   C C2     . U A 1 54  ? 120.282 107.719 74.859  1.00 0.00 ? 54  U A C2     1  
ATOM 1739   O O2     . U A 1 54  ? 119.105 107.668 74.547  1.00 0.00 ? 54  U A O2     1  
ATOM 1740   N N3     . U A 1 54  ? 120.864 106.755 75.644  1.00 0.00 ? 54  U A N3     1  
ATOM 1741   C C4     . U A 1 54  ? 122.179 106.704 76.060  1.00 0.00 ? 54  U A C4     1  
ATOM 1742   O O4     . U A 1 54  ? 122.553 105.766 76.768  1.00 0.00 ? 54  U A O4     1  
ATOM 1743   C C5     . U A 1 54  ? 122.993 107.790 75.605  1.00 0.00 ? 54  U A C5     1  
ATOM 1744   C C6     . U A 1 54  ? 122.452 108.742 74.839  1.00 0.00 ? 54  U A C6     1  
ATOM 1745   H "H5'"  . U A 1 54  ? 123.282 112.491 72.461  1.00 0.00 ? 54  U A "H5'"  1  
ATOM 1746   H "H5''" . U A 1 54  ? 122.820 113.489 73.616  1.00 0.00 ? 54  U A "H5''" 1  
ATOM 1747   H "H4'"  . U A 1 54  ? 120.963 112.439 72.663  1.00 0.00 ? 54  U A "H4'"  1  
ATOM 1748   H "H3'"  . U A 1 54  ? 121.366 111.641 75.356  1.00 0.00 ? 54  U A "H3'"  1  
ATOM 1749   H "H2'"  . U A 1 54  ? 119.422 110.427 75.266  1.00 0.00 ? 54  U A "H2'"  1  
ATOM 1750   H "HO2'" . U A 1 54  ? 118.612 112.249 73.663  1.00 0.00 ? 54  U A "HO2'" 1  
ATOM 1751   H "H1'"  . U A 1 54  ? 119.970 109.394 72.924  1.00 0.00 ? 54  U A "H1'"  1  
ATOM 1752   H H3     . U A 1 54  ? 120.285 106.025 75.940  1.00 0.00 ? 54  U A H3     1  
ATOM 1753   H H5     . U A 1 54  ? 123.940 107.834 75.853  1.00 0.00 ? 54  U A H5     1  
ATOM 1754   H H6     . U A 1 54  ? 123.029 109.473 74.542  1.00 0.00 ? 54  U A H6     1  
ATOM 1755   P P      . G A 1 55  ? 119.836 113.510 76.516  1.00 0.00 ? 55  G A P      1  
ATOM 1756   O OP1    . G A 1 55  ? 119.438 114.939 76.591  1.00 0.00 ? 55  G A OP1    1  
ATOM 1757   O OP2    . G A 1 55  ? 120.957 113.016 77.357  1.00 0.00 ? 55  G A OP2    1  
ATOM 1758   O "O5'"  . G A 1 55  ? 118.552 112.623 76.837  1.00 0.00 ? 55  G A "O5'"  1  
ATOM 1759   C "C5'"  . G A 1 55  ? 117.299 112.905 76.231  1.00 0.00 ? 55  G A "C5'"  1  
ATOM 1760   C "C4'"  . G A 1 55  ? 116.241 111.922 76.662  1.00 0.00 ? 55  G A "C4'"  1  
ATOM 1761   O "O4'"  . G A 1 55  ? 116.601 110.587 76.220  1.00 0.00 ? 55  G A "O4'"  1  
ATOM 1762   C "C3'"  . G A 1 55  ? 116.037 111.774 78.161  1.00 0.00 ? 55  G A "C3'"  1  
ATOM 1763   O "O3'"  . G A 1 55  ? 115.273 112.827 78.724  1.00 0.00 ? 55  G A "O3'"  1  
ATOM 1764   C "C2'"  . G A 1 55  ? 115.369 110.411 78.271  1.00 0.00 ? 55  G A "C2'"  1  
ATOM 1765   O "O2'"  . G A 1 55  ? 113.993 110.479 77.935  1.00 0.00 ? 55  G A "O2'"  1  
ATOM 1766   C "C1'"  . G A 1 55  ? 116.107 109.622 77.189  1.00 0.00 ? 55  G A "C1'"  1  
ATOM 1767   N N9     . G A 1 55  ? 117.202 108.803 77.743  1.00 0.00 ? 55  G A N9     1  
ATOM 1768   C C8     . G A 1 55  ? 118.549 109.069 77.687  1.00 0.00 ? 55  G A C8     1  
ATOM 1769   N N7     . G A 1 55  ? 119.276 108.154 78.269  1.00 0.00 ? 55  G A N7     1  
ATOM 1770   C C5     . G A 1 55  ? 118.356 107.231 78.741  1.00 0.00 ? 55  G A C5     1  
ATOM 1771   C C6     . G A 1 55  ? 118.551 106.023 79.458  1.00 0.00 ? 55  G A C6     1  
ATOM 1772   O O6     . G A 1 55  ? 119.613 105.511 79.833  1.00 0.00 ? 55  G A O6     1  
ATOM 1773   N N1     . G A 1 55  ? 117.342 105.391 79.740  1.00 0.00 ? 55  G A N1     1  
ATOM 1774   C C2     . G A 1 55  ? 116.105 105.862 79.376  1.00 0.00 ? 55  G A C2     1  
ATOM 1775   N N2     . G A 1 55  ? 115.053 105.112 79.735  1.00 0.00 ? 55  G A N2     1  
ATOM 1776   N N3     . G A 1 55  ? 115.910 106.987 78.707  1.00 0.00 ? 55  G A N3     1  
ATOM 1777   C C4     . G A 1 55  ? 117.070 107.615 78.425  1.00 0.00 ? 55  G A C4     1  
ATOM 1778   H "H5'"  . G A 1 55  ? 117.399 112.863 75.256  1.00 0.00 ? 55  G A "H5'"  1  
ATOM 1779   H "H5''" . G A 1 55  ? 117.019 113.811 76.485  1.00 0.00 ? 55  G A "H5''" 1  
ATOM 1780   H "H4'"  . G A 1 55  ? 115.388 112.173 76.248  1.00 0.00 ? 55  G A "H4'"  1  
ATOM 1781   H "H3'"  . G A 1 55  ? 116.911 111.738 78.602  1.00 0.00 ? 55  G A "H3'"  1  
ATOM 1782   H "H2'"  . G A 1 55  ? 115.507 110.013 79.159  1.00 0.00 ? 55  G A "H2'"  1  
ATOM 1783   H "HO2'" . G A 1 55  ? 113.589 109.596 78.051  1.00 0.00 ? 55  G A "HO2'" 1  
ATOM 1784   H "H1'"  . G A 1 55  ? 115.472 109.040 76.719  1.00 0.00 ? 55  G A "H1'"  1  
ATOM 1785   H H8     . G A 1 55  ? 118.925 109.861 77.252  1.00 0.00 ? 55  G A H8     1  
ATOM 1786   H H1     . G A 1 55  ? 117.379 104.547 80.235  1.00 0.00 ? 55  G A H1     1  
ATOM 1787   H H21    . G A 1 55  ? 115.188 104.280 80.232  1.00 0.00 ? 55  G A H21    1  
ATOM 1788   H H22    . G A 1 55  ? 114.144 105.400 79.505  1.00 0.00 ? 55  G A H22    1  
ATOM 1789   P P      . C A 1 56  ? 115.535 113.293 80.240  1.00 0.00 ? 56  C A P      1  
ATOM 1790   O OP1    . C A 1 56  ? 114.618 114.423 80.538  1.00 0.00 ? 56  C A OP1    1  
ATOM 1791   O OP2    . C A 1 56  ? 116.996 113.465 80.425  1.00 0.00 ? 56  C A OP2    1  
ATOM 1792   O "O5'"  . C A 1 56  ? 115.072 112.042 81.111  1.00 0.00 ? 56  C A "O5'"  1  
ATOM 1793   C "C5'"  . C A 1 56  ? 113.700 111.692 81.217  1.00 0.00 ? 56  C A "C5'"  1  
ATOM 1794   C "C4'"  . C A 1 56  ? 113.512 110.385 81.948  1.00 0.00 ? 56  C A "C4'"  1  
ATOM 1795   O "O4'"  . C A 1 56  ? 114.202 109.322 81.242  1.00 0.00 ? 56  C A "O4'"  1  
ATOM 1796   C "C3'"  . C A 1 56  ? 114.075 110.320 83.358  1.00 0.00 ? 56  C A "C3'"  1  
ATOM 1797   O "O3'"  . C A 1 56  ? 113.238 110.939 84.320  1.00 0.00 ? 56  C A "O3'"  1  
ATOM 1798   C "C2'"  . C A 1 56  ? 114.251 108.822 83.576  1.00 0.00 ? 56  C A "C2'"  1  
ATOM 1799   O "O2'"  . C A 1 56  ? 113.011 108.195 83.870  1.00 0.00 ? 56  C A "O2'"  1  
ATOM 1800   C "C1'"  . C A 1 56  ? 114.724 108.368 82.195  1.00 0.00 ? 56  C A "C1'"  1  
ATOM 1801   N N1     . C A 1 56  ? 116.202 108.280 82.104  1.00 0.00 ? 56  C A N1     1  
ATOM 1802   C C2     . C A 1 56  ? 116.837 107.169 82.674  1.00 0.00 ? 56  C A C2     1  
ATOM 1803   O O2     . C A 1 56  ? 116.153 106.299 83.235  1.00 0.00 ? 56  C A O2     1  
ATOM 1804   N N3     . C A 1 56  ? 118.184 107.066 82.606  1.00 0.00 ? 56  C A N3     1  
ATOM 1805   C C4     . C A 1 56  ? 118.899 108.013 82.000  1.00 0.00 ? 56  C A C4     1  
ATOM 1806   N N4     . C A 1 56  ? 120.225 107.869 81.956  1.00 0.00 ? 56  C A N4     1  
ATOM 1807   C C5     . C A 1 56  ? 118.284 109.154 81.412  1.00 0.00 ? 56  C A C5     1  
ATOM 1808   C C6     . C A 1 56  ? 116.949 109.246 81.483  1.00 0.00 ? 56  C A C6     1  
ATOM 1809   H "H5'"  . C A 1 56  ? 113.321 111.614 80.318  1.00 0.00 ? 56  C A "H5'"  1  
ATOM 1810   H "H5''" . C A 1 56  ? 113.227 112.401 81.703  1.00 0.00 ? 56  C A "H5''" 1  
ATOM 1811   H "H4'"  . C A 1 56  ? 112.553 110.175 81.978  1.00 0.00 ? 56  C A "H4'"  1  
ATOM 1812   H "H3'"  . C A 1 56  ? 114.955 110.752 83.374  1.00 0.00 ? 56  C A "H3'"  1  
ATOM 1813   H "H2'"  . C A 1 56  ? 114.926 108.635 84.265  1.00 0.00 ? 56  C A "H2'"  1  
ATOM 1814   H "HO2'" . C A 1 56  ? 112.377 108.873 84.183  1.00 0.00 ? 56  C A "HO2'" 1  
ATOM 1815   H "H1'"  . C A 1 56  ? 114.333 107.491 81.989  1.00 0.00 ? 56  C A "H1'"  1  
ATOM 1816   H H41    . C A 1 56  ? 120.646 107.082 82.365  1.00 0.00 ? 56  C A H41    1  
ATOM 1817   H H42    . C A 1 56  ? 120.777 108.548 81.518  1.00 0.00 ? 56  C A H42    1  
ATOM 1818   H H5     . C A 1 56  ? 118.816 109.846 80.966  1.00 0.00 ? 56  C A H5     1  
ATOM 1819   H H6     . C A 1 56  ? 116.506 110.022 81.085  1.00 0.00 ? 56  C A H6     1  
ATOM 1820   P P      . G A 1 57  ? 113.853 111.480 85.702  1.00 0.00 ? 57  G A P      1  
ATOM 1821   O OP1    . G A 1 57  ? 112.796 112.244 86.411  1.00 0.00 ? 57  G A OP1    1  
ATOM 1822   O OP2    . G A 1 57  ? 115.154 112.130 85.401  1.00 0.00 ? 57  G A OP2    1  
ATOM 1823   O "O5'"  . G A 1 57  ? 114.149 110.157 86.538  1.00 0.00 ? 57  G A "O5'"  1  
ATOM 1824   C "C5'"  . G A 1 57  ? 113.085 109.343 87.015  1.00 0.00 ? 57  G A "C5'"  1  
ATOM 1825   C "C4'"  . G A 1 57  ? 113.602 108.138 87.762  1.00 0.00 ? 57  G A "C4'"  1  
ATOM 1826   O "O4'"  . G A 1 57  ? 114.374 107.298 86.863  1.00 0.00 ? 57  G A "O4'"  1  
ATOM 1827   C "C3'"  . G A 1 57  ? 114.553 108.422 88.913  1.00 0.00 ? 57  G A "C3'"  1  
ATOM 1828   O "O3'"  . G A 1 57  ? 113.887 108.853 90.088  1.00 0.00 ? 57  G A "O3'"  1  
ATOM 1829   C "C2'"  . G A 1 57  ? 115.284 107.095 89.075  1.00 0.00 ? 57  G A "C2'"  1  
ATOM 1830   O "O2'"  . G A 1 57  ? 114.481 106.147 89.763  1.00 0.00 ? 57  G A "O2'"  1  
ATOM 1831   C "C1'"  . G A 1 57  ? 115.439 106.653 87.619  1.00 0.00 ? 57  G A "C1'"  1  
ATOM 1832   N N9     . G A 1 57  ? 116.769 106.990 87.076  1.00 0.00 ? 57  G A N9     1  
ATOM 1833   C C8     . G A 1 57  ? 117.072 107.981 86.172  1.00 0.00 ? 57  G A C8     1  
ATOM 1834   N N7     . G A 1 57  ? 118.341 108.038 85.879  1.00 0.00 ? 57  G A N7     1  
ATOM 1835   C C5     . G A 1 57  ? 118.914 107.023 86.632  1.00 0.00 ? 57  G A C5     1  
ATOM 1836   C C6     . G A 1 57  ? 120.266 106.604 86.734  1.00 0.00 ? 57  G A C6     1  
ATOM 1837   O O6     . G A 1 57  ? 121.259 107.057 86.155  1.00 0.00 ? 57  G A O6     1  
ATOM 1838   N N1     . G A 1 57  ? 120.407 105.536 87.618  1.00 0.00 ? 57  G A N1     1  
ATOM 1839   C C2     . G A 1 57  ? 119.379 104.952 88.317  1.00 0.00 ? 57  G A C2     1  
ATOM 1840   N N2     . G A 1 57  ? 119.713 103.933 89.124  1.00 0.00 ? 57  G A N2     1  
ATOM 1841   N N3     . G A 1 57  ? 118.115 105.334 88.231  1.00 0.00 ? 57  G A N3     1  
ATOM 1842   C C4     . G A 1 57  ? 117.957 106.369 87.379  1.00 0.00 ? 57  G A C4     1  
ATOM 1843   H "H5'"  . G A 1 57  ? 112.547 109.042 86.256  1.00 0.00 ? 57  G A "H5'"  1  
ATOM 1844   H "H5''" . G A 1 57  ? 112.524 109.874 87.617  1.00 0.00 ? 57  G A "H5''" 1  
ATOM 1845   H "H4'"  . G A 1 57  ? 112.838 107.623 88.097  1.00 0.00 ? 57  G A "H4'"  1  
ATOM 1846   H "H3'"  . G A 1 57  ? 115.195 109.110 88.638  1.00 0.00 ? 57  G A "H3'"  1  
ATOM 1847   H "H2'"  . G A 1 57  ? 116.157 107.217 89.509  1.00 0.00 ? 57  G A "H2'"  1  
ATOM 1848   H "HO2'" . G A 1 57  ? 114.995 105.320 89.881  1.00 0.00 ? 57  G A "HO2'" 1  
ATOM 1849   H "H1'"  . G A 1 57  ? 115.297 105.686 87.556  1.00 0.00 ? 57  G A "H1'"  1  
ATOM 1850   H H8     . G A 1 57  ? 116.402 108.583 85.786  1.00 0.00 ? 57  G A H8     1  
ATOM 1851   H H1     . G A 1 57  ? 121.310 105.178 87.751  1.00 0.00 ? 57  G A H1     1  
ATOM 1852   H H21    . G A 1 57  ? 120.646 103.643 89.192  1.00 0.00 ? 57  G A H21    1  
ATOM 1853   H H22    . G A 1 57  ? 119.022 103.474 89.647  1.00 0.00 ? 57  G A H22    1  
ATOM 1854   P P      . G A 1 58  ? 114.656 109.766 91.162  1.00 0.00 ? 58  G A P      1  
ATOM 1855   O OP1    . G A 1 58  ? 113.686 110.158 92.216  1.00 0.00 ? 58  G A OP1    1  
ATOM 1856   O OP2    . G A 1 58  ? 115.399 110.819 90.423  1.00 0.00 ? 58  G A OP2    1  
ATOM 1857   O "O5'"  . G A 1 58  ? 115.723 108.780 91.817  1.00 0.00 ? 58  G A "O5'"  1  
ATOM 1858   C "C5'"  . G A 1 58  ? 115.306 107.671 92.598  1.00 0.00 ? 58  G A "C5'"  1  
ATOM 1859   C "C4'"  . G A 1 58  ? 116.482 106.868 93.093  1.00 0.00 ? 58  G A "C4'"  1  
ATOM 1860   O "O4'"  . G A 1 58  ? 117.179 106.273 91.968  1.00 0.00 ? 58  G A "O4'"  1  
ATOM 1861   C "C3'"  . G A 1 58  ? 117.562 107.647 93.827  1.00 0.00 ? 58  G A "C3'"  1  
ATOM 1862   O "O3'"  . G A 1 58  ? 117.217 107.944 95.170  1.00 0.00 ? 58  G A "O3'"  1  
ATOM 1863   C "C2'"  . G A 1 58  ? 118.777 106.739 93.697  1.00 0.00 ? 58  G A "C2'"  1  
ATOM 1864   O "O2'"  . G A 1 58  ? 118.715 105.661 94.618  1.00 0.00 ? 58  G A "O2'"  1  
ATOM 1865   C "C1'"  . G A 1 58  ? 118.597 106.192 92.279  1.00 0.00 ? 58  G A "C1'"  1  
ATOM 1866   N N9     . G A 1 58  ? 119.404 106.933 91.291  1.00 0.00 ? 58  G A N9     1  
ATOM 1867   C C8     . G A 1 58  ? 118.954 107.844 90.365  1.00 0.00 ? 58  G A C8     1  
ATOM 1868   N N7     . G A 1 58  ? 119.908 108.336 89.623  1.00 0.00 ? 58  G A N7     1  
ATOM 1869   C C5     . G A 1 58  ? 121.058 107.713 90.088  1.00 0.00 ? 58  G A C5     1  
ATOM 1870   C C6     . G A 1 58  ? 122.408 107.846 89.670  1.00 0.00 ? 58  G A C6     1  
ATOM 1871   O O6     . G A 1 58  ? 122.872 108.562 88.775  1.00 0.00 ? 58  G A O6     1  
ATOM 1872   N N1     . G A 1 58  ? 123.256 107.030 90.410  1.00 0.00 ? 58  G A N1     1  
ATOM 1873   C C2     . G A 1 58  ? 122.860 106.193 91.424  1.00 0.00 ? 58  G A C2     1  
ATOM 1874   N N2     . G A 1 58  ? 123.825 105.482 92.023  1.00 0.00 ? 58  G A N2     1  
ATOM 1875   N N3     . G A 1 58  ? 121.604 106.059 91.824  1.00 0.00 ? 58  G A N3     1  
ATOM 1876   C C4     . G A 1 58  ? 120.764 106.844 91.116  1.00 0.00 ? 58  G A C4     1  
ATOM 1877   H "H5'"  . G A 1 58  ? 114.730 107.093 92.054  1.00 0.00 ? 58  G A "H5'"  1  
ATOM 1878   H "H5''" . G A 1 58  ? 114.793 107.996 93.369  1.00 0.00 ? 58  G A "H5''" 1  
ATOM 1879   H "H4'"  . G A 1 58  ? 116.155 106.151 93.679  1.00 0.00 ? 58  G A "H4'"  1  
ATOM 1880   H "H3'"  . G A 1 58  ? 117.735 108.486 93.347  1.00 0.00 ? 58  G A "H3'"  1  
ATOM 1881   H "H2'"  . G A 1 58  ? 119.614 107.242 93.782  1.00 0.00 ? 58  G A "H2'"  1  
ATOM 1882   H "HO2'" . G A 1 58  ? 119.515 105.104 94.512  1.00 0.00 ? 58  G A "HO2'" 1  
ATOM 1883   H "H1'"  . G A 1 58  ? 118.848 105.246 92.261  1.00 0.00 ? 58  G A "H1'"  1  
ATOM 1884   H H8     . G A 1 58  ? 118.012 108.098 90.270  1.00 0.00 ? 58  G A H8     1  
ATOM 1885   H H1     . G A 1 58  ? 124.211 107.054 90.191  1.00 0.00 ? 58  G A H1     1  
ATOM 1886   H H21    . G A 1 58  ? 124.756 105.574 91.733  1.00 0.00 ? 58  G A H21    1  
ATOM 1887   H H22    . G A 1 58  ? 123.601 104.867 92.754  1.00 0.00 ? 58  G A H22    1  
ATOM 1888   P P      . G A 1 59  ? 117.754 109.291 95.864  1.00 0.00 ? 59  G A P      1  
ATOM 1889   O OP1    . G A 1 59  ? 117.171 109.370 97.229  1.00 0.00 ? 59  G A OP1    1  
ATOM 1890   O OP2    . G A 1 59  ? 117.549 110.413 94.911  1.00 0.00 ? 59  G A OP2    1  
ATOM 1891   O "O5'"  . G A 1 59  ? 119.323 109.050 96.011  1.00 0.00 ? 59  G A "O5'"  1  
ATOM 1892   C "C5'"  . G A 1 59  ? 119.827 108.047 96.881  1.00 0.00 ? 59  G A "C5'"  1  
ATOM 1893   C "C4'"  . G A 1 59  ? 121.326 107.921 96.771  1.00 0.00 ? 59  G A "C4'"  1  
ATOM 1894   O "O4'"  . G A 1 59  ? 121.686 107.498 95.430  1.00 0.00 ? 59  G A "O4'"  1  
ATOM 1895   C "C3'"  . G A 1 59  ? 122.119 109.202 96.981  1.00 0.00 ? 59  G A "C3'"  1  
ATOM 1896   O "O3'"  . G A 1 59  ? 122.289 109.532 98.348  1.00 0.00 ? 59  G A "O3'"  1  
ATOM 1897   C "C2'"  . G A 1 59  ? 123.425 108.906 96.258  1.00 0.00 ? 59  G A "C2'"  1  
ATOM 1898   O "O2'"  . G A 1 59  ? 124.271 108.075 97.038  1.00 0.00 ? 59  G A "O2'"  1  
ATOM 1899   C "C1'"  . G A 1 59  ? 122.929 108.114 95.046  1.00 0.00 ? 59  G A "C1'"  1  
ATOM 1900   N N9     . G A 1 59  ? 122.748 108.968 93.858  1.00 0.00 ? 59  G A N9     1  
ATOM 1901   C C8     . G A 1 59  ? 121.560 109.383 93.306  1.00 0.00 ? 59  G A C8     1  
ATOM 1902   N N7     . G A 1 59  ? 121.719 110.134 92.252  1.00 0.00 ? 59  G A N7     1  
ATOM 1903   C C5     . G A 1 59  ? 123.095 110.225 92.098  1.00 0.00 ? 59  G A C5     1  
ATOM 1904   C C6     . G A 1 59  ? 123.869 110.911 91.125  1.00 0.00 ? 59  G A C6     1  
ATOM 1905   O O6     . G A 1 59  ? 123.478 111.597 90.175  1.00 0.00 ? 59  G A O6     1  
ATOM 1906   N N1     . G A 1 59  ? 125.232 110.737 91.340  1.00 0.00 ? 59  G A N1     1  
ATOM 1907   C C2     . G A 1 59  ? 125.781 109.997 92.359  1.00 0.00 ? 59  G A C2     1  
ATOM 1908   N N2     . G A 1 59  ? 127.122 109.946 92.402  1.00 0.00 ? 59  G A N2     1  
ATOM 1909   N N3     . G A 1 59  ? 125.072 109.353 93.271  1.00 0.00 ? 59  G A N3     1  
ATOM 1910   C C4     . G A 1 59  ? 123.746 109.510 93.082  1.00 0.00 ? 59  G A C4     1  
ATOM 1911   H "H5'"  . G A 1 59  ? 119.417 107.187 96.649  1.00 0.00 ? 59  G A "H5'"  1  
ATOM 1912   H "H5''" . G A 1 59  ? 119.592 108.276 97.804  1.00 0.00 ? 59  G A "H5''" 1  
ATOM 1913   H "H4'"  . G A 1 59  ? 121.636 107.247 97.411  1.00 0.00 ? 59  G A "H4'"  1  
ATOM 1914   H "H3'"  . G A 1 59  ? 121.664 109.942 96.526  1.00 0.00 ? 59  G A "H3'"  1  
ATOM 1915   H "H2'"  . G A 1 59  ? 123.882 109.731 95.983  1.00 0.00 ? 59  G A "H2'"  1  
ATOM 1916   H "HO2'" . G A 1 59  ? 123.994 108.126 97.976  1.00 0.00 ? 59  G A "HO2'" 1  
ATOM 1917   H "H1'"  . G A 1 59  ? 123.571 107.401 94.841  1.00 0.00 ? 59  G A "H1'"  1  
ATOM 1918   H H8     . G A 1 59  ? 120.682 109.137 93.665  1.00 0.00 ? 59  G A H8     1  
ATOM 1919   H H1     . G A 1 59  ? 125.845 111.176 90.715  1.00 0.00 ? 59  G A H1     1  
ATOM 1920   H H21    . G A 1 59  ? 127.654 110.420 91.730  1.00 0.00 ? 59  G A H21    1  
ATOM 1921   H H22    . G A 1 59  ? 127.571 109.434 93.107  1.00 0.00 ? 59  G A H22    1  
ATOM 1922   P P      . A A 1 60  ? 122.449 111.069 98.795  1.00 0.00 ? 60  A A P      1  
ATOM 1923   O OP1    . A A 1 60  ? 122.449 111.120 100.278 1.00 0.00 ? 60  A A OP1    1  
ATOM 1924   O OP2    . A A 1 60  ? 121.461 111.874 98.033  1.00 0.00 ? 60  A A OP2    1  
ATOM 1925   O "O5'"  . A A 1 60  ? 123.905 111.468 98.288  1.00 0.00 ? 60  A A "O5'"  1  
ATOM 1926   C "C5'"  . A A 1 60  ? 125.064 110.888 98.868  1.00 0.00 ? 60  A A "C5'"  1  
ATOM 1927   C "C4'"  . A A 1 60  ? 126.321 111.337 98.164  1.00 0.00 ? 60  A A "C4'"  1  
ATOM 1928   O "O4'"  . A A 1 60  ? 126.289 110.906 96.778  1.00 0.00 ? 60  A A "O4'"  1  
ATOM 1929   C "C3'"  . A A 1 60  ? 126.536 112.840 98.080  1.00 0.00 ? 60  A A "C3'"  1  
ATOM 1930   O "O3'"  . A A 1 60  ? 127.058 113.392 99.278  1.00 0.00 ? 60  A A "O3'"  1  
ATOM 1931   C "C2'"  . A A 1 60  ? 127.471 112.976 96.887  1.00 0.00 ? 60  A A "C2'"  1  
ATOM 1932   O "O2'"  . A A 1 60  ? 128.808 112.650 97.239  1.00 0.00 ? 60  A A "O2'"  1  
ATOM 1933   C "C1'"  . A A 1 60  ? 126.926 111.898 95.951  1.00 0.00 ? 60  A A "C1'"  1  
ATOM 1934   N N9     . A A 1 60  ? 125.979 112.448 94.962  1.00 0.00 ? 60  A A N9     1  
ATOM 1935   C C8     . A A 1 60  ? 124.610 112.343 94.957  1.00 0.00 ? 60  A A C8     1  
ATOM 1936   N N7     . A A 1 60  ? 124.039 112.941 93.941  1.00 0.00 ? 60  A A N7     1  
ATOM 1937   C C5     . A A 1 60  ? 125.103 113.473 93.226  1.00 0.00 ? 60  A A C5     1  
ATOM 1938   C C6     . A A 1 60  ? 125.164 114.225 92.039  1.00 0.00 ? 60  A A C6     1  
ATOM 1939   N N6     . A A 1 60  ? 124.088 114.586 91.335  1.00 0.00 ? 60  A A N6     1  
ATOM 1940   N N1     . A A 1 60  ? 126.384 114.601 91.597  1.00 0.00 ? 60  A A N1     1  
ATOM 1941   C C2     . A A 1 60  ? 127.461 114.239 92.302  1.00 0.00 ? 60  A A C2     1  
ATOM 1942   N N3     . A A 1 60  ? 127.531 113.533 93.429  1.00 0.00 ? 60  A A N3     1  
ATOM 1943   C C4     . A A 1 60  ? 126.303 113.177 93.843  1.00 0.00 ? 60  A A C4     1  
ATOM 1944   H "H5'"  . A A 1 60  ? 124.996 109.911 98.807  1.00 0.00 ? 60  A A "H5'"  1  
ATOM 1945   H "H5''" . A A 1 60  ? 125.115 111.143 99.810  1.00 0.00 ? 60  A A "H5''" 1  
ATOM 1946   H "H4'"  . A A 1 60  ? 127.094 110.930 98.607  1.00 0.00 ? 60  A A "H4'"  1  
ATOM 1947   H "H3'"  . A A 1 60  ? 125.683 113.277 97.871  1.00 0.00 ? 60  A A "H3'"  1  
ATOM 1948   H "H2'"  . A A 1 60  ? 127.410 113.867 96.481  1.00 0.00 ? 60  A A "H2'"  1  
ATOM 1949   H "HO2'" . A A 1 60  ? 128.906 112.718 98.212  1.00 0.00 ? 60  A A "HO2'" 1  
ATOM 1950   H "H1'"  . A A 1 60  ? 127.671 111.466 95.481  1.00 0.00 ? 60  A A "H1'"  1  
ATOM 1951   H H8     . A A 1 60  ? 124.106 111.869 95.651  1.00 0.00 ? 60  A A H8     1  
ATOM 1952   H H61    . A A 1 60  ? 124.195 115.111 90.514  1.00 0.00 ? 60  A A H61    1  
ATOM 1953   H H62    . A A 1 60  ? 123.194 114.326 91.636  1.00 0.00 ? 60  A A H62    1  
ATOM 1954   H H2     . A A 1 60  ? 128.322 114.534 91.938  1.00 0.00 ? 60  A A H2     1  
ATOM 1955   P P      . A A 1 61  ? 126.744 114.919 99.667  1.00 0.00 ? 61  A A P      1  
ATOM 1956   O OP1    . A A 1 61  ? 127.288 115.170 101.026 1.00 0.00 ? 61  A A OP1    1  
ATOM 1957   O OP2    . A A 1 61  ? 125.308 115.179 99.394  1.00 0.00 ? 61  A A OP2    1  
ATOM 1958   O "O5'"  . A A 1 61  ? 127.604 115.767 98.627  1.00 0.00 ? 61  A A "O5'"  1  
ATOM 1959   C "C5'"  . A A 1 61  ? 129.024 115.749 98.669  1.00 0.00 ? 61  A A "C5'"  1  
ATOM 1960   C "C4'"  . A A 1 61  ? 129.622 116.512 97.515  1.00 0.00 ? 61  A A "C4'"  1  
ATOM 1961   O "O4'"  . A A 1 61  ? 129.225 115.896 96.261  1.00 0.00 ? 61  A A "O4'"  1  
ATOM 1962   C "C3'"  . A A 1 61  ? 129.180 117.962 97.371  1.00 0.00 ? 61  A A "C3'"  1  
ATOM 1963   O "O3'"  . A A 1 61  ? 129.858 118.836 98.257  1.00 0.00 ? 61  A A "O3'"  1  
ATOM 1964   C "C2'"  . A A 1 61  ? 129.454 118.246 95.902  1.00 0.00 ? 61  A A "C2'"  1  
ATOM 1965   O "O2'"  . A A 1 61  ? 130.836 118.485 95.670  1.00 0.00 ? 61  A A "O2'"  1  
ATOM 1966   C "C1'"  . A A 1 61  ? 129.065 116.917 95.253  1.00 0.00 ? 61  A A "C1'"  1  
ATOM 1967   N N9     . A A 1 61  ? 127.684 116.937 94.731  1.00 0.00 ? 61  A A N9     1  
ATOM 1968   C C8     . A A 1 61  ? 126.566 116.354 95.275  1.00 0.00 ? 61  A A C8     1  
ATOM 1969   N N7     . A A 1 61  ? 125.477 116.546 94.576  1.00 0.00 ? 61  A A N7     1  
ATOM 1970   C C5     . A A 1 61  ? 125.903 117.308 93.497  1.00 0.00 ? 61  A A C5     1  
ATOM 1971   C C6     . A A 1 61  ? 125.223 117.844 92.388  1.00 0.00 ? 61  A A C6     1  
ATOM 1972   N N6     . A A 1 61  ? 123.915 117.689 92.175  1.00 0.00 ? 61  A A N6     1  
ATOM 1973   N N1     . A A 1 61  ? 125.944 118.555 91.493  1.00 0.00 ? 61  A A N1     1  
ATOM 1974   C C2     . A A 1 61  ? 127.256 118.712 91.707  1.00 0.00 ? 61  A A C2     1  
ATOM 1975   N N3     . A A 1 61  ? 128.007 118.259 92.709  1.00 0.00 ? 61  A A N3     1  
ATOM 1976   C C4     . A A 1 61  ? 127.261 117.556 93.580  1.00 0.00 ? 61  A A C4     1  
ATOM 1977   H "H5'"  . A A 1 61  ? 129.332 114.820 98.633  1.00 0.00 ? 61  A A "H5'"  1  
ATOM 1978   H "H5''" . A A 1 61  ? 129.324 116.155 99.509  1.00 0.00 ? 61  A A "H5''" 1  
ATOM 1979   H "H4'"  . A A 1 61  ? 130.600 116.484 97.588  1.00 0.00 ? 61  A A "H4'"  1  
ATOM 1980   H "H3'"  . A A 1 61  ? 128.216 118.020 97.536  1.00 0.00 ? 61  A A "H3'"  1  
ATOM 1981   H "H2'"  . A A 1 61  ? 128.898 118.984 95.570  1.00 0.00 ? 61  A A "H2'"  1  
ATOM 1982   H "HO2'" . A A 1 61  ? 131.244 117.670 95.313  1.00 0.00 ? 61  A A "HO2'" 1  
ATOM 1983   H "H1'"  . A A 1 61  ? 129.686 116.715 94.525  1.00 0.00 ? 61  A A "H1'"  1  
ATOM 1984   H H8     . A A 1 61  ? 126.584 115.841 96.112  1.00 0.00 ? 61  A A H8     1  
ATOM 1985   H H61    . A A 1 61  ? 123.497 118.084 91.380  1.00 0.00 ? 61  A A H61    1  
ATOM 1986   H H62    . A A 1 61  ? 123.373 117.176 92.810  1.00 0.00 ? 61  A A H62    1  
ATOM 1987   H H2     . A A 1 61  ? 127.733 119.237 91.029  1.00 0.00 ? 61  A A H2     1  
ATOM 1988   P P      . A A 1 62  ? 130.292 120.292 97.755  1.00 0.00 ? 62  A A P      1  
ATOM 1989   O OP1    . A A 1 62  ? 130.610 121.137 98.933  1.00 0.00 ? 62  A A OP1    1  
ATOM 1990   O OP2    . A A 1 62  ? 129.172 120.674 96.859  1.00 0.00 ? 62  A A OP2    1  
ATOM 1991   O "O5'"  . A A 1 62  ? 131.610 120.164 96.869  1.00 0.00 ? 62  A A "O5'"  1  
ATOM 1992   C "C5'"  . A A 1 62  ? 132.821 120.787 97.270  1.00 0.00 ? 62  A A "C5'"  1  
ATOM 1993   C "C4'"  . A A 1 62  ? 133.397 121.639 96.167  1.00 0.00 ? 62  A A "C4'"  1  
ATOM 1994   O "O4'"  . A A 1 62  ? 133.181 121.048 94.858  1.00 0.00 ? 62  A A "O4'"  1  
ATOM 1995   C "C3'"  . A A 1 62  ? 132.826 123.044 96.041  1.00 0.00 ? 62  A A "C3'"  1  
ATOM 1996   O "O3'"  . A A 1 62  ? 133.486 123.987 96.868  1.00 0.00 ? 62  A A "O3'"  1  
ATOM 1997   C "C2'"  . A A 1 62  ? 133.123 123.360 94.583  1.00 0.00 ? 62  A A "C2'"  1  
ATOM 1998   O "O2'"  . A A 1 62  ? 134.492 123.690 94.397  1.00 0.00 ? 62  A A "O2'"  1  
ATOM 1999   C "C1'"  . A A 1 62  ? 132.843 122.019 93.918  1.00 0.00 ? 62  A A "C1'"  1  
ATOM 2000   N N9     . A A 1 62  ? 131.417 121.853 93.579  1.00 0.00 ? 62  A A N9     1  
ATOM 2001   C C8     . A A 1 62  ? 130.424 121.301 94.351  1.00 0.00 ? 62  A A C8     1  
ATOM 2002   N N7     . A A 1 62  ? 129.248 121.294 93.773  1.00 0.00 ? 62  A A N7     1  
ATOM 2003   C C5     . A A 1 62  ? 129.481 121.882 92.537  1.00 0.00 ? 62  A A C5     1  
ATOM 2004   C C6     . A A 1 62  ? 128.636 122.167 91.450  1.00 0.00 ? 62  A A C6     1  
ATOM 2005   N N6     . A A 1 62  ? 127.330 121.888 91.434  1.00 0.00 ? 62  A A N6     1  
ATOM 2006   N N1     . A A 1 62  ? 129.184 122.758 90.367  1.00 0.00 ? 62  A A N1     1  
ATOM 2007   C C2     . A A 1 62  ? 130.493 123.038 90.382  1.00 0.00 ? 62  A A C2     1  
ATOM 2008   N N3     . A A 1 62  ? 131.389 122.819 91.342  1.00 0.00 ? 62  A A N3     1  
ATOM 2009   C C4     . A A 1 62  ? 130.812 122.231 92.405  1.00 0.00 ? 62  A A C4     1  
ATOM 2010   H "H5'"  . A A 1 62  ? 133.472 120.096 97.512  1.00 0.00 ? 62  A A "H5'"  1  
ATOM 2011   H "H5''" . A A 1 62  ? 132.648 121.351 98.052  1.00 0.00 ? 62  A A "H5''" 1  
ATOM 2012   H "H4'"  . A A 1 62  ? 134.361 121.703 96.331  1.00 0.00 ? 62  A A "H4'"  1  
ATOM 2013   H "H3'"  . A A 1 62  ? 131.863 123.075 96.224  1.00 0.00 ? 62  A A "H3'"  1  
ATOM 2014   H "H2'"  . A A 1 62  ? 132.530 124.061 94.240  1.00 0.00 ? 62  A A "H2'"  1  
ATOM 2015   H "HO2'" . A A 1 62  ? 134.644 123.895 93.451  1.00 0.00 ? 62  A A "HO2'" 1  
ATOM 2016   H "H1'"  . A A 1 62  ? 133.384 121.939 93.104  1.00 0.00 ? 62  A A "H1'"  1  
ATOM 2017   H H8     . A A 1 62  ? 130.581 120.945 95.251  1.00 0.00 ? 62  A A H8     1  
ATOM 2018   H H61    . A A 1 62  ? 126.791 122.111 90.646  1.00 0.00 ? 62  A A H61    1  
ATOM 2019   H H62    . A A 1 62  ? 126.911 121.460 92.209  1.00 0.00 ? 62  A A H62    1  
ATOM 2020   H H2     . A A 1 62  ? 130.841 123.467 89.572  1.00 0.00 ? 62  A A H2     1  
ATOM 2021   P P      . G A 1 63  ? 132.634 125.055 97.714  1.00 0.00 ? 63  G A P      1  
ATOM 2022   O OP1    . G A 1 63  ? 133.561 126.118 98.179  1.00 0.00 ? 63  G A OP1    1  
ATOM 2023   O OP2    . G A 1 63  ? 131.816 124.309 98.705  1.00 0.00 ? 63  G A OP2    1  
ATOM 2024   O "O5'"  . G A 1 63  ? 131.646 125.697 96.643  1.00 0.00 ? 63  G A "O5'"  1  
ATOM 2025   C "C5'"  . G A 1 63  ? 132.142 126.492 95.576  1.00 0.00 ? 63  G A "C5'"  1  
ATOM 2026   C "C4'"  . G A 1 63  ? 131.023 127.024 94.715  1.00 0.00 ? 63  G A "C4'"  1  
ATOM 2027   O "O4'"  . G A 1 63  ? 130.363 125.927 94.034  1.00 0.00 ? 63  G A "O4'"  1  
ATOM 2028   C "C3'"  . G A 1 63  ? 129.897 127.736 95.446  1.00 0.00 ? 63  G A "C3'"  1  
ATOM 2029   O "O3'"  . G A 1 63  ? 130.211 129.079 95.777  1.00 0.00 ? 63  G A "O3'"  1  
ATOM 2030   C "C2'"  . G A 1 63  ? 128.732 127.603 94.475  1.00 0.00 ? 63  G A "C2'"  1  
ATOM 2031   O "O2'"  . G A 1 63  ? 128.840 128.536 93.411  1.00 0.00 ? 63  G A "O2'"  1  
ATOM 2032   C "C1'"  . G A 1 63  ? 128.956 126.193 93.925  1.00 0.00 ? 63  G A "C1'"  1  
ATOM 2033   N N9     . G A 1 63  ? 128.171 125.179 94.656  1.00 0.00 ? 63  G A N9     1  
ATOM 2034   C C8     . G A 1 63  ? 128.644 124.235 95.533  1.00 0.00 ? 63  G A C8     1  
ATOM 2035   N N7     . G A 1 63  ? 127.704 123.472 96.023  1.00 0.00 ? 63  G A N7     1  
ATOM 2036   C C5     . G A 1 63  ? 126.538 123.946 95.435  1.00 0.00 ? 63  G A C5     1  
ATOM 2037   C C6     . G A 1 63  ? 125.194 123.514 95.585  1.00 0.00 ? 63  G A C6     1  
ATOM 2038   O O6     . G A 1 63  ? 124.751 122.599 96.286  1.00 0.00 ? 63  G A O6     1  
ATOM 2039   N N1     . G A 1 63  ? 124.324 124.270 94.804  1.00 0.00 ? 63  G A N1     1  
ATOM 2040   C C2     . G A 1 63  ? 124.699 125.308 93.985  1.00 0.00 ? 63  G A C2     1  
ATOM 2041   N N2     . G A 1 63  ? 123.714 125.918 93.310  1.00 0.00 ? 63  G A N2     1  
ATOM 2042   N N3     . G A 1 63  ? 125.948 125.719 93.839  1.00 0.00 ? 63  G A N3     1  
ATOM 2043   C C4     . G A 1 63  ? 126.809 124.999 94.588  1.00 0.00 ? 63  G A C4     1  
ATOM 2044   H "H5'"  . G A 1 63  ? 132.741 125.948 95.025  1.00 0.00 ? 63  G A "H5'"  1  
ATOM 2045   H "H5''" . G A 1 63  ? 132.646 127.246 95.949  1.00 0.00 ? 63  G A "H5''" 1  
ATOM 2046   H "H4'"  . G A 1 63  ? 131.401 127.632 94.045  1.00 0.00 ? 63  G A "H4'"  1  
ATOM 2047   H "H3'"  . G A 1 63  ? 129.686 127.243 96.268  1.00 0.00 ? 63  G A "H3'"  1  
ATOM 2048   H "H2'"  . G A 1 63  ? 127.869 127.674 94.937  1.00 0.00 ? 63  G A "H2'"  1  
ATOM 2049   H "HO2'" . G A 1 63  ? 129.440 129.261 93.683  1.00 0.00 ? 63  G A "HO2'" 1  
ATOM 2050   H "H1'"  . G A 1 63  ? 128.712 126.172 92.977  1.00 0.00 ? 63  G A "H1'"  1  
ATOM 2051   H H8     . G A 1 63  ? 129.590 124.138 95.765  1.00 0.00 ? 63  G A H8     1  
ATOM 2052   H H1     . G A 1 63  ? 123.372 124.043 94.841  1.00 0.00 ? 63  G A H1     1  
ATOM 2053   H H21    . G A 1 63  ? 122.787 125.620 93.413  1.00 0.00 ? 63  G A H21    1  
ATOM 2054   H H22    . G A 1 63  ? 123.922 126.666 92.710  1.00 0.00 ? 63  G A H22    1  
ATOM 2055   P P      . G A 1 64  ? 129.453 129.809 96.991  1.00 0.00 ? 64  G A P      1  
ATOM 2056   O OP1    . G A 1 64  ? 130.087 131.135 97.198  1.00 0.00 ? 64  G A OP1    1  
ATOM 2057   O OP2    . G A 1 64  ? 129.367 128.854 98.125  1.00 0.00 ? 64  G A OP2    1  
ATOM 2058   O "O5'"  . G A 1 64  ? 127.978 130.051 96.437  1.00 0.00 ? 64  G A "O5'"  1  
ATOM 2059   C "C5'"  . G A 1 64  ? 127.725 131.027 95.437  1.00 0.00 ? 64  G A "C5'"  1  
ATOM 2060   C "C4'"  . G A 1 64  ? 126.253 131.136 95.130  1.00 0.00 ? 64  G A "C4'"  1  
ATOM 2061   O "O4'"  . G A 1 64  ? 125.769 129.876 94.597  1.00 0.00 ? 64  G A "O4'"  1  
ATOM 2062   C "C3'"  . G A 1 64  ? 125.340 131.413 96.315  1.00 0.00 ? 64  G A "C3'"  1  
ATOM 2063   O "O3'"  . G A 1 64  ? 125.341 132.774 96.710  1.00 0.00 ? 64  G A "O3'"  1  
ATOM 2064   C "C2'"  . G A 1 64  ? 123.989 130.921 95.816  1.00 0.00 ? 64  G A "C2'"  1  
ATOM 2065   O "O2'"  . G A 1 64  ? 123.392 131.864 94.936  1.00 0.00 ? 64  G A "O2'"  1  
ATOM 2066   C "C1'"  . G A 1 64  ? 124.391 129.683 95.015  1.00 0.00 ? 64  G A "C1'"  1  
ATOM 2067   N N9     . G A 1 64  ? 124.238 128.442 95.799  1.00 0.00 ? 64  G A N9     1  
ATOM 2068   C C8     . G A 1 64  ? 125.238 127.686 96.361  1.00 0.00 ? 64  G A C8     1  
ATOM 2069   N N7     . G A 1 64  ? 124.792 126.636 96.999  1.00 0.00 ? 64  G A N7     1  
ATOM 2070   C C5     . G A 1 64  ? 123.414 126.704 96.848  1.00 0.00 ? 64  G A C5     1  
ATOM 2071   C C6     . G A 1 64  ? 122.394 125.841 97.324  1.00 0.00 ? 64  G A C6     1  
ATOM 2072   O O6     . G A 1 64  ? 122.509 124.808 97.995  1.00 0.00 ? 64  G A O6     1  
ATOM 2073   N N1     . G A 1 64  ? 121.131 126.281 96.943  1.00 0.00 ? 64  G A N1     1  
ATOM 2074   C C2     . G A 1 64  ? 120.880 127.408 96.201  1.00 0.00 ? 64  G A C2     1  
ATOM 2075   N N2     . G A 1 64  ? 119.592 127.671 95.934  1.00 0.00 ? 64  G A N2     1  
ATOM 2076   N N3     . G A 1 64  ? 121.821 128.223 95.752  1.00 0.00 ? 64  G A N3     1  
ATOM 2077   C C4     . G A 1 64  ? 123.055 127.812 96.111  1.00 0.00 ? 64  G A C4     1  
ATOM 2078   H "H5'"  . G A 1 64  ? 128.206 130.781 94.621  1.00 0.00 ? 64  G A "H5'"  1  
ATOM 2079   H "H5''" . G A 1 64  ? 128.050 131.898 95.753  1.00 0.00 ? 64  G A "H5''" 1  
ATOM 2080   H "H4'"  . G A 1 64  ? 126.122 131.838 94.459  1.00 0.00 ? 64  G A "H4'"  1  
ATOM 2081   H "H3'"  . G A 1 64  ? 125.623 130.858 97.073  1.00 0.00 ? 64  G A "H3'"  1  
ATOM 2082   H "H2'"  . G A 1 64  ? 123.392 130.690 96.559  1.00 0.00 ? 64  G A "H2'"  1  
ATOM 2083   H "HO2'" . G A 1 64  ? 122.520 131.523 94.647  1.00 0.00 ? 64  G A "HO2'" 1  
ATOM 2084   H "H1'"  . G A 1 64  ? 123.843 129.626 94.205  1.00 0.00 ? 64  G A "H1'"  1  
ATOM 2085   H H8     . G A 1 64  ? 126.190 127.909 96.292  1.00 0.00 ? 64  G A H8     1  
ATOM 2086   H H1     . G A 1 64  ? 120.363 125.744 97.227  1.00 0.00 ? 64  G A H1     1  
ATOM 2087   H H21    . G A 1 64  ? 118.888 127.074 96.262  1.00 0.00 ? 64  G A H21    1  
ATOM 2088   H H22    . G A 1 64  ? 119.352 128.462 95.406  1.00 0.00 ? 64  G A H22    1  
ATOM 2089   P P      . G A 1 65  ? 125.081 133.168 98.246  1.00 0.00 ? 65  G A P      1  
ATOM 2090   O OP1    . G A 1 65  ? 125.188 134.645 98.367  1.00 0.00 ? 65  G A OP1    1  
ATOM 2091   O OP2    . G A 1 65  ? 125.931 132.298 99.097  1.00 0.00 ? 65  G A OP2    1  
ATOM 2092   O "O5'"  . G A 1 65  ? 123.558 132.766 98.495  1.00 0.00 ? 65  G A "O5'"  1  
ATOM 2093   C "C5'"  . G A 1 65  ? 122.506 133.439 97.823  1.00 0.00 ? 65  G A "C5'"  1  
ATOM 2094   C "C4'"  . G A 1 65  ? 121.172 132.786 98.087  1.00 0.00 ? 65  G A "C4'"  1  
ATOM 2095   O "O4'"  . G A 1 65  ? 121.177 131.429 97.575  1.00 0.00 ? 65  G A "O4'"  1  
ATOM 2096   C "C3'"  . G A 1 65  ? 120.785 132.631 99.551  1.00 0.00 ? 65  G A "C3'"  1  
ATOM 2097   O "O3'"  . G A 1 65  ? 120.277 133.823 100.122 1.00 0.00 ? 65  G A "O3'"  1  
ATOM 2098   C "C2'"  . G A 1 65  ? 119.772 131.493 99.508  1.00 0.00 ? 65  G A "C2'"  1  
ATOM 2099   O "O2'"  . G A 1 65  ? 118.504 131.951 99.060  1.00 0.00 ? 65  G A "O2'"  1  
ATOM 2100   C "C1'"  . G A 1 65  ? 120.379 130.589 98.435  1.00 0.00 ? 65  G A "C1'"  1  
ATOM 2101   N N9     . G A 1 65  ? 121.185 129.499 99.019  1.00 0.00 ? 65  G A N9     1  
ATOM 2102   C C8     . G A 1 65  ? 122.556 129.404 99.051  1.00 0.00 ? 65  G A C8     1  
ATOM 2103   N N7     . G A 1 65  ? 122.982 128.320 99.638  1.00 0.00 ? 65  G A N7     1  
ATOM 2104   C C5     . G A 1 65  ? 121.824 127.657 100.018 1.00 0.00 ? 65  G A C5     1  
ATOM 2105   C C6     . G A 1 65  ? 121.651 126.423 100.698 1.00 0.00 ? 65  G A C6     1  
ATOM 2106   O O6     . G A 1 65  ? 122.518 125.644 101.111 1.00 0.00 ? 65  G A O6     1  
ATOM 2107   N N1     . G A 1 65  ? 120.304 126.124 100.883 1.00 0.00 ? 65  G A N1     1  
ATOM 2108   C C2     . G A 1 65  ? 119.257 126.910 100.467 1.00 0.00 ? 65  G A C2     1  
ATOM 2109   N N2     . G A 1 65  ? 118.025 126.453 100.739 1.00 0.00 ? 65  G A N2     1  
ATOM 2110   N N3     . G A 1 65  ? 119.405 128.063 99.834  1.00 0.00 ? 65  G A N3     1  
ATOM 2111   C C4     . G A 1 65  ? 120.706 128.372 99.644  1.00 0.00 ? 65  G A C4     1  
ATOM 2112   H "H5'"  . G A 1 65  ? 122.681 133.426 96.858  1.00 0.00 ? 65  G A "H5'"  1  
ATOM 2113   H "H5''" . G A 1 65  ? 122.474 134.369 98.130  1.00 0.00 ? 65  G A "H5''" 1  
ATOM 2114   H "H4'"  . G A 1 65  ? 120.472 133.298 97.627  1.00 0.00 ? 65  G A "H4'"  1  
ATOM 2115   H "H3'"  . G A 1 65  ? 121.570 132.339 100.062 1.00 0.00 ? 65  G A "H3'"  1  
ATOM 2116   H "H2'"  . G A 1 65  ? 119.709 131.035 100.370 1.00 0.00 ? 65  G A "H2'"  1  
ATOM 2117   H "HO2'" . G A 1 65  ? 118.456 132.923 99.179  1.00 0.00 ? 65  G A "HO2'" 1  
ATOM 2118   H "H1'"  . G A 1 65  ? 119.659 130.204 97.888  1.00 0.00 ? 65  G A "H1'"  1  
ATOM 2119   H H8     . G A 1 65  ? 123.152 130.081 98.669  1.00 0.00 ? 65  G A H8     1  
ATOM 2120   H H1     . G A 1 65  ? 120.090 125.287 101.344 1.00 0.00 ? 65  G A H1     1  
ATOM 2121   H H21    . G A 1 65  ? 117.908 125.601 101.207 1.00 0.00 ? 65  G A H21    1  
ATOM 2122   H H22    . G A 1 65  ? 117.240 126.973 100.464 1.00 0.00 ? 65  G A H22    1  
ATOM 2123   P P      . G A 1 66  ? 120.614 134.195 101.649 1.00 0.00 ? 66  G A P      1  
ATOM 2124   O OP1    . G A 1 66  ? 120.148 135.583 101.899 1.00 0.00 ? 66  G A OP1    1  
ATOM 2125   O OP2    . G A 1 66  ? 122.033 133.840 101.906 1.00 0.00 ? 66  G A OP2    1  
ATOM 2126   O "O5'"  . G A 1 66  ? 119.697 133.207 102.498 1.00 0.00 ? 66  G A "O5'"  1  
ATOM 2127   C "C5'"  . G A 1 66  ? 118.302 133.112 102.250 1.00 0.00 ? 66  G A "C5'"  1  
ATOM 2128   C "C4'"  . G A 1 66  ? 117.734 131.813 102.765 1.00 0.00 ? 66  G A "C4'"  1  
ATOM 2129   O "O4'"  . G A 1 66  ? 118.322 130.696 102.013 1.00 0.00 ? 66  G A "O4'"  1  
ATOM 2130   C "C3'"  . G A 1 66  ? 118.029 131.487 104.221 1.00 0.00 ? 66  G A "C3'"  1  
ATOM 2131   O "O3'"  . G A 1 66  ? 117.059 132.010 105.113 1.00 0.00 ? 66  G A "O3'"  1  
ATOM 2132   C "C2'"  . G A 1 66  ? 118.082 129.967 104.213 1.00 0.00 ? 66  G A "C2'"  1  
ATOM 2133   O "O2'"  . G A 1 66  ? 116.777 129.406 104.181 1.00 0.00 ? 66  G A "O2'"  1  
ATOM 2134   C "C1'"  . G A 1 66  ? 118.777 129.701 102.868 1.00 0.00 ? 66  G A "C1'"  1  
ATOM 2135   N N9     . G A 1 66  ? 120.245 129.806 102.972 1.00 0.00 ? 66  G A N9     1  
ATOM 2136   C C8     . G A 1 66  ? 121.017 130.919 102.743 1.00 0.00 ? 66  G A C8     1  
ATOM 2137   N N7     . G A 1 66  ? 122.293 130.703 102.914 1.00 0.00 ? 66  G A N7     1  
ATOM 2138   C C5     . G A 1 66  ? 122.369 129.366 103.278 1.00 0.00 ? 66  G A C5     1  
ATOM 2139   C C6     . G A 1 66  ? 123.494 128.562 103.594 1.00 0.00 ? 66  G A C6     1  
ATOM 2140   O O6     . G A 1 66  ? 124.688 128.882 103.615 1.00 0.00 ? 66  G A O6     1  
ATOM 2141   N N1     . G A 1 66  ? 123.121 127.258 103.908 1.00 0.00 ? 66  G A N1     1  
ATOM 2142   C C2     . G A 1 66  ? 121.830 126.789 103.918 1.00 0.00 ? 66  G A C2     1  
ATOM 2143   N N2     . G A 1 66  ? 121.668 125.499 104.248 1.00 0.00 ? 66  G A N2     1  
ATOM 2144   N N3     . G A 1 66  ? 120.772 127.529 103.626 1.00 0.00 ? 66  G A N3     1  
ATOM 2145   C C4     . G A 1 66  ? 121.113 128.798 103.318 1.00 0.00 ? 66  G A C4     1  
ATOM 2146   H "H5'"  . G A 1 66  ? 118.144 133.170 101.285 1.00 0.00 ? 66  G A "H5'"  1  
ATOM 2147   H "H5''" . G A 1 66  ? 117.847 133.859 102.693 1.00 0.00 ? 66  G A "H5''" 1  
ATOM 2148   H "H4'"  . G A 1 66  ? 116.763 131.816 102.630 1.00 0.00 ? 66  G A "H4'"  1  
ATOM 2149   H "H3'"  . G A 1 66  ? 118.912 131.837 104.457 1.00 0.00 ? 66  G A "H3'"  1  
ATOM 2150   H "H2'"  . G A 1 66  ? 118.607 129.622 104.966 1.00 0.00 ? 66  G A "H2'"  1  
ATOM 2151   H "HO2'" . G A 1 66  ? 116.144 130.048 104.565 1.00 0.00 ? 66  G A "HO2'" 1  
ATOM 2152   H "H1'"  . G A 1 66  ? 118.536 128.807 102.547 1.00 0.00 ? 66  G A "H1'"  1  
ATOM 2153   H H8     . G A 1 66  ? 120.649 131.788 102.478 1.00 0.00 ? 66  G A H8     1  
ATOM 2154   H H1     . G A 1 66  ? 123.835 126.629 104.140 1.00 0.00 ? 66  G A H1     1  
ATOM 2155   H H21    . G A 1 66  ? 122.446 124.945 104.466 1.00 0.00 ? 66  G A H21    1  
ATOM 2156   H H22    . G A 1 66  ? 120.769 125.108 104.272 1.00 0.00 ? 66  G A H22    1  
ATOM 2157   P P      . A A 1 67  ? 117.500 132.543 106.564 1.00 0.00 ? 67  A A P      1  
ATOM 2158   O OP1    . A A 1 67  ? 116.319 133.180 107.198 1.00 0.00 ? 67  A A OP1    1  
ATOM 2159   O OP2    . A A 1 67  ? 118.757 133.317 106.407 1.00 0.00 ? 67  A A OP2    1  
ATOM 2160   O "O5'"  . A A 1 67  ? 117.838 131.214 107.375 1.00 0.00 ? 67  A A "O5'"  1  
ATOM 2161   C "C5'"  . A A 1 67  ? 116.891 130.161 107.477 1.00 0.00 ? 67  A A "C5'"  1  
ATOM 2162   C "C4'"  . A A 1 67  ? 117.501 128.924 108.088 1.00 0.00 ? 67  A A "C4'"  1  
ATOM 2163   O "O4'"  . A A 1 67  ? 118.533 128.395 107.217 1.00 0.00 ? 67  A A "O4'"  1  
ATOM 2164   C "C3'"  . A A 1 67  ? 118.243 129.126 109.401 1.00 0.00 ? 67  A A "C3'"  1  
ATOM 2165   O "O3'"  . A A 1 67  ? 117.379 129.202 110.521 1.00 0.00 ? 67  A A "O3'"  1  
ATOM 2166   C "C2'"  . A A 1 67  ? 119.122 127.884 109.445 1.00 0.00 ? 67  A A "C2'"  1  
ATOM 2167   O "O2'"  . A A 1 67  ? 118.372 126.736 109.815 1.00 0.00 ? 67  A A "O2'"  1  
ATOM 2168   C "C1'"  . A A 1 67  ? 119.531 127.763 107.976 1.00 0.00 ? 67  A A "C1'"  1  
ATOM 2169   N N9     . A A 1 67  ? 120.807 128.450 107.696 1.00 0.00 ? 67  A A N9     1  
ATOM 2170   C C8     . A A 1 67  ? 121.044 129.453 106.789 1.00 0.00 ? 67  A A C8     1  
ATOM 2171   N N7     . A A 1 67  ? 122.288 129.864 106.769 1.00 0.00 ? 67  A A N7     1  
ATOM 2172   C C5     . A A 1 67  ? 122.914 129.079 107.728 1.00 0.00 ? 67  A A C5     1  
ATOM 2173   C C6     . A A 1 67  ? 124.242 129.023 108.188 1.00 0.00 ? 67  A A C6     1  
ATOM 2174   N N6     . A A 1 67  ? 125.219 129.806 107.724 1.00 0.00 ? 67  A A N6     1  
ATOM 2175   N N1     . A A 1 67  ? 124.535 128.127 109.154 1.00 0.00 ? 67  A A N1     1  
ATOM 2176   C C2     . A A 1 67  ? 123.555 127.342 109.620 1.00 0.00 ? 67  A A C2     1  
ATOM 2177   N N3     . A A 1 67  ? 122.272 127.300 109.268 1.00 0.00 ? 67  A A N3     1  
ATOM 2178   C C4     . A A 1 67  ? 122.013 128.204 108.307 1.00 0.00 ? 67  A A C4     1  
ATOM 2179   H "H5'"  . A A 1 67  ? 116.557 129.943 106.581 1.00 0.00 ? 67  A A "H5'"  1  
ATOM 2180   H "H5''" . A A 1 67  ? 116.141 130.457 108.033 1.00 0.00 ? 67  A A "H5''" 1  
ATOM 2181   H "H4'"  . A A 1 67  ? 116.801 128.246 108.198 1.00 0.00 ? 67  A A "H4'"  1  
ATOM 2182   H "H3'"  . A A 1 67  ? 118.808 129.925 109.331 1.00 0.00 ? 67  A A "H3'"  1  
ATOM 2183   H "H2'"  . A A 1 67  ? 119.899 128.014 110.027 1.00 0.00 ? 67  A A "H2'"  1  
ATOM 2184   H "HO2'" . A A 1 67  ? 117.554 127.024 110.271 1.00 0.00 ? 67  A A "HO2'" 1  
ATOM 2185   H "H1'"  . A A 1 67  ? 119.611 126.816 107.737 1.00 0.00 ? 67  A A "H1'"  1  
ATOM 2186   H H8     . A A 1 67  ? 120.347 129.828 106.210 1.00 0.00 ? 67  A A H8     1  
ATOM 2187   H H61    . A A 1 67  ? 126.127 129.721 108.084 1.00 0.00 ? 67  A A H61    1  
ATOM 2188   H H62    . A A 1 67  ? 125.029 130.464 107.023 1.00 0.00 ? 67  A A H62    1  
ATOM 2189   H H2     . A A 1 67  ? 123.820 126.709 110.320 1.00 0.00 ? 67  A A H2     1  
ATOM 2190   P P      . C A 1 68  ? 117.681 130.248 111.704 1.00 0.00 ? 68  C A P      1  
ATOM 2191   O OP1    . C A 1 68  ? 116.503 130.270 112.609 1.00 0.00 ? 68  C A OP1    1  
ATOM 2192   O OP2    . C A 1 68  ? 118.159 131.512 111.091 1.00 0.00 ? 68  C A OP2    1  
ATOM 2193   O "O5'"  . C A 1 68  ? 118.898 129.593 112.497 1.00 0.00 ? 68  C A "O5'"  1  
ATOM 2194   C "C5'"  . C A 1 68  ? 118.780 128.304 113.079 1.00 0.00 ? 68  C A "C5'"  1  
ATOM 2195   C "C4'"  . C A 1 68  ? 120.093 127.828 113.651 1.00 0.00 ? 68  C A "C4'"  1  
ATOM 2196   O "O4'"  . C A 1 68  ? 121.061 127.654 112.585 1.00 0.00 ? 68  C A "O4'"  1  
ATOM 2197   C "C3'"  . C A 1 68  ? 120.770 128.762 114.642 1.00 0.00 ? 68  C A "C3'"  1  
ATOM 2198   O "O3'"  . C A 1 68  ? 120.315 128.580 115.972 1.00 0.00 ? 68  C A "O3'"  1  
ATOM 2199   C "C2'"  . C A 1 68  ? 122.255 128.439 114.473 1.00 0.00 ? 68  C A "C2'"  1  
ATOM 2200   O "O2'"  . C A 1 68  ? 122.617 127.283 115.213 1.00 0.00 ? 68  C A "O2'"  1  
ATOM 2201   C "C1'"  . C A 1 68  ? 122.345 128.114 112.977 1.00 0.00 ? 68  C A "C1'"  1  
ATOM 2202   N N1     . C A 1 68  ? 122.679 129.308 112.161 1.00 0.00 ? 68  C A N1     1  
ATOM 2203   C C2     . C A 1 68  ? 124.009 129.746 112.137 1.00 0.00 ? 68  C A C2     1  
ATOM 2204   O O2     . C A 1 68  ? 124.862 129.131 112.795 1.00 0.00 ? 68  C A O2     1  
ATOM 2205   N N3     . C A 1 68  ? 124.339 130.832 111.400 1.00 0.00 ? 68  C A N3     1  
ATOM 2206   C C4     . C A 1 68  ? 123.404 131.476 110.703 1.00 0.00 ? 68  C A C4     1  
ATOM 2207   N N4     . C A 1 68  ? 123.776 132.542 109.990 1.00 0.00 ? 68  C A N4     1  
ATOM 2208   C C5     . C A 1 68  ? 122.044 131.056 110.707 1.00 0.00 ? 68  C A C5     1  
ATOM 2209   C C6     . C A 1 68  ? 121.729 129.980 111.438 1.00 0.00 ? 68  C A C6     1  
ATOM 2210   H "H5'"  . C A 1 68  ? 118.481 127.670 112.394 1.00 0.00 ? 68  C A "H5'"  1  
ATOM 2211   H "H5''" . C A 1 68  ? 118.113 128.337 113.796 1.00 0.00 ? 68  C A "H5''" 1  
ATOM 2212   H "H4'"  . C A 1 68  ? 119.951 126.966 114.093 1.00 0.00 ? 68  C A "H4'"  1  
ATOM 2213   H "H3'"  . C A 1 68  ? 120.617 129.691 114.369 1.00 0.00 ? 68  C A "H3'"  1  
ATOM 2214   H "H2'"  . C A 1 68  ? 122.817 129.207 114.703 1.00 0.00 ? 68  C A "H2'"  1  
ATOM 2215   H "HO2'" . C A 1 68  ? 121.990 127.169 115.957 1.00 0.00 ? 68  C A "HO2'" 1  
ATOM 2216   H "H1'"  . C A 1 68  ? 123.026 127.423 112.839 1.00 0.00 ? 68  C A "H1'"  1  
ATOM 2217   H H41    . C A 1 68  ? 124.714 132.829 109.991 1.00 0.00 ? 68  C A H41    1  
ATOM 2218   H H42    . C A 1 68  ? 123.112 133.037 109.467 1.00 0.00 ? 68  C A H42    1  
ATOM 2219   H H5     . C A 1 68  ? 121.363 131.536 110.190 1.00 0.00 ? 68  C A H5     1  
ATOM 2220   H H6     . C A 1 68  ? 120.798 129.675 111.454 1.00 0.00 ? 68  C A H6     1  
ATOM 2221   P P      . A A 1 69  ? 120.683 129.657 117.107 1.00 0.00 ? 69  A A P      1  
ATOM 2222   O OP1    . A A 1 69  ? 121.878 130.413 116.655 1.00 0.00 ? 69  A A OP1    1  
ATOM 2223   O OP2    . A A 1 69  ? 120.709 128.956 118.415 1.00 0.00 ? 69  A A OP2    1  
ATOM 2224   O "O5'"  . A A 1 69  ? 119.441 130.655 117.109 1.00 0.00 ? 69  A A "O5'"  1  
ATOM 2225   C "C5'"  . A A 1 69  ? 119.622 132.046 116.888 1.00 0.00 ? 69  A A "C5'"  1  
ATOM 2226   C "C4'"  . A A 1 69  ? 118.338 132.711 116.461 1.00 0.00 ? 69  A A "C4'"  1  
ATOM 2227   O "O4'"  . A A 1 69  ? 117.764 132.011 115.326 1.00 0.00 ? 69  A A "O4'"  1  
ATOM 2228   C "C3'"  . A A 1 69  ? 117.216 132.718 117.487 1.00 0.00 ? 69  A A "C3'"  1  
ATOM 2229   O "O3'"  . A A 1 69  ? 117.379 133.715 118.481 1.00 0.00 ? 69  A A "O3'"  1  
ATOM 2230   C "C2'"  . A A 1 69  ? 115.982 132.928 116.625 1.00 0.00 ? 69  A A "C2'"  1  
ATOM 2231   O "O2'"  . A A 1 69  ? 115.838 134.292 116.256 1.00 0.00 ? 69  A A "O2'"  1  
ATOM 2232   C "C1'"  . A A 1 69  ? 116.347 132.112 115.389 1.00 0.00 ? 69  A A "C1'"  1  
ATOM 2233   N N9     . A A 1 69  ? 115.763 130.758 115.424 1.00 0.00 ? 69  A A N9     1  
ATOM 2234   C C8     . A A 1 69  ? 116.395 129.573 115.708 1.00 0.00 ? 69  A A C8     1  
ATOM 2235   N N7     . A A 1 69  ? 115.606 128.528 115.661 1.00 0.00 ? 69  A A N7     1  
ATOM 2236   C C5     . A A 1 69  ? 114.369 129.060 115.323 1.00 0.00 ? 69  A A C5     1  
ATOM 2237   C C6     . A A 1 69  ? 113.109 128.471 115.115 1.00 0.00 ? 69  A A C6     1  
ATOM 2238   N N6     . A A 1 69  ? 112.878 127.161 115.224 1.00 0.00 ? 69  A A N6     1  
ATOM 2239   N N1     . A A 1 69  ? 112.081 129.284 114.789 1.00 0.00 ? 69  A A N1     1  
ATOM 2240   C C2     . A A 1 69  ? 112.313 130.599 114.681 1.00 0.00 ? 69  A A C2     1  
ATOM 2241   N N3     . A A 1 69  ? 113.450 131.269 114.851 1.00 0.00 ? 69  A A N3     1  
ATOM 2242   C C4     . A A 1 69  ? 114.451 130.432 115.174 1.00 0.00 ? 69  A A C4     1  
ATOM 2243   H "H5'"  . A A 1 69  ? 120.296 132.173 116.188 1.00 0.00 ? 69  A A "H5'"  1  
ATOM 2244   H "H5''" . A A 1 69  ? 119.939 132.463 117.716 1.00 0.00 ? 69  A A "H5''" 1  
ATOM 2245   H "H4'"  . A A 1 69  ? 118.533 133.635 116.195 1.00 0.00 ? 69  A A "H4'"  1  
ATOM 2246   H "H3'"  . A A 1 69  ? 117.164 131.835 117.912 1.00 0.00 ? 69  A A "H3'"  1  
ATOM 2247   H "H2'"  . A A 1 69  ? 115.175 132.583 117.061 1.00 0.00 ? 69  A A "H2'"  1  
ATOM 2248   H "HO2'" . A A 1 69  ? 116.359 134.846 116.875 1.00 0.00 ? 69  A A "HO2'" 1  
ATOM 2249   H "H1'"  . A A 1 69  ? 116.037 132.581 114.585 1.00 0.00 ? 69  A A "H1'"  1  
ATOM 2250   H H8     . A A 1 69  ? 117.349 129.513 115.926 1.00 0.00 ? 69  A A H8     1  
ATOM 2251   H H61    . A A 1 69  ? 111.976 126.808 115.067 1.00 0.00 ? 69  A A H61    1  
ATOM 2252   H H62    . A A 1 69  ? 113.608 126.551 115.459 1.00 0.00 ? 69  A A H62    1  
ATOM 2253   H H2     . A A 1 69  ? 111.534 131.145 114.442 1.00 0.00 ? 69  A A H2     1  
ATOM 2254   P P      . A A 1 70  ? 117.185 133.348 120.034 1.00 0.00 ? 70  A A P      1  
ATOM 2255   O OP1    . A A 1 70  ? 117.413 134.580 120.830 1.00 0.00 ? 70  A A OP1    1  
ATOM 2256   O OP2    . A A 1 70  ? 117.983 132.129 120.321 1.00 0.00 ? 70  A A OP2    1  
ATOM 2257   O "O5'"  . A A 1 70  ? 115.643 132.965 120.149 1.00 0.00 ? 70  A A "O5'"  1  
ATOM 2258   C "C5'"  . A A 1 70  ? 114.647 133.972 120.256 1.00 0.00 ? 70  A A "C5'"  1  
ATOM 2259   C "C4'"  . A A 1 70  ? 113.263 133.405 120.064 1.00 0.00 ? 70  A A "C4'"  1  
ATOM 2260   O "O4'"  . A A 1 70  ? 113.330 132.280 119.150 1.00 0.00 ? 70  A A "O4'"  1  
ATOM 2261   C "C3'"  . A A 1 70  ? 112.568 132.901 121.319 1.00 0.00 ? 70  A A "C3'"  1  
ATOM 2262   O "O3'"  . A A 1 70  ? 111.160 133.053 121.273 1.00 0.00 ? 70  A A "O3'"  1  
ATOM 2263   C "C2'"  . A A 1 70  ? 112.871 131.407 121.303 1.00 0.00 ? 70  A A "C2'"  1  
ATOM 2264   O "O2'"  . A A 1 70  ? 111.839 130.665 121.936 1.00 0.00 ? 70  A A "O2'"  1  
ATOM 2265   C "C1'"  . A A 1 70  ? 112.851 131.095 119.807 1.00 0.00 ? 70  A A "C1'"  1  
ATOM 2266   N N9     . A A 1 70  ? 113.729 129.960 119.464 1.00 0.00 ? 70  A A N9     1  
ATOM 2267   C C8     . A A 1 70  ? 115.099 129.899 119.544 1.00 0.00 ? 70  A A C8     1  
ATOM 2268   N N7     . A A 1 70  ? 115.599 128.748 119.167 1.00 0.00 ? 70  A A N7     1  
ATOM 2269   C C5     . A A 1 70  ? 114.484 128.000 118.815 1.00 0.00 ? 70  A A C5     1  
ATOM 2270   C C6     . A A 1 70  ? 114.338 126.688 118.330 1.00 0.00 ? 70  A A C6     1  
ATOM 2271   N N6     . A A 1 70  ? 115.364 125.862 118.110 1.00 0.00 ? 70  A A N6     1  
ATOM 2272   N N1     . A A 1 70  ? 113.087 126.246 118.078 1.00 0.00 ? 70  A A N1     1  
ATOM 2273   C C2     . A A 1 70  ? 112.058 127.074 118.300 1.00 0.00 ? 70  A A C2     1  
ATOM 2274   N N3     . A A 1 70  ? 112.068 128.326 118.752 1.00 0.00 ? 70  A A N3     1  
ATOM 2275   C C4     . A A 1 70  ? 113.327 128.734 118.993 1.00 0.00 ? 70  A A C4     1  
ATOM 2276   H "H5'"  . A A 1 70  ? 114.810 134.656 119.574 1.00 0.00 ? 70  A A "H5'"  1  
ATOM 2277   H "H5''" . A A 1 70  ? 114.704 134.385 121.142 1.00 0.00 ? 70  A A "H5''" 1  
ATOM 2278   H "H4'"  . A A 1 70  ? 112.687 134.099 119.679 1.00 0.00 ? 70  A A "H4'"  1  
ATOM 2279   H "H3'"  . A A 1 70  ? 112.994 133.303 122.106 1.00 0.00 ? 70  A A "H3'"  1  
ATOM 2280   H "H2'"  . A A 1 70  ? 113.749 131.215 121.693 1.00 0.00 ? 70  A A "H2'"  1  
ATOM 2281   H "HO2'" . A A 1 70  ? 112.081 129.716 121.932 1.00 0.00 ? 70  A A "HO2'" 1  
ATOM 2282   H "H1'"  . A A 1 70  ? 111.933 130.893 119.528 1.00 0.00 ? 70  A A "H1'"  1  
ATOM 2283   H H8     . A A 1 70  ? 115.651 130.647 119.855 1.00 0.00 ? 70  A A H8     1  
ATOM 2284   H H61    . A A 1 70  ? 115.200 124.957 117.772 1.00 0.00 ? 70  A A H61    1  
ATOM 2285   H H62    . A A 1 70  ? 116.280 126.160 118.286 1.00 0.00 ? 70  A A H62    1  
ATOM 2286   H H2     . A A 1 70  ? 111.171 126.706 118.101 1.00 0.00 ? 70  A A H2     1  
ATOM 2287   P P      . C A 1 71  ? 110.527 134.476 120.892 1.00 0.00 ? 71  C A P      1  
ATOM 2288   O OP1    . C A 1 71  ? 109.257 134.660 121.639 1.00 0.00 ? 71  C A OP1    1  
ATOM 2289   O OP2    . C A 1 71  ? 110.505 134.433 119.408 1.00 0.00 ? 71  C A OP2    1  
ATOM 2290   O "O5'"  . C A 1 71  ? 111.531 135.630 121.337 1.00 0.00 ? 71  C A "O5'"  1  
ATOM 2291   C "C5'"  . C A 1 71  ? 111.096 136.695 122.169 1.00 0.00 ? 71  C A "C5'"  1  
ATOM 2292   C "C4'"  . C A 1 71  ? 111.443 138.040 121.579 1.00 0.00 ? 71  C A "C4'"  1  
ATOM 2293   O "O4'"  . C A 1 71  ? 112.816 138.051 121.104 1.00 0.00 ? 71  C A "O4'"  1  
ATOM 2294   C "C3'"  . C A 1 71  ? 110.631 138.471 120.368 1.00 0.00 ? 71  C A "C3'"  1  
ATOM 2295   O "O3'"  . C A 1 71  ? 109.359 138.993 120.713 1.00 0.00 ? 71  C A "O3'"  1  
ATOM 2296   C "C2'"  . C A 1 71  ? 111.537 139.517 119.742 1.00 0.00 ? 71  C A "C2'"  1  
ATOM 2297   O "O2'"  . C A 1 71  ? 111.447 140.755 120.433 1.00 0.00 ? 71  C A "O2'"  1  
ATOM 2298   C "C1'"  . C A 1 71  ? 112.911 138.903 119.989 1.00 0.00 ? 71  C A "C1'"  1  
ATOM 2299   N N1     . C A 1 71  ? 113.403 138.133 118.820 1.00 0.00 ? 71  C A N1     1  
ATOM 2300   C C2     . C A 1 71  ? 114.015 138.833 117.772 1.00 0.00 ? 71  C A C2     1  
ATOM 2301   O O2     . C A 1 71  ? 114.126 140.067 117.852 1.00 0.00 ? 71  C A O2     1  
ATOM 2302   N N3     . C A 1 71  ? 114.472 138.155 116.695 1.00 0.00 ? 71  C A N3     1  
ATOM 2303   C C4     . C A 1 71  ? 114.340 136.831 116.634 1.00 0.00 ? 71  C A C4     1  
ATOM 2304   N N4     . C A 1 71  ? 114.806 136.203 115.551 1.00 0.00 ? 71  C A N4     1  
ATOM 2305   C C5     . C A 1 71  ? 113.723 136.090 117.681 1.00 0.00 ? 71  C A C5     1  
ATOM 2306   C C6     . C A 1 71  ? 113.275 136.771 118.742 1.00 0.00 ? 71  C A C6     1  
ATOM 2307   H "H5'"  . C A 1 71  ? 111.524 136.610 123.046 1.00 0.00 ? 71  C A "H5'"  1  
ATOM 2308   H "H5''" . C A 1 71  ? 110.124 136.636 122.280 1.00 0.00 ? 71  C A "H5''" 1  
ATOM 2309   H "H4'"  . C A 1 71  ? 111.347 138.715 122.282 1.00 0.00 ? 71  C A "H4'"  1  
ATOM 2310   H "H3'"  . C A 1 71  ? 110.513 137.722 119.747 1.00 0.00 ? 71  C A "H3'"  1  
ATOM 2311   H "H2'"  . C A 1 71  ? 111.354 139.623 118.785 1.00 0.00 ? 71  C A "H2'"  1  
ATOM 2312   H "HO2'" . C A 1 71  ? 112.042 141.404 120.004 1.00 0.00 ? 71  C A "HO2'" 1  
ATOM 2313   H "H1'"  . C A 1 71  ? 113.549 139.615 120.202 1.00 0.00 ? 71  C A "H1'"  1  
ATOM 2314   H H41    . C A 1 71  ? 115.230 136.717 114.831 1.00 0.00 ? 71  C A H41    1  
ATOM 2315   H H42    . C A 1 71  ? 114.724 135.230 115.476 1.00 0.00 ? 71  C A H42    1  
ATOM 2316   H H5     . C A 1 71  ? 113.631 135.115 117.627 1.00 0.00 ? 71  C A H5     1  
ATOM 2317   H H6     . C A 1 71  ? 112.848 136.279 119.473 1.00 0.00 ? 71  C A H6     1  
ATOM 2318   P P      . A A 1 72  ? 108.075 138.658 119.807 1.00 0.00 ? 72  A A P      1  
ATOM 2319   O OP1    . A A 1 72  ? 106.947 139.500 120.277 1.00 0.00 ? 72  A A OP1    1  
ATOM 2320   O OP2    . A A 1 72  ? 107.919 137.182 119.759 1.00 0.00 ? 72  A A OP2    1  
ATOM 2321   O "O5'"  . A A 1 72  ? 108.490 139.156 118.351 1.00 0.00 ? 72  A A "O5'"  1  
ATOM 2322   C "C5'"  . A A 1 72  ? 108.641 140.540 118.070 1.00 0.00 ? 72  A A "C5'"  1  
ATOM 2323   C "C4'"  . A A 1 72  ? 109.292 140.765 116.729 1.00 0.00 ? 72  A A "C4'"  1  
ATOM 2324   O "O4'"  . A A 1 72  ? 110.595 140.131 116.689 1.00 0.00 ? 72  A A "O4'"  1  
ATOM 2325   C "C3'"  . A A 1 72  ? 108.572 140.169 115.529 1.00 0.00 ? 72  A A "C3'"  1  
ATOM 2326   O "O3'"  . A A 1 72  ? 107.486 140.962 115.083 1.00 0.00 ? 72  A A "O3'"  1  
ATOM 2327   C "C2'"  . A A 1 72  ? 109.702 140.028 114.513 1.00 0.00 ? 72  A A "C2'"  1  
ATOM 2328   O "O2'"  . A A 1 72  ? 110.011 141.277 113.912 1.00 0.00 ? 72  A A "O2'"  1  
ATOM 2329   C "C1'"  . A A 1 72  ? 110.865 139.607 115.412 1.00 0.00 ? 72  A A "C1'"  1  
ATOM 2330   N N9     . A A 1 72  ? 110.978 138.140 115.522 1.00 0.00 ? 72  A A N9     1  
ATOM 2331   C C8     . A A 1 72  ? 110.468 137.325 116.502 1.00 0.00 ? 72  A A C8     1  
ATOM 2332   N N7     . A A 1 72  ? 110.736 136.055 116.326 1.00 0.00 ? 72  A A N7     1  
ATOM 2333   C C5     . A A 1 72  ? 111.474 136.030 115.150 1.00 0.00 ? 72  A A C5     1  
ATOM 2334   C C6     . A A 1 72  ? 112.060 134.980 114.422 1.00 0.00 ? 72  A A C6     1  
ATOM 2335   N N6     . A A 1 72  ? 111.992 133.698 114.787 1.00 0.00 ? 72  A A N6     1  
ATOM 2336   N N1     . A A 1 72  ? 112.727 135.295 113.291 1.00 0.00 ? 72  A A N1     1  
ATOM 2337   C C2     . A A 1 72  ? 112.796 136.582 112.924 1.00 0.00 ? 72  A A C2     1  
ATOM 2338   N N3     . A A 1 72  ? 112.287 137.656 113.524 1.00 0.00 ? 72  A A N3     1  
ATOM 2339   C C4     . A A 1 72  ? 111.630 137.307 114.645 1.00 0.00 ? 72  A A C4     1  
ATOM 2340   H "H5'"  . A A 1 72  ? 109.195 140.949 118.767 1.00 0.00 ? 72  A A "H5'"  1  
ATOM 2341   H "H5''" . A A 1 72  ? 107.759 140.966 118.073 1.00 0.00 ? 72  A A "H5''" 1  
ATOM 2342   H "H4'"  . A A 1 72  ? 109.397 141.729 116.588 1.00 0.00 ? 72  A A "H4'"  1  
ATOM 2343   H "H3'"  . A A 1 72  ? 108.243 139.274 115.761 1.00 0.00 ? 72  A A "H3'"  1  
ATOM 2344   H "H2'"  . A A 1 72  ? 109.499 139.342 113.843 1.00 0.00 ? 72  A A "H2'"  1  
ATOM 2345   H "HO2'" . A A 1 72  ? 109.221 141.854 113.952 1.00 0.00 ? 72  A A "HO2'" 1  
ATOM 2346   H "H1'"  . A A 1 72  ? 111.701 139.973 115.055 1.00 0.00 ? 72  A A "H1'"  1  
ATOM 2347   H H8     . A A 1 72  ? 109.950 137.662 117.263 1.00 0.00 ? 72  A A H8     1  
ATOM 2348   H H61    . A A 1 72  ? 112.422 133.008 114.238 1.00 0.00 ? 72  A A H61    1  
ATOM 2349   H H62    . A A 1 72  ? 111.514 133.445 115.604 1.00 0.00 ? 72  A A H62    1  
ATOM 2350   H H2     . A A 1 72  ? 113.291 136.757 112.096 1.00 0.00 ? 72  A A H2     1  
ATOM 2351   P P      . G A 1 73  ? 106.196 140.267 114.423 1.00 0.00 ? 73  G A P      1  
ATOM 2352   O OP1    . G A 1 73  ? 105.257 141.341 114.009 1.00 0.00 ? 73  G A OP1    1  
ATOM 2353   O OP2    . G A 1 73  ? 105.729 139.198 115.342 1.00 0.00 ? 73  G A OP2    1  
ATOM 2354   O "O5'"  . G A 1 73  ? 106.762 139.572 113.106 1.00 0.00 ? 73  G A "O5'"  1  
ATOM 2355   C "C5'"  . G A 1 73  ? 106.910 140.307 111.900 1.00 0.00 ? 73  G A "C5'"  1  
ATOM 2356   C "C4'"  . G A 1 73  ? 107.910 139.659 110.975 1.00 0.00 ? 73  G A "C4'"  1  
ATOM 2357   O "O4'"  . G A 1 73  ? 108.904 138.880 111.687 1.00 0.00 ? 73  G A "O4'"  1  
ATOM 2358   C "C3'"  . G A 1 73  ? 107.349 138.634 110.000 1.00 0.00 ? 73  G A "C3'"  1  
ATOM 2359   O "O3'"  . G A 1 73  ? 106.630 139.224 108.931 1.00 0.00 ? 73  G A "O3'"  1  
ATOM 2360   C "C2'"  . G A 1 73  ? 108.671 138.025 109.529 1.00 0.00 ? 73  G A "C2'"  1  
ATOM 2361   O "O2'"  . G A 1 73  ? 109.354 138.900 108.642 1.00 0.00 ? 73  G A "O2'"  1  
ATOM 2362   C "C1'"  . G A 1 73  ? 109.449 137.941 110.842 1.00 0.00 ? 73  G A "C1'"  1  
ATOM 2363   N N9     . G A 1 73  ? 109.307 136.623 111.488 1.00 0.00 ? 73  G A N9     1  
ATOM 2364   C C8     . G A 1 73  ? 108.444 136.283 112.502 1.00 0.00 ? 73  G A C8     1  
ATOM 2365   N N7     . G A 1 73  ? 108.550 135.035 112.870 1.00 0.00 ? 73  G A N7     1  
ATOM 2366   C C5     . G A 1 73  ? 109.542 134.518 112.048 1.00 0.00 ? 73  G A C5     1  
ATOM 2367   C C6     . G A 1 73  ? 110.092 133.212 111.980 1.00 0.00 ? 73  G A C6     1  
ATOM 2368   O O6     . G A 1 73  ? 109.802 132.218 112.656 1.00 0.00 ? 73  G A O6     1  
ATOM 2369   N N1     . G A 1 73  ? 111.079 133.121 111.004 1.00 0.00 ? 73  G A N1     1  
ATOM 2370   C C2     . G A 1 73  ? 111.485 134.154 110.194 1.00 0.00 ? 73  G A C2     1  
ATOM 2371   N N2     . G A 1 73  ? 112.452 133.873 109.309 1.00 0.00 ? 73  G A N2     1  
ATOM 2372   N N3     . G A 1 73  ? 110.980 135.376 110.248 1.00 0.00 ? 73  G A N3     1  
ATOM 2373   C C4     . G A 1 73  ? 110.020 135.486 111.190 1.00 0.00 ? 73  G A C4     1  
ATOM 2374   H "H5'"  . G A 1 73  ? 107.213 141.214 112.113 1.00 0.00 ? 73  G A "H5'"  1  
ATOM 2375   H "H5''" . G A 1 73  ? 106.042 140.359 111.448 1.00 0.00 ? 73  G A "H5''" 1  
ATOM 2376   H "H4'"  . G A 1 73  ? 108.348 140.374 110.468 1.00 0.00 ? 73  G A "H4'"  1  
ATOM 2377   H "H3'"  . G A 1 73  ? 106.793 137.946 110.420 1.00 0.00 ? 73  G A "H3'"  1  
ATOM 2378   H "H2'"  . G A 1 73  ? 108.538 137.139 109.133 1.00 0.00 ? 73  G A "H2'"  1  
ATOM 2379   H "HO2'" . G A 1 73  ? 108.713 139.540 108.268 1.00 0.00 ? 73  G A "HO2'" 1  
ATOM 2380   H "H1'"  . G A 1 73  ? 110.398 138.121 110.672 1.00 0.00 ? 73  G A "H1'"  1  
ATOM 2381   H H8     . G A 1 73  ? 107.814 136.913 112.910 1.00 0.00 ? 73  G A H8     1  
ATOM 2382   H H1     . G A 1 73  ? 111.516 132.252 110.885 1.00 0.00 ? 73  G A H1     1  
ATOM 2383   H H21    . G A 1 73  ? 112.831 132.970 109.264 1.00 0.00 ? 73  G A H21    1  
ATOM 2384   H H22    . G A 1 73  ? 112.782 134.571 108.705 1.00 0.00 ? 73  G A H22    1  
ATOM 2385   P P      . C A 1 74  ? 105.546 138.363 108.115 1.00 0.00 ? 74  C A P      1  
ATOM 2386   O OP1    . C A 1 74  ? 104.280 139.138 108.073 1.00 0.00 ? 74  C A OP1    1  
ATOM 2387   O OP2    . C A 1 74  ? 105.543 136.984 108.666 1.00 0.00 ? 74  C A OP2    1  
ATOM 2388   O "O5'"  . C A 1 74  ? 106.134 138.302 106.637 1.00 0.00 ? 74  C A "O5'"  1  
ATOM 2389   C "C5'"  . C A 1 74  ? 107.233 137.459 106.322 1.00 0.00 ? 74  C A "C5'"  1  
ATOM 2390   C "C4'"  . C A 1 74  ? 107.800 137.768 104.957 1.00 0.00 ? 74  C A "C4'"  1  
ATOM 2391   O "O4'"  . C A 1 74  ? 106.969 137.167 103.930 1.00 0.00 ? 74  C A "O4'"  1  
ATOM 2392   C "C3'"  . C A 1 74  ? 107.856 139.238 104.572 1.00 0.00 ? 74  C A "C3'"  1  
ATOM 2393   O "O3'"  . C A 1 74  ? 108.974 139.914 105.124 1.00 0.00 ? 74  C A "O3'"  1  
ATOM 2394   C "C2'"  . C A 1 74  ? 107.868 139.184 103.051 1.00 0.00 ? 74  C A "C2'"  1  
ATOM 2395   O "O2'"  . C A 1 74  ? 109.155 138.848 102.557 1.00 0.00 ? 74  C A "O2'"  1  
ATOM 2396   C "C1'"  . C A 1 74  ? 106.911 138.021 102.782 1.00 0.00 ? 74  C A "C1'"  1  
ATOM 2397   N N1     . C A 1 74  ? 105.520 138.479 102.538 1.00 0.00 ? 74  C A N1     1  
ATOM 2398   C C2     . C A 1 74  ? 105.212 139.029 101.289 1.00 0.00 ? 74  C A C2     1  
ATOM 2399   O O2     . C A 1 74  ? 106.101 139.120 100.430 1.00 0.00 ? 74  C A O2     1  
ATOM 2400   N N3     . C A 1 74  ? 103.950 139.454 101.042 1.00 0.00 ? 74  C A N3     1  
ATOM 2401   C C4     . C A 1 74  ? 103.014 139.346 101.983 1.00 0.00 ? 74  C A C4     1  
ATOM 2402   N N4     . C A 1 74  ? 101.782 139.778 101.696 1.00 0.00 ? 74  C A N4     1  
ATOM 2403   C C5     . C A 1 74  ? 103.296 138.790 103.264 1.00 0.00 ? 74  C A C5     1  
ATOM 2404   C C6     . C A 1 74  ? 104.546 138.373 103.497 1.00 0.00 ? 74  C A C6     1  
ATOM 2405   H "H5'"  . C A 1 74  ? 106.936 136.526 106.343 1.00 0.00 ? 74  C A "H5'"  1  
ATOM 2406   H "H5''" . C A 1 74  ? 107.933 137.587 106.994 1.00 0.00 ? 74  C A "H5''" 1  
ATOM 2407   H "H4'"  . C A 1 74  ? 108.700 137.389 104.898 1.00 0.00 ? 74  C A "H4'"  1  
ATOM 2408   H "H3'"  . C A 1 74  ? 107.034 139.681 104.870 1.00 0.00 ? 74  C A "H3'"  1  
ATOM 2409   H "H2'"  . C A 1 74  ? 107.535 140.018 102.659 1.00 0.00 ? 74  C A "H2'"  1  
ATOM 2410   H "HO2'" . C A 1 74  ? 109.821 139.031 103.251 1.00 0.00 ? 74  C A "HO2'" 1  
ATOM 2411   H "H1'"  . C A 1 74  ? 107.226 137.513 102.003 1.00 0.00 ? 74  C A "H1'"  1  
ATOM 2412   H H41    . C A 1 74  ? 101.591 140.162 100.813 1.00 0.00 ? 74  C A H41    1  
ATOM 2413   H H42    . C A 1 74  ? 101.071 139.714 102.366 1.00 0.00 ? 74  C A H42    1  
ATOM 2414   H H5     . C A 1 74  ? 102.599 138.716 103.949 1.00 0.00 ? 74  C A H5     1  
ATOM 2415   H H6     . C A 1 74  ? 104.759 137.989 104.371 1.00 0.00 ? 74  C A H6     1  
ATOM 2416   P P      . C A 1 75  ? 108.912 141.497 105.390 1.00 0.00 ? 75  C A P      1  
ATOM 2417   O OP1    . C A 1 75  ? 110.184 141.906 106.037 1.00 0.00 ? 75  C A OP1    1  
ATOM 2418   O OP2    . C A 1 75  ? 107.619 141.804 106.052 1.00 0.00 ? 75  C A OP2    1  
ATOM 2419   O "O5'"  . C A 1 75  ? 108.878 142.132 103.928 1.00 0.00 ? 75  C A "O5'"  1  
ATOM 2420   C "C5'"  . C A 1 75  ? 110.046 142.165 103.120 1.00 0.00 ? 75  C A "C5'"  1  
ATOM 2421   C "C4'"  . C A 1 75  ? 109.778 142.804 101.780 1.00 0.00 ? 75  C A "C4'"  1  
ATOM 2422   O "O4'"  . C A 1 75  ? 108.746 142.065 101.076 1.00 0.00 ? 75  C A "O4'"  1  
ATOM 2423   C "C3'"  . C A 1 75  ? 109.252 144.230 101.811 1.00 0.00 ? 75  C A "C3'"  1  
ATOM 2424   O "O3'"  . C A 1 75  ? 110.269 145.193 102.027 1.00 0.00 ? 75  C A "O3'"  1  
ATOM 2425   C "C2'"  . C A 1 75  ? 108.565 144.363 100.459 1.00 0.00 ? 75  C A "C2'"  1  
ATOM 2426   O "O2'"  . C A 1 75  ? 109.511 144.566 99.419  1.00 0.00 ? 75  C A "O2'"  1  
ATOM 2427   C "C1'"  . C A 1 75  ? 107.941 142.976 100.297 1.00 0.00 ? 75  C A "C1'"  1  
ATOM 2428   N N1     . C A 1 75  ? 106.523 142.942 100.734 1.00 0.00 ? 75  C A N1     1  
ATOM 2429   C C2     . C A 1 75  ? 105.551 143.476 99.879  1.00 0.00 ? 75  C A C2     1  
ATOM 2430   O O2     . C A 1 75  ? 105.901 143.960 98.791  1.00 0.00 ? 75  C A O2     1  
ATOM 2431   N N3     . C A 1 75  ? 104.251 143.456 100.254 1.00 0.00 ? 75  C A N3     1  
ATOM 2432   C C4     . C A 1 75  ? 103.903 142.932 101.427 1.00 0.00 ? 75  C A C4     1  
ATOM 2433   N N4     . C A 1 75  ? 102.607 142.935 101.756 1.00 0.00 ? 75  C A N4     1  
ATOM 2434   C C5     . C A 1 75  ? 104.868 142.380 102.319 1.00 0.00 ? 75  C A C5     1  
ATOM 2435   C C6     . C A 1 75  ? 106.149 142.404 101.938 1.00 0.00 ? 75  C A C6     1  
ATOM 2436   H "H5'"  . C A 1 75  ? 110.363 141.247 102.980 1.00 0.00 ? 75  C A "H5'"  1  
ATOM 2437   H "H5''" . C A 1 75  ? 110.741 142.674 103.585 1.00 0.00 ? 75  C A "H5''" 1  
ATOM 2438   H "H4'"  . C A 1 75  ? 110.602 142.781 101.250 1.00 0.00 ? 75  C A "H4'"  1  
ATOM 2439   H "H3'"  . C A 1 75  ? 108.580 144.310 102.520 1.00 0.00 ? 75  C A "H3'"  1  
ATOM 2440   H "H2'"  . C A 1 75  ? 107.882 145.064 100.470 1.00 0.00 ? 75  C A "H2'"  1  
ATOM 2441   H "HO2'" . C A 1 75  ? 110.348 144.894 99.808  1.00 0.00 ? 75  C A "HO2'" 1  
ATOM 2442   H "H1'"  . C A 1 75  ? 107.999 142.700 99.359  1.00 0.00 ? 75  C A "H1'"  1  
ATOM 2443   H H41    . C A 1 75  ? 101.947 143.315 101.138 1.00 0.00 ? 75  C A H41    1  
ATOM 2444   H H42    . C A 1 75  ? 102.319 142.556 102.610 1.00 0.00 ? 75  C A H42    1  
ATOM 2445   H H5     . C A 1 75  ? 104.599 141.998 103.180 1.00 0.00 ? 75  C A H5     1  
ATOM 2446   H H6     . C A 1 75  ? 106.827 142.030 102.537 1.00 0.00 ? 75  C A H6     1  
ATOM 2447   P P      . G A 1 76  ? 109.912 146.616 102.686 1.00 0.00 ? 76  G A P      1  
ATOM 2448   O OP1    . G A 1 76  ? 111.184 147.347 102.920 1.00 0.00 ? 76  G A OP1    1  
ATOM 2449   O OP2    . G A 1 76  ? 108.980 146.379 103.817 1.00 0.00 ? 76  G A OP2    1  
ATOM 2450   O "O5'"  . G A 1 76  ? 109.110 147.379 101.537 1.00 0.00 ? 76  G A "O5'"  1  
ATOM 2451   C "C5'"  . G A 1 76  ? 109.752 147.767 100.333 1.00 0.00 ? 76  G A "C5'"  1  
ATOM 2452   C "C4'"  . G A 1 76  ? 108.771 148.339 99.340  1.00 0.00 ? 76  G A "C4'"  1  
ATOM 2453   O "O4'"  . G A 1 76  ? 107.768 147.344 99.014  1.00 0.00 ? 76  G A "O4'"  1  
ATOM 2454   C "C3'"  . G A 1 76  ? 107.964 149.539 99.816  1.00 0.00 ? 76  G A "C3'"  1  
ATOM 2455   O "O3'"  . G A 1 76  ? 108.691 150.754 99.754  1.00 0.00 ? 76  G A "O3'"  1  
ATOM 2456   C "C2'"  . G A 1 76  ? 106.750 149.506 98.901  1.00 0.00 ? 76  G A "C2'"  1  
ATOM 2457   O "O2'"  . G A 1 76  ? 107.058 150.027 97.614  1.00 0.00 ? 76  G A "O2'"  1  
ATOM 2458   C "C1'"  . G A 1 76  ? 106.500 148.001 98.778  1.00 0.00 ? 76  G A "C1'"  1  
ATOM 2459   N N9     . G A 1 76  ? 105.474 147.530 99.726  1.00 0.00 ? 76  G A N9     1  
ATOM 2460   C C8     . G A 1 76  ? 105.674 146.816 100.883 1.00 0.00 ? 76  G A C8     1  
ATOM 2461   N N7     . G A 1 76  ? 104.564 146.541 101.514 1.00 0.00 ? 76  G A N7     1  
ATOM 2462   C C5     . G A 1 76  ? 103.571 147.109 100.730 1.00 0.00 ? 76  G A C5     1  
ATOM 2463   C C6     . G A 1 76  ? 102.163 147.138 100.906 1.00 0.00 ? 76  G A C6     1  
ATOM 2464   O O6     . G A 1 76  ? 101.492 146.651 101.822 1.00 0.00 ? 76  G A O6     1  
ATOM 2465   N N1     . G A 1 76  ? 101.531 147.819 99.870  1.00 0.00 ? 76  G A N1     1  
ATOM 2466   C C2     . G A 1 76  ? 102.172 148.401 98.801  1.00 0.00 ? 76  G A C2     1  
ATOM 2467   N N2     . G A 1 76  ? 101.390 149.016 97.902  1.00 0.00 ? 76  G A N2     1  
ATOM 2468   N N3     . G A 1 76  ? 103.484 148.380 98.627  1.00 0.00 ? 76  G A N3     1  
ATOM 2469   C C4     . G A 1 76  ? 104.114 147.722 99.621  1.00 0.00 ? 76  G A C4     1  
ATOM 2470   H "H5'"  . G A 1 76  ? 110.189 146.985 99.936  1.00 0.00 ? 76  G A "H5'"  1  
ATOM 2471   H "H5''" . G A 1 76  ? 110.433 148.443 100.537 1.00 0.00 ? 76  G A "H5''" 1  
ATOM 2472   H "H4'"  . G A 1 76  ? 109.254 148.585 98.523  1.00 0.00 ? 76  G A "H4'"  1  
ATOM 2473   H "H3'"  . G A 1 76  ? 107.675 149.386 100.739 1.00 0.00 ? 76  G A "H3'"  1  
ATOM 2474   H "H2'"  . G A 1 76  ? 105.983 149.965 99.303  1.00 0.00 ? 76  G A "H2'"  1  
ATOM 2475   H "HO2'" . G A 1 76  ? 107.864 150.578 97.679  1.00 0.00 ? 76  G A "HO2'" 1  
ATOM 2476   H "H1'"  . G A 1 76  ? 106.221 147.790 97.864  1.00 0.00 ? 76  G A "H1'"  1  
ATOM 2477   H H8     . G A 1 76  ? 106.557 146.539 101.201 1.00 0.00 ? 76  G A H8     1  
ATOM 2478   H H1     . G A 1 76  ? 100.554 147.889 99.907  1.00 0.00 ? 76  G A H1     1  
ATOM 2479   H H21    . G A 1 76  ? 100.417 149.035 98.026  1.00 0.00 ? 76  G A H21    1  
ATOM 2480   H H22    . G A 1 76  ? 101.791 149.448 97.119  1.00 0.00 ? 76  G A H22    1  
ATOM 2481   P P      . U A 1 77  ? 108.471 151.885 100.875 1.00 0.00 ? 77  U A P      1  
ATOM 2482   O OP1    . U A 1 77  ? 109.348 153.037 100.544 1.00 0.00 ? 77  U A OP1    1  
ATOM 2483   O OP2    . U A 1 77  ? 108.579 151.238 102.206 1.00 0.00 ? 77  U A OP2    1  
ATOM 2484   O "O5'"  . U A 1 77  ? 106.959 152.341 100.669 1.00 0.00 ? 77  U A "O5'"  1  
ATOM 2485   C "C5'"  . U A 1 77  ? 106.555 153.017 99.488  1.00 0.00 ? 77  U A "C5'"  1  
ATOM 2486   C "C4'"  . U A 1 77  ? 105.052 153.086 99.372  1.00 0.00 ? 77  U A "C4'"  1  
ATOM 2487   O "O4'"  . U A 1 77  ? 104.467 151.759 99.328  1.00 0.00 ? 77  U A "O4'"  1  
ATOM 2488   C "C3'"  . U A 1 77  ? 104.320 153.741 100.534 1.00 0.00 ? 77  U A "C3'"  1  
ATOM 2489   O "O3'"  . U A 1 77  ? 104.425 155.153 100.530 1.00 0.00 ? 77  U A "O3'"  1  
ATOM 2490   C "C2'"  . U A 1 77  ? 102.910 153.209 100.337 1.00 0.00 ? 77  U A "C2'"  1  
ATOM 2491   O "O2'"  . U A 1 77  ? 102.262 153.858 99.252  1.00 0.00 ? 77  U A "O2'"  1  
ATOM 2492   C "C1'"  . U A 1 77  ? 103.209 151.761 99.958  1.00 0.00 ? 77  U A "C1'"  1  
ATOM 2493   N N1     . U A 1 77  ? 103.265 150.869 101.141 1.00 0.00 ? 77  U A N1     1  
ATOM 2494   C C2     . U A 1 77  ? 102.074 150.307 101.564 1.00 0.00 ? 77  U A C2     1  
ATOM 2495   O O2     . U A 1 77  ? 101.008 150.513 101.012 1.00 0.00 ? 77  U A O2     1  
ATOM 2496   N N3     . U A 1 77  ? 102.174 149.489 102.662 1.00 0.00 ? 77  U A N3     1  
ATOM 2497   C C4     . U A 1 77  ? 103.317 149.180 103.369 1.00 0.00 ? 77  U A C4     1  
ATOM 2498   O O4     . U A 1 77  ? 103.243 148.425 104.339 1.00 0.00 ? 77  U A O4     1  
ATOM 2499   C C5     . U A 1 77  ? 104.510 149.797 102.874 1.00 0.00 ? 77  U A C5     1  
ATOM 2500   C C6     . U A 1 77  ? 104.442 150.598 101.806 1.00 0.00 ? 77  U A C6     1  
ATOM 2501   H "H5'"  . U A 1 77  ? 106.913 152.542 98.710  1.00 0.00 ? 77  U A "H5'"  1  
ATOM 2502   H "H5''" . U A 1 77  ? 106.916 153.928 99.501  1.00 0.00 ? 77  U A "H5''" 1  
ATOM 2503   H "H4'"  . U A 1 77  ? 104.820 153.551 98.542  1.00 0.00 ? 77  U A "H4'"  1  
ATOM 2504   H "H3'"  . U A 1 77  ? 104.683 153.400 101.377 1.00 0.00 ? 77  U A "H3'"  1  
ATOM 2505   H "H2'"  . U A 1 77  ? 102.385 153.271 101.162 1.00 0.00 ? 77  U A "H2'"  1  
ATOM 2506   H "HO2'" . U A 1 77  ? 101.343 153.524 99.183  1.00 0.00 ? 77  U A "HO2'" 1  
ATOM 2507   H "H1'"  . U A 1 77  ? 102.517 151.440 99.341  1.00 0.00 ? 77  U A "H1'"  1  
ATOM 2508   H H3     . U A 1 77  ? 101.342 149.080 102.979 1.00 0.00 ? 77  U A H3     1  
ATOM 2509   H H5     . U A 1 77  ? 105.370 149.633 103.315 1.00 0.00 ? 77  U A H5     1  
ATOM 2510   H H6     . U A 1 77  ? 105.272 151.008 101.487 1.00 0.00 ? 77  U A H6     1  
ATOM 2511   P P      . U A 1 78  ? 104.987 155.907 101.828 1.00 0.00 ? 78  U A P      1  
ATOM 2512   O OP1    . U A 1 78  ? 106.203 156.674 101.454 1.00 0.00 ? 78  U A OP1    1  
ATOM 2513   O OP2    . U A 1 78  ? 105.089 154.809 102.822 1.00 0.00 ? 78  U A OP2    1  
ATOM 2514   O "O5'"  . U A 1 78  ? 103.892 156.941 102.346 1.00 0.00 ? 78  U A "O5'"  1  
ATOM 2515   C "C5'"  . U A 1 78  ? 102.984 156.588 103.379 1.00 0.00 ? 78  U A "C5'"  1  
ATOM 2516   C "C4'"  . U A 1 78  ? 101.552 156.793 102.957 1.00 0.00 ? 78  U A "C4'"  1  
ATOM 2517   O "O4'"  . U A 1 78  ? 101.140 155.721 102.068 1.00 0.00 ? 78  U A "O4'"  1  
ATOM 2518   C "C3'"  . U A 1 78  ? 100.516 156.768 104.068 1.00 0.00 ? 78  U A "C3'"  1  
ATOM 2519   O "O3'"  . U A 1 78  ? 100.427 157.995 104.771 1.00 0.00 ? 78  U A "O3'"  1  
ATOM 2520   C "C2'"  . U A 1 78  ? 99.239  156.398 103.326 1.00 0.00 ? 78  U A "C2'"  1  
ATOM 2521   O "O2'"  . U A 1 78  ? 98.698  157.516 102.638 1.00 0.00 ? 78  U A "O2'"  1  
ATOM 2522   C "C1'"  . U A 1 78  ? 99.766  155.392 102.299 1.00 0.00 ? 78  U A "C1'"  1  
ATOM 2523   N N1     . U A 1 78  ? 99.641  153.991 102.771 1.00 0.00 ? 78  U A N1     1  
ATOM 2524   C C2     . U A 1 78  ? 98.385  153.418 102.724 1.00 0.00 ? 78  U A C2     1  
ATOM 2525   O O2     . U A 1 78  ? 97.397  154.007 102.316 1.00 0.00 ? 78  U A O2     1  
ATOM 2526   N N3     . U A 1 78  ? 98.318  152.121 103.168 1.00 0.00 ? 78  U A N3     1  
ATOM 2527   C C4     . U A 1 78  ? 99.354  151.352 103.648 1.00 0.00 ? 78  U A C4     1  
ATOM 2528   O O4     . U A 1 78  ? 99.135  150.196 104.014 1.00 0.00 ? 78  U A O4     1  
ATOM 2529   C C5     . U A 1 78  ? 100.628 152.009 103.669 1.00 0.00 ? 78  U A C5     1  
ATOM 2530   C C6     . U A 1 78  ? 100.720 153.272 103.239 1.00 0.00 ? 78  U A C6     1  
ATOM 2531   H "H5'"  . U A 1 78  ? 103.168 157.141 104.168 1.00 0.00 ? 78  U A "H5'"  1  
ATOM 2532   H "H5''" . U A 1 78  ? 103.120 155.645 103.612 1.00 0.00 ? 78  U A "H5''" 1  
ATOM 2533   H "H4'"  . U A 1 78  ? 101.482 157.645 102.477 1.00 0.00 ? 78  U A "H4'"  1  
ATOM 2534   H "H3'"  . U A 1 78  ? 100.736 156.051 104.699 1.00 0.00 ? 78  U A "H3'"  1  
ATOM 2535   H "H2'"  . U A 1 78  ? 98.579  155.987 103.923 1.00 0.00 ? 78  U A "H2'"  1  
ATOM 2536   H "HO2'" . U A 1 78  ? 97.863  157.251 102.201 1.00 0.00 ? 78  U A "HO2'" 1  
ATOM 2537   H "H1'"  . U A 1 78  ? 99.271  155.494 101.459 1.00 0.00 ? 78  U A "H1'"  1  
ATOM 2538   H H3     . U A 1 78  ? 97.435  151.695 103.142 1.00 0.00 ? 78  U A H3     1  
ATOM 2539   H H5     . U A 1 78  ? 101.421 151.538 103.994 1.00 0.00 ? 78  U A H5     1  
ATOM 2540   H H6     . U A 1 78  ? 101.600 153.700 103.265 1.00 0.00 ? 78  U A H6     1  
ATOM 2541   P P      . C A 1 79  ? 99.980  158.015 106.313 1.00 0.00 ? 79  C A P      1  
ATOM 2542   O OP1    . C A 1 79  ? 100.115 159.408 106.813 1.00 0.00 ? 79  C A OP1    1  
ATOM 2543   O OP2    . C A 1 79  ? 100.688 156.915 107.013 1.00 0.00 ? 79  C A OP2    1  
ATOM 2544   O "O5'"  . C A 1 79  ? 98.428  157.657 106.271 1.00 0.00 ? 79  C A "O5'"  1  
ATOM 2545   C "C5'"  . C A 1 79  ? 97.470  158.612 105.843 1.00 0.00 ? 79  C A "C5'"  1  
ATOM 2546   C "C4'"  . C A 1 79  ? 96.070  158.050 105.875 1.00 0.00 ? 79  C A "C4'"  1  
ATOM 2547   O "O4'"  . C A 1 79  ? 95.982  156.889 105.008 1.00 0.00 ? 79  C A "O4'"  1  
ATOM 2548   C "C3'"  . C A 1 79  ? 95.583  157.542 107.223 1.00 0.00 ? 79  C A "C3'"  1  
ATOM 2549   O "O3'"  . C A 1 79  ? 95.146  158.580 108.085 1.00 0.00 ? 79  C A "O3'"  1  
ATOM 2550   C "C2'"  . C A 1 79  ? 94.479  156.568 106.835 1.00 0.00 ? 79  C A "C2'"  1  
ATOM 2551   O "O2'"  . C A 1 79  ? 93.286  157.255 106.485 1.00 0.00 ? 79  C A "O2'"  1  
ATOM 2552   C "C1'"  . C A 1 79  ? 95.070  155.928 105.577 1.00 0.00 ? 79  C A "C1'"  1  
ATOM 2553   N N1     . C A 1 79  ? 95.763  154.649 105.868 1.00 0.00 ? 79  C A N1     1  
ATOM 2554   C C2     . C A 1 79  ? 94.986  153.502 106.072 1.00 0.00 ? 79  C A C2     1  
ATOM 2555   O O2     . C A 1 79  ? 93.750  153.588 106.006 1.00 0.00 ? 79  C A O2     1  
ATOM 2556   N N3     . C A 1 79  ? 95.593  152.323 106.341 1.00 0.00 ? 79  C A N3     1  
ATOM 2557   C C4     . C A 1 79  ? 96.922  152.257 106.405 1.00 0.00 ? 79  C A C4     1  
ATOM 2558   N N4     . C A 1 79  ? 97.478  151.072 106.673 1.00 0.00 ? 79  C A N4     1  
ATOM 2559   C C5     . C A 1 79  ? 97.741  153.405 106.202 1.00 0.00 ? 79  C A C5     1  
ATOM 2560   C C6     . C A 1 79  ? 97.128  154.565 105.940 1.00 0.00 ? 79  C A C6     1  
ATOM 2561   H "H5'"  . C A 1 79  ? 97.681  158.889 104.927 1.00 0.00 ? 79  C A "H5'"  1  
ATOM 2562   H "H5''" . C A 1 79  ? 97.515  159.394 106.432 1.00 0.00 ? 79  C A "H5''" 1  
ATOM 2563   H "H4'"  . C A 1 79  ? 95.447  158.734 105.552 1.00 0.00 ? 79  C A "H4'"  1  
ATOM 2564   H "H3'"  . C A 1 79  ? 96.307  157.046 107.661 1.00 0.00 ? 79  C A "H3'"  1  
ATOM 2565   H "H2'"  . C A 1 79  ? 94.323  155.900 107.535 1.00 0.00 ? 79  C A "H2'"  1  
ATOM 2566   H "HO2'" . C A 1 79  ? 92.592  156.598 106.274 1.00 0.00 ? 79  C A "HO2'" 1  
ATOM 2567   H "H1'"  . C A 1 79  ? 94.354  155.767 104.925 1.00 0.00 ? 79  C A "H1'"  1  
ATOM 2568   H H41    . C A 1 79  ? 96.911  150.285 106.812 1.00 0.00 ? 79  C A H41    1  
ATOM 2569   H H42    . C A 1 79  ? 98.454  150.993 106.728 1.00 0.00 ? 79  C A H42    1  
ATOM 2570   H H5     . C A 1 79  ? 98.719  153.345 106.253 1.00 0.00 ? 79  C A H5     1  
ATOM 2571   H H6     . C A 1 79  ? 97.675  155.366 105.797 1.00 0.00 ? 79  C A H6     1  
ATOM 2572   P P      . A A 1 80  ? 95.180  158.378 109.679 1.00 0.00 ? 80  A A P      1  
ATOM 2573   O OP1    . A A 1 80  ? 94.815  159.667 110.315 1.00 0.00 ? 80  A A OP1    1  
ATOM 2574   O OP2    . A A 1 80  ? 96.465  157.723 110.031 1.00 0.00 ? 80  A A OP2    1  
ATOM 2575   O "O5'"  . A A 1 80  ? 94.005  157.339 109.959 1.00 0.00 ? 80  A A "O5'"  1  
ATOM 2576   C "C5'"  . A A 1 80  ? 92.648  157.693 109.732 1.00 0.00 ? 80  A A "C5'"  1  
ATOM 2577   C "C4'"  . A A 1 80  ? 91.727  156.517 109.932 1.00 0.00 ? 80  A A "C4'"  1  
ATOM 2578   O "O4'"  . A A 1 80  ? 92.053  155.471 108.979 1.00 0.00 ? 80  A A "O4'"  1  
ATOM 2579   C "C3'"  . A A 1 80  ? 91.810  155.826 111.284 1.00 0.00 ? 80  A A "C3'"  1  
ATOM 2580   O "O3'"  . A A 1 80  ? 91.102  156.511 112.303 1.00 0.00 ? 80  A A "O3'"  1  
ATOM 2581   C "C2'"  . A A 1 80  ? 91.257  154.440 110.984 1.00 0.00 ? 80  A A "C2'"  1  
ATOM 2582   O "O2'"  . A A 1 80  ? 89.838  154.456 110.906 1.00 0.00 ? 80  A A "O2'"  1  
ATOM 2583   C "C1'"  . A A 1 80  ? 91.826  154.179 109.590 1.00 0.00 ? 80  A A "C1'"  1  
ATOM 2584   N N9     . A A 1 80  ? 93.069  153.386 109.634 1.00 0.00 ? 80  A A N9     1  
ATOM 2585   C C8     . A A 1 80  ? 94.359  153.826 109.475 1.00 0.00 ? 80  A A C8     1  
ATOM 2586   N N7     . A A 1 80  ? 95.258  152.879 109.571 1.00 0.00 ? 80  A A N7     1  
ATOM 2587   C C5     . A A 1 80  ? 94.511  151.734 109.809 1.00 0.00 ? 80  A A C5     1  
ATOM 2588   C C6     . A A 1 80  ? 94.873  150.389 110.005 1.00 0.00 ? 80  A A C6     1  
ATOM 2589   N N6     . A A 1 80  ? 96.136  149.954 109.993 1.00 0.00 ? 80  A A N6     1  
ATOM 2590   N N1     . A A 1 80  ? 93.883  149.497 110.218 1.00 0.00 ? 80  A A N1     1  
ATOM 2591   C C2     . A A 1 80  ? 92.617  149.934 110.233 1.00 0.00 ? 80  A A C2     1  
ATOM 2592   N N3     . A A 1 80  ? 92.151  151.169 110.061 1.00 0.00 ? 80  A A N3     1  
ATOM 2593   C C4     . A A 1 80  ? 93.161  152.031 109.851 1.00 0.00 ? 80  A A C4     1  
ATOM 2594   H "H5'"  . A A 1 80  ? 92.552  158.022 108.814 1.00 0.00 ? 80  A A "H5'"  1  
ATOM 2595   H "H5''" . A A 1 80  ? 92.395  158.406 110.356 1.00 0.00 ? 80  A A "H5''" 1  
ATOM 2596   H "H4'"  . A A 1 80  ? 90.803  156.808 109.781 1.00 0.00 ? 80  A A "H4'"  1  
ATOM 2597   H "H3'"  . A A 1 80  ? 92.751  155.743 111.546 1.00 0.00 ? 80  A A "H3'"  1  
ATOM 2598   H "H2'"  . A A 1 80  ? 91.575  153.777 111.631 1.00 0.00 ? 80  A A "H2'"  1  
ATOM 2599   H "HO2'" . A A 1 80  ? 89.502  155.255 111.365 1.00 0.00 ? 80  A A "HO2'" 1  
ATOM 2600   H "H1'"  . A A 1 80  ? 91.159  153.708 109.046 1.00 0.00 ? 80  A A "H1'"  1  
ATOM 2601   H H8     . A A 1 80  ? 94.588  154.766 109.307 1.00 0.00 ? 80  A A H8     1  
ATOM 2602   H H61    . A A 1 80  ? 96.326  149.003 110.135 1.00 0.00 ? 80  A A H61    1  
ATOM 2603   H H62    . A A 1 80  ? 96.870  150.583 109.839 1.00 0.00 ? 80  A A H62    1  
ATOM 2604   H H2     . A A 1 80  ? 91.937  149.245 110.392 1.00 0.00 ? 80  A A H2     1  
ATOM 2605   P P      . G A 1 81  ? 91.551  156.367 113.839 1.00 0.00 ? 81  G A P      1  
ATOM 2606   O OP1    . G A 1 81  ? 90.723  157.291 114.651 1.00 0.00 ? 81  G A OP1    1  
ATOM 2607   O OP2    . G A 1 81  ? 93.032  156.462 113.897 1.00 0.00 ? 81  G A OP2    1  
ATOM 2608   O "O5'"  . G A 1 81  ? 91.139  154.874 114.221 1.00 0.00 ? 81  G A "O5'"  1  
ATOM 2609   C "C5'"  . G A 1 81  ? 89.776  154.485 114.275 1.00 0.00 ? 81  G A "C5'"  1  
ATOM 2610   C "C4'"  . G A 1 81  ? 89.630  153.001 114.496 1.00 0.00 ? 81  G A "C4'"  1  
ATOM 2611   O "O4'"  . G A 1 81  ? 90.254  152.277 113.403 1.00 0.00 ? 81  G A "O4'"  1  
ATOM 2612   C "C3'"  . G A 1 81  ? 90.303  152.442 115.739 1.00 0.00 ? 81  G A "C3'"  1  
ATOM 2613   O "O3'"  . G A 1 81  ? 89.553  152.658 116.923 1.00 0.00 ? 81  G A "O3'"  1  
ATOM 2614   C "C2'"  . G A 1 81  ? 90.481  150.971 115.391 1.00 0.00 ? 81  G A "C2'"  1  
ATOM 2615   O "O2'"  . G A 1 81  ? 89.263  150.256 115.540 1.00 0.00 ? 81  G A "O2'"  1  
ATOM 2616   C "C1'"  . G A 1 81  ? 90.830  151.050 113.904 1.00 0.00 ? 81  G A "C1'"  1  
ATOM 2617   N N9     . G A 1 81  ? 92.287  151.007 113.671 1.00 0.00 ? 81  G A N9     1  
ATOM 2618   C C8     . G A 1 81  ? 93.107  152.054 113.329 1.00 0.00 ? 81  G A C8     1  
ATOM 2619   N N7     . G A 1 81  ? 94.357  151.704 113.192 1.00 0.00 ? 81  G A N7     1  
ATOM 2620   C C5     . G A 1 81  ? 94.364  150.344 113.460 1.00 0.00 ? 81  G A C5     1  
ATOM 2621   C C6     . G A 1 81  ? 95.435  149.412 113.468 1.00 0.00 ? 81  G A C6     1  
ATOM 2622   O O6     . G A 1 81  ? 96.632  149.615 113.231 1.00 0.00 ? 81  G A O6     1  
ATOM 2623   N N1     . G A 1 81  ? 95.000  148.132 113.792 1.00 0.00 ? 81  G A N1     1  
ATOM 2624   C C2     . G A 1 81  ? 93.701  147.789 114.074 1.00 0.00 ? 81  G A C2     1  
ATOM 2625   N N2     . G A 1 81  ? 93.475  146.500 114.367 1.00 0.00 ? 81  G A N2     1  
ATOM 2626   N N3     . G A 1 81  ? 92.693  148.646 114.070 1.00 0.00 ? 81  G A N3     1  
ATOM 2627   C C4     . G A 1 81  ? 93.094  149.896 113.759 1.00 0.00 ? 81  G A C4     1  
ATOM 2628   H "H5'"  . G A 1 81  ? 89.339  154.728 113.433 1.00 0.00 ? 81  G A "H5'"  1  
ATOM 2629   H "H5''" . G A 1 81  ? 89.337  154.963 115.012 1.00 0.00 ? 81  G A "H5''" 1  
ATOM 2630   H "H4'"  . G A 1 81  ? 88.678  152.775 114.522 1.00 0.00 ? 81  G A "H4'"  1  
ATOM 2631   H "H3'"  . G A 1 81  ? 91.188  152.855 115.840 1.00 0.00 ? 81  G A "H3'"  1  
ATOM 2632   H "H2'"  . G A 1 81  ? 91.206  150.563 115.907 1.00 0.00 ? 81  G A "H2'"  1  
ATOM 2633   H "HO2'" . G A 1 81  ? 89.419  149.312 115.326 1.00 0.00 ? 81  G A "HO2'" 1  
ATOM 2634   H "H1'"  . G A 1 81  ? 90.402  150.309 113.428 1.00 0.00 ? 81  G A "H1'"  1  
ATOM 2635   H H8     . G A 1 81  ? 92.788  152.972 113.202 1.00 0.00 ? 81  G A H8     1  
ATOM 2636   H H1     . G A 1 81  ? 95.673  147.420 113.822 1.00 0.00 ? 81  G A H1     1  
ATOM 2637   H H21    . G A 1 81  ? 94.215  145.857 114.372 1.00 0.00 ? 81  G A H21    1  
ATOM 2638   H H22    . G A 1 81  ? 92.566  146.195 114.576 1.00 0.00 ? 81  G A H22    1  
ATOM 2639   P P      . U A 1 82  ? 90.104  153.655 118.057 1.00 0.00 ? 82  U A P      1  
ATOM 2640   O OP1    . U A 1 82  ? 88.986  153.957 118.987 1.00 0.00 ? 82  U A OP1    1  
ATOM 2641   O OP2    . U A 1 82  ? 90.818  154.768 117.382 1.00 0.00 ? 82  U A OP2    1  
ATOM 2642   O "O5'"  . U A 1 82  ? 91.179  152.784 118.845 1.00 0.00 ? 82  U A "O5'"  1  
ATOM 2643   C "C5'"  . U A 1 82  ? 90.787  151.921 119.902 1.00 0.00 ? 82  U A "C5'"  1  
ATOM 2644   C "C4'"  . U A 1 82  ? 91.944  151.096 120.407 1.00 0.00 ? 82  U A "C4'"  1  
ATOM 2645   O "O4'"  . U A 1 82  ? 92.555  150.327 119.339 1.00 0.00 ? 82  U A "O4'"  1  
ATOM 2646   C "C3'"  . U A 1 82  ? 93.110  151.870 121.003 1.00 0.00 ? 82  U A "C3'"  1  
ATOM 2647   O "O3'"  . U A 1 82  ? 92.873  152.290 122.334 1.00 0.00 ? 82  U A "O3'"  1  
ATOM 2648   C "C2'"  . U A 1 82  ? 94.214  150.829 120.930 1.00 0.00 ? 82  U A "C2'"  1  
ATOM 2649   O "O2'"  . U A 1 82  ? 94.059  149.843 121.940 1.00 0.00 ? 82  U A "O2'"  1  
ATOM 2650   C "C1'"  . U A 1 82  ? 93.923  150.205 119.562 1.00 0.00 ? 82  U A "C1'"  1  
ATOM 2651   N N1     . U A 1 82  ? 94.641  150.896 118.464 1.00 0.00 ? 82  U A N1     1  
ATOM 2652   C C2     . U A 1 82  ? 96.020  150.796 118.451 1.00 0.00 ? 82  U A C2     1  
ATOM 2653   O O2     . U A 1 82  ? 96.651  150.174 119.289 1.00 0.00 ? 82  U A O2     1  
ATOM 2654   N N3     . U A 1 82  ? 96.642  151.451 117.416 1.00 0.00 ? 82  U A N3     1  
ATOM 2655   C C4     . U A 1 82  ? 96.041  152.182 116.414 1.00 0.00 ? 82  U A C4     1  
ATOM 2656   O O4     . U A 1 82  ? 96.741  152.715 115.552 1.00 0.00 ? 82  U A O4     1  
ATOM 2657   C C5     . U A 1 82  ? 94.613  152.243 116.492 1.00 0.00 ? 82  U A C5     1  
ATOM 2658   C C6     . U A 1 82  ? 93.982  151.613 117.488 1.00 0.00 ? 82  U A C6     1  
ATOM 2659   H "H5'"  . U A 1 82  ? 90.083  151.320 119.579 1.00 0.00 ? 82  U A "H5'"  1  
ATOM 2660   H "H5''" . U A 1 82  ? 90.433  152.460 120.640 1.00 0.00 ? 82  U A "H5''" 1  
ATOM 2661   H "H4'"  . U A 1 82  ? 91.614  150.468 121.082 1.00 0.00 ? 82  U A "H4'"  1  
ATOM 2662   H "H3'"  . U A 1 82  ? 93.329  152.625 120.418 1.00 0.00 ? 82  U A "H3'"  1  
ATOM 2663   H "H2'"  . U A 1 82  ? 95.101  151.243 120.961 1.00 0.00 ? 82  U A "H2'"  1  
ATOM 2664   H "HO2'" . U A 1 82  ? 94.788  149.191 121.865 1.00 0.00 ? 82  U A "HO2'" 1  
ATOM 2665   H "H1'"  . U A 1 82  ? 94.184  149.260 119.577 1.00 0.00 ? 82  U A "H1'"  1  
ATOM 2666   H H3     . U A 1 82  ? 97.620  151.393 117.389 1.00 0.00 ? 82  U A H3     1  
ATOM 2667   H H5     . U A 1 82  ? 94.103  152.741 115.819 1.00 0.00 ? 82  U A H5     1  
ATOM 2668   H H6     . U A 1 82  ? 93.005  151.670 117.519 1.00 0.00 ? 82  U A H6     1  
ATOM 2669   P P      . A A 1 83  ? 92.440  153.805 122.625 1.00 0.00 ? 83  A A P      1  
ATOM 2670   O OP1    . A A 1 83  ? 90.962  153.873 122.738 1.00 0.00 ? 83  A A OP1    1  
ATOM 2671   O OP2    . A A 1 83  ? 93.130  154.553 121.544 1.00 0.00 ? 83  A A OP2    1  
ATOM 2672   O "O5'"  . A A 1 83  ? 93.063  154.266 124.016 1.00 0.00 ? 83  A A "O5'"  1  
ATOM 2673   C "C5'"  . A A 1 83  ? 92.279  154.268 125.201 1.00 0.00 ? 83  A A "C5'"  1  
ATOM 2674   C "C4'"  . A A 1 83  ? 92.487  153.006 126.004 1.00 0.00 ? 83  A A "C4'"  1  
ATOM 2675   O "O4'"  . A A 1 83  ? 92.981  151.950 125.138 1.00 0.00 ? 83  A A "O4'"  1  
ATOM 2676   C "C3'"  . A A 1 83  ? 93.517  153.085 127.119 1.00 0.00 ? 83  A A "C3'"  1  
ATOM 2677   O "O3'"  . A A 1 83  ? 93.010  153.681 128.301 1.00 0.00 ? 83  A A "O3'"  1  
ATOM 2678   C "C2'"  . A A 1 83  ? 93.929  151.630 127.296 1.00 0.00 ? 83  A A "C2'"  1  
ATOM 2679   O "O2'"  . A A 1 83  ? 92.961  150.908 128.040 1.00 0.00 ? 83  A A "O2'"  1  
ATOM 2680   C "C1'"  . A A 1 83  ? 93.915  151.132 125.850 1.00 0.00 ? 83  A A "C1'"  1  
ATOM 2681   N N9     . A A 1 83  ? 95.252  151.198 125.226 1.00 0.00 ? 83  A A N9     1  
ATOM 2682   C C8     . A A 1 83  ? 95.706  152.102 124.298 1.00 0.00 ? 83  A A C8     1  
ATOM 2683   N N7     . A A 1 83  ? 96.948  151.902 123.931 1.00 0.00 ? 83  A A N7     1  
ATOM 2684   C C5     . A A 1 83  ? 97.339  150.792 124.669 1.00 0.00 ? 83  A A C5     1  
ATOM 2685   C C6     . A A 1 83  ? 98.548  150.077 124.732 1.00 0.00 ? 83  A A C6     1  
ATOM 2686   N N6     . A A 1 83  ? 99.631  150.385 124.018 1.00 0.00 ? 83  A A N6     1  
ATOM 2687   N N1     . A A 1 83  ? 98.606  149.016 125.569 1.00 0.00 ? 83  A A N1     1  
ATOM 2688   C C2     . A A 1 83  ? 97.518  148.707 126.286 1.00 0.00 ? 83  A A C2     1  
ATOM 2689   N N3     . A A 1 83  ? 96.328  149.300 126.311 1.00 0.00 ? 83  A A N3     1  
ATOM 2690   C C4     . A A 1 83  ? 96.304  150.348 125.468 1.00 0.00 ? 83  A A C4     1  
ATOM 2691   H "H5'"  . A A 1 83  ? 91.332  154.339 124.959 1.00 0.00 ? 83  A A "H5'"  1  
ATOM 2692   H "H5''" . A A 1 83  ? 92.528  155.039 125.749 1.00 0.00 ? 83  A A "H5''" 1  
ATOM 2693   H "H4'"  . A A 1 83  ? 91.626  152.728 126.384 1.00 0.00 ? 83  A A "H4'"  1  
ATOM 2694   H "H3'"  . A A 1 83  ? 94.291  153.601 126.806 1.00 0.00 ? 83  A A "H3'"  1  
ATOM 2695   H "H2'"  . A A 1 83  ? 94.821  151.556 127.692 1.00 0.00 ? 83  A A "H2'"  1  
ATOM 2696   H "HO2'" . A A 1 83  ? 92.409  151.541 128.546 1.00 0.00 ? 83  A A "HO2'" 1  
ATOM 2697   H "H1'"  . A A 1 83  ? 93.590  150.209 125.825 1.00 0.00 ? 83  A A "H1'"  1  
ATOM 2698   H H8     . A A 1 83  ? 95.153  152.830 123.941 1.00 0.00 ? 83  A A H8     1  
ATOM 2699   H H61    . A A 1 83  ? 100.447 149.849 124.106 1.00 0.00 ? 83  A A H61    1  
ATOM 2700   H H62    . A A 1 83  ? 99.612  151.149 123.405 1.00 0.00 ? 83  A A H62    1  
ATOM 2701   H H2     . A A 1 83  ? 97.613  147.929 126.877 1.00 0.00 ? 83  A A H2     1  
ATOM 2702   P P      . C A 1 84  ? 93.990  154.495 129.282 1.00 0.00 ? 84  C A P      1  
ATOM 2703   O OP1    . C A 1 84  ? 93.159  155.130 130.337 1.00 0.00 ? 84  C A OP1    1  
ATOM 2704   O OP2    . C A 1 84  ? 94.882  155.336 128.446 1.00 0.00 ? 84  C A OP2    1  
ATOM 2705   O "O5'"  . C A 1 84  ? 94.876  153.364 129.967 1.00 0.00 ? 84  C A "O5'"  1  
ATOM 2706   C "C5'"  . C A 1 84  ? 94.333  152.515 130.966 1.00 0.00 ? 84  C A "C5'"  1  
ATOM 2707   C "C4'"  . C A 1 84  ? 95.337  151.489 131.435 1.00 0.00 ? 84  C A "C4'"  1  
ATOM 2708   O "O4'"  . C A 1 84  ? 95.780  150.684 130.313 1.00 0.00 ? 84  C A "O4'"  1  
ATOM 2709   C "C3'"  . C A 1 84  ? 96.626  152.036 132.029 1.00 0.00 ? 84  C A "C3'"  1  
ATOM 2710   O "O3'"  . C A 1 84  ? 96.484  152.447 133.377 1.00 0.00 ? 84  C A "O3'"  1  
ATOM 2711   C "C2'"  . C A 1 84  ? 97.595  150.878 131.840 1.00 0.00 ? 84  C A "C2'"  1  
ATOM 2712   O "O2'"  . C A 1 84  ? 97.387  149.868 132.818 1.00 0.00 ? 84  C A "O2'"  1  
ATOM 2713   C "C1'"  . C A 1 84  ? 97.168  150.340 130.474 1.00 0.00 ? 84  C A "C1'"  1  
ATOM 2714   N N1     . C A 1 84  ? 97.989  150.898 129.369 1.00 0.00 ? 84  C A N1     1  
ATOM 2715   C C2     . C A 1 84  ? 99.274  150.382 129.168 1.00 0.00 ? 84  C A C2     1  
ATOM 2716   O O2     . C A 1 84  ? 99.688  149.481 129.915 1.00 0.00 ? 84  C A O2     1  
ATOM 2717   N N3     . C A 1 84  ? 100.041 150.870 128.170 1.00 0.00 ? 84  C A N3     1  
ATOM 2718   C C4     . C A 1 84  ? 99.574  151.839 127.382 1.00 0.00 ? 84  C A C4     1  
ATOM 2719   N N4     . C A 1 84  ? 100.365 152.293 126.406 1.00 0.00 ? 84  C A N4     1  
ATOM 2720   C C5     . C A 1 84  ? 98.272  152.386 127.558 1.00 0.00 ? 84  C A C5     1  
ATOM 2721   C C6     . C A 1 84  ? 97.520  151.893 128.552 1.00 0.00 ? 84  C A C6     1  
ATOM 2722   H "H5'"  . C A 1 84  ? 93.550  152.053 130.601 1.00 0.00 ? 84  C A "H5'"  1  
ATOM 2723   H "H5''" . C A 1 84  ? 94.054  153.060 131.732 1.00 0.00 ? 84  C A "H5''" 1  
ATOM 2724   H "H4'"  . C A 1 84  ? 94.907  150.904 132.093 1.00 0.00 ? 84  C A "H4'"  1  
ATOM 2725   H "H3'"  . C A 1 84  ? 96.928  152.798 131.491 1.00 0.00 ? 84  C A "H3'"  1  
ATOM 2726   H "H2'"  . C A 1 84  ? 98.525  151.184 131.830 1.00 0.00 ? 84  C A "H2'"  1  
ATOM 2727   H "HO2'" . C A 1 84  ? 98.059  149.166 132.699 1.00 0.00 ? 84  C A "HO2'" 1  
ATOM 2728   H "H1'"  . C A 1 84  ? 97.241  149.363 130.470 1.00 0.00 ? 84  C A "H1'"  1  
ATOM 2729   H H41    . C A 1 84  ? 101.262 151.915 126.288 1.00 0.00 ? 84  C A H41    1  
ATOM 2730   H H42    . C A 1 84  ? 100.052 153.004 125.811 1.00 0.00 ? 84  C A H42    1  
ATOM 2731   H H5     . C A 1 84  ? 97.937  153.098 126.974 1.00 0.00 ? 84  C A H5     1  
ATOM 2732   H H6     . C A 1 84  ? 96.621  152.257 128.690 1.00 0.00 ? 84  C A H6     1  
ATOM 2733   P P      . C A 1 85  ? 97.449  153.580 133.983 1.00 0.00 ? 85  C A P      1  
ATOM 2734   O OP1    . C A 1 85  ? 96.994  153.881 135.366 1.00 0.00 ? 85  C A OP1    1  
ATOM 2735   O OP2    . C A 1 85  ? 97.548  154.680 132.990 1.00 0.00 ? 85  C A OP2    1  
ATOM 2736   O "O5'"  . C A 1 85  ? 98.871  152.870 134.078 1.00 0.00 ? 85  C A "O5'"  1  
ATOM 2737   C "C5'"  . C A 1 85  ? 99.098  151.812 134.996 1.00 0.00 ? 85  C A "C5'"  1  
ATOM 2738   C "C4'"  . C A 1 85  ? 100.478 151.223 134.836 1.00 0.00 ? 85  C A "C4'"  1  
ATOM 2739   O "O4'"  . C A 1 85  ? 100.631 150.673 133.502 1.00 0.00 ? 85  C A "O4'"  1  
ATOM 2740   C "C3'"  . C A 1 85  ? 101.642 152.192 134.972 1.00 0.00 ? 85  C A "C3'"  1  
ATOM 2741   O "O3'"  . C A 1 85  ? 101.957 152.496 136.320 1.00 0.00 ? 85  C A "O3'"  1  
ATOM 2742   C "C2'"  . C A 1 85  ? 102.760 151.477 134.229 1.00 0.00 ? 85  C A "C2'"  1  
ATOM 2743   O "O2'"  . C A 1 85  ? 103.326 150.443 135.022 1.00 0.00 ? 85  C A "O2'"  1  
ATOM 2744   C "C1'"  . C A 1 85  ? 101.996 150.846 133.061 1.00 0.00 ? 85  C A "C1'"  1  
ATOM 2745   N N1     . C A 1 85  ? 102.061 151.674 131.833 1.00 0.00 ? 85  C A N1     1  
ATOM 2746   C C2     . C A 1 85  ? 103.233 151.637 131.068 1.00 0.00 ? 85  C A C2     1  
ATOM 2747   O O2     . C A 1 85  ? 104.179 150.921 131.439 1.00 0.00 ? 85  C A O2     1  
ATOM 2748   N N3     . C A 1 85  ? 103.321 152.382 129.942 1.00 0.00 ? 85  C A N3     1  
ATOM 2749   C C4     . C A 1 85  ? 102.294 153.144 129.566 1.00 0.00 ? 85  C A C4     1  
ATOM 2750   N N4     . C A 1 85  ? 102.421 153.861 128.447 1.00 0.00 ? 85  C A N4     1  
ATOM 2751   C C5     . C A 1 85  ? 101.087 153.203 130.321 1.00 0.00 ? 85  C A C5     1  
ATOM 2752   C C6     . C A 1 85  ? 101.015 152.461 131.433 1.00 0.00 ? 85  C A C6     1  
ATOM 2753   H "H5'"  . C A 1 85  ? 98.431  151.109 134.845 1.00 0.00 ? 85  C A "H5'"  1  
ATOM 2754   H "H5''" . C A 1 85  ? 99.001  152.154 135.910 1.00 0.00 ? 85  C A "H5''" 1  
ATOM 2755   H "H4'"  . C A 1 85  ? 100.590 150.500 135.489 1.00 0.00 ? 85  C A "H4'"  1  
ATOM 2756   H "H3'"  . C A 1 85  ? 101.424 153.024 134.499 1.00 0.00 ? 85  C A "H3'"  1  
ATOM 2757   H "H2'"  . C A 1 85  ? 103.442 152.106 133.912 1.00 0.00 ? 85  C A "H2'"  1  
ATOM 2758   H "HO2'" . C A 1 85  ? 103.113 150.608 135.962 1.00 0.00 ? 85  C A "HO2'" 1  
ATOM 2759   H "H1'"  . C A 1 85  ? 102.363 149.956 132.875 1.00 0.00 ? 85  C A "H1'"  1  
ATOM 2760   H H41    . C A 1 85  ? 103.254 153.820 127.931 1.00 0.00 ? 85  C A H41    1  
ATOM 2761   H H42    . C A 1 85  ? 101.684 154.430 128.144 1.00 0.00 ? 85  C A H42    1  
ATOM 2762   H H5     . C A 1 85  ? 100.338 153.766 130.034 1.00 0.00 ? 85  C A H5     1  
ATOM 2763   H H6     . C A 1 85  ? 100.193 152.487 131.966 1.00 0.00 ? 85  C A H6     1  
ATOM 2764   P P      . A A 1 86  ? 103.114 153.559 136.660 1.00 0.00 ? 86  A A P      1  
ATOM 2765   O OP1    . A A 1 86  ? 102.914 154.026 138.054 1.00 0.00 ? 86  A A OP1    1  
ATOM 2766   O OP2    . A A 1 86  ? 103.169 154.548 135.554 1.00 0.00 ? 86  A A OP2    1  
ATOM 2767   O "O5'"  . A A 1 86  ? 104.453 152.697 136.615 1.00 0.00 ? 86  A A "O5'"  1  
ATOM 2768   C "C5'"  . A A 1 86  ? 105.721 153.310 136.800 1.00 0.00 ? 86  A A "C5'"  1  
ATOM 2769   C "C4'"  . A A 1 86  ? 106.838 152.298 136.746 1.00 0.00 ? 86  A A "C4'"  1  
ATOM 2770   O "O4'"  . A A 1 86  ? 106.868 151.579 138.010 1.00 0.00 ? 86  A A "O4'"  1  
ATOM 2771   C "C3'"  . A A 1 86  ? 106.730 151.243 135.656 1.00 0.00 ? 86  A A "C3'"  1  
ATOM 2772   O "O3'"  . A A 1 86  ? 107.977 150.933 135.058 1.00 0.00 ? 86  A A "O3'"  1  
ATOM 2773   C "C2'"  . A A 1 86  ? 106.278 150.015 136.432 1.00 0.00 ? 86  A A "C2'"  1  
ATOM 2774   O "O2'"  . A A 1 86  ? 106.739 148.820 135.819 1.00 0.00 ? 86  A A "O2'"  1  
ATOM 2775   C "C1'"  . A A 1 86  ? 107.008 150.205 137.757 1.00 0.00 ? 86  A A "C1'"  1  
ATOM 2776   N N9     . A A 1 86  ? 106.407 149.407 138.843 1.00 0.00 ? 86  A A N9     1  
ATOM 2777   C C8     . A A 1 86  ? 105.196 149.598 139.460 1.00 0.00 ? 86  A A C8     1  
ATOM 2778   N N7     . A A 1 86  ? 104.935 148.719 140.396 1.00 0.00 ? 86  A A N7     1  
ATOM 2779   C C5     . A A 1 86  ? 106.050 147.892 140.396 1.00 0.00 ? 86  A A C5     1  
ATOM 2780   C C6     . A A 1 86  ? 106.392 146.763 141.162 1.00 0.00 ? 86  A A C6     1  
ATOM 2781   N N6     . A A 1 86  ? 105.610 146.250 142.114 1.00 0.00 ? 86  A A N6     1  
ATOM 2782   N N1     . A A 1 86  ? 107.579 146.170 140.911 1.00 0.00 ? 86  A A N1     1  
ATOM 2783   C C2     . A A 1 86  ? 108.363 146.683 139.955 1.00 0.00 ? 86  A A C2     1  
ATOM 2784   N N3     . A A 1 86  ? 108.153 147.738 139.170 1.00 0.00 ? 86  A A N3     1  
ATOM 2785   C C4     . A A 1 86  ? 106.964 148.304 139.444 1.00 0.00 ? 86  A A C4     1  
ATOM 2786   H "H5'"  . A A 1 86  ? 105.736 153.756 137.673 1.00 0.00 ? 86  A A "H5'"  1  
ATOM 2787   H "H5''" . A A 1 86  ? 105.860 153.978 136.098 1.00 0.00 ? 86  A A "H5''" 1  
ATOM 2788   H "H4'"  . A A 1 86  ? 107.687 152.770 136.615 1.00 0.00 ? 86  A A "H4'"  1  
ATOM 2789   H "H3'"  . A A 1 86  ? 106.025 151.502 135.026 1.00 0.00 ? 86  A A "H3'"  1  
ATOM 2790   H "H2'"  . A A 1 86  ? 105.305 150.007 136.557 1.00 0.00 ? 86  A A "H2'"  1  
ATOM 2791   H "HO2'" . A A 1 86  ? 106.030 148.144 135.865 1.00 0.00 ? 86  A A "HO2'" 1  
ATOM 2792   H "H1'"  . A A 1 86  ? 107.950 149.953 137.649 1.00 0.00 ? 86  A A "H1'"  1  
ATOM 2793   H H8     . A A 1 86  ? 104.582 150.324 139.222 1.00 0.00 ? 86  A A H8     1  
ATOM 2794   H H61    . A A 1 86  ? 105.902 145.460 142.616 1.00 0.00 ? 86  A A H61    1  
ATOM 2795   H H62    . A A 1 86  ? 104.744 146.664 142.314 1.00 0.00 ? 86  A A H62    1  
ATOM 2796   H H2     . A A 1 86  ? 109.214 146.216 139.813 1.00 0.00 ? 86  A A H2     1  
ATOM 2797   P P      . A A 1 87  ? 108.026 150.423 133.541 1.00 0.00 ? 87  A A P      1  
ATOM 2798   O OP1    . A A 1 87  ? 107.961 151.596 132.633 1.00 0.00 ? 87  A A OP1    1  
ATOM 2799   O OP2    . A A 1 87  ? 106.946 149.406 133.506 1.00 0.00 ? 87  A A OP2    1  
ATOM 2800   O "O5'"  . A A 1 87  ? 109.412 149.679 133.286 1.00 0.00 ? 87  A A "O5'"  1  
ATOM 2801   C "C5'"  . A A 1 87  ? 109.465 148.475 132.536 1.00 0.00 ? 87  A A "C5'"  1  
ATOM 2802   C "C4'"  . A A 1 87  ? 110.867 147.922 132.475 1.00 0.00 ? 87  A A "C4'"  1  
ATOM 2803   O "O4'"  . A A 1 87  ? 111.333 148.002 131.098 1.00 0.00 ? 87  A A "O4'"  1  
ATOM 2804   C "C3'"  . A A 1 87  ? 111.907 148.645 133.317 1.00 0.00 ? 87  A A "C3'"  1  
ATOM 2805   O "O3'"  . A A 1 87  ? 112.852 147.769 133.905 1.00 0.00 ? 87  A A "O3'"  1  
ATOM 2806   C "C2'"  . A A 1 87  ? 112.618 149.515 132.289 1.00 0.00 ? 87  A A "C2'"  1  
ATOM 2807   O "O2'"  . A A 1 87  ? 113.959 149.778 132.676 1.00 0.00 ? 87  A A "O2'"  1  
ATOM 2808   C "C1'"  . A A 1 87  ? 112.624 148.598 131.069 1.00 0.00 ? 87  A A "C1'"  1  
ATOM 2809   N N9     . A A 1 87  ? 112.933 149.330 129.826 1.00 0.00 ? 87  A A N9     1  
ATOM 2810   C C8     . A A 1 87  ? 112.345 150.477 129.353 1.00 0.00 ? 87  A A C8     1  
ATOM 2811   N N7     . A A 1 87  ? 112.837 150.891 128.212 1.00 0.00 ? 87  A A N7     1  
ATOM 2812   C C5     . A A 1 87  ? 113.816 149.954 127.912 1.00 0.00 ? 87  A A C5     1  
ATOM 2813   C C6     . A A 1 87  ? 114.705 149.827 126.829 1.00 0.00 ? 87  A A C6     1  
ATOM 2814   N N6     . A A 1 87  ? 114.753 150.683 125.806 1.00 0.00 ? 87  A A N6     1  
ATOM 2815   N N1     . A A 1 87  ? 115.554 148.777 126.834 1.00 0.00 ? 87  A A N1     1  
ATOM 2816   C C2     . A A 1 87  ? 115.507 147.918 127.861 1.00 0.00 ? 87  A A C2     1  
ATOM 2817   N N3     . A A 1 87  ? 114.718 147.931 128.933 1.00 0.00 ? 87  A A N3     1  
ATOM 2818   C C4     . A A 1 87  ? 113.886 148.988 128.897 1.00 0.00 ? 87  A A C4     1  
ATOM 2819   H "H5'"  . A A 1 87  ? 109.152 148.652 131.624 1.00 0.00 ? 87  A A "H5'"  1  
ATOM 2820   H "H5''" . A A 1 87  ? 108.878 147.811 132.952 1.00 0.00 ? 87  A A "H5''" 1  
ATOM 2821   H "H4'"  . A A 1 87  ? 110.851 146.977 132.735 1.00 0.00 ? 87  A A "H4'"  1  
ATOM 2822   H "H3'"  . A A 1 87  ? 111.490 149.186 134.020 1.00 0.00 ? 87  A A "H3'"  1  
ATOM 2823   H "H2'"  . A A 1 87  ? 112.121 150.342 132.114 1.00 0.00 ? 87  A A "H2'"  1  
ATOM 2824   H "HO2'" . A A 1 87  ? 114.542 149.670 131.897 1.00 0.00 ? 87  A A "HO2'" 1  
ATOM 2825   H "H1'"  . A A 1 87  ? 113.284 147.885 131.201 1.00 0.00 ? 87  A A "H1'"  1  
ATOM 2826   H H8     . A A 1 87  ? 111.623 150.943 129.826 1.00 0.00 ? 87  A A H8     1  
ATOM 2827   H H61    . A A 1 87  ? 115.396 150.541 125.079 1.00 0.00 ? 87  A A H61    1  
ATOM 2828   H H62    . A A 1 87  ? 114.147 151.452 125.781 1.00 0.00 ? 87  A A H62    1  
ATOM 2829   H H2     . A A 1 87  ? 116.144 147.174 127.817 1.00 0.00 ? 87  A A H2     1  
ATOM 2830   P P      . G A 1 88  ? 113.553 148.154 135.299 1.00 0.00 ? 88  G A P      1  
ATOM 2831   O OP1    . G A 1 88  ? 114.476 147.051 135.671 1.00 0.00 ? 88  G A OP1    1  
ATOM 2832   O OP2    . G A 1 88  ? 112.490 148.573 136.247 1.00 0.00 ? 88  G A OP2    1  
ATOM 2833   O "O5'"  . G A 1 88  ? 114.433 149.435 134.948 1.00 0.00 ? 88  G A "O5'"  1  
ATOM 2834   C "C5'"  . G A 1 88  ? 115.768 149.297 134.486 1.00 0.00 ? 88  G A "C5'"  1  
ATOM 2835   C "C4'"  . G A 1 88  ? 116.325 150.613 133.999 1.00 0.00 ? 88  G A "C4'"  1  
ATOM 2836   O "O4'"  . G A 1 88  ? 115.404 151.216 133.055 1.00 0.00 ? 88  G A "O4'"  1  
ATOM 2837   C "C3'"  . G A 1 88  ? 116.522 151.684 135.060 1.00 0.00 ? 88  G A "C3'"  1  
ATOM 2838   O "O3'"  . G A 1 88  ? 117.708 151.505 135.817 1.00 0.00 ? 88  G A "O3'"  1  
ATOM 2839   C "C2'"  . G A 1 88  ? 116.512 152.969 134.240 1.00 0.00 ? 88  G A "C2'"  1  
ATOM 2840   O "O2'"  . G A 1 88  ? 117.756 153.173 133.585 1.00 0.00 ? 88  G A "O2'"  1  
ATOM 2841   C "C1'"  . G A 1 88  ? 115.446 152.650 133.189 1.00 0.00 ? 88  G A "C1'"  1  
ATOM 2842   N N9     . G A 1 88  ? 114.121 153.173 133.568 1.00 0.00 ? 88  G A N9     1  
ATOM 2843   C C8     . G A 1 88  ? 113.029 152.451 133.984 1.00 0.00 ? 88  G A C8     1  
ATOM 2844   N N7     . G A 1 88  ? 111.990 153.195 134.249 1.00 0.00 ? 88  G A N7     1  
ATOM 2845   C C5     . G A 1 88  ? 112.420 154.488 133.995 1.00 0.00 ? 88  G A C5     1  
ATOM 2846   C C6     . G A 1 88  ? 111.734 155.723 134.105 1.00 0.00 ? 88  G A C6     1  
ATOM 2847   O O6     . G A 1 88  ? 110.567 155.929 134.461 1.00 0.00 ? 88  G A O6     1  
ATOM 2848   N N1     . G A 1 88  ? 112.547 156.797 133.749 1.00 0.00 ? 88  G A N1     1  
ATOM 2849   C C2     . G A 1 88  ? 113.854 156.692 133.338 1.00 0.00 ? 88  G A C2     1  
ATOM 2850   N N2     . G A 1 88  ? 114.477 157.842 133.035 1.00 0.00 ? 88  G A N2     1  
ATOM 2851   N N3     . G A 1 88  ? 114.505 155.546 133.232 1.00 0.00 ? 88  G A N3     1  
ATOM 2852   C C4     . G A 1 88  ? 113.735 154.492 133.574 1.00 0.00 ? 88  G A C4     1  
ATOM 2853   H "H5'"  . G A 1 88  ? 115.788 148.650 133.750 1.00 0.00 ? 88  G A "H5'"  1  
ATOM 2854   H "H5''" . G A 1 88  ? 116.328 148.966 135.220 1.00 0.00 ? 88  G A "H5''" 1  
ATOM 2855   H "H4'"  . G A 1 88  ? 117.181 150.448 133.550 1.00 0.00 ? 88  G A "H4'"  1  
ATOM 2856   H "H3'"  . G A 1 88  ? 115.753 151.685 135.665 1.00 0.00 ? 88  G A "H3'"  1  
ATOM 2857   H "H2'"  . G A 1 88  ? 116.257 153.741 134.785 1.00 0.00 ? 88  G A "H2'"  1  
ATOM 2858   H "HO2'" . G A 1 88  ? 118.445 152.642 134.035 1.00 0.00 ? 88  G A "HO2'" 1  
ATOM 2859   H "H1'"  . G A 1 88  ? 115.714 153.031 132.328 1.00 0.00 ? 88  G A "H1'"  1  
ATOM 2860   H H8     . G A 1 88  ? 113.027 151.475 134.070 1.00 0.00 ? 88  G A H8     1  
ATOM 2861   H H1     . G A 1 88  ? 112.156 157.694 133.793 1.00 0.00 ? 88  G A H1     1  
ATOM 2862   H H21    . G A 1 88  ? 114.001 158.694 133.114 1.00 0.00 ? 88  G A H21    1  
ATOM 2863   H H22    . G A 1 88  ? 115.410 157.828 132.739 1.00 0.00 ? 88  G A H22    1  
ATOM 2864   P P      . U A 1 89  ? 117.781 152.018 137.338 1.00 0.00 ? 89  U A P      1  
ATOM 2865   O OP1    . U A 1 89  ? 119.146 151.740 137.852 1.00 0.00 ? 89  U A OP1    1  
ATOM 2866   O OP2    . U A 1 89  ? 116.603 151.478 138.060 1.00 0.00 ? 89  U A OP2    1  
ATOM 2867   O "O5'"  . U A 1 89  ? 117.608 153.597 137.220 1.00 0.00 ? 89  U A "O5'"  1  
ATOM 2868   C "C5'"  . U A 1 89  ? 118.658 154.409 136.713 1.00 0.00 ? 89  U A "C5'"  1  
ATOM 2869   C "C4'"  . U A 1 89  ? 118.264 155.865 136.676 1.00 0.00 ? 89  U A "C4'"  1  
ATOM 2870   O "O4'"  . U A 1 89  ? 117.125 156.049 135.795 1.00 0.00 ? 89  U A "O4'"  1  
ATOM 2871   C "C3'"  . U A 1 89  ? 117.811 156.471 137.995 1.00 0.00 ? 89  U A "C3'"  1  
ATOM 2872   O "O3'"  . U A 1 89  ? 118.889 156.823 138.844 1.00 0.00 ? 89  U A "O3'"  1  
ATOM 2873   C "C2'"  . U A 1 89  ? 116.976 157.663 137.544 1.00 0.00 ? 89  U A "C2'"  1  
ATOM 2874   O "O2'"  . U A 1 89  ? 117.799 158.749 137.145 1.00 0.00 ? 89  U A "O2'"  1  
ATOM 2875   C "C1'"  . U A 1 89  ? 116.274 157.092 136.310 1.00 0.00 ? 89  U A "C1'"  1  
ATOM 2876   N N1     . U A 1 89  ? 114.922 156.569 136.622 1.00 0.00 ? 89  U A N1     1  
ATOM 2877   C C2     . U A 1 89  ? 113.908 157.496 136.775 1.00 0.00 ? 89  U A C2     1  
ATOM 2878   O O2     . U A 1 89  ? 114.079 158.696 136.665 1.00 0.00 ? 89  U A O2     1  
ATOM 2879   N N3     . U A 1 89  ? 112.674 156.963 137.065 1.00 0.00 ? 89  U A N3     1  
ATOM 2880   C C4     . U A 1 89  ? 112.356 155.630 137.213 1.00 0.00 ? 89  U A C4     1  
ATOM 2881   O O4     . U A 1 89  ? 111.193 155.314 137.473 1.00 0.00 ? 89  U A O4     1  
ATOM 2882   C C5     . U A 1 89  ? 113.454 154.730 137.040 1.00 0.00 ? 89  U A C5     1  
ATOM 2883   C C6     . U A 1 89  ? 114.666 155.220 136.758 1.00 0.00 ? 89  U A C6     1  
ATOM 2884   H "H5'"  . U A 1 89  ? 118.879 154.115 135.807 1.00 0.00 ? 89  U A "H5'"  1  
ATOM 2885   H "H5''" . U A 1 89  ? 119.446 154.307 137.285 1.00 0.00 ? 89  U A "H5''" 1  
ATOM 2886   H "H4'"  . U A 1 89  ? 119.018 156.389 136.330 1.00 0.00 ? 89  U A "H4'"  1  
ATOM 2887   H "H3'"  . U A 1 89  ? 117.231 155.832 138.461 1.00 0.00 ? 89  U A "H3'"  1  
ATOM 2888   H "H2'"  . U A 1 89  ? 116.329 157.931 138.232 1.00 0.00 ? 89  U A "H2'"  1  
ATOM 2889   H "HO2'" . U A 1 89  ? 117.230 159.505 136.892 1.00 0.00 ? 89  U A "HO2'" 1  
ATOM 2890   H "H1'"  . U A 1 89  ? 116.200 157.790 135.627 1.00 0.00 ? 89  U A "H1'"  1  
ATOM 2891   H H3     . U A 1 89  ? 111.939 157.605 137.177 1.00 0.00 ? 89  U A H3     1  
ATOM 2892   H H5     . U A 1 89  ? 113.319 153.763 137.128 1.00 0.00 ? 89  U A H5     1  
ATOM 2893   H H6     . U A 1 89  ? 115.403 154.585 136.647 1.00 0.00 ? 89  U A H6     1  
ATOM 2894   P P      . C A 1 90  ? 118.700 156.818 140.439 1.00 0.00 ? 90  C A P      1  
ATOM 2895   O OP1    . C A 1 90  ? 120.022 157.092 141.059 1.00 0.00 ? 90  C A OP1    1  
ATOM 2896   O OP2    . C A 1 90  ? 117.955 155.589 140.811 1.00 0.00 ? 90  C A OP2    1  
ATOM 2897   O "O5'"  . C A 1 90  ? 117.757 158.070 140.720 1.00 0.00 ? 90  C A "O5'"  1  
ATOM 2898   C "C5'"  . C A 1 90  ? 118.234 159.395 140.555 1.00 0.00 ? 90  C A "C5'"  1  
ATOM 2899   C "C4'"  . C A 1 90  ? 117.150 160.415 140.808 1.00 0.00 ? 90  C A "C4'"  1  
ATOM 2900   O "O4'"  . C A 1 90  ? 116.074 160.242 139.850 1.00 0.00 ? 90  C A "O4'"  1  
ATOM 2901   C "C3'"  . C A 1 90  ? 116.456 160.333 142.158 1.00 0.00 ? 90  C A "C3'"  1  
ATOM 2902   O "O3'"  . C A 1 90  ? 117.208 160.920 143.205 1.00 0.00 ? 90  C A "O3'"  1  
ATOM 2903   C "C2'"  . C A 1 90  ? 115.129 161.031 141.893 1.00 0.00 ? 90  C A "C2'"  1  
ATOM 2904   O "O2'"  . C A 1 90  ? 115.282 162.443 141.883 1.00 0.00 ? 90  C A "O2'"  1  
ATOM 2905   C "C1'"  . C A 1 90  ? 114.813 160.557 140.473 1.00 0.00 ? 90  C A "C1'"  1  
ATOM 2906   N N1     . C A 1 90  ? 113.905 159.382 140.461 1.00 0.00 ? 90  C A N1     1  
ATOM 2907   C C2     . C A 1 90  ? 112.537 159.595 140.664 1.00 0.00 ? 90  C A C2     1  
ATOM 2908   O O2     . C A 1 90  ? 112.127 160.752 140.851 1.00 0.00 ? 90  C A O2     1  
ATOM 2909   N N3     . C A 1 90  ? 111.689 158.543 140.658 1.00 0.00 ? 90  C A N3     1  
ATOM 2910   C C4     . C A 1 90  ? 112.156 157.310 140.458 1.00 0.00 ? 90  C A C4     1  
ATOM 2911   N N4     . C A 1 90  ? 111.281 156.301 140.459 1.00 0.00 ? 90  C A N4     1  
ATOM 2912   C C5     . C A 1 90  ? 113.540 157.058 140.247 1.00 0.00 ? 90  C A C5     1  
ATOM 2913   C C6     . C A 1 90  ? 114.371 158.109 140.257 1.00 0.00 ? 90  C A C6     1  
ATOM 2914   H "H5'"  . C A 1 90  ? 118.566 159.504 139.638 1.00 0.00 ? 90  C A "H5'"  1  
ATOM 2915   H "H5''" . C A 1 90  ? 118.971 159.551 141.182 1.00 0.00 ? 90  C A "H5''" 1  
ATOM 2916   H "H4'"  . C A 1 90  ? 117.530 161.311 140.700 1.00 0.00 ? 90  C A "H4'"  1  
ATOM 2917   H "H3'"  . C A 1 90  ? 116.285 159.392 142.376 1.00 0.00 ? 90  C A "H3'"  1  
ATOM 2918   H "H2'"  . C A 1 90  ? 114.439 160.746 142.527 1.00 0.00 ? 90  C A "H2'"  1  
ATOM 2919   H "HO2'" . C A 1 90  ? 114.407 162.858 141.745 1.00 0.00 ? 90  C A "HO2'" 1  
ATOM 2920   H "H1'"  . C A 1 90  ? 114.402 161.287 139.969 1.00 0.00 ? 90  C A "H1'"  1  
ATOM 2921   H H41    . C A 1 90  ? 110.329 156.478 140.604 1.00 0.00 ? 90  C A H41    1  
ATOM 2922   H H42    . C A 1 90  ? 111.593 155.382 140.315 1.00 0.00 ? 90  C A H42    1  
ATOM 2923   H H5     . C A 1 90  ? 113.876 156.149 140.101 1.00 0.00 ? 90  C A H5     1  
ATOM 2924   H H6     . C A 1 90  ? 115.328 157.956 140.113 1.00 0.00 ? 90  C A H6     1  
ATOM 2925   P P      . U A 1 91  ? 116.998 160.437 144.724 1.00 0.00 ? 91  U A P      1  
ATOM 2926   O OP1    . U A 1 91  ? 118.001 161.130 145.572 1.00 0.00 ? 91  U A OP1    1  
ATOM 2927   O OP2    . U A 1 91  ? 116.933 158.954 144.727 1.00 0.00 ? 91  U A OP2    1  
ATOM 2928   O "O5'"  . U A 1 91  ? 115.557 160.995 145.110 1.00 0.00 ? 91  U A "O5'"  1  
ATOM 2929   C "C5'"  . U A 1 91  ? 115.312 162.390 145.194 1.00 0.00 ? 91  U A "C5'"  1  
ATOM 2930   C "C4'"  . U A 1 91  ? 113.850 162.688 145.408 1.00 0.00 ? 91  U A "C4'"  1  
ATOM 2931   O "O4'"  . U A 1 91  ? 113.072 162.182 144.293 1.00 0.00 ? 91  U A "O4'"  1  
ATOM 2932   C "C3'"  . U A 1 91  ? 113.209 162.046 146.630 1.00 0.00 ? 91  U A "C3'"  1  
ATOM 2933   O "O3'"  . U A 1 91  ? 113.501 162.729 147.835 1.00 0.00 ? 91  U A "O3'"  1  
ATOM 2934   C "C2'"  . U A 1 91  ? 111.730 162.049 146.270 1.00 0.00 ? 91  U A "C2'"  1  
ATOM 2935   O "O2'"  . U A 1 91  ? 111.157 163.336 146.449 1.00 0.00 ? 91  U A "O2'"  1  
ATOM 2936   C "C1'"  . U A 1 91  ? 111.780 161.735 144.771 1.00 0.00 ? 91  U A "C1'"  1  
ATOM 2937   N N1     . U A 1 91  ? 111.575 160.292 144.494 1.00 0.00 ? 91  U A N1     1  
ATOM 2938   C C2     . U A 1 91  ? 110.277 159.819 144.527 1.00 0.00 ? 91  U A C2     1  
ATOM 2939   O O2     . U A 1 91  ? 109.317 160.531 144.772 1.00 0.00 ? 91  U A O2     1  
ATOM 2940   N N3     . U A 1 91  ? 110.137 158.481 144.263 1.00 0.00 ? 91  U A N3     1  
ATOM 2941   C C4     . U A 1 91  ? 111.140 157.580 143.976 1.00 0.00 ? 91  U A C4     1  
ATOM 2942   O O4     . U A 1 91  ? 110.852 156.400 143.760 1.00 0.00 ? 91  U A O4     1  
ATOM 2943   C C5     . U A 1 91  ? 112.458 158.137 143.957 1.00 0.00 ? 91  U A C5     1  
ATOM 2944   C C6     . U A 1 91  ? 112.623 159.442 144.210 1.00 0.00 ? 91  U A C6     1  
ATOM 2945   H "H5'"  . U A 1 91  ? 115.604 162.815 144.358 1.00 0.00 ? 91  U A "H5'"  1  
ATOM 2946   H "H5''" . U A 1 91  ? 115.827 162.763 145.937 1.00 0.00 ? 91  U A "H5''" 1  
ATOM 2947   H "H4'"  . U A 1 91  ? 113.731 163.659 145.464 1.00 0.00 ? 91  U A "H4'"  1  
ATOM 2948   H "H3'"  . U A 1 91  ? 113.517 161.118 146.704 1.00 0.00 ? 91  U A "H3'"  1  
ATOM 2949   H "H2'"  . U A 1 91  ? 111.236 161.361 146.763 1.00 0.00 ? 91  U A "H2'"  1  
ATOM 2950   H "HO2'" . U A 1 91  ? 110.264 163.239 146.836 1.00 0.00 ? 91  U A "HO2'" 1  
ATOM 2951   H "H1'"  . U A 1 91  ? 111.091 162.253 144.305 1.00 0.00 ? 91  U A "H1'"  1  
ATOM 2952   H H3     . U A 1 91  ? 109.225 158.124 144.282 1.00 0.00 ? 91  U A H3     1  
ATOM 2953   H H5     . U A 1 91  ? 113.232 157.571 143.760 1.00 0.00 ? 91  U A H5     1  
ATOM 2954   H H6     . U A 1 91  ? 113.536 159.798 144.193 1.00 0.00 ? 91  U A H6     1  
ATOM 2955   P P      . C A 1 92  ? 113.466 161.947 149.238 1.00 0.00 ? 92  C A P      1  
ATOM 2956   O OP1    . C A 1 92  ? 114.095 162.817 150.265 1.00 0.00 ? 92  C A OP1    1  
ATOM 2957   O OP2    . C A 1 92  ? 113.993 160.577 149.015 1.00 0.00 ? 92  C A OP2    1  
ATOM 2958   O "O5'"  . C A 1 92  ? 111.914 161.830 149.576 1.00 0.00 ? 92  C A "O5'"  1  
ATOM 2959   C "C5'"  . C A 1 92  ? 111.087 162.983 149.617 1.00 0.00 ? 92  C A "C5'"  1  
ATOM 2960   C "C4'"  . C A 1 92  ? 109.640 162.641 149.360 1.00 0.00 ? 92  C A "C4'"  1  
ATOM 2961   O "O4'"  . C A 1 92  ? 109.556 161.899 148.127 1.00 0.00 ? 92  C A "O4'"  1  
ATOM 2962   C "C3'"  . C A 1 92  ? 108.976 161.729 150.379 1.00 0.00 ? 92  C A "C3'"  1  
ATOM 2963   O "O3'"  . C A 1 92  ? 108.531 162.421 151.533 1.00 0.00 ? 92  C A "O3'"  1  
ATOM 2964   C "C2'"  . C A 1 92  ? 107.798 161.209 149.567 1.00 0.00 ? 92  C A "C2'"  1  
ATOM 2965   O "O2'"  . C A 1 92  ? 106.788 162.198 149.434 1.00 0.00 ? 92  C A "O2'"  1  
ATOM 2966   C "C1'"  . C A 1 92  ? 108.470 160.983 148.215 1.00 0.00 ? 92  C A "C1'"  1  
ATOM 2967   N N1     . C A 1 92  ? 108.971 159.595 148.060 1.00 0.00 ? 92  C A N1     1  
ATOM 2968   C C2     . C A 1 92  ? 108.040 158.574 147.832 1.00 0.00 ? 92  C A C2     1  
ATOM 2969   O O2     . C A 1 92  ? 106.834 158.856 147.768 1.00 0.00 ? 92  C A O2     1  
ATOM 2970   N N3     . C A 1 92  ? 108.471 157.300 147.687 1.00 0.00 ? 92  C A N3     1  
ATOM 2971   C C4     . C A 1 92  ? 109.773 157.022 147.760 1.00 0.00 ? 92  C A C4     1  
ATOM 2972   N N4     . C A 1 92  ? 110.152 155.751 147.611 1.00 0.00 ? 92  C A N4     1  
ATOM 2973   C C5     . C A 1 92  ? 110.744 158.037 147.991 1.00 0.00 ? 92  C A C5     1  
ATOM 2974   C C6     . C A 1 92  ? 110.306 159.294 148.132 1.00 0.00 ? 92  C A C6     1  
ATOM 2975   H "H5'"  . C A 1 92  ? 111.391 163.618 148.935 1.00 0.00 ? 92  C A "H5'"  1  
ATOM 2976   H "H5''" . C A 1 92  ? 111.164 163.401 150.500 1.00 0.00 ? 92  C A "H5''" 1  
ATOM 2977   H "H4'"  . C A 1 92  ? 109.129 163.472 149.276 1.00 0.00 ? 92  C A "H4'"  1  
ATOM 2978   H "H3'"  . C A 1 92  ? 109.583 160.991 150.597 1.00 0.00 ? 92  C A "H3'"  1  
ATOM 2979   H "H2'"  . C A 1 92  ? 107.443 160.377 149.943 1.00 0.00 ? 92  C A "H2'"  1  
ATOM 2980   H "HO2'" . C A 1 92  ? 106.902 162.868 150.139 1.00 0.00 ? 92  C A "HO2'" 1  
ATOM 2981   H "H1'"  . C A 1 92  ? 107.829 161.181 147.501 1.00 0.00 ? 92  C A "H1'"  1  
ATOM 2982   H H41    . C A 1 92  ? 109.481 155.054 147.452 1.00 0.00 ? 92  C A H41    1  
ATOM 2983   H H42    . C A 1 92  ? 111.102 155.514 147.659 1.00 0.00 ? 92  C A H42    1  
ATOM 2984   H H5     . C A 1 92  ? 111.699 157.824 148.043 1.00 0.00 ? 92  C A H5     1  
ATOM 2985   H H6     . C A 1 92  ? 110.958 160.007 148.292 1.00 0.00 ? 92  C A H6     1  
ATOM 2986   P P      . A A 1 93  ? 108.860 161.837 152.988 1.00 0.00 ? 93  A A P      1  
ATOM 2987   O OP1    . A A 1 93  ? 109.548 162.883 153.785 1.00 0.00 ? 93  A A OP1    1  
ATOM 2988   O OP2    . A A 1 93  ? 109.564 160.568 152.677 1.00 0.00 ? 93  A A OP2    1  
ATOM 2989   O "O5'"  . A A 1 93  ? 107.494 161.474 153.725 1.00 0.00 ? 93  A A "O5'"  1  
ATOM 2990   C "C5'"  . A A 1 93  ? 106.324 162.251 153.517 1.00 0.00 ? 93  A A "C5'"  1  
ATOM 2991   C "C4'"  . A A 1 93  ? 105.221 161.435 152.892 1.00 0.00 ? 93  A A "C4'"  1  
ATOM 2992   O "O4'"  . A A 1 93  ? 105.739 160.860 151.665 1.00 0.00 ? 93  A A "O4'"  1  
ATOM 2993   C "C3'"  . A A 1 93  ? 104.765 160.216 153.679 1.00 0.00 ? 93  A A "C3'"  1  
ATOM 2994   O "O3'"  . A A 1 93  ? 103.830 160.530 154.696 1.00 0.00 ? 93  A A "O3'"  1  
ATOM 2995   C "C2'"  . A A 1 93  ? 104.157 159.354 152.582 1.00 0.00 ? 93  A A "C2'"  1  
ATOM 2996   O "O2'"  . A A 1 93  ? 102.887 159.850 152.182 1.00 0.00 ? 93  A A "O2'"  1  
ATOM 2997   C "C1'"  . A A 1 93  ? 105.164 159.579 151.456 1.00 0.00 ? 93  A A "C1'"  1  
ATOM 2998   N N9     . A A 1 93  ? 106.242 158.572 151.465 1.00 0.00 ? 93  A A N9     1  
ATOM 2999   C C8     . A A 1 93  ? 107.562 158.751 151.799 1.00 0.00 ? 93  A A C8     1  
ATOM 3000   N N7     . A A 1 93  ? 108.282 157.660 151.710 1.00 0.00 ? 93  A A N7     1  
ATOM 3001   C C5     . A A 1 93  ? 107.376 156.696 151.289 1.00 0.00 ? 93  A A C5     1  
ATOM 3002   C C6     . A A 1 93  ? 107.515 155.326 151.006 1.00 0.00 ? 93  A A C6     1  
ATOM 3003   N N6     . A A 1 93  ? 108.667 154.661 151.110 1.00 0.00 ? 93  A A N6     1  
ATOM 3004   N N1     . A A 1 93  ? 106.414 154.652 150.609 1.00 0.00 ? 93  A A N1     1  
ATOM 3005   C C2     . A A 1 93  ? 105.257 155.318 150.504 1.00 0.00 ? 93  A A C2     1  
ATOM 3006   N N3     . A A 1 93  ? 105.001 156.603 150.741 1.00 0.00 ? 93  A A N3     1  
ATOM 3007   C C4     . A A 1 93  ? 106.116 157.244 151.135 1.00 0.00 ? 93  A A C4     1  
ATOM 3008   H "H5'"  . A A 1 93  ? 106.540 163.002 152.925 1.00 0.00 ? 93  A A "H5'"  1  
ATOM 3009   H "H5''" . A A 1 93  ? 106.015 162.602 154.378 1.00 0.00 ? 93  A A "H5''" 1  
ATOM 3010   H "H4'"  . A A 1 93  ? 104.439 161.990 152.687 1.00 0.00 ? 93  A A "H4'"  1  
ATOM 3011   H "H3'"  . A A 1 93  ? 105.531 159.752 154.079 1.00 0.00 ? 93  A A "H3'"  1  
ATOM 3012   H "H2'"  . A A 1 93  ? 104.112 158.412 152.848 1.00 0.00 ? 93  A A "H2'"  1  
ATOM 3013   H "HO2'" . A A 1 93  ? 102.194 159.221 152.473 1.00 0.00 ? 93  A A "HO2'" 1  
ATOM 3014   H "H1'"  . A A 1 93  ? 104.699 159.552 150.593 1.00 0.00 ? 93  A A "H1'"  1  
ATOM 3015   H H8     . A A 1 93  ? 107.931 159.615 152.078 1.00 0.00 ? 93  A A H8     1  
ATOM 3016   H H61    . A A 1 93  ? 108.702 153.704 150.899 1.00 0.00 ? 93  A A H61    1  
ATOM 3017   H H62    . A A 1 93  ? 109.479 155.129 151.397 1.00 0.00 ? 93  A A H62    1  
ATOM 3018   H H2     . A A 1 93  ? 104.488 154.783 150.212 1.00 0.00 ? 93  A A H2     1  
ATOM 3019   P P      . G A 1 94  ? 103.852 159.729 156.089 1.00 0.00 ? 94  G A P      1  
ATOM 3020   O OP1    . G A 1 94  ? 103.120 160.538 157.097 1.00 0.00 ? 94  G A OP1    1  
ATOM 3021   O OP2    . G A 1 94  ? 105.252 159.313 156.358 1.00 0.00 ? 94  G A OP2    1  
ATOM 3022   O "O5'"  . G A 1 94  ? 102.997 158.418 155.795 1.00 0.00 ? 94  G A "O5'"  1  
ATOM 3023   C "C5'"  . G A 1 94  ? 101.582 158.433 155.897 1.00 0.00 ? 94  G A "C5'"  1  
ATOM 3024   C "C4'"  . G A 1 94  ? 100.953 157.344 155.062 1.00 0.00 ? 94  G A "C4'"  1  
ATOM 3025   O "O4'"  . G A 1 94  ? 101.729 157.151 153.850 1.00 0.00 ? 94  G A "O4'"  1  
ATOM 3026   C "C3'"  . G A 1 94  ? 100.906 155.962 155.693 1.00 0.00 ? 94  G A "C3'"  1  
ATOM 3027   O "O3'"  . G A 1 94  ? 99.779  155.774 156.534 1.00 0.00 ? 94  G A "O3'"  1  
ATOM 3028   C "C2'"  . G A 1 94  ? 100.881 155.048 154.470 1.00 0.00 ? 94  G A "C2'"  1  
ATOM 3029   O "O2'"  . G A 1 94  ? 99.586  155.007 153.885 1.00 0.00 ? 94  G A "O2'"  1  
ATOM 3030   C "C1'"  . G A 1 94  ? 101.836 155.797 153.532 1.00 0.00 ? 94  G A "C1'"  1  
ATOM 3031   N N9     . G A 1 94  ? 103.244 155.408 153.744 1.00 0.00 ? 94  G A N9     1  
ATOM 3032   C C8     . G A 1 94  ? 104.294 156.230 154.072 1.00 0.00 ? 94  G A C8     1  
ATOM 3033   N N7     . G A 1 94  ? 105.427 155.592 154.193 1.00 0.00 ? 94  G A N7     1  
ATOM 3034   C C5     . G A 1 94  ? 105.105 154.268 153.931 1.00 0.00 ? 94  G A C5     1  
ATOM 3035   C C6     . G A 1 94  ? 105.923 153.109 153.915 1.00 0.00 ? 94  G A C6     1  
ATOM 3036   O O6     . G A 1 94  ? 107.138 153.020 154.136 1.00 0.00 ? 94  G A O6     1  
ATOM 3037   N N1     . G A 1 94  ? 105.191 151.969 153.601 1.00 0.00 ? 94  G A N1     1  
ATOM 3038   C C2     . G A 1 94  ? 103.844 151.945 153.338 1.00 0.00 ? 94  G A C2     1  
ATOM 3039   N N2     . G A 1 94  ? 103.312 150.745 153.055 1.00 0.00 ? 94  G A N2     1  
ATOM 3040   N N3     . G A 1 94  ? 103.069 153.018 153.350 1.00 0.00 ? 94  G A N3     1  
ATOM 3041   C C4     . G A 1 94  ? 103.761 154.136 153.652 1.00 0.00 ? 94  G A C4     1  
ATOM 3042   H "H5'"  . G A 1 94  ? 101.246 159.302 155.594 1.00 0.00 ? 94  G A "H5'"  1  
ATOM 3043   H "H5''" . G A 1 94  ? 101.328 158.303 156.835 1.00 0.00 ? 94  G A "H5''" 1  
ATOM 3044   H "H4'"  . G A 1 94  ? 100.042 157.613 154.818 1.00 0.00 ? 94  G A "H4'"  1  
ATOM 3045   H "H3'"  . G A 1 94  ? 101.722 155.799 156.210 1.00 0.00 ? 94  G A "H3'"  1  
ATOM 3046   H "H2'"  . G A 1 94  ? 101.212 154.150 154.684 1.00 0.00 ? 94  G A "H2'"  1  
ATOM 3047   H "HO2'" . G A 1 94  ? 99.606  154.403 153.114 1.00 0.00 ? 94  G A "HO2'" 1  
ATOM 3048   H "H1'"  . G A 1 94  ? 101.586 155.620 152.601 1.00 0.00 ? 94  G A "H1'"  1  
ATOM 3049   H H8     . G A 1 94  ? 104.204 157.197 154.200 1.00 0.00 ? 94  G A H8     1  
ATOM 3050   H H1     . G A 1 94  ? 105.676 151.117 153.567 1.00 0.00 ? 94  G A H1     1  
ATOM 3051   H H21    . G A 1 94  ? 103.878 149.947 153.044 1.00 0.00 ? 94  G A H21    1  
ATOM 3052   H H22    . G A 1 94  ? 102.354 150.668 152.859 1.00 0.00 ? 94  G A H22    1  
ATOM 3053   P P      . G A 1 95  ? 99.989  155.578 158.106 1.00 0.00 ? 95  G A P      1  
ATOM 3054   O OP1    . G A 1 95  ? 99.084  154.504 158.590 1.00 0.00 ? 95  G A OP1    1  
ATOM 3055   O OP2    . G A 1 95  ? 99.835  156.960 158.628 1.00 0.00 ? 95  G A OP2    1  
ATOM 3056   O "O5'"  . G A 1 95  ? 101.483 155.117 158.372 1.00 0.00 ? 95  G A "O5'"  1  
ATOM 3057   C "C5'"  . G A 1 95  ? 101.804 154.405 159.545 1.00 0.00 ? 95  G A "C5'"  1  
ATOM 3058   C "C4'"  . G A 1 95  ? 102.126 152.978 159.201 1.00 0.00 ? 95  G A "C4'"  1  
ATOM 3059   O "O4'"  . G A 1 95  ? 102.952 152.927 158.012 1.00 0.00 ? 95  G A "O4'"  1  
ATOM 3060   C "C3'"  . G A 1 95  ? 102.954 152.213 160.214 1.00 0.00 ? 95  G A "C3'"  1  
ATOM 3061   O "O3'"  . G A 1 95  ? 102.200 151.748 161.295 1.00 0.00 ? 95  G A "O3'"  1  
ATOM 3062   C "C2'"  . G A 1 95  ? 103.454 151.063 159.374 1.00 0.00 ? 95  G A "C2'"  1  
ATOM 3063   O "O2'"  . G A 1 95  ? 102.449 150.090 159.148 1.00 0.00 ? 95  G A "O2'"  1  
ATOM 3064   C "C1'"  . G A 1 95  ? 103.815 151.800 158.087 1.00 0.00 ? 95  G A "C1'"  1  
ATOM 3065   N N9     . G A 1 95  ? 105.200 152.265 158.072 1.00 0.00 ? 95  G A N9     1  
ATOM 3066   C C8     . G A 1 95  ? 105.656 153.540 158.282 1.00 0.00 ? 95  G A C8     1  
ATOM 3067   N N7     . G A 1 95  ? 106.955 153.639 158.191 1.00 0.00 ? 95  G A N7     1  
ATOM 3068   C C5     . G A 1 95  ? 107.378 152.345 157.905 1.00 0.00 ? 95  G A C5     1  
ATOM 3069   C C6     . G A 1 95  ? 108.689 151.821 157.683 1.00 0.00 ? 95  G A C6     1  
ATOM 3070   O O6     . G A 1 95  ? 109.769 152.405 157.678 1.00 0.00 ? 95  G A O6     1  
ATOM 3071   N N1     . G A 1 95  ? 108.653 150.462 157.438 1.00 0.00 ? 95  G A N1     1  
ATOM 3072   C C2     . G A 1 95  ? 107.523 149.708 157.397 1.00 0.00 ? 95  G A C2     1  
ATOM 3073   N N2     . G A 1 95  ? 107.696 148.427 157.145 1.00 0.00 ? 95  G A N2     1  
ATOM 3074   N N3     . G A 1 95  ? 106.304 150.172 157.587 1.00 0.00 ? 95  G A N3     1  
ATOM 3075   C C4     . G A 1 95  ? 106.305 151.492 157.836 1.00 0.00 ? 95  G A C4     1  
ATOM 3076   H "H5'"  . G A 1 95  ? 101.042 154.436 160.158 1.00 0.00 ? 95  G A "H5'"  1  
ATOM 3077   H "H5''" . G A 1 95  ? 102.578 154.829 159.973 1.00 0.00 ? 95  G A "H5''" 1  
ATOM 3078   H "H4'"  . G A 1 95  ? 101.291 152.496 159.025 1.00 0.00 ? 95  G A "H4'"  1  
ATOM 3079   H "H3'"  . G A 1 95  ? 103.668 152.795 160.549 1.00 0.00 ? 95  G A "H3'"  1  
ATOM 3080   H "H2'"  . G A 1 95  ? 104.259 150.659 159.760 1.00 0.00 ? 95  G A "H2'"  1  
ATOM 3081   H "HO2'" . G A 1 95  ? 101.750 150.189 159.828 1.00 0.00 ? 95  G A "HO2'" 1  
ATOM 3082   H "H1'"  . G A 1 95  ? 103.667 151.207 157.320 1.00 0.00 ? 95  G A "H1'"  1  
ATOM 3083   H H8     . G A 1 95  ? 105.071 154.300 158.478 1.00 0.00 ? 95  G A H8     1  
ATOM 3084   H H1     . G A 1 95  ? 109.509 150.010 157.282 1.00 0.00 ? 95  G A H1     1  
ATOM 3085   H H21    . G A 1 95  ? 108.596 148.072 157.001 1.00 0.00 ? 95  G A H21    1  
ATOM 3086   H H22    . G A 1 95  ? 106.920 147.828 157.104 1.00 0.00 ? 95  G A H22    1  
ATOM 3087   P P      . G A 1 96  ? 102.848 151.749 162.768 1.00 0.00 ? 96  G A P      1  
ATOM 3088   O OP1    . G A 1 96  ? 101.815 151.250 163.723 1.00 0.00 ? 96  G A OP1    1  
ATOM 3089   O OP2    . G A 1 96  ? 103.534 153.043 163.022 1.00 0.00 ? 96  G A OP2    1  
ATOM 3090   O "O5'"  . G A 1 96  ? 103.944 150.610 162.694 1.00 0.00 ? 96  G A "O5'"  1  
ATOM 3091   C "C5'"  . G A 1 96  ? 103.549 149.257 162.552 1.00 0.00 ? 96  G A "C5'"  1  
ATOM 3092   C "C4'"  . G A 1 96  ? 104.765 148.387 162.407 1.00 0.00 ? 96  G A "C4'"  1  
ATOM 3093   O "O4'"  . G A 1 96  ? 105.476 148.755 161.195 1.00 0.00 ? 96  G A "O4'"  1  
ATOM 3094   C "C3'"  . G A 1 96  ? 105.822 148.537 163.478 1.00 0.00 ? 96  G A "C3'"  1  
ATOM 3095   O "O3'"  . G A 1 96  ? 105.487 147.822 164.657 1.00 0.00 ? 96  G A "O3'"  1  
ATOM 3096   C "C2'"  . G A 1 96  ? 107.020 147.947 162.768 1.00 0.00 ? 96  G A "C2'"  1  
ATOM 3097   O "O2'"  . G A 1 96  ? 106.943 146.540 162.687 1.00 0.00 ? 96  G A "O2'"  1  
ATOM 3098   C "C1'"  . G A 1 96  ? 106.855 148.559 161.381 1.00 0.00 ? 96  G A "C1'"  1  
ATOM 3099   N N9     . G A 1 96  ? 107.506 149.853 161.300 1.00 0.00 ? 96  G A N9     1  
ATOM 3100   C C8     . G A 1 96  ? 106.943 151.077 161.505 1.00 0.00 ? 96  G A C8     1  
ATOM 3101   N N7     . G A 1 96  ? 107.798 152.051 161.395 1.00 0.00 ? 96  G A N7     1  
ATOM 3102   C C5     . G A 1 96  ? 108.999 151.420 161.096 1.00 0.00 ? 96  G A C5     1  
ATOM 3103   C C6     . G A 1 96  ? 110.306 151.954 160.867 1.00 0.00 ? 96  G A C6     1  
ATOM 3104   O O6     . G A 1 96  ? 110.685 153.132 160.880 1.00 0.00 ? 96  G A O6     1  
ATOM 3105   N N1     . G A 1 96  ? 111.225 150.949 160.593 1.00 0.00 ? 96  G A N1     1  
ATOM 3106   C C2     . G A 1 96  ? 110.936 149.617 160.534 1.00 0.00 ? 96  G A C2     1  
ATOM 3107   N N2     . G A 1 96  ? 111.958 148.810 160.243 1.00 0.00 ? 96  G A N2     1  
ATOM 3108   N N3     . G A 1 96  ? 109.734 149.114 160.741 1.00 0.00 ? 96  G A N3     1  
ATOM 3109   C C4     . G A 1 96  ? 108.824 150.066 161.021 1.00 0.00 ? 96  G A C4     1  
ATOM 3110   H "H5'"  . G A 1 96  ? 102.979 149.173 161.760 1.00 0.00 ? 96  G A "H5'"  1  
ATOM 3111   H "H5''" . G A 1 96  ? 103.036 148.988 163.342 1.00 0.00 ? 96  G A "H5''" 1  
ATOM 3112   H "H4'"  . G A 1 96  ? 104.478 147.450 162.341 1.00 0.00 ? 96  G A "H4'"  1  
ATOM 3113   H "H3'"  . G A 1 96  ? 105.934 149.486 163.689 1.00 0.00 ? 96  G A "H3'"  1  
ATOM 3114   H "H2'"  . G A 1 96  ? 107.861 148.235 163.183 1.00 0.00 ? 96  G A "H2'"  1  
ATOM 3115   H "HO2'" . G A 1 96  ? 107.834 146.163 162.846 1.00 0.00 ? 96  G A "HO2'" 1  
ATOM 3116   H "H1'"  . G A 1 96  ? 107.234 147.952 160.711 1.00 0.00 ? 96  G A "H1'"  1  
ATOM 3117   H H8     . G A 1 96  ? 105.997 151.213 161.717 1.00 0.00 ? 96  G A H8     1  
ATOM 3118   H H1     . G A 1 96  ? 112.152 151.223 160.434 1.00 0.00 ? 96  G A H1     1  
ATOM 3119   H H21    . G A 1 96  ? 112.853 149.180 160.089 1.00 0.00 ? 96  G A H21    1  
ATOM 3120   H H22    . G A 1 96  ? 111.815 147.841 160.183 1.00 0.00 ? 96  G A H22    1  
ATOM 3121   P P      . A A 1 97  ? 105.768 148.496 166.083 1.00 0.00 ? 97  A A P      1  
ATOM 3122   O OP1    . A A 1 97  ? 105.654 147.445 167.119 1.00 0.00 ? 97  A A OP1    1  
ATOM 3123   O OP2    . A A 1 97  ? 104.948 149.728 166.176 1.00 0.00 ? 97  A A OP2    1  
ATOM 3124   O "O5'"  . A A 1 97  ? 107.282 148.973 166.015 1.00 0.00 ? 97  A A "O5'"  1  
ATOM 3125   C "C5'"  . A A 1 97  ? 107.928 149.531 167.159 1.00 0.00 ? 97  A A "C5'"  1  
ATOM 3126   C "C4'"  . A A 1 97  ? 109.185 148.753 167.486 1.00 0.00 ? 97  A A "C4'"  1  
ATOM 3127   O "O4'"  . A A 1 97  ? 108.791 147.408 167.816 1.00 0.00 ? 97  A A "O4'"  1  
ATOM 3128   C "C3'"  . A A 1 97  ? 110.099 148.565 166.292 1.00 0.00 ? 97  A A "C3'"  1  
ATOM 3129   O "O3'"  . A A 1 97  ? 110.975 149.661 166.189 1.00 0.00 ? 97  A A "O3'"  1  
ATOM 3130   C "C2'"  . A A 1 97  ? 110.841 147.274 166.611 1.00 0.00 ? 97  A A "C2'"  1  
ATOM 3131   O "O2'"  . A A 1 97  ? 112.034 147.484 167.328 1.00 0.00 ? 97  A A "O2'"  1  
ATOM 3132   C "C1'"  . A A 1 97  ? 109.833 146.524 167.478 1.00 0.00 ? 97  A A "C1'"  1  
ATOM 3133   N N9     . A A 1 97  ? 109.207 145.364 166.862 1.00 0.00 ? 97  A A N9     1  
ATOM 3134   C C8     . A A 1 97  ? 107.867 145.221 166.633 1.00 0.00 ? 97  A A C8     1  
ATOM 3135   N N7     . A A 1 97  ? 107.534 144.067 166.109 1.00 0.00 ? 97  A A N7     1  
ATOM 3136   C C5     . A A 1 97  ? 108.745 143.409 165.968 1.00 0.00 ? 97  A A C5     1  
ATOM 3137   C C6     . A A 1 97  ? 109.070 142.144 165.472 1.00 0.00 ? 97  A A C6     1  
ATOM 3138   N N6     . A A 1 97  ? 108.166 141.273 164.997 1.00 0.00 ? 97  A A N6     1  
ATOM 3139   N N1     . A A 1 97  ? 110.370 141.791 165.475 1.00 0.00 ? 97  A A N1     1  
ATOM 3140   C C2     . A A 1 97  ? 111.272 142.661 165.945 1.00 0.00 ? 97  A A C2     1  
ATOM 3141   N N3     . A A 1 97  ? 111.090 143.889 166.436 1.00 0.00 ? 97  A A N3     1  
ATOM 3142   C C4     . A A 1 97  ? 109.788 144.202 166.422 1.00 0.00 ? 97  A A C4     1  
ATOM 3143   H "H5'"  . A A 1 97  ? 107.311 149.498 167.921 1.00 0.00 ? 97  A A "H5'"  1  
ATOM 3144   H "H5''" . A A 1 97  ? 108.156 150.467 166.973 1.00 0.00 ? 97  A A "H5''" 1  
ATOM 3145   H "H4'"  . A A 1 97  ? 109.626 149.172 168.254 1.00 0.00 ? 97  A A "H4'"  1  
ATOM 3146   H "H3'"  . A A 1 97  ? 109.556 148.476 165.482 1.00 0.00 ? 97  A A "H3'"  1  
ATOM 3147   H "H2'"  . A A 1 97  ? 111.012 146.748 165.801 1.00 0.00 ? 97  A A "H2'"  1  
ATOM 3148   H "HO2'" . A A 1 97  ? 112.317 148.416 167.208 1.00 0.00 ? 97  A A "HO2'" 1  
ATOM 3149   H "H1'"  . A A 1 97  ? 110.274 146.219 168.300 1.00 0.00 ? 97  A A "H1'"  1  
ATOM 3150   H H8     . A A 1 97  ? 107.211 145.918 166.855 1.00 0.00 ? 97  A A H8     1  
ATOM 3151   H H61    . A A 1 97  ? 108.457 140.398 164.663 1.00 0.00 ? 97  A A H61    1  
ATOM 3152   H H62    . A A 1 97  ? 107.214 141.510 164.984 1.00 0.00 ? 97  A A H62    1  
ATOM 3153   H H2     . A A 1 97  ? 112.203 142.349 165.923 1.00 0.00 ? 97  A A H2     1  
ATOM 3154   P P      . A A 1 98  ? 111.195 150.332 164.767 1.00 0.00 ? 98  A A P      1  
ATOM 3155   O OP1    . A A 1 98  ? 111.845 151.666 164.902 1.00 0.00 ? 98  A A OP1    1  
ATOM 3156   O OP2    . A A 1 98  ? 109.934 150.186 164.011 1.00 0.00 ? 98  A A OP2    1  
ATOM 3157   O "O5'"  . A A 1 98  ? 112.263 149.368 164.110 1.00 0.00 ? 98  A A "O5'"  1  
ATOM 3158   C "C5'"  . A A 1 98  ? 113.549 149.235 164.690 1.00 0.00 ? 98  A A "C5'"  1  
ATOM 3159   C "C4'"  . A A 1 98  ? 114.112 147.902 164.338 1.00 0.00 ? 98  A A "C4'"  1  
ATOM 3160   O "O4'"  . A A 1 98  ? 113.113 146.931 164.682 1.00 0.00 ? 98  A A "O4'"  1  
ATOM 3161   C "C3'"  . A A 1 98  ? 114.329 147.657 162.859 1.00 0.00 ? 98  A A "C3'"  1  
ATOM 3162   O "O3'"  . A A 1 98  ? 115.578 148.198 162.439 1.00 0.00 ? 98  A A "O3'"  1  
ATOM 3163   C "C2'"  . A A 1 98  ? 114.298 146.135 162.785 1.00 0.00 ? 98  A A "C2'"  1  
ATOM 3164   O "O2'"  . A A 1 98  ? 115.549 145.555 163.086 1.00 0.00 ? 98  A A "O2'"  1  
ATOM 3165   C "C1'"  . A A 1 98  ? 113.264 145.792 163.867 1.00 0.00 ? 98  A A "C1'"  1  
ATOM 3166   N N9     . A A 1 98  ? 111.936 145.486 163.348 1.00 0.00 ? 98  A A N9     1  
ATOM 3167   C C8     . A A 1 98  ? 110.912 146.380 163.177 1.00 0.00 ? 98  A A C8     1  
ATOM 3168   N N7     . A A 1 98  ? 109.819 145.840 162.690 1.00 0.00 ? 98  A A N7     1  
ATOM 3169   C C5     . A A 1 98  ? 110.149 144.501 162.535 1.00 0.00 ? 98  A A C5     1  
ATOM 3170   C C6     . A A 1 98  ? 109.431 143.399 162.059 1.00 0.00 ? 98  A A C6     1  
ATOM 3171   N N6     . A A 1 98  ? 108.182 143.454 161.632 1.00 0.00 ? 98  A A N6     1  
ATOM 3172   N N1     . A A 1 98  ? 110.051 142.214 162.036 1.00 0.00 ? 98  A A N1     1  
ATOM 3173   C C2     . A A 1 98  ? 111.311 142.140 162.465 1.00 0.00 ? 98  A A C2     1  
ATOM 3174   N N3     . A A 1 98  ? 112.095 143.099 162.932 1.00 0.00 ? 98  A A N3     1  
ATOM 3175   C C4     . A A 1 98  ? 111.448 144.269 162.943 1.00 0.00 ? 98  A A C4     1  
ATOM 3176   H "H5'"  . A A 1 98  ? 113.471 149.324 165.663 1.00 0.00 ? 98  A A "H5'"  1  
ATOM 3177   H "H5''" . A A 1 98  ? 114.130 149.949 164.353 1.00 0.00 ? 98  A A "H5''" 1  
ATOM 3178   H "H4'"  . A A 1 98  ? 114.929 147.755 164.862 1.00 0.00 ? 98  A A "H4'"  1  
ATOM 3179   H "H3'"  . A A 1 98  ? 113.594 148.065 162.355 1.00 0.00 ? 98  A A "H3'"  1  
ATOM 3180   H "H2'"  . A A 1 98  ? 113.965 145.823 161.918 1.00 0.00 ? 98  A A "H2'"  1  
ATOM 3181   H "HO2'" . A A 1 98  ? 115.473 144.581 163.025 1.00 0.00 ? 98  A A "HO2'" 1  
ATOM 3182   H "H1'"  . A A 1 98  ? 113.577 145.021 164.386 1.00 0.00 ? 98  A A "H1'"  1  
ATOM 3183   H H8     . A A 1 98  ? 110.987 147.334 163.394 1.00 0.00 ? 98  A A H8     1  
ATOM 3184   H H61    . A A 1 98  ? 107.737 142.642 161.310 1.00 0.00 ? 98  A A H61    1  
ATOM 3185   H H62    . A A 1 98  ? 107.700 144.306 161.637 1.00 0.00 ? 98  A A H62    1  
ATOM 3186   H H2     . A A 1 98  ? 111.716 141.247 162.430 1.00 0.00 ? 98  A A H2     1  
ATOM 3187   P P      . A A 1 99  ? 115.792 148.614 160.899 1.00 0.00 ? 99  A A P      1  
ATOM 3188   O OP1    . A A 1 99  ? 117.135 149.243 160.846 1.00 0.00 ? 99  A A OP1    1  
ATOM 3189   O OP2    . A A 1 99  ? 114.620 149.355 160.376 1.00 0.00 ? 99  A A OP2    1  
ATOM 3190   O "O5'"  . A A 1 99  ? 115.766 147.216 160.148 1.00 0.00 ? 99  A A "O5'"  1  
ATOM 3191   C "C5'"  . A A 1 99  ? 116.862 146.328 160.226 1.00 0.00 ? 99  A A "C5'"  1  
ATOM 3192   C "C4'"  . A A 1 99  ? 116.495 145.035 159.570 1.00 0.00 ? 99  A A "C4'"  1  
ATOM 3193   O "O4'"  . A A 1 99  ? 115.276 144.636 160.204 1.00 0.00 ? 99  A A "O4'"  1  
ATOM 3194   C "C3'"  . A A 1 99  ? 116.118 145.150 158.101 1.00 0.00 ? 99  A A "C3'"  1  
ATOM 3195   O "O3'"  . A A 1 99  ? 117.227 144.876 157.282 1.00 0.00 ? 99  A A "O3'"  1  
ATOM 3196   C "C2'"  . A A 1 99  ? 115.151 144.011 157.913 1.00 0.00 ? 99  A A "C2'"  1  
ATOM 3197   O "O2'"  . A A 1 99  ? 115.809 142.788 157.679 1.00 0.00 ? 99  A A "O2'"  1  
ATOM 3198   C "C1'"  . A A 1 99  ? 114.439 143.998 159.266 1.00 0.00 ? 99  A A "C1'"  1  
ATOM 3199   N N9     . A A 1 99  ? 113.152 144.698 159.260 1.00 0.00 ? 99  A A N9     1  
ATOM 3200   C C8     . A A 1 99  ? 112.902 146.046 159.314 1.00 0.00 ? 99  A A C8     1  
ATOM 3201   N N7     . A A 1 99  ? 111.624 146.338 159.295 1.00 0.00 ? 99  A A N7     1  
ATOM 3202   C C5     . A A 1 99  ? 110.997 145.104 159.223 1.00 0.00 ? 99  A A C5     1  
ATOM 3203   C C6     . A A 1 99  ? 109.647 144.730 159.187 1.00 0.00 ? 99  A A C6     1  
ATOM 3204   N N6     . A A 1 99  ? 108.636 145.592 159.209 1.00 0.00 ? 99  A A N6     1  
ATOM 3205   N N1     . A A 1 99  ? 109.364 143.417 159.126 1.00 0.00 ? 99  A A N1     1  
ATOM 3206   C C2     . A A 1 99  ? 110.375 142.544 159.096 1.00 0.00 ? 99  A A C2     1  
ATOM 3207   N N3     . A A 1 99  ? 111.681 142.776 159.128 1.00 0.00 ? 99  A A N3     1  
ATOM 3208   C C4     . A A 1 99  ? 111.925 144.090 159.196 1.00 0.00 ? 99  A A C4     1  
ATOM 3209   H "H5'"  . A A 1 99  ? 117.086 146.177 161.168 1.00 0.00 ? 99  A A "H5'"  1  
ATOM 3210   H "H5''" . A A 1 99  ? 117.634 146.730 159.775 1.00 0.00 ? 99  A A "H5''" 1  
ATOM 3211   H "H4'"  . A A 1 99  ? 117.210 144.383 159.731 1.00 0.00 ? 99  A A "H4'"  1  
ATOM 3212   H "H3'"  . A A 1 99  ? 115.780 146.055 157.928 1.00 0.00 ? 99  A A "H3'"  1  
ATOM 3213   H "H2'"  . A A 1 99  ? 114.500 144.204 157.206 1.00 0.00 ? 99  A A "H2'"  1  
ATOM 3214   H "HO2'" . A A 1 99  ? 115.320 142.288 156.994 1.00 0.00 ? 99  A A "HO2'" 1  
ATOM 3215   H "H1'"  . A A 1 99  ? 114.292 143.072 159.549 1.00 0.00 ? 99  A A "H1'"  1  
ATOM 3216   H H8     . A A 1 99  ? 113.606 146.724 159.363 1.00 0.00 ? 99  A A H8     1  
ATOM 3217   H H61    . A A 1 99  ? 107.712 145.263 159.182 1.00 0.00 ? 99  A A H61    1  
ATOM 3218   H H62    . A A 1 99  ? 108.811 146.554 159.255 1.00 0.00 ? 99  A A H62    1  
ATOM 3219   H H2     . A A 1 99  ? 110.117 141.600 159.042 1.00 0.00 ? 99  A A H2     1  
ATOM 3220   P P      . C A 1 100 ? 117.400 145.653 155.896 1.00 0.00 ? 100 C A P      1  
ATOM 3221   O OP1    . C A 1 100 ? 118.130 144.715 155.035 1.00 0.00 ? 100 C A OP1    1  
ATOM 3222   O OP2    . C A 1 100 ? 117.963 146.991 156.164 1.00 0.00 ? 100 C A OP2    1  
ATOM 3223   O "O5'"  . C A 1 100 ? 115.925 145.857 155.360 1.00 0.00 ? 100 C A "O5'"  1  
ATOM 3224   C "C5'"  . C A 1 100 ? 115.407 145.047 154.335 1.00 0.00 ? 100 C A "C5'"  1  
ATOM 3225   C "C4'"  . C A 1 100 ? 113.910 144.912 154.478 1.00 0.00 ? 100 C A "C4'"  1  
ATOM 3226   O "O4'"  . C A 1 100 ? 113.524 145.281 155.819 1.00 0.00 ? 100 C A "O4'"  1  
ATOM 3227   C "C3'"  . C A 1 100 ? 113.075 145.824 153.607 1.00 0.00 ? 100 C A "C3'"  1  
ATOM 3228   O "O3'"  . C A 1 100 ? 112.964 145.300 152.288 1.00 0.00 ? 100 C A "O3'"  1  
ATOM 3229   C "C2'"  . C A 1 100 ? 111.754 145.818 154.354 1.00 0.00 ? 100 C A "C2'"  1  
ATOM 3230   O "O2'"  . C A 1 100 ? 111.015 144.637 154.145 1.00 0.00 ? 100 C A "O2'"  1  
ATOM 3231   C "C1'"  . C A 1 100 ? 112.240 145.864 155.804 1.00 0.00 ? 100 C A "C1'"  1  
ATOM 3232   N N1     . C A 1 100 ? 112.351 147.244 156.292 1.00 0.00 ? 100 C A N1     1  
ATOM 3233   C C2     . C A 1 100 ? 111.193 147.948 156.512 1.00 0.00 ? 100 C A C2     1  
ATOM 3234   O O2     . C A 1 100 ? 110.131 147.390 156.328 1.00 0.00 ? 100 C A O2     1  
ATOM 3235   N N3     . C A 1 100 ? 111.256 149.223 156.917 1.00 0.00 ? 100 C A N3     1  
ATOM 3236   C C4     . C A 1 100 ? 112.433 149.783 157.126 1.00 0.00 ? 100 C A C4     1  
ATOM 3237   N N4     . C A 1 100 ? 112.455 151.037 157.527 1.00 0.00 ? 100 C A N4     1  
ATOM 3238   C C5     . C A 1 100 ? 113.646 149.081 156.929 1.00 0.00 ? 100 C A C5     1  
ATOM 3239   C C6     . C A 1 100 ? 113.560 147.823 156.517 1.00 0.00 ? 100 C A C6     1  
ATOM 3240   H "H5'"  . C A 1 100 ? 115.827 144.163 154.383 1.00 0.00 ? 100 C A "H5'"  1  
ATOM 3241   H "H5''" . C A 1 100 ? 115.621 145.456 153.471 1.00 0.00 ? 100 C A "H5''" 1  
ATOM 3242   H "H4'"  . C A 1 100 ? 113.665 143.976 154.319 1.00 0.00 ? 100 C A "H4'"  1  
ATOM 3243   H "H3'"  . C A 1 100 ? 113.485 146.715 153.584 1.00 0.00 ? 100 C A "H3'"  1  
ATOM 3244   H "H2'"  . C A 1 100 ? 111.214 146.606 154.139 1.00 0.00 ? 100 C A "H2'"  1  
ATOM 3245   H "HO2'" . C A 1 100 ? 110.066 144.864 154.050 1.00 0.00 ? 100 C A "HO2'" 1  
ATOM 3246   H "H1'"  . C A 1 100 ? 111.617 145.361 156.368 1.00 0.00 ? 100 C A "H1'"  1  
ATOM 3247   H H41    . C A 1 100 ? 111.615 151.522 157.662 1.00 0.00 ? 100 C A H41    1  
ATOM 3248   H H42    . C A 1 100 ? 113.311 151.483 157.693 1.00 0.00 ? 100 C A H42    1  
ATOM 3249   H H5     . C A 1 100 ? 114.513 149.509 157.095 1.00 0.00 ? 100 C A H5     1  
ATOM 3250   H H6     . C A 1 100 ? 114.384 147.314 156.373 1.00 0.00 ? 100 C A H6     1  
ATOM 3251   P P      . U A 1 101 ? 112.580 146.484 151.237 1.00 0.00 ? 101 U A P      1  
ATOM 3252   O OP1    . U A 1 101 ? 112.959 146.081 149.859 1.00 0.00 ? 101 U A OP1    1  
ATOM 3253   O OP2    . U A 1 101 ? 113.191 147.694 151.842 1.00 0.00 ? 101 U A OP2    1  
ATOM 3254   O "O5'"  . U A 1 101 ? 110.996 146.654 151.283 1.00 0.00 ? 101 U A "O5'"  1  
ATOM 3255   C "C5'"  . U A 1 101 ? 110.135 145.572 150.964 1.00 0.00 ? 101 U A "C5'"  1  
ATOM 3256   C "C4'"  . U A 1 101 ? 108.700 145.881 151.310 1.00 0.00 ? 101 U A "C4'"  1  
ATOM 3257   O "O4'"  . U A 1 101 ? 108.609 146.213 152.725 1.00 0.00 ? 101 U A "O4'"  1  
ATOM 3258   C "C3'"  . U A 1 101 ? 108.088 147.088 150.617 1.00 0.00 ? 101 U A "C3'"  1  
ATOM 3259   O "O3'"  . U A 1 101 ? 107.541 146.781 149.348 1.00 0.00 ? 101 U A "O3'"  1  
ATOM 3260   C "C2'"  . U A 1 101 ? 106.999 147.475 151.600 1.00 0.00 ? 101 U A "C2'"  1  
ATOM 3261   O "O2'"  . U A 1 101 ? 105.888 146.595 151.507 1.00 0.00 ? 101 U A "O2'"  1  
ATOM 3262   C "C1'"  . U A 1 101 ? 107.709 147.248 152.934 1.00 0.00 ? 101 U A "C1'"  1  
ATOM 3263   N N1     . U A 1 101 ? 108.461 148.444 153.383 1.00 0.00 ? 101 U A N1     1  
ATOM 3264   C C2     . U A 1 101 ? 107.722 149.521 153.838 1.00 0.00 ? 101 U A C2     1  
ATOM 3265   O O2     . U A 1 101 ? 106.503 149.519 153.882 1.00 0.00 ? 101 U A O2     1  
ATOM 3266   N N3     . U A 1 101 ? 108.461 150.605 154.242 1.00 0.00 ? 101 U A N3     1  
ATOM 3267   C C4     . U A 1 101 ? 109.834 150.724 154.238 1.00 0.00 ? 101 U A C4     1  
ATOM 3268   O O4     . U A 1 101 ? 110.351 151.770 154.635 1.00 0.00 ? 101 U A O4     1  
ATOM 3269   C C5     . U A 1 101 ? 110.532 149.572 153.756 1.00 0.00 ? 101 U A C5     1  
ATOM 3270   C C6     . U A 1 101 ? 109.838 148.502 153.356 1.00 0.00 ? 101 U A C6     1  
ATOM 3271   H "H5'"  . U A 1 101 ? 110.420 144.780 151.463 1.00 0.00 ? 101 U A "H5'"  1  
ATOM 3272   H "H5''" . U A 1 101 ? 110.198 145.386 150.004 1.00 0.00 ? 101 U A "H5''" 1  
ATOM 3273   H "H4'"  . U A 1 101 ? 108.154 145.088 151.131 1.00 0.00 ? 101 U A "H4'"  1  
ATOM 3274   H "H3'"  . U A 1 101 ? 108.754 147.805 150.569 1.00 0.00 ? 101 U A "H3'"  1  
ATOM 3275   H "H2'"  . U A 1 101 ? 106.730 148.410 151.488 1.00 0.00 ? 101 U A "H2'"  1  
ATOM 3276   H "HO2'" . U A 1 101 ? 105.868 146.197 150.613 1.00 0.00 ? 101 U A "HO2'" 1  
ATOM 3277   H "H1'"  . U A 1 101 ? 107.045 147.006 153.616 1.00 0.00 ? 101 U A "H1'"  1  
ATOM 3278   H H3     . U A 1 101 ? 107.957 151.379 154.568 1.00 0.00 ? 101 U A H3     1  
ATOM 3279   H H5     . U A 1 101 ? 111.512 149.569 153.719 1.00 0.00 ? 101 U A H5     1  
ATOM 3280   H H6     . U A 1 101 ? 110.339 147.726 153.028 1.00 0.00 ? 101 U A H6     1  
ATOM 3281   P P      . U A 1 102 ? 108.298 147.260 148.020 1.00 0.00 ? 102 U A P      1  
ATOM 3282   O OP1    . U A 1 102 ? 108.259 146.166 147.017 1.00 0.00 ? 102 U A OP1    1  
ATOM 3283   O OP2    . U A 1 102 ? 109.605 147.729 148.545 1.00 0.00 ? 102 U A OP2    1  
ATOM 3284   O "O5'"  . U A 1 102 ? 107.532 148.516 147.409 1.00 0.00 ? 102 U A "O5'"  1  
ATOM 3285   C "C5'"  . U A 1 102 ? 106.588 149.242 148.182 1.00 0.00 ? 102 U A "C5'"  1  
ATOM 3286   C "C4'"  . U A 1 102 ? 105.418 148.380 148.587 1.00 0.00 ? 102 U A "C4'"  1  
ATOM 3287   O "O4'"  . U A 1 102 ? 104.870 148.868 149.839 1.00 0.00 ? 102 U A "O4'"  1  
ATOM 3288   C "C3'"  . U A 1 102 ? 104.230 148.373 147.636 1.00 0.00 ? 102 U A "C3'"  1  
ATOM 3289   O "O3'"  . U A 1 102 ? 104.405 147.495 146.539 1.00 0.00 ? 102 U A "O3'"  1  
ATOM 3290   C "C2'"  . U A 1 102 ? 103.071 147.986 148.545 1.00 0.00 ? 102 U A "C2'"  1  
ATOM 3291   O "O2'"  . U A 1 102 ? 103.001 146.577 148.717 1.00 0.00 ? 102 U A "O2'"  1  
ATOM 3292   C "C1'"  . U A 1 102 ? 103.492 148.628 149.869 1.00 0.00 ? 102 U A "C1'"  1  
ATOM 3293   N N1     . U A 1 102 ? 102.804 149.919 150.112 1.00 0.00 ? 102 U A N1     1  
ATOM 3294   C C2     . U A 1 102 ? 101.451 149.869 150.394 1.00 0.00 ? 102 U A C2     1  
ATOM 3295   O O2     . U A 1 102 ? 100.820 148.827 150.449 1.00 0.00 ? 102 U A O2     1  
ATOM 3296   N N3     . U A 1 102 ? 100.856 151.087 150.612 1.00 0.00 ? 102 U A N3     1  
ATOM 3297   C C4     . U A 1 102 ? 101.460 152.326 150.577 1.00 0.00 ? 102 U A C4     1  
ATOM 3298   O O4     . U A 1 102 ? 100.786 153.334 150.795 1.00 0.00 ? 102 U A O4     1  
ATOM 3299   C C5     . U A 1 102 ? 102.860 152.301 150.280 1.00 0.00 ? 102 U A C5     1  
ATOM 3300   C C6     . U A 1 102 ? 103.465 151.128 150.064 1.00 0.00 ? 102 U A C6     1  
ATOM 3301   H "H5'"  . U A 1 102 ? 106.259 150.000 147.655 1.00 0.00 ? 102 U A "H5'"  1  
ATOM 3302   H "H5''" . U A 1 102 ? 107.029 149.581 148.989 1.00 0.00 ? 102 U A "H5''" 1  
ATOM 3303   H "H4'"  . U A 1 102 ? 105.726 147.459 148.715 1.00 0.00 ? 102 U A "H4'"  1  
ATOM 3304   H "H3'"  . U A 1 102 ? 104.084 149.281 147.300 1.00 0.00 ? 102 U A "H3'"  1  
ATOM 3305   H "H2'"  . U A 1 102 ? 102.223 148.354 148.221 1.00 0.00 ? 102 U A "H2'"  1  
ATOM 3306   H "HO2'" . U A 1 102 ? 102.237 146.364 149.293 1.00 0.00 ? 102 U A "HO2'" 1  
ATOM 3307   H "H1'"  . U A 1 102 ? 103.294 148.011 150.604 1.00 0.00 ? 102 U A "H1'"  1  
ATOM 3308   H H3     . U A 1 102 ? 99.897  151.075 150.813 1.00 0.00 ? 102 U A H3     1  
ATOM 3309   H H5     . U A 1 102 ? 103.370 153.136 150.235 1.00 0.00 ? 102 U A H5     1  
ATOM 3310   H H6     . U A 1 102 ? 104.422 151.137 149.862 1.00 0.00 ? 102 U A H6     1  
ATOM 3311   P P      . C A 1 103 ? 104.586 148.081 145.054 1.00 0.00 ? 103 C A P      1  
ATOM 3312   O OP1    . C A 1 103 ? 104.227 147.010 144.090 1.00 0.00 ? 103 C A OP1    1  
ATOM 3313   O OP2    . C A 1 103 ? 105.922 148.722 144.972 1.00 0.00 ? 103 C A OP2    1  
ATOM 3314   O "O5'"  . C A 1 103 ? 103.482 149.224 144.952 1.00 0.00 ? 103 C A "O5'"  1  
ATOM 3315   C "C5'"  . C A 1 103 ? 102.156 149.000 145.405 1.00 0.00 ? 103 C A "C5'"  1  
ATOM 3316   C "C4'"  . C A 1 103 ? 101.540 150.257 145.972 1.00 0.00 ? 103 C A "C4'"  1  
ATOM 3317   O "O4'"  . C A 1 103 ? 102.269 150.714 147.138 1.00 0.00 ? 103 C A "O4'"  1  
ATOM 3318   C "C3'"  . C A 1 103 ? 101.542 151.474 145.061 1.00 0.00 ? 103 C A "C3'"  1  
ATOM 3319   O "O3'"  . C A 1 103 ? 100.551 151.409 144.050 1.00 0.00 ? 103 C A "O3'"  1  
ATOM 3320   C "C2'"  . C A 1 103 ? 101.323 152.603 146.050 1.00 0.00 ? 103 C A "C2'"  1  
ATOM 3321   O "O2'"  . C A 1 103 ? 99.968  152.662 146.472 1.00 0.00 ? 103 C A "O2'"  1  
ATOM 3322   C "C1'"  . C A 1 103 ? 102.192 152.140 147.214 1.00 0.00 ? 103 C A "C1'"  1  
ATOM 3323   N N1     . C A 1 103 ? 103.552 152.733 147.172 1.00 0.00 ? 103 C A N1     1  
ATOM 3324   C C2     . C A 1 103 ? 103.715 154.055 147.605 1.00 0.00 ? 103 C A C2     1  
ATOM 3325   O O2     . C A 1 103 ? 102.727 154.687 148.007 1.00 0.00 ? 103 C A O2     1  
ATOM 3326   N N3     . C A 1 103 ? 104.945 154.619 147.576 1.00 0.00 ? 103 C A N3     1  
ATOM 3327   C C4     . C A 1 103 ? 105.991 153.918 147.140 1.00 0.00 ? 103 C A C4     1  
ATOM 3328   N N4     . C A 1 103 ? 107.186 154.515 147.130 1.00 0.00 ? 103 C A N4     1  
ATOM 3329   C C5     . C A 1 103 ? 105.859 152.573 146.693 1.00 0.00 ? 103 C A C5     1  
ATOM 3330   C C6     . C A 1 103 ? 104.638 152.025 146.726 1.00 0.00 ? 103 C A C6     1  
ATOM 3331   H "H5'"  . C A 1 103 ? 102.168 148.309 146.100 1.00 0.00 ? 103 C A "H5'"  1  
ATOM 3332   H "H5''" . C A 1 103 ? 101.610 148.689 144.653 1.00 0.00 ? 103 C A "H5''" 1  
ATOM 3333   H "H4'"  . C A 1 103 ? 100.617 150.054 146.229 1.00 0.00 ? 103 C A "H4'"  1  
ATOM 3334   H "H3'"  . C A 1 103 ? 102.421 151.580 144.641 1.00 0.00 ? 103 C A "H3'"  1  
ATOM 3335   H "H2'"  . C A 1 103 ? 101.627 153.461 145.688 1.00 0.00 ? 103 C A "H2'"  1  
ATOM 3336   H "HO2'" . C A 1 103 ? 99.856  153.416 147.087 1.00 0.00 ? 103 C A "HO2'" 1  
ATOM 3337   H "H1'"  . C A 1 103 ? 101.757 152.383 148.058 1.00 0.00 ? 103 C A "H1'"  1  
ATOM 3338   H H41    . C A 1 103 ? 107.273 155.442 147.437 1.00 0.00 ? 103 C A H41    1  
ATOM 3339   H H42    . C A 1 103 ? 107.974 154.027 146.814 1.00 0.00 ? 103 C A H42    1  
ATOM 3340   H H5     . C A 1 103 ? 106.634 152.066 146.373 1.00 0.00 ? 103 C A H5     1  
ATOM 3341   H H6     . C A 1 103 ? 104.526 151.101 146.423 1.00 0.00 ? 103 C A H6     1  
ATOM 3342   P P      . A A 1 104 ? 100.817 152.075 142.612 1.00 0.00 ? 104 A A P      1  
ATOM 3343   O OP1    . A A 1 104 ? 99.621  151.837 141.766 1.00 0.00 ? 104 A A OP1    1  
ATOM 3344   O OP2    . A A 1 104 ? 102.152 151.629 142.139 1.00 0.00 ? 104 A A OP2    1  
ATOM 3345   O "O5'"  . A A 1 104 ? 100.901 153.636 142.920 1.00 0.00 ? 104 A A "O5'"  1  
ATOM 3346   C "C5'"  . A A 1 104 ? 99.935  154.268 143.747 1.00 0.00 ? 104 A A "C5'"  1  
ATOM 3347   C "C4'"  . A A 1 104 ? 100.350 155.670 144.114 1.00 0.00 ? 104 A A "C4'"  1  
ATOM 3348   O "O4'"  . A A 1 104 ? 101.382 155.627 145.132 1.00 0.00 ? 104 A A "O4'"  1  
ATOM 3349   C "C3'"  . A A 1 104 ? 100.967 156.497 142.996 1.00 0.00 ? 104 A A "C3'"  1  
ATOM 3350   O "O3'"  . A A 1 104 ? 100.003 157.082 142.139 1.00 0.00 ? 104 A A "O3'"  1  
ATOM 3351   C "C2'"  . A A 1 104 ? 101.806 157.514 143.757 1.00 0.00 ? 104 A A "C2'"  1  
ATOM 3352   O "O2'"  . A A 1 104 ? 100.997 158.553 144.290 1.00 0.00 ? 104 A A "O2'"  1  
ATOM 3353   C "C1'"  . A A 1 104 ? 102.341 156.664 144.912 1.00 0.00 ? 104 A A "C1'"  1  
ATOM 3354   N N9     . A A 1 104 ? 103.659 156.074 144.601 1.00 0.00 ? 104 A A N9     1  
ATOM 3355   C C8     . A A 1 104 ? 103.940 154.774 144.254 1.00 0.00 ? 104 A A C8     1  
ATOM 3356   N N7     . A A 1 104 ? 105.212 154.550 144.036 1.00 0.00 ? 104 A A N7     1  
ATOM 3357   C C5     . A A 1 104 ? 105.811 155.784 144.256 1.00 0.00 ? 104 A A C5     1  
ATOM 3358   C C6     . A A 1 104 ? 107.147 156.211 144.189 1.00 0.00 ? 104 A A C6     1  
ATOM 3359   N N6     . A A 1 104 ? 108.165 155.413 143.866 1.00 0.00 ? 104 A A N6     1  
ATOM 3360   N N1     . A A 1 104 ? 107.404 157.508 144.467 1.00 0.00 ? 104 A A N1     1  
ATOM 3361   C C2     . A A 1 104 ? 106.384 158.311 144.789 1.00 0.00 ? 104 A A C2     1  
ATOM 3362   N N3     . A A 1 104 ? 105.086 158.026 144.886 1.00 0.00 ? 104 A A N3     1  
ATOM 3363   C C4     . A A 1 104 ? 104.864 156.730 144.603 1.00 0.00 ? 104 A A C4     1  
ATOM 3364   H "H5'"  . A A 1 104 ? 99.823  153.743 144.568 1.00 0.00 ? 104 A A "H5'"  1  
ATOM 3365   H "H5''" . A A 1 104 ? 99.079  154.301 143.271 1.00 0.00 ? 104 A A "H5''" 1  
ATOM 3366   H "H4'"  . A A 1 104 ? 99.572  156.150 144.468 1.00 0.00 ? 104 A A "H4'"  1  
ATOM 3367   H "H3'"  . A A 1 104 ? 101.562 155.926 142.465 1.00 0.00 ? 104 A A "H3'"  1  
ATOM 3368   H "H2'"  . A A 1 104 ? 102.533 157.869 143.204 1.00 0.00 ? 104 A A "H2'"  1  
ATOM 3369   H "HO2'" . A A 1 104 ? 100.149 158.579 143.801 1.00 0.00 ? 104 A A "HO2'" 1  
ATOM 3370   H "H1'"  . A A 1 104 ? 102.415 157.217 145.718 1.00 0.00 ? 104 A A "H1'"  1  
ATOM 3371   H H8     . A A 1 104 ? 103.251 154.080 144.176 1.00 0.00 ? 104 A A H8     1  
ATOM 3372   H H61    . A A 1 104 ? 109.077 155.769 143.835 1.00 0.00 ? 104 A A H61    1  
ATOM 3373   H H62    . A A 1 104 ? 108.002 154.469 143.661 1.00 0.00 ? 104 A A H62    1  
ATOM 3374   H H2     . A A 1 104 ? 106.624 159.242 144.981 1.00 0.00 ? 104 A A H2     1  
ATOM 3375   P P      . G A 1 105 ? 100.355 157.367 140.598 1.00 0.00 ? 105 G A P      1  
ATOM 3376   O OP1    . G A 1 105 ? 99.097  157.739 139.899 1.00 0.00 ? 105 G A OP1    1  
ATOM 3377   O OP2    . G A 1 105 ? 101.167 156.230 140.094 1.00 0.00 ? 105 G A OP2    1  
ATOM 3378   O "O5'"  . G A 1 105 ? 101.288 158.656 140.647 1.00 0.00 ? 105 G A "O5'"  1  
ATOM 3379   C "C5'"  . G A 1 105 ? 100.772 159.916 141.052 1.00 0.00 ? 105 G A "C5'"  1  
ATOM 3380   C "C4'"  . G A 1 105 ? 101.865 160.946 141.183 1.00 0.00 ? 105 G A "C4'"  1  
ATOM 3381   O "O4'"  . G A 1 105 ? 102.830 160.518 142.180 1.00 0.00 ? 105 G A "O4'"  1  
ATOM 3382   C "C3'"  . G A 1 105 ? 102.704 161.191 139.938 1.00 0.00 ? 105 G A "C3'"  1  
ATOM 3383   O "O3'"  . G A 1 105 ? 102.083 162.070 139.014 1.00 0.00 ? 105 G A "O3'"  1  
ATOM 3384   C "C2'"  . G A 1 105 ? 104.005 161.735 140.515 1.00 0.00 ? 105 G A "C2'"  1  
ATOM 3385   O "O2'"  . G A 1 105 ? 103.875 163.100 140.887 1.00 0.00 ? 105 G A "O2'"  1  
ATOM 3386   C "C1'"  . G A 1 105 ? 104.152 160.889 141.780 1.00 0.00 ? 105 G A "C1'"  1  
ATOM 3387   N N9     . G A 1 105 ? 104.978 159.687 141.555 1.00 0.00 ? 105 G A N9     1  
ATOM 3388   C C8     . G A 1 105 ? 104.544 158.388 141.448 1.00 0.00 ? 105 G A C8     1  
ATOM 3389   N N7     . G A 1 105 ? 105.515 157.537 141.248 1.00 0.00 ? 105 G A N7     1  
ATOM 3390   C C5     . G A 1 105 ? 106.658 158.323 141.220 1.00 0.00 ? 105 G A C5     1  
ATOM 3391   C C6     . G A 1 105 ? 108.018 157.961 141.036 1.00 0.00 ? 105 G A C6     1  
ATOM 3392   O O6     . G A 1 105 ? 108.497 156.836 140.855 1.00 0.00 ? 105 G A O6     1  
ATOM 3393   N N1     . G A 1 105 ? 108.855 159.072 141.080 1.00 0.00 ? 105 G A N1     1  
ATOM 3394   C C2     . G A 1 105 ? 108.439 160.365 141.273 1.00 0.00 ? 105 G A C2     1  
ATOM 3395   N N2     . G A 1 105 ? 109.396 161.305 141.283 1.00 0.00 ? 105 G A N2     1  
ATOM 3396   N N3     . G A 1 105 ? 107.175 160.716 141.447 1.00 0.00 ? 105 G A N3     1  
ATOM 3397   C C4     . G A 1 105 ? 106.346 159.653 141.408 1.00 0.00 ? 105 G A C4     1  
ATOM 3398   H "H5'"  . G A 1 105 ? 100.323 159.816 141.917 1.00 0.00 ? 105 G A "H5'"  1  
ATOM 3399   H "H5''" . G A 1 105 ? 100.122 160.223 140.388 1.00 0.00 ? 105 G A "H5''" 1  
ATOM 3400   H "H4'"  . G A 1 105 ? 101.468 161.797 141.469 1.00 0.00 ? 105 G A "H4'"  1  
ATOM 3401   H "H3'"  . G A 1 105 ? 102.882 160.334 139.498 1.00 0.00 ? 105 G A "H3'"  1  
ATOM 3402   H "H2'"  . G A 1 105 ? 104.756 161.596 139.904 1.00 0.00 ? 105 G A "H2'"  1  
ATOM 3403   H "HO2'" . G A 1 105 ? 104.743 163.428 141.201 1.00 0.00 ? 105 G A "HO2'" 1  
ATOM 3404   H "H1'"  . G A 1 105 ? 104.554 161.434 142.493 1.00 0.00 ? 105 G A "H1'"  1  
ATOM 3405   H H8     . G A 1 105 ? 103.603 158.125 141.515 1.00 0.00 ? 105 G A H8     1  
ATOM 3406   H H1     . G A 1 105 ? 109.815 158.915 140.960 1.00 0.00 ? 105 G A H1     1  
ATOM 3407   H H21    . G A 1 105 ? 110.333 161.054 141.155 1.00 0.00 ? 105 G A H21    1  
ATOM 3408   H H22    . G A 1 105 ? 109.157 162.246 141.419 1.00 0.00 ? 105 G A H22    1  
ATOM 3409   P P      . A A 1 106 ? 102.393 161.939 137.442 1.00 0.00 ? 106 A A P      1  
ATOM 3410   O OP1    . A A 1 106 ? 101.449 162.821 136.713 1.00 0.00 ? 106 A A OP1    1  
ATOM 3411   O OP2    . A A 1 106 ? 102.460 160.496 137.106 1.00 0.00 ? 106 A A OP2    1  
ATOM 3412   O "O5'"  . A A 1 106 ? 103.855 162.550 137.287 1.00 0.00 ? 106 A A "O5'"  1  
ATOM 3413   C "C5'"  . A A 1 106 ? 104.101 163.929 137.527 1.00 0.00 ? 106 A A "C5'"  1  
ATOM 3414   C "C4'"  . A A 1 106 ? 105.570 164.253 137.446 1.00 0.00 ? 106 A A "C4'"  1  
ATOM 3415   O "O4'"  . A A 1 106 ? 106.294 163.520 138.467 1.00 0.00 ? 106 A A "O4'"  1  
ATOM 3416   C "C3'"  . A A 1 106 ? 106.268 163.870 136.151 1.00 0.00 ? 106 A A "C3'"  1  
ATOM 3417   O "O3'"  . A A 1 106 ? 106.080 164.823 135.117 1.00 0.00 ? 106 A A "O3'"  1  
ATOM 3418   C "C2'"  . A A 1 106 ? 107.718 163.717 136.587 1.00 0.00 ? 106 A A "C2'"  1  
ATOM 3419   O "O2'"  . A A 1 106 ? 108.350 164.983 136.726 1.00 0.00 ? 106 A A "O2'"  1  
ATOM 3420   C "C1'"  . A A 1 106 ? 107.555 163.088 137.971 1.00 0.00 ? 106 A A "C1'"  1  
ATOM 3421   N N9     . A A 1 106 ? 107.619 161.615 137.923 1.00 0.00 ? 106 A A N9     1  
ATOM 3422   C C8     . A A 1 106 ? 106.580 160.723 137.997 1.00 0.00 ? 106 A A C8     1  
ATOM 3423   N N7     . A A 1 106 ? 106.953 159.468 137.924 1.00 0.00 ? 106 A A N7     1  
ATOM 3424   C C5     . A A 1 106 ? 108.334 159.538 137.790 1.00 0.00 ? 106 A A C5     1  
ATOM 3425   C C6     . A A 1 106 ? 109.325 158.549 137.665 1.00 0.00 ? 106 A A C6     1  
ATOM 3426   N N6     . A A 1 106 ? 109.066 157.241 137.652 1.00 0.00 ? 106 A A N6     1  
ATOM 3427   N N1     . A A 1 106 ? 110.606 158.956 137.550 1.00 0.00 ? 106 A A N1     1  
ATOM 3428   C C2     . A A 1 106 ? 110.868 160.269 137.564 1.00 0.00 ? 106 A A C2     1  
ATOM 3429   N N3     . A A 1 106 ? 110.022 161.292 137.674 1.00 0.00 ? 106 A A N3     1  
ATOM 3430   C C4     . A A 1 106 ? 108.756 160.855 137.786 1.00 0.00 ? 106 A A C4     1  
ATOM 3431   H "H5'"  . A A 1 106 ? 103.770 164.161 138.422 1.00 0.00 ? 106 A A "H5'"  1  
ATOM 3432   H "H5''" . A A 1 106 ? 103.617 164.460 136.861 1.00 0.00 ? 106 A A "H5''" 1  
ATOM 3433   H "H4'"  . A A 1 106 ? 105.693 165.215 137.599 1.00 0.00 ? 106 A A "H4'"  1  
ATOM 3434   H "H3'"  . A A 1 106 ? 105.931 163.000 135.849 1.00 0.00 ? 106 A A "H3'"  1  
ATOM 3435   H "H2'"  . A A 1 106 ? 108.216 163.130 135.981 1.00 0.00 ? 106 A A "H2'"  1  
ATOM 3436   H "HO2'" . A A 1 106 ? 109.296 164.846 136.940 1.00 0.00 ? 106 A A "HO2'" 1  
ATOM 3437   H "H1'"  . A A 1 106 ? 108.258 163.425 138.567 1.00 0.00 ? 106 A A "H1'"  1  
ATOM 3438   H H8     . A A 1 106 ? 105.644 160.998 138.098 1.00 0.00 ? 106 A A H8     1  
ATOM 3439   H H61    . A A 1 106 ? 109.799 156.597 137.562 1.00 0.00 ? 106 A A H61    1  
ATOM 3440   H H62    . A A 1 106 ? 108.143 156.921 137.734 1.00 0.00 ? 106 A A H62    1  
ATOM 3441   H H2     . A A 1 106 ? 111.812 160.512 137.478 1.00 0.00 ? 106 A A H2     1  
ATOM 3442   P P      . U A 1 107 ? 105.986 164.346 133.586 1.00 0.00 ? 107 U A P      1  
ATOM 3443   O OP1    . U A 1 107 ? 105.671 165.535 132.753 1.00 0.00 ? 107 U A OP1    1  
ATOM 3444   O OP2    . U A 1 107 ? 105.099 163.155 133.529 1.00 0.00 ? 107 U A OP2    1  
ATOM 3445   O "O5'"  . U A 1 107 ? 107.467 163.875 133.235 1.00 0.00 ? 107 U A "O5'"  1  
ATOM 3446   C "C5'"  . U A 1 107 ? 108.543 164.800 133.230 1.00 0.00 ? 107 U A "C5'"  1  
ATOM 3447   C "C4'"  . U A 1 107 ? 109.879 164.101 133.159 1.00 0.00 ? 107 U A "C4'"  1  
ATOM 3448   O "O4'"  . U A 1 107 ? 110.046 163.238 134.315 1.00 0.00 ? 107 U A "O4'"  1  
ATOM 3449   C "C3'"  . U A 1 107 ? 110.087 163.174 131.972 1.00 0.00 ? 107 U A "C3'"  1  
ATOM 3450   O "O3'"  . U A 1 107 ? 110.489 163.858 130.797 1.00 0.00 ? 107 U A "O3'"  1  
ATOM 3451   C "C2'"  . U A 1 107 ? 111.126 162.192 132.494 1.00 0.00 ? 107 U A "C2'"  1  
ATOM 3452   O "O2'"  . U A 1 107 ? 112.430 162.758 132.464 1.00 0.00 ? 107 U A "O2'"  1  
ATOM 3453   C "C1'"  . U A 1 107 ? 110.688 162.031 133.949 1.00 0.00 ? 107 U A "C1'"  1  
ATOM 3454   N N1     . U A 1 107 ? 109.776 160.877 134.138 1.00 0.00 ? 107 U A N1     1  
ATOM 3455   C C2     . U A 1 107 ? 110.348 159.619 134.164 1.00 0.00 ? 107 U A C2     1  
ATOM 3456   O O2     . U A 1 107 ? 111.546 159.428 134.040 1.00 0.00 ? 107 U A O2     1  
ATOM 3457   N N3     . U A 1 107 ? 109.466 158.582 134.341 1.00 0.00 ? 107 U A N3     1  
ATOM 3458   C C4     . U A 1 107 ? 108.100 158.669 134.492 1.00 0.00 ? 107 U A C4     1  
ATOM 3459   O O4     . U A 1 107 ? 107.441 157.637 134.640 1.00 0.00 ? 107 U A O4     1  
ATOM 3460   C C5     . U A 1 107 ? 107.577 160.000 134.456 1.00 0.00 ? 107 U A C5     1  
ATOM 3461   C C6     . U A 1 107 ? 108.415 161.029 134.286 1.00 0.00 ? 107 U A C6     1  
ATOM 3462   H "H5'"  . U A 1 107 ? 108.509 165.336 134.050 1.00 0.00 ? 107 U A "H5'"  1  
ATOM 3463   H "H5''" . U A 1 107 ? 108.453 165.394 132.456 1.00 0.00 ? 107 U A "H5''" 1  
ATOM 3464   H "H4'"  . U A 1 107 ? 110.586 164.778 133.162 1.00 0.00 ? 107 U A "H4'"  1  
ATOM 3465   H "H3'"  . U A 1 107 ? 109.253 162.689 131.792 1.00 0.00 ? 107 U A "H3'"  1  
ATOM 3466   H "H2'"  . U A 1 107 ? 111.090 161.340 132.011 1.00 0.00 ? 107 U A "H2'"  1  
ATOM 3467   H "HO2'" . U A 1 107 ? 112.436 163.509 131.837 1.00 0.00 ? 107 U A "HO2'" 1  
ATOM 3468   H "H1'"  . U A 1 107 ? 111.479 161.913 134.518 1.00 0.00 ? 107 U A "H1'"  1  
ATOM 3469   H H3     . U A 1 107 ? 109.852 157.679 134.360 1.00 0.00 ? 107 U A H3     1  
ATOM 3470   H H5     . U A 1 107 ? 106.615 160.156 134.556 1.00 0.00 ? 107 U A H5     1  
ATOM 3471   H H6     . U A 1 107 ? 108.032 161.930 134.264 1.00 0.00 ? 107 U A H6     1  
ATOM 3472   P P      . G A 1 108 ? 110.740 163.045 129.434 1.00 0.00 ? 108 G A P      1  
ATOM 3473   O OP1    . G A 1 108 ? 110.688 164.010 128.306 1.00 0.00 ? 108 G A OP1    1  
ATOM 3474   O OP2    . G A 1 108 ? 109.840 161.864 129.431 1.00 0.00 ? 108 G A OP2    1  
ATOM 3475   O "O5'"  . G A 1 108 ? 112.239 162.522 129.566 1.00 0.00 ? 108 G A "O5'"  1  
ATOM 3476   C "C5'"  . G A 1 108 ? 112.700 161.425 128.792 1.00 0.00 ? 108 G A "C5'"  1  
ATOM 3477   C "C4'"  . G A 1 108 ? 112.817 160.171 129.622 1.00 0.00 ? 108 G A "C4'"  1  
ATOM 3478   O "O4'"  . G A 1 108 ? 111.588 159.948 130.358 1.00 0.00 ? 108 G A "O4'"  1  
ATOM 3479   C "C3'"  . G A 1 108 ? 113.037 158.878 128.851 1.00 0.00 ? 108 G A "C3'"  1  
ATOM 3480   O "O3'"  . G A 1 108 ? 114.392 158.675 128.487 1.00 0.00 ? 108 G A "O3'"  1  
ATOM 3481   C "C2'"  . G A 1 108 ? 112.536 157.822 129.830 1.00 0.00 ? 108 G A "C2'"  1  
ATOM 3482   O "O2'"  . G A 1 108 ? 113.528 157.501 130.795 1.00 0.00 ? 108 G A "O2'"  1  
ATOM 3483   C "C1'"  . G A 1 108 ? 111.390 158.566 130.525 1.00 0.00 ? 108 G A "C1'"  1  
ATOM 3484   N N9     . G A 1 108 ? 110.073 158.199 129.971 1.00 0.00 ? 108 G A N9     1  
ATOM 3485   C C8     . G A 1 108 ? 109.486 158.686 128.829 1.00 0.00 ? 108 G A C8     1  
ATOM 3486   N N7     . G A 1 108 ? 108.309 158.169 128.596 1.00 0.00 ? 108 G A N7     1  
ATOM 3487   C C5     . G A 1 108 ? 108.107 157.287 129.648 1.00 0.00 ? 108 G A C5     1  
ATOM 3488   C C6     . G A 1 108 ? 107.009 156.436 129.936 1.00 0.00 ? 108 G A C6     1  
ATOM 3489   O O6     . G A 1 108 ? 105.961 156.288 129.297 1.00 0.00 ? 108 G A O6     1  
ATOM 3490   N N1     . G A 1 108 ? 107.217 155.709 131.104 1.00 0.00 ? 108 G A N1     1  
ATOM 3491   C C2     . G A 1 108 ? 108.338 155.789 131.894 1.00 0.00 ? 108 G A C2     1  
ATOM 3492   N N2     . G A 1 108 ? 108.356 155.007 132.984 1.00 0.00 ? 108 G A N2     1  
ATOM 3493   N N3     . G A 1 108 ? 109.368 156.578 131.636 1.00 0.00 ? 108 G A N3     1  
ATOM 3494   C C4     . G A 1 108 ? 109.187 157.293 130.506 1.00 0.00 ? 108 G A C4     1  
ATOM 3495   H "H5'"  . G A 1 108 ? 113.578 161.644 128.417 1.00 0.00 ? 108 G A "H5'"  1  
ATOM 3496   H "H5''" . G A 1 108 ? 112.070 161.265 128.058 1.00 0.00 ? 108 G A "H5''" 1  
ATOM 3497   H "H4'"  . G A 1 108 ? 113.552 160.281 130.261 1.00 0.00 ? 108 G A "H4'"  1  
ATOM 3498   H "H3'"  . G A 1 108 ? 112.465 158.876 128.056 1.00 0.00 ? 108 G A "H3'"  1  
ATOM 3499   H "H2'"  . G A 1 108 ? 112.212 157.023 129.363 1.00 0.00 ? 108 G A "H2'"  1  
ATOM 3500   H "HO2'" . G A 1 108 ? 114.413 157.684 130.415 1.00 0.00 ? 108 G A "HO2'" 1  
ATOM 3501   H "H1'"  . G A 1 108 ? 111.408 158.369 131.485 1.00 0.00 ? 108 G A "H1'"  1  
ATOM 3502   H H8     . G A 1 108 ? 109.905 159.354 128.248 1.00 0.00 ? 108 G A H8     1  
ATOM 3503   H H1     . G A 1 108 ? 106.508 155.092 131.383 1.00 0.00 ? 108 G A H1     1  
ATOM 3504   H H21    . G A 1 108 ? 107.597 154.420 133.181 1.00 0.00 ? 108 G A H21    1  
ATOM 3505   H H22    . G A 1 108 ? 109.130 155.023 133.585 1.00 0.00 ? 108 G A H22    1  
ATOM 3506   P P      . G A 1 109 ? 114.777 158.351 126.960 1.00 0.00 ? 109 G A P      1  
ATOM 3507   O OP1    . G A 1 109 ? 115.910 159.231 126.575 1.00 0.00 ? 109 G A OP1    1  
ATOM 3508   O OP2    . G A 1 109 ? 113.528 158.369 126.157 1.00 0.00 ? 109 G A OP2    1  
ATOM 3509   O "O5'"  . G A 1 109 ? 115.312 156.851 127.007 1.00 0.00 ? 109 G A "O5'"  1  
ATOM 3510   C "C5'"  . G A 1 109 ? 116.553 156.538 127.622 1.00 0.00 ? 109 G A "C5'"  1  
ATOM 3511   C "C4'"  . G A 1 109 ? 116.487 155.231 128.371 1.00 0.00 ? 109 G A "C4'"  1  
ATOM 3512   O "O4'"  . G A 1 109 ? 115.443 155.289 129.376 1.00 0.00 ? 109 G A "O4'"  1  
ATOM 3513   C "C3'"  . G A 1 109 ? 116.120 154.006 127.546 1.00 0.00 ? 109 G A "C3'"  1  
ATOM 3514   O "O3'"  . G A 1 109 ? 117.232 153.435 126.878 1.00 0.00 ? 109 G A "O3'"  1  
ATOM 3515   C "C2'"  . G A 1 109 ? 115.481 153.090 128.581 1.00 0.00 ? 109 G A "C2'"  1  
ATOM 3516   O "O2'"  . G A 1 109 ? 116.466 152.450 129.380 1.00 0.00 ? 109 G A "O2'"  1  
ATOM 3517   C "C1'"  . G A 1 109 ? 114.717 154.098 129.443 1.00 0.00 ? 109 G A "C1'"  1  
ATOM 3518   N N9     . G A 1 109 ? 113.373 154.381 128.906 1.00 0.00 ? 109 G A N9     1  
ATOM 3519   C C8     . G A 1 109 ? 113.064 155.043 127.742 1.00 0.00 ? 109 G A C8     1  
ATOM 3520   N N7     . G A 1 109 ? 111.779 155.141 127.533 1.00 0.00 ? 109 G A N7     1  
ATOM 3521   C C5     . G A 1 109 ? 111.204 154.506 128.624 1.00 0.00 ? 109 G A C5     1  
ATOM 3522   C C6     . G A 1 109 ? 109.839 154.293 128.950 1.00 0.00 ? 109 G A C6     1  
ATOM 3523   O O6     . G A 1 109 ? 108.834 154.638 128.318 1.00 0.00 ? 109 G A O6     1  
ATOM 3524   N N1     . G A 1 109 ? 109.700 153.604 130.151 1.00 0.00 ? 109 G A N1     1  
ATOM 3525   C C2     . G A 1 109 ? 110.741 153.172 130.937 1.00 0.00 ? 109 G A C2     1  
ATOM 3526   N N2     . G A 1 109 ? 110.407 152.522 132.061 1.00 0.00 ? 109 G A N2     1  
ATOM 3527   N N3     . G A 1 109 ? 112.017 153.363 130.644 1.00 0.00 ? 109 G A N3     1  
ATOM 3528   C C4     . G A 1 109 ? 112.173 154.031 129.481 1.00 0.00 ? 109 G A C4     1  
ATOM 3529   H "H5'"  . G A 1 109 ? 116.790 157.254 128.247 1.00 0.00 ? 109 G A "H5'"  1  
ATOM 3530   H "H5''" . G A 1 109 ? 117.246 156.477 126.930 1.00 0.00 ? 109 G A "H5''" 1  
ATOM 3531   H "H4'"  . G A 1 109 ? 117.347 155.077 128.817 1.00 0.00 ? 109 G A "H4'"  1  
ATOM 3532   H "H3'"  . G A 1 109 ? 115.446 154.257 126.881 1.00 0.00 ? 109 G A "H3'"  1  
ATOM 3533   H "H2'"  . G A 1 109 ? 114.876 152.442 128.163 1.00 0.00 ? 109 G A "H2'"  1  
ATOM 3534   H "HO2'" . G A 1 109 ? 117.323 152.470 128.906 1.00 0.00 ? 109 G A "HO2'" 1  
ATOM 3535   H "H1'"  . G A 1 109 ? 114.638 153.753 130.357 1.00 0.00 ? 109 G A "H1'"  1  
ATOM 3536   H H8     . G A 1 109 ? 113.738 155.405 127.131 1.00 0.00 ? 109 G A H8     1  
ATOM 3537   H H1     . G A 1 109 ? 108.789 153.412 130.457 1.00 0.00 ? 109 G A H1     1  
ATOM 3538   H H21    . G A 1 109 ? 109.464 152.376 132.285 1.00 0.00 ? 109 G A H21    1  
ATOM 3539   H H22    . G A 1 109 ? 111.108 152.190 132.662 1.00 0.00 ? 109 G A H22    1  
ATOM 3540   P P      . C A 1 110 ? 117.187 153.235 125.288 1.00 0.00 ? 110 C A P      1  
ATOM 3541   O OP1    . C A 1 110 ? 118.172 154.147 124.653 1.00 0.00 ? 110 C A OP1    1  
ATOM 3542   O OP2    . C A 1 110 ? 115.742 153.389 124.984 1.00 0.00 ? 110 C A OP2    1  
ATOM 3543   O "O5'"  . C A 1 110 ? 117.607 151.739 124.938 1.00 0.00 ? 110 C A "O5'"  1  
ATOM 3544   C "C5'"  . C A 1 110 ? 117.295 151.169 123.676 1.00 0.00 ? 110 C A "C5'"  1  
ATOM 3545   C "C4'"  . C A 1 110 ? 117.898 151.962 122.543 1.00 0.00 ? 110 C A "C4'"  1  
ATOM 3546   O "O4'"  . C A 1 110 ? 118.933 152.843 123.052 1.00 0.00 ? 110 C A "O4'"  1  
ATOM 3547   C "C3'"  . C A 1 110 ? 118.598 151.159 121.458 1.00 0.00 ? 110 C A "C3'"  1  
ATOM 3548   O "O3'"  . C A 1 110 ? 117.699 150.603 120.513 1.00 0.00 ? 110 C A "O3'"  1  
ATOM 3549   C "C2'"  . C A 1 110 ? 119.563 152.173 120.862 1.00 0.00 ? 110 C A "C2'"  1  
ATOM 3550   O "O2'"  . C A 1 110 ? 118.893 153.064 119.982 1.00 0.00 ? 110 C A "O2'"  1  
ATOM 3551   C "C1'"  . C A 1 110 ? 120.005 152.944 122.107 1.00 0.00 ? 110 C A "C1'"  1  
ATOM 3552   N N1     . C A 1 110 ? 121.264 152.410 122.683 1.00 0.00 ? 110 C A N1     1  
ATOM 3553   C C2     . C A 1 110 ? 122.470 152.730 122.049 1.00 0.00 ? 110 C A C2     1  
ATOM 3554   O O2     . C A 1 110 ? 122.453 153.442 121.035 1.00 0.00 ? 110 C A O2     1  
ATOM 3555   N N3     . C A 1 110 ? 123.633 152.256 122.553 1.00 0.00 ? 110 C A N3     1  
ATOM 3556   C C4     . C A 1 110 ? 123.626 151.493 123.647 1.00 0.00 ? 110 C A C4     1  
ATOM 3557   N N4     . C A 1 110 ? 124.797 151.048 124.109 1.00 0.00 ? 110 C A N4     1  
ATOM 3558   C C5     . C A 1 110 ? 122.415 151.148 124.312 1.00 0.00 ? 110 C A C5     1  
ATOM 3559   C C6     . C A 1 110 ? 121.270 151.624 123.805 1.00 0.00 ? 110 C A C6     1  
ATOM 3560   H "H5'"  . C A 1 110 ? 116.321 151.147 123.569 1.00 0.00 ? 110 C A "H5'"  1  
ATOM 3561   H "H5''" . C A 1 110 ? 117.642 150.252 123.644 1.00 0.00 ? 110 C A "H5''" 1  
ATOM 3562   H "H4'"  . C A 1 110 ? 117.194 152.506 122.129 1.00 0.00 ? 110 C A "H4'"  1  
ATOM 3563   H "H3'"  . C A 1 110 ? 119.113 150.436 121.875 1.00 0.00 ? 110 C A "H3'"  1  
ATOM 3564   H "H2'"  . C A 1 110 ? 120.323 151.734 120.424 1.00 0.00 ? 110 C A "H2'"  1  
ATOM 3565   H "HO2'" . C A 1 110 ? 118.048 152.657 119.698 1.00 0.00 ? 110 C A "HO2'" 1  
ATOM 3566   H "H1'"  . C A 1 110 ? 120.126 153.891 121.879 1.00 0.00 ? 110 C A "H1'"  1  
ATOM 3567   H H41    . C A 1 110 ? 125.627 151.284 123.648 1.00 0.00 ? 110 C A H41    1  
ATOM 3568   H H42    . C A 1 110 ? 124.824 150.484 124.910 1.00 0.00 ? 110 C A H42    1  
ATOM 3569   H H5     . C A 1 110 ? 122.419 150.586 125.116 1.00 0.00 ? 110 C A H5     1  
ATOM 3570   H H6     . C A 1 110 ? 120.428 151.399 124.249 1.00 0.00 ? 110 C A H6     1  
ATOM 3571   P P      . C A 1 111 ? 118.097 149.268 119.709 1.00 0.00 ? 111 C A P      1  
ATOM 3572   O OP1    . C A 1 111 ? 116.942 148.885 118.857 1.00 0.00 ? 111 C A OP1    1  
ATOM 3573   O OP2    . C A 1 111 ? 118.649 148.291 120.679 1.00 0.00 ? 111 C A OP2    1  
ATOM 3574   O "O5'"  . C A 1 111 ? 119.282 149.734 118.750 1.00 0.00 ? 111 C A "O5'"  1  
ATOM 3575   C "C5'"  . C A 1 111 ? 119.022 150.533 117.603 1.00 0.00 ? 111 C A "C5'"  1  
ATOM 3576   C "C4'"  . C A 1 111 ? 120.289 150.852 116.849 1.00 0.00 ? 111 C A "C4'"  1  
ATOM 3577   O "O4'"  . C A 1 111 ? 121.209 151.574 117.707 1.00 0.00 ? 111 C A "O4'"  1  
ATOM 3578   C "C3'"  . C A 1 111 ? 121.098 149.658 116.363 1.00 0.00 ? 111 C A "C3'"  1  
ATOM 3579   O "O3'"  . C A 1 111 ? 120.575 149.080 115.178 1.00 0.00 ? 111 C A "O3'"  1  
ATOM 3580   C "C2'"  . C A 1 111 ? 122.490 150.246 116.193 1.00 0.00 ? 111 C A "C2'"  1  
ATOM 3581   O "O2'"  . C A 1 111 ? 122.590 150.999 114.992 1.00 0.00 ? 111 C A "O2'"  1  
ATOM 3582   C "C1'"  . C A 1 111 ? 122.565 151.201 117.386 1.00 0.00 ? 111 C A "C1'"  1  
ATOM 3583   N N1     . C A 1 111 ? 123.237 150.586 118.556 1.00 0.00 ? 111 C A N1     1  
ATOM 3584   C C2     . C A 1 111 ? 124.634 150.495 118.549 1.00 0.00 ? 111 C A C2     1  
ATOM 3585   O O2     . C A 1 111 ? 125.266 150.924 117.571 1.00 0.00 ? 111 C A O2     1  
ATOM 3586   N N3     . C A 1 111 ? 125.273 149.937 119.605 1.00 0.00 ? 111 C A N3     1  
ATOM 3587   C C4     . C A 1 111 ? 124.572 149.484 120.645 1.00 0.00 ? 111 C A C4     1  
ATOM 3588   N N4     . C A 1 111 ? 125.245 148.943 121.664 1.00 0.00 ? 111 C A N4     1  
ATOM 3589   C C5     . C A 1 111 ? 123.151 149.562 120.683 1.00 0.00 ? 111 C A C5     1  
ATOM 3590   C C6     . C A 1 111 ? 122.531 150.114 119.634 1.00 0.00 ? 111 C A C6     1  
ATOM 3591   H "H5'"  . C A 1 111 ? 118.600 151.372 117.889 1.00 0.00 ? 111 C A "H5'"  1  
ATOM 3592   H "H5''" . C A 1 111 ? 118.408 150.052 117.011 1.00 0.00 ? 111 C A "H5''" 1  
ATOM 3593   H "H4'"  . C A 1 111 ? 120.063 151.415 116.081 1.00 0.00 ? 111 C A "H4'"  1  
ATOM 3594   H "H3'"  . C A 1 111 ? 121.120 148.976 117.067 1.00 0.00 ? 111 C A "H3'"  1  
ATOM 3595   H "H2'"  . C A 1 111 ? 123.182 149.554 116.245 1.00 0.00 ? 111 C A "H2'"  1  
ATOM 3596   H "HO2'" . C A 1 111 ? 121.872 150.727 114.385 1.00 0.00 ? 111 C A "HO2'" 1  
ATOM 3597   H "H1'"  . C A 1 111 ? 123.047 152.013 117.125 1.00 0.00 ? 111 C A "H1'"  1  
ATOM 3598   H H41    . C A 1 111 ? 126.223 148.889 121.634 1.00 0.00 ? 111 C A H41    1  
ATOM 3599   H H42    . C A 1 111 ? 124.758 148.599 122.442 1.00 0.00 ? 111 C A H42    1  
ATOM 3600   H H5     . C A 1 111 ? 122.647 149.227 121.452 1.00 0.00 ? 111 C A H5     1  
ATOM 3601   H H6     . C A 1 111 ? 121.555 150.178 119.643 1.00 0.00 ? 111 C A H6     1  
ATOM 3602   P P      . U A 1 112 ? 120.842 147.530 114.848 1.00 0.00 ? 112 U A P      1  
ATOM 3603   O OP1    . U A 1 112 ? 120.073 147.179 113.627 1.00 0.00 ? 112 U A OP1    1  
ATOM 3604   O OP2    . U A 1 112 ? 120.629 146.753 116.097 1.00 0.00 ? 112 U A OP2    1  
ATOM 3605   O "O5'"  . U A 1 112 ? 122.390 147.472 114.489 1.00 0.00 ? 112 U A "O5'"  1  
ATOM 3606   C "C5'"  . U A 1 112 ? 122.899 148.131 113.339 1.00 0.00 ? 112 U A "C5'"  1  
ATOM 3607   C "C4'"  . U A 1 112 ? 124.404 148.070 113.278 1.00 0.00 ? 112 U A "C4'"  1  
ATOM 3608   O "O4'"  . U A 1 112 ? 124.976 148.739 114.433 1.00 0.00 ? 112 U A "O4'"  1  
ATOM 3609   C "C3'"  . U A 1 112 ? 125.019 146.678 113.316 1.00 0.00 ? 112 U A "C3'"  1  
ATOM 3610   O "O3'"  . U A 1 112 ? 124.967 146.014 112.065 1.00 0.00 ? 112 U A "O3'"  1  
ATOM 3611   C "C2'"  . U A 1 112 ? 126.435 146.953 113.804 1.00 0.00 ? 112 U A "C2'"  1  
ATOM 3612   O "O2'"  . U A 1 112 ? 127.251 147.459 112.756 1.00 0.00 ? 112 U A "O2'"  1  
ATOM 3613   C "C1'"  . U A 1 112 ? 126.194 148.067 114.825 1.00 0.00 ? 112 U A "C1'"  1  
ATOM 3614   N N1     . U A 1 112 ? 126.098 147.547 116.211 1.00 0.00 ? 112 U A N1     1  
ATOM 3615   C C2     . U A 1 112 ? 127.281 147.228 116.849 1.00 0.00 ? 112 U A C2     1  
ATOM 3616   O O2     . U A 1 112 ? 128.375 147.355 116.326 1.00 0.00 ? 112 U A O2     1  
ATOM 3617   N N3     . U A 1 112 ? 127.143 146.751 118.130 1.00 0.00 ? 112 U A N3     1  
ATOM 3618   C C4     . U A 1 112 ? 125.969 146.564 118.826 1.00 0.00 ? 112 U A C4     1  
ATOM 3619   O O4     . U A 1 112 ? 126.010 146.124 119.975 1.00 0.00 ? 112 U A O4     1  
ATOM 3620   C C5     . U A 1 112 ? 124.783 146.916 118.103 1.00 0.00 ? 112 U A C5     1  
ATOM 3621   C C6     . U A 1 112 ? 124.890 147.384 116.855 1.00 0.00 ? 112 U A C6     1  
ATOM 3622   H "H5'"  . U A 1 112 ? 122.619 149.073 113.360 1.00 0.00 ? 112 U A "H5'"  1  
ATOM 3623   H "H5''" . U A 1 112 ? 122.529 147.707 112.536 1.00 0.00 ? 112 U A "H5''" 1  
ATOM 3624   H "H4'"  . U A 1 112 ? 124.709 148.526 112.466 1.00 0.00 ? 112 U A "H4'"  1  
ATOM 3625   H "H3'"  . U A 1 112 ? 124.551 146.137 113.988 1.00 0.00 ? 112 U A "H3'"  1  
ATOM 3626   H "H2'"  . U A 1 112 ? 126.832 146.162 114.225 1.00 0.00 ? 112 U A "H2'"  1  
ATOM 3627   H "HO2'" . U A 1 112 ? 126.844 147.227 111.896 1.00 0.00 ? 112 U A "HO2'" 1  
ATOM 3628   H "H1'"  . U A 1 112 ? 126.925 148.719 114.775 1.00 0.00 ? 112 U A "H1'"  1  
ATOM 3629   H H3     . U A 1 112 ? 127.972 146.518 118.600 1.00 0.00 ? 112 U A H3     1  
ATOM 3630   H H5     . U A 1 112 ? 123.903 146.817 118.522 1.00 0.00 ? 112 U A H5     1  
ATOM 3631   H H6     . U A 1 112 ? 124.064 147.616 116.383 1.00 0.00 ? 112 U A H6     1  
ATOM 3632   P P      . C A 1 113 ? 124.165 144.636 111.933 1.00 0.00 ? 113 C A P      1  
ATOM 3633   O OP1    . C A 1 113 ? 124.525 143.983 110.648 1.00 0.00 ? 113 C A OP1    1  
ATOM 3634   O OP2    . C A 1 113 ? 122.761 145.055 112.174 1.00 0.00 ? 113 C A OP2    1  
ATOM 3635   O "O5'"  . C A 1 113 ? 124.601 143.664 113.117 1.00 0.00 ? 113 C A "O5'"  1  
ATOM 3636   C "C5'"  . C A 1 113 ? 125.239 142.425 112.847 1.00 0.00 ? 113 C A "C5'"  1  
ATOM 3637   C "C4'"  . C A 1 113 ? 124.448 141.260 113.391 1.00 0.00 ? 113 C A "C4'"  1  
ATOM 3638   O "O4'"  . C A 1 113 ? 125.186 140.023 113.200 1.00 0.00 ? 113 C A "O4'"  1  
ATOM 3639   C "C3'"  . C A 1 113 ? 124.202 141.259 114.891 1.00 0.00 ? 113 C A "C3'"  1  
ATOM 3640   O "O3'"  . C A 1 113 ? 123.193 142.172 115.286 1.00 0.00 ? 113 C A "O3'"  1  
ATOM 3641   C "C2'"  . C A 1 113 ? 123.840 139.810 115.133 1.00 0.00 ? 113 C A "C2'"  1  
ATOM 3642   O "O2'"  . C A 1 113 ? 122.518 139.530 114.695 1.00 0.00 ? 113 C A "O2'"  1  
ATOM 3643   C "C1'"  . C A 1 113 ? 124.843 139.122 114.208 1.00 0.00 ? 113 C A "C1'"  1  
ATOM 3644   N N1     . C A 1 113 ? 126.081 138.719 114.919 1.00 0.00 ? 113 C A N1     1  
ATOM 3645   C C2     . C A 1 113 ? 126.055 137.553 115.693 1.00 0.00 ? 113 C A C2     1  
ATOM 3646   O O2     . C A 1 113 ? 125.005 136.895 115.762 1.00 0.00 ? 113 C A O2     1  
ATOM 3647   N N3     . C A 1 113 ? 127.170 137.164 116.352 1.00 0.00 ? 113 C A N3     1  
ATOM 3648   C C4     . C A 1 113 ? 128.286 137.888 116.262 1.00 0.00 ? 113 C A C4     1  
ATOM 3649   N N4     . C A 1 113 ? 129.363 137.466 116.929 1.00 0.00 ? 113 C A N4     1  
ATOM 3650   C C5     . C A 1 113 ? 128.346 139.079 115.484 1.00 0.00 ? 113 C A C5     1  
ATOM 3651   C C6     . C A 1 113 ? 127.236 139.453 114.836 1.00 0.00 ? 113 C A C6     1  
ATOM 3652   H "H5'"  . C A 1 113 ? 126.128 142.428 113.260 1.00 0.00 ? 113 C A "H5'"  1  
ATOM 3653   H "H5''" . C A 1 113 ? 125.336 142.321 111.878 1.00 0.00 ? 113 C A "H5''" 1  
ATOM 3654   H "H4'"  . C A 1 113 ? 123.587 141.205 112.928 1.00 0.00 ? 113 C A "H4'"  1  
ATOM 3655   H "H3'"  . C A 1 113 ? 125.029 141.466 115.374 1.00 0.00 ? 113 C A "H3'"  1  
ATOM 3656   H "H2'"  . C A 1 113 ? 123.971 139.559 116.070 1.00 0.00 ? 113 C A "H2'"  1  
ATOM 3657   H "HO2'" . C A 1 113 ? 121.994 140.357 114.712 1.00 0.00 ? 113 C A "HO2'" 1  
ATOM 3658   H "H1'"  . C A 1 113 ? 124.424 138.330 113.810 1.00 0.00 ? 113 C A "H1'"  1  
ATOM 3659   H H41    . C A 1 113 ? 129.318 136.646 117.464 1.00 0.00 ? 113 C A H41    1  
ATOM 3660   H H42    . C A 1 113 ? 130.198 137.976 116.883 1.00 0.00 ? 113 C A H42    1  
ATOM 3661   H H5     . C A 1 113 ? 129.170 139.605 115.424 1.00 0.00 ? 113 C A H5     1  
ATOM 3662   H H6     . C A 1 113 ? 127.257 140.270 114.296 1.00 0.00 ? 113 C A H6     1  
ATOM 3663   P P      . G A 1 114 ? 123.294 142.926 116.702 1.00 0.00 ? 114 G A P      1  
ATOM 3664   O OP1    . G A 1 114 ? 122.041 143.697 116.904 1.00 0.00 ? 114 G A OP1    1  
ATOM 3665   O OP2    . G A 1 114 ? 124.603 143.626 116.757 1.00 0.00 ? 114 G A OP2    1  
ATOM 3666   O "O5'"  . G A 1 114 ? 123.323 141.744 117.768 1.00 0.00 ? 114 G A "O5'"  1  
ATOM 3667   C "C5'"  . G A 1 114 ? 122.202 141.486 118.600 1.00 0.00 ? 114 G A "C5'"  1  
ATOM 3668   C "C4'"  . G A 1 114 ? 122.609 140.798 119.880 1.00 0.00 ? 114 G A "C4'"  1  
ATOM 3669   O "O4'"  . G A 1 114 ? 123.387 139.613 119.576 1.00 0.00 ? 114 G A "O4'"  1  
ATOM 3670   C "C3'"  . G A 1 114 ? 123.503 141.601 120.813 1.00 0.00 ? 114 G A "C3'"  1  
ATOM 3671   O "O3'"  . G A 1 114 ? 122.783 142.522 121.615 1.00 0.00 ? 114 G A "O3'"  1  
ATOM 3672   C "C2'"  . G A 1 114 ? 124.207 140.514 121.614 1.00 0.00 ? 114 G A "C2'"  1  
ATOM 3673   O "O2'"  . G A 1 114 ? 123.358 139.987 122.624 1.00 0.00 ? 114 G A "O2'"  1  
ATOM 3674   C "C1'"  . G A 1 114 ? 124.432 139.445 120.544 1.00 0.00 ? 114 G A "C1'"  1  
ATOM 3675   N N9     . G A 1 114 ? 125.757 139.565 119.907 1.00 0.00 ? 114 G A N9     1  
ATOM 3676   C C8     . G A 1 114 ? 126.032 140.013 118.638 1.00 0.00 ? 114 G A C8     1  
ATOM 3677   N N7     . G A 1 114 ? 127.307 140.004 118.355 1.00 0.00 ? 114 G A N7     1  
ATOM 3678   C C5     . G A 1 114 ? 127.911 139.522 119.509 1.00 0.00 ? 114 G A C5     1  
ATOM 3679   C C6     . G A 1 114 ? 129.280 139.293 119.802 1.00 0.00 ? 114 G A C6     1  
ATOM 3680   O O6     . G A 1 114 ? 130.264 139.476 119.078 1.00 0.00 ? 114 G A O6     1  
ATOM 3681   N N1     . G A 1 114 ? 129.451 138.797 121.091 1.00 0.00 ? 114 G A N1     1  
ATOM 3682   C C2     . G A 1 114 ? 128.437 138.555 121.984 1.00 0.00 ? 114 G A C2     1  
ATOM 3683   N N2     . G A 1 114 ? 128.800 138.076 123.184 1.00 0.00 ? 114 G A N2     1  
ATOM 3684   N N3     . G A 1 114 ? 127.156 138.765 121.722 1.00 0.00 ? 114 G A N3     1  
ATOM 3685   C C4     . G A 1 114 ? 126.968 139.246 120.477 1.00 0.00 ? 114 G A C4     1  
ATOM 3686   H "H5'"  . G A 1 114 ? 121.570 140.914 118.117 1.00 0.00 ? 114 G A "H5'"  1  
ATOM 3687   H "H5''" . G A 1 114 ? 121.763 142.335 118.819 1.00 0.00 ? 114 G A "H5''" 1  
ATOM 3688   H "H4'"  . G A 1 114 ? 121.800 140.532 120.368 1.00 0.00 ? 114 G A "H4'"  1  
ATOM 3689   H "H3'"  . G A 1 114 ? 124.167 142.087 120.282 1.00 0.00 ? 114 G A "H3'"  1  
ATOM 3690   H "H2'"  . G A 1 114 ? 125.057 140.833 121.984 1.00 0.00 ? 114 G A "H2'"  1  
ATOM 3691   H "HO2'" . G A 1 114 ? 122.639 140.626 122.805 1.00 0.00 ? 114 G A "HO2'" 1  
ATOM 3692   H "H1'"  . G A 1 114 ? 124.343 138.556 120.947 1.00 0.00 ? 114 G A "H1'"  1  
ATOM 3693   H H8     . G A 1 114 ? 125.344 140.309 118.008 1.00 0.00 ? 114 G A H8     1  
ATOM 3694   H H1     . G A 1 114 ? 130.368 138.608 121.382 1.00 0.00 ? 114 G A H1     1  
ATOM 3695   H H21    . G A 1 114 ? 129.745 137.919 123.385 1.00 0.00 ? 114 G A H21    1  
ATOM 3696   H H22    . G A 1 114 ? 128.118 137.884 123.861 1.00 0.00 ? 114 G A H22    1  
ATOM 3697   P P      . C A 1 115 ? 123.483 143.885 122.101 1.00 0.00 ? 115 C A P      1  
ATOM 3698   O OP1    . C A 1 115 ? 122.441 144.736 122.731 1.00 0.00 ? 115 C A OP1    1  
ATOM 3699   O OP2    . C A 1 115 ? 124.284 144.421 120.973 1.00 0.00 ? 115 C A OP2    1  
ATOM 3700   O "O5'"  . C A 1 115 ? 124.489 143.418 123.243 1.00 0.00 ? 115 C A "O5'"  1  
ATOM 3701   C "C5'"  . C A 1 115 ? 124.008 142.872 124.463 1.00 0.00 ? 115 C A "C5'"  1  
ATOM 3702   C "C4'"  . C A 1 115 ? 125.135 142.359 125.326 1.00 0.00 ? 115 C A "C4'"  1  
ATOM 3703   O "O4'"  . C A 1 115 ? 125.838 141.295 124.636 1.00 0.00 ? 115 C A "O4'"  1  
ATOM 3704   C "C3'"  . C A 1 115 ? 126.224 143.361 125.674 1.00 0.00 ? 115 C A "C3'"  1  
ATOM 3705   O "O3'"  . C A 1 115 ? 125.878 144.203 126.760 1.00 0.00 ? 115 C A "O3'"  1  
ATOM 3706   C "C2'"  . C A 1 115 ? 127.422 142.464 125.955 1.00 0.00 ? 115 C A "C2'"  1  
ATOM 3707   O "O2'"  . C A 1 115 ? 127.337 141.880 127.247 1.00 0.00 ? 115 C A "O2'"  1  
ATOM 3708   C "C1'"  . C A 1 115 ? 127.238 141.370 124.902 1.00 0.00 ? 115 C A "C1'"  1  
ATOM 3709   N N1     . C A 1 115 ? 127.993 141.654 123.657 1.00 0.00 ? 115 C A N1     1  
ATOM 3710   C C2     . C A 1 115 ? 129.375 141.431 123.651 1.00 0.00 ? 115 C A C2     1  
ATOM 3711   O O2     . C A 1 115 ? 129.924 141.008 124.680 1.00 0.00 ? 115 C A O2     1  
ATOM 3712   N N3     . C A 1 115 ? 130.086 141.681 122.528 1.00 0.00 ? 115 C A N3     1  
ATOM 3713   C C4     . C A 1 115 ? 129.473 142.137 121.436 1.00 0.00 ? 115 C A C4     1  
ATOM 3714   N N4     . C A 1 115 ? 130.214 142.371 120.350 1.00 0.00 ? 115 C A N4     1  
ATOM 3715   C C5     . C A 1 115 ? 128.069 142.374 121.409 1.00 0.00 ? 115 C A C5     1  
ATOM 3716   C C6     . C A 1 115 ? 127.375 142.122 122.526 1.00 0.00 ? 115 C A C6     1  
ATOM 3717   H "H5'"  . C A 1 115 ? 123.395 142.135 124.263 1.00 0.00 ? 115 C A "H5'"  1  
ATOM 3718   H "H5''" . C A 1 115 ? 123.522 143.568 124.954 1.00 0.00 ? 115 C A "H5''" 1  
ATOM 3719   H "H4'"  . C A 1 115 ? 124.755 142.002 126.159 1.00 0.00 ? 115 C A "H4'"  1  
ATOM 3720   H "H3'"  . C A 1 115 ? 126.415 143.914 124.886 1.00 0.00 ? 115 C A "H3'"  1  
ATOM 3721   H "H2'"  . C A 1 115 ? 128.268 142.944 125.830 1.00 0.00 ? 115 C A "H2'"  1  
ATOM 3722   H "HO2'" . C A 1 115 ? 128.152 141.365 127.418 1.00 0.00 ? 115 C A "HO2'" 1  
ATOM 3723   H "H1'"  . C A 1 115 ? 127.532 140.511 125.271 1.00 0.00 ? 115 C A "H1'"  1  
ATOM 3724   H H41    . C A 1 115 ? 131.180 142.207 120.374 1.00 0.00 ? 115 C A H41    1  
ATOM 3725   H H42    . C A 1 115 ? 129.794 142.706 119.533 1.00 0.00 ? 115 C A H42    1  
ATOM 3726   H H5     . C A 1 115 ? 127.627 142.708 120.601 1.00 0.00 ? 115 C A H5     1  
ATOM 3727   H H6     . C A 1 115 ? 126.410 142.278 122.526 1.00 0.00 ? 115 C A H6     1  
ATOM 3728   P P      . A A 1 116 ? 126.900 145.337 127.244 1.00 0.00 ? 116 A A P      1  
ATOM 3729   O OP1    . A A 1 116 ? 128.269 144.765 127.292 1.00 0.00 ? 116 A A OP1    1  
ATOM 3730   O OP2    . A A 1 116 ? 126.267 145.833 128.492 1.00 0.00 ? 116 A A OP2    1  
ATOM 3731   O "O5'"  . A A 1 116 ? 126.899 146.527 126.185 1.00 0.00 ? 116 A A "O5'"  1  
ATOM 3732   C "C5'"  . A A 1 116 ? 126.157 147.714 126.423 1.00 0.00 ? 116 A A "C5'"  1  
ATOM 3733   C "C4'"  . A A 1 116 ? 127.060 148.873 126.766 1.00 0.00 ? 116 A A "C4'"  1  
ATOM 3734   O "O4'"  . A A 1 116 ? 126.453 150.109 126.284 1.00 0.00 ? 116 A A "O4'"  1  
ATOM 3735   C "C3'"  . A A 1 116 ? 127.342 149.084 128.246 1.00 0.00 ? 116 A A "C3'"  1  
ATOM 3736   O "O3'"  . A A 1 116 ? 128.676 149.482 128.505 1.00 0.00 ? 116 A A "O3'"  1  
ATOM 3737   C "C2'"  . A A 1 116 ? 126.429 150.252 128.594 1.00 0.00 ? 116 A A "C2'"  1  
ATOM 3738   O "O2'"  . A A 1 116 ? 126.955 151.012 129.673 1.00 0.00 ? 116 A A "O2'"  1  
ATOM 3739   C "C1'"  . A A 1 116 ? 126.514 151.072 127.316 1.00 0.00 ? 116 A A "C1'"  1  
ATOM 3740   N N9     . A A 1 116 ? 125.386 152.013 127.183 1.00 0.00 ? 116 A A N9     1  
ATOM 3741   C C8     . A A 1 116 ? 124.044 151.724 127.163 1.00 0.00 ? 116 A A C8     1  
ATOM 3742   N N7     . A A 1 116 ? 123.278 152.779 127.032 1.00 0.00 ? 116 A A N7     1  
ATOM 3743   C C5     . A A 1 116 ? 124.176 153.835 126.960 1.00 0.00 ? 116 A A C5     1  
ATOM 3744   C C6     . A A 1 116 ? 123.997 155.223 126.816 1.00 0.00 ? 116 A A C6     1  
ATOM 3745   N N6     . A A 1 116 ? 122.802 155.808 126.716 1.00 0.00 ? 116 A A N6     1  
ATOM 3746   N N1     . A A 1 116 ? 125.102 155.998 126.779 1.00 0.00 ? 116 A A N1     1  
ATOM 3747   C C2     . A A 1 116 ? 126.302 155.411 126.880 1.00 0.00 ? 116 A A C2     1  
ATOM 3748   N N3     . A A 1 116 ? 126.598 154.121 127.018 1.00 0.00 ? 116 A A N3     1  
ATOM 3749   C C4     . A A 1 116 ? 125.477 153.377 127.052 1.00 0.00 ? 116 A A C4     1  
ATOM 3750   H "H5'"  . A A 1 116 ? 125.538 147.561 127.167 1.00 0.00 ? 116 A A "H5'"  1  
ATOM 3751   H "H5''" . A A 1 116 ? 125.642 147.937 125.620 1.00 0.00 ? 116 A A "H5''" 1  
ATOM 3752   H "H4'"  . A A 1 116 ? 127.911 148.750 126.296 1.00 0.00 ? 116 A A "H4'"  1  
ATOM 3753   H "H3'"  . A A 1 116 ? 127.136 148.285 128.777 1.00 0.00 ? 116 A A "H3'"  1  
ATOM 3754   H "H2'"  . A A 1 116 ? 125.513 149.952 128.773 1.00 0.00 ? 116 A A "H2'"  1  
ATOM 3755   H "HO2'" . A A 1 116 ? 126.219 151.277 130.263 1.00 0.00 ? 116 A A "HO2'" 1  
ATOM 3756   H "H1'"  . A A 1 116 ? 127.359 151.570 127.304 1.00 0.00 ? 116 A A "H1'"  1  
ATOM 3757   H H8     . A A 1 116 ? 123.691 150.813 127.241 1.00 0.00 ? 116 A A H8     1  
ATOM 3758   H H61    . A A 1 116 ? 122.740 156.782 126.617 1.00 0.00 ? 116 A A H61    1  
ATOM 3759   H H62    . A A 1 116 ? 121.986 155.266 126.740 1.00 0.00 ? 116 A A H62    1  
ATOM 3760   H H2     . A A 1 116 ? 127.071 156.018 126.847 1.00 0.00 ? 116 A A H2     1  
ATOM 3761   P P      . A A 1 117 ? 129.612 148.597 129.466 1.00 0.00 ? 117 A A P      1  
ATOM 3762   O OP1    . A A 1 117 ? 128.804 147.461 129.977 1.00 0.00 ? 117 A A OP1    1  
ATOM 3763   O OP2    . A A 1 117 ? 130.283 149.511 130.425 1.00 0.00 ? 117 A A OP2    1  
ATOM 3764   O "O5'"  . A A 1 117 ? 130.724 148.010 128.487 1.00 0.00 ? 117 A A "O5'"  1  
ATOM 3765   C "C5'"  . A A 1 117 ? 130.431 146.924 127.620 1.00 0.00 ? 117 A A "C5'"  1  
ATOM 3766   C "C4'"  . A A 1 117 ? 131.335 146.920 126.412 1.00 0.00 ? 117 A A "C4'"  1  
ATOM 3767   O "O4'"  . A A 1 117 ? 131.060 148.087 125.570 1.00 0.00 ? 117 A A "O4'"  1  
ATOM 3768   C "C3'"  . A A 1 117 ? 132.829 146.923 126.698 1.00 0.00 ? 117 A A "C3'"  1  
ATOM 3769   O "O3'"  . A A 1 117 ? 133.590 146.298 125.678 1.00 0.00 ? 117 A A "O3'"  1  
ATOM 3770   C "C2'"  . A A 1 117 ? 133.172 148.410 126.658 1.00 0.00 ? 117 A A "C2'"  1  
ATOM 3771   O "O2'"  . A A 1 117 ? 134.517 148.618 126.254 1.00 0.00 ? 117 A A "O2'"  1  
ATOM 3772   C "C1'"  . A A 1 117 ? 132.240 148.894 125.558 1.00 0.00 ? 117 A A "C1'"  1  
ATOM 3773   N N9     . A A 1 117 ? 131.787 150.281 125.782 1.00 0.00 ? 117 A A N9     1  
ATOM 3774   C C8     . A A 1 117 ? 131.283 150.827 126.936 1.00 0.00 ? 117 A A C8     1  
ATOM 3775   N N7     . A A 1 117 ? 130.966 152.094 126.826 1.00 0.00 ? 117 A A N7     1  
ATOM 3776   C C5     . A A 1 117 ? 131.283 152.404 125.511 1.00 0.00 ? 117 A A C5     1  
ATOM 3777   C C6     . A A 1 117 ? 131.181 153.592 124.766 1.00 0.00 ? 117 A A C6     1  
ATOM 3778   N N6     . A A 1 117 ? 130.712 154.739 125.263 1.00 0.00 ? 117 A A N6     1  
ATOM 3779   N N1     . A A 1 117 ? 131.584 153.563 123.478 1.00 0.00 ? 117 A A N1     1  
ATOM 3780   C C2     . A A 1 117 ? 132.056 152.413 122.979 1.00 0.00 ? 117 A A C2     1  
ATOM 3781   N N3     . A A 1 117 ? 132.199 151.233 123.577 1.00 0.00 ? 117 A A N3     1  
ATOM 3782   C C4     . A A 1 117 ? 131.790 151.296 124.857 1.00 0.00 ? 117 A A C4     1  
ATOM 3783   H "H5'"  . A A 1 117 ? 129.500 146.994 127.321 1.00 0.00 ? 117 A A "H5'"  1  
ATOM 3784   H "H5''" . A A 1 117 ? 130.547 146.083 128.109 1.00 0.00 ? 117 A A "H5''" 1  
ATOM 3785   H "H4'"  . A A 1 117 ? 131.113 146.119 125.893 1.00 0.00 ? 117 A A "H4'"  1  
ATOM 3786   H "H3'"  . A A 1 117 ? 133.047 146.510 127.560 1.00 0.00 ? 117 A A "H3'"  1  
ATOM 3787   H "H2'"  . A A 1 117 ? 132.978 148.846 127.514 1.00 0.00 ? 117 A A "H2'"  1  
ATOM 3788   H "HO2'" . A A 1 117 ? 134.700 149.581 126.241 1.00 0.00 ? 117 A A "HO2'" 1  
ATOM 3789   H "H1'"  . A A 1 117 ? 132.699 148.836 124.693 1.00 0.00 ? 117 A A "H1'"  1  
ATOM 3790   H H8     . A A 1 117 ? 131.170 150.318 127.766 1.00 0.00 ? 117 A A H8     1  
ATOM 3791   H H61    . A A 1 117 ? 130.665 155.536 124.695 1.00 0.00 ? 117 A A H61    1  
ATOM 3792   H H62    . A A 1 117 ? 130.414 154.784 126.196 1.00 0.00 ? 117 A A H62    1  
ATOM 3793   H H2     . A A 1 117 ? 132.335 152.446 122.040 1.00 0.00 ? 117 A A H2     1  
ATOM 3794   P P      . A A 1 118 ? 134.465 144.991 126.009 1.00 0.00 ? 118 A A P      1  
ATOM 3795   O OP1    . A A 1 118 ? 133.552 143.947 126.540 1.00 0.00 ? 118 A A OP1    1  
ATOM 3796   O OP2    . A A 1 118 ? 135.640 145.415 126.811 1.00 0.00 ? 118 A A OP2    1  
ATOM 3797   O "O5'"  . A A 1 118 ? 134.991 144.508 124.584 1.00 0.00 ? 118 A A "O5'"  1  
ATOM 3798   C "C5'"  . A A 1 118 ? 136.243 144.947 124.082 1.00 0.00 ? 118 A A "C5'"  1  
ATOM 3799   C "C4'"  . A A 1 118 ? 136.161 145.304 122.619 1.00 0.00 ? 118 A A "C4'"  1  
ATOM 3800   O "O4'"  . A A 1 118 ? 135.263 144.390 121.939 1.00 0.00 ? 118 A A "O4'"  1  
ATOM 3801   C "C3'"  . A A 1 118 ? 135.597 146.682 122.300 1.00 0.00 ? 118 A A "C3'"  1  
ATOM 3802   O "O3'"  . A A 1 118 ? 136.561 147.715 122.418 1.00 0.00 ? 118 A A "O3'"  1  
ATOM 3803   C "C2'"  . A A 1 118 ? 135.063 146.503 120.888 1.00 0.00 ? 118 A A "C2'"  1  
ATOM 3804   O "O2'"  . A A 1 118 ? 136.113 146.530 119.931 1.00 0.00 ? 118 A A "O2'"  1  
ATOM 3805   C "C1'"  . A A 1 118 ? 134.489 145.087 120.955 1.00 0.00 ? 118 A A "C1'"  1  
ATOM 3806   N N9     . A A 1 118 ? 133.062 145.082 121.326 1.00 0.00 ? 118 A A N9     1  
ATOM 3807   C C8     . A A 1 118 ? 132.505 144.753 122.538 1.00 0.00 ? 118 A A C8     1  
ATOM 3808   N N7     . A A 1 118 ? 131.200 144.846 122.561 1.00 0.00 ? 118 A A N7     1  
ATOM 3809   C C5     . A A 1 118 ? 130.871 145.264 121.281 1.00 0.00 ? 118 A A C5     1  
ATOM 3810   C C6     . A A 1 118 ? 129.639 145.545 120.662 1.00 0.00 ? 118 A A C6     1  
ATOM 3811   N N6     . A A 1 118 ? 128.460 145.446 121.280 1.00 0.00 ? 118 A A N6     1  
ATOM 3812   N N1     . A A 1 118 ? 129.662 145.939 119.371 1.00 0.00 ? 118 A A N1     1  
ATOM 3813   C C2     . A A 1 118 ? 130.843 146.039 118.748 1.00 0.00 ? 118 A A C2     1  
ATOM 3814   N N3     . A A 1 118 ? 132.064 145.801 119.222 1.00 0.00 ? 118 A A N3     1  
ATOM 3815   C C4     . A A 1 118 ? 132.008 145.413 120.510 1.00 0.00 ? 118 A A C4     1  
ATOM 3816   H "H5'"  . A A 1 118 ? 136.904 144.230 124.198 1.00 0.00 ? 118 A A "H5'"  1  
ATOM 3817   H "H5''" . A A 1 118 ? 136.534 145.734 124.588 1.00 0.00 ? 118 A A "H5''" 1  
ATOM 3818   H "H4'"  . A A 1 118 ? 137.053 145.228 122.223 1.00 0.00 ? 118 A A "H4'"  1  
ATOM 3819   H "H3'"  . A A 1 118 ? 134.848 146.871 122.905 1.00 0.00 ? 118 A A "H3'"  1  
ATOM 3820   H "H2'"  . A A 1 118 ? 134.366 147.162 120.678 1.00 0.00 ? 118 A A "H2'"  1  
ATOM 3821   H "HO2'" . A A 1 118 ? 136.895 146.965 120.327 1.00 0.00 ? 118 A A "HO2'" 1  
ATOM 3822   H "H1'"  . A A 1 118 ? 134.602 144.648 120.086 1.00 0.00 ? 118 A A "H1'"  1  
ATOM 3823   H H8     . A A 1 118 ? 133.037 144.478 123.314 1.00 0.00 ? 118 A A H8     1  
ATOM 3824   H H61    . A A 1 118 ? 127.634 145.657 120.797 1.00 0.00 ? 118 A A H61    1  
ATOM 3825   H H62    . A A 1 118 ? 128.421 145.163 122.218 1.00 0.00 ? 118 A A H62    1  
ATOM 3826   H H2     . A A 1 118 ? 130.802 146.328 117.812 1.00 0.00 ? 118 A A H2     1  
ATOM 3827   P P      . G A 1 119 ? 136.109 149.194 122.854 1.00 0.00 ? 119 G A P      1  
ATOM 3828   O OP1    . G A 1 119 ? 137.333 149.985 123.145 1.00 0.00 ? 119 G A OP1    1  
ATOM 3829   O OP2    . G A 1 119 ? 135.056 149.065 123.892 1.00 0.00 ? 119 G A OP2    1  
ATOM 3830   O "O5'"  . G A 1 119 ? 135.437 149.796 121.541 1.00 0.00 ? 119 G A "O5'"  1  
ATOM 3831   C "C5'"  . G A 1 119 ? 136.214 150.079 120.385 1.00 0.00 ? 119 G A "C5'"  1  
ATOM 3832   C "C4'"  . G A 1 119 ? 135.349 150.492 119.221 1.00 0.00 ? 119 G A "C4'"  1  
ATOM 3833   O "O4'"  . G A 1 119 ? 134.434 149.418 118.883 1.00 0.00 ? 119 G A "O4'"  1  
ATOM 3834   C "C3'"  . G A 1 119 ? 134.444 151.689 119.456 1.00 0.00 ? 119 G A "C3'"  1  
ATOM 3835   O "O3'"  . G A 1 119 ? 135.114 152.931 119.305 1.00 0.00 ? 119 G A "O3'"  1  
ATOM 3836   C "C2'"  . G A 1 119 ? 133.330 151.470 118.443 1.00 0.00 ? 119 G A "C2'"  1  
ATOM 3837   O "O2'"  . G A 1 119 ? 133.746 151.837 117.134 1.00 0.00 ? 119 G A "O2'"  1  
ATOM 3838   C "C1'"  . G A 1 119 ? 133.160 149.950 118.500 1.00 0.00 ? 119 G A "C1'"  1  
ATOM 3839   N N9     . G A 1 119 ? 132.118 149.547 119.463 1.00 0.00 ? 119 G A N9     1  
ATOM 3840   C C8     . G A 1 119 ? 132.302 148.952 120.688 1.00 0.00 ? 119 G A C8     1  
ATOM 3841   N N7     . G A 1 119 ? 131.183 148.709 121.316 1.00 0.00 ? 119 G A N7     1  
ATOM 3842   C C5     . G A 1 119 ? 130.201 149.170 120.452 1.00 0.00 ? 119 G A C5     1  
ATOM 3843   C C6     . G A 1 119 ? 128.788 149.178 120.588 1.00 0.00 ? 119 G A C6     1  
ATOM 3844   O O6     . G A 1 119 ? 128.101 148.764 121.531 1.00 0.00 ? 119 G A O6     1  
ATOM 3845   N N1     . G A 1 119 ? 128.168 149.740 119.477 1.00 0.00 ? 119 G A N1     1  
ATOM 3846   C C2     . G A 1 119 ? 128.824 150.233 118.373 1.00 0.00 ? 119 G A C2     1  
ATOM 3847   N N2     . G A 1 119 ? 128.053 150.739 117.398 1.00 0.00 ? 119 G A N2     1  
ATOM 3848   N N3     . G A 1 119 ? 130.140 150.231 118.235 1.00 0.00 ? 119 G A N3     1  
ATOM 3849   C C4     . G A 1 119 ? 130.760 149.691 119.304 1.00 0.00 ? 119 G A C4     1  
ATOM 3850   H "H5'"  . G A 1 119 ? 136.722 149.278 120.139 1.00 0.00 ? 119 G A "H5'"  1  
ATOM 3851   H "H5''" . G A 1 119 ? 136.841 150.805 120.592 1.00 0.00 ? 119 G A "H5''" 1  
ATOM 3852   H "H4'"  . G A 1 119 ? 135.924 150.676 118.449 1.00 0.00 ? 119 G A "H4'"  1  
ATOM 3853   H "H3'"  . G A 1 119 ? 134.067 151.635 120.361 1.00 0.00 ? 119 G A "H3'"  1  
ATOM 3854   H "H2'"  . G A 1 119 ? 132.506 151.933 118.703 1.00 0.00 ? 119 G A "H2'"  1  
ATOM 3855   H "HO2'" . G A 1 119 ? 132.987 151.743 116.521 1.00 0.00 ? 119 G A "HO2'" 1  
ATOM 3856   H "H1'"  . G A 1 119 ? 132.931 149.612 117.610 1.00 0.00 ? 119 G A "H1'"  1  
ATOM 3857   H H8     . G A 1 119 ? 133.184 148.731 121.055 1.00 0.00 ? 119 G A H8     1  
ATOM 3858   H H1     . G A 1 119 ? 127.188 149.788 119.483 1.00 0.00 ? 119 G A H1     1  
ATOM 3859   H H21    . G A 1 119 ? 127.077 150.743 117.495 1.00 0.00 ? 119 G A H21    1  
ATOM 3860   H H22    . G A 1 119 ? 128.464 151.103 116.587 1.00 0.00 ? 119 G A H22    1  
ATOM 3861   P P      . G A 1 120 ? 134.641 154.210 120.154 1.00 0.00 ? 120 G A P      1  
ATOM 3862   O OP1    . G A 1 120 ? 135.641 155.291 119.951 1.00 0.00 ? 120 G A OP1    1  
ATOM 3863   O OP2    . G A 1 120 ? 134.321 153.758 121.532 1.00 0.00 ? 120 G A OP2    1  
ATOM 3864   O "O5'"  . G A 1 120 ? 133.282 154.659 119.454 1.00 0.00 ? 120 G A "O5'"  1  
ATOM 3865   C "C5'"  . G A 1 120 ? 133.277 155.169 118.130 1.00 0.00 ? 120 G A "C5'"  1  
ATOM 3866   C "C4'"  . G A 1 120 ? 131.874 155.406 117.632 1.00 0.00 ? 120 G A "C4'"  1  
ATOM 3867   O "O4'"  . G A 1 120 ? 131.144 154.154 117.599 1.00 0.00 ? 120 G A "O4'"  1  
ATOM 3868   C "C3'"  . G A 1 120 ? 131.006 156.317 118.489 1.00 0.00 ? 120 G A "C3'"  1  
ATOM 3869   O "O3'"  . G A 1 120 ? 131.254 157.695 118.259 1.00 0.00 ? 120 G A "O3'"  1  
ATOM 3870   C "C2'"  . G A 1 120 ? 129.597 155.879 118.118 1.00 0.00 ? 120 G A "C2'"  1  
ATOM 3871   O "O2'"  . G A 1 120 ? 129.201 156.421 116.867 1.00 0.00 ? 120 G A "O2'"  1  
ATOM 3872   C "C1'"  . G A 1 120 ? 129.776 154.368 117.971 1.00 0.00 ? 120 G A "C1'"  1  
ATOM 3873   N N9     . G A 1 120 ? 129.446 153.646 119.212 1.00 0.00 ? 120 G A N9     1  
ATOM 3874   C C8     . G A 1 120 ? 130.321 153.027 120.074 1.00 0.00 ? 120 G A C8     1  
ATOM 3875   N N7     . G A 1 120 ? 129.729 152.467 121.094 1.00 0.00 ? 120 G A N7     1  
ATOM 3876   C C5     . G A 1 120 ? 128.382 152.733 120.897 1.00 0.00 ? 120 G A C5     1  
ATOM 3877   C C6     . G A 1 120 ? 127.252 152.380 121.679 1.00 0.00 ? 120 G A C6     1  
ATOM 3878   O O6     . G A 1 120 ? 127.216 151.740 122.737 1.00 0.00 ? 120 G A O6     1  
ATOM 3879   N N1     . G A 1 120 ? 126.071 152.852 121.114 1.00 0.00 ? 120 G A N1     1  
ATOM 3880   C C2     . G A 1 120 ? 125.987 153.572 119.949 1.00 0.00 ? 120 G A C2     1  
ATOM 3881   N N2     . G A 1 120 ? 124.756 153.940 119.563 1.00 0.00 ? 120 G A N2     1  
ATOM 3882   N N3     . G A 1 120 ? 127.033 153.909 119.210 1.00 0.00 ? 120 G A N3     1  
ATOM 3883   C C4     . G A 1 120 ? 128.190 153.460 119.741 1.00 0.00 ? 120 G A C4     1  
ATOM 3884   H "H5'"  . G A 1 120 ? 133.724 154.527 117.537 1.00 0.00 ? 120 G A "H5'"  1  
ATOM 3885   H "H5''" . G A 1 120 ? 133.773 156.016 118.110 1.00 0.00 ? 120 G A "H5''" 1  
ATOM 3886   H "H4'"  . G A 1 120 ? 131.917 155.773 116.724 1.00 0.00 ? 120 G A "H4'"  1  
ATOM 3887   H "H3'"  . G A 1 120 ? 131.167 156.115 119.435 1.00 0.00 ? 120 G A "H3'"  1  
ATOM 3888   H "H2'"  . G A 1 120 ? 128.955 156.096 118.826 1.00 0.00 ? 120 G A "H2'"  1  
ATOM 3889   H "HO2'" . G A 1 120 ? 128.264 156.696 116.920 1.00 0.00 ? 120 G A "HO2'" 1  
ATOM 3890   H "H1'"  . G A 1 120 ? 129.206 154.040 117.242 1.00 0.00 ? 120 G A "H1'"  1  
ATOM 3891   H H8     . G A 1 120 ? 131.291 153.005 119.935 1.00 0.00 ? 120 G A H8     1  
ATOM 3892   H H1     . G A 1 120 ? 125.237 152.654 121.588 1.00 0.00 ? 120 G A H1     1  
ATOM 3893   H H21    . G A 1 120 ? 123.976 153.695 120.103 1.00 0.00 ? 120 G A H21    1  
ATOM 3894   H H22    . G A 1 120 ? 124.635 154.457 118.737 1.00 0.00 ? 120 G A H22    1  
ATOM 3895   P P      . G A 1 121 ? 130.837 158.786 119.362 1.00 0.00 ? 121 G A P      1  
ATOM 3896   O OP1    . G A 1 121 ? 131.405 160.096 118.953 1.00 0.00 ? 121 G A OP1    1  
ATOM 3897   O OP2    . G A 1 121 ? 131.160 158.232 120.702 1.00 0.00 ? 121 G A OP2    1  
ATOM 3898   O "O5'"  . G A 1 121 ? 129.251 158.876 119.235 1.00 0.00 ? 121 G A "O5'"  1  
ATOM 3899   C "C5'"  . G A 1 121 ? 128.644 159.510 118.119 1.00 0.00 ? 121 G A "C5'"  1  
ATOM 3900   C "C4'"  . G A 1 121 ? 127.163 159.230 118.060 1.00 0.00 ? 121 G A "C4'"  1  
ATOM 3901   O "O4'"  . G A 1 121 ? 126.882 157.825 118.277 1.00 0.00 ? 121 G A "O4'"  1  
ATOM 3902   C "C3'"  . G A 1 121 ? 126.310 159.923 119.112 1.00 0.00 ? 121 G A "C3'"  1  
ATOM 3903   O "O3'"  . G A 1 121 ? 126.059 161.285 118.811 1.00 0.00 ? 121 G A "O3'"  1  
ATOM 3904   C "C2'"  . G A 1 121 ? 125.047 159.077 119.098 1.00 0.00 ? 121 G A "C2'"  1  
ATOM 3905   O "O2'"  . G A 1 121 ? 124.227 159.394 117.982 1.00 0.00 ? 121 G A "O2'"  1  
ATOM 3906   C "C1'"  . G A 1 121 ? 125.623 157.675 118.908 1.00 0.00 ? 121 G A "C1'"  1  
ATOM 3907   N N9     . G A 1 121 ? 125.795 156.968 120.191 1.00 0.00 ? 121 G A N9     1  
ATOM 3908   C C8     . G A 1 121 ? 126.977 156.588 120.779 1.00 0.00 ? 121 G A C8     1  
ATOM 3909   N N7     . G A 1 121 ? 126.810 155.973 121.919 1.00 0.00 ? 121 G A N7     1  
ATOM 3910   C C5     . G A 1 121 ? 125.434 155.946 122.095 1.00 0.00 ? 121 G A C5     1  
ATOM 3911   C C6     . G A 1 121 ? 124.653 155.410 123.152 1.00 0.00 ? 121 G A C6     1  
ATOM 3912   O O6     . G A 1 121 ? 125.035 154.832 124.175 1.00 0.00 ? 121 G A O6     1  
ATOM 3913   N N1     . G A 1 121 ? 123.292 155.599 122.930 1.00 0.00 ? 121 G A N1     1  
ATOM 3914   C C2     . G A 1 121 ? 122.751 156.224 121.833 1.00 0.00 ? 121 G A C2     1  
ATOM 3915   N N2     . G A 1 121 ? 121.413 156.311 121.796 1.00 0.00 ? 121 G A N2     1  
ATOM 3916   N N3     . G A 1 121 ? 123.468 156.728 120.842 1.00 0.00 ? 121 G A N3     1  
ATOM 3917   C C4     . G A 1 121 ? 124.792 156.556 121.038 1.00 0.00 ? 121 G A C4     1  
ATOM 3918   H "H5'"  . G A 1 121 ? 129.065 159.184 117.297 1.00 0.00 ? 121 G A "H5'"  1  
ATOM 3919   H "H5''" . G A 1 121 ? 128.784 160.478 118.187 1.00 0.00 ? 121 G A "H5''" 1  
ATOM 3920   H "H4'"  . G A 1 121 ? 126.829 159.473 117.171 1.00 0.00 ? 121 G A "H4'"  1  
ATOM 3921   H "H3'"  . G A 1 121 ? 126.746 159.841 119.985 1.00 0.00 ? 121 G A "H3'"  1  
ATOM 3922   H "H2'"  . G A 1 121 ? 124.554 159.151 119.942 1.00 0.00 ? 121 G A "H2'"  1  
ATOM 3923   H "HO2'" . G A 1 121 ? 123.288 159.385 118.263 1.00 0.00 ? 121 G A "HO2'" 1  
ATOM 3924   H "H1'"  . G A 1 121 ? 125.031 157.155 118.325 1.00 0.00 ? 121 G A "H1'"  1  
ATOM 3925   H H8     . G A 1 121 ? 127.857 156.759 120.383 1.00 0.00 ? 121 G A H8     1  
ATOM 3926   H H1     . G A 1 121 ? 122.674 155.259 123.610 1.00 0.00 ? 121 G A H1     1  
ATOM 3927   H H21    . G A 1 121 ? 120.876 155.940 122.526 1.00 0.00 ? 121 G A H21    1  
ATOM 3928   H H22    . G A 1 121 ? 120.971 156.747 121.037 1.00 0.00 ? 121 G A H22    1  
ATOM 3929   P P      . U A 1 122 ? 125.776 162.335 119.994 1.00 0.00 ? 122 U A P      1  
ATOM 3930   O OP1    . U A 1 122 ? 125.437 163.643 119.378 1.00 0.00 ? 122 U A OP1    1  
ATOM 3931   O OP2    . U A 1 122 ? 126.898 162.248 120.962 1.00 0.00 ? 122 U A OP2    1  
ATOM 3932   O "O5'"  . U A 1 122 ? 124.467 161.770 120.705 1.00 0.00 ? 122 U A "O5'"  1  
ATOM 3933   C "C5'"  . U A 1 122 ? 123.221 161.743 120.024 1.00 0.00 ? 122 U A "C5'"  1  
ATOM 3934   C "C4'"  . U A 1 122 ? 122.171 161.002 120.814 1.00 0.00 ? 122 U A "C4'"  1  
ATOM 3935   O "O4'"  . U A 1 122 ? 122.780 159.798 121.357 1.00 0.00 ? 122 U A "O4'"  1  
ATOM 3936   C "C3'"  . U A 1 122 ? 121.568 161.749 121.994 1.00 0.00 ? 122 U A "C3'"  1  
ATOM 3937   O "O3'"  . U A 1 122 ? 120.230 161.373 122.263 1.00 0.00 ? 122 U A "O3'"  1  
ATOM 3938   C "C2'"  . U A 1 122 ? 122.408 161.270 123.165 1.00 0.00 ? 122 U A "C2'"  1  
ATOM 3939   O "O2'"  . U A 1 122 ? 121.662 161.287 124.374 1.00 0.00 ? 122 U A "O2'"  1  
ATOM 3940   C "C1'"  . U A 1 122 ? 122.683 159.828 122.779 1.00 0.00 ? 122 U A "C1'"  1  
ATOM 3941   N N1     . U A 1 122 ? 123.970 159.334 123.325 1.00 0.00 ? 122 U A N1     1  
ATOM 3942   C C2     . U A 1 122 ? 123.908 158.464 124.397 1.00 0.00 ? 122 U A C2     1  
ATOM 3943   O O2     . U A 1 122 ? 122.859 158.096 124.897 1.00 0.00 ? 122 U A O2     1  
ATOM 3944   N N3     . U A 1 122 ? 125.124 158.033 124.869 1.00 0.00 ? 122 U A N3     1  
ATOM 3945   C C4     . U A 1 122 ? 126.371 158.375 124.390 1.00 0.00 ? 122 U A C4     1  
ATOM 3946   O O4     . U A 1 122 ? 127.375 157.902 124.925 1.00 0.00 ? 122 U A O4     1  
ATOM 3947   C C5     . U A 1 122 ? 126.357 159.279 123.280 1.00 0.00 ? 122 U A C5     1  
ATOM 3948   C C6     . U A 1 122 ? 125.188 159.713 122.800 1.00 0.00 ? 122 U A C6     1  
ATOM 3949   H "H5'"  . U A 1 122 ? 123.341 161.300 119.158 1.00 0.00 ? 122 U A "H5'"  1  
ATOM 3950   H "H5''" . U A 1 122 ? 122.918 162.662 119.874 1.00 0.00 ? 122 U A "H5''" 1  
ATOM 3951   H "H4'"  . U A 1 122 ? 121.437 160.758 120.213 1.00 0.00 ? 122 U A "H4'"  1  
ATOM 3952   H "H3'"  . U A 1 122 ? 121.713 162.711 121.874 1.00 0.00 ? 122 U A "H3'"  1  
ATOM 3953   H "H2'"  . U A 1 122 ? 123.239 161.783 123.246 1.00 0.00 ? 122 U A "H2'"  1  
ATOM 3954   H "HO2'" . U A 1 122 ? 122.233 160.975 125.107 1.00 0.00 ? 122 U A "HO2'" 1  
ATOM 3955   H "H1'"  . U A 1 122 ? 121.952 159.261 123.106 1.00 0.00 ? 122 U A "H1'"  1  
ATOM 3956   H H3     . U A 1 122 ? 125.103 157.415 125.629 1.00 0.00 ? 122 U A H3     1  
ATOM 3957   H H5     . U A 1 122 ? 127.199 159.576 122.875 1.00 0.00 ? 122 U A H5     1  
ATOM 3958   H H6     . U A 1 122 ? 125.205 160.332 122.041 1.00 0.00 ? 122 U A H6     1  
ATOM 3959   P P      . A A 1 123 ? 119.017 162.341 121.848 1.00 0.00 ? 123 A A P      1  
ATOM 3960   O OP1    . A A 1 123 ? 119.595 163.616 121.354 1.00 0.00 ? 123 A A OP1    1  
ATOM 3961   O OP2    . A A 1 123 ? 118.041 162.362 122.966 1.00 0.00 ? 123 A A OP2    1  
ATOM 3962   O "O5'"  . A A 1 123 ? 118.336 161.598 120.614 1.00 0.00 ? 123 A A "O5'"  1  
ATOM 3963   C "C5'"  . A A 1 123 ? 117.497 162.302 119.711 1.00 0.00 ? 123 A A "C5'"  1  
ATOM 3964   C "C4'"  . A A 1 123 ? 116.934 161.390 118.650 1.00 0.00 ? 123 A A "C4'"  1  
ATOM 3965   O "O4'"  . A A 1 123 ? 118.037 160.735 117.982 1.00 0.00 ? 123 A A "O4'"  1  
ATOM 3966   C "C3'"  . A A 1 123 ? 116.062 160.247 119.148 1.00 0.00 ? 123 A A "C3'"  1  
ATOM 3967   O "O3'"  . A A 1 123 ? 114.712 160.626 119.350 1.00 0.00 ? 123 A A "O3'"  1  
ATOM 3968   C "C2'"  . A A 1 123 ? 116.200 159.195 118.059 1.00 0.00 ? 123 A A "C2'"  1  
ATOM 3969   O "O2'"  . A A 1 123 ? 115.306 159.447 116.984 1.00 0.00 ? 123 A A "O2'"  1  
ATOM 3970   C "C1'"  . A A 1 123 ? 117.628 159.429 117.576 1.00 0.00 ? 123 A A "C1'"  1  
ATOM 3971   N N9     . A A 1 123 ? 118.565 158.417 118.101 1.00 0.00 ? 123 A A N9     1  
ATOM 3972   C C8     . A A 1 123 ? 119.425 158.534 119.165 1.00 0.00 ? 123 A A C8     1  
ATOM 3973   N N7     . A A 1 123 ? 120.136 157.457 119.391 1.00 0.00 ? 123 A A N7     1  
ATOM 3974   C C5     . A A 1 123 ? 119.717 156.570 118.409 1.00 0.00 ? 123 A A C5     1  
ATOM 3975   C C6     . A A 1 123 ? 120.091 155.249 118.105 1.00 0.00 ? 123 A A C6     1  
ATOM 3976   N N6     . A A 1 123 ? 121.009 154.563 118.789 1.00 0.00 ? 123 A A N6     1  
ATOM 3977   N N1     . A A 1 123 ? 119.481 154.648 117.060 1.00 0.00 ? 123 A A N1     1  
ATOM 3978   C C2     . A A 1 123 ? 118.559 155.335 116.373 1.00 0.00 ? 123 A A C2     1  
ATOM 3979   N N3     . A A 1 123 ? 118.124 156.579 116.562 1.00 0.00 ? 123 A A N3     1  
ATOM 3980   C C4     . A A 1 123 ? 118.750 157.148 117.608 1.00 0.00 ? 123 A A C4     1  
ATOM 3981   H "H5'"  . A A 1 123 ? 118.017 163.012 119.278 1.00 0.00 ? 123 A A "H5'"  1  
ATOM 3982   H "H5''" . A A 1 123 ? 116.758 162.708 120.209 1.00 0.00 ? 123 A A "H5''" 1  
ATOM 3983   H "H4'"  . A A 1 123 ? 116.429 161.927 118.004 1.00 0.00 ? 123 A A "H4'"  1  
ATOM 3984   H "H3'"  . A A 1 123 ? 116.443 159.890 119.978 1.00 0.00 ? 123 A A "H3'"  1  
ATOM 3985   H "H2'"  . A A 1 123 ? 116.090 158.289 118.418 1.00 0.00 ? 123 A A "H2'"  1  
ATOM 3986   H "HO2'" . A A 1 123 ? 115.415 158.746 116.309 1.00 0.00 ? 123 A A "HO2'" 1  
ATOM 3987   H "H1'"  . A A 1 123 ? 117.647 159.414 116.596 1.00 0.00 ? 123 A A "H1'"  1  
ATOM 3988   H H8     . A A 1 123 ? 119.499 159.348 119.706 1.00 0.00 ? 123 A A H8     1  
ATOM 3989   H H61    . A A 1 123 ? 121.228 153.643 118.529 1.00 0.00 ? 123 A A H61    1  
ATOM 3990   H H62    . A A 1 123 ? 121.465 154.978 119.551 1.00 0.00 ? 123 A A H62    1  
ATOM 3991   H H2     . A A 1 123 ? 118.147 154.854 115.625 1.00 0.00 ? 123 A A H2     1  
ATOM 3992   P P      . U A 1 124 ? 114.039 160.426 120.789 1.00 0.00 ? 124 U A P      1  
ATOM 3993   O OP1    . U A 1 124 ? 112.584 160.707 120.687 1.00 0.00 ? 124 U A OP1    1  
ATOM 3994   O OP2    . U A 1 124 ? 114.890 161.270 121.665 1.00 0.00 ? 124 U A OP2    1  
ATOM 3995   O "O5'"  . U A 1 124 ? 114.218 158.909 121.240 1.00 0.00 ? 124 U A "O5'"  1  
ATOM 3996   C "C5'"  . U A 1 124 ? 113.125 158.003 121.205 1.00 0.00 ? 124 U A "C5'"  1  
ATOM 3997   C "C4'"  . U A 1 124 ? 112.843 157.418 122.567 1.00 0.00 ? 124 U A "C4'"  1  
ATOM 3998   O "O4'"  . U A 1 124 ? 111.715 158.109 123.161 1.00 0.00 ? 124 U A "O4'"  1  
ATOM 3999   C "C3'"  . U A 1 124 ? 112.393 155.966 122.592 1.00 0.00 ? 124 U A "C3'"  1  
ATOM 4000   O "O3'"  . U A 1 124 ? 113.457 155.052 122.394 1.00 0.00 ? 124 U A "O3'"  1  
ATOM 4001   C "C2'"  . U A 1 124 ? 111.738 155.878 123.971 1.00 0.00 ? 124 U A "C2'"  1  
ATOM 4002   O "O2'"  . U A 1 124 ? 112.713 155.789 124.999 1.00 0.00 ? 124 U A "O2'"  1  
ATOM 4003   C "C1'"  . U A 1 124 ? 111.054 157.229 124.041 1.00 0.00 ? 124 U A "C1'"  1  
ATOM 4004   N N1     . U A 1 124 ? 109.617 157.151 123.683 1.00 0.00 ? 124 U A N1     1  
ATOM 4005   C C2     . U A 1 124 ? 108.739 156.770 124.681 1.00 0.00 ? 124 U A C2     1  
ATOM 4006   O O2     . U A 1 124 ? 109.095 156.502 125.815 1.00 0.00 ? 124 U A O2     1  
ATOM 4007   N N3     . U A 1 124 ? 107.419 156.713 124.305 1.00 0.00 ? 124 U A N3     1  
ATOM 4008   C C4     . U A 1 124 ? 106.896 156.991 123.060 1.00 0.00 ? 124 U A C4     1  
ATOM 4009   O O4     . U A 1 124 ? 105.682 156.892 122.878 1.00 0.00 ? 124 U A O4     1  
ATOM 4010   C C5     . U A 1 124 ? 107.863 157.379 122.078 1.00 0.00 ? 124 U A C5     1  
ATOM 4011   C C6     . U A 1 124 ? 109.155 157.444 122.418 1.00 0.00 ? 124 U A C6     1  
ATOM 4012   H "H5'"  . U A 1 124 ? 113.333 157.276 120.582 1.00 0.00 ? 124 U A "H5'"  1  
ATOM 4013   H "H5''" . U A 1 124 ? 112.327 158.477 120.890 1.00 0.00 ? 124 U A "H5''" 1  
ATOM 4014   H "H4'"  . U A 1 124 ? 113.627 157.516 123.147 1.00 0.00 ? 124 U A "H4'"  1  
ATOM 4015   H "H3'"  . U A 1 124 ? 111.707 155.813 121.909 1.00 0.00 ? 124 U A "H3'"  1  
ATOM 4016   H "H2'"  . U A 1 124 ? 111.095 155.140 124.017 1.00 0.00 ? 124 U A "H2'"  1  
ATOM 4017   H "HO2'" . U A 1 124 ? 113.012 156.692 125.235 1.00 0.00 ? 124 U A "HO2'" 1  
ATOM 4018   H "H1'"  . U A 1 124 ? 111.144 157.589 124.948 1.00 0.00 ? 124 U A "H1'"  1  
ATOM 4019   H H3     . U A 1 124 ? 106.780 156.444 124.997 1.00 0.00 ? 124 U A H3     1  
ATOM 4020   H H5     . U A 1 124 ? 107.580 157.596 121.165 1.00 0.00 ? 124 U A H5     1  
ATOM 4021   H H6     . U A 1 124 ? 109.796 157.711 121.728 1.00 0.00 ? 124 U A H6     1  
ATOM 4022   P P      . G A 1 125 ? 113.155 153.550 121.910 1.00 0.00 ? 125 G A P      1  
ATOM 4023   O OP1    . G A 1 125 ? 114.442 152.928 121.508 1.00 0.00 ? 125 G A OP1    1  
ATOM 4024   O OP2    . G A 1 125 ? 112.029 153.597 120.942 1.00 0.00 ? 125 G A OP2    1  
ATOM 4025   O "O5'"  . G A 1 125 ? 112.642 152.815 123.228 1.00 0.00 ? 125 G A "O5'"  1  
ATOM 4026   C "C5'"  . G A 1 125 ? 111.910 151.602 123.148 1.00 0.00 ? 125 G A "C5'"  1  
ATOM 4027   C "C4'"  . G A 1 125 ? 111.729 150.974 124.508 1.00 0.00 ? 125 G A "C4'"  1  
ATOM 4028   O "O4'"  . G A 1 125 ? 111.362 151.994 125.475 1.00 0.00 ? 125 G A "O4'"  1  
ATOM 4029   C "C3'"  . G A 1 125 ? 110.618 149.941 124.624 1.00 0.00 ? 125 G A "C3'"  1  
ATOM 4030   O "O3'"  . G A 1 125 ? 111.007 148.656 124.162 1.00 0.00 ? 125 G A "O3'"  1  
ATOM 4031   C "C2'"  . G A 1 125 ? 110.280 149.979 126.108 1.00 0.00 ? 125 G A "C2'"  1  
ATOM 4032   O "O2'"  . G A 1 125 ? 111.242 149.267 126.874 1.00 0.00 ? 125 G A "O2'"  1  
ATOM 4033   C "C1'"  . G A 1 125 ? 110.411 151.473 126.409 1.00 0.00 ? 125 G A "C1'"  1  
ATOM 4034   N N9     . G A 1 125 ? 109.124 152.180 126.278 1.00 0.00 ? 125 G A N9     1  
ATOM 4035   C C8     . G A 1 125 ? 108.746 153.041 125.276 1.00 0.00 ? 125 G A C8     1  
ATOM 4036   N N7     . G A 1 125 ? 107.539 153.514 125.432 1.00 0.00 ? 125 G A N7     1  
ATOM 4037   C C5     . G A 1 125 ? 107.093 152.930 126.609 1.00 0.00 ? 125 G A C5     1  
ATOM 4038   C C6     . G A 1 125 ? 105.854 153.065 127.289 1.00 0.00 ? 125 G A C6     1  
ATOM 4039   O O6     . G A 1 125 ? 104.873 153.748 126.974 1.00 0.00 ? 125 G A O6     1  
ATOM 4040   N N1     . G A 1 125 ? 105.819 152.296 128.449 1.00 0.00 ? 125 G A N1     1  
ATOM 4041   C C2     . G A 1 125 ? 106.845 151.500 128.897 1.00 0.00 ? 125 G A C2     1  
ATOM 4042   N N2     . G A 1 125 ? 106.623 150.832 130.039 1.00 0.00 ? 125 G A N2     1  
ATOM 4043   N N3     . G A 1 125 ? 108.003 151.367 128.274 1.00 0.00 ? 125 G A N3     1  
ATOM 4044   C C4     . G A 1 125 ? 108.056 152.103 127.145 1.00 0.00 ? 125 G A C4     1  
ATOM 4045   H "H5'"  . G A 1 125 ? 112.390 150.975 122.568 1.00 0.00 ? 125 G A "H5'"  1  
ATOM 4046   H "H5''" . G A 1 125 ? 111.028 151.785 122.760 1.00 0.00 ? 125 G A "H5''" 1  
ATOM 4047   H "H4'"  . G A 1 125 ? 112.576 150.564 124.783 1.00 0.00 ? 125 G A "H4'"  1  
ATOM 4048   H "H3'"  . G A 1 125 ? 109.841 150.243 124.110 1.00 0.00 ? 125 G A "H3'"  1  
ATOM 4049   H "H2'"  . G A 1 125 ? 109.371 149.656 126.278 1.00 0.00 ? 125 G A "H2'"  1  
ATOM 4050   H "HO2'" . G A 1 125 ? 111.726 148.649 126.287 1.00 0.00 ? 125 G A "HO2'" 1  
ATOM 4051   H "H1'"  . G A 1 125 ? 110.757 151.590 127.319 1.00 0.00 ? 125 G A "H1'"  1  
ATOM 4052   H H8     . G A 1 125 ? 109.324 153.275 124.520 1.00 0.00 ? 125 G A H8     1  
ATOM 4053   H H1     . G A 1 125 ? 104.999 152.326 128.984 1.00 0.00 ? 125 G A H1     1  
ATOM 4054   H H21    . G A 1 125 ? 105.767 150.925 130.507 1.00 0.00 ? 125 G A H21    1  
ATOM 4055   H H22    . G A 1 125 ? 107.319 150.248 130.407 1.00 0.00 ? 125 G A H22    1  
ATOM 4056   P P      . G A 1 126 ? 109.923 147.674 123.499 1.00 0.00 ? 126 G A P      1  
ATOM 4057   O OP1    . G A 1 126 ? 110.650 146.536 122.883 1.00 0.00 ? 126 G A OP1    1  
ATOM 4058   O OP2    . G A 1 126 ? 109.005 148.496 122.670 1.00 0.00 ? 126 G A OP2    1  
ATOM 4059   O "O5'"  . G A 1 126 ? 109.097 147.115 124.742 1.00 0.00 ? 126 G A "O5'"  1  
ATOM 4060   C "C5'"  . G A 1 126 ? 109.703 146.252 125.693 1.00 0.00 ? 126 G A "C5'"  1  
ATOM 4061   C "C4'"  . G A 1 126 ? 108.792 145.989 126.865 1.00 0.00 ? 126 G A "C4'"  1  
ATOM 4062   O "O4'"  . G A 1 126 ? 108.478 147.240 127.533 1.00 0.00 ? 126 G A "O4'"  1  
ATOM 4063   C "C3'"  . G A 1 126 ? 107.431 145.395 126.532 1.00 0.00 ? 126 G A "C3'"  1  
ATOM 4064   O "O3'"  . G A 1 126 ? 107.473 143.992 126.334 1.00 0.00 ? 126 G A "O3'"  1  
ATOM 4065   C "C2'"  . G A 1 126 ? 106.583 145.819 127.723 1.00 0.00 ? 126 G A "C2'"  1  
ATOM 4066   O "O2'"  . G A 1 126 ? 106.842 145.006 128.857 1.00 0.00 ? 126 G A "O2'"  1  
ATOM 4067   C "C1'"  . G A 1 126 ? 107.118 147.229 127.990 1.00 0.00 ? 126 G A "C1'"  1  
ATOM 4068   N N9     . G A 1 126 ? 106.322 148.264 127.303 1.00 0.00 ? 126 G A N9     1  
ATOM 4069   C C8     . G A 1 126 ? 106.693 149.010 126.211 1.00 0.00 ? 126 G A C8     1  
ATOM 4070   N N7     . G A 1 126 ? 105.774 149.852 125.828 1.00 0.00 ? 126 G A N7     1  
ATOM 4071   C C5     . G A 1 126 ? 104.731 149.653 126.721 1.00 0.00 ? 126 G A C5     1  
ATOM 4072   C C6     . G A 1 126 ? 103.461 150.279 126.808 1.00 0.00 ? 126 G A C6     1  
ATOM 4073   O O6     . G A 1 126 ? 102.991 151.165 126.087 1.00 0.00 ? 126 G A O6     1  
ATOM 4074   N N1     . G A 1 126 ? 102.711 149.775 127.865 1.00 0.00 ? 126 G A N1     1  
ATOM 4075   C C2     . G A 1 126 ? 103.128 148.791 128.731 1.00 0.00 ? 126 G A C2     1  
ATOM 4076   N N2     . G A 1 126 ? 102.262 148.437 129.690 1.00 0.00 ? 126 G A N2     1  
ATOM 4077   N N3     . G A 1 126 ? 104.309 148.199 128.661 1.00 0.00 ? 126 G A N3     1  
ATOM 4078   C C4     . G A 1 126 ? 105.052 148.676 127.638 1.00 0.00 ? 126 G A C4     1  
ATOM 4079   H "H5'"  . G A 1 126 ? 110.531 146.664 126.018 1.00 0.00 ? 126 G A "H5'"  1  
ATOM 4080   H "H5''" . G A 1 126 ? 109.920 145.401 125.257 1.00 0.00 ? 126 G A "H5''" 1  
ATOM 4081   H "H4'"  . G A 1 126 ? 109.250 145.397 127.497 1.00 0.00 ? 126 G A "H4'"  1  
ATOM 4082   H "H3'"  . G A 1 126 ? 107.082 145.823 125.720 1.00 0.00 ? 126 G A "H3'"  1  
ATOM 4083   H "H2'"  . G A 1 126 ? 105.629 145.836 127.496 1.00 0.00 ? 126 G A "H2'"  1  
ATOM 4084   H "HO2'" . G A 1 126 ? 107.254 144.169 128.561 1.00 0.00 ? 126 G A "HO2'" 1  
ATOM 4085   H "H1'"  . G A 1 126 ? 107.114 147.399 128.954 1.00 0.00 ? 126 G A "H1'"  1  
ATOM 4086   H H8     . G A 1 126 ? 107.561 148.919 125.764 1.00 0.00 ? 126 G A H8     1  
ATOM 4087   H H1     . G A 1 126 ? 101.815 150.150 128.001 1.00 0.00 ? 126 G A H1     1  
ATOM 4088   H H21    . G A 1 126 ? 101.386 148.870 129.748 1.00 0.00 ? 126 G A H21    1  
ATOM 4089   H H22    . G A 1 126 ? 102.505 147.741 130.335 1.00 0.00 ? 126 G A H22    1  
ATOM 4090   P P      . U A 1 127 ? 106.430 143.286 125.334 1.00 0.00 ? 127 U A P      1  
ATOM 4091   O OP1    . U A 1 127 ? 106.823 141.862 125.191 1.00 0.00 ? 127 U A OP1    1  
ATOM 4092   O OP2    . U A 1 127 ? 106.305 144.140 124.125 1.00 0.00 ? 127 U A OP2    1  
ATOM 4093   O "O5'"  . U A 1 127 ? 105.046 143.340 126.122 1.00 0.00 ? 127 U A "O5'"  1  
ATOM 4094   C "C5'"  . U A 1 127 ? 104.863 142.610 127.325 1.00 0.00 ? 127 U A "C5'"  1  
ATOM 4095   C "C4'"  . U A 1 127 ? 103.520 142.896 127.952 1.00 0.00 ? 127 U A "C4'"  1  
ATOM 4096   O "O4'"  . U A 1 127 ? 103.433 144.300 128.313 1.00 0.00 ? 127 U A "O4'"  1  
ATOM 4097   C "C3'"  . U A 1 127 ? 102.304 142.667 127.067 1.00 0.00 ? 127 U A "C3'"  1  
ATOM 4098   O "O3'"  . U A 1 127 ? 101.908 141.307 127.012 1.00 0.00 ? 127 U A "O3'"  1  
ATOM 4099   C "C2'"  . U A 1 127 ? 101.260 143.581 127.690 1.00 0.00 ? 127 U A "C2'"  1  
ATOM 4100   O "O2'"  . U A 1 127 ? 100.706 143.006 128.866 1.00 0.00 ? 127 U A "O2'"  1  
ATOM 4101   C "C1'"  . U A 1 127 ? 102.112 144.789 128.084 1.00 0.00 ? 127 U A "C1'"  1  
ATOM 4102   N N1     . U A 1 127 ? 102.120 145.836 127.034 1.00 0.00 ? 127 U A N1     1  
ATOM 4103   C C2     . U A 1 127 ? 100.994 146.633 126.927 1.00 0.00 ? 127 U A C2     1  
ATOM 4104   O O2     . U A 1 127 ? 100.019 146.505 127.645 1.00 0.00 ? 127 U A O2     1  
ATOM 4105   N N3     . U A 1 127 ? 101.048 147.589 125.941 1.00 0.00 ? 127 U A N3     1  
ATOM 4106   C C4     . U A 1 127 ? 102.089 147.825 125.070 1.00 0.00 ? 127 U A C4     1  
ATOM 4107   O O4     . U A 1 127 ? 101.984 148.725 124.234 1.00 0.00 ? 127 U A O4     1  
ATOM 4108   C C5     . U A 1 127 ? 103.219 146.965 125.240 1.00 0.00 ? 127 U A C5     1  
ATOM 4109   C C6     . U A 1 127 ? 103.195 146.027 126.192 1.00 0.00 ? 127 U A C6     1  
ATOM 4110   H "H5'"  . U A 1 127 ? 105.569 142.855 127.957 1.00 0.00 ? 127 U A "H5'"  1  
ATOM 4111   H "H5''" . U A 1 127 ? 104.924 141.651 127.131 1.00 0.00 ? 127 U A "H5''" 1  
ATOM 4112   H "H4'"  . U A 1 127 ? 103.428 142.352 128.762 1.00 0.00 ? 127 U A "H4'"  1  
ATOM 4113   H "H3'"  . U A 1 127 ? 102.503 142.978 126.158 1.00 0.00 ? 127 U A "H3'"  1  
ATOM 4114   H "H2'"  . U A 1 127 ? 100.565 143.828 127.045 1.00 0.00 ? 127 U A "H2'"  1  
ATOM 4115   H "HO2'" . U A 1 127 ? 100.866 142.041 128.852 1.00 0.00 ? 127 U A "HO2'" 1  
ATOM 4116   H "H1'"  . U A 1 127 ? 101.766 145.173 128.918 1.00 0.00 ? 127 U A "H1'"  1  
ATOM 4117   H H3     . U A 1 127 ? 100.260 148.162 125.847 1.00 0.00 ? 127 U A H3     1  
ATOM 4118   H H5     . U A 1 127 ? 104.007 147.064 124.664 1.00 0.00 ? 127 U A H5     1  
ATOM 4119   H H6     . U A 1 127 ? 103.981 145.452 126.287 1.00 0.00 ? 127 U A H6     1  
ATOM 4120   P P      . A A 1 128 ? 101.144 140.737 125.718 1.00 0.00 ? 128 A A P      1  
ATOM 4121   O OP1    . A A 1 128 ? 99.941  140.002 126.181 1.00 0.00 ? 128 A A OP1    1  
ATOM 4122   O OP2    . A A 1 128 ? 102.141 140.049 124.861 1.00 0.00 ? 128 A A OP2    1  
ATOM 4123   O "O5'"  . A A 1 128 ? 100.657 142.047 124.952 1.00 0.00 ? 128 A A "O5'"  1  
ATOM 4124   C "C5'"  . A A 1 128 ? 101.374 142.546 123.833 1.00 0.00 ? 128 A A "C5'"  1  
ATOM 4125   C "C4'"  . A A 1 128 ? 100.518 143.453 122.986 1.00 0.00 ? 128 A A "C4'"  1  
ATOM 4126   O "O4'"  . A A 1 128 ? 99.152  143.388 123.487 1.00 0.00 ? 128 A A "O4'"  1  
ATOM 4127   C "C3'"  . A A 1 128 ? 100.896 144.927 122.994 1.00 0.00 ? 128 A A "C3'"  1  
ATOM 4128   O "O3'"  . A A 1 128 ? 100.687 145.560 121.743 1.00 0.00 ? 128 A A "O3'"  1  
ATOM 4129   C "C2'"  . A A 1 128 ? 99.918  145.509 124.012 1.00 0.00 ? 128 A A "C2'"  1  
ATOM 4130   O "O2'"  . A A 1 128 ? 99.654  146.879 123.747 1.00 0.00 ? 128 A A "O2'"  1  
ATOM 4131   C "C1'"  . A A 1 128 ? 98.659  144.694 123.719 1.00 0.00 ? 128 A A "C1'"  1  
ATOM 4132   N N9     . A A 1 128 ? 97.711  144.709 124.850 1.00 0.00 ? 128 A A N9     1  
ATOM 4133   C C8     . A A 1 128 ? 97.807  144.032 126.041 1.00 0.00 ? 128 A A C8     1  
ATOM 4134   N N7     . A A 1 128 ? 96.803  144.248 126.854 1.00 0.00 ? 128 A A N7     1  
ATOM 4135   C C5     . A A 1 128 ? 95.988  145.125 126.151 1.00 0.00 ? 128 A A C5     1  
ATOM 4136   C C6     . A A 1 128 ? 94.761  145.737 126.465 1.00 0.00 ? 128 A A C6     1  
ATOM 4137   N N6     . A A 1 128 ? 94.115  145.550 127.618 1.00 0.00 ? 128 A A N6     1  
ATOM 4138   N N1     . A A 1 128 ? 94.215  146.558 125.543 1.00 0.00 ? 128 A A N1     1  
ATOM 4139   C C2     . A A 1 128 ? 94.863  146.747 124.387 1.00 0.00 ? 128 A A C2     1  
ATOM 4140   N N3     . A A 1 128 ? 96.019  146.229 123.976 1.00 0.00 ? 128 A A N3     1  
ATOM 4141   C C4     . A A 1 128 ? 96.536  145.417 124.916 1.00 0.00 ? 128 A A C4     1  
ATOM 4142   H "H5'"  . A A 1 128 ? 101.678 141.792 123.286 1.00 0.00 ? 128 A A "H5'"  1  
ATOM 4143   H "H5''" . A A 1 128 ? 102.154 143.046 124.149 1.00 0.00 ? 128 A A "H5''" 1  
ATOM 4144   H "H4'"  . A A 1 128 ? 100.545 143.139 122.057 1.00 0.00 ? 128 A A "H4'"  1  
ATOM 4145   H "H3'"  . A A 1 128 ? 101.810 145.022 123.335 1.00 0.00 ? 128 A A "H3'"  1  
ATOM 4146   H "H2'"  . A A 1 128 ? 100.230 145.370 124.931 1.00 0.00 ? 128 A A "H2'"  1  
ATOM 4147   H "HO2'" . A A 1 128 ? 98.685  147.024 123.756 1.00 0.00 ? 128 A A "HO2'" 1  
ATOM 4148   H "H1'"  . A A 1 128 ? 98.218  145.050 122.919 1.00 0.00 ? 128 A A "H1'"  1  
ATOM 4149   H H8     . A A 1 128 ? 98.559  143.443 126.263 1.00 0.00 ? 128 A A H8     1  
ATOM 4150   H H61    . A A 1 128 ? 93.262  146.005 127.780 1.00 0.00 ? 128 A A H61    1  
ATOM 4151   H H62    . A A 1 128 ? 94.492  144.958 128.302 1.00 0.00 ? 128 A A H62    1  
ATOM 4152   H H2     . A A 1 128 ? 94.424  147.352 123.752 1.00 0.00 ? 128 A A H2     1  
ATOM 4153   P P      . A A 1 129 ? 101.765 146.609 121.192 1.00 0.00 ? 129 A A P      1  
ATOM 4154   O OP1    . A A 1 129 ? 102.457 146.022 120.018 1.00 0.00 ? 129 A A OP1    1  
ATOM 4155   O OP2    . A A 1 129 ? 102.543 146.946 122.410 1.00 0.00 ? 129 A A OP2    1  
ATOM 4156   O "O5'"  . A A 1 129 ? 101.010 147.928 120.711 1.00 0.00 ? 129 A A "O5'"  1  
ATOM 4157   C "C5'"  . A A 1 129 ? 101.016 149.103 121.508 1.00 0.00 ? 129 A A "C5'"  1  
ATOM 4158   C "C4'"  . A A 1 129 ? 100.439 150.281 120.763 1.00 0.00 ? 129 A A "C4'"  1  
ATOM 4159   O "O4'"  . A A 1 129 ? 99.427  150.904 121.592 1.00 0.00 ? 129 A A "O4'"  1  
ATOM 4160   C "C3'"  . A A 1 129 ? 101.414 151.400 120.428 1.00 0.00 ? 129 A A "C3'"  1  
ATOM 4161   O "O3'"  . A A 1 129 ? 102.154 151.154 119.245 1.00 0.00 ? 129 A A "O3'"  1  
ATOM 4162   C "C2'"  . A A 1 129 ? 100.485 152.588 120.211 1.00 0.00 ? 129 A A "C2'"  1  
ATOM 4163   O "O2'"  . A A 1 129 ? 99.934  152.579 118.903 1.00 0.00 ? 129 A A "O2'"  1  
ATOM 4164   C "C1'"  . A A 1 129 ? 99.374  152.303 121.214 1.00 0.00 ? 129 A A "C1'"  1  
ATOM 4165   N N9     . A A 1 129 ? 99.428  153.210 122.376 1.00 0.00 ? 129 A A N9     1  
ATOM 4166   C C8     . A A 1 129 ? 100.351 153.225 123.394 1.00 0.00 ? 129 A A C8     1  
ATOM 4167   N N7     . A A 1 129 ? 100.134 154.155 124.290 1.00 0.00 ? 129 A A N7     1  
ATOM 4168   C C5     . A A 1 129 ? 98.991  154.797 123.834 1.00 0.00 ? 129 A A C5     1  
ATOM 4169   C C6     . A A 1 129 ? 98.244  155.876 124.341 1.00 0.00 ? 129 A A C6     1  
ATOM 4170   N N6     . A A 1 129 ? 98.552  156.526 125.465 1.00 0.00 ? 129 A A N6     1  
ATOM 4171   N N1     . A A 1 129 ? 97.157  156.270 123.643 1.00 0.00 ? 129 A A N1     1  
ATOM 4172   C C2     . A A 1 129 ? 96.848  155.618 122.515 1.00 0.00 ? 129 A A C2     1  
ATOM 4173   N N3     . A A 1 129 ? 97.470  154.592 121.939 1.00 0.00 ? 129 A A N3     1  
ATOM 4174   C C4     . A A 1 129 ? 98.546  154.225 122.657 1.00 0.00 ? 129 A A C4     1  
ATOM 4175   H "H5'"  . A A 1 129 ? 101.938 149.309 121.767 1.00 0.00 ? 129 A A "H5'"  1  
ATOM 4176   H "H5''" . A A 1 129 ? 100.485 148.945 122.316 1.00 0.00 ? 129 A A "H5''" 1  
ATOM 4177   H "H4'"  . A A 1 129 ? 100.017 149.969 119.935 1.00 0.00 ? 129 A A "H4'"  1  
ATOM 4178   H "H3'"  . A A 1 129 ? 102.036 151.566 121.167 1.00 0.00 ? 129 A A "H3'"  1  
ATOM 4179   H "H2'"  . A A 1 129 ? 100.935 153.436 120.411 1.00 0.00 ? 129 A A "H2'"  1  
ATOM 4180   H "HO2'" . A A 1 129 ? 99.348  153.357 118.799 1.00 0.00 ? 129 A A "HO2'" 1  
ATOM 4181   H "H1'"  . A A 1 129 ? 98.504  152.392 120.771 1.00 0.00 ? 129 A A "H1'"  1  
ATOM 4182   H H8     . A A 1 129 ? 101.103 152.598 123.444 1.00 0.00 ? 129 A A H8     1  
ATOM 4183   H H61    . A A 1 129 ? 97.993  157.272 125.769 1.00 0.00 ? 129 A A H61    1  
ATOM 4184   H H62    . A A 1 129 ? 99.336  156.257 125.988 1.00 0.00 ? 129 A A H62    1  
ATOM 4185   H H2     . A A 1 129 ? 96.050  155.943 122.047 1.00 0.00 ? 129 A A H2     1  
ATOM 4186   P P      . U A 1 130 ? 103.546 151.917 118.990 1.00 0.00 ? 130 U A P      1  
ATOM 4187   O OP1    . U A 1 130 ? 103.876 151.803 117.546 1.00 0.00 ? 130 U A OP1    1  
ATOM 4188   O OP2    . U A 1 130 ? 104.520 151.446 120.005 1.00 0.00 ? 130 U A OP2    1  
ATOM 4189   O "O5'"  . U A 1 130 ? 103.210 153.443 119.299 1.00 0.00 ? 130 U A "O5'"  1  
ATOM 4190   C "C5'"  . U A 1 130 ? 103.244 154.421 118.271 1.00 0.00 ? 130 U A "C5'"  1  
ATOM 4191   C "C4'"  . U A 1 130 ? 103.064 155.815 118.820 1.00 0.00 ? 130 U A "C4'"  1  
ATOM 4192   O "O4'"  . U A 1 130 ? 102.252 155.722 120.014 1.00 0.00 ? 130 U A "O4'"  1  
ATOM 4193   C "C3'"  . U A 1 130 ? 104.327 156.519 119.290 1.00 0.00 ? 130 U A "C3'"  1  
ATOM 4194   O "O3'"  . U A 1 130 ? 105.017 157.176 118.242 1.00 0.00 ? 130 U A "O3'"  1  
ATOM 4195   C "C2'"  . U A 1 130 ? 103.780 157.532 120.291 1.00 0.00 ? 130 U A "C2'"  1  
ATOM 4196   O "O2'"  . U A 1 130 ? 103.378 158.731 119.643 1.00 0.00 ? 130 U A "O2'"  1  
ATOM 4197   C "C1'"  . U A 1 130 ? 102.526 156.819 120.825 1.00 0.00 ? 130 U A "C1'"  1  
ATOM 4198   N N1     . U A 1 130 ? 102.672 156.411 122.243 1.00 0.00 ? 130 U A N1     1  
ATOM 4199   C C2     . U A 1 130 ? 102.468 157.384 123.204 1.00 0.00 ? 130 U A C2     1  
ATOM 4200   O O2     . U A 1 130 ? 102.180 158.537 122.933 1.00 0.00 ? 130 U A O2     1  
ATOM 4201   N N3     . U A 1 130 ? 102.613 156.960 124.502 1.00 0.00 ? 130 U A N3     1  
ATOM 4202   C C4     . U A 1 130 ? 102.935 155.690 124.932 1.00 0.00 ? 130 U A C4     1  
ATOM 4203   O O4     . U A 1 130 ? 103.030 155.466 126.139 1.00 0.00 ? 130 U A O4     1  
ATOM 4204   C C5     . U A 1 130 ? 103.131 154.736 123.883 1.00 0.00 ? 130 U A C5     1  
ATOM 4205   C C6     . U A 1 130 ? 102.995 155.121 122.610 1.00 0.00 ? 130 U A C6     1  
ATOM 4206   H "H5'"  . U A 1 130 ? 102.527 154.236 117.630 1.00 0.00 ? 130 U A "H5'"  1  
ATOM 4207   H "H5''" . U A 1 130 ? 104.107 154.370 117.809 1.00 0.00 ? 130 U A "H5''" 1  
ATOM 4208   H "H4'"  . U A 1 130 ? 102.606 156.386 118.170 1.00 0.00 ? 130 U A "H4'"  1  
ATOM 4209   H "H3'"  . U A 1 130 ? 104.937 155.893 119.732 1.00 0.00 ? 130 U A "H3'"  1  
ATOM 4210   H "H2'"  . U A 1 130 ? 104.420 157.708 121.012 1.00 0.00 ? 130 U A "H2'"  1  
ATOM 4211   H "HO2'" . U A 1 130 ? 103.054 159.365 120.316 1.00 0.00 ? 130 U A "HO2'" 1  
ATOM 4212   H "H1'"  . U A 1 130 ? 101.753 157.416 120.737 1.00 0.00 ? 130 U A "H1'"  1  
ATOM 4213   H H3     . U A 1 130 ? 102.474 157.634 125.199 1.00 0.00 ? 130 U A H3     1  
ATOM 4214   H H5     . U A 1 130 ? 103.362 153.808 124.097 1.00 0.00 ? 130 U A H5     1  
ATOM 4215   H H6     . U A 1 130 ? 103.135 154.450 121.911 1.00 0.00 ? 130 U A H6     1  
ATOM 4216   P P      . A A 1 131 ? 105.987 156.346 117.265 1.00 0.00 ? 131 A A P      1  
ATOM 4217   O OP1    . A A 1 131 ? 106.926 157.301 116.627 1.00 0.00 ? 131 A A OP1    1  
ATOM 4218   O OP2    . A A 1 131 ? 105.142 155.469 116.415 1.00 0.00 ? 131 A A OP2    1  
ATOM 4219   O "O5'"  . A A 1 131 ? 106.823 155.416 118.252 1.00 0.00 ? 131 A A "O5'"  1  
ATOM 4220   C "C5'"  . A A 1 131 ? 108.239 155.346 118.163 1.00 0.00 ? 131 A A "C5'"  1  
ATOM 4221   C "C4'"  . A A 1 131 ? 108.774 154.101 118.824 1.00 0.00 ? 131 A A "C4'"  1  
ATOM 4222   O "O4'"  . A A 1 131 ? 108.500 154.131 120.247 1.00 0.00 ? 131 A A "O4'"  1  
ATOM 4223   C "C3'"  . A A 1 131 ? 108.164 152.786 118.365 1.00 0.00 ? 131 A A "C3'"  1  
ATOM 4224   O "O3'"  . A A 1 131 ? 108.658 152.353 117.109 1.00 0.00 ? 131 A A "O3'"  1  
ATOM 4225   C "C2'"  . A A 1 131 ? 108.518 151.853 119.512 1.00 0.00 ? 131 A A "C2'"  1  
ATOM 4226   O "O2'"  . A A 1 131 ? 109.851 151.376 119.395 1.00 0.00 ? 131 A A "O2'"  1  
ATOM 4227   C "C1'"  . A A 1 131 ? 108.429 152.808 120.702 1.00 0.00 ? 131 A A "C1'"  1  
ATOM 4228   N N9     . A A 1 131 ? 107.176 152.635 121.462 1.00 0.00 ? 131 A A N9     1  
ATOM 4229   C C8     . A A 1 131 ? 106.333 153.610 121.935 1.00 0.00 ? 131 A A C8     1  
ATOM 4230   N N7     . A A 1 131 ? 105.292 153.143 122.578 1.00 0.00 ? 131 A A N7     1  
ATOM 4231   C C5     . A A 1 131 ? 105.458 151.766 122.525 1.00 0.00 ? 131 A A C5     1  
ATOM 4232   C C6     . A A 1 131 ? 104.690 150.699 123.025 1.00 0.00 ? 131 A A C6     1  
ATOM 4233   N N6     . A A 1 131 ? 103.552 150.860 123.703 1.00 0.00 ? 131 A A N6     1  
ATOM 4234   N N1     . A A 1 131 ? 105.136 149.444 122.800 1.00 0.00 ? 131 A A N1     1  
ATOM 4235   C C2     . A A 1 131 ? 106.278 149.282 122.118 1.00 0.00 ? 131 A A C2     1  
ATOM 4236   N N3     . A A 1 131 ? 107.086 150.203 121.600 1.00 0.00 ? 131 A A N3     1  
ATOM 4237   C C4     . A A 1 131 ? 106.614 151.439 121.841 1.00 0.00 ? 131 A A C4     1  
ATOM 4238   H "H5'"  . A A 1 131 ? 108.626 156.132 118.601 1.00 0.00 ? 131 A A "H5'"  1  
ATOM 4239   H "H5''" . A A 1 131 ? 108.501 155.345 117.219 1.00 0.00 ? 131 A A "H5''" 1  
ATOM 4240   H "H4'"  . A A 1 131 ? 109.744 154.065 118.685 1.00 0.00 ? 131 A A "H4'"  1  
ATOM 4241   H "H3'"  . A A 1 131 ? 107.188 152.874 118.312 1.00 0.00 ? 131 A A "H3'"  1  
ATOM 4242   H "H2'"  . A A 1 131 ? 107.874 151.117 119.589 1.00 0.00 ? 131 A A "H2'"  1  
ATOM 4243   H "HO2'" . A A 1 131 ? 110.037 150.767 120.139 1.00 0.00 ? 131 A A "HO2'" 1  
ATOM 4244   H "H1'"  . A A 1 131 ? 109.194 152.661 121.297 1.00 0.00 ? 131 A A "H1'"  1  
ATOM 4245   H H8     . A A 1 131 ? 106.496 154.568 121.804 1.00 0.00 ? 131 A A H8     1  
ATOM 4246   H H61    . A A 1 131 ? 103.060 150.077 124.027 1.00 0.00 ? 131 A A H61    1  
ATOM 4247   H H62    . A A 1 131 ? 103.209 151.761 123.879 1.00 0.00 ? 131 A A H62    1  
ATOM 4248   H H2     . A A 1 131 ? 106.558 148.352 121.982 1.00 0.00 ? 131 A A H2     1  
ATOM 4249   P P      . A A 1 132 ? 107.640 151.870 115.963 1.00 0.00 ? 132 A A P      1  
ATOM 4250   O OP1    . A A 1 132 ? 108.428 151.191 114.904 1.00 0.00 ? 132 A A OP1    1  
ATOM 4251   O OP2    . A A 1 132 ? 106.769 153.019 115.608 1.00 0.00 ? 132 A A OP2    1  
ATOM 4252   O "O5'"  . A A 1 132 ? 106.738 150.774 116.686 1.00 0.00 ? 132 A A "O5'"  1  
ATOM 4253   C "C5'"  . A A 1 132 ? 107.060 149.393 116.601 1.00 0.00 ? 132 A A "C5'"  1  
ATOM 4254   C "C4'"  . A A 1 132 ? 105.962 148.532 117.173 1.00 0.00 ? 132 A A "C4'"  1  
ATOM 4255   O "O4'"  . A A 1 132 ? 104.881 149.360 117.684 1.00 0.00 ? 132 A A "O4'"  1  
ATOM 4256   C "C3'"  . A A 1 132 ? 105.274 147.592 116.194 1.00 0.00 ? 132 A A "C3'"  1  
ATOM 4257   O "O3'"  . A A 1 132 ? 105.980 146.379 116.000 1.00 0.00 ? 132 A A "O3'"  1  
ATOM 4258   C "C2'"  . A A 1 132 ? 103.960 147.317 116.913 1.00 0.00 ? 132 A A "C2'"  1  
ATOM 4259   O "O2'"  . A A 1 132 ? 104.138 146.393 117.977 1.00 0.00 ? 132 A A "O2'"  1  
ATOM 4260   C "C1'"  . A A 1 132 ? 103.643 148.689 117.496 1.00 0.00 ? 132 A A "C1'"  1  
ATOM 4261   N N9     . A A 1 132 ? 102.763 149.478 116.613 1.00 0.00 ? 132 A A N9     1  
ATOM 4262   C C8     . A A 1 132 ? 103.113 150.198 115.497 1.00 0.00 ? 132 A A C8     1  
ATOM 4263   N N7     . A A 1 132 ? 102.103 150.798 114.918 1.00 0.00 ? 132 A A N7     1  
ATOM 4264   C C5     . A A 1 132 ? 101.013 150.452 115.705 1.00 0.00 ? 132 A A C5     1  
ATOM 4265   C C6     . A A 1 132 ? 99.646  150.771 115.624 1.00 0.00 ? 132 A A C6     1  
ATOM 4266   N N6     . A A 1 132 ? 99.122  151.543 114.669 1.00 0.00 ? 132 A A N6     1  
ATOM 4267   N N1     . A A 1 132 ? 98.825  150.263 116.568 1.00 0.00 ? 132 A A N1     1  
ATOM 4268   C C2     . A A 1 132 ? 99.350  149.488 117.525 1.00 0.00 ? 132 A A C2     1  
ATOM 4269   N N3     . A A 1 132 ? 100.616 149.117 117.708 1.00 0.00 ? 132 A A N3     1  
ATOM 4270   C C4     . A A 1 132 ? 101.406 149.639 116.752 1.00 0.00 ? 132 A A C4     1  
ATOM 4271   H "H5'"  . A A 1 132 ? 107.888 149.227 117.099 1.00 0.00 ? 132 A A "H5'"  1  
ATOM 4272   H "H5''" . A A 1 132 ? 107.199 149.154 115.662 1.00 0.00 ? 132 A A "H5''" 1  
ATOM 4273   H "H4'"  . A A 1 132 ? 106.336 148.004 117.909 1.00 0.00 ? 132 A A "H4'"  1  
ATOM 4274   H "H3'"  . A A 1 132 ? 105.116 148.015 115.324 1.00 0.00 ? 132 A A "H3'"  1  
ATOM 4275   H "H2'"  . A A 1 132 ? 103.263 147.023 116.289 1.00 0.00 ? 132 A A "H2'"  1  
ATOM 4276   H "HO2'" . A A 1 132 ? 103.401 145.748 117.965 1.00 0.00 ? 132 A A "HO2'" 1  
ATOM 4277   H "H1'"  . A A 1 132 ? 103.216 148.580 118.371 1.00 0.00 ? 132 A A "H1'"  1  
ATOM 4278   H H8     . A A 1 132 ? 104.033 150.256 115.164 1.00 0.00 ? 132 A A H8     1  
ATOM 4279   H H61    . A A 1 132 ? 98.160  151.730 114.665 1.00 0.00 ? 132 A A H61    1  
ATOM 4280   H H62    . A A 1 132 ? 99.698  151.923 113.974 1.00 0.00 ? 132 A A H62    1  
ATOM 4281   H H2     . A A 1 132 ? 98.713  149.144 118.186 1.00 0.00 ? 132 A A H2     1  
ATOM 4282   P P      . G A 1 133 ? 105.563 145.383 114.810 1.00 0.00 ? 133 G A P      1  
ATOM 4283   O OP1    . G A 1 133 ? 106.658 144.395 114.631 1.00 0.00 ? 133 G A OP1    1  
ATOM 4284   O OP2    . G A 1 133 ? 105.121 146.206 113.655 1.00 0.00 ? 133 G A OP2    1  
ATOM 4285   O "O5'"  . G A 1 133 ? 104.291 144.611 115.381 1.00 0.00 ? 133 G A "O5'"  1  
ATOM 4286   C "C5'"  . G A 1 133 ? 104.427 143.646 116.413 1.00 0.00 ? 133 G A "C5'"  1  
ATOM 4287   C "C4'"  . G A 1 133 ? 103.116 142.961 116.707 1.00 0.00 ? 133 G A "C4'"  1  
ATOM 4288   O "O4'"  . G A 1 133 ? 102.320 143.808 117.578 1.00 0.00 ? 133 G A "O4'"  1  
ATOM 4289   C "C3'"  . G A 1 133 ? 102.210 142.710 115.511 1.00 0.00 ? 133 G A "C3'"  1  
ATOM 4290   O "O3'"  . G A 1 133 ? 102.566 141.547 114.782 1.00 0.00 ? 133 G A "O3'"  1  
ATOM 4291   C "C2'"  . G A 1 133 ? 100.857 142.506 116.183 1.00 0.00 ? 133 G A "C2'"  1  
ATOM 4292   O "O2'"  . G A 1 133 ? 100.746 141.201 116.734 1.00 0.00 ? 133 G A "O2'"  1  
ATOM 4293   C "C1'"  . G A 1 133 ? 100.928 143.521 117.323 1.00 0.00 ? 133 G A "C1'"  1  
ATOM 4294   N N9     . G A 1 133 ? 100.167 144.749 117.023 1.00 0.00 ? 133 G A N9     1  
ATOM 4295   C C8     . G A 1 133 ? 100.631 145.882 116.400 1.00 0.00 ? 133 G A C8     1  
ATOM 4296   N N7     . G A 1 133 ? 99.719  146.808 116.274 1.00 0.00 ? 133 G A N7     1  
ATOM 4297   C C5     . G A 1 133 ? 98.585  146.253 116.848 1.00 0.00 ? 133 G A C5     1  
ATOM 4298   C C6     . G A 1 133 ? 97.279  146.786 117.005 1.00 0.00 ? 133 G A C6     1  
ATOM 4299   O O6     . G A 1 133 ? 96.852  147.893 116.658 1.00 0.00 ? 133 G A O6     1  
ATOM 4300   N N1     . G A 1 133 ? 96.431  145.885 117.643 1.00 0.00 ? 133 G A N1     1  
ATOM 4301   C C2     . G A 1 133 ? 96.792  144.631 118.073 1.00 0.00 ? 133 G A C2     1  
ATOM 4302   N N2     . G A 1 133 ? 95.832  143.906 118.667 1.00 0.00 ? 133 G A N2     1  
ATOM 4303   N N3     . G A 1 133 ? 98.005  144.123 117.932 1.00 0.00 ? 133 G A N3     1  
ATOM 4304   C C4     . G A 1 133 ? 98.844  144.981 117.315 1.00 0.00 ? 133 G A C4     1  
ATOM 4305   H "H5'"  . G A 1 133 ? 104.746 144.089 117.226 1.00 0.00 ? 133 G A "H5'"  1  
ATOM 4306   H "H5''" . G A 1 133 ? 105.085 142.973 116.137 1.00 0.00 ? 133 G A "H5''" 1  
ATOM 4307   H "H4'"  . G A 1 133 ? 103.286 142.109 117.162 1.00 0.00 ? 133 G A "H4'"  1  
ATOM 4308   H "H3'"  . G A 1 133 ? 102.189 143.476 114.901 1.00 0.00 ? 133 G A "H3'"  1  
ATOM 4309   H "H2'"  . G A 1 133 ? 100.118 142.705 115.571 1.00 0.00 ? 133 G A "H2'"  1  
ATOM 4310   H "HO2'" . G A 1 133 ? 99.845  140.856 116.559 1.00 0.00 ? 133 G A "HO2'" 1  
ATOM 4311   H "H1'"  . G A 1 133 ? 100.580 143.114 118.145 1.00 0.00 ? 133 G A "H1'"  1  
ATOM 4312   H H8     . G A 1 133 ? 101.552 145.987 116.083 1.00 0.00 ? 133 G A H8     1  
ATOM 4313   H H1     . G A 1 133 ? 95.505  146.169 117.795 1.00 0.00 ? 133 G A H1     1  
ATOM 4314   H H21    . G A 1 133 ? 94.931  144.276 118.775 1.00 0.00 ? 133 G A H21    1  
ATOM 4315   H H22    . G A 1 133 ? 96.032  143.004 118.994 1.00 0.00 ? 133 G A H22    1  
ATOM 4316   P P      . C A 1 134 ? 102.170 141.414 113.231 1.00 0.00 ? 134 C A P      1  
ATOM 4317   O OP1    . C A 1 134 ? 102.604 140.074 112.759 1.00 0.00 ? 134 C A OP1    1  
ATOM 4318   O OP2    . C A 1 134 ? 102.651 142.629 112.527 1.00 0.00 ? 134 C A OP2    1  
ATOM 4319   O "O5'"  . C A 1 134 ? 100.578 141.443 113.234 1.00 0.00 ? 134 C A "O5'"  1  
ATOM 4320   C "C5'"  . C A 1 134 ? 99.827  140.237 113.250 1.00 0.00 ? 134 C A "C5'"  1  
ATOM 4321   C "C4'"  . C A 1 134 ? 98.385  140.483 113.626 1.00 0.00 ? 134 C A "C4'"  1  
ATOM 4322   O "O4'"  . C A 1 134 ? 98.308  141.534 114.624 1.00 0.00 ? 134 C A "O4'"  1  
ATOM 4323   C "C3'"  . C A 1 134 ? 97.476  140.968 112.508 1.00 0.00 ? 134 C A "C3'"  1  
ATOM 4324   O "O3'"  . C A 1 134 ? 96.996  139.915 111.689 1.00 0.00 ? 134 C A "O3'"  1  
ATOM 4325   C "C2'"  . C A 1 134 ? 96.378  141.699 113.267 1.00 0.00 ? 134 C A "C2'"  1  
ATOM 4326   O "O2'"  . C A 1 134 ? 95.449  140.789 113.837 1.00 0.00 ? 134 C A "O2'"  1  
ATOM 4327   C "C1'"  . C A 1 134 ? 97.175  142.363 114.392 1.00 0.00 ? 134 C A "C1'"  1  
ATOM 4328   N N1     . C A 1 134 ? 97.604  143.740 114.041 1.00 0.00 ? 134 C A N1     1  
ATOM 4329   C C2     . C A 1 134 ? 96.662  144.771 114.121 1.00 0.00 ? 134 C A C2     1  
ATOM 4330   O O2     . C A 1 134 ? 95.504  144.507 114.480 1.00 0.00 ? 134 C A O2     1  
ATOM 4331   N N3     . C A 1 134 ? 97.028  146.035 113.807 1.00 0.00 ? 134 C A N3     1  
ATOM 4332   C C4     . C A 1 134 ? 98.279  146.293 113.425 1.00 0.00 ? 134 C A C4     1  
ATOM 4333   N N4     . C A 1 134 ? 98.596  147.555 113.126 1.00 0.00 ? 134 C A N4     1  
ATOM 4334   C C5     . C A 1 134 ? 99.260  145.265 113.332 1.00 0.00 ? 134 C A C5     1  
ATOM 4335   C C6     . C A 1 134 ? 98.886  144.020 113.648 1.00 0.00 ? 134 C A C6     1  
ATOM 4336   H "H5'"  . C A 1 134 ? 100.226 139.621 113.899 1.00 0.00 ? 134 C A "H5'"  1  
ATOM 4337   H "H5''" . C A 1 134 ? 99.860  139.831 112.359 1.00 0.00 ? 134 C A "H5''" 1  
ATOM 4338   H "H4'"  . C A 1 134 ? 98.013  139.659 114.003 1.00 0.00 ? 134 C A "H4'"  1  
ATOM 4339   H "H3'"  . C A 1 134 ? 97.962  141.610 111.952 1.00 0.00 ? 134 C A "H3'"  1  
ATOM 4340   H "H2'"  . C A 1 134 ? 95.932  142.365 112.702 1.00 0.00 ? 134 C A "H2'"  1  
ATOM 4341   H "HO2'" . C A 1 134 ? 95.517  139.929 113.372 1.00 0.00 ? 134 C A "HO2'" 1  
ATOM 4342   H "H1'"  . C A 1 134 ? 96.629  142.391 115.204 1.00 0.00 ? 134 C A "H1'"  1  
ATOM 4343   H H41    . C A 1 134 ? 97.914  148.258 113.189 1.00 0.00 ? 134 C A H41    1  
ATOM 4344   H H42    . C A 1 134 ? 99.505  147.778 112.841 1.00 0.00 ? 134 C A H42    1  
ATOM 4345   H H5     . C A 1 134 ? 100.178 145.466 113.051 1.00 0.00 ? 134 C A H5     1  
ATOM 4346   H H6     . C A 1 134 ? 99.548  143.300 113.590 1.00 0.00 ? 134 C A H6     1  
ATOM 4347   P P      . U A 1 135 ? 96.656  140.185 110.141 1.00 0.00 ? 135 U A P      1  
ATOM 4348   O OP1    . U A 1 135 ? 96.433  138.871 109.483 1.00 0.00 ? 135 U A OP1    1  
ATOM 4349   O OP2    . U A 1 135 ? 97.684  141.109 109.602 1.00 0.00 ? 135 U A OP2    1  
ATOM 4350   O "O5'"  . U A 1 135 ? 95.266  140.961 110.180 1.00 0.00 ? 135 U A "O5'"  1  
ATOM 4351   C "C5'"  . U A 1 135 ? 94.077  140.308 110.602 1.00 0.00 ? 135 U A "C5'"  1  
ATOM 4352   C "C4'"  . U A 1 135 ? 92.903  141.252 110.627 1.00 0.00 ? 135 U A "C4'"  1  
ATOM 4353   O "O4'"  . U A 1 135 ? 93.131  142.299 111.606 1.00 0.00 ? 135 U A "O4'"  1  
ATOM 4354   C "C3'"  . U A 1 135 ? 92.621  142.010 109.338 1.00 0.00 ? 135 U A "C3'"  1  
ATOM 4355   O "O3'"  . U A 1 135 ? 91.887  141.246 108.396 1.00 0.00 ? 135 U A "O3'"  1  
ATOM 4356   C "C2'"  . U A 1 135 ? 91.883  143.246 109.830 1.00 0.00 ? 135 U A "C2'"  1  
ATOM 4357   O "O2'"  . U A 1 135 ? 90.529  142.947 110.140 1.00 0.00 ? 135 U A "O2'"  1  
ATOM 4358   C "C1'"  . U A 1 135 ? 92.633  143.552 111.127 1.00 0.00 ? 135 U A "C1'"  1  
ATOM 4359   N N1     . U A 1 135 ? 93.754  144.498 110.918 1.00 0.00 ? 135 U A N1     1  
ATOM 4360   C C2     . U A 1 135 ? 93.436  145.841 110.811 1.00 0.00 ? 135 U A C2     1  
ATOM 4361   O O2     . U A 1 135 ? 92.293  146.260 110.879 1.00 0.00 ? 135 U A O2     1  
ATOM 4362   N N3     . U A 1 135 ? 94.506  146.680 110.617 1.00 0.00 ? 135 U A N3     1  
ATOM 4363   C C4     . U A 1 135 ? 95.836  146.324 110.524 1.00 0.00 ? 135 U A C4     1  
ATOM 4364   O O4     . U A 1 135 ? 96.684  147.200 110.349 1.00 0.00 ? 135 U A O4     1  
ATOM 4365   C C5     . U A 1 135 ? 96.089  144.921 110.646 1.00 0.00 ? 135 U A C5     1  
ATOM 4366   C C6     . U A 1 135 ? 95.067  144.081 110.834 1.00 0.00 ? 135 U A C6     1  
ATOM 4367   H "H5'"  . U A 1 135 ? 94.215  139.945 111.501 1.00 0.00 ? 135 U A "H5'"  1  
ATOM 4368   H "H5''" . U A 1 135 ? 93.881  139.571 109.985 1.00 0.00 ? 135 U A "H5''" 1  
ATOM 4369   H "H4'"  . U A 1 135 ? 92.099  140.749 110.880 1.00 0.00 ? 135 U A "H4'"  1  
ATOM 4370   H "H3'"  . U A 1 135 ? 93.473  142.283 108.934 1.00 0.00 ? 135 U A "H3'"  1  
ATOM 4371   H "H2'"  . U A 1 135 ? 91.955  143.987 109.192 1.00 0.00 ? 135 U A "H2'"  1  
ATOM 4372   H "HO2'" . U A 1 135 ? 90.271  142.120 109.683 1.00 0.00 ? 135 U A "HO2'" 1  
ATOM 4373   H "H1'"  . U A 1 135 ? 92.010  143.929 111.782 1.00 0.00 ? 135 U A "H1'"  1  
ATOM 4374   H H3     . U A 1 135 ? 94.303  147.635 110.537 1.00 0.00 ? 135 U A H3     1  
ATOM 4375   H H5     . U A 1 135 ? 97.007  144.581 110.592 1.00 0.00 ? 135 U A H5     1  
ATOM 4376   H H6     . U A 1 135 ? 95.267  143.126 110.914 1.00 0.00 ? 135 U A H6     1  
ATOM 4377   P P      . G A 1 136 ? 92.103  141.477 106.819 1.00 0.00 ? 136 G A P      1  
ATOM 4378   O OP1    . G A 1 136 ? 91.410  140.381 106.096 1.00 0.00 ? 136 G A OP1    1  
ATOM 4379   O OP2    . G A 1 136 ? 93.550  141.712 106.583 1.00 0.00 ? 136 G A OP2    1  
ATOM 4380   O "O5'"  . G A 1 136 ? 91.326  142.835 106.520 1.00 0.00 ? 136 G A "O5'"  1  
ATOM 4381   C "C5'"  . G A 1 136 ? 89.912  142.898 106.602 1.00 0.00 ? 136 G A "C5'"  1  
ATOM 4382   C "C4'"  . G A 1 136 ? 89.410  144.315 106.463 1.00 0.00 ? 136 G A "C4'"  1  
ATOM 4383   O "O4'"  . G A 1 136 ? 89.962  145.136 107.525 1.00 0.00 ? 136 G A "O4'"  1  
ATOM 4384   C "C3'"  . G A 1 136 ? 89.810  145.042 105.188 1.00 0.00 ? 136 G A "C3'"  1  
ATOM 4385   O "O3'"  . G A 1 136 ? 88.987  144.713 104.081 1.00 0.00 ? 136 G A "O3'"  1  
ATOM 4386   C "C2'"  . G A 1 136 ? 89.727  146.505 105.598 1.00 0.00 ? 136 G A "C2'"  1  
ATOM 4387   O "O2'"  . G A 1 136 ? 88.380  146.957 105.622 1.00 0.00 ? 136 G A "O2'"  1  
ATOM 4388   C "C1'"  . G A 1 136 ? 90.257  146.451 107.031 1.00 0.00 ? 136 G A "C1'"  1  
ATOM 4389   N N9     . G A 1 136 ? 91.706  146.723 107.096 1.00 0.00 ? 136 G A N9     1  
ATOM 4390   C C8     . G A 1 136 ? 92.714  145.815 107.327 1.00 0.00 ? 136 G A C8     1  
ATOM 4391   N N7     . G A 1 136 ? 93.902  146.357 107.327 1.00 0.00 ? 136 G A N7     1  
ATOM 4392   C C5     . G A 1 136 ? 93.666  147.703 107.081 1.00 0.00 ? 136 G A C5     1  
ATOM 4393   C C6     . G A 1 136 ? 94.572  148.788 106.969 1.00 0.00 ? 136 G A C6     1  
ATOM 4394   O O6     . G A 1 136 ? 95.805  148.777 107.065 1.00 0.00 ? 136 G A O6     1  
ATOM 4395   N N1     . G A 1 136 ? 93.908  149.986 106.717 1.00 0.00 ? 136 G A N1     1  
ATOM 4396   C C2     . G A 1 136 ? 92.546  150.121 106.590 1.00 0.00 ? 136 G A C2     1  
ATOM 4397   N N2     . G A 1 136 ? 92.093  151.360 106.347 1.00 0.00 ? 136 G A N2     1  
ATOM 4398   N N3     . G A 1 136 ? 91.692  149.116 106.694 1.00 0.00 ? 136 G A N3     1  
ATOM 4399   C C4     . G A 1 136 ? 92.316  147.944 106.937 1.00 0.00 ? 136 G A C4     1  
ATOM 4400   H "H5'"  . G A 1 136 ? 89.624  142.543 107.468 1.00 0.00 ? 136 G A "H5'"  1  
ATOM 4401   H "H5''" . G A 1 136 ? 89.524  142.351 105.888 1.00 0.00 ? 136 G A "H5''" 1  
ATOM 4402   H "H4'"  . G A 1 136 ? 88.432  144.316 106.534 1.00 0.00 ? 136 G A "H4'"  1  
ATOM 4403   H "H3'"  . G A 1 136 ? 90.742  144.822 104.969 1.00 0.00 ? 136 G A "H3'"  1  
ATOM 4404   H "H2'"  . G A 1 136 ? 90.288  147.072 105.029 1.00 0.00 ? 136 G A "H2'"  1  
ATOM 4405   H "HO2'" . G A 1 136 ? 88.368  147.912 105.838 1.00 0.00 ? 136 G A "HO2'" 1  
ATOM 4406   H "H1'"  . G A 1 136 ? 89.779  147.104 107.582 1.00 0.00 ? 136 G A "H1'"  1  
ATOM 4407   H H8     . G A 1 136 ? 92.557  144.860 107.475 1.00 0.00 ? 136 G A H8     1  
ATOM 4408   H H1     . G A 1 136 ? 94.456  150.794 106.623 1.00 0.00 ? 136 G A H1     1  
ATOM 4409   H H21    . G A 1 136 ? 92.719  152.108 106.270 1.00 0.00 ? 136 G A H21    1  
ATOM 4410   H H22    . G A 1 136 ? 91.130  151.516 106.247 1.00 0.00 ? 136 G A H22    1  
ATOM 4411   P P      . A A 1 137 ? 89.582  144.762 102.589 1.00 0.00 ? 137 A A P      1  
ATOM 4412   O OP1    . A A 1 137 ? 88.570  144.184 101.669 1.00 0.00 ? 137 A A OP1    1  
ATOM 4413   O OP2    . A A 1 137 ? 90.953  144.195 102.622 1.00 0.00 ? 137 A A OP2    1  
ATOM 4414   O "O5'"  . A A 1 137 ? 89.702  146.320 102.273 1.00 0.00 ? 137 A A "O5'"  1  
ATOM 4415   C "C5'"  . A A 1 137 ? 88.544  147.132 102.157 1.00 0.00 ? 137 A A "C5'"  1  
ATOM 4416   C "C4'"  . A A 1 137 ? 88.901  148.588 101.988 1.00 0.00 ? 137 A A "C4'"  1  
ATOM 4417   O "O4'"  . A A 1 137 ? 89.623  149.056 103.156 1.00 0.00 ? 137 A A "O4'"  1  
ATOM 4418   C "C3'"  . A A 1 137 ? 89.824  148.915 100.826 1.00 0.00 ? 137 A A "C3'"  1  
ATOM 4419   O "O3'"  . A A 1 137 ? 89.144  149.008 99.585  1.00 0.00 ? 137 A A "O3'"  1  
ATOM 4420   C "C2'"  . A A 1 137 ? 90.467  150.222 101.270 1.00 0.00 ? 137 A A "C2'"  1  
ATOM 4421   O "O2'"  . A A 1 137 ? 89.586  151.318 101.081 1.00 0.00 ? 137 A A "O2'"  1  
ATOM 4422   C "C1'"  . A A 1 137 ? 90.643  149.981 102.770 1.00 0.00 ? 137 A A "C1'"  1  
ATOM 4423   N N9     . A A 1 137 ? 91.981  149.452 103.093 1.00 0.00 ? 137 A A N9     1  
ATOM 4424   C C8     . A A 1 137 ? 92.319  148.168 103.446 1.00 0.00 ? 137 A A C8     1  
ATOM 4425   N N7     . A A 1 137 ? 93.599  148.002 103.676 1.00 0.00 ? 137 A A N7     1  
ATOM 4426   C C5     . A A 1 137 ? 94.141  149.261 103.460 1.00 0.00 ? 137 A A C5     1  
ATOM 4427   C C6     . A A 1 137 ? 95.456  149.754 103.542 1.00 0.00 ? 137 A A C6     1  
ATOM 4428   N N6     . A A 1 137 ? 96.509  149.002 103.875 1.00 0.00 ? 137 A A N6     1  
ATOM 4429   N N1     . A A 1 137 ? 95.658  151.059 103.267 1.00 0.00 ? 137 A A N1     1  
ATOM 4430   C C2     . A A 1 137 ? 94.603  151.814 102.932 1.00 0.00 ? 137 A A C2     1  
ATOM 4431   N N3     . A A 1 137 ? 93.321  151.468 102.820 1.00 0.00 ? 137 A A N3     1  
ATOM 4432   C C4     . A A 1 137 ? 93.157  150.162 103.102 1.00 0.00 ? 137 A A C4     1  
ATOM 4433   H "H5'"  . A A 1 137 ? 88.000  147.030 102.967 1.00 0.00 ? 137 A A "H5'"  1  
ATOM 4434   H "H5''" . A A 1 137 ? 88.022  146.837 101.382 1.00 0.00 ? 137 A A "H5''" 1  
ATOM 4435   H "H4'"  . A A 1 137 ? 88.074  149.107 101.893 1.00 0.00 ? 137 A A "H4'"  1  
ATOM 4436   H "H3'"  . A A 1 137 ? 90.518  148.224 100.761 1.00 0.00 ? 137 A A "H3'"  1  
ATOM 4437   H "H2'"  . A A 1 137 ? 91.328  150.369 100.827 1.00 0.00 ? 137 A A "H2'"  1  
ATOM 4438   H "HO2'" . A A 1 137 ? 90.046  152.146 101.333 1.00 0.00 ? 137 A A "HO2'" 1  
ATOM 4439   H "H1'"  . A A 1 137 ? 90.498  150.820 103.255 1.00 0.00 ? 137 A A "H1'"  1  
ATOM 4440   H H8     . A A 1 137 ? 91.665  147.441 103.518 1.00 0.00 ? 137 A A H8     1  
ATOM 4441   H H61    . A A 1 137 ? 97.403  149.401 103.916 1.00 0.00 ? 137 A A H61    1  
ATOM 4442   H H62    . A A 1 137 ? 96.386  148.050 104.081 1.00 0.00 ? 137 A A H62    1  
ATOM 4443   H H2     . A A 1 137 ? 94.802  152.754 102.741 1.00 0.00 ? 137 A A H2     1  
ATOM 4444   P P      . C A 1 138 ? 89.874  148.528 98.242  1.00 0.00 ? 138 C A P      1  
ATOM 4445   O OP1    . C A 1 138 ? 89.184  149.233 97.131  1.00 0.00 ? 138 C A OP1    1  
ATOM 4446   O OP2    . C A 1 138 ? 89.868  147.044 98.284  1.00 0.00 ? 138 C A OP2    1  
ATOM 4447   O "O5'"  . C A 1 138 ? 91.388  149.019 98.270  1.00 0.00 ? 138 C A "O5'"  1  
ATOM 4448   C "C5'"  . C A 1 138 ? 92.457  148.094 98.142  1.00 0.00 ? 138 C A "C5'"  1  
ATOM 4449   C "C4'"  . C A 1 138 ? 93.609  148.678 97.361  1.00 0.00 ? 138 C A "C4'"  1  
ATOM 4450   O "O4'"  . C A 1 138 ? 94.467  149.445 98.247  1.00 0.00 ? 138 C A "O4'"  1  
ATOM 4451   C "C3'"  . C A 1 138 ? 94.551  147.678 96.708  1.00 0.00 ? 138 C A "C3'"  1  
ATOM 4452   O "O3'"  . C A 1 138 ? 94.068  147.192 95.466  1.00 0.00 ? 138 C A "O3'"  1  
ATOM 4453   C "C2'"  . C A 1 138 ? 95.846  148.467 96.591  1.00 0.00 ? 138 C A "C2'"  1  
ATOM 4454   O "O2'"  . C A 1 138 ? 95.799  149.380 95.501  1.00 0.00 ? 138 C A "O2'"  1  
ATOM 4455   C "C1'"  . C A 1 138 ? 95.841  149.262 97.898  1.00 0.00 ? 138 C A "C1'"  1  
ATOM 4456   N N1     . C A 1 138 ? 96.553  148.551 98.990  1.00 0.00 ? 138 C A N1     1  
ATOM 4457   C C2     . C A 1 138 ? 97.952  148.587 99.003  1.00 0.00 ? 138 C A C2     1  
ATOM 4458   O O2     . C A 1 138 ? 98.551  149.201 98.108  1.00 0.00 ? 138 C A O2     1  
ATOM 4459   N N3     . C A 1 138 ? 98.626  147.947 99.988  1.00 0.00 ? 138 C A N3     1  
ATOM 4460   C C4     . C A 1 138 ? 97.959  147.291 100.937 1.00 0.00 ? 138 C A C4     1  
ATOM 4461   N N4     . C A 1 138 ? 98.666  146.678 101.889 1.00 0.00 ? 138 C A N4     1  
ATOM 4462   C C5     . C A 1 138 ? 96.537  147.239 100.952 1.00 0.00 ? 138 C A C5     1  
ATOM 4463   C C6     . C A 1 138 ? 95.882  147.874 99.974  1.00 0.00 ? 138 C A C6     1  
ATOM 4464   H "H5'"  . C A 1 138 ? 92.133  147.293 97.682  1.00 0.00 ? 138 C A "H5'"  1  
ATOM 4465   H "H5''" . C A 1 138 ? 92.771  147.845 99.037  1.00 0.00 ? 138 C A "H5''" 1  
ATOM 4466   H "H4'"  . C A 1 138 ? 93.251  149.274 96.671  1.00 0.00 ? 138 C A "H4'"  1  
ATOM 4467   H "H3'"  . C A 1 138 ? 94.692  146.924 97.316  1.00 0.00 ? 138 C A "H3'"  1  
ATOM 4468   H "H2'"  . C A 1 138 ? 96.627  147.877 96.534  1.00 0.00 ? 138 C A "H2'"  1  
ATOM 4469   H "HO2'" . C A 1 138 ? 95.101  149.094 94.877  1.00 0.00 ? 138 C A "HO2'" 1  
ATOM 4470   H "H1'"  . C A 1 138 ? 96.258  150.135 97.753  1.00 0.00 ? 138 C A "H1'"  1  
ATOM 4471   H H41    . C A 1 138 ? 99.644  146.715 101.876 1.00 0.00 ? 138 C A H41    1  
ATOM 4472   H H42    . C A 1 138 ? 98.204  146.187 102.602 1.00 0.00 ? 138 C A H42    1  
ATOM 4473   H H5     . C A 1 138 ? 96.055  146.753 101.654 1.00 0.00 ? 138 C A H5     1  
ATOM 4474   H H6     . C A 1 138 ? 94.902  147.849 99.967  1.00 0.00 ? 138 C A H6     1  
ATOM 4475   P P      . G A 1 139 ? 94.422  145.698 94.993  1.00 0.00 ? 139 G A P      1  
ATOM 4476   O OP1    . G A 1 139 ? 93.580  145.380 93.811  1.00 0.00 ? 139 G A OP1    1  
ATOM 4477   O OP2    . G A 1 139 ? 94.378  144.814 96.184  1.00 0.00 ? 139 G A OP2    1  
ATOM 4478   O "O5'"  . G A 1 139 ? 95.936  145.795 94.505  1.00 0.00 ? 139 G A "O5'"  1  
ATOM 4479   C "C5'"  . G A 1 139 ? 96.282  146.528 93.340  1.00 0.00 ? 139 G A "C5'"  1  
ATOM 4480   C "C4'"  . G A 1 139 ? 97.777  146.640 93.179  1.00 0.00 ? 139 G A "C4'"  1  
ATOM 4481   O "O4'"  . G A 1 139 ? 98.346  147.312 94.332  1.00 0.00 ? 139 G A "O4'"  1  
ATOM 4482   C "C3'"  . G A 1 139 ? 98.541  145.327 93.102  1.00 0.00 ? 139 G A "C3'"  1  
ATOM 4483   O "O3'"  . G A 1 139 ? 98.508  144.742 91.810  1.00 0.00 ? 139 G A "O3'"  1  
ATOM 4484   C "C2'"  . G A 1 139 ? 99.937  145.724 93.557  1.00 0.00 ? 139 G A "C2'"  1  
ATOM 4485   O "O2'"  . G A 1 139 ? 100.645 146.389 92.521  1.00 0.00 ? 139 G A "O2'"  1  
ATOM 4486   C "C1'"  . G A 1 139 ? 99.620  146.733 94.663  1.00 0.00 ? 139 G A "C1'"  1  
ATOM 4487   N N9     . G A 1 139 ? 99.570  146.099 95.995  1.00 0.00 ? 139 G A N9     1  
ATOM 4488   C C8     . G A 1 139 ? 98.454  145.851 96.756  1.00 0.00 ? 139 G A C8     1  
ATOM 4489   N N7     . G A 1 139 ? 98.726  145.276 97.896  1.00 0.00 ? 139 G A N7     1  
ATOM 4490   C C5     . G A 1 139 ? 100.105 145.135 97.887  1.00 0.00 ? 139 G A C5     1  
ATOM 4491   C C6     . G A 1 139 ? 100.980 144.576 98.856  1.00 0.00 ? 139 G A C6     1  
ATOM 4492   O O6     . G A 1 139 ? 100.697 144.079 99.952  1.00 0.00 ? 139 G A O6     1  
ATOM 4493   N N1     . G A 1 139 ? 102.307 144.634 98.443  1.00 0.00 ? 139 G A N1     1  
ATOM 4494   C C2     . G A 1 139 ? 102.740 145.162 97.250  1.00 0.00 ? 139 G A C2     1  
ATOM 4495   N N2     . G A 1 139 ? 104.062 145.129 97.030  1.00 0.00 ? 139 G A N2     1  
ATOM 4496   N N3     . G A 1 139 ? 101.936 145.685 96.338  1.00 0.00 ? 139 G A N3     1  
ATOM 4497   C C4     . G A 1 139 ? 100.644 145.639 96.720  1.00 0.00 ? 139 G A C4     1  
ATOM 4498   H "H5'"  . G A 1 139 ? 95.897  147.427 93.401  1.00 0.00 ? 139 G A "H5'"  1  
ATOM 4499   H "H5''" . G A 1 139 ? 95.907  146.073 92.554  1.00 0.00 ? 139 G A "H5''" 1  
ATOM 4500   H "H4'"  . G A 1 139 ? 97.970  147.166 92.375  1.00 0.00 ? 139 G A "H4'"  1  
ATOM 4501   H "H3'"  . G A 1 139 ? 98.160  144.695 93.749  1.00 0.00 ? 139 G A "H3'"  1  
ATOM 4502   H "H2'"  . G A 1 139 ? 100.436 144.957 93.905  1.00 0.00 ? 139 G A "H2'"  1  
ATOM 4503   H "HO2'" . G A 1 139 ? 100.234 146.174 91.660  1.00 0.00 ? 139 G A "HO2'" 1  
ATOM 4504   H "H1'"  . G A 1 139 ? 100.297 147.441 94.665  1.00 0.00 ? 139 G A "H1'"  1  
ATOM 4505   H H8     . G A 1 139 ? 97.545  146.084 96.475  1.00 0.00 ? 139 G A H8     1  
ATOM 4506   H H1     . G A 1 139 ? 102.984 144.271 99.052  1.00 0.00 ? 139 G A H1     1  
ATOM 4507   H H21    . G A 1 139 ? 104.665 144.743 97.699  1.00 0.00 ? 139 G A H21    1  
ATOM 4508   H H22    . G A 1 139 ? 104.430 145.490 96.196  1.00 0.00 ? 139 G A H22    1  
ATOM 4509   P P      . G A 1 140 ? 98.579  143.145 91.646  1.00 0.00 ? 140 G A P      1  
ATOM 4510   O OP1    . G A 1 140 ? 98.313  142.817 90.221  1.00 0.00 ? 140 G A OP1    1  
ATOM 4511   O OP2    . G A 1 140 ? 97.737  142.536 92.707  1.00 0.00 ? 140 G A OP2    1  
ATOM 4512   O "O5'"  . G A 1 140 ? 100.101 142.790 91.958  1.00 0.00 ? 140 G A "O5'"  1  
ATOM 4513   C "C5'"  . G A 1 140 ? 101.141 143.219 91.092  1.00 0.00 ? 140 G A "C5'"  1  
ATOM 4514   C "C4'"  . G A 1 140 ? 102.501 142.881 91.650  1.00 0.00 ? 140 G A "C4'"  1  
ATOM 4515   O "O4'"  . G A 1 140 ? 102.699 143.566 92.913  1.00 0.00 ? 140 G A "O4'"  1  
ATOM 4516   C "C3'"  . G A 1 140 ? 102.739 141.415 91.982  1.00 0.00 ? 140 G A "C3'"  1  
ATOM 4517   O "O3'"  . G A 1 140 ? 103.081 140.638 90.847  1.00 0.00 ? 140 G A "O3'"  1  
ATOM 4518   C "C2'"  . G A 1 140 ? 103.845 141.489 93.027  1.00 0.00 ? 140 G A "C2'"  1  
ATOM 4519   O "O2'"  . G A 1 140 ? 105.109 141.721 92.426  1.00 0.00 ? 140 G A "O2'"  1  
ATOM 4520   C "C1'"  . G A 1 140 ? 103.434 142.732 93.817  1.00 0.00 ? 140 G A "C1'"  1  
ATOM 4521   N N9     . G A 1 140 ? 102.623 142.396 95.003  1.00 0.00 ? 140 G A N9     1  
ATOM 4522   C C8     . G A 1 140 ? 101.279 142.616 95.183  1.00 0.00 ? 140 G A C8     1  
ATOM 4523   N N7     . G A 1 140 ? 100.842 142.209 96.342  1.00 0.00 ? 140 G A N7     1  
ATOM 4524   C C5     . G A 1 140 ? 101.963 141.687 96.968  1.00 0.00 ? 140 G A C5     1  
ATOM 4525   C C6     . G A 1 140 ? 102.111 141.096 98.248  1.00 0.00 ? 140 G A C6     1  
ATOM 4526   O O6     . G A 1 140 ? 101.248 140.909 99.117  1.00 0.00 ? 140 G A O6     1  
ATOM 4527   N N1     . G A 1 140 ? 103.425 140.702 98.485  1.00 0.00 ? 140 G A N1     1  
ATOM 4528   C C2     . G A 1 140 ? 104.464 140.855 97.602  1.00 0.00 ? 140 G A C2     1  
ATOM 4529   N N2     . G A 1 140 ? 105.663 140.413 98.009  1.00 0.00 ? 140 G A N2     1  
ATOM 4530   N N3     . G A 1 140 ? 104.340 141.406 96.403  1.00 0.00 ? 140 G A N3     1  
ATOM 4531   C C4     . G A 1 140 ? 103.074 141.796 96.155  1.00 0.00 ? 140 G A C4     1  
ATOM 4532   H "H5'"  . G A 1 140 ? 101.077 144.189 90.970  1.00 0.00 ? 140 G A "H5'"  1  
ATOM 4533   H "H5''" . G A 1 140 ? 101.034 142.782 90.221  1.00 0.00 ? 140 G A "H5''" 1  
ATOM 4534   H "H4'"  . G A 1 140 ? 103.187 143.177 91.014  1.00 0.00 ? 140 G A "H4'"  1  
ATOM 4535   H "H3'"  . G A 1 140 ? 101.932 141.044 92.394  1.00 0.00 ? 140 G A "H3'"  1  
ATOM 4536   H "H2'"  . G A 1 140 ? 103.854 140.691 93.597  1.00 0.00 ? 140 G A "H2'"  1  
ATOM 4537   H "HO2'" . G A 1 140 ? 105.063 141.472 91.481  1.00 0.00 ? 140 G A "HO2'" 1  
ATOM 4538   H "H1'"  . G A 1 140 ? 104.237 143.220 94.097  1.00 0.00 ? 140 G A "H1'"  1  
ATOM 4539   H H8     . G A 1 140 ? 100.707 143.038 94.508  1.00 0.00 ? 140 G A H8     1  
ATOM 4540   H H1     . G A 1 140 ? 103.620 140.283 99.349  1.00 0.00 ? 140 G A H1     1  
ATOM 4541   H H21    . G A 1 140 ? 105.762 140.006 98.895  1.00 0.00 ? 140 G A H21    1  
ATOM 4542   H H22    . G A 1 140 ? 106.442 140.497 97.421  1.00 0.00 ? 140 G A H22    1  
ATOM 4543   P P      . A A 1 141 ? 102.571 139.118 90.726  1.00 0.00 ? 141 A A P      1  
ATOM 4544   O OP1    . A A 1 141 ? 103.021 138.585 89.416  1.00 0.00 ? 141 A A OP1    1  
ATOM 4545   O OP2    . A A 1 141 ? 101.129 139.089 91.074  1.00 0.00 ? 141 A A OP2    1  
ATOM 4546   O "O5'"  . A A 1 141 ? 103.370 138.352 91.872  1.00 0.00 ? 141 A A "O5'"  1  
ATOM 4547   C "C5'"  . A A 1 141 ? 104.788 138.281 91.850  1.00 0.00 ? 141 A A "C5'"  1  
ATOM 4548   C "C4'"  . A A 1 141 ? 105.339 137.781 93.161  1.00 0.00 ? 141 A A "C4'"  1  
ATOM 4549   O "O4'"  . A A 1 141 ? 104.953 138.678 94.246  1.00 0.00 ? 141 A A "O4'"  1  
ATOM 4550   C "C3'"  . A A 1 141 ? 104.833 136.422 93.622  1.00 0.00 ? 141 A A "C3'"  1  
ATOM 4551   O "O3'"  . A A 1 141 ? 105.472 135.341 92.966  1.00 0.00 ? 141 A A "O3'"  1  
ATOM 4552   C "C2'"  . A A 1 141 ? 105.080 136.482 95.120  1.00 0.00 ? 141 A A "C2'"  1  
ATOM 4553   O "O2'"  . A A 1 141 ? 106.452 136.279 95.424  1.00 0.00 ? 141 A A "O2'"  1  
ATOM 4554   C "C1'"  . A A 1 141 ? 104.705 137.938 95.407  1.00 0.00 ? 141 A A "C1'"  1  
ATOM 4555   N N9     . A A 1 141 ? 103.289 138.082 95.795  1.00 0.00 ? 141 A A N9     1  
ATOM 4556   C C8     . A A 1 141 ? 102.233 138.467 95.006  1.00 0.00 ? 141 A A C8     1  
ATOM 4557   N N7     . A A 1 141 ? 101.086 138.502 95.639  1.00 0.00 ? 141 A A N7     1  
ATOM 4558   C C5     . A A 1 141 ? 101.407 138.113 96.932  1.00 0.00 ? 141 A A C5     1  
ATOM 4559   C C6     . A A 1 141 ? 100.630 137.948 98.092  1.00 0.00 ? 141 A A C6     1  
ATOM 4560   N N6     . A A 1 141 ? 99.313  138.163 98.138  1.00 0.00 ? 141 A A N6     1  
ATOM 4561   N N1     . A A 1 141 ? 101.259 137.549 99.219  1.00 0.00 ? 141 A A N1     1  
ATOM 4562   C C2     . A A 1 141 ? 102.580 137.333 99.174  1.00 0.00 ? 141 A A C2     1  
ATOM 4563   N N3     . A A 1 141 ? 103.418 137.453 98.146  1.00 0.00 ? 141 A A N3     1  
ATOM 4564   C C4     . A A 1 141 ? 102.760 137.851 97.042  1.00 0.00 ? 141 A A C4     1  
ATOM 4565   H "H5'"  . A A 1 141 ? 105.150 139.174 91.671  1.00 0.00 ? 141 A A "H5'"  1  
ATOM 4566   H "H5''" . A A 1 141 ? 105.068 137.675 91.133  1.00 0.00 ? 141 A A "H5''" 1  
ATOM 4567   H "H4'"  . A A 1 141 ? 106.317 137.756 93.106  1.00 0.00 ? 141 A A "H4'"  1  
ATOM 4568   H "H3'"  . A A 1 141 ? 103.869 136.364 93.455  1.00 0.00 ? 141 A A "H3'"  1  
ATOM 4569   H "H2'"  . A A 1 141 ? 104.503 135.854 95.604  1.00 0.00 ? 141 A A "H2'"  1  
ATOM 4570   H "HO2'" . A A 1 141 ? 106.522 135.657 96.178  1.00 0.00 ? 141 A A "HO2'" 1  
ATOM 4571   H "H1'"  . A A 1 141 ? 105.277 138.286 96.124  1.00 0.00 ? 141 A A "H1'"  1  
ATOM 4572   H H8     . A A 1 141 ? 102.328 138.695 94.058  1.00 0.00 ? 141 A A H8     1  
ATOM 4573   H H61    . A A 1 141 ? 98.824  138.031 98.977  1.00 0.00 ? 141 A A H61    1  
ATOM 4574   H H62    . A A 1 141 ? 98.836  138.453 97.333  1.00 0.00 ? 141 A A H62    1  
ATOM 4575   H H2     . A A 1 141 ? 102.988 137.045 100.017 1.00 0.00 ? 141 A A H2     1  
ATOM 4576   P P      . C A 1 142 ? 104.681 133.963 92.721  1.00 0.00 ? 142 C A P      1  
ATOM 4577   O OP1    . C A 1 142 ? 105.467 133.147 91.761  1.00 0.00 ? 142 C A OP1    1  
ATOM 4578   O OP2    . C A 1 142 ? 103.266 134.293 92.417  1.00 0.00 ? 142 C A OP2    1  
ATOM 4579   O "O5'"  . C A 1 142 ? 104.725 133.235 94.137  1.00 0.00 ? 142 C A "O5'"  1  
ATOM 4580   C "C5'"  . C A 1 142 ? 105.959 132.995 94.796  1.00 0.00 ? 142 C A "C5'"  1  
ATOM 4581   C "C4'"  . C A 1 142 ? 105.781 132.887 96.291  1.00 0.00 ? 142 C A "C4'"  1  
ATOM 4582   O "O4'"  . C A 1 142 ? 105.162 134.086 96.811  1.00 0.00 ? 142 C A "O4'"  1  
ATOM 4583   C "C3'"  . C A 1 142 ? 104.861 131.779 96.778  1.00 0.00 ? 142 C A "C3'"  1  
ATOM 4584   O "O3'"  . C A 1 142 ? 105.505 130.518 96.852  1.00 0.00 ? 142 C A "O3'"  1  
ATOM 4585   C "C2'"  . C A 1 142 ? 104.403 132.311 98.128  1.00 0.00 ? 142 C A "C2'"  1  
ATOM 4586   O "O2'"  . C A 1 142 ? 105.414 132.156 99.112  1.00 0.00 ? 142 C A "O2'"  1  
ATOM 4587   C "C1'"  . C A 1 142 ? 104.229 133.800 97.815  1.00 0.00 ? 142 C A "C1'"  1  
ATOM 4588   N N1     . C A 1 142 ? 102.873 134.113 97.300  1.00 0.00 ? 142 C A N1     1  
ATOM 4589   C C2     . C A 1 142 ? 101.841 134.317 98.225  1.00 0.00 ? 142 C A C2     1  
ATOM 4590   O O2     . C A 1 142 ? 102.088 134.229 99.438  1.00 0.00 ? 142 C A O2     1  
ATOM 4591   N N3     . C A 1 142 ? 100.596 134.604 97.782  1.00 0.00 ? 142 C A N3     1  
ATOM 4592   C C4     . C A 1 142 ? 100.356 134.692 96.473  1.00 0.00 ? 142 C A C4     1  
ATOM 4593   N N4     . C A 1 142 ? 99.112  134.978 96.082  1.00 0.00 ? 142 C A N4     1  
ATOM 4594   C C5     . C A 1 142 ? 101.383 134.491 95.508  1.00 0.00 ? 142 C A C5     1  
ATOM 4595   C C6     . C A 1 142 ? 102.611 134.208 95.959  1.00 0.00 ? 142 C A C6     1  
ATOM 4596   H "H5'"  . C A 1 142 ? 106.575 133.732 94.600  1.00 0.00 ? 142 C A "H5'"  1  
ATOM 4597   H "H5''" . C A 1 142 ? 106.343 132.159 94.459  1.00 0.00 ? 142 C A "H5''" 1  
ATOM 4598   H "H4'"  . C A 1 142 ? 106.662 132.784 96.707  1.00 0.00 ? 142 C A "H4'"  1  
ATOM 4599   H "H3'"  . C A 1 142 ? 104.089 131.712 96.178  1.00 0.00 ? 142 C A "H3'"  1  
ATOM 4600   H "H2'"  . C A 1 142 ? 103.559 131.899 98.407  1.00 0.00 ? 142 C A "H2'"  1  
ATOM 4601   H "HO2'" . C A 1 142 ? 106.009 131.424 98.848  1.00 0.00 ? 142 C A "HO2'" 1  
ATOM 4602   H "H1'"  . C A 1 142 ? 104.398 134.321 98.627  1.00 0.00 ? 142 C A "H1'"  1  
ATOM 4603   H H41    . C A 1 142 ? 98.408  135.115 96.749  1.00 0.00 ? 142 C A H41    1  
ATOM 4604   H H42    . C A 1 142 ? 98.904  135.050 95.127  1.00 0.00 ? 142 C A H42    1  
ATOM 4605   H H5     . C A 1 142 ? 101.197 134.558 94.548  1.00 0.00 ? 142 C A H5     1  
ATOM 4606   H H6     . C A 1 142 ? 103.331 134.066 95.310  1.00 0.00 ? 142 C A H6     1  
ATOM 4607   P P      . A A 1 143 ? 104.748 129.193 96.346  1.00 0.00 ? 143 A A P      1  
ATOM 4608   O OP1    . A A 1 143 ? 105.762 128.125 96.164  1.00 0.00 ? 143 A A OP1    1  
ATOM 4609   O OP2    . A A 1 143 ? 103.867 129.571 95.213  1.00 0.00 ? 143 A A OP2    1  
ATOM 4610   O "O5'"  . A A 1 143 ? 103.820 128.787 97.576  1.00 0.00 ? 143 A A "O5'"  1  
ATOM 4611   C "C5'"  . A A 1 143 ? 102.511 129.321 97.710  1.00 0.00 ? 143 A A "C5'"  1  
ATOM 4612   C "C4'"  . A A 1 143 ? 101.860 128.878 98.996  1.00 0.00 ? 143 A A "C4'"  1  
ATOM 4613   O "O4'"  . A A 1 143 ? 102.678 129.300 100.135 1.00 0.00 ? 143 A A "O4'"  1  
ATOM 4614   C "C3'"  . A A 1 143 ? 100.456 129.405 99.249  1.00 0.00 ? 143 A A "C3'"  1  
ATOM 4615   O "O3'"  . A A 1 143 ? 99.596  128.438 99.826  1.00 0.00 ? 143 A A "O3'"  1  
ATOM 4616   C "C2'"  . A A 1 143 ? 100.694 130.492 100.304 1.00 0.00 ? 143 A A "C2'"  1  
ATOM 4617   O "O2'"  . A A 1 143 ? 99.562  130.648 101.148 1.00 0.00 ? 143 A A "O2'"  1  
ATOM 4618   C "C1'"  . A A 1 143 ? 101.827 129.880 101.101 1.00 0.00 ? 143 A A "C1'"  1  
ATOM 4619   N N9     . A A 1 143 ? 102.574 130.891 101.873 1.00 0.00 ? 143 A A N9     1  
ATOM 4620   C C8     . A A 1 143 ? 103.168 132.039 101.409 1.00 0.00 ? 143 A A C8     1  
ATOM 4621   N N7     . A A 1 143 ? 103.761 132.741 102.342 1.00 0.00 ? 143 A A N7     1  
ATOM 4622   C C5     . A A 1 143 ? 103.544 132.007 103.500 1.00 0.00 ? 143 A A C5     1  
ATOM 4623   C C6     . A A 1 143 ? 103.923 132.216 104.839 1.00 0.00 ? 143 A A C6     1  
ATOM 4624   N N6     . A A 1 143 ? 104.627 133.271 105.253 1.00 0.00 ? 143 A A N6     1  
ATOM 4625   N N1     . A A 1 143 ? 103.546 131.292 105.749 1.00 0.00 ? 143 A A N1     1  
ATOM 4626   C C2     . A A 1 143 ? 102.839 130.233 105.334 1.00 0.00 ? 143 A A C2     1  
ATOM 4627   N N3     . A A 1 143 ? 102.425 129.927 104.107 1.00 0.00 ? 143 A A N3     1  
ATOM 4628   C C4     . A A 1 143 ? 102.814 130.866 103.226 1.00 0.00 ? 143 A A C4     1  
ATOM 4629   H "H5'"  . A A 1 143 ? 101.964 129.020 96.954  1.00 0.00 ? 143 A A "H5'"  1  
ATOM 4630   H "H5''" . A A 1 143 ? 102.561 130.299 97.697  1.00 0.00 ? 143 A A "H5''" 1  
ATOM 4631   H "H4'"  . A A 1 143 ? 101.793 127.900 98.996  1.00 0.00 ? 143 A A "H4'"  1  
ATOM 4632   H "H3'"  . A A 1 143 ? 100.117 129.823 98.429  1.00 0.00 ? 143 A A "H3'"  1  
ATOM 4633   H "H2'"  . A A 1 143 ? 100.960 131.341 99.892  1.00 0.00 ? 143 A A "H2'"  1  
ATOM 4634   H "HO2'" . A A 1 143 ? 99.752  131.345 101.810 1.00 0.00 ? 143 A A "HO2'" 1  
ATOM 4635   H "H1'"  . A A 1 143 ? 101.467 129.202 101.712 1.00 0.00 ? 143 A A "H1'"  1  
ATOM 4636   H H8     . A A 1 143 ? 103.149 132.308 100.467 1.00 0.00 ? 143 A A H8     1  
ATOM 4637   H H61    . A A 1 143 ? 104.861 133.362 106.201 1.00 0.00 ? 143 A A H61    1  
ATOM 4638   H H62    . A A 1 143 ? 104.911 133.954 104.610 1.00 0.00 ? 143 A A H62    1  
ATOM 4639   H H2     . A A 1 143 ? 102.591 129.593 106.034 1.00 0.00 ? 143 A A H2     1  
ATOM 4640   P P      . U A 1 144 ? 98.857  127.356 98.895  1.00 0.00 ? 144 U A P      1  
ATOM 4641   O OP1    . U A 1 144 ? 99.209  127.648 97.482  1.00 0.00 ? 144 U A OP1    1  
ATOM 4642   O OP2    . U A 1 144 ? 97.430  127.299 99.301  1.00 0.00 ? 144 U A OP2    1  
ATOM 4643   O "O5'"  . U A 1 144 ? 99.540  125.973 99.297  1.00 0.00 ? 144 U A "O5'"  1  
ATOM 4644   C "C5'"  . U A 1 144 ? 98.930  124.735 98.966  1.00 0.00 ? 144 U A "C5'"  1  
ATOM 4645   C "C4'"  . U A 1 144 ? 99.027  123.745 100.101 1.00 0.00 ? 144 U A "C4'"  1  
ATOM 4646   O "O4'"  . U A 1 144 ? 100.437 123.508 100.387 1.00 0.00 ? 144 U A "O4'"  1  
ATOM 4647   C "C3'"  . U A 1 144 ? 98.395  124.171 101.417 1.00 0.00 ? 144 U A "C3'"  1  
ATOM 4648   O "O3'"  . U A 1 144 ? 97.960  123.076 102.202 1.00 0.00 ? 144 U A "O3'"  1  
ATOM 4649   C "C2'"  . U A 1 144 ? 99.563  124.797 102.155 1.00 0.00 ? 144 U A "C2'"  1  
ATOM 4650   O "O2'"  . U A 1 144 ? 99.397  124.698 103.562 1.00 0.00 ? 144 U A "O2'"  1  
ATOM 4651   C "C1'"  . U A 1 144 ? 100.714 123.885 101.720 1.00 0.00 ? 144 U A "C1'"  1  
ATOM 4652   N N1     . U A 1 144 ? 102.024 124.580 101.745 1.00 0.00 ? 144 U A N1     1  
ATOM 4653   C C2     . U A 1 144 ? 102.898 124.241 102.761 1.00 0.00 ? 144 U A C2     1  
ATOM 4654   O O2     . U A 1 144 ? 102.637 123.411 103.615 1.00 0.00 ? 144 U A O2     1  
ATOM 4655   N N3     . U A 1 144 ? 104.098 124.909 102.744 1.00 0.00 ? 144 U A N3     1  
ATOM 4656   C C4     . U A 1 144 ? 104.506 125.862 101.835 1.00 0.00 ? 144 U A C4     1  
ATOM 4657   O O4     . U A 1 144 ? 105.620 126.374 101.956 1.00 0.00 ? 144 U A O4     1  
ATOM 4658   C C5     . U A 1 144 ? 103.551 126.161 100.813 1.00 0.00 ? 144 U A C5     1  
ATOM 4659   C C6     . U A 1 144 ? 102.375 125.525 100.805 1.00 0.00 ? 144 U A C6     1  
ATOM 4660   H "H5'"  . U A 1 144 ? 99.376  124.361 98.177  1.00 0.00 ? 144 U A "H5'"  1  
ATOM 4661   H "H5''" . U A 1 144 ? 97.985  124.889 98.757  1.00 0.00 ? 144 U A "H5''" 1  
ATOM 4662   H "H4'"  . U A 1 144 ? 98.603  122.906 99.825  1.00 0.00 ? 144 U A "H4'"  1  
ATOM 4663   H "H3'"  . U A 1 144 ? 97.721  124.860 101.243 1.00 0.00 ? 144 U A "H3'"  1  
ATOM 4664   H "H2'"  . U A 1 144 ? 99.711  125.724 101.872 1.00 0.00 ? 144 U A "H2'"  1  
ATOM 4665   H "HO2'" . U A 1 144 ? 100.181 125.086 104.005 1.00 0.00 ? 144 U A "HO2'" 1  
ATOM 4666   H "H1'"  . U A 1 144 ? 100.748 123.105 102.313 1.00 0.00 ? 144 U A "H1'"  1  
ATOM 4667   H H3     . U A 1 144 ? 104.732 124.684 103.456 1.00 0.00 ? 144 U A H3     1  
ATOM 4668   H H5     . U A 1 144 ? 103.758 126.827 100.124 1.00 0.00 ? 144 U A H5     1  
ATOM 4669   H H6     . U A 1 144 ? 101.738 125.749 100.096 1.00 0.00 ? 144 U A H6     1  
ATOM 4670   P P      . G A 1 145 ? 96.553  123.143 102.977 1.00 0.00 ? 145 G A P      1  
ATOM 4671   O OP1    . G A 1 145 ? 96.554  124.361 103.827 1.00 0.00 ? 145 G A OP1    1  
ATOM 4672   O OP2    . G A 1 145 ? 96.305  121.816 103.596 1.00 0.00 ? 145 G A OP2    1  
ATOM 4673   O "O5'"  . G A 1 145 ? 95.483  123.353 101.815 1.00 0.00 ? 145 G A "O5'"  1  
ATOM 4674   C "C5'"  . G A 1 145 ? 94.799  122.247 101.245 1.00 0.00 ? 145 G A "C5'"  1  
ATOM 4675   C "C4'"  . G A 1 145 ? 93.319  122.514 101.122 1.00 0.00 ? 145 G A "C4'"  1  
ATOM 4676   O "O4'"  . G A 1 145 ? 92.768  122.627 102.453 1.00 0.00 ? 145 G A "O4'"  1  
ATOM 4677   C "C3'"  . G A 1 145 ? 92.931  123.816 100.437 1.00 0.00 ? 145 G A "C3'"  1  
ATOM 4678   O "O3'"  . G A 1 145 ? 92.808  123.686 99.031  1.00 0.00 ? 145 G A "O3'"  1  
ATOM 4679   C "C2'"  . G A 1 145 ? 91.601  124.162 101.084 1.00 0.00 ? 145 G A "C2'"  1  
ATOM 4680   O "O2'"  . G A 1 145 ? 90.536  123.429 100.496 1.00 0.00 ? 145 G A "O2'"  1  
ATOM 4681   C "C1'"  . G A 1 145 ? 91.814  123.663 102.513 1.00 0.00 ? 145 G A "C1'"  1  
ATOM 4682   N N9     . G A 1 145 ? 92.334  124.722 103.399 1.00 0.00 ? 145 G A N9     1  
ATOM 4683   C C8     . G A 1 145 ? 93.570  124.772 103.999 1.00 0.00 ? 145 G A C8     1  
ATOM 4684   N N7     . G A 1 145 ? 93.742  125.839 104.731 1.00 0.00 ? 145 G A N7     1  
ATOM 4685   C C5     . G A 1 145 ? 92.549  126.536 104.607 1.00 0.00 ? 145 G A C5     1  
ATOM 4686   C C6     . G A 1 145 ? 92.143  127.772 105.175 1.00 0.00 ? 145 G A C6     1  
ATOM 4687   O O6     . G A 1 145 ? 92.779  128.521 105.926 1.00 0.00 ? 145 G A O6     1  
ATOM 4688   N N1     . G A 1 145 ? 90.850  128.114 104.789 1.00 0.00 ? 145 G A N1     1  
ATOM 4689   C C2     . G A 1 145 ? 90.050  127.363 103.962 1.00 0.00 ? 145 G A C2     1  
ATOM 4690   N N2     . G A 1 145 ? 88.831  127.859 103.703 1.00 0.00 ? 145 G A N2     1  
ATOM 4691   N N3     . G A 1 145 ? 90.417  126.210 103.427 1.00 0.00 ? 145 G A N3     1  
ATOM 4692   C C4     . G A 1 145 ? 91.669  125.861 103.789 1.00 0.00 ? 145 G A C4     1  
ATOM 4693   H "H5'"  . G A 1 145 ? 94.936  121.460 101.812 1.00 0.00 ? 145 G A "H5'"  1  
ATOM 4694   H "H5''" . G A 1 145 ? 95.168  122.068 100.355 1.00 0.00 ? 145 G A "H5''" 1  
ATOM 4695   H "H4'"  . G A 1 145 ? 92.899  121.762 100.654 1.00 0.00 ? 145 G A "H4'"  1  
ATOM 4696   H "H3'"  . G A 1 145 ? 93.584  124.508 100.668 1.00 0.00 ? 145 G A "H3'"  1  
ATOM 4697   H "H2'"  . G A 1 145 ? 91.432  125.127 101.064 1.00 0.00 ? 145 G A "H2'"  1  
ATOM 4698   H "HO2'" . G A 1 145 ? 89.696  123.677 100.937 1.00 0.00 ? 145 G A "HO2'" 1  
ATOM 4699   H "H1'"  . G A 1 145 ? 90.967  123.325 102.871 1.00 0.00 ? 145 G A "H1'"  1  
ATOM 4700   H H8     . G A 1 145 ? 94.252  124.078 103.889 1.00 0.00 ? 145 G A H8     1  
ATOM 4701   H H1     . G A 1 145 ? 90.485  128.955 105.134 1.00 0.00 ? 145 G A H1     1  
ATOM 4702   H H21    . G A 1 145 ? 88.552  128.712 104.096 1.00 0.00 ? 145 G A H21    1  
ATOM 4703   H H22    . G A 1 145 ? 88.216  127.367 103.119 1.00 0.00 ? 145 G A H22    1  
ATOM 4704   P P      . G A 1 146 ? 93.724  124.577 98.055  1.00 0.00 ? 146 G A P      1  
ATOM 4705   O OP1    . G A 1 146 ? 93.554  124.065 96.671  1.00 0.00 ? 146 G A OP1    1  
ATOM 4706   O OP2    . G A 1 146 ? 95.083  124.657 98.647  1.00 0.00 ? 146 G A OP2    1  
ATOM 4707   O "O5'"  . G A 1 146 ? 93.068  126.027 98.127  1.00 0.00 ? 146 G A "O5'"  1  
ATOM 4708   C "C5'"  . G A 1 146 ? 91.826  126.298 97.495  1.00 0.00 ? 146 G A "C5'"  1  
ATOM 4709   C "C4'"  . G A 1 146 ? 91.170  127.530 98.067  1.00 0.00 ? 146 G A "C4'"  1  
ATOM 4710   O "O4'"  . G A 1 146 ? 90.948  127.347 99.496  1.00 0.00 ? 146 G A "O4'"  1  
ATOM 4711   C "C3'"  . G A 1 146 ? 91.976  128.818 97.976  1.00 0.00 ? 146 G A "C3'"  1  
ATOM 4712   O "O3'"  . G A 1 146 ? 91.815  129.485 96.736  1.00 0.00 ? 146 G A "O3'"  1  
ATOM 4713   C "C2'"  . G A 1 146 ? 91.464  129.613 99.173  1.00 0.00 ? 146 G A "C2'"  1  
ATOM 4714   O "O2'"  . G A 1 146 ? 90.200  130.200 98.899  1.00 0.00 ? 146 G A "O2'"  1  
ATOM 4715   C "C1'"  . G A 1 146 ? 91.288  128.494 100.215 1.00 0.00 ? 146 G A "C1'"  1  
ATOM 4716   N N9     . G A 1 146 ? 92.539  128.210 100.943 1.00 0.00 ? 146 G A N9     1  
ATOM 4717   C C8     . G A 1 146 ? 93.436  127.200 100.693 1.00 0.00 ? 146 G A C8     1  
ATOM 4718   N N7     . G A 1 146 ? 94.454  127.202 101.510 1.00 0.00 ? 146 G A N7     1  
ATOM 4719   C C5     . G A 1 146 ? 94.216  128.280 102.351 1.00 0.00 ? 146 G A C5     1  
ATOM 4720   C C6     . G A 1 146 ? 94.977  128.784 103.438 1.00 0.00 ? 146 G A C6     1  
ATOM 4721   O O6     . G A 1 146 ? 96.047  128.362 103.890 1.00 0.00 ? 146 G A O6     1  
ATOM 4722   N N1     . G A 1 146 ? 94.371  129.895 104.017 1.00 0.00 ? 146 G A N1     1  
ATOM 4723   C C2     . G A 1 146 ? 93.185  130.452 103.602 1.00 0.00 ? 146 G A C2     1  
ATOM 4724   N N2     . G A 1 146 ? 92.760  131.524 104.286 1.00 0.00 ? 146 G A N2     1  
ATOM 4725   N N3     . G A 1 146 ? 92.467  129.992 102.590 1.00 0.00 ? 146 G A N3     1  
ATOM 4726   C C4     . G A 1 146 ? 93.038  128.914 102.014 1.00 0.00 ? 146 G A C4     1  
ATOM 4727   H "H5'"  . G A 1 146 ? 91.229  125.531 97.620  1.00 0.00 ? 146 G A "H5'"  1  
ATOM 4728   H "H5''" . G A 1 146 ? 91.977  126.431 96.536  1.00 0.00 ? 146 G A "H5''" 1  
ATOM 4729   H "H4'"  . G A 1 146 ? 90.305  127.664 97.624  1.00 0.00 ? 146 G A "H4'"  1  
ATOM 4730   H "H3'"  . G A 1 146 ? 92.924  128.613 98.109  1.00 0.00 ? 146 G A "H3'"  1  
ATOM 4731   H "H2'"  . G A 1 146 ? 92.119  130.281 99.466  1.00 0.00 ? 146 G A "H2'"  1  
ATOM 4732   H "HO2'" . G A 1 146 ? 89.908  130.709 99.684  1.00 0.00 ? 146 G A "HO2'" 1  
ATOM 4733   H "H1'"  . G A 1 146 ? 90.590  128.750 100.854 1.00 0.00 ? 146 G A "H1'"  1  
ATOM 4734   H H8     . G A 1 146 ? 93.323  126.542 99.975  1.00 0.00 ? 146 G A H8     1  
ATOM 4735   H H1     . G A 1 146 ? 94.826  130.311 104.778 1.00 0.00 ? 146 G A H1     1  
ATOM 4736   H H21    . G A 1 146 ? 93.286  131.870 105.037 1.00 0.00 ? 146 G A H21    1  
ATOM 4737   H H22    . G A 1 146 ? 91.920  131.963 104.035 1.00 0.00 ? 146 G A H22    1  
ATOM 4738   P P      . U A 1 147 ? 93.066  130.223 96.048  1.00 0.00 ? 147 U A P      1  
ATOM 4739   O OP1    . U A 1 147 ? 92.737  130.449 94.618  1.00 0.00 ? 147 U A OP1    1  
ATOM 4740   O OP2    . U A 1 147 ? 94.296  129.473 96.409  1.00 0.00 ? 147 U A OP2    1  
ATOM 4741   O "O5'"  . U A 1 147 ? 93.123  131.640 96.772  1.00 0.00 ? 147 U A "O5'"  1  
ATOM 4742   C "C5'"  . U A 1 147 ? 94.288  132.448 96.705  1.00 0.00 ? 147 U A "C5'"  1  
ATOM 4743   C "C4'"  . U A 1 147 ? 93.949  133.918 96.738  1.00 0.00 ? 147 U A "C4'"  1  
ATOM 4744   O "O4'"  . U A 1 147 ? 92.888  134.198 95.784  1.00 0.00 ? 147 U A "O4'"  1  
ATOM 4745   C "C3'"  . U A 1 147 ? 93.408  134.452 98.055  1.00 0.00 ? 147 U A "C3'"  1  
ATOM 4746   O "O3'"  . U A 1 147 ? 94.429  134.783 98.980  1.00 0.00 ? 147 U A "O3'"  1  
ATOM 4747   C "C2'"  . U A 1 147 ? 92.600  135.664 97.610  1.00 0.00 ? 147 U A "C2'"  1  
ATOM 4748   O "O2'"  . U A 1 147 ? 93.444  136.771 97.329  1.00 0.00 ? 147 U A "O2'"  1  
ATOM 4749   C "C1'"  . U A 1 147 ? 91.994  135.155 96.306  1.00 0.00 ? 147 U A "C1'"  1  
ATOM 4750   N N1     . U A 1 147 ? 90.681  134.498 96.514  1.00 0.00 ? 147 U A N1     1  
ATOM 4751   C C2     . U A 1 147 ? 89.602  135.318 96.790  1.00 0.00 ? 147 U A C2     1  
ATOM 4752   O O2     . U A 1 147 ? 89.691  136.531 96.866  1.00 0.00 ? 147 U A O2     1  
ATOM 4753   N N3     . U A 1 147 ? 88.407  134.667 96.975  1.00 0.00 ? 147 U A N3     1  
ATOM 4754   C C4     . U A 1 147 ? 88.183  133.308 96.914  1.00 0.00 ? 147 U A C4     1  
ATOM 4755   O O4     . U A 1 147 ? 87.046  132.874 97.105  1.00 0.00 ? 147 U A O4     1  
ATOM 4756   C C5     . U A 1 147 ? 89.343  132.522 96.624  1.00 0.00 ? 147 U A C5     1  
ATOM 4757   C C6     . U A 1 147 ? 90.519  133.131 96.439  1.00 0.00 ? 147 U A C6     1  
ATOM 4758   H "H5'"  . U A 1 147 ? 94.767  132.249 95.873  1.00 0.00 ? 147 U A "H5'"  1  
ATOM 4759   H "H5''" . U A 1 147 ? 94.868  132.238 97.466  1.00 0.00 ? 147 U A "H5''" 1  
ATOM 4760   H "H4'"  . U A 1 147 ? 94.745  134.431 96.487  1.00 0.00 ? 147 U A "H4'"  1  
ATOM 4761   H "H3'"  . U A 1 147 ? 92.802  133.790 98.447  1.00 0.00 ? 147 U A "H3'"  1  
ATOM 4762   H "H2'"  . U A 1 147 ? 91.907  135.894 98.264  1.00 0.00 ? 147 U A "H2'"  1  
ATOM 4763   H "HO2'" . U A 1 147 ? 92.891  137.533 97.054  1.00 0.00 ? 147 U A "HO2'" 1  
ATOM 4764   H "H1'"  . U A 1 147 ? 91.887  135.906 95.685  1.00 0.00 ? 147 U A "H1'"  1  
ATOM 4765   H H3     . U A 1 147 ? 87.630  135.230 97.172  1.00 0.00 ? 147 U A H3     1  
ATOM 4766   H H5     . U A 1 147 ? 89.276  131.547 96.561  1.00 0.00 ? 147 U A H5     1  
ATOM 4767   H H6     . U A 1 147 ? 91.298  132.571 96.243  1.00 0.00 ? 147 U A H6     1  
ATOM 4768   P P      . C A 1 148 ? 94.062  134.994 100.526 1.00 0.00 ? 148 C A P      1  
ATOM 4769   O OP1    . C A 1 148 ? 93.688  133.686 101.121 1.00 0.00 ? 148 C A OP1    1  
ATOM 4770   O OP2    . C A 1 148 ? 93.062  136.089 100.474 1.00 0.00 ? 148 C A OP2    1  
ATOM 4771   O "O5'"  . C A 1 148 ? 95.347  135.535 101.296 1.00 0.00 ? 148 C A "O5'"  1  
ATOM 4772   C "C5'"  . C A 1 148 ? 95.557  135.232 102.667 1.00 0.00 ? 148 C A "C5'"  1  
ATOM 4773   C "C4'"  . C A 1 148 ? 95.737  133.750 102.889 1.00 0.00 ? 148 C A "C4'"  1  
ATOM 4774   O "O4'"  . C A 1 148 ? 95.183  133.019 101.790 1.00 0.00 ? 148 C A "O4'"  1  
ATOM 4775   C "C3'"  . C A 1 148 ? 97.171  133.247 102.930 1.00 0.00 ? 148 C A "C3'"  1  
ATOM 4776   O "O3'"  . C A 1 148 ? 97.805  133.484 104.175 1.00 0.00 ? 148 C A "O3'"  1  
ATOM 4777   C "C2'"  . C A 1 148 ? 96.937  131.782 102.726 1.00 0.00 ? 148 C A "C2'"  1  
ATOM 4778   O "O2'"  . C A 1 148 ? 96.374  131.185 103.885 1.00 0.00 ? 148 C A "O2'"  1  
ATOM 4779   C "C1'"  . C A 1 148 ? 95.896  131.843 101.618 1.00 0.00 ? 148 C A "C1'"  1  
ATOM 4780   N N1     . C A 1 148 ? 96.510  131.842 100.267 1.00 0.00 ? 148 C A N1     1  
ATOM 4781   C C2     . C A 1 148 ? 96.642  130.619 99.597  1.00 0.00 ? 148 C A C2     1  
ATOM 4782   O O2     . C A 1 148 ? 96.245  129.581 100.148 1.00 0.00 ? 148 C A O2     1  
ATOM 4783   N N3     . C A 1 148 ? 97.198  130.591 98.364  1.00 0.00 ? 148 C A N3     1  
ATOM 4784   C C4     . C A 1 148 ? 97.617  131.721 97.794  1.00 0.00 ? 148 C A C4     1  
ATOM 4785   N N4     . C A 1 148 ? 98.159  131.645 96.576  1.00 0.00 ? 148 C A N4     1  
ATOM 4786   C C5     . C A 1 148 ? 97.498  132.979 98.449  1.00 0.00 ? 148 C A C5     1  
ATOM 4787   C C6     . C A 1 148 ? 96.945  132.995 99.667  1.00 0.00 ? 148 C A C6     1  
ATOM 4788   H "H5'"  . C A 1 148 ? 94.785  135.542 103.184 1.00 0.00 ? 148 C A "H5'"  1  
ATOM 4789   H "H5''" . C A 1 148 ? 96.360  135.701 102.978 1.00 0.00 ? 148 C A "H5''" 1  
ATOM 4790   H "H4'"  . C A 1 148 ? 95.285  133.487 103.717 1.00 0.00 ? 148 C A "H4'"  1  
ATOM 4791   H "H3'"  . C A 1 148 ? 97.730  133.610 102.211 1.00 0.00 ? 148 C A "H3'"  1  
ATOM 4792   H "H2'"  . C A 1 148 ? 97.756  131.324 102.444 1.00 0.00 ? 148 C A "H2'"  1  
ATOM 4793   H "HO2'" . C A 1 148 ? 96.850  130.351 104.079 1.00 0.00 ? 148 C A "HO2'" 1  
ATOM 4794   H "H1'"  . C A 1 148 ? 95.291  131.077 101.701 1.00 0.00 ? 148 C A "H1'"  1  
ATOM 4795   H H41    . C A 1 148 ? 98.240  130.777 96.129  1.00 0.00 ? 148 C A H41    1  
ATOM 4796   H H42    . C A 1 148 ? 98.477  132.458 96.131  1.00 0.00 ? 148 C A H42    1  
ATOM 4797   H H5     . C A 1 148 ? 97.808  133.805 98.021  1.00 0.00 ? 148 C A H5     1  
ATOM 4798   H H6     . C A 1 148 ? 96.854  133.851 100.134 1.00 0.00 ? 148 C A H6     1  
ATOM 4799   P P      . C A 1 149 ? 99.260  132.871 104.471 1.00 0.00 ? 149 C A P      1  
ATOM 4800   O OP1    . C A 1 149 ? 99.769  133.482 105.725 1.00 0.00 ? 149 C A OP1    1  
ATOM 4801   O OP2    . C A 1 149 ? 100.064 132.971 103.228 1.00 0.00 ? 149 C A OP2    1  
ATOM 4802   O "O5'"  . C A 1 149 ? 98.978  131.329 104.755 1.00 0.00 ? 149 C A "O5'"  1  
ATOM 4803   C "C5'"  . C A 1 149 ? 99.118  130.790 106.061 1.00 0.00 ? 149 C A "C5'"  1  
ATOM 4804   C "C4'"  . C A 1 149 ? 97.825  130.191 106.558 1.00 0.00 ? 149 C A "C4'"  1  
ATOM 4805   O "O4'"  . C A 1 149 ? 97.615  128.936 105.882 1.00 0.00 ? 149 C A "O4'"  1  
ATOM 4806   C "C3'"  . C A 1 149 ? 97.782  129.819 108.032 1.00 0.00 ? 149 C A "C3'"  1  
ATOM 4807   O "O3'"  . C A 1 149 ? 97.390  130.898 108.863 1.00 0.00 ? 149 C A "O3'"  1  
ATOM 4808   C "C2'"  . C A 1 149 ? 96.776  128.684 108.091 1.00 0.00 ? 149 C A "C2'"  1  
ATOM 4809   O "O2'"  . C A 1 149 ? 95.444  129.176 108.084 1.00 0.00 ? 149 C A "O2'"  1  
ATOM 4810   C "C1'"  . C A 1 149 ? 97.054  127.979 106.780 1.00 0.00 ? 149 C A "C1'"  1  
ATOM 4811   N N1     . C A 1 149 ? 98.003  126.849 106.938 1.00 0.00 ? 149 C A N1     1  
ATOM 4812   C C2     . C A 1 149 ? 97.580  125.720 107.649 1.00 0.00 ? 149 C A C2     1  
ATOM 4813   O O2     . C A 1 149 ? 96.434  125.697 108.124 1.00 0.00 ? 149 C A O2     1  
ATOM 4814   N N3     . C A 1 149 ? 98.426  124.676 107.807 1.00 0.00 ? 149 C A N3     1  
ATOM 4815   C C4     . C A 1 149 ? 99.652  124.725 107.287 1.00 0.00 ? 149 C A C4     1  
ATOM 4816   N N4     . C A 1 149 ? 100.453 123.671 107.468 1.00 0.00 ? 149 C A N4     1  
ATOM 4817   C C5     . C A 1 149 ? 100.113 125.859 106.560 1.00 0.00 ? 149 C A C5     1  
ATOM 4818   C C6     . C A 1 149 ? 99.267  126.885 106.409 1.00 0.00 ? 149 C A C6     1  
ATOM 4819   H "H5'"  . C A 1 149 ? 99.397  131.503 106.672 1.00 0.00 ? 149 C A "H5'"  1  
ATOM 4820   H "H5''" . C A 1 149 ? 99.808  130.094 106.046 1.00 0.00 ? 149 C A "H5''" 1  
ATOM 4821   H "H4'"  . C A 1 149 ? 97.075  130.789 106.360 1.00 0.00 ? 149 C A "H4'"  1  
ATOM 4822   H "H3'"  . C A 1 149 ? 98.667  129.505 108.312 1.00 0.00 ? 149 C A "H3'"  1  
ATOM 4823   H "H2'"  . C A 1 149 ? 96.942  128.098 108.859 1.00 0.00 ? 149 C A "H2'"  1  
ATOM 4824   H "HO2'" . C A 1 149 ? 94.841  128.470 108.397 1.00 0.00 ? 149 C A "HO2'" 1  
ATOM 4825   H "H1'"  . C A 1 149 ? 96.211  127.647 106.408 1.00 0.00 ? 149 C A "H1'"  1  
ATOM 4826   H H41    . C A 1 149 ? 100.132 122.893 107.970 1.00 0.00 ? 149 C A H41    1  
ATOM 4827   H H42    . C A 1 149 ? 101.360 123.677 107.099 1.00 0.00 ? 149 C A H42    1  
ATOM 4828   H H5     . C A 1 149 ? 101.016 125.886 106.181 1.00 0.00 ? 149 C A H5     1  
ATOM 4829   H H6     . C A 1 149 ? 99.565  127.674 105.911 1.00 0.00 ? 149 C A H6     1  
ATOM 4830   P P      . U A 1 150 ? 98.024  131.061 110.331 1.00 0.00 ? 150 U A P      1  
ATOM 4831   O OP1    . U A 1 150 ? 97.497  132.317 110.923 1.00 0.00 ? 150 U A OP1    1  
ATOM 4832   O OP2    . U A 1 150 ? 99.491  130.859 110.222 1.00 0.00 ? 150 U A OP2    1  
ATOM 4833   O "O5'"  . U A 1 150 ? 97.417  129.837 111.150 1.00 0.00 ? 150 U A "O5'"  1  
ATOM 4834   C "C5'"  . U A 1 150 ? 96.019  129.724 111.365 1.00 0.00 ? 150 U A "C5'"  1  
ATOM 4835   C "C4'"  . U A 1 150 ? 95.672  128.476 112.139 1.00 0.00 ? 150 U A "C4'"  1  
ATOM 4836   O "O4'"  . U A 1 150 ? 95.923  127.331 111.290 1.00 0.00 ? 150 U A "O4'"  1  
ATOM 4837   C "C3'"  . U A 1 150 ? 96.516  128.197 113.373 1.00 0.00 ? 150 U A "C3'"  1  
ATOM 4838   O "O3'"  . U A 1 150 ? 96.084  128.916 114.514 1.00 0.00 ? 150 U A "O3'"  1  
ATOM 4839   C "C2'"  . U A 1 150 ? 96.296  126.702 113.546 1.00 0.00 ? 150 U A "C2'"  1  
ATOM 4840   O "O2'"  . U A 1 150 ? 95.010  126.431 114.085 1.00 0.00 ? 150 U A "O2'"  1  
ATOM 4841   C "C1'"  . U A 1 150 ? 96.344  126.250 112.088 1.00 0.00 ? 150 U A "C1'"  1  
ATOM 4842   N N1     . U A 1 150 ? 97.710  125.852 111.668 1.00 0.00 ? 150 U A N1     1  
ATOM 4843   C C2     . U A 1 150 ? 98.158  124.609 112.077 1.00 0.00 ? 150 U A C2     1  
ATOM 4844   O O2     . U A 1 150 ? 97.487  123.848 112.752 1.00 0.00 ? 150 U A O2     1  
ATOM 4845   N N3     . U A 1 150 ? 99.427  124.283 111.664 1.00 0.00 ? 150 U A N3     1  
ATOM 4846   C C4     . U A 1 150 ? 100.278 125.055 110.902 1.00 0.00 ? 150 U A C4     1  
ATOM 4847   O O4     . U A 1 150 ? 101.393 124.619 110.613 1.00 0.00 ? 150 U A O4     1  
ATOM 4848   C C5     . U A 1 150 ? 99.747  126.327 110.516 1.00 0.00 ? 150 U A C5     1  
ATOM 4849   C C6     . U A 1 150 ? 98.514  126.669 110.903 1.00 0.00 ? 150 U A C6     1  
ATOM 4850   H "H5'"  . U A 1 150 ? 95.563  129.698 110.497 1.00 0.00 ? 150 U A "H5'"  1  
ATOM 4851   H "H5''" . U A 1 150 ? 95.708  130.506 111.866 1.00 0.00 ? 150 U A "H5''" 1  
ATOM 4852   H "H4'"  . U A 1 150 ? 94.727  128.482 112.396 1.00 0.00 ? 150 U A "H4'"  1  
ATOM 4853   H "H3'"  . U A 1 150 ? 97.465  128.383 113.217 1.00 0.00 ? 150 U A "H3'"  1  
ATOM 4854   H "H2'"  . U A 1 150 ? 97.006  126.293 114.082 1.00 0.00 ? 150 U A "H2'"  1  
ATOM 4855   H "HO2'" . U A 1 150 ? 94.879  125.460 114.126 1.00 0.00 ? 150 U A "HO2'" 1  
ATOM 4856   H "H1'"  . U A 1 150 ? 95.733  125.493 111.965 1.00 0.00 ? 150 U A "H1'"  1  
ATOM 4857   H H3     . U A 1 150 ? 99.764  123.407 111.943 1.00 0.00 ? 150 U A H3     1  
ATOM 4858   H H5     . U A 1 150 ? 100.284 126.941 109.972 1.00 0.00 ? 150 U A H5     1  
ATOM 4859   H H6     . U A 1 150 ? 98.174  127.545 110.627 1.00 0.00 ? 150 U A H6     1  
ATOM 4860   P P      . A A 1 151 ? 97.137  129.340 115.651 1.00 0.00 ? 151 A A P      1  
ATOM 4861   O OP1    . A A 1 151 ? 96.517  130.404 116.480 1.00 0.00 ? 151 A A OP1    1  
ATOM 4862   O OP2    . A A 1 151 ? 98.446  129.589 114.996 1.00 0.00 ? 151 A A OP2    1  
ATOM 4863   O "O5'"  . A A 1 151 ? 97.279  128.033 116.551 1.00 0.00 ? 151 A A "O5'"  1  
ATOM 4864   C "C5'"  . A A 1 151 ? 96.193  127.570 117.341 1.00 0.00 ? 151 A A "C5'"  1  
ATOM 4865   C "C4'"  . A A 1 151 ? 96.663  126.669 118.455 1.00 0.00 ? 151 A A "C4'"  1  
ATOM 4866   O "O4'"  . A A 1 151 ? 96.924  125.336 117.921 1.00 0.00 ? 151 A A "O4'"  1  
ATOM 4867   C "C3'"  . A A 1 151 ? 97.917  127.115 119.190 1.00 0.00 ? 151 A A "C3'"  1  
ATOM 4868   O "O3'"  . A A 1 151 ? 97.827  126.947 120.594 1.00 0.00 ? 151 A A "O3'"  1  
ATOM 4869   C "C2'"  . A A 1 151 ? 99.016  126.196 118.643 1.00 0.00 ? 151 A A "C2'"  1  
ATOM 4870   O "O2'"  . A A 1 151 ? 99.979  125.893 119.642 1.00 0.00 ? 151 A A "O2'"  1  
ATOM 4871   C "C1'"  . A A 1 151 ? 98.256  124.916 118.309 1.00 0.00 ? 151 A A "C1'"  1  
ATOM 4872   N N9     . A A 1 151 ? 98.873  124.179 117.191 1.00 0.00 ? 151 A A N9     1  
ATOM 4873   C C8     . A A 1 151 ? 99.410  124.691 116.036 1.00 0.00 ? 151 A A C8     1  
ATOM 4874   N N7     . A A 1 151 ? 99.887  123.780 115.225 1.00 0.00 ? 151 A A N7     1  
ATOM 4875   C C5     . A A 1 151 ? 99.649  122.585 115.890 1.00 0.00 ? 151 A A C5     1  
ATOM 4876   C C6     . A A 1 151 ? 99.920  121.245 115.558 1.00 0.00 ? 151 A A C6     1  
ATOM 4877   N N6     . A A 1 151 ? 100.517 120.870 114.424 1.00 0.00 ? 151 A A N6     1  
ATOM 4878   N N1     . A A 1 151 ? 99.553  120.292 116.441 1.00 0.00 ? 151 A A N1     1  
ATOM 4879   C C2     . A A 1 151 ? 98.955  120.668 117.579 1.00 0.00 ? 151 A A C2     1  
ATOM 4880   N N3     . A A 1 151 ? 98.647  121.892 118.003 1.00 0.00 ? 151 A A N3     1  
ATOM 4881   C C4     . A A 1 151 ? 99.025  122.816 117.102 1.00 0.00 ? 151 A A C4     1  
ATOM 4882   H "H5'"  . A A 1 151 ? 95.571  127.074 116.769 1.00 0.00 ? 151 A A "H5'"  1  
ATOM 4883   H "H5''" . A A 1 151 ? 95.727  128.340 117.727 1.00 0.00 ? 151 A A "H5''" 1  
ATOM 4884   H "H4'"  . A A 1 151 ? 95.929  126.590 119.100 1.00 0.00 ? 151 A A "H4'"  1  
ATOM 4885   H "H3'"  . A A 1 151 ? 98.107  128.057 118.991 1.00 0.00 ? 151 A A "H3'"  1  
ATOM 4886   H "H2'"  . A A 1 151 ? 99.432  126.572 117.839 1.00 0.00 ? 151 A A "H2'"  1  
ATOM 4887   H "HO2'" . A A 1 151 ? 100.871 125.903 119.238 1.00 0.00 ? 151 A A "HO2'" 1  
ATOM 4888   H "H1'"  . A A 1 151 ? 98.223  124.340 119.102 1.00 0.00 ? 151 A A "H1'"  1  
ATOM 4889   H H8     . A A 1 151 ? 99.434  125.651 115.836 1.00 0.00 ? 151 A A H8     1  
ATOM 4890   H H61    . A A 1 151 ? 100.679 119.920 114.247 1.00 0.00 ? 151 A A H61    1  
ATOM 4891   H H62    . A A 1 151 ? 100.791 121.544 113.768 1.00 0.00 ? 151 A A H62    1  
ATOM 4892   H H2     . A A 1 151 ? 98.709  119.939 118.186 1.00 0.00 ? 151 A A H2     1  
ATOM 4893   P P      . A A 1 152 ? 96.975  127.984 121.479 1.00 0.00 ? 152 A A P      1  
ATOM 4894   O OP1    . A A 1 152 ? 95.548  127.856 121.091 1.00 0.00 ? 152 A A OP1    1  
ATOM 4895   O OP2    . A A 1 152 ? 97.641  129.309 121.403 1.00 0.00 ? 152 A A OP2    1  
ATOM 4896   O "O5'"  . A A 1 152 ? 97.132  127.439 122.968 1.00 0.00 ? 152 A A "O5'"  1  
ATOM 4897   C "C5'"  . A A 1 152 ? 96.381  128.002 124.034 1.00 0.00 ? 152 A A "C5'"  1  
ATOM 4898   C "C4'"  . A A 1 152 ? 95.676  126.938 124.837 1.00 0.00 ? 152 A A "C4'"  1  
ATOM 4899   O "O4'"  . A A 1 152 ? 94.795  126.195 123.948 1.00 0.00 ? 152 A A "O4'"  1  
ATOM 4900   C "C3'"  . A A 1 152 ? 96.566  125.873 125.461 1.00 0.00 ? 152 A A "C3'"  1  
ATOM 4901   O "O3'"  . A A 1 152 ? 97.114  126.269 126.706 1.00 0.00 ? 152 A A "O3'"  1  
ATOM 4902   C "C2'"  . A A 1 152 ? 95.634  124.677 125.556 1.00 0.00 ? 152 A A "C2'"  1  
ATOM 4903   O "O2'"  . A A 1 152 ? 94.733  124.812 126.645 1.00 0.00 ? 152 A A "O2'"  1  
ATOM 4904   C "C1'"  . A A 1 152 ? 94.854  124.797 124.247 1.00 0.00 ? 152 A A "C1'"  1  
ATOM 4905   N N9     . A A 1 152 ? 95.525  124.097 123.135 1.00 0.00 ? 152 A A N9     1  
ATOM 4906   C C8     . A A 1 152 ? 95.982  124.631 121.955 1.00 0.00 ? 152 A A C8     1  
ATOM 4907   N N7     . A A 1 152 ? 96.537  123.753 121.157 1.00 0.00 ? 152 A A N7     1  
ATOM 4908   C C5     . A A 1 152 ? 96.441  122.559 121.858 1.00 0.00 ? 152 A A C5     1  
ATOM 4909   C C6     . A A 1 152 ? 96.846  121.247 121.555 1.00 0.00 ? 152 A A C6     1  
ATOM 4910   N N6     . A A 1 152 ? 97.457  120.905 120.418 1.00 0.00 ? 152 A A N6     1  
ATOM 4911   N N1     . A A 1 152 ? 96.601  120.286 122.471 1.00 0.00 ? 152 A A N1     1  
ATOM 4912   C C2     . A A 1 152 ? 95.988  120.628 123.611 1.00 0.00 ? 152 A A C2     1  
ATOM 4913   N N3     . A A 1 152 ? 95.560  121.823 124.010 1.00 0.00 ? 152 A A N3     1  
ATOM 4914   C C4     . A A 1 152 ? 95.820  122.757 123.077 1.00 0.00 ? 152 A A C4     1  
ATOM 4915   H "H5'"  . A A 1 152 ? 95.713  128.617 123.664 1.00 0.00 ? 152 A A "H5'"  1  
ATOM 4916   H "H5''" . A A 1 152 ? 96.983  128.500 124.623 1.00 0.00 ? 152 A A "H5''" 1  
ATOM 4917   H "H4'"  . A A 1 152 ? 95.137  127.353 125.542 1.00 0.00 ? 152 A A "H4'"  1  
ATOM 4918   H "H3'"  . A A 1 152 ? 97.295  125.661 124.841 1.00 0.00 ? 152 A A "H3'"  1  
ATOM 4919   H "H2'"  . A A 1 152 ? 96.134  123.835 125.601 1.00 0.00 ? 152 A A "H2'"  1  
ATOM 4920   H "HO2'" . A A 1 152 ? 94.150  124.025 126.676 1.00 0.00 ? 152 A A "HO2'" 1  
ATOM 4921   H "H1'"  . A A 1 152 ? 93.954  124.428 124.369 1.00 0.00 ? 152 A A "H1'"  1  
ATOM 4922   H H8     . A A 1 152 ? 95.900  125.582 121.730 1.00 0.00 ? 152 A A H8     1  
ATOM 4923   H H61    . A A 1 152 ? 97.717  119.973 120.263 1.00 0.00 ? 152 A A H61    1  
ATOM 4924   H H62    . A A 1 152 ? 97.646  121.586 119.739 1.00 0.00 ? 152 A A H62    1  
ATOM 4925   H H2     . A A 1 152 ? 95.833  119.893 124.242 1.00 0.00 ? 152 A A H2     1  
ATOM 4926   P P      . C A 1 153 ? 98.679  126.610 126.827 1.00 0.00 ? 153 C A P      1  
ATOM 4927   O OP1    . C A 1 153 ? 98.810  127.950 127.455 1.00 0.00 ? 153 C A OP1    1  
ATOM 4928   O OP2    . C A 1 153 ? 99.311  126.354 125.508 1.00 0.00 ? 153 C A OP2    1  
ATOM 4929   O "O5'"  . C A 1 153 ? 99.232  125.528 127.858 1.00 0.00 ? 153 C A "O5'"  1  
ATOM 4930   C "C5'"  . C A 1 153 ? 98.353  124.616 128.498 1.00 0.00 ? 153 C A "C5'"  1  
ATOM 4931   C "C4'"  . C A 1 153 ? 98.542  123.209 127.985 1.00 0.00 ? 153 C A "C4'"  1  
ATOM 4932   O "O4'"  . C A 1 153 ? 97.913  123.068 126.683 1.00 0.00 ? 153 C A "O4'"  1  
ATOM 4933   C "C3'"  . C A 1 153 ? 99.978  122.768 127.748 1.00 0.00 ? 153 C A "C3'"  1  
ATOM 4934   O "O3'"  . C A 1 153 ? 100.634 122.360 128.937 1.00 0.00 ? 153 C A "O3'"  1  
ATOM 4935   C "C2'"  . C A 1 153 ? 99.821  121.653 126.725 1.00 0.00 ? 153 C A "C2'"  1  
ATOM 4936   O "O2'"  . C A 1 153 ? 99.389  120.446 127.340 1.00 0.00 ? 153 C A "O2'"  1  
ATOM 4937   C "C1'"  . C A 1 153 ? 98.689  122.196 125.853 1.00 0.00 ? 153 C A "C1'"  1  
ATOM 4938   N N1     . C A 1 153 ? 99.195  122.924 124.662 1.00 0.00 ? 153 C A N1     1  
ATOM 4939   C C2     . C A 1 153 ? 99.674  122.173 123.581 1.00 0.00 ? 153 C A C2     1  
ATOM 4940   O O2     . C A 1 153 ? 99.664  120.935 123.651 1.00 0.00 ? 153 C A O2     1  
ATOM 4941   N N3     . C A 1 153 ? 100.141 122.812 122.482 1.00 0.00 ? 153 C A N3     1  
ATOM 4942   C C4     . C A 1 153 ? 100.142 124.142 122.434 1.00 0.00 ? 153 C A C4     1  
ATOM 4943   N N4     . C A 1 153 ? 100.612 124.730 121.329 1.00 0.00 ? 153 C A N4     1  
ATOM 4944   C C5     . C A 1 153 ? 99.663  124.934 123.516 1.00 0.00 ? 153 C A C5     1  
ATOM 4945   C C6     . C A 1 153 ? 99.202  124.293 124.597 1.00 0.00 ? 153 C A C6     1  
ATOM 4946   H "H5'"  . C A 1 153 ? 97.428  124.895 128.334 1.00 0.00 ? 153 C A "H5'"  1  
ATOM 4947   H "H5''" . C A 1 153 ? 98.525  124.629 129.462 1.00 0.00 ? 153 C A "H5''" 1  
ATOM 4948   H "H4'"  . C A 1 153 ? 98.117  122.586 128.610 1.00 0.00 ? 153 C A "H4'"  1  
ATOM 4949   H "H3'"  . C A 1 153 ? 100.478 123.506 127.342 1.00 0.00 ? 153 C A "H3'"  1  
ATOM 4950   H "H2'"  . C A 1 153 ? 100.641 121.520 126.206 1.00 0.00 ? 153 C A "H2'"  1  
ATOM 4951   H "HO2'" . C A 1 153 ? 99.588  120.487 128.298 1.00 0.00 ? 153 C A "HO2'" 1  
ATOM 4952   H "H1'"  . C A 1 153 ? 98.116  121.456 125.563 1.00 0.00 ? 153 C A "H1'"  1  
ATOM 4953   H H41    . C A 1 153 ? 100.944 124.182 120.587 1.00 0.00 ? 153 C A H41    1  
ATOM 4954   H H42    . C A 1 153 ? 100.627 125.706 121.263 1.00 0.00 ? 153 C A H42    1  
ATOM 4955   H H5     . C A 1 153 ? 99.666  125.913 123.472 1.00 0.00 ? 153 C A H5     1  
ATOM 4956   H H6     . C A 1 153 ? 98.867  124.818 125.352 1.00 0.00 ? 153 C A H6     1  
ATOM 4957   P P      . C A 1 154 ? 102.234 122.466 129.054 1.00 0.00 ? 154 C A P      1  
ATOM 4958   O OP1    . C A 1 154 ? 102.623 122.045 130.424 1.00 0.00 ? 154 C A OP1    1  
ATOM 4959   O OP2    . C A 1 154 ? 102.647 123.800 128.552 1.00 0.00 ? 154 C A OP2    1  
ATOM 4960   O "O5'"  . C A 1 154 ? 102.770 121.366 128.033 1.00 0.00 ? 154 C A "O5'"  1  
ATOM 4961   C "C5'"  . C A 1 154 ? 102.682 119.983 128.336 1.00 0.00 ? 154 C A "C5'"  1  
ATOM 4962   C "C4'"  . C A 1 154 ? 103.241 119.131 127.222 1.00 0.00 ? 154 C A "C4'"  1  
ATOM 4963   O "O4'"  . C A 1 154 ? 102.504 119.379 125.996 1.00 0.00 ? 154 C A "O4'"  1  
ATOM 4964   C "C3'"  . C A 1 154 ? 104.689 119.392 126.842 1.00 0.00 ? 154 C A "C3'"  1  
ATOM 4965   O "O3'"  . C A 1 154 ? 105.613 118.778 127.726 1.00 0.00 ? 154 C A "O3'"  1  
ATOM 4966   C "C2'"  . C A 1 154 ? 104.761 118.856 125.419 1.00 0.00 ? 154 C A "C2'"  1  
ATOM 4967   O "O2'"  . C A 1 154 ? 104.846 117.438 125.404 1.00 0.00 ? 154 C A "O2'"  1  
ATOM 4968   C "C1'"  . C A 1 154 ? 103.399 119.278 124.867 1.00 0.00 ? 154 C A "C1'"  1  
ATOM 4969   N N1     . C A 1 154 ? 103.464 120.560 124.123 1.00 0.00 ? 154 C A N1     1  
ATOM 4970   C C2     . C A 1 154 ? 103.985 120.548 122.822 1.00 0.00 ? 154 C A C2     1  
ATOM 4971   O O2     . C A 1 154 ? 104.374 119.475 122.334 1.00 0.00 ? 154 C A O2     1  
ATOM 4972   N N3     . C A 1 154 ? 104.055 121.704 122.122 1.00 0.00 ? 154 C A N3     1  
ATOM 4973   C C4     . C A 1 154 ? 103.632 122.843 122.669 1.00 0.00 ? 154 C A C4     1  
ATOM 4974   N N4     . C A 1 154 ? 103.721 123.960 121.941 1.00 0.00 ? 154 C A N4     1  
ATOM 4975   C C5     . C A 1 154 ? 103.098 122.889 123.989 1.00 0.00 ? 154 C A C5     1  
ATOM 4976   C C6     . C A 1 154 ? 103.032 121.739 124.671 1.00 0.00 ? 154 C A C6     1  
ATOM 4977   H "H5'"  . C A 1 154 ? 101.743 119.747 128.478 1.00 0.00 ? 154 C A "H5'"  1  
ATOM 4978   H "H5''" . C A 1 154 ? 103.186 119.805 129.158 1.00 0.00 ? 154 C A "H5''" 1  
ATOM 4979   H "H4'"  . C A 1 154 ? 103.139 118.187 127.467 1.00 0.00 ? 154 C A "H4'"  1  
ATOM 4980   H "H3'"  . C A 1 154 ? 104.851 120.358 126.827 1.00 0.00 ? 154 C A "H3'"  1  
ATOM 4981   H "H2'"  . C A 1 154 ? 105.494 119.269 124.916 1.00 0.00 ? 154 C A "H2'"  1  
ATOM 4982   H "HO2'" . C A 1 154 ? 104.929 117.134 124.478 1.00 0.00 ? 154 C A "HO2'" 1  
ATOM 4983   H "H1'"  . C A 1 154 ? 103.057 118.575 124.274 1.00 0.00 ? 154 C A "H1'"  1  
ATOM 4984   H H41    . C A 1 154 ? 104.089 123.924 121.032 1.00 0.00 ? 154 C A H41    1  
ATOM 4985   H H42    . C A 1 154 ? 103.418 124.812 122.314 1.00 0.00 ? 154 C A H42    1  
ATOM 4986   H H5     . C A 1 154 ? 102.788 123.730 124.380 1.00 0.00 ? 154 C A H5     1  
ATOM 4987   H H6     . C A 1 154 ? 102.668 121.749 125.579 1.00 0.00 ? 154 C A H6     1  
ATOM 4988   P P      . A A 1 155 ? 107.059 119.434 127.944 1.00 0.00 ? 155 A A P      1  
ATOM 4989   O OP1    . A A 1 155 ? 107.705 118.647 129.024 1.00 0.00 ? 155 A A OP1    1  
ATOM 4990   O OP2    . A A 1 155 ? 106.821 120.886 128.136 1.00 0.00 ? 155 A A OP2    1  
ATOM 4991   O "O5'"  . A A 1 155 ? 107.919 119.247 126.615 1.00 0.00 ? 155 A A "O5'"  1  
ATOM 4992   C "C5'"  . A A 1 155 ? 109.313 118.984 126.682 1.00 0.00 ? 155 A A "C5'"  1  
ATOM 4993   C "C4'"  . A A 1 155 ? 110.063 119.691 125.582 1.00 0.00 ? 155 A A "C4'"  1  
ATOM 4994   O "O4'"  . A A 1 155 ? 109.171 119.953 124.466 1.00 0.00 ? 155 A A "O4'"  1  
ATOM 4995   C "C3'"  . A A 1 155 ? 110.627 121.060 125.931 1.00 0.00 ? 155 A A "C3'"  1  
ATOM 4996   O "O3'"  . A A 1 155 ? 111.852 120.989 126.639 1.00 0.00 ? 155 A A "O3'"  1  
ATOM 4997   C "C2'"  . A A 1 155 ? 110.744 121.730 124.571 1.00 0.00 ? 155 A A "C2'"  1  
ATOM 4998   O "O2'"  . A A 1 155 ? 111.892 121.272 123.868 1.00 0.00 ? 155 A A "O2'"  1  
ATOM 4999   C "C1'"  . A A 1 155 ? 109.491 121.209 123.864 1.00 0.00 ? 155 A A "C1'"  1  
ATOM 5000   N N9     . A A 1 155 ? 108.359 122.148 123.975 1.00 0.00 ? 155 A A N9     1  
ATOM 5001   C C8     . A A 1 155 ? 107.247 122.040 124.774 1.00 0.00 ? 155 A A C8     1  
ATOM 5002   N N7     . A A 1 155 ? 106.411 123.040 124.652 1.00 0.00 ? 155 A A N7     1  
ATOM 5003   C C5     . A A 1 155 ? 107.012 123.866 123.708 1.00 0.00 ? 155 A A C5     1  
ATOM 5004   C C6     . A A 1 155 ? 106.626 125.092 123.141 1.00 0.00 ? 155 A A C6     1  
ATOM 5005   N N6     . A A 1 155 ? 105.496 125.728 123.453 1.00 0.00 ? 155 A A N6     1  
ATOM 5006   N N1     . A A 1 155 ? 107.452 125.648 122.228 1.00 0.00 ? 155 A A N1     1  
ATOM 5007   C C2     . A A 1 155 ? 108.586 125.009 121.916 1.00 0.00 ? 155 A A C2     1  
ATOM 5008   N N3     . A A 1 155 ? 109.057 123.855 122.381 1.00 0.00 ? 155 A A N3     1  
ATOM 5009   C C4     . A A 1 155 ? 108.211 123.328 123.285 1.00 0.00 ? 155 A A C4     1  
ATOM 5010   H "H5'"  . A A 1 155 ? 109.458 118.018 126.597 1.00 0.00 ? 155 A A "H5'"  1  
ATOM 5011   H "H5''" . A A 1 155 ? 109.656 119.283 127.548 1.00 0.00 ? 155 A A "H5''" 1  
ATOM 5012   H "H4'"  . A A 1 155 ? 110.795 119.116 125.275 1.00 0.00 ? 155 A A "H4'"  1  
ATOM 5013   H "H3'"  . A A 1 155 ? 109.971 121.548 126.473 1.00 0.00 ? 155 A A "H3'"  1  
ATOM 5014   H "H2'"  . A A 1 155 ? 110.732 122.706 124.648 1.00 0.00 ? 155 A A "H2'"  1  
ATOM 5015   H "HO2'" . A A 1 155 ? 111.965 121.760 123.022 1.00 0.00 ? 155 A A "HO2'" 1  
ATOM 5016   H "H1'"  . A A 1 155 ? 109.692 121.050 122.918 1.00 0.00 ? 155 A A "H1'"  1  
ATOM 5017   H H8     . A A 1 155 ? 107.093 121.285 125.379 1.00 0.00 ? 155 A A H8     1  
ATOM 5018   H H61    . A A 1 155 ? 105.279 126.585 123.022 1.00 0.00 ? 155 A A H61    1  
ATOM 5019   H H62    . A A 1 155 ? 104.881 125.344 124.112 1.00 0.00 ? 155 A A H62    1  
ATOM 5020   H H2     . A A 1 155 ? 109.150 125.457 121.250 1.00 0.00 ? 155 A A H2     1  
ATOM 5021   P P      . C A 1 156 ? 112.249 122.141 127.687 1.00 0.00 ? 156 C A P      1  
ATOM 5022   O OP1    . C A 1 156 ? 113.493 121.724 128.380 1.00 0.00 ? 156 C A OP1    1  
ATOM 5023   O OP2    . C A 1 156 ? 111.043 122.475 128.483 1.00 0.00 ? 156 C A OP2    1  
ATOM 5024   O "O5'"  . C A 1 156 ? 112.595 123.397 126.767 1.00 0.00 ? 156 C A "O5'"  1  
ATOM 5025   C "C5'"  . C A 1 156 ? 113.804 123.444 126.024 1.00 0.00 ? 156 C A "C5'"  1  
ATOM 5026   C "C4'"  . C A 1 156 ? 113.897 124.699 125.190 1.00 0.00 ? 156 C A "C4'"  1  
ATOM 5027   O "O4'"  . C A 1 156 ? 112.770 124.768 124.278 1.00 0.00 ? 156 C A "O4'"  1  
ATOM 5028   C "C3'"  . C A 1 156 ? 113.839 126.016 125.950 1.00 0.00 ? 156 C A "C3'"  1  
ATOM 5029   O "O3'"  . C A 1 156 ? 115.076 126.370 126.539 1.00 0.00 ? 156 C A "O3'"  1  
ATOM 5030   C "C2'"  . C A 1 156 ? 113.364 126.994 124.884 1.00 0.00 ? 156 C A "C2'"  1  
ATOM 5031   O "O2'"  . C A 1 156 ? 114.426 127.360 124.013 1.00 0.00 ? 156 C A "O2'"  1  
ATOM 5032   C "C1'"  . C A 1 156 ? 112.360 126.138 124.109 1.00 0.00 ? 156 C A "C1'"  1  
ATOM 5033   N N1     . C A 1 156 ? 110.969 126.341 124.579 1.00 0.00 ? 156 C A N1     1  
ATOM 5034   C C2     . C A 1 156 ? 110.292 127.498 124.176 1.00 0.00 ? 156 C A C2     1  
ATOM 5035   O O2     . C A 1 156 ? 110.872 128.316 123.442 1.00 0.00 ? 156 C A O2     1  
ATOM 5036   N N3     . C A 1 156 ? 109.022 127.707 124.586 1.00 0.00 ? 156 C A N3     1  
ATOM 5037   C C4     . C A 1 156 ? 108.420 126.815 125.374 1.00 0.00 ? 156 C A C4     1  
ATOM 5038   N N4     . C A 1 156 ? 107.164 127.063 125.757 1.00 0.00 ? 156 C A N4     1  
ATOM 5039   C C5     . C A 1 156 ? 109.079 125.629 125.803 1.00 0.00 ? 156 C A C5     1  
ATOM 5040   C C6     . C A 1 156 ? 110.336 125.432 125.387 1.00 0.00 ? 156 C A C6     1  
ATOM 5041   H "H5'"  . C A 1 156 ? 113.846 122.663 125.435 1.00 0.00 ? 156 C A "H5'"  1  
ATOM 5042   H "H5''" . C A 1 156 ? 114.562 123.418 126.646 1.00 0.00 ? 156 C A "H5''" 1  
ATOM 5043   H "H4'"  . C A 1 156 ? 114.726 124.670 124.667 1.00 0.00 ? 156 C A "H4'"  1  
ATOM 5044   H "H3'"  . C A 1 156 ? 113.155 125.951 126.650 1.00 0.00 ? 156 C A "H3'"  1  
ATOM 5045   H "H2'"  . C A 1 156 ? 112.935 127.779 125.282 1.00 0.00 ? 156 C A "H2'"  1  
ATOM 5046   H "HO2'" . C A 1 156 ? 114.099 128.025 123.374 1.00 0.00 ? 156 C A "HO2'" 1  
ATOM 5047   H "H1'"  . C A 1 156 ? 112.416 126.355 123.154 1.00 0.00 ? 156 C A "H1'"  1  
ATOM 5048   H H41    . C A 1 156 ? 106.713 127.880 125.462 1.00 0.00 ? 156 C A H41    1  
ATOM 5049   H H42    . C A 1 156 ? 106.697 126.427 126.336 1.00 0.00 ? 156 C A H42    1  
ATOM 5050   H H5     . C A 1 156 ? 108.629 124.979 126.382 1.00 0.00 ? 156 C A H5     1  
ATOM 5051   H H6     . C A 1 156 ? 110.808 124.622 125.671 1.00 0.00 ? 156 C A H6     1  
ATOM 5052   P P      . G A 1 157 ? 115.670 127.841 126.309 1.00 0.00 ? 157 G A P      1  
ATOM 5053   O OP1    . G A 1 157 ? 116.212 127.850 124.925 1.00 0.00 ? 157 G A OP1    1  
ATOM 5054   O OP2    . G A 1 157 ? 116.579 128.094 127.455 1.00 0.00 ? 157 G A OP2    1  
ATOM 5055   O "O5'"  . G A 1 157 ? 114.483 128.898 126.377 1.00 0.00 ? 157 G A "O5'"  1  
ATOM 5056   C "C5'"  . G A 1 157 ? 113.978 129.348 127.626 1.00 0.00 ? 157 G A "C5'"  1  
ATOM 5057   C "C4'"  . G A 1 157 ? 113.041 130.519 127.455 1.00 0.00 ? 157 G A "C4'"  1  
ATOM 5058   O "O4'"  . G A 1 157 ? 111.897 130.122 126.656 1.00 0.00 ? 157 G A "O4'"  1  
ATOM 5059   C "C3'"  . G A 1 157 ? 112.426 131.071 128.733 1.00 0.00 ? 157 G A "C3'"  1  
ATOM 5060   O "O3'"  . G A 1 157 ? 113.297 131.941 129.436 1.00 0.00 ? 157 G A "O3'"  1  
ATOM 5061   C "C2'"  . G A 1 157 ? 111.164 131.754 128.222 1.00 0.00 ? 157 G A "C2'"  1  
ATOM 5062   O "O2'"  . G A 1 157 ? 111.458 133.016 127.640 1.00 0.00 ? 157 G A "O2'"  1  
ATOM 5063   C "C1'"  . G A 1 157 ? 110.719 130.791 127.122 1.00 0.00 ? 157 G A "C1'"  1  
ATOM 5064   N N9     . G A 1 157 ? 109.723 129.815 127.605 1.00 0.00 ? 157 G A N9     1  
ATOM 5065   C C8     . G A 1 157 ? 109.920 128.477 127.844 1.00 0.00 ? 157 G A C8     1  
ATOM 5066   N N7     . G A 1 157 ? 108.844 127.868 128.267 1.00 0.00 ? 157 G A N7     1  
ATOM 5067   C C5     . G A 1 157 ? 107.880 128.867 128.311 1.00 0.00 ? 157 G A C5     1  
ATOM 5068   C C6     . G A 1 157 ? 106.515 128.810 128.694 1.00 0.00 ? 157 G A C6     1  
ATOM 5069   O O6     . G A 1 157 ? 105.864 127.833 129.084 1.00 0.00 ? 157 G A O6     1  
ATOM 5070   N N1     . G A 1 157 ? 105.901 130.054 128.589 1.00 0.00 ? 157 G A N1     1  
ATOM 5071   C C2     . G A 1 157 ? 106.520 131.206 128.169 1.00 0.00 ? 157 G A C2     1  
ATOM 5072   N N2     . G A 1 157 ? 105.760 132.310 128.134 1.00 0.00 ? 157 G A N2     1  
ATOM 5073   N N3     . G A 1 157 ? 107.792 131.272 127.810 1.00 0.00 ? 157 G A N3     1  
ATOM 5074   C C4     . G A 1 157 ? 108.406 130.074 127.905 1.00 0.00 ? 157 G A C4     1  
ATOM 5075   H "H5'"  . G A 1 157 ? 114.726 129.619 128.196 1.00 0.00 ? 157 G A "H5'"  1  
ATOM 5076   H "H5''" . G A 1 157 ? 113.496 128.614 128.059 1.00 0.00 ? 157 G A "H5''" 1  
ATOM 5077   H "H4'"  . G A 1 157 ? 113.518 131.241 126.993 1.00 0.00 ? 157 G A "H4'"  1  
ATOM 5078   H "H3'"  . G A 1 157 ? 112.173 130.326 129.316 1.00 0.00 ? 157 G A "H3'"  1  
ATOM 5079   H "H2'"  . G A 1 157 ? 110.487 131.830 128.927 1.00 0.00 ? 157 G A "H2'"  1  
ATOM 5080   H "HO2'" . G A 1 157 ? 110.621 133.451 127.380 1.00 0.00 ? 157 G A "HO2'" 1  
ATOM 5081   H "H1'"  . G A 1 157 ? 110.342 131.302 126.375 1.00 0.00 ? 157 G A "H1'"  1  
ATOM 5082   H H8     . G A 1 157 ? 110.778 128.023 127.709 1.00 0.00 ? 157 G A H8     1  
ATOM 5083   H H1     . G A 1 157 ? 104.953 130.111 128.833 1.00 0.00 ? 157 G A H1     1  
ATOM 5084   H H21    . G A 1 157 ? 104.820 132.270 128.399 1.00 0.00 ? 157 G A H21    1  
ATOM 5085   H H22    . G A 1 157 ? 106.150 133.162 127.842 1.00 0.00 ? 157 G A H22    1  
ATOM 5086   P P      . C A 1 158 ? 113.152 132.110 131.027 1.00 0.00 ? 158 C A P      1  
ATOM 5087   O OP1    . C A 1 158 ? 114.242 133.005 131.495 1.00 0.00 ? 158 C A OP1    1  
ATOM 5088   O OP2    . C A 1 158 ? 113.005 130.759 131.624 1.00 0.00 ? 158 C A OP2    1  
ATOM 5089   O "O5'"  . C A 1 158 ? 111.770 132.881 131.210 1.00 0.00 ? 158 C A "O5'"  1  
ATOM 5090   C "C5'"  . C A 1 158 ? 111.660 134.262 130.900 1.00 0.00 ? 158 C A "C5'"  1  
ATOM 5091   C "C4'"  . C A 1 158 ? 110.261 134.777 131.141 1.00 0.00 ? 158 C A "C4'"  1  
ATOM 5092   O "O4'"  . C A 1 158 ? 109.315 134.036 130.326 1.00 0.00 ? 158 C A "O4'"  1  
ATOM 5093   C "C3'"  . C A 1 158 ? 109.725 134.628 132.557 1.00 0.00 ? 158 C A "C3'"  1  
ATOM 5094   O "O3'"  . C A 1 158 ? 110.203 135.630 133.439 1.00 0.00 ? 158 C A "O3'"  1  
ATOM 5095   C "C2'"  . C A 1 158 ? 108.219 134.663 132.348 1.00 0.00 ? 158 C A "C2'"  1  
ATOM 5096   O "O2'"  . C A 1 158 ? 107.758 135.992 132.147 1.00 0.00 ? 158 C A "O2'"  1  
ATOM 5097   C "C1'"  . C A 1 158 ? 108.072 133.883 131.040 1.00 0.00 ? 158 C A "C1'"  1  
ATOM 5098   N N1     . C A 1 158 ? 107.765 132.450 131.272 1.00 0.00 ? 158 C A N1     1  
ATOM 5099   C C2     . C A 1 158 ? 106.452 132.098 131.608 1.00 0.00 ? 158 C A C2     1  
ATOM 5100   O O2     . C A 1 158 ? 105.591 132.987 131.701 1.00 0.00 ? 158 C A O2     1  
ATOM 5101   N N3     . C A 1 158 ? 106.143 130.797 131.822 1.00 0.00 ? 158 C A N3     1  
ATOM 5102   C C4     . C A 1 158 ? 107.086 129.862 131.716 1.00 0.00 ? 158 C A C4     1  
ATOM 5103   N N4     . C A 1 158 ? 106.737 128.593 131.936 1.00 0.00 ? 158 C A N4     1  
ATOM 5104   C C5     . C A 1 158 ? 108.431 130.186 131.377 1.00 0.00 ? 158 C A C5     1  
ATOM 5105   C C6     . C A 1 158 ? 108.722 131.477 131.165 1.00 0.00 ? 158 C A C6     1  
ATOM 5106   H "H5'"  . C A 1 158 ? 111.892 134.396 129.957 1.00 0.00 ? 158 C A "H5'"  1  
ATOM 5107   H "H5''" . C A 1 158 ? 112.286 134.768 131.459 1.00 0.00 ? 158 C A "H5''" 1  
ATOM 5108   H "H4'"  . C A 1 158 ? 110.225 135.722 130.886 1.00 0.00 ? 158 C A "H4'"  1  
ATOM 5109   H "H3'"  . C A 1 158 ? 109.980 133.745 132.904 1.00 0.00 ? 158 C A "H3'"  1  
ATOM 5110   H "H2'"  . C A 1 158 ? 107.742 134.222 133.083 1.00 0.00 ? 158 C A "H2'"  1  
ATOM 5111   H "HO2'" . C A 1 158 ? 108.426 136.617 132.495 1.00 0.00 ? 158 C A "HO2'" 1  
ATOM 5112   H "H1'"  . C A 1 158 ? 107.361 134.284 130.499 1.00 0.00 ? 158 C A "H1'"  1  
ATOM 5113   H H41    . C A 1 158 ? 105.810 128.373 132.171 1.00 0.00 ? 158 C A H41    1  
ATOM 5114   H H42    . C A 1 158 ? 107.405 127.882 131.865 1.00 0.00 ? 158 C A H42    1  
ATOM 5115   H H5     . C A 1 158 ? 109.117 129.492 131.300 1.00 0.00 ? 158 C A H5     1  
ATOM 5116   H H6     . C A 1 158 ? 109.642 131.721 130.932 1.00 0.00 ? 158 C A H6     1  
ATOM 5117   P P      . A A 1 159 ? 110.292 135.342 135.018 1.00 0.00 ? 159 A A P      1  
ATOM 5118   O OP1    . A A 1 159 ? 110.959 136.502 135.659 1.00 0.00 ? 159 A A OP1    1  
ATOM 5119   O OP2    . A A 1 159 ? 110.847 133.978 135.206 1.00 0.00 ? 159 A A OP2    1  
ATOM 5120   O "O5'"  . A A 1 159 ? 108.772 135.324 135.492 1.00 0.00 ? 159 A A "O5'"  1  
ATOM 5121   C "C5'"  . A A 1 159 ? 107.980 136.502 135.449 1.00 0.00 ? 159 A A "C5'"  1  
ATOM 5122   C "C4'"  . A A 1 159 ? 106.546 136.221 135.823 1.00 0.00 ? 159 A A "C4'"  1  
ATOM 5123   O "O4'"  . A A 1 159 ? 105.964 135.296 134.869 1.00 0.00 ? 159 A A "O4'"  1  
ATOM 5124   C "C3'"  . A A 1 159 ? 106.326 135.552 137.171 1.00 0.00 ? 159 A A "C3'"  1  
ATOM 5125   O "O3'"  . A A 1 159 ? 106.399 136.458 138.257 1.00 0.00 ? 159 A A "O3'"  1  
ATOM 5126   C "C2'"  . A A 1 159 ? 104.956 134.908 137.003 1.00 0.00 ? 159 A A "C2'"  1  
ATOM 5127   O "O2'"  . A A 1 159 ? 103.916 135.867 137.135 1.00 0.00 ? 159 A A "O2'"  1  
ATOM 5128   C "C1'"  . A A 1 159 ? 105.015 134.439 135.548 1.00 0.00 ? 159 A A "C1'"  1  
ATOM 5129   N N9     . A A 1 159 ? 105.407 133.020 135.439 1.00 0.00 ? 159 A A N9     1  
ATOM 5130   C C8     . A A 1 159 ? 106.625 132.506 135.069 1.00 0.00 ? 159 A A C8     1  
ATOM 5131   N N7     . A A 1 159 ? 106.667 131.197 135.065 1.00 0.00 ? 159 A A N7     1  
ATOM 5132   C C5     . A A 1 159 ? 105.390 130.821 135.457 1.00 0.00 ? 159 A A C5     1  
ATOM 5133   C C6     . A A 1 159 ? 104.789 129.565 135.647 1.00 0.00 ? 159 A A C6     1  
ATOM 5134   N N6     . A A 1 159 ? 105.422 128.405 135.462 1.00 0.00 ? 159 A A N6     1  
ATOM 5135   N N1     . A A 1 159 ? 103.497 129.540 136.042 1.00 0.00 ? 159 A A N1     1  
ATOM 5136   C C2     . A A 1 159 ? 102.862 130.704 136.230 1.00 0.00 ? 159 A A C2     1  
ATOM 5137   N N3     . A A 1 159 ? 103.319 131.946 136.083 1.00 0.00 ? 159 A A N3     1  
ATOM 5138   C C4     . A A 1 159 ? 104.605 131.936 135.690 1.00 0.00 ? 159 A A C4     1  
ATOM 5139   H "H5'"  . A A 1 159 ? 108.007 136.875 134.542 1.00 0.00 ? 159 A A "H5'"  1  
ATOM 5140   H "H5''" . A A 1 159 ? 108.351 137.160 136.075 1.00 0.00 ? 159 A A "H5''" 1  
ATOM 5141   H "H4'"  . A A 1 159 ? 106.041 137.063 135.799 1.00 0.00 ? 159 A A "H4'"  1  
ATOM 5142   H "H3'"  . A A 1 159 ? 106.997 134.849 137.292 1.00 0.00 ? 159 A A "H3'"  1  
ATOM 5143   H "H2'"  . A A 1 159 ? 104.836 134.156 137.618 1.00 0.00 ? 159 A A "H2'"  1  
ATOM 5144   H "HO2'" . A A 1 159 ? 104.261 136.651 137.611 1.00 0.00 ? 159 A A "HO2'" 1  
ATOM 5145   H "H1'"  . A A 1 159 ? 104.141 134.571 135.127 1.00 0.00 ? 159 A A "H1'"  1  
ATOM 5146   H H8     . A A 1 159 ? 107.394 133.069 134.831 1.00 0.00 ? 159 A A H8     1  
ATOM 5147   H H61    . A A 1 159 ? 104.948 127.560 135.610 1.00 0.00 ? 159 A A H61    1  
ATOM 5148   H H62    . A A 1 159 ? 106.360 128.399 135.176 1.00 0.00 ? 159 A A H62    1  
ATOM 5149   H H2     . A A 1 159 ? 101.926 130.630 136.516 1.00 0.00 ? 159 A A H2     1  
ATOM 5150   P P      . G A 1 160 ? 106.835 135.941 139.715 1.00 0.00 ? 160 G A P      1  
ATOM 5151   O OP1    . G A 1 160 ? 106.950 137.118 140.610 1.00 0.00 ? 160 G A OP1    1  
ATOM 5152   O OP2    . G A 1 160 ? 107.998 135.031 139.550 1.00 0.00 ? 160 G A OP2    1  
ATOM 5153   O "O5'"  . G A 1 160 ? 105.593 135.069 140.203 1.00 0.00 ? 160 G A "O5'"  1  
ATOM 5154   C "C5'"  . G A 1 160 ? 104.342 135.677 140.480 1.00 0.00 ? 160 G A "C5'"  1  
ATOM 5155   C "C4'"  . G A 1 160 ? 103.277 134.648 140.777 1.00 0.00 ? 160 G A "C4'"  1  
ATOM 5156   O "O4'"  . G A 1 160 ? 103.105 133.777 139.628 1.00 0.00 ? 160 G A "O4'"  1  
ATOM 5157   C "C3'"  . G A 1 160 ? 103.574 133.694 141.924 1.00 0.00 ? 160 G A "C3'"  1  
ATOM 5158   O "O3'"  . G A 1 160 ? 103.329 134.267 143.198 1.00 0.00 ? 160 G A "O3'"  1  
ATOM 5159   C "C2'"  . G A 1 160 ? 102.680 132.505 141.605 1.00 0.00 ? 160 G A "C2'"  1  
ATOM 5160   O "O2'"  . G A 1 160 ? 101.330 132.763 141.962 1.00 0.00 ? 160 G A "O2'"  1  
ATOM 5161   C "C1'"  . G A 1 160 ? 102.785 132.442 140.080 1.00 0.00 ? 160 G A "C1'"  1  
ATOM 5162   N N9     . G A 1 160 ? 103.793 131.464 139.633 1.00 0.00 ? 160 G A N9     1  
ATOM 5163   C C8     . G A 1 160 ? 105.046 131.729 139.135 1.00 0.00 ? 160 G A C8     1  
ATOM 5164   N N7     . G A 1 160 ? 105.712 130.651 138.819 1.00 0.00 ? 160 G A N7     1  
ATOM 5165   C C5     . G A 1 160 ? 104.850 129.612 139.131 1.00 0.00 ? 160 G A C5     1  
ATOM 5166   C C6     . G A 1 160 ? 105.018 128.206 139.008 1.00 0.00 ? 160 G A C6     1  
ATOM 5167   O O6     . G A 1 160 ? 105.999 127.584 138.585 1.00 0.00 ? 160 G A O6     1  
ATOM 5168   N N1     . G A 1 160 ? 103.890 127.515 139.439 1.00 0.00 ? 160 G A N1     1  
ATOM 5169   C C2     . G A 1 160 ? 102.747 128.098 139.928 1.00 0.00 ? 160 G A C2     1  
ATOM 5170   N N2     . G A 1 160 ? 101.764 127.263 140.296 1.00 0.00 ? 160 G A N2     1  
ATOM 5171   N N3     . G A 1 160 ? 102.576 129.405 140.048 1.00 0.00 ? 160 G A N3     1  
ATOM 5172   C C4     . G A 1 160 ? 103.659 130.095 139.634 1.00 0.00 ? 160 G A C4     1  
ATOM 5173   H "H5'"  . G A 1 160 ? 104.064 136.210 139.706 1.00 0.00 ? 160 G A "H5'"  1  
ATOM 5174   H "H5''" . G A 1 160 ? 104.438 136.270 141.256 1.00 0.00 ? 160 G A "H5''" 1  
ATOM 5175   H "H4'"  . G A 1 160 ? 102.433 135.109 140.956 1.00 0.00 ? 160 G A "H4'"  1  
ATOM 5176   H "H3'"  . G A 1 160 ? 104.512 133.412 141.873 1.00 0.00 ? 160 G A "H3'"  1  
ATOM 5177   H "H2'"  . G A 1 160 ? 103.014 131.683 142.021 1.00 0.00 ? 160 G A "H2'"  1  
ATOM 5178   H "HO2'" . G A 1 160 ? 100.789 131.973 141.767 1.00 0.00 ? 160 G A "HO2'" 1  
ATOM 5179   H "H1'"  . G A 1 160 ? 101.913 132.208 139.702 1.00 0.00 ? 160 G A "H1'"  1  
ATOM 5180   H H8     . G A 1 160 ? 105.401 132.635 139.023 1.00 0.00 ? 160 G A H8     1  
ATOM 5181   H H1     . G A 1 160 ? 103.918 126.537 139.391 1.00 0.00 ? 160 G A H1     1  
ATOM 5182   H H21    . G A 1 160 ? 101.882 126.294 140.211 1.00 0.00 ? 160 G A H21    1  
ATOM 5183   H H22    . G A 1 160 ? 100.923 127.622 140.650 1.00 0.00 ? 160 G A H22    1  
ATOM 5184   P P      . U A 1 161 ? 104.133 133.741 144.487 1.00 0.00 ? 161 U A P      1  
ATOM 5185   O OP1    . U A 1 161 ? 103.761 134.600 145.641 1.00 0.00 ? 161 U A OP1    1  
ATOM 5186   O OP2    . U A 1 161 ? 105.560 133.596 144.110 1.00 0.00 ? 161 U A OP2    1  
ATOM 5187   O "O5'"  . U A 1 161 ? 103.540 132.287 144.744 1.00 0.00 ? 161 U A "O5'"  1  
ATOM 5188   C "C5'"  . U A 1 161 ? 102.187 132.107 145.132 1.00 0.00 ? 161 U A "C5'"  1  
ATOM 5189   C "C4'"  . U A 1 161 ? 101.808 130.648 145.179 1.00 0.00 ? 161 U A "C4'"  1  
ATOM 5190   O "O4'"  . U A 1 161 ? 101.955 130.055 143.862 1.00 0.00 ? 161 U A "O4'"  1  
ATOM 5191   C "C3'"  . U A 1 161 ? 102.656 129.765 146.079 1.00 0.00 ? 161 U A "C3'"  1  
ATOM 5192   O "O3'"  . U A 1 161 ? 102.307 129.868 147.449 1.00 0.00 ? 161 U A "O3'"  1  
ATOM 5193   C "C2'"  . U A 1 161 ? 102.429 128.378 145.494 1.00 0.00 ? 161 U A "C2'"  1  
ATOM 5194   O "O2'"  . U A 1 161 ? 101.173 127.850 145.892 1.00 0.00 ? 161 U A "O2'"  1  
ATOM 5195   C "C1'"  . U A 1 161 ? 102.386 128.682 143.995 1.00 0.00 ? 161 U A "C1'"  1  
ATOM 5196   N N1     . U A 1 161 ? 103.699 128.465 143.339 1.00 0.00 ? 161 U A N1     1  
ATOM 5197   C C2     . U A 1 161 ? 104.055 127.160 143.055 1.00 0.00 ? 161 U A C2     1  
ATOM 5198   O O2     . U A 1 161 ? 103.345 126.206 143.319 1.00 0.00 ? 161 U A O2     1  
ATOM 5199   N N3     . U A 1 161 ? 105.277 127.008 142.449 1.00 0.00 ? 161 U A N3     1  
ATOM 5200   C C4     . U A 1 161 ? 106.164 128.006 142.102 1.00 0.00 ? 161 U A C4     1  
ATOM 5201   O O4     . U A 1 161 ? 107.231 127.706 141.562 1.00 0.00 ? 161 U A O4     1  
ATOM 5202   C C5     . U A 1 161 ? 105.730 129.330 142.427 1.00 0.00 ? 161 U A C5     1  
ATOM 5203   C C6     . U A 1 161 ? 104.543 129.506 143.017 1.00 0.00 ? 161 U A C6     1  
ATOM 5204   H "H5'"  . U A 1 161 ? 101.607 132.568 144.489 1.00 0.00 ? 161 U A "H5'"  1  
ATOM 5205   H "H5''" . U A 1 161 ? 102.053 132.501 146.021 1.00 0.00 ? 161 U A "H5''" 1  
ATOM 5206   H "H4'"  . U A 1 161 ? 100.870 130.573 145.456 1.00 0.00 ? 161 U A "H4'"  1  
ATOM 5207   H "H3'"  . U A 1 161 ? 103.601 130.007 145.970 1.00 0.00 ? 161 U A "H3'"  1  
ATOM 5208   H "H2'"  . U A 1 161 ? 103.166 127.767 145.714 1.00 0.00 ? 161 U A "H2'"  1  
ATOM 5209   H "HO2'" . U A 1 161 ? 101.276 126.896 146.091 1.00 0.00 ? 161 U A "HO2'" 1  
ATOM 5210   H "H1'"  . U A 1 161 ? 101.714 128.113 143.567 1.00 0.00 ? 161 U A "H1'"  1  
ATOM 5211   H H3     . U A 1 161 ? 105.550 126.091 142.240 1.00 0.00 ? 161 U A H3     1  
ATOM 5212   H H5     . U A 1 161 ? 106.297 130.101 142.215 1.00 0.00 ? 161 U A H5     1  
ATOM 5213   H H6     . U A 1 161 ? 104.269 130.423 143.229 1.00 0.00 ? 161 U A H6     1  
ATOM 5214   P P      . C A 1 162 ? 103.437 129.749 148.584 1.00 0.00 ? 162 C A P      1  
ATOM 5215   O OP1    . C A 1 162 ? 102.863 130.250 149.859 1.00 0.00 ? 162 C A OP1    1  
ATOM 5216   O OP2    . C A 1 162 ? 104.686 130.353 148.056 1.00 0.00 ? 162 C A OP2    1  
ATOM 5217   O "O5'"  . C A 1 162 ? 103.672 128.181 148.733 1.00 0.00 ? 162 C A "O5'"  1  
ATOM 5218   C "C5'"  . C A 1 162 ? 102.595 127.307 149.033 1.00 0.00 ? 162 C A "C5'"  1  
ATOM 5219   C "C4'"  . C A 1 162 ? 102.846 125.912 148.513 1.00 0.00 ? 162 C A "C4'"  1  
ATOM 5220   O "O4'"  . C A 1 162 ? 103.015 125.945 147.061 1.00 0.00 ? 162 C A "O4'"  1  
ATOM 5221   C "C3'"  . C A 1 162 ? 104.139 125.252 148.966 1.00 0.00 ? 162 C A "C3'"  1  
ATOM 5222   O "O3'"  . C A 1 162 ? 104.086 124.794 150.306 1.00 0.00 ? 162 C A "O3'"  1  
ATOM 5223   C "C2'"  . C A 1 162 ? 104.217 124.143 147.923 1.00 0.00 ? 162 C A "C2'"  1  
ATOM 5224   O "O2'"  . C A 1 162 ? 103.217 123.160 148.142 1.00 0.00 ? 162 C A "O2'"  1  
ATOM 5225   C "C1'"  . C A 1 162 ? 103.888 124.946 146.669 1.00 0.00 ? 162 C A "C1'"  1  
ATOM 5226   N N1     . C A 1 162 ? 105.092 125.571 146.068 1.00 0.00 ? 162 C A N1     1  
ATOM 5227   C C2     . C A 1 162 ? 105.887 124.796 145.214 1.00 0.00 ? 162 C A C2     1  
ATOM 5228   O O2     . C A 1 162 ? 105.565 123.620 144.987 1.00 0.00 ? 162 C A O2     1  
ATOM 5229   N N3     . C A 1 162 ? 106.990 125.342 144.652 1.00 0.00 ? 162 C A N3     1  
ATOM 5230   C C4     . C A 1 162 ? 107.315 126.608 144.912 1.00 0.00 ? 162 C A C4     1  
ATOM 5231   N N4     . C A 1 162 ? 108.413 127.105 144.336 1.00 0.00 ? 162 C A N4     1  
ATOM 5232   C C5     . C A 1 162 ? 106.529 127.422 145.776 1.00 0.00 ? 162 C A C5     1  
ATOM 5233   C C6     . C A 1 162 ? 105.439 126.871 146.325 1.00 0.00 ? 162 C A C6     1  
ATOM 5234   H "H5'"  . C A 1 162 ? 101.776 127.657 148.624 1.00 0.00 ? 162 C A "H5'"  1  
ATOM 5235   H "H5''" . C A 1 162 ? 102.476 127.268 150.005 1.00 0.00 ? 162 C A "H5''" 1  
ATOM 5236   H "H4'"  . C A 1 162 ? 102.073 125.351 148.730 1.00 0.00 ? 162 C A "H4'"  1  
ATOM 5237   H "H3'"  . C A 1 162 ? 104.881 125.882 148.855 1.00 0.00 ? 162 C A "H3'"  1  
ATOM 5238   H "H2'"  . C A 1 162 ? 105.113 123.748 147.888 1.00 0.00 ? 162 C A "H2'"  1  
ATOM 5239   H "HO2'" . C A 1 162 ? 102.908 123.219 149.070 1.00 0.00 ? 162 C A "HO2'" 1  
ATOM 5240   H "H1'"  . C A 1 162 ? 103.464 124.356 146.012 1.00 0.00 ? 162 C A "H1'"  1  
ATOM 5241   H H41    . C A 1 162 ? 108.952 126.542 143.742 1.00 0.00 ? 162 C A H41    1  
ATOM 5242   H H42    . C A 1 162 ? 108.678 128.032 144.507 1.00 0.00 ? 162 C A H42    1  
ATOM 5243   H H5     . C A 1 162 ? 106.776 128.352 145.961 1.00 0.00 ? 162 C A H5     1  
ATOM 5244   H H6     . C A 1 162 ? 104.885 127.415 146.922 1.00 0.00 ? 162 C A H6     1  
ATOM 5245   P P      . A A 1 163 ? 105.427 124.728 151.191 1.00 0.00 ? 163 A A P      1  
ATOM 5246   O OP1    . A A 1 163 ? 105.031 124.610 152.617 1.00 0.00 ? 163 A A OP1    1  
ATOM 5247   O OP2    . A A 1 163 ? 106.314 125.839 150.765 1.00 0.00 ? 163 A A OP2    1  
ATOM 5248   O "O5'"  . A A 1 163 ? 106.110 123.357 150.754 1.00 0.00 ? 163 A A "O5'"  1  
ATOM 5249   C "C5'"  . A A 1 163 ? 105.576 122.110 151.174 1.00 0.00 ? 163 A A "C5'"  1  
ATOM 5250   C "C4'"  . A A 1 163 ? 106.249 120.955 150.476 1.00 0.00 ? 163 A A "C4'"  1  
ATOM 5251   O "O4'"  . A A 1 163 ? 105.986 121.004 149.050 1.00 0.00 ? 163 A A "O4'"  1  
ATOM 5252   C "C3'"  . A A 1 163 ? 107.767 120.914 150.567 1.00 0.00 ? 163 A A "C3'"  1  
ATOM 5253   O "O3'"  . A A 1 163 ? 108.235 120.320 151.766 1.00 0.00 ? 163 A A "O3'"  1  
ATOM 5254   C "C2'"  . A A 1 163 ? 108.140 120.054 149.365 1.00 0.00 ? 163 A A "C2'"  1  
ATOM 5255   O "O2'"  . A A 1 163 ? 107.938 118.675 149.636 1.00 0.00 ? 163 A A "O2'"  1  
ATOM 5256   C "C1'"  . A A 1 163 ? 107.110 120.515 148.333 1.00 0.00 ? 163 A A "C1'"  1  
ATOM 5257   N N9     . A A 1 163 ? 107.630 121.593 147.471 1.00 0.00 ? 163 A A N9     1  
ATOM 5258   C C8     . A A 1 163 ? 107.674 122.940 147.738 1.00 0.00 ? 163 A A C8     1  
ATOM 5259   N N7     . A A 1 163 ? 108.197 123.653 146.771 1.00 0.00 ? 163 A A N7     1  
ATOM 5260   C C5     . A A 1 163 ? 108.519 122.713 145.801 1.00 0.00 ? 163 A A C5     1  
ATOM 5261   C C6     . A A 1 163 ? 109.105 122.829 144.528 1.00 0.00 ? 163 A A C6     1  
ATOM 5262   N N6     . A A 1 163 ? 109.489 123.990 143.992 1.00 0.00 ? 163 A A N6     1  
ATOM 5263   N N1     . A A 1 163 ? 109.288 121.697 143.815 1.00 0.00 ? 163 A A N1     1  
ATOM 5264   C C2     . A A 1 163 ? 108.904 120.531 144.352 1.00 0.00 ? 163 A A C2     1  
ATOM 5265   N N3     . A A 1 163 ? 108.342 120.295 145.536 1.00 0.00 ? 163 A A N3     1  
ATOM 5266   C C4     . A A 1 163 ? 108.175 121.441 146.220 1.00 0.00 ? 163 A A C4     1  
ATOM 5267   H "H5'"  . A A 1 163 ? 104.617 122.088 150.974 1.00 0.00 ? 163 A A "H5'"  1  
ATOM 5268   H "H5''" . A A 1 163 ? 105.702 122.017 152.141 1.00 0.00 ? 163 A A "H5''" 1  
ATOM 5269   H "H4'"  . A A 1 163 ? 105.890 120.116 150.832 1.00 0.00 ? 163 A A "H4'"  1  
ATOM 5270   H "H3'"  . A A 1 163 ? 108.122 121.819 150.439 1.00 0.00 ? 163 A A "H3'"  1  
ATOM 5271   H "H2'"  . A A 1 163 ? 109.055 120.236 149.064 1.00 0.00 ? 163 A A "H2'"  1  
ATOM 5272   H "HO2'" . A A 1 163 ? 108.194 118.155 148.846 1.00 0.00 ? 163 A A "HO2'" 1  
ATOM 5273   H "H1'"  . A A 1 163 ? 106.842 119.753 147.777 1.00 0.00 ? 163 A A "H1'"  1  
ATOM 5274   H H8     . A A 1 163 ? 107.346 123.331 148.574 1.00 0.00 ? 163 A A H8     1  
ATOM 5275   H H61    . A A 1 163 ? 109.892 124.008 143.099 1.00 0.00 ? 163 A A H61    1  
ATOM 5276   H H62    . A A 1 163 ? 109.366 124.824 144.491 1.00 0.00 ? 163 A A H62    1  
ATOM 5277   H H2     . A A 1 163 ? 109.058 119.740 143.795 1.00 0.00 ? 163 A A H2     1  
ATOM 5278   P P      . A A 1 164 ? 107.530 120.685 153.190 1.00 0.00 ? 164 A A P      1  
ATOM 5279   O OP1    . A A 1 164 ? 108.218 119.925 154.263 1.00 0.00 ? 164 A A OP1    1  
ATOM 5280   O OP2    . A A 1 164 ? 106.097 120.420 152.905 1.00 0.00 ? 164 A A OP2    1  
ATOM 5281   O "O5'"  . A A 1 164 ? 107.689 122.238 153.506 1.00 0.00 ? 164 A A "O5'"  1  
ATOM 5282   C "C5'"  . A A 1 164 ? 108.864 122.739 154.125 1.00 0.00 ? 164 A A "C5'"  1  
ATOM 5283   C "C4'"  . A A 1 164 ? 110.096 122.425 153.313 1.00 0.00 ? 164 A A "C4'"  1  
ATOM 5284   O "O4'"  . A A 1 164 ? 109.757 122.407 151.904 1.00 0.00 ? 164 A A "O4'"  1  
ATOM 5285   C "C3'"  . A A 1 164 ? 111.230 123.434 153.404 1.00 0.00 ? 164 A A "C3'"  1  
ATOM 5286   O "O3'"  . A A 1 164 ? 112.048 123.249 154.546 1.00 0.00 ? 164 A A "O3'"  1  
ATOM 5287   C "C2'"  . A A 1 164 ? 111.968 123.241 152.089 1.00 0.00 ? 164 A A "C2'"  1  
ATOM 5288   O "O2'"  . A A 1 164 ? 112.840 122.121 152.148 1.00 0.00 ? 164 A A "O2'"  1  
ATOM 5289   C "C1'"  . A A 1 164 ? 110.820 122.924 151.136 1.00 0.00 ? 164 A A "C1'"  1  
ATOM 5290   N N9     . A A 1 164 ? 110.341 124.123 150.425 1.00 0.00 ? 164 A A N9     1  
ATOM 5291   C C8     . A A 1 164 ? 109.534 125.125 150.907 1.00 0.00 ? 164 A A C8     1  
ATOM 5292   N N7     . A A 1 164 ? 109.278 126.065 150.031 1.00 0.00 ? 164 A A N7     1  
ATOM 5293   C C5     . A A 1 164 ? 109.962 125.656 148.894 1.00 0.00 ? 164 A A C5     1  
ATOM 5294   C C6     . A A 1 164 ? 110.092 126.221 147.613 1.00 0.00 ? 164 A A C6     1  
ATOM 5295   N N6     . A A 1 164 ? 109.516 127.368 147.248 1.00 0.00 ? 164 A A N6     1  
ATOM 5296   N N1     . A A 1 164 ? 110.846 125.560 146.709 1.00 0.00 ? 164 A A N1     1  
ATOM 5297   C C2     . A A 1 164 ? 111.426 124.409 147.075 1.00 0.00 ? 164 A A C2     1  
ATOM 5298   N N3     . A A 1 164 ? 111.377 123.779 148.247 1.00 0.00 ? 164 A A N3     1  
ATOM 5299   C C4     . A A 1 164 ? 110.621 124.463 149.123 1.00 0.00 ? 164 A A C4     1  
ATOM 5300   H "H5'"  . A A 1 164 ? 108.955 122.335 155.014 1.00 0.00 ? 164 A A "H5'"  1  
ATOM 5301   H "H5''" . A A 1 164 ? 108.786 123.711 154.224 1.00 0.00 ? 164 A A "H5''" 1  
ATOM 5302   H "H4'"  . A A 1 164 ? 110.435 121.543 153.572 1.00 0.00 ? 164 A A "H4'"  1  
ATOM 5303   H "H3'"  . A A 1 164 ? 110.847 124.336 153.426 1.00 0.00 ? 164 A A "H3'"  1  
ATOM 5304   H "H2'"  . A A 1 164 ? 112.441 124.056 151.819 1.00 0.00 ? 164 A A "H2'"  1  
ATOM 5305   H "HO2'" . A A 1 164 ? 113.021 121.908 153.087 1.00 0.00 ? 164 A A "HO2'" 1  
ATOM 5306   H "H1'"  . A A 1 164 ? 111.114 122.253 150.484 1.00 0.00 ? 164 A A "H1'"  1  
ATOM 5307   H H8     . A A 1 164 ? 109.183 125.136 151.822 1.00 0.00 ? 164 A A H8     1  
ATOM 5308   H H61    . A A 1 164 ? 109.643 127.713 146.339 1.00 0.00 ? 164 A A H61    1  
ATOM 5309   H H62    . A A 1 164 ? 108.964 127.865 147.887 1.00 0.00 ? 164 A A H62    1  
ATOM 5310   H H2     . A A 1 164 ? 111.962 123.969 146.382 1.00 0.00 ? 164 A A H2     1  
ATOM 5311   P P      . G A 1 165 ? 112.720 124.515 155.272 1.00 0.00 ? 165 G A P      1  
ATOM 5312   O OP1    . G A 1 165 ? 113.371 124.039 156.519 1.00 0.00 ? 165 G A OP1    1  
ATOM 5313   O OP2    . G A 1 165 ? 111.706 125.598 155.340 1.00 0.00 ? 165 G A OP2    1  
ATOM 5314   O "O5'"  . G A 1 165 ? 113.865 124.975 154.264 1.00 0.00 ? 165 G A "O5'"  1  
ATOM 5315   C "C5'"  . G A 1 165 ? 114.848 124.056 153.810 1.00 0.00 ? 165 G A "C5'"  1  
ATOM 5316   C "C4'"  . G A 1 165 ? 115.753 124.683 152.776 1.00 0.00 ? 165 G A "C4'"  1  
ATOM 5317   O "O4'"  . G A 1 165 ? 114.958 125.235 151.697 1.00 0.00 ? 165 G A "O4'"  1  
ATOM 5318   C "C3'"  . G A 1 165 ? 116.596 125.856 153.254 1.00 0.00 ? 165 G A "C3'"  1  
ATOM 5319   O "O3'"  . G A 1 165 ? 117.752 125.454 153.969 1.00 0.00 ? 165 G A "O3'"  1  
ATOM 5320   C "C2'"  . G A 1 165 ? 116.907 126.591 151.957 1.00 0.00 ? 165 G A "C2'"  1  
ATOM 5321   O "O2'"  . G A 1 165 ? 117.945 125.944 151.234 1.00 0.00 ? 165 G A "O2'"  1  
ATOM 5322   C "C1'"  . G A 1 165 ? 115.593 126.425 151.193 1.00 0.00 ? 165 G A "C1'"  1  
ATOM 5323   N N9     . G A 1 165 ? 114.707 127.593 151.353 1.00 0.00 ? 165 G A N9     1  
ATOM 5324   C C8     . G A 1 165 ? 113.546 127.663 152.081 1.00 0.00 ? 165 G A C8     1  
ATOM 5325   N N7     . G A 1 165 ? 112.975 128.836 152.032 1.00 0.00 ? 165 G A N7     1  
ATOM 5326   C C5     . G A 1 165 ? 113.814 129.590 151.222 1.00 0.00 ? 165 G A C5     1  
ATOM 5327   C C6     . G A 1 165 ? 113.718 130.943 150.807 1.00 0.00 ? 165 G A C6     1  
ATOM 5328   O O6     . G A 1 165 ? 112.842 131.774 151.080 1.00 0.00 ? 165 G A O6     1  
ATOM 5329   N N1     . G A 1 165 ? 114.785 131.305 149.988 1.00 0.00 ? 165 G A N1     1  
ATOM 5330   C C2     . G A 1 165 ? 115.811 130.473 149.618 1.00 0.00 ? 165 G A C2     1  
ATOM 5331   N N2     . G A 1 165 ? 116.751 131.004 148.821 1.00 0.00 ? 165 G A N2     1  
ATOM 5332   N N3     . G A 1 165 ? 115.912 129.209 149.999 1.00 0.00 ? 165 G A N3     1  
ATOM 5333   C C4     . G A 1 165 ? 114.889 128.838 150.794 1.00 0.00 ? 165 G A C4     1  
ATOM 5334   H "H5'"  . G A 1 165 ? 114.404 123.278 153.415 1.00 0.00 ? 165 G A "H5'"  1  
ATOM 5335   H "H5''" . G A 1 165 ? 115.390 123.763 154.573 1.00 0.00 ? 165 G A "H5''" 1  
ATOM 5336   H "H4'"  . G A 1 165 ? 116.347 123.991 152.413 1.00 0.00 ? 165 G A "H4'"  1  
ATOM 5337   H "H3'"  . G A 1 165 ? 116.050 126.434 153.826 1.00 0.00 ? 165 G A "H3'"  1  
ATOM 5338   H "H2'"  . G A 1 165 ? 117.112 127.534 152.119 1.00 0.00 ? 165 G A "H2'"  1  
ATOM 5339   H "HO2'" . G A 1 165 ? 118.452 125.370 151.846 1.00 0.00 ? 165 G A "HO2'" 1  
ATOM 5340   H "H1'"  . G A 1 165 ? 115.786 126.290 150.240 1.00 0.00 ? 165 G A "H1'"  1  
ATOM 5341   H H8     . G A 1 165 ? 113.178 126.907 152.586 1.00 0.00 ? 165 G A H8     1  
ATOM 5342   H H1     . G A 1 165 ? 114.801 132.225 149.652 1.00 0.00 ? 165 G A H1     1  
ATOM 5343   H H21    . G A 1 165 ? 116.683 131.938 148.535 1.00 0.00 ? 165 G A H21    1  
ATOM 5344   H H22    . G A 1 165 ? 117.508 130.456 148.526 1.00 0.00 ? 165 G A H22    1  
ATOM 5345   P P      . U A 1 166 ? 118.368 126.403 155.111 1.00 0.00 ? 166 U A P      1  
ATOM 5346   O OP1    . U A 1 166 ? 119.589 125.751 155.644 1.00 0.00 ? 166 U A OP1    1  
ATOM 5347   O OP2    . U A 1 166 ? 117.270 126.776 156.040 1.00 0.00 ? 166 U A OP2    1  
ATOM 5348   O "O5'"  . U A 1 166 ? 118.813 127.713 154.323 1.00 0.00 ? 166 U A "O5'"  1  
ATOM 5349   C "C5'"  . U A 1 166 ? 119.950 127.704 153.473 1.00 0.00 ? 166 U A "C5'"  1  
ATOM 5350   C "C4'"  . U A 1 166 ? 120.169 129.045 152.818 1.00 0.00 ? 166 U A "C4'"  1  
ATOM 5351   O "O4'"  . U A 1 166 ? 119.026 129.381 151.987 1.00 0.00 ? 166 U A "O4'"  1  
ATOM 5352   C "C3'"  . U A 1 166 ? 120.307 130.235 153.756 1.00 0.00 ? 166 U A "C3'"  1  
ATOM 5353   O "O3'"  . U A 1 166 ? 121.600 130.344 154.326 1.00 0.00 ? 166 U A "O3'"  1  
ATOM 5354   C "C2'"  . U A 1 166 ? 119.932 131.407 152.860 1.00 0.00 ? 166 U A "C2'"  1  
ATOM 5355   O "O2'"  . U A 1 166 ? 121.003 131.760 151.997 1.00 0.00 ? 166 U A "O2'"  1  
ATOM 5356   C "C1'"  . U A 1 166 ? 118.801 130.804 152.026 1.00 0.00 ? 166 U A "C1'"  1  
ATOM 5357   N N1     . U A 1 166 ? 117.463 131.115 152.584 1.00 0.00 ? 166 U A N1     1  
ATOM 5358   C C2     . U A 1 166 ? 116.960 132.381 152.355 1.00 0.00 ? 166 U A C2     1  
ATOM 5359   O O2     . U A 1 166 ? 117.565 133.232 151.724 1.00 0.00 ? 166 U A O2     1  
ATOM 5360   N N3     . U A 1 166 ? 115.719 132.623 152.889 1.00 0.00 ? 166 U A N3     1  
ATOM 5361   C C4     . U A 1 166 ? 114.943 131.747 153.618 1.00 0.00 ? 166 U A C4     1  
ATOM 5362   O O4     . U A 1 166 ? 113.842 132.116 154.034 1.00 0.00 ? 166 U A O4     1  
ATOM 5363   C C5     . U A 1 166 ? 115.524 130.455 153.815 1.00 0.00 ? 166 U A C5     1  
ATOM 5364   C C6     . U A 1 166 ? 116.732 130.192 153.305 1.00 0.00 ? 166 U A C6     1  
ATOM 5365   H "H5'"  . U A 1 166 ? 119.825 127.025 152.778 1.00 0.00 ? 166 U A "H5'"  1  
ATOM 5366   H "H5''" . U A 1 166 ? 120.744 127.475 154.003 1.00 0.00 ? 166 U A "H5''" 1  
ATOM 5367   H "H4'"  . U A 1 166 ? 120.968 128.992 152.253 1.00 0.00 ? 166 U A "H4'"  1  
ATOM 5368   H "H3'"  . U A 1 166 ? 119.645 130.155 154.474 1.00 0.00 ? 166 U A "H3'"  1  
ATOM 5369   H "H2'"  . U A 1 166 ? 119.620 132.175 153.385 1.00 0.00 ? 166 U A "H2'"  1  
ATOM 5370   H "HO2'" . U A 1 166 ? 121.841 131.407 152.365 1.00 0.00 ? 166 U A "HO2'" 1  
ATOM 5371   H "H1'"  . U A 1 166 ? 118.855 131.147 151.109 1.00 0.00 ? 166 U A "H1'"  1  
ATOM 5372   H H3     . U A 1 166 ? 115.346 133.517 152.740 1.00 0.00 ? 166 U A H3     1  
ATOM 5373   H H5     . U A 1 166 ? 115.042 129.767 154.321 1.00 0.00 ? 166 U A H5     1  
ATOM 5374   H H6     . U A 1 166 ? 117.110 129.302 153.454 1.00 0.00 ? 166 U A H6     1  
ATOM 5375   P P      . C A 1 167 ? 121.757 130.791 155.858 1.00 0.00 ? 167 C A P      1  
ATOM 5376   O OP1    . C A 1 167 ? 123.123 130.377 156.265 1.00 0.00 ? 167 C A OP1    1  
ATOM 5377   O OP2    . C A 1 167 ? 120.578 130.233 156.566 1.00 0.00 ? 167 C A OP2    1  
ATOM 5378   O "O5'"  . C A 1 167 ? 121.679 132.368 155.947 1.00 0.00 ? 167 C A "O5'"  1  
ATOM 5379   C "C5'"  . C A 1 167 ? 122.652 133.158 155.292 1.00 0.00 ? 167 C A "C5'"  1  
ATOM 5380   C "C4'"  . C A 1 167 ? 122.112 134.533 154.998 1.00 0.00 ? 167 C A "C4'"  1  
ATOM 5381   O "O4'"  . C A 1 167 ? 120.942 134.416 154.159 1.00 0.00 ? 167 C A "O4'"  1  
ATOM 5382   C "C3'"  . C A 1 167 ? 121.642 135.317 156.198 1.00 0.00 ? 167 C A "C3'"  1  
ATOM 5383   O "O3'"  . C A 1 167 ? 122.726 136.033 156.747 1.00 0.00 ? 167 C A "O3'"  1  
ATOM 5384   C "C2'"  . C A 1 167 ? 120.692 136.289 155.546 1.00 0.00 ? 167 C A "C2'"  1  
ATOM 5385   O "O2'"  . C A 1 167 ? 121.401 137.276 154.845 1.00 0.00 ? 167 C A "O2'"  1  
ATOM 5386   C "C1'"  . C A 1 167 ? 120.002 135.387 154.540 1.00 0.00 ? 167 C A "C1'"  1  
ATOM 5387   N N1     . C A 1 167 ? 118.859 134.693 155.102 1.00 0.00 ? 167 C A N1     1  
ATOM 5388   C C2     . C A 1 167 ? 117.640 135.288 155.024 1.00 0.00 ? 167 C A C2     1  
ATOM 5389   O O2     . C A 1 167 ? 117.563 136.385 154.500 1.00 0.00 ? 167 C A O2     1  
ATOM 5390   N N3     . C A 1 167 ? 116.556 134.663 155.528 1.00 0.00 ? 167 C A N3     1  
ATOM 5391   C C4     . C A 1 167 ? 116.690 133.474 156.092 1.00 0.00 ? 167 C A C4     1  
ATOM 5392   N N4     . C A 1 167 ? 115.603 132.879 156.566 1.00 0.00 ? 167 C A N4     1  
ATOM 5393   C C5     . C A 1 167 ? 117.947 132.836 156.188 1.00 0.00 ? 167 C A C5     1  
ATOM 5394   C C6     . C A 1 167 ? 118.999 133.478 155.684 1.00 0.00 ? 167 C A C6     1  
ATOM 5395   H "H5'"  . C A 1 167 ? 122.907 132.721 154.452 1.00 0.00 ? 167 C A "H5'"  1  
ATOM 5396   H "H5''" . C A 1 167 ? 123.442 133.233 155.865 1.00 0.00 ? 167 C A "H5''" 1  
ATOM 5397   H "H4'"  . C A 1 167 ? 122.798 135.046 154.523 1.00 0.00 ? 167 C A "H4'"  1  
ATOM 5398   H "H3'"  . C A 1 167 ? 121.258 134.701 156.856 1.00 0.00 ? 167 C A "H3'"  1  
ATOM 5399   H "H2'"  . C A 1 167 ? 120.071 136.677 156.199 1.00 0.00 ? 167 C A "H2'"  1  
ATOM 5400   H "HO2'" . C A 1 167 ? 122.319 137.312 155.184 1.00 0.00 ? 167 C A "HO2'" 1  
ATOM 5401   H "H1'"  . C A 1 167 ? 119.711 135.923 153.773 1.00 0.00 ? 167 C A "H1'"  1  
ATOM 5402   H H41    . C A 1 167 ? 114.731 133.323 156.494 1.00 0.00 ? 167 C A H41    1  
ATOM 5403   H H42    . C A 1 167 ? 115.674 131.999 156.987 1.00 0.00 ? 167 C A H42    1  
ATOM 5404   H H5     . C A 1 167 ? 118.041 131.957 156.609 1.00 0.00 ? 167 C A H5     1  
ATOM 5405   H H6     . C A 1 167 ? 119.882 133.056 155.742 1.00 0.00 ? 167 C A H6     1  
ATOM 5406   P P      . C A 1 168 ? 122.536 136.753 158.149 1.00 0.00 ? 168 C A P      1  
ATOM 5407   O OP1    . C A 1 168 ? 123.745 137.469 158.627 1.00 0.00 ? 168 C A OP1    1  
ATOM 5408   O OP2    . C A 1 168 ? 121.885 135.747 158.997 1.00 0.00 ? 168 C A OP2    1  
ATOM 5409   O "O5'"  . C A 1 168 ? 121.447 137.834 157.791 1.00 0.00 ? 168 C A "O5'"  1  
ATOM 5410   C "C5'"  . C A 1 168 ? 121.817 139.152 157.459 1.00 0.00 ? 168 C A "C5'"  1  
ATOM 5411   C "C4'"  . C A 1 168 ? 120.620 140.041 157.580 1.00 0.00 ? 168 C A "C4'"  1  
ATOM 5412   O "O4'"  . C A 1 168 ? 119.511 139.405 156.910 1.00 0.00 ? 168 C A "O4'"  1  
ATOM 5413   C "C3'"  . C A 1 168 ? 120.078 140.215 158.983 1.00 0.00 ? 168 C A "C3'"  1  
ATOM 5414   O "O3'"  . C A 1 168 ? 120.785 141.177 159.722 1.00 0.00 ? 168 C A "O3'"  1  
ATOM 5415   C "C2'"  . C A 1 168 ? 118.673 140.701 158.704 1.00 0.00 ? 168 C A "C2'"  1  
ATOM 5416   O "O2'"  . C A 1 168 ? 118.659 142.060 158.319 1.00 0.00 ? 168 C A "O2'"  1  
ATOM 5417   C "C1'"  . C A 1 168 ? 118.295 139.821 157.521 1.00 0.00 ? 168 C A "C1'"  1  
ATOM 5418   N N1     . C A 1 168 ? 117.547 138.641 157.938 1.00 0.00 ? 168 C A N1     1  
ATOM 5419   C C2     . C A 1 168 ? 116.189 138.755 158.130 1.00 0.00 ? 168 C A C2     1  
ATOM 5420   O O2     . C A 1 168 ? 115.650 139.845 157.943 1.00 0.00 ? 168 C A O2     1  
ATOM 5421   N N3     . C A 1 168 ? 115.487 137.677 158.510 1.00 0.00 ? 168 C A N3     1  
ATOM 5422   C C4     . C A 1 168 ? 116.105 136.515 158.703 1.00 0.00 ? 168 C A C4     1  
ATOM 5423   N N4     . C A 1 168 ? 115.373 135.468 159.088 1.00 0.00 ? 168 C A N4     1  
ATOM 5424   C C5     . C A 1 168 ? 117.498 136.374 158.511 1.00 0.00 ? 168 C A C5     1  
ATOM 5425   C C6     . C A 1 168 ? 118.174 137.453 158.131 1.00 0.00 ? 168 C A C6     1  
ATOM 5426   H "H5'"  . C A 1 168 ? 122.161 139.166 156.543 1.00 0.00 ? 168 C A "H5'"  1  
ATOM 5427   H "H5''" . C A 1 168 ? 122.523 139.449 158.071 1.00 0.00 ? 168 C A "H5''" 1  
ATOM 5428   H "H4'"  . C A 1 168 ? 120.818 140.898 157.145 1.00 0.00 ? 168 C A "H4'"  1  
ATOM 5429   H "H3'"  . C A 1 168 ? 120.115 139.355 159.451 1.00 0.00 ? 168 C A "H3'"  1  
ATOM 5430   H "H2'"  . C A 1 168 ? 118.079 140.539 159.466 1.00 0.00 ? 168 C A "H2'"  1  
ATOM 5431   H "HO2'" . C A 1 168 ? 117.737 142.338 158.150 1.00 0.00 ? 168 C A "HO2'" 1  
ATOM 5432   H "H1'"  . C A 1 168 ? 117.761 140.344 156.889 1.00 0.00 ? 168 C A "H1'"  1  
ATOM 5433   H H41    . C A 1 168 ? 114.407 135.569 159.219 1.00 0.00 ? 168 C A H41    1  
ATOM 5434   H H42    . C A 1 168 ? 115.802 134.601 159.237 1.00 0.00 ? 168 C A H42    1  
ATOM 5435   H H5     . C A 1 168 ? 117.945 135.512 158.647 1.00 0.00 ? 168 C A H5     1  
ATOM 5436   H H6     . C A 1 168 ? 119.141 137.383 157.992 1.00 0.00 ? 168 C A H6     1  
ATOM 5437   P P      . U A 1 169 ? 120.801 141.044 161.315 1.00 0.00 ? 169 U A P      1  
ATOM 5438   O OP1    . U A 1 169 ? 121.679 142.067 161.920 1.00 0.00 ? 169 U A OP1    1  
ATOM 5439   O OP2    . U A 1 169 ? 121.014 139.617 161.614 1.00 0.00 ? 169 U A OP2    1  
ATOM 5440   O "O5'"  . U A 1 169 ? 119.313 141.382 161.732 1.00 0.00 ? 169 U A "O5'"  1  
ATOM 5441   C "C5'"  . U A 1 169 ? 118.888 142.715 161.778 1.00 0.00 ? 169 U A "C5'"  1  
ATOM 5442   C "C4'"  . U A 1 169 ? 117.447 142.762 162.135 1.00 0.00 ? 169 U A "C4'"  1  
ATOM 5443   O "O4'"  . U A 1 169 ? 116.771 141.799 161.308 1.00 0.00 ? 169 U A "O4'"  1  
ATOM 5444   C "C3'"  . U A 1 169 ? 117.100 142.296 163.526 1.00 0.00 ? 169 U A "C3'"  1  
ATOM 5445   O "O3'"  . U A 1 169 ? 117.301 143.368 164.419 1.00 0.00 ? 169 U A "O3'"  1  
ATOM 5446   C "C2'"  . U A 1 169 ? 115.628 141.994 163.358 1.00 0.00 ? 169 U A "C2'"  1  
ATOM 5447   O "O2'"  . U A 1 169 ? 114.886 143.190 163.329 1.00 0.00 ? 169 U A "O2'"  1  
ATOM 5448   C "C1'"  . U A 1 169 ? 115.619 141.348 161.969 1.00 0.00 ? 169 U A "C1'"  1  
ATOM 5449   N N1     . U A 1 169 ? 115.682 139.890 162.016 1.00 0.00 ? 169 U A N1     1  
ATOM 5450   C C2     . U A 1 169 ? 114.556 139.228 162.375 1.00 0.00 ? 169 U A C2     1  
ATOM 5451   O O2     . U A 1 169 ? 113.521 139.794 162.636 1.00 0.00 ? 169 U A O2     1  
ATOM 5452   N N3     . U A 1 169 ? 114.672 137.874 162.423 1.00 0.00 ? 169 U A N3     1  
ATOM 5453   C C4     . U A 1 169 ? 115.782 137.132 162.148 1.00 0.00 ? 169 U A C4     1  
ATOM 5454   O O4     . U A 1 169 ? 115.738 135.904 162.262 1.00 0.00 ? 169 U A O4     1  
ATOM 5455   C C5     . U A 1 169 ? 116.910 137.897 161.773 1.00 0.00 ? 169 U A C5     1  
ATOM 5456   C C6     . U A 1 169 ? 116.821 139.225 161.720 1.00 0.00 ? 169 U A C6     1  
ATOM 5457   H "H5'"  . U A 1 169 ? 119.032 143.126 160.901 1.00 0.00 ? 169 U A "H5'"  1  
ATOM 5458   H "H5''" . U A 1 169 ? 119.418 143.197 162.449 1.00 0.00 ? 169 U A "H5''" 1  
ATOM 5459   H "H4'"  . U A 1 169 ? 117.106 143.662 161.951 1.00 0.00 ? 169 U A "H4'"  1  
ATOM 5460   H "H3'"  . U A 1 169 ? 117.662 141.527 163.758 1.00 0.00 ? 169 U A "H3'"  1  
ATOM 5461   H "H2'"  . U A 1 169 ? 115.308 141.375 164.046 1.00 0.00 ? 169 U A "H2'"  1  
ATOM 5462   H "HO2'" . U A 1 169 ? 113.936 142.972 163.218 1.00 0.00 ? 169 U A "HO2'" 1  
ATOM 5463   H "H1'"  . U A 1 169 ? 114.804 141.617 161.494 1.00 0.00 ? 169 U A "H1'"  1  
ATOM 5464   H H3     . U A 1 169 ? 113.869 137.375 162.683 1.00 0.00 ? 169 U A H3     1  
ATOM 5465   H H5     . U A 1 169 ? 117.755 137.452 161.548 1.00 0.00 ? 169 U A H5     1  
ATOM 5466   H H6     . U A 1 169 ? 117.620 139.729 161.458 1.00 0.00 ? 169 U A H6     1  
ATOM 5467   P P      . A A 1 170 ? 118.038 143.106 165.820 1.00 0.00 ? 170 A A P      1  
ATOM 5468   O OP1    . A A 1 170 ? 118.450 144.440 166.339 1.00 0.00 ? 170 A A OP1    1  
ATOM 5469   O OP2    . A A 1 170 ? 119.040 142.026 165.714 1.00 0.00 ? 170 A A OP2    1  
ATOM 5470   O "O5'"  . A A 1 170 ? 116.881 142.478 166.691 1.00 0.00 ? 170 A A "O5'"  1  
ATOM 5471   C "C5'"  . A A 1 170 ? 115.569 142.927 166.515 1.00 0.00 ? 170 A A "C5'"  1  
ATOM 5472   C "C4'"  . A A 1 170 ? 114.620 141.941 167.109 1.00 0.00 ? 170 A A "C4'"  1  
ATOM 5473   O "O4'"  . A A 1 170 ? 114.709 140.733 166.334 1.00 0.00 ? 170 A A "O4'"  1  
ATOM 5474   C "C3'"  . A A 1 170 ? 114.950 141.527 168.539 1.00 0.00 ? 170 A A "C3'"  1  
ATOM 5475   O "O3'"  . A A 1 170 ? 113.814 141.806 169.375 1.00 0.00 ? 170 A A "O3'"  1  
ATOM 5476   C "C2'"  . A A 1 170 ? 115.123 140.007 168.442 1.00 0.00 ? 170 A A "C2'"  1  
ATOM 5477   O "O2'"  . A A 1 170 ? 114.564 139.315 169.538 1.00 0.00 ? 170 A A "O2'"  1  
ATOM 5478   C "C1'"  . A A 1 170 ? 114.353 139.684 167.166 1.00 0.00 ? 170 A A "C1'"  1  
ATOM 5479   N N9     . A A 1 170 ? 114.775 138.457 166.523 1.00 0.00 ? 170 A A N9     1  
ATOM 5480   C C8     . A A 1 170 ? 115.940 138.257 165.863 1.00 0.00 ? 170 A A C8     1  
ATOM 5481   N N7     . A A 1 170 ? 116.071 137.047 165.389 1.00 0.00 ? 170 A A N7     1  
ATOM 5482   C C5     . A A 1 170 ? 114.899 136.412 165.769 1.00 0.00 ? 170 A A C5     1  
ATOM 5483   C C6     . A A 1 170 ? 114.425 135.111 165.574 1.00 0.00 ? 170 A A C6     1  
ATOM 5484   N N6     . A A 1 170 ? 115.091 134.155 164.915 1.00 0.00 ? 170 A A N6     1  
ATOM 5485   N N1     . A A 1 170 ? 113.221 134.806 166.085 1.00 0.00 ? 170 A A N1     1  
ATOM 5486   C C2     . A A 1 170 ? 112.552 135.741 166.738 1.00 0.00 ? 170 A A C2     1  
ATOM 5487   N N3     . A A 1 170 ? 112.886 136.998 166.983 1.00 0.00 ? 170 A A N3     1  
ATOM 5488   C C4     . A A 1 170 ? 114.091 137.272 166.465 1.00 0.00 ? 170 A A C4     1  
ATOM 5489   H "H5'"  . A A 1 170 ? 115.390 143.030 165.557 1.00 0.00 ? 170 A A "H5'"  1  
ATOM 5490   H "H5''" . A A 1 170 ? 115.468 143.798 166.952 1.00 0.00 ? 170 A A "H5''" 1  
ATOM 5491   H "H4'"  . A A 1 170 ? 113.712 142.304 167.061 1.00 0.00 ? 170 A A "H4'"  1  
ATOM 5492   H "H3'"  . A A 1 170 ? 115.741 142.021 168.843 1.00 0.00 ? 170 A A "H3'"  1  
ATOM 5493   H "H2'"  . A A 1 170 ? 116.063 139.759 168.316 1.00 0.00 ? 170 A A "H2'"  1  
ATOM 5494   H "HO2'" . A A 1 170 ? 115.162 138.581 169.791 1.00 0.00 ? 170 A A "HO2'" 1  
ATOM 5495   H "H1'"  . A A 1 170 ? 113.396 139.617 167.370 1.00 0.00 ? 170 A A "H1'"  1  
ATOM 5496   H H8     . A A 1 170 ? 116.624 138.951 165.751 1.00 0.00 ? 170 A A H8     1  
ATOM 5497   H H61    . A A 1 170 ? 114.696 133.263 164.815 1.00 0.00 ? 170 A A H61    1  
ATOM 5498   H H62    . A A 1 170 ? 115.970 134.345 164.529 1.00 0.00 ? 170 A A H62    1  
ATOM 5499   H H2     . A A 1 170 ? 111.681 135.464 167.091 1.00 0.00 ? 170 A A H2     1  
ATOM 5500   P P      . A A 1 171 ? 113.925 142.842 170.600 1.00 0.00 ? 171 A A P      1  
ATOM 5501   O OP1    . A A 1 171 ? 114.474 144.139 170.120 1.00 0.00 ? 171 A A OP1    1  
ATOM 5502   O OP2    . A A 1 171 ? 114.589 142.108 171.704 1.00 0.00 ? 171 A A OP2    1  
ATOM 5503   O "O5'"  . A A 1 171 ? 112.413 143.080 171.035 1.00 0.00 ? 171 A A "O5'"  1  
ATOM 5504   C "C5'"  . A A 1 171 ? 111.773 144.352 170.910 1.00 0.00 ? 171 A A "C5'"  1  
ATOM 5505   C "C4'"  . A A 1 171 ? 110.292 144.159 170.664 1.00 0.00 ? 171 A A "C4'"  1  
ATOM 5506   O "O4'"  . A A 1 171 ? 110.144 143.560 169.354 1.00 0.00 ? 171 A A "O4'"  1  
ATOM 5507   C "C3'"  . A A 1 171 ? 109.641 143.151 171.587 1.00 0.00 ? 171 A A "C3'"  1  
ATOM 5508   O "O3'"  . A A 1 171 ? 109.172 143.779 172.764 1.00 0.00 ? 171 A A "O3'"  1  
ATOM 5509   C "C2'"  . A A 1 171 ? 108.472 142.638 170.766 1.00 0.00 ? 171 A A "C2'"  1  
ATOM 5510   O "O2'"  . A A 1 171 ? 107.349 143.469 170.854 1.00 0.00 ? 171 A A "O2'"  1  
ATOM 5511   C "C1'"  . A A 1 171 ? 109.044 142.678 169.348 1.00 0.00 ? 171 A A "C1'"  1  
ATOM 5512   N N9     . A A 1 171 ? 109.526 141.392 168.903 1.00 0.00 ? 171 A A N9     1  
ATOM 5513   C C8     . A A 1 171 ? 110.807 141.052 168.645 1.00 0.00 ? 171 A A C8     1  
ATOM 5514   N N7     . A A 1 171 ? 110.955 139.806 168.281 1.00 0.00 ? 171 A A N7     1  
ATOM 5515   C C5     . A A 1 171 ? 109.670 139.300 168.297 1.00 0.00 ? 171 A A C5     1  
ATOM 5516   C C6     . A A 1 171 ? 109.142 138.033 168.013 1.00 0.00 ? 171 A A C6     1  
ATOM 5517   N N6     . A A 1 171 ? 109.865 136.997 167.650 1.00 0.00 ? 171 A A N6     1  
ATOM 5518   N N1     . A A 1 171 ? 107.814 137.860 168.122 1.00 0.00 ? 171 A A N1     1  
ATOM 5519   C C2     . A A 1 171 ? 107.064 138.901 168.494 1.00 0.00 ? 171 A A C2     1  
ATOM 5520   N N3     . A A 1 171 ? 107.447 140.146 168.799 1.00 0.00 ? 171 A A N3     1  
ATOM 5521   C C4     . A A 1 171 ? 108.777 140.274 168.675 1.00 0.00 ? 171 A A C4     1  
ATOM 5522   H "H5'"  . A A 1 171 ? 112.175 144.842 170.163 1.00 0.00 ? 171 A A "H5'"  1  
ATOM 5523   H "H5''" . A A 1 171 ? 111.911 144.863 171.734 1.00 0.00 ? 171 A A "H5''" 1  
ATOM 5524   H "H4'"  . A A 1 171 ? 109.850 145.031 170.685 1.00 0.00 ? 171 A A "H4'"  1  
ATOM 5525   H "H3'"  . A A 1 171 ? 110.291 142.452 171.812 1.00 0.00 ? 171 A A "H3'"  1  
ATOM 5526   H "H2'"  . A A 1 171 ? 108.244 141.713 171.001 1.00 0.00 ? 171 A A "H2'"  1  
ATOM 5527   H "HO2'" . A A 1 171 ? 107.427 144.025 171.659 1.00 0.00 ? 171 A A "HO2'" 1  
ATOM 5528   H "H1'"  . A A 1 171 ? 108.355 142.997 168.727 1.00 0.00 ? 171 A A "H1'"  1  
ATOM 5529   H H8     . A A 1 171 ? 111.557 141.679 168.727 1.00 0.00 ? 171 A A H8     1  
ATOM 5530   H H61    . A A 1 171 ? 109.431 136.138 167.466 1.00 0.00 ? 171 A A H61    1  
ATOM 5531   H H62    . A A 1 171 ? 110.837 137.084 167.561 1.00 0.00 ? 171 A A H62    1  
ATOM 5532   H H2     . A A 1 171 ? 106.102 138.731 168.553 1.00 0.00 ? 171 A A H2     1  
ATOM 5533   P P      . G A 1 172 ? 109.234 142.993 174.162 1.00 0.00 ? 172 G A P      1  
ATOM 5534   O OP1    . G A 1 172 ? 108.374 143.759 175.080 1.00 0.00 ? 172 G A OP1    1  
ATOM 5535   O OP2    . G A 1 172 ? 110.648 142.733 174.532 1.00 0.00 ? 172 G A OP2    1  
ATOM 5536   O "O5'"  . G A 1 172 ? 108.553 141.593 173.841 1.00 0.00 ? 172 G A "O5'"  1  
ATOM 5537   C "C5'"  . G A 1 172 ? 107.164 141.475 173.849 1.00 0.00 ? 172 G A "C5'"  1  
ATOM 5538   C "C4'"  . G A 1 172 ? 106.752 140.057 173.547 1.00 0.00 ? 172 G A "C4'"  1  
ATOM 5539   O "O4'"  . G A 1 172 ? 107.093 139.753 172.183 1.00 0.00 ? 172 G A "O4'"  1  
ATOM 5540   C "C3'"  . G A 1 172 ? 107.423 138.972 174.353 1.00 0.00 ? 172 G A "C3'"  1  
ATOM 5541   O "O3'"  . G A 1 172 ? 106.709 138.718 175.541 1.00 0.00 ? 172 G A "O3'"  1  
ATOM 5542   C "C2'"  . G A 1 172 ? 107.282 137.769 173.443 1.00 0.00 ? 172 G A "C2'"  1  
ATOM 5543   O "O2'"  . G A 1 172 ? 106.016 137.169 173.510 1.00 0.00 ? 172 G A "O2'"  1  
ATOM 5544   C "C1'"  . G A 1 172 ? 107.522 138.412 172.085 1.00 0.00 ? 172 G A "C1'"  1  
ATOM 5545   N N9     . G A 1 172 ? 108.949 138.415 171.765 1.00 0.00 ? 172 G A N9     1  
ATOM 5546   C C8     . G A 1 172 ? 109.827 139.471 171.844 1.00 0.00 ? 172 G A C8     1  
ATOM 5547   N N7     . G A 1 172 ? 111.055 139.139 171.527 1.00 0.00 ? 172 G A N7     1  
ATOM 5548   C C5     . G A 1 172 ? 110.970 137.798 171.216 1.00 0.00 ? 172 G A C5     1  
ATOM 5549   C C6     . G A 1 172 ? 111.956 136.930 170.823 1.00 0.00 ? 172 G A C6     1  
ATOM 5550   O O6     . G A 1 172 ? 113.156 137.152 170.671 1.00 0.00 ? 172 G A O6     1  
ATOM 5551   N N1     . G A 1 172 ? 111.445 135.662 170.599 1.00 0.00 ? 172 G A N1     1  
ATOM 5552   C C2     . G A 1 172 ? 110.133 135.300 170.749 1.00 0.00 ? 172 G A C2     1  
ATOM 5553   N N2     . G A 1 172 ? 109.825 134.030 170.498 1.00 0.00 ? 172 G A N2     1  
ATOM 5554   N N3     . G A 1 172 ? 109.197 136.116 171.126 1.00 0.00 ? 172 G A N3     1  
ATOM 5555   C C4     . G A 1 172 ? 109.678 137.343 171.340 1.00 0.00 ? 172 G A C4     1  
ATOM 5556   H "H5'"  . G A 1 172 ? 106.787 142.076 173.177 1.00 0.00 ? 172 G A "H5'"  1  
ATOM 5557   H "H5''" . G A 1 172 ? 106.826 141.732 174.734 1.00 0.00 ? 172 G A "H5''" 1  
ATOM 5558   H "H4'"  . G A 1 172 ? 105.784 139.975 173.663 1.00 0.00 ? 172 G A "H4'"  1  
ATOM 5559   H "H3'"  . G A 1 172 ? 108.340 139.246 174.561 1.00 0.00 ? 172 G A "H3'"  1  
ATOM 5560   H "H2'"  . G A 1 172 ? 107.989 137.109 173.609 1.00 0.00 ? 172 G A "H2'"  1  
ATOM 5561   H "HO2'" . G A 1 172 ? 105.581 137.433 174.346 1.00 0.00 ? 172 G A "HO2'" 1  
ATOM 5562   H "H1'"  . G A 1 172 ? 107.019 137.923 171.400 1.00 0.00 ? 172 G A "H1'"  1  
ATOM 5563   H H8     . G A 1 172 ? 109.569 140.375 172.115 1.00 0.00 ? 172 G A H8     1  
ATOM 5564   H H1     . G A 1 172 ? 112.077 134.969 170.311 1.00 0.00 ? 172 G A H1     1  
ATOM 5565   H H21    . G A 1 172 ? 110.522 133.401 170.214 1.00 0.00 ? 172 G A H21    1  
ATOM 5566   H H22    . G A 1 172 ? 108.900 133.721 170.598 1.00 0.00 ? 172 G A H22    1  
ATOM 5567   P P      . U A 1 173 ? 107.467 138.088 176.795 1.00 0.00 ? 173 U A P      1  
ATOM 5568   O OP1    . U A 1 173 ? 106.427 137.918 177.832 1.00 0.00 ? 173 U A OP1    1  
ATOM 5569   O OP2    . U A 1 173 ? 108.660 138.935 177.046 1.00 0.00 ? 173 U A OP2    1  
ATOM 5570   O "O5'"  . U A 1 173 ? 107.941 136.658 176.326 1.00 0.00 ? 173 U A "O5'"  1  
ATOM 5571   C "C5'"  . U A 1 173 ? 107.008 135.626 176.177 1.00 0.00 ? 173 U A "C5'"  1  
ATOM 5572   C "C4'"  . U A 1 173 ? 107.715 134.367 175.782 1.00 0.00 ? 173 U A "C4'"  1  
ATOM 5573   O "O4'"  . U A 1 173 ? 108.342 134.577 174.497 1.00 0.00 ? 173 U A "O4'"  1  
ATOM 5574   C "C3'"  . U A 1 173 ? 108.876 133.975 176.667 1.00 0.00 ? 173 U A "C3'"  1  
ATOM 5575   O "O3'"  . U A 1 173 ? 108.429 133.245 177.798 1.00 0.00 ? 173 U A "O3'"  1  
ATOM 5576   C "C2'"  . U A 1 173 ? 109.660 133.081 175.730 1.00 0.00 ? 173 U A "C2'"  1  
ATOM 5577   O "O2'"  . U A 1 173 ? 109.063 131.809 175.569 1.00 0.00 ? 173 U A "O2'"  1  
ATOM 5578   C "C1'"  . U A 1 173 ? 109.546 133.862 174.433 1.00 0.00 ? 173 U A "C1'"  1  
ATOM 5579   N N1     . U A 1 173 ? 110.626 134.826 174.241 1.00 0.00 ? 173 U A N1     1  
ATOM 5580   C C2     . U A 1 173 ? 111.788 134.371 173.666 1.00 0.00 ? 173 U A C2     1  
ATOM 5581   O O2     . U A 1 173 ? 111.943 133.208 173.325 1.00 0.00 ? 173 U A O2     1  
ATOM 5582   N N3     . U A 1 173 ? 112.765 135.314 173.494 1.00 0.00 ? 173 U A N3     1  
ATOM 5583   C C4     . U A 1 173 ? 112.696 136.634 173.818 1.00 0.00 ? 173 U A C4     1  
ATOM 5584   O O4     . U A 1 173 ? 113.630 137.373 173.518 1.00 0.00 ? 173 U A O4     1  
ATOM 5585   C C5     . U A 1 173 ? 111.471 137.029 174.418 1.00 0.00 ? 173 U A C5     1  
ATOM 5586   C C6     . U A 1 173 ? 110.499 136.124 174.607 1.00 0.00 ? 173 U A C6     1  
ATOM 5587   H "H5'"  . U A 1 173 ? 106.361 135.879 175.488 1.00 0.00 ? 173 U A "H5'"  1  
ATOM 5588   H "H5''" . U A 1 173 ? 106.540 135.497 177.026 1.00 0.00 ? 173 U A "H5''" 1  
ATOM 5589   H "H4'"  . U A 1 173 ? 107.060 133.644 175.712 1.00 0.00 ? 173 U A "H4'"  1  
ATOM 5590   H "H3'"  . U A 1 173 ? 109.351 134.784 176.952 1.00 0.00 ? 173 U A "H3'"  1  
ATOM 5591   H "H2'"  . U A 1 173 ? 110.595 132.993 176.015 1.00 0.00 ? 173 U A "H2'"  1  
ATOM 5592   H "HO2'" . U A 1 173 ? 108.454 131.643 176.320 1.00 0.00 ? 173 U A "HO2'" 1  
ATOM 5593   H "H1'"  . U A 1 173 ? 109.544 133.236 173.678 1.00 0.00 ? 173 U A "H1'"  1  
ATOM 5594   H H3     . U A 1 173 ? 113.604 135.005 173.093 1.00 0.00 ? 173 U A H3     1  
ATOM 5595   H H5     . U A 1 173 ? 111.336 137.959 174.696 1.00 0.00 ? 173 U A H5     1  
ATOM 5596   H H6     . U A 1 173 ? 109.668 136.427 175.025 1.00 0.00 ? 173 U A H6     1  
ATOM 5597   P P      . C A 1 174 ? 109.256 133.324 179.169 1.00 0.00 ? 174 C A P      1  
ATOM 5598   O OP1    . C A 1 174 ? 108.481 132.654 180.244 1.00 0.00 ? 174 C A OP1    1  
ATOM 5599   O OP2    . C A 1 174 ? 109.562 134.773 179.279 1.00 0.00 ? 174 C A OP2    1  
ATOM 5600   O "O5'"  . C A 1 174 ? 110.631 132.541 178.993 1.00 0.00 ? 174 C A "O5'"  1  
ATOM 5601   C "C5'"  . C A 1 174 ? 110.828 131.268 179.587 1.00 0.00 ? 174 C A "C5'"  1  
ATOM 5602   C "C4'"  . C A 1 174 ? 112.149 130.662 179.184 1.00 0.00 ? 174 C A "C4'"  1  
ATOM 5603   O "O4'"  . C A 1 174 ? 112.419 130.947 177.786 1.00 0.00 ? 174 C A "O4'"  1  
ATOM 5604   C "C3'"  . C A 1 174 ? 113.379 131.189 179.910 1.00 0.00 ? 174 C A "C3'"  1  
ATOM 5605   O "O3'"  . C A 1 174 ? 113.563 130.599 181.185 1.00 0.00 ? 174 C A "O3'"  1  
ATOM 5606   C "C2'"  . C A 1 174 ? 114.501 130.887 178.928 1.00 0.00 ? 174 C A "C2'"  1  
ATOM 5607   O "O2'"  . C A 1 174 ? 114.872 129.516 178.975 1.00 0.00 ? 174 C A "O2'"  1  
ATOM 5608   C "C1'"  . C A 1 174 ? 113.818 131.170 177.588 1.00 0.00 ? 174 C A "C1'"  1  
ATOM 5609   N N1     . C A 1 174 ? 114.063 132.554 177.113 1.00 0.00 ? 174 C A N1     1  
ATOM 5610   C C2     . C A 1 174 ? 115.307 132.850 176.543 1.00 0.00 ? 174 C A C2     1  
ATOM 5611   O O2     . C A 1 174 ? 116.162 131.956 176.453 1.00 0.00 ? 174 C A O2     1  
ATOM 5612   N N3     . C A 1 174 ? 115.555 134.105 176.102 1.00 0.00 ? 174 C A N3     1  
ATOM 5613   C C4     . C A 1 174 ? 114.621 135.049 176.209 1.00 0.00 ? 174 C A C4     1  
ATOM 5614   N N4     . C A 1 174 ? 114.911 136.273 175.759 1.00 0.00 ? 174 C A N4     1  
ATOM 5615   C C5     . C A 1 174 ? 113.346 134.779 176.783 1.00 0.00 ? 174 C A C5     1  
ATOM 5616   C C6     . C A 1 174 ? 113.111 133.535 177.216 1.00 0.00 ? 174 C A C6     1  
ATOM 5617   H "H5'"  . C A 1 174 ? 110.103 130.669 179.307 1.00 0.00 ? 174 C A "H5'"  1  
ATOM 5618   H "H5''" . C A 1 174 ? 110.804 131.364 180.562 1.00 0.00 ? 174 C A "H5''" 1  
ATOM 5619   H "H4'"  . C A 1 174 ? 112.102 129.691 179.304 1.00 0.00 ? 174 C A "H4'"  1  
ATOM 5620   H "H3'"  . C A 1 174 ? 113.297 132.161 180.015 1.00 0.00 ? 174 C A "H3'"  1  
ATOM 5621   H "H2'"  . C A 1 174 ? 115.271 131.477 179.069 1.00 0.00 ? 174 C A "H2'"  1  
ATOM 5622   H "HO2'" . C A 1 174 ? 115.615 129.366 178.354 1.00 0.00 ? 174 C A "HO2'" 1  
ATOM 5623   H "H1'"  . C A 1 174 ? 114.142 130.534 176.917 1.00 0.00 ? 174 C A "H1'"  1  
ATOM 5624   H H41    . C A 1 174 ? 115.790 136.455 175.365 1.00 0.00 ? 174 C A H41    1  
ATOM 5625   H H42    . C A 1 174 ? 114.245 136.988 175.824 1.00 0.00 ? 174 C A H42    1  
ATOM 5626   H H5     . C A 1 174 ? 112.666 135.481 176.857 1.00 0.00 ? 174 C A H5     1  
ATOM 5627   H H6     . C A 1 174 ? 112.241 133.329 177.614 1.00 0.00 ? 174 C A H6     1  
ATOM 5628   P P      . A A 1 175 ? 114.343 131.398 182.341 1.00 0.00 ? 175 A A P      1  
ATOM 5629   O OP1    . A A 1 175 ? 114.261 130.599 183.590 1.00 0.00 ? 175 A A OP1    1  
ATOM 5630   O OP2    . A A 1 175 ? 113.860 132.802 182.334 1.00 0.00 ? 175 A A OP2    1  
ATOM 5631   O "O5'"  . A A 1 175 ? 115.860 131.398 181.854 1.00 0.00 ? 175 A A "O5'"  1  
ATOM 5632   C "C5'"  . A A 1 175 ? 116.625 130.202 181.853 1.00 0.00 ? 175 A A "C5'"  1  
ATOM 5633   C "C4'"  . A A 1 175 ? 118.014 130.432 181.313 1.00 0.00 ? 175 A A "C4'"  1  
ATOM 5634   O "O4'"  . A A 1 175 ? 117.936 130.894 179.938 1.00 0.00 ? 175 A A "O4'"  1  
ATOM 5635   C "C3'"  . A A 1 175 ? 118.835 131.501 182.016 1.00 0.00 ? 175 A A "C3'"  1  
ATOM 5636   O "O3'"  . A A 1 175 ? 119.423 131.043 183.223 1.00 0.00 ? 175 A A "O3'"  1  
ATOM 5637   C "C2'"  . A A 1 175 ? 119.851 131.895 180.954 1.00 0.00 ? 175 A A "C2'"  1  
ATOM 5638   O "O2'"  . A A 1 175 ? 120.894 130.935 180.857 1.00 0.00 ? 175 A A "O2'"  1  
ATOM 5639   C "C1'"  . A A 1 175 ? 119.001 131.832 179.684 1.00 0.00 ? 175 A A "C1'"  1  
ATOM 5640   N N9     . A A 1 175 ? 118.464 133.154 179.310 1.00 0.00 ? 175 A A N9     1  
ATOM 5641   C C8     . A A 1 175 ? 117.178 133.616 179.457 1.00 0.00 ? 175 A A C8     1  
ATOM 5642   N N7     . A A 1 175 ? 117.004 134.842 179.029 1.00 0.00 ? 175 A A N7     1  
ATOM 5643   C C5     . A A 1 175 ? 118.259 135.214 178.566 1.00 0.00 ? 175 A A C5     1  
ATOM 5644   C C6     . A A 1 175 ? 118.741 136.400 177.984 1.00 0.00 ? 175 A A C6     1  
ATOM 5645   N N6     . A A 1 175 ? 117.983 137.475 177.762 1.00 0.00 ? 175 A A N6     1  
ATOM 5646   N N1     . A A 1 175 ? 120.045 136.446 177.636 1.00 0.00 ? 175 A A N1     1  
ATOM 5647   C C2     . A A 1 175 ? 120.807 135.366 177.861 1.00 0.00 ? 175 A A C2     1  
ATOM 5648   N N3     . A A 1 175 ? 120.469 134.196 178.398 1.00 0.00 ? 175 A A N3     1  
ATOM 5649   C C4     . A A 1 175 ? 119.168 134.185 178.734 1.00 0.00 ? 175 A A C4     1  
ATOM 5650   H "H5'"  . A A 1 175 ? 116.173 129.534 181.297 1.00 0.00 ? 175 A A "H5'"  1  
ATOM 5651   H "H5''" . A A 1 175 ? 116.690 129.863 182.770 1.00 0.00 ? 175 A A "H5''" 1  
ATOM 5652   H "H4'"  . A A 1 175 ? 118.508 129.585 181.336 1.00 0.00 ? 175 A A "H4'"  1  
ATOM 5653   H "H3'"  . A A 1 175 ? 118.261 132.271 182.213 1.00 0.00 ? 175 A A "H3'"  1  
ATOM 5654   H "H2'"  . A A 1 175 ? 120.201 132.796 181.107 1.00 0.00 ? 175 A A "H2'"  1  
ATOM 5655   H "HO2'" . A A 1 175 ? 120.920 130.408 181.681 1.00 0.00 ? 175 A A "HO2'" 1  
ATOM 5656   H "H1'"  . A A 1 175 ? 119.541 131.480 178.946 1.00 0.00 ? 175 A A "H1'"  1  
ATOM 5657   H H8     . A A 1 175 ? 116.458 133.078 179.849 1.00 0.00 ? 175 A A H8     1  
ATOM 5658   H H61    . A A 1 175 ? 118.375 138.276 177.353 1.00 0.00 ? 175 A A H61    1  
ATOM 5659   H H62    . A A 1 175 ? 117.034 137.466 178.006 1.00 0.00 ? 175 A A H62    1  
ATOM 5660   H H2     . A A 1 175 ? 121.745 135.451 177.590 1.00 0.00 ? 175 A A H2     1  
ATOM 5661   P P      . A A 1 176 ? 119.736 132.076 184.412 1.00 0.00 ? 176 A A P      1  
ATOM 5662   O OP1    . A A 1 176 ? 120.207 131.299 185.586 1.00 0.00 ? 176 A A OP1    1  
ATOM 5663   O OP2    . A A 1 176 ? 118.570 132.983 184.553 1.00 0.00 ? 176 A A OP2    1  
ATOM 5664   O "O5'"  . A A 1 176 ? 120.963 132.935 183.865 1.00 0.00 ? 176 A A "O5'"  1  
ATOM 5665   C "C5'"  . A A 1 176 ? 122.231 132.335 183.648 1.00 0.00 ? 176 A A "C5'"  1  
ATOM 5666   C "C4'"  . A A 1 176 ? 123.190 133.295 182.984 1.00 0.00 ? 176 A A "C4'"  1  
ATOM 5667   O "O4'"  . A A 1 176 ? 122.671 133.687 181.686 1.00 0.00 ? 176 A A "O4'"  1  
ATOM 5668   C "C3'"  . A A 1 176 ? 123.421 134.611 183.707 1.00 0.00 ? 176 A A "C3'"  1  
ATOM 5669   O "O3'"  . A A 1 176 ? 124.332 134.501 184.787 1.00 0.00 ? 176 A A "O3'"  1  
ATOM 5670   C "C2'"  . A A 1 176 ? 123.909 135.521 182.588 1.00 0.00 ? 176 A A "C2'"  1  
ATOM 5671   O "O2'"  . A A 1 176 ? 125.272 135.274 182.278 1.00 0.00 ? 176 A A "O2'"  1  
ATOM 5672   C "C1'"  . A A 1 176 ? 123.041 135.056 181.417 1.00 0.00 ? 176 A A "C1'"  1  
ATOM 5673   N N9     . A A 1 176 ? 121.852 135.908 181.233 1.00 0.00 ? 176 A A N9     1  
ATOM 5674   C C8     . A A 1 176 ? 120.552 135.627 181.575 1.00 0.00 ? 176 A A C8     1  
ATOM 5675   N N7     . A A 1 176 ? 119.711 136.589 181.284 1.00 0.00 ? 176 A A N7     1  
ATOM 5676   C C5     . A A 1 176 ? 120.510 137.570 180.711 1.00 0.00 ? 176 A A C5     1  
ATOM 5677   C C6     . A A 1 176 ? 120.218 138.843 180.189 1.00 0.00 ? 176 A A C6     1  
ATOM 5678   N N6     . A A 1 176 ? 118.990 139.366 180.158 1.00 0.00 ? 176 A A N6     1  
ATOM 5679   N N1     . A A 1 176 ? 121.243 139.569 179.694 1.00 0.00 ? 176 A A N1     1  
ATOM 5680   C C2     . A A 1 176 ? 122.475 139.043 179.725 1.00 0.00 ? 176 A A C2     1  
ATOM 5681   N N3     . A A 1 176 ? 122.874 137.860 180.190 1.00 0.00 ? 176 A A N3     1  
ATOM 5682   C C4     . A A 1 176 ? 121.830 137.164 180.673 1.00 0.00 ? 176 A A C4     1  
ATOM 5683   H "H5'"  . A A 1 176 ? 122.120 131.549 183.074 1.00 0.00 ? 176 A A "H5'"  1  
ATOM 5684   H "H5''" . A A 1 176 ? 122.604 132.053 184.508 1.00 0.00 ? 176 A A "H5''" 1  
ATOM 5685   H "H4'"  . A A 1 176 ? 124.052 132.844 182.861 1.00 0.00 ? 176 A A "H4'"  1  
ATOM 5686   H "H3'"  . A A 1 176 ? 122.564 134.949 184.043 1.00 0.00 ? 176 A A "H3'"  1  
ATOM 5687   H "H2'"  . A A 1 176 ? 123.751 136.466 182.798 1.00 0.00 ? 176 A A "H2'"  1  
ATOM 5688   H "HO2'" . A A 1 176 ? 125.563 135.903 181.588 1.00 0.00 ? 176 A A "HO2'" 1  
ATOM 5689   H "H1'"  . A A 1 176 ? 123.575 135.060 180.595 1.00 0.00 ? 176 A A "H1'"  1  
ATOM 5690   H H8     . A A 1 176 ? 120.280 134.786 181.997 1.00 0.00 ? 176 A A H8     1  
ATOM 5691   H H61    . A A 1 176 ? 118.849 140.261 179.781 1.00 0.00 ? 176 A A H61    1  
ATOM 5692   H H62    . A A 1 176 ? 118.230 138.859 180.511 1.00 0.00 ? 176 A A H62    1  
ATOM 5693   H H2     . A A 1 176 ? 123.183 139.609 179.355 1.00 0.00 ? 176 A A H2     1  
ATOM 5694   P P      . C A 1 177 ? 124.230 135.503 186.038 1.00 0.00 ? 177 C A P      1  
ATOM 5695   O OP1    . C A 1 177 ? 125.213 135.065 187.060 1.00 0.00 ? 177 C A OP1    1  
ATOM 5696   O OP2    . C A 1 177 ? 122.798 135.635 186.407 1.00 0.00 ? 177 C A OP2    1  
ATOM 5697   O "O5'"  . C A 1 177 ? 124.720 136.900 185.452 1.00 0.00 ? 177 C A "O5'"  1  
ATOM 5698   C "C5'"  . C A 1 177 ? 126.074 137.099 185.074 1.00 0.00 ? 177 C A "C5'"  1  
ATOM 5699   C "C4'"  . C A 1 177 ? 126.289 138.462 184.462 1.00 0.00 ? 177 C A "C4'"  1  
ATOM 5700   O "O4'"  . C A 1 177 ? 125.483 138.597 183.260 1.00 0.00 ? 177 C A "O4'"  1  
ATOM 5701   C "C3'"  . C A 1 177 ? 125.878 139.652 185.316 1.00 0.00 ? 177 C A "C3'"  1  
ATOM 5702   O "O3'"  . C A 1 177 ? 126.840 139.983 186.303 1.00 0.00 ? 177 C A "O3'"  1  
ATOM 5703   C "C2'"  . C A 1 177 ? 125.666 140.747 184.278 1.00 0.00 ? 177 C A "C2'"  1  
ATOM 5704   O "O2'"  . C A 1 177 ? 126.903 141.288 183.838 1.00 0.00 ? 177 C A "O2'"  1  
ATOM 5705   C "C1'"  . C A 1 177 ? 125.030 139.959 183.130 1.00 0.00 ? 177 C A "C1'"  1  
ATOM 5706   N N1     . C A 1 177 ? 123.549 140.034 183.147 1.00 0.00 ? 177 C A N1     1  
ATOM 5707   C C2     . C A 1 177 ? 122.935 141.194 182.658 1.00 0.00 ? 177 C A C2     1  
ATOM 5708   O O2     . C A 1 177 ? 123.642 142.118 182.228 1.00 0.00 ? 177 C A O2     1  
ATOM 5709   N N3     . C A 1 177 ? 121.586 141.286 182.663 1.00 0.00 ? 177 C A N3     1  
ATOM 5710   C C4     . C A 1 177 ? 120.848 140.278 183.130 1.00 0.00 ? 177 C A C4     1  
ATOM 5711   N N4     . C A 1 177 ? 119.520 140.413 183.114 1.00 0.00 ? 177 C A N4     1  
ATOM 5712   C C5     . C A 1 177 ? 121.441 139.087 183.635 1.00 0.00 ? 177 C A C5     1  
ATOM 5713   C C6     . C A 1 177 ? 122.777 139.006 183.625 1.00 0.00 ? 177 C A C6     1  
ATOM 5714   H "H5'"  . C A 1 177 ? 126.327 136.411 184.420 1.00 0.00 ? 177 C A "H5'"  1  
ATOM 5715   H "H5''" . C A 1 177 ? 126.643 137.012 185.866 1.00 0.00 ? 177 C A "H5''" 1  
ATOM 5716   H "H4'"  . C A 1 177 ? 127.234 138.553 184.220 1.00 0.00 ? 177 C A "H4'"  1  
ATOM 5717   H "H3'"  . C A 1 177 ? 125.024 139.455 185.753 1.00 0.00 ? 177 C A "H3'"  1  
ATOM 5718   H "H2'"  . C A 1 177 ? 125.062 141.444 184.611 1.00 0.00 ? 177 C A "H2'"  1  
ATOM 5719   H "HO2'" . C A 1 177 ? 126.726 142.009 183.201 1.00 0.00 ? 177 C A "HO2'" 1  
ATOM 5720   H "H1'"  . C A 1 177 ? 125.363 140.306 182.276 1.00 0.00 ? 177 C A "H1'"  1  
ATOM 5721   H H41    . C A 1 177 ? 119.116 141.236 182.766 1.00 0.00 ? 177 C A H41    1  
ATOM 5722   H H42    . C A 1 177 ? 118.951 139.690 183.450 1.00 0.00 ? 177 C A H42    1  
ATOM 5723   H H5     . C A 1 177 ? 120.891 138.352 183.976 1.00 0.00 ? 177 C A H5     1  
ATOM 5724   H H6     . C A 1 177 ? 123.204 138.194 183.967 1.00 0.00 ? 177 C A H6     1  
ATOM 5725   P P      . A A 1 178 ? 126.389 140.738 187.648 1.00 0.00 ? 178 A A P      1  
ATOM 5726   O OP1    . A A 1 178 ? 127.567 140.813 188.549 1.00 0.00 ? 178 A A OP1    1  
ATOM 5727   O OP2    . A A 1 178 ? 125.135 140.108 188.131 1.00 0.00 ? 178 A A OP2    1  
ATOM 5728   O "O5'"  . A A 1 178 ? 126.043 142.215 187.163 1.00 0.00 ? 178 A A "O5'"  1  
ATOM 5729   C "C5'"  . A A 1 178 ? 127.056 143.074 186.660 1.00 0.00 ? 178 A A "C5'"  1  
ATOM 5730   C "C4'"  . A A 1 178 ? 126.481 144.366 186.138 1.00 0.00 ? 178 A A "C4'"  1  
ATOM 5731   O "O4'"  . A A 1 178 ? 125.587 144.089 185.026 1.00 0.00 ? 178 A A "O4'"  1  
ATOM 5732   C "C3'"  . A A 1 178 ? 125.625 145.158 187.113 1.00 0.00 ? 178 A A "C3'"  1  
ATOM 5733   O "O3'"  . A A 1 178 ? 126.393 145.912 188.037 1.00 0.00 ? 178 A A "O3'"  1  
ATOM 5734   C "C2'"  . A A 1 178 ? 124.771 146.014 186.189 1.00 0.00 ? 178 A A "C2'"  1  
ATOM 5735   O "O2'"  . A A 1 178 ? 125.504 147.123 185.687 1.00 0.00 ? 178 A A "O2'"  1  
ATOM 5736   C "C1'"  . A A 1 178 ? 124.497 145.041 185.040 1.00 0.00 ? 178 A A "C1'"  1  
ATOM 5737   N N9     . A A 1 178 ? 123.195 144.362 185.186 1.00 0.00 ? 178 A A N9     1  
ATOM 5738   C C8     . A A 1 178 ? 122.957 143.075 185.600 1.00 0.00 ? 178 A A C8     1  
ATOM 5739   N N7     . A A 1 178 ? 121.686 142.756 185.628 1.00 0.00 ? 178 A A N7     1  
ATOM 5740   C C5     . A A 1 178 ? 121.042 143.910 185.204 1.00 0.00 ? 178 A A C5     1  
ATOM 5741   C C6     . A A 1 178 ? 119.685 144.224 185.018 1.00 0.00 ? 178 A A C6     1  
ATOM 5742   N N6     . A A 1 178 ? 118.688 143.365 185.242 1.00 0.00 ? 178 A A N6     1  
ATOM 5743   N N1     . A A 1 178 ? 119.381 145.467 184.585 1.00 0.00 ? 178 A A N1     1  
ATOM 5744   C C2     . A A 1 178 ? 120.380 146.330 184.360 1.00 0.00 ? 178 A A C2     1  
ATOM 5745   N N3     . A A 1 178 ? 121.692 146.152 184.500 1.00 0.00 ? 178 A A N3     1  
ATOM 5746   C C4     . A A 1 178 ? 121.960 144.907 184.930 1.00 0.00 ? 178 A A C4     1  
ATOM 5747   H "H5'"  . A A 1 178 ? 127.531 142.618 185.933 1.00 0.00 ? 178 A A "H5'"  1  
ATOM 5748   H "H5''" . A A 1 178 ? 127.692 143.276 187.378 1.00 0.00 ? 178 A A "H5''" 1  
ATOM 5749   H "H4'"  . A A 1 178 ? 127.213 144.936 185.823 1.00 0.00 ? 178 A A "H4'"  1  
ATOM 5750   H "H3'"  . A A 1 178 ? 125.044 144.542 187.606 1.00 0.00 ? 178 A A "H3'"  1  
ATOM 5751   H "H2'"  . A A 1 178 ? 123.940 146.297 186.625 1.00 0.00 ? 178 A A "H2'"  1  
ATOM 5752   H "HO2'" . A A 1 178 ? 126.274 147.285 186.269 1.00 0.00 ? 178 A A "HO2'" 1  
ATOM 5753   H "H1'"  . A A 1 178 ? 124.517 145.527 184.189 1.00 0.00 ? 178 A A "H1'"  1  
ATOM 5754   H H8     . A A 1 178 ? 123.670 142.451 185.851 1.00 0.00 ? 178 A A H8     1  
ATOM 5755   H H61    . A A 1 178 ? 117.759 143.641 185.094 1.00 0.00 ? 178 A A H61    1  
ATOM 5756   H H62    . A A 1 178 ? 118.885 142.457 185.555 1.00 0.00 ? 178 A A H62    1  
ATOM 5757   H H2     . A A 1 178 ? 120.106 147.218 184.048 1.00 0.00 ? 178 A A H2     1  
ATOM 5758   P P      . G A 1 179 ? 125.788 146.277 189.481 1.00 0.00 ? 179 G A P      1  
ATOM 5759   O OP1    . G A 1 179 ? 126.855 146.943 190.272 1.00 0.00 ? 179 G A OP1    1  
ATOM 5760   O OP2    . G A 1 179 ? 125.123 145.064 190.021 1.00 0.00 ? 179 G A OP2    1  
ATOM 5761   O "O5'"  . G A 1 179 ? 124.659 147.358 189.166 1.00 0.00 ? 179 G A "O5'"  1  
ATOM 5762   C "C5'"  . G A 1 179 ? 125.001 148.642 188.667 1.00 0.00 ? 179 G A "C5'"  1  
ATOM 5763   C "C4'"  . G A 1 179 ? 123.773 149.439 188.302 1.00 0.00 ? 179 G A "C4'"  1  
ATOM 5764   O "O4'"  . G A 1 179 ? 123.027 148.746 187.269 1.00 0.00 ? 179 G A "O4'"  1  
ATOM 5765   C "C3'"  . G A 1 179 ? 122.756 149.646 189.415 1.00 0.00 ? 179 G A "C3'"  1  
ATOM 5766   O "O3'"  . G A 1 179 ? 123.122 150.683 190.311 1.00 0.00 ? 179 G A "O3'"  1  
ATOM 5767   C "C2'"  . G A 1 179 ? 121.475 149.929 188.645 1.00 0.00 ? 179 G A "C2'"  1  
ATOM 5768   O "O2'"  . G A 1 179 ? 121.448 151.263 188.158 1.00 0.00 ? 179 G A "O2'"  1  
ATOM 5769   C "C1'"  . G A 1 179 ? 121.612 148.971 187.462 1.00 0.00 ? 179 G A "C1'"  1  
ATOM 5770   N N9     . G A 1 179 ? 120.889 147.705 187.682 1.00 0.00 ? 179 G A N9     1  
ATOM 5771   C C8     . G A 1 179 ? 121.431 146.480 187.992 1.00 0.00 ? 179 G A C8     1  
ATOM 5772   N N7     . G A 1 179 ? 120.533 145.542 188.127 1.00 0.00 ? 179 G A N7     1  
ATOM 5773   C C5     . G A 1 179 ? 119.325 146.185 187.894 1.00 0.00 ? 179 G A C5     1  
ATOM 5774   C C6     . G A 1 179 ? 118.000 145.681 187.902 1.00 0.00 ? 179 G A C6     1  
ATOM 5775   O O6     . G A 1 179 ? 117.616 144.528 188.125 1.00 0.00 ? 179 G A O6     1  
ATOM 5776   N N1     . G A 1 179 ? 117.071 146.677 187.613 1.00 0.00 ? 179 G A N1     1  
ATOM 5777   C C2     . G A 1 179 ? 117.378 147.990 187.349 1.00 0.00 ? 179 G A C2     1  
ATOM 5778   N N2     . G A 1 179 ? 116.345 148.805 187.092 1.00 0.00 ? 179 G A N2     1  
ATOM 5779   N N3     . G A 1 179 ? 118.611 148.472 187.339 1.00 0.00 ? 179 G A N3     1  
ATOM 5780   C C4     . G A 1 179 ? 119.529 147.520 187.617 1.00 0.00 ? 179 G A C4     1  
ATOM 5781   H "H5'"  . G A 1 179 ? 125.564 148.539 187.872 1.00 0.00 ? 179 G A "H5'"  1  
ATOM 5782   H "H5''" . G A 1 179 ? 125.506 149.127 189.354 1.00 0.00 ? 179 G A "H5''" 1  
ATOM 5783   H "H4'"  . G A 1 179 ? 124.053 150.312 187.959 1.00 0.00 ? 179 G A "H4'"  1  
ATOM 5784   H "H3'"  . G A 1 179 ? 122.653 148.812 189.915 1.00 0.00 ? 179 G A "H3'"  1  
ATOM 5785   H "H2'"  . G A 1 179 ? 120.681 149.722 189.182 1.00 0.00 ? 179 G A "H2'"  1  
ATOM 5786   H "HO2'" . G A 1 179 ? 120.599 151.417 187.694 1.00 0.00 ? 179 G A "HO2'" 1  
ATOM 5787   H "H1'"  . G A 1 179 ? 121.273 149.405 186.650 1.00 0.00 ? 179 G A "H1'"  1  
ATOM 5788   H H8     . G A 1 179 ? 122.393 146.327 188.099 1.00 0.00 ? 179 G A H8     1  
ATOM 5789   H H1     . G A 1 179 ? 116.125 146.421 187.597 1.00 0.00 ? 179 G A H1     1  
ATOM 5790   H H21    . G A 1 179 ? 115.430 148.456 187.098 1.00 0.00 ? 179 G A H21    1  
ATOM 5791   H H22    . G A 1 179 ? 116.504 149.752 186.897 1.00 0.00 ? 179 G A H22    1  
ATOM 5792   P P      . C A 1 180 ? 123.065 150.435 191.898 1.00 0.00 ? 180 C A P      1  
ATOM 5793   O OP1    . C A 1 180 ? 123.865 151.498 192.558 1.00 0.00 ? 180 C A OP1    1  
ATOM 5794   O OP2    . C A 1 180 ? 123.387 149.009 192.154 1.00 0.00 ? 180 C A OP2    1  
ATOM 5795   O "O5'"  . C A 1 180 ? 121.534 150.671 192.271 1.00 0.00 ? 180 C A "O5'"  1  
ATOM 5796   C "C5'"  . C A 1 180 ? 120.935 151.949 192.123 1.00 0.00 ? 180 C A "C5'"  1  
ATOM 5797   C "C4'"  . C A 1 180 ? 119.428 151.865 192.141 1.00 0.00 ? 180 C A "C4'"  1  
ATOM 5798   O "O4'"  . C A 1 180 ? 118.953 151.039 191.051 1.00 0.00 ? 180 C A "O4'"  1  
ATOM 5799   C "C3'"  . C A 1 180 ? 118.808 151.223 193.372 1.00 0.00 ? 180 C A "C3'"  1  
ATOM 5800   O "O3'"  . C A 1 180 ? 118.699 152.118 194.466 1.00 0.00 ? 180 C A "O3'"  1  
ATOM 5801   C "C2'"  . C A 1 180 ? 117.464 150.747 192.843 1.00 0.00 ? 180 C A "C2'"  1  
ATOM 5802   O "O2'"  . C A 1 180 ? 116.538 151.820 192.752 1.00 0.00 ? 180 C A "O2'"  1  
ATOM 5803   C "C1'"  . C A 1 180 ? 117.843 150.292 191.437 1.00 0.00 ? 180 C A "C1'"  1  
ATOM 5804   N N1     . C A 1 180 ? 118.184 148.848 191.386 1.00 0.00 ? 180 C A N1     1  
ATOM 5805   C C2     . C A 1 180 ? 117.142 147.923 191.244 1.00 0.00 ? 180 C A C2     1  
ATOM 5806   O O2     . C A 1 180 ? 115.974 148.334 191.168 1.00 0.00 ? 180 C A O2     1  
ATOM 5807   N N3     . C A 1 180 ? 117.426 146.602 191.194 1.00 0.00 ? 180 C A N3     1  
ATOM 5808   C C4     . C A 1 180 ? 118.690 146.186 191.279 1.00 0.00 ? 180 C A C4     1  
ATOM 5809   N N4     . C A 1 180 ? 118.923 144.873 191.224 1.00 0.00 ? 180 C A N4     1  
ATOM 5810   C C5     . C A 1 180 ? 119.771 147.101 191.423 1.00 0.00 ? 180 C A C5     1  
ATOM 5811   C C6     . C A 1 180 ? 119.478 148.406 191.470 1.00 0.00 ? 180 C A C6     1  
ATOM 5812   H "H5'"  . C A 1 180 ? 121.223 152.340 191.272 1.00 0.00 ? 180 C A "H5'"  1  
ATOM 5813   H "H5''" . C A 1 180 ? 121.231 152.527 192.857 1.00 0.00 ? 180 C A "H5''" 1  
ATOM 5814   H "H4'"  . C A 1 180 ? 119.060 152.766 192.032 1.00 0.00 ? 180 C A "H4'"  1  
ATOM 5815   H "H3'"  . C A 1 180 ? 119.344 150.447 193.637 1.00 0.00 ? 180 C A "H3'"  1  
ATOM 5816   H "H2'"  . C A 1 180 ? 117.110 150.008 193.380 1.00 0.00 ? 180 C A "H2'"  1  
ATOM 5817   H "HO2'" . C A 1 180 ? 115.686 151.479 192.408 1.00 0.00 ? 180 C A "HO2'" 1  
ATOM 5818   H "H1'"  . C A 1 180 ? 117.097 150.472 190.829 1.00 0.00 ? 180 C A "H1'"  1  
ATOM 5819   H H41    . C A 1 180 ? 118.176 144.246 191.126 1.00 0.00 ? 180 C A H41    1  
ATOM 5820   H H42    . C A 1 180 ? 119.841 144.536 191.284 1.00 0.00 ? 180 C A H42    1  
ATOM 5821   H H5     . C A 1 180 ? 120.697 146.786 191.484 1.00 0.00 ? 180 C A H5     1  
ATOM 5822   H H6     . C A 1 180 ? 120.208 149.051 191.570 1.00 0.00 ? 180 C A H6     1  
ATOM 5823   P P      . C A 1 181 ? 119.957 152.346 195.434 1.00 0.00 ? 181 C A P      1  
ATOM 5824   O OP1    . C A 1 181 ? 120.351 153.777 195.393 1.00 0.00 ? 181 C A OP1    1  
ATOM 5825   O OP2    . C A 1 181 ? 120.913 151.309 194.971 1.00 0.00 ? 181 C A OP2    1  
ATOM 5826   O "O5'"  . C A 1 181 ? 119.534 151.995 196.929 1.00 0.00 ? 181 C A "O5'"  1  
ATOM 5827   C "C5'"  . C A 1 181 ? 120.514 151.726 197.920 1.00 0.00 ? 181 C A "C5'"  1  
ATOM 5828   C "C4'"  . C A 1 181 ? 119.999 150.770 198.969 1.00 0.00 ? 181 C A "C4'"  1  
ATOM 5829   O "O4'"  . C A 1 181 ? 118.980 151.421 199.770 1.00 0.00 ? 181 C A "O4'"  1  
ATOM 5830   C "C3'"  . C A 1 181 ? 119.332 149.505 198.452 1.00 0.00 ? 181 C A "C3'"  1  
ATOM 5831   O "O3'"  . C A 1 181 ? 120.260 148.545 197.979 1.00 0.00 ? 181 C A "O3'"  1  
ATOM 5832   C "C2'"  . C A 1 181 ? 118.635 149.084 199.731 1.00 0.00 ? 181 C A "C2'"  1  
ATOM 5833   O "O2'"  . C A 1 181 ? 119.564 148.583 200.682 1.00 0.00 ? 181 C A "O2'"  1  
ATOM 5834   C "C1'"  . C A 1 181 ? 118.102 150.432 200.192 1.00 0.00 ? 181 C A "C1'"  1  
ATOM 5835   N N1     . C A 1 181 ? 116.736 150.703 199.678 1.00 0.00 ? 181 C A N1     1  
ATOM 5836   C C2     . C A 1 181 ? 115.645 150.168 200.374 1.00 0.00 ? 181 C A C2     1  
ATOM 5837   O O2     . C A 1 181 ? 115.850 149.488 201.392 1.00 0.00 ? 181 C A O2     1  
ATOM 5838   N N3     . C A 1 181 ? 114.390 150.400 199.927 1.00 0.00 ? 181 C A N3     1  
ATOM 5839   C C4     . C A 1 181 ? 114.197 151.134 198.831 1.00 0.00 ? 181 C A C4     1  
ATOM 5840   N N4     . C A 1 181 ? 112.940 151.337 198.427 1.00 0.00 ? 181 C A N4     1  
ATOM 5841   C C5     . C A 1 181 ? 115.284 151.691 198.100 1.00 0.00 ? 181 C A C5     1  
ATOM 5842   C C6     . C A 1 181 ? 116.521 151.455 198.553 1.00 0.00 ? 181 C A C6     1  
ATOM 5843   H "H5'"  . C A 1 181 ? 120.770 152.568 198.353 1.00 0.00 ? 181 C A "H5'"  1  
ATOM 5844   H "H5''" . C A 1 181 ? 121.303 151.334 197.491 1.00 0.00 ? 181 C A "H5''" 1  
ATOM 5845   H "H4'"  . C A 1 181 ? 120.743 150.520 199.554 1.00 0.00 ? 181 C A "H4'"  1  
ATOM 5846   H "H3'"  . C A 1 181 ? 118.661 149.672 197.758 1.00 0.00 ? 181 C A "H3'"  1  
ATOM 5847   H "H2'"  . C A 1 181 ? 117.918 148.441 199.553 1.00 0.00 ? 181 C A "H2'"  1  
ATOM 5848   H "HO2'" . C A 1 181 ? 119.081 148.321 201.493 1.00 0.00 ? 181 C A "HO2'" 1  
ATOM 5849   H "H1'"  . C A 1 181 ? 118.093 150.457 201.171 1.00 0.00 ? 181 C A "H1'"  1  
ATOM 5850   H H41    . C A 1 181 ? 112.194 150.951 198.932 1.00 0.00 ? 181 C A H41    1  
ATOM 5851   H H42    . C A 1 181 ? 112.765 151.872 197.625 1.00 0.00 ? 181 C A H42    1  
ATOM 5852   H H5     . C A 1 181 ? 115.131 152.230 197.296 1.00 0.00 ? 181 C A H5     1  
ATOM 5853   H H6     . C A 1 181 ? 117.282 151.830 198.064 1.00 0.00 ? 181 C A H6     1  
ATOM 5854   P P      . U A 1 182 ? 119.796 147.423 196.926 1.00 0.00 ? 182 U A P      1  
ATOM 5855   O OP1    . U A 1 182 ? 120.984 146.605 196.572 1.00 0.00 ? 182 U A OP1    1  
ATOM 5856   O OP2    . U A 1 182 ? 119.019 148.093 195.853 1.00 0.00 ? 182 U A OP2    1  
ATOM 5857   O "O5'"  . U A 1 182 ? 118.796 146.504 197.759 1.00 0.00 ? 182 U A "O5'"  1  
ATOM 5858   C "C5'"  . U A 1 182 ? 119.253 145.747 198.869 1.00 0.00 ? 182 U A "C5'"  1  
ATOM 5859   C "C4'"  . U A 1 182 ? 118.105 145.204 199.684 1.00 0.00 ? 182 U A "C4'"  1  
ATOM 5860   O "O4'"  . U A 1 182 ? 117.252 146.293 200.129 1.00 0.00 ? 182 U A "O4'"  1  
ATOM 5861   C "C3'"  . U A 1 182 ? 117.140 144.284 198.953 1.00 0.00 ? 182 U A "C3'"  1  
ATOM 5862   O "O3'"  . U A 1 182 ? 117.614 142.953 198.851 1.00 0.00 ? 182 U A "O3'"  1  
ATOM 5863   C "C2'"  . U A 1 182 ? 115.873 144.417 199.779 1.00 0.00 ? 182 U A "C2'"  1  
ATOM 5864   O "O2'"  . U A 1 182 ? 115.961 143.666 200.982 1.00 0.00 ? 182 U A "O2'"  1  
ATOM 5865   C "C1'"  . U A 1 182 ? 115.898 145.907 200.112 1.00 0.00 ? 182 U A "C1'"  1  
ATOM 5866   N N1     . U A 1 182 ? 115.184 146.722 199.100 1.00 0.00 ? 182 U A N1     1  
ATOM 5867   C C2     . U A 1 182 ? 113.833 146.934 199.300 1.00 0.00 ? 182 U A C2     1  
ATOM 5868   O O2     . U A 1 182 ? 113.223 146.487 200.256 1.00 0.00 ? 182 U A O2     1  
ATOM 5869   N N3     . U A 1 182 ? 113.214 147.695 198.339 1.00 0.00 ? 182 U A N3     1  
ATOM 5870   C C4     . U A 1 182 ? 113.793 148.253 197.220 1.00 0.00 ? 182 U A C4     1  
ATOM 5871   O O4     . U A 1 182 ? 113.099 148.914 196.445 1.00 0.00 ? 182 U A O4     1  
ATOM 5872   C C5     . U A 1 182 ? 115.193 147.992 197.078 1.00 0.00 ? 182 U A C5     1  
ATOM 5873   C C6     . U A 1 182 ? 115.821 147.256 198.000 1.00 0.00 ? 182 U A C6     1  
ATOM 5874   H "H5'"  . U A 1 182 ? 119.807 146.319 199.440 1.00 0.00 ? 182 U A "H5'"  1  
ATOM 5875   H "H5''" . U A 1 182 ? 119.795 144.998 198.544 1.00 0.00 ? 182 U A "H5''" 1  
ATOM 5876   H "H4'"  . U A 1 182 ? 118.460 144.733 200.466 1.00 0.00 ? 182 U A "H4'"  1  
ATOM 5877   H "H3'"  . U A 1 182 ? 116.974 144.635 198.054 1.00 0.00 ? 182 U A "H3'"  1  
ATOM 5878   H "H2'"  . U A 1 182 ? 115.078 144.175 199.259 1.00 0.00 ? 182 U A "H2'"  1  
ATOM 5879   H "HO2'" . U A 1 182 ? 115.129 143.776 201.488 1.00 0.00 ? 182 U A "HO2'" 1  
ATOM 5880   H "H1'"  . U A 1 182 ? 115.488 146.048 200.991 1.00 0.00 ? 182 U A "H1'"  1  
ATOM 5881   H H3     . U A 1 182 ? 112.255 147.857 198.462 1.00 0.00 ? 182 U A H3     1  
ATOM 5882   H H5     . U A 1 182 ? 115.686 148.352 196.311 1.00 0.00 ? 182 U A H5     1  
ATOM 5883   H H6     . U A 1 182 ? 116.779 147.091 197.879 1.00 0.00 ? 182 U A H6     1  
ATOM 5884   P P      . U A 1 183 ? 117.620 142.202 197.430 1.00 0.00 ? 183 U A P      1  
ATOM 5885   O OP1    . U A 1 183 ? 118.713 141.197 197.445 1.00 0.00 ? 183 U A OP1    1  
ATOM 5886   O OP2    . U A 1 183 ? 117.587 143.236 196.365 1.00 0.00 ? 183 U A OP2    1  
ATOM 5887   O "O5'"  . U A 1 183 ? 116.232 141.420 197.402 1.00 0.00 ? 183 U A "O5'"  1  
ATOM 5888   C "C5'"  . U A 1 183 ? 116.059 140.215 198.132 1.00 0.00 ? 183 U A "C5'"  1  
ATOM 5889   C "C4'"  . U A 1 183 ? 114.600 139.909 198.365 1.00 0.00 ? 183 U A "C4'"  1  
ATOM 5890   O "O4'"  . U A 1 183 ? 114.002 141.015 199.077 1.00 0.00 ? 183 U A "O4'"  1  
ATOM 5891   C "C3'"  . U A 1 183 ? 113.721 139.850 197.124 1.00 0.00 ? 183 U A "C3'"  1  
ATOM 5892   O "O3'"  . U A 1 183 ? 113.851 138.634 196.411 1.00 0.00 ? 183 U A "O3'"  1  
ATOM 5893   C "C2'"  . U A 1 183 ? 112.340 139.994 197.757 1.00 0.00 ? 183 U A "C2'"  1  
ATOM 5894   O "O2'"  . U A 1 183 ? 111.922 138.779 198.362 1.00 0.00 ? 183 U A "O2'"  1  
ATOM 5895   C "C1'"  . U A 1 183 ? 112.615 141.031 198.856 1.00 0.00 ? 183 U A "C1'"  1  
ATOM 5896   N N1     . U A 1 183 ? 112.219 142.401 198.448 1.00 0.00 ? 183 U A N1     1  
ATOM 5897   C C2     . U A 1 183 ? 110.898 142.760 198.646 1.00 0.00 ? 183 U A C2     1  
ATOM 5898   O O2     . U A 1 183 ? 110.069 142.011 199.131 1.00 0.00 ? 183 U A O2     1  
ATOM 5899   N N3     . U A 1 183 ? 110.578 144.037 198.255 1.00 0.00 ? 183 U A N3     1  
ATOM 5900   C C4     . U A 1 183 ? 111.423 144.973 197.697 1.00 0.00 ? 183 U A C4     1  
ATOM 5901   O O4     . U A 1 183 ? 110.981 146.084 197.397 1.00 0.00 ? 183 U A O4     1  
ATOM 5902   C C5     . U A 1 183 ? 112.773 144.531 197.523 1.00 0.00 ? 183 U A C5     1  
ATOM 5903   C C6     . U A 1 183 ? 113.113 143.293 197.896 1.00 0.00 ? 183 U A C6     1  
ATOM 5904   H "H5'"  . U A 1 183 ? 116.509 140.298 198.998 1.00 0.00 ? 183 U A "H5'"  1  
ATOM 5905   H "H5''" . U A 1 183 ? 116.463 139.476 197.631 1.00 0.00 ? 183 U A "H5''" 1  
ATOM 5906   H "H4'"  . U A 1 183 ? 114.484 139.080 198.873 1.00 0.00 ? 183 U A "H4'"  1  
ATOM 5907   H "H3'"  . U A 1 183 ? 113.889 140.599 196.516 1.00 0.00 ? 183 U A "H3'"  1  
ATOM 5908   H "H2'"  . U A 1 183 ? 111.681 140.322 197.110 1.00 0.00 ? 183 U A "H2'"  1  
ATOM 5909   H "HO2'" . U A 1 183 ? 111.033 138.907 198.757 1.00 0.00 ? 183 U A "HO2'" 1  
ATOM 5910   H "H1'"  . U A 1 183 ? 112.125 140.779 199.667 1.00 0.00 ? 183 U A "H1'"  1  
ATOM 5911   H H3     . U A 1 183 ? 109.647 144.313 198.385 1.00 0.00 ? 183 U A H3     1  
ATOM 5912   H H5     . U A 1 183 ? 113.443 145.133 197.134 1.00 0.00 ? 183 U A H5     1  
ATOM 5913   H H6     . U A 1 183 ? 114.042 143.015 197.766 1.00 0.00 ? 183 U A H6     1  
ATOM 5914   P P      . G A 1 184 ? 113.944 138.642 194.807 1.00 0.00 ? 184 G A P      1  
ATOM 5915   O OP1    . G A 1 184 ? 113.953 137.233 194.338 1.00 0.00 ? 184 G A OP1    1  
ATOM 5916   O OP2    . G A 1 184 ? 115.050 139.553 194.415 1.00 0.00 ? 184 G A OP2    1  
ATOM 5917   O "O5'"  . G A 1 184 ? 112.571 139.306 194.344 1.00 0.00 ? 184 G A "O5'"  1  
ATOM 5918   C "C5'"  . G A 1 184 ? 111.326 138.705 194.664 1.00 0.00 ? 184 G A "C5'"  1  
ATOM 5919   C "C4'"  . G A 1 184 ? 110.181 139.672 194.488 1.00 0.00 ? 184 G A "C4'"  1  
ATOM 5920   O "O4'"  . G A 1 184 ? 110.338 140.796 195.392 1.00 0.00 ? 184 G A "O4'"  1  
ATOM 5921   C "C3'"  . G A 1 184 ? 110.061 140.322 193.118 1.00 0.00 ? 184 G A "C3'"  1  
ATOM 5922   O "O3'"  . G A 1 184 ? 109.401 139.499 192.171 1.00 0.00 ? 184 G A "O3'"  1  
ATOM 5923   C "C2'"  . G A 1 184 ? 109.314 141.610 193.432 1.00 0.00 ? 184 G A "C2'"  1  
ATOM 5924   O "O2'"  . G A 1 184 ? 107.925 141.370 193.608 1.00 0.00 ? 184 G A "O2'"  1  
ATOM 5925   C "C1'"  . G A 1 184 ? 109.929 141.993 194.778 1.00 0.00 ? 184 G A "C1'"  1  
ATOM 5926   N N9     . G A 1 184 ? 111.108 142.866 194.622 1.00 0.00 ? 184 G A N9     1  
ATOM 5927   C C8     . G A 1 184 ? 112.429 142.490 194.638 1.00 0.00 ? 184 G A C8     1  
ATOM 5928   N N7     . G A 1 184 ? 113.251 143.492 194.475 1.00 0.00 ? 184 G A N7     1  
ATOM 5929   C C5     . G A 1 184 ? 112.422 144.596 194.343 1.00 0.00 ? 184 G A C5     1  
ATOM 5930   C C6     . G A 1 184 ? 112.739 145.965 194.141 1.00 0.00 ? 184 G A C6     1  
ATOM 5931   O O6     . G A 1 184 ? 113.853 146.490 194.037 1.00 0.00 ? 184 G A O6     1  
ATOM 5932   N N1     . G A 1 184 ? 111.593 146.751 194.064 1.00 0.00 ? 184 G A N1     1  
ATOM 5933   C C2     . G A 1 184 ? 110.306 146.280 194.166 1.00 0.00 ? 184 G A C2     1  
ATOM 5934   N N2     . G A 1 184 ? 109.329 147.194 194.065 1.00 0.00 ? 184 G A N2     1  
ATOM 5935   N N3     . G A 1 184 ? 109.997 145.008 194.354 1.00 0.00 ? 184 G A N3     1  
ATOM 5936   C C4     . G A 1 184 ? 111.096 144.228 194.432 1.00 0.00 ? 184 G A C4     1  
ATOM 5937   H "H5'"  . G A 1 184 ? 111.347 138.400 195.595 1.00 0.00 ? 184 G A "H5'"  1  
ATOM 5938   H "H5''" . G A 1 184 ? 111.184 137.931 194.078 1.00 0.00 ? 184 G A "H5''" 1  
ATOM 5939   H "H4'"  . G A 1 184 ? 109.342 139.209 194.695 1.00 0.00 ? 184 G A "H4'"  1  
ATOM 5940   H "H3'"  . G A 1 184 ? 110.955 140.542 192.783 1.00 0.00 ? 184 G A "H3'"  1  
ATOM 5941   H "H2'"  . G A 1 184 ? 109.480 142.297 192.752 1.00 0.00 ? 184 G A "H2'"  1  
ATOM 5942   H "HO2'" . G A 1 184 ? 107.692 140.518 193.184 1.00 0.00 ? 184 G A "HO2'" 1  
ATOM 5943   H "H1'"  . G A 1 184 ? 109.257 142.447 195.327 1.00 0.00 ? 184 G A "H1'"  1  
ATOM 5944   H H8     . G A 1 184 ? 112.727 141.564 194.760 1.00 0.00 ? 184 G A H8     1  
ATOM 5945   H H1     . G A 1 184 ? 111.715 147.713 193.925 1.00 0.00 ? 184 G A H1     1  
ATOM 5946   H H21    . G A 1 184 ? 109.549 148.138 193.926 1.00 0.00 ? 184 G A H21    1  
ATOM 5947   H H22    . G A 1 184 ? 108.391 146.916 194.130 1.00 0.00 ? 184 G A H22    1  
ATOM 5948   P P      . G A 1 185 ? 109.859 139.513 190.631 1.00 0.00 ? 185 G A P      1  
ATOM 5949   O OP1    . G A 1 185 ? 109.114 138.443 189.919 1.00 0.00 ? 185 G A OP1    1  
ATOM 5950   O OP2    . G A 1 185 ? 111.344 139.523 190.593 1.00 0.00 ? 185 G A OP2    1  
ATOM 5951   O "O5'"  . G A 1 185 ? 109.342 140.918 190.087 1.00 0.00 ? 185 G A "O5'"  1  
ATOM 5952   C "C5'"  . G A 1 185 ? 107.972 141.276 190.180 1.00 0.00 ? 185 G A "C5'"  1  
ATOM 5953   C "C4'"  . G A 1 185 ? 107.775 142.764 190.021 1.00 0.00 ? 185 G A "C4'"  1  
ATOM 5954   O "O4'"  . G A 1 185 ? 108.423 143.435 191.136 1.00 0.00 ? 185 G A "O4'"  1  
ATOM 5955   C "C3'"  . G A 1 185 ? 108.384 143.387 188.774 1.00 0.00 ? 185 G A "C3'"  1  
ATOM 5956   O "O3'"  . G A 1 185 ? 107.530 143.314 187.645 1.00 0.00 ? 185 G A "O3'"  1  
ATOM 5957   C "C2'"  . G A 1 185 ? 108.611 144.822 189.249 1.00 0.00 ? 185 G A "C2'"  1  
ATOM 5958   O "O2'"  . G A 1 185 ? 107.395 145.555 189.273 1.00 0.00 ? 185 G A "O2'"  1  
ATOM 5959   C "C1'"  . G A 1 185 ? 109.083 144.585 190.687 1.00 0.00 ? 185 G A "C1'"  1  
ATOM 5960   N N9     . G A 1 185 ? 110.537 144.345 190.763 1.00 0.00 ? 185 G A N9     1  
ATOM 5961   C C8     . G A 1 185 ? 111.178 143.131 190.815 1.00 0.00 ? 185 G A C8     1  
ATOM 5962   N N7     . G A 1 185 ? 112.478 143.239 190.878 1.00 0.00 ? 185 G A N7     1  
ATOM 5963   C C5     . G A 1 185 ? 112.709 144.607 190.866 1.00 0.00 ? 185 G A C5     1  
ATOM 5964   C C6     . G A 1 185 ? 113.928 145.333 190.912 1.00 0.00 ? 185 G A C6     1  
ATOM 5965   O O6     . G A 1 185 ? 115.083 144.897 190.977 1.00 0.00 ? 185 G A O6     1  
ATOM 5966   N N1     . G A 1 185 ? 113.707 146.707 190.878 1.00 0.00 ? 185 G A N1     1  
ATOM 5967   C C2     . G A 1 185 ? 112.472 147.306 190.807 1.00 0.00 ? 185 G A C2     1  
ATOM 5968   N N2     . G A 1 185 ? 112.462 148.647 190.784 1.00 0.00 ? 185 G A N2     1  
ATOM 5969   N N3     . G A 1 185 ? 111.330 146.640 190.763 1.00 0.00 ? 185 G A N3     1  
ATOM 5970   C C4     . G A 1 185 ? 111.522 145.305 190.795 1.00 0.00 ? 185 G A C4     1  
ATOM 5971   H "H5'"  . G A 1 185 ? 107.627 141.000 191.055 1.00 0.00 ? 185 G A "H5'"  1  
ATOM 5972   H "H5''" . G A 1 185 ? 107.471 140.810 189.478 1.00 0.00 ? 185 G A "H5''" 1  
ATOM 5973   H "H4'"  . G A 1 185 ? 106.818 142.974 190.046 1.00 0.00 ? 185 G A "H4'"  1  
ATOM 5974   H "H3'"  . G A 1 185 ? 109.244 142.974 188.553 1.00 0.00 ? 185 G A "H3'"  1  
ATOM 5975   H "H2'"  . G A 1 185 ? 109.297 145.274 188.713 1.00 0.00 ? 185 G A "H2'"  1  
ATOM 5976   H "HO2'" . G A 1 185 ? 107.583 146.476 189.549 1.00 0.00 ? 185 G A "HO2'" 1  
ATOM 5977   H "H1'"  . G A 1 185 ? 108.852 145.361 191.239 1.00 0.00 ? 185 G A "H1'"  1  
ATOM 5978   H H8     . G A 1 185 ? 110.709 142.271 190.807 1.00 0.00 ? 185 G A H8     1  
ATOM 5979   H H1     . G A 1 185 ? 114.494 147.290 190.907 1.00 0.00 ? 185 G A H1     1  
ATOM 5980   H H21    . G A 1 185 ? 113.303 149.147 190.816 1.00 0.00 ? 185 G A H21    1  
ATOM 5981   H H22    . G A 1 185 ? 111.609 149.129 190.733 1.00 0.00 ? 185 G A H22    1  
ATOM 5982   P P      . C A 1 186 ? 108.147 143.079 186.180 1.00 0.00 ? 186 C A P      1  
ATOM 5983   O OP1    . C A 1 186 ? 107.022 142.837 185.241 1.00 0.00 ? 186 C A OP1    1  
ATOM 5984   O OP2    . C A 1 186 ? 109.236 142.077 186.294 1.00 0.00 ? 186 C A OP2    1  
ATOM 5985   O "O5'"  . C A 1 186 ? 108.805 144.483 185.808 1.00 0.00 ? 186 C A "O5'"  1  
ATOM 5986   C "C5'"  . C A 1 186 ? 108.039 145.678 185.831 1.00 0.00 ? 186 C A "C5'"  1  
ATOM 5987   C "C4'"  . C A 1 186 ? 108.918 146.903 185.820 1.00 0.00 ? 186 C A "C4'"  1  
ATOM 5988   O "O4'"  . C A 1 186 ? 109.682 146.973 187.053 1.00 0.00 ? 186 C A "O4'"  1  
ATOM 5989   C "C3'"  . C A 1 186 ? 109.973 146.963 184.727 1.00 0.00 ? 186 C A "C3'"  1  
ATOM 5990   O "O3'"  . C A 1 186 ? 109.460 147.418 183.486 1.00 0.00 ? 186 C A "O3'"  1  
ATOM 5991   C "C2'"  . C A 1 186 ? 111.023 147.886 185.328 1.00 0.00 ? 186 C A "C2'"  1  
ATOM 5992   O "O2'"  . C A 1 186 ? 110.629 149.248 185.235 1.00 0.00 ? 186 C A "O2'"  1  
ATOM 5993   C "C1'"  . C A 1 186 ? 110.997 147.461 186.798 1.00 0.00 ? 186 C A "C1'"  1  
ATOM 5994   N N1     . C A 1 186 ? 112.005 146.414 187.100 1.00 0.00 ? 186 C A N1     1  
ATOM 5995   C C2     . C A 1 186 ? 113.342 146.803 187.246 1.00 0.00 ? 186 C A C2     1  
ATOM 5996   O O2     . C A 1 186 ? 113.644 148.000 187.117 1.00 0.00 ? 186 C A O2     1  
ATOM 5997   N N3     . C A 1 186 ? 114.282 145.868 187.522 1.00 0.00 ? 186 C A N3     1  
ATOM 5998   C C4     . C A 1 186 ? 113.932 144.589 187.653 1.00 0.00 ? 186 C A C4     1  
ATOM 5999   N N4     . C A 1 186 ? 114.892 143.703 187.927 1.00 0.00 ? 186 C A N4     1  
ATOM 6000   C C5     . C A 1 186 ? 112.581 144.163 187.512 1.00 0.00 ? 186 C A C5     1  
ATOM 6001   C C6     . C A 1 186 ? 111.661 145.096 187.240 1.00 0.00 ? 186 C A C6     1  
ATOM 6002   H "H5'"  . C A 1 186 ? 107.487 145.686 186.640 1.00 0.00 ? 186 C A "H5'"  1  
ATOM 6003   H "H5''" . C A 1 186 ? 107.453 145.696 185.045 1.00 0.00 ? 186 C A "H5''" 1  
ATOM 6004   H "H4'"  . C A 1 186 ? 108.347 147.697 185.755 1.00 0.00 ? 186 C A "H4'"  1  
ATOM 6005   H "H3'"  . C A 1 186 ? 110.362 146.071 184.605 1.00 0.00 ? 186 C A "H3'"  1  
ATOM 6006   H "H2'"  . C A 1 186 ? 111.906 147.735 184.928 1.00 0.00 ? 186 C A "H2'"  1  
ATOM 6007   H "HO2'" . C A 1 186 ? 109.945 149.335 184.540 1.00 0.00 ? 186 C A "HO2'" 1  
ATOM 6008   H "H1'"  . C A 1 186 ? 111.159 148.242 187.365 1.00 0.00 ? 186 C A "H1'"  1  
ATOM 6009   H H41    . C A 1 186 ? 115.821 143.999 188.024 1.00 0.00 ? 186 C A H41    1  
ATOM 6010   H H42    . C A 1 186 ? 114.668 142.754 188.030 1.00 0.00 ? 186 C A H42    1  
ATOM 6011   H H5     . C A 1 186 ? 112.334 143.220 187.611 1.00 0.00 ? 186 C A H5     1  
ATOM 6012   H H6     . C A 1 186 ? 110.727 144.821 187.138 1.00 0.00 ? 186 C A H6     1  
ATOM 6013   P P      . U A 1 187 ? 110.110 146.911 182.107 1.00 0.00 ? 187 U A P      1  
ATOM 6014   O OP1    . U A 1 187 ? 109.218 147.329 180.997 1.00 0.00 ? 187 U A OP1    1  
ATOM 6015   O OP2    . U A 1 187 ? 110.464 145.479 182.267 1.00 0.00 ? 187 U A OP2    1  
ATOM 6016   O "O5'"  . U A 1 187 ? 111.464 147.744 181.993 1.00 0.00 ? 187 U A "O5'"  1  
ATOM 6017   C "C5'"  . U A 1 187 ? 111.442 149.146 181.776 1.00 0.00 ? 187 U A "C5'"  1  
ATOM 6018   C "C4'"  . U A 1 187 ? 112.833 149.730 181.769 1.00 0.00 ? 187 U A "C4'"  1  
ATOM 6019   O "O4'"  . U A 1 187 ? 113.450 149.553 183.071 1.00 0.00 ? 187 U A "O4'"  1  
ATOM 6020   C "C3'"  . U A 1 187 ? 113.822 149.098 180.802 1.00 0.00 ? 187 U A "C3'"  1  
ATOM 6021   O "O3'"  . U A 1 187 ? 113.694 149.588 179.478 1.00 0.00 ? 187 U A "O3'"  1  
ATOM 6022   C "C2'"  . U A 1 187 ? 115.165 149.416 181.442 1.00 0.00 ? 187 U A "C2'"  1  
ATOM 6023   O "O2'"  . U A 1 187 ? 115.544 150.763 181.202 1.00 0.00 ? 187 U A "O2'"  1  
ATOM 6024   C "C1'"  . U A 1 187 ? 114.841 149.248 182.928 1.00 0.00 ? 187 U A "C1'"  1  
ATOM 6025   N N1     . U A 1 187 ? 115.107 147.872 183.412 1.00 0.00 ? 187 U A N1     1  
ATOM 6026   C C2     . U A 1 187 ? 116.422 147.543 183.683 1.00 0.00 ? 187 U A C2     1  
ATOM 6027   O O2     . U A 1 187 ? 117.346 148.324 183.545 1.00 0.00 ? 187 U A O2     1  
ATOM 6028   N N3     . U A 1 187 ? 116.621 146.259 184.129 1.00 0.00 ? 187 U A N3     1  
ATOM 6029   C C4     . U A 1 187 ? 115.661 145.289 184.326 1.00 0.00 ? 187 U A C4     1  
ATOM 6030   O O4     . U A 1 187 ? 116.000 144.177 184.732 1.00 0.00 ? 187 U A O4     1  
ATOM 6031   C C5     . U A 1 187 ? 114.324 145.701 184.024 1.00 0.00 ? 187 U A C5     1  
ATOM 6032   C C6     . U A 1 187 ? 114.101 146.946 183.590 1.00 0.00 ? 187 U A C6     1  
ATOM 6033   H "H5'"  . U A 1 187 ? 110.921 149.571 182.488 1.00 0.00 ? 187 U A "H5'"  1  
ATOM 6034   H "H5''" . U A 1 187 ? 111.016 149.329 180.914 1.00 0.00 ? 187 U A "H5''" 1  
ATOM 6035   H "H4'"  . U A 1 187 ? 112.770 150.688 181.574 1.00 0.00 ? 187 U A "H4'"  1  
ATOM 6036   H "H3'"  . U A 1 187 ? 113.691 148.126 180.798 1.00 0.00 ? 187 U A "H3'"  1  
ATOM 6037   H "H2'"  . U A 1 187 ? 115.859 148.787 181.155 1.00 0.00 ? 187 U A "H2'"  1  
ATOM 6038   H "HO2'" . U A 1 187 ? 115.045 151.102 180.431 1.00 0.00 ? 187 U A "HO2'" 1  
ATOM 6039   H "H1'"  . U A 1 187 ? 115.373 149.884 183.451 1.00 0.00 ? 187 U A "H1'"  1  
ATOM 6040   H H3     . U A 1 187 ? 117.545 146.005 184.327 1.00 0.00 ? 187 U A H3     1  
ATOM 6041   H H5     . U A 1 187 ? 113.578 145.075 184.136 1.00 0.00 ? 187 U A H5     1  
ATOM 6042   H H6     . U A 1 187 ? 113.178 147.202 183.389 1.00 0.00 ? 187 U A H6     1  
ATOM 6043   P P      . G A 1 188 ? 114.072 148.652 178.227 1.00 0.00 ? 188 G A P      1  
ATOM 6044   O OP1    . G A 1 188 ? 113.629 149.340 176.988 1.00 0.00 ? 188 G A OP1    1  
ATOM 6045   O OP2    . G A 1 188 ? 113.585 147.279 178.516 1.00 0.00 ? 188 G A OP2    1  
ATOM 6046   O "O5'"  . G A 1 188 ? 115.665 148.624 178.234 1.00 0.00 ? 188 G A "O5'"  1  
ATOM 6047   C "C5'"  . G A 1 188 ? 116.416 149.793 177.939 1.00 0.00 ? 188 G A "C5'"  1  
ATOM 6048   C "C4'"  . G A 1 188 ? 117.890 149.576 178.172 1.00 0.00 ? 188 G A "C4'"  1  
ATOM 6049   O "O4'"  . G A 1 188 ? 118.122 149.241 179.565 1.00 0.00 ? 188 G A "O4'"  1  
ATOM 6050   C "C3'"  . G A 1 188 ? 118.528 148.430 177.404 1.00 0.00 ? 188 G A "C3'"  1  
ATOM 6051   O "O3'"  . G A 1 188 ? 118.857 148.773 176.068 1.00 0.00 ? 188 G A "O3'"  1  
ATOM 6052   C "C2'"  . G A 1 188 ? 119.736 148.085 178.261 1.00 0.00 ? 188 G A "C2'"  1  
ATOM 6053   O "O2'"  . G A 1 188 ? 120.791 149.015 178.062 1.00 0.00 ? 188 G A "O2'"  1  
ATOM 6054   C "C1'"  . G A 1 188 ? 119.173 148.269 179.671 1.00 0.00 ? 188 G A "C1'"  1  
ATOM 6055   N N9     . G A 1 188 ? 118.663 147.003 180.234 1.00 0.00 ? 188 G A N9     1  
ATOM 6056   C C8     . G A 1 188 ? 117.350 146.642 180.411 1.00 0.00 ? 188 G A C8     1  
ATOM 6057   N N7     . G A 1 188 ? 117.212 145.454 180.936 1.00 0.00 ? 188 G A N7     1  
ATOM 6058   C C5     . G A 1 188 ? 118.512 145.005 181.120 1.00 0.00 ? 188 G A C5     1  
ATOM 6059   C C6     . G A 1 188 ? 118.996 143.783 181.651 1.00 0.00 ? 188 G A C6     1  
ATOM 6060   O O6     . G A 1 188 ? 118.350 142.822 182.084 1.00 0.00 ? 188 G A O6     1  
ATOM 6061   N N1     . G A 1 188 ? 120.387 143.741 181.656 1.00 0.00 ? 188 G A N1     1  
ATOM 6062   C C2     . G A 1 188 ? 121.207 144.744 181.202 1.00 0.00 ? 188 G A C2     1  
ATOM 6063   N N2     . G A 1 188 ? 122.527 144.519 181.286 1.00 0.00 ? 188 G A N2     1  
ATOM 6064   N N3     . G A 1 188 ? 120.768 145.889 180.703 1.00 0.00 ? 188 G A N3     1  
ATOM 6065   C C4     . G A 1 188 ? 119.421 145.950 180.691 1.00 0.00 ? 188 G A C4     1  
ATOM 6066   H "H5'"  . G A 1 188 ? 116.105 150.526 178.509 1.00 0.00 ? 188 G A "H5'"  1  
ATOM 6067   H "H5''" . G A 1 188 ? 116.272 150.036 177.000 1.00 0.00 ? 188 G A "H5''" 1  
ATOM 6068   H "H4'"  . G A 1 188 ? 118.369 150.405 177.960 1.00 0.00 ? 188 G A "H4'"  1  
ATOM 6069   H "H3'"  . G A 1 188 ? 117.912 147.667 177.396 1.00 0.00 ? 188 G A "H3'"  1  
ATOM 6070   H "H2'"  . G A 1 188 ? 120.033 147.163 178.112 1.00 0.00 ? 188 G A "H2'"  1  
ATOM 6071   H "HO2'" . G A 1 188 ? 121.567 148.733 178.590 1.00 0.00 ? 188 G A "HO2'" 1  
ATOM 6072   H "H1'"  . G A 1 188 ? 119.870 148.629 180.256 1.00 0.00 ? 188 G A "H1'"  1  
ATOM 6073   H H8     . G A 1 188 ? 116.594 147.214 180.167 1.00 0.00 ? 188 G A H8     1  
ATOM 6074   H H1     . G A 1 188 ? 120.812 142.930 182.007 1.00 0.00 ? 188 G A H1     1  
ATOM 6075   H H21    . G A 1 188 ? 122.860 143.674 181.654 1.00 0.00 ? 188 G A H21    1  
ATOM 6076   H H22    . G A 1 188 ? 123.161 145.200 180.976 1.00 0.00 ? 188 G A H22    1  
ATOM 6077   P P      . U A 1 189 ? 118.845 147.650 174.918 1.00 0.00 ? 189 U A P      1  
ATOM 6078   O OP1    . U A 1 189 ? 118.964 148.333 173.605 1.00 0.00 ? 189 U A OP1    1  
ATOM 6079   O OP2    . U A 1 189 ? 117.695 146.745 175.174 1.00 0.00 ? 189 U A OP2    1  
ATOM 6080   O "O5'"  . U A 1 189 ? 120.186 146.827 175.170 1.00 0.00 ? 189 U A "O5'"  1  
ATOM 6081   C "C5'"  . U A 1 189 ? 121.457 147.424 174.961 1.00 0.00 ? 189 U A "C5'"  1  
ATOM 6082   C "C4'"  . U A 1 189 ? 122.578 146.493 175.351 1.00 0.00 ? 189 U A "C4'"  1  
ATOM 6083   O "O4'"  . U A 1 189 ? 122.502 146.195 176.769 1.00 0.00 ? 189 U A "O4'"  1  
ATOM 6084   C "C3'"  . U A 1 189 ? 122.580 145.126 174.686 1.00 0.00 ? 189 U A "C3'"  1  
ATOM 6085   O "O3'"  . U A 1 189 ? 123.153 145.141 173.389 1.00 0.00 ? 189 U A "O3'"  1  
ATOM 6086   C "C2'"  . U A 1 189 ? 123.347 144.271 175.683 1.00 0.00 ? 189 U A "C2'"  1  
ATOM 6087   O "O2'"  . U A 1 189 ? 124.746 144.494 175.587 1.00 0.00 ? 189 U A "O2'"  1  
ATOM 6088   C "C1'"  . U A 1 189 ? 122.847 144.832 177.015 1.00 0.00 ? 189 U A "C1'"  1  
ATOM 6089   N N1     . U A 1 189 ? 121.671 144.090 177.533 1.00 0.00 ? 189 U A N1     1  
ATOM 6090   C C2     . U A 1 189 ? 121.912 142.867 178.132 1.00 0.00 ? 189 U A C2     1  
ATOM 6091   O O2     . U A 1 189 ? 123.027 142.390 178.248 1.00 0.00 ? 189 U A O2     1  
ATOM 6092   N N3     . U A 1 189 ? 120.795 142.216 178.596 1.00 0.00 ? 189 U A N3     1  
ATOM 6093   C C4     . U A 1 189 ? 119.490 142.651 178.524 1.00 0.00 ? 189 U A C4     1  
ATOM 6094   O O4     . U A 1 189 ? 118.592 141.947 178.989 1.00 0.00 ? 189 U A O4     1  
ATOM 6095   C C5     . U A 1 189 ? 119.316 143.924 177.892 1.00 0.00 ? 189 U A C5     1  
ATOM 6096   C C6     . U A 1 189 ? 120.387 144.579 177.432 1.00 0.00 ? 189 U A C6     1  
ATOM 6097   H "H5'"  . U A 1 189 ? 121.518 148.240 175.496 1.00 0.00 ? 189 U A "H5'"  1  
ATOM 6098   H "H5''" . U A 1 189 ? 121.550 147.654 174.012 1.00 0.00 ? 189 U A "H5''" 1  
ATOM 6099   H "H4'"  . U A 1 189 ? 123.433 146.937 175.165 1.00 0.00 ? 189 U A "H4'"  1  
ATOM 6100   H "H3'"  . U A 1 189 ? 121.658 144.798 174.625 1.00 0.00 ? 189 U A "H3'"  1  
ATOM 6101   H "H2'"  . U A 1 189 ? 123.125 143.320 175.589 1.00 0.00 ? 189 U A "H2'"  1  
ATOM 6102   H "HO2'" . U A 1 189 ? 125.210 143.892 176.203 1.00 0.00 ? 189 U A "HO2'" 1  
ATOM 6103   H "H1'"  . U A 1 189 ? 123.567 144.794 177.677 1.00 0.00 ? 189 U A "H1'"  1  
ATOM 6104   H H3     . U A 1 189 ? 120.943 141.347 179.024 1.00 0.00 ? 189 U A H3     1  
ATOM 6105   H H5     . U A 1 189 ? 118.420 144.310 177.798 1.00 0.00 ? 189 U A H5     1  
ATOM 6106   H H6     . U A 1 189 ? 120.242 145.447 177.003 1.00 0.00 ? 189 U A H6     1  
ATOM 6107   P P      . U A 1 190 ? 122.654 144.101 172.272 1.00 0.00 ? 190 U A P      1  
ATOM 6108   O OP1    . U A 1 190 ? 123.233 144.514 170.967 1.00 0.00 ? 190 U A OP1    1  
ATOM 6109   O OP2    . U A 1 190 ? 121.182 143.954 172.405 1.00 0.00 ? 190 U A OP2    1  
ATOM 6110   O "O5'"  . U A 1 190 ? 123.328 142.723 172.697 1.00 0.00 ? 190 U A "O5'"  1  
ATOM 6111   C "C5'"  . U A 1 190 ? 124.735 142.543 172.610 1.00 0.00 ? 190 U A "C5'"  1  
ATOM 6112   C "C4'"  . U A 1 190 ? 125.159 141.205 173.167 1.00 0.00 ? 190 U A "C4'"  1  
ATOM 6113   O "O4'"  . U A 1 190 ? 124.827 141.131 174.578 1.00 0.00 ? 190 U A "O4'"  1  
ATOM 6114   C "C3'"  . U A 1 190 ? 124.487 139.983 172.562 1.00 0.00 ? 190 U A "C3'"  1  
ATOM 6115   O "O3'"  . U A 1 190 ? 125.076 139.575 171.339 1.00 0.00 ? 190 U A "O3'"  1  
ATOM 6116   C "C2'"  . U A 1 190 ? 124.610 138.951 173.675 1.00 0.00 ? 190 U A "C2'"  1  
ATOM 6117   O "O2'"  . U A 1 190 ? 125.923 138.406 173.729 1.00 0.00 ? 190 U A "O2'"  1  
ATOM 6118   C "C1'"  . U A 1 190 ? 124.381 139.813 174.918 1.00 0.00 ? 190 U A "C1'"  1  
ATOM 6119   N N1     . U A 1 190 ? 122.956 139.841 175.326 1.00 0.00 ? 190 U A N1     1  
ATOM 6120   C C2     . U A 1 190 ? 122.473 138.741 176.009 1.00 0.00 ? 190 U A C2     1  
ATOM 6121   O O2     . U A 1 190 ? 123.161 137.773 176.283 1.00 0.00 ? 190 U A O2     1  
ATOM 6122   N N3     . U A 1 190 ? 121.148 138.811 176.366 1.00 0.00 ? 190 U A N3     1  
ATOM 6123   C C4     . U A 1 190 ? 120.273 139.847 176.117 1.00 0.00 ? 190 U A C4     1  
ATOM 6124   O O4     . U A 1 190 ? 119.108 139.760 176.503 1.00 0.00 ? 190 U A O4     1  
ATOM 6125   C C5     . U A 1 190 ? 120.842 140.951 175.404 1.00 0.00 ? 190 U A C5     1  
ATOM 6126   C C6     . U A 1 190 ? 122.129 140.910 175.046 1.00 0.00 ? 190 U A C6     1  
ATOM 6127   H "H5'"  . U A 1 190 ? 125.181 143.254 173.115 1.00 0.00 ? 190 U A "H5'"  1  
ATOM 6128   H "H5''" . U A 1 190 ? 125.006 142.597 171.671 1.00 0.00 ? 190 U A "H5''" 1  
ATOM 6129   H "H4'"  . U A 1 190 ? 126.131 141.118 173.064 1.00 0.00 ? 190 U A "H4'"  1  
ATOM 6130   H "H3'"  . U A 1 190 ? 123.538 140.178 172.412 1.00 0.00 ? 190 U A "H3'"  1  
ATOM 6131   H "H2'"  . U A 1 190 ? 123.931 138.251 173.594 1.00 0.00 ? 190 U A "H2'"  1  
ATOM 6132   H "HO2'" . U A 1 190 ? 125.952 137.715 174.421 1.00 0.00 ? 190 U A "HO2'" 1  
ATOM 6133   H "H1'"  . U A 1 190 ? 124.921 139.469 175.659 1.00 0.00 ? 190 U A "H1'"  1  
ATOM 6134   H H3     . U A 1 190 ? 120.787 138.041 176.852 1.00 0.00 ? 190 U A H3     1  
ATOM 6135   H H5     . U A 1 190 ? 120.292 141.732 175.186 1.00 0.00 ? 190 U A H5     1  
ATOM 6136   H H6     . U A 1 190 ? 122.494 141.676 174.559 1.00 0.00 ? 190 U A H6     1  
ATOM 6137   P P      . G A 1 191 ? 124.192 138.826 170.225 1.00 0.00 ? 191 G A P      1  
ATOM 6138   O OP1    . G A 1 191 ? 125.022 138.684 169.000 1.00 0.00 ? 191 G A OP1    1  
ATOM 6139   O OP2    . G A 1 191 ? 122.878 139.512 170.146 1.00 0.00 ? 191 G A OP2    1  
ATOM 6140   O "O5'"  . G A 1 191 ? 123.956 137.372 170.832 1.00 0.00 ? 191 G A "O5'"  1  
ATOM 6141   C "C5'"  . G A 1 191 ? 125.039 136.472 171.013 1.00 0.00 ? 191 G A "C5'"  1  
ATOM 6142   C "C4'"  . G A 1 191 ? 124.607 135.225 171.743 1.00 0.00 ? 191 G A "C4'"  1  
ATOM 6143   O "O4'"  . G A 1 191 ? 124.112 135.575 173.063 1.00 0.00 ? 191 G A "O4'"  1  
ATOM 6144   C "C3'"  . G A 1 191 ? 123.462 134.446 171.114 1.00 0.00 ? 191 G A "C3'"  1  
ATOM 6145   O "O3'"  . G A 1 191 ? 123.883 133.606 170.050 1.00 0.00 ? 191 G A "O3'"  1  
ATOM 6146   C "C2'"  . G A 1 191 ? 122.885 133.687 172.301 1.00 0.00 ? 191 G A "C2'"  1  
ATOM 6147   O "O2'"  . G A 1 191 ? 123.682 132.558 172.627 1.00 0.00 ? 191 G A "O2'"  1  
ATOM 6148   C "C1'"  . G A 1 191 ? 123.011 134.724 173.416 1.00 0.00 ? 191 G A "C1'"  1  
ATOM 6149   N N9     . G A 1 191 ? 121.771 135.503 173.594 1.00 0.00 ? 191 G A N9     1  
ATOM 6150   C C8     . G A 1 191 ? 121.560 136.819 173.262 1.00 0.00 ? 191 G A C8     1  
ATOM 6151   N N7     . G A 1 191 ? 120.354 137.233 173.543 1.00 0.00 ? 191 G A N7     1  
ATOM 6152   C C5     . G A 1 191 ? 119.729 136.121 174.091 1.00 0.00 ? 191 G A C5     1  
ATOM 6153   C C6     . G A 1 191 ? 118.409 135.959 174.583 1.00 0.00 ? 191 G A C6     1  
ATOM 6154   O O6     . G A 1 191 ? 117.499 136.793 174.634 1.00 0.00 ? 191 G A O6     1  
ATOM 6155   N N1     . G A 1 191 ? 118.191 134.666 175.052 1.00 0.00 ? 191 G A N1     1  
ATOM 6156   C C2     . G A 1 191 ? 119.125 133.658 175.046 1.00 0.00 ? 191 G A C2     1  
ATOM 6157   N N2     . G A 1 191 ? 118.729 132.475 175.540 1.00 0.00 ? 191 G A N2     1  
ATOM 6158   N N3     . G A 1 191 ? 120.358 133.797 174.591 1.00 0.00 ? 191 G A N3     1  
ATOM 6159   C C4     . G A 1 191 ? 120.591 135.045 174.131 1.00 0.00 ? 191 G A C4     1  
ATOM 6160   H "H5'"  . G A 1 191 ? 125.743 136.917 171.528 1.00 0.00 ? 191 G A "H5'"  1  
ATOM 6161   H "H5''" . G A 1 191 ? 125.396 136.221 170.134 1.00 0.00 ? 191 G A "H5''" 1  
ATOM 6162   H "H4'"  . G A 1 191 ? 125.381 134.631 171.840 1.00 0.00 ? 191 G A "H4'"  1  
ATOM 6163   H "H3'"  . G A 1 191 ? 122.790 135.076 170.778 1.00 0.00 ? 191 G A "H3'"  1  
ATOM 6164   H "H2'"  . G A 1 191 ? 121.949 133.437 172.147 1.00 0.00 ? 191 G A "H2'"  1  
ATOM 6165   H "HO2'" . G A 1 191 ? 123.261 132.072 173.367 1.00 0.00 ? 191 G A "HO2'" 1  
ATOM 6166   H "H1'"  . G A 1 191 ? 123.238 134.274 174.256 1.00 0.00 ? 191 G A "H1'"  1  
ATOM 6167   H H8     . G A 1 191 ? 122.245 137.392 172.858 1.00 0.00 ? 191 G A H8     1  
ATOM 6168   H H1     . G A 1 191 ? 117.304 134.461 175.412 1.00 0.00 ? 191 G A H1     1  
ATOM 6169   H H21    . G A 1 191 ? 117.816 132.365 175.879 1.00 0.00 ? 191 G A H21    1  
ATOM 6170   H H22    . G A 1 191 ? 119.351 131.720 175.562 1.00 0.00 ? 191 G A H22    1  
ATOM 6171   P P      . A A 1 192 ? 123.055 133.589 168.676 1.00 0.00 ? 192 A A P      1  
ATOM 6172   O OP1    . A A 1 192 ? 123.964 133.199 167.569 1.00 0.00 ? 192 A A OP1    1  
ATOM 6173   O OP2    . A A 1 192 ? 122.417 134.929 168.665 1.00 0.00 ? 192 A A OP2    1  
ATOM 6174   O "O5'"  . A A 1 192 ? 121.909 132.503 168.775 1.00 0.00 ? 192 A A "O5'"  1  
ATOM 6175   C "C5'"  . A A 1 192 ? 122.196 131.195 169.185 1.00 0.00 ? 192 A A "C5'"  1  
ATOM 6176   C "C4'"  . A A 1 192 ? 120.960 130.573 169.759 1.00 0.00 ? 192 A A "C4'"  1  
ATOM 6177   O "O4'"  . A A 1 192 ? 120.614 131.317 170.952 1.00 0.00 ? 192 A A "O4'"  1  
ATOM 6178   C "C3'"  . A A 1 192 ? 119.711 130.756 168.919 1.00 0.00 ? 192 A A "C3'"  1  
ATOM 6179   O "O3'"  . A A 1 192 ? 119.636 129.847 167.842 1.00 0.00 ? 192 A A "O3'"  1  
ATOM 6180   C "C2'"  . A A 1 192 ? 118.612 130.565 169.947 1.00 0.00 ? 192 A A "C2'"  1  
ATOM 6181   O "O2'"  . A A 1 192 ? 118.380 129.217 170.251 1.00 0.00 ? 192 A A "O2'"  1  
ATOM 6182   C "C1'"  . A A 1 192 ? 119.222 131.239 171.162 1.00 0.00 ? 192 A A "C1'"  1  
ATOM 6183   N N9     . A A 1 192 ? 118.727 132.585 171.311 1.00 0.00 ? 192 A A N9     1  
ATOM 6184   C C8     . A A 1 192 ? 119.399 133.753 171.103 1.00 0.00 ? 192 A A C8     1  
ATOM 6185   N N7     . A A 1 192 ? 118.682 134.814 171.340 1.00 0.00 ? 192 A A N7     1  
ATOM 6186   C C5     . A A 1 192 ? 117.453 134.309 171.729 1.00 0.00 ? 192 A A C5     1  
ATOM 6187   C C6     . A A 1 192 ? 116.271 134.919 172.102 1.00 0.00 ? 192 A A C6     1  
ATOM 6188   N N6     . A A 1 192 ? 116.112 136.238 172.147 1.00 0.00 ? 192 A A N6     1  
ATOM 6189   N N1     . A A 1 192 ? 115.233 134.126 172.420 1.00 0.00 ? 192 A A N1     1  
ATOM 6190   C C2     . A A 1 192 ? 115.394 132.797 172.361 1.00 0.00 ? 192 A A C2     1  
ATOM 6191   N N3     . A A 1 192 ? 116.463 132.104 172.016 1.00 0.00 ? 192 A A N3     1  
ATOM 6192   C C4     . A A 1 192 ? 117.469 132.935 171.710 1.00 0.00 ? 192 A A C4     1  
ATOM 6193   H "H5'"  . A A 1 192 ? 122.906 131.220 169.862 1.00 0.00 ? 192 A A "H5'"  1  
ATOM 6194   H "H5''" . A A 1 192 ? 122.509 130.679 168.414 1.00 0.00 ? 192 A A "H5''" 1  
ATOM 6195   H "H4'"  . A A 1 192 ? 121.148 129.639 169.988 1.00 0.00 ? 192 A A "H4'"  1  
ATOM 6196   H "H3'"  . A A 1 192 ? 119.693 131.673 168.570 1.00 0.00 ? 192 A A "H3'"  1  
ATOM 6197   H "H2'"  . A A 1 192 ? 117.782 131.007 169.670 1.00 0.00 ? 192 A A "H2'"  1  
ATOM 6198   H "HO2'" . A A 1 192 ? 118.737 128.658 169.525 1.00 0.00 ? 192 A A "HO2'" 1  
ATOM 6199   H "H1'"  . A A 1 192 ? 119.015 130.713 171.964 1.00 0.00 ? 192 A A "H1'"  1  
ATOM 6200   H H8     . A A 1 192 ? 120.332 133.793 170.805 1.00 0.00 ? 192 A A H8     1  
ATOM 6201   H H61    . A A 1 192 ? 115.248 136.617 172.415 1.00 0.00 ? 192 A A H61    1  
ATOM 6202   H H62    . A A 1 192 ? 116.855 136.831 171.918 1.00 0.00 ? 192 A A H62    1  
ATOM 6203   H H2     . A A 1 192 ? 114.610 132.264 172.606 1.00 0.00 ? 192 A A H2     1  
ATOM 6204   P P      . U A 1 193 ? 119.074 130.369 166.421 1.00 0.00 ? 193 U A P      1  
ATOM 6205   O OP1    . U A 1 193 ? 119.181 129.281 165.403 1.00 0.00 ? 193 U A OP1    1  
ATOM 6206   O OP2    . U A 1 193 ? 119.682 131.714 166.152 1.00 0.00 ? 193 U A OP2    1  
ATOM 6207   O "O5'"  . U A 1 193 ? 117.521 130.599 166.681 1.00 0.00 ? 193 U A "O5'"  1  
ATOM 6208   C "C5'"  . U A 1 193 ? 116.621 129.501 166.773 1.00 0.00 ? 193 U A "C5'"  1  
ATOM 6209   C "C4'"  . U A 1 193 ? 115.269 129.990 167.254 1.00 0.00 ? 193 U A "C4'"  1  
ATOM 6210   O "O4'"  . U A 1 193 ? 115.489 130.877 168.377 1.00 0.00 ? 193 U A "O4'"  1  
ATOM 6211   C "C3'"  . U A 1 193 ? 114.485 130.891 166.312 1.00 0.00 ? 193 U A "C3'"  1  
ATOM 6212   O "O3'"  . U A 1 193 ? 113.761 130.133 165.349 1.00 0.00 ? 193 U A "O3'"  1  
ATOM 6213   C "C2'"  . U A 1 193 ? 113.522 131.566 167.270 1.00 0.00 ? 193 U A "C2'"  1  
ATOM 6214   O "O2'"  . U A 1 193 ? 112.437 130.725 167.604 1.00 0.00 ? 193 U A "O2'"  1  
ATOM 6215   C "C1'"  . U A 1 193 ? 114.396 131.752 168.505 1.00 0.00 ? 193 U A "C1'"  1  
ATOM 6216   N N1     . U A 1 193 ? 114.924 133.108 168.599 1.00 0.00 ? 193 U A N1     1  
ATOM 6217   C C2     . U A 1 193 ? 114.189 134.027 169.270 1.00 0.00 ? 193 U A C2     1  
ATOM 6218   O O2     . U A 1 193 ? 113.122 133.762 169.761 1.00 0.00 ? 193 U A O2     1  
ATOM 6219   N N3     . U A 1 193 ? 114.732 135.278 169.342 1.00 0.00 ? 193 U A N3     1  
ATOM 6220   C C4     . U A 1 193 ? 115.926 135.676 168.803 1.00 0.00 ? 193 U A C4     1  
ATOM 6221   O O4     . U A 1 193 ? 116.292 136.842 168.907 1.00 0.00 ? 193 U A O4     1  
ATOM 6222   C C5     . U A 1 193 ? 116.620 134.653 168.120 1.00 0.00 ? 193 U A C5     1  
ATOM 6223   C C6     . U A 1 193 ? 116.102 133.428 168.046 1.00 0.00 ? 193 U A C6     1  
ATOM 6224   H "H5'"  . U A 1 193 ? 116.983 128.843 167.404 1.00 0.00 ? 193 U A "H5'"  1  
ATOM 6225   H "H5''" . U A 1 193 ? 116.533 129.086 165.891 1.00 0.00 ? 193 U A "H5''" 1  
ATOM 6226   H "H4'"  . U A 1 193 ? 114.738 129.219 167.538 1.00 0.00 ? 193 U A "H4'"  1  
ATOM 6227   H "H3'"  . U A 1 193 ? 115.104 131.501 165.859 1.00 0.00 ? 193 U A "H3'"  1  
ATOM 6228   H "H2'"  . U A 1 193 ? 113.210 132.427 166.921 1.00 0.00 ? 193 U A "H2'"  1  
ATOM 6229   H "HO2'" . U A 1 193 ? 112.355 130.025 166.923 1.00 0.00 ? 193 U A "HO2'" 1  
ATOM 6230   H "H1'"  . U A 1 193 ? 113.870 131.549 169.305 1.00 0.00 ? 193 U A "H1'"  1  
ATOM 6231   H H3     . U A 1 193 ? 114.213 135.953 169.825 1.00 0.00 ? 193 U A H3     1  
ATOM 6232   H H5     . U A 1 193 ? 117.488 134.840 167.702 1.00 0.00 ? 193 U A H5     1  
ATOM 6233   H H6     . U A 1 193 ? 116.611 132.745 167.564 1.00 0.00 ? 193 U A H6     1  
ATOM 6234   P P      . A A 1 194 ? 113.784 130.587 163.821 1.00 0.00 ? 194 A A P      1  
ATOM 6235   O OP1    . A A 1 194 ? 113.909 129.412 162.929 1.00 0.00 ? 194 A A OP1    1  
ATOM 6236   O OP2    . A A 1 194 ? 114.702 131.725 163.716 1.00 0.00 ? 194 A A OP2    1  
ATOM 6237   O "O5'"  . A A 1 194 ? 112.374 131.224 163.532 1.00 0.00 ? 194 A A "O5'"  1  
ATOM 6238   C "C5'"  . A A 1 194 ? 111.195 130.607 164.006 1.00 0.00 ? 194 A A "C5'"  1  
ATOM 6239   C "C4'"  . A A 1 194 ? 110.041 131.527 163.777 1.00 0.00 ? 194 A A "C4'"  1  
ATOM 6240   O "O4'"  . A A 1 194 ? 110.504 132.880 164.021 1.00 0.00 ? 194 A A "O4'"  1  
ATOM 6241   C "C3'"  . A A 1 194 ? 109.542 131.543 162.345 1.00 0.00 ? 194 A A "C3'"  1  
ATOM 6242   O "O3'"  . A A 1 194 ? 108.149 131.477 162.514 1.00 0.00 ? 194 A A "O3'"  1  
ATOM 6243   C "C2'"  . A A 1 194 ? 109.929 132.939 161.839 1.00 0.00 ? 194 A A "C2'"  1  
ATOM 6244   O "O2'"  . A A 1 194 ? 108.999 133.478 160.910 1.00 0.00 ? 194 A A "O2'"  1  
ATOM 6245   C "C1'"  . A A 1 194 ? 109.859 133.724 163.132 1.00 0.00 ? 194 A A "C1'"  1  
ATOM 6246   N N9     . A A 1 194 ? 110.502 135.011 163.240 1.00 0.00 ? 194 A A N9     1  
ATOM 6247   C C8     . A A 1 194 ? 111.784 135.347 162.977 1.00 0.00 ? 194 A A C8     1  
ATOM 6248   N N7     . A A 1 194 ? 112.071 136.592 163.259 1.00 0.00 ? 194 A A N7     1  
ATOM 6249   C C5     . A A 1 194 ? 110.876 137.107 163.731 1.00 0.00 ? 194 A A C5     1  
ATOM 6250   C C6     . A A 1 194 ? 110.509 138.372 164.183 1.00 0.00 ? 194 A A C6     1  
ATOM 6251   N N6     . A A 1 194 ? 111.337 139.406 164.230 1.00 0.00 ? 194 A A N6     1  
ATOM 6252   N N1     . A A 1 194 ? 109.231 138.559 164.575 1.00 0.00 ? 194 A A N1     1  
ATOM 6253   C C2     . A A 1 194 ? 108.389 137.525 164.507 1.00 0.00 ? 194 A A C2     1  
ATOM 6254   N N3     . A A 1 194 ? 108.618 136.280 164.092 1.00 0.00 ? 194 A A N3     1  
ATOM 6255   C C4     . A A 1 194 ? 109.898 136.144 163.711 1.00 0.00 ? 194 A A C4     1  
ATOM 6256   H "H5'"  . A A 1 194 ? 111.293 130.419 164.962 1.00 0.00 ? 194 A A "H5'"  1  
ATOM 6257   H "H5''" . A A 1 194 ? 111.059 129.764 163.526 1.00 0.00 ? 194 A A "H5''" 1  
ATOM 6258   H "H4'"  . A A 1 194 ? 109.323 131.299 164.404 1.00 0.00 ? 194 A A "H4'"  1  
ATOM 6259   H "H3'"  . A A 1 194 ? 109.931 130.783 161.861 1.00 0.00 ? 194 A A "H3'"  1  
ATOM 6260   H "H2'"  . A A 1 194 ? 110.835 132.949 161.464 1.00 0.00 ? 194 A A "H2'"  1  
ATOM 6261   H "HO2'" . A A 1 194 ? 109.309 134.366 160.630 1.00 0.00 ? 194 A A "HO2'" 1  
ATOM 6262   H "H1'"  . A A 1 194 ? 108.920 133.888 163.362 1.00 0.00 ? 194 A A "H1'"  1  
ATOM 6263   H H8     . A A 1 194 ? 112.442 134.717 162.617 1.00 0.00 ? 194 A A H8     1  
ATOM 6264   H H61    . A A 1 194 ? 111.015 140.279 164.545 1.00 0.00 ? 194 A A H61    1  
ATOM 6265   H H62    . A A 1 194 ? 112.270 139.303 163.953 1.00 0.00 ? 194 A A H62    1  
ATOM 6266   H H2     . A A 1 194 ? 107.472 137.707 164.803 1.00 0.00 ? 194 A A H2     1  
ATOM 6267   P P      . U A 1 195 ? 107.255 130.631 161.513 1.00 0.00 ? 195 U A P      1  
ATOM 6268   O OP1    . U A 1 195 ? 106.606 129.499 162.212 1.00 0.00 ? 195 U A OP1    1  
ATOM 6269   O OP2    . U A 1 195 ? 107.990 130.374 160.254 1.00 0.00 ? 195 U A OP2    1  
ATOM 6270   O "O5'"  . U A 1 195 ? 106.157 131.725 161.235 1.00 0.00 ? 195 U A "O5'"  1  
ATOM 6271   C "C5'"  . U A 1 195 ? 104.866 131.587 161.751 1.00 0.00 ? 195 U A "C5'"  1  
ATOM 6272   C "C4'"  . U A 1 195 ? 104.493 132.798 162.533 1.00 0.00 ? 195 U A "C4'"  1  
ATOM 6273   O "O4'"  . U A 1 195 ? 104.990 132.665 163.856 1.00 0.00 ? 195 U A "O4'"  1  
ATOM 6274   C "C3'"  . U A 1 195 ? 105.054 134.137 162.098 1.00 0.00 ? 195 U A "C3'"  1  
ATOM 6275   O "O3'"  . U A 1 195 ? 104.285 134.688 161.018 1.00 0.00 ? 195 U A "O3'"  1  
ATOM 6276   C "C2'"  . U A 1 195 ? 104.859 134.977 163.365 1.00 0.00 ? 195 U A "C2'"  1  
ATOM 6277   O "O2'"  . U A 1 195 ? 103.616 135.646 163.381 1.00 0.00 ? 195 U A "O2'"  1  
ATOM 6278   C "C1'"  . U A 1 195 ? 104.881 133.915 164.474 1.00 0.00 ? 195 U A "C1'"  1  
ATOM 6279   N N1     . U A 1 195 ? 105.976 134.029 165.432 1.00 0.00 ? 195 U A N1     1  
ATOM 6280   C C2     . U A 1 195 ? 106.234 135.266 165.919 1.00 0.00 ? 195 U A C2     1  
ATOM 6281   O O2     . U A 1 195 ? 105.584 136.223 165.598 1.00 0.00 ? 195 U A O2     1  
ATOM 6282   N N3     . U A 1 195 ? 107.279 135.344 166.793 1.00 0.00 ? 195 U A N3     1  
ATOM 6283   C C4     . U A 1 195 ? 108.074 134.308 167.210 1.00 0.00 ? 195 U A C4     1  
ATOM 6284   O O4     . U A 1 195 ? 108.999 134.543 167.985 1.00 0.00 ? 195 U A O4     1  
ATOM 6285   C C5     . U A 1 195 ? 107.729 133.029 166.666 1.00 0.00 ? 195 U A C5     1  
ATOM 6286   C C6     . U A 1 195 ? 106.713 132.939 165.818 1.00 0.00 ? 195 U A C6     1  
ATOM 6287   H "H5'"  . U A 1 195 ? 104.839 130.797 162.330 1.00 0.00 ? 195 U A "H5'"  1  
ATOM 6288   H "H5''" . U A 1 195 ? 104.236 131.465 161.012 1.00 0.00 ? 195 U A "H5''" 1  
ATOM 6289   H "H4'"  . U A 1 195 ? 103.515 132.868 162.561 1.00 0.00 ? 195 U A "H4'"  1  
ATOM 6290   H "H3'"  . U A 1 195 ? 105.987 134.025 161.826 1.00 0.00 ? 195 U A "H3'"  1  
ATOM 6291   H "H2'"  . U A 1 195 ? 105.598 135.607 163.494 1.00 0.00 ? 195 U A "H2'"  1  
ATOM 6292   H "HO2'" . U A 1 195 ? 103.270 135.700 162.466 1.00 0.00 ? 195 U A "HO2'" 1  
ATOM 6293   H "H1'"  . U A 1 195 ? 104.040 133.954 164.975 1.00 0.00 ? 195 U A "H1'"  1  
ATOM 6294   H H3     . U A 1 195 ? 107.478 136.231 167.157 1.00 0.00 ? 195 U A H3     1  
ATOM 6295   H H5     . U A 1 195 ? 108.240 132.231 166.921 1.00 0.00 ? 195 U A H5     1  
ATOM 6296   H H6     . U A 1 195 ? 106.497 132.054 165.456 1.00 0.00 ? 195 U A H6     1  
ATOM 6297   P P      . G A 1 196 ? 105.018 135.368 159.754 1.00 0.00 ? 196 G A P      1  
ATOM 6298   O OP1    . G A 1 196 ? 103.968 135.827 158.824 1.00 0.00 ? 196 G A OP1    1  
ATOM 6299   O OP2    . G A 1 196 ? 106.057 134.430 159.272 1.00 0.00 ? 196 G A OP2    1  
ATOM 6300   O "O5'"  . G A 1 196 ? 105.761 136.650 160.331 1.00 0.00 ? 196 G A "O5'"  1  
ATOM 6301   C "C5'"  . G A 1 196 ? 105.016 137.748 160.805 1.00 0.00 ? 196 G A "C5'"  1  
ATOM 6302   C "C4'"  . G A 1 196 ? 105.806 139.026 160.654 1.00 0.00 ? 196 G A "C4'"  1  
ATOM 6303   O "O4'"  . G A 1 196 ? 106.966 138.965 161.509 1.00 0.00 ? 196 G A "O4'"  1  
ATOM 6304   C "C3'"  . G A 1 196 ? 106.371 139.256 159.274 1.00 0.00 ? 196 G A "C3'"  1  
ATOM 6305   O "O3'"  . G A 1 196 ? 105.409 139.923 158.485 1.00 0.00 ? 196 G A "O3'"  1  
ATOM 6306   C "C2'"  . G A 1 196 ? 107.551 140.154 159.575 1.00 0.00 ? 196 G A "C2'"  1  
ATOM 6307   O "O2'"  . G A 1 196 ? 107.158 141.479 159.837 1.00 0.00 ? 196 G A "O2'"  1  
ATOM 6308   C "C1'"  . G A 1 196 ? 108.081 139.504 160.850 1.00 0.00 ? 196 G A "C1'"  1  
ATOM 6309   N N9     . G A 1 196 ? 108.987 138.382 160.620 1.00 0.00 ? 196 G A N9     1  
ATOM 6310   C C8     . G A 1 196 ? 108.696 137.042 160.756 1.00 0.00 ? 196 G A C8     1  
ATOM 6311   N N7     . G A 1 196 ? 109.716 136.270 160.502 1.00 0.00 ? 196 G A N7     1  
ATOM 6312   C C5     . G A 1 196 ? 110.730 137.155 160.164 1.00 0.00 ? 196 G A C5     1  
ATOM 6313   C C6     . G A 1 196 ? 112.058 136.915 159.776 1.00 0.00 ? 196 G A C6     1  
ATOM 6314   O O6     . G A 1 196 ? 112.645 135.830 159.620 1.00 0.00 ? 196 G A O6     1  
ATOM 6315   N N1     . G A 1 196 ? 112.736 138.099 159.539 1.00 0.00 ? 196 G A N1     1  
ATOM 6316   C C2     . G A 1 196 ? 112.205 139.344 159.648 1.00 0.00 ? 196 G A C2     1  
ATOM 6317   N N2     . G A 1 196 ? 113.009 140.350 159.363 1.00 0.00 ? 196 G A N2     1  
ATOM 6318   N N3     . G A 1 196 ? 110.972 139.583 159.997 1.00 0.00 ? 196 G A N3     1  
ATOM 6319   C C4     . G A 1 196 ? 110.292 138.456 160.239 1.00 0.00 ? 196 G A C4     1  
ATOM 6320   H "H5'"  . G A 1 196 ? 104.799 137.608 161.749 1.00 0.00 ? 196 G A "H5'"  1  
ATOM 6321   H "H5''" . G A 1 196 ? 104.182 137.816 160.293 1.00 0.00 ? 196 G A "H5''" 1  
ATOM 6322   H "H4'"  . G A 1 196 ? 105.244 139.782 160.926 1.00 0.00 ? 196 G A "H4'"  1  
ATOM 6323   H "H3'"  . G A 1 196 ? 106.613 138.393 158.878 1.00 0.00 ? 196 G A "H3'"  1  
ATOM 6324   H "H2'"  . G A 1 196 ? 108.222 140.120 158.862 1.00 0.00 ? 196 G A "H2'"  1  
ATOM 6325   H "HO2'" . G A 1 196 ? 107.800 142.091 159.417 1.00 0.00 ? 196 G A "HO2'" 1  
ATOM 6326   H "H1'"  . G A 1 196 ? 108.554 140.175 161.386 1.00 0.00 ? 196 G A "H1'"  1  
ATOM 6327   H H8     . G A 1 196 ? 107.819 136.704 161.026 1.00 0.00 ? 196 G A H8     1  
ATOM 6328   H H1     . G A 1 196 ? 113.675 138.027 159.271 1.00 0.00 ? 196 G A H1     1  
ATOM 6329   H H21    . G A 1 196 ? 113.937 140.178 159.098 1.00 0.00 ? 196 G A H21    1  
ATOM 6330   H H22    . G A 1 196 ? 112.678 141.272 159.417 1.00 0.00 ? 196 G A H22    1  
ATOM 6331   P P      . G A 1 197 ? 105.538 139.888 156.899 1.00 0.00 ? 197 G A P      1  
ATOM 6332   O OP1    . G A 1 197 ? 104.488 140.760 156.349 1.00 0.00 ? 197 G A OP1    1  
ATOM 6333   O OP2    . G A 1 197 ? 105.618 138.464 156.464 1.00 0.00 ? 197 G A OP2    1  
ATOM 6334   O "O5'"  . G A 1 197 ? 106.902 140.674 156.698 1.00 0.00 ? 197 G A "O5'"  1  
ATOM 6335   C "C5'"  . G A 1 197 ? 107.630 140.601 155.481 1.00 0.00 ? 197 G A "C5'"  1  
ATOM 6336   C "C4'"  . G A 1 197 ? 108.985 141.233 155.661 1.00 0.00 ? 197 G A "C4'"  1  
ATOM 6337   O "O4'"  . G A 1 197 ? 109.646 140.621 156.789 1.00 0.00 ? 197 G A "O4'"  1  
ATOM 6338   C "C3'"  . G A 1 197 ? 109.905 140.967 154.512 1.00 0.00 ? 197 G A "C3'"  1  
ATOM 6339   O "O3'"  . G A 1 197 ? 109.658 141.983 153.588 1.00 0.00 ? 197 G A "O3'"  1  
ATOM 6340   C "C2'"  . G A 1 197 ? 111.273 141.086 155.164 1.00 0.00 ? 197 G A "C2'"  1  
ATOM 6341   O "O2'"  . G A 1 197 ? 111.673 142.418 155.412 1.00 0.00 ? 197 G A "O2'"  1  
ATOM 6342   C "C1'"  . G A 1 197 ? 111.001 140.402 156.492 1.00 0.00 ? 197 G A "C1'"  1  
ATOM 6343   N N9     . G A 1 197 ? 111.165 138.964 156.421 1.00 0.00 ? 197 G A N9     1  
ATOM 6344   C C8     . G A 1 197 ? 110.189 138.021 156.630 1.00 0.00 ? 197 G A C8     1  
ATOM 6345   N N7     . G A 1 197 ? 110.639 136.801 156.539 1.00 0.00 ? 197 G A N7     1  
ATOM 6346   C C5     . G A 1 197 ? 111.990 136.956 156.239 1.00 0.00 ? 197 G A C5     1  
ATOM 6347   C C6     . G A 1 197 ? 112.990 135.998 156.033 1.00 0.00 ? 197 G A C6     1  
ATOM 6348   O O6     . G A 1 197 ? 112.902 134.781 156.089 1.00 0.00 ? 197 G A O6     1  
ATOM 6349   N N1     . G A 1 197 ? 114.206 136.585 155.748 1.00 0.00 ? 197 G A N1     1  
ATOM 6350   C C2     . G A 1 197 ? 114.433 137.926 155.683 1.00 0.00 ? 197 G A C2     1  
ATOM 6351   N N2     . G A 1 197 ? 115.665 138.301 155.403 1.00 0.00 ? 197 G A N2     1  
ATOM 6352   N N3     . G A 1 197 ? 113.517 138.836 155.882 1.00 0.00 ? 197 G A N3     1  
ATOM 6353   C C4     . G A 1 197 ? 112.320 138.283 156.153 1.00 0.00 ? 197 G A C4     1  
ATOM 6354   H "H5'"  . G A 1 197 ? 107.133 141.069 154.781 1.00 0.00 ? 197 G A "H5'"  1  
ATOM 6355   H "H5''" . G A 1 197 ? 107.733 139.659 155.226 1.00 0.00 ? 197 G A "H5''" 1  
ATOM 6356   H "H4'"  . G A 1 197 ? 108.867 142.189 155.835 1.00 0.00 ? 197 G A "H4'"  1  
ATOM 6357   H "H3'"  . G A 1 197 ? 109.723 140.074 154.154 1.00 0.00 ? 197 G A "H3'"  1  
ATOM 6358   H "H2'"  . G A 1 197 ? 111.961 140.618 154.646 1.00 0.00 ? 197 G A "H2'"  1  
ATOM 6359   H "HO2'" . G A 1 197 ? 111.151 143.019 154.840 1.00 0.00 ? 197 G A "HO2'" 1  
ATOM 6360   H "H1'"  . G A 1 197 ? 111.605 140.761 157.175 1.00 0.00 ? 197 G A "H1'"  1  
ATOM 6361   H H8     . G A 1 197 ? 109.256 138.240 156.836 1.00 0.00 ? 197 G A H8     1  
ATOM 6362   H H1     . G A 1 197 ? 114.966 135.988 155.581 1.00 0.00 ? 197 G A H1     1  
ATOM 6363   H H21    . G A 1 197 ? 116.363 137.630 155.254 1.00 0.00 ? 197 G A H21    1  
ATOM 6364   H H22    . G A 1 197 ? 115.887 139.255 155.346 1.00 0.00 ? 197 G A H22    1  
ATOM 6365   P P      . A A 1 198 ? 109.013 141.595 152.179 1.00 0.00 ? 198 A A P      1  
ATOM 6366   O OP1    . A A 1 198 ? 108.298 142.809 151.709 1.00 0.00 ? 198 A A OP1    1  
ATOM 6367   O OP2    . A A 1 198 ? 108.255 140.339 152.408 1.00 0.00 ? 198 A A OP2    1  
ATOM 6368   O "O5'"  . A A 1 198 ? 110.186 141.282 151.149 1.00 0.00 ? 198 A A "O5'"  1  
ATOM 6369   C "C5'"  . A A 1 198 ? 110.955 142.329 150.578 1.00 0.00 ? 198 A A "C5'"  1  
ATOM 6370   C "C4'"  . A A 1 198 ? 112.374 141.890 150.312 1.00 0.00 ? 198 A A "C4'"  1  
ATOM 6371   O "O4'"  . A A 1 198 ? 112.959 141.350 151.523 1.00 0.00 ? 198 A A "O4'"  1  
ATOM 6372   C "C3'"  . A A 1 198 ? 112.547 140.779 149.288 1.00 0.00 ? 198 A A "C3'"  1  
ATOM 6373   O "O3'"  . A A 1 198 ? 112.522 141.249 147.950 1.00 0.00 ? 198 A A "O3'"  1  
ATOM 6374   C "C2'"  . A A 1 198 ? 113.875 140.158 149.692 1.00 0.00 ? 198 A A "C2'"  1  
ATOM 6375   O "O2'"  . A A 1 198 ? 114.971 140.944 149.244 1.00 0.00 ? 198 A A "O2'"  1  
ATOM 6376   C "C1'"  . A A 1 198 ? 113.799 140.240 151.220 1.00 0.00 ? 198 A A "C1'"  1  
ATOM 6377   N N9     . A A 1 198 ? 113.261 139.004 151.816 1.00 0.00 ? 198 A A N9     1  
ATOM 6378   C C8     . A A 1 198 ? 111.999 138.784 152.312 1.00 0.00 ? 198 A A C8     1  
ATOM 6379   N N7     . A A 1 198 ? 111.819 137.575 152.780 1.00 0.00 ? 198 A A N7     1  
ATOM 6380   C C5     . A A 1 198 ? 113.044 136.951 152.579 1.00 0.00 ? 198 A A C5     1  
ATOM 6381   C C6     . A A 1 198 ? 113.505 135.654 152.862 1.00 0.00 ? 198 A A C6     1  
ATOM 6382   N N6     . A A 1 198 ? 112.753 134.711 153.431 1.00 0.00 ? 198 A A N6     1  
ATOM 6383   N N1     . A A 1 198 ? 114.780 135.357 152.534 1.00 0.00 ? 198 A A N1     1  
ATOM 6384   C C2     . A A 1 198 ? 115.535 136.304 151.963 1.00 0.00 ? 198 A A C2     1  
ATOM 6385   N N3     . A A 1 198 ? 115.214 137.556 151.646 1.00 0.00 ? 198 A A N3     1  
ATOM 6386   C C4     . A A 1 198 ? 113.940 137.821 151.985 1.00 0.00 ? 198 A A C4     1  
ATOM 6387   H "H5'"  . A A 1 198 ? 110.967 143.089 151.198 1.00 0.00 ? 198 A A "H5'"  1  
ATOM 6388   H "H5''" . A A 1 198 ? 110.542 142.608 149.736 1.00 0.00 ? 198 A A "H5''" 1  
ATOM 6389   H "H4'"  . A A 1 198 ? 112.897 142.668 150.026 1.00 0.00 ? 198 A A "H4'"  1  
ATOM 6390   H "H3'"  . A A 1 198 ? 111.833 140.116 149.409 1.00 0.00 ? 198 A A "H3'"  1  
ATOM 6391   H "H2'"  . A A 1 198 ? 113.946 139.229 149.387 1.00 0.00 ? 198 A A "H2'"  1  
ATOM 6392   H "HO2'" . A A 1 198 ? 114.670 141.527 148.516 1.00 0.00 ? 198 A A "HO2'" 1  
ATOM 6393   H "H1'"  . A A 1 198 ? 114.692 140.416 151.580 1.00 0.00 ? 198 A A "H1'"  1  
ATOM 6394   H H8     . A A 1 198 ? 111.300 139.470 152.315 1.00 0.00 ? 198 A A H8     1  
ATOM 6395   H H61    . A A 1 198 ? 113.131 133.823 153.604 1.00 0.00 ? 198 A A H61    1  
ATOM 6396   H H62    . A A 1 198 ? 111.825 134.904 153.678 1.00 0.00 ? 198 A A H62    1  
ATOM 6397   H H2     . A A 1 198 ? 116.451 136.035 151.744 1.00 0.00 ? 198 A A H2     1  
ATOM 6398   P P      . U A 1 199 ? 111.899 140.332 146.785 1.00 0.00 ? 199 U A P      1  
ATOM 6399   O OP1    . U A 1 199 ? 111.898 141.125 145.529 1.00 0.00 ? 199 U A OP1    1  
ATOM 6400   O OP2    . U A 1 199 ? 110.625 139.754 147.288 1.00 0.00 ? 199 U A OP2    1  
ATOM 6401   O "O5'"  . U A 1 199 ? 112.949 139.147 146.621 1.00 0.00 ? 199 U A "O5'"  1  
ATOM 6402   C "C5'"  . U A 1 199 ? 114.273 139.403 146.176 1.00 0.00 ? 199 U A "C5'"  1  
ATOM 6403   C "C4'"  . U A 1 199 ? 115.166 138.201 146.367 1.00 0.00 ? 199 U A "C4'"  1  
ATOM 6404   O "O4'"  . U A 1 199 ? 115.238 137.860 147.776 1.00 0.00 ? 199 U A "O4'"  1  
ATOM 6405   C "C3'"  . U A 1 199 ? 114.714 136.914 145.698 1.00 0.00 ? 199 U A "C3'"  1  
ATOM 6406   O "O3'"  . U A 1 199 ? 115.074 136.845 144.329 1.00 0.00 ? 199 U A "O3'"  1  
ATOM 6407   C "C2'"  . U A 1 199 ? 115.369 135.843 146.557 1.00 0.00 ? 199 U A "C2'"  1  
ATOM 6408   O "O2'"  . U A 1 199 ? 116.746 135.694 146.236 1.00 0.00 ? 199 U A "O2'"  1  
ATOM 6409   C "C1'"  . U A 1 199 ? 115.248 136.456 147.953 1.00 0.00 ? 199 U A "C1'"  1  
ATOM 6410   N N1     . U A 1 199 ? 114.023 136.009 148.659 1.00 0.00 ? 199 U A N1     1  
ATOM 6411   C C2     . U A 1 199 ? 114.039 134.741 149.210 1.00 0.00 ? 199 U A C2     1  
ATOM 6412   O O2     . U A 1 199 ? 115.001 133.997 149.138 1.00 0.00 ? 199 U A O2     1  
ATOM 6413   N N3     . U A 1 199 ? 112.885 134.371 149.853 1.00 0.00 ? 199 U A N3     1  
ATOM 6414   C C4     . U A 1 199 ? 111.737 135.121 150.001 1.00 0.00 ? 199 U A C4     1  
ATOM 6415   O O4     . U A 1 199 ? 110.777 134.645 150.608 1.00 0.00 ? 199 U A O4     1  
ATOM 6416   C C5     . U A 1 199 ? 111.792 136.423 149.407 1.00 0.00 ? 199 U A C5     1  
ATOM 6417   C C6     . U A 1 199 ? 112.904 136.809 148.775 1.00 0.00 ? 199 U A C6     1  
ATOM 6418   H "H5'"  . U A 1 199 ? 114.640 140.159 146.678 1.00 0.00 ? 199 U A "H5'"  1  
ATOM 6419   H "H5''" . U A 1 199 ? 114.248 139.632 145.221 1.00 0.00 ? 199 U A "H5''" 1  
ATOM 6420   H "H4'"  . U A 1 199 ? 116.065 138.426 146.047 1.00 0.00 ? 199 U A "H4'"  1  
ATOM 6421   H "H3'"  . U A 1 199 ? 113.739 136.834 145.777 1.00 0.00 ? 199 U A "H3'"  1  
ATOM 6422   H "H2'"  . U A 1 199 ? 114.889 134.988 146.498 1.00 0.00 ? 199 U A "H2'"  1  
ATOM 6423   H "HO2'" . U A 1 199 ? 116.905 136.064 145.344 1.00 0.00 ? 199 U A "HO2'" 1  
ATOM 6424   H "H1'"  . U A 1 199 ? 116.035 136.213 148.485 1.00 0.00 ? 199 U A "H1'"  1  
ATOM 6425   H H3     . U A 1 199 ? 112.875 133.475 150.251 1.00 0.00 ? 199 U A H3     1  
ATOM 6426   H H5     . U A 1 199 ? 111.021 137.024 149.464 1.00 0.00 ? 199 U A H5     1  
ATOM 6427   H H6     . U A 1 199 ? 112.916 137.702 148.375 1.00 0.00 ? 199 U A H6     1  
ATOM 6428   P P      . G A 1 200 ? 113.951 136.986 143.189 1.00 0.00 ? 200 G A P      1  
ATOM 6429   O OP1    . G A 1 200 ? 114.346 136.128 142.043 1.00 0.00 ? 200 G A OP1    1  
ATOM 6430   O OP2    . G A 1 200 ? 113.698 138.433 142.969 1.00 0.00 ? 200 G A OP2    1  
ATOM 6431   O "O5'"  . G A 1 200 ? 112.647 136.353 143.851 1.00 0.00 ? 200 G A "O5'"  1  
ATOM 6432   C "C5'"  . G A 1 200 ? 111.463 137.121 144.008 1.00 0.00 ? 200 G A "C5'"  1  
ATOM 6433   C "C4'"  . G A 1 200 ? 110.233 136.322 143.655 1.00 0.00 ? 200 G A "C4'"  1  
ATOM 6434   O "O4'"  . G A 1 200 ? 110.292 135.991 142.242 1.00 0.00 ? 200 G A "O4'"  1  
ATOM 6435   C "C3'"  . G A 1 200 ? 110.086 134.979 144.355 1.00 0.00 ? 200 G A "C3'"  1  
ATOM 6436   O "O3'"  . G A 1 200 ? 109.454 135.081 145.620 1.00 0.00 ? 200 G A "O3'"  1  
ATOM 6437   C "C2'"  . G A 1 200 ? 109.262 134.168 143.366 1.00 0.00 ? 200 G A "C2'"  1  
ATOM 6438   O "O2'"  . G A 1 200 ? 107.883 134.496 143.454 1.00 0.00 ? 200 G A "O2'"  1  
ATOM 6439   C "C1'"  . G A 1 200 ? 109.807 134.671 142.034 1.00 0.00 ? 200 G A "C1'"  1  
ATOM 6440   N N9     . G A 1 200 ? 110.893 133.816 141.520 1.00 0.00 ? 200 G A N9     1  
ATOM 6441   C C8     . G A 1 200 ? 112.066 133.489 142.156 1.00 0.00 ? 200 G A C8     1  
ATOM 6442   N N7     . G A 1 200 ? 112.837 132.711 141.445 1.00 0.00 ? 200 G A N7     1  
ATOM 6443   C C5     . G A 1 200 ? 112.130 132.511 140.268 1.00 0.00 ? 200 G A C5     1  
ATOM 6444   C C6     . G A 1 200 ? 112.460 131.752 139.116 1.00 0.00 ? 200 G A C6     1  
ATOM 6445   O O6     . G A 1 200 ? 113.477 131.084 138.898 1.00 0.00 ? 200 G A O6     1  
ATOM 6446   N N1     . G A 1 200 ? 111.458 131.821 138.152 1.00 0.00 ? 200 G A N1     1  
ATOM 6447   C C2     . G A 1 200 ? 110.288 132.529 138.281 1.00 0.00 ? 200 G A C2     1  
ATOM 6448   N N2     . G A 1 200 ? 109.441 132.475 137.242 1.00 0.00 ? 200 G A N2     1  
ATOM 6449   N N3     . G A 1 200 ? 109.969 133.240 139.350 1.00 0.00 ? 200 G A N3     1  
ATOM 6450   C C4     . G A 1 200 ? 110.928 133.186 140.298 1.00 0.00 ? 200 G A C4     1  
ATOM 6451   H "H5'"  . G A 1 200 ? 111.512 137.907 143.426 1.00 0.00 ? 200 G A "H5'"  1  
ATOM 6452   H "H5''" . G A 1 200 ? 111.396 137.417 144.940 1.00 0.00 ? 200 G A "H5''" 1  
ATOM 6453   H "H4'"  . G A 1 200 ? 109.438 136.868 143.832 1.00 0.00 ? 200 G A "H4'"  1  
ATOM 6454   H "H3'"  . G A 1 200 ? 110.969 134.566 144.447 1.00 0.00 ? 200 G A "H3'"  1  
ATOM 6455   H "H2'"  . G A 1 200 ? 109.414 133.206 143.476 1.00 0.00 ? 200 G A "H2'"  1  
ATOM 6456   H "HO2'" . G A 1 200 ? 107.694 134.844 144.351 1.00 0.00 ? 200 G A "HO2'" 1  
ATOM 6457   H "H1'"  . G A 1 200 ? 109.081 134.707 141.377 1.00 0.00 ? 200 G A "H1'"  1  
ATOM 6458   H H8     . G A 1 200 ? 112.302 133.808 143.052 1.00 0.00 ? 200 G A H8     1  
ATOM 6459   H H1     . G A 1 200 ? 111.600 131.326 137.318 1.00 0.00 ? 200 G A H1     1  
ATOM 6460   H H21    . G A 1 200 ? 109.671 131.950 136.447 1.00 0.00 ? 200 G A H21    1  
ATOM 6461   H H22    . G A 1 200 ? 108.590 132.960 137.277 1.00 0.00 ? 200 G A H22    1  
ATOM 6462   P P      . C A 1 201 ? 109.489 133.841 146.642 1.00 0.00 ? 201 C A P      1  
ATOM 6463   O OP1    . C A 1 201 ? 108.405 134.036 147.638 1.00 0.00 ? 201 C A OP1    1  
ATOM 6464   O OP2    . C A 1 201 ? 110.888 133.665 147.106 1.00 0.00 ? 201 C A OP2    1  
ATOM 6465   O "O5'"  . C A 1 201 ? 109.107 132.586 145.739 1.00 0.00 ? 201 C A "O5'"  1  
ATOM 6466   C "C5'"  . C A 1 201 ? 108.883 131.310 146.320 1.00 0.00 ? 201 C A "C5'"  1  
ATOM 6467   C "C4'"  . C A 1 201 ? 109.817 130.268 145.754 1.00 0.00 ? 201 C A "C4'"  1  
ATOM 6468   O "O4'"  . C A 1 201 ? 109.267 129.739 144.511 1.00 0.00 ? 201 C A "O4'"  1  
ATOM 6469   C "C3'"  . C A 1 201 ? 111.230 130.734 145.441 1.00 0.00 ? 201 C A "C3'"  1  
ATOM 6470   O "O3'"  . C A 1 201 ? 112.216 129.775 145.783 1.00 0.00 ? 201 C A "O3'"  1  
ATOM 6471   C "C2'"  . C A 1 201 ? 111.222 130.810 143.917 1.00 0.00 ? 201 C A "C2'"  1  
ATOM 6472   O "O2'"  . C A 1 201 ? 112.515 130.569 143.383 1.00 0.00 ? 201 C A "O2'"  1  
ATOM 6473   C "C1'"  . C A 1 201 ? 110.309 129.638 143.582 1.00 0.00 ? 201 C A "C1'"  1  
ATOM 6474   N N1     . C A 1 201 ? 109.722 129.752 142.223 1.00 0.00 ? 201 C A N1     1  
ATOM 6475   C C2     . C A 1 201 ? 110.091 128.805 141.259 1.00 0.00 ? 201 C A C2     1  
ATOM 6476   O O2     . C A 1 201 ? 110.891 127.908 141.565 1.00 0.00 ? 201 C A O2     1  
ATOM 6477   N N3     . C A 1 201 ? 109.570 128.886 140.013 1.00 0.00 ? 201 C A N3     1  
ATOM 6478   C C4     . C A 1 201 ? 108.713 129.860 139.709 1.00 0.00 ? 201 C A C4     1  
ATOM 6479   N N4     . C A 1 201 ? 108.225 129.900 138.467 1.00 0.00 ? 201 C A N4     1  
ATOM 6480   C C5     . C A 1 201 ? 108.319 130.837 140.666 1.00 0.00 ? 201 C A C5     1  
ATOM 6481   C C6     . C A 1 201 ? 108.839 130.747 141.896 1.00 0.00 ? 201 C A C6     1  
ATOM 6482   H "H5'"  . C A 1 201 ? 107.958 131.038 146.147 1.00 0.00 ? 201 C A "H5'"  1  
ATOM 6483   H "H5''" . C A 1 201 ? 109.023 131.371 147.288 1.00 0.00 ? 201 C A "H5''" 1  
ATOM 6484   H "H4'"  . C A 1 201 ? 109.902 129.537 146.400 1.00 0.00 ? 201 C A "H4'"  1  
ATOM 6485   H "H3'"  . C A 1 201 ? 111.363 131.633 145.807 1.00 0.00 ? 201 C A "H3'"  1  
ATOM 6486   H "H2'"  . C A 1 201 ? 110.853 131.662 143.604 1.00 0.00 ? 201 C A "H2'"  1  
ATOM 6487   H "HO2'" . C A 1 201 ? 112.670 131.179 142.633 1.00 0.00 ? 201 C A "HO2'" 1  
ATOM 6488   H "H1'"  . C A 1 201 ? 110.818 128.804 143.649 1.00 0.00 ? 201 C A "H1'"  1  
ATOM 6489   H H41    . C A 1 201 ? 108.499 129.226 137.810 1.00 0.00 ? 201 C A H41    1  
ATOM 6490   H H42    . C A 1 201 ? 107.593 130.604 138.212 1.00 0.00 ? 201 C A H42    1  
ATOM 6491   H H5     . C A 1 201 ? 107.687 131.550 140.433 1.00 0.00 ? 201 C A H5     1  
ATOM 6492   H H6     . C A 1 201 ? 108.581 131.410 142.568 1.00 0.00 ? 201 C A H6     1  
ATOM 6493   P P      . A A 1 202 ? 113.508 130.228 146.613 1.00 0.00 ? 202 A A P      1  
ATOM 6494   O OP1    . A A 1 202 ? 114.657 129.370 146.230 1.00 0.00 ? 202 A A OP1    1  
ATOM 6495   O OP2    . A A 1 202 ? 113.015 130.213 148.014 1.00 0.00 ? 202 A A OP2    1  
ATOM 6496   O "O5'"  . A A 1 202 ? 113.869 131.733 146.235 1.00 0.00 ? 202 A A "O5'"  1  
ATOM 6497   C "C5'"  . A A 1 202 ? 115.160 132.074 145.753 1.00 0.00 ? 202 A A "C5'"  1  
ATOM 6498   C "C4'"  . A A 1 202 ? 116.034 130.855 145.600 1.00 0.00 ? 202 A A "C4'"  1  
ATOM 6499   O "O4'"  . A A 1 202 ? 116.009 130.063 146.820 1.00 0.00 ? 202 A A "O4'"  1  
ATOM 6500   C "C3'"  . A A 1 202 ? 115.624 129.871 144.514 1.00 0.00 ? 202 A A "C3'"  1  
ATOM 6501   O "O3'"  . A A 1 202 ? 115.926 130.329 143.207 1.00 0.00 ? 202 A A "O3'"  1  
ATOM 6502   C "C2'"  . A A 1 202 ? 116.389 128.621 144.908 1.00 0.00 ? 202 A A "C2'"  1  
ATOM 6503   O "O2'"  . A A 1 202 ? 117.734 128.675 144.454 1.00 0.00 ? 202 A A "O2'"  1  
ATOM 6504   C "C1'"  . A A 1 202 ? 116.371 128.733 146.428 1.00 0.00 ? 202 A A "C1'"  1  
ATOM 6505   N N9     . A A 1 202 ? 115.538 127.687 147.052 1.00 0.00 ? 202 A A N9     1  
ATOM 6506   C C8     . A A 1 202 ? 114.322 127.834 147.672 1.00 0.00 ? 202 A A C8     1  
ATOM 6507   N N7     . A A 1 202 ? 113.824 126.713 148.132 1.00 0.00 ? 202 A A N7     1  
ATOM 6508   C C5     . A A 1 202 ? 114.777 125.762 147.793 1.00 0.00 ? 202 A A C5     1  
ATOM 6509   C C6     . A A 1 202 ? 114.844 124.373 148.002 1.00 0.00 ? 202 A A C6     1  
ATOM 6510   N N6     . A A 1 202 ? 113.896 123.671 148.627 1.00 0.00 ? 202 A A N6     1  
ATOM 6511   N N1     . A A 1 202 ? 115.931 123.720 147.538 1.00 0.00 ? 202 A A N1     1  
ATOM 6512   C C2     . A A 1 202 ? 116.883 124.423 146.910 1.00 0.00 ? 202 A A C2     1  
ATOM 6513   N N3     . A A 1 202 ? 116.933 125.729 146.655 1.00 0.00 ? 202 A A N3     1  
ATOM 6514   C C4     . A A 1 202 ? 115.837 126.348 147.128 1.00 0.00 ? 202 A A C4     1  
ATOM 6515   H "H5'"  . A A 1 202 ? 115.584 132.694 146.383 1.00 0.00 ? 202 A A "H5'"  1  
ATOM 6516   H "H5''" . A A 1 202 ? 115.071 132.515 144.883 1.00 0.00 ? 202 A A "H5''" 1  
ATOM 6517   H "H4'"  . A A 1 202 ? 116.953 131.149 145.429 1.00 0.00 ? 202 A A "H4'"  1  
ATOM 6518   H "H3'"  . A A 1 202 ? 114.662 129.693 144.577 1.00 0.00 ? 202 A A "H3'"  1  
ATOM 6519   H "H2'"  . A A 1 202 ? 115.934 127.809 144.600 1.00 0.00 ? 202 A A "H2'"  1  
ATOM 6520   H "HO2'" . A A 1 202 ? 118.191 127.848 144.712 1.00 0.00 ? 202 A A "HO2'" 1  
ATOM 6521   H "H1'"  . A A 1 202 ? 117.287 128.669 146.771 1.00 0.00 ? 202 A A "H1'"  1  
ATOM 6522   H H8     . A A 1 202 ? 113.868 128.699 147.762 1.00 0.00 ? 202 A A H8     1  
ATOM 6523   H H61    . A A 1 202 ? 113.998 122.703 148.742 1.00 0.00 ? 202 A A H61    1  
ATOM 6524   H H62    . A A 1 202 ? 113.098 124.124 148.971 1.00 0.00 ? 202 A A H62    1  
ATOM 6525   H H2     . A A 1 202 ? 117.651 123.903 146.594 1.00 0.00 ? 202 A A H2     1  
ATOM 6526   P P      . U A 1 203 ? 115.467 129.476 141.926 1.00 0.00 ? 203 U A P      1  
ATOM 6527   O OP1    . U A 1 203 ? 115.683 130.310 140.716 1.00 0.00 ? 203 U A OP1    1  
ATOM 6528   O OP2    . U A 1 203 ? 114.118 128.921 142.203 1.00 0.00 ? 203 U A OP2    1  
ATOM 6529   O "O5'"  . U A 1 203 ? 116.500 128.264 141.880 1.00 0.00 ? 203 U A "O5'"  1  
ATOM 6530   C "C5'"  . U A 1 203 ? 116.143 127.023 141.290 1.00 0.00 ? 203 U A "C5'"  1  
ATOM 6531   C "C4'"  . U A 1 203 ? 116.993 125.892 141.813 1.00 0.00 ? 203 U A "C4'"  1  
ATOM 6532   O "O4'"  . U A 1 203 ? 116.625 125.593 143.184 1.00 0.00 ? 203 U A "O4'"  1  
ATOM 6533   C "C3'"  . U A 1 203 ? 116.845 124.557 141.101 1.00 0.00 ? 203 U A "C3'"  1  
ATOM 6534   O "O3'"  . U A 1 203 ? 117.585 124.486 139.896 1.00 0.00 ? 203 U A "O3'"  1  
ATOM 6535   C "C2'"  . U A 1 203 ? 117.364 123.594 142.159 1.00 0.00 ? 203 U A "C2'"  1  
ATOM 6536   O "O2'"  . U A 1 203 ? 118.784 123.594 142.203 1.00 0.00 ? 203 U A "O2'"  1  
ATOM 6537   C "C1'"  . U A 1 203 ? 116.830 124.229 143.439 1.00 0.00 ? 203 U A "C1'"  1  
ATOM 6538   N N1     . U A 1 203 ? 115.541 123.632 143.867 1.00 0.00 ? 203 U A N1     1  
ATOM 6539   C C2     . U A 1 203 ? 115.576 122.339 144.355 1.00 0.00 ? 203 U A C2     1  
ATOM 6540   O O2     . U A 1 203 ? 116.602 121.688 144.443 1.00 0.00 ? 203 U A O2     1  
ATOM 6541   N N3     . U A 1 203 ? 114.360 121.829 144.739 1.00 0.00 ? 203 U A N3     1  
ATOM 6542   C C4     . U A 1 203 ? 113.138 122.464 144.688 1.00 0.00 ? 203 U A C4     1  
ATOM 6543   O O4     . U A 1 203 ? 112.130 121.868 145.072 1.00 0.00 ? 203 U A O4     1  
ATOM 6544   C C5     . U A 1 203 ? 113.178 123.799 144.174 1.00 0.00 ? 203 U A C5     1  
ATOM 6545   C C6     . U A 1 203 ? 114.349 124.321 143.793 1.00 0.00 ? 203 U A C6     1  
ATOM 6546   H "H5'"  . U A 1 203 ? 116.258 127.086 140.319 1.00 0.00 ? 203 U A "H5'"  1  
ATOM 6547   H "H5''" . U A 1 203 ? 115.202 126.833 141.488 1.00 0.00 ? 203 U A "H5''" 1  
ATOM 6548   H "H4'"  . U A 1 203 ? 117.935 126.161 141.788 1.00 0.00 ? 203 U A "H4'"  1  
ATOM 6549   H "H3'"  . U A 1 203 ? 115.904 124.361 140.912 1.00 0.00 ? 203 U A "H3'"  1  
ATOM 6550   H "H2'"  . U A 1 203 ? 117.005 122.692 142.031 1.00 0.00 ? 203 U A "H2'"  1  
ATOM 6551   H "HO2'" . U A 1 203 ? 119.129 123.947 141.356 1.00 0.00 ? 203 U A "HO2'" 1  
ATOM 6552   H "H1'"  . U A 1 203 ? 117.492 124.119 144.154 1.00 0.00 ? 203 U A "H1'"  1  
ATOM 6553   H H3     . U A 1 203 ? 114.362 120.913 145.087 1.00 0.00 ? 203 U A H3     1  
ATOM 6554   H H5     . U A 1 203 ? 112.355 124.325 144.102 1.00 0.00 ? 203 U A H5     1  
ATOM 6555   H H6     . U A 1 203 ? 114.350 125.235 143.443 1.00 0.00 ? 203 U A H6     1  
ATOM 6556   P P      . U A 1 204 ? 117.074 123.561 138.685 1.00 0.00 ? 204 U A P      1  
ATOM 6557   O OP1    . U A 1 204 ? 118.258 123.153 137.886 1.00 0.00 ? 204 U A OP1    1  
ATOM 6558   O OP2    . U A 1 204 ? 115.945 124.258 138.020 1.00 0.00 ? 204 U A OP2    1  
ATOM 6559   O "O5'"  . U A 1 204 ? 116.497 122.264 139.408 1.00 0.00 ? 204 U A "O5'"  1  
ATOM 6560   C "C5'"  . U A 1 204 ? 117.336 121.157 139.700 1.00 0.00 ? 204 U A "C5'"  1  
ATOM 6561   C "C4'"  . U A 1 204 ? 116.538 119.955 140.143 1.00 0.00 ? 204 U A "C4'"  1  
ATOM 6562   O "O4'"  . U A 1 204 ? 115.785 120.352 141.308 1.00 0.00 ? 204 U A "O4'"  1  
ATOM 6563   C "C3'"  . U A 1 204 ? 115.500 119.441 139.158 1.00 0.00 ? 204 U A "C3'"  1  
ATOM 6564   O "O3'"  . U A 1 204 ? 116.031 118.520 138.222 1.00 0.00 ? 204 U A "O3'"  1  
ATOM 6565   C "C2'"  . U A 1 204 ? 114.324 118.980 140.036 1.00 0.00 ? 204 U A "C2'"  1  
ATOM 6566   O "O2'"  . U A 1 204 ? 114.469 117.619 140.417 1.00 0.00 ? 204 U A "O2'"  1  
ATOM 6567   C "C1'"  . U A 1 204 ? 114.455 119.842 141.300 1.00 0.00 ? 204 U A "C1'"  1  
ATOM 6568   N N1     . U A 1 204 ? 113.512 120.986 141.301 1.00 0.00 ? 204 U A N1     1  
ATOM 6569   C C2     . U A 1 204 ? 112.260 120.771 141.846 1.00 0.00 ? 204 U A C2     1  
ATOM 6570   O O2     . U A 1 204 ? 111.912 119.701 142.313 1.00 0.00 ? 204 U A O2     1  
ATOM 6571   N N3     . U A 1 204 ? 111.421 121.858 141.826 1.00 0.00 ? 204 U A N3     1  
ATOM 6572   C C4     . U A 1 204 ? 111.698 123.113 141.327 1.00 0.00 ? 204 U A C4     1  
ATOM 6573   O O4     . U A 1 204 ? 110.834 123.990 141.382 1.00 0.00 ? 204 U A O4     1  
ATOM 6574   C C5     . U A 1 204 ? 113.012 123.263 140.780 1.00 0.00 ? 204 U A C5     1  
ATOM 6575   C C6     . U A 1 204 ? 113.850 122.221 140.788 1.00 0.00 ? 204 U A C6     1  
ATOM 6576   H "H5'"  . U A 1 204 ? 117.958 121.408 140.415 1.00 0.00 ? 204 U A "H5'"  1  
ATOM 6577   H "H5''" . U A 1 204 ? 117.848 120.923 138.898 1.00 0.00 ? 204 U A "H5''" 1  
ATOM 6578   H "H4'"  . U A 1 204 ? 117.129 119.216 140.394 1.00 0.00 ? 204 U A "H4'"  1  
ATOM 6579   H "H3'"  . U A 1 204 ? 115.198 120.243 138.684 1.00 0.00 ? 204 U A "H3'"  1  
ATOM 6580   H "H2'"  . U A 1 204 ? 113.463 119.144 139.599 1.00 0.00 ? 204 U A "H2'"  1  
ATOM 6581   H "HO2'" . U A 1 204 ? 113.597 117.175 140.351 1.00 0.00 ? 204 U A "HO2'" 1  
ATOM 6582   H "H1'"  . U A 1 204 ? 114.290 119.284 142.090 1.00 0.00 ? 204 U A "H1'"  1  
ATOM 6583   H H3     . U A 1 204 ? 110.528 121.727 142.206 1.00 0.00 ? 204 U A H3     1  
ATOM 6584   H H5     . U A 1 204 ? 113.295 124.123 140.404 1.00 0.00 ? 204 U A H5     1  
ATOM 6585   H H6     . U A 1 204 ? 114.743 122.348 140.407 1.00 0.00 ? 204 U A H6     1  
ATOM 6586   P P      . U A 1 205 ? 116.658 117.128 138.723 1.00 0.00 ? 205 U A P      1  
ATOM 6587   O OP1    . U A 1 205 ? 116.161 116.051 137.829 1.00 0.00 ? 205 U A OP1    1  
ATOM 6588   O OP2    . U A 1 205 ? 116.438 117.026 140.188 1.00 0.00 ? 205 U A OP2    1  
ATOM 6589   O "O5'"  . U A 1 205 ? 118.222 117.296 138.470 1.00 0.00 ? 205 U A "O5'"  1  
ATOM 6590   C "C5'"  . U A 1 205 ? 119.044 116.169 138.206 1.00 0.00 ? 205 U A "C5'"  1  
ATOM 6591   C "C4'"  . U A 1 205 ? 120.299 116.188 139.042 1.00 0.00 ? 205 U A "C4'"  1  
ATOM 6592   O "O4'"  . U A 1 205 ? 119.928 116.325 140.441 1.00 0.00 ? 205 U A "O4'"  1  
ATOM 6593   C "C3'"  . U A 1 205 ? 121.181 114.951 138.956 1.00 0.00 ? 205 U A "C3'"  1  
ATOM 6594   O "O3'"  . U A 1 205 ? 122.191 115.058 137.969 1.00 0.00 ? 205 U A "O3'"  1  
ATOM 6595   C "C2'"  . U A 1 205 ? 121.834 114.886 140.328 1.00 0.00 ? 205 U A "C2'"  1  
ATOM 6596   O "O2'"  . U A 1 205 ? 122.960 115.749 140.403 1.00 0.00 ? 205 U A "O2'"  1  
ATOM 6597   C "C1'"  . U A 1 205 ? 120.732 115.438 141.235 1.00 0.00 ? 205 U A "C1'"  1  
ATOM 6598   N N1     . U A 1 205 ? 119.870 114.365 141.788 1.00 0.00 ? 205 U A N1     1  
ATOM 6599   C C2     . U A 1 205 ? 120.401 113.590 142.803 1.00 0.00 ? 205 U A C2     1  
ATOM 6600   O O2     . U A 1 205 ? 121.524 113.753 143.247 1.00 0.00 ? 205 U A O2     1  
ATOM 6601   N N3     . U A 1 205 ? 119.567 112.611 143.285 1.00 0.00 ? 205 U A N3     1  
ATOM 6602   C C4     . U A 1 205 ? 118.284 112.331 142.866 1.00 0.00 ? 205 U A C4     1  
ATOM 6603   O O4     . U A 1 205 ? 117.660 111.413 143.400 1.00 0.00 ? 205 U A O4     1  
ATOM 6604   C C5     . U A 1 205 ? 117.801 113.173 141.814 1.00 0.00 ? 205 U A C5     1  
ATOM 6605   C C6     . U A 1 205 ? 118.592 114.135 141.327 1.00 0.00 ? 205 U A C6     1  
ATOM 6606   H "H5'"  . U A 1 205 ? 119.292 116.170 137.258 1.00 0.00 ? 205 U A "H5'"  1  
ATOM 6607   H "H5''" . U A 1 205 ? 118.541 115.353 138.404 1.00 0.00 ? 205 U A "H5''" 1  
ATOM 6608   H "H4'"  . U A 1 205 ? 120.831 116.972 138.795 1.00 0.00 ? 205 U A "H4'"  1  
ATOM 6609   H "H3'"  . U A 1 205 ? 120.642 114.152 138.779 1.00 0.00 ? 205 U A "H3'"  1  
ATOM 6610   H "H2'"  . U A 1 205 ? 122.067 113.966 140.572 1.00 0.00 ? 205 U A "H2'"  1  
ATOM 6611   H "HO2'" . U A 1 205 ? 123.270 115.949 139.494 1.00 0.00 ? 205 U A "HO2'" 1  
ATOM 6612   H "H1'"  . U A 1 205 ? 121.141 115.938 141.972 1.00 0.00 ? 205 U A "H1'"  1  
ATOM 6613   H H3     . U A 1 205 ? 119.924 112.050 144.004 1.00 0.00 ? 205 U A H3     1  
ATOM 6614   H H5     . U A 1 205 ? 116.898 113.045 141.455 1.00 0.00 ? 205 U A H5     1  
ATOM 6615   H H6     . U A 1 205 ? 118.238 114.697 140.607 1.00 0.00 ? 205 U A H6     1  
ATOM 6616   P P      . C A 1 206 ? 122.657 113.761 137.144 1.00 0.00 ? 206 C A P      1  
ATOM 6617   O OP1    . C A 1 206 ? 123.620 114.200 136.102 1.00 0.00 ? 206 C A OP1    1  
ATOM 6618   O OP2    . C A 1 206 ? 121.443 113.005 136.748 1.00 0.00 ? 206 C A OP2    1  
ATOM 6619   O "O5'"  . C A 1 206 ? 123.455 112.890 138.214 1.00 0.00 ? 206 C A "O5'"  1  
ATOM 6620   C "C5'"  . C A 1 206 ? 124.691 113.341 138.746 1.00 0.00 ? 206 C A "C5'"  1  
ATOM 6621   C "C4'"  . C A 1 206 ? 125.262 112.357 139.739 1.00 0.00 ? 206 C A "C4'"  1  
ATOM 6622   O "O4'"  . C A 1 206 ? 124.349 112.165 140.846 1.00 0.00 ? 206 C A "O4'"  1  
ATOM 6623   C "C3'"  . C A 1 206 ? 125.503 110.947 139.222 1.00 0.00 ? 206 C A "C3'"  1  
ATOM 6624   O "O3'"  . C A 1 206 ? 126.696 110.832 138.467 1.00 0.00 ? 206 C A "O3'"  1  
ATOM 6625   C "C2'"  . C A 1 206 ? 125.526 110.124 140.501 1.00 0.00 ? 206 C A "C2'"  1  
ATOM 6626   O "O2'"  . C A 1 206 ? 126.801 110.178 141.124 1.00 0.00 ? 206 C A "O2'"  1  
ATOM 6627   C "C1'"  . C A 1 206 ? 124.517 110.871 141.377 1.00 0.00 ? 206 C A "C1'"  1  
ATOM 6628   N N1     . C A 1 206 ? 123.190 110.207 141.398 1.00 0.00 ? 206 C A N1     1  
ATOM 6629   C C2     . C A 1 206 ? 123.070 108.984 142.069 1.00 0.00 ? 206 C A C2     1  
ATOM 6630   O O2     . C A 1 206 ? 124.068 108.494 142.620 1.00 0.00 ? 206 C A O2     1  
ATOM 6631   N N3     . C A 1 206 ? 121.871 108.358 142.104 1.00 0.00 ? 206 C A N3     1  
ATOM 6632   C C4     . C A 1 206 ? 120.814 108.905 141.504 1.00 0.00 ? 206 C A C4     1  
ATOM 6633   N N4     . C A 1 206 ? 119.651 108.252 141.565 1.00 0.00 ? 206 C A N4     1  
ATOM 6634   C C5     . C A 1 206 ? 120.903 110.147 140.814 1.00 0.00 ? 206 C A C5     1  
ATOM 6635   C C6     . C A 1 206 ? 122.094 110.757 140.787 1.00 0.00 ? 206 C A C6     1  
ATOM 6636   H "H5'"  . C A 1 206 ? 124.550 114.201 139.194 1.00 0.00 ? 206 C A "H5'"  1  
ATOM 6637   H "H5''" . C A 1 206 ? 125.329 113.461 138.013 1.00 0.00 ? 206 C A "H5''" 1  
ATOM 6638   H "H4'"  . C A 1 206 ? 126.106 112.718 140.081 1.00 0.00 ? 206 C A "H4'"  1  
ATOM 6639   H "H3'"  . C A 1 206 ? 124.744 110.667 138.669 1.00 0.00 ? 206 C A "H3'"  1  
ATOM 6640   H "H2'"  . C A 1 206 ? 125.241 109.201 140.338 1.00 0.00 ? 206 C A "H2'"  1  
ATOM 6641   H "HO2'" . C A 1 206 ? 127.470 110.449 140.462 1.00 0.00 ? 206 C A "HO2'" 1  
ATOM 6642   H "H1'"  . C A 1 206 ? 124.867 110.932 142.290 1.00 0.00 ? 206 C A "H1'"  1  
ATOM 6643   H H41    . C A 1 206 ? 119.594 107.396 142.040 1.00 0.00 ? 206 C A H41    1  
ATOM 6644   H H42    . C A 1 206 ? 118.856 108.627 141.134 1.00 0.00 ? 206 C A H42    1  
ATOM 6645   H H5     . C A 1 206 ? 120.120 110.541 140.376 1.00 0.00 ? 206 C A H5     1  
ATOM 6646   H H6     . C A 1 206 ? 122.176 111.612 140.317 1.00 0.00 ? 206 C A H6     1  
ATOM 6647   P P      . G A 1 207 ? 126.656 110.222 136.980 1.00 0.00 ? 207 G A P      1  
ATOM 6648   O OP1    . G A 1 207 ? 127.776 110.818 136.207 1.00 0.00 ? 207 G A OP1    1  
ATOM 6649   O OP2    . G A 1 207 ? 125.266 110.344 136.471 1.00 0.00 ? 207 G A OP2    1  
ATOM 6650   O "O5'"  . G A 1 207 ? 126.970 108.675 137.189 1.00 0.00 ? 207 G A "O5'"  1  
ATOM 6651   C "C5'"  . G A 1 207 ? 128.173 108.252 137.814 1.00 0.00 ? 207 G A "C5'"  1  
ATOM 6652   C "C4'"  . G A 1 207 ? 128.032 106.874 138.411 1.00 0.00 ? 207 G A "C4'"  1  
ATOM 6653   O "O4'"  . G A 1 207 ? 126.880 106.836 139.294 1.00 0.00 ? 207 G A "O4'"  1  
ATOM 6654   C "C3'"  . G A 1 207 ? 127.780 105.742 137.426 1.00 0.00 ? 207 G A "C3'"  1  
ATOM 6655   O "O3'"  . G A 1 207 ? 128.964 105.287 136.793 1.00 0.00 ? 207 G A "O3'"  1  
ATOM 6656   C "C2'"  . G A 1 207 ? 127.109 104.687 138.294 1.00 0.00 ? 207 G A "C2'"  1  
ATOM 6657   O "O2'"  . G A 1 207 ? 128.059 103.989 139.085 1.00 0.00 ? 207 G A "O2'"  1  
ATOM 6658   C "C1'"  . G A 1 207 ? 126.241 105.555 139.208 1.00 0.00 ? 207 G A "C1'"  1  
ATOM 6659   N N9     . G A 1 207 ? 124.863 105.695 138.698 1.00 0.00 ? 207 G A N9     1  
ATOM 6660   C C8     . G A 1 207 ? 124.296 106.806 138.122 1.00 0.00 ? 207 G A C8     1  
ATOM 6661   N N7     . G A 1 207 ? 123.053 106.626 137.771 1.00 0.00 ? 207 G A N7     1  
ATOM 6662   C C5     . G A 1 207 ? 122.780 105.315 138.136 1.00 0.00 ? 207 G A C5     1  
ATOM 6663   C C6     . G A 1 207 ? 121.591 104.551 138.004 1.00 0.00 ? 207 G A C6     1  
ATOM 6664   O O6     . G A 1 207 ? 120.507 104.894 137.521 1.00 0.00 ? 207 G A O6     1  
ATOM 6665   N N1     . G A 1 207 ? 121.751 103.262 138.505 1.00 0.00 ? 207 G A N1     1  
ATOM 6666   C C2     . G A 1 207 ? 122.905 102.771 139.063 1.00 0.00 ? 207 G A C2     1  
ATOM 6667   N N2     . G A 1 207 ? 122.866 101.499 139.493 1.00 0.00 ? 207 G A N2     1  
ATOM 6668   N N3     . G A 1 207 ? 124.021 103.472 139.191 1.00 0.00 ? 207 G A N3     1  
ATOM 6669   C C4     . G A 1 207 ? 123.886 104.724 138.711 1.00 0.00 ? 207 G A C4     1  
ATOM 6670   H "H5'"  . G A 1 207 ? 128.406 108.886 138.523 1.00 0.00 ? 207 G A "H5'"  1  
ATOM 6671   H "H5''" . G A 1 207 ? 128.892 108.240 137.147 1.00 0.00 ? 207 G A "H5''" 1  
ATOM 6672   H "H4'"  . G A 1 207 ? 128.838 106.669 138.930 1.00 0.00 ? 207 G A "H4'"  1  
ATOM 6673   H "H3'"  . G A 1 207 ? 127.147 106.045 136.742 1.00 0.00 ? 207 G A "H3'"  1  
ATOM 6674   H "H2'"  . G A 1 207 ? 126.562 104.075 137.756 1.00 0.00 ? 207 G A "H2'"  1  
ATOM 6675   H "HO2'" . G A 1 207 ? 128.947 104.098 138.690 1.00 0.00 ? 207 G A "HO2'" 1  
ATOM 6676   H "H1'"  . G A 1 207 ? 126.220 105.163 140.107 1.00 0.00 ? 207 G A "H1'"  1  
ATOM 6677   H H8     . G A 1 207 ? 124.778 107.648 137.990 1.00 0.00 ? 207 G A H8     1  
ATOM 6678   H H1     . G A 1 207 ? 120.979 102.663 138.455 1.00 0.00 ? 207 G A H1     1  
ATOM 6679   H H21    . G A 1 207 ? 122.045 100.976 139.400 1.00 0.00 ? 207 G A H21    1  
ATOM 6680   H H22    . G A 1 207 ? 123.659 101.095 139.897 1.00 0.00 ? 207 G A H22    1  
ATOM 6681   P P      . A A 1 208 ? 128.894 104.619 135.332 1.00 0.00 ? 208 A A P      1  
ATOM 6682   O OP1    . A A 1 208 ? 130.280 104.350 134.880 1.00 0.00 ? 208 A A OP1    1  
ATOM 6683   O OP2    . A A 1 208 ? 127.994 105.449 134.491 1.00 0.00 ? 208 A A OP2    1  
ATOM 6684   O "O5'"  . A A 1 208 ? 128.175 103.218 135.583 1.00 0.00 ? 208 A A "O5'"  1  
ATOM 6685   C "C5'"  . A A 1 208 ? 128.854 102.162 136.245 1.00 0.00 ? 208 A A "C5'"  1  
ATOM 6686   C "C4'"  . A A 1 208 ? 127.972 100.949 136.403 1.00 0.00 ? 208 A A "C4'"  1  
ATOM 6687   O "O4'"  . A A 1 208 ? 126.801 101.294 137.190 1.00 0.00 ? 208 A A "O4'"  1  
ATOM 6688   C "C3'"  . A A 1 208 ? 127.396 100.369 135.118 1.00 0.00 ? 208 A A "C3'"  1  
ATOM 6689   O "O3'"  . A A 1 208 ? 128.320 99.555  134.416 1.00 0.00 ? 208 A A "O3'"  1  
ATOM 6690   C "C2'"  . A A 1 208 ? 126.170 99.616  135.615 1.00 0.00 ? 208 A A "C2'"  1  
ATOM 6691   O "O2'"  . A A 1 208 ? 126.531 98.373  136.197 1.00 0.00 ? 208 A A "O2'"  1  
ATOM 6692   C "C1'"  . A A 1 208 ? 125.661 100.550 136.711 1.00 0.00 ? 208 A A "C1'"  1  
ATOM 6693   N N9     . A A 1 208 ? 124.603 101.455 136.225 1.00 0.00 ? 208 A A N9     1  
ATOM 6694   C C8     . A A 1 208 ? 124.703 102.791 135.925 1.00 0.00 ? 208 A A C8     1  
ATOM 6695   N N7     . A A 1 208 ? 123.581 103.327 135.512 1.00 0.00 ? 208 A A N7     1  
ATOM 6696   C C5     . A A 1 208 ? 122.679 102.274 135.542 1.00 0.00 ? 208 A A C5     1  
ATOM 6697   C C6     . A A 1 208 ? 121.312 102.188 135.220 1.00 0.00 ? 208 A A C6     1  
ATOM 6698   N N6     . A A 1 208 ? 120.588 103.221 134.785 1.00 0.00 ? 208 A A N6     1  
ATOM 6699   N N1     . A A 1 208 ? 120.706 100.989 135.362 1.00 0.00 ? 208 A A N1     1  
ATOM 6700   C C2     . A A 1 208 ? 121.433 99.951  135.799 1.00 0.00 ? 208 A A C2     1  
ATOM 6701   N N3     . A A 1 208 ? 122.721 99.907  136.131 1.00 0.00 ? 208 A A N3     1  
ATOM 6702   C C4     . A A 1 208 ? 123.292 101.114 135.979 1.00 0.00 ? 208 A A C4     1  
ATOM 6703   H "H5'"  . A A 1 208 ? 129.137 102.468 137.131 1.00 0.00 ? 208 A A "H5'"  1  
ATOM 6704   H "H5''" . A A 1 208 ? 129.644 101.914 135.725 1.00 0.00 ? 208 A A "H5''" 1  
ATOM 6705   H "H4'"  . A A 1 208 ? 128.472 100.248 136.870 1.00 0.00 ? 208 A A "H4'"  1  
ATOM 6706   H "H3'"  . A A 1 208 ? 127.107 101.104 134.535 1.00 0.00 ? 208 A A "H3'"  1  
ATOM 6707   H "H2'"  . A A 1 208 ? 125.507 99.502  134.903 1.00 0.00 ? 208 A A "H2'"  1  
ATOM 6708   H "HO2'" . A A 1 208 ? 127.422 98.118  135.880 1.00 0.00 ? 208 A A "HO2'" 1  
ATOM 6709   H "H1'"  . A A 1 208 ? 125.317 100.020 137.461 1.00 0.00 ? 208 A A "H1'"  1  
ATOM 6710   H H8     . A A 1 208 ? 125.539 103.297 136.010 1.00 0.00 ? 208 A A H8     1  
ATOM 6711   H H61    . A A 1 208 ? 119.638 103.101 134.577 1.00 0.00 ? 208 A A H61    1  
ATOM 6712   H H62    . A A 1 208 ? 121.005 104.101 134.676 1.00 0.00 ? 208 A A H62    1  
ATOM 6713   H H2     . A A 1 208 ? 120.946 99.105  135.884 1.00 0.00 ? 208 A A H2     1  
ATOM 6714   P P      . U A 1 209 ? 128.541 99.762  132.837 1.00 0.00 ? 209 U A P      1  
ATOM 6715   O OP1    . U A 1 209 ? 129.597 98.817  132.393 1.00 0.00 ? 209 U A OP1    1  
ATOM 6716   O OP2    . U A 1 209 ? 128.703 101.215 132.583 1.00 0.00 ? 209 U A OP2    1  
ATOM 6717   O "O5'"  . U A 1 209 ? 127.161 99.298  132.191 1.00 0.00 ? 209 U A "O5'"  1  
ATOM 6718   C "C5'"  . U A 1 209 ? 126.512 98.114  132.628 1.00 0.00 ? 209 U A "C5'"  1  
ATOM 6719   C "C4'"  . U A 1 209 ? 125.054 98.103  132.241 1.00 0.00 ? 209 U A "C4'"  1  
ATOM 6720   O "O4'"  . U A 1 209 ? 124.341 99.004  133.130 1.00 0.00 ? 209 U A "O4'"  1  
ATOM 6721   C "C3'"  . U A 1 209 ? 124.728 98.602  130.842 1.00 0.00 ? 209 U A "C3'"  1  
ATOM 6722   O "O3'"  . U A 1 209 ? 124.886 97.606  129.847 1.00 0.00 ? 209 U A "O3'"  1  
ATOM 6723   C "C2'"  . U A 1 209 ? 123.261 99.001  130.991 1.00 0.00 ? 209 U A "C2'"  1  
ATOM 6724   O "O2'"  . U A 1 209 ? 122.414 97.861  130.974 1.00 0.00 ? 209 U A "O2'"  1  
ATOM 6725   C "C1'"  . U A 1 209 ? 123.249 99.610  132.400 1.00 0.00 ? 209 U A "C1'"  1  
ATOM 6726   N N1     . U A 1 209 ? 123.425 101.082 132.378 1.00 0.00 ? 209 U A N1     1  
ATOM 6727   C C2     . U A 1 209 ? 122.312 101.846 132.079 1.00 0.00 ? 209 U A C2     1  
ATOM 6728   O O2     . U A 1 209 ? 121.219 101.365 131.840 1.00 0.00 ? 209 U A O2     1  
ATOM 6729   N N3     . U A 1 209 ? 122.522 103.204 132.071 1.00 0.00 ? 209 U A N3     1  
ATOM 6730   C C4     . U A 1 209 ? 123.706 103.864 132.324 1.00 0.00 ? 209 U A C4     1  
ATOM 6731   O O4     . U A 1 209 ? 123.734 105.094 132.277 1.00 0.00 ? 209 U A O4     1  
ATOM 6732   C C5     . U A 1 209 ? 124.814 103.010 132.625 1.00 0.00 ? 209 U A C5     1  
ATOM 6733   C C6     . U A 1 209 ? 124.637 101.684 132.641 1.00 0.00 ? 209 U A C6     1  
ATOM 6734   H "H5'"  . U A 1 209 ? 126.583 98.053  133.604 1.00 0.00 ? 209 U A "H5'"  1  
ATOM 6735   H "H5''" . U A 1 209 ? 126.955 97.339  132.226 1.00 0.00 ? 209 U A "H5''" 1  
ATOM 6736   H "H4'"  . U A 1 209 ? 124.706 97.193  132.346 1.00 0.00 ? 209 U A "H4'"  1  
ATOM 6737   H "H3'"  . U A 1 209 ? 125.264 99.400  130.651 1.00 0.00 ? 209 U A "H3'"  1  
ATOM 6738   H "H2'"  . U A 1 209 ? 122.996 99.658  130.314 1.00 0.00 ? 209 U A "H2'"  1  
ATOM 6739   H "HO2'" . U A 1 209 ? 121.480 98.155  131.035 1.00 0.00 ? 209 U A "HO2'" 1  
ATOM 6740   H "H1'"  . U A 1 209 ? 122.400 99.391  132.839 1.00 0.00 ? 209 U A "H1'"  1  
ATOM 6741   H H3     . U A 1 209 ? 121.746 103.764 131.861 1.00 0.00 ? 209 U A H3     1  
ATOM 6742   H H5     . U A 1 209 ? 125.695 103.394 132.819 1.00 0.00 ? 209 U A H5     1  
ATOM 6743   H H6     . U A 1 209 ? 125.411 101.122 132.849 1.00 0.00 ? 209 U A H6     1  
ATOM 6744   P P      . C A 1 210 ? 125.600 97.976  128.463 1.00 0.00 ? 210 C A P      1  
ATOM 6745   O OP1    . C A 1 210 ? 127.033 97.594  128.535 1.00 0.00 ? 210 C A OP1    1  
ATOM 6746   O OP2    . C A 1 210 ? 125.230 99.401  128.278 1.00 0.00 ? 210 C A OP2    1  
ATOM 6747   O "O5'"  . C A 1 210 ? 124.926 97.134  127.290 1.00 0.00 ? 210 C A "O5'"  1  
ATOM 6748   C "C5'"  . C A 1 210 ? 124.322 95.876  127.551 1.00 0.00 ? 210 C A "C5'"  1  
ATOM 6749   C "C4'"  . C A 1 210 ? 122.815 95.960  127.496 1.00 0.00 ? 210 C A "C4'"  1  
ATOM 6750   O "O4'"  . C A 1 210 ? 122.335 96.897  128.495 1.00 0.00 ? 210 C A "O4'"  1  
ATOM 6751   C "C3'"  . C A 1 210 ? 122.217 96.472  126.194 1.00 0.00 ? 210 C A "C3'"  1  
ATOM 6752   O "O3'"  . C A 1 210 ? 122.141 95.473  125.192 1.00 0.00 ? 210 C A "O3'"  1  
ATOM 6753   C "C2'"  . C A 1 210 ? 120.861 96.999  126.636 1.00 0.00 ? 210 C A "C2'"  1  
ATOM 6754   O "O2'"  . C A 1 210 ? 119.932 95.941  126.825 1.00 0.00 ? 210 C A "O2'"  1  
ATOM 6755   C "C1'"  . C A 1 210 ? 121.199 97.612  127.996 1.00 0.00 ? 210 C A "C1'"  1  
ATOM 6756   N N1     . C A 1 210 ? 121.492 99.064  127.904 1.00 0.00 ? 210 C A N1     1  
ATOM 6757   C C2     . C A 1 210 ? 120.417 99.950  127.766 1.00 0.00 ? 210 C A C2     1  
ATOM 6758   O O2     . C A 1 210 ? 119.263 99.501  127.724 1.00 0.00 ? 210 C A O2     1  
ATOM 6759   N N3     . C A 1 210 ? 120.657 101.279 127.679 1.00 0.00 ? 210 C A N3     1  
ATOM 6760   C C4     . C A 1 210 ? 121.908 101.736 127.726 1.00 0.00 ? 210 C A C4     1  
ATOM 6761   N N4     . C A 1 210 ? 122.096 103.055 127.637 1.00 0.00 ? 210 C A N4     1  
ATOM 6762   C C5     . C A 1 210 ? 123.022 100.860 127.866 1.00 0.00 ? 210 C A C5     1  
ATOM 6763   C C6     . C A 1 210 ? 122.773 99.548  127.951 1.00 0.00 ? 210 C A C6     1  
ATOM 6764   H "H5'"  . C A 1 210 ? 124.594 95.568  128.440 1.00 0.00 ? 210 C A "H5'"  1  
ATOM 6765   H "H5''" . C A 1 210 ? 124.629 95.231  126.882 1.00 0.00 ? 210 C A "H5''" 1  
ATOM 6766   H "H4'"  . C A 1 210 ? 122.445 95.074  127.689 1.00 0.00 ? 210 C A "H4'"  1  
ATOM 6767   H "H3'"  . C A 1 210 ? 122.760 97.218  125.863 1.00 0.00 ? 210 C A "H3'"  1  
ATOM 6768   H "H2'"  . C A 1 210 ? 120.518 97.675  126.015 1.00 0.00 ? 210 C A "H2'"  1  
ATOM 6769   H "HO2'" . C A 1 210 ? 120.245 95.151  126.338 1.00 0.00 ? 210 C A "HO2'" 1  
ATOM 6770   H "H1'"  . C A 1 210 ? 120.450 97.471  128.611 1.00 0.00 ? 210 C A "H1'"  1  
ATOM 6771   H H41    . C A 1 210 ? 121.328 103.653 127.542 1.00 0.00 ? 210 C A H41    1  
ATOM 6772   H H42    . C A 1 210 ? 123.005 103.422 127.670 1.00 0.00 ? 210 C A H42    1  
ATOM 6773   H H5     . C A 1 210 ? 123.939 101.207 127.900 1.00 0.00 ? 210 C A H5     1  
ATOM 6774   H H6     . C A 1 210 ? 123.525 98.929  128.048 1.00 0.00 ? 210 C A H6     1  
ATOM 6775   P P      . C A 1 211 ? 122.158 95.884  123.638 1.00 0.00 ? 211 C A P      1  
ATOM 6776   O OP1    . C A 1 211 ? 122.143 94.638  122.830 1.00 0.00 ? 211 C A OP1    1  
ATOM 6777   O OP2    . C A 1 211 ? 123.243 96.876  123.435 1.00 0.00 ? 211 C A OP2    1  
ATOM 6778   O "O5'"  . C A 1 211 ? 120.766 96.628  123.421 1.00 0.00 ? 211 C A "O5'"  1  
ATOM 6779   C "C5'"  . C A 1 211 ? 119.549 95.898  123.366 1.00 0.00 ? 211 C A "C5'"  1  
ATOM 6780   C "C4'"  . C A 1 211 ? 118.364 96.804  123.142 1.00 0.00 ? 211 C A "C4'"  1  
ATOM 6781   O "O4'"  . C A 1 211 ? 118.266 97.767  124.223 1.00 0.00 ? 211 C A "O4'"  1  
ATOM 6782   C "C3'"  . C A 1 211 ? 118.405 97.661  121.887 1.00 0.00 ? 211 C A "C3'"  1  
ATOM 6783   O "O3'"  . C A 1 211 ? 118.039 96.949  120.716 1.00 0.00 ? 211 C A "O3'"  1  
ATOM 6784   C "C2'"  . C A 1 211 ? 117.456 98.801  122.231 1.00 0.00 ? 211 C A "C2'"  1  
ATOM 6785   O "O2'"  . C A 1 211 ? 116.101 98.400  122.100 1.00 0.00 ? 211 C A "O2'"  1  
ATOM 6786   C "C1'"  . C A 1 211 ? 117.768 99.021  123.712 1.00 0.00 ? 211 C A "C1'"  1  
ATOM 6787   N N1     . C A 1 211 ? 118.757 100.107 123.926 1.00 0.00 ? 211 C A N1     1  
ATOM 6788   C C2     . C A 1 211 ? 118.318 101.435 123.829 1.00 0.00 ? 211 C A C2     1  
ATOM 6789   O O2     . C A 1 211 ? 117.125 101.660 123.569 1.00 0.00 ? 211 C A O2     1  
ATOM 6790   N N3     . C A 1 211 ? 119.197 102.442 124.018 1.00 0.00 ? 211 C A N3     1  
ATOM 6791   C C4     . C A 1 211 ? 120.474 102.174 124.295 1.00 0.00 ? 211 C A C4     1  
ATOM 6792   N N4     . C A 1 211 ? 121.307 103.203 124.474 1.00 0.00 ? 211 C A N4     1  
ATOM 6793   C C5     . C A 1 211 ? 120.952 100.836 124.400 1.00 0.00 ? 211 C A C5     1  
ATOM 6794   C C6     . C A 1 211 ? 120.072 99.847  124.210 1.00 0.00 ? 211 C A C6     1  
ATOM 6795   H "H5'"  . C A 1 211 ? 119.429 95.416  124.212 1.00 0.00 ? 211 C A "H5'"  1  
ATOM 6796   H "H5''" . C A 1 211 ? 119.598 95.248  122.635 1.00 0.00 ? 211 C A "H5''" 1  
ATOM 6797   H "H4'"  . C A 1 211 ? 117.547 96.260  123.128 1.00 0.00 ? 211 C A "H4'"  1  
ATOM 6798   H "H3'"  . C A 1 211 ? 119.310 98.021  121.773 1.00 0.00 ? 211 C A "H3'"  1  
ATOM 6799   H "H2'"  . C A 1 211 ? 117.650 99.603  121.702 1.00 0.00 ? 211 C A "H2'"  1  
ATOM 6800   H "HO2'" . C A 1 211 ? 116.056 97.608  121.526 1.00 0.00 ? 211 C A "HO2'" 1  
ATOM 6801   H "H1'"  . C A 1 211 ? 116.943 99.236  124.192 1.00 0.00 ? 211 C A "H1'"  1  
ATOM 6802   H H41    . C A 1 211 ? 120.973 104.122 124.402 1.00 0.00 ? 211 C A H41    1  
ATOM 6803   H H42    . C A 1 211 ? 122.251 103.037 124.679 1.00 0.00 ? 211 C A H42    1  
ATOM 6804   H H5     . C A 1 211 ? 121.892 100.649 124.603 1.00 0.00 ? 211 C A H5     1  
ATOM 6805   H H6     . C A 1 211 ? 120.380 98.921  124.278 1.00 0.00 ? 211 C A H6     1  
ATOM 6806   P P      . A A 1 212 ? 118.582 97.422  119.278 1.00 0.00 ? 212 A A P      1  
ATOM 6807   O OP1    . A A 1 212 ? 118.162 96.414  118.274 1.00 0.00 ? 212 A A OP1    1  
ATOM 6808   O OP2    . A A 1 212 ? 120.019 97.764  119.422 1.00 0.00 ? 212 A A OP2    1  
ATOM 6809   O "O5'"  . A A 1 212 ? 117.784 98.771  118.989 1.00 0.00 ? 212 A A "O5'"  1  
ATOM 6810   C "C5'"  . A A 1 212 ? 116.379 98.755  118.781 1.00 0.00 ? 212 A A "C5'"  1  
ATOM 6811   C "C4'"  . A A 1 212 ? 115.825 100.148 118.633 1.00 0.00 ? 212 A A "C4'"  1  
ATOM 6812   O "O4'"  . A A 1 212 ? 116.053 100.900 119.852 1.00 0.00 ? 212 A A "O4'"  1  
ATOM 6813   C "C3'"  . A A 1 212 ? 116.456 101.005 117.546 1.00 0.00 ? 212 A A "C3'"  1  
ATOM 6814   O "O3'"  . A A 1 212 ? 115.967 100.706 116.248 1.00 0.00 ? 212 A A "O3'"  1  
ATOM 6815   C "C2'"  . A A 1 212 ? 116.133 102.418 118.010 1.00 0.00 ? 212 A A "C2'"  1  
ATOM 6816   O "O2'"  . A A 1 212 ? 114.786 102.763 117.710 1.00 0.00 ? 212 A A "O2'"  1  
ATOM 6817   C "C1'"  . A A 1 212 ? 116.288 102.288 119.525 1.00 0.00 ? 212 A A "C1'"  1  
ATOM 6818   N N9     . A A 1 212 ? 117.621 102.717 119.986 1.00 0.00 ? 212 A A N9     1  
ATOM 6819   C C8     . A A 1 212 ? 118.677 101.930 120.370 1.00 0.00 ? 212 A A C8     1  
ATOM 6820   N N7     . A A 1 212 ? 119.739 102.606 120.731 1.00 0.00 ? 212 A A N7     1  
ATOM 6821   C C5     . A A 1 212 ? 119.358 103.932 120.577 1.00 0.00 ? 212 A A C5     1  
ATOM 6822   C C6     . A A 1 212 ? 120.035 105.145 120.797 1.00 0.00 ? 212 A A C6     1  
ATOM 6823   N N6     . A A 1 212 ? 121.293 105.221 121.237 1.00 0.00 ? 212 A A N6     1  
ATOM 6824   N N1     . A A 1 212 ? 119.367 106.292 120.543 1.00 0.00 ? 212 A A N1     1  
ATOM 6825   C C2     . A A 1 212 ? 118.107 106.218 120.101 1.00 0.00 ? 212 A A C2     1  
ATOM 6826   N N3     . A A 1 212 ? 117.363 105.139 119.858 1.00 0.00 ? 212 A A N3     1  
ATOM 6827   C C4     . A A 1 212 ? 118.057 104.016 120.118 1.00 0.00 ? 212 A A C4     1  
ATOM 6828   H "H5'"  . A A 1 212 ? 115.948 98.318  119.546 1.00 0.00 ? 212 A A "H5'"  1  
ATOM 6829   H "H5''" . A A 1 212 ? 116.181 98.243  117.968 1.00 0.00 ? 212 A A "H5''" 1  
ATOM 6830   H "H4'"  . A A 1 212 ? 114.859 100.090 118.470 1.00 0.00 ? 212 A A "H4'"  1  
ATOM 6831   H "H3'"  . A A 1 212 ? 117.428 100.878 117.562 1.00 0.00 ? 212 A A "H3'"  1  
ATOM 6832   H "H2'"  . A A 1 212 ? 116.765 103.072 117.639 1.00 0.00 ? 212 A A "H2'"  1  
ATOM 6833   H "HO2'" . A A 1 212 ? 114.454 102.168 117.006 1.00 0.00 ? 212 A A "HO2'" 1  
ATOM 6834   H "H1'"  . A A 1 212 ? 115.598 102.823 119.970 1.00 0.00 ? 212 A A "H1'"  1  
ATOM 6835   H H8     . A A 1 212 ? 118.642 100.950 120.373 1.00 0.00 ? 212 A A H8     1  
ATOM 6836   H H61    . A A 1 212 ? 121.713 106.096 121.371 1.00 0.00 ? 212 A A H61    1  
ATOM 6837   H H62    . A A 1 212 ? 121.796 104.402 121.427 1.00 0.00 ? 212 A A H62    1  
ATOM 6838   H H2     . A A 1 212 ? 117.666 107.076 119.935 1.00 0.00 ? 212 A A H2     1  
ATOM 6839   P P      . A A 1 213 ? 116.892 100.967 114.958 1.00 0.00 ? 213 A A P      1  
ATOM 6840   O OP1    . A A 1 213 ? 116.179 100.435 113.769 1.00 0.00 ? 213 A A OP1    1  
ATOM 6841   O OP2    . A A 1 213 ? 118.259 100.484 115.269 1.00 0.00 ? 213 A A OP2    1  
ATOM 6842   O "O5'"  . A A 1 213 ? 116.941 102.553 114.835 1.00 0.00 ? 213 A A "O5'"  1  
ATOM 6843   C "C5'"  . A A 1 213 ? 115.775 103.298 114.517 1.00 0.00 ? 213 A A "C5'"  1  
ATOM 6844   C "C4'"  . A A 1 213 ? 116.024 104.783 114.612 1.00 0.00 ? 213 A A "C4'"  1  
ATOM 6845   O "O4'"  . A A 1 213 ? 116.403 105.131 115.969 1.00 0.00 ? 213 A A "O4'"  1  
ATOM 6846   C "C3'"  . A A 1 213 ? 117.157 105.327 113.757 1.00 0.00 ? 213 A A "C3'"  1  
ATOM 6847   O "O3'"  . A A 1 213 ? 116.790 105.505 112.399 1.00 0.00 ? 213 A A "O3'"  1  
ATOM 6848   C "C2'"  . A A 1 213 ? 117.518 106.623 114.467 1.00 0.00 ? 213 A A "C2'"  1  
ATOM 6849   O "O2'"  . A A 1 213 ? 116.589 107.652 114.163 1.00 0.00 ? 213 A A "O2'"  1  
ATOM 6850   C "C1'"  . A A 1 213 ? 117.352 106.221 115.935 1.00 0.00 ? 213 A A "C1'"  1  
ATOM 6851   N N9     . A A 1 213 ? 118.634 105.836 116.554 1.00 0.00 ? 213 A A N9     1  
ATOM 6852   C C8     . A A 1 213 ? 119.086 104.573 116.841 1.00 0.00 ? 213 A A C8     1  
ATOM 6853   N N7     . A A 1 213 ? 120.274 104.549 117.394 1.00 0.00 ? 213 A A N7     1  
ATOM 6854   C C5     . A A 1 213 ? 120.628 105.888 117.478 1.00 0.00 ? 213 A A C5     1  
ATOM 6855   C C6     . A A 1 213 ? 121.774 106.535 117.973 1.00 0.00 ? 213 A A C6     1  
ATOM 6856   N N6     . A A 1 213 ? 122.819 105.889 118.498 1.00 0.00 ? 213 A A N6     1  
ATOM 6857   N N1     . A A 1 213 ? 121.812 107.884 117.909 1.00 0.00 ? 213 A A N1     1  
ATOM 6858   C C2     . A A 1 213 ? 120.765 108.529 117.383 1.00 0.00 ? 213 A A C2     1  
ATOM 6859   N N3     . A A 1 213 ? 119.635 108.033 116.887 1.00 0.00 ? 213 A A N3     1  
ATOM 6860   C C4     . A A 1 213 ? 119.628 106.690 116.966 1.00 0.00 ? 213 A A C4     1  
ATOM 6861   H "H5'"  . A A 1 213 ? 115.060 103.053 115.141 1.00 0.00 ? 213 A A "H5'"  1  
ATOM 6862   H "H5''" . A A 1 213 ? 115.494 103.079 113.606 1.00 0.00 ? 213 A A "H5''" 1  
ATOM 6863   H "H4'"  . A A 1 213 ? 115.197 105.256 114.382 1.00 0.00 ? 213 A A "H4'"  1  
ATOM 6864   H "H3'"  . A A 1 213 ? 117.919 104.711 113.806 1.00 0.00 ? 213 A A "H3'"  1  
ATOM 6865   H "H2'"  . A A 1 213 ? 118.440 106.895 114.274 1.00 0.00 ? 213 A A "H2'"  1  
ATOM 6866   H "HO2'" . A A 1 213 ? 116.114 107.422 113.338 1.00 0.00 ? 213 A A "HO2'" 1  
ATOM 6867   H "H1'"  . A A 1 213 ? 116.959 106.968 116.435 1.00 0.00 ? 213 A A "H1'"  1  
ATOM 6868   H H8     . A A 1 213 ? 118.568 103.761 116.650 1.00 0.00 ? 213 A A H8     1  
ATOM 6869   H H61    . A A 1 213 ? 123.590 106.396 118.827 1.00 0.00 ? 213 A A H61    1  
ATOM 6870   H H62    . A A 1 213 ? 122.815 104.913 118.555 1.00 0.00 ? 213 A A H62    1  
ATOM 6871   H H2     . A A 1 213 ? 120.841 109.506 117.360 1.00 0.00 ? 213 A A H2     1  
ATOM 6872   P P      . C A 1 214 ? 117.904 105.417 111.244 1.00 0.00 ? 214 C A P      1  
ATOM 6873   O OP1    . C A 1 214 ? 117.213 105.510 109.932 1.00 0.00 ? 214 C A OP1    1  
ATOM 6874   O OP2    . C A 1 214 ? 118.777 104.252 111.533 1.00 0.00 ? 214 C A OP2    1  
ATOM 6875   O "O5'"  . C A 1 214 ? 118.768 106.743 111.439 1.00 0.00 ? 214 C A "O5'"  1  
ATOM 6876   C "C5'"  . C A 1 214 ? 118.211 108.021 111.178 1.00 0.00 ? 214 C A "C5'"  1  
ATOM 6877   C "C4'"  . C A 1 214 ? 119.164 109.131 111.552 1.00 0.00 ? 214 C A "C4'"  1  
ATOM 6878   O "O4'"  . C A 1 214 ? 119.466 109.064 112.970 1.00 0.00 ? 214 C A "O4'"  1  
ATOM 6879   C "C3'"  . C A 1 214 ? 120.527 109.099 110.881 1.00 0.00 ? 214 C A "C3'"  1  
ATOM 6880   O "O3'"  . C A 1 214 ? 120.506 109.607 109.557 1.00 0.00 ? 214 C A "O3'"  1  
ATOM 6881   C "C2'"  . C A 1 214 ? 121.386 109.918 111.837 1.00 0.00 ? 214 C A "C2'"  1  
ATOM 6882   O "O2'"  . C A 1 214 ? 121.160 111.310 111.668 1.00 0.00 ? 214 C A "O2'"  1  
ATOM 6883   C "C1'"  . C A 1 214 ? 120.830 109.483 113.192 1.00 0.00 ? 214 C A "C1'"  1  
ATOM 6884   N N1     . C A 1 214 ? 121.631 108.399 113.811 1.00 0.00 ? 214 C A N1     1  
ATOM 6885   C C2     . C A 1 214 ? 122.840 108.736 114.434 1.00 0.00 ? 214 C A C2     1  
ATOM 6886   O O2     . C A 1 214 ? 123.203 109.922 114.449 1.00 0.00 ? 214 C A O2     1  
ATOM 6887   N N3     . C A 1 214 ? 123.589 107.766 115.005 1.00 0.00 ? 214 C A N3     1  
ATOM 6888   C C4     . C A 1 214 ? 123.177 106.498 114.973 1.00 0.00 ? 214 C A C4     1  
ATOM 6889   N N4     . C A 1 214 ? 123.949 105.574 115.550 1.00 0.00 ? 214 C A N4     1  
ATOM 6890   C C5     . C A 1 214 ? 121.955 106.121 114.348 1.00 0.00 ? 214 C A C5     1  
ATOM 6891   C C6     . C A 1 214 ? 121.220 107.092 113.788 1.00 0.00 ? 214 C A C6     1  
ATOM 6892   H "H5'"  . C A 1 214 ? 117.385 108.120 111.694 1.00 0.00 ? 214 C A "H5'"  1  
ATOM 6893   H "H5''" . C A 1 214 ? 118.002 108.092 110.222 1.00 0.00 ? 214 C A "H5''" 1  
ATOM 6894   H "H4'"  . C A 1 214 ? 118.735 109.992 111.361 1.00 0.00 ? 214 C A "H4'"  1  
ATOM 6895   H "H3'"  . C A 1 214 ? 120.856 108.175 110.866 1.00 0.00 ? 214 C A "H3'"  1  
ATOM 6896   H "H2'"  . C A 1 214 ? 122.336 109.689 111.748 1.00 0.00 ? 214 C A "H2'"  1  
ATOM 6897   H "HO2'" . C A 1 214 ? 120.762 111.465 110.788 1.00 0.00 ? 214 C A "HO2'" 1  
ATOM 6898   H "H1'"  . C A 1 214 ? 120.809 110.257 113.797 1.00 0.00 ? 214 C A "H1'"  1  
ATOM 6899   H H41    . C A 1 214 ? 124.791 105.835 115.979 1.00 0.00 ? 214 C A H41    1  
ATOM 6900   H H42    . C A 1 214 ? 123.675 104.632 115.544 1.00 0.00 ? 214 C A H42    1  
ATOM 6901   H H5     . C A 1 214 ? 121.659 105.189 114.332 1.00 0.00 ? 214 C A H5     1  
ATOM 6902   H H6     . C A 1 214 ? 120.376 106.854 113.352 1.00 0.00 ? 214 C A H6     1  
ATOM 6903   P P      . C A 1 215 ? 121.598 109.114 108.487 1.00 0.00 ? 215 C A P      1  
ATOM 6904   O OP1    . C A 1 215 ? 121.258 109.718 107.172 1.00 0.00 ? 215 C A OP1    1  
ATOM 6905   O OP2    . C A 1 215 ? 121.728 107.640 108.604 1.00 0.00 ? 215 C A OP2    1  
ATOM 6906   O "O5'"  . C A 1 215 ? 122.959 109.769 108.991 1.00 0.00 ? 215 C A "O5'"  1  
ATOM 6907   C "C5'"  . C A 1 215 ? 123.155 111.174 108.940 1.00 0.00 ? 215 C A "C5'"  1  
ATOM 6908   C "C4'"  . C A 1 215 ? 124.464 111.578 109.575 1.00 0.00 ? 215 C A "C4'"  1  
ATOM 6909   O "O4'"  . C A 1 215 ? 124.474 111.191 110.973 1.00 0.00 ? 215 C A "O4'"  1  
ATOM 6910   C "C3'"  . C A 1 215 ? 125.714 110.930 109.003 1.00 0.00 ? 215 C A "C3'"  1  
ATOM 6911   O "O3'"  . C A 1 215 ? 126.146 111.530 107.793 1.00 0.00 ? 215 C A "O3'"  1  
ATOM 6912   C "C2'"  . C A 1 215 ? 126.715 111.069 110.143 1.00 0.00 ? 215 C A "C2'"  1  
ATOM 6913   O "O2'"  . C A 1 215 ? 127.239 112.387 110.211 1.00 0.00 ? 215 C A "O2'"  1  
ATOM 6914   C "C1'"  . C A 1 215 ? 125.821 110.826 111.360 1.00 0.00 ? 215 C A "C1'"  1  
ATOM 6915   N N1     . C A 1 215 ? 125.881 109.423 111.832 1.00 0.00 ? 215 C A N1     1  
ATOM 6916   C C2     . C A 1 215 ? 126.991 109.022 112.588 1.00 0.00 ? 215 C A C2     1  
ATOM 6917   O O2     . C A 1 215 ? 127.884 109.845 112.839 1.00 0.00 ? 215 C A O2     1  
ATOM 6918   N N3     . C A 1 215 ? 127.068 107.746 113.031 1.00 0.00 ? 215 C A N3     1  
ATOM 6919   C C4     . C A 1 215 ? 126.096 106.880 112.749 1.00 0.00 ? 215 C A C4     1  
ATOM 6920   N N4     . C A 1 215 ? 126.217 105.631 113.210 1.00 0.00 ? 215 C A N4     1  
ATOM 6921   C C5     . C A 1 215 ? 124.956 107.256 111.984 1.00 0.00 ? 215 C A C5     1  
ATOM 6922   C C6     . C A 1 215 ? 124.890 108.518 111.552 1.00 0.00 ? 215 C A C6     1  
ATOM 6923   H "H5'"  . C A 1 215 ? 122.421 111.617 109.414 1.00 0.00 ? 215 C A "H5'"  1  
ATOM 6924   H "H5''" . C A 1 215 ? 123.152 111.462 108.003 1.00 0.00 ? 215 C A "H5''" 1  
ATOM 6925   H "H4'"  . C A 1 215 ? 124.556 112.552 109.516 1.00 0.00 ? 215 C A "H4'"  1  
ATOM 6926   H "H3'"  . C A 1 215 ? 125.541 109.978 108.844 1.00 0.00 ? 215 C A "H3'"  1  
ATOM 6927   H "H2'"  . C A 1 215 ? 127.426 110.399 110.082 1.00 0.00 ? 215 C A "H2'"  1  
ATOM 6928   H "HO2'" . C A 1 215 ? 127.103 112.830 109.350 1.00 0.00 ? 215 C A "HO2'" 1  
ATOM 6929   H "H1'"  . C A 1 215 ? 126.092 111.425 112.089 1.00 0.00 ? 215 C A "H1'"  1  
ATOM 6930   H H41    . C A 1 215 ? 127.004 105.377 113.734 1.00 0.00 ? 215 C A H41    1  
ATOM 6931   H H42    . C A 1 215 ? 125.518 104.970 113.018 1.00 0.00 ? 215 C A H42    1  
ATOM 6932   H H5     . C A 1 215 ? 124.246 106.611 111.784 1.00 0.00 ? 215 C A H5     1  
ATOM 6933   H H6     . C A 1 215 ? 124.112 108.799 111.025 1.00 0.00 ? 215 C A H6     1  
ATOM 6934   P P      . G A 1 216 ? 126.357 110.631 106.477 1.00 0.00 ? 216 G A P      1  
ATOM 6935   O OP1    . G A 1 216 ? 126.424 111.541 105.304 1.00 0.00 ? 216 G A OP1    1  
ATOM 6936   O OP2    . G A 1 216 ? 125.354 109.537 106.501 1.00 0.00 ? 216 G A OP2    1  
ATOM 6937   O "O5'"  . G A 1 216 ? 127.799 109.983 106.679 1.00 0.00 ? 216 G A "O5'"  1  
ATOM 6938   C "C5'"  . G A 1 216 ? 128.953 110.799 106.814 1.00 0.00 ? 216 G A "C5'"  1  
ATOM 6939   C "C4'"  . G A 1 216 ? 130.194 110.086 106.339 1.00 0.00 ? 216 G A "C4'"  1  
ATOM 6940   O "O4'"  . G A 1 216 ? 130.641 109.261 107.429 1.00 0.00 ? 216 G A "O4'"  1  
ATOM 6941   C "C3'"  . G A 1 216 ? 130.008 109.125 105.175 1.00 0.00 ? 216 G A "C3'"  1  
ATOM 6942   O "O3'"  . G A 1 216 ? 130.217 109.736 103.913 1.00 0.00 ? 216 G A "O3'"  1  
ATOM 6943   C "C2'"  . G A 1 216 ? 131.111 108.103 105.418 1.00 0.00 ? 216 G A "C2'"  1  
ATOM 6944   O "O2'"  . G A 1 216 ? 132.361 108.568 104.931 1.00 0.00 ? 216 G A "O2'"  1  
ATOM 6945   C "C1'"  . G A 1 216 ? 131.182 108.039 106.936 1.00 0.00 ? 216 G A "C1'"  1  
ATOM 6946   N N9     . G A 1 216 ? 130.373 106.934 107.484 1.00 0.00 ? 216 G A N9     1  
ATOM 6947   C C8     . G A 1 216 ? 129.029 106.950 107.772 1.00 0.00 ? 216 G A C8     1  
ATOM 6948   N N7     . G A 1 216 ? 128.593 105.816 108.250 1.00 0.00 ? 216 G A N7     1  
ATOM 6949   C C5     . G A 1 216 ? 129.716 105.001 108.279 1.00 0.00 ? 216 G A C5     1  
ATOM 6950   C C6     . G A 1 216 ? 129.863 103.654 108.699 1.00 0.00 ? 216 G A C6     1  
ATOM 6951   O O6     . G A 1 216 ? 129.002 102.888 109.146 1.00 0.00 ? 216 G A O6     1  
ATOM 6952   N N1     . G A 1 216 ? 131.177 103.215 108.561 1.00 0.00 ? 216 G A N1     1  
ATOM 6953   C C2     . G A 1 216 ? 132.215 103.973 108.078 1.00 0.00 ? 216 G A C2     1  
ATOM 6954   N N2     . G A 1 216 ? 133.413 103.373 108.018 1.00 0.00 ? 216 G A N2     1  
ATOM 6955   N N3     . G A 1 216 ? 132.091 105.230 107.683 1.00 0.00 ? 216 G A N3     1  
ATOM 6956   C C4     . G A 1 216 ? 130.823 105.676 107.809 1.00 0.00 ? 216 G A C4     1  
ATOM 6957   H "H5'"  . G A 1 216 ? 129.064 111.042 107.757 1.00 0.00 ? 216 G A "H5'"  1  
ATOM 6958   H "H5''" . G A 1 216 ? 128.830 111.616 106.286 1.00 0.00 ? 216 G A "H5''" 1  
ATOM 6959   H "H4'"  . G A 1 216 ? 130.877 110.754 106.115 1.00 0.00 ? 216 G A "H4'"  1  
ATOM 6960   H "H3'"  . G A 1 216 ? 129.137 108.685 105.258 1.00 0.00 ? 216 G A "H3'"  1  
ATOM 6961   H "H2'"  . G A 1 216 ? 130.878 107.227 105.043 1.00 0.00 ? 216 G A "H2'"  1  
ATOM 6962   H "HO2'" . G A 1 216 ? 132.837 107.822 104.509 1.00 0.00 ? 216 G A "HO2'" 1  
ATOM 6963   H "H1'"  . G A 1 216 ? 132.115 107.930 107.215 1.00 0.00 ? 216 G A "H1'"  1  
ATOM 6964   H H8     . G A 1 216 ? 128.456 107.733 107.634 1.00 0.00 ? 216 G A H8     1  
ATOM 6965   H H1     . G A 1 216 ? 131.373 102.293 108.828 1.00 0.00 ? 216 G A H1     1  
ATOM 6966   H H21    . G A 1 216 ? 133.513 102.443 108.309 1.00 0.00 ? 216 G A H21    1  
ATOM 6967   H H22    . G A 1 216 ? 134.192 103.866 107.682 1.00 0.00 ? 216 G A H22    1  
ATOM 6968   P P      . A A 1 217 ? 131.053 111.105 103.808 1.00 0.00 ? 217 A A P      1  
ATOM 6969   O OP1    . A A 1 217 ? 131.165 111.466 102.373 1.00 0.00 ? 217 A A OP1    1  
ATOM 6970   O OP2    . A A 1 217 ? 132.283 110.956 104.626 1.00 0.00 ? 217 A A OP2    1  
ATOM 6971   O "O5'"  . A A 1 217 ? 130.118 112.183 104.517 1.00 0.00 ? 217 A A "O5'"  1  
ATOM 6972   C "C5'"  . A A 1 217 ? 129.637 113.312 103.803 1.00 0.00 ? 217 A A "C5'"  1  
ATOM 6973   C "C4'"  . A A 1 217 ? 128.826 114.224 104.690 1.00 0.00 ? 217 A A "C4'"  1  
ATOM 6974   O "O4'"  . A A 1 217 ? 128.661 113.709 106.045 1.00 0.00 ? 217 A A "O4'"  1  
ATOM 6975   C "C3'"  . A A 1 217 ? 129.333 115.652 104.820 1.00 0.00 ? 217 A A "C3'"  1  
ATOM 6976   O "O3'"  . A A 1 217 ? 128.293 116.613 104.809 1.00 0.00 ? 217 A A "O3'"  1  
ATOM 6977   C "C2'"  . A A 1 217 ? 130.056 115.648 106.159 1.00 0.00 ? 217 A A "C2'"  1  
ATOM 6978   O "O2'"  . A A 1 217 ? 130.003 116.926 106.777 1.00 0.00 ? 217 A A "O2'"  1  
ATOM 6979   C "C1'"  . A A 1 217 ? 129.199 114.668 106.976 1.00 0.00 ? 217 A A "C1'"  1  
ATOM 6980   N N9     . A A 1 217 ? 129.997 113.930 107.973 1.00 0.00 ? 217 A A N9     1  
ATOM 6981   C C8     . A A 1 217 ? 130.963 112.981 107.746 1.00 0.00 ? 217 A A C8     1  
ATOM 6982   N N7     . A A 1 217 ? 131.500 112.500 108.840 1.00 0.00 ? 217 A A N7     1  
ATOM 6983   C C5     . A A 1 217 ? 130.843 113.178 109.858 1.00 0.00 ? 217 A A C5     1  
ATOM 6984   C C6     . A A 1 217 ? 130.954 113.121 111.259 1.00 0.00 ? 217 A A C6     1  
ATOM 6985   N N6     . A A 1 217 ? 131.805 112.318 111.902 1.00 0.00 ? 217 A A N6     1  
ATOM 6986   N N1     . A A 1 217 ? 130.152 113.929 111.986 1.00 0.00 ? 217 A A N1     1  
ATOM 6987   C C2     . A A 1 217 ? 129.299 114.735 111.341 1.00 0.00 ? 217 A A C2     1  
ATOM 6988   N N3     . A A 1 217 ? 129.102 114.877 110.032 1.00 0.00 ? 217 A A N3     1  
ATOM 6989   C C4     . A A 1 217 ? 129.915 114.061 109.338 1.00 0.00 ? 217 A A C4     1  
ATOM 6990   H "H5'"  . A A 1 217 ? 129.075 113.006 103.061 1.00 0.00 ? 217 A A "H5'"  1  
ATOM 6991   H "H5''" . A A 1 217 ? 130.398 113.811 103.442 1.00 0.00 ? 217 A A "H5''" 1  
ATOM 6992   H "H4'"  . A A 1 217 ? 127.930 114.325 104.306 1.00 0.00 ? 217 A A "H4'"  1  
ATOM 6993   H "H3'"  . A A 1 217 ? 129.987 115.827 104.110 1.00 0.00 ? 217 A A "H3'"  1  
ATOM 6994   H "H2'"  . A A 1 217 ? 130.977 115.325 106.070 1.00 0.00 ? 217 A A "H2'"  1  
ATOM 6995   H "HO2'" . A A 1 217 ? 130.731 116.995 107.429 1.00 0.00 ? 217 A A "HO2'" 1  
ATOM 6996   H "H1'"  . A A 1 217 ? 128.484 115.162 107.431 1.00 0.00 ? 217 A A "H1'"  1  
ATOM 6997   H H8     . A A 1 217 ? 131.228 112.690 106.848 1.00 0.00 ? 217 A A H8     1  
ATOM 6998   H H61    . A A 1 217 ? 131.837 112.323 112.882 1.00 0.00 ? 217 A A H61    1  
ATOM 6999   H H62    . A A 1 217 ? 132.396 111.724 111.396 1.00 0.00 ? 217 A A H62    1  
ATOM 7000   H H2     . A A 1 217 ? 128.740 115.300 111.914 1.00 0.00 ? 217 A A H2     1  
ATOM 7001   P P      . G A 1 218 ? 128.564 118.068 104.197 1.00 0.00 ? 218 G A P      1  
ATOM 7002   O OP1    . G A 1 218 ? 128.055 118.113 102.802 1.00 0.00 ? 218 G A OP1    1  
ATOM 7003   O OP2    . G A 1 218 ? 130.013 118.263 104.456 1.00 0.00 ? 218 G A OP2    1  
ATOM 7004   O "O5'"  . G A 1 218 ? 127.761 119.148 105.049 1.00 0.00 ? 218 G A "O5'"  1  
ATOM 7005   C "C5'"  . G A 1 218 ? 128.118 119.427 106.395 1.00 0.00 ? 218 G A "C5'"  1  
ATOM 7006   C "C4'"  . G A 1 218 ? 126.905 119.478 107.291 1.00 0.00 ? 218 G A "C4'"  1  
ATOM 7007   O "O4'"  . G A 1 218 ? 126.875 120.733 108.017 1.00 0.00 ? 218 G A "O4'"  1  
ATOM 7008   C "C3'"  . G A 1 218 ? 125.555 119.440 106.590 1.00 0.00 ? 218 G A "C3'"  1  
ATOM 7009   O "O3'"  . G A 1 218 ? 125.152 118.128 106.237 1.00 0.00 ? 218 G A "O3'"  1  
ATOM 7010   C "C2'"  . G A 1 218 ? 124.661 119.989 107.694 1.00 0.00 ? 218 G A "C2'"  1  
ATOM 7011   O "O2'"  . G A 1 218 ? 124.438 119.019 108.707 1.00 0.00 ? 218 G A "O2'"  1  
ATOM 7012   C "C1'"  . G A 1 218 ? 125.541 121.103 108.251 1.00 0.00 ? 218 G A "C1'"  1  
ATOM 7013   N N9     . G A 1 218 ? 125.289 122.395 107.586 1.00 0.00 ? 218 G A N9     1  
ATOM 7014   C C8     . G A 1 218 ? 126.085 123.023 106.660 1.00 0.00 ? 218 G A C8     1  
ATOM 7015   N N7     . G A 1 218 ? 125.596 124.163 106.250 1.00 0.00 ? 218 G A N7     1  
ATOM 7016   C C5     . G A 1 218 ? 124.405 124.295 106.948 1.00 0.00 ? 218 G A C5     1  
ATOM 7017   C C6     . G A 1 218 ? 123.433 125.330 106.921 1.00 0.00 ? 218 G A C6     1  
ATOM 7018   O O6     . G A 1 218 ? 123.434 126.370 106.253 1.00 0.00 ? 218 G A O6     1  
ATOM 7019   N N1     . G A 1 218 ? 122.377 125.064 107.787 1.00 0.00 ? 218 G A N1     1  
ATOM 7020   C C2     . G A 1 218 ? 122.267 123.945 108.577 1.00 0.00 ? 218 G A C2     1  
ATOM 7021   N N2     . G A 1 218 ? 121.173 123.866 109.348 1.00 0.00 ? 218 G A N2     1  
ATOM 7022   N N3     . G A 1 218 ? 123.165 122.974 108.612 1.00 0.00 ? 218 G A N3     1  
ATOM 7023   C C4     . G A 1 218 ? 124.199 123.213 107.778 1.00 0.00 ? 218 G A C4     1  
ATOM 7024   H "H5'"  . G A 1 218 ? 128.579 120.291 106.431 1.00 0.00 ? 218 G A "H5'"  1  
ATOM 7025   H "H5''" . G A 1 218 ? 128.724 118.727 106.716 1.00 0.00 ? 218 G A "H5''" 1  
ATOM 7026   H "H4'"  . G A 1 218 ? 126.952 118.737 107.931 1.00 0.00 ? 218 G A "H4'"  1  
ATOM 7027   H "H3'"  . G A 1 218 ? 125.519 120.011 105.796 1.00 0.00 ? 218 G A "H3'"  1  
ATOM 7028   H "H2'"  . G A 1 218 ? 123.818 120.338 107.334 1.00 0.00 ? 218 G A "H2'"  1  
ATOM 7029   H "HO2'" . G A 1 218 ? 123.853 119.402 109.394 1.00 0.00 ? 218 G A "HO2'" 1  
ATOM 7030   H "H1'"  . G A 1 218 ? 125.382 121.194 109.214 1.00 0.00 ? 218 G A "H1'"  1  
ATOM 7031   H H8     . G A 1 218 ? 126.934 122.655 106.338 1.00 0.00 ? 218 G A H8     1  
ATOM 7032   H H1     . G A 1 218 ? 121.657 125.726 107.835 1.00 0.00 ? 218 G A H1     1  
ATOM 7033   H H21    . G A 1 218 ? 120.503 124.581 109.329 1.00 0.00 ? 218 G A H21    1  
ATOM 7034   H H22    . G A 1 218 ? 121.041 123.090 109.933 1.00 0.00 ? 218 G A H22    1  
ATOM 7035   P P      . G A 1 219 ? 123.995 117.906 105.144 1.00 0.00 ? 219 G A P      1  
ATOM 7036   O OP1    . G A 1 219 ? 123.920 116.453 104.841 1.00 0.00 ? 219 G A OP1    1  
ATOM 7037   O OP2    . G A 1 219 ? 124.213 118.875 104.040 1.00 0.00 ? 219 G A OP2    1  
ATOM 7038   O "O5'"  . G A 1 219 ? 122.659 118.319 105.906 1.00 0.00 ? 219 G A "O5'"  1  
ATOM 7039   C "C5'"  . G A 1 219 ? 122.076 117.459 106.874 1.00 0.00 ? 219 G A "C5'"  1  
ATOM 7040   C "C4'"  . G A 1 219 ? 120.761 118.002 107.377 1.00 0.00 ? 219 G A "C4'"  1  
ATOM 7041   O "O4'"  . G A 1 219 ? 120.930 119.340 107.932 1.00 0.00 ? 219 G A "O4'"  1  
ATOM 7042   C "C3'"  . G A 1 219 ? 119.689 118.238 106.323 1.00 0.00 ? 219 G A "C3'"  1  
ATOM 7043   O "O3'"  . G A 1 219 ? 119.130 117.036 105.824 1.00 0.00 ? 219 G A "O3'"  1  
ATOM 7044   C "C2'"  . G A 1 219 ? 118.729 119.132 107.094 1.00 0.00 ? 219 G A "C2'"  1  
ATOM 7045   O "O2'"  . G A 1 219 ? 117.975 118.384 108.038 1.00 0.00 ? 219 G A "O2'"  1  
ATOM 7046   C "C1'"  . G A 1 219 ? 119.718 120.031 107.833 1.00 0.00 ? 219 G A "C1'"  1  
ATOM 7047   N N9     . G A 1 219 ? 119.939 121.309 107.130 1.00 0.00 ? 219 G A N9     1  
ATOM 7048   C C8     . G A 1 219 ? 121.091 121.727 106.508 1.00 0.00 ? 219 G A C8     1  
ATOM 7049   N N7     . G A 1 219 ? 120.983 122.912 105.970 1.00 0.00 ? 219 G A N7     1  
ATOM 7050   C C5     . G A 1 219 ? 119.681 123.300 106.253 1.00 0.00 ? 219 G A C5     1  
ATOM 7051   C C6     . G A 1 219 ? 118.985 124.492 105.924 1.00 0.00 ? 219 G A C6     1  
ATOM 7052   O O6     . G A 1 219 ? 119.395 125.475 105.296 1.00 0.00 ? 219 G A O6     1  
ATOM 7053   N N1     . G A 1 219 ? 117.680 124.473 106.407 1.00 0.00 ? 219 G A N1     1  
ATOM 7054   C C2     . G A 1 219 ? 117.116 123.440 107.115 1.00 0.00 ? 219 G A C2     1  
ATOM 7055   N N2     . G A 1 219 ? 115.841 123.606 107.497 1.00 0.00 ? 219 G A N2     1  
ATOM 7056   N N3     . G A 1 219 ? 117.754 122.324 107.428 1.00 0.00 ? 219 G A N3     1  
ATOM 7057   C C4     . G A 1 219 ? 119.023 122.322 106.968 1.00 0.00 ? 219 G A C4     1  
ATOM 7058   H "H5'"  . G A 1 219 ? 122.692 117.362 107.629 1.00 0.00 ? 219 G A "H5'"  1  
ATOM 7059   H "H5''" . G A 1 219 ? 121.925 116.579 106.470 1.00 0.00 ? 219 G A "H5''" 1  
ATOM 7060   H "H4'"  . G A 1 219 ? 120.405 117.398 108.063 1.00 0.00 ? 219 G A "H4'"  1  
ATOM 7061   H "H3'"  . G A 1 219 ? 120.057 118.756 105.577 1.00 0.00 ? 219 G A "H3'"  1  
ATOM 7062   H "H2'"  . G A 1 219 ? 118.150 119.643 106.490 1.00 0.00 ? 219 G A "H2'"  1  
ATOM 7063   H "HO2'" . G A 1 219 ? 117.369 118.990 108.514 1.00 0.00 ? 219 G A "HO2'" 1  
ATOM 7064   H "H1'"  . G A 1 219 ? 119.384 120.210 108.737 1.00 0.00 ? 219 G A "H1'"  1  
ATOM 7065   H H8     . G A 1 219 ? 121.911 121.192 106.472 1.00 0.00 ? 219 G A H8     1  
ATOM 7066   H H1     . G A 1 219 ? 117.122 125.258 106.227 1.00 0.00 ? 219 G A H1     1  
ATOM 7067   H H21    . G A 1 219 ? 115.362 124.429 107.269 1.00 0.00 ? 219 G A H21    1  
ATOM 7068   H H22    . G A 1 219 ? 115.386 122.902 108.005 1.00 0.00 ? 219 G A H22    1  
ATOM 7069   P P      . C A 1 220 ? 118.900 116.848 104.244 1.00 0.00 ? 220 C A P      1  
ATOM 7070   O OP1    . C A 1 220 ? 118.080 115.627 104.042 1.00 0.00 ? 220 C A OP1    1  
ATOM 7071   O OP2    . C A 1 220 ? 120.218 116.966 103.570 1.00 0.00 ? 220 C A OP2    1  
ATOM 7072   O "O5'"  . C A 1 220 ? 118.018 118.108 103.829 1.00 0.00 ? 220 C A "O5'"  1  
ATOM 7073   C "C5'"  . C A 1 220 ? 116.689 118.257 104.306 1.00 0.00 ? 220 C A "C5'"  1  
ATOM 7074   C "C4'"  . C A 1 220 ? 116.023 119.481 103.727 1.00 0.00 ? 220 C A "C4'"  1  
ATOM 7075   O "O4'"  . C A 1 220 ? 116.596 120.679 104.314 1.00 0.00 ? 220 C A "O4'"  1  
ATOM 7076   C "C3'"  . C A 1 220 ? 116.189 119.686 102.228 1.00 0.00 ? 220 C A "C3'"  1  
ATOM 7077   O "O3'"  . C A 1 220 ? 115.278 118.918 101.459 1.00 0.00 ? 220 C A "O3'"  1  
ATOM 7078   C "C2'"  . C A 1 220 ? 115.998 121.189 102.077 1.00 0.00 ? 220 C A "C2'"  1  
ATOM 7079   O "O2'"  . C A 1 220 ? 114.622 121.543 102.123 1.00 0.00 ? 220 C A "O2'"  1  
ATOM 7080   C "C1'"  . C A 1 220 ? 116.687 121.713 103.338 1.00 0.00 ? 220 C A "C1'"  1  
ATOM 7081   N N1     . C A 1 220 ? 118.112 122.054 103.101 1.00 0.00 ? 220 C A N1     1  
ATOM 7082   C C2     . C A 1 220 ? 118.410 123.272 102.474 1.00 0.00 ? 220 C A C2     1  
ATOM 7083   O O2     . C A 1 220 ? 117.480 124.023 102.138 1.00 0.00 ? 220 C A O2     1  
ATOM 7084   N N3     . C A 1 220 ? 119.700 123.605 102.247 1.00 0.00 ? 220 C A N3     1  
ATOM 7085   C C4     . C A 1 220 ? 120.679 122.782 102.617 1.00 0.00 ? 220 C A C4     1  
ATOM 7086   N N4     . C A 1 220 ? 121.938 123.153 102.372 1.00 0.00 ? 220 C A N4     1  
ATOM 7087   C C5     . C A 1 220 ? 120.410 121.537 103.255 1.00 0.00 ? 220 C A C5     1  
ATOM 7088   C C6     . C A 1 220 ? 119.130 121.217 103.475 1.00 0.00 ? 220 C A C6     1  
ATOM 7089   H "H5'"  . C A 1 220 ? 116.707 118.335 105.282 1.00 0.00 ? 220 C A "H5'"  1  
ATOM 7090   H "H5''" . C A 1 220 ? 116.171 117.463 104.059 1.00 0.00 ? 220 C A "H5''" 1  
ATOM 7091   H "H4'"  . C A 1 220 ? 115.067 119.448 103.939 1.00 0.00 ? 220 C A "H4'"  1  
ATOM 7092   H "H3'"  . C A 1 220 ? 117.105 119.452 101.970 1.00 0.00 ? 220 C A "H3'"  1  
ATOM 7093   H "H2'"  . C A 1 220 ? 116.431 121.527 101.265 1.00 0.00 ? 220 C A "H2'"  1  
ATOM 7094   H "HO2'" . C A 1 220 ? 114.083 120.752 101.923 1.00 0.00 ? 220 C A "HO2'" 1  
ATOM 7095   H "H1'"  . C A 1 220 ? 116.214 122.508 103.661 1.00 0.00 ? 220 C A "H1'"  1  
ATOM 7096   H H41    . C A 1 220 ? 122.119 124.011 101.932 1.00 0.00 ? 220 C A H41    1  
ATOM 7097   H H42    . C A 1 220 ? 122.681 122.569 102.634 1.00 0.00 ? 220 C A H42    1  
ATOM 7098   H H5     . C A 1 220 ? 121.137 120.938 103.523 1.00 0.00 ? 220 C A H5     1  
ATOM 7099   H H6     . C A 1 220 ? 118.925 120.365 103.913 1.00 0.00 ? 220 C A H6     1  
ATOM 7100   P P      . U A 1 221 ? 115.701 118.383 100.004 1.00 0.00 ? 221 U A P      1  
ATOM 7101   O OP1    . U A 1 221 ? 114.622 117.489 99.512  1.00 0.00 ? 221 U A OP1    1  
ATOM 7102   O OP2    . U A 1 221 ? 117.093 117.876 100.087 1.00 0.00 ? 221 U A OP2    1  
ATOM 7103   O "O5'"  . U A 1 221 ? 115.706 119.694 99.099  1.00 0.00 ? 221 U A "O5'"  1  
ATOM 7104   C "C5'"  . U A 1 221 ? 114.504 120.400 98.830  1.00 0.00 ? 221 U A "C5'"  1  
ATOM 7105   C "C4'"  . U A 1 221 ? 114.777 121.739 98.188  1.00 0.00 ? 221 U A "C4'"  1  
ATOM 7106   O "O4'"  . U A 1 221 ? 115.592 122.554 99.069  1.00 0.00 ? 221 U A "O4'"  1  
ATOM 7107   C "C3'"  . U A 1 221 ? 115.555 121.708 96.882  1.00 0.00 ? 221 U A "C3'"  1  
ATOM 7108   O "O3'"  . U A 1 221 ? 114.739 121.440 95.754  1.00 0.00 ? 221 U A "O3'"  1  
ATOM 7109   C "C2'"  . U A 1 221 ? 116.204 123.085 96.852  1.00 0.00 ? 221 U A "C2'"  1  
ATOM 7110   O "O2'"  . U A 1 221 ? 115.275 124.085 96.457  1.00 0.00 ? 221 U A "O2'"  1  
ATOM 7111   C "C1'"  . U A 1 221 ? 116.555 123.290 98.328  1.00 0.00 ? 221 U A "C1'"  1  
ATOM 7112   N N1     . U A 1 221 ? 117.928 122.826 98.647  1.00 0.00 ? 221 U A N1     1  
ATOM 7113   C C2     . U A 1 221 ? 118.970 123.670 98.313  1.00 0.00 ? 221 U A C2     1  
ATOM 7114   O O2     . U A 1 221 ? 118.808 124.754 97.780  1.00 0.00 ? 221 U A O2     1  
ATOM 7115   N N3     . U A 1 221 ? 120.223 123.201 98.630  1.00 0.00 ? 221 U A N3     1  
ATOM 7116   C C4     . U A 1 221 ? 120.533 121.998 99.233  1.00 0.00 ? 221 U A C4     1  
ATOM 7117   O O4     . U A 1 221 ? 121.713 121.721 99.452  1.00 0.00 ? 221 U A O4     1  
ATOM 7118   C C5     . U A 1 221 ? 119.403 121.179 99.548  1.00 0.00 ? 221 U A C5     1  
ATOM 7119   C C6     . U A 1 221 ? 118.174 121.612 99.254  1.00 0.00 ? 221 U A C6     1  
ATOM 7120   H "H5'"  . U A 1 221 ? 114.021 120.542 99.672  1.00 0.00 ? 221 U A "H5'"  1  
ATOM 7121   H "H5''" . U A 1 221 ? 113.946 119.865 98.229  1.00 0.00 ? 221 U A "H5''" 1  
ATOM 7122   H "H4'"  . U A 1 221 ? 113.920 122.192 98.036  1.00 0.00 ? 221 U A "H4'"  1  
ATOM 7123   H "H3'"  . U A 1 221 ? 116.257 121.026 96.941  1.00 0.00 ? 221 U A "H3'"  1  
ATOM 7124   H "H2'"  . U A 1 221 ? 117.006 123.094 96.289  1.00 0.00 ? 221 U A "H2'"  1  
ATOM 7125   H "HO2'" . U A 1 221 ? 114.528 123.658 95.989  1.00 0.00 ? 221 U A "HO2'" 1  
ATOM 7126   H "H1'"  . U A 1 221 ? 116.473 124.240 98.553  1.00 0.00 ? 221 U A "H1'"  1  
ATOM 7127   H H3     . U A 1 221 ? 120.976 123.784 98.403  1.00 0.00 ? 221 U A H3     1  
ATOM 7128   H H5     . U A 1 221 ? 119.533 120.309 99.979  1.00 0.00 ? 221 U A H5     1  
ATOM 7129   H H6     . U A 1 221 ? 117.419 121.032 99.478  1.00 0.00 ? 221 U A H6     1  
ATOM 7130   P P      . C A 1 222 ? 115.327 120.619 94.506  1.00 0.00 ? 222 C A P      1  
ATOM 7131   O OP1    . C A 1 222 ? 114.184 120.150 93.683  1.00 0.00 ? 222 C A OP1    1  
ATOM 7132   O OP2    . C A 1 222 ? 116.310 119.635 95.024  1.00 0.00 ? 222 C A OP2    1  
ATOM 7133   O "O5'"  . C A 1 222 ? 116.123 121.713 93.663  1.00 0.00 ? 222 C A "O5'"  1  
ATOM 7134   C "C5'"  . C A 1 222 ? 115.432 122.727 92.949  1.00 0.00 ? 222 C A "C5'"  1  
ATOM 7135   C "C4'"  . C A 1 222 ? 116.369 123.805 92.463  1.00 0.00 ? 222 C A "C4'"  1  
ATOM 7136   O "O4'"  . C A 1 222 ? 117.059 124.405 93.591  1.00 0.00 ? 222 C A "O4'"  1  
ATOM 7137   C "C3'"  . C A 1 222 ? 117.492 123.351 91.543  1.00 0.00 ? 222 C A "C3'"  1  
ATOM 7138   O "O3'"  . C A 1 222 ? 117.084 123.221 90.191  1.00 0.00 ? 222 C A "O3'"  1  
ATOM 7139   C "C2'"  . C A 1 222 ? 118.553 124.421 91.758  1.00 0.00 ? 222 C A "C2'"  1  
ATOM 7140   O "O2'"  . C A 1 222 ? 118.238 125.609 91.047  1.00 0.00 ? 222 C A "O2'"  1  
ATOM 7141   C "C1'"  . C A 1 222 ? 118.415 124.690 93.258  1.00 0.00 ? 222 C A "C1'"  1  
ATOM 7142   N N1     . C A 1 222 ? 119.345 123.865 94.066  1.00 0.00 ? 222 C A N1     1  
ATOM 7143   C C2     . C A 1 222 ? 120.683 124.270 94.158  1.00 0.00 ? 222 C A C2     1  
ATOM 7144   O O2     . C A 1 222 ? 121.048 125.296 93.565  1.00 0.00 ? 222 C A O2     1  
ATOM 7145   N N3     . C A 1 222 ? 121.553 123.534 94.891  1.00 0.00 ? 222 C A N3     1  
ATOM 7146   C C4     . C A 1 222 ? 121.137 122.436 95.518  1.00 0.00 ? 222 C A C4     1  
ATOM 7147   N N4     . C A 1 222 ? 122.031 121.743 96.227  1.00 0.00 ? 222 C A N4     1  
ATOM 7148   C C5     . C A 1 222 ? 119.785 121.996 95.444  1.00 0.00 ? 222 C A C5     1  
ATOM 7149   C C6     . C A 1 222 ? 118.934 122.732 94.719  1.00 0.00 ? 222 C A C6     1  
ATOM 7150   H "H5'"  . C A 1 222 ? 114.759 123.131 93.538  1.00 0.00 ? 222 C A "H5'"  1  
ATOM 7151   H "H5''" . C A 1 222 ? 114.980 122.324 92.179  1.00 0.00 ? 222 C A "H5''" 1  
ATOM 7152   H "H4'"  . C A 1 222 ? 115.845 124.495 92.007  1.00 0.00 ? 222 C A "H4'"  1  
ATOM 7153   H "H3'"  . C A 1 222 ? 117.837 122.489 91.858  1.00 0.00 ? 222 C A "H3'"  1  
ATOM 7154   H "H2'"  . C A 1 222 ? 119.448 124.091 91.536  1.00 0.00 ? 222 C A "H2'"  1  
ATOM 7155   H "HO2'" . C A 1 222 ? 117.602 125.394 90.335  1.00 0.00 ? 222 C A "HO2'" 1  
ATOM 7156   H "H1'"  . C A 1 222 ? 118.583 125.637 93.437  1.00 0.00 ? 222 C A "H1'"  1  
ATOM 7157   H H41    . C A 1 222 ? 122.963 122.048 96.275  1.00 0.00 ? 222 C A H41    1  
ATOM 7158   H H42    . C A 1 222 ? 121.756 120.931 96.701  1.00 0.00 ? 222 C A H42    1  
ATOM 7159   H H5     . C A 1 222 ? 119.488 121.189 95.910  1.00 0.00 ? 222 C A H5     1  
ATOM 7160   H H6     . C A 1 222 ? 117.999 122.449 94.656  1.00 0.00 ? 222 C A H6     1  
ATOM 7161   P P      . A A 1 223 ? 118.060 122.519 89.130  1.00 0.00 ? 223 A A P      1  
ATOM 7162   O OP1    . A A 1 223 ? 117.640 121.107 88.946  1.00 0.00 ? 223 A A OP1    1  
ATOM 7163   O OP2    . A A 1 223 ? 119.406 122.820 89.680  1.00 0.00 ? 223 A A OP2    1  
ATOM 7164   O "O5'"  . A A 1 223 ? 117.925 123.261 87.727  1.00 0.00 ? 223 A A "O5'"  1  
ATOM 7165   C "C5'"  . A A 1 223 ? 118.828 122.986 86.667  1.00 0.00 ? 223 A A "C5'"  1  
ATOM 7166   C "C4'"  . A A 1 223 ? 120.067 123.841 86.758  1.00 0.00 ? 223 A A "C4'"  1  
ATOM 7167   O "O4'"  . A A 1 223 ? 120.339 124.164 88.134  1.00 0.00 ? 223 A A "O4'"  1  
ATOM 7168   C "C3'"  . A A 1 223 ? 121.359 123.198 86.277  1.00 0.00 ? 223 A A "C3'"  1  
ATOM 7169   O "O3'"  . A A 1 223 ? 121.556 123.327 84.880  1.00 0.00 ? 223 A A "O3'"  1  
ATOM 7170   C "C2'"  . A A 1 223 ? 122.420 123.938 87.058  1.00 0.00 ? 223 A A "C2'"  1  
ATOM 7171   O "O2'"  . A A 1 223 ? 122.747 125.174 86.440  1.00 0.00 ? 223 A A "O2'"  1  
ATOM 7172   C "C1'"  . A A 1 223 ? 121.691 124.214 88.361  1.00 0.00 ? 223 A A "C1'"  1  
ATOM 7173   N N9     . A A 1 223 ? 122.061 123.254 89.419  1.00 0.00 ? 223 A A N9     1  
ATOM 7174   C C8     . A A 1 223 ? 121.371 122.138 89.825  1.00 0.00 ? 223 A A C8     1  
ATOM 7175   N N7     . A A 1 223 ? 121.955 121.479 90.794  1.00 0.00 ? 223 A A N7     1  
ATOM 7176   C C5     . A A 1 223 ? 123.109 122.210 91.046  1.00 0.00 ? 223 A A C5     1  
ATOM 7177   C C6     . A A 1 223 ? 124.159 122.035 91.964  1.00 0.00 ? 223 A A C6     1  
ATOM 7178   N N6     . A A 1 223 ? 124.221 121.026 92.835  1.00 0.00 ? 223 A A N6     1  
ATOM 7179   N N1     . A A 1 223 ? 125.158 122.944 91.956  1.00 0.00 ? 223 A A N1     1  
ATOM 7180   C C2     . A A 1 223 ? 125.097 123.957 91.082  1.00 0.00 ? 223 A A C2     1  
ATOM 7181   N N3     . A A 1 223 ? 124.164 124.227 90.172  1.00 0.00 ? 223 A A N3     1  
ATOM 7182   C C4     . A A 1 223 ? 123.186 123.305 90.206  1.00 0.00 ? 223 A A C4     1  
ATOM 7183   H "H5'"  . A A 1 223 ? 118.382 123.161 85.812  1.00 0.00 ? 223 A A "H5'"  1  
ATOM 7184   H "H5''" . A A 1 223 ? 119.087 122.042 86.703  1.00 0.00 ? 223 A A "H5''" 1  
ATOM 7185   H "H4'"  . A A 1 223 ? 119.920 124.670 86.257  1.00 0.00 ? 223 A A "H4'"  1  
ATOM 7186   H "H3'"  . A A 1 223 ? 121.365 122.247 86.515  1.00 0.00 ? 223 A A "H3'"  1  
ATOM 7187   H "H2'"  . A A 1 223 ? 123.214 123.381 87.202  1.00 0.00 ? 223 A A "H2'"  1  
ATOM 7188   H "HO2'" . A A 1 223 ? 123.446 125.617 86.964  1.00 0.00 ? 223 A A "HO2'" 1  
ATOM 7189   H "H1'"  . A A 1 223 ? 121.894 125.125 88.662  1.00 0.00 ? 223 A A "H1'"  1  
ATOM 7190   H H8     . A A 1 223 ? 120.520 121.859 89.425  1.00 0.00 ? 223 A A H8     1  
ATOM 7191   H H61    . A A 1 223 ? 124.980 120.957 93.452  1.00 0.00 ? 223 A A H61    1  
ATOM 7192   H H62    . A A 1 223 ? 123.508 120.355 92.860  1.00 0.00 ? 223 A A H62    1  
ATOM 7193   H H2     . A A 1 223 ? 125.846 124.588 91.117  1.00 0.00 ? 223 A A H2     1  
ATOM 7194   P P      . U A 1 224 ? 121.497 122.030 83.932  1.00 0.00 ? 224 U A P      1  
ATOM 7195   O OP1    . U A 1 224 ? 121.242 122.487 82.542  1.00 0.00 ? 224 U A OP1    1  
ATOM 7196   O OP2    . U A 1 224 ? 120.583 121.044 84.560  1.00 0.00 ? 224 U A OP2    1  
ATOM 7197   O "O5'"  . U A 1 224 ? 122.975 121.442 83.994  1.00 0.00 ? 224 U A "O5'"  1  
ATOM 7198   C "C5'"  . U A 1 224 ? 124.034 122.047 83.271  1.00 0.00 ? 224 U A "C5'"  1  
ATOM 7199   C "C4'"  . U A 1 224 ? 125.320 122.044 84.057  1.00 0.00 ? 224 U A "C4'"  1  
ATOM 7200   O "O4'"  . U A 1 224 ? 125.076 122.512 85.409  1.00 0.00 ? 224 U A "O4'"  1  
ATOM 7201   C "C3'"  . U A 1 224 ? 125.984 120.688 84.251  1.00 0.00 ? 224 U A "C3'"  1  
ATOM 7202   O "O3'"  . U A 1 224 ? 126.760 120.287 83.135  1.00 0.00 ? 224 U A "O3'"  1  
ATOM 7203   C "C2'"  . U A 1 224 ? 126.800 120.896 85.519  1.00 0.00 ? 224 U A "C2'"  1  
ATOM 7204   O "O2'"  . U A 1 224 ? 127.994 121.618 85.251  1.00 0.00 ? 224 U A "O2'"  1  
ATOM 7205   C "C1'"  . U A 1 224 ? 125.863 121.779 86.344  1.00 0.00 ? 224 U A "C1'"  1  
ATOM 7206   N N1     . U A 1 224 ? 124.989 120.987 87.241  1.00 0.00 ? 224 U A N1     1  
ATOM 7207   C C2     . U A 1 224 ? 125.560 120.488 88.399  1.00 0.00 ? 224 U A C2     1  
ATOM 7208   O O2     . U A 1 224 ? 126.725 120.675 88.700  1.00 0.00 ? 224 U A O2     1  
ATOM 7209   N N3     . U A 1 224 ? 124.714 119.760 89.199  1.00 0.00 ? 224 U A N3     1  
ATOM 7210   C C4     . U A 1 224 ? 123.382 119.483 88.968  1.00 0.00 ? 224 U A C4     1  
ATOM 7211   O O4     . U A 1 224 ? 122.754 118.812 89.787  1.00 0.00 ? 224 U A O4     1  
ATOM 7212   C C5     . U A 1 224 ? 122.861 120.030 87.753  1.00 0.00 ? 224 U A C5     1  
ATOM 7213   C C6     . U A 1 224 ? 123.663 120.743 86.956  1.00 0.00 ? 224 U A C6     1  
ATOM 7214   H "H5'"  . U A 1 224 ? 123.790 122.974 83.063  1.00 0.00 ? 224 U A "H5'"  1  
ATOM 7215   H "H5''" . U A 1 224 ? 124.170 121.557 82.433  1.00 0.00 ? 224 U A "H5''" 1  
ATOM 7216   H "H4'"  . U A 1 224 ? 125.957 122.648 83.622  1.00 0.00 ? 224 U A "H4'"  1  
ATOM 7217   H "H3'"  . U A 1 224 ? 125.294 120.014 84.422  1.00 0.00 ? 224 U A "H3'"  1  
ATOM 7218   H "H2'"  . U A 1 224 ? 126.985 120.046 85.973  1.00 0.00 ? 224 U A "H2'"  1  
ATOM 7219   H "HO2'" . U A 1 224 ? 128.200 121.553 84.296  1.00 0.00 ? 224 U A "HO2'" 1  
ATOM 7220   H "H1'"  . U A 1 224 ? 126.392 122.406 86.881  1.00 0.00 ? 224 U A "H1'"  1  
ATOM 7221   H H3     . U A 1 224 ? 125.098 119.398 90.024  1.00 0.00 ? 224 U A H3     1  
ATOM 7222   H H5     . U A 1 224 ? 121.923 119.883 87.508  1.00 0.00 ? 224 U A H5     1  
ATOM 7223   H H6     . U A 1 224 ? 123.281 121.106 86.129  1.00 0.00 ? 224 U A H6     1  
ATOM 7224   P P      . U A 1 225 ? 126.942 118.725 82.795  1.00 0.00 ? 225 U A P      1  
ATOM 7225   O OP1    . U A 1 225 ? 127.602 118.619 81.468  1.00 0.00 ? 225 U A OP1    1  
ATOM 7226   O OP2    . U A 1 225 ? 125.640 118.052 83.025  1.00 0.00 ? 225 U A OP2    1  
ATOM 7227   O "O5'"  . U A 1 225 ? 127.966 118.208 83.898  1.00 0.00 ? 225 U A "O5'"  1  
ATOM 7228   C "C5'"  . U A 1 225 ? 129.316 118.653 83.908  1.00 0.00 ? 225 U A "C5'"  1  
ATOM 7229   C "C4'"  . U A 1 225 ? 130.064 118.131 85.108  1.00 0.00 ? 225 U A "C4'"  1  
ATOM 7230   O "O4'"  . U A 1 225 ? 129.462 118.635 86.326  1.00 0.00 ? 225 U A "O4'"  1  
ATOM 7231   C "C3'"  . U A 1 225 ? 130.070 116.621 85.293  1.00 0.00 ? 225 U A "C3'"  1  
ATOM 7232   O "O3'"  . U A 1 225 ? 131.036 115.965 84.490  1.00 0.00 ? 225 U A "O3'"  1  
ATOM 7233   C "C2'"  . U A 1 225 ? 130.313 116.470 86.788  1.00 0.00 ? 225 U A "C2'"  1  
ATOM 7234   O "O2'"  . U A 1 225 ? 131.681 116.669 87.111  1.00 0.00 ? 225 U A "O2'"  1  
ATOM 7235   C "C1'"  . U A 1 225 ? 129.495 117.636 87.348  1.00 0.00 ? 225 U A "C1'"  1  
ATOM 7236   N N1     . U A 1 225 ? 128.118 117.229 87.723  1.00 0.00 ? 225 U A N1     1  
ATOM 7237   C C2     . U A 1 225 ? 127.965 116.550 88.918  1.00 0.00 ? 225 U A C2     1  
ATOM 7238   O O2     . U A 1 225 ? 128.897 116.282 89.656  1.00 0.00 ? 225 U A O2     1  
ATOM 7239   N N3     . U A 1 225 ? 126.674 116.194 89.224  1.00 0.00 ? 225 U A N3     1  
ATOM 7240   C C4     . U A 1 225 ? 125.543 116.440 88.473  1.00 0.00 ? 225 U A C4     1  
ATOM 7241   O O4     . U A 1 225 ? 124.447 116.055 88.884  1.00 0.00 ? 225 U A O4     1  
ATOM 7242   C C5     . U A 1 225 ? 125.780 117.145 87.251  1.00 0.00 ? 225 U A C5     1  
ATOM 7243   C C6     . U A 1 225 ? 127.026 117.505 86.930  1.00 0.00 ? 225 U A C6     1  
ATOM 7244   H "H5'"  . U A 1 225 ? 129.329 119.633 83.924  1.00 0.00 ? 225 U A "H5'"  1  
ATOM 7245   H "H5''" . U A 1 225 ? 129.760 118.339 83.093  1.00 0.00 ? 225 U A "H5''" 1  
ATOM 7246   H "H4'"  . U A 1 225 ? 130.992 118.446 85.058  1.00 0.00 ? 225 U A "H4'"  1  
ATOM 7247   H "H3'"  . U A 1 225 ? 129.179 116.269 85.077  1.00 0.00 ? 225 U A "H3'"  1  
ATOM 7248   H "H2'"  . U A 1 225 ? 129.982 115.609 87.122  1.00 0.00 ? 225 U A "H2'"  1  
ATOM 7249   H "HO2'" . U A 1 225 ? 131.804 116.533 88.072  1.00 0.00 ? 225 U A "HO2'" 1  
ATOM 7250   H "H1'"  . U A 1 225 ? 129.949 118.002 88.137  1.00 0.00 ? 225 U A "H1'"  1  
ATOM 7251   H H3     . U A 1 225 ? 126.542 115.711 90.065  1.00 0.00 ? 225 U A H3     1  
ATOM 7252   H H5     . U A 1 225 ? 125.031 117.366 86.655  1.00 0.00 ? 225 U A H5     1  
ATOM 7253   H H6     . U A 1 225 ? 127.161 117.988 86.087  1.00 0.00 ? 225 U A H6     1  
ATOM 7254   P P      . C A 1 226 ? 130.786 114.460 83.989  1.00 0.00 ? 226 C A P      1  
ATOM 7255   O OP1    . C A 1 226 ? 131.852 114.116 83.015  1.00 0.00 ? 226 C A OP1    1  
ATOM 7256   O OP2    . C A 1 226 ? 129.360 114.337 83.590  1.00 0.00 ? 226 C A OP2    1  
ATOM 7257   O "O5'"  . C A 1 226 ? 131.010 113.576 85.295  1.00 0.00 ? 226 C A "O5'"  1  
ATOM 7258   C "C5'"  . C A 1 226 ? 132.292 113.474 85.896  1.00 0.00 ? 226 C A "C5'"  1  
ATOM 7259   C "C4'"  . C A 1 226 ? 132.248 112.661 87.168  1.00 0.00 ? 226 C A "C4'"  1  
ATOM 7260   O "O4'"  . C A 1 226 ? 131.417 113.328 88.150  1.00 0.00 ? 226 C A "O4'"  1  
ATOM 7261   C "C3'"  . C A 1 226 ? 131.645 111.270 87.054  1.00 0.00 ? 226 C A "C3'"  1  
ATOM 7262   O "O3'"  . C A 1 226 ? 132.557 110.311 86.547  1.00 0.00 ? 226 C A "O3'"  1  
ATOM 7263   C "C2'"  . C A 1 226 ? 131.190 110.987 88.478  1.00 0.00 ? 226 C A "C2'"  1  
ATOM 7264   O "O2'"  . C A 1 226 ? 132.283 110.609 89.303  1.00 0.00 ? 226 C A "O2'"  1  
ATOM 7265   C "C1'"  . C A 1 226 ? 130.690 112.365 88.918  1.00 0.00 ? 226 C A "C1'"  1  
ATOM 7266   N N1     . C A 1 226 ? 129.230 112.527 88.706  1.00 0.00 ? 226 C A N1     1  
ATOM 7267   C C2     . C A 1 226 ? 128.356 111.938 89.629  1.00 0.00 ? 226 C A C2     1  
ATOM 7268   O O2     . C A 1 226 ? 128.822 111.301 90.586  1.00 0.00 ? 226 C A O2     1  
ATOM 7269   N N3     . C A 1 226 ? 127.020 112.070 89.459  1.00 0.00 ? 226 C A N3     1  
ATOM 7270   C C4     . C A 1 226 ? 126.544 112.760 88.421  1.00 0.00 ? 226 C A C4     1  
ATOM 7271   N N4     . C A 1 226 ? 125.219 112.865 88.295  1.00 0.00 ? 226 C A N4     1  
ATOM 7272   C C5     . C A 1 226 ? 127.406 113.370 87.467  1.00 0.00 ? 226 C A C5     1  
ATOM 7273   C C6     . C A 1 226 ? 128.727 113.233 87.645  1.00 0.00 ? 226 C A C6     1  
ATOM 7274   H "H5'"  . C A 1 226 ? 132.621 114.373 86.102  1.00 0.00 ? 226 C A "H5'"  1  
ATOM 7275   H "H5''" . C A 1 226 ? 132.906 113.046 85.263  1.00 0.00 ? 226 C A "H5''" 1  
ATOM 7276   H "H4'"  . C A 1 226 ? 133.160 112.584 87.521  1.00 0.00 ? 226 C A "H4'"  1  
ATOM 7277   H "H3'"  . C A 1 226 ? 130.859 111.309 86.469  1.00 0.00 ? 226 C A "H3'"  1  
ATOM 7278   H "H2'"  . C A 1 226 ? 130.473 110.320 88.502  1.00 0.00 ? 226 C A "H2'"  1  
ATOM 7279   H "HO2'" . C A 1 226 ? 131.952 110.416 90.204  1.00 0.00 ? 226 C A "HO2'" 1  
ATOM 7280   H "H1'"  . C A 1 226 ? 130.897 112.499 89.867  1.00 0.00 ? 226 C A "H1'"  1  
ATOM 7281   H H41    . C A 1 226 ? 124.627 112.443 88.952  1.00 0.00 ? 226 C A H41    1  
ATOM 7282   H H42    . C A 1 226 ? 124.838 113.366 87.542  1.00 0.00 ? 226 C A H42    1  
ATOM 7283   H H5     . C A 1 226 ? 127.046 113.876 86.709  1.00 0.00 ? 226 C A H5     1  
ATOM 7284   H H6     . C A 1 226 ? 129.335 113.645 87.000  1.00 0.00 ? 226 C A H6     1  
ATOM 7285   P P      . U A 1 227 ? 132.024 109.083 85.654  1.00 0.00 ? 227 U A P      1  
ATOM 7286   O OP1    . U A 1 227 ? 133.205 108.332 85.157  1.00 0.00 ? 227 U A OP1    1  
ATOM 7287   O OP2    . U A 1 227 ? 131.032 109.615 84.687  1.00 0.00 ? 227 U A OP2    1  
ATOM 7288   O "O5'"  . U A 1 227 ? 131.253 108.157 86.695  1.00 0.00 ? 227 U A "O5'"  1  
ATOM 7289   C "C5'"  . U A 1 227 ? 131.951 107.498 87.741  1.00 0.00 ? 227 U A "C5'"  1  
ATOM 7290   C "C4'"  . U A 1 227 ? 131.007 106.763 88.662  1.00 0.00 ? 227 U A "C4'"  1  
ATOM 7291   O "O4'"  . U A 1 227 ? 130.135 107.710 89.334  1.00 0.00 ? 227 U A "O4'"  1  
ATOM 7292   C "C3'"  . U A 1 227 ? 130.052 105.783 88.001  1.00 0.00 ? 227 U A "C3'"  1  
ATOM 7293   O "O3'"  . U A 1 227 ? 130.646 104.524 87.736  1.00 0.00 ? 227 U A "O3'"  1  
ATOM 7294   C "C2'"  . U A 1 227 ? 128.899 105.719 88.993  1.00 0.00 ? 227 U A "C2'"  1  
ATOM 7295   O "O2'"  . U A 1 227 ? 129.219 104.890 90.100  1.00 0.00 ? 227 U A "O2'"  1  
ATOM 7296   C "C1'"  . U A 1 227 ? 128.826 107.172 89.469  1.00 0.00 ? 227 U A "C1'"  1  
ATOM 7297   N N1     . U A 1 227 ? 127.871 107.978 88.671  1.00 0.00 ? 227 U A N1     1  
ATOM 7298   C C2     . U A 1 227 ? 126.529 107.854 88.979  1.00 0.00 ? 227 U A C2     1  
ATOM 7299   O O2     . U A 1 227 ? 126.115 107.123 89.863  1.00 0.00 ? 227 U A O2     1  
ATOM 7300   N N3     . U A 1 227 ? 125.681 108.618 88.216  1.00 0.00 ? 227 U A N3     1  
ATOM 7301   C C4     . U A 1 227 ? 126.031 109.477 87.193  1.00 0.00 ? 227 U A C4     1  
ATOM 7302   O O4     . U A 1 227 ? 125.146 110.096 86.599  1.00 0.00 ? 227 U A O4     1  
ATOM 7303   C C5     . U A 1 227 ? 127.434 109.554 86.930  1.00 0.00 ? 227 U A C5     1  
ATOM 7304   C C6     . U A 1 227 ? 128.281 108.820 87.661  1.00 0.00 ? 227 U A C6     1  
ATOM 7305   H "H5'"  . U A 1 227 ? 132.450 108.163 88.260  1.00 0.00 ? 227 U A "H5'"  1  
ATOM 7306   H "H5''" . U A 1 227 ? 132.581 106.857 87.353  1.00 0.00 ? 227 U A "H5''" 1  
ATOM 7307   H "H4'"  . U A 1 227 ? 131.536 106.286 89.336  1.00 0.00 ? 227 U A "H4'"  1  
ATOM 7308   H "H3'"  . U A 1 227 ? 129.729 106.168 87.159  1.00 0.00 ? 227 U A "H3'"  1  
ATOM 7309   H "H2'"  . U A 1 227 ? 128.064 105.444 88.560  1.00 0.00 ? 227 U A "H2'"  1  
ATOM 7310   H "HO2'" . U A 1 227 ? 129.956 104.293 89.851  1.00 0.00 ? 227 U A "HO2'" 1  
ATOM 7311   H "H1'"  . U A 1 227 ? 128.557 107.194 90.412  1.00 0.00 ? 227 U A "H1'"  1  
ATOM 7312   H H3     . U A 1 227 ? 124.727 108.545 88.419  1.00 0.00 ? 227 U A H3     1  
ATOM 7313   H H5     . U A 1 227 ? 127.771 110.141 86.220  1.00 0.00 ? 227 U A H5     1  
ATOM 7314   H H6     . U A 1 227 ? 129.237 108.892 87.459  1.00 0.00 ? 227 U A H6     1  
ATOM 7315   P P      . U A 1 228 ? 130.172 103.654 86.470  1.00 0.00 ? 228 U A P      1  
ATOM 7316   O OP1    . U A 1 228 ? 131.145 102.547 86.282  1.00 0.00 ? 228 U A OP1    1  
ATOM 7317   O OP2    . U A 1 228 ? 129.900 104.590 85.351  1.00 0.00 ? 228 U A OP2    1  
ATOM 7318   O "O5'"  . U A 1 228 ? 128.787 103.022 86.932  1.00 0.00 ? 228 U A "O5'"  1  
ATOM 7319   C "C5'"  . U A 1 228 ? 128.734 102.060 87.976  1.00 0.00 ? 228 U A "C5'"  1  
ATOM 7320   C "C4'"  . U A 1 228 ? 127.330 101.871 88.490  1.00 0.00 ? 228 U A "C4'"  1  
ATOM 7321   O "O4'"  . U A 1 228 ? 126.800 103.139 88.960  1.00 0.00 ? 228 U A "O4'"  1  
ATOM 7322   C "C3'"  . U A 1 228 ? 126.303 101.392 87.476  1.00 0.00 ? 228 U A "C3'"  1  
ATOM 7323   O "O3'"  . U A 1 228 ? 126.321 99.986  87.291  1.00 0.00 ? 228 U A "O3'"  1  
ATOM 7324   C "C2'"  . U A 1 228 ? 124.995 101.915 88.054  1.00 0.00 ? 228 U A "C2'"  1  
ATOM 7325   O "O2'"  . U A 1 228 ? 124.548 101.106 89.132  1.00 0.00 ? 228 U A "O2'"  1  
ATOM 7326   C "C1'"  . U A 1 228 ? 125.429 103.277 88.602  1.00 0.00 ? 228 U A "C1'"  1  
ATOM 7327   N N1     . U A 1 228 ? 125.241 104.366 87.615  1.00 0.00 ? 228 U A N1     1  
ATOM 7328   C C2     . U A 1 228 ? 123.965 104.882 87.481  1.00 0.00 ? 228 U A C2     1  
ATOM 7329   O O2     . U A 1 228 ? 123.013 104.482 88.127  1.00 0.00 ? 228 U A O2     1  
ATOM 7330   N N3     . U A 1 228 ? 123.837 105.889 86.556  1.00 0.00 ? 228 U A N3     1  
ATOM 7331   C C4     . U A 1 228 ? 124.833 106.425 85.767  1.00 0.00 ? 228 U A C4     1  
ATOM 7332   O O4     . U A 1 228 ? 124.562 107.331 84.977  1.00 0.00 ? 228 U A O4     1  
ATOM 7333   C C5     . U A 1 228 ? 126.127 105.843 85.961  1.00 0.00 ? 228 U A C5     1  
ATOM 7334   C C6     . U A 1 228 ? 126.280 104.861 86.855  1.00 0.00 ? 228 U A C6     1  
ATOM 7335   H "H5'"  . U A 1 228 ? 129.308 102.359 88.713  1.00 0.00 ? 228 U A "H5'"  1  
ATOM 7336   H "H5''" . U A 1 228 ? 129.069 101.203 87.638  1.00 0.00 ? 228 U A "H5''" 1  
ATOM 7337   H "H4'"  . U A 1 228 ? 127.354 101.240 89.240  1.00 0.00 ? 228 U A "H4'"  1  
ATOM 7338   H "H3'"  . U A 1 228 ? 126.473 101.832 86.616  1.00 0.00 ? 228 U A "H3'"  1  
ATOM 7339   H "H2'"  . U A 1 228 ? 124.308 102.011 87.363  1.00 0.00 ? 228 U A "H2'"  1  
ATOM 7340   H "HO2'" . U A 1 228 ? 124.979 100.229 89.073  1.00 0.00 ? 228 U A "HO2'" 1  
ATOM 7341   H "H1'"  . U A 1 228 ? 124.914 103.481 89.411  1.00 0.00 ? 228 U A "H1'"  1  
ATOM 7342   H H3     . U A 1 228 ? 122.942 106.268 86.443  1.00 0.00 ? 228 U A H3     1  
ATOM 7343   H H5     . U A 1 228 ? 126.896 106.163 85.442  1.00 0.00 ? 228 U A H5     1  
ATOM 7344   H H6     . U A 1 228 ? 127.173 104.480 86.968  1.00 0.00 ? 228 U A H6     1  
ATOM 7345   P P      . G A 1 229 ? 125.867 99.348  85.888  1.00 0.00 ? 229 G A P      1  
ATOM 7346   O OP1    . G A 1 229 ? 126.334 97.938  85.849  1.00 0.00 ? 229 G A OP1    1  
ATOM 7347   O OP2    . G A 1 229 ? 126.267 100.285 84.806  1.00 0.00 ? 229 G A OP2    1  
ATOM 7348   O "O5'"  . G A 1 229 ? 124.274 99.338  85.967  1.00 0.00 ? 229 G A "O5'"  1  
ATOM 7349   C "C5'"  . G A 1 229 ? 123.595 98.456  86.847  1.00 0.00 ? 229 G A "C5'"  1  
ATOM 7350   C "C4'"  . G A 1 229 ? 122.112 98.737  86.876  1.00 0.00 ? 229 G A "C4'"  1  
ATOM 7351   O "O4'"  . G A 1 229 ? 121.880 100.101 87.319  1.00 0.00 ? 229 G A "O4'"  1  
ATOM 7352   C "C3'"  . G A 1 229 ? 121.390 98.652  85.543  1.00 0.00 ? 229 G A "C3'"  1  
ATOM 7353   O "O3'"  . G A 1 229 ? 121.047 97.324  85.181  1.00 0.00 ? 229 G A "O3'"  1  
ATOM 7354   C "C2'"  . G A 1 229 ? 120.183 99.555  85.761  1.00 0.00 ? 229 G A "C2'"  1  
ATOM 7355   O "O2'"  . G A 1 229 ? 119.178 98.899  86.522  1.00 0.00 ? 229 G A "O2'"  1  
ATOM 7356   C "C1'"  . G A 1 229 ? 120.790 100.678 86.604  1.00 0.00 ? 229 G A "C1'"  1  
ATOM 7357   N N9     . G A 1 229 ? 121.256 101.807 85.774  1.00 0.00 ? 229 G A N9     1  
ATOM 7358   C C8     . G A 1 229 ? 122.547 102.096 85.416  1.00 0.00 ? 229 G A C8     1  
ATOM 7359   N N7     . G A 1 229 ? 122.647 103.168 84.674  1.00 0.00 ? 229 G A N7     1  
ATOM 7360   C C5     . G A 1 229 ? 121.340 103.609 84.531  1.00 0.00 ? 229 G A C5     1  
ATOM 7361   C C6     . G A 1 229 ? 120.818 104.726 83.829  1.00 0.00 ? 229 G A C6     1  
ATOM 7362   O O6     . G A 1 229 ? 121.429 105.577 83.172  1.00 0.00 ? 229 G A O6     1  
ATOM 7363   N N1     . G A 1 229 ? 119.434 104.803 83.947  1.00 0.00 ? 229 G A N1     1  
ATOM 7364   C C2     . G A 1 229 ? 118.650 103.918 84.649  1.00 0.00 ? 229 G A C2     1  
ATOM 7365   N N2     . G A 1 229 ? 117.330 104.159 84.644  1.00 0.00 ? 229 G A N2     1  
ATOM 7366   N N3     . G A 1 229 ? 119.124 102.873 85.305  1.00 0.00 ? 229 G A N3     1  
ATOM 7367   C C4     . G A 1 229 ? 120.468 102.778 85.204  1.00 0.00 ? 229 G A C4     1  
ATOM 7368   H "H5'"  . G A 1 229 ? 123.959 98.560  87.750  1.00 0.00 ? 229 G A "H5'"  1  
ATOM 7369   H "H5''" . G A 1 229 ? 123.739 97.533  86.549  1.00 0.00 ? 229 G A "H5''" 1  
ATOM 7370   H "H4'"  . G A 1 229 ? 121.686 98.121  87.510  1.00 0.00 ? 229 G A "H4'"  1  
ATOM 7371   H "H3'"  . G A 1 229 ? 121.956 99.039  84.844  1.00 0.00 ? 229 G A "H3'"  1  
ATOM 7372   H "H2'"  . G A 1 229 ? 119.830 99.894  84.911  1.00 0.00 ? 229 G A "H2'"  1  
ATOM 7373   H "HO2'" . G A 1 229 ? 118.402 99.491  86.603  1.00 0.00 ? 229 G A "HO2'" 1  
ATOM 7374   H "H1'"  . G A 1 229 ? 120.124 100.999 87.247  1.00 0.00 ? 229 G A "H1'"  1  
ATOM 7375   H H8     . G A 1 229 ? 123.319 101.559 85.690  1.00 0.00 ? 229 G A H8     1  
ATOM 7376   H H1     . G A 1 229 ? 118.984 105.546 83.493  1.00 0.00 ? 229 G A H1     1  
ATOM 7377   H H21    . G A 1 229 ? 116.972 104.931 84.160  1.00 0.00 ? 229 G A H21    1  
ATOM 7378   H H22    . G A 1 229 ? 116.723 103.561 85.129  1.00 0.00 ? 229 G A H22    1  
ATOM 7379   P P      . U A 1 230 ? 121.040 96.886  83.635  1.00 0.00 ? 230 U A P      1  
ATOM 7380   O OP1    . U A 1 230 ? 120.835 95.417  83.575  1.00 0.00 ? 230 U A OP1    1  
ATOM 7381   O OP2    . U A 1 230 ? 122.230 97.488  82.981  1.00 0.00 ? 230 U A OP2    1  
ATOM 7382   O "O5'"  . U A 1 230 ? 119.743 97.589  83.040  1.00 0.00 ? 230 U A "O5'"  1  
ATOM 7383   C "C5'"  . U A 1 230 ? 118.443 97.191  83.450  1.00 0.00 ? 230 U A "C5'"  1  
ATOM 7384   C "C4'"  . U A 1 230 ? 117.382 98.129  82.929  1.00 0.00 ? 230 U A "C4'"  1  
ATOM 7385   O "O4'"  . U A 1 230 ? 117.599 99.463  83.458  1.00 0.00 ? 230 U A "O4'"  1  
ATOM 7386   C "C3'"  . U A 1 230 ? 117.344 98.329  81.421  1.00 0.00 ? 230 U A "C3'"  1  
ATOM 7387   O "O3'"  . U A 1 230 ? 116.632 97.307  80.744  1.00 0.00 ? 230 U A "O3'"  1  
ATOM 7388   C "C2'"  . U A 1 230 ? 116.715 99.708  81.286  1.00 0.00 ? 230 U A "C2'"  1  
ATOM 7389   O "O2'"  . U A 1 230 ? 115.307 99.651  81.466  1.00 0.00 ? 230 U A "O2'"  1  
ATOM 7390   C "C1'"  . U A 1 230 ? 117.337 100.447 82.469  1.00 0.00 ? 230 U A "C1'"  1  
ATOM 7391   N N1     . U A 1 230 ? 118.594 101.145 82.101  1.00 0.00 ? 230 U A N1     1  
ATOM 7392   C C2     . U A 1 230 ? 118.471 102.366 81.463  1.00 0.00 ? 230 U A C2     1  
ATOM 7393   O O2     . U A 1 230 ? 117.396 102.877 81.201  1.00 0.00 ? 230 U A O2     1  
ATOM 7394   N N3     . U A 1 230 ? 119.659 102.975 81.142  1.00 0.00 ? 230 U A N3     1  
ATOM 7395   C C4     . U A 1 230 ? 120.930 102.501 81.384  1.00 0.00 ? 230 U A C4     1  
ATOM 7396   O O4     . U A 1 230 ? 121.903 103.170 81.030  1.00 0.00 ? 230 U A O4     1  
ATOM 7397   C C5     . U A 1 230 ? 120.979 101.234 82.047  1.00 0.00 ? 230 U A C5     1  
ATOM 7398   C C6     . U A 1 230 ? 119.838 100.619 82.373  1.00 0.00 ? 230 U A C6     1  
ATOM 7399   H "H5'"  . U A 1 230 ? 118.406 97.180  84.429  1.00 0.00 ? 230 U A "H5'"  1  
ATOM 7400   H "H5''" . U A 1 230 ? 118.265 96.289  83.113  1.00 0.00 ? 230 U A "H5''" 1  
ATOM 7401   H "H4'"  . U A 1 230 ? 116.504 97.806  83.228  1.00 0.00 ? 230 U A "H4'"  1  
ATOM 7402   H "H3'"  . U A 1 230 ? 118.262 98.361  81.079  1.00 0.00 ? 230 U A "H3'"  1  
ATOM 7403   H "H2'"  . U A 1 230 ? 116.954 100.131 80.434  1.00 0.00 ? 230 U A "H2'"  1  
ATOM 7404   H "HO2'" . U A 1 230 ? 115.002 98.731  81.321  1.00 0.00 ? 230 U A "HO2'" 1  
ATOM 7405   H "H1'"  . U A 1 230 ? 116.696 101.099 82.821  1.00 0.00 ? 230 U A "H1'"  1  
ATOM 7406   H H3     . U A 1 230 ? 119.594 103.841 80.687  1.00 0.00 ? 230 U A H3     1  
ATOM 7407   H H5     . U A 1 230 ? 121.843 100.822 82.261  1.00 0.00 ? 230 U A H5     1  
ATOM 7408   H H6     . U A 1 230 ? 119.897 99.751  82.825  1.00 0.00 ? 230 U A H6     1  
ATOM 7409   P P      . A A 1 231 ? 117.059 96.874  79.257  1.00 0.00 ? 231 A A P      1  
ATOM 7410   O OP1    . A A 1 231 ? 116.472 95.537  78.982  1.00 0.00 ? 231 A A OP1    1  
ATOM 7411   O OP2    . A A 1 231 ? 118.522 97.076  79.120  1.00 0.00 ? 231 A A OP2    1  
ATOM 7412   O "O5'"  . A A 1 231 ? 116.324 97.935  78.321  1.00 0.00 ? 231 A A "O5'"  1  
ATOM 7413   C "C5'"  . A A 1 231 ? 114.916 97.899  78.143  1.00 0.00 ? 231 A A "C5'"  1  
ATOM 7414   C "C4'"  . A A 1 231 ? 114.415 99.137  77.441  1.00 0.00 ? 231 A A "C4'"  1  
ATOM 7415   O "O4'"  . A A 1 231 ? 114.780 100.315 78.207  1.00 0.00 ? 231 A A "O4'"  1  
ATOM 7416   C "C3'"  . A A 1 231 ? 114.989 99.399  76.060  1.00 0.00 ? 231 A A "C3'"  1  
ATOM 7417   O "O3'"  . A A 1 231 ? 114.323 98.675  75.037  1.00 0.00 ? 231 A A "O3'"  1  
ATOM 7418   C "C2'"  . A A 1 231 ? 114.853 100.911 75.924  1.00 0.00 ? 231 A A "C2'"  1  
ATOM 7419   O "O2'"  . A A 1 231 ? 113.518 101.285 75.623  1.00 0.00 ? 231 A A "O2'"  1  
ATOM 7420   C "C1'"  . A A 1 231 ? 115.192 101.374 77.342  1.00 0.00 ? 231 A A "C1'"  1  
ATOM 7421   N N9     . A A 1 231 ? 116.633 101.649 77.508  1.00 0.00 ? 231 A A N9     1  
ATOM 7422   C C8     . A A 1 231 ? 117.587 100.843 78.078  1.00 0.00 ? 231 A A C8     1  
ATOM 7423   N N7     . A A 1 231 ? 118.789 101.366 78.083  1.00 0.00 ? 231 A A N7     1  
ATOM 7424   C C5     . A A 1 231 ? 118.613 102.604 77.472  1.00 0.00 ? 231 A A C5     1  
ATOM 7425   C C6     . A A 1 231 ? 119.508 103.646 77.172  1.00 0.00 ? 231 A A C6     1  
ATOM 7426   N N6     . A A 1 231 ? 120.811 103.607 77.457  1.00 0.00 ? 231 A A N6     1  
ATOM 7427   N N1     . A A 1 231 ? 119.012 104.743 76.561  1.00 0.00 ? 231 A A N1     1  
ATOM 7428   C C2     . A A 1 231 ? 117.705 104.781 76.275  1.00 0.00 ? 231 A A C2     1  
ATOM 7429   N N3     . A A 1 231 ? 116.765 103.869 76.507  1.00 0.00 ? 231 A A N3     1  
ATOM 7430   C C4     . A A 1 231 ? 117.291 102.789 77.114  1.00 0.00 ? 231 A A C4     1  
ATOM 7431   H "H5'"  . A A 1 231 ? 114.483 97.832  79.021  1.00 0.00 ? 231 A A "H5'"  1  
ATOM 7432   H "H5''" . A A 1 231 ? 114.682 97.112  77.610  1.00 0.00 ? 231 A A "H5''" 1  
ATOM 7433   H "H4'"  . A A 1 231 ? 113.437 99.090  77.377  1.00 0.00 ? 231 A A "H4'"  1  
ATOM 7434   H "H3'"  . A A 1 231 ? 115.938 99.161  76.053  1.00 0.00 ? 231 A A "H3'"  1  
ATOM 7435   H "H2'"  . A A 1 231 ? 115.488 101.271 75.270  1.00 0.00 ? 231 A A "H2'"  1  
ATOM 7436   H "HO2'" . A A 1 231 ? 113.044 100.509 75.256  1.00 0.00 ? 231 A A "HO2'" 1  
ATOM 7437   H "H1'"  . A A 1 231 ? 114.678 102.181 77.551  1.00 0.00 ? 231 A A "H1'"  1  
ATOM 7438   H H8     . A A 1 231 ? 117.388 99.958  78.448  1.00 0.00 ? 231 A A H8     1  
ATOM 7439   H H61    . A A 1 231 ? 121.386 104.365 77.224  1.00 0.00 ? 231 A A H61    1  
ATOM 7440   H H62    . A A 1 231 ? 121.195 102.823 77.901  1.00 0.00 ? 231 A A H62    1  
ATOM 7441   H H2     . A A 1 231 ? 117.395 105.600 75.831  1.00 0.00 ? 231 A A H2     1  
ATOM 7442   P P      . A A 1 232 ? 115.108 98.269  73.694  1.00 0.00 ? 232 A A P      1  
ATOM 7443   O OP1    . A A 1 232 ? 114.228 97.377  72.900  1.00 0.00 ? 232 A A OP1    1  
ATOM 7444   O OP2    . A A 1 232 ? 116.467 97.809  74.076  1.00 0.00 ? 232 A A OP2    1  
ATOM 7445   O "O5'"  . A A 1 232 ? 115.259 99.645  72.904  1.00 0.00 ? 232 A A "O5'"  1  
ATOM 7446   C "C5'"  . A A 1 232 ? 114.118 100.317 72.385  1.00 0.00 ? 232 A A "C5'"  1  
ATOM 7447   C "C4'"  . A A 1 232 ? 114.475 101.683 71.857  1.00 0.00 ? 232 A A "C4'"  1  
ATOM 7448   O "O4'"  . A A 1 232 ? 115.031 102.495 72.926  1.00 0.00 ? 232 A A "O4'"  1  
ATOM 7449   C "C3'"  . A A 1 232 ? 115.538 101.723 70.770  1.00 0.00 ? 232 A A "C3'"  1  
ATOM 7450   O "O3'"  . A A 1 232 ? 115.024 101.440 69.480  1.00 0.00 ? 232 A A "O3'"  1  
ATOM 7451   C "C2'"  . A A 1 232 ? 116.105 103.128 70.909  1.00 0.00 ? 232 A A "C2'"  1  
ATOM 7452   O "O2'"  . A A 1 232 ? 115.241 104.092 70.320  1.00 0.00 ? 232 A A "O2'"  1  
ATOM 7453   C "C1'"  . A A 1 232 ? 116.092 103.315 72.426  1.00 0.00 ? 232 A A "C1'"  1  
ATOM 7454   N N9     . A A 1 232 ? 117.375 102.933 73.045  1.00 0.00 ? 232 A A N9     1  
ATOM 7455   C C8     . A A 1 232 ? 117.661 101.805 73.772  1.00 0.00 ? 232 A A C8     1  
ATOM 7456   N N7     . A A 1 232 ? 118.901 101.747 74.195  1.00 0.00 ? 232 A A N7     1  
ATOM 7457   C C5     . A A 1 232 ? 119.471 102.917 73.713  1.00 0.00 ? 232 A A C5     1  
ATOM 7458   C C6     . A A 1 232 ? 120.768 103.452 73.818  1.00 0.00 ? 232 A A C6     1  
ATOM 7459   N N6     . A A 1 232 ? 121.765 102.852 74.469  1.00 0.00 ? 232 A A N6     1  
ATOM 7460   N N1     . A A 1 232 ? 121.008 104.639 73.221  1.00 0.00 ? 232 A A N1     1  
ATOM 7461   C C2     . A A 1 232 ? 120.007 105.243 72.566  1.00 0.00 ? 232 A A C2     1  
ATOM 7462   N N3     . A A 1 232 ? 118.750 104.842 72.398  1.00 0.00 ? 232 A A N3     1  
ATOM 7463   C C4     . A A 1 232 ? 118.544 103.655 73.002  1.00 0.00 ? 232 A A C4     1  
ATOM 7464   H "H5'"  . A A 1 232 ? 113.452 100.415 73.099  1.00 0.00 ? 232 A A "H5'"  1  
ATOM 7465   H "H5''" . A A 1 232 ? 113.735 99.783  71.661  1.00 0.00 ? 232 A A "H5''" 1  
ATOM 7466   H "H4'"  . A A 1 232 ? 113.662 102.114 71.520  1.00 0.00 ? 232 A A "H4'"  1  
ATOM 7467   H "H3'"  . A A 1 232 ? 116.242 101.071 70.984  1.00 0.00 ? 232 A A "H3'"  1  
ATOM 7468   H "H2'"  . A A 1 232 ? 117.015 103.188 70.548  1.00 0.00 ? 232 A A "H2'"  1  
ATOM 7469   H "HO2'" . A A 1 232 ? 115.672 104.971 70.357  1.00 0.00 ? 232 A A "HO2'" 1  
ATOM 7470   H "H1'"  . A A 1 232 ? 115.891 104.250 72.639  1.00 0.00 ? 232 A A "H1'"  1  
ATOM 7471   H H8     . A A 1 232 ? 116.999 101.106 73.959  1.00 0.00 ? 232 A A H8     1  
ATOM 7472   H H61    . A A 1 232 ? 122.649 103.274 74.509  1.00 0.00 ? 232 A A H61    1  
ATOM 7473   H H62    . A A 1 232 ? 121.614 101.989 74.909  1.00 0.00 ? 232 A A H62    1  
ATOM 7474   H H2     . A A 1 232 ? 120.234 106.103 72.152  1.00 0.00 ? 232 A A H2     1  
ATOM 7475   P P      . U A 1 233 ? 115.957 100.739 68.374  1.00 0.00 ? 233 U A P      1  
ATOM 7476   O OP1    . U A 1 233 ? 115.106 100.410 67.199  1.00 0.00 ? 233 U A OP1    1  
ATOM 7477   O OP2    . U A 1 233 ? 116.736 99.667  69.042  1.00 0.00 ? 233 U A OP2    1  
ATOM 7478   O "O5'"  . U A 1 233 ? 116.968 101.892 67.941  1.00 0.00 ? 233 U A "O5'"  1  
ATOM 7479   C "C5'"  . U A 1 233 ? 116.511 103.048 67.258  1.00 0.00 ? 233 U A "C5'"  1  
ATOM 7480   C "C4'"  . U A 1 233 ? 117.624 104.041 67.038  1.00 0.00 ? 233 U A "C4'"  1  
ATOM 7481   O "O4'"  . U A 1 233 ? 118.127 104.513 68.315  1.00 0.00 ? 233 U A "O4'"  1  
ATOM 7482   C "C3'"  . U A 1 233 ? 118.860 103.517 66.324  1.00 0.00 ? 233 U A "C3'"  1  
ATOM 7483   O "O3'"  . U A 1 233 ? 118.714 103.480 64.916  1.00 0.00 ? 233 U A "O3'"  1  
ATOM 7484   C "C2'"  . U A 1 233 ? 119.949 104.469 66.799  1.00 0.00 ? 233 U A "C2'"  1  
ATOM 7485   O "O2'"  . U A 1 233 ? 119.887 105.709 66.106  1.00 0.00 ? 233 U A "O2'"  1  
ATOM 7486   C "C1'"  . U A 1 233 ? 119.541 104.695 68.257  1.00 0.00 ? 233 U A "C1'"  1  
ATOM 7487   N N1     . U A 1 233 ? 120.222 103.757 69.183  1.00 0.00 ? 233 U A N1     1  
ATOM 7488   C C2     . U A 1 233 ? 121.544 104.018 69.487  1.00 0.00 ? 233 U A C2     1  
ATOM 7489   O O2     . U A 1 233 ? 122.155 104.971 69.035  1.00 0.00 ? 233 U A O2     1  
ATOM 7490   N N3     . U A 1 233 ? 122.131 103.124 70.348  1.00 0.00 ? 233 U A N3     1  
ATOM 7491   C C4     . U A 1 233 ? 121.547 102.017 70.923  1.00 0.00 ? 233 U A C4     1  
ATOM 7492   O O4     . U A 1 233 ? 122.210 101.306 71.679  1.00 0.00 ? 233 U A O4     1  
ATOM 7493   C C5     . U A 1 233 ? 120.178 101.808 70.563  1.00 0.00 ? 233 U A C5     1  
ATOM 7494   C C6     . U A 1 233 ? 119.579 102.665 69.729  1.00 0.00 ? 233 U A C6     1  
ATOM 7495   H "H5'"  . U A 1 233 ? 115.804 103.473 67.791  1.00 0.00 ? 233 U A "H5'"  1  
ATOM 7496   H "H5''" . U A 1 233 ? 116.143 102.784 66.390  1.00 0.00 ? 233 U A "H5''" 1  
ATOM 7497   H "H4'"  . U A 1 233 ? 117.268 104.805 66.535  1.00 0.00 ? 233 U A "H4'"  1  
ATOM 7498   H "H3'"  . U A 1 233 ? 119.061 102.615 66.652  1.00 0.00 ? 233 U A "H3'"  1  
ATOM 7499   H "H2'"  . U A 1 233 ? 120.838 104.061 66.736  1.00 0.00 ? 233 U A "H2'"  1  
ATOM 7500   H "HO2'" . U A 1 233 ? 120.646 106.265 66.382  1.00 0.00 ? 233 U A "HO2'" 1  
ATOM 7501   H "H1'"  . U A 1 233 ? 119.755 105.615 68.516  1.00 0.00 ? 233 U A "H1'"  1  
ATOM 7502   H H3     . U A 1 233 ? 123.071 103.292 70.577  1.00 0.00 ? 233 U A H3     1  
ATOM 7503   H H5     . U A 1 233 ? 119.682 101.044 70.926  1.00 0.00 ? 233 U A H5     1  
ATOM 7504   H H6     . U A 1 233 ? 118.643 102.500 69.495  1.00 0.00 ? 233 U A H6     1  
ATOM 7505   P P      . U A 1 234 ? 119.480 102.363 64.052  1.00 0.00 ? 234 U A P      1  
ATOM 7506   O OP1    . U A 1 234 ? 119.555 102.840 62.647  1.00 0.00 ? 234 U A OP1    1  
ATOM 7507   O OP2    . U A 1 234 ? 118.860 101.047 64.348  1.00 0.00 ? 234 U A OP2    1  
ATOM 7508   O "O5'"  . U A 1 234 ? 120.956 102.359 64.650  1.00 0.00 ? 234 U A "O5'"  1  
ATOM 7509   C "C5'"  . U A 1 234 ? 121.960 103.213 64.124  1.00 0.00 ? 234 U A "C5'"  1  
ATOM 7510   C "C4'"  . U A 1 234 ? 123.264 103.066 64.868  1.00 0.00 ? 234 U A "C4'"  1  
ATOM 7511   O "O4'"  . U A 1 234 ? 123.006 103.016 66.294  1.00 0.00 ? 234 U A "O4'"  1  
ATOM 7512   C "C3'"  . U A 1 234 ? 124.055 101.797 64.589  1.00 0.00 ? 234 U A "C3'"  1  
ATOM 7513   O "O3'"  . U A 1 234 ? 124.829 101.875 63.406  1.00 0.00 ? 234 U A "O3'"  1  
ATOM 7514   C "C2'"  . U A 1 234 ? 124.894 101.637 65.851  1.00 0.00 ? 234 U A "C2'"  1  
ATOM 7515   O "O2'"  . U A 1 234 ? 126.044 102.471 65.812  1.00 0.00 ? 234 U A "O2'"  1  
ATOM 7516   C "C1'"  . U A 1 234 ? 123.937 102.160 66.927  1.00 0.00 ? 234 U A "C1'"  1  
ATOM 7517   N N1     . U A 1 234 ? 123.198 101.066 67.602  1.00 0.00 ? 234 U A N1     1  
ATOM 7518   C C2     . U A 1 234 ? 123.865 100.373 68.595  1.00 0.00 ? 234 U A C2     1  
ATOM 7519   O O2     . U A 1 234 ? 125.010 100.624 68.927  1.00 0.00 ? 234 U A O2     1  
ATOM 7520   N N3     . U A 1 234 ? 123.141 99.370  69.192  1.00 0.00 ? 234 U A N3     1  
ATOM 7521   C C4     . U A 1 234 ? 121.846 98.995  68.904  1.00 0.00 ? 234 U A C4     1  
ATOM 7522   O O4     . U A 1 234 ? 121.332 98.068  69.532  1.00 0.00 ? 234 U A O4     1  
ATOM 7523   C C5     . U A 1 234 ? 121.219 99.756  67.867  1.00 0.00 ? 234 U A C5     1  
ATOM 7524   C C6     . U A 1 234 ? 121.900 100.739 67.270  1.00 0.00 ? 234 U A C6     1  
ATOM 7525   H "H5'"  . U A 1 234 ? 121.657 104.143 64.193  1.00 0.00 ? 234 U A "H5'"  1  
ATOM 7526   H "H5''" . U A 1 234 ? 122.104 102.993 63.180  1.00 0.00 ? 234 U A "H5''" 1  
ATOM 7527   H "H4'"  . U A 1 234 ? 123.829 103.842 64.673  1.00 0.00 ? 234 U A "H4'"  1  
ATOM 7528   H "H3'"  . U A 1 234 ? 123.437 101.040 64.522  1.00 0.00 ? 234 U A "H3'"  1  
ATOM 7529   H "H2'"  . U A 1 234 ? 125.132 100.700 66.008  1.00 0.00 ? 234 U A "H2'"  1  
ATOM 7530   H "HO2'" . U A 1 234 ? 126.555 102.347 66.640  1.00 0.00 ? 234 U A "HO2'" 1  
ATOM 7531   H "H1'"  . U A 1 234 ? 124.447 102.667 67.593  1.00 0.00 ? 234 U A "H1'"  1  
ATOM 7532   H H3     . U A 1 234 ? 123.595 98.866  69.898  1.00 0.00 ? 234 U A H3     1  
ATOM 7533   H H5     . U A 1 234 ? 120.297 99.558  67.598  1.00 0.00 ? 234 U A H5     1  
ATOM 7534   H H6     . U A 1 234 ? 121.449 101.244 66.562  1.00 0.00 ? 234 U A H6     1  
ATOM 7535   P P      . C A 1 235 ? 125.114 100.555 62.536  1.00 0.00 ? 235 C A P      1  
ATOM 7536   O OP1    . C A 1 235 ? 125.586 100.982 61.194  1.00 0.00 ? 235 C A OP1    1  
ATOM 7537   O OP2    . C A 1 235 ? 123.931 99.665  62.647  1.00 0.00 ? 235 C A OP2    1  
ATOM 7538   O "O5'"  . C A 1 235 ? 126.332 99.853  63.285  1.00 0.00 ? 235 C A "O5'"  1  
ATOM 7539   C "C5'"  . C A 1 235 ? 127.669 100.271 63.055  1.00 0.00 ? 235 C A "C5'"  1  
ATOM 7540   C "C4'"  . C A 1 235 ? 128.644 99.529  63.936  1.00 0.00 ? 235 C A "C4'"  1  
ATOM 7541   O "O4'"  . C A 1 235 ? 127.925 98.934  65.031  1.00 0.00 ? 235 C A "O4'"  1  
ATOM 7542   C "C3'"  . C A 1 235 ? 129.381 98.367  63.289  1.00 0.00 ? 235 C A "C3'"  1  
ATOM 7543   O "O3'"  . C A 1 235 ? 130.559 98.768  62.611  1.00 0.00 ? 235 C A "O3'"  1  
ATOM 7544   C "C2'"  . C A 1 235 ? 129.683 97.455  64.470  1.00 0.00 ? 235 C A "C2'"  1  
ATOM 7545   O "O2'"  . C A 1 235 ? 130.853 97.874  65.157  1.00 0.00 ? 235 C A "O2'"  1  
ATOM 7546   C "C1'"  . C A 1 235 ? 128.470 97.692  65.372  1.00 0.00 ? 235 C A "C1'"  1  
ATOM 7547   N N1     . C A 1 235 ? 127.442 96.632  65.224  1.00 0.00 ? 235 C A N1     1  
ATOM 7548   C C2     . C A 1 235 ? 127.610 95.438  65.937  1.00 0.00 ? 235 C A C2     1  
ATOM 7549   O O2     . C A 1 235 ? 128.605 95.302  66.666  1.00 0.00 ? 235 C A O2     1  
ATOM 7550   N N3     . C A 1 235 ? 126.688 94.456  65.820  1.00 0.00 ? 235 C A N3     1  
ATOM 7551   C C4     . C A 1 235 ? 125.627 94.626  65.030  1.00 0.00 ? 235 C A C4     1  
ATOM 7552   N N4     . C A 1 235 ? 124.743 93.629  64.945  1.00 0.00 ? 235 C A N4     1  
ATOM 7553   C C5     . C A 1 235 ? 125.428 95.826  64.292  1.00 0.00 ? 235 C A C5     1  
ATOM 7554   C C6     . C A 1 235 ? 126.347 96.792  64.417  1.00 0.00 ? 235 C A C6     1  
ATOM 7555   H "H5'"  . C A 1 235 ? 127.739 101.231 63.237  1.00 0.00 ? 235 C A "H5'"  1  
ATOM 7556   H "H5''" . C A 1 235 ? 127.897 100.106 62.116  1.00 0.00 ? 235 C A "H5''" 1  
ATOM 7557   H "H4'"  . C A 1 235 ? 129.300 100.167 64.287  1.00 0.00 ? 235 C A "H4'"  1  
ATOM 7558   H "H3'"  . C A 1 235 ? 128.776 97.901  62.676  1.00 0.00 ? 235 C A "H3'"  1  
ATOM 7559   H "H2'"  . C A 1 235 ? 129.742 96.518  64.192  1.00 0.00 ? 235 C A "H2'"  1  
ATOM 7560   H "HO2'" . C A 1 235 ? 130.626 98.619  65.751  1.00 0.00 ? 235 C A "HO2'" 1  
ATOM 7561   H "H1'"  . C A 1 235 ? 128.766 97.731  66.305  1.00 0.00 ? 235 C A "H1'"  1  
ATOM 7562   H H41    . C A 1 235 ? 124.884 92.804  65.455  1.00 0.00 ? 235 C A H41    1  
ATOM 7563   H H42    . C A 1 235 ? 123.953 93.724  64.374  1.00 0.00 ? 235 C A H42    1  
ATOM 7564   H H5     . C A 1 235 ? 124.645 95.943  63.714  1.00 0.00 ? 235 C A H5     1  
ATOM 7565   H H6     . C A 1 235 ? 126.227 97.625  63.917  1.00 0.00 ? 235 C A H6     1  
ATOM 7566   P P      . A A 1 236 ? 131.024 98.002  61.277  1.00 0.00 ? 236 A A P      1  
ATOM 7567   O OP1    . A A 1 236 ? 130.540 98.777  60.107  1.00 0.00 ? 236 A A OP1    1  
ATOM 7568   O OP2    . A A 1 236 ? 130.652 96.571  61.415  1.00 0.00 ? 236 A A OP2    1  
ATOM 7569   O "O5'"  . A A 1 236 ? 132.615 98.101  61.310  1.00 0.00 ? 236 A A "O5'"  1  
ATOM 7570   C "C5'"  . A A 1 236 ? 133.289 98.615  62.449  1.00 0.00 ? 236 A A "C5'"  1  
ATOM 7571   C "C4'"  . A A 1 236 ? 134.425 97.719  62.872  1.00 0.00 ? 236 A A "C4'"  1  
ATOM 7572   O "O4'"  . A A 1 236 ? 134.474 96.532  62.055  1.00 0.00 ? 236 A A "O4'"  1  
ATOM 7573   C "C3'"  . A A 1 236 ? 135.825 98.287  62.694  1.00 0.00 ? 236 A A "C3'"  1  
ATOM 7574   O "O3'"  . A A 1 236 ? 136.137 99.299  63.636  1.00 0.00 ? 236 A A "O3'"  1  
ATOM 7575   C "C2'"  . A A 1 236 ? 136.661 97.013  62.833  1.00 0.00 ? 236 A A "C2'"  1  
ATOM 7576   O "O2'"  . A A 1 236 ? 136.753 96.603  64.190  1.00 0.00 ? 236 A A "O2'"  1  
ATOM 7577   C "C1'"  . A A 1 236 ? 135.782 96.035  62.061  1.00 0.00 ? 236 A A "C1'"  1  
ATOM 7578   N N9     . A A 1 236 ? 136.240 95.855  60.670  1.00 0.00 ? 236 A A N9     1  
ATOM 7579   C C8     . A A 1 236 ? 135.771 96.478  59.540  1.00 0.00 ? 236 A A C8     1  
ATOM 7580   N N7     . A A 1 236 ? 136.381 96.108  58.441  1.00 0.00 ? 236 A A N7     1  
ATOM 7581   C C5     . A A 1 236 ? 137.316 95.178  58.876  1.00 0.00 ? 236 A A C5     1  
ATOM 7582   C C6     . A A 1 236 ? 138.279 94.413  58.195  1.00 0.00 ? 236 A A C6     1  
ATOM 7583   N N6     . A A 1 236 ? 138.468 94.466  56.874  1.00 0.00 ? 236 A A N6     1  
ATOM 7584   N N1     . A A 1 236 ? 139.052 93.580  58.925  1.00 0.00 ? 236 A A N1     1  
ATOM 7585   C C2     . A A 1 236 ? 138.863 93.526  60.250  1.00 0.00 ? 236 A A C2     1  
ATOM 7586   N N3     . A A 1 236 ? 137.992 94.194  61.003  1.00 0.00 ? 236 A A N3     1  
ATOM 7587   C C4     . A A 1 236 ? 137.239 95.013  60.246  1.00 0.00 ? 236 A A C4     1  
ATOM 7588   H "H5'"  . A A 1 236 ? 132.651 98.694  63.190  1.00 0.00 ? 236 A A "H5'"  1  
ATOM 7589   H "H5''" . A A 1 236 ? 133.643 99.504  62.238  1.00 0.00 ? 236 A A "H5''" 1  
ATOM 7590   H "H4'"  . A A 1 236 ? 134.286 97.448  63.804  1.00 0.00 ? 236 A A "H4'"  1  
ATOM 7591   H "H3'"  . A A 1 236 ? 135.913 98.648  61.787  1.00 0.00 ? 236 A A "H3'"  1  
ATOM 7592   H "H2'"  . A A 1 236 ? 137.545 97.118  62.424  1.00 0.00 ? 236 A A "H2'"  1  
ATOM 7593   H "HO2'" . A A 1 236 ? 137.300 95.792  64.241  1.00 0.00 ? 236 A A "HO2'" 1  
ATOM 7594   H "H1'"  . A A 1 236 ? 135.779 95.168  62.519  1.00 0.00 ? 236 A A "H1'"  1  
ATOM 7595   H H8     . A A 1 236 ? 135.047 97.139  59.553  1.00 0.00 ? 236 A A H8     1  
ATOM 7596   H H61    . A A 1 236 ? 139.156 93.908  56.455  1.00 0.00 ? 236 A A H61    1  
ATOM 7597   H H62    . A A 1 236 ? 137.919 95.063  56.324  1.00 0.00 ? 236 A A H62    1  
ATOM 7598   H H2     . A A 1 236 ? 139.449 92.907  60.733  1.00 0.00 ? 236 A A H2     1  
ATOM 7599   P P      . U A 1 237 ? 137.511 100.116 63.504  1.00 0.00 ? 237 U A P      1  
ATOM 7600   O OP1    . U A 1 237 ? 137.214 101.571 63.538  1.00 0.00 ? 237 U A OP1    1  
ATOM 7601   O OP2    . U A 1 237 ? 138.126 99.521  62.291  1.00 0.00 ? 237 U A OP2    1  
ATOM 7602   O "O5'"  . U A 1 237 ? 138.443 99.774  64.749  1.00 0.00 ? 237 U A "O5'"  1  
ATOM 7603   C "C5'"  . U A 1 237 ? 139.103 100.801 65.471  1.00 0.00 ? 237 U A "C5'"  1  
ATOM 7604   C "C4'"  . U A 1 237 ? 138.850 100.689 66.955  1.00 0.00 ? 237 U A "C4'"  1  
ATOM 7605   O "O4'"  . U A 1 237 ? 137.562 101.269 67.280  1.00 0.00 ? 237 U A "O4'"  1  
ATOM 7606   C "C3'"  . U A 1 237 ? 138.774 99.279  67.516  1.00 0.00 ? 237 U A "C3'"  1  
ATOM 7607   O "O3'"  . U A 1 237 ? 140.050 98.716  67.775  1.00 0.00 ? 237 U A "O3'"  1  
ATOM 7608   C "C2'"  . U A 1 237 ? 137.925 99.464  68.766  1.00 0.00 ? 237 U A "C2'"  1  
ATOM 7609   O "O2'"  . U A 1 237 ? 138.685 100.020 69.829  1.00 0.00 ? 237 U A "O2'"  1  
ATOM 7610   C "C1'"  . U A 1 237 ? 136.905 100.499 68.289  1.00 0.00 ? 237 U A "C1'"  1  
ATOM 7611   N N1     . U A 1 237 ? 135.684 99.871  67.730  1.00 0.00 ? 237 U A N1     1  
ATOM 7612   C C2     . U A 1 237 ? 134.757 99.379  68.632  1.00 0.00 ? 237 U A C2     1  
ATOM 7613   O O2     . U A 1 237 ? 134.904 99.443  69.841  1.00 0.00 ? 237 U A O2     1  
ATOM 7614   N N3     . U A 1 237 ? 133.643 98.808  68.070  1.00 0.00 ? 237 U A N3     1  
ATOM 7615   C C4     . U A 1 237 ? 133.364 98.675  66.725  1.00 0.00 ? 237 U A C4     1  
ATOM 7616   O O4     . U A 1 237 ? 132.316 98.134  66.377  1.00 0.00 ? 237 U A O4     1  
ATOM 7617   C C5     . U A 1 237 ? 134.367 99.206  65.853  1.00 0.00 ? 237 U A C5     1  
ATOM 7618   C C6     . U A 1 237 ? 135.462 99.771  66.372  1.00 0.00 ? 237 U A C6     1  
ATOM 7619   H "H5'"  . U A 1 237 ? 138.781 101.671 65.157  1.00 0.00 ? 237 U A "H5'"  1  
ATOM 7620   H "H5''" . U A 1 237 ? 140.067 100.740 65.306  1.00 0.00 ? 237 U A "H5''" 1  
ATOM 7621   H "H4'"  . U A 1 237 ? 139.551 101.183 67.430  1.00 0.00 ? 237 U A "H4'"  1  
ATOM 7622   H "H3'"  . U A 1 237 ? 138.294 98.706  66.883  1.00 0.00 ? 237 U A "H3'"  1  
ATOM 7623   H "H2'"  . U A 1 237 ? 137.487 98.627  69.032  1.00 0.00 ? 237 U A "H2'"  1  
ATOM 7624   H "HO2'" . U A 1 237 ? 139.639 99.873  69.651  1.00 0.00 ? 237 U A "HO2'" 1  
ATOM 7625   H "H1'"  . U A 1 237 ? 136.656 101.080 69.040  1.00 0.00 ? 237 U A "H1'"  1  
ATOM 7626   H H3     . U A 1 237 ? 132.975 98.453  68.691  1.00 0.00 ? 237 U A H3     1  
ATOM 7627   H H5     . U A 1 237 ? 134.249 99.157  64.879  1.00 0.00 ? 237 U A H5     1  
ATOM 7628   H H6     . U A 1 237 ? 136.133 100.125 65.755  1.00 0.00 ? 237 U A H6     1  
ATOM 7629   P P      . G A 1 238 ? 140.269 97.127  67.676  1.00 0.00 ? 238 G A P      1  
ATOM 7630   O OP1    . G A 1 238 ? 141.727 96.857  67.746  1.00 0.00 ? 238 G A OP1    1  
ATOM 7631   O OP2    . G A 1 238 ? 139.487 96.626  66.517  1.00 0.00 ? 238 G A OP2    1  
ATOM 7632   O "O5'"  . G A 1 238 ? 139.598 96.560  69.005  1.00 0.00 ? 238 G A "O5'"  1  
ATOM 7633   C "C5'"  . G A 1 238 ? 140.166 96.825  70.278  1.00 0.00 ? 238 G A "C5'"  1  
ATOM 7634   C "C4'"  . G A 1 238 ? 139.278 96.336  71.395  1.00 0.00 ? 238 G A "C4'"  1  
ATOM 7635   O "O4'"  . G A 1 238 ? 137.988 97.001  71.326  1.00 0.00 ? 238 G A "O4'"  1  
ATOM 7636   C "C3'"  . G A 1 238 ? 138.934 94.855  71.372  1.00 0.00 ? 238 G A "C3'"  1  
ATOM 7637   O "O3'"  . G A 1 238 ? 139.955 94.038  71.919  1.00 0.00 ? 238 G A "O3'"  1  
ATOM 7638   C "C2'"  . G A 1 238 ? 137.629 94.807  72.154  1.00 0.00 ? 238 G A "C2'"  1  
ATOM 7639   O "O2'"  . G A 1 238 ? 137.862 94.891  73.551  1.00 0.00 ? 238 G A "O2'"  1  
ATOM 7640   C "C1'"  . G A 1 238 ? 136.941 96.091  71.687  1.00 0.00 ? 238 G A "C1'"  1  
ATOM 7641   N N9     . G A 1 238 ? 136.045 95.857  70.539  1.00 0.00 ? 238 G A N9     1  
ATOM 7642   C C8     . G A 1 238 ? 136.263 96.204  69.228  1.00 0.00 ? 238 G A C8     1  
ATOM 7643   N N7     . G A 1 238 ? 135.282 95.863  68.437  1.00 0.00 ? 238 G A N7     1  
ATOM 7644   C C5     . G A 1 238 ? 134.360 95.253  69.275  1.00 0.00 ? 238 G A C5     1  
ATOM 7645   C C6     . G A 1 238 ? 133.095 94.678  68.988  1.00 0.00 ? 238 G A C6     1  
ATOM 7646   O O6     . G A 1 238 ? 132.518 94.593  67.897  1.00 0.00 ? 238 G A O6     1  
ATOM 7647   N N1     . G A 1 238 ? 132.491 94.169  70.133  1.00 0.00 ? 238 G A N1     1  
ATOM 7648   C C2     . G A 1 238 ? 133.034 94.209  71.394  1.00 0.00 ? 238 G A C2     1  
ATOM 7649   N N2     . G A 1 238 ? 132.297 93.665  72.375  1.00 0.00 ? 238 G A N2     1  
ATOM 7650   N N3     . G A 1 238 ? 134.212 94.741  71.675  1.00 0.00 ? 238 G A N3     1  
ATOM 7651   C C4     . G A 1 238 ? 134.816 95.238  70.577  1.00 0.00 ? 238 G A C4     1  
ATOM 7652   H "H5'"  . G A 1 238 ? 140.296 97.794  70.373  1.00 0.00 ? 238 G A "H5'"  1  
ATOM 7653   H "H5''" . G A 1 238 ? 141.035 96.378  70.340  1.00 0.00 ? 238 G A "H5''" 1  
ATOM 7654   H "H4'"  . G A 1 238 ? 139.700 96.549  72.254  1.00 0.00 ? 238 G A "H4'"  1  
ATOM 7655   H "H3'"  . G A 1 238 ? 138.762 94.579  70.445  1.00 0.00 ? 238 G A "H3'"  1  
ATOM 7656   H "H2'"  . G A 1 238 ? 137.098 94.014  71.923  1.00 0.00 ? 238 G A "H2'"  1  
ATOM 7657   H "HO2'" . G A 1 238 ? 138.792 94.645  73.737  1.00 0.00 ? 238 G A "HO2'" 1  
ATOM 7658   H "H1'"  . G A 1 238 ? 136.431 96.476  72.428  1.00 0.00 ? 238 G A "H1'"  1  
ATOM 7659   H H8     . G A 1 238 ? 137.071 96.662  68.918  1.00 0.00 ? 238 G A H8     1  
ATOM 7660   H H1     . G A 1 238 ? 131.610 93.753  70.031  1.00 0.00 ? 238 G A H1     1  
ATOM 7661   H H21    . G A 1 238 ? 131.426 93.269  72.176  1.00 0.00 ? 238 G A H21    1  
ATOM 7662   H H22    . G A 1 238 ? 132.635 93.663  73.298  1.00 0.00 ? 238 G A H22    1  
ATOM 7663   P P      . G A 1 239 ? 140.165 92.540  71.377  1.00 0.00 ? 239 G A P      1  
ATOM 7664   O OP1    . G A 1 239 ? 141.441 92.025  71.936  1.00 0.00 ? 239 G A OP1    1  
ATOM 7665   O OP2    . G A 1 239 ? 139.958 92.549  69.906  1.00 0.00 ? 239 G A OP2    1  
ATOM 7666   O "O5'"  . G A 1 239 ? 138.970 91.719  72.038  1.00 0.00 ? 239 G A "O5'"  1  
ATOM 7667   C "C5'"  . G A 1 239 ? 138.922 91.502  73.440  1.00 0.00 ? 239 G A "C5'"  1  
ATOM 7668   C "C4'"  . G A 1 239 ? 137.641 90.822  73.853  1.00 0.00 ? 239 G A "C4'"  1  
ATOM 7669   O "O4'"  . G A 1 239 ? 136.507 91.659  73.509  1.00 0.00 ? 239 G A "O4'"  1  
ATOM 7670   C "C3'"  . G A 1 239 ? 137.341 89.494  73.173  1.00 0.00 ? 239 G A "C3'"  1  
ATOM 7671   O "O3'"  . G A 1 239 ? 138.029 88.403  73.761  1.00 0.00 ? 239 G A "O3'"  1  
ATOM 7672   C "C2'"  . G A 1 239 ? 135.826 89.396  73.288  1.00 0.00 ? 239 G A "C2'"  1  
ATOM 7673   O "O2'"  . G A 1 239 ? 135.435 88.996  74.594  1.00 0.00 ? 239 G A "O2'"  1  
ATOM 7674   C "C1'"  . G A 1 239 ? 135.408 90.851  73.069  1.00 0.00 ? 239 G A "C1'"  1  
ATOM 7675   N N9     . G A 1 239 ? 135.088 91.130  71.659  1.00 0.00 ? 239 G A N9     1  
ATOM 7676   C C8     . G A 1 239 ? 135.844 91.843  70.758  1.00 0.00 ? 239 G A C8     1  
ATOM 7677   N N7     . G A 1 239 ? 135.294 91.922  69.575  1.00 0.00 ? 239 G A N7     1  
ATOM 7678   C C5     . G A 1 239 ? 134.105 91.219  69.701  1.00 0.00 ? 239 G A C5     1  
ATOM 7679   C C6     . G A 1 239 ? 133.084 90.961  68.749  1.00 0.00 ? 239 G A C6     1  
ATOM 7680   O O6     . G A 1 239 ? 133.028 91.314  67.565  1.00 0.00 ? 239 G A O6     1  
ATOM 7681   N N1     . G A 1 239 ? 132.051 90.208  69.297  1.00 0.00 ? 239 G A N1     1  
ATOM 7682   C C2     . G A 1 239 ? 132.003 89.760  70.597  1.00 0.00 ? 239 G A C2     1  
ATOM 7683   N N2     . G A 1 239 ? 130.921 89.047  70.941  1.00 0.00 ? 239 G A N2     1  
ATOM 7684   N N3     . G A 1 239 ? 132.947 89.995  71.493  1.00 0.00 ? 239 G A N3     1  
ATOM 7685   C C4     . G A 1 239 ? 133.961 90.725  70.981  1.00 0.00 ? 239 G A C4     1  
ATOM 7686   H "H5'"  . G A 1 239 ? 138.988 92.367  73.900  1.00 0.00 ? 239 G A "H5'"  1  
ATOM 7687   H "H5''" . G A 1 239 ? 139.681 90.944  73.703  1.00 0.00 ? 239 G A "H5''" 1  
ATOM 7688   H "H4'"  . G A 1 239 ? 137.653 90.686  74.823  1.00 0.00 ? 239 G A "H4'"  1  
ATOM 7689   H "H3'"  . G A 1 239 ? 137.587 89.557  72.225  1.00 0.00 ? 239 G A "H3'"  1  
ATOM 7690   H "H2'"  . G A 1 239 ? 135.451 88.808  72.600  1.00 0.00 ? 239 G A "H2'"  1  
ATOM 7691   H "HO2'" . G A 1 239 ? 136.195 88.568  75.037  1.00 0.00 ? 239 G A "HO2'" 1  
ATOM 7692   H "H1'"  . G A 1 239 ? 134.629 91.054  73.628  1.00 0.00 ? 239 G A "H1'"  1  
ATOM 7693   H H8     . G A 1 239 ? 136.707 92.251  70.980  1.00 0.00 ? 239 G A H8     1  
ATOM 7694   H H1     . G A 1 239 ? 131.299 89.981  68.710  1.00 0.00 ? 239 G A H1     1  
ATOM 7695   H H21    . G A 1 239 ? 130.218 88.870  70.282  1.00 0.00 ? 239 G A H21    1  
ATOM 7696   H H22    . G A 1 239 ? 130.834 88.701  71.855  1.00 0.00 ? 239 G A H22    1  
ATOM 7697   P P      . C A 1 240 ? 138.431 87.131  72.868  1.00 0.00 ? 240 C A P      1  
ATOM 7698   O OP1    . C A 1 240 ? 139.350 86.280  73.669  1.00 0.00 ? 240 C A OP1    1  
ATOM 7699   O OP2    . C A 1 240 ? 138.861 87.619  71.533  1.00 0.00 ? 240 C A OP2    1  
ATOM 7700   O "O5'"  . C A 1 240 ? 137.062 86.338  72.686  1.00 0.00 ? 240 C A "O5'"  1  
ATOM 7701   C "C5'"  . C A 1 240 ? 136.425 85.718  73.794  1.00 0.00 ? 240 C A "C5'"  1  
ATOM 7702   C "C4'"  . C A 1 240 ? 135.074 85.157  73.416  1.00 0.00 ? 240 C A "C4'"  1  
ATOM 7703   O "O4'"  . C A 1 240 ? 134.206 86.225  72.959  1.00 0.00 ? 240 C A "O4'"  1  
ATOM 7704   C "C3'"  . C A 1 240 ? 135.061 84.152  72.276  1.00 0.00 ? 240 C A "C3'"  1  
ATOM 7705   O "O3'"  . C A 1 240 ? 135.397 82.839  72.688  1.00 0.00 ? 240 C A "O3'"  1  
ATOM 7706   C "C2'"  . C A 1 240 ? 133.643 84.282  71.738  1.00 0.00 ? 240 C A "C2'"  1  
ATOM 7707   O "O2'"  . C A 1 240 ? 132.715 83.587  72.561  1.00 0.00 ? 240 C A "O2'"  1  
ATOM 7708   C "C1'"  . C A 1 240 ? 133.399 85.785  71.873  1.00 0.00 ? 240 C A "C1'"  1  
ATOM 7709   N N1     . C A 1 240 ? 133.748 86.525  70.635  1.00 0.00 ? 240 C A N1     1  
ATOM 7710   C C2     . C A 1 240 ? 132.844 86.494  69.566  1.00 0.00 ? 240 C A C2     1  
ATOM 7711   O O2     . C A 1 240 ? 131.786 85.854  69.682  1.00 0.00 ? 240 C A O2     1  
ATOM 7712   N N3     . C A 1 240 ? 133.136 87.160  68.427  1.00 0.00 ? 240 C A N3     1  
ATOM 7713   C C4     . C A 1 240 ? 134.279 87.840  68.326  1.00 0.00 ? 240 C A C4     1  
ATOM 7714   N N4     . C A 1 240 ? 134.528 88.485  67.181  1.00 0.00 ? 240 C A N4     1  
ATOM 7715   C C5     . C A 1 240 ? 135.218 87.891  69.394  1.00 0.00 ? 240 C A C5     1  
ATOM 7716   C C6     . C A 1 240 ? 134.917 87.228  70.518  1.00 0.00 ? 240 C A C6     1  
ATOM 7717   H "H5'"  . C A 1 240 ? 136.308 86.382  74.506  1.00 0.00 ? 240 C A "H5'"  1  
ATOM 7718   H "H5''" . C A 1 240 ? 136.993 84.991  74.122  1.00 0.00 ? 240 C A "H5''" 1  
ATOM 7719   H "H4'"  . C A 1 240 ? 134.676 84.740  74.212  1.00 0.00 ? 240 C A "H4'"  1  
ATOM 7720   H "H3'"  . C A 1 240 ? 135.692 84.444  71.584  1.00 0.00 ? 240 C A "H3'"  1  
ATOM 7721   H "H2'"  . C A 1 240 ? 133.583 83.989  70.803  1.00 0.00 ? 240 C A "H2'"  1  
ATOM 7722   H "HO2'" . C A 1 240 ? 131.822 83.656  72.165  1.00 0.00 ? 240 C A "HO2'" 1  
ATOM 7723   H "H1'"  . C A 1 240 ? 132.457 85.943  72.092  1.00 0.00 ? 240 C A "H1'"  1  
ATOM 7724   H H41    . C A 1 240 ? 133.878 88.447  66.448  1.00 0.00 ? 240 C A H41    1  
ATOM 7725   H H42    . C A 1 240 ? 135.357 88.993  67.076  1.00 0.00 ? 240 C A H42    1  
ATOM 7726   H H5     . C A 1 240 ? 136.055 88.395  69.310  1.00 0.00 ? 240 C A H5     1  
ATOM 7727   H H6     . C A 1 240 ? 135.549 87.249  71.263  1.00 0.00 ? 240 C A H6     1  
ATOM 7728   P P      . C A 1 241 ? 136.128 81.835  71.670  1.00 0.00 ? 241 C A P      1  
ATOM 7729   O OP1    . C A 1 241 ? 136.578 80.646  72.440  1.00 0.00 ? 241 C A OP1    1  
ATOM 7730   O OP2    . C A 1 241 ? 137.118 82.615  70.883  1.00 0.00 ? 241 C A OP2    1  
ATOM 7731   O "O5'"  . C A 1 241 ? 134.967 81.372  70.684  1.00 0.00 ? 241 C A "O5'"  1  
ATOM 7732   C "C5'"  . C A 1 241 ? 133.902 80.555  71.143  1.00 0.00 ? 241 C A "C5'"  1  
ATOM 7733   C "C4'"  . C A 1 241 ? 132.858 80.345  70.074  1.00 0.00 ? 241 C A "C4'"  1  
ATOM 7734   O "O4'"  . C A 1 241 ? 132.271 81.619  69.700  1.00 0.00 ? 241 C A "O4'"  1  
ATOM 7735   C "C3'"  . C A 1 241 ? 133.353 79.765  68.758  1.00 0.00 ? 241 C A "C3'"  1  
ATOM 7736   O "O3'"  . C A 1 241 ? 133.493 78.355  68.790  1.00 0.00 ? 241 C A "O3'"  1  
ATOM 7737   C "C2'"  . C A 1 241 ? 132.308 80.254  67.765  1.00 0.00 ? 241 C A "C2'"  1  
ATOM 7738   O "O2'"  . C A 1 241 ? 131.121 79.477  67.841  1.00 0.00 ? 241 C A "O2'"  1  
ATOM 7739   C "C1'"  . C A 1 241 ? 132.016 81.660  68.294  1.00 0.00 ? 241 C A "C1'"  1  
ATOM 7740   N N1     . C A 1 241 ? 132.865 82.692  67.651  1.00 0.00 ? 241 C A N1     1  
ATOM 7741   C C2     . C A 1 241 ? 132.518 83.132  66.367  1.00 0.00 ? 241 C A C2     1  
ATOM 7742   O O2     . C A 1 241 ? 131.520 82.647  65.811  1.00 0.00 ? 241 C A O2     1  
ATOM 7743   N N3     . C A 1 241 ? 133.274 84.073  65.757  1.00 0.00 ? 241 C A N3     1  
ATOM 7744   C C4     . C A 1 241 ? 134.340 84.576  66.379  1.00 0.00 ? 241 C A C4     1  
ATOM 7745   N N4     . C A 1 241 ? 135.057 85.503  65.737  1.00 0.00 ? 241 C A N4     1  
ATOM 7746   C C5     . C A 1 241 ? 134.720 84.152  67.680  1.00 0.00 ? 241 C A C5     1  
ATOM 7747   C C6     . C A 1 241 ? 133.964 83.221  68.276  1.00 0.00 ? 241 C A C6     1  
ATOM 7748   H "H5'"  . C A 1 241 ? 133.483 80.983  71.919  1.00 0.00 ? 241 C A "H5'"  1  
ATOM 7749   H "H5''" . C A 1 241 ? 134.259 79.683  71.414  1.00 0.00 ? 241 C A "H5''" 1  
ATOM 7750   H "H4'"  . C A 1 241 ? 132.154 79.762  70.431  1.00 0.00 ? 241 C A "H4'"  1  
ATOM 7751   H "H3'"  . C A 1 241 ? 134.219 80.169  68.537  1.00 0.00 ? 241 C A "H3'"  1  
ATOM 7752   H "H2'"  . C A 1 241 ? 132.664 80.284  66.851  1.00 0.00 ? 241 C A "H2'"  1  
ATOM 7753   H "HO2'" . C A 1 241 ? 131.329 78.620  68.265  1.00 0.00 ? 241 C A "HO2'" 1  
ATOM 7754   H "H1'"  . C A 1 241 ? 131.072 81.875  68.147  1.00 0.00 ? 241 C A "H1'"  1  
ATOM 7755   H H41    . C A 1 241 ? 134.793 85.793  64.839  1.00 0.00 ? 241 C A H41    1  
ATOM 7756   H H42    . C A 1 241 ? 135.847 85.894  66.166  1.00 0.00 ? 241 C A H42    1  
ATOM 7757   H H5     . C A 1 241 ? 135.506 84.530  68.130  1.00 0.00 ? 241 C A H5     1  
ATOM 7758   H H6     . C A 1 241 ? 134.208 82.917  69.174  1.00 0.00 ? 241 C A H6     1  
ATOM 7759   P P      . G A 1 242 ? 134.622 77.635  67.901  1.00 0.00 ? 242 G A P      1  
ATOM 7760   O OP1    . G A 1 242 ? 134.703 76.214  68.327  1.00 0.00 ? 242 G A OP1    1  
ATOM 7761   O OP2    . G A 1 242 ? 135.840 78.482  67.930  1.00 0.00 ? 242 G A OP2    1  
ATOM 7762   O "O5'"  . G A 1 242 ? 134.030 77.670  66.421  1.00 0.00 ? 242 G A "O5'"  1  
ATOM 7763   C "C5'"  . G A 1 242 ? 132.886 76.905  66.073  1.00 0.00 ? 242 G A "C5'"  1  
ATOM 7764   C "C4'"  . G A 1 242 ? 132.410 77.224  64.679  1.00 0.00 ? 242 G A "C4'"  1  
ATOM 7765   O "O4'"  . G A 1 242 ? 132.046 78.625  64.590  1.00 0.00 ? 242 G A "O4'"  1  
ATOM 7766   C "C3'"  . G A 1 242 ? 133.429 77.033  63.567  1.00 0.00 ? 242 G A "C3'"  1  
ATOM 7767   O "O3'"  . G A 1 242 ? 133.551 75.683  63.148  1.00 0.00 ? 242 G A "O3'"  1  
ATOM 7768   C "C2'"  . G A 1 242 ? 132.912 77.965  62.480  1.00 0.00 ? 242 G A "C2'"  1  
ATOM 7769   O "O2'"  . G A 1 242 ? 131.815 77.390  61.788  1.00 0.00 ? 242 G A "O2'"  1  
ATOM 7770   C "C1'"  . G A 1 242 ? 132.412 79.149  63.307  1.00 0.00 ? 242 G A "C1'"  1  
ATOM 7771   N N9     . G A 1 242 ? 133.436 80.202  63.449  1.00 0.00 ? 242 G A N9     1  
ATOM 7772   C C8     . G A 1 242 ? 134.174 80.501  64.568  1.00 0.00 ? 242 G A C8     1  
ATOM 7773   N N7     . G A 1 242 ? 135.007 81.490  64.388  1.00 0.00 ? 242 G A N7     1  
ATOM 7774   C C5     . G A 1 242 ? 134.808 81.864  63.066  1.00 0.00 ? 242 G A C5     1  
ATOM 7775   C C6     . G A 1 242 ? 135.430 82.885  62.298  1.00 0.00 ? 242 G A C6     1  
ATOM 7776   O O6     . G A 1 242 ? 136.308 83.684  62.645  1.00 0.00 ? 242 G A O6     1  
ATOM 7777   N N1     . G A 1 242 ? 134.933 82.924  61.000  1.00 0.00 ? 242 G A N1     1  
ATOM 7778   C C2     . G A 1 242 ? 133.961 82.089  60.502  1.00 0.00 ? 242 G A C2     1  
ATOM 7779   N N2     . G A 1 242 ? 133.611 82.280  59.223  1.00 0.00 ? 242 G A N2     1  
ATOM 7780   N N3     . G A 1 242 ? 133.375 81.136  61.209  1.00 0.00 ? 242 G A N3     1  
ATOM 7781   C C4     . G A 1 242 ? 133.844 81.081  62.472  1.00 0.00 ? 242 G A C4     1  
ATOM 7782   H "H5'"  . G A 1 242 ? 132.166 77.097  66.709  1.00 0.00 ? 242 G A "H5'"  1  
ATOM 7783   H "H5''" . G A 1 242 ? 133.111 75.952  66.128  1.00 0.00 ? 242 G A "H5''" 1  
ATOM 7784   H "H4'"  . G A 1 242 ? 131.621 76.674  64.480  1.00 0.00 ? 242 G A "H4'"  1  
ATOM 7785   H "H3'"  . G A 1 242 ? 134.304 77.354  63.875  1.00 0.00 ? 242 G A "H3'"  1  
ATOM 7786   H "H2'"  . G A 1 242 ? 133.628 78.234  61.864  1.00 0.00 ? 242 G A "H2'"  1  
ATOM 7787   H "HO2'" . G A 1 242 ? 131.540 77.993  61.065  1.00 0.00 ? 242 G A "HO2'" 1  
ATOM 7788   H "H1'"  . G A 1 242 ? 131.612 79.528  62.886  1.00 0.00 ? 242 G A "H1'"  1  
ATOM 7789   H H8     . G A 1 242 ? 134.083 80.023  65.419  1.00 0.00 ? 242 G A H8     1  
ATOM 7790   H H1     . G A 1 242 ? 135.304 83.599  60.396  1.00 0.00 ? 242 G A H1     1  
ATOM 7791   H H21    . G A 1 242 ? 134.042 82.983  58.694  1.00 0.00 ? 242 G A H21    1  
ATOM 7792   H H22    . G A 1 242 ? 132.922 81.714  58.813  1.00 0.00 ? 242 G A H22    1  
ATOM 7793   P P      . U A 1 243 ? 134.949 75.140  62.572  1.00 0.00 ? 243 U A P      1  
ATOM 7794   O OP1    . U A 1 243 ? 134.862 73.661  62.474  1.00 0.00 ? 243 U A OP1    1  
ATOM 7795   O OP2    . U A 1 243 ? 136.043 75.759  63.361  1.00 0.00 ? 243 U A OP2    1  
ATOM 7796   O "O5'"  . U A 1 243 ? 135.011 75.730  61.093  1.00 0.00 ? 243 U A "O5'"  1  
ATOM 7797   C "C5'"  . U A 1 243 ? 134.109 75.285  60.093  1.00 0.00 ? 243 U A "C5'"  1  
ATOM 7798   C "C4'"  . U A 1 243 ? 134.286 76.050  58.803  1.00 0.00 ? 243 U A "C4'"  1  
ATOM 7799   O "O4'"  . U A 1 243 ? 133.995 77.456  59.019  1.00 0.00 ? 243 U A "O4'"  1  
ATOM 7800   C "C3'"  . U A 1 243 ? 135.687 76.049  58.210  1.00 0.00 ? 243 U A "C3'"  1  
ATOM 7801   O "O3'"  . U A 1 243 ? 135.968 74.883  57.456  1.00 0.00 ? 243 U A "O3'"  1  
ATOM 7802   C "C2'"  . U A 1 243 ? 135.698 77.328  57.383  1.00 0.00 ? 243 U A "C2'"  1  
ATOM 7803   O "O2'"  . U A 1 243 ? 135.011 77.155  56.155  1.00 0.00 ? 243 U A "O2'"  1  
ATOM 7804   C "C1'"  . U A 1 243 ? 134.893 78.274  58.276  1.00 0.00 ? 243 U A "C1'"  1  
ATOM 7805   N N1     . U A 1 243 ? 135.757 79.054  59.195  1.00 0.00 ? 243 U A N1     1  
ATOM 7806   C C2     . U A 1 243 ? 136.429 80.138  58.661  1.00 0.00 ? 243 U A C2     1  
ATOM 7807   O O2     . U A 1 243 ? 136.338 80.466  57.490  1.00 0.00 ? 243 U A O2     1  
ATOM 7808   N N3     . U A 1 243 ? 137.216 80.831  59.548  1.00 0.00 ? 243 U A N3     1  
ATOM 7809   C C4     . U A 1 243 ? 137.398 80.558  60.886  1.00 0.00 ? 243 U A C4     1  
ATOM 7810   O O4     . U A 1 243 ? 138.142 81.277  61.555  1.00 0.00 ? 243 U A O4     1  
ATOM 7811   C C5     . U A 1 243 ? 136.672 79.424  61.370  1.00 0.00 ? 243 U A C5     1  
ATOM 7812   C C6     . U A 1 243 ? 135.897 78.732  60.528  1.00 0.00 ? 243 U A C6     1  
ATOM 7813   H "H5'"  . U A 1 243 ? 133.192 75.408  60.412  1.00 0.00 ? 243 U A "H5'"  1  
ATOM 7814   H "H5''" . U A 1 243 ? 134.265 74.335  59.921  1.00 0.00 ? 243 U A "H5''" 1  
ATOM 7815   H "H4'"  . U A 1 243 ? 133.660 75.694  58.139  1.00 0.00 ? 243 U A "H4'"  1  
ATOM 7816   H "H3'"  . U A 1 243 ? 136.343 76.130  58.935  1.00 0.00 ? 243 U A "H3'"  1  
ATOM 7817   H "H2'"  . U A 1 243 ? 136.612 77.659  57.245  1.00 0.00 ? 243 U A "H2'"  1  
ATOM 7818   H "HO2'" . U A 1 243 ? 135.098 77.971  55.622  1.00 0.00 ? 243 U A "HO2'" 1  
ATOM 7819   H "H1'"  . U A 1 243 ? 134.378 78.892  57.715  1.00 0.00 ? 243 U A "H1'"  1  
ATOM 7820   H H3     . U A 1 243 ? 137.702 81.603  59.189  1.00 0.00 ? 243 U A H3     1  
ATOM 7821   H H5     . U A 1 243 ? 136.743 79.157  62.310  1.00 0.00 ? 243 U A H5     1  
ATOM 7822   H H6     . U A 1 243 ? 135.412 77.959  60.883  1.00 0.00 ? 243 U A H6     1  
ATOM 7823   P P      . C A 1 244 ? 137.472 74.327  57.357  1.00 0.00 ? 244 C A P      1  
ATOM 7824   O OP1    . C A 1 244 ? 137.433 73.009  56.676  1.00 0.00 ? 244 C A OP1    1  
ATOM 7825   O OP2    . C A 1 244 ? 138.095 74.438  58.702  1.00 0.00 ? 244 C A OP2    1  
ATOM 7826   O "O5'"  . C A 1 244 ? 138.204 75.359  56.388  1.00 0.00 ? 244 C A "O5'"  1  
ATOM 7827   C "C5'"  . C A 1 244 ? 137.835 75.462  55.022  1.00 0.00 ? 244 C A "C5'"  1  
ATOM 7828   C "C4'"  . C A 1 244 ? 138.524 76.622  54.346  1.00 0.00 ? 244 C A "C4'"  1  
ATOM 7829   O "O4'"  . C A 1 244 ? 138.146 77.866  54.991  1.00 0.00 ? 244 C A "O4'"  1  
ATOM 7830   C "C3'"  . C A 1 244 ? 140.046 76.626  54.403  1.00 0.00 ? 244 C A "C3'"  1  
ATOM 7831   O "O3'"  . C A 1 244 ? 140.637 75.788  53.424  1.00 0.00 ? 244 C A "O3'"  1  
ATOM 7832   C "C2'"  . C A 1 244 ? 140.382 78.099  54.232  1.00 0.00 ? 244 C A "C2'"  1  
ATOM 7833   O "O2'"  . C A 1 244 ? 140.282 78.497  52.872  1.00 0.00 ? 244 C A "O2'"  1  
ATOM 7834   C "C1'"  . C A 1 244 ? 139.257 78.763  55.027  1.00 0.00 ? 244 C A "C1'"  1  
ATOM 7835   N N1     . C A 1 244 ? 139.652 79.052  56.427  1.00 0.00 ? 244 C A N1     1  
ATOM 7836   C C2     . C A 1 244 ? 140.478 80.155  56.670  1.00 0.00 ? 244 C A C2     1  
ATOM 7837   O O2     . C A 1 244 ? 140.856 80.854  55.718  1.00 0.00 ? 244 C A O2     1  
ATOM 7838   N N3     . C A 1 244 ? 140.854 80.440  57.940  1.00 0.00 ? 244 C A N3     1  
ATOM 7839   C C4     . C A 1 244 ? 140.436 79.674  58.950  1.00 0.00 ? 244 C A C4     1  
ATOM 7840   N N4     . C A 1 244 ? 140.830 79.995  60.183  1.00 0.00 ? 244 C A N4     1  
ATOM 7841   C C5     . C A 1 244 ? 139.595 78.547  58.734  1.00 0.00 ? 244 C A C5     1  
ATOM 7842   C C6     . C A 1 244 ? 139.231 78.274  57.474  1.00 0.00 ? 244 C A C6     1  
ATOM 7843   H "H5'"  . C A 1 244 ? 136.866 75.588  54.961  1.00 0.00 ? 244 C A "H5'"  1  
ATOM 7844   H "H5''" . C A 1 244 ? 138.080 74.634  54.560  1.00 0.00 ? 244 C A "H5''" 1  
ATOM 7845   H "H4'"  . C A 1 244 ? 138.244 76.652  53.407  1.00 0.00 ? 244 C A "H4'"  1  
ATOM 7846   H "H3'"  . C A 1 244 ? 140.333 76.331  55.294  1.00 0.00 ? 244 C A "H3'"  1  
ATOM 7847   H "H2'"  . C A 1 244 ? 141.261 78.315  54.608  1.00 0.00 ? 244 C A "H2'"  1  
ATOM 7848   H "HO2'" . C A 1 244 ? 140.333 77.703  52.301  1.00 0.00 ? 244 C A "HO2'" 1  
ATOM 7849   H "H1'"  . C A 1 244 ? 138.994 79.598  54.586  1.00 0.00 ? 244 C A "H1'"  1  
ATOM 7850   H H41    . C A 1 244 ? 141.410 80.773  60.328  1.00 0.00 ? 244 C A H41    1  
ATOM 7851   H H42    . C A 1 244 ? 140.539 79.453  60.947  1.00 0.00 ? 244 C A H42    1  
ATOM 7852   H H5     . C A 1 244 ? 139.292 77.991  59.484  1.00 0.00 ? 244 C A H5     1  
ATOM 7853   H H6     . C A 1 244 ? 138.651 77.503  57.308  1.00 0.00 ? 244 C A H6     1  
ATOM 7854   P P      . G A 1 245 ? 141.467 74.486  53.869  1.00 0.00 ? 245 G A P      1  
ATOM 7855   O OP1    . G A 1 245 ? 141.441 73.516  52.745  1.00 0.00 ? 245 G A OP1    1  
ATOM 7856   O OP2    . G A 1 245 ? 140.983 74.068  55.210  1.00 0.00 ? 245 G A OP2    1  
ATOM 7857   O "O5'"  . G A 1 245 ? 142.962 75.016  54.028  1.00 0.00 ? 245 G A "O5'"  1  
ATOM 7858   C "C5'"  . G A 1 245 ? 143.849 75.039  52.920  1.00 0.00 ? 245 G A "C5'"  1  
ATOM 7859   C "C4'"  . G A 1 245 ? 144.442 76.410  52.713  1.00 0.00 ? 245 G A "C4'"  1  
ATOM 7860   O "O4'"  . G A 1 245 ? 143.567 77.417  53.295  1.00 0.00 ? 245 G A "O4'"  1  
ATOM 7861   C "C3'"  . G A 1 245 ? 145.782 76.666  53.386  1.00 0.00 ? 245 G A "C3'"  1  
ATOM 7862   O "O3'"  . G A 1 245 ? 146.879 76.166  52.641  1.00 0.00 ? 245 G A "O3'"  1  
ATOM 7863   C "C2'"  . G A 1 245 ? 145.789 78.181  53.522  1.00 0.00 ? 245 G A "C2'"  1  
ATOM 7864   O "O2'"  . G A 1 245 ? 146.076 78.809  52.281  1.00 0.00 ? 245 G A "O2'"  1  
ATOM 7865   C "C1'"  . G A 1 245 ? 144.333 78.444  53.894  1.00 0.00 ? 245 G A "C1'"  1  
ATOM 7866   N N9     . G A 1 245 ? 144.120 78.424  55.353  1.00 0.00 ? 245 G A N9     1  
ATOM 7867   C C8     . G A 1 245 ? 143.382 77.515  56.073  1.00 0.00 ? 245 G A C8     1  
ATOM 7868   N N7     . G A 1 245 ? 143.377 77.758  57.356  1.00 0.00 ? 245 G A N7     1  
ATOM 7869   C C5     . G A 1 245 ? 144.159 78.896  57.492  1.00 0.00 ? 245 G A C5     1  
ATOM 7870   C C6     . G A 1 245 ? 144.519 79.631  58.651  1.00 0.00 ? 245 G A C6     1  
ATOM 7871   O O6     . G A 1 245 ? 144.206 79.416  59.828  1.00 0.00 ? 245 G A O6     1  
ATOM 7872   N N1     . G A 1 245 ? 145.326 80.720  58.338  1.00 0.00 ? 245 G A N1     1  
ATOM 7873   C C2     . G A 1 245 ? 145.737 81.059  57.072  1.00 0.00 ? 245 G A C2     1  
ATOM 7874   N N2     . G A 1 245 ? 146.516 82.146  56.969  1.00 0.00 ? 245 G A N2     1  
ATOM 7875   N N3     . G A 1 245 ? 145.409 80.382  55.983  1.00 0.00 ? 245 G A N3     1  
ATOM 7876   C C4     . G A 1 245 ? 144.625 79.320  56.265  1.00 0.00 ? 245 G A C4     1  
ATOM 7877   H "H5'"  . G A 1 245 ? 143.359 74.777  52.113  1.00 0.00 ? 245 G A "H5'"  1  
ATOM 7878   H "H5''" . G A 1 245 ? 144.573 74.397  53.077  1.00 0.00 ? 245 G A "H5''" 1  
ATOM 7879   H "H4'"  . G A 1 245 ? 144.523 76.579  51.751  1.00 0.00 ? 245 G A "H4'"  1  
ATOM 7880   H "H3'"  . G A 1 245 ? 145.776 76.262  54.278  1.00 0.00 ? 245 G A "H3'"  1  
ATOM 7881   H "H2'"  . G A 1 245 ? 146.403 78.475  54.228  1.00 0.00 ? 245 G A "H2'"  1  
ATOM 7882   H "HO2'" . G A 1 245 ? 146.591 78.190  51.722  1.00 0.00 ? 245 G A "HO2'" 1  
ATOM 7883   H "H1'"  . G A 1 245 ? 144.057 79.314  53.536  1.00 0.00 ? 245 G A "H1'"  1  
ATOM 7884   H H8     . G A 1 245 ? 142.908 76.761  55.666  1.00 0.00 ? 245 G A H8     1  
ATOM 7885   H H1     . G A 1 245 ? 145.624 81.288  59.079  1.00 0.00 ? 245 G A H1     1  
ATOM 7886   H H21    . G A 1 245 ? 146.763 82.653  57.770  1.00 0.00 ? 245 G A H21    1  
ATOM 7887   H H22    . G A 1 245 ? 146.839 82.436  56.090  1.00 0.00 ? 245 G A H22    1  
ATOM 7888   P P      . G A 1 246 ? 148.136 75.508  53.398  1.00 0.00 ? 246 G A P      1  
ATOM 7889   O OP1    . G A 1 246 ? 148.480 74.241  52.704  1.00 0.00 ? 246 G A OP1    1  
ATOM 7890   O OP2    . G A 1 246 ? 147.838 75.490  54.853  1.00 0.00 ? 246 G A OP2    1  
ATOM 7891   O "O5'"  . G A 1 246 ? 149.321 76.544  53.150  1.00 0.00 ? 246 G A "O5'"  1  
ATOM 7892   C "C5'"  . G A 1 246 ? 149.279 77.848  53.710  1.00 0.00 ? 246 G A "C5'"  1  
ATOM 7893   C "C4'"  . G A 1 246 ? 150.238 77.985  54.866  1.00 0.00 ? 246 G A "C4'"  1  
ATOM 7894   O "O4'"  . G A 1 246 ? 150.515 76.704  55.489  1.00 0.00 ? 246 G A "O4'"  1  
ATOM 7895   C "C3'"  . G A 1 246 ? 151.629 78.496  54.523  1.00 0.00 ? 246 G A "C3'"  1  
ATOM 7896   O "O3'"  . G A 1 246 ? 151.662 79.892  54.279  1.00 0.00 ? 246 G A "O3'"  1  
ATOM 7897   C "C2'"  . G A 1 246 ? 152.421 78.092  55.747  1.00 0.00 ? 246 G A "C2'"  1  
ATOM 7898   O "O2'"  . G A 1 246 ? 152.170 78.970  56.835  1.00 0.00 ? 246 G A "O2'"  1  
ATOM 7899   C "C1'"  . G A 1 246 ? 151.803 76.735  56.038  1.00 0.00 ? 246 G A "C1'"  1  
ATOM 7900   N N9     . G A 1 246 ? 152.594 75.629  55.466  1.00 0.00 ? 246 G A N9     1  
ATOM 7901   C C8     . G A 1 246 ? 152.534 75.140  54.184  1.00 0.00 ? 246 G A C8     1  
ATOM 7902   N N7     . G A 1 246 ? 153.360 74.151  53.972  1.00 0.00 ? 246 G A N7     1  
ATOM 7903   C C5     . G A 1 246 ? 154.006 73.977  55.188  1.00 0.00 ? 246 G A C5     1  
ATOM 7904   C C6     . G A 1 246 ? 155.012 73.053  55.570  1.00 0.00 ? 246 G A C6     1  
ATOM 7905   O O6     . G A 1 246 ? 155.550 72.173  54.888  1.00 0.00 ? 246 G A O6     1  
ATOM 7906   N N1     . G A 1 246 ? 155.385 73.222  56.900  1.00 0.00 ? 246 G A N1     1  
ATOM 7907   C C2     . G A 1 246 ? 154.860 74.162  57.753  1.00 0.00 ? 246 G A C2     1  
ATOM 7908   N N2     . G A 1 246 ? 155.349 74.173  59.002  1.00 0.00 ? 246 G A N2     1  
ATOM 7909   N N3     . G A 1 246 ? 153.922 75.030  57.409  1.00 0.00 ? 246 G A N3     1  
ATOM 7910   C C4     . G A 1 246 ? 153.545 74.882  56.121  1.00 0.00 ? 246 G A C4     1  
ATOM 7911   H "H5'"  . G A 1 246 ? 148.370 78.032  54.025  1.00 0.00 ? 246 G A "H5'"  1  
ATOM 7912   H "H5''" . G A 1 246 ? 149.516 78.500  53.018  1.00 0.00 ? 246 G A "H5''" 1  
ATOM 7913   H "H4'"  . G A 1 246 ? 149.837 78.570  55.544  1.00 0.00 ? 246 G A "H4'"  1  
ATOM 7914   H "H3'"  . G A 1 246 ? 151.967 78.009  53.743  1.00 0.00 ? 246 G A "H3'"  1  
ATOM 7915   H "H2'"  . G A 1 246 ? 153.379 78.024  55.549  1.00 0.00 ? 246 G A "H2'"  1  
ATOM 7916   H "HO2'" . G A 1 246 ? 151.502 78.563  57.425  1.00 0.00 ? 246 G A "HO2'" 1  
ATOM 7917   H "H1'"  . G A 1 246 ? 151.724 76.613  57.007  1.00 0.00 ? 246 G A "H1'"  1  
ATOM 7918   H H8     . G A 1 246 ? 151.932 75.495  53.497  1.00 0.00 ? 246 G A H8     1  
ATOM 7919   H H1     . G A 1 246 ? 156.077 72.625  57.253  1.00 0.00 ? 246 G A H1     1  
ATOM 7920   H H21    . G A 1 246 ? 156.043 73.534  59.264  1.00 0.00 ? 246 G A H21    1  
ATOM 7921   H H22    . G A 1 246 ? 155.011 74.822  59.655  1.00 0.00 ? 246 G A H22    1  
ATOM 7922   P P      . G A 1 247 ? 152.997 80.725  54.593  1.00 0.00 ? 247 G A P      1  
ATOM 7923   O OP1    . G A 1 247 ? 154.124 80.153  53.812  1.00 0.00 ? 247 G A OP1    1  
ATOM 7924   O OP2    . G A 1 247 ? 153.049 80.705  56.077  1.00 0.00 ? 247 G A OP2    1  
ATOM 7925   O "O5'"  . G A 1 247 ? 152.791 82.234  54.127  1.00 0.00 ? 247 G A "O5'"  1  
ATOM 7926   C "C5'"  . G A 1 247 ? 153.764 83.226  54.418  1.00 0.00 ? 247 G A "C5'"  1  
ATOM 7927   C "C4'"  . G A 1 247 ? 153.710 83.648  55.865  1.00 0.00 ? 247 G A "C4'"  1  
ATOM 7928   O "O4'"  . G A 1 247 ? 152.329 83.743  56.299  1.00 0.00 ? 247 G A "O4'"  1  
ATOM 7929   C "C3'"  . G A 1 247 ? 154.347 82.695  56.865  1.00 0.00 ? 247 G A "C3'"  1  
ATOM 7930   O "O3'"  . G A 1 247 ? 155.761 82.813  56.918  1.00 0.00 ? 247 G A "O3'"  1  
ATOM 7931   C "C2'"  . G A 1 247 ? 153.653 83.065  58.167  1.00 0.00 ? 247 G A "C2'"  1  
ATOM 7932   O "O2'"  . G A 1 247 ? 154.201 84.249  58.725  1.00 0.00 ? 247 G A "O2'"  1  
ATOM 7933   C "C1'"  . G A 1 247 ? 152.233 83.353  57.683  1.00 0.00 ? 247 G A "C1'"  1  
ATOM 7934   N N9     . G A 1 247 ? 151.346 82.184  57.826  1.00 0.00 ? 247 G A N9     1  
ATOM 7935   C C8     . G A 1 247 ? 150.857 81.384  56.822  1.00 0.00 ? 247 G A C8     1  
ATOM 7936   N N7     . G A 1 247 ? 150.094 80.419  57.260  1.00 0.00 ? 247 G A N7     1  
ATOM 7937   C C5     . G A 1 247 ? 150.077 80.591  58.635  1.00 0.00 ? 247 G A C5     1  
ATOM 7938   C C6     . G A 1 247 ? 149.419 79.848  59.648  1.00 0.00 ? 247 G A C6     1  
ATOM 7939   O O6     . G A 1 247 ? 148.693 78.854  59.525  1.00 0.00 ? 247 G A O6     1  
ATOM 7940   N N1     . G A 1 247 ? 149.673 80.367  60.914  1.00 0.00 ? 247 G A N1     1  
ATOM 7941   C C2     . G A 1 247 ? 150.461 81.463  61.174  1.00 0.00 ? 247 G A C2     1  
ATOM 7942   N N2     . G A 1 247 ? 150.588 81.813  62.461  1.00 0.00 ? 247 G A N2     1  
ATOM 7943   N N3     . G A 1 247 ? 151.079 82.165  60.239  1.00 0.00 ? 247 G A N3     1  
ATOM 7944   C C4     . G A 1 247 ? 150.847 81.677  59.003  1.00 0.00 ? 247 G A C4     1  
ATOM 7945   H "H5'"  . G A 1 247 ? 153.605 84.008  53.850  1.00 0.00 ? 247 G A "H5'"  1  
ATOM 7946   H "H5''" . G A 1 247 ? 154.656 82.866  54.222  1.00 0.00 ? 247 G A "H5''" 1  
ATOM 7947   H "H4'"  . G A 1 247 ? 154.130 84.531  55.953  1.00 0.00 ? 247 G A "H4'"  1  
ATOM 7948   H "H3'"  . G A 1 247 ? 154.112 81.775  56.624  1.00 0.00 ? 247 G A "H3'"  1  
ATOM 7949   H "H2'"  . G A 1 247 ? 153.669 82.321  58.807  1.00 0.00 ? 247 G A "H2'"  1  
ATOM 7950   H "HO2'" . G A 1 247 ? 155.093 84.398  58.345  1.00 0.00 ? 247 G A "HO2'" 1  
ATOM 7951   H "H1'"  . G A 1 247 ? 151.861 84.107  58.189  1.00 0.00 ? 247 G A "H1'"  1  
ATOM 7952   H H8     . G A 1 247 ? 151.059 81.522  55.874  1.00 0.00 ? 247 G A H8     1  
ATOM 7953   H H1     . G A 1 247 ? 149.258 79.916  61.678  1.00 0.00 ? 247 G A H1     1  
ATOM 7954   H H21    . G A 1 247 ? 150.132 81.299  63.159  1.00 0.00 ? 247 G A H21    1  
ATOM 7955   H H22    . G A 1 247 ? 151.138 82.587  62.708  1.00 0.00 ? 247 G A H22    1  
ATOM 7956   P P      . G A 1 248 ? 156.664 81.531  57.278  1.00 0.00 ? 248 G A P      1  
ATOM 7957   O OP1    . G A 1 248 ? 158.088 81.953  57.257  1.00 0.00 ? 248 G A OP1    1  
ATOM 7958   O OP2    . G A 1 248 ? 156.220 80.401  56.427  1.00 0.00 ? 248 G A OP2    1  
ATOM 7959   O "O5'"  . G A 1 248 ? 156.273 81.197  58.786  1.00 0.00 ? 248 G A "O5'"  1  
ATOM 7960   C "C5'"  . G A 1 248 ? 156.719 82.015  59.856  1.00 0.00 ? 248 G A "C5'"  1  
ATOM 7961   C "C4'"  . G A 1 248 ? 156.207 81.523  61.186  1.00 0.00 ? 248 G A "C4'"  1  
ATOM 7962   O "O4'"  . G A 1 248 ? 154.757 81.553  61.197  1.00 0.00 ? 248 G A "O4'"  1  
ATOM 7963   C "C3'"  . G A 1 248 ? 156.550 80.081  61.538  1.00 0.00 ? 248 G A "C3'"  1  
ATOM 7964   O "O3'"  . G A 1 248 ? 157.867 79.929  62.033  1.00 0.00 ? 248 G A "O3'"  1  
ATOM 7965   C "C2'"  . G A 1 248 ? 155.472 79.723  62.551  1.00 0.00 ? 248 G A "C2'"  1  
ATOM 7966   O "O2'"  . G A 1 248 ? 155.765 80.269  63.830  1.00 0.00 ? 248 G A "O2'"  1  
ATOM 7967   C "C1'"  . G A 1 248 ? 154.254 80.445  61.971  1.00 0.00 ? 248 G A "C1'"  1  
ATOM 7968   N N9     . G A 1 248 ? 153.423 79.552  61.141  1.00 0.00 ? 248 G A N9     1  
ATOM 7969   C C8     . G A 1 248 ? 153.332 79.535  59.770  1.00 0.00 ? 248 G A C8     1  
ATOM 7970   N N7     . G A 1 248 ? 152.507 78.627  59.320  1.00 0.00 ? 248 G A N7     1  
ATOM 7971   C C5     . G A 1 248 ? 152.025 78.006  60.464  1.00 0.00 ? 248 G A C5     1  
ATOM 7972   C C6     . G A 1 248 ? 151.097 76.944  60.610  1.00 0.00 ? 248 G A C6     1  
ATOM 7973   O O6     . G A 1 248 ? 150.497 76.318  59.729  1.00 0.00 ? 248 G A O6     1  
ATOM 7974   N N1     . G A 1 248 ? 150.889 76.624  61.949  1.00 0.00 ? 248 G A N1     1  
ATOM 7975   C C2     . G A 1 248 ? 151.498 77.248  63.010  1.00 0.00 ? 248 G A C2     1  
ATOM 7976   N N2     . G A 1 248 ? 151.169 76.798  64.232  1.00 0.00 ? 248 G A N2     1  
ATOM 7977   N N3     . G A 1 248 ? 152.364 78.240  62.890  1.00 0.00 ? 248 G A N3     1  
ATOM 7978   C C4     . G A 1 248 ? 152.580 78.565  61.597  1.00 0.00 ? 248 G A C4     1  
ATOM 7979   H "H5'"  . G A 1 248 ? 156.402 82.933  59.711  1.00 0.00 ? 248 G A "H5'"  1  
ATOM 7980   H "H5''" . G A 1 248 ? 157.699 82.016  59.871  1.00 0.00 ? 248 G A "H5''" 1  
ATOM 7981   H "H4'"  . G A 1 248 ? 156.543 82.111  61.894  1.00 0.00 ? 248 G A "H4'"  1  
ATOM 7982   H "H3'"  . G A 1 248 ? 156.439 79.521  60.741  1.00 0.00 ? 248 G A "H3'"  1  
ATOM 7983   H "H2'"  . G A 1 248 ? 155.326 78.754  62.595  1.00 0.00 ? 248 G A "H2'"  1  
ATOM 7984   H "HO2'" . G A 1 248 ? 156.722 80.478  63.877  1.00 0.00 ? 248 G A "HO2'" 1  
ATOM 7985   H "H1'"  . G A 1 248 ? 153.713 80.811  62.701  1.00 0.00 ? 248 G A "H1'"  1  
ATOM 7986   H H8     . G A 1 248 ? 153.834 80.142  59.188  1.00 0.00 ? 248 G A H8     1  
ATOM 7987   H H1     . G A 1 248 ? 150.260 75.899  62.146  1.00 0.00 ? 248 G A H1     1  
ATOM 7988   H H21    . G A 1 248 ? 150.529 76.065  64.332  1.00 0.00 ? 248 G A H21    1  
ATOM 7989   H H22    . G A 1 248 ? 151.572 77.206  65.028  1.00 0.00 ? 248 G A H22    1  
ATOM 7990   P P      . A A 1 249 ? 158.649 78.538  61.840  1.00 0.00 ? 249 A A P      1  
ATOM 7991   O OP1    . A A 1 249 ? 160.045 78.722  62.311  1.00 0.00 ? 249 A A OP1    1  
ATOM 7992   O OP2    . A A 1 249 ? 158.399 78.060  60.457  1.00 0.00 ? 249 A A OP2    1  
ATOM 7993   O "O5'"  . A A 1 249 ? 157.917 77.543  62.845  1.00 0.00 ? 249 A A "O5'"  1  
ATOM 7994   C "C5'"  . A A 1 249 ? 158.007 77.729  64.249  1.00 0.00 ? 249 A A "C5'"  1  
ATOM 7995   C "C4'"  . A A 1 249 ? 157.149 76.737  64.996  1.00 0.00 ? 249 A A "C4'"  1  
ATOM 7996   O "O4'"  . A A 1 249 ? 155.754 76.934  64.649  1.00 0.00 ? 249 A A "O4'"  1  
ATOM 7997   C "C3'"  . A A 1 249 ? 157.403 75.270  64.688  1.00 0.00 ? 249 A A "C3'"  1  
ATOM 7998   O "O3'"  . A A 1 249 ? 158.534 74.747  65.367  1.00 0.00 ? 249 A A "O3'"  1  
ATOM 7999   C "C2'"  . A A 1 249 ? 156.091 74.613  65.092  1.00 0.00 ? 249 A A "C2'"  1  
ATOM 8000   O "O2'"  . A A 1 249 ? 156.003 74.460  66.501  1.00 0.00 ? 249 A A "O2'"  1  
ATOM 8001   C "C1'"  . A A 1 249 ? 155.074 75.661  64.640  1.00 0.00 ? 249 A A "C1'"  1  
ATOM 8002   N N9     . A A 1 249 ? 154.519 75.363  63.306  1.00 0.00 ? 249 A A N9     1  
ATOM 8003   C C8     . A A 1 249 ? 154.833 75.959  62.110  1.00 0.00 ? 249 A A C8     1  
ATOM 8004   N N7     . A A 1 249 ? 154.169 75.474  61.088  1.00 0.00 ? 249 A A N7     1  
ATOM 8005   C C5     . A A 1 249 ? 153.364 74.493  61.650  1.00 0.00 ? 249 A A C5     1  
ATOM 8006   C C6     . A A 1 249 ? 152.421 73.608  61.096  1.00 0.00 ? 249 A A C6     1  
ATOM 8007   N N6     . A A 1 249 ? 152.118 73.568  59.796  1.00 0.00 ? 249 A A N6     1  
ATOM 8008   N N1     . A A 1 249 ? 151.792 72.754  61.932  1.00 0.00 ? 249 A A N1     1  
ATOM 8009   C C2     . A A 1 249 ? 152.095 72.792  63.236  1.00 0.00 ? 249 A A C2     1  
ATOM 8010   N N3     . A A 1 249 ? 152.961 73.576  63.874  1.00 0.00 ? 249 A A N3     1  
ATOM 8011   C C4     . A A 1 249 ? 153.570 74.412  63.015  1.00 0.00 ? 249 A A C4     1  
ATOM 8012   H "H5'"  . A A 1 249 ? 157.711 78.636  64.472  1.00 0.00 ? 249 A A "H5'"  1  
ATOM 8013   H "H5''" . A A 1 249 ? 158.939 77.618  64.530  1.00 0.00 ? 249 A A "H5''" 1  
ATOM 8014   H "H4'"  . A A 1 249 ? 157.261 76.882  65.960  1.00 0.00 ? 249 A A "H4'"  1  
ATOM 8015   H "H3'"  . A A 1 249 ? 157.533 75.161  63.720  1.00 0.00 ? 249 A A "H3'"  1  
ATOM 8016   H "H2'"  . A A 1 249 ? 155.957 73.760  64.624  1.00 0.00 ? 249 A A "H2'"  1  
ATOM 8017   H "HO2'" . A A 1 249 ? 156.904 74.508  66.882  1.00 0.00 ? 249 A A "HO2'" 1  
ATOM 8018   H "H1'"  . A A 1 249 ? 154.345 75.712  65.292  1.00 0.00 ? 249 A A "H1'"  1  
ATOM 8019   H H8     . A A 1 249 ? 155.491 76.678  62.025  1.00 0.00 ? 249 A A H8     1  
ATOM 8020   H H61    . A A 1 249 ? 151.451 72.930  59.469  1.00 0.00 ? 249 A A H61    1  
ATOM 8021   H H62    . A A 1 249 ? 152.561 74.178  59.171  1.00 0.00 ? 249 A A H62    1  
ATOM 8022   H H2     . A A 1 249 ? 151.612 72.154  63.799  1.00 0.00 ? 249 A A H2     1  
ATOM 8023   P P      . G A 1 250 ? 159.350 73.511  64.744  1.00 0.00 ? 250 G A P      1  
ATOM 8024   O OP1    . G A 1 250 ? 160.547 73.276  65.592  1.00 0.00 ? 250 G A OP1    1  
ATOM 8025   O OP2    . G A 1 250 ? 159.520 73.759  63.289  1.00 0.00 ? 250 G A OP2    1  
ATOM 8026   O "O5'"  . G A 1 250 ? 158.368 72.270  64.922  1.00 0.00 ? 250 G A "O5'"  1  
ATOM 8027   C "C5'"  . G A 1 250 ? 158.047 71.773  66.212  1.00 0.00 ? 250 G A "C5'"  1  
ATOM 8028   C "C4'"  . G A 1 250 ? 156.998 70.692  66.144  1.00 0.00 ? 250 G A "C4'"  1  
ATOM 8029   O "O4'"  . G A 1 250 ? 155.778 71.226  65.568  1.00 0.00 ? 250 G A "O4'"  1  
ATOM 8030   C "C3'"  . G A 1 250 ? 157.331 69.494  65.267  1.00 0.00 ? 250 G A "C3'"  1  
ATOM 8031   O "O3'"  . G A 1 250 ? 158.198 68.569  65.897  1.00 0.00 ? 250 G A "O3'"  1  
ATOM 8032   C "C2'"  . G A 1 250 ? 155.955 68.923  64.950  1.00 0.00 ? 250 G A "C2'"  1  
ATOM 8033   O "O2'"  . G A 1 250 ? 155.442 68.175  66.043  1.00 0.00 ? 250 G A "O2'"  1  
ATOM 8034   C "C1'"  . G A 1 250 ? 155.125 70.199  64.787  1.00 0.00 ? 250 G A "C1'"  1  
ATOM 8035   N N9     . G A 1 250 ? 154.993 70.599  63.375  1.00 0.00 ? 250 G A N9     1  
ATOM 8036   C C8     . G A 1 250 ? 155.644 71.628  62.738  1.00 0.00 ? 250 G A C8     1  
ATOM 8037   N N7     . G A 1 250 ? 155.320 71.739  61.479  1.00 0.00 ? 250 G A N7     1  
ATOM 8038   C C5     . G A 1 250 ? 154.396 70.724  61.270  1.00 0.00 ? 250 G A C5     1  
ATOM 8039   C C6     . G A 1 250 ? 153.692 70.346  60.099  1.00 0.00 ? 250 G A C6     1  
ATOM 8040   O O6     . G A 1 250 ? 153.744 70.855  58.971  1.00 0.00 ? 250 G A O6     1  
ATOM 8041   N N1     . G A 1 250 ? 152.856 69.259  60.329  1.00 0.00 ? 250 G A N1     1  
ATOM 8042   C C2     . G A 1 250 ? 152.716 68.616  61.534  1.00 0.00 ? 250 G A C2     1  
ATOM 8043   N N2     . G A 1 250 ? 151.860 67.582  61.561  1.00 0.00 ? 250 G A N2     1  
ATOM 8044   N N3     . G A 1 250 ? 153.366 68.956  62.633  1.00 0.00 ? 250 G A N3     1  
ATOM 8045   C C4     . G A 1 250 ? 154.184 70.010  62.430  1.00 0.00 ? 250 G A C4     1  
ATOM 8046   H "H5'"  . G A 1 250 ? 157.713 72.510  66.764  1.00 0.00 ? 250 G A "H5'"  1  
ATOM 8047   H "H5''" . G A 1 250 ? 158.859 71.407  66.623  1.00 0.00 ? 250 G A "H5''" 1  
ATOM 8048   H "H4'"  . G A 1 250 ? 156.809 70.376  67.052  1.00 0.00 ? 250 G A "H4'"  1  
ATOM 8049   H "H3'"  . G A 1 250 ? 157.744 69.809  64.437  1.00 0.00 ? 250 G A "H3'"  1  
ATOM 8050   H "H2'"  . G A 1 250 ? 155.966 68.396  64.124  1.00 0.00 ? 250 G A "H2'"  1  
ATOM 8051   H "HO2'" . G A 1 250 ? 156.184 67.916  66.629  1.00 0.00 ? 250 G A "HO2'" 1  
ATOM 8052   H "H1'"  . G A 1 250 ? 154.234 70.060  65.174  1.00 0.00 ? 250 G A "H1'"  1  
ATOM 8053   H H8     . G A 1 250 ? 156.287 72.219  63.182  1.00 0.00 ? 250 G A H8     1  
ATOM 8054   H H1     . G A 1 250 ? 152.328 68.929  59.572  1.00 0.00 ? 250 G A H1     1  
ATOM 8055   H H21    . G A 1 250 ? 151.373 67.324  60.750  1.00 0.00 ? 250 G A H21    1  
ATOM 8056   H H22    . G A 1 250 ? 151.718 67.086  62.393  1.00 0.00 ? 250 G A H22    1  
ATOM 8057   P P      . G A 1 251 ? 159.146 67.617  65.012  1.00 0.00 ? 251 G A P      1  
ATOM 8058   O OP1    . G A 1 251 ? 160.025 66.856  65.935  1.00 0.00 ? 251 G A OP1    1  
ATOM 8059   O OP2    . G A 1 251 ? 159.752 68.448  63.940  1.00 0.00 ? 251 G A OP2    1  
ATOM 8060   O "O5'"  . G A 1 251 ? 158.136 66.592  64.330  1.00 0.00 ? 251 G A "O5'"  1  
ATOM 8061   C "C5'"  . G A 1 251 ? 157.430 65.637  65.110  1.00 0.00 ? 251 G A "C5'"  1  
ATOM 8062   C "C4'"  . G A 1 251 ? 156.436 64.867  64.277  1.00 0.00 ? 251 G A "C4'"  1  
ATOM 8063   O "O4'"  . G A 1 251 ? 155.462 65.780  63.708  1.00 0.00 ? 251 G A "O4'"  1  
ATOM 8064   C "C3'"  . G A 1 251 ? 157.003 64.131  63.073  1.00 0.00 ? 251 G A "C3'"  1  
ATOM 8065   O "O3'"  . G A 1 251 ? 157.623 62.903  63.416  1.00 0.00 ? 251 G A "O3'"  1  
ATOM 8066   C "C2'"  . G A 1 251 ? 155.783 63.970  62.176  1.00 0.00 ? 251 G A "C2'"  1  
ATOM 8067   O "O2'"  . G A 1 251 ? 154.950 62.911  62.628  1.00 0.00 ? 251 G A "O2'"  1  
ATOM 8068   C "C1'"  . G A 1 251 ? 155.063 65.300  62.401  1.00 0.00 ? 251 G A "C1'"  1  
ATOM 8069   N N9     . G A 1 251 ? 155.375 66.286  61.351  1.00 0.00 ? 251 G A N9     1  
ATOM 8070   C C8     . G A 1 251 ? 156.202 67.378  61.453  1.00 0.00 ? 251 G A C8     1  
ATOM 8071   N N7     . G A 1 251 ? 156.281 68.068  60.348  1.00 0.00 ? 251 G A N7     1  
ATOM 8072   C C5     . G A 1 251 ? 155.456 67.393  59.461  1.00 0.00 ? 251 G A C5     1  
ATOM 8073   C C6     . G A 1 251 ? 155.142 67.669  58.106  1.00 0.00 ? 251 G A C6     1  
ATOM 8074   O O6     . G A 1 251 ? 155.542 68.598  57.397  1.00 0.00 ? 251 G A O6     1  
ATOM 8075   N N1     . G A 1 251 ? 154.262 66.728  57.582  1.00 0.00 ? 251 G A N1     1  
ATOM 8076   C C2     . G A 1 251 ? 153.748 65.655  58.272  1.00 0.00 ? 251 G A C2     1  
ATOM 8077   N N2     . G A 1 251 ? 152.914 64.854  57.596  1.00 0.00 ? 251 G A N2     1  
ATOM 8078   N N3     . G A 1 251 ? 154.036 65.386  59.537  1.00 0.00 ? 251 G A N3     1  
ATOM 8079   C C4     . G A 1 251 ? 154.888 66.289  60.063  1.00 0.00 ? 251 G A C4     1  
ATOM 8080   H "H5'"  . G A 1 251 ? 156.954 66.100  65.831  1.00 0.00 ? 251 G A "H5'"  1  
ATOM 8081   H "H5''" . G A 1 251 ? 158.072 65.011  65.505  1.00 0.00 ? 251 G A "H5''" 1  
ATOM 8082   H "H4'"  . G A 1 251 ? 155.971 64.225  64.852  1.00 0.00 ? 251 G A "H4'"  1  
ATOM 8083   H "H3'"  . G A 1 251 ? 157.657 64.706  62.623  1.00 0.00 ? 251 G A "H3'"  1  
ATOM 8084   H "H2'"  . G A 1 251 ? 156.039 63.854  61.238  1.00 0.00 ? 251 G A "H2'"  1  
ATOM 8085   H "HO2'" . G A 1 251 ? 155.472 62.317  63.203  1.00 0.00 ? 251 G A "HO2'" 1  
ATOM 8086   H "H1'"  . G A 1 251 ? 154.095 65.146  62.426  1.00 0.00 ? 251 G A "H1'"  1  
ATOM 8087   H H8     . G A 1 251 ? 156.686 67.614  62.272  1.00 0.00 ? 251 G A H8     1  
ATOM 8088   H H1     . G A 1 251 ? 153.987 66.838  56.648  1.00 0.00 ? 251 G A H1     1  
ATOM 8089   H H21    . G A 1 251 ? 152.697 65.046  56.660  1.00 0.00 ? 251 G A H21    1  
ATOM 8090   H H22    . G A 1 251 ? 152.517 64.074  58.039  1.00 0.00 ? 251 G A H22    1  
ATOM 8091   P P      . C A 1 252 ? 158.806 62.311  62.502  1.00 0.00 ? 252 C A P      1  
ATOM 8092   O OP1    . C A 1 252 ? 159.339 61.097  63.169  1.00 0.00 ? 252 C A OP1    1  
ATOM 8093   O OP2    . C A 1 252 ? 159.724 63.425  62.160  1.00 0.00 ? 252 C A OP2    1  
ATOM 8094   O "O5'"  . C A 1 252 ? 158.067 61.854  61.166  1.00 0.00 ? 252 C A "O5'"  1  
ATOM 8095   C "C5'"  . C A 1 252 ? 157.166 60.756  61.170  1.00 0.00 ? 252 C A "C5'"  1  
ATOM 8096   C "C4'"  . C A 1 252 ? 156.508 60.571  59.824  1.00 0.00 ? 252 C A "C4'"  1  
ATOM 8097   O "O4'"  . C A 1 252 ? 155.741 61.754  59.482  1.00 0.00 ? 252 C A "O4'"  1  
ATOM 8098   C "C3'"  . C A 1 252 ? 157.444 60.386  58.640  1.00 0.00 ? 252 C A "C3'"  1  
ATOM 8099   O "O3'"  . C A 1 252 ? 157.949 59.065  58.534  1.00 0.00 ? 252 C A "O3'"  1  
ATOM 8100   C "C2'"  . C A 1 252 ? 156.576 60.801  57.460  1.00 0.00 ? 252 C A "C2'"  1  
ATOM 8101   O "O2'"  . C A 1 252 ? 155.662 59.774  57.103  1.00 0.00 ? 252 C A "O2'"  1  
ATOM 8102   C "C1'"  . C A 1 252 ? 155.794 61.972  58.056  1.00 0.00 ? 252 C A "C1'"  1  
ATOM 8103   N N1     . C A 1 252 ? 156.414 63.283  57.740  1.00 0.00 ? 252 C A N1     1  
ATOM 8104   C C2     . C A 1 252 ? 156.200 63.831  56.468  1.00 0.00 ? 252 C A C2     1  
ATOM 8105   O O2     . C A 1 252 ? 155.504 63.209  55.652  1.00 0.00 ? 252 C A O2     1  
ATOM 8106   N N3     . C A 1 252 ? 156.754 65.024  56.154  1.00 0.00 ? 252 C A N3     1  
ATOM 8107   C C4     . C A 1 252 ? 157.497 65.671  57.050  1.00 0.00 ? 252 C A C4     1  
ATOM 8108   N N4     . C A 1 252 ? 158.022 66.847  56.696  1.00 0.00 ? 252 C A N4     1  
ATOM 8109   C C5     . C A 1 252 ? 157.735 65.142  58.352  1.00 0.00 ? 252 C A C5     1  
ATOM 8110   C C6     . C A 1 252 ? 157.182 63.963  58.650  1.00 0.00 ? 252 C A C6     1  
ATOM 8111   H "H5'"  . C A 1 252 ? 156.474 60.914  61.844  1.00 0.00 ? 252 C A "H5'"  1  
ATOM 8112   H "H5''" . C A 1 252 ? 157.659 59.939  61.399  1.00 0.00 ? 252 C A "H5''" 1  
ATOM 8113   H "H4'"  . C A 1 252 ? 155.900 59.803  59.873  1.00 0.00 ? 252 C A "H4'"  1  
ATOM 8114   H "H3'"  . C A 1 252 ? 158.194 61.009  58.721  1.00 0.00 ? 252 C A "H3'"  1  
ATOM 8115   H "H2'"  . C A 1 252 ? 157.119 61.085  56.695  1.00 0.00 ? 252 C A "H2'"  1  
ATOM 8116   H "HO2'" . C A 1 252 ? 155.985 58.921  57.459  1.00 0.00 ? 252 C A "HO2'" 1  
ATOM 8117   H "H1'"  . C A 1 252 ? 154.875 61.958  57.717  1.00 0.00 ? 252 C A "H1'"  1  
ATOM 8118   H H41    . C A 1 252 ? 157.858 67.209  55.801  1.00 0.00 ? 252 C A H41    1  
ATOM 8119   H H42    . C A 1 252 ? 158.575 67.348  57.333  1.00 0.00 ? 252 C A H42    1  
ATOM 8120   H H5     . C A 1 252 ? 158.283 65.627  59.004  1.00 0.00 ? 252 C A H5     1  
ATOM 8121   H H6     . C A 1 252 ? 157.332 63.582  59.540  1.00 0.00 ? 252 C A H6     1  
ATOM 8122   P P      . A A 1 253 ? 159.355 58.791  57.805  1.00 0.00 ? 253 A A P      1  
ATOM 8123   O OP1    . A A 1 253 ? 159.695 57.358  57.979  1.00 0.00 ? 253 A A OP1    1  
ATOM 8124   O OP2    . A A 1 253 ? 160.315 59.832  58.253  1.00 0.00 ? 253 A A OP2    1  
ATOM 8125   O "O5'"  . A A 1 253 ? 159.044 59.043  56.264  1.00 0.00 ? 253 A A "O5'"  1  
ATOM 8126   C "C5'"  . A A 1 253 ? 158.158 58.192  55.551  1.00 0.00 ? 253 A A "C5'"  1  
ATOM 8127   C "C4'"  . A A 1 253 ? 157.900 58.702  54.156  1.00 0.00 ? 253 A A "C4'"  1  
ATOM 8128   O "O4'"  . A A 1 253 ? 157.262 60.005  54.221  1.00 0.00 ? 253 A A "O4'"  1  
ATOM 8129   C "C3'"  . A A 1 253 ? 159.130 58.933  53.289  1.00 0.00 ? 253 A A "C3'"  1  
ATOM 8130   O "O3'"  . A A 1 253 ? 159.642 57.740  52.725  1.00 0.00 ? 253 A A "O3'"  1  
ATOM 8131   C "C2'"  . A A 1 253 ? 158.626 59.931  52.257  1.00 0.00 ? 253 A A "C2'"  1  
ATOM 8132   O "O2'"  . A A 1 253 ? 157.851 59.289  51.255  1.00 0.00 ? 253 A A "O2'"  1  
ATOM 8133   C "C1'"  . A A 1 253 ? 157.706 60.811  53.104  1.00 0.00 ? 253 A A "C1'"  1  
ATOM 8134   N N9     . A A 1 253 ? 158.384 62.036  53.570  1.00 0.00 ? 253 A A N9     1  
ATOM 8135   C C8     . A A 1 253 ? 158.878 62.304  54.824  1.00 0.00 ? 253 A A C8     1  
ATOM 8136   N N7     . A A 1 253 ? 159.430 63.486  54.934  1.00 0.00 ? 253 A A N7     1  
ATOM 8137   C C5     . A A 1 253 ? 159.289 64.037  53.668  1.00 0.00 ? 253 A A C5     1  
ATOM 8138   C C6     . A A 1 253 ? 159.670 65.279  53.127  1.00 0.00 ? 253 A A C6     1  
ATOM 8139   N N6     . A A 1 253 ? 160.297 66.228  53.825  1.00 0.00 ? 253 A A N6     1  
ATOM 8140   N N1     . A A 1 253 ? 159.382 65.515  51.829  1.00 0.00 ? 253 A A N1     1  
ATOM 8141   C C2     . A A 1 253 ? 158.753 64.562  51.128  1.00 0.00 ? 253 A A C2     1  
ATOM 8142   N N3     . A A 1 253 ? 158.345 63.358  51.524  1.00 0.00 ? 253 A A N3     1  
ATOM 8143   C C4     . A A 1 253 ? 158.646 63.154  52.819  1.00 0.00 ? 253 A A C4     1  
ATOM 8144   H "H5'"  . A A 1 253 ? 157.307 58.138  56.035  1.00 0.00 ? 253 A A "H5'"  1  
ATOM 8145   H "H5''" . A A 1 253 ? 158.551 57.295  55.495  1.00 0.00 ? 253 A A "H5''" 1  
ATOM 8146   H "H4'"  . A A 1 253 ? 157.300 58.077  53.694  1.00 0.00 ? 253 A A "H4'"  1  
ATOM 8147   H "H3'"  . A A 1 253 ? 159.828 59.361  53.833  1.00 0.00 ? 253 A A "H3'"  1  
ATOM 8148   H "H2'"  . A A 1 253 ? 159.361 60.450  51.870  1.00 0.00 ? 253 A A "H2'"  1  
ATOM 8149   H "HO2'" . A A 1 253 ? 158.063 58.332  51.250  1.00 0.00 ? 253 A A "HO2'" 1  
ATOM 8150   H "H1'"  . A A 1 253 ? 156.914 61.055  52.582  1.00 0.00 ? 253 A A "H1'"  1  
ATOM 8151   H H8     . A A 1 253 ? 158.823 61.666  55.569  1.00 0.00 ? 253 A A H8     1  
ATOM 8152   H H61    . A A 1 253 ? 160.537 67.074  53.393  1.00 0.00 ? 253 A A H61    1  
ATOM 8153   H H62    . A A 1 253 ? 160.516 66.079  54.769  1.00 0.00 ? 253 A A H62    1  
ATOM 8154   H H2     . A A 1 253 ? 158.568 64.781  50.191  1.00 0.00 ? 253 A A H2     1  
ATOM 8155   P P      . C A 1 254 ? 161.206 57.618  52.373  1.00 0.00 ? 254 C A P      1  
ATOM 8156   O OP1    . C A 1 254 ? 161.471 56.228  51.929  1.00 0.00 ? 254 C A OP1    1  
ATOM 8157   O OP2    . C A 1 254 ? 161.978 58.188  53.506  1.00 0.00 ? 254 C A OP2    1  
ATOM 8158   O "O5'"  . C A 1 254 ? 161.394 58.581  51.117  1.00 0.00 ? 254 C A "O5'"  1  
ATOM 8159   C "C5'"  . C A 1 254 ? 160.822 58.256  49.858  1.00 0.00 ? 254 C A "C5'"  1  
ATOM 8160   C "C4'"  . C A 1 254 ? 161.023 59.364  48.851  1.00 0.00 ? 254 C A "C4'"  1  
ATOM 8161   O "O4'"  . C A 1 254 ? 160.394 60.582  49.329  1.00 0.00 ? 254 C A "O4'"  1  
ATOM 8162   C "C3'"  . C A 1 254 ? 162.462 59.773  48.583  1.00 0.00 ? 254 C A "C3'"  1  
ATOM 8163   O "O3'"  . C A 1 254 ? 163.131 58.893  47.695  1.00 0.00 ? 254 C A "O3'"  1  
ATOM 8164   C "C2'"  . C A 1 254 ? 162.310 61.186  48.040  1.00 0.00 ? 254 C A "C2'"  1  
ATOM 8165   O "O2'"  . C A 1 254 ? 161.893 61.177  46.683  1.00 0.00 ? 254 C A "O2'"  1  
ATOM 8166   C "C1'"  . C A 1 254 ? 161.171 61.722  48.907  1.00 0.00 ? 254 C A "C1'"  1  
ATOM 8167   N N1     . C A 1 254 ? 161.663 62.494  50.077  1.00 0.00 ? 254 C A N1     1  
ATOM 8168   C C2     . C A 1 254 ? 162.105 63.806  49.868  1.00 0.00 ? 254 C A C2     1  
ATOM 8169   O O2     . C A 1 254 ? 162.070 64.284  48.722  1.00 0.00 ? 254 C A O2     1  
ATOM 8170   N N3     . C A 1 254 ? 162.560 64.531  50.917  1.00 0.00 ? 254 C A N3     1  
ATOM 8171   C C4     . C A 1 254 ? 162.588 63.995  52.137  1.00 0.00 ? 254 C A C4     1  
ATOM 8172   N N4     . C A 1 254 ? 163.045 64.746  53.141  1.00 0.00 ? 254 C A N4     1  
ATOM 8173   C C5     . C A 1 254 ? 162.149 62.664  52.380  1.00 0.00 ? 254 C A C5     1  
ATOM 8174   C C6     . C A 1 254 ? 161.698 61.957  51.336  1.00 0.00 ? 254 C A C6     1  
ATOM 8175   H "H5'"  . C A 1 254 ? 159.862 58.098  49.974  1.00 0.00 ? 254 C A "H5'"  1  
ATOM 8176   H "H5''" . C A 1 254 ? 161.242 57.437  49.519  1.00 0.00 ? 254 C A "H5''" 1  
ATOM 8177   H "H4'"  . C A 1 254 ? 160.603 59.101  48.007  1.00 0.00 ? 254 C A "H4'"  1  
ATOM 8178   H "H3'"  . C A 1 254 ? 162.951 59.805  49.432  1.00 0.00 ? 254 C A "H3'"  1  
ATOM 8179   H "H2'"  . C A 1 254 ? 163.131 61.709  48.163  1.00 0.00 ? 254 C A "H2'"  1  
ATOM 8180   H "HO2'" . C A 1 254 ? 162.096 60.301  46.292  1.00 0.00 ? 254 C A "HO2'" 1  
ATOM 8181   H "H1'"  . C A 1 254 ? 160.588 62.297  48.364  1.00 0.00 ? 254 C A "H1'"  1  
ATOM 8182   H H41    . C A 1 254 ? 163.348 65.663  52.969  1.00 0.00 ? 254 C A H41    1  
ATOM 8183   H H42    . C A 1 254 ? 163.079 64.381  54.049  1.00 0.00 ? 254 C A H42    1  
ATOM 8184   H H5     . C A 1 254 ? 162.173 62.278  53.281  1.00 0.00 ? 254 C A H5     1  
ATOM 8185   H H6     . C A 1 254 ? 161.391 61.039  51.483  1.00 0.00 ? 254 C A H6     1  
ATOM 8186   P P      . U A 1 255 ? 164.728 58.722  47.777  1.00 0.00 ? 255 U A P      1  
ATOM 8187   O OP1    . U A 1 255 ? 165.175 57.993  46.563  1.00 0.00 ? 255 U A OP1    1  
ATOM 8188   O OP2    . U A 1 255 ? 165.064 58.187  49.120  1.00 0.00 ? 255 U A OP2    1  
ATOM 8189   O "O5'"  . U A 1 255 ? 165.279 60.214  47.687  1.00 0.00 ? 255 U A "O5'"  1  
ATOM 8190   C "C5'"  . U A 1 255 ? 165.334 60.898  46.445  1.00 0.00 ? 255 U A "C5'"  1  
ATOM 8191   C "C4'"  . U A 1 255 ? 165.707 62.349  46.624  1.00 0.00 ? 255 U A "C4'"  1  
ATOM 8192   O "O4'"  . U A 1 255 ? 164.815 62.988  47.572  1.00 0.00 ? 255 U A "O4'"  1  
ATOM 8193   C "C3'"  . U A 1 255 ? 167.079 62.620  47.222  1.00 0.00 ? 255 U A "C3'"  1  
ATOM 8194   O "O3'"  . U A 1 255 ? 168.127 62.505  46.276  1.00 0.00 ? 255 U A "O3'"  1  
ATOM 8195   C "C2'"  . U A 1 255 ? 166.903 64.022  47.794  1.00 0.00 ? 255 U A "C2'"  1  
ATOM 8196   O "O2'"  . U A 1 255 ? 166.918 65.003  46.767  1.00 0.00 ? 255 U A "O2'"  1  
ATOM 8197   C "C1'"  . U A 1 255 ? 165.500 63.917  48.371  1.00 0.00 ? 255 U A "C1'"  1  
ATOM 8198   N N1     . U A 1 255 ? 165.502 63.428  49.771  1.00 0.00 ? 255 U A N1     1  
ATOM 8199   C C2     . U A 1 255 ? 165.846 64.335  50.756  1.00 0.00 ? 255 U A C2     1  
ATOM 8200   O O2     . U A 1 255 ? 166.139 65.494  50.520  1.00 0.00 ? 255 U A O2     1  
ATOM 8201   N N3     . U A 1 255 ? 165.834 63.838  52.036  1.00 0.00 ? 255 U A N3     1  
ATOM 8202   C C4     . U A 1 255 ? 165.521 62.553  52.427  1.00 0.00 ? 255 U A C4     1  
ATOM 8203   O O4     . U A 1 255 ? 165.557 62.259  53.622  1.00 0.00 ? 255 U A O4     1  
ATOM 8204   C C5     . U A 1 255 ? 165.176 61.670  51.355  1.00 0.00 ? 255 U A C5     1  
ATOM 8205   C C6     . U A 1 255 ? 165.178 62.128  50.099  1.00 0.00 ? 255 U A C6     1  
ATOM 8206   H "H5'"  . U A 1 255 ? 164.456 60.846  46.012  1.00 0.00 ? 255 U A "H5'"  1  
ATOM 8207   H "H5''" . U A 1 255 ? 166.000 60.466  45.871  1.00 0.00 ? 255 U A "H5''" 1  
ATOM 8208   H "H4'"  . U A 1 255 ? 165.624 62.805  45.761  1.00 0.00 ? 255 U A "H4'"  1  
ATOM 8209   H "H3'"  . U A 1 255 ? 167.242 61.990  47.954  1.00 0.00 ? 255 U A "H3'"  1  
ATOM 8210   H "H2'"  . U A 1 255 ? 167.570 64.213  48.487  1.00 0.00 ? 255 U A "H2'"  1  
ATOM 8211   H "HO2'" . U A 1 255 ? 166.912 65.894  47.176  1.00 0.00 ? 255 U A "HO2'" 1  
ATOM 8212   H "H1'"  . U A 1 255 ? 165.070 64.798  48.336  1.00 0.00 ? 255 U A "H1'"  1  
ATOM 8213   H H3     . U A 1 255 ? 166.075 64.465  52.750  1.00 0.00 ? 255 U A H3     1  
ATOM 8214   H H5     . U A 1 255 ? 164.939 60.737  51.541  1.00 0.00 ? 255 U A H5     1  
ATOM 8215   H H6     . U A 1 255 ? 164.939 61.504  49.383  1.00 0.00 ? 255 U A H6     1  
ATOM 8216   P P      . U A 1 256 ? 169.503 63.288  46.520  1.00 0.00 ? 256 U A P      1  
ATOM 8217   O OP1    . U A 1 256 ? 169.268 64.745  46.355  1.00 0.00 ? 256 U A OP1    1  
ATOM 8218   O OP2    . U A 1 256 ? 170.440 62.588  45.606  1.00 0.00 ? 256 U A OP2    1  
ATOM 8219   O "O5'"  . U A 1 256 ? 169.989 63.033  48.015  1.00 0.00 ? 256 U A "O5'"  1  
ATOM 8220   C "C5'"  . U A 1 256 ? 170.270 64.117  48.886  1.00 0.00 ? 256 U A "C5'"  1  
ATOM 8221   C "C4'"  . U A 1 256 ? 169.490 64.015  50.174  1.00 0.00 ? 256 U A "C4'"  1  
ATOM 8222   O "O4'"  . U A 1 256 ? 168.893 62.702  50.260  1.00 0.00 ? 256 U A "O4'"  1  
ATOM 8223   C "C3'"  . U A 1 256 ? 170.294 64.156  51.457  1.00 0.00 ? 256 U A "C3'"  1  
ATOM 8224   O "O3'"  . U A 1 256 ? 170.439 65.501  51.875  1.00 0.00 ? 256 U A "O3'"  1  
ATOM 8225   C "C2'"  . U A 1 256 ? 169.487 63.355  52.467  1.00 0.00 ? 256 U A "C2'"  1  
ATOM 8226   O "O2'"  . U A 1 256 ? 168.412 64.123  52.991  1.00 0.00 ? 256 U A "O2'"  1  
ATOM 8227   C "C1'"  . U A 1 256 ? 168.915 62.239  51.604  1.00 0.00 ? 256 U A "C1'"  1  
ATOM 8228   N N1     . U A 1 256 ? 169.741 61.008  51.656  1.00 0.00 ? 256 U A N1     1  
ATOM 8229   C C2     . U A 1 256 ? 169.616 60.211  52.779  1.00 0.00 ? 256 U A C2     1  
ATOM 8230   O O2     . U A 1 256 ? 168.868 60.477  53.704  1.00 0.00 ? 256 U A O2     1  
ATOM 8231   N N3     . U A 1 256 ? 170.399 59.083  52.784  1.00 0.00 ? 256 U A N3     1  
ATOM 8232   C C4     . U A 1 256 ? 171.278 58.677  51.802  1.00 0.00 ? 256 U A C4     1  
ATOM 8233   O O4     . U A 1 256 ? 171.914 57.633  51.955  1.00 0.00 ? 256 U A O4     1  
ATOM 8234   C C5     . U A 1 256 ? 171.356 59.550  50.671  1.00 0.00 ? 256 U A C5     1  
ATOM 8235   C C6     . U A 1 256 ? 170.603 60.655  50.640  1.00 0.00 ? 256 U A C6     1  
ATOM 8236   H "H5'"  . U A 1 256 ? 170.036 64.956  48.437  1.00 0.00 ? 256 U A "H5'"  1  
ATOM 8237   H "H5''" . U A 1 256 ? 171.228 64.122  49.093  1.00 0.00 ? 256 U A "H5''" 1  
ATOM 8238   H "H4'"  . U A 1 256 ? 168.775 64.684  50.174  1.00 0.00 ? 256 U A "H4'"  1  
ATOM 8239   H "H3'"  . U A 1 256 ? 171.182 63.759  51.339  1.00 0.00 ? 256 U A "H3'"  1  
ATOM 8240   H "H2'"  . U A 1 256 ? 170.057 62.997  53.179  1.00 0.00 ? 256 U A "H2'"  1  
ATOM 8241   H "HO2'" . U A 1 256 ? 168.634 65.075  52.917  1.00 0.00 ? 256 U A "HO2'" 1  
ATOM 8242   H "H1'"  . U A 1 256 ? 168.005 62.032  51.905  1.00 0.00 ? 256 U A "H1'"  1  
ATOM 8243   H H3     . U A 1 256 ? 170.325 58.504  53.571  1.00 0.00 ? 256 U A H3     1  
ATOM 8244   H H5     . U A 1 256 ? 171.955 59.338  49.924  1.00 0.00 ? 256 U A H5     1  
ATOM 8245   H H6     . U A 1 256 ? 170.675 61.236  49.855  1.00 0.00 ? 256 U A H6     1  
ATOM 8246   P P      . C A 1 257 ? 171.710 65.944  52.752  1.00 0.00 ? 257 C A P      1  
ATOM 8247   O OP1    . C A 1 257 ? 172.876 66.070  51.841  1.00 0.00 ? 257 C A OP1    1  
ATOM 8248   O OP2    . C A 1 257 ? 171.794 65.044  53.930  1.00 0.00 ? 257 C A OP2    1  
ATOM 8249   O "O5'"  . C A 1 257 ? 171.333 67.402  53.272  1.00 0.00 ? 257 C A "O5'"  1  
ATOM 8250   C "C5'"  . C A 1 257 ? 172.060 68.011  54.328  1.00 0.00 ? 257 C A "C5'"  1  
ATOM 8251   C "C4'"  . C A 1 257 ? 172.717 69.296  53.883  1.00 0.00 ? 257 C A "C4'"  1  
ATOM 8252   O "O4'"  . C A 1 257 ? 173.502 69.031  52.694  1.00 0.00 ? 257 C A "O4'"  1  
ATOM 8253   C "C3'"  . C A 1 257 ? 171.780 70.422  53.475  1.00 0.00 ? 257 C A "C3'"  1  
ATOM 8254   O "O3'"  . C A 1 257 ? 171.374 71.227  54.569  1.00 0.00 ? 257 C A "O3'"  1  
ATOM 8255   C "C2'"  . C A 1 257 ? 172.597 71.200  52.450  1.00 0.00 ? 257 C A "C2'"  1  
ATOM 8256   O "O2'"  . C A 1 257 ? 173.522 72.071  53.083  1.00 0.00 ? 257 C A "O2'"  1  
ATOM 8257   C "C1'"  . C A 1 257 ? 173.376 70.084  51.744  1.00 0.00 ? 257 C A "C1'"  1  
ATOM 8258   N N1     . C A 1 257 ? 172.657 69.557  50.558  1.00 0.00 ? 257 C A N1     1  
ATOM 8259   C C2     . C A 1 257 ? 172.612 70.347  49.403  1.00 0.00 ? 257 C A C2     1  
ATOM 8260   O O2     . C A 1 257 ? 173.169 71.456  49.405  1.00 0.00 ? 257 C A O2     1  
ATOM 8261   N N3     . C A 1 257 ? 171.963 69.891  48.307  1.00 0.00 ? 257 C A N3     1  
ATOM 8262   C C4     . C A 1 257 ? 171.371 68.696  48.331  1.00 0.00 ? 257 C A C4     1  
ATOM 8263   N N4     . C A 1 257 ? 170.742 68.286  47.227  1.00 0.00 ? 257 C A N4     1  
ATOM 8264   C C5     . C A 1 257 ? 171.398 67.869  49.489  1.00 0.00 ? 257 C A C5     1  
ATOM 8265   C C6     . C A 1 257 ? 172.044 68.331  50.567  1.00 0.00 ? 257 C A C6     1  
ATOM 8266   H "H5'"  . C A 1 257 ? 172.750 67.390  54.640  1.00 0.00 ? 257 C A "H5'"  1  
ATOM 8267   H "H5''" . C A 1 257 ? 171.446 68.206  55.067  1.00 0.00 ? 257 C A "H5''" 1  
ATOM 8268   H "H4'"  . C A 1 257 ? 173.314 69.620  54.588  1.00 0.00 ? 257 C A "H4'"  1  
ATOM 8269   H "H3'"  . C A 1 257 ? 170.986 70.042  53.045  1.00 0.00 ? 257 C A "H3'"  1  
ATOM 8270   H "H2'"  . C A 1 257 ? 172.019 71.680  51.821  1.00 0.00 ? 257 C A "H2'"  1  
ATOM 8271   H "HO2'" . C A 1 257 ? 174.022 72.561  52.397  1.00 0.00 ? 257 C A "HO2'" 1  
ATOM 8272   H "H1'"  . C A 1 257 ? 174.252 70.426  51.469  1.00 0.00 ? 257 C A "H1'"  1  
ATOM 8273   H H41    . C A 1 257 ? 170.725 68.859  46.431  1.00 0.00 ? 257 C A H41    1  
ATOM 8274   H H42    . C A 1 257 ? 170.298 67.414  47.212  1.00 0.00 ? 257 C A H42    1  
ATOM 8275   H H5     . C A 1 257 ? 170.961 66.992  49.497  1.00 0.00 ? 257 C A H5     1  
ATOM 8276   H H6     . C A 1 257 ? 172.074 67.777  51.374  1.00 0.00 ? 257 C A H6     1  
ATOM 8277   P P      . G A 1 258 ? 169.840 71.229  55.046  1.00 0.00 ? 258 G A P      1  
ATOM 8278   O OP1    . G A 1 258 ? 169.758 71.966  56.333  1.00 0.00 ? 258 G A OP1    1  
ATOM 8279   O OP2    . G A 1 258 ? 169.332 69.835  54.965  1.00 0.00 ? 258 G A OP2    1  
ATOM 8280   O "O5'"  . G A 1 258 ? 169.091 72.092  53.935  1.00 0.00 ? 258 G A "O5'"  1  
ATOM 8281   C "C5'"  . G A 1 258 ? 169.515 73.412  53.629  1.00 0.00 ? 258 G A "C5'"  1  
ATOM 8282   C "C4'"  . G A 1 258 ? 169.520 73.661  52.142  1.00 0.00 ? 258 G A "C4'"  1  
ATOM 8283   O "O4'"  . G A 1 258 ? 170.120 72.563  51.403  1.00 0.00 ? 258 G A "O4'"  1  
ATOM 8284   C "C3'"  . G A 1 258 ? 168.155 73.812  51.486  1.00 0.00 ? 258 G A "C3'"  1  
ATOM 8285   O "O3'"  . G A 1 258 ? 167.567 75.081  51.718  1.00 0.00 ? 258 G A "O3'"  1  
ATOM 8286   C "C2'"  . G A 1 258 ? 168.489 73.556  50.021  1.00 0.00 ? 258 G A "C2'"  1  
ATOM 8287   O "O2'"  . G A 1 258 ? 169.097 74.693  49.424  1.00 0.00 ? 258 G A "O2'"  1  
ATOM 8288   C "C1'"  . G A 1 258 ? 169.530 72.440  50.137  1.00 0.00 ? 258 G A "C1'"  1  
ATOM 8289   N N9     . G A 1 258 ? 168.920 71.100  50.044  1.00 0.00 ? 258 G A N9     1  
ATOM 8290   C C8     . G A 1 258 ? 168.764 70.186  51.057  1.00 0.00 ? 258 G A C8     1  
ATOM 8291   N N7     . G A 1 258 ? 168.187 69.081  50.668  1.00 0.00 ? 258 G A N7     1  
ATOM 8292   C C5     . G A 1 258 ? 167.947 69.278  49.315  1.00 0.00 ? 258 G A C5     1  
ATOM 8293   C C6     . G A 1 258 ? 167.341 68.426  48.355  1.00 0.00 ? 258 G A C6     1  
ATOM 8294   O O6     . G A 1 258 ? 166.882 67.289  48.515  1.00 0.00 ? 258 G A O6     1  
ATOM 8295   N N1     . G A 1 258 ? 167.298 69.020  47.098  1.00 0.00 ? 258 G A N1     1  
ATOM 8296   C C2     . G A 1 258 ? 167.775 70.273  46.801  1.00 0.00 ? 258 G A C2     1  
ATOM 8297   N N2     . G A 1 258 ? 167.644 70.674  45.527  1.00 0.00 ? 258 G A N2     1  
ATOM 8298   N N3     . G A 1 258 ? 168.342 71.077  47.686  1.00 0.00 ? 258 G A N3     1  
ATOM 8299   C C4     . G A 1 258 ? 168.393 70.519  48.914  1.00 0.00 ? 258 G A C4     1  
ATOM 8300   H "H5'"  . G A 1 258 ? 170.420 73.546  53.979  1.00 0.00 ? 258 G A "H5'"  1  
ATOM 8301   H "H5''" . G A 1 258 ? 168.908 74.050  54.060  1.00 0.00 ? 258 G A "H5''" 1  
ATOM 8302   H "H4'"  . G A 1 258 ? 170.039 74.479  51.987  1.00 0.00 ? 258 G A "H4'"  1  
ATOM 8303   H "H3'"  . G A 1 258 ? 167.547 73.114  51.805  1.00 0.00 ? 258 G A "H3'"  1  
ATOM 8304   H "H2'"  . G A 1 258 ? 167.701 73.261  49.519  1.00 0.00 ? 258 G A "H2'"  1  
ATOM 8305   H "HO2'" . G A 1 258 ? 169.302 74.491  48.488  1.00 0.00 ? 258 G A "HO2'" 1  
ATOM 8306   H "H1'"  . G A 1 258 ? 170.200 72.544  49.429  1.00 0.00 ? 258 G A "H1'"  1  
ATOM 8307   H H8     . G A 1 258 ? 169.056 70.345  51.979  1.00 0.00 ? 258 G A H8     1  
ATOM 8308   H H1     . G A 1 258 ? 166.896 68.503  46.369  1.00 0.00 ? 258 G A H1     1  
ATOM 8309   H H21    . G A 1 258 ? 167.226 70.085  44.866  1.00 0.00 ? 258 G A H21    1  
ATOM 8310   H H22    . G A 1 258 ? 167.966 71.560  45.257  1.00 0.00 ? 258 G A H22    1  
ATOM 8311   P P      . G A 1 259 ? 166.067 75.185  52.283  1.00 0.00 ? 259 G A P      1  
ATOM 8312   O OP1    . G A 1 259 ? 165.730 76.624  52.436  1.00 0.00 ? 259 G A OP1    1  
ATOM 8313   O OP2    . G A 1 259 ? 165.952 74.276  53.452  1.00 0.00 ? 259 G A OP2    1  
ATOM 8314   O "O5'"  . G A 1 259 ? 165.170 74.592  51.108  1.00 0.00 ? 259 G A "O5'"  1  
ATOM 8315   C "C5'"  . G A 1 259 ? 165.197 75.165  49.809  1.00 0.00 ? 259 G A "C5'"  1  
ATOM 8316   C "C4'"  . G A 1 259 ? 164.834 74.153  48.748  1.00 0.00 ? 259 G A "C4'"  1  
ATOM 8317   O "O4'"  . G A 1 259 ? 165.658 72.970  48.897  1.00 0.00 ? 259 G A "O4'"  1  
ATOM 8318   C "C3'"  . G A 1 259 ? 163.411 73.623  48.793  1.00 0.00 ? 259 G A "C3'"  1  
ATOM 8319   O "O3'"  . G A 1 259 ? 162.473 74.495  48.185  1.00 0.00 ? 259 G A "O3'"  1  
ATOM 8320   C "C2'"  . G A 1 259 ? 163.535 72.278  48.090  1.00 0.00 ? 259 G A "C2'"  1  
ATOM 8321   O "O2'"  . G A 1 259 ? 163.601 72.438  46.680  1.00 0.00 ? 259 G A "O2'"  1  
ATOM 8322   C "C1'"  . G A 1 259 ? 164.894 71.794  48.598  1.00 0.00 ? 259 G A "C1'"  1  
ATOM 8323   N N9     . G A 1 259 ? 164.768 70.936  49.793  1.00 0.00 ? 259 G A N9     1  
ATOM 8324   C C8     . G A 1 259 ? 165.088 71.261  51.088  1.00 0.00 ? 259 G A C8     1  
ATOM 8325   N N7     . G A 1 259 ? 164.868 70.289  51.931  1.00 0.00 ? 259 G A N7     1  
ATOM 8326   C C5     . G A 1 259 ? 164.369 69.262  51.145  1.00 0.00 ? 259 G A C5     1  
ATOM 8327   C C6     . G A 1 259 ? 163.947 67.954  51.501  1.00 0.00 ? 259 G A C6     1  
ATOM 8328   O O6     . G A 1 259 ? 163.930 67.428  52.620  1.00 0.00 ? 259 G A O6     1  
ATOM 8329   N N1     . G A 1 259 ? 163.512 67.234  50.392  1.00 0.00 ? 259 G A N1     1  
ATOM 8330   C C2     . G A 1 259 ? 163.485 67.714  49.104  1.00 0.00 ? 259 G A C2     1  
ATOM 8331   N N2     . G A 1 259 ? 163.033 66.868  48.166  1.00 0.00 ? 259 G A N2     1  
ATOM 8332   N N3     . G A 1 259 ? 163.875 68.929  48.758  1.00 0.00 ? 259 G A N3     1  
ATOM 8333   C C4     . G A 1 259 ? 164.301 69.643  49.822  1.00 0.00 ? 259 G A C4     1  
ATOM 8334   H "H5'"  . G A 1 259 ? 166.098 75.508  49.630  1.00 0.00 ? 259 G A "H5'"  1  
ATOM 8335   H "H5''" . G A 1 259 ? 164.560 75.907  49.774  1.00 0.00 ? 259 G A "H5''" 1  
ATOM 8336   H "H4'"  . G A 1 259 ? 164.999 74.548  47.865  1.00 0.00 ? 259 G A "H4'"  1  
ATOM 8337   H "H3'"  . G A 1 259 ? 163.151 73.473  49.727  1.00 0.00 ? 259 G A "H3'"  1  
ATOM 8338   H "H2'"  . G A 1 259 ? 162.815 71.667  48.352  1.00 0.00 ? 259 G A "H2'"  1  
ATOM 8339   H "HO2'" . G A 1 259 ? 163.240 73.315  46.443  1.00 0.00 ? 259 G A "HO2'" 1  
ATOM 8340   H "H1'"  . G A 1 259 ? 165.351 71.298  47.887  1.00 0.00 ? 259 G A "H1'"  1  
ATOM 8341   H H8     . G A 1 259 ? 165.449 72.134  51.354  1.00 0.00 ? 259 G A H8     1  
ATOM 8342   H H1     . G A 1 259 ? 163.202 66.318  50.543  1.00 0.00 ? 259 G A H1     1  
ATOM 8343   H H21    . G A 1 259 ? 162.741 65.966  48.412  1.00 0.00 ? 259 G A H21    1  
ATOM 8344   H H22    . G A 1 259 ? 162.989 67.155  47.228  1.00 0.00 ? 259 G A H22    1  
ATOM 8345   P P      . U A 1 260 ? 160.956 74.543  48.711  1.00 0.00 ? 260 U A P      1  
ATOM 8346   O OP1    . U A 1 260 ? 160.290 75.719  48.091  1.00 0.00 ? 260 U A OP1    1  
ATOM 8347   O OP2    . U A 1 260 ? 160.977 74.406  50.188  1.00 0.00 ? 260 U A OP2    1  
ATOM 8348   O "O5'"  . U A 1 260 ? 160.296 73.228  48.102  1.00 0.00 ? 260 U A "O5'"  1  
ATOM 8349   C "C5'"  . U A 1 260 ? 160.103 73.089  46.702  1.00 0.00 ? 260 U A "C5'"  1  
ATOM 8350   C "C4'"  . U A 1 260 ? 159.524 71.742  46.352  1.00 0.00 ? 260 U A "C4'"  1  
ATOM 8351   O "O4'"  . U A 1 260 ? 160.455 70.690  46.723  1.00 0.00 ? 260 U A "O4'"  1  
ATOM 8352   C "C3'"  . U A 1 260 ? 158.235 71.360  47.062  1.00 0.00 ? 260 U A "C3'"  1  
ATOM 8353   O "O3'"  . U A 1 260 ? 157.080 71.922  46.458  1.00 0.00 ? 260 U A "O3'"  1  
ATOM 8354   C "C2'"  . U A 1 260 ? 158.267 69.839  47.018  1.00 0.00 ? 260 U A "C2'"  1  
ATOM 8355   O "O2'"  . U A 1 260 ? 157.892 69.352  45.737  1.00 0.00 ? 260 U A "O2'"  1  
ATOM 8356   C "C1'"  . U A 1 260 ? 159.753 69.558  47.237  1.00 0.00 ? 260 U A "C1'"  1  
ATOM 8357   N N1     . U A 1 260 ? 160.084 69.376  48.673  1.00 0.00 ? 260 U A N1     1  
ATOM 8358   C C2     . U A 1 260 ? 159.781 68.152  49.239  1.00 0.00 ? 260 U A C2     1  
ATOM 8359   O O2     . U A 1 260 ? 159.264 67.240  48.616  1.00 0.00 ? 260 U A O2     1  
ATOM 8360   N N3     . U A 1 260 ? 160.105 68.027  50.567  1.00 0.00 ? 260 U A N3     1  
ATOM 8361   C C4     . U A 1 260 ? 160.688 68.980  51.374  1.00 0.00 ? 260 U A C4     1  
ATOM 8362   O O4     . U A 1 260 ? 160.918 68.715  52.555  1.00 0.00 ? 260 U A O4     1  
ATOM 8363   C C5     . U A 1 260 ? 160.974 70.220  50.722  1.00 0.00 ? 260 U A C5     1  
ATOM 8364   C C6     . U A 1 260 ? 160.671 70.369  49.429  1.00 0.00 ? 260 U A C6     1  
ATOM 8365   H "H5'"  . U A 1 260 ? 160.966 73.193  46.248  1.00 0.00 ? 260 U A "H5'"  1  
ATOM 8366   H "H5''" . U A 1 260 ? 159.491 73.789  46.394  1.00 0.00 ? 260 U A "H5''" 1  
ATOM 8367   H "H4'"  . U A 1 260 ? 159.374 71.707  45.382  1.00 0.00 ? 260 U A "H4'"  1  
ATOM 8368   H "H3'"  . U A 1 260 ? 158.282 71.654  47.997  1.00 0.00 ? 260 U A "H3'"  1  
ATOM 8369   H "H2'"  . U A 1 260 ? 157.718 69.446  47.728  1.00 0.00 ? 260 U A "H2'"  1  
ATOM 8370   H "HO2'" . U A 1 260 ? 157.396 70.050  45.264  1.00 0.00 ? 260 U A "HO2'" 1  
ATOM 8371   H "H1'"  . U A 1 260 ? 160.013 68.753  46.744  1.00 0.00 ? 260 U A "H1'"  1  
ATOM 8372   H H3     . U A 1 260 ? 159.896 67.166  50.988  1.00 0.00 ? 260 U A H3     1  
ATOM 8373   H H5     . U A 1 260 ? 161.391 70.955  51.220  1.00 0.00 ? 260 U A H5     1  
ATOM 8374   H H6     . U A 1 260 ? 160.874 71.227  49.005  1.00 0.00 ? 260 U A H6     1  
ATOM 8375   P P      . G A 1 261 ? 155.783 72.250  47.345  1.00 0.00 ? 261 G A P      1  
ATOM 8376   O OP1    . G A 1 261 ? 154.833 73.022  46.500  1.00 0.00 ? 261 G A OP1    1  
ATOM 8377   O OP2    . G A 1 261 ? 156.238 72.817  48.638  1.00 0.00 ? 261 G A OP2    1  
ATOM 8378   O "O5'"  . G A 1 261 ? 155.139 70.822  47.632  1.00 0.00 ? 261 G A "O5'"  1  
ATOM 8379   C "C5'"  . G A 1 261 ? 154.567 70.055  46.584  1.00 0.00 ? 261 G A "C5'"  1  
ATOM 8380   C "C4'"  . G A 1 261 ? 154.170 68.680  47.055  1.00 0.00 ? 261 G A "C4'"  1  
ATOM 8381   O "O4'"  . G A 1 261 ? 155.343 67.967  47.532  1.00 0.00 ? 261 G A "O4'"  1  
ATOM 8382   C "C3'"  . G A 1 261 ? 153.204 68.627  48.229  1.00 0.00 ? 261 G A "C3'"  1  
ATOM 8383   O "O3'"  . G A 1 261 ? 151.853 68.816  47.841  1.00 0.00 ? 261 G A "O3'"  1  
ATOM 8384   C "C2'"  . G A 1 261 ? 153.484 67.258  48.830  1.00 0.00 ? 261 G A "C2'"  1  
ATOM 8385   O "O2'"  . G A 1 261 ? 152.871 66.226  48.073  1.00 0.00 ? 261 G A "O2'"  1  
ATOM 8386   C "C1'"  . G A 1 261 ? 155.002 67.158  48.671  1.00 0.00 ? 261 G A "C1'"  1  
ATOM 8387   N N9     . G A 1 261 ? 155.721 67.616  49.873  1.00 0.00 ? 261 G A N9     1  
ATOM 8388   C C8     . G A 1 261 ? 156.414 68.789  50.030  1.00 0.00 ? 261 G A C8     1  
ATOM 8389   N N7     . G A 1 261 ? 156.949 68.916  51.216  1.00 0.00 ? 261 G A N7     1  
ATOM 8390   C C5     . G A 1 261 ? 156.582 67.754  51.883  1.00 0.00 ? 261 G A C5     1  
ATOM 8391   C C6     . G A 1 261 ? 156.868 67.323  53.204  1.00 0.00 ? 261 G A C6     1  
ATOM 8392   O O6     . G A 1 261 ? 157.523 67.903  54.077  1.00 0.00 ? 261 G A O6     1  
ATOM 8393   N N1     . G A 1 261 ? 156.302 66.079  53.472  1.00 0.00 ? 261 G A N1     1  
ATOM 8394   C C2     . G A 1 261 ? 155.556 65.346  52.581  1.00 0.00 ? 261 G A C2     1  
ATOM 8395   N N2     . G A 1 261 ? 155.094 64.166  53.025  1.00 0.00 ? 261 G A N2     1  
ATOM 8396   N N3     . G A 1 261 ? 155.284 65.736  51.347  1.00 0.00 ? 261 G A N3     1  
ATOM 8397   C C4     . G A 1 261 ? 155.824 66.942  51.068  1.00 0.00 ? 261 G A C4     1  
ATOM 8398   H "H5'"  . G A 1 261 ? 155.221 69.970  45.858  1.00 0.00 ? 261 G A "H5'"  1  
ATOM 8399   H "H5''" . G A 1 261 ? 153.773 70.519  46.244  1.00 0.00 ? 261 G A "H5''" 1  
ATOM 8400   H "H4'"  . G A 1 261 ? 153.782 68.184  46.304  1.00 0.00 ? 261 G A "H4'"  1  
ATOM 8401   H "H3'"  . G A 1 261 ? 153.449 69.319  48.878  1.00 0.00 ? 261 G A "H3'"  1  
ATOM 8402   H "H2'"  . G A 1 261 ? 153.222 67.219  49.775  1.00 0.00 ? 261 G A "H2'"  1  
ATOM 8403   H "HO2'" . G A 1 261 ? 152.152 66.610  47.530  1.00 0.00 ? 261 G A "HO2'" 1  
ATOM 8404   H "H1'"  . G A 1 261 ? 155.249 66.229  48.473  1.00 0.00 ? 261 G A "H1'"  1  
ATOM 8405   H H8     . G A 1 261 ? 156.502 69.464  49.327  1.00 0.00 ? 261 G A H8     1  
ATOM 8406   H H1     . G A 1 261 ? 156.448 65.702  54.364  1.00 0.00 ? 261 G A H1     1  
ATOM 8407   H H21    . G A 1 261 ? 155.292 63.869  53.937  1.00 0.00 ? 261 G A H21    1  
ATOM 8408   H H22    . G A 1 261 ? 154.556 63.599  52.433  1.00 0.00 ? 261 G A H22    1  
ATOM 8409   P P      . C A 1 262 ? 150.803 69.470  48.866  1.00 0.00 ? 262 C A P      1  
ATOM 8410   O OP1    . C A 1 262 ? 149.556 69.770  48.115  1.00 0.00 ? 262 C A OP1    1  
ATOM 8411   O OP2    . C A 1 262 ? 151.494 70.557  49.600  1.00 0.00 ? 262 C A OP2    1  
ATOM 8412   O "O5'"  . C A 1 262 ? 150.485 68.300  49.899  1.00 0.00 ? 262 C A "O5'"  1  
ATOM 8413   C "C5'"  . C A 1 262 ? 149.785 67.137  49.487  1.00 0.00 ? 262 C A "C5'"  1  
ATOM 8414   C "C4'"  . C A 1 262 ? 149.720 66.108  50.590  1.00 0.00 ? 262 C A "C4'"  1  
ATOM 8415   O "O4'"  . C A 1 262 ? 151.062 65.699  50.965  1.00 0.00 ? 262 C A "O4'"  1  
ATOM 8416   C "C3'"  . C A 1 262 ? 149.093 66.565  51.898  1.00 0.00 ? 262 C A "C3'"  1  
ATOM 8417   O "O3'"  . C A 1 262 ? 147.677 66.514  51.882  1.00 0.00 ? 262 C A "O3'"  1  
ATOM 8418   C "C2'"  . C A 1 262 ? 149.727 65.627  52.916  1.00 0.00 ? 262 C A "C2'"  1  
ATOM 8419   O "O2'"  . C A 1 262 ? 149.110 64.349  52.894  1.00 0.00 ? 262 C A "O2'"  1  
ATOM 8420   C "C1'"  . C A 1 262 ? 151.151 65.503  52.372  1.00 0.00 ? 262 C A "C1'"  1  
ATOM 8421   N N1     . C A 1 262 ? 152.074 66.497  52.970  1.00 0.00 ? 262 C A N1     1  
ATOM 8422   C C2     . C A 1 262 ? 152.569 66.253  54.258  1.00 0.00 ? 262 C A C2     1  
ATOM 8423   O O2     . C A 1 262 ? 152.225 65.221  54.855  1.00 0.00 ? 262 C A O2     1  
ATOM 8424   N N3     . C A 1 262 ? 153.413 67.144  54.827  1.00 0.00 ? 262 C A N3     1  
ATOM 8425   C C4     . C A 1 262 ? 153.768 68.244  54.165  1.00 0.00 ? 262 C A C4     1  
ATOM 8426   N N4     . C A 1 262 ? 154.602 69.097  54.767  1.00 0.00 ? 262 C A N4     1  
ATOM 8427   C C5     . C A 1 262 ? 153.281 68.523  52.857  1.00 0.00 ? 262 C A C5     1  
ATOM 8428   C C6     . C A 1 262 ? 152.448 67.635  52.303  1.00 0.00 ? 262 C A C6     1  
ATOM 8429   H "H5'"  . C A 1 262 ? 150.238 66.746  48.712  1.00 0.00 ? 262 C A "H5'"  1  
ATOM 8430   H "H5''" . C A 1 262 ? 148.873 67.387  49.231  1.00 0.00 ? 262 C A "H5''" 1  
ATOM 8431   H "H4'"  . C A 1 262 ? 149.230 65.325  50.260  1.00 0.00 ? 262 C A "H4'"  1  
ATOM 8432   H "H3'"  . C A 1 262 ? 149.380 67.484  52.086  1.00 0.00 ? 262 C A "H3'"  1  
ATOM 8433   H "H2'"  . C A 1 262 ? 149.723 66.017  53.816  1.00 0.00 ? 262 C A "H2'"  1  
ATOM 8434   H "HO2'" . C A 1 262 ? 148.227 64.426  52.479  1.00 0.00 ? 262 C A "HO2'" 1  
ATOM 8435   H "H1'"  . C A 1 262 ? 151.489 64.600  52.547  1.00 0.00 ? 262 C A "H1'"  1  
ATOM 8436   H H41    . C A 1 262 ? 154.935 68.903  55.668  1.00 0.00 ? 262 C A H41    1  
ATOM 8437   H H42    . C A 1 262 ? 154.881 69.915  54.307  1.00 0.00 ? 262 C A H42    1  
ATOM 8438   H H5     . C A 1 262 ? 153.546 69.336  52.378  1.00 0.00 ? 262 C A H5     1  
ATOM 8439   H H6     . C A 1 262 ? 152.101 67.807  51.403  1.00 0.00 ? 262 C A H6     1  
ATOM 8440   P P      . C A 1 263 ? 146.823 67.559  52.755  1.00 0.00 ? 263 C A P      1  
ATOM 8441   O OP1    . C A 1 263 ? 145.395 67.426  52.359  1.00 0.00 ? 263 C A OP1    1  
ATOM 8442   O OP2    . C A 1 263 ? 147.487 68.883  52.674  1.00 0.00 ? 263 C A OP2    1  
ATOM 8443   O "O5'"  . C A 1 263 ? 146.968 67.025  54.249  1.00 0.00 ? 263 C A "O5'"  1  
ATOM 8444   C "C5'"  . C A 1 263 ? 146.383 65.792  54.643  1.00 0.00 ? 263 C A "C5'"  1  
ATOM 8445   C "C4'"  . C A 1 263 ? 146.770 65.417  56.053  1.00 0.00 ? 263 C A "C4'"  1  
ATOM 8446   O "O4'"  . C A 1 263 ? 148.210 65.250  56.142  1.00 0.00 ? 263 C A "O4'"  1  
ATOM 8447   C "C3'"  . C A 1 263 ? 146.452 66.443  57.131  1.00 0.00 ? 263 C A "C3'"  1  
ATOM 8448   O "O3'"  . C A 1 263 ? 145.103 66.387  57.566  1.00 0.00 ? 263 C A "O3'"  1  
ATOM 8449   C "C2'"  . C A 1 263 ? 147.459 66.105  58.220  1.00 0.00 ? 263 C A "C2'"  1  
ATOM 8450   O "O2'"  . C A 1 263 ? 147.050 64.970  58.967  1.00 0.00 ? 263 C A "O2'"  1  
ATOM 8451   C "C1'"  . C A 1 263 ? 148.692 65.739  57.391  1.00 0.00 ? 263 C A "C1'"  1  
ATOM 8452   N N1     . C A 1 263 ? 149.594 66.897  57.181  1.00 0.00 ? 263 C A N1     1  
ATOM 8453   C C2     . C A 1 263 ? 150.435 67.286  58.228  1.00 0.00 ? 263 C A C2     1  
ATOM 8454   O O2     . C A 1 263 ? 150.402 66.656  59.298  1.00 0.00 ? 263 C A O2     1  
ATOM 8455   N N3     . C A 1 263 ? 151.267 68.339  58.062  1.00 0.00 ? 263 C A N3     1  
ATOM 8456   C C4     . C A 1 263 ? 151.285 68.999  56.905  1.00 0.00 ? 263 C A C4     1  
ATOM 8457   N N4     . C A 1 263 ? 152.120 70.033  56.783  1.00 0.00 ? 263 C A N4     1  
ATOM 8458   C C5     . C A 1 263 ? 150.442 68.630  55.819  1.00 0.00 ? 263 C A C5     1  
ATOM 8459   C C6     . C A 1 263 ? 149.621 67.585  55.996  1.00 0.00 ? 263 C A C6     1  
ATOM 8460   H "H5'"  . C A 1 263 ? 146.681 65.088  54.033  1.00 0.00 ? 263 C A "H5'"  1  
ATOM 8461   H "H5''" . C A 1 263 ? 145.409 65.868  54.592  1.00 0.00 ? 263 C A "H5''" 1  
ATOM 8462   H "H4'"  . C A 1 263 ? 146.337 64.570  56.284  1.00 0.00 ? 263 C A "H4'"  1  
ATOM 8463   H "H3'"  . C A 1 263 ? 146.642 67.341  56.787  1.00 0.00 ? 263 C A "H3'"  1  
ATOM 8464   H "H2'"  . C A 1 263 ? 147.634 66.877  58.800  1.00 0.00 ? 263 C A "H2'"  1  
ATOM 8465   H "HO2'" . C A 1 263 ? 146.087 64.838  58.847  1.00 0.00 ? 263 C A "HO2'" 1  
ATOM 8466   H "H1'"  . C A 1 263 ? 149.185 65.022  57.843  1.00 0.00 ? 263 C A "H1'"  1  
ATOM 8467   H H41    . C A 1 263 ? 152.700 70.286  57.533  1.00 0.00 ? 263 C A H41    1  
ATOM 8468   H H42    . C A 1 263 ? 152.158 70.539  55.947  1.00 0.00 ? 263 C A H42    1  
ATOM 8469   H H5     . C A 1 263 ? 150.460 69.121  54.971  1.00 0.00 ? 263 C A H5     1  
ATOM 8470   H H6     . C A 1 263 ? 149.035 67.316  55.260  1.00 0.00 ? 263 C A H6     1  
ATOM 8471   P P      . U A 1 264 ? 144.374 67.712  58.110  1.00 0.00 ? 264 U A P      1  
ATOM 8472   O OP1    . U A 1 264 ? 142.929 67.410  58.268  1.00 0.00 ? 264 U A OP1    1  
ATOM 8473   O OP2    . U A 1 264 ? 144.798 68.852  57.258  1.00 0.00 ? 264 U A OP2    1  
ATOM 8474   O "O5'"  . U A 1 264 ? 144.995 67.924  59.562  1.00 0.00 ? 264 U A "O5'"  1  
ATOM 8475   C "C5'"  . U A 1 264 ? 144.725 67.006  60.610  1.00 0.00 ? 264 U A "C5'"  1  
ATOM 8476   C "C4'"  . U A 1 264 ? 145.490 67.356  61.864  1.00 0.00 ? 264 U A "C4'"  1  
ATOM 8477   O "O4'"  . U A 1 264 ? 146.917 67.260  61.619  1.00 0.00 ? 264 U A "O4'"  1  
ATOM 8478   C "C3'"  . U A 1 264 ? 145.299 68.769  62.394  1.00 0.00 ? 264 U A "C3'"  1  
ATOM 8479   O "O3'"  . U A 1 264 ? 144.117 68.919  63.163  1.00 0.00 ? 264 U A "O3'"  1  
ATOM 8480   C "C2'"  . U A 1 264 ? 146.577 69.001  63.187  1.00 0.00 ? 264 U A "C2'"  1  
ATOM 8481   O "O2'"  . U A 1 264 ? 146.522 68.356  64.451  1.00 0.00 ? 264 U A "O2'"  1  
ATOM 8482   C "C1'"  . U A 1 264 ? 147.612 68.294  62.311  1.00 0.00 ? 264 U A "C1'"  1  
ATOM 8483   N N1     . U A 1 264 ? 148.257 69.219  61.347  1.00 0.00 ? 264 U A N1     1  
ATOM 8484   C C2     . U A 1 264 ? 149.253 70.044  61.835  1.00 0.00 ? 264 U A C2     1  
ATOM 8485   O O2     . U A 1 264 ? 149.612 70.039  62.999  1.00 0.00 ? 264 U A O2     1  
ATOM 8486   N N3     . U A 1 264 ? 149.823 70.881  60.907  1.00 0.00 ? 264 U A N3     1  
ATOM 8487   C C4     . U A 1 264 ? 149.505 70.977  59.567  1.00 0.00 ? 264 U A C4     1  
ATOM 8488   O O4     . U A 1 264 ? 150.111 71.785  58.860  1.00 0.00 ? 264 U A O4     1  
ATOM 8489   C C5     . U A 1 264 ? 148.466 70.094  59.135  1.00 0.00 ? 264 U A C5     1  
ATOM 8490   C C6     . U A 1 264 ? 147.896 69.268  60.018  1.00 0.00 ? 264 U A C6     1  
ATOM 8491   H "H5'"  . U A 1 264 ? 144.982 66.107  60.321  1.00 0.00 ? 264 U A "H5'"  1  
ATOM 8492   H "H5''" . U A 1 264 ? 143.766 67.018  60.809  1.00 0.00 ? 264 U A "H5''" 1  
ATOM 8493   H "H4'"  . U A 1 264 ? 145.243 66.719  62.567  1.00 0.00 ? 264 U A "H4'"  1  
ATOM 8494   H "H3'"  . U A 1 264 ? 145.272 69.394  61.639  1.00 0.00 ? 264 U A "H3'"  1  
ATOM 8495   H "H2'"  . U A 1 264 ? 146.777 69.957  63.277  1.00 0.00 ? 264 U A "H2'"  1  
ATOM 8496   H "HO2'" . U A 1 264 ? 145.586 68.174  64.679  1.00 0.00 ? 264 U A "HO2'" 1  
ATOM 8497   H "H1'"  . U A 1 264 ? 148.300 67.891  62.880  1.00 0.00 ? 264 U A "H1'"  1  
ATOM 8498   H H3     . U A 1 264 ? 150.532 71.475  61.231  1.00 0.00 ? 264 U A H3     1  
ATOM 8499   H H5     . U A 1 264 ? 148.177 70.096  58.197  1.00 0.00 ? 264 U A H5     1  
ATOM 8500   H H6     . U A 1 264 ? 147.187 68.674  59.696  1.00 0.00 ? 264 U A H6     1  
ATOM 8501   P P      . C A 1 265 ? 143.362 70.337  63.220  1.00 0.00 ? 265 C A P      1  
ATOM 8502   O OP1    . C A 1 265 ? 142.067 70.138  63.917  1.00 0.00 ? 265 C A OP1    1  
ATOM 8503   O OP2    . C A 1 265 ? 143.378 70.922  61.853  1.00 0.00 ? 265 C A OP2    1  
ATOM 8504   O "O5'"  . C A 1 265 ? 144.292 71.233  64.150  1.00 0.00 ? 265 C A "O5'"  1  
ATOM 8505   C "C5'"  . C A 1 265 ? 144.445 70.936  65.531  1.00 0.00 ? 265 C A "C5'"  1  
ATOM 8506   C "C4'"  . C A 1 265 ? 145.476 71.827  66.181  1.00 0.00 ? 265 C A "C4'"  1  
ATOM 8507   O "O4'"  . C A 1 265 ? 146.773 71.611  65.564  1.00 0.00 ? 265 C A "O4'"  1  
ATOM 8508   C "C3'"  . C A 1 265 ? 145.248 73.323  66.051  1.00 0.00 ? 265 C A "C3'"  1  
ATOM 8509   O "O3'"  . C A 1 265 ? 144.318 73.828  66.993  1.00 0.00 ? 265 C A "O3'"  1  
ATOM 8510   C "C2'"  . C A 1 265 ? 146.652 73.889  66.215  1.00 0.00 ? 265 C A "C2'"  1  
ATOM 8511   O "O2'"  . C A 1 265 ? 147.040 73.919  67.579  1.00 0.00 ? 265 C A "O2'"  1  
ATOM 8512   C "C1'"  . C A 1 265 ? 147.491 72.841  65.481  1.00 0.00 ? 265 C A "C1'"  1  
ATOM 8513   N N1     . C A 1 265 ? 147.734 73.204  64.063  1.00 0.00 ? 265 C A N1     1  
ATOM 8514   C C2     . C A 1 265 ? 148.718 74.157  63.779  1.00 0.00 ? 265 C A C2     1  
ATOM 8515   O O2     . C A 1 265 ? 149.354 74.669  64.714  1.00 0.00 ? 265 C A O2     1  
ATOM 8516   N N3     . C A 1 265 ? 148.959 74.505  62.495  1.00 0.00 ? 265 C A N3     1  
ATOM 8517   C C4     . C A 1 265 ? 148.262 73.943  61.508  1.00 0.00 ? 265 C A C4     1  
ATOM 8518   N N4     . C A 1 265 ? 148.534 74.318  60.255  1.00 0.00 ? 265 C A N4     1  
ATOM 8519   C C5     . C A 1 265 ? 147.254 72.971  61.763  1.00 0.00 ? 265 C A C5     1  
ATOM 8520   C C6     . C A 1 265 ? 147.024 72.634  63.037  1.00 0.00 ? 265 C A C6     1  
ATOM 8521   H "H5'"  . C A 1 265 ? 144.724 70.001  65.628  1.00 0.00 ? 265 C A "H5'"  1  
ATOM 8522   H "H5''" . C A 1 265 ? 143.585 71.062  65.982  1.00 0.00 ? 265 C A "H5''" 1  
ATOM 8523   H "H4'"  . C A 1 265 ? 145.535 71.597  67.133  1.00 0.00 ? 265 C A "H4'"  1  
ATOM 8524   H "H3'"  . C A 1 265 ? 144.927 73.523  65.144  1.00 0.00 ? 265 C A "H3'"  1  
ATOM 8525   H "H2'"  . C A 1 265 ? 146.734 74.773  65.793  1.00 0.00 ? 265 C A "H2'"  1  
ATOM 8526   H "HO2'" . C A 1 265 ? 146.238 73.876  68.141  1.00 0.00 ? 265 C A "HO2'" 1  
ATOM 8527   H "H1'"  . C A 1 265 ? 148.350 72.733  65.939  1.00 0.00 ? 265 C A "H1'"  1  
ATOM 8528   H H41    . C A 1 265 ? 149.228 74.987  60.085  1.00 0.00 ? 265 C A H41    1  
ATOM 8529   H H42    . C A 1 265 ? 148.038 73.921  59.509  1.00 0.00 ? 265 C A H42    1  
ATOM 8530   H H5     . C A 1 265 ? 146.747 72.561  61.030  1.00 0.00 ? 265 C A H5     1  
ATOM 8531   H H6     . C A 1 265 ? 146.335 71.967  63.232  1.00 0.00 ? 265 C A H6     1  
ATOM 8532   P P      . U A 1 266 ? 143.358 75.055  66.605  1.00 0.00 ? 266 U A P      1  
ATOM 8533   O OP1    . U A 1 266 ? 142.414 75.275  67.730  1.00 0.00 ? 266 U A OP1    1  
ATOM 8534   O OP2    . U A 1 266 ? 142.828 74.809  65.241  1.00 0.00 ? 266 U A OP2    1  
ATOM 8535   O "O5'"  . U A 1 266 ? 144.340 76.305  66.535  1.00 0.00 ? 266 U A "O5'"  1  
ATOM 8536   C "C5'"  . U A 1 266 ? 145.023 76.763  67.692  1.00 0.00 ? 266 U A "C5'"  1  
ATOM 8537   C "C4'"  . U A 1 266 ? 146.121 77.739  67.342  1.00 0.00 ? 266 U A "C4'"  1  
ATOM 8538   O "O4'"  . U A 1 266 ? 147.085 77.106  66.462  1.00 0.00 ? 266 U A "O4'"  1  
ATOM 8539   C "C3'"  . U A 1 266 ? 145.690 78.985  66.587  1.00 0.00 ? 266 U A "C3'"  1  
ATOM 8540   O "O3'"  . U A 1 266 ? 145.179 79.999  67.434  1.00 0.00 ? 266 U A "O3'"  1  
ATOM 8541   C "C2'"  . U A 1 266 ? 146.964 79.386  65.856  1.00 0.00 ? 266 U A "C2'"  1  
ATOM 8542   O "O2'"  . U A 1 266 ? 147.871 80.049  66.726  1.00 0.00 ? 266 U A "O2'"  1  
ATOM 8543   C "C1'"  . U A 1 266 ? 147.544 78.021  65.481  1.00 0.00 ? 266 U A "C1'"  1  
ATOM 8544   N N1     . U A 1 266 ? 147.132 77.586  64.125  1.00 0.00 ? 266 U A N1     1  
ATOM 8545   C C2     . U A 1 266 ? 147.781 78.170  63.051  1.00 0.00 ? 266 U A C2     1  
ATOM 8546   O O2     . U A 1 266 ? 148.657 79.007  63.178  1.00 0.00 ? 266 U A O2     1  
ATOM 8547   N N3     . U A 1 266 ? 147.367 77.737  61.815  1.00 0.00 ? 266 U A N3     1  
ATOM 8548   C C4     . U A 1 266 ? 146.392 76.803  61.545  1.00 0.00 ? 266 U A C4     1  
ATOM 8549   O O4     . U A 1 266 ? 146.133 76.520  60.374  1.00 0.00 ? 266 U A O4     1  
ATOM 8550   C C5     . U A 1 266 ? 145.765 76.243  62.703  1.00 0.00 ? 266 U A C5     1  
ATOM 8551   C C6     . U A 1 266 ? 146.147 76.643  63.919  1.00 0.00 ? 266 U A C6     1  
ATOM 8552   H "H5'"  . U A 1 266 ? 145.419 75.992  68.154  1.00 0.00 ? 266 U A "H5'"  1  
ATOM 8553   H "H5''" . U A 1 266 ? 144.386 77.201  68.291  1.00 0.00 ? 266 U A "H5''" 1  
ATOM 8554   H "H4'"  . U A 1 266 ? 146.574 78.010  68.168  1.00 0.00 ? 266 U A "H4'"  1  
ATOM 8555   H "H3'"  . U A 1 266 ? 145.006 78.743  65.928  1.00 0.00 ? 266 U A "H3'"  1  
ATOM 8556   H "H2'"  . U A 1 266 ? 146.768 79.923  65.057  1.00 0.00 ? 266 U A "H2'"  1  
ATOM 8557   H "HO2'" . U A 1 266 ? 148.556 79.413  67.017  1.00 0.00 ? 266 U A "HO2'" 1  
ATOM 8558   H "H1'"  . U A 1 266 ? 148.523 78.060  65.525  1.00 0.00 ? 266 U A "H1'"  1  
ATOM 8559   H H3     . U A 1 266 ? 147.814 78.140  61.042  1.00 0.00 ? 266 U A H3     1  
ATOM 8560   H H5     . U A 1 266 ? 145.058 75.568  62.604  1.00 0.00 ? 266 U A H5     1  
ATOM 8561   H H6     . U A 1 266 ? 145.702 76.246  64.695  1.00 0.00 ? 266 U A H6     1  
ATOM 8562   P P      . G A 1 267 ? 145.863 80.284  68.860  1.00 0.00 ? 267 G A P      1  
ATOM 8563   O OP1    . G A 1 267 ? 145.261 79.357  69.852  1.00 0.00 ? 267 G A OP1    1  
ATOM 8564   O OP2    . G A 1 267 ? 145.824 81.748  69.104  1.00 0.00 ? 267 G A OP2    1  
ATOM 8565   O "O5'"  . G A 1 267 ? 147.385 79.860  68.650  1.00 0.00 ? 267 G A "O5'"  1  
ATOM 8566   C "C5'"  . G A 1 267 ? 148.163 79.376  69.734  1.00 0.00 ? 267 G A "C5'"  1  
ATOM 8567   C "C4'"  . G A 1 267 ? 149.307 78.517  69.255  1.00 0.00 ? 267 G A "C4'"  1  
ATOM 8568   O "O4'"  . G A 1 267 ? 149.559 78.764  67.847  1.00 0.00 ? 267 G A "O4'"  1  
ATOM 8569   C "C3'"  . G A 1 267 ? 150.659 78.786  69.899  1.00 0.00 ? 267 G A "C3'"  1  
ATOM 8570   O "O3'"  . G A 1 267 ? 150.794 78.183  71.174  1.00 0.00 ? 267 G A "O3'"  1  
ATOM 8571   C "C2'"  . G A 1 267 ? 151.603 78.158  68.883  1.00 0.00 ? 267 G A "C2'"  1  
ATOM 8572   O "O2'"  . G A 1 267 ? 151.616 76.743  68.998  1.00 0.00 ? 267 G A "O2'"  1  
ATOM 8573   C "C1'"  . G A 1 267 ? 150.924 78.548  67.570  1.00 0.00 ? 267 G A "C1'"  1  
ATOM 8574   N N9     . G A 1 267 ? 151.501 79.775  66.989  1.00 0.00 ? 267 G A N9     1  
ATOM 8575   C C8     . G A 1 267 ? 150.823 80.891  66.562  1.00 0.00 ? 267 G A C8     1  
ATOM 8576   N N7     . G A 1 267 ? 151.609 81.821  66.092  1.00 0.00 ? 267 G A N7     1  
ATOM 8577   C C5     . G A 1 267 ? 152.884 81.288  66.216  1.00 0.00 ? 267 G A C5     1  
ATOM 8578   C C6     . G A 1 267 ? 154.148 81.835  65.873  1.00 0.00 ? 267 G A C6     1  
ATOM 8579   O O6     . G A 1 267 ? 154.399 82.938  65.373  1.00 0.00 ? 267 G A O6     1  
ATOM 8580   N N1     . G A 1 267 ? 155.185 80.955  66.167  1.00 0.00 ? 267 G A N1     1  
ATOM 8581   C C2     . G A 1 267 ? 155.027 79.708  66.721  1.00 0.00 ? 267 G A C2     1  
ATOM 8582   N N2     . G A 1 267 ? 156.150 79.004  66.932  1.00 0.00 ? 267 G A N2     1  
ATOM 8583   N N3     . G A 1 267 ? 153.855 79.186  67.046  1.00 0.00 ? 267 G A N3     1  
ATOM 8584   C C4     . G A 1 267 ? 152.835 80.025  66.768  1.00 0.00 ? 267 G A C4     1  
ATOM 8585   H "H5'"  . G A 1 267 ? 147.591 78.846  70.327  1.00 0.00 ? 267 G A "H5'"  1  
ATOM 8586   H "H5''" . G A 1 267 ? 148.523 80.138  70.235  1.00 0.00 ? 267 G A "H5''" 1  
ATOM 8587   H "H4'"  . G A 1 267 ? 149.066 77.574  69.372  1.00 0.00 ? 267 G A "H4'"  1  
ATOM 8588   H "H3'"  . G A 1 267 ? 150.810 79.753  69.936  1.00 0.00 ? 267 G A "H3'"  1  
ATOM 8589   H "H2'"  . G A 1 267 ? 152.505 78.536  68.949  1.00 0.00 ? 267 G A "H2'"  1  
ATOM 8590   H "HO2'" . G A 1 267 ? 152.242 76.375  68.340  1.00 0.00 ? 267 G A "HO2'" 1  
ATOM 8591   H "H1'"  . G A 1 267 ? 151.008 77.812  66.928  1.00 0.00 ? 267 G A "H1'"  1  
ATOM 8592   H H8     . G A 1 267 ? 149.848 80.981  66.605  1.00 0.00 ? 267 G A H8     1  
ATOM 8593   H H1     . G A 1 267 ? 156.097 81.250  65.962  1.00 0.00 ? 267 G A H1     1  
ATOM 8594   H H21    . G A 1 267 ? 157.021 79.384  66.695  1.00 0.00 ? 267 G A H21    1  
ATOM 8595   H H22    . G A 1 267 ? 156.099 78.108  67.326  1.00 0.00 ? 267 G A H22    1  
ATOM 8596   P P      . A A 1 268 ? 151.675 78.895  72.315  1.00 0.00 ? 268 A A P      1  
ATOM 8597   O OP1    . A A 1 268 ? 150.911 78.844  73.586  1.00 0.00 ? 268 A A OP1    1  
ATOM 8598   O OP2    . A A 1 268 ? 152.139 80.203  71.788  1.00 0.00 ? 268 A A OP2    1  
ATOM 8599   O "O5'"  . A A 1 268 ? 152.948 77.947  72.466  1.00 0.00 ? 268 A A "O5'"  1  
ATOM 8600   C "C5'"  . A A 1 268 ? 152.796 76.559  72.721  1.00 0.00 ? 268 A A "C5'"  1  
ATOM 8601   C "C4'"  . A A 1 268 ? 153.343 76.181  74.075  1.00 0.00 ? 268 A A "C4'"  1  
ATOM 8602   O "O4'"  . A A 1 268 ? 154.322 77.162  74.482  1.00 0.00 ? 268 A A "O4'"  1  
ATOM 8603   C "C3'"  . A A 1 268 ? 152.358 76.239  75.232  1.00 0.00 ? 268 A A "C3'"  1  
ATOM 8604   O "O3'"  . A A 1 268 ? 151.551 75.079  75.333  1.00 0.00 ? 268 A A "O3'"  1  
ATOM 8605   C "C2'"  . A A 1 268 ? 153.285 76.324  76.434  1.00 0.00 ? 268 A A "C2'"  1  
ATOM 8606   O "O2'"  . A A 1 268 ? 153.841 75.055  76.746  1.00 0.00 ? 268 A A "O2'"  1  
ATOM 8607   C "C1'"  . A A 1 268 ? 154.367 77.227  75.879  1.00 0.00 ? 268 A A "C1'"  1  
ATOM 8608   N N9     . A A 1 268 ? 154.176 78.634  76.278  1.00 0.00 ? 268 A A N9     1  
ATOM 8609   C C8     . A A 1 268 ? 153.770 79.687  75.495  1.00 0.00 ? 268 A A C8     1  
ATOM 8610   N N7     . A A 1 268 ? 153.693 80.825  76.138  1.00 0.00 ? 268 A A N7     1  
ATOM 8611   C C5     . A A 1 268 ? 154.074 80.503  77.433  1.00 0.00 ? 268 A A C5     1  
ATOM 8612   C C6     . A A 1 268 ? 154.202 81.273  78.603  1.00 0.00 ? 268 A A C6     1  
ATOM 8613   N N6     . A A 1 268 ? 153.947 82.582  78.658  1.00 0.00 ? 268 A A N6     1  
ATOM 8614   N N1     . A A 1 268 ? 154.604 80.645  79.728  1.00 0.00 ? 268 A A N1     1  
ATOM 8615   C C2     . A A 1 268 ? 154.860 79.331  79.673  1.00 0.00 ? 268 A A C2     1  
ATOM 8616   N N3     . A A 1 268 ? 154.777 78.501  78.636  1.00 0.00 ? 268 A A N3     1  
ATOM 8617   C C4     . A A 1 268 ? 154.374 79.157  77.533  1.00 0.00 ? 268 A A C4     1  
ATOM 8618   H "H5'"  . A A 1 268 ? 153.274 76.053  72.031  1.00 0.00 ? 268 A A "H5'"  1  
ATOM 8619   H "H5''" . A A 1 268 ? 151.845 76.328  72.685  1.00 0.00 ? 268 A A "H5''" 1  
ATOM 8620   H "H4'"  . A A 1 268 ? 153.773 75.303  74.009  1.00 0.00 ? 268 A A "H4'"  1  
ATOM 8621   H "H3'"  . A A 1 268 ? 151.834 77.066  75.168  1.00 0.00 ? 268 A A "H3'"  1  
ATOM 8622   H "H2'"  . A A 1 268 ? 152.834 76.724  77.207  1.00 0.00 ? 268 A A "H2'"  1  
ATOM 8623   H "HO2'" . A A 1 268 ? 154.431 75.148  77.522  1.00 0.00 ? 268 A A "HO2'" 1  
ATOM 8624   H "H1'"  . A A 1 268 ? 155.243 76.915  76.190  1.00 0.00 ? 268 A A "H1'"  1  
ATOM 8625   H H8     . A A 1 268 ? 153.557 79.594  74.542  1.00 0.00 ? 268 A A H8     1  
ATOM 8626   H H61    . A A 1 268 ? 154.054 83.067  79.504  1.00 0.00 ? 268 A A H61    1  
ATOM 8627   H H62    . A A 1 268 ? 153.654 83.060  77.854  1.00 0.00 ? 268 A A H62    1  
ATOM 8628   H H2     . A A 1 268 ? 155.148 78.923  80.517  1.00 0.00 ? 268 A A H2     1  
ATOM 8629   P P      . U A 1 269 ? 149.957 75.214  75.491  1.00 0.00 ? 269 U A P      1  
ATOM 8630   O OP1    . U A 1 269 ? 149.371 73.850  75.430  1.00 0.00 ? 269 U A OP1    1  
ATOM 8631   O OP2    . U A 1 269 ? 149.489 76.257  74.545  1.00 0.00 ? 269 U A OP2    1  
ATOM 8632   O "O5'"  . U A 1 269 ? 149.763 75.767  76.972  1.00 0.00 ? 269 U A "O5'"  1  
ATOM 8633   C "C5'"  . U A 1 269 ? 149.951 74.923  78.097  1.00 0.00 ? 269 U A "C5'"  1  
ATOM 8634   C "C4'"  . U A 1 269 ? 150.168 75.718  79.361  1.00 0.00 ? 269 U A "C4'"  1  
ATOM 8635   O "O4'"  . U A 1 269 ? 151.346 76.572  79.218  1.00 0.00 ? 269 U A "O4'"  1  
ATOM 8636   C "C3'"  . U A 1 269 ? 149.127 76.784  79.670  1.00 0.00 ? 269 U A "C3'"  1  
ATOM 8637   O "O3'"  . U A 1 269 ? 147.843 76.245  79.926  1.00 0.00 ? 269 U A "O3'"  1  
ATOM 8638   C "C2'"  . U A 1 269 ? 149.871 77.415  80.826  1.00 0.00 ? 269 U A "C2'"  1  
ATOM 8639   O "O2'"  . U A 1 269 ? 150.100 76.474  81.866  1.00 0.00 ? 269 U A "O2'"  1  
ATOM 8640   C "C1'"  . U A 1 269 ? 151.125 77.682  79.990  1.00 0.00 ? 269 U A "C1'"  1  
ATOM 8641   N N1     . U A 1 269 ? 150.982 78.881  79.130  1.00 0.00 ? 269 U A N1     1  
ATOM 8642   C C2     . U A 1 269 ? 151.183 80.113  79.726  1.00 0.00 ? 269 U A C2     1  
ATOM 8643   O O2     . U A 1 269 ? 151.466 80.244  80.904  1.00 0.00 ? 269 U A O2     1  
ATOM 8644   N N3     . U A 1 269 ? 151.041 81.194  78.891  1.00 0.00 ? 269 U A N3     1  
ATOM 8645   C C4     . U A 1 269 ? 150.725 81.173  77.549  1.00 0.00 ? 269 U A C4     1  
ATOM 8646   O O4     . U A 1 269 ? 150.632 82.236  76.933  1.00 0.00 ? 269 U A O4     1  
ATOM 8647   C C5     . U A 1 269 ? 150.532 79.865  77.001  1.00 0.00 ? 269 U A C5     1  
ATOM 8648   C C6     . U A 1 269 ? 150.665 78.795  77.791  1.00 0.00 ? 269 U A C6     1  
ATOM 8649   H "H5'"  . U A 1 269 ? 150.733 74.352  77.942  1.00 0.00 ? 269 U A "H5'"  1  
ATOM 8650   H "H5''" . U A 1 269 ? 149.159 74.357  78.209  1.00 0.00 ? 269 U A "H5''" 1  
ATOM 8651   H "H4'"  . U A 1 269 ? 150.317 75.097  80.104  1.00 0.00 ? 269 U A "H4'"  1  
ATOM 8652   H "H3'"  . U A 1 269 ? 149.057 77.396  78.908  1.00 0.00 ? 269 U A "H3'"  1  
ATOM 8653   H "H2'"  . U A 1 269 ? 149.411 78.214  81.156  1.00 0.00 ? 269 U A "H2'"  1  
ATOM 8654   H "HO2'" . U A 1 269 ? 150.417 76.949  82.662  1.00 0.00 ? 269 U A "HO2'" 1  
ATOM 8655   H "H1'"  . U A 1 269 ? 151.893 77.801  80.589  1.00 0.00 ? 269 U A "H1'"  1  
ATOM 8656   H H3     . U A 1 269 ? 151.178 82.076  79.293  1.00 0.00 ? 269 U A H3     1  
ATOM 8657   H H5     . U A 1 269 ? 150.305 79.756  76.053  1.00 0.00 ? 269 U A H5     1  
ATOM 8658   H H6     . U A 1 269 ? 150.527 77.911  77.392  1.00 0.00 ? 269 U A H6     1  
ATOM 8659   P P      . A A 1 270 ? 147.653 75.098  81.035  1.00 0.00 ? 270 A A P      1  
ATOM 8660   O OP1    . A A 1 270 ? 148.965 74.867  81.688  1.00 0.00 ? 270 A A OP1    1  
ATOM 8661   O OP2    . A A 1 270 ? 146.937 73.961  80.403  1.00 0.00 ? 270 A A OP2    1  
ATOM 8662   O "O5'"  . A A 1 270 ? 146.677 75.758  82.109  1.00 0.00 ? 270 A A "O5'"  1  
ATOM 8663   C "C5'"  . A A 1 270 ? 145.632 75.004  82.704  1.00 0.00 ? 270 A A "C5'"  1  
ATOM 8664   C "C4'"  . A A 1 270 ? 145.477 75.332  84.168  1.00 0.00 ? 270 A A "C4'"  1  
ATOM 8665   O "O4'"  . A A 1 270 ? 146.744 75.129  84.817  1.00 0.00 ? 270 A A "O4'"  1  
ATOM 8666   C "C3'"  . A A 1 270 ? 145.130 76.777  84.495  1.00 0.00 ? 270 A A "C3'"  1  
ATOM 8667   O "O3'"  . A A 1 270 ? 143.741 77.045  84.421  1.00 0.00 ? 270 A A "O3'"  1  
ATOM 8668   C "C2'"  . A A 1 270 ? 145.695 76.949  85.902  1.00 0.00 ? 270 A A "C2'"  1  
ATOM 8669   O "O2'"  . A A 1 270 ? 144.814 76.413  86.879  1.00 0.00 ? 270 A A "O2'"  1  
ATOM 8670   C "C1'"  . A A 1 270 ? 146.946 76.085  85.840  1.00 0.00 ? 270 A A "C1'"  1  
ATOM 8671   N N9     . A A 1 270 ? 148.148 76.870  85.499  1.00 0.00 ? 270 A A N9     1  
ATOM 8672   C C8     . A A 1 270 ? 148.614 77.199  84.250  1.00 0.00 ? 270 A A C8     1  
ATOM 8673   N N7     . A A 1 270 ? 149.714 77.911  84.267  1.00 0.00 ? 270 A A N7     1  
ATOM 8674   C C5     . A A 1 270 ? 149.992 78.061  85.619  1.00 0.00 ? 270 A A C5     1  
ATOM 8675   C C6     . A A 1 270 ? 151.030 78.716  86.305  1.00 0.00 ? 270 A A C6     1  
ATOM 8676   N N6     . A A 1 270 ? 152.021 79.371  85.697  1.00 0.00 ? 270 A A N6     1  
ATOM 8677   N N1     . A A 1 270 ? 151.014 78.676  87.655  1.00 0.00 ? 270 A A N1     1  
ATOM 8678   C C2     . A A 1 270 ? 150.020 78.019  88.266  1.00 0.00 ? 270 A A C2     1  
ATOM 8679   N N3     . A A 1 270 ? 148.991 77.365  87.731  1.00 0.00 ? 270 A A N3     1  
ATOM 8680   C C4     . A A 1 270 ? 149.036 77.425  86.388  1.00 0.00 ? 270 A A C4     1  
ATOM 8681   H "H5'"  . A A 1 270 ? 145.832 74.049  82.611  1.00 0.00 ? 270 A A "H5'"  1  
ATOM 8682   H "H5''" . A A 1 270 ? 144.791 75.200  82.242  1.00 0.00 ? 270 A A "H5''" 1  
ATOM 8683   H "H4'"  . A A 1 270 ? 144.807 74.731  84.559  1.00 0.00 ? 270 A A "H4'"  1  
ATOM 8684   H "H3'"  . A A 1 270 ? 145.614 77.370  83.883  1.00 0.00 ? 270 A A "H3'"  1  
ATOM 8685   H "H2'"  . A A 1 270 ? 145.917 77.886  86.088  1.00 0.00 ? 270 A A "H2'"  1  
ATOM 8686   H "HO2'" . A A 1 270 ? 145.208 76.541  87.767  1.00 0.00 ? 270 A A "HO2'" 1  
ATOM 8687   H "H1'"  . A A 1 270 ? 147.080 75.642  86.705  1.00 0.00 ? 270 A A "H1'"  1  
ATOM 8688   H H8     . A A 1 270 ? 148.165 76.928  83.421  1.00 0.00 ? 270 A A H8     1  
ATOM 8689   H H61    . A A 1 270 ? 152.718 79.809  86.230  1.00 0.00 ? 270 A A H61    1  
ATOM 8690   H H62    . A A 1 270 ? 152.054 79.414  84.719  1.00 0.00 ? 270 A A H62    1  
ATOM 8691   H H2     . A A 1 270 ? 150.054 78.019  89.245  1.00 0.00 ? 270 A A H2     1  
ATOM 8692   P P      . A A 1 271 ? 143.183 78.138  83.383  1.00 0.00 ? 271 A A P      1  
ATOM 8693   O OP1    . A A 1 271 ? 141.790 77.768  83.029  1.00 0.00 ? 271 A A OP1    1  
ATOM 8694   O OP2    . A A 1 271 ? 144.194 78.310  82.309  1.00 0.00 ? 271 A A OP2    1  
ATOM 8695   O "O5'"  . A A 1 271 ? 143.135 79.485  84.233  1.00 0.00 ? 271 A A "O5'"  1  
ATOM 8696   C "C5'"  . A A 1 271 ? 142.312 79.591  85.385  1.00 0.00 ? 271 A A "C5'"  1  
ATOM 8697   C "C4'"  . A A 1 271 ? 143.090 80.091  86.577  1.00 0.00 ? 271 A A "C4'"  1  
ATOM 8698   O "O4'"  . A A 1 271 ? 144.351 79.382  86.692  1.00 0.00 ? 271 A A "O4'"  1  
ATOM 8699   C "C3'"  . A A 1 271 ? 143.500 81.555  86.540  1.00 0.00 ? 271 A A "C3'"  1  
ATOM 8700   O "O3'"  . A A 1 271 ? 142.506 82.423  87.058  1.00 0.00 ? 271 A A "O3'"  1  
ATOM 8701   C "C2'"  . A A 1 271 ? 144.764 81.558  87.376  1.00 0.00 ? 271 A A "C2'"  1  
ATOM 8702   O "O2'"  . A A 1 271 ? 144.464 81.502  88.763  1.00 0.00 ? 271 A A "O2'"  1  
ATOM 8703   C "C1'"  . A A 1 271 ? 145.403 80.246  86.953  1.00 0.00 ? 271 A A "C1'"  1  
ATOM 8704   N N9     . A A 1 271 ? 146.218 80.392  85.732  1.00 0.00 ? 271 A A N9     1  
ATOM 8705   C C8     . A A 1 271 ? 145.856 80.111  84.438  1.00 0.00 ? 271 A A C8     1  
ATOM 8706   N N7     . A A 1 271 ? 146.802 80.344  83.562  1.00 0.00 ? 271 A A N7     1  
ATOM 8707   C C5     . A A 1 271 ? 147.859 80.811  84.330  1.00 0.00 ? 271 A A C5     1  
ATOM 8708   C C6     . A A 1 271 ? 149.159 81.234  83.997  1.00 0.00 ? 271 A A C6     1  
ATOM 8709   N N6     . A A 1 271 ? 149.633 81.256  82.749  1.00 0.00 ? 271 A A N6     1  
ATOM 8710   N N1     . A A 1 271 ? 149.965 81.639  85.002  1.00 0.00 ? 271 A A N1     1  
ATOM 8711   C C2     . A A 1 271 ? 149.490 81.618  86.254  1.00 0.00 ? 271 A A C2     1  
ATOM 8712   N N3     . A A 1 271 ? 148.290 81.243  86.692  1.00 0.00 ? 271 A A N3     1  
ATOM 8713   C C4     . A A 1 271 ? 147.513 80.846  85.668  1.00 0.00 ? 271 A A C4     1  
ATOM 8714   H "H5'"  . A A 1 271 ? 141.939 78.709  85.594  1.00 0.00 ? 271 A A "H5'"  1  
ATOM 8715   H "H5''" . A A 1 271 ? 141.578 80.212  85.199  1.00 0.00 ? 271 A A "H5''" 1  
ATOM 8716   H "H4'"  . A A 1 271 ? 142.564 79.930  87.388  1.00 0.00 ? 271 A A "H4'"  1  
ATOM 8717   H "H3'"  . A A 1 271 ? 143.723 81.804  85.618  1.00 0.00 ? 271 A A "H3'"  1  
ATOM 8718   H "H2'"  . A A 1 271 ? 145.337 82.324  87.158  1.00 0.00 ? 271 A A "H2'"  1  
ATOM 8719   H "HO2'" . A A 1 271 ? 145.302 81.521  89.270  1.00 0.00 ? 271 A A "HO2'" 1  
ATOM 8720   H "H1'"  . A A 1 271 ? 145.966 79.908  87.682  1.00 0.00 ? 271 A A "H1'"  1  
ATOM 8721   H H8     . A A 1 271 ? 144.971 79.767  84.191  1.00 0.00 ? 271 A A H8     1  
ATOM 8722   H H61    . A A 1 271 ? 150.548 81.561  82.578  1.00 0.00 ? 271 A A H61    1  
ATOM 8723   H H62    . A A 1 271 ? 149.066 80.966  82.004  1.00 0.00 ? 271 A A H62    1  
ATOM 8724   H H2     . A A 1 271 ? 150.114 81.922  86.946  1.00 0.00 ? 271 A A H2     1  
ATOM 8725   P P      . C A 1 272 ? 142.328 83.901  86.452  1.00 0.00 ? 272 C A P      1  
ATOM 8726   O OP1    . C A 1 272 ? 141.124 84.510  87.072  1.00 0.00 ? 272 C A OP1    1  
ATOM 8727   O OP2    . C A 1 272 ? 142.424 83.807  84.973  1.00 0.00 ? 272 C A OP2    1  
ATOM 8728   O "O5'"  . C A 1 272 ? 143.607 84.691  86.980  1.00 0.00 ? 272 C A "O5'"  1  
ATOM 8729   C "C5'"  . C A 1 272 ? 143.861 84.821  88.370  1.00 0.00 ? 272 C A "C5'"  1  
ATOM 8730   C "C4'"  . C A 1 272 ? 145.312 85.133  88.645  1.00 0.00 ? 272 C A "C4'"  1  
ATOM 8731   O "O4'"  . C A 1 272 ? 146.150 84.072  88.115  1.00 0.00 ? 272 C A "O4'"  1  
ATOM 8732   C "C3'"  . C A 1 272 ? 145.866 86.383  87.978  1.00 0.00 ? 272 C A "C3'"  1  
ATOM 8733   O "O3'"  . C A 1 272 ? 145.569 87.569  88.694  1.00 0.00 ? 272 C A "O3'"  1  
ATOM 8734   C "C2'"  . C A 1 272 ? 147.343 86.048  87.844  1.00 0.00 ? 272 C A "C2'"  1  
ATOM 8735   O "O2'"  . C A 1 272 ? 148.013 86.164  89.090  1.00 0.00 ? 272 C A "O2'"  1  
ATOM 8736   C "C1'"  . C A 1 272 ? 147.257 84.574  87.446  1.00 0.00 ? 272 C A "C1'"  1  
ATOM 8737   N N1     . C A 1 272 ? 147.040 84.396  85.989  1.00 0.00 ? 272 C A N1     1  
ATOM 8738   C C2     . C A 1 272 ? 148.151 84.462  85.138  1.00 0.00 ? 272 C A C2     1  
ATOM 8739   O O2     . C A 1 272 ? 149.274 84.666  85.623  1.00 0.00 ? 272 C A O2     1  
ATOM 8740   N N3     . C A 1 272 ? 147.980 84.302  83.806  1.00 0.00 ? 272 C A N3     1  
ATOM 8741   C C4     . C A 1 272 ? 146.763 84.084  83.309  1.00 0.00 ? 272 C A C4     1  
ATOM 8742   N N4     . C A 1 272 ? 146.642 83.932  81.988  1.00 0.00 ? 272 C A N4     1  
ATOM 8743   C C5     . C A 1 272 ? 145.614 84.012  84.146  1.00 0.00 ? 272 C A C5     1  
ATOM 8744   C C6     . C A 1 272 ? 145.795 84.171  85.463  1.00 0.00 ? 272 C A C6     1  
ATOM 8745   H "H5'"  . C A 1 272 ? 143.625 83.981  88.818  1.00 0.00 ? 272 C A "H5'"  1  
ATOM 8746   H "H5''" . C A 1 272 ? 143.306 85.543  88.731  1.00 0.00 ? 272 C A "H5''" 1  
ATOM 8747   H "H4'"  . C A 1 272 ? 145.445 85.190  89.613  1.00 0.00 ? 272 C A "H4'"  1  
ATOM 8748   H "H3'"  . C A 1 272 ? 145.473 86.474  87.085  1.00 0.00 ? 272 C A "H3'"  1  
ATOM 8749   H "H2'"  . C A 1 272 ? 147.772 86.591  87.150  1.00 0.00 ? 272 C A "H2'"  1  
ATOM 8750   H "HO2'" . C A 1 272 ? 148.863 85.680  89.043  1.00 0.00 ? 272 C A "HO2'" 1  
ATOM 8751   H "H1'"  . C A 1 272 ? 148.083 84.120  87.711  1.00 0.00 ? 272 C A "H1'"  1  
ATOM 8752   H H41    . C A 1 272 ? 147.436 83.983  81.415  1.00 0.00 ? 272 C A H41    1  
ATOM 8753   H H42    . C A 1 272 ? 145.761 83.771  81.592  1.00 0.00 ? 272 C A H42    1  
ATOM 8754   H H5     . C A 1 272 ? 144.722 83.851  83.772  1.00 0.00 ? 272 C A H5     1  
ATOM 8755   H H6     . C A 1 272 ? 145.016 84.125  86.056  1.00 0.00 ? 272 C A H6     1  
ATOM 8756   P P      . A A 1 273 ? 145.238 88.929  87.903  1.00 0.00 ? 273 A A P      1  
ATOM 8757   O OP1    . A A 1 273 ? 144.962 89.989  88.905  1.00 0.00 ? 273 A A OP1    1  
ATOM 8758   O OP2    . A A 1 273 ? 144.225 88.621  86.862  1.00 0.00 ? 273 A A OP2    1  
ATOM 8759   O "O5'"  . A A 1 273 ? 146.605 89.289  87.168  1.00 0.00 ? 273 A A "O5'"  1  
ATOM 8760   C "C5'"  . A A 1 273 ? 147.778 89.581  87.913  1.00 0.00 ? 273 A A "C5'"  1  
ATOM 8761   C "C4'"  . A A 1 273 ? 149.013 89.517  87.049  1.00 0.00 ? 273 A A "C4'"  1  
ATOM 8762   O "O4'"  . A A 1 273 ? 149.064 88.239  86.375  1.00 0.00 ? 273 A A "O4'"  1  
ATOM 8763   C "C3'"  . A A 1 273 ? 149.084 90.524  85.912  1.00 0.00 ? 273 A A "C3'"  1  
ATOM 8764   O "O3'"  . A A 1 273 ? 149.525 91.804  86.330  1.00 0.00 ? 273 A A "O3'"  1  
ATOM 8765   C "C2'"  . A A 1 273 ? 150.078 89.859  84.966  1.00 0.00 ? 273 A A "C2'"  1  
ATOM 8766   O "O2'"  . A A 1 273 ? 151.416 90.061  85.398  1.00 0.00 ? 273 A A "O2'"  1  
ATOM 8767   C "C1'"  . A A 1 273 ? 149.720 88.383  85.136  1.00 0.00 ? 273 A A "C1'"  1  
ATOM 8768   N N9     . A A 1 273 ? 148.842 87.895  84.055  1.00 0.00 ? 273 A A N9     1  
ATOM 8769   C C8     . A A 1 273 ? 147.505 87.590  84.127  1.00 0.00 ? 273 A A C8     1  
ATOM 8770   N N7     . A A 1 273 ? 146.995 87.178  82.992  1.00 0.00 ? 273 A A N7     1  
ATOM 8771   C C5     . A A 1 273 ? 148.069 87.215  82.112  1.00 0.00 ? 273 A A C5     1  
ATOM 8772   C C6     . A A 1 273 ? 148.186 86.895  80.748  1.00 0.00 ? 273 A A C6     1  
ATOM 8773   N N6     . A A 1 273 ? 147.170 86.460  80.000  1.00 0.00 ? 273 A A N6     1  
ATOM 8774   N N1     . A A 1 273 ? 149.398 87.042  80.171  1.00 0.00 ? 273 A A N1     1  
ATOM 8775   C C2     . A A 1 273 ? 150.418 87.479  80.921  1.00 0.00 ? 273 A A C2     1  
ATOM 8776   N N3     . A A 1 273 ? 150.431 87.811  82.210  1.00 0.00 ? 273 A A N3     1  
ATOM 8777   C C4     . A A 1 273 ? 149.211 87.655  82.754  1.00 0.00 ? 273 A A C4     1  
ATOM 8778   H "H5'"  . A A 1 273 ? 147.865 88.930  88.642  1.00 0.00 ? 273 A A "H5'"  1  
ATOM 8779   H "H5''" . A A 1 273 ? 147.701 90.479  88.295  1.00 0.00 ? 273 A A "H5''" 1  
ATOM 8780   H "H4'"  . A A 1 273 ? 149.805 89.610  87.620  1.00 0.00 ? 273 A A "H4'"  1  
ATOM 8781   H "H3'"  . A A 1 273 ? 148.207 90.579  85.476  1.00 0.00 ? 273 A A "H3'"  1  
ATOM 8782   H "H2'"  . A A 1 273 ? 149.947 90.154  84.040  1.00 0.00 ? 273 A A "H2'"  1  
ATOM 8783   H "HO2'" . A A 1 273 ? 152.024 89.858  84.658  1.00 0.00 ? 273 A A "HO2'" 1  
ATOM 8784   H "H1'"  . A A 1 273 ? 150.542 87.848  85.155  1.00 0.00 ? 273 A A "H1'"  1  
ATOM 8785   H H8     . A A 1 273 ? 146.980 87.673  84.951  1.00 0.00 ? 273 A A H8     1  
ATOM 8786   H H61    . A A 1 273 ? 147.313 86.253  79.052  1.00 0.00 ? 273 A A H61    1  
ATOM 8787   H H62    . A A 1 273 ? 146.282 86.345  80.397  1.00 0.00 ? 273 A A H62    1  
ATOM 8788   H H2     . A A 1 273 ? 151.275 87.569  80.454  1.00 0.00 ? 273 A A H2     1  
ATOM 8789   P P      . A A 1 274 ? 148.554 93.077  86.197  1.00 0.00 ? 274 A A P      1  
ATOM 8790   O OP1    . A A 1 274 ? 149.172 94.208  86.933  1.00 0.00 ? 274 A A OP1    1  
ATOM 8791   O OP2    . A A 1 274 ? 147.177 92.642  86.541  1.00 0.00 ? 274 A A OP2    1  
ATOM 8792   O "O5'"  . A A 1 274 ? 148.585 93.424  84.642  1.00 0.00 ? 274 A A "O5'"  1  
ATOM 8793   C "C5'"  . A A 1 274 ? 149.415 94.463  84.144  1.00 0.00 ? 274 A A "C5'"  1  
ATOM 8794   C "C4'"  . A A 1 274 ? 149.296 94.597  82.647  1.00 0.00 ? 274 A A "C4'"  1  
ATOM 8795   O "O4'"  . A A 1 274 ? 149.690 93.354  82.010  1.00 0.00 ? 274 A A "O4'"  1  
ATOM 8796   C "C3'"  . A A 1 274 ? 147.897 94.859  82.109  1.00 0.00 ? 274 A A "C3'"  1  
ATOM 8797   O "O3'"  . A A 1 274 ? 147.523 96.224  82.178  1.00 0.00 ? 274 A A "O3'"  1  
ATOM 8798   C "C2'"  . A A 1 274 ? 147.994 94.311  80.691  1.00 0.00 ? 274 A A "C2'"  1  
ATOM 8799   O "O2'"  . A A 1 274 ? 148.681 95.213  79.836  1.00 0.00 ? 274 A A "O2'"  1  
ATOM 8800   C "C1'"  . A A 1 274 ? 148.860 93.076  80.920  1.00 0.00 ? 274 A A "C1'"  1  
ATOM 8801   N N9     . A A 1 274 ? 148.056 91.891  81.276  1.00 0.00 ? 274 A A N9     1  
ATOM 8802   C C8     . A A 1 274 ? 148.019 91.226  82.477  1.00 0.00 ? 274 A A C8     1  
ATOM 8803   N N7     . A A 1 274 ? 147.201 90.203  82.489  1.00 0.00 ? 274 A A N7     1  
ATOM 8804   C C5     . A A 1 274 ? 146.663 90.191  81.209  1.00 0.00 ? 274 A A C5     1  
ATOM 8805   C C6     . A A 1 274 ? 145.728 89.348  80.582  1.00 0.00 ? 274 A A C6     1  
ATOM 8806   N N6     . A A 1 274 ? 145.145 88.311  81.187  1.00 0.00 ? 274 A A N6     1  
ATOM 8807   N N1     . A A 1 274 ? 145.408 89.611  79.297  1.00 0.00 ? 274 A A N1     1  
ATOM 8808   C C2     . A A 1 274 ? 145.993 90.652  78.690  1.00 0.00 ? 274 A A C2     1  
ATOM 8809   N N3     . A A 1 274 ? 146.885 91.514  79.173  1.00 0.00 ? 274 A A N3     1  
ATOM 8810   C C4     . A A 1 274 ? 147.181 91.226  80.453  1.00 0.00 ? 274 A A C4     1  
ATOM 8811   H "H5'"  . A A 1 274 ? 150.348 94.265  84.374  1.00 0.00 ? 274 A A "H5'"  1  
ATOM 8812   H "H5''" . A A 1 274 ? 149.156 95.309  84.563  1.00 0.00 ? 274 A A "H5''" 1  
ATOM 8813   H "H4'"  . A A 1 274 ? 149.894 95.313  82.344  1.00 0.00 ? 274 A A "H4'"  1  
ATOM 8814   H "H3'"  . A A 1 274 ? 147.252 94.325  82.619  1.00 0.00 ? 274 A A "H3'"  1  
ATOM 8815   H "H2'"  . A A 1 274 ? 147.111 94.075  80.336  1.00 0.00 ? 274 A A "H2'"  1  
ATOM 8816   H "HO2'" . A A 1 274 ? 148.714 94.834  78.933  1.00 0.00 ? 274 A A "HO2'" 1  
ATOM 8817   H "H1'"  . A A 1 274 ? 149.379 92.887  80.109  1.00 0.00 ? 274 A A "H1'"  1  
ATOM 8818   H H8     . A A 1 274 ? 148.554 91.493  83.254  1.00 0.00 ? 274 A A H8     1  
ATOM 8819   H H61    . A A 1 274 ? 144.500 87.758  80.698  1.00 0.00 ? 274 A A H61    1  
ATOM 8820   H H62    . A A 1 274 ? 145.362 88.101  82.119  1.00 0.00 ? 274 A A H62    1  
ATOM 8821   H H2     . A A 1 274 ? 145.726 90.799  77.758  1.00 0.00 ? 274 A A H2     1  
ATOM 8822   P P      . C A 1 275 ? 146.225 96.664  83.017  1.00 0.00 ? 275 C A P      1  
ATOM 8823   O OP1    . C A 1 275 ? 146.020 98.121  82.815  1.00 0.00 ? 275 C A OP1    1  
ATOM 8824   O OP2    . C A 1 275 ? 146.364 96.128  84.395  1.00 0.00 ? 275 C A OP2    1  
ATOM 8825   O "O5'"  . C A 1 275 ? 145.025 95.895  82.306  1.00 0.00 ? 275 C A "O5'"  1  
ATOM 8826   C "C5'"  . C A 1 275 ? 144.572 96.283  81.018  1.00 0.00 ? 275 C A "C5'"  1  
ATOM 8827   C "C4'"  . C A 1 275 ? 143.532 95.329  80.483  1.00 0.00 ? 275 C A "C4'"  1  
ATOM 8828   O "O4'"  . C A 1 275 ? 144.095 94.007  80.254  1.00 0.00 ? 275 C A "O4'"  1  
ATOM 8829   C "C3'"  . C A 1 275 ? 142.343 95.055  81.391  1.00 0.00 ? 275 C A "C3'"  1  
ATOM 8830   O "O3'"  . C A 1 275 ? 141.378 96.092  81.366  1.00 0.00 ? 275 C A "O3'"  1  
ATOM 8831   C "C2'"  . C A 1 275 ? 141.843 93.720  80.852  1.00 0.00 ? 275 C A "C2'"  1  
ATOM 8832   O "O2'"  . C A 1 275 ? 141.132 93.891  79.635  1.00 0.00 ? 275 C A "O2'"  1  
ATOM 8833   C "C1'"  . C A 1 275 ? 143.164 93.006  80.568  1.00 0.00 ? 275 C A "C1'"  1  
ATOM 8834   N N1     . C A 1 275 ? 143.683 92.287  81.757  1.00 0.00 ? 275 C A N1     1  
ATOM 8835   C C2     . C A 1 275 ? 143.169 91.015  82.042  1.00 0.00 ? 275 C A C2     1  
ATOM 8836   O O2     . C A 1 275 ? 142.301 90.532  81.298  1.00 0.00 ? 275 C A O2     1  
ATOM 8837   N N3     . C A 1 275 ? 143.625 90.338  83.120  1.00 0.00 ? 275 C A N3     1  
ATOM 8838   C C4     . C A 1 275 ? 144.557 90.879  83.904  1.00 0.00 ? 275 C A C4     1  
ATOM 8839   N N4     . C A 1 275 ? 144.978 90.174  84.957  1.00 0.00 ? 275 C A N4     1  
ATOM 8840   C C5     . C A 1 275 ? 145.099 92.169  83.642  1.00 0.00 ? 275 C A C5     1  
ATOM 8841   C C6     . C A 1 275 ? 144.641 92.829  82.572  1.00 0.00 ? 275 C A C6     1  
ATOM 8842   H "H5'"  . C A 1 275 ? 145.335 96.303  80.403  1.00 0.00 ? 275 C A "H5'"  1  
ATOM 8843   H "H5''" . C A 1 275 ? 144.183 97.181  81.074  1.00 0.00 ? 275 C A "H5''" 1  
ATOM 8844   H "H4'"  . C A 1 275 ? 143.200 95.672  79.627  1.00 0.00 ? 275 C A "H4'"  1  
ATOM 8845   H "H3'"  . C A 1 275 ? 142.659 94.937  82.310  1.00 0.00 ? 275 C A "H3'"  1  
ATOM 8846   H "H2'"  . C A 1 275 ? 141.309 93.242  81.520  1.00 0.00 ? 275 C A "H2'"  1  
ATOM 8847   H "HO2'" . C A 1 275 ? 140.816 93.017  79.324  1.00 0.00 ? 275 C A "HO2'" 1  
ATOM 8848   H "H1'"  . C A 1 275 ? 143.035 92.371  79.833  1.00 0.00 ? 275 C A "H1'"  1  
ATOM 8849   H H41    . C A 1 275 ? 144.601 89.286  85.134  1.00 0.00 ? 275 C A H41    1  
ATOM 8850   H H42    . C A 1 275 ? 145.662 90.544  85.552  1.00 0.00 ? 275 C A H42    1  
ATOM 8851   H H5     . C A 1 275 ? 145.785 92.559  84.224  1.00 0.00 ? 275 C A H5     1  
ATOM 8852   H H6     . C A 1 275 ? 145.002 93.718  82.375  1.00 0.00 ? 275 C A H6     1  
ATOM 8853   P P      . U A 1 276 ? 140.537 96.445  82.690  1.00 0.00 ? 276 U A P      1  
ATOM 8854   O OP1    . U A 1 276 ? 139.294 97.143  82.273  1.00 0.00 ? 276 U A OP1    1  
ATOM 8855   O OP2    . U A 1 276 ? 141.456 97.098  83.657  1.00 0.00 ? 276 U A OP2    1  
ATOM 8856   O "O5'"  . U A 1 276 ? 140.131 95.022  83.279  1.00 0.00 ? 276 U A "O5'"  1  
ATOM 8857   C "C5'"  . U A 1 276 ? 140.095 94.795  84.680  1.00 0.00 ? 276 U A "C5'"  1  
ATOM 8858   C "C4'"  . U A 1 276 ? 141.344 94.103  85.165  1.00 0.00 ? 276 U A "C4'"  1  
ATOM 8859   O "O4'"  . U A 1 276 ? 142.482 94.954  84.864  1.00 0.00 ? 276 U A "O4'"  1  
ATOM 8860   C "C3'"  . U A 1 276 ? 141.420 93.824  86.658  1.00 0.00 ? 276 U A "C3'"  1  
ATOM 8861   O "O3'"  . U A 1 276 ? 140.858 92.575  87.018  1.00 0.00 ? 276 U A "O3'"  1  
ATOM 8862   C "C2'"  . U A 1 276 ? 142.924 93.851  86.921  1.00 0.00 ? 276 U A "C2'"  1  
ATOM 8863   O "O2'"  . U A 1 276 ? 143.527 92.610  86.587  1.00 0.00 ? 276 U A "O2'"  1  
ATOM 8864   C "C1'"  . U A 1 276 ? 143.409 94.911  85.933  1.00 0.00 ? 276 U A "C1'"  1  
ATOM 8865   N N1     . U A 1 276 ? 143.509 96.254  86.553  1.00 0.00 ? 276 U A N1     1  
ATOM 8866   C C2     . U A 1 276 ? 144.598 96.492  87.371  1.00 0.00 ? 276 U A C2     1  
ATOM 8867   O O2     . U A 1 276 ? 145.458 95.657  87.594  1.00 0.00 ? 276 U A O2     1  
ATOM 8868   N N3     . U A 1 276 ? 144.650 97.749  87.921  1.00 0.00 ? 276 U A N3     1  
ATOM 8869   C C4     . U A 1 276 ? 143.744 98.773  87.744  1.00 0.00 ? 276 U A C4     1  
ATOM 8870   O O4     . U A 1 276 ? 143.930 99.850  88.311  1.00 0.00 ? 276 U A O4     1  
ATOM 8871   C C5     . U A 1 276 ? 142.643 98.455  86.886  1.00 0.00 ? 276 U A C5     1  
ATOM 8872   C C6     . U A 1 276 ? 142.569 97.239  86.335  1.00 0.00 ? 276 U A C6     1  
ATOM 8873   H "H5'"  . U A 1 276 ? 139.318 94.237  84.893  1.00 0.00 ? 276 U A "H5'"  1  
ATOM 8874   H "H5''" . U A 1 276 ? 140.007 95.655  85.141  1.00 0.00 ? 276 U A "H5''" 1  
ATOM 8875   H "H4'"  . U A 1 276 ? 141.437 93.250  84.691  1.00 0.00 ? 276 U A "H4'"  1  
ATOM 8876   H "H3'"  . U A 1 276 ? 140.996 94.561  87.145  1.00 0.00 ? 276 U A "H3'"  1  
ATOM 8877   H "H2'"  . U A 1 276 ? 143.122 94.113  87.844  1.00 0.00 ? 276 U A "H2'"  1  
ATOM 8878   H "HO2'" . U A 1 276 ? 142.858 91.897  86.669  1.00 0.00 ? 276 U A "HO2'" 1  
ATOM 8879   H "H1'"  . U A 1 276 ? 144.287 94.648  85.584  1.00 0.00 ? 276 U A "H1'"  1  
ATOM 8880   H H3     . U A 1 276 ? 145.414 97.938  88.505  1.00 0.00 ? 276 U A H3     1  
ATOM 8881   H H5     . U A 1 276 ? 141.951 99.124  86.703  1.00 0.00 ? 276 U A H5     1  
ATOM 8882   H H6     . U A 1 276 ? 141.806 97.046  85.752  1.00 0.00 ? 276 U A H6     1  
ATOM 8883   P P      . U A 1 277 ? 140.019 92.427  88.380  1.00 0.00 ? 277 U A P      1  
ATOM 8884   O OP1    . U A 1 277 ? 139.706 90.988  88.574  1.00 0.00 ? 277 U A OP1    1  
ATOM 8885   O OP2    . U A 1 277 ? 138.915 93.420  88.350  1.00 0.00 ? 277 U A OP2    1  
ATOM 8886   O "O5'"  . U A 1 277 ? 141.047 92.866  89.515  1.00 0.00 ? 277 U A "O5'"  1  
ATOM 8887   C "C5'"  . U A 1 277 ? 142.252 92.147  89.725  1.00 0.00 ? 277 U A "C5'"  1  
ATOM 8888   C "C4'"  . U A 1 277 ? 143.198 92.898  90.630  1.00 0.00 ? 277 U A "C4'"  1  
ATOM 8889   O "O4'"  . U A 1 277 ? 143.584 94.119  89.962  1.00 0.00 ? 277 U A "O4'"  1  
ATOM 8890   C "C3'"  . U A 1 277 ? 142.627 93.359  91.962  1.00 0.00 ? 277 U A "C3'"  1  
ATOM 8891   O "O3'"  . U A 1 277 ? 142.656 92.350  92.956  1.00 0.00 ? 277 U A "O3'"  1  
ATOM 8892   C "C2'"  . U A 1 277 ? 143.537 94.530  92.264  1.00 0.00 ? 277 U A "C2'"  1  
ATOM 8893   O "O2'"  . U A 1 277 ? 144.791 94.091  92.766  1.00 0.00 ? 277 U A "O2'"  1  
ATOM 8894   C "C1'"  . U A 1 277 ? 143.750 95.136  90.890  1.00 0.00 ? 277 U A "C1'"  1  
ATOM 8895   N N1     . U A 1 277 ? 142.770 96.207  90.589  1.00 0.00 ? 277 U A N1     1  
ATOM 8896   C C2     . U A 1 277 ? 143.056 97.475  91.060  1.00 0.00 ? 277 U A C2     1  
ATOM 8897   O O2     . U A 1 277 ? 144.061 97.737  91.698  1.00 0.00 ? 277 U A O2     1  
ATOM 8898   N N3     . U A 1 277 ? 142.121 98.434  90.757  1.00 0.00 ? 277 U A N3     1  
ATOM 8899   C C4     . U A 1 277 ? 140.952 98.261  90.047  1.00 0.00 ? 277 U A C4     1  
ATOM 8900   O O4     . U A 1 277 ? 140.210 99.227  89.858  1.00 0.00 ? 277 U A O4     1  
ATOM 8901   C C5     . U A 1 277 ? 140.722 96.924  89.591  1.00 0.00 ? 277 U A C5     1  
ATOM 8902   C C6     . U A 1 277 ? 141.617 95.971  89.871  1.00 0.00 ? 277 U A C6     1  
ATOM 8903   H "H5'"  . U A 1 277 ? 142.689 91.997  88.861  1.00 0.00 ? 277 U A "H5'"  1  
ATOM 8904   H "H5''" . U A 1 277 ? 142.042 91.281  90.132  1.00 0.00 ? 277 U A "H5''" 1  
ATOM 8905   H "H4'"  . U A 1 277 ? 143.990 92.344  90.788  1.00 0.00 ? 277 U A "H4'"  1  
ATOM 8906   H "H3'"  . U A 1 277 ? 141.710 93.676  91.827  1.00 0.00 ? 277 U A "H3'"  1  
ATOM 8907   H "H2'"  . U A 1 277 ? 143.109 95.171  92.869  1.00 0.00 ? 277 U A "H2'"  1  
ATOM 8908   H "HO2'" . U A 1 277 ? 145.287 94.865  93.107  1.00 0.00 ? 277 U A "HO2'" 1  
ATOM 8909   H "H1'"  . U A 1 277 ? 144.658 95.503  90.836  1.00 0.00 ? 277 U A "H1'"  1  
ATOM 8910   H H3     . U A 1 277 ? 142.304 99.340  91.082  1.00 0.00 ? 277 U A H3     1  
ATOM 8911   H H5     . U A 1 277 ? 139.915 96.710  89.077  1.00 0.00 ? 277 U A H5     1  
ATOM 8912   H H6     . U A 1 277 ? 141.436 95.064  89.548  1.00 0.00 ? 277 U A H6     1  
ATOM 8913   P P      . G A 1 278 ? 141.440 92.222  93.993  1.00 0.00 ? 278 G A P      1  
ATOM 8914   O OP1    . G A 1 278 ? 140.284 91.584  93.312  1.00 0.00 ? 278 G A OP1    1  
ATOM 8915   O OP2    . G A 1 278 ? 141.312 93.607  94.513  1.00 0.00 ? 278 G A OP2    1  
ATOM 8916   O "O5'"  . G A 1 278 ? 141.881 91.281  95.201  1.00 0.00 ? 278 G A "O5'"  1  
ATOM 8917   C "C5'"  . G A 1 278 ? 141.275 91.402  96.478  1.00 0.00 ? 278 G A "C5'"  1  
ATOM 8918   C "C4'"  . G A 1 278 ? 139.997 90.604  96.564  1.00 0.00 ? 278 G A "C4'"  1  
ATOM 8919   O "O4'"  . G A 1 278 ? 138.898 91.491  96.868  1.00 0.00 ? 278 G A "O4'"  1  
ATOM 8920   C "C3'"  . G A 1 278 ? 139.560 89.906  95.284  1.00 0.00 ? 278 G A "C3'"  1  
ATOM 8921   O "O3'"  . G A 1 278 ? 140.262 88.697  95.046  1.00 0.00 ? 278 G A "O3'"  1  
ATOM 8922   C "C2'"  . G A 1 278 ? 138.064 89.739  95.492  1.00 0.00 ? 278 G A "C2'"  1  
ATOM 8923   O "O2'"  . G A 1 278 ? 137.782 88.643  96.351  1.00 0.00 ? 278 G A "O2'"  1  
ATOM 8924   C "C1'"  . G A 1 278 ? 137.721 91.045  96.214  1.00 0.00 ? 278 G A "C1'"  1  
ATOM 8925   N N9     . G A 1 278 ? 137.277 92.096  95.280  1.00 0.00 ? 278 G A N9     1  
ATOM 8926   C C8     . G A 1 278 ? 137.588 92.209  93.947  1.00 0.00 ? 278 G A C8     1  
ATOM 8927   N N7     . G A 1 278 ? 137.044 93.252  93.379  1.00 0.00 ? 278 G A N7     1  
ATOM 8928   C C5     . G A 1 278 ? 136.331 93.865  94.399  1.00 0.00 ? 278 G A C5     1  
ATOM 8929   C C6     . G A 1 278 ? 135.535 95.040  94.387  1.00 0.00 ? 278 G A C6     1  
ATOM 8930   O O6     . G A 1 278 ? 135.295 95.798  93.441  1.00 0.00 ? 278 G A O6     1  
ATOM 8931   N N1     . G A 1 278 ? 134.992 95.304  95.641  1.00 0.00 ? 278 G A N1     1  
ATOM 8932   C C2     . G A 1 278 ? 135.188 94.535  96.763  1.00 0.00 ? 278 G A C2     1  
ATOM 8933   N N2     . G A 1 278 ? 134.579 94.952  97.884  1.00 0.00 ? 278 G A N2     1  
ATOM 8934   N N3     . G A 1 278 ? 135.928 93.439  96.787  1.00 0.00 ? 278 G A N3     1  
ATOM 8935   C C4     . G A 1 278 ? 136.464 93.165  95.580  1.00 0.00 ? 278 G A C4     1  
ATOM 8936   H "H5'"  . G A 1 278 ? 141.074 92.346  96.650  1.00 0.00 ? 278 G A "H5'"  1  
ATOM 8937   H "H5''" . G A 1 278 ? 141.900 91.080  97.161  1.00 0.00 ? 278 G A "H5''" 1  
ATOM 8938   H "H4'"  . G A 1 278 ? 140.077 89.937  97.278  1.00 0.00 ? 278 G A "H4'"  1  
ATOM 8939   H "H3'"  . G A 1 278 ? 139.705 90.514  94.531  1.00 0.00 ? 278 G A "H3'"  1  
ATOM 8940   H "H2'"  . G A 1 278 ? 137.589 89.662  94.638  1.00 0.00 ? 278 G A "H2'"  1  
ATOM 8941   H "HO2'" . G A 1 278 ? 136.886 88.302  96.149  1.00 0.00 ? 278 G A "HO2'" 1  
ATOM 8942   H "H1'"  . G A 1 278 ? 137.018 90.877  96.876  1.00 0.00 ? 278 G A "H1'"  1  
ATOM 8943   H H8     . G A 1 278 ? 138.160 91.573  93.469  1.00 0.00 ? 278 G A H8     1  
ATOM 8944   H H1     . G A 1 278 ? 134.426 96.099  95.728  1.00 0.00 ? 278 G A H1     1  
ATOM 8945   H H21    . G A 1 278 ? 134.030 95.763  97.874  1.00 0.00 ? 278 G A H21    1  
ATOM 8946   H H22    . G A 1 278 ? 134.684 94.443  98.715  1.00 0.00 ? 278 G A H22    1  
ATOM 8947   P P      . A A 1 279 ? 139.517 87.456  94.347  1.00 0.00 ? 279 A A P      1  
ATOM 8948   O OP1    . A A 1 279 ? 140.552 86.571  93.757  1.00 0.00 ? 279 A A OP1    1  
ATOM 8949   O OP2    . A A 1 279 ? 138.434 87.995  93.487  1.00 0.00 ? 279 A A OP2    1  
ATOM 8950   O "O5'"  . A A 1 279 ? 138.840 86.679  95.563  1.00 0.00 ? 279 A A "O5'"  1  
ATOM 8951   C "C5'"  . A A 1 279 ? 138.477 85.312  95.443  1.00 0.00 ? 279 A A "C5'"  1  
ATOM 8952   C "C4'"  . A A 1 279 ? 137.992 84.749  96.755  1.00 0.00 ? 279 A A "C4'"  1  
ATOM 8953   O "O4'"  . A A 1 279 ? 139.096 84.739  97.699  1.00 0.00 ? 279 A A "O4'"  1  
ATOM 8954   C "C3'"  . A A 1 279 ? 136.909 85.548  97.464  1.00 0.00 ? 279 A A "C3'"  1  
ATOM 8955   O "O3'"  . A A 1 279 ? 135.603 85.239  97.006  1.00 0.00 ? 279 A A "O3'"  1  
ATOM 8956   C "C2'"  . A A 1 279 ? 137.125 85.195  98.922  1.00 0.00 ? 279 A A "C2'"  1  
ATOM 8957   O "O2'"  . A A 1 279 ? 136.557 83.932  99.237  1.00 0.00 ? 279 A A "O2'"  1  
ATOM 8958   C "C1'"  . A A 1 279 ? 138.644 85.086  98.980  1.00 0.00 ? 279 A A "C1'"  1  
ATOM 8959   N N9     . A A 1 279 ? 139.278 86.359  99.371  1.00 0.00 ? 279 A A N9     1  
ATOM 8960   C C8     . A A 1 279 ? 140.032 87.201  98.591  1.00 0.00 ? 279 A A C8     1  
ATOM 8961   N N7     . A A 1 279 ? 140.463 88.263  99.224  1.00 0.00 ? 279 A A N7     1  
ATOM 8962   C C5     . A A 1 279 ? 139.960 88.112  100.509 1.00 0.00 ? 279 A A C5     1  
ATOM 8963   C C6     . A A 1 279 ? 140.063 88.905  101.666 1.00 0.00 ? 279 A A C6     1  
ATOM 8964   N N6     . A A 1 279 ? 140.735 90.057  101.716 1.00 0.00 ? 279 A A N6     1  
ATOM 8965   N N1     . A A 1 279 ? 139.443 88.469  102.784 1.00 0.00 ? 279 A A N1     1  
ATOM 8966   C C2     . A A 1 279 ? 138.768 87.313  102.734 1.00 0.00 ? 279 A A C2     1  
ATOM 8967   N N3     . A A 1 279 ? 138.600 86.481  101.708 1.00 0.00 ? 279 A A N3     1  
ATOM 8968   C C4     . A A 1 279 ? 139.228 86.944  100.613 1.00 0.00 ? 279 A A C4     1  
ATOM 8969   H "H5'"  . A A 1 279 ? 139.257 84.799  95.144  1.00 0.00 ? 279 A A "H5'"  1  
ATOM 8970   H "H5''" . A A 1 279 ? 137.765 85.226  94.776  1.00 0.00 ? 279 A A "H5''" 1  
ATOM 8971   H "H4'"  . A A 1 279 ? 137.675 83.831  96.625  1.00 0.00 ? 279 A A "H4'"  1  
ATOM 8972   H "H3'"  . A A 1 279 ? 137.077 86.505  97.332  1.00 0.00 ? 279 A A "H3'"  1  
ATOM 8973   H "H2'"  . A A 1 279 ? 136.793 85.901  99.516  1.00 0.00 ? 279 A A "H2'"  1  
ATOM 8974   H "HO2'" . A A 1 279 ? 136.711 83.741  100.185 1.00 0.00 ? 279 A A "HO2'" 1  
ATOM 8975   H "H1'"  . A A 1 279 ? 138.896 84.385  99.618  1.00 0.00 ? 279 A A "H1'"  1  
ATOM 8976   H H8     . A A 1 279 ? 140.229 87.023  97.647  1.00 0.00 ? 279 A A H8     1  
ATOM 8977   H H61    . A A 1 279 ? 140.771 90.567  102.553 1.00 0.00 ? 279 A A H61    1  
ATOM 8978   H H62    . A A 1 279 ? 141.193 90.394  100.918 1.00 0.00 ? 279 A A H62    1  
ATOM 8979   H H2     . A A 1 279 ? 138.337 87.042  103.571 1.00 0.00 ? 279 A A H2     1  
ATOM 8980   P P      . A A 1 280 ? 134.604 86.416  96.561  1.00 0.00 ? 280 A A P      1  
ATOM 8981   O OP1    . A A 1 280 ? 133.353 85.793  96.061  1.00 0.00 ? 280 A A OP1    1  
ATOM 8982   O OP2    . A A 1 280 ? 135.356 87.353  95.690  1.00 0.00 ? 280 A A OP2    1  
ATOM 8983   O "O5'"  . A A 1 280 ? 134.269 87.173  97.923  1.00 0.00 ? 280 A A "O5'"  1  
ATOM 8984   C "C5'"  . A A 1 280 ? 133.709 86.475  99.025  1.00 0.00 ? 280 A A "C5'"  1  
ATOM 8985   C "C4'"  . A A 1 280 ? 133.790 87.286  100.294 1.00 0.00 ? 280 A A "C4'"  1  
ATOM 8986   O "O4'"  . A A 1 280 ? 135.164 87.519  100.712 1.00 0.00 ? 280 A A "O4'"  1  
ATOM 8987   C "C3'"  . A A 1 280 ? 133.240 88.702  100.217 1.00 0.00 ? 280 A A "C3'"  1  
ATOM 8988   O "O3'"  . A A 1 280 ? 131.824 88.749  100.252 1.00 0.00 ? 280 A A "O3'"  1  
ATOM 8989   C "C2'"  . A A 1 280 ? 133.832 89.289  101.493 1.00 0.00 ? 280 A A "C2'"  1  
ATOM 8990   O "O2'"  . A A 1 280 ? 133.143 88.819  102.643 1.00 0.00 ? 280 A A "O2'"  1  
ATOM 8991   C "C1'"  . A A 1 280 ? 135.239 88.687  101.472 1.00 0.00 ? 280 A A "C1'"  1  
ATOM 8992   N N9     . A A 1 280 ? 136.216 89.581  100.823 1.00 0.00 ? 280 A A N9     1  
ATOM 8993   C C8     . A A 1 280 ? 136.559 89.634  99.495  1.00 0.00 ? 280 A A C8     1  
ATOM 8994   N N7     . A A 1 280 ? 137.465 90.540  99.219  1.00 0.00 ? 280 A A N7     1  
ATOM 8995   C C5     . A A 1 280 ? 137.738 91.124  100.448 1.00 0.00 ? 280 A A C5     1  
ATOM 8996   C C6     . A A 1 280 ? 138.615 92.153  100.834 1.00 0.00 ? 280 A A C6     1  
ATOM 8997   N N6     . A A 1 280 ? 139.410 92.805  99.984  1.00 0.00 ? 280 A A N6     1  
ATOM 8998   N N1     . A A 1 280 ? 138.645 92.495  102.140 1.00 0.00 ? 280 A A N1     1  
ATOM 8999   C C2     . A A 1 280 ? 137.847 91.842  102.994 1.00 0.00 ? 280 A A C2     1  
ATOM 9000   N N3     . A A 1 280 ? 136.982 90.859  102.752 1.00 0.00 ? 280 A A N3     1  
ATOM 9001   C C4     . A A 1 280 ? 136.976 90.543  101.445 1.00 0.00 ? 280 A A C4     1  
ATOM 9002   H "H5'"  . A A 1 280 ? 134.196 85.634  99.153  1.00 0.00 ? 280 A A "H5'"  1  
ATOM 9003   H "H5''" . A A 1 280 ? 132.770 86.274  98.834  1.00 0.00 ? 280 A A "H5''" 1  
ATOM 9004   H "H4'"  . A A 1 280 ? 133.308 86.796  100.992 1.00 0.00 ? 280 A A "H4'"  1  
ATOM 9005   H "H3'"  . A A 1 280 ? 133.558 89.195  99.431  1.00 0.00 ? 280 A A "H3'"  1  
ATOM 9006   H "H2'"  . A A 1 280 ? 133.858 90.268  101.459 1.00 0.00 ? 280 A A "H2'"  1  
ATOM 9007   H "HO2'" . A A 1 280 ? 133.023 89.564  103.268 1.00 0.00 ? 280 A A "HO2'" 1  
ATOM 9008   H "H1'"  . A A 1 280 ? 135.527 88.500  102.391 1.00 0.00 ? 280 A A "H1'"  1  
ATOM 9009   H H8     . A A 1 280 ? 136.163 89.049  98.815  1.00 0.00 ? 280 A A H8     1  
ATOM 9010   H H61    . A A 1 280 ? 140.001 93.515  100.313 1.00 0.00 ? 280 A A H61    1  
ATOM 9011   H H62    . A A 1 280 ? 139.405 92.574  99.032  1.00 0.00 ? 280 A A H62    1  
ATOM 9012   H H2     . A A 1 280 ? 137.907 92.128  103.930 1.00 0.00 ? 280 A A H2     1  
ATOM 9013   P P      . A A 1 281 ? 131.057 90.149  100.063 1.00 0.00 ? 281 A A P      1  
ATOM 9014   O OP1    . A A 1 281 ? 129.869 89.911  99.206  1.00 0.00 ? 281 A A OP1    1  
ATOM 9015   O OP2    . A A 1 281 ? 132.057 91.171  99.664  1.00 0.00 ? 281 A A OP2    1  
ATOM 9016   O "O5'"  . A A 1 281 ? 130.544 90.508  101.528 1.00 0.00 ? 281 A A "O5'"  1  
ATOM 9017   C "C5'"  . A A 1 281 ? 130.515 91.854  101.981 1.00 0.00 ? 281 A A "C5'"  1  
ATOM 9018   C "C4'"  . A A 1 281 ? 131.316 92.030  103.246 1.00 0.00 ? 281 A A "C4'"  1  
ATOM 9019   O "O4'"  . A A 1 281 ? 132.663 91.577  102.992 1.00 0.00 ? 281 A A "O4'"  1  
ATOM 9020   C "C3'"  . A A 1 281 ? 131.487 93.461  103.734 1.00 0.00 ? 281 A A "C3'"  1  
ATOM 9021   O "O3'"  . A A 1 281 ? 130.429 93.891  104.573 1.00 0.00 ? 281 A A "O3'"  1  
ATOM 9022   C "C2'"  . A A 1 281 ? 132.831 93.430  104.447 1.00 0.00 ? 281 A A "C2'"  1  
ATOM 9023   O "O2'"  . A A 1 281 ? 132.705 92.900  105.759 1.00 0.00 ? 281 A A "O2'"  1  
ATOM 9024   C "C1'"  . A A 1 281 ? 133.608 92.444  103.588 1.00 0.00 ? 281 A A "C1'"  1  
ATOM 9025   N N9     . A A 1 281 ? 134.375 93.119  102.524 1.00 0.00 ? 281 A A N9     1  
ATOM 9026   C C8     . A A 1 281 ? 134.200 93.021  101.166 1.00 0.00 ? 281 A A C8     1  
ATOM 9027   N N7     . A A 1 281 ? 135.043 93.745  100.471 1.00 0.00 ? 281 A A N7     1  
ATOM 9028   C C5     . A A 1 281 ? 135.827 94.361  101.436 1.00 0.00 ? 281 A A C5     1  
ATOM 9029   C C6     . A A 1 281 ? 136.907 95.258  101.348 1.00 0.00 ? 281 A A C6     1  
ATOM 9030   N N6     . A A 1 281 ? 137.402 95.710  100.194 1.00 0.00 ? 281 A A N6     1  
ATOM 9031   N N1     . A A 1 281 ? 137.467 95.682  102.502 1.00 0.00 ? 281 A A N1     1  
ATOM 9032   C C2     . A A 1 281 ? 136.970 95.230  103.660 1.00 0.00 ? 281 A A C2     1  
ATOM 9033   N N3     . A A 1 281 ? 135.962 94.386  103.871 1.00 0.00 ? 281 A A N3     1  
ATOM 9034   C C4     . A A 1 281 ? 135.427 93.984  102.705 1.00 0.00 ? 281 A A C4     1  
ATOM 9035   H "H5'"  . A A 1 281 ? 129.586 92.114  102.152 1.00 0.00 ? 281 A A "H5'"  1  
ATOM 9036   H "H5''" . A A 1 281 ? 130.885 92.435  101.284 1.00 0.00 ? 281 A A "H5''" 1  
ATOM 9037   H "H4'"  . A A 1 281 ? 130.932 91.493  103.970 1.00 0.00 ? 281 A A "H4'"  1  
ATOM 9038   H "H3'"  . A A 1 281 ? 131.542 94.057  102.957 1.00 0.00 ? 281 A A "H3'"  1  
ATOM 9039   H "H2'"  . A A 1 281 ? 133.256 94.314  104.451 1.00 0.00 ? 281 A A "H2'"  1  
ATOM 9040   H "HO2'" . A A 1 281 ? 133.227 93.453  106.377 1.00 0.00 ? 281 A A "HO2'" 1  
ATOM 9041   H "H1'"  . A A 1 281 ? 134.219 91.929  104.156 1.00 0.00 ? 281 A A "H1'"  1  
ATOM 9042   H H8     . A A 1 281 ? 133.508 92.462  100.754 1.00 0.00 ? 281 A A H8     1  
ATOM 9043   H H61    . A A 1 281 ? 138.157 96.335  100.196 1.00 0.00 ? 281 A A H61    1  
ATOM 9044   H H62    . A A 1 281 ? 137.012 95.416  99.345  1.00 0.00 ? 281 A A H62    1  
ATOM 9045   H H2     . A A 1 281 ? 137.412 95.567  104.468 1.00 0.00 ? 281 A A H2     1  
ATOM 9046   P P      . U A 1 282 ? 130.252 95.451  104.915 1.00 0.00 ? 282 U A P      1  
ATOM 9047   O OP1    . U A 1 282 ? 128.860 95.663  105.388 1.00 0.00 ? 282 U A OP1    1  
ATOM 9048   O OP2    . U A 1 282 ? 130.763 96.234  103.763 1.00 0.00 ? 282 U A OP2    1  
ATOM 9049   O "O5'"  . U A 1 282 ? 131.233 95.689  106.147 1.00 0.00 ? 282 U A "O5'"  1  
ATOM 9050   C "C5'"  . U A 1 282 ? 131.082 94.955  107.353 1.00 0.00 ? 282 U A "C5'"  1  
ATOM 9051   C "C4'"  . U A 1 282 ? 132.115 95.349  108.379 1.00 0.00 ? 282 U A "C4'"  1  
ATOM 9052   O "O4'"  . U A 1 282 ? 133.451 95.130  107.847 1.00 0.00 ? 282 U A "O4'"  1  
ATOM 9053   C "C3'"  . U A 1 282 ? 132.125 96.813  108.792 1.00 0.00 ? 282 U A "C3'"  1  
ATOM 9054   O "O3'"  . U A 1 282 ? 131.100 97.136  109.713 1.00 0.00 ? 282 U A "O3'"  1  
ATOM 9055   C "C2'"  . U A 1 282 ? 133.535 96.986  109.345 1.00 0.00 ? 282 U A "C2'"  1  
ATOM 9056   O "O2'"  . U A 1 282 ? 133.632 96.486  110.671 1.00 0.00 ? 282 U A "O2'"  1  
ATOM 9057   C "C1'"  . U A 1 282 ? 134.343 96.079  108.408 1.00 0.00 ? 282 U A "C1'"  1  
ATOM 9058   N N1     . U A 1 282 ? 134.989 96.838  107.310 1.00 0.00 ? 282 U A N1     1  
ATOM 9059   C C2     . U A 1 282 ? 136.140 97.539  107.620 1.00 0.00 ? 282 U A C2     1  
ATOM 9060   O O2     . U A 1 282 ? 136.630 97.554  108.736 1.00 0.00 ? 282 U A O2     1  
ATOM 9061   N N3     . U A 1 282 ? 136.704 98.225  106.573 1.00 0.00 ? 282 U A N3     1  
ATOM 9062   C C4     . U A 1 282 ? 136.246 98.283  105.274 1.00 0.00 ? 282 U A C4     1  
ATOM 9063   O O4     . U A 1 282 ? 136.868 98.948  104.443 1.00 0.00 ? 282 U A O4     1  
ATOM 9064   C C5     . U A 1 282 ? 135.052 97.534  105.027 1.00 0.00 ? 282 U A C5     1  
ATOM 9065   C C6     . U A 1 282 ? 134.483 96.856  106.028 1.00 0.00 ? 282 U A C6     1  
ATOM 9066   H "H5'"  . U A 1 282 ? 131.174 93.999  107.159 1.00 0.00 ? 282 U A "H5'"  1  
ATOM 9067   H "H5''" . U A 1 282 ? 130.189 95.122  107.719 1.00 0.00 ? 282 U A "H5''" 1  
ATOM 9068   H "H4'"  . U A 1 282 ? 131.997 94.797  109.179 1.00 0.00 ? 282 U A "H4'"  1  
ATOM 9069   H "H3'"  . U A 1 282 ? 132.029 97.374  107.994 1.00 0.00 ? 282 U A "H3'"  1  
ATOM 9070   H "H2'"  . U A 1 282 ? 133.832 97.918  109.287 1.00 0.00 ? 282 U A "H2'"  1  
ATOM 9071   H "HO2'" . U A 1 282 ? 132.734 96.435  111.059 1.00 0.00 ? 282 U A "HO2'" 1  
ATOM 9072   H "H1'"  . U A 1 282 ? 135.030 95.610  108.927 1.00 0.00 ? 282 U A "H1'"  1  
ATOM 9073   H H3     . U A 1 282 ? 137.521 98.729  106.771 1.00 0.00 ? 282 U A H3     1  
ATOM 9074   H H5     . U A 1 282 ? 134.656 97.519  104.130 1.00 0.00 ? 282 U A H5     1  
ATOM 9075   H H6     . U A 1 282 ? 133.666 96.352  105.833 1.00 0.00 ? 282 U A H6     1  
ATOM 9076   P P      . A A 1 283 ? 130.647 98.665  109.918 1.00 0.00 ? 283 A A P      1  
ATOM 9077   O OP1    . A A 1 283 ? 129.171 98.730  109.786 1.00 0.00 ? 283 A A OP1    1  
ATOM 9078   O OP2    . A A 1 283 ? 131.501 99.517  109.052 1.00 0.00 ? 283 A A OP2    1  
ATOM 9079   O "O5'"  . A A 1 283 ? 131.021 98.977  111.436 1.00 0.00 ? 283 A A "O5'"  1  
ATOM 9080   C "C5'"  . A A 1 283 ? 130.614 98.105  112.480 1.00 0.00 ? 283 A A "C5'"  1  
ATOM 9081   C "C4'"  . A A 1 283 ? 131.768 97.741  113.380 1.00 0.00 ? 283 A A "C4'"  1  
ATOM 9082   O "O4'"  . A A 1 283 ? 132.927 97.364  112.585 1.00 0.00 ? 283 A A "O4'"  1  
ATOM 9083   C "C3'"  . A A 1 283 ? 132.303 98.857  114.264 1.00 0.00 ? 283 A A "C3'"  1  
ATOM 9084   O "O3'"  . A A 1 283 ? 131.531 99.054  115.436 1.00 0.00 ? 283 A A "O3'"  1  
ATOM 9085   C "C2'"  . A A 1 283 ? 133.674 98.300  114.617 1.00 0.00 ? 283 A A "C2'"  1  
ATOM 9086   O "O2'"  . A A 1 283 ? 133.577 97.284  115.604 1.00 0.00 ? 283 A A "O2'"  1  
ATOM 9087   C "C1'"  . A A 1 283 ? 134.079 97.673  113.284 1.00 0.00 ? 283 A A "C1'"  1  
ATOM 9088   N N9     . A A 1 283 ? 134.900 98.586  112.467 1.00 0.00 ? 283 A A N9     1  
ATOM 9089   C C8     . A A 1 283 ? 134.478 99.644  111.700 1.00 0.00 ? 283 A A C8     1  
ATOM 9090   N N7     . A A 1 283 ? 135.449 100.272 111.085 1.00 0.00 ? 283 A A N7     1  
ATOM 9091   C C5     . A A 1 283 ? 136.590 99.581  111.471 1.00 0.00 ? 283 A A C5     1  
ATOM 9092   C C6     . A A 1 283 ? 137.951 99.750  111.160 1.00 0.00 ? 283 A A C6     1  
ATOM 9093   N N6     . A A 1 283 ? 138.412 100.709 110.355 1.00 0.00 ? 283 A A N6     1  
ATOM 9094   N N1     . A A 1 283 ? 138.833 98.890  111.712 1.00 0.00 ? 283 A A N1     1  
ATOM 9095   C C2     . A A 1 283 ? 138.371 97.927  112.521 1.00 0.00 ? 283 A A C2     1  
ATOM 9096   N N3     . A A 1 283 ? 137.118 97.667  112.888 1.00 0.00 ? 283 A A N3     1  
ATOM 9097   C C4     . A A 1 283 ? 136.266 98.541  112.322 1.00 0.00 ? 283 A A C4     1  
ATOM 9098   H "H5'"  . A A 1 283 ? 130.244 97.287  112.088 1.00 0.00 ? 283 A A "H5'"  1  
ATOM 9099   H "H5''" . A A 1 283 ? 129.920 98.546  113.013 1.00 0.00 ? 283 A A "H5''" 1  
ATOM 9100   H "H4'"  . A A 1 283 ? 131.504 96.987  113.947 1.00 0.00 ? 283 A A "H4'"  1  
ATOM 9101   H "H3'"  . A A 1 283 ? 132.388 99.710  113.788 1.00 0.00 ? 283 A A "H3'"  1  
ATOM 9102   H "H2'"  . A A 1 283 ? 134.292 99.012  114.887 1.00 0.00 ? 283 A A "H2'"  1  
ATOM 9103   H "HO2'" . A A 1 283 ? 134.293 97.409  116.262 1.00 0.00 ? 283 A A "HO2'" 1  
ATOM 9104   H "H1'"  . A A 1 283 ? 134.578 96.846  113.451 1.00 0.00 ? 283 A A "H1'"  1  
ATOM 9105   H H8     . A A 1 283 ? 133.537 99.906  111.621 1.00 0.00 ? 283 A A H8     1  
ATOM 9106   H H61    . A A 1 283 ? 139.374 100.777 110.175 1.00 0.00 ? 283 A A H61    1  
ATOM 9107   H H62    . A A 1 283 ? 137.791 101.345 109.942 1.00 0.00 ? 283 A A H62    1  
ATOM 9108   H H2     . A A 1 283 ? 139.052 97.330  112.895 1.00 0.00 ? 283 A A H2     1  
ATOM 9109   P P      . A A 1 284 ? 131.331 100.534 116.032 1.00 0.00 ? 284 A A P      1  
ATOM 9110   O OP1    . A A 1 284 ? 130.089 100.539 116.844 1.00 0.00 ? 284 A A OP1    1  
ATOM 9111   O OP2    . A A 1 284 ? 131.483 101.503 114.917 1.00 0.00 ? 284 A A OP2    1  
ATOM 9112   O "O5'"  . A A 1 284 ? 132.567 100.722 117.019 1.00 0.00 ? 284 A A "O5'"  1  
ATOM 9113   C "C5'"  . A A 1 284 ? 132.798 99.808  118.081 1.00 0.00 ? 284 A A "C5'"  1  
ATOM 9114   C "C4'"  . A A 1 284 ? 134.262 99.725  118.433 1.00 0.00 ? 284 A A "C4'"  1  
ATOM 9115   O "O4'"  . A A 1 284 ? 135.009 99.284  117.267 1.00 0.00 ? 284 A A "O4'"  1  
ATOM 9116   C "C3'"  . A A 1 284 ? 134.934 101.037 118.806 1.00 0.00 ? 284 A A "C3'"  1  
ATOM 9117   O "O3'"  . A A 1 284 ? 134.793 101.362 120.178 1.00 0.00 ? 284 A A "O3'"  1  
ATOM 9118   C "C2'"  . A A 1 284 ? 136.381 100.803 118.378 1.00 0.00 ? 284 A A "C2'"  1  
ATOM 9119   O "O2'"  . A A 1 284 ? 137.080 100.016 119.331 1.00 0.00 ? 284 A A "O2'"  1  
ATOM 9120   C "C1'"  . A A 1 284 ? 136.197 99.985  117.102 1.00 0.00 ? 284 A A "C1'"  1  
ATOM 9121   N N9     . A A 1 284 ? 136.065 100.840 115.907 1.00 0.00 ? 284 A A N9     1  
ATOM 9122   C C8     . A A 1 284 ? 134.925 101.415 115.402 1.00 0.00 ? 284 A A C8     1  
ATOM 9123   N N7     . A A 1 284 ? 135.127 102.126 114.320 1.00 0.00 ? 284 A A N7     1  
ATOM 9124   C C5     . A A 1 284 ? 136.492 102.012 114.095 1.00 0.00 ? 284 A A C5     1  
ATOM 9125   C C6     . A A 1 284 ? 137.335 102.535 113.099 1.00 0.00 ? 284 A A C6     1  
ATOM 9126   N N6     . A A 1 284 ? 136.908 103.312 112.101 1.00 0.00 ? 284 A A N6     1  
ATOM 9127   N N1     . A A 1 284 ? 138.649 102.229 113.164 1.00 0.00 ? 284 A A N1     1  
ATOM 9128   C C2     . A A 1 284 ? 139.078 101.450 114.165 1.00 0.00 ? 284 A A C2     1  
ATOM 9129   N N3     . A A 1 284 ? 138.384 100.899 115.159 1.00 0.00 ? 284 A A N3     1  
ATOM 9130   C C4     . A A 1 284 ? 137.082 101.223 115.065 1.00 0.00 ? 284 A A C4     1  
ATOM 9131   H "H5'"  . A A 1 284 ? 132.483 98.919  117.812 1.00 0.00 ? 284 A A "H5'"  1  
ATOM 9132   H "H5''" . A A 1 284 ? 132.295 100.099 118.870 1.00 0.00 ? 284 A A "H5''" 1  
ATOM 9133   H "H4'"  . A A 1 284 ? 134.393 99.083  119.162 1.00 0.00 ? 284 A A "H4'"  1  
ATOM 9134   H "H3'"  . A A 1 284 ? 134.552 101.760 118.264 1.00 0.00 ? 284 A A "H3'"  1  
ATOM 9135   H "H2'"  . A A 1 284 ? 136.843 101.649 118.195 1.00 0.00 ? 284 A A "H2'"  1  
ATOM 9136   H "HO2'" . A A 1 284 ? 138.007 99.906  119.035 1.00 0.00 ? 284 A A "HO2'" 1  
ATOM 9137   H "H1'"  . A A 1 284 ? 136.961 99.381  116.989 1.00 0.00 ? 284 A A "H1'"  1  
ATOM 9138   H H8     . A A 1 284 ? 134.042 101.305 115.813 1.00 0.00 ? 284 A A H8     1  
ATOM 9139   H H61    . A A 1 284 ? 137.545 103.647 111.435 1.00 0.00 ? 284 A A H61    1  
ATOM 9140   H H62    . A A 1 284 ? 135.959 103.546 112.033 1.00 0.00 ? 284 A A H62    1  
ATOM 9141   H H2     . A A 1 284 ? 140.039 101.259 114.167 1.00 0.00 ? 284 A A H2     1  
ATOM 9142   P P      . G A 1 285 ? 133.694 102.438 120.645 1.00 0.00 ? 285 G A P      1  
ATOM 9143   O OP1    . G A 1 285 ? 134.032 102.872 122.025 1.00 0.00 ? 285 G A OP1    1  
ATOM 9144   O OP2    . G A 1 285 ? 132.350 101.875 120.361 1.00 0.00 ? 285 G A OP2    1  
ATOM 9145   O "O5'"  . G A 1 285 ? 133.927 103.677 119.669 1.00 0.00 ? 285 G A "O5'"  1  
ATOM 9146   C "C5'"  . G A 1 285 ? 135.123 104.441 119.736 1.00 0.00 ? 285 G A "C5'"  1  
ATOM 9147   C "C4'"  . G A 1 285 ? 134.973 105.765 119.028 1.00 0.00 ? 285 G A "C4'"  1  
ATOM 9148   O "O4'"  . G A 1 285 ? 134.752 105.543 117.610 1.00 0.00 ? 285 G A "O4'"  1  
ATOM 9149   C "C3'"  . G A 1 285 ? 133.792 106.621 119.456 1.00 0.00 ? 285 G A "C3'"  1  
ATOM 9150   O "O3'"  . G A 1 285 ? 134.045 107.364 120.638 1.00 0.00 ? 285 G A "O3'"  1  
ATOM 9151   C "C2'"  . G A 1 285 ? 133.548 107.489 118.230 1.00 0.00 ? 285 G A "C2'"  1  
ATOM 9152   O "O2'"  . G A 1 285 ? 134.493 108.547 118.152 1.00 0.00 ? 285 G A "O2'"  1  
ATOM 9153   C "C1'"  . G A 1 285 ? 133.819 106.498 117.095 1.00 0.00 ? 285 G A "C1'"  1  
ATOM 9154   N N9     . G A 1 285 ? 132.587 105.824 116.643 1.00 0.00 ? 285 G A N9     1  
ATOM 9155   C C8     . G A 1 285 ? 132.219 104.521 116.877 1.00 0.00 ? 285 G A C8     1  
ATOM 9156   N N7     . G A 1 285 ? 131.068 104.209 116.346 1.00 0.00 ? 285 G A N7     1  
ATOM 9157   C C5     . G A 1 285 ? 130.651 105.378 115.722 1.00 0.00 ? 285 G A C5     1  
ATOM 9158   C C6     . G A 1 285 ? 129.473 105.653 114.981 1.00 0.00 ? 285 G A C6     1  
ATOM 9159   O O6     . G A 1 285 ? 128.533 104.894 114.717 1.00 0.00 ? 285 G A O6     1  
ATOM 9160   N N1     . G A 1 285 ? 129.449 106.970 114.527 1.00 0.00 ? 285 G A N1     1  
ATOM 9161   C C2     . G A 1 285 ? 130.432 107.900 114.757 1.00 0.00 ? 285 G A C2     1  
ATOM 9162   N N2     . G A 1 285 ? 130.229 109.119 114.239 1.00 0.00 ? 285 G A N2     1  
ATOM 9163   N N3     . G A 1 285 ? 131.534 107.655 115.447 1.00 0.00 ? 285 G A N3     1  
ATOM 9164   C C4     . G A 1 285 ? 131.578 106.384 115.898 1.00 0.00 ? 285 G A C4     1  
ATOM 9165   H "H5'"  . G A 1 285 ? 135.849 103.936 119.318 1.00 0.00 ? 285 G A "H5'"  1  
ATOM 9166   H "H5''" . G A 1 285 ? 135.344 104.605 120.677 1.00 0.00 ? 285 G A "H5''" 1  
ATOM 9167   H "H4'"  . G A 1 285 ? 135.798 106.281 119.142 1.00 0.00 ? 285 G A "H4'"  1  
ATOM 9168   H "H3'"  . G A 1 285 ? 133.012 106.044 119.601 1.00 0.00 ? 285 G A "H3'"  1  
ATOM 9169   H "H2'"  . G A 1 285 ? 132.627 107.823 118.202 1.00 0.00 ? 285 G A "H2'"  1  
ATOM 9170   H "HO2'" . G A 1 285 ? 134.886 108.691 119.037 1.00 0.00 ? 285 G A "HO2'" 1  
ATOM 9171   H "H1'"  . G A 1 285 ? 134.230 106.971 116.342 1.00 0.00 ? 285 G A "H1'"  1  
ATOM 9172   H H8     . G A 1 285 ? 132.765 103.888 117.388 1.00 0.00 ? 285 G A H8     1  
ATOM 9173   H H1     . G A 1 285 ? 128.670 107.250 114.003 1.00 0.00 ? 285 G A H1     1  
ATOM 9174   H H21    . G A 1 285 ? 129.417 109.311 113.727 1.00 0.00 ? 285 G A H21    1  
ATOM 9175   H H22    . G A 1 285 ? 130.899 109.827 114.370 1.00 0.00 ? 285 G A H22    1  
ATOM 9176   P P      . G A 1 286 ? 132.846 107.702 121.652 1.00 0.00 ? 286 G A P      1  
ATOM 9177   O OP1    . G A 1 286 ? 133.439 108.241 122.903 1.00 0.00 ? 286 G A OP1    1  
ATOM 9178   O OP2    . G A 1 286 ? 131.947 106.523 121.711 1.00 0.00 ? 286 G A OP2    1  
ATOM 9179   O "O5'"  . G A 1 286 ? 132.057 108.886 120.932 1.00 0.00 ? 286 G A "O5'"  1  
ATOM 9180   C "C5'"  . G A 1 286 ? 132.651 110.167 120.773 1.00 0.00 ? 286 G A "C5'"  1  
ATOM 9181   C "C4'"  . G A 1 286 ? 131.781 111.081 119.942 1.00 0.00 ? 286 G A "C4'"  1  
ATOM 9182   O "O4'"  . G A 1 286 ? 131.605 110.518 118.617 1.00 0.00 ? 286 G A "O4'"  1  
ATOM 9183   C "C3'"  . G A 1 286 ? 130.364 111.294 120.448 1.00 0.00 ? 286 G A "C3'"  1  
ATOM 9184   O "O3'"  . G A 1 286 ? 130.284 112.265 121.478 1.00 0.00 ? 286 G A "O3'"  1  
ATOM 9185   C "C2'"  . G A 1 286 ? 129.616 111.685 119.181 1.00 0.00 ? 286 G A "C2'"  1  
ATOM 9186   O "O2'"  . G A 1 286 ? 129.863 113.037 118.831 1.00 0.00 ? 286 G A "O2'"  1  
ATOM 9187   C "C1'"  . G A 1 286 ? 130.275 110.774 118.145 1.00 0.00 ? 286 G A "C1'"  1  
ATOM 9188   N N9     . G A 1 286 ? 129.538 109.509 117.965 1.00 0.00 ? 286 G A N9     1  
ATOM 9189   C C8     . G A 1 286 ? 129.906 108.261 118.402 1.00 0.00 ? 286 G A C8     1  
ATOM 9190   N N7     . G A 1 286 ? 129.045 107.331 118.091 1.00 0.00 ? 286 G A N7     1  
ATOM 9191   C C5     . G A 1 286 ? 128.045 108.006 117.404 1.00 0.00 ? 286 G A C5     1  
ATOM 9192   C C6     . G A 1 286 ? 126.845 107.524 116.822 1.00 0.00 ? 286 G A C6     1  
ATOM 9193   O O6     . G A 1 286 ? 126.412 106.367 116.793 1.00 0.00 ? 286 G A O6     1  
ATOM 9194   N N1     . G A 1 286 ? 126.118 108.551 116.223 1.00 0.00 ? 286 G A N1     1  
ATOM 9195   C C2     . G A 1 286 ? 126.498 109.871 116.193 1.00 0.00 ? 286 G A C2     1  
ATOM 9196   N N2     . G A 1 286 ? 125.665 110.715 115.567 1.00 0.00 ? 286 G A N2     1  
ATOM 9197   N N3     . G A 1 286 ? 127.614 110.331 116.734 1.00 0.00 ? 286 G A N3     1  
ATOM 9198   C C4     . G A 1 286 ? 128.334 109.351 117.319 1.00 0.00 ? 286 G A C4     1  
ATOM 9199   H "H5'"  . G A 1 286 ? 133.519 110.064 120.333 1.00 0.00 ? 286 G A "H5'"  1  
ATOM 9200   H "H5''" . G A 1 286 ? 132.785 110.570 121.655 1.00 0.00 ? 286 G A "H5''" 1  
ATOM 9201   H "H4'"  . G A 1 286 ? 132.226 111.952 119.862 1.00 0.00 ? 286 G A "H4'"  1  
ATOM 9202   H "H3'"  . G A 1 286 ? 130.010 110.444 120.782 1.00 0.00 ? 286 G A "H3'"  1  
ATOM 9203   H "H2'"  . G A 1 286 ? 128.655 111.500 119.260 1.00 0.00 ? 286 G A "H2'"  1  
ATOM 9204   H "HO2'" . G A 1 286 ? 130.188 113.517 119.619 1.00 0.00 ? 286 G A "HO2'" 1  
ATOM 9205   H "H1'"  . G A 1 286 ? 130.332 111.245 117.288 1.00 0.00 ? 286 G A "H1'"  1  
ATOM 9206   H H8     . G A 1 286 ? 130.733 108.085 118.899 1.00 0.00 ? 286 G A H8     1  
ATOM 9207   H H1     . G A 1 286 ? 125.272 108.311 115.793 1.00 0.00 ? 286 G A H1     1  
ATOM 9208   H H21    . G A 1 286 ? 124.834 110.381 115.166 1.00 0.00 ? 286 G A H21    1  
ATOM 9209   H H22    . G A 1 286 ? 125.882 111.670 115.514 1.00 0.00 ? 286 G A H22    1  
ATOM 9210   P P      . U A 1 287 ? 129.141 112.158 122.603 1.00 0.00 ? 287 U A P      1  
ATOM 9211   O OP1    . U A 1 287 ? 129.455 113.136 123.676 1.00 0.00 ? 287 U A OP1    1  
ATOM 9212   O OP2    . U A 1 287 ? 128.970 110.722 122.945 1.00 0.00 ? 287 U A OP2    1  
ATOM 9213   O "O5'"  . U A 1 287 ? 127.821 112.647 121.859 1.00 0.00 ? 287 U A "O5'"  1  
ATOM 9214   C "C5'"  . U A 1 287 ? 127.676 113.998 121.445 1.00 0.00 ? 287 U A "C5'"  1  
ATOM 9215   C "C4'"  . U A 1 287 ? 126.394 114.209 120.679 1.00 0.00 ? 287 U A "C4'"  1  
ATOM 9216   O "O4'"  . U A 1 287 ? 126.404 113.413 119.466 1.00 0.00 ? 287 U A "O4'"  1  
ATOM 9217   C "C3'"  . U A 1 287 ? 125.112 113.792 121.385 1.00 0.00 ? 287 U A "C3'"  1  
ATOM 9218   O "O3'"  . U A 1 287 ? 124.636 114.769 122.294 1.00 0.00 ? 287 U A "O3'"  1  
ATOM 9219   C "C2'"  . U A 1 287 ? 124.164 113.526 120.223 1.00 0.00 ? 287 U A "C2'"  1  
ATOM 9220   O "O2'"  . U A 1 287 ? 123.658 114.737 119.683 1.00 0.00 ? 287 U A "O2'"  1  
ATOM 9221   C "C1'"  . U A 1 287 ? 125.107 112.883 119.203 1.00 0.00 ? 287 U A "C1'"  1  
ATOM 9222   N N1     . U A 1 287 ? 125.127 111.405 119.310 1.00 0.00 ? 287 U A N1     1  
ATOM 9223   C C2     . U A 1 287 ? 124.057 110.718 118.765 1.00 0.00 ? 287 U A C2     1  
ATOM 9224   O O2     . U A 1 287 ? 123.122 111.271 118.214 1.00 0.00 ? 287 U A O2     1  
ATOM 9225   N N3     . U A 1 287 ? 124.120 109.351 118.888 1.00 0.00 ? 287 U A N3     1  
ATOM 9226   C C4     . U A 1 287 ? 125.119 108.615 119.488 1.00 0.00 ? 287 U A C4     1  
ATOM 9227   O O4     . U A 1 287 ? 125.029 107.385 119.516 1.00 0.00 ? 287 U A O4     1  
ATOM 9228   C C5     . U A 1 287 ? 126.193 109.392 120.027 1.00 0.00 ? 287 U A C5     1  
ATOM 9229   C C6     . U A 1 287 ? 126.159 110.722 119.922 1.00 0.00 ? 287 U A C6     1  
ATOM 9230   H "H5'"  . U A 1 287 ? 128.433 114.241 120.873 1.00 0.00 ? 287 U A "H5'"  1  
ATOM 9231   H "H5''" . U A 1 287 ? 127.672 114.576 122.236 1.00 0.00 ? 287 U A "H5''" 1  
ATOM 9232   H "H4'"  . U A 1 287 ? 126.326 115.158 120.436 1.00 0.00 ? 287 U A "H4'"  1  
ATOM 9233   H "H3'"  . U A 1 287 ? 125.272 112.955 121.867 1.00 0.00 ? 287 U A "H3'"  1  
ATOM 9234   H "H2'"  . U A 1 287 ? 123.443 112.913 120.481 1.00 0.00 ? 287 U A "H2'"  1  
ATOM 9235   H "HO2'" . U A 1 287 ? 123.759 115.451 120.345 1.00 0.00 ? 287 U A "HO2'" 1  
ATOM 9236   H "H1'"  . U A 1 287 ? 124.828 113.138 118.298 1.00 0.00 ? 287 U A "H1'"  1  
ATOM 9237   H H3     . U A 1 287 ? 123.372 108.844 118.509 1.00 0.00 ? 287 U A H3     1  
ATOM 9238   H H5     . U A 1 287 ? 126.946 108.950 120.471 1.00 0.00 ? 287 U A H5     1  
ATOM 9239   H H6     . U A 1 287 ? 126.904 111.234 120.300 1.00 0.00 ? 287 U A H6     1  
ATOM 9240   P P      . U A 1 288 ? 123.815 114.325 123.601 1.00 0.00 ? 288 U A P      1  
ATOM 9241   O OP1    . U A 1 288 ? 123.693 115.509 124.492 1.00 0.00 ? 288 U A OP1    1  
ATOM 9242   O OP2    . U A 1 288 ? 124.420 113.075 124.122 1.00 0.00 ? 288 U A OP2    1  
ATOM 9243   O "O5'"  . U A 1 288 ? 122.362 113.978 123.046 1.00 0.00 ? 288 U A "O5'"  1  
ATOM 9244   C "C5'"  . U A 1 288 ? 121.509 114.996 122.546 1.00 0.00 ? 288 U A "C5'"  1  
ATOM 9245   C "C4'"  . U A 1 288 ? 120.230 114.426 121.983 1.00 0.00 ? 288 U A "C4'"  1  
ATOM 9246   O "O4'"  . U A 1 288 ? 120.531 113.560 120.858 1.00 0.00 ? 288 U A "O4'"  1  
ATOM 9247   C "C3'"  . U A 1 288 ? 119.420 113.545 122.921 1.00 0.00 ? 288 U A "C3'"  1  
ATOM 9248   O "O3'"  . U A 1 288 ? 118.602 114.287 123.809 1.00 0.00 ? 288 U A "O3'"  1  
ATOM 9249   C "C2'"  . U A 1 288 ? 118.635 112.667 121.957 1.00 0.00 ? 288 U A "C2'"  1  
ATOM 9250   O "O2'"  . U A 1 288 ? 117.531 113.370 121.403 1.00 0.00 ? 288 U A "O2'"  1  
ATOM 9251   C "C1'"  . U A 1 288 ? 119.669 112.421 120.859 1.00 0.00 ? 288 U A "C1'"  1  
ATOM 9252   N N1     . U A 1 288 ? 120.460 111.192 121.096 1.00 0.00 ? 288 U A N1     1  
ATOM 9253   C C2     . U A 1 288 ? 119.865 109.984 120.780 1.00 0.00 ? 288 U A C2     1  
ATOM 9254   O O2     . U A 1 288 ? 118.739 109.898 120.322 1.00 0.00 ? 288 U A O2     1  
ATOM 9255   N N3     . U A 1 288 ? 120.636 108.873 121.018 1.00 0.00 ? 288 U A N3     1  
ATOM 9256   C C4     . U A 1 288 ? 121.915 108.842 121.530 1.00 0.00 ? 288 U A C4     1  
ATOM 9257   O O4     . U A 1 288 ? 122.479 107.756 121.687 1.00 0.00 ? 288 U A O4     1  
ATOM 9258   C C5     . U A 1 288 ? 122.469 110.128 121.833 1.00 0.00 ? 288 U A C5     1  
ATOM 9259   C C6     . U A 1 288 ? 121.740 111.225 121.612 1.00 0.00 ? 288 U A C6     1  
ATOM 9260   H "H5'"  . U A 1 288 ? 121.977 115.488 121.840 1.00 0.00 ? 288 U A "H5'"  1  
ATOM 9261   H "H5''" . U A 1 288 ? 121.288 115.615 123.274 1.00 0.00 ? 288 U A "H5''" 1  
ATOM 9262   H "H4'"  . U A 1 288 ? 119.666 115.164 121.675 1.00 0.00 ? 288 U A "H4'"  1  
ATOM 9263   H "H3'"  . U A 1 288 ? 120.031 112.979 123.442 1.00 0.00 ? 288 U A "H3'"  1  
ATOM 9264   H "H2'"  . U A 1 288 ? 118.354 111.827 122.380 1.00 0.00 ? 288 U A "H2'"  1  
ATOM 9265   H "HO2'" . U A 1 288 ? 117.320 114.134 121.978 1.00 0.00 ? 288 U A "HO2'" 1  
ATOM 9266   H "H1'"  . U A 1 288 ? 119.213 112.349 119.992 1.00 0.00 ? 288 U A "H1'"  1  
ATOM 9267   H H3     . U A 1 288 ? 120.233 108.008 120.801 1.00 0.00 ? 288 U A H3     1  
ATOM 9268   H H5     . U A 1 288 ? 123.375 110.200 122.201 1.00 0.00 ? 288 U A H5     1  
ATOM 9269   H H6     . U A 1 288 ? 122.140 112.093 121.829 1.00 0.00 ? 288 U A H6     1  
ATOM 9270   P P      . G A 1 289 ? 118.254 113.707 125.268 1.00 0.00 ? 289 G A P      1  
ATOM 9271   O OP1    . G A 1 289 ? 117.596 114.784 126.049 1.00 0.00 ? 289 G A OP1    1  
ATOM 9272   O OP2    . G A 1 289 ? 119.475 113.051 125.804 1.00 0.00 ? 289 G A OP2    1  
ATOM 9273   O "O5'"  . G A 1 289 ? 117.171 112.574 124.984 1.00 0.00 ? 289 G A "O5'"  1  
ATOM 9274   C "C5'"  . G A 1 289 ? 115.877 112.907 124.506 1.00 0.00 ? 289 G A "C5'"  1  
ATOM 9275   C "C4'"  . G A 1 289 ? 115.086 111.674 124.142 1.00 0.00 ? 289 G A "C4'"  1  
ATOM 9276   O "O4'"  . G A 1 289 ? 115.773 110.941 123.094 1.00 0.00 ? 289 G A "O4'"  1  
ATOM 9277   C "C3'"  . G A 1 289 ? 114.899 110.648 125.250 1.00 0.00 ? 289 G A "C3'"  1  
ATOM 9278   O "O3'"  . G A 1 289 ? 113.848 110.980 126.140 1.00 0.00 ? 289 G A "O3'"  1  
ATOM 9279   C "C2'"  . G A 1 289 ? 114.661 109.362 124.475 1.00 0.00 ? 289 G A "C2'"  1  
ATOM 9280   O "O2'"  . G A 1 289 ? 113.334 109.301 123.973 1.00 0.00 ? 289 G A "O2'"  1  
ATOM 9281   C "C1'"  . G A 1 289 ? 115.629 109.528 123.301 1.00 0.00 ? 289 G A "C1'"  1  
ATOM 9282   N N9     . G A 1 289 ? 116.939 108.906 123.569 1.00 0.00 ? 289 G A N9     1  
ATOM 9283   C C8     . G A 1 289 ? 118.125 109.544 123.835 1.00 0.00 ? 289 G A C8     1  
ATOM 9284   N N7     . G A 1 289 ? 119.120 108.722 124.031 1.00 0.00 ? 289 G A N7     1  
ATOM 9285   C C5     . G A 1 289 ? 118.557 107.461 123.883 1.00 0.00 ? 289 G A C5     1  
ATOM 9286   C C6     . G A 1 289 ? 119.146 106.175 123.982 1.00 0.00 ? 289 G A C6     1  
ATOM 9287   O O6     . G A 1 289 ? 120.321 105.882 124.227 1.00 0.00 ? 289 G A O6     1  
ATOM 9288   N N1     . G A 1 289 ? 118.213 105.166 123.763 1.00 0.00 ? 289 G A N1     1  
ATOM 9289   C C2     . G A 1 289 ? 116.882 105.369 123.483 1.00 0.00 ? 289 G A C2     1  
ATOM 9290   N N2     . G A 1 289 ? 116.137 104.269 123.302 1.00 0.00 ? 289 G A N2     1  
ATOM 9291   N N3     . G A 1 289 ? 116.322 106.564 123.389 1.00 0.00 ? 289 G A N3     1  
ATOM 9292   C C4     . G A 1 289 ? 117.211 107.556 123.599 1.00 0.00 ? 289 G A C4     1  
ATOM 9293   H "H5'"  . G A 1 289 ? 115.962 113.477 123.715 1.00 0.00 ? 289 G A "H5'"  1  
ATOM 9294   H "H5''" . G A 1 289 ? 115.396 113.401 125.202 1.00 0.00 ? 289 G A "H5''" 1  
ATOM 9295   H "H4'"  . G A 1 289 ? 114.204 111.948 123.813 1.00 0.00 ? 289 G A "H4'"  1  
ATOM 9296   H "H3'"  . G A 1 289 ? 115.735 110.568 125.756 1.00 0.00 ? 289 G A "H3'"  1  
ATOM 9297   H "H2'"  . G A 1 289 ? 114.883 108.572 125.011 1.00 0.00 ? 289 G A "H2'"  1  
ATOM 9298   H "HO2'" . G A 1 289 ? 112.772 109.919 124.482 1.00 0.00 ? 289 G A "HO2'" 1  
ATOM 9299   H "H1'"  . G A 1 289 ? 115.236 109.131 122.496 1.00 0.00 ? 289 G A "H1'"  1  
ATOM 9300   H H8     . G A 1 289 ? 118.217 110.519 123.875 1.00 0.00 ? 289 G A H8     1  
ATOM 9301   H H1     . G A 1 289 ? 118.531 104.241 123.810 1.00 0.00 ? 289 G A H1     1  
ATOM 9302   H H21    . G A 1 289 ? 116.545 103.381 123.371 1.00 0.00 ? 289 G A H21    1  
ATOM 9303   H H22    . G A 1 289 ? 115.182 104.352 123.098 1.00 0.00 ? 289 G A H22    1  
ATOM 9304   P P      . G A 1 290 ? 113.920 110.522 127.679 1.00 0.00 ? 290 G A P      1  
ATOM 9305   O OP1    . G A 1 290 ? 112.804 111.179 128.408 1.00 0.00 ? 290 G A OP1    1  
ATOM 9306   O OP2    . G A 1 290 ? 115.315 110.704 128.150 1.00 0.00 ? 290 G A OP2    1  
ATOM 9307   O "O5'"  . G A 1 290 ? 113.617 108.956 127.630 1.00 0.00 ? 290 G A "O5'"  1  
ATOM 9308   C "C5'"  . G A 1 290 ? 112.341 108.472 127.238 1.00 0.00 ? 290 G A "C5'"  1  
ATOM 9309   C "C4'"  . G A 1 290 ? 112.325 106.968 127.145 1.00 0.00 ? 290 G A "C4'"  1  
ATOM 9310   O "O4'"  . G A 1 290 ? 113.265 106.527 126.131 1.00 0.00 ? 290 G A "O4'"  1  
ATOM 9311   C "C3'"  . G A 1 290 ? 112.750 106.215 128.394 1.00 0.00 ? 290 G A "C3'"  1  
ATOM 9312   O "O3'"  . G A 1 290 ? 111.711 106.103 129.354 1.00 0.00 ? 290 G A "O3'"  1  
ATOM 9313   C "C2'"  . G A 1 290 ? 113.213 104.877 127.838 1.00 0.00 ? 290 G A "C2'"  1  
ATOM 9314   O "O2'"  . G A 1 290 ? 112.111 104.041 127.520 1.00 0.00 ? 290 G A "O2'"  1  
ATOM 9315   C "C1'"  . G A 1 290 ? 113.899 105.308 126.540 1.00 0.00 ? 290 G A "C1'"  1  
ATOM 9316   N N9     . G A 1 290 ? 115.350 105.498 126.716 1.00 0.00 ? 290 G A N9     1  
ATOM 9317   C C8     . G A 1 290 ? 116.038 106.689 126.730 1.00 0.00 ? 290 G A C8     1  
ATOM 9318   N N7     . G A 1 290 ? 117.323 106.537 126.903 1.00 0.00 ? 290 G A N7     1  
ATOM 9319   C C5     . G A 1 290 ? 117.496 105.164 127.012 1.00 0.00 ? 290 G A C5     1  
ATOM 9320   C C6     . G A 1 290 ? 118.673 104.399 127.213 1.00 0.00 ? 290 G A C6     1  
ATOM 9321   O O6     . G A 1 290 ? 119.838 104.796 127.338 1.00 0.00 ? 290 G A O6     1  
ATOM 9322   N N1     . G A 1 290 ? 118.397 103.036 127.261 1.00 0.00 ? 290 G A N1     1  
ATOM 9323   C C2     . G A 1 290 ? 117.147 102.478 127.136 1.00 0.00 ? 290 G A C2     1  
ATOM 9324   N N2     . G A 1 290 ? 117.079 101.144 127.210 1.00 0.00 ? 290 G A N2     1  
ATOM 9325   N N3     . G A 1 290 ? 116.041 103.183 126.947 1.00 0.00 ? 290 G A N3     1  
ATOM 9326   C C4     . G A 1 290 ? 116.287 104.509 126.899 1.00 0.00 ? 290 G A C4     1  
ATOM 9327   H "H5'"  . G A 1 290 ? 112.108 108.851 126.366 1.00 0.00 ? 290 G A "H5'"  1  
ATOM 9328   H "H5''" . G A 1 290 ? 111.674 108.758 127.898 1.00 0.00 ? 290 G A "H5''" 1  
ATOM 9329   H "H4'"  . G A 1 290 ? 111.424 106.674 126.890 1.00 0.00 ? 290 G A "H4'"  1  
ATOM 9330   H "H3'"  . G A 1 290 ? 113.516 106.674 128.802 1.00 0.00 ? 290 G A "H3'"  1  
ATOM 9331   H "H2'"  . G A 1 290 ? 113.842 104.433 128.444 1.00 0.00 ? 290 G A "H2'"  1  
ATOM 9332   H "HO2'" . G A 1 290 ? 112.321 103.121 127.783 1.00 0.00 ? 290 G A "HO2'" 1  
ATOM 9333   H "H1'"  . G A 1 290 ? 113.739 104.634 125.848 1.00 0.00 ? 290 G A "H1'"  1  
ATOM 9334   H H8     . G A 1 290 ? 115.608 107.561 126.619 1.00 0.00 ? 290 G A H8     1  
ATOM 9335   H H1     . G A 1 290 ? 119.153 102.428 127.397 1.00 0.00 ? 290 G A H1     1  
ATOM 9336   H H21    . G A 1 290 ? 117.893 100.616 127.348 1.00 0.00 ? 290 G A H21    1  
ATOM 9337   H H22    . G A 1 290 ? 116.213 100.690 127.126 1.00 0.00 ? 290 G A H22    1  
ATOM 9338   P P      . C A 1 291 ? 112.062 105.676 130.856 1.00 0.00 ? 291 C A P      1  
ATOM 9339   O OP1    . C A 1 291 ? 110.877 105.909 131.720 1.00 0.00 ? 291 C A OP1    1  
ATOM 9340   O OP2    . C A 1 291 ? 113.319 106.422 131.119 1.00 0.00 ? 291 C A OP2    1  
ATOM 9341   O "O5'"  . C A 1 291 ? 112.396 104.119 130.889 1.00 0.00 ? 291 C A "O5'"  1  
ATOM 9342   C "C5'"  . C A 1 291 ? 111.366 103.149 130.767 1.00 0.00 ? 291 C A "C5'"  1  
ATOM 9343   C "C4'"  . C A 1 291 ? 111.927 101.767 130.535 1.00 0.00 ? 291 C A "C4'"  1  
ATOM 9344   O "O4'"  . C A 1 291 ? 113.083 101.837 129.648 1.00 0.00 ? 291 C A "O4'"  1  
ATOM 9345   C "C3'"  . C A 1 291 ? 112.469 101.049 131.761 1.00 0.00 ? 291 C A "C3'"  1  
ATOM 9346   O "O3'"  . C A 1 291 ? 111.451 100.465 132.555 1.00 0.00 ? 291 C A "O3'"  1  
ATOM 9347   C "C2'"  . C A 1 291 ? 113.385 100.024 131.113 1.00 0.00 ? 291 C A "C2'"  1  
ATOM 9348   O "O2'"  . C A 1 291 ? 112.642 98.950  130.556 1.00 0.00 ? 291 C A "O2'"  1  
ATOM 9349   C "C1'"  . C A 1 291 ? 113.992 100.856 129.990 1.00 0.00 ? 291 C A "C1'"  1  
ATOM 9350   N N1     . C A 1 291 ? 115.274 101.488 130.387 1.00 0.00 ? 291 C A N1     1  
ATOM 9351   C C2     . C A 1 291 ? 116.415 100.680 130.472 1.00 0.00 ? 291 C A C2     1  
ATOM 9352   O O2     . C A 1 291 ? 116.321 99.470  130.215 1.00 0.00 ? 291 C A O2     1  
ATOM 9353   N N3     . C A 1 291 ? 117.597 101.231 130.831 1.00 0.00 ? 291 C A N3     1  
ATOM 9354   C C4     . C A 1 291 ? 117.672 102.534 131.101 1.00 0.00 ? 291 C A C4     1  
ATOM 9355   N N4     . C A 1 291 ? 118.859 103.035 131.452 1.00 0.00 ? 291 C A N4     1  
ATOM 9356   C C5     . C A 1 291 ? 116.531 103.382 131.025 1.00 0.00 ? 291 C A C5     1  
ATOM 9357   C C6     . C A 1 291 ? 115.367 102.826 130.668 1.00 0.00 ? 291 C A C6     1  
ATOM 9358   H "H5'"  . C A 1 291 ? 110.788 103.391 130.014 1.00 0.00 ? 291 C A "H5'"  1  
ATOM 9359   H "H5''" . C A 1 291 ? 110.834 103.144 131.590 1.00 0.00 ? 291 C A "H5''" 1  
ATOM 9360   H "H4'"  . C A 1 291 ? 111.237 101.209 130.120 1.00 0.00 ? 291 C A "H4'"  1  
ATOM 9361   H "H3'"  . C A 1 291 ? 113.003 101.654 132.317 1.00 0.00 ? 291 C A "H3'"  1  
ATOM 9362   H "H2'"  . C A 1 291 ? 114.066 99.705  131.741 1.00 0.00 ? 291 C A "H2'"  1  
ATOM 9363   H "HO2'" . C A 1 291 ? 113.262 98.307  130.152 1.00 0.00 ? 291 C A "HO2'" 1  
ATOM 9364   H "H1'"  . C A 1 291 ? 114.138 100.284 129.209 1.00 0.00 ? 291 C A "H1'"  1  
ATOM 9365   H H41    . C A 1 291 ? 119.643 102.448 131.504 1.00 0.00 ? 291 C A H41    1  
ATOM 9366   H H42    . C A 1 291 ? 118.947 103.989 131.657 1.00 0.00 ? 291 C A H42    1  
ATOM 9367   H H5     . C A 1 291 ? 116.596 104.339 131.226 1.00 0.00 ? 291 C A H5     1  
ATOM 9368   H H6     . C A 1 291 ? 114.571 103.392 130.610 1.00 0.00 ? 291 C A H6     1  
ATOM 9369   P P      . U A 1 292 ? 111.237 100.943 134.074 1.00 0.00 ? 292 U A P      1  
ATOM 9370   O OP1    . U A 1 292 ? 109.831 100.650 134.455 1.00 0.00 ? 292 U A OP1    1  
ATOM 9371   O OP2    . U A 1 292 ? 111.757 102.328 134.198 1.00 0.00 ? 292 U A OP2    1  
ATOM 9372   O "O5'"  . U A 1 292 ? 112.188 99.981  134.918 1.00 0.00 ? 292 U A "O5'"  1  
ATOM 9373   C "C5'"  . U A 1 292 ? 111.856 98.614  135.113 1.00 0.00 ? 292 U A "C5'"  1  
ATOM 9374   C "C4'"  . U A 1 292 ? 113.071 97.789  135.459 1.00 0.00 ? 292 U A "C4'"  1  
ATOM 9375   O "O4'"  . U A 1 292 ? 114.087 97.953  134.433 1.00 0.00 ? 292 U A "O4'"  1  
ATOM 9376   C "C3'"  . U A 1 292 ? 113.786 98.156  136.750 1.00 0.00 ? 292 U A "C3'"  1  
ATOM 9377   O "O3'"  . U A 1 292 ? 113.180 97.584  137.899 1.00 0.00 ? 292 U A "O3'"  1  
ATOM 9378   C "C2'"  . U A 1 292 ? 115.203 97.658  136.499 1.00 0.00 ? 292 U A "C2'"  1  
ATOM 9379   O "O2'"  . U A 1 292 ? 115.294 96.251  136.664 1.00 0.00 ? 292 U A "O2'"  1  
ATOM 9380   C "C1'"  . U A 1 292 ? 115.387 97.998  135.017 1.00 0.00 ? 292 U A "C1'"  1  
ATOM 9381   N N1     . U A 1 292 ? 115.995 99.336  134.820 1.00 0.00 ? 292 U A N1     1  
ATOM 9382   C C2     . U A 1 292 ? 117.358 99.443  135.006 1.00 0.00 ? 292 U A C2     1  
ATOM 9383   O O2     . U A 1 292 ? 118.062 98.498  135.322 1.00 0.00 ? 292 U A O2     1  
ATOM 9384   N N3     . U A 1 292 ? 117.878 100.698 134.809 1.00 0.00 ? 292 U A N3     1  
ATOM 9385   C C4     . U A 1 292 ? 117.188 101.836 134.452 1.00 0.00 ? 292 U A C4     1  
ATOM 9386   O O4     . U A 1 292 ? 117.798 102.897 134.314 1.00 0.00 ? 292 U A O4     1  
ATOM 9387   C C5     . U A 1 292 ? 115.779 101.652 134.275 1.00 0.00 ? 292 U A C5     1  
ATOM 9388   C C6     . U A 1 292 ? 115.248 100.437 134.458 1.00 0.00 ? 292 U A C6     1  
ATOM 9389   H "H5'"  . U A 1 292 ? 111.455 98.264  134.291 1.00 0.00 ? 292 U A "H5'"  1  
ATOM 9390   H "H5''" . U A 1 292 ? 111.207 98.543  135.842 1.00 0.00 ? 292 U A "H5''" 1  
ATOM 9391   H "H4'"  . U A 1 292 ? 112.809 96.845  135.496 1.00 0.00 ? 292 U A "H4'"  1  
ATOM 9392   H "H3'"  . U A 1 292 ? 113.799 99.130  136.845 1.00 0.00 ? 292 U A "H3'"  1  
ATOM 9393   H "H2'"  . U A 1 292 ? 115.854 98.133  137.057 1.00 0.00 ? 292 U A "H2'"  1  
ATOM 9394   H "HO2'" . U A 1 292 ? 114.535 95.942  137.202 1.00 0.00 ? 292 U A "HO2'" 1  
ATOM 9395   H "H1'"  . U A 1 292 ? 115.954 97.318  134.596 1.00 0.00 ? 292 U A "H1'"  1  
ATOM 9396   H H3     . U A 1 292 ? 118.844 100.795 134.938 1.00 0.00 ? 292 U A H3     1  
ATOM 9397   H H5     . U A 1 292 ? 115.212 102.408 134.019 1.00 0.00 ? 292 U A H5     1  
ATOM 9398   H H6     . U A 1 292 ? 114.283 100.338 134.332 1.00 0.00 ? 292 U A H6     1  
ATOM 9399   P P      . C A 1 293 ? 113.263 98.339  139.314 1.00 0.00 ? 293 C A P      1  
ATOM 9400   O OP1    . C A 1 293 ? 112.388 97.616  140.272 1.00 0.00 ? 293 C A OP1    1  
ATOM 9401   O OP2    . C A 1 293 ? 113.050 99.788  139.078 1.00 0.00 ? 293 C A OP2    1  
ATOM 9402   O "O5'"  . C A 1 293 ? 114.773 98.128  139.774 1.00 0.00 ? 293 C A "O5'"  1  
ATOM 9403   C "C5'"  . C A 1 293 ? 115.264 96.838  140.096 1.00 0.00 ? 293 C A "C5'"  1  
ATOM 9404   C "C4'"  . C A 1 293 ? 116.757 96.851  140.325 1.00 0.00 ? 293 C A "C4'"  1  
ATOM 9405   O "O4'"  . C A 1 293 ? 117.438 97.283  139.118 1.00 0.00 ? 293 C A "O4'"  1  
ATOM 9406   C "C3'"  . C A 1 293 ? 117.263 97.804  141.397 1.00 0.00 ? 293 C A "C3'"  1  
ATOM 9407   O "O3'"  . C A 1 293 ? 117.136 97.281  142.709 1.00 0.00 ? 293 C A "O3'"  1  
ATOM 9408   C "C2'"  . C A 1 293 ? 118.704 98.045  140.974 1.00 0.00 ? 293 C A "C2'"  1  
ATOM 9409   O "O2'"  . C A 1 293 ? 119.538 96.955  141.337 1.00 0.00 ? 293 C A "O2'"  1  
ATOM 9410   C "C1'"  . C A 1 293 ? 118.575 98.084  139.453 1.00 0.00 ? 293 C A "C1'"  1  
ATOM 9411   N N1     . C A 1 293 ? 118.414 99.467  138.935 1.00 0.00 ? 293 C A N1     1  
ATOM 9412   C C2     . C A 1 293 ? 119.546 100.285 138.862 1.00 0.00 ? 293 C A C2     1  
ATOM 9413   O O2     . C A 1 293 ? 120.644 99.837  139.228 1.00 0.00 ? 293 C A O2     1  
ATOM 9414   N N3     . C A 1 293 ? 119.425 101.548 138.393 1.00 0.00 ? 293 C A N3     1  
ATOM 9415   C C4     . C A 1 293 ? 118.235 102.009 138.007 1.00 0.00 ? 293 C A C4     1  
ATOM 9416   N N4     . C A 1 293 ? 118.166 103.260 137.549 1.00 0.00 ? 293 C A N4     1  
ATOM 9417   C C5     . C A 1 293 ? 117.066 101.200 138.069 1.00 0.00 ? 293 C A C5     1  
ATOM 9418   C C6     . C A 1 293 ? 117.197 99.951  138.533 1.00 0.00 ? 293 C A C6     1  
ATOM 9419   H "H5'"  . C A 1 293 ? 115.061 96.226  139.359 1.00 0.00 ? 293 C A "H5'"  1  
ATOM 9420   H "H5''" . C A 1 293 ? 114.821 96.519  140.909 1.00 0.00 ? 293 C A "H5''" 1  
ATOM 9421   H "H4'"  . C A 1 293 ? 117.050 95.940  140.546 1.00 0.00 ? 293 C A "H4'"  1  
ATOM 9422   H "H3'"  . C A 1 293 ? 116.766 98.647  141.337 1.00 0.00 ? 293 C A "H3'"  1  
ATOM 9423   H "H2'"  . C A 1 293 ? 119.046 98.894  141.326 1.00 0.00 ? 293 C A "H2'"  1  
ATOM 9424   H "HO2'" . C A 1 293 ? 120.395 97.300  141.660 1.00 0.00 ? 293 C A "HO2'" 1  
ATOM 9425   H "H1'"  . C A 1 293 ? 119.369 97.676  139.045 1.00 0.00 ? 293 C A "H1'"  1  
ATOM 9426   H H41    . C A 1 293 ? 118.973 103.815 137.510 1.00 0.00 ? 293 C A H41    1  
ATOM 9427   H H42    . C A 1 293 ? 117.305 103.628 137.258 1.00 0.00 ? 293 C A H42    1  
ATOM 9428   H H5     . C A 1 293 ? 116.193 101.547 137.780 1.00 0.00 ? 293 C A H5     1  
ATOM 9429   H H6     . C A 1 293 ? 116.401 99.382  138.583 1.00 0.00 ? 293 C A H6     1  
ATOM 9430   P P      . A A 1 294 ? 116.758 98.253  143.933 1.00 0.00 ? 294 A A P      1  
ATOM 9431   O OP1    . A A 1 294 ? 116.141 97.428  145.001 1.00 0.00 ? 294 A A OP1    1  
ATOM 9432   O OP2    . A A 1 294 ? 116.018 99.417  143.384 1.00 0.00 ? 294 A A OP2    1  
ATOM 9433   O "O5'"  . A A 1 294 ? 118.169 98.772  144.462 1.00 0.00 ? 294 A A "O5'"  1  
ATOM 9434   C "C5'"  . A A 1 294 ? 119.297 97.910  144.494 1.00 0.00 ? 294 A A "C5'"  1  
ATOM 9435   C "C4'"  . A A 1 294 ? 120.585 98.677  144.327 1.00 0.00 ? 294 A A "C4'"  1  
ATOM 9436   O "O4'"  . A A 1 294 ? 120.705 99.181  142.972 1.00 0.00 ? 294 A A "O4'"  1  
ATOM 9437   C "C3'"  . A A 1 294 ? 120.736 99.923  145.186 1.00 0.00 ? 294 A A "C3'"  1  
ATOM 9438   O "O3'"  . A A 1 294 ? 121.154 99.637  146.509 1.00 0.00 ? 294 A A "O3'"  1  
ATOM 9439   C "C2'"  . A A 1 294 ? 121.774 100.723 144.418 1.00 0.00 ? 294 A A "C2'"  1  
ATOM 9440   O "O2'"  . A A 1 294 ? 123.085 100.235 144.662 1.00 0.00 ? 294 A A "O2'"  1  
ATOM 9441   C "C1'"  . A A 1 294 ? 121.389 100.412 142.973 1.00 0.00 ? 294 A A "C1'"  1  
ATOM 9442   N N9     . A A 1 294 ? 120.515 101.450 142.395 1.00 0.00 ? 294 A A N9     1  
ATOM 9443   C C8     . A A 1 294 ? 119.167 101.376 142.147 1.00 0.00 ? 294 A A C8     1  
ATOM 9444   N N7     . A A 1 294 ? 118.665 102.468 141.624 1.00 0.00 ? 294 A A N7     1  
ATOM 9445   C C5     . A A 1 294 ? 119.757 103.319 141.520 1.00 0.00 ? 294 A A C5     1  
ATOM 9446   C C6     . A A 1 294 ? 119.890 104.634 141.040 1.00 0.00 ? 294 A A C6     1  
ATOM 9447   N N6     . A A 1 294 ? 118.874 105.352 140.556 1.00 0.00 ? 294 A A N6     1  
ATOM 9448   N N1     . A A 1 294 ? 121.118 105.195 141.076 1.00 0.00 ? 294 A A N1     1  
ATOM 9449   C C2     . A A 1 294 ? 122.137 104.476 141.562 1.00 0.00 ? 294 A A C2     1  
ATOM 9450   N N3     . A A 1 294 ? 122.138 103.234 142.041 1.00 0.00 ? 294 A A N3     1  
ATOM 9451   C C4     . A A 1 294 ? 120.902 102.705 141.991 1.00 0.00 ? 294 A A C4     1  
ATOM 9452   H "H5'"  . A A 1 294 ? 119.219 97.254  143.770 1.00 0.00 ? 294 A A "H5'"  1  
ATOM 9453   H "H5''" . A A 1 294 ? 119.315 97.438  145.352 1.00 0.00 ? 294 A A "H5''" 1  
ATOM 9454   H "H4'"  . A A 1 294 ? 121.338 98.075  144.503 1.00 0.00 ? 294 A A "H4'"  1  
ATOM 9455   H "H3'"  . A A 1 294 ? 119.888 100.416 145.190 1.00 0.00 ? 294 A A "H3'"  1  
ATOM 9456   H "H2'"  . A A 1 294 ? 121.702 101.682 144.609 1.00 0.00 ? 294 A A "H2'"  1  
ATOM 9457   H "HO2'" . A A 1 294 ? 123.082 99.718  145.494 1.00 0.00 ? 294 A A "HO2'" 1  
ATOM 9458   H "H1'"  . A A 1 294 ? 122.201 100.329 142.430 1.00 0.00 ? 294 A A "H1'"  1  
ATOM 9459   H H8     . A A 1 294 ? 118.628 100.581 142.343 1.00 0.00 ? 294 A A H8     1  
ATOM 9460   H H61    . A A 1 294 ? 119.028 106.266 140.235 1.00 0.00 ? 294 A A H61    1  
ATOM 9461   H H62    . A A 1 294 ? 117.974 104.966 140.519 1.00 0.00 ? 294 A A H62    1  
ATOM 9462   H H2     . A A 1 294 ? 123.007 104.928 141.566 1.00 0.00 ? 294 A A H2     1  
ATOM 9463   P P      . A A 1 295 ? 121.154 100.800 147.610 1.00 0.00 ? 295 A A P      1  
ATOM 9464   O OP1    . A A 1 295 ? 120.112 100.507 148.625 1.00 0.00 ? 295 A A OP1    1  
ATOM 9465   O OP2    . A A 1 295 ? 121.049 102.029 146.784 1.00 0.00 ? 295 A A OP2    1  
ATOM 9466   O "O5'"  . A A 1 295 ? 122.568 100.820 148.345 1.00 0.00 ? 295 A A "O5'"  1  
ATOM 9467   C "C5'"  . A A 1 295 ? 122.934 101.901 149.191 1.00 0.00 ? 295 A A "C5'"  1  
ATOM 9468   C "C4'"  . A A 1 295 ? 124.200 102.569 148.718 1.00 0.00 ? 295 A A "C4'"  1  
ATOM 9469   O "O4'"  . A A 1 295 ? 124.139 102.826 147.285 1.00 0.00 ? 295 A A "O4'"  1  
ATOM 9470   C "C3'"  . A A 1 295 ? 124.502 103.931 149.325 1.00 0.00 ? 295 A A "C3'"  1  
ATOM 9471   O "O3'"  . A A 1 295 ? 125.142 103.847 150.586 1.00 0.00 ? 295 A A "O3'"  1  
ATOM 9472   C "C2'"  . A A 1 295 ? 125.381 104.582 148.260 1.00 0.00 ? 295 A A "C2'"  1  
ATOM 9473   O "O2'"  . A A 1 295 ? 126.704 104.069 148.300 1.00 0.00 ? 295 A A "O2'"  1  
ATOM 9474   C "C1'"  . A A 1 295 ? 124.702 104.106 146.977 1.00 0.00 ? 295 A A "C1'"  1  
ATOM 9475   N N9     . A A 1 295 ? 123.573 104.973 146.591 1.00 0.00 ? 295 A A N9     1  
ATOM 9476   C C8     . A A 1 295 ? 122.254 104.624 146.436 1.00 0.00 ? 295 A A C8     1  
ATOM 9477   N N7     . A A 1 295 ? 121.481 105.620 146.084 1.00 0.00 ? 295 A A N7     1  
ATOM 9478   C C5     . A A 1 295 ? 122.348 106.701 146.000 1.00 0.00 ? 295 A A C5     1  
ATOM 9479   C C6     . A A 1 295 ? 122.147 108.053 145.669 1.00 0.00 ? 295 A A C6     1  
ATOM 9480   N N6     . A A 1 295 ? 120.958 108.569 145.350 1.00 0.00 ? 295 A A N6     1  
ATOM 9481   N N1     . A A 1 295 ? 123.224 108.869 145.680 1.00 0.00 ? 295 A A N1     1  
ATOM 9482   C C2     . A A 1 295 ? 124.417 108.353 146.002 1.00 0.00 ? 295 A A C2     1  
ATOM 9483   N N3     . A A 1 295 ? 124.731 107.101 146.330 1.00 0.00 ? 295 A A N3     1  
ATOM 9484   C C4     . A A 1 295 ? 123.639 106.317 146.310 1.00 0.00 ? 295 A A C4     1  
ATOM 9485   H "H5'"  . A A 1 295 ? 123.071 101.563 150.100 1.00 0.00 ? 295 A A "H5'"  1  
ATOM 9486   H "H5''" . A A 1 295 ? 122.209 102.559 149.201 1.00 0.00 ? 295 A A "H5''" 1  
ATOM 9487   H "H4'"  . A A 1 295 ? 124.951 101.967 148.902 1.00 0.00 ? 295 A A "H4'"  1  
ATOM 9488   H "H3'"  . A A 1 295 ? 123.670 104.441 149.420 1.00 0.00 ? 295 A A "H3'"  1  
ATOM 9489   H "H2'"  . A A 1 295 ? 125.367 105.559 148.331 1.00 0.00 ? 295 A A "H2'"  1  
ATOM 9490   H "HO2'" . A A 1 295 ? 127.105 104.289 149.167 1.00 0.00 ? 295 A A "HO2'" 1  
ATOM 9491   H "H1'"  . A A 1 295 ? 125.359 104.082 146.250 1.00 0.00 ? 295 A A "H1'"  1  
ATOM 9492   H H8     . A A 1 295 ? 121.921 103.712 146.577 1.00 0.00 ? 295 A A H8     1  
ATOM 9493   H H61    . A A 1 295 ? 120.880 109.520 145.128 1.00 0.00 ? 295 A A H61    1  
ATOM 9494   H H62    . A A 1 295 ? 120.163 107.996 145.335 1.00 0.00 ? 295 A A H62    1  
ATOM 9495   H H2     . A A 1 295 ? 125.165 108.986 145.994 1.00 0.00 ? 295 A A H2     1  
ATOM 9496   P P      . C A 1 296 ? 124.368 104.307 151.917 1.00 0.00 ? 296 C A P      1  
ATOM 9497   O OP1    . C A 1 296 ? 125.383 104.728 152.917 1.00 0.00 ? 296 C A OP1    1  
ATOM 9498   O OP2    . C A 1 296 ? 123.387 103.250 152.268 1.00 0.00 ? 296 C A OP2    1  
ATOM 9499   O "O5'"  . C A 1 296 ? 123.558 105.603 151.464 1.00 0.00 ? 296 C A "O5'"  1  
ATOM 9500   C "C5'"  . C A 1 296 ? 124.226 106.724 150.906 1.00 0.00 ? 296 C A "C5'"  1  
ATOM 9501   C "C4'"  . C A 1 296 ? 123.252 107.757 150.397 1.00 0.00 ? 296 C A "C4'"  1  
ATOM 9502   O "O4'"  . C A 1 296 ? 122.682 107.322 149.134 1.00 0.00 ? 296 C A "O4'"  1  
ATOM 9503   C "C3'"  . C A 1 296 ? 122.039 108.024 151.275 1.00 0.00 ? 296 C A "C3'"  1  
ATOM 9504   O "O3'"  . C A 1 296 ? 122.316 108.903 152.351 1.00 0.00 ? 296 C A "O3'"  1  
ATOM 9505   C "C2'"  . C A 1 296 ? 121.023 108.576 150.283 1.00 0.00 ? 296 C A "C2'"  1  
ATOM 9506   O "O2'"  . C A 1 296 ? 121.294 109.934 149.972 1.00 0.00 ? 296 C A "O2'"  1  
ATOM 9507   C "C1'"  . C A 1 296 ? 121.308 107.715 149.048 1.00 0.00 ? 296 C A "C1'"  1  
ATOM 9508   N N1     . C A 1 296 ? 120.420 106.530 148.973 1.00 0.00 ? 296 C A N1     1  
ATOM 9509   C C2     . C A 1 296 ? 119.094 106.717 148.558 1.00 0.00 ? 296 C A C2     1  
ATOM 9510   O O2     . C A 1 296 ? 118.706 107.859 148.269 1.00 0.00 ? 296 C A O2     1  
ATOM 9511   N N3     . C A 1 296 ? 118.263 105.653 148.478 1.00 0.00 ? 296 C A N3     1  
ATOM 9512   C C4     . C A 1 296 ? 118.706 104.435 148.794 1.00 0.00 ? 296 C A C4     1  
ATOM 9513   N N4     . C A 1 296 ? 117.850 103.414 148.701 1.00 0.00 ? 296 C A N4     1  
ATOM 9514   C C5     . C A 1 296 ? 120.045 104.211 149.220 1.00 0.00 ? 296 C A C5     1  
ATOM 9515   C C6     . C A 1 296 ? 120.859 105.271 149.292 1.00 0.00 ? 296 C A C6     1  
ATOM 9516   H "H5'"  . C A 1 296 ? 124.790 106.422 150.162 1.00 0.00 ? 296 C A "H5'"  1  
ATOM 9517   H "H5''" . C A 1 296 ? 124.795 107.131 151.593 1.00 0.00 ? 296 C A "H5''" 1  
ATOM 9518   H "H4'"  . C A 1 296 ? 123.731 108.600 150.254 1.00 0.00 ? 296 C A "H4'"  1  
ATOM 9519   H "H3'"  . C A 1 296 ? 121.709 107.174 151.632 1.00 0.00 ? 296 C A "H3'"  1  
ATOM 9520   H "H2'"  . C A 1 296 ? 120.104 108.452 150.602 1.00 0.00 ? 296 C A "H2'"  1  
ATOM 9521   H "HO2'" . C A 1 296 ? 121.858 110.316 150.676 1.00 0.00 ? 296 C A "HO2'" 1  
ATOM 9522   H "H1'"  . C A 1 296 ? 121.194 108.259 148.242 1.00 0.00 ? 296 C A "H1'"  1  
ATOM 9523   H H41    . C A 1 296 ? 116.929 103.573 148.408 1.00 0.00 ? 296 C A H41    1  
ATOM 9524   H H42    . C A 1 296 ? 118.145 102.507 148.925 1.00 0.00 ? 296 C A H42    1  
ATOM 9525   H H5     . C A 1 296 ? 120.362 103.311 149.450 1.00 0.00 ? 296 C A H5     1  
ATOM 9526   H H6     . C A 1 296 ? 121.784 105.139 149.584 1.00 0.00 ? 296 C A H6     1  
ATOM 9527   P P      . G A 1 297 ? 121.373 108.912 153.652 1.00 0.00 ? 297 G A P      1  
ATOM 9528   O OP1    . G A 1 297 ? 122.002 109.791 154.673 1.00 0.00 ? 297 G A OP1    1  
ATOM 9529   O OP2    . G A 1 297 ? 121.050 107.504 153.996 1.00 0.00 ? 297 G A OP2    1  
ATOM 9530   O "O5'"  . G A 1 297 ? 120.033 109.617 153.154 1.00 0.00 ? 297 G A "O5'"  1  
ATOM 9531   C "C5'"  . G A 1 297 ? 120.008 111.004 152.849 1.00 0.00 ? 297 G A "C5'"  1  
ATOM 9532   C "C4'"  . G A 1 297 ? 118.626 111.460 152.459 1.00 0.00 ? 297 G A "C4'"  1  
ATOM 9533   O "O4'"  . G A 1 297 ? 118.195 110.753 151.266 1.00 0.00 ? 297 G A "O4'"  1  
ATOM 9534   C "C3'"  . G A 1 297 ? 117.522 111.190 153.468 1.00 0.00 ? 297 G A "C3'"  1  
ATOM 9535   O "O3'"  . G A 1 297 ? 117.509 112.120 154.539 1.00 0.00 ? 297 G A "O3'"  1  
ATOM 9536   C "C2'"  . G A 1 297 ? 116.265 111.233 152.608 1.00 0.00 ? 297 G A "C2'"  1  
ATOM 9537   O "O2'"  . G A 1 297 ? 115.886 112.572 152.317 1.00 0.00 ? 297 G A "O2'"  1  
ATOM 9538   C "C1'"  . G A 1 297 ? 116.753 110.565 151.323 1.00 0.00 ? 297 G A "C1'"  1  
ATOM 9539   N N9     . G A 1 297 ? 116.398 109.134 151.271 1.00 0.00 ? 297 G A N9     1  
ATOM 9540   C C8     . G A 1 297 ? 117.245 108.060 151.424 1.00 0.00 ? 297 G A C8     1  
ATOM 9541   N N7     . G A 1 297 ? 116.636 106.910 151.326 1.00 0.00 ? 297 G A N7     1  
ATOM 9542   C C5     . G A 1 297 ? 115.309 107.241 151.096 1.00 0.00 ? 297 G A C5     1  
ATOM 9543   C C6     . G A 1 297 ? 114.173 106.412 150.907 1.00 0.00 ? 297 G A C6     1  
ATOM 9544   O O6     . G A 1 297 ? 114.115 105.177 150.904 1.00 0.00 ? 297 G A O6     1  
ATOM 9545   N N1     . G A 1 297 ? 113.018 107.161 150.704 1.00 0.00 ? 297 G A N1     1  
ATOM 9546   C C2     . G A 1 297 ? 112.963 108.534 150.685 1.00 0.00 ? 297 G A C2     1  
ATOM 9547   N N2     . G A 1 297 ? 111.755 109.076 150.472 1.00 0.00 ? 297 G A N2     1  
ATOM 9548   N N3     . G A 1 297 ? 114.013 109.319 150.859 1.00 0.00 ? 297 G A N3     1  
ATOM 9549   C C4     . G A 1 297 ? 115.145 108.610 151.058 1.00 0.00 ? 297 G A C4     1  
ATOM 9550   H "H5'"  . G A 1 297 ? 120.626 111.181 152.111 1.00 0.00 ? 297 G A "H5'"  1  
ATOM 9551   H "H5''" . G A 1 297 ? 120.301 111.509 153.638 1.00 0.00 ? 297 G A "H5''" 1  
ATOM 9552   H "H4'"  . G A 1 297 ? 118.650 112.421 152.265 1.00 0.00 ? 297 G A "H4'"  1  
ATOM 9553   H "H3'"  . G A 1 297 ? 117.631 110.285 153.830 1.00 0.00 ? 297 G A "H3'"  1  
ATOM 9554   H "H2'"  . G A 1 297 ? 115.531 110.730 153.019 1.00 0.00 ? 297 G A "H2'"  1  
ATOM 9555   H "HO2'" . G A 1 297 ? 116.301 113.171 152.971 1.00 0.00 ? 297 G A "HO2'" 1  
ATOM 9556   H "H1'"  . G A 1 297 ? 116.365 111.026 150.549 1.00 0.00 ? 297 G A "H1'"  1  
ATOM 9557   H H8     . G A 1 297 ? 118.205 108.151 151.589 1.00 0.00 ? 297 G A H8     1  
ATOM 9558   H H1     . G A 1 297 ? 112.183 106.669 150.562 1.00 0.00 ? 297 G A H1     1  
ATOM 9559   H H21    . G A 1 297 ? 110.972 108.503 150.342 1.00 0.00 ? 297 G A H21    1  
ATOM 9560   H H22    . G A 1 297 ? 111.654 110.052 150.448 1.00 0.00 ? 297 G A H22    1  
ATOM 9561   P P      . G A 1 298 ? 116.988 111.671 155.992 1.00 0.00 ? 298 G A P      1  
ATOM 9562   O OP1    . G A 1 298 ? 117.142 112.826 156.912 1.00 0.00 ? 298 G A OP1    1  
ATOM 9563   O OP2    . G A 1 298 ? 117.628 110.373 156.330 1.00 0.00 ? 298 G A OP2    1  
ATOM 9564   O "O5'"  . G A 1 298 ? 115.428 111.415 155.779 1.00 0.00 ? 298 G A "O5'"  1  
ATOM 9565   C "C5'"  . G A 1 298 ? 114.551 112.482 155.454 1.00 0.00 ? 298 G A "C5'"  1  
ATOM 9566   C "C4'"  . G A 1 298 ? 113.159 111.984 155.156 1.00 0.00 ? 298 G A "C4'"  1  
ATOM 9567   O "O4'"  . G A 1 298 ? 113.188 111.106 154.001 1.00 0.00 ? 298 G A "O4'"  1  
ATOM 9568   C "C3'"  . G A 1 298 ? 112.504 111.145 156.244 1.00 0.00 ? 298 G A "C3'"  1  
ATOM 9569   O "O3'"  . G A 1 298 ? 111.958 111.926 157.293 1.00 0.00 ? 298 G A "O3'"  1  
ATOM 9570   C "C2'"  . G A 1 298 ? 111.462 110.352 155.468 1.00 0.00 ? 298 G A "C2'"  1  
ATOM 9571   O "O2'"  . G A 1 298 ? 110.321 111.145 155.179 1.00 0.00 ? 298 G A "O2'"  1  
ATOM 9572   C "C1'"  . G A 1 298 ? 112.208 110.062 154.165 1.00 0.00 ? 298 G A "C1'"  1  
ATOM 9573   N N9     . G A 1 298 ? 112.847 108.732 154.176 1.00 0.00 ? 298 G A N9     1  
ATOM 9574   C C8     . G A 1 298 ? 114.187 108.455 154.306 1.00 0.00 ? 298 G A C8     1  
ATOM 9575   N N7     . G A 1 298 ? 114.453 107.177 154.277 1.00 0.00 ? 298 G A N7     1  
ATOM 9576   C C5     . G A 1 298 ? 113.214 106.573 154.118 1.00 0.00 ? 298 G A C5     1  
ATOM 9577   C C6     . G A 1 298 ? 112.866 105.199 154.023 1.00 0.00 ? 298 G A C6     1  
ATOM 9578   O O6     . G A 1 298 ? 113.609 104.214 154.058 1.00 0.00 ? 298 G A O6     1  
ATOM 9579   N N1     . G A 1 298 ? 111.494 105.030 153.867 1.00 0.00 ? 298 G A N1     1  
ATOM 9580   C C2     . G A 1 298 ? 110.572 106.047 153.814 1.00 0.00 ? 298 G A C2     1  
ATOM 9581   N N2     . G A 1 298 ? 109.292 105.683 153.661 1.00 0.00 ? 298 G A N2     1  
ATOM 9582   N N3     . G A 1 298 ? 110.884 107.331 153.903 1.00 0.00 ? 298 G A N3     1  
ATOM 9583   C C4     . G A 1 298 ? 112.213 107.518 154.054 1.00 0.00 ? 298 G A C4     1  
ATOM 9584   H "H5'"  . G A 1 298 ? 114.898 112.952 154.667 1.00 0.00 ? 298 G A "H5'"  1  
ATOM 9585   H "H5''" . G A 1 298 ? 114.515 113.105 156.208 1.00 0.00 ? 298 G A "H5''" 1  
ATOM 9586   H "H4'"  . G A 1 298 ? 112.584 112.751 154.958 1.00 0.00 ? 298 G A "H4'"  1  
ATOM 9587   H "H3'"  . G A 1 298 ? 113.167 110.526 156.614 1.00 0.00 ? 298 G A "H3'"  1  
ATOM 9588   H "H2'"  . G A 1 298 ? 111.219 109.523 155.934 1.00 0.00 ? 298 G A "H2'"  1  
ATOM 9589   H "HO2'" . G A 1 298 ? 110.298 111.907 155.794 1.00 0.00 ? 298 G A "HO2'" 1  
ATOM 9590   H "H1'"  . G A 1 298 ? 111.584 110.116 153.411 1.00 0.00 ? 298 G A "H1'"  1  
ATOM 9591   H H8     . G A 1 298 ? 114.875 109.145 154.409 1.00 0.00 ? 298 G A H8     1  
ATOM 9592   H H1     . G A 1 298 ? 111.159 104.110 153.792 1.00 0.00 ? 298 G A H1     1  
ATOM 9593   H H21    . G A 1 298 ? 109.052 104.736 153.593 1.00 0.00 ? 298 G A H21    1  
ATOM 9594   H H22    . G A 1 298 ? 108.590 106.368 153.617 1.00 0.00 ? 298 G A H22    1  
ATOM 9595   P P      . C A 1 299 ? 111.865 111.325 158.779 1.00 0.00 ? 299 C A P      1  
ATOM 9596   O OP1    . C A 1 299 ? 111.388 112.403 159.683 1.00 0.00 ? 299 C A OP1    1  
ATOM 9597   O OP2    . C A 1 299 ? 113.141 110.628 159.079 1.00 0.00 ? 299 C A OP2    1  
ATOM 9598   O "O5'"  . C A 1 299 ? 110.714 110.224 158.680 1.00 0.00 ? 299 C A "O5'"  1  
ATOM 9599   C "C5'"  . C A 1 299 ? 109.362 110.601 158.460 1.00 0.00 ? 299 C A "C5'"  1  
ATOM 9600   C "C4'"  . C A 1 299 ? 108.469 109.395 158.296 1.00 0.00 ? 299 C A "C4'"  1  
ATOM 9601   O "O4'"  . C A 1 299 ? 108.891 108.618 157.146 1.00 0.00 ? 299 C A "O4'"  1  
ATOM 9602   C "C3'"  . C A 1 299 ? 108.481 108.394 159.442 1.00 0.00 ? 299 C A "C3'"  1  
ATOM 9603   O "O3'"  . C A 1 299 ? 107.677 108.794 160.536 1.00 0.00 ? 299 C A "O3'"  1  
ATOM 9604   C "C2'"  . C A 1 299 ? 108.005 107.114 158.768 1.00 0.00 ? 299 C A "C2'"  1  
ATOM 9605   O "O2'"  . C A 1 299 ? 106.596 107.121 158.583 1.00 0.00 ? 299 C A "O2'"  1  
ATOM 9606   C "C1'"  . C A 1 299 ? 108.685 107.218 157.403 1.00 0.00 ? 299 C A "C1'"  1  
ATOM 9607   N N1     . C A 1 299 ? 109.970 106.474 157.356 1.00 0.00 ? 299 C A N1     1  
ATOM 9608   C C2     . C A 1 299 ? 109.928 105.082 157.211 1.00 0.00 ? 299 C A C2     1  
ATOM 9609   O O2     . C A 1 299 ? 108.828 104.514 157.130 1.00 0.00 ? 299 C A O2     1  
ATOM 9610   N N3     . C A 1 299 ? 111.084 104.381 157.165 1.00 0.00 ? 299 C A N3     1  
ATOM 9611   C C4     . C A 1 299 ? 112.253 105.017 157.253 1.00 0.00 ? 299 C A C4     1  
ATOM 9612   N N4     . C A 1 299 ? 113.371 104.284 157.203 1.00 0.00 ? 299 C A N4     1  
ATOM 9613   C C5     . C A 1 299 ? 112.330 106.430 157.401 1.00 0.00 ? 299 C A C5     1  
ATOM 9614   C C6     . C A 1 299 ? 111.179 107.113 157.445 1.00 0.00 ? 299 C A C6     1  
ATOM 9615   H "H5'"  . C A 1 299 ? 109.311 111.147 157.646 1.00 0.00 ? 299 C A "H5'"  1  
ATOM 9616   H "H5''" . C A 1 299 ? 109.049 111.129 159.222 1.00 0.00 ? 299 C A "H5''" 1  
ATOM 9617   H "H4'"  . C A 1 299 ? 107.549 109.702 158.153 1.00 0.00 ? 299 C A "H4'"  1  
ATOM 9618   H "H3'"  . C A 1 299 ? 109.404 108.269 159.749 1.00 0.00 ? 299 C A "H3'"  1  
ATOM 9619   H "H2'"  . C A 1 299 ? 108.302 106.318 159.258 1.00 0.00 ? 299 C A "H2'"  1  
ATOM 9620   H "HO2'" . C A 1 299 ? 106.198 107.775 159.196 1.00 0.00 ? 299 C A "HO2'" 1  
ATOM 9621   H "H1'"  . C A 1 299 ? 108.083 106.869 156.713 1.00 0.00 ? 299 C A "H1'"  1  
ATOM 9622   H H41    . C A 1 299 ? 113.314 103.312 157.103 1.00 0.00 ? 299 C A H41    1  
ATOM 9623   H H42    . C A 1 299 ? 114.244 104.719 157.267 1.00 0.00 ? 299 C A H42    1  
ATOM 9624   H H5     . C A 1 299 ? 113.194 106.888 157.466 1.00 0.00 ? 299 C A H5     1  
ATOM 9625   H H6     . C A 1 299 ? 111.211 108.086 157.546 1.00 0.00 ? 299 C A H6     1  
ATOM 9626   P P      . G A 1 300 ? 108.002 108.263 162.018 1.00 0.00 ? 300 G A P      1  
ATOM 9627   O OP1    . G A 1 300 ? 107.092 108.955 162.967 1.00 0.00 ? 300 G A OP1    1  
ATOM 9628   O OP2    . G A 1 300 ? 109.470 108.342 162.221 1.00 0.00 ? 300 G A OP2    1  
ATOM 9629   O "O5'"  . G A 1 300 ? 107.591 106.723 161.975 1.00 0.00 ? 300 G A "O5'"  1  
ATOM 9630   C "C5'"  . G A 1 300 ? 106.234 106.336 161.829 1.00 0.00 ? 300 G A "C5'"  1  
ATOM 9631   C "C4'"  . G A 1 300 ? 106.099 104.840 161.686 1.00 0.00 ? 300 G A "C4'"  1  
ATOM 9632   O "O4'"  . G A 1 300 ? 106.808 104.392 160.502 1.00 0.00 ? 300 G A "O4'"  1  
ATOM 9633   C "C3'"  . G A 1 300 ? 106.691 104.006 162.812 1.00 0.00 ? 300 G A "C3'"  1  
ATOM 9634   O "O3'"  . G A 1 300 ? 105.855 103.940 163.954 1.00 0.00 ? 300 G A "O3'"  1  
ATOM 9635   C "C2'"  . G A 1 300 ? 106.916 102.657 162.141 1.00 0.00 ? 300 G A "C2'"  1  
ATOM 9636   O "O2'"  . G A 1 300 ? 105.703 101.926 162.031 1.00 0.00 ? 300 G A "O2'"  1  
ATOM 9637   C "C1'"  . G A 1 300 ? 107.368 103.081 160.744 1.00 0.00 ? 300 G A "C1'"  1  
ATOM 9638   N N9     . G A 1 300 ? 108.838 103.095 160.615 1.00 0.00 ? 300 G A N9     1  
ATOM 9639   C C8     . G A 1 300 ? 109.659 104.195 160.583 1.00 0.00 ? 300 G A C8     1  
ATOM 9640   N N7     . G A 1 300 ? 110.924 103.889 160.459 1.00 0.00 ? 300 G A N7     1  
ATOM 9641   C C5     . G A 1 300 ? 110.935 102.503 160.405 1.00 0.00 ? 300 G A C5     1  
ATOM 9642   C C6     . G A 1 300 ? 112.022 101.598 160.276 1.00 0.00 ? 300 G A C6     1  
ATOM 9643   O O6     . G A 1 300 ? 113.228 101.851 160.178 1.00 0.00 ? 300 G A O6     1  
ATOM 9644   N N1     . G A 1 300 ? 111.587 100.274 160.264 1.00 0.00 ? 300 G A N1     1  
ATOM 9645   C C2     . G A 1 300 ? 110.278 99.874  160.366 1.00 0.00 ? 300 G A C2     1  
ATOM 9646   N N2     . G A 1 300 ? 110.056 98.551  160.335 1.00 0.00 ? 300 G A N2     1  
ATOM 9647   N N3     . G A 1 300 ? 109.258 100.706 160.487 1.00 0.00 ? 300 G A N3     1  
ATOM 9648   C C4     . G A 1 300 ? 109.656 101.996 160.501 1.00 0.00 ? 300 G A C4     1  
ATOM 9649   H "H5'"  . G A 1 300 ? 105.862 106.768 161.032 1.00 0.00 ? 300 G A "H5'"  1  
ATOM 9650   H "H5''" . G A 1 300 ? 105.730 106.629 162.616 1.00 0.00 ? 300 G A "H5''" 1  
ATOM 9651   H "H4'"  . G A 1 300 ? 105.148 104.615 161.591 1.00 0.00 ? 300 G A "H4'"  1  
ATOM 9652   H "H3'"  . G A 1 300 ? 107.558 104.384 163.069 1.00 0.00 ? 300 G A "H3'"  1  
ATOM 9653   H "H2'"  . G A 1 300 ? 107.610 102.138 162.599 1.00 0.00 ? 300 G A "H2'"  1  
ATOM 9654   H "HO2'" . G A 1 300 ? 105.056 102.285 162.676 1.00 0.00 ? 300 G A "HO2'" 1  
ATOM 9655   H "H1'"  . G A 1 300 ? 106.985 102.471 160.079 1.00 0.00 ? 300 G A "H1'"  1  
ATOM 9656   H H8     . G A 1 300 ? 109.333 105.116 160.646 1.00 0.00 ? 300 G A H8     1  
ATOM 9657   H H1     . G A 1 300 ? 112.273 99.577  160.178 1.00 0.00 ? 300 G A H1     1  
ATOM 9658   H H21    . G A 1 300 ? 110.807 97.928  160.246 1.00 0.00 ? 300 G A H21    1  
ATOM 9659   H H22    . G A 1 300 ? 109.140 98.206  160.405 1.00 0.00 ? 300 G A H22    1  
ATOM 9660   P P      . C A 1 301 ? 106.496 103.721 165.410 1.00 0.00 ? 301 C A P      1  
ATOM 9661   O OP1    . C A 1 301 ? 105.402 103.818 166.412 1.00 0.00 ? 301 C A OP1    1  
ATOM 9662   O OP2    . C A 1 301 ? 107.680 104.604 165.533 1.00 0.00 ? 301 C A OP2    1  
ATOM 9663   O "O5'"  . C A 1 301 ? 107.005 102.212 165.386 1.00 0.00 ? 301 C A "O5'"  1  
ATOM 9664   C "C5'"  . C A 1 301 ? 106.085 101.130 165.348 1.00 0.00 ? 301 C A "C5'"  1  
ATOM 9665   C "C4'"  . C A 1 301 ? 106.791 99.804  165.213 1.00 0.00 ? 301 C A "C4'"  1  
ATOM 9666   O "O4'"  . C A 1 301 ? 107.559 99.775  163.983 1.00 0.00 ? 301 C A "O4'"  1  
ATOM 9667   C "C3'"  . C A 1 301 ? 107.812 99.472  166.293 1.00 0.00 ? 301 C A "C3'"  1  
ATOM 9668   O "O3'"  . C A 1 301 ? 107.217 99.000  167.490 1.00 0.00 ? 301 C A "O3'"  1  
ATOM 9669   C "C2'"  . C A 1 301 ? 108.702 98.448  165.605 1.00 0.00 ? 301 C A "C2'"  1  
ATOM 9670   O "O2'"  . C A 1 301 ? 108.088 97.168  165.576 1.00 0.00 ? 301 C A "O2'"  1  
ATOM 9671   C "C1'"  . C A 1 301 ? 108.761 99.002  164.182 1.00 0.00 ? 301 C A "C1'"  1  
ATOM 9672   N N1     . C A 1 301 ? 109.969 99.835  163.951 1.00 0.00 ? 301 C A N1     1  
ATOM 9673   C C2     . C A 1 301 ? 111.188 99.188  163.721 1.00 0.00 ? 301 C A C2     1  
ATOM 9674   O O2     . C A 1 301 ? 111.225 97.948  163.718 1.00 0.00 ? 301 C A O2     1  
ATOM 9675   N N3     . C A 1 301 ? 112.304 99.921  163.507 1.00 0.00 ? 301 C A N3     1  
ATOM 9676   C C4     . C A 1 301 ? 112.238 101.253 163.517 1.00 0.00 ? 301 C A C4     1  
ATOM 9677   N N4     . C A 1 301 ? 113.364 101.939 163.302 1.00 0.00 ? 301 C A N4     1  
ATOM 9678   C C5     . C A 1 301 ? 111.013 101.942 163.747 1.00 0.00 ? 301 C A C5     1  
ATOM 9679   C C6     . C A 1 301 ? 109.916 101.204 163.955 1.00 0.00 ? 301 C A C6     1  
ATOM 9680   H "H5'"  . C A 1 301 ? 105.481 101.250 164.586 1.00 0.00 ? 301 C A "H5'"  1  
ATOM 9681   H "H5''" . C A 1 301 ? 105.559 101.129 166.177 1.00 0.00 ? 301 C A "H5''" 1  
ATOM 9682   H "H4'"  . C A 1 301 ? 106.118 99.089  165.183 1.00 0.00 ? 301 C A "H4'"  1  
ATOM 9683   H "H3'"  . C A 1 301 ? 108.341 100.273 166.491 1.00 0.00 ? 301 C A "H3'"  1  
ATOM 9684   H "H2'"  . C A 1 301 ? 109.594 98.413  166.014 1.00 0.00 ? 301 C A "H2'"  1  
ATOM 9685   H "HO2'" . C A 1 301 ? 107.392 97.132  166.262 1.00 0.00 ? 301 C A "HO2'" 1  
ATOM 9686   H "H1'"  . C A 1 301 ? 108.754 98.260  163.541 1.00 0.00 ? 301 C A "H1'"  1  
ATOM 9687   H H41    . C A 1 301 ? 114.204 101.460 163.144 1.00 0.00 ? 301 C A H41    1  
ATOM 9688   H H42    . C A 1 301 ? 113.348 102.919 163.300 1.00 0.00 ? 301 C A H42    1  
ATOM 9689   H H5     . C A 1 301 ? 110.975 102.921 163.749 1.00 0.00 ? 301 C A H5     1  
ATOM 9690   H H6     . C A 1 301 ? 109.064 101.658 164.116 1.00 0.00 ? 301 C A H6     1  
ATOM 9691   P P      . G A 1 302 ? 107.980 99.173  168.894 1.00 0.00 ? 302 G A P      1  
ATOM 9692   O OP1    . G A 1 302 ? 107.071 98.710  169.974 1.00 0.00 ? 302 G A OP1    1  
ATOM 9693   O OP2    . G A 1 302 ? 108.538 100.549 168.946 1.00 0.00 ? 302 G A OP2    1  
ATOM 9694   O "O5'"  . G A 1 302 ? 109.199 98.152  168.802 1.00 0.00 ? 302 G A "O5'"  1  
ATOM 9695   C "C5'"  . G A 1 302 ? 108.973 96.751  168.772 1.00 0.00 ? 302 G A "C5'"  1  
ATOM 9696   C "C4'"  . G A 1 302 ? 110.254 95.989  168.532 1.00 0.00 ? 302 G A "C4'"  1  
ATOM 9697   O "O4'"  . G A 1 302 ? 110.821 96.370  167.253 1.00 0.00 ? 302 G A "O4'"  1  
ATOM 9698   C "C3'"  . G A 1 302 ? 111.376 96.241  169.528 1.00 0.00 ? 302 G A "C3'"  1  
ATOM 9699   O "O3'"  . G A 1 302 ? 111.213 95.531  170.742 1.00 0.00 ? 302 G A "O3'"  1  
ATOM 9700   C "C2'"  . G A 1 302 ? 112.615 95.832  168.741 1.00 0.00 ? 302 G A "C2'"  1  
ATOM 9701   O "O2'"  . G A 1 302 ? 112.757 94.419  168.705 1.00 0.00 ? 302 G A "O2'"  1  
ATOM 9702   C "C1'"  . G A 1 302 ? 112.262 96.331  167.339 1.00 0.00 ? 302 G A "C1'"  1  
ATOM 9703   N N9     . G A 1 302 ? 112.856 97.651  167.055 1.00 0.00 ? 302 G A N9     1  
ATOM 9704   C C8     . G A 1 302 ? 112.209 98.863  167.023 1.00 0.00 ? 302 G A C8     1  
ATOM 9705   N N7     . G A 1 302 ? 113.002 99.861  166.743 1.00 0.00 ? 302 G A N7     1  
ATOM 9706   C C5     . G A 1 302 ? 114.247 99.275  166.578 1.00 0.00 ? 302 G A C5     1  
ATOM 9707   C C6     . G A 1 302 ? 115.504 99.856  166.264 1.00 0.00 ? 302 G A C6     1  
ATOM 9708   O O6     . G A 1 302 ? 115.772 101.045 166.059 1.00 0.00 ? 302 G A O6     1  
ATOM 9709   N N1     . G A 1 302 ? 116.508 98.897  166.195 1.00 0.00 ? 302 G A N1     1  
ATOM 9710   C C2     . G A 1 302 ? 116.331 97.551  166.402 1.00 0.00 ? 302 G A C2     1  
ATOM 9711   N N2     . G A 1 302 ? 117.423 96.781  166.292 1.00 0.00 ? 302 G A N2     1  
ATOM 9712   N N3     . G A 1 302 ? 115.167 96.997  166.696 1.00 0.00 ? 302 G A N3     1  
ATOM 9713   C C4     . G A 1 302 ? 114.176 97.911  166.769 1.00 0.00 ? 302 G A C4     1  
ATOM 9714   H "H5'"  . G A 1 302 ? 108.339 96.543  168.055 1.00 0.00 ? 302 G A "H5'"  1  
ATOM 9715   H "H5''" . G A 1 302 ? 108.590 96.468  169.630 1.00 0.00 ? 302 G A "H5''" 1  
ATOM 9716   H "H4'"  . G A 1 302 ? 110.054 95.028  168.519 1.00 0.00 ? 302 G A "H4'"  1  
ATOM 9717   H "H3'"  . G A 1 302 ? 111.423 97.203  169.721 1.00 0.00 ? 302 G A "H3'"  1  
ATOM 9718   H "H2'"  . G A 1 302 ? 113.421 96.270  169.086 1.00 0.00 ? 302 G A "H2'"  1  
ATOM 9719   H "HO2'" . G A 1 302 ? 112.427 94.086  167.844 1.00 0.00 ? 302 G A "HO2'" 1  
ATOM 9720   H "H1'"  . G A 1 302 ? 112.578 95.684  166.674 1.00 0.00 ? 302 G A "H1'"  1  
ATOM 9721   H H8     . G A 1 302 ? 111.249 98.969  167.194 1.00 0.00 ? 302 G A H8     1  
ATOM 9722   H H1     . G A 1 302 ? 117.415 99.208  165.982 1.00 0.00 ? 302 G A H1     1  
ATOM 9723   H H21    . G A 1 302 ? 118.289 97.184  166.074 1.00 0.00 ? 302 G A H21    1  
ATOM 9724   H H22    . G A 1 302 ? 117.356 95.813  166.430 1.00 0.00 ? 302 G A H22    1  
ATOM 9725   P P      . U A 1 303 ? 110.489 94.098  170.734 1.00 0.00 ? 303 U A P      1  
ATOM 9726   O OP1    . U A 1 303 ? 109.398 94.113  169.725 1.00 0.00 ? 303 U A OP1    1  
ATOM 9727   O OP2    . U A 1 303 ? 110.160 93.893  172.167 1.00 0.00 ? 303 U A OP2    1  
ATOM 9728   O "O5'"  . U A 1 303 ? 111.542 92.983  170.304 1.00 0.00 ? 303 U A "O5'"  1  
ATOM 9729   C "C5'"  . U A 1 303 ? 111.206 91.604  170.355 1.00 0.00 ? 303 U A "C5'"  1  
ATOM 9730   C "C4'"  . U A 1 303 ? 112.222 90.757  169.629 1.00 0.00 ? 303 U A "C4'"  1  
ATOM 9731   O "O4'"  . U A 1 303 ? 112.414 91.251  168.280 1.00 0.00 ? 303 U A "O4'"  1  
ATOM 9732   C "C3'"  . U A 1 303 ? 113.637 90.782  170.186 1.00 0.00 ? 303 U A "C3'"  1  
ATOM 9733   O "O3'"  . U A 1 303 ? 113.771 90.051  171.391 1.00 0.00 ? 303 U A "O3'"  1  
ATOM 9734   C "C2'"  . U A 1 303 ? 114.386 90.126  169.031 1.00 0.00 ? 303 U A "C2'"  1  
ATOM 9735   O "O2'"  . U A 1 303 ? 114.180 88.721  169.016 1.00 0.00 ? 303 U A "O2'"  1  
ATOM 9736   C "C1'"  . U A 1 303 ? 113.671 90.757  167.839 1.00 0.00 ? 303 U A "C1'"  1  
ATOM 9737   N N1     . U A 1 303 ? 114.484 91.814  167.190 1.00 0.00 ? 303 U A N1     1  
ATOM 9738   C C2     . U A 1 303 ? 114.723 91.683  165.835 1.00 0.00 ? 303 U A C2     1  
ATOM 9739   O O2     . U A 1 303 ? 114.299 90.753  165.171 1.00 0.00 ? 303 U A O2     1  
ATOM 9740   N N3     . U A 1 303 ? 115.478 92.685  165.277 1.00 0.00 ? 303 U A N3     1  
ATOM 9741   C C4     . U A 1 303 ? 116.011 93.782  165.920 1.00 0.00 ? 303 U A C4     1  
ATOM 9742   O O4     . U A 1 303 ? 116.672 94.598  165.277 1.00 0.00 ? 303 U A O4     1  
ATOM 9743   C C5     . U A 1 303 ? 115.723 93.851  167.321 1.00 0.00 ? 303 U A C5     1  
ATOM 9744   C C6     . U A 1 303 ? 114.988 92.890  167.889 1.00 0.00 ? 303 U A C6     1  
ATOM 9745   H "H5'"  . U A 1 303 ? 110.327 91.474  169.940 1.00 0.00 ? 303 U A "H5'"  1  
ATOM 9746   H "H5''" . U A 1 303 ? 111.163 91.319  171.291 1.00 0.00 ? 303 U A "H5''" 1  
ATOM 9747   H "H4'"  . U A 1 303 ? 111.911 89.828  169.598 1.00 0.00 ? 303 U A "H4'"  1  
ATOM 9748   H "H3'"  . U A 1 303 ? 113.971 91.693  170.324 1.00 0.00 ? 303 U A "H3'"  1  
ATOM 9749   H "H2'"  . U A 1 303 ? 115.339 90.352  169.046 1.00 0.00 ? 303 U A "H2'"  1  
ATOM 9750   H "HO2'" . U A 1 303 ? 114.682 88.332  168.269 1.00 0.00 ? 303 U A "HO2'" 1  
ATOM 9751   H "H1'"  . U A 1 303 ? 113.462 90.059  167.182 1.00 0.00 ? 303 U A "H1'"  1  
ATOM 9752   H H3     . U A 1 303 ? 115.660 92.611  164.317 1.00 0.00 ? 303 U A H3     1  
ATOM 9753   H H5     . U A 1 303 ? 116.061 94.598  167.857 1.00 0.00 ? 303 U A H5     1  
ATOM 9754   H H6     . U A 1 303 ? 114.806 92.960  168.849 1.00 0.00 ? 303 U A H6     1  
ATOM 9755   P P      . G A 1 304 ? 114.967 90.384  172.412 1.00 0.00 ? 304 G A P      1  
ATOM 9756   O OP1    . G A 1 304 ? 115.542 89.098  172.883 1.00 0.00 ? 304 G A OP1    1  
ATOM 9757   O OP2    . G A 1 304 ? 114.466 91.371  173.401 1.00 0.00 ? 304 G A OP2    1  
ATOM 9758   O "O5'"  . G A 1 304 ? 116.058 91.107  171.504 1.00 0.00 ? 304 G A "O5'"  1  
ATOM 9759   C "C5'"  . G A 1 304 ? 116.690 92.302  171.941 1.00 0.00 ? 304 G A "C5'"  1  
ATOM 9760   C "C4'"  . G A 1 304 ? 118.089 92.424  171.388 1.00 0.00 ? 304 G A "C4'"  1  
ATOM 9761   O "O4'"  . G A 1 304 ? 118.055 93.137  170.124 1.00 0.00 ? 304 G A "O4'"  1  
ATOM 9762   C "C3'"  . G A 1 304 ? 119.075 93.214  172.235 1.00 0.00 ? 304 G A "C3'"  1  
ATOM 9763   O "O3'"  . G A 1 304 ? 119.609 92.462  173.312 1.00 0.00 ? 304 G A "O3'"  1  
ATOM 9764   C "C2'"  . G A 1 304 ? 120.120 93.643  171.215 1.00 0.00 ? 304 G A "C2'"  1  
ATOM 9765   O "O2'"  . G A 1 304 ? 121.009 92.577  170.907 1.00 0.00 ? 304 G A "O2'"  1  
ATOM 9766   C "C1'"  . G A 1 304 ? 119.250 93.932  169.990 1.00 0.00 ? 304 G A "C1'"  1  
ATOM 9767   N N9     . G A 1 304 ? 118.905 95.361  169.878 1.00 0.00 ? 304 G A N9     1  
ATOM 9768   C C8     . G A 1 304 ? 117.682 95.942  170.112 1.00 0.00 ? 304 G A C8     1  
ATOM 9769   N N7     . G A 1 304 ? 117.684 97.234  169.929 1.00 0.00 ? 304 G A N7     1  
ATOM 9770   C C5     . G A 1 304 ? 118.986 97.526  169.552 1.00 0.00 ? 304 G A C5     1  
ATOM 9771   C C6     . G A 1 304 ? 119.594 98.766  169.221 1.00 0.00 ? 304 G A C6     1  
ATOM 9772   O O6     . G A 1 304 ? 119.081 99.891  169.193 1.00 0.00 ? 304 G A O6     1  
ATOM 9773   N N1     . G A 1 304 ? 120.937 98.609  168.891 1.00 0.00 ? 304 G A N1     1  
ATOM 9774   C C2     . G A 1 304 ? 121.611 97.412  168.886 1.00 0.00 ? 304 G A C2     1  
ATOM 9775   N N2     . G A 1 304 ? 122.906 97.462  168.542 1.00 0.00 ? 304 G A N2     1  
ATOM 9776   N N3     . G A 1 304 ? 121.058 96.249  169.192 1.00 0.00 ? 304 G A N3     1  
ATOM 9777   C C4     . G A 1 304 ? 119.753 96.379  169.514 1.00 0.00 ? 304 G A C4     1  
ATOM 9778   H "H5'"  . G A 1 304 ? 116.735 92.304  172.920 1.00 0.00 ? 304 G A "H5'"  1  
ATOM 9779   H "H5''" . G A 1 304 ? 116.162 93.074  171.644 1.00 0.00 ? 304 G A "H5''" 1  
ATOM 9780   H "H4'"  . G A 1 304 ? 118.450 91.525  171.236 1.00 0.00 ? 304 G A "H4'"  1  
ATOM 9781   H "H3'"  . G A 1 304 ? 118.628 94.012  172.588 1.00 0.00 ? 304 G A "H3'"  1  
ATOM 9782   H "H2'"  . G A 1 304 ? 120.602 94.445  171.509 1.00 0.00 ? 304 G A "H2'"  1  
ATOM 9783   H "HO2'" . G A 1 304 ? 120.971 91.916  171.627 1.00 0.00 ? 304 G A "HO2'" 1  
ATOM 9784   H "H1'"  . G A 1 304 ? 119.721 93.646  169.180 1.00 0.00 ? 304 G A "H1'"  1  
ATOM 9785   H H8     . G A 1 304 ? 116.888 95.437  170.390 1.00 0.00 ? 304 G A H8     1  
ATOM 9786   H H1     . G A 1 304 ? 121.438 99.412  168.648 1.00 0.00 ? 304 G A H1     1  
ATOM 9787   H H21    . G A 1 304 ? 123.324 98.318  168.316 1.00 0.00 ? 304 G A H21    1  
ATOM 9788   H H22    . G A 1 304 ? 123.438 96.639  168.521 1.00 0.00 ? 304 G A H22    1  
ATOM 9789   P P      . A A 1 305 ? 119.997 93.194  174.691 1.00 0.00 ? 305 A A P      1  
ATOM 9790   O OP1    . A A 1 305 ? 120.478 92.159  175.639 1.00 0.00 ? 305 A A OP1    1  
ATOM 9791   O OP2    . A A 1 305 ? 118.869 94.076  175.077 1.00 0.00 ? 305 A A OP2    1  
ATOM 9792   O "O5'"  . A A 1 305 ? 121.234 94.119  174.300 1.00 0.00 ? 305 A A "O5'"  1  
ATOM 9793   C "C5'"  . A A 1 305 ? 122.503 93.553  173.997 1.00 0.00 ? 305 A A "C5'"  1  
ATOM 9794   C "C4'"  . A A 1 305 ? 123.500 94.609  173.597 1.00 0.00 ? 305 A A "C4'"  1  
ATOM 9795   O "O4'"  . A A 1 305 ? 123.052 95.270  172.383 1.00 0.00 ? 305 A A "O4'"  1  
ATOM 9796   C "C3'"  . A A 1 305 ? 123.703 95.746  174.586 1.00 0.00 ? 305 A A "C3'"  1  
ATOM 9797   O "O3'"  . A A 1 305 ? 124.564 95.399  175.657 1.00 0.00 ? 305 A A "O3'"  1  
ATOM 9798   C "C2'"  . A A 1 305 ? 124.245 96.860  173.703 1.00 0.00 ? 305 A A "C2'"  1  
ATOM 9799   O "O2'"  . A A 1 305 ? 125.621 96.663  173.411 1.00 0.00 ? 305 A A "O2'"  1  
ATOM 9800   C "C1'"  . A A 1 305 ? 123.432 96.657  172.423 1.00 0.00 ? 305 A A "C1'"  1  
ATOM 9801   N N9     . A A 1 305 ? 122.247 97.536  172.375 1.00 0.00 ? 305 A A N9     1  
ATOM 9802   C C8     . A A 1 305 ? 120.933 97.192  172.577 1.00 0.00 ? 305 A A C8     1  
ATOM 9803   N N7     . A A 1 305 ? 120.099 98.196  172.467 1.00 0.00 ? 305 A A N7     1  
ATOM 9804   C C5     . A A 1 305 ? 120.918 99.278  172.175 1.00 0.00 ? 305 A A C5     1  
ATOM 9805   C C6     . A A 1 305 ? 120.645 100.637 171.939 1.00 0.00 ? 305 A A C6     1  
ATOM 9806   N N6     . A A 1 305 ? 119.418 101.159 171.963 1.00 0.00 ? 305 A A N6     1  
ATOM 9807   N N1     . A A 1 305 ? 121.689 101.451 171.674 1.00 0.00 ? 305 A A N1     1  
ATOM 9808   C C2     . A A 1 305 ? 122.921 100.925 171.649 1.00 0.00 ? 305 A A C2     1  
ATOM 9809   N N3     . A A 1 305 ? 123.305 99.668  171.854 1.00 0.00 ? 305 A A N3     1  
ATOM 9810   C C4     . A A 1 305 ? 122.243 98.883  172.113 1.00 0.00 ? 305 A A C4     1  
ATOM 9811   H "H5'"  . A A 1 305 ? 122.399 92.911  173.263 1.00 0.00 ? 305 A A "H5'"  1  
ATOM 9812   H "H5''" . A A 1 305 ? 122.837 93.080  174.789 1.00 0.00 ? 305 A A "H5''" 1  
ATOM 9813   H "H4'"  . A A 1 305 ? 124.363 94.180  173.424 1.00 0.00 ? 305 A A "H4'"  1  
ATOM 9814   H "H3'"  . A A 1 305 ? 122.832 96.018  174.946 1.00 0.00 ? 305 A A "H3'"  1  
ATOM 9815   H "H2'"  . A A 1 305 ? 124.082 97.742  174.095 1.00 0.00 ? 305 A A "H2'"  1  
ATOM 9816   H "HO2'" . A A 1 305 ? 126.007 96.055  174.074 1.00 0.00 ? 305 A A "HO2'" 1  
ATOM 9817   H "H1'"  . A A 1 305 ? 124.000 96.836  171.645 1.00 0.00 ? 305 A A "H1'"  1  
ATOM 9818   H H8     . A A 1 305 ? 120.645 96.276  172.783 1.00 0.00 ? 305 A A H8     1  
ATOM 9819   H H61    . A A 1 305 ? 119.288 102.116 171.791 1.00 0.00 ? 305 A A H61    1  
ATOM 9820   H H62    . A A 1 305 ? 118.644 100.588 172.154 1.00 0.00 ? 305 A A H62    1  
ATOM 9821   H H2     . A A 1 305 ? 123.644 101.561 171.452 1.00 0.00 ? 305 A A H2     1  
ATOM 9822   P P      . C A 1 306 ? 124.178 95.797  177.165 1.00 0.00 ? 306 C A P      1  
ATOM 9823   O OP1    . C A 1 306 ? 125.166 95.165  178.075 1.00 0.00 ? 306 C A OP1    1  
ATOM 9824   O OP2    . C A 1 306 ? 122.730 95.530  177.356 1.00 0.00 ? 306 C A OP2    1  
ATOM 9825   O "O5'"  . C A 1 306 ? 124.400 97.374  177.217 1.00 0.00 ? 306 C A "O5'"  1  
ATOM 9826   C "C5'"  . C A 1 306 ? 125.695 97.934  177.067 1.00 0.00 ? 306 C A "C5'"  1  
ATOM 9827   C "C4'"  . C A 1 306 ? 125.632 99.408  176.750 1.00 0.00 ? 306 C A "C4'"  1  
ATOM 9828   O "O4'"  . C A 1 306 ? 124.942 99.616  175.492 1.00 0.00 ? 306 C A "O4'"  1  
ATOM 9829   C "C3'"  . C A 1 306 ? 124.889 100.278 177.751 1.00 0.00 ? 306 C A "C3'"  1  
ATOM 9830   O "O3'"  . C A 1 306 ? 125.695 100.671 178.848 1.00 0.00 ? 306 C A "O3'"  1  
ATOM 9831   C "C2'"  . C A 1 306 ? 124.472 101.467 176.904 1.00 0.00 ? 306 C A "C2'"  1  
ATOM 9832   O "O2'"  . C A 1 306 ? 125.554 102.366 176.712 1.00 0.00 ? 306 C A "O2'"  1  
ATOM 9833   C "C1'"  . C A 1 306 ? 124.142 100.793 175.569 1.00 0.00 ? 306 C A "C1'"  1  
ATOM 9834   N N1     . C A 1 306 ? 122.710 100.417 175.467 1.00 0.00 ? 306 C A N1     1  
ATOM 9835   C C2     . C A 1 306 ? 121.796 101.389 175.043 1.00 0.00 ? 306 C A C2     1  
ATOM 9836   O O2     . C A 1 306 ? 122.206 102.528 174.769 1.00 0.00 ? 306 C A O2     1  
ATOM 9837   N N3     . C A 1 306 ? 120.485 101.072 174.941 1.00 0.00 ? 306 C A N3     1  
ATOM 9838   C C4     . C A 1 306 ? 120.070 99.842  175.242 1.00 0.00 ? 306 C A C4     1  
ATOM 9839   N N4     . C A 1 306 ? 118.766 99.574  175.127 1.00 0.00 ? 306 C A N4     1  
ATOM 9840   C C5     . C A 1 306 ? 120.973 98.831  175.676 1.00 0.00 ? 306 C A C5     1  
ATOM 9841   C C6     . C A 1 306 ? 122.268 99.156  175.772 1.00 0.00 ? 306 C A C6     1  
ATOM 9842   H "H5'"  . C A 1 306 ? 126.161 97.470  176.340 1.00 0.00 ? 306 C A "H5'"  1  
ATOM 9843   H "H5''" . C A 1 306 ? 126.196 97.807  177.899 1.00 0.00 ? 306 C A "H5''" 1  
ATOM 9844   H "H4'"  . C A 1 306 ? 126.546 99.752  176.669 1.00 0.00 ? 306 C A "H4'"  1  
ATOM 9845   H "H3'"  . C A 1 306 ? 124.087 99.805  178.057 1.00 0.00 ? 306 C A "H3'"  1  
ATOM 9846   H "H2'"  . C A 1 306 ? 123.689 101.919 177.281 1.00 0.00 ? 306 C A "H2'"  1  
ATOM 9847   H "HO2'" . C A 1 306 ? 126.225 102.213 177.409 1.00 0.00 ? 306 C A "HO2'" 1  
ATOM 9848   H "H1'"  . C A 1 306 ? 124.373 101.400 174.836 1.00 0.00 ? 306 C A "H1'"  1  
ATOM 9849   H H41    . C A 1 306 ? 118.147 100.273 174.828 1.00 0.00 ? 306 C A H41    1  
ATOM 9850   H H42    . C A 1 306 ? 118.430 98.680  175.340 1.00 0.00 ? 306 C A H42    1  
ATOM 9851   H H5     . C A 1 306 ? 120.658 97.929  175.895 1.00 0.00 ? 306 C A H5     1  
ATOM 9852   H H6     . C A 1 306 ? 122.905 98.475  176.069 1.00 0.00 ? 306 C A H6     1  
ATOM 9853   P P      . A A 1 307 ? 125.044 100.854 180.306 1.00 0.00 ? 307 A A P      1  
ATOM 9854   O OP1    . A A 1 307 ? 126.135 101.168 181.262 1.00 0.00 ? 307 A A OP1    1  
ATOM 9855   O OP2    . A A 1 307 ? 124.155 99.693  180.562 1.00 0.00 ? 307 A A OP2    1  
ATOM 9856   O "O5'"  . A A 1 307 ? 124.129 102.151 180.159 1.00 0.00 ? 307 A A "O5'"  1  
ATOM 9857   C "C5'"  . A A 1 307 ? 124.709 103.436 179.987 1.00 0.00 ? 307 A A "C5'"  1  
ATOM 9858   C "C4'"  . A A 1 307 ? 123.669 104.471 179.638 1.00 0.00 ? 307 A A "C4'"  1  
ATOM 9859   O "O4'"  . A A 1 307 ? 123.035 104.155 178.377 1.00 0.00 ? 307 A A "O4'"  1  
ATOM 9860   C "C3'"  . A A 1 307 ? 122.498 104.590 180.602 1.00 0.00 ? 307 A A "C3'"  1  
ATOM 9861   O "O3'"  . A A 1 307 ? 122.823 105.300 181.785 1.00 0.00 ? 307 A A "O3'"  1  
ATOM 9862   C "C2'"  . A A 1 307 ? 121.449 105.287 179.749 1.00 0.00 ? 307 A A "C2'"  1  
ATOM 9863   O "O2'"  . A A 1 307 ? 121.710 106.679 179.648 1.00 0.00 ? 307 A A "O2'"  1  
ATOM 9864   C "C1'"  . A A 1 307 ? 121.692 104.633 178.391 1.00 0.00 ? 307 A A "C1'"  1  
ATOM 9865   N N9     . A A 1 307 ? 120.761 103.516 178.137 1.00 0.00 ? 307 A A N9     1  
ATOM 9866   C C8     . A A 1 307 ? 121.005 102.170 178.260 1.00 0.00 ? 307 A A C8     1  
ATOM 9867   N N7     . A A 1 307 ? 119.974 101.418 177.963 1.00 0.00 ? 307 A A N7     1  
ATOM 9868   C C5     . A A 1 307 ? 118.984 102.329 177.620 1.00 0.00 ? 307 A A C5     1  
ATOM 9869   C C6     . A A 1 307 ? 117.650 102.167 177.206 1.00 0.00 ? 307 A A C6     1  
ATOM 9870   N N6     . A A 1 307 ? 117.059 100.979 177.062 1.00 0.00 ? 307 A A N6     1  
ATOM 9871   N N1     . A A 1 307 ? 116.935 103.281 176.942 1.00 0.00 ? 307 A A N1     1  
ATOM 9872   C C2     . A A 1 307 ? 117.527 104.473 177.087 1.00 0.00 ? 307 A A C2     1  
ATOM 9873   N N3     . A A 1 307 ? 118.771 104.753 177.469 1.00 0.00 ? 307 A A N3     1  
ATOM 9874   C C4     . A A 1 307 ? 119.456 103.624 177.724 1.00 0.00 ? 307 A A C4     1  
ATOM 9875   H "H5'"  . A A 1 307 ? 125.372 103.394 179.266 1.00 0.00 ? 307 A A "H5'"  1  
ATOM 9876   H "H5''" . A A 1 307 ? 125.157 103.699 180.817 1.00 0.00 ? 307 A A "H5''" 1  
ATOM 9877   H "H4'"  . A A 1 307 ? 124.106 105.344 179.557 1.00 0.00 ? 307 A A "H4'"  1  
ATOM 9878   H "H3'"  . A A 1 307 ? 122.180 103.693 180.835 1.00 0.00 ? 307 A A "H3'"  1  
ATOM 9879   H "H2'"  . A A 1 307 ? 120.543 105.109 180.078 1.00 0.00 ? 307 A A "H2'"  1  
ATOM 9880   H "HO2'" . A A 1 307 ? 122.238 106.962 180.423 1.00 0.00 ? 307 A A "HO2'" 1  
ATOM 9881   H "H1'"  . A A 1 307 ? 121.595 105.305 177.684 1.00 0.00 ? 307 A A "H1'"  1  
ATOM 9882   H H8     . A A 1 307 ? 121.869 101.806 178.545 1.00 0.00 ? 307 A A H8     1  
ATOM 9883   H H61    . A A 1 307 ? 116.125 100.929 176.769 1.00 0.00 ? 307 A A H61    1  
ATOM 9884   H H62    . A A 1 307 ? 117.559 100.156 177.247 1.00 0.00 ? 307 A A H62    1  
ATOM 9885   H H2     . A A 1 307 ? 116.964 105.250 176.884 1.00 0.00 ? 307 A A H2     1  
ATOM 9886   P P      . G A 1 308 ? 122.406 104.711 183.221 1.00 0.00 ? 308 G A P      1  
ATOM 9887   O OP1    . G A 1 308 ? 122.429 105.827 184.201 1.00 0.00 ? 308 G A OP1    1  
ATOM 9888   O OP2    . G A 1 308 ? 123.220 103.495 183.473 1.00 0.00 ? 308 G A OP2    1  
ATOM 9889   O "O5'"  . G A 1 308 ? 120.890 104.258 183.027 1.00 0.00 ? 308 G A "O5'"  1  
ATOM 9890   C "C5'"  . G A 1 308 ? 119.870 105.213 182.778 1.00 0.00 ? 308 G A "C5'"  1  
ATOM 9891   C "C4'"  . G A 1 308 ? 118.620 104.562 182.240 1.00 0.00 ? 308 G A "C4'"  1  
ATOM 9892   O "O4'"  . G A 1 308 ? 118.919 103.794 181.041 1.00 0.00 ? 308 G A "O4'"  1  
ATOM 9893   C "C3'"  . G A 1 308 ? 117.949 103.549 183.155 1.00 0.00 ? 308 G A "C3'"  1  
ATOM 9894   O "O3'"  . G A 1 308 ? 117.146 104.153 184.155 1.00 0.00 ? 308 G A "O3'"  1  
ATOM 9895   C "C2'"  . G A 1 308 ? 117.137 102.714 182.167 1.00 0.00 ? 308 G A "C2'"  1  
ATOM 9896   O "O2'"  . G A 1 308 ? 115.941 103.380 181.790 1.00 0.00 ? 308 G A "O2'"  1  
ATOM 9897   C "C1'"  . G A 1 308 ? 118.076 102.662 180.959 1.00 0.00 ? 308 G A "C1'"  1  
ATOM 9898   N N9     . G A 1 308 ? 118.921 101.453 180.963 1.00 0.00 ? 308 G A N9     1  
ATOM 9899   C C8     . G A 1 308 ? 120.195 101.330 181.463 1.00 0.00 ? 308 G A C8     1  
ATOM 9900   N N7     . G A 1 308 ? 120.689 100.130 181.321 1.00 0.00 ? 308 G A N7     1  
ATOM 9901   C C5     . G A 1 308 ? 119.680 99.416  180.691 1.00 0.00 ? 308 G A C5     1  
ATOM 9902   C C6     . G A 1 308 ? 119.634 98.059  180.279 1.00 0.00 ? 308 G A C6     1  
ATOM 9903   O O6     . G A 1 308 ? 120.505 97.189  180.392 1.00 0.00 ? 308 G A O6     1  
ATOM 9904   N N1     . G A 1 308 ? 118.418 97.747  179.677 1.00 0.00 ? 308 G A N1     1  
ATOM 9905   C C2     . G A 1 308 ? 117.379 98.627  179.496 1.00 0.00 ? 308 G A C2     1  
ATOM 9906   N N2     . G A 1 308 ? 116.284 98.140  178.895 1.00 0.00 ? 308 G A N2     1  
ATOM 9907   N N3     . G A 1 308 ? 117.410 99.894  179.876 1.00 0.00 ? 308 G A N3     1  
ATOM 9908   C C4     . G A 1 308 ? 118.581 100.217 180.463 1.00 0.00 ? 308 G A C4     1  
ATOM 9909   H "H5'"  . G A 1 308 ? 120.196 105.867 182.125 1.00 0.00 ? 308 G A "H5'"  1  
ATOM 9910   H "H5''" . G A 1 308 ? 119.655 105.677 183.614 1.00 0.00 ? 308 G A "H5''" 1  
ATOM 9911   H "H4'"  . G A 1 308 ? 117.973 105.261 182.008 1.00 0.00 ? 308 G A "H4'"  1  
ATOM 9912   H "H3'"  . G A 1 308 ? 118.635 102.985 183.568 1.00 0.00 ? 308 G A "H3'"  1  
ATOM 9913   H "H2'"  . G A 1 308 ? 116.957 101.816 182.518 1.00 0.00 ? 308 G A "H2'"  1  
ATOM 9914   H "HO2'" . G A 1 308 ? 115.450 102.819 181.154 1.00 0.00 ? 308 G A "HO2'" 1  
ATOM 9915   H "H1'"  . G A 1 308 ? 117.548 102.688 180.134 1.00 0.00 ? 308 G A "H1'"  1  
ATOM 9916   H H8     . G A 1 308 ? 120.684 102.068 181.882 1.00 0.00 ? 308 G A H8     1  
ATOM 9917   H H1     . G A 1 308 ? 118.296 96.828  179.360 1.00 0.00 ? 308 G A H1     1  
ATOM 9918   H H21    . G A 1 308 ? 116.253 97.203  178.611 1.00 0.00 ? 308 G A H21    1  
ATOM 9919   H H22    . G A 1 308 ? 115.510 98.722  178.739 1.00 0.00 ? 308 G A H22    1  
ATOM 9920   P P      . A A 1 309 ? 117.091 103.514 185.621 1.00 0.00 ? 309 A A P      1  
ATOM 9921   O OP1    . A A 1 309 ? 116.998 104.605 186.623 1.00 0.00 ? 309 A A OP1    1  
ATOM 9922   O OP2    . A A 1 309 ? 118.269 102.610 185.627 1.00 0.00 ? 309 A A OP2    1  
ATOM 9923   O "O5'"  . A A 1 309 ? 115.781 102.615 185.747 1.00 0.00 ? 309 A A "O5'"  1  
ATOM 9924   C "C5'"  . A A 1 309 ? 114.789 102.627 184.732 1.00 0.00 ? 309 A A "C5'"  1  
ATOM 9925   C "C4'"  . A A 1 309 ? 113.687 103.607 185.045 1.00 0.00 ? 309 A A "C4'"  1  
ATOM 9926   O "O4'"  . A A 1 309 ? 114.181 104.636 185.938 1.00 0.00 ? 309 A A "O4'"  1  
ATOM 9927   C "C3'"  . A A 1 309 ? 113.119 104.374 183.860 1.00 0.00 ? 309 A A "C3'"  1  
ATOM 9928   O "O3'"  . A A 1 309 ? 112.191 103.617 183.103 1.00 0.00 ? 309 A A "O3'"  1  
ATOM 9929   C "C2'"  . A A 1 309 ? 112.528 105.613 184.519 1.00 0.00 ? 309 A A "C2'"  1  
ATOM 9930   O "O2'"  . A A 1 309 ? 111.256 105.337 185.086 1.00 0.00 ? 309 A A "O2'"  1  
ATOM 9931   C "C1'"  . A A 1 309 ? 113.532 105.861 185.645 1.00 0.00 ? 309 A A "C1'"  1  
ATOM 9932   N N9     . A A 1 309 ? 114.540 106.874 185.277 1.00 0.00 ? 309 A A N9     1  
ATOM 9933   C C8     . A A 1 309 ? 115.902 106.719 185.196 1.00 0.00 ? 309 A A C8     1  
ATOM 9934   N N7     . A A 1 309 ? 116.537 107.809 184.841 1.00 0.00 ? 309 A A N7     1  
ATOM 9935   C C5     . A A 1 309 ? 115.526 108.746 184.678 1.00 0.00 ? 309 A A C5     1  
ATOM 9936   C C6     . A A 1 309 ? 115.543 110.103 184.309 1.00 0.00 ? 309 A A C6     1  
ATOM 9937   N N6     . A A 1 309 ? 116.658 110.778 184.023 1.00 0.00 ? 309 A A N6     1  
ATOM 9938   N N1     . A A 1 309 ? 114.359 110.750 184.240 1.00 0.00 ? 309 A A N1     1  
ATOM 9939   C C2     . A A 1 309 ? 113.240 110.072 184.526 1.00 0.00 ? 309 A A C2     1  
ATOM 9940   N N3     . A A 1 309 ? 113.097 108.798 184.886 1.00 0.00 ? 309 A A N3     1  
ATOM 9941   C C4     . A A 1 309 ? 114.291 108.183 184.943 1.00 0.00 ? 309 A A C4     1  
ATOM 9942   H "H5'"  . A A 1 309 ? 114.404 101.729 184.650 1.00 0.00 ? 309 A A "H5'"  1  
ATOM 9943   H "H5''" . A A 1 309 ? 115.205 102.874 183.880 1.00 0.00 ? 309 A A "H5''" 1  
ATOM 9944   H "H4'"  . A A 1 309 ? 112.957 103.126 185.490 1.00 0.00 ? 309 A A "H4'"  1  
ATOM 9945   H "H3'"  . A A 1 309 ? 113.859 104.650 183.279 1.00 0.00 ? 309 A A "H3'"  1  
ATOM 9946   H "H2'"  . A A 1 309 ? 112.493 106.369 183.896 1.00 0.00 ? 309 A A "H2'"  1  
ATOM 9947   H "HO2'" . A A 1 309 ? 110.908 106.154 185.500 1.00 0.00 ? 309 A A "HO2'" 1  
ATOM 9948   H "H1'"  . A A 1 309 ? 113.054 106.153 186.449 1.00 0.00 ? 309 A A "H1'"  1  
ATOM 9949   H H8     . A A 1 309 ? 116.357 105.871 185.384 1.00 0.00 ? 309 A A H8     1  
ATOM 9950   H H61    . A A 1 309 ? 116.606 111.724 183.771 1.00 0.00 ? 309 A A H61    1  
ATOM 9951   H H62    . A A 1 309 ? 117.528 110.330 184.066 1.00 0.00 ? 309 A A H62    1  
ATOM 9952   H H2     . A A 1 309 ? 112.408 110.587 184.462 1.00 0.00 ? 309 A A H2     1  
ATOM 9953   P P      . C A 1 310 ? 112.345 103.515 181.507 1.00 0.00 ? 310 C A P      1  
ATOM 9954   O OP1    . C A 1 310 ? 111.171 102.773 180.979 1.00 0.00 ? 310 C A OP1    1  
ATOM 9955   O OP2    . C A 1 310 ? 113.715 103.029 181.206 1.00 0.00 ? 310 C A OP2    1  
ATOM 9956   O "O5'"  . C A 1 310 ? 112.236 105.024 181.010 1.00 0.00 ? 310 C A "O5'"  1  
ATOM 9957   C "C5'"  . C A 1 310 ? 111.024 105.751 181.144 1.00 0.00 ? 310 C A "C5'"  1  
ATOM 9958   C "C4'"  . C A 1 310 ? 111.208 107.210 180.805 1.00 0.00 ? 310 C A "C4'"  1  
ATOM 9959   O "O4'"  . C A 1 310 ? 112.094 107.868 181.758 1.00 0.00 ? 310 C A "O4'"  1  
ATOM 9960   C "C3'"  . C A 1 310 ? 111.867 107.509 179.467 1.00 0.00 ? 310 C A "C3'"  1  
ATOM 9961   O "O3'"  . C A 1 310 ? 110.978 107.375 178.372 1.00 0.00 ? 310 C A "O3'"  1  
ATOM 9962   C "C2'"  . C A 1 310 ? 112.165 108.999 179.685 1.00 0.00 ? 310 C A "C2'"  1  
ATOM 9963   O "O2'"  . C A 1 310 ? 110.972 109.770 179.666 1.00 0.00 ? 310 C A "O2'"  1  
ATOM 9964   C "C1'"  . C A 1 310 ? 112.724 108.933 181.109 1.00 0.00 ? 310 C A "C1'"  1  
ATOM 9965   N N1     . C A 1 310 ? 114.192 108.721 181.128 1.00 0.00 ? 310 C A N1     1  
ATOM 9966   C C2     . C A 1 310 ? 115.027 109.826 180.923 1.00 0.00 ? 310 C A C2     1  
ATOM 9967   O O2     . C A 1 310 ? 114.519 110.942 180.731 1.00 0.00 ? 310 C A O2     1  
ATOM 9968   N N3     . C A 1 310 ? 116.369 109.660 180.936 1.00 0.00 ? 310 C A N3     1  
ATOM 9969   C C4     . C A 1 310 ? 116.890 108.451 181.143 1.00 0.00 ? 310 C A C4     1  
ATOM 9970   N N4     . C A 1 310 ? 118.221 108.334 181.148 1.00 0.00 ? 310 C A N4     1  
ATOM 9971   C C5     . C A 1 310 ? 116.070 107.307 181.355 1.00 0.00 ? 310 C A C5     1  
ATOM 9972   C C6     . C A 1 310 ? 114.743 107.484 181.341 1.00 0.00 ? 310 C A C6     1  
ATOM 9973   H "H5'"  . C A 1 310 ? 110.707 105.675 182.069 1.00 0.00 ? 310 C A "H5'"  1  
ATOM 9974   H "H5''" . C A 1 310 ? 110.353 105.366 180.543 1.00 0.00 ? 310 C A "H5''" 1  
ATOM 9975   H "H4'"  . C A 1 310 ? 110.329 107.641 180.829 1.00 0.00 ? 310 C A "H4'"  1  
ATOM 9976   H "H3'"  . C A 1 310 ? 112.685 107.002 179.281 1.00 0.00 ? 310 C A "H3'"  1  
ATOM 9977   H "H2'"  . C A 1 310 ? 112.821 109.331 179.039 1.00 0.00 ? 310 C A "H2'"  1  
ATOM 9978   H "HO2'" . C A 1 310 ? 110.295 109.299 179.138 1.00 0.00 ? 310 C A "HO2'" 1  
ATOM 9979   H "H1'"  . C A 1 310 ? 112.508 109.766 181.578 1.00 0.00 ? 310 C A "H1'"  1  
ATOM 9980   H H41    . C A 1 310 ? 118.783 109.124 181.001 1.00 0.00 ? 310 C A H41    1  
ATOM 9981   H H42    . C A 1 310 ? 118.634 107.459 181.298 1.00 0.00 ? 310 C A H42    1  
ATOM 9982   H H5     . C A 1 310 ? 116.462 106.422 181.507 1.00 0.00 ? 310 C A H5     1  
ATOM 9983   H H6     . C A 1 310 ? 114.161 106.710 181.484 1.00 0.00 ? 310 C A H6     1  
ATOM 9984   P P      . A A 1 311 ? 111.541 106.986 176.917 1.00 0.00 ? 311 A A P      1  
ATOM 9985   O OP1    . A A 1 311 ? 110.385 106.852 175.996 1.00 0.00 ? 311 A A OP1    1  
ATOM 9986   O OP2    . A A 1 311 ? 112.487 105.852 177.078 1.00 0.00 ? 311 A A OP2    1  
ATOM 9987   O "O5'"  . A A 1 311 ? 112.380 108.266 176.474 1.00 0.00 ? 311 A A "O5'"  1  
ATOM 9988   C "C5'"  . A A 1 311 ? 111.751 109.529 176.312 1.00 0.00 ? 311 A A "C5'"  1  
ATOM 9989   C "C4'"  . A A 1 311 ? 112.763 110.643 176.210 1.00 0.00 ? 311 A A "C4'"  1  
ATOM 9990   O "O4'"  . A A 1 311 ? 113.624 110.656 177.388 1.00 0.00 ? 311 A A "O4'"  1  
ATOM 9991   C "C3'"  . A A 1 311 ? 113.744 110.549 175.052 1.00 0.00 ? 311 A A "C3'"  1  
ATOM 9992   O "O3'"  . A A 1 311 ? 113.195 110.989 173.822 1.00 0.00 ? 311 A A "O3'"  1  
ATOM 9993   C "C2'"  . A A 1 311 ? 114.895 111.408 175.546 1.00 0.00 ? 311 A A "C2'"  1  
ATOM 9994   O "O2'"  . A A 1 311 ? 114.592 112.791 175.430 1.00 0.00 ? 311 A A "O2'"  1  
ATOM 9995   C "C1'"  . A A 1 311 ? 114.922 111.017 177.024 1.00 0.00 ? 311 A A "C1'"  1  
ATOM 9996   N N9     . A A 1 311 ? 115.833 109.886 177.283 1.00 0.00 ? 311 A A N9     1  
ATOM 9997   C C8     . A A 1 311 ? 115.508 108.565 177.469 1.00 0.00 ? 311 A A C8     1  
ATOM 9998   N N7     . A A 1 311 ? 116.543 107.790 177.681 1.00 0.00 ? 311 A A N7     1  
ATOM 9999   C C5     . A A 1 311 ? 117.625 108.659 177.631 1.00 0.00 ? 311 A A C5     1  
ATOM 10000  C C6     . A A 1 311 ? 119.008 108.458 177.780 1.00 0.00 ? 311 A A C6     1  
ATOM 10001  N N6     . A A 1 311 ? 119.562 107.267 178.019 1.00 0.00 ? 311 A A N6     1  
ATOM 10002  N N1     . A A 1 311 ? 119.815 109.536 177.673 1.00 0.00 ? 311 A A N1     1  
ATOM 10003  C C2     . A A 1 311 ? 119.260 110.731 177.434 1.00 0.00 ? 311 A A C2     1  
ATOM 10004  N N3     . A A 1 311 ? 117.977 111.046 177.275 1.00 0.00 ? 311 A A N3     1  
ATOM 10005  C C4     . A A 1 311 ? 117.202 109.952 177.386 1.00 0.00 ? 311 A A C4     1  
ATOM 10006  H "H5'"  . A A 1 311 ? 111.168 109.697 177.082 1.00 0.00 ? 311 A A "H5'"  1  
ATOM 10007  H "H5''" . A A 1 311 ? 111.208 109.514 175.497 1.00 0.00 ? 311 A A "H5''" 1  
ATOM 10008  H "H4'"  . A A 1 311 ? 112.284 111.496 176.152 1.00 0.00 ? 311 A A "H4'"  1  
ATOM 10009  H "H3'"  . A A 1 311 ? 114.055 109.624 174.952 1.00 0.00 ? 311 A A "H3'"  1  
ATOM 10010  H "H2'"  . A A 1 311 ? 115.734 111.181 175.093 1.00 0.00 ? 311 A A "H2'"  1  
ATOM 10011  H "HO2'" . A A 1 311 ? 115.354 113.312 175.758 1.00 0.00 ? 311 A A "HO2'" 1  
ATOM 10012  H "H1'"  . A A 1 311 ? 115.200 111.789 177.561 1.00 0.00 ? 311 A A "H1'"  1  
ATOM 10013  H H8     . A A 1 311 ? 114.586 108.232 177.446 1.00 0.00 ? 311 A A H8     1  
ATOM 10014  H H61    . A A 1 311 ? 120.535 107.189 178.114 1.00 0.00 ? 311 A A H61    1  
ATOM 10015  H H62    . A A 1 311 ? 118.997 106.471 178.101 1.00 0.00 ? 311 A A H62    1  
ATOM 10016  H H2     . A A 1 311 ? 119.889 111.480 177.365 1.00 0.00 ? 311 A A H2     1  
ATOM 10017  P P      . A A 1 312 ? 113.856 110.529 172.431 1.00 0.00 ? 312 A A P      1  
ATOM 10018  O OP1    . A A 1 312 ? 113.063 111.125 171.326 1.00 0.00 ? 312 A A OP1    1  
ATOM 10019  O OP2    . A A 1 312 ? 114.057 109.059 172.481 1.00 0.00 ? 312 A A OP2    1  
ATOM 10020  O "O5'"  . A A 1 312 ? 115.290 111.223 172.439 1.00 0.00 ? 312 A A "O5'"  1  
ATOM 10021  C "C5'"  . A A 1 312 ? 116.332 110.751 171.597 1.00 0.00 ? 312 A A "C5'"  1  
ATOM 10022  C "C4'"  . A A 1 312 ? 117.671 110.805 172.290 1.00 0.00 ? 312 A A "C4'"  1  
ATOM 10023  O "O4'"  . A A 1 312 ? 117.570 110.139 173.577 1.00 0.00 ? 312 A A "O4'"  1  
ATOM 10024  C "C3'"  . A A 1 312 ? 118.818 110.103 171.580 1.00 0.00 ? 312 A A "C3'"  1  
ATOM 10025  O "O3'"  . A A 1 312 ? 119.459 110.922 170.617 1.00 0.00 ? 312 A A "O3'"  1  
ATOM 10026  C "C2'"  . A A 1 312 ? 119.764 109.877 172.753 1.00 0.00 ? 312 A A "C2'"  1  
ATOM 10027  O "O2'"  . A A 1 312 ? 120.434 111.076 173.113 1.00 0.00 ? 312 A A "O2'"  1  
ATOM 10028  C "C1'"  . A A 1 312 ? 118.776 109.504 173.855 1.00 0.00 ? 312 A A "C1'"  1  
ATOM 10029  N N9     . A A 1 312 ? 118.531 108.050 173.914 1.00 0.00 ? 312 A A N9     1  
ATOM 10030  C C8     . A A 1 312 ? 117.350 107.383 173.698 1.00 0.00 ? 312 A A C8     1  
ATOM 10031  N N7     . A A 1 312 ? 117.447 106.083 173.823 1.00 0.00 ? 312 A A N7     1  
ATOM 10032  C C5     . A A 1 312 ? 118.783 105.878 174.143 1.00 0.00 ? 312 A A C5     1  
ATOM 10033  C C6     . A A 1 312 ? 119.526 104.713 174.405 1.00 0.00 ? 312 A A C6     1  
ATOM 10034  N N6     . A A 1 312 ? 119.007 103.483 174.383 1.00 0.00 ? 312 A A N6     1  
ATOM 10035  N N1     . A A 1 312 ? 120.837 104.856 174.692 1.00 0.00 ? 312 A A N1     1  
ATOM 10036  C C2     . A A 1 312 ? 121.359 106.089 174.713 1.00 0.00 ? 312 A A C2     1  
ATOM 10037  N N3     . A A 1 312 ? 120.764 107.258 174.485 1.00 0.00 ? 312 A A N3     1  
ATOM 10038  C C4     . A A 1 312 ? 119.461 107.081 174.202 1.00 0.00 ? 312 A A C4     1  
ATOM 10039  H "H5'"  . A A 1 312 ? 116.368 111.306 170.790 1.00 0.00 ? 312 A A "H5'"  1  
ATOM 10040  H "H5''" . A A 1 312 ? 116.142 109.826 171.340 1.00 0.00 ? 312 A A "H5''" 1  
ATOM 10041  H "H4'"  . A A 1 312 ? 117.917 111.742 172.440 1.00 0.00 ? 312 A A "H4'"  1  
ATOM 10042  H "H3'"  . A A 1 312 ? 118.561 109.255 171.159 1.00 0.00 ? 312 A A "H3'"  1  
ATOM 10043  H "H2'"  . A A 1 312 ? 120.394 109.149 172.570 1.00 0.00 ? 312 A A "H2'"  1  
ATOM 10044  H "HO2'" . A A 1 312 ? 121.039 110.891 173.861 1.00 0.00 ? 312 A A "HO2'" 1  
ATOM 10045  H "H1'"  . A A 1 312 ? 119.121 109.812 174.720 1.00 0.00 ? 312 A A "H1'"  1  
ATOM 10046  H H8     . A A 1 312 ? 116.512 107.838 173.471 1.00 0.00 ? 312 A A H8     1  
ATOM 10047  H H61    . A A 1 312 ? 119.575 102.708 174.575 1.00 0.00 ? 312 A A H61    1  
ATOM 10048  H H62    . A A 1 312 ? 118.057 103.355 174.178 1.00 0.00 ? 312 A A H62    1  
ATOM 10049  H H2     . A A 1 312 ? 122.315 106.138 174.927 1.00 0.00 ? 312 A A H2     1  
ATOM 10050  P P      . U A 1 313 ? 119.460 110.498 169.067 1.00 0.00 ? 313 U A P      1  
ATOM 10051  O OP1    . U A 1 313 ? 119.615 111.730 168.253 1.00 0.00 ? 313 U A OP1    1  
ATOM 10052  O OP2    . U A 1 313 ? 118.296 109.606 168.835 1.00 0.00 ? 313 U A OP2    1  
ATOM 10053  O "O5'"  . U A 1 313 ? 120.787 109.630 168.906 1.00 0.00 ? 313 U A "O5'"  1  
ATOM 10054  C "C5'"  . U A 1 313 ? 122.068 110.241 168.948 1.00 0.00 ? 313 U A "C5'"  1  
ATOM 10055  C "C4'"  . U A 1 313 ? 123.165 109.225 169.145 1.00 0.00 ? 313 U A "C4'"  1  
ATOM 10056  O "O4'"  . U A 1 313 ? 123.009 108.574 170.434 1.00 0.00 ? 313 U A "O4'"  1  
ATOM 10057  C "C3'"  . U A 1 313 ? 123.199 108.073 168.153 1.00 0.00 ? 313 U A "C3'"  1  
ATOM 10058  O "O3'"  . U A 1 313 ? 123.841 108.413 166.934 1.00 0.00 ? 313 U A "O3'"  1  
ATOM 10059  C "C2'"  . U A 1 313 ? 123.913 106.980 168.934 1.00 0.00 ? 313 U A "C2'"  1  
ATOM 10060  O "O2'"  . U A 1 313 ? 125.317 107.195 168.959 1.00 0.00 ? 313 U A "O2'"  1  
ATOM 10061  C "C1'"  . U A 1 313 ? 123.350 107.196 170.341 1.00 0.00 ? 313 U A "C1'"  1  
ATOM 10062  N N1     . U A 1 313 ? 122.161 106.353 170.608 1.00 0.00 ? 313 U A N1     1  
ATOM 10063  C C2     . U A 1 313 ? 122.388 105.022 170.908 1.00 0.00 ? 313 U A C2     1  
ATOM 10064  O O2     . U A 1 313 ? 123.502 104.532 170.963 1.00 0.00 ? 313 U A O2     1  
ATOM 10065  N N3     . U A 1 313 ? 121.257 104.280 171.150 1.00 0.00 ? 313 U A N3     1  
ATOM 10066  C C4     . U A 1 313 ? 119.951 104.719 171.119 1.00 0.00 ? 313 U A C4     1  
ATOM 10067  O O4     . U A 1 313 ? 119.040 103.925 171.359 1.00 0.00 ? 313 U A O4     1  
ATOM 10068  C C5     . U A 1 313 ? 119.794 106.105 170.800 1.00 0.00 ? 313 U A C5     1  
ATOM 10069  C C6     . U A 1 313 ? 120.876 106.852 170.562 1.00 0.00 ? 313 U A C6     1  
ATOM 10070  H "H5'"  . U A 1 313 ? 122.090 110.885 169.686 1.00 0.00 ? 313 U A "H5'"  1  
ATOM 10071  H "H5''" . U A 1 313 ? 122.222 110.717 168.105 1.00 0.00 ? 313 U A "H5''" 1  
ATOM 10072  H "H4'"  . U A 1 313 ? 124.028 109.688 169.124 1.00 0.00 ? 313 U A "H4'"  1  
ATOM 10073  H "H3'"  . U A 1 313 ? 122.282 107.785 167.960 1.00 0.00 ? 313 U A "H3'"  1  
ATOM 10074  H "H2'"  . U A 1 313 ? 123.689 106.088 168.593 1.00 0.00 ? 313 U A "H2'"  1  
ATOM 10075  H "HO2'" . U A 1 313 ? 125.559 107.796 168.225 1.00 0.00 ? 313 U A "HO2'" 1  
ATOM 10076  H "H1'"  . U A 1 313 ? 124.044 106.994 171.004 1.00 0.00 ? 313 U A "H1'"  1  
ATOM 10077  H H3     . U A 1 313 ? 121.394 103.334 171.364 1.00 0.00 ? 313 U A H3     1  
ATOM 10078  H H5     . U A 1 313 ? 118.898 106.504 170.756 1.00 0.00 ? 313 U A H5     1  
ATOM 10079  H H6     . U A 1 313 ? 120.744 107.797 170.345 1.00 0.00 ? 313 U A H6     1  
ATOM 10080  P P      . U A 1 314 ? 123.363 107.743 165.554 1.00 0.00 ? 314 U A P      1  
ATOM 10081  O OP1    . U A 1 314 ? 124.145 108.355 164.450 1.00 0.00 ? 314 U A OP1    1  
ATOM 10082  O OP2    . U A 1 314 ? 121.880 107.786 165.513 1.00 0.00 ? 314 U A OP2    1  
ATOM 10083  O "O5'"  . U A 1 314 ? 123.808 106.220 165.688 1.00 0.00 ? 314 U A "O5'"  1  
ATOM 10084  C "C5'"  . U A 1 314 ? 125.181 105.868 165.776 1.00 0.00 ? 314 U A "C5'"  1  
ATOM 10085  C "C4'"  . U A 1 314 ? 125.361 104.429 166.195 1.00 0.00 ? 314 U A "C4'"  1  
ATOM 10086  O "O4'"  . U A 1 314 ? 124.753 104.214 167.496 1.00 0.00 ? 314 U A "O4'"  1  
ATOM 10087  C "C3'"  . U A 1 314 ? 124.711 103.383 165.303 1.00 0.00 ? 314 U A "C3'"  1  
ATOM 10088  O "O3'"  . U A 1 314 ? 125.494 103.054 164.170 1.00 0.00 ? 314 U A "O3'"  1  
ATOM 10089  C "C2'"  . U A 1 314 ? 124.499 102.217 166.259 1.00 0.00 ? 314 U A "C2'"  1  
ATOM 10090  O "O2'"  . U A 1 314 ? 125.706 101.497 166.467 1.00 0.00 ? 314 U A "O2'"  1  
ATOM 10091  C "C1'"  . U A 1 314 ? 124.127 102.943 167.552 1.00 0.00 ? 314 U A "C1'"  1  
ATOM 10092  N N1     . U A 1 314 ? 122.660 103.088 167.711 1.00 0.00 ? 314 U A N1     1  
ATOM 10093  C C2     . U A 1 314 ? 121.959 101.970 168.131 1.00 0.00 ? 314 U A C2     1  
ATOM 10094  O O2     . U A 1 314 ? 122.491 100.902 168.366 1.00 0.00 ? 314 U A O2     1  
ATOM 10095  N N3     . U A 1 314 ? 120.603 102.150 168.268 1.00 0.00 ? 314 U A N3     1  
ATOM 10096  C C4     . U A 1 314 ? 119.889 103.307 168.033 1.00 0.00 ? 314 U A C4     1  
ATOM 10097  O O4     . U A 1 314 ? 118.669 103.309 168.201 1.00 0.00 ? 314 U A O4     1  
ATOM 10098  C C5     . U A 1 314 ? 120.681 104.420 167.601 1.00 0.00 ? 314 U A C5     1  
ATOM 10099  C C6     . U A 1 314 ? 122.001 104.274 167.462 1.00 0.00 ? 314 U A C6     1  
ATOM 10100  H "H5'"  . U A 1 314 ? 125.620 106.448 166.432 1.00 0.00 ? 314 U A "H5'"  1  
ATOM 10101  H "H5''" . U A 1 314 ? 125.602 105.998 164.900 1.00 0.00 ? 314 U A "H5''" 1  
ATOM 10102  H "H4'"  . U A 1 314 ? 126.321 104.238 166.257 1.00 0.00 ? 314 U A "H4'"  1  
ATOM 10103  H "H3'"  . U A 1 314 ? 123.836 103.715 165.004 1.00 0.00 ? 314 U A "H3'"  1  
ATOM 10104  H "H2'"  . U A 1 314 ? 123.775 101.631 165.956 1.00 0.00 ? 314 U A "H2'"  1  
ATOM 10105  H "HO2'" . U A 1 314 ? 126.325 101.690 165.734 1.00 0.00 ? 314 U A "HO2'" 1  
ATOM 10106  H "H1'"  . U A 1 314 ? 124.488 102.453 168.318 1.00 0.00 ? 314 U A "H1'"  1  
ATOM 10107  H H3     . U A 1 314 ? 120.089 101.372 168.561 1.00 0.00 ? 314 U A H3     1  
ATOM 10108  H H5     . U A 1 314 ? 120.255 105.283 167.413 1.00 0.00 ? 314 U A H5     1  
ATOM 10109  H H6     . U A 1 314 ? 122.519 105.051 167.166 1.00 0.00 ? 314 U A H6     1  
ATOM 10110  P P      . C A 1 315 ? 124.777 102.641 162.801 1.00 0.00 ? 315 C A P      1  
ATOM 10111  O OP1    . C A 1 315 ? 125.836 102.674 161.765 1.00 0.00 ? 315 C A OP1    1  
ATOM 10112  O OP2    . C A 1 315 ? 123.595 103.531 162.673 1.00 0.00 ? 315 C A OP2    1  
ATOM 10113  O "O5'"  . C A 1 315 ? 124.251 101.141 162.921 1.00 0.00 ? 315 C A "O5'"  1  
ATOM 10114  C "C5'"  . C A 1 315 ? 125.157 100.063 163.104 1.00 0.00 ? 315 C A "C5'"  1  
ATOM 10115  C "C4'"  . C A 1 315 ? 124.451 98.814  163.573 1.00 0.00 ? 315 C A "C4'"  1  
ATOM 10116  O "O4'"  . C A 1 315 ? 123.818 99.056  164.856 1.00 0.00 ? 315 C A "O4'"  1  
ATOM 10117  C "C3'"  . C A 1 315 ? 123.322 98.309  162.690 1.00 0.00 ? 315 C A "C3'"  1  
ATOM 10118  O "O3'"  . C A 1 315 ? 123.777 97.539  161.590 1.00 0.00 ? 315 C A "O3'"  1  
ATOM 10119  C "C2'"  . C A 1 315 ? 122.457 97.528  163.668 1.00 0.00 ? 315 C A "C2'"  1  
ATOM 10120  O "O2'"  . C A 1 315 ? 123.020 96.254  163.946 1.00 0.00 ? 315 C A "O2'"  1  
ATOM 10121  C "C1'"  . C A 1 315 ? 122.555 98.397  164.924 1.00 0.00 ? 315 C A "C1'"  1  
ATOM 10122  N N1     . C A 1 315 ? 121.459 99.395  165.002 1.00 0.00 ? 315 C A N1     1  
ATOM 10123  C C2     . C A 1 315 ? 120.195 98.964  165.425 1.00 0.00 ? 315 C A C2     1  
ATOM 10124  O O2     . C A 1 315 ? 120.030 97.769  165.717 1.00 0.00 ? 315 C A O2     1  
ATOM 10125  N N3     . C A 1 315 ? 119.180 99.854  165.505 1.00 0.00 ? 315 C A N3     1  
ATOM 10126  C C4     . C A 1 315 ? 119.384 101.130 165.184 1.00 0.00 ? 315 C A C4     1  
ATOM 10127  N N4     . C A 1 315 ? 118.352 101.974 165.278 1.00 0.00 ? 315 C A N4     1  
ATOM 10128  C C5     . C A 1 315 ? 120.656 101.602 164.750 1.00 0.00 ? 315 C A C5     1  
ATOM 10129  C C6     . C A 1 315 ? 121.653 100.713 164.675 1.00 0.00 ? 315 C A C6     1  
ATOM 10130  H "H5'"  . C A 1 315 ? 125.828 100.319 163.769 1.00 0.00 ? 315 C A "H5'"  1  
ATOM 10131  H "H5''" . C A 1 315 ? 125.607 99.876  162.252 1.00 0.00 ? 315 C A "H5''" 1  
ATOM 10132  H "H4'"  . C A 1 315 ? 125.116 98.100  163.676 1.00 0.00 ? 315 C A "H4'"  1  
ATOM 10133  H "H3'"  . C A 1 315 ? 122.811 99.077  162.353 1.00 0.00 ? 315 C A "H3'"  1  
ATOM 10134  H "H2'"  . C A 1 315 ? 121.532 97.454  163.353 1.00 0.00 ? 315 C A "H2'"  1  
ATOM 10135  H "HO2'" . C A 1 315 ? 123.649 96.019  163.231 1.00 0.00 ? 315 C A "HO2'" 1  
ATOM 10136  H "H1'"  . C A 1 315 ? 122.529 97.825  165.718 1.00 0.00 ? 315 C A "H1'"  1  
ATOM 10137  H H41    . C A 1 315 ? 117.477 101.647 165.578 1.00 0.00 ? 315 C A H41    1  
ATOM 10138  H H42    . C A 1 315 ? 118.468 102.919 165.052 1.00 0.00 ? 315 C A H42    1  
ATOM 10139  H H5     . C A 1 315 ? 120.796 102.541 164.517 1.00 0.00 ? 315 C A H5     1  
ATOM 10140  H H6     . C A 1 315 ? 122.534 101.017 164.380 1.00 0.00 ? 315 C A H6     1  
ATOM 10141  P P      . G A 1 316 ? 122.953 97.532  160.209 1.00 0.00 ? 316 G A P      1  
ATOM 10142  O OP1    . G A 1 316 ? 123.786 96.860  159.181 1.00 0.00 ? 316 G A OP1    1  
ATOM 10143  O OP2    . G A 1 316 ? 122.455 98.910  159.968 1.00 0.00 ? 316 G A OP2    1  
ATOM 10144  O "O5'"  . G A 1 316 ? 121.700 96.598  160.515 1.00 0.00 ? 316 G A "O5'"  1  
ATOM 10145  C "C5'"  . G A 1 316 ? 121.862 95.207  160.735 1.00 0.00 ? 316 G A "C5'"  1  
ATOM 10146  C "C4'"  . G A 1 316 ? 120.572 94.560  161.174 1.00 0.00 ? 316 G A "C4'"  1  
ATOM 10147  O "O4'"  . G A 1 316 ? 120.117 95.163  162.414 1.00 0.00 ? 316 G A "O4'"  1  
ATOM 10148  C "C3'"  . G A 1 316 ? 119.392 94.717  160.228 1.00 0.00 ? 316 G A "C3'"  1  
ATOM 10149  O "O3'"  . G A 1 316 ? 119.413 93.790  159.156 1.00 0.00 ? 316 G A "O3'"  1  
ATOM 10150  C "C2'"  . G A 1 316 ? 118.198 94.548  161.158 1.00 0.00 ? 316 G A "C2'"  1  
ATOM 10151  O "O2'"  . G A 1 316 ? 117.973 93.180  161.465 1.00 0.00 ? 316 G A "O2'"  1  
ATOM 10152  C "C1'"  . G A 1 316 ? 118.685 95.267  162.418 1.00 0.00 ? 316 G A "C1'"  1  
ATOM 10153  N N9     . G A 1 316 ? 118.266 96.679  162.448 1.00 0.00 ? 316 G A N9     1  
ATOM 10154  C C8     . G A 1 316 ? 119.053 97.786  162.244 1.00 0.00 ? 316 G A C8     1  
ATOM 10155  N N7     . G A 1 316 ? 118.395 98.910  162.337 1.00 0.00 ? 316 G A N7     1  
ATOM 10156  C C5     . G A 1 316 ? 117.094 98.523  162.618 1.00 0.00 ? 316 G A C5     1  
ATOM 10157  C C6     . G A 1 316 ? 115.927 99.303  162.827 1.00 0.00 ? 316 G A C6     1  
ATOM 10158  O O6     . G A 1 316 ? 115.810 100.533 162.804 1.00 0.00 ? 316 G A O6     1  
ATOM 10159  N N1     . G A 1 316 ? 114.816 98.505  163.086 1.00 0.00 ? 316 G A N1     1  
ATOM 10160  C C2     . G A 1 316 ? 114.826 97.132  163.135 1.00 0.00 ? 316 G A C2     1  
ATOM 10161  N N2     . G A 1 316 ? 113.654 96.538  163.399 1.00 0.00 ? 316 G A N2     1  
ATOM 10162  N N3     . G A 1 316 ? 115.906 96.393  162.943 1.00 0.00 ? 316 G A N3     1  
ATOM 10163  C C4     . G A 1 316 ? 116.995 97.148  162.691 1.00 0.00 ? 316 G A C4     1  
ATOM 10164  H "H5'"  . G A 1 316 ? 122.540 95.071  161.429 1.00 0.00 ? 316 G A "H5'"  1  
ATOM 10165  H "H5''" . G A 1 316 ? 122.166 94.784  159.903 1.00 0.00 ? 316 G A "H5''" 1  
ATOM 10166  H "H4'"  . G A 1 316 ? 120.732 93.604  161.327 1.00 0.00 ? 316 G A "H4'"  1  
ATOM 10167  H "H3'"  . G A 1 316 ? 119.388 95.629  159.865 1.00 0.00 ? 316 G A "H3'"  1  
ATOM 10168  H "H2'"  . G A 1 316 ? 117.394 94.973  160.792 1.00 0.00 ? 316 G A "H2'"  1  
ATOM 10169  H "HO2'" . G A 1 316 ? 118.410 92.626  160.785 1.00 0.00 ? 316 G A "HO2'" 1  
ATOM 10170  H "H1'"  . G A 1 316 ? 118.341 94.806  163.209 1.00 0.00 ? 316 G A "H1'"  1  
ATOM 10171  H H8     . G A 1 316 ? 120.011 97.739  162.049 1.00 0.00 ? 316 G A H8     1  
ATOM 10172  H H1     . G A 1 316 ? 113.963 98.959  163.243 1.00 0.00 ? 316 G A H1     1  
ATOM 10173  H H21    . G A 1 316 ? 112.849 97.078  163.543 1.00 0.00 ? 316 G A H21    1  
ATOM 10174  H H22    . G A 1 316 ? 113.600 95.560  163.449 1.00 0.00 ? 316 G A H22    1  
ATOM 10175  P P      . C A 1 317 ? 118.775 94.185  157.734 1.00 0.00 ? 317 C A P      1  
ATOM 10176  O OP1    . C A 1 317 ? 119.183 93.155  156.746 1.00 0.00 ? 317 C A OP1    1  
ATOM 10177  O OP2    . C A 1 317 ? 119.082 95.614  157.473 1.00 0.00 ? 317 C A OP2    1  
ATOM 10178  O "O5'"  . C A 1 317 ? 117.206 94.052  157.964 1.00 0.00 ? 317 C A "O5'"  1  
ATOM 10179  C "C5'"  . C A 1 317 ? 116.606 92.787  158.192 1.00 0.00 ? 317 C A "C5'"  1  
ATOM 10180  C "C4'"  . C A 1 317 ? 115.138 92.914  158.516 1.00 0.00 ? 317 C A "C4'"  1  
ATOM 10181  O "O4'"  . C A 1 317 ? 114.967 93.682  159.736 1.00 0.00 ? 317 C A "O4'"  1  
ATOM 10182  C "C3'"  . C A 1 317 ? 114.287 93.648  157.492 1.00 0.00 ? 317 C A "C3'"  1  
ATOM 10183  O "O3'"  . C A 1 317 ? 113.890 92.827  156.408 1.00 0.00 ? 317 C A "O3'"  1  
ATOM 10184  C "C2'"  . C A 1 317 ? 113.122 94.156  158.330 1.00 0.00 ? 317 C A "C2'"  1  
ATOM 10185  O "O2'"  . C A 1 317 ? 112.188 93.120  158.599 1.00 0.00 ? 317 C A "O2'"  1  
ATOM 10186  C "C1'"  . C A 1 317 ? 113.827 94.537  159.635 1.00 0.00 ? 317 C A "C1'"  1  
ATOM 10187  N N1     . C A 1 317 ? 114.252 95.958  159.653 1.00 0.00 ? 317 C A N1     1  
ATOM 10188  C C2     . C A 1 317 ? 113.284 96.936  159.915 1.00 0.00 ? 317 C A C2     1  
ATOM 10189  O O2     . C A 1 317 ? 112.111 96.590  160.121 1.00 0.00 ? 317 C A O2     1  
ATOM 10190  N N3     . C A 1 317 ? 113.646 98.240  159.937 1.00 0.00 ? 317 C A N3     1  
ATOM 10191  C C4     . C A 1 317 ? 114.912 98.586  159.713 1.00 0.00 ? 317 C A C4     1  
ATOM 10192  N N4     . C A 1 317 ? 115.222 99.885  159.745 1.00 0.00 ? 317 C A N4     1  
ATOM 10193  C C5     . C A 1 317 ? 115.920 97.617  159.442 1.00 0.00 ? 317 C A C5     1  
ATOM 10194  C C6     . C A 1 317 ? 115.551 96.330  159.425 1.00 0.00 ? 317 C A C6     1  
ATOM 10195  H "H5'"  . C A 1 317 ? 117.062 92.346  158.939 1.00 0.00 ? 317 C A "H5'"  1  
ATOM 10196  H "H5''" . C A 1 317 ? 116.709 92.236  157.386 1.00 0.00 ? 317 C A "H5''" 1  
ATOM 10197  H "H4'"  . C A 1 317 ? 114.767 92.016  158.652 1.00 0.00 ? 317 C A "H4'"  1  
ATOM 10198  H "H3'"  . C A 1 317 ? 114.790 94.416  157.147 1.00 0.00 ? 317 C A "H3'"  1  
ATOM 10199  H "H2'"  . C A 1 317 ? 112.693 94.935  157.918 1.00 0.00 ? 317 C A "H2'"  1  
ATOM 10200  H "HO2'" . C A 1 317 ? 112.310 92.403  157.943 1.00 0.00 ? 317 C A "HO2'" 1  
ATOM 10201  H "H1'"  . C A 1 317 ? 113.228 94.366  160.391 1.00 0.00 ? 317 C A "H1'"  1  
ATOM 10202  H H41    . C A 1 317 ? 114.526 100.551 159.930 1.00 0.00 ? 317 C A H41    1  
ATOM 10203  H H42    . C A 1 317 ? 116.145 100.174 159.582 1.00 0.00 ? 317 C A H42    1  
ATOM 10204  H H5     . C A 1 317 ? 116.847 97.881  159.279 1.00 0.00 ? 317 C A H5     1  
ATOM 10205  H H6     . C A 1 317 ? 116.228 95.648  159.239 1.00 0.00 ? 317 C A H6     1  
ATOM 10206  P P      . G A 1 318 ? 113.662 93.465  154.951 1.00 0.00 ? 318 G A P      1  
ATOM 10207  O OP1    . G A 1 318 ? 113.476 92.353  153.984 1.00 0.00 ? 318 G A OP1    1  
ATOM 10208  O OP2    . G A 1 318 ? 114.729 94.470  154.717 1.00 0.00 ? 318 G A OP2    1  
ATOM 10209  O "O5'"  . G A 1 318 ? 112.275 94.238  155.081 1.00 0.00 ? 318 G A "O5'"  1  
ATOM 10210  C "C5'"  . G A 1 318 ? 111.060 93.530  155.269 1.00 0.00 ? 318 G A "C5'"  1  
ATOM 10211  C "C4'"  . G A 1 318 ? 109.904 94.467  155.523 1.00 0.00 ? 318 G A "C4'"  1  
ATOM 10212  O "O4'"  . G A 1 318 ? 110.150 95.236  156.728 1.00 0.00 ? 318 G A "O4'"  1  
ATOM 10213  C "C3'"  . G A 1 318 ? 109.656 95.523  154.455 1.00 0.00 ? 318 G A "C3'"  1  
ATOM 10214  O "O3'"  . G A 1 318 ? 108.927 95.027  153.346 1.00 0.00 ? 318 G A "O3'"  1  
ATOM 10215  C "C2'"  . G A 1 318 ? 108.925 96.611  155.228 1.00 0.00 ? 318 G A "C2'"  1  
ATOM 10216  O "O2'"  . G A 1 318 ? 107.562 96.269  155.434 1.00 0.00 ? 318 G A "O2'"  1  
ATOM 10217  C "C1'"  . G A 1 318 ? 109.653 96.574  156.570 1.00 0.00 ? 318 G A "C1'"  1  
ATOM 10218  N N9     . G A 1 318 ? 110.753 97.553  156.634 1.00 0.00 ? 318 G A N9     1  
ATOM 10219  C C8     . G A 1 318 ? 112.103 97.296  156.592 1.00 0.00 ? 318 G A C8     1  
ATOM 10220  N N7     . G A 1 318 ? 112.835 98.374  156.669 1.00 0.00 ? 318 G A N7     1  
ATOM 10221  C C5     . G A 1 318 ? 111.914 99.407  156.767 1.00 0.00 ? 318 G A C5     1  
ATOM 10222  C C6     . G A 1 318 ? 112.113 100.808 156.878 1.00 0.00 ? 318 G A C6     1  
ATOM 10223  O O6     . G A 1 318 ? 113.179 101.434 156.911 1.00 0.00 ? 318 G A O6     1  
ATOM 10224  N N1     . G A 1 318 ? 110.904 101.494 156.954 1.00 0.00 ? 318 G A N1     1  
ATOM 10225  C C2     . G A 1 318 ? 109.664 100.907 156.924 1.00 0.00 ? 318 G A C2     1  
ATOM 10226  N N2     . G A 1 318 ? 108.612 101.735 157.009 1.00 0.00 ? 318 G A N2     1  
ATOM 10227  N N3     . G A 1 318 ? 109.465 99.604  156.823 1.00 0.00 ? 318 G A N3     1  
ATOM 10228  C C4     . G A 1 318 ? 110.626 98.919  156.748 1.00 0.00 ? 318 G A C4     1  
ATOM 10229  H "H5'"  . G A 1 318 ? 111.156 92.927  156.036 1.00 0.00 ? 318 G A "H5'"  1  
ATOM 10230  H "H5''" . G A 1 318 ? 110.871 92.999  154.467 1.00 0.00 ? 318 G A "H5''" 1  
ATOM 10231  H "H4'"  . G A 1 318 ? 109.088 93.939  155.643 1.00 0.00 ? 318 G A "H4'"  1  
ATOM 10232  H "H3'"  . G A 1 318 ? 110.517 95.873  154.143 1.00 0.00 ? 318 G A "H3'"  1  
ATOM 10233  H "H2'"  . G A 1 318 ? 109.018 97.486  154.793 1.00 0.00 ? 318 G A "H2'"  1  
ATOM 10234  H "HO2'" . G A 1 318 ? 107.300 95.586  154.784 1.00 0.00 ? 318 G A "HO2'" 1  
ATOM 10235  H "H1'"  . G A 1 318 ? 109.016 96.750  157.294 1.00 0.00 ? 318 G A "H1'"  1  
ATOM 10236  H H8     . G A 1 318 ? 112.478 96.393  156.511 1.00 0.00 ? 318 G A H8     1  
ATOM 10237  H H1     . G A 1 318 ? 110.946 102.471 157.031 1.00 0.00 ? 318 G A H1     1  
ATOM 10238  H H21    . G A 1 318 ? 108.751 102.701 157.085 1.00 0.00 ? 318 G A H21    1  
ATOM 10239  H H22    . G A 1 318 ? 107.700 101.372 156.993 1.00 0.00 ? 318 G A H22    1  
ATOM 10240  P P      . C A 1 319 ? 109.143 95.667  151.887 1.00 0.00 ? 319 C A P      1  
ATOM 10241  O OP1    . C A 1 319 ? 108.440 94.809  150.900 1.00 0.00 ? 319 C A OP1    1  
ATOM 10242  O OP2    . C A 1 319 ? 110.591 95.948  151.718 1.00 0.00 ? 319 C A OP2    1  
ATOM 10243  O "O5'"  . C A 1 319 ? 108.376 97.062  151.962 1.00 0.00 ? 319 C A "O5'"  1  
ATOM 10244  C "C5'"  . C A 1 319 ? 106.962 97.109  152.090 1.00 0.00 ? 319 C A "C5'"  1  
ATOM 10245  C "C4'"  . C A 1 319 ? 106.462 98.530  152.203 1.00 0.00 ? 319 C A "C4'"  1  
ATOM 10246  O "O4'"  . C A 1 319 ? 106.983 99.145  153.409 1.00 0.00 ? 319 C A "O4'"  1  
ATOM 10247  C "C3'"  . C A 1 319 ? 106.888 99.479  151.091 1.00 0.00 ? 319 C A "C3'"  1  
ATOM 10248  O "O3'"  . C A 1 319 ? 106.084 99.369  149.930 1.00 0.00 ? 319 C A "O3'"  1  
ATOM 10249  C "C2'"  . C A 1 319 ? 106.798 100.841 151.766 1.00 0.00 ? 319 C A "C2'"  1  
ATOM 10250  O "O2'"  . C A 1 319 ? 105.453 101.292 151.843 1.00 0.00 ? 319 C A "O2'"  1  
ATOM 10251  C "C1'"  . C A 1 319 ? 107.294 100.515 153.176 1.00 0.00 ? 319 C A "C1'"  1  
ATOM 10252  N N1     . C A 1 319 ? 108.756 100.734 153.323 1.00 0.00 ? 319 C A N1     1  
ATOM 10253  C C2     . C A 1 319 ? 109.216 102.048 153.489 1.00 0.00 ? 319 C A C2     1  
ATOM 10254  O O2     . C A 1 319 ? 108.399 102.981 153.505 1.00 0.00 ? 319 C A O2     1  
ATOM 10255  N N3     . C A 1 319 ? 110.543 102.276 153.626 1.00 0.00 ? 319 C A N3     1  
ATOM 10256  C C4     . C A 1 319 ? 111.402 101.256 153.603 1.00 0.00 ? 319 C A C4     1  
ATOM 10257  N N4     . C A 1 319 ? 112.702 101.528 153.743 1.00 0.00 ? 319 C A N4     1  
ATOM 10258  C C5     . C A 1 319 ? 110.965 99.912  153.435 1.00 0.00 ? 319 C A C5     1  
ATOM 10259  C C6     . C A 1 319 ? 109.651 99.698  153.301 1.00 0.00 ? 319 C A C6     1  
ATOM 10260  H "H5'"  . C A 1 319 ? 106.700 96.615  152.894 1.00 0.00 ? 319 C A "H5'"  1  
ATOM 10261  H "H5''" . C A 1 319 ? 106.555 96.688  151.306 1.00 0.00 ? 319 C A "H5''" 1  
ATOM 10262  H "H4'"  . C A 1 319 ? 105.483 98.516  152.249 1.00 0.00 ? 319 C A "H4'"  1  
ATOM 10263  H "H3'"  . C A 1 319 ? 107.821 99.300  150.855 1.00 0.00 ? 319 C A "H3'"  1  
ATOM 10264  H "H2'"  . C A 1 319 ? 107.377 101.500 151.326 1.00 0.00 ? 319 C A "H2'"  1  
ATOM 10265  H "HO2'" . C A 1 319 ? 104.917 100.807 151.182 1.00 0.00 ? 319 C A "HO2'" 1  
ATOM 10266  H "H1'"  . C A 1 319 ? 106.817 101.071 153.826 1.00 0.00 ? 319 C A "H1'"  1  
ATOM 10267  H H41    . C A 1 319 ? 112.998 102.455 153.857 1.00 0.00 ? 319 C A H41    1  
ATOM 10268  H H42    . C A 1 319 ? 113.357 100.801 153.731 1.00 0.00 ? 319 C A H42    1  
ATOM 10269  H H5     . C A 1 319 ? 111.604 99.168  153.420 1.00 0.00 ? 319 C A H5     1  
ATOM 10270  H H6     . C A 1 319 ? 109.329 98.780  153.185 1.00 0.00 ? 319 C A H6     1  
ATOM 10271  P P      . U A 1 320 ? 106.725 99.613  148.476 1.00 0.00 ? 320 U A P      1  
ATOM 10272  O OP1    . U A 1 320 ? 105.704 99.262  147.456 1.00 0.00 ? 320 U A OP1    1  
ATOM 10273  O OP2    . U A 1 320 ? 108.054 98.950  148.443 1.00 0.00 ? 320 U A OP2    1  
ATOM 10274  O "O5'"  . U A 1 320 ? 106.957 101.188 148.420 1.00 0.00 ? 320 U A "O5'"  1  
ATOM 10275  C "C5'"  . U A 1 320 ? 105.860 102.087 148.411 1.00 0.00 ? 320 U A "C5'"  1  
ATOM 10276  C "C4'"  . U A 1 320 ? 106.308 103.516 148.593 1.00 0.00 ? 320 U A "C4'"  1  
ATOM 10277  O "O4'"  . U A 1 320 ? 106.987 103.664 149.869 1.00 0.00 ? 320 U A "O4'"  1  
ATOM 10278  C "C3'"  . U A 1 320 ? 107.315 104.038 147.576 1.00 0.00 ? 320 U A "C3'"  1  
ATOM 10279  O "O3'"  . U A 1 320 ? 106.709 104.474 146.372 1.00 0.00 ? 320 U A "O3'"  1  
ATOM 10280  C "C2'"  . U A 1 320 ? 108.017 105.146 148.346 1.00 0.00 ? 320 U A "C2'"  1  
ATOM 10281  O "O2'"  . U A 1 320 ? 107.221 106.320 148.402 1.00 0.00 ? 320 U A "O2'"  1  
ATOM 10282  C "C1'"  . U A 1 320 ? 108.107 104.539 149.746 1.00 0.00 ? 320 U A "C1'"  1  
ATOM 10283  N N1     . U A 1 320 ? 109.372 103.795 149.960 1.00 0.00 ? 320 U A N1     1  
ATOM 10284  C C2     . U A 1 320 ? 110.504 104.541 150.229 1.00 0.00 ? 320 U A C2     1  
ATOM 10285  O O2     . U A 1 320 ? 110.499 105.758 150.296 1.00 0.00 ? 320 U A O2     1  
ATOM 10286  N N3     . U A 1 320 ? 111.650 103.812 150.417 1.00 0.00 ? 320 U A N3     1  
ATOM 10287  C C4     . U A 1 320 ? 111.782 102.440 150.368 1.00 0.00 ? 320 U A C4     1  
ATOM 10288  O O4     . U A 1 320 ? 112.887 101.928 150.561 1.00 0.00 ? 320 U A O4     1  
ATOM 10289  C C5     . U A 1 320 ? 110.568 101.733 150.086 1.00 0.00 ? 320 U A C5     1  
ATOM 10290  C C6     . U A 1 320 ? 109.438 102.419 149.897 1.00 0.00 ? 320 U A C6     1  
ATOM 10291  H "H5'"  . U A 1 320 ? 105.247 101.849 149.140 1.00 0.00 ? 320 U A "H5'"  1  
ATOM 10292  H "H5''" . U A 1 320 ? 105.387 102.008 147.558 1.00 0.00 ? 320 U A "H5''" 1  
ATOM 10293  H "H4'"  . U A 1 320 ? 105.519 104.097 148.584 1.00 0.00 ? 320 U A "H4'"  1  
ATOM 10294  H "H3'"  . U A 1 320 ? 107.961 103.329 147.374 1.00 0.00 ? 320 U A "H3'"  1  
ATOM 10295  H "H2'"  . U A 1 320 ? 108.908 105.330 147.978 1.00 0.00 ? 320 U A "H2'"  1  
ATOM 10296  H "HO2'" . U A 1 320 ? 106.552 106.288 147.685 1.00 0.00 ? 320 U A "HO2'" 1  
ATOM 10297  H "H1'"  . U A 1 320 ? 108.034 105.251 150.416 1.00 0.00 ? 320 U A "H1'"  1  
ATOM 10298  H H3     . U A 1 320 ? 112.467 104.320 150.609 1.00 0.00 ? 320 U A H3     1  
ATOM 10299  H H5     . U A 1 320 ? 110.568 100.755 150.031 1.00 0.00 ? 320 U A H5     1  
ATOM 10300  H H6     . U A 1 320 ? 108.622 101.914 149.705 1.00 0.00 ? 320 U A H6     1  
ATOM 10301  P P      . G A 1 321 ? 107.510 104.383 144.984 1.00 0.00 ? 321 G A P      1  
ATOM 10302  O OP1    . G A 1 321 ? 106.539 104.570 143.877 1.00 0.00 ? 321 G A OP1    1  
ATOM 10303  O OP2    . G A 1 321 ? 108.356 103.162 145.020 1.00 0.00 ? 321 G A OP2    1  
ATOM 10304  O "O5'"  . G A 1 321 ? 108.475 105.651 145.011 1.00 0.00 ? 321 G A "O5'"  1  
ATOM 10305  C "C5'"  . G A 1 321 ? 107.953 106.968 144.912 1.00 0.00 ? 321 G A "C5'"  1  
ATOM 10306  C "C4'"  . G A 1 321 ? 109.006 108.004 145.215 1.00 0.00 ? 321 G A "C4'"  1  
ATOM 10307  O "O4'"  . G A 1 321 ? 109.553 107.779 146.542 1.00 0.00 ? 321 G A "O4'"  1  
ATOM 10308  C "C3'"  . G A 1 321 ? 110.225 108.002 144.305 1.00 0.00 ? 321 G A "C3'"  1  
ATOM 10309  O "O3'"  . G A 1 321 ? 110.005 108.684 143.081 1.00 0.00 ? 321 G A "O3'"  1  
ATOM 10310  C "C2'"  . G A 1 321 ? 111.291 108.647 145.180 1.00 0.00 ? 321 G A "C2'"  1  
ATOM 10311  O "O2'"  . G A 1 321 ? 111.133 110.057 145.232 1.00 0.00 ? 321 G A "O2'"  1  
ATOM 10312  C "C1'"  . G A 1 321 ? 110.960 108.058 146.551 1.00 0.00 ? 321 G A "C1'"  1  
ATOM 10313  N N9     . G A 1 321 ? 111.749 106.845 146.842 1.00 0.00 ? 321 G A N9     1  
ATOM 10314  C C8     . G A 1 321 ? 111.303 105.547 146.846 1.00 0.00 ? 321 G A C8     1  
ATOM 10315  N N7     . G A 1 321 ? 112.237 104.683 147.144 1.00 0.00 ? 321 G A N7     1  
ATOM 10316  C C5     . G A 1 321 ? 113.369 105.461 147.346 1.00 0.00 ? 321 G A C5     1  
ATOM 10317  C C6     . G A 1 321 ? 114.692 105.083 147.694 1.00 0.00 ? 321 G A C6     1  
ATOM 10318  O O6     . G A 1 321 ? 115.143 103.951 147.895 1.00 0.00 ? 321 G A O6     1  
ATOM 10319  N N1     . G A 1 321 ? 115.527 106.192 147.799 1.00 0.00 ? 321 G A N1     1  
ATOM 10320  C C2     . G A 1 321 ? 115.143 107.494 147.597 1.00 0.00 ? 321 G A C2     1  
ATOM 10321  N N2     . G A 1 321 ? 116.095 108.428 147.744 1.00 0.00 ? 321 G A N2     1  
ATOM 10322  N N3     . G A 1 321 ? 113.911 107.859 147.273 1.00 0.00 ? 321 G A N3     1  
ATOM 10323  C C4     . G A 1 321 ? 113.084 106.799 147.165 1.00 0.00 ? 321 G A C4     1  
ATOM 10324  H "H5'"  . G A 1 321 ? 107.214 107.066 145.548 1.00 0.00 ? 321 G A "H5'"  1  
ATOM 10325  H "H5''" . G A 1 321 ? 107.614 107.110 144.005 1.00 0.00 ? 321 G A "H5''" 1  
ATOM 10326  H "H4'"  . G A 1 321 ? 108.593 108.894 145.188 1.00 0.00 ? 321 G A "H4'"  1  
ATOM 10327  H "H3'"  . G A 1 321 ? 110.483 107.076 144.116 1.00 0.00 ? 321 G A "H3'"  1  
ATOM 10328  H "H2'"  . G A 1 321 ? 112.196 108.393 144.891 1.00 0.00 ? 321 G A "H2'"  1  
ATOM 10329  H "HO2'" . G A 1 321 ? 110.594 110.345 144.467 1.00 0.00 ? 321 G A "HO2'" 1  
ATOM 10330  H "H1'"  . G A 1 321 ? 111.128 108.732 147.244 1.00 0.00 ? 321 G A "H1'"  1  
ATOM 10331  H H8     . G A 1 321 ? 110.377 105.291 146.649 1.00 0.00 ? 321 G A H8     1  
ATOM 10332  H H1     . G A 1 321 ? 116.466 106.028 148.036 1.00 0.00 ? 321 G A H1     1  
ATOM 10333  H H21    . G A 1 321 ? 117.008 108.165 147.983 1.00 0.00 ? 321 G A H21    1  
ATOM 10334  H H22    . G A 1 321 ? 115.877 109.373 147.611 1.00 0.00 ? 321 G A H22    1  
ATOM 10335  P P      . G A 1 322 ? 110.740 108.192 141.739 1.00 0.00 ? 322 G A P      1  
ATOM 10336  O OP1    . G A 1 322 ? 110.408 109.150 140.654 1.00 0.00 ? 322 G A OP1    1  
ATOM 10337  O OP2    . G A 1 322 ? 110.446 106.747 141.558 1.00 0.00 ? 322 G A OP2    1  
ATOM 10338  O "O5'"  . G A 1 322 ? 112.291 108.341 142.071 1.00 0.00 ? 322 G A "O5'"  1  
ATOM 10339  C "C5'"  . G A 1 322 ? 112.870 109.620 142.286 1.00 0.00 ? 322 G A "C5'"  1  
ATOM 10340  C "C4'"  . G A 1 322 ? 114.370 109.582 142.130 1.00 0.00 ? 322 G A "C4'"  1  
ATOM 10341  O "O4'"  . G A 1 322 ? 115.011 109.180 143.372 1.00 0.00 ? 322 G A "O4'"  1  
ATOM 10342  C "C3'"  . G A 1 322 ? 114.909 108.605 141.096 1.00 0.00 ? 322 G A "C3'"  1  
ATOM 10343  O "O3'"  . G A 1 322 ? 114.795 109.086 139.767 1.00 0.00 ? 322 G A "O3'"  1  
ATOM 10344  C "C2'"  . G A 1 322 ? 116.352 108.429 141.539 1.00 0.00 ? 322 G A "C2'"  1  
ATOM 10345  O "O2'"  . G A 1 322 ? 117.160 109.514 141.106 1.00 0.00 ? 322 G A "O2'"  1  
ATOM 10346  C "C1'"  . G A 1 322 ? 116.205 108.490 143.058 1.00 0.00 ? 322 G A "C1'"  1  
ATOM 10347  N N9     . G A 1 322 ? 116.197 107.148 143.670 1.00 0.00 ? 322 G A N9     1  
ATOM 10348  C C8     . G A 1 322 ? 115.105 106.442 144.113 1.00 0.00 ? 322 G A C8     1  
ATOM 10349  N N7     . G A 1 322 ? 115.414 105.276 144.611 1.00 0.00 ? 322 G A N7     1  
ATOM 10350  C C5     . G A 1 322 ? 116.795 105.206 144.489 1.00 0.00 ? 322 G A C5     1  
ATOM 10351  C C6     . G A 1 322 ? 117.699 104.176 144.856 1.00 0.00 ? 322 G A C6     1  
ATOM 10352  O O6     . G A 1 322 ? 117.452 103.085 145.381 1.00 0.00 ? 322 G A O6     1  
ATOM 10353  N N1     . G A 1 322 ? 119.015 104.517 144.555 1.00 0.00 ? 322 G A N1     1  
ATOM 10354  C C2     . G A 1 322 ? 119.409 105.697 143.973 1.00 0.00 ? 322 G A C2     1  
ATOM 10355  N N2     . G A 1 322 ? 120.725 105.845 143.759 1.00 0.00 ? 322 G A N2     1  
ATOM 10356  N N3     . G A 1 322 ? 118.576 106.665 143.626 1.00 0.00 ? 322 G A N3     1  
ATOM 10357  C C4     . G A 1 322 ? 117.294 106.353 143.910 1.00 0.00 ? 322 G A C4     1  
ATOM 10358  H "H5'"  . G A 1 322 ? 112.650 109.923 143.192 1.00 0.00 ? 322 G A "H5'"  1  
ATOM 10359  H "H5''" . G A 1 322 ? 112.497 110.253 141.638 1.00 0.00 ? 322 G A "H5''" 1  
ATOM 10360  H "H4'"  . G A 1 322 ? 114.688 110.479 141.895 1.00 0.00 ? 322 G A "H4'"  1  
ATOM 10361  H "H3'"  . G A 1 322 ? 114.438 107.751 141.184 1.00 0.00 ? 322 G A "H3'"  1  
ATOM 10362  H "H2'"  . G A 1 322 ? 116.715 107.566 141.246 1.00 0.00 ? 322 G A "H2'"  1  
ATOM 10363  H "HO2'" . G A 1 322 ? 117.201 110.185 141.819 1.00 0.00 ? 322 G A "HO2'" 1  
ATOM 10364  H "H1'"  . G A 1 322 ? 116.940 109.017 143.436 1.00 0.00 ? 322 G A "H1'"  1  
ATOM 10365  H H8     . G A 1 322 ? 114.186 106.779 144.062 1.00 0.00 ? 322 G A H8     1  
ATOM 10366  H H1     . G A 1 322 ? 119.711 103.864 144.775 1.00 0.00 ? 322 G A H1     1  
ATOM 10367  H H21    . G A 1 322 ? 121.349 105.133 144.014 1.00 0.00 ? 322 G A H21    1  
ATOM 10368  H H22    . G A 1 322 ? 121.066 106.667 143.347 1.00 0.00 ? 322 G A H22    1  
ATOM 10369  P P      . A A 1 323 ? 115.007 110.648 139.454 1.00 0.00 ? 323 A A P      1  
ATOM 10370  O OP1    . A A 1 323 ? 114.882 110.845 137.988 1.00 0.00 ? 323 A A OP1    1  
ATOM 10371  O OP2    . A A 1 323 ? 116.238 111.095 140.152 1.00 0.00 ? 323 A A OP2    1  
ATOM 10372  O "O5'"  . A A 1 323 ? 113.761 111.354 140.154 1.00 0.00 ? 323 A A "O5'"  1  
ATOM 10373  C "C5'"  . A A 1 323 ? 113.455 112.716 139.895 1.00 0.00 ? 323 A A "C5'"  1  
ATOM 10374  C "C4'"  . A A 1 323 ? 112.574 113.300 140.971 1.00 0.00 ? 323 A A "C4'"  1  
ATOM 10375  O "O4'"  . A A 1 323 ? 113.276 113.378 142.237 1.00 0.00 ? 323 A A "O4'"  1  
ATOM 10376  C "C3'"  . A A 1 323 ? 112.118 114.735 140.755 1.00 0.00 ? 323 A A "C3'"  1  
ATOM 10377  O "O3'"  . A A 1 323 ? 111.136 114.858 139.741 1.00 0.00 ? 323 A A "O3'"  1  
ATOM 10378  C "C2'"  . A A 1 323 ? 111.665 115.107 142.156 1.00 0.00 ? 323 A A "C2'"  1  
ATOM 10379  O "O2'"  . A A 1 323 ? 110.420 114.501 142.472 1.00 0.00 ? 323 A A "O2'"  1  
ATOM 10380  C "C1'"  . A A 1 323 ? 112.771 114.458 142.991 1.00 0.00 ? 323 A A "C1'"  1  
ATOM 10381  N N9     . A A 1 323 ? 113.882 115.390 143.263 1.00 0.00 ? 323 A A N9     1  
ATOM 10382  C C8     . A A 1 323 ? 115.202 115.256 142.909 1.00 0.00 ? 323 A A C8     1  
ATOM 10383  N N7     . A A 1 323 ? 115.956 116.256 143.293 1.00 0.00 ? 323 A A N7     1  
ATOM 10384  C C5     . A A 1 323 ? 115.074 117.107 143.945 1.00 0.00 ? 323 A A C5     1  
ATOM 10385  C C6     . A A 1 323 ? 115.253 118.347 144.583 1.00 0.00 ? 323 A A C6     1  
ATOM 10386  N N6     . A A 1 323 ? 116.429 118.972 144.673 1.00 0.00 ? 323 A A N6     1  
ATOM 10387  N N1     . A A 1 323 ? 114.167 118.932 145.133 1.00 0.00 ? 323 A A N1     1  
ATOM 10388  C C2     . A A 1 323 ? 112.986 118.307 145.043 1.00 0.00 ? 323 A A C2     1  
ATOM 10389  N N3     . A A 1 323 ? 112.693 117.141 144.470 1.00 0.00 ? 323 A A N3     1  
ATOM 10390  C C4     . A A 1 323 ? 113.794 116.586 143.933 1.00 0.00 ? 323 A A C4     1  
ATOM 10391  H "H5'"  . A A 1 323 ? 112.993 112.782 139.033 1.00 0.00 ? 323 A A "H5'"  1  
ATOM 10392  H "H5''" . A A 1 323 ? 114.288 113.229 139.851 1.00 0.00 ? 323 A A "H5''" 1  
ATOM 10393  H "H4'"  . A A 1 323 ? 111.792 112.721 141.090 1.00 0.00 ? 323 A A "H4'"  1  
ATOM 10394  H "H3'"  . A A 1 323 ? 112.891 115.282 140.500 1.00 0.00 ? 323 A A "H3'"  1  
ATOM 10395  H "H2'"  . A A 1 323 ? 111.638 116.079 142.278 1.00 0.00 ? 323 A A "H2'"  1  
ATOM 10396  H "HO2'" . A A 1 323 ? 109.968 114.249 141.640 1.00 0.00 ? 323 A A "HO2'" 1  
ATOM 10397  H "H1'"  . A A 1 323 ? 112.396 114.142 143.840 1.00 0.00 ? 323 A A "H1'"  1  
ATOM 10398  H H8     . A A 1 323 ? 115.548 114.484 142.414 1.00 0.00 ? 323 A A H8     1  
ATOM 10399  H H61    . A A 1 323 ? 116.491 119.836 145.131 1.00 0.00 ? 323 A A H61    1  
ATOM 10400  H H62    . A A 1 323 ? 117.230 118.566 144.282 1.00 0.00 ? 323 A A H62    1  
ATOM 10401  H H2     . A A 1 323 ? 112.230 118.773 145.458 1.00 0.00 ? 323 A A H2     1  
ATOM 10402  P P      . A A 1 324 ? 110.756 116.307 139.173 1.00 0.00 ? 324 A A P      1  
ATOM 10403  O OP1    . A A 1 324 ? 110.549 116.214 137.707 1.00 0.00 ? 324 A A OP1    1  
ATOM 10404  O OP2    . A A 1 324 ? 111.844 117.162 139.709 1.00 0.00 ? 324 A A OP2    1  
ATOM 10405  O "O5'"  . A A 1 324 ? 109.386 116.781 139.836 1.00 0.00 ? 324 A A "O5'"  1  
ATOM 10406  C "C5'"  . A A 1 324 ? 108.207 116.913 139.057 1.00 0.00 ? 324 A A "C5'"  1  
ATOM 10407  C "C4'"  . A A 1 324 ? 107.022 117.301 139.904 1.00 0.00 ? 324 A A "C4'"  1  
ATOM 10408  O "O4'"  . A A 1 324 ? 107.462 118.118 141.022 1.00 0.00 ? 324 A A "O4'"  1  
ATOM 10409  C "C3'"  . A A 1 324 ? 105.963 118.153 139.220 1.00 0.00 ? 324 A A "C3'"  1  
ATOM 10410  O "O3'"  . A A 1 324 ? 105.055 117.389 138.440 1.00 0.00 ? 324 A A "O3'"  1  
ATOM 10411  C "C2'"  . A A 1 324 ? 105.307 118.873 140.388 1.00 0.00 ? 324 A A "C2'"  1  
ATOM 10412  O "O2'"  . A A 1 324 ? 104.401 118.022 141.076 1.00 0.00 ? 324 A A "O2'"  1  
ATOM 10413  C "C1'"  . A A 1 324 ? 106.510 119.150 141.291 1.00 0.00 ? 324 A A "C1'"  1  
ATOM 10414  N N9     . A A 1 324 ? 107.102 120.477 141.036 1.00 0.00 ? 324 A A N9     1  
ATOM 10415  C C8     . A A 1 324 ? 108.254 120.769 140.351 1.00 0.00 ? 324 A A C8     1  
ATOM 10416  N N7     . A A 1 324 ? 108.525 122.051 140.292 1.00 0.00 ? 324 A A N7     1  
ATOM 10417  C C5     . A A 1 324 ? 107.477 122.643 140.985 1.00 0.00 ? 324 A A C5     1  
ATOM 10418  C C6     . A A 1 324 ? 107.175 123.986 141.282 1.00 0.00 ? 324 A A C6     1  
ATOM 10419  N N6     . A A 1 324 ? 107.933 125.014 140.899 1.00 0.00 ? 324 A A N6     1  
ATOM 10420  N N1     . A A 1 324 ? 106.053 124.235 141.991 1.00 0.00 ? 324 A A N1     1  
ATOM 10421  C C2     . A A 1 324 ? 105.292 123.201 142.373 1.00 0.00 ? 324 A A C2     1  
ATOM 10422  N N3     . A A 1 324 ? 105.471 121.900 142.155 1.00 0.00 ? 324 A A N3     1  
ATOM 10423  C C4     . A A 1 324 ? 106.593 121.685 141.448 1.00 0.00 ? 324 A A C4     1  
ATOM 10424  H "H5'"  . A A 1 324 ? 108.015 116.058 138.616 1.00 0.00 ? 324 A A "H5'"  1  
ATOM 10425  H "H5''" . A A 1 324 ? 108.349 117.599 138.372 1.00 0.00 ? 324 A A "H5''" 1  
ATOM 10426  H "H4'"  . A A 1 324 ? 106.599 116.489 140.251 1.00 0.00 ? 324 A A "H4'"  1  
ATOM 10427  H "H3'"  . A A 1 324 ? 106.405 118.813 138.644 1.00 0.00 ? 324 A A "H3'"  1  
ATOM 10428  H "H2'"  . A A 1 324 ? 104.875 119.704 140.103 1.00 0.00 ? 324 A A "H2'"  1  
ATOM 10429  H "HO2'" . A A 1 324 ? 103.968 118.528 141.794 1.00 0.00 ? 324 A A "HO2'" 1  
ATOM 10430  H "H1'"  . A A 1 324 ? 106.235 119.090 142.230 1.00 0.00 ? 324 A A "H1'"  1  
ATOM 10431  H H8     . A A 1 324 ? 108.826 120.084 139.945 1.00 0.00 ? 324 A A H8     1  
ATOM 10432  H H61    . A A 1 324 ? 107.671 125.930 141.137 1.00 0.00 ? 324 A A H61    1  
ATOM 10433  H H62    . A A 1 324 ? 108.752 124.857 140.383 1.00 0.00 ? 324 A A H62    1  
ATOM 10434  H H2     . A A 1 324 ? 104.489 123.437 142.885 1.00 0.00 ? 324 A A H2     1  
ATOM 10435  P P      . C A 1 325 ? 104.373 118.031 137.136 1.00 0.00 ? 325 C A P      1  
ATOM 10436  O OP1    . C A 1 325 ? 103.687 116.942 136.394 1.00 0.00 ? 325 C A OP1    1  
ATOM 10437  O OP2    . C A 1 325 ? 105.389 118.863 136.445 1.00 0.00 ? 325 C A OP2    1  
ATOM 10438  O "O5'"  . C A 1 325 ? 103.255 119.002 137.725 1.00 0.00 ? 325 C A "O5'"  1  
ATOM 10439  C "C5'"  . C A 1 325 ? 102.124 118.484 138.405 1.00 0.00 ? 325 C A "C5'"  1  
ATOM 10440  C "C4'"  . C A 1 325 ? 101.280 119.585 139.000 1.00 0.00 ? 325 C A "C4'"  1  
ATOM 10441  O "O4'"  . C A 1 325 ? 102.056 120.337 139.967 1.00 0.00 ? 325 C A "O4'"  1  
ATOM 10442  C "C3'"  . C A 1 325 ? 100.774 120.642 138.029 1.00 0.00 ? 325 C A "C3'"  1  
ATOM 10443  O "O3'"  . C A 1 325 ? 99.611  120.240 137.327 1.00 0.00 ? 325 C A "O3'"  1  
ATOM 10444  C "C2'"  . C A 1 325 ? 100.556 121.848 138.933 1.00 0.00 ? 325 C A "C2'"  1  
ATOM 10445  O "O2'"  . C A 1 325 ? 99.350  121.728 139.672 1.00 0.00 ? 325 C A "O2'"  1  
ATOM 10446  C "C1'"  . C A 1 325 ? 101.740 121.724 139.895 1.00 0.00 ? 325 C A "C1'"  1  
ATOM 10447  N N1     . C A 1 325 ? 102.923 122.496 139.436 1.00 0.00 ? 325 C A N1     1  
ATOM 10448  C C2     . C A 1 325 ? 102.926 123.883 139.627 1.00 0.00 ? 325 C A C2     1  
ATOM 10449  O O2     . C A 1 325 ? 101.951 124.422 140.173 1.00 0.00 ? 325 C A O2     1  
ATOM 10450  N N3     . C A 1 325 ? 103.992 124.609 139.220 1.00 0.00 ? 325 C A N3     1  
ATOM 10451  C C4     . C A 1 325 ? 105.028 124.006 138.639 1.00 0.00 ? 325 C A C4     1  
ATOM 10452  N N4     . C A 1 325 ? 106.057 124.762 138.250 1.00 0.00 ? 325 C A N4     1  
ATOM 10453  C C5     . C A 1 325 ? 105.054 122.599 138.427 1.00 0.00 ? 325 C A C5     1  
ATOM 10454  C C6     . C A 1 325 ? 103.994 121.890 138.838 1.00 0.00 ? 325 C A C6     1  
ATOM 10455  H "H5'"  . C A 1 325 ? 102.426 117.891 139.125 1.00 0.00 ? 325 C A "H5'"  1  
ATOM 10456  H "H5''" . C A 1 325 ? 101.578 117.971 137.773 1.00 0.00 ? 325 C A "H5''" 1  
ATOM 10457  H "H4'"  . C A 1 325 ? 100.509 119.180 139.454 1.00 0.00 ? 325 C A "H4'"  1  
ATOM 10458  H "H3'"  . C A 1 325 ? 101.483 120.849 137.384 1.00 0.00 ? 325 C A "H3'"  1  
ATOM 10459  H "H2'"  . C A 1 325 ? 100.591 122.687 138.428 1.00 0.00 ? 325 C A "H2'"  1  
ATOM 10460  H "HO2'" . C A 1 325 ? 99.224  122.535 140.213 1.00 0.00 ? 325 C A "HO2'" 1  
ATOM 10461  H "H1'"  . C A 1 325 ? 101.472 122.039 140.783 1.00 0.00 ? 325 C A "H1'"  1  
ATOM 10462  H H41    . C A 1 325 ? 106.035 125.733 138.398 1.00 0.00 ? 325 C A H41    1  
ATOM 10463  H H42    . C A 1 325 ? 106.833 124.350 137.820 1.00 0.00 ? 325 C A H42    1  
ATOM 10464  H H5     . C A 1 325 ? 105.822 122.164 137.999 1.00 0.00 ? 325 C A H5     1  
ATOM 10465  H H6     . C A 1 325 ? 103.993 120.919 138.699 1.00 0.00 ? 325 C A H6     1  
ATOM 10466  P P      . U A 1 326 ? 99.333  120.787 135.841 1.00 0.00 ? 326 U A P      1  
ATOM 10467  O OP1    . U A 1 326 ? 98.208  120.006 135.266 1.00 0.00 ? 326 U A OP1    1  
ATOM 10468  O OP2    . U A 1 326 ? 100.630 120.842 135.123 1.00 0.00 ? 326 U A OP2    1  
ATOM 10469  O "O5'"  . U A 1 326 ? 98.829  122.281 136.069 1.00 0.00 ? 326 U A "O5'"  1  
ATOM 10470  C "C5'"  . U A 1 326 ? 97.577  122.543 136.683 1.00 0.00 ? 326 U A "C5'"  1  
ATOM 10471  C "C4'"  . U A 1 326 ? 97.347  124.024 136.865 1.00 0.00 ? 326 U A "C4'"  1  
ATOM 10472  O "O4'"  . U A 1 326 ? 98.340  124.571 137.768 1.00 0.00 ? 326 U A "O4'"  1  
ATOM 10473  C "C3'"  . U A 1 326 ? 97.467  124.881 135.615 1.00 0.00 ? 326 U A "C3'"  1  
ATOM 10474  O "O3'"  . U A 1 326 ? 96.292  124.876 134.822 1.00 0.00 ? 326 U A "O3'"  1  
ATOM 10475  C "C2'"  . U A 1 326 ? 97.815  126.249 136.183 1.00 0.00 ? 326 U A "C2'"  1  
ATOM 10476  O "O2'"  . U A 1 326 ? 96.668  126.896 136.710 1.00 0.00 ? 326 U A "O2'"  1  
ATOM 10477  C "C1'"  . U A 1 326 ? 98.747  125.873 137.337 1.00 0.00 ? 326 U A "C1'"  1  
ATOM 10478  N N1     . U A 1 326 ? 100.172 125.852 136.926 1.00 0.00 ? 326 U A N1     1  
ATOM 10479  C C2     . U A 1 326 ? 100.818 127.069 136.825 1.00 0.00 ? 326 U A C2     1  
ATOM 10480  O O2     . U A 1 326 ? 100.270 128.133 137.058 1.00 0.00 ? 326 U A O2     1  
ATOM 10481  N N3     . U A 1 326 ? 102.135 127.000 136.445 1.00 0.00 ? 326 U A N3     1  
ATOM 10482  C C4     . U A 1 326 ? 102.859 125.864 136.156 1.00 0.00 ? 326 U A C4     1  
ATOM 10483  O O4     . U A 1 326 ? 104.040 125.967 135.823 1.00 0.00 ? 326 U A O4     1  
ATOM 10484  C C5     . U A 1 326 ? 102.127 124.642 136.280 1.00 0.00 ? 326 U A C5     1  
ATOM 10485  C C6     . U A 1 326 ? 100.843 124.678 136.652 1.00 0.00 ? 326 U A C6     1  
ATOM 10486  H "H5'"  . U A 1 326 ? 97.552  122.107 137.559 1.00 0.00 ? 326 U A "H5'"  1  
ATOM 10487  H "H5''" . U A 1 326 ? 96.863  122.176 136.121 1.00 0.00 ? 326 U A "H5''" 1  
ATOM 10488  H "H4'"  . U A 1 326 ? 96.454  124.155 137.255 1.00 0.00 ? 326 U A "H4'"  1  
ATOM 10489  H "H3'"  . U A 1 326 ? 98.220  124.557 135.076 1.00 0.00 ? 326 U A "H3'"  1  
ATOM 10490  H "H2'"  . U A 1 326 ? 98.275  126.808 135.522 1.00 0.00 ? 326 U A "H2'"  1  
ATOM 10491  H "HO2'" . U A 1 326 ? 96.920  127.787 137.028 1.00 0.00 ? 326 U A "HO2'" 1  
ATOM 10492  H "H1'"  . U A 1 326 ? 98.632  126.511 138.070 1.00 0.00 ? 326 U A "H1'"  1  
ATOM 10493  H H3     . U A 1 326 ? 102.612 127.854 136.367 1.00 0.00 ? 326 U A H3     1  
ATOM 10494  H H5     . U A 1 326 ? 102.562 123.783 136.095 1.00 0.00 ? 326 U A H5     1  
ATOM 10495  H H6     . U A 1 326 ? 100.363 123.828 136.729 1.00 0.00 ? 326 U A H6     1  
ATOM 10496  P P      . G A 1 327 ? 96.389  125.059 133.229 1.00 0.00 ? 327 G A P      1  
ATOM 10497  O OP1    . G A 1 327 ? 95.051  124.779 132.650 1.00 0.00 ? 327 G A OP1    1  
ATOM 10498  O OP2    . G A 1 327 ? 97.569  124.294 132.749 1.00 0.00 ? 327 G A OP2    1  
ATOM 10499  O "O5'"  . G A 1 327 ? 96.695  126.610 133.036 1.00 0.00 ? 327 G A "O5'"  1  
ATOM 10500  C "C5'"  . G A 1 327 ? 95.727  127.592 133.368 1.00 0.00 ? 327 G A "C5'"  1  
ATOM 10501  C "C4'"  . G A 1 327 ? 96.298  128.986 133.285 1.00 0.00 ? 327 G A "C4'"  1  
ATOM 10502  O "O4'"  . G A 1 327 ? 97.410  129.116 134.210 1.00 0.00 ? 327 G A "O4'"  1  
ATOM 10503  C "C3'"  . G A 1 327 ? 96.885  129.388 131.941 1.00 0.00 ? 327 G A "C3'"  1  
ATOM 10504  O "O3'"  . G A 1 327 ? 95.902  129.807 131.010 1.00 0.00 ? 327 G A "O3'"  1  
ATOM 10505  C "C2'"  . G A 1 327 ? 97.871  130.483 132.322 1.00 0.00 ? 327 G A "C2'"  1  
ATOM 10506  O "O2'"  . G A 1 327 ? 97.204  131.710 132.580 1.00 0.00 ? 327 G A "O2'"  1  
ATOM 10507  C "C1'"  . G A 1 327 ? 98.435  129.940 133.637 1.00 0.00 ? 327 G A "C1'"  1  
ATOM 10508  N N9     . G A 1 327 ? 99.678  129.172 133.432 1.00 0.00 ? 327 G A N9     1  
ATOM 10509  C C8     . G A 1 327 ? 99.835  127.809 133.517 1.00 0.00 ? 327 G A C8     1  
ATOM 10510  N N7     . G A 1 327 ? 101.059 127.419 133.284 1.00 0.00 ? 327 G A N7     1  
ATOM 10511  C C5     . G A 1 327 ? 101.751 128.594 133.032 1.00 0.00 ? 327 G A C5     1  
ATOM 10512  C C6     . G A 1 327 ? 103.119 128.804 132.717 1.00 0.00 ? 327 G A C6     1  
ATOM 10513  O O6     . G A 1 327 ? 104.020 127.966 132.593 1.00 0.00 ? 327 G A O6     1  
ATOM 10514  N N1     . G A 1 327 ? 103.402 130.156 132.539 1.00 0.00 ? 327 G A N1     1  
ATOM 10515  C C2     . G A 1 327 ? 102.485 131.174 132.650 1.00 0.00 ? 327 G A C2     1  
ATOM 10516  N N2     . G A 1 327 ? 102.949 132.417 132.442 1.00 0.00 ? 327 G A N2     1  
ATOM 10517  N N3     . G A 1 327 ? 101.209 130.991 132.943 1.00 0.00 ? 327 G A N3     1  
ATOM 10518  C C4     . G A 1 327 ? 100.914 129.686 133.119 1.00 0.00 ? 327 G A C4     1  
ATOM 10519  H "H5'"  . G A 1 327 ? 95.406  127.431 134.279 1.00 0.00 ? 327 G A "H5'"  1  
ATOM 10520  H "H5''" . G A 1 327 ? 94.971  127.518 132.746 1.00 0.00 ? 327 G A "H5''" 1  
ATOM 10521  H "H4'"  . G A 1 327 ? 95.602  129.630 133.531 1.00 0.00 ? 327 G A "H4'"  1  
ATOM 10522  H "H3'"  . G A 1 327 ? 97.380  128.628 131.566 1.00 0.00 ? 327 G A "H3'"  1  
ATOM 10523  H "H2'"  . G A 1 327 ? 98.573  130.586 131.647 1.00 0.00 ? 327 G A "H2'"  1  
ATOM 10524  H "HO2'" . G A 1 327 ? 97.871  132.407 132.754 1.00 0.00 ? 327 G A "HO2'" 1  
ATOM 10525  H "H1'"  . G A 1 327 ? 98.609  130.686 134.248 1.00 0.00 ? 327 G A "H1'"  1  
ATOM 10526  H H8     . G A 1 327 ? 99.103  127.193 133.728 1.00 0.00 ? 327 G A H8     1  
ATOM 10527  H H1     . G A 1 327 ? 104.325 130.398 132.317 1.00 0.00 ? 327 G A H1     1  
ATOM 10528  H H21    . G A 1 327 ? 103.892 132.561 132.224 1.00 0.00 ? 327 G A H21    1  
ATOM 10529  H H22    . G A 1 327 ? 102.339 133.183 132.508 1.00 0.00 ? 327 G A H22    1  
ATOM 10530  P P      . C A 1 328 ? 96.140  129.592 129.435 1.00 0.00 ? 328 C A P      1  
ATOM 10531  O OP1    . C A 1 328 ? 94.873  129.919 128.731 1.00 0.00 ? 328 C A OP1    1  
ATOM 10532  O OP2    . C A 1 328 ? 96.765  128.262 129.237 1.00 0.00 ? 328 C A OP2    1  
ATOM 10533  O "O5'"  . C A 1 328 ? 97.214  130.705 129.051 1.00 0.00 ? 328 C A "O5'"  1  
ATOM 10534  C "C5'"  . C A 1 328 ? 96.893  132.087 129.123 1.00 0.00 ? 328 C A "C5'"  1  
ATOM 10535  C "C4'"  . C A 1 328 ? 98.101  132.953 128.867 1.00 0.00 ? 328 C A "C4'"  1  
ATOM 10536  O "O4'"  . C A 1 328 ? 99.113  132.701 129.876 1.00 0.00 ? 328 C A "O4'"  1  
ATOM 10537  C "C3'"  . C A 1 328 ? 98.825  132.723 127.550 1.00 0.00 ? 328 C A "C3'"  1  
ATOM 10538  O "O3'"  . C A 1 328 ? 98.211  133.385 126.457 1.00 0.00 ? 328 C A "O3'"  1  
ATOM 10539  C "C2'"  . C A 1 328 ? 100.233 133.218 127.853 1.00 0.00 ? 328 C A "C2'"  1  
ATOM 10540  O "O2'"  . C A 1 328 ? 100.298 134.638 127.815 1.00 0.00 ? 328 C A "O2'"  1  
ATOM 10541  C "C1'"  . C A 1 328 ? 100.416 132.752 129.298 1.00 0.00 ? 328 C A "C1'"  1  
ATOM 10542  N N1     . C A 1 328 ? 101.078 131.426 129.380 1.00 0.00 ? 328 C A N1     1  
ATOM 10543  C C2     . C A 1 328 ? 102.461 131.360 129.180 1.00 0.00 ? 328 C A C2     1  
ATOM 10544  O O2     . C A 1 328 ? 103.088 132.401 128.939 1.00 0.00 ? 328 C A O2     1  
ATOM 10545  N N3     . C A 1 328 ? 103.088 130.163 129.252 1.00 0.00 ? 328 C A N3     1  
ATOM 10546  C C4     . C A 1 328 ? 102.393 129.058 129.513 1.00 0.00 ? 328 C A C4     1  
ATOM 10547  N N4     . C A 1 328 ? 103.053 127.899 129.573 1.00 0.00 ? 328 C A N4     1  
ATOM 10548  C C5     . C A 1 328 ? 100.984 129.091 129.720 1.00 0.00 ? 328 C A C5     1  
ATOM 10549  C C6     . C A 1 328 ? 100.374 130.280 129.649 1.00 0.00 ? 328 C A C6     1  
ATOM 10550  H "H5'"  . C A 1 328 ? 96.538  132.287 130.017 1.00 0.00 ? 328 C A "H5'"  1  
ATOM 10551  H "H5''" . C A 1 328 ? 96.206  132.290 128.455 1.00 0.00 ? 328 C A "H5''" 1  
ATOM 10552  H "H4'"  . C A 1 328 ? 97.828  133.894 128.919 1.00 0.00 ? 328 C A "H4'"  1  
ATOM 10553  H "H3'"  . C A 1 328 ? 98.857  131.760 127.367 1.00 0.00 ? 328 C A "H3'"  1  
ATOM 10554  H "H2'"  . C A 1 328 ? 100.894 132.809 127.257 1.00 0.00 ? 328 C A "H2'"  1  
ATOM 10555  H "HO2'" . C A 1 328 ? 99.537  134.979 127.304 1.00 0.00 ? 328 C A "HO2'" 1  
ATOM 10556  H "H1'"  . C A 1 328 ? 100.949 133.410 129.787 1.00 0.00 ? 328 C A "H1'"  1  
ATOM 10557  H H41    . C A 1 328 ? 104.023 127.879 129.427 1.00 0.00 ? 328 C A H41    1  
ATOM 10558  H H42    . C A 1 328 ? 102.570 127.070 129.762 1.00 0.00 ? 328 C A H42    1  
ATOM 10559  H H5     . C A 1 328 ? 100.479 128.271 129.913 1.00 0.00 ? 328 C A H5     1  
ATOM 10560  H H6     . C A 1 328 ? 99.406  130.324 129.789 1.00 0.00 ? 328 C A H6     1  
ATOM 10561  P P      . A A 1 329 ? 97.289  132.563 125.428 1.00 0.00 ? 329 A A P      1  
ATOM 10562  O OP1    . A A 1 329 ? 96.618  133.537 124.531 1.00 0.00 ? 329 A A OP1    1  
ATOM 10563  O OP2    . A A 1 329 ? 96.472  131.602 126.211 1.00 0.00 ? 329 A A OP2    1  
ATOM 10564  O "O5'"  . A A 1 329 ? 98.332  131.728 124.559 1.00 0.00 ? 329 A A "O5'"  1  
ATOM 10565  C "C5'"  . A A 1 329 ? 98.475  131.966 123.167 1.00 0.00 ? 329 A A "C5'"  1  
ATOM 10566  C "C4'"  . A A 1 329 ? 99.822  132.561 122.842 1.00 0.00 ? 329 A A "C4'"  1  
ATOM 10567  O "O4'"  . A A 1 329 ? 100.834 131.807 123.565 1.00 0.00 ? 329 A A "O4'"  1  
ATOM 10568  C "C3'"  . A A 1 329 ? 100.232 132.526 121.378 1.00 0.00 ? 329 A A "C3'"  1  
ATOM 10569  O "O3'"  . A A 1 329 ? 101.127 133.567 121.027 1.00 0.00 ? 329 A A "O3'"  1  
ATOM 10570  C "C2'"  . A A 1 329 ? 100.975 131.198 121.275 1.00 0.00 ? 329 A A "C2'"  1  
ATOM 10571  O "O2'"  . A A 1 329 ? 101.987 131.249 120.280 1.00 0.00 ? 329 A A "O2'"  1  
ATOM 10572  C "C1'"  . A A 1 329 ? 101.640 131.104 122.650 1.00 0.00 ? 329 A A "C1'"  1  
ATOM 10573  N N9     . A A 1 329 ? 101.741 129.711 123.125 1.00 0.00 ? 329 A A N9     1  
ATOM 10574  C C8     . A A 1 329 ? 101.263 128.575 122.518 1.00 0.00 ? 329 A A C8     1  
ATOM 10575  N N7     . A A 1 329 ? 101.508 127.476 123.186 1.00 0.00 ? 329 A A N7     1  
ATOM 10576  C C5     . A A 1 329 ? 102.194 127.915 124.310 1.00 0.00 ? 329 A A C5     1  
ATOM 10577  C C6     . A A 1 329 ? 102.735 127.235 125.416 1.00 0.00 ? 329 A A C6     1  
ATOM 10578  N N6     . A A 1 329 ? 102.668 125.912 125.576 1.00 0.00 ? 329 A A N6     1  
ATOM 10579  N N1     . A A 1 329 ? 103.357 127.970 126.363 1.00 0.00 ? 329 A A N1     1  
ATOM 10580  C C2     . A A 1 329 ? 103.425 129.298 126.203 1.00 0.00 ? 329 A A C2     1  
ATOM 10581  N N3     . A A 1 329 ? 102.956 130.050 125.209 1.00 0.00 ? 329 A A N3     1  
ATOM 10582  C C4     . A A 1 329 ? 102.344 129.289 124.285 1.00 0.00 ? 329 A A C4     1  
ATOM 10583  H "H5'"  . A A 1 329 ? 97.774  132.585 122.874 1.00 0.00 ? 329 A A "H5'"  1  
ATOM 10584  H "H5''" . A A 1 329 ? 98.375  131.119 122.685 1.00 0.00 ? 329 A A "H5''" 1  
ATOM 10585  H "H4'"  . A A 1 329 ? 99.835  133.497 123.134 1.00 0.00 ? 329 A A "H4'"  1  
ATOM 10586  H "H3'"  . A A 1 329 ? 99.427  132.487 120.820 1.00 0.00 ? 329 A A "H3'"  1  
ATOM 10587  H "H2'"  . A A 1 329 ? 100.357 130.451 121.127 1.00 0.00 ? 329 A A "H2'"  1  
ATOM 10588  H "HO2'" . A A 1 329 ? 102.458 130.391 120.260 1.00 0.00 ? 329 A A "HO2'" 1  
ATOM 10589  H "H1'"  . A A 1 329 ? 102.536 131.500 122.606 1.00 0.00 ? 329 A A "H1'"  1  
ATOM 10590  H H8     . A A 1 329 ? 100.783 128.586 121.663 1.00 0.00 ? 329 A A H8     1  
ATOM 10591  H H61    . A A 1 329 ? 103.064 125.494 126.370 1.00 0.00 ? 329 A A H61    1  
ATOM 10592  H H62    . A A 1 329 ? 102.221 125.358 124.903 1.00 0.00 ? 329 A A H62    1  
ATOM 10593  H H2     . A A 1 329 ? 103.886 129.785 126.918 1.00 0.00 ? 329 A A H2     1  
ATOM 10594  P P      . G A 1 330 ? 102.359 133.983 121.981 1.00 0.00 ? 330 G A P      1  
ATOM 10595  O OP1    . G A 1 330 ? 103.582 133.281 121.516 1.00 0.00 ? 330 G A OP1    1  
ATOM 10596  O OP2    . G A 1 330 ? 101.818 133.698 123.335 1.00 0.00 ? 330 G A OP2    1  
ATOM 10597  O "O5'"  . G A 1 330 ? 102.621 135.552 121.876 1.00 0.00 ? 330 G A "O5'"  1  
ATOM 10598  C "C5'"  . G A 1 330 ? 103.132 136.126 120.682 1.00 0.00 ? 330 G A "C5'"  1  
ATOM 10599  C "C4'"  . G A 1 330 ? 104.597 135.823 120.503 1.00 0.00 ? 330 G A "C4'"  1  
ATOM 10600  O "O4'"  . G A 1 330 ? 105.219 135.616 121.797 1.00 0.00 ? 330 G A "O4'"  1  
ATOM 10601  C "C3'"  . G A 1 330 ? 104.926 134.555 119.728 1.00 0.00 ? 330 G A "C3'"  1  
ATOM 10602  O "O3'"  . G A 1 330 ? 104.858 134.731 118.323 1.00 0.00 ? 330 G A "O3'"  1  
ATOM 10603  C "C2'"  . G A 1 330 ? 106.319 134.207 120.233 1.00 0.00 ? 330 G A "C2'"  1  
ATOM 10604  O "O2'"  . G A 1 330 ? 107.306 135.028 119.627 1.00 0.00 ? 330 G A "O2'"  1  
ATOM 10605  C "C1'"  . G A 1 330 ? 106.206 134.577 121.714 1.00 0.00 ? 330 G A "C1'"  1  
ATOM 10606  N N9     . G A 1 330 ? 105.828 133.422 122.548 1.00 0.00 ? 330 G A N9     1  
ATOM 10607  C C8     . G A 1 330 ? 104.618 133.195 123.158 1.00 0.00 ? 330 G A C8     1  
ATOM 10608  N N7     . G A 1 330 ? 104.584 132.081 123.833 1.00 0.00 ? 330 G A N7     1  
ATOM 10609  C C5     . G A 1 330 ? 105.848 131.535 123.661 1.00 0.00 ? 330 G A C5     1  
ATOM 10610  C C6     . G A 1 330 ? 106.403 130.329 124.158 1.00 0.00 ? 330 G A C6     1  
ATOM 10611  O O6     . G A 1 330 ? 105.873 129.474 124.877 1.00 0.00 ? 330 G A O6     1  
ATOM 10612  N N1     . G A 1 330 ? 107.723 130.162 123.742 1.00 0.00 ? 330 G A N1     1  
ATOM 10613  C C2     . G A 1 330 ? 108.415 131.042 122.945 1.00 0.00 ? 330 G A C2     1  
ATOM 10614  N N2     . G A 1 330 ? 109.679 130.706 122.649 1.00 0.00 ? 330 G A N2     1  
ATOM 10615  N N3     . G A 1 330 ? 107.908 132.169 122.474 1.00 0.00 ? 330 G A N3     1  
ATOM 10616  C C4     . G A 1 330 ? 106.629 132.351 122.870 1.00 0.00 ? 330 G A C4     1  
ATOM 10617  H "H5'"  . G A 1 330 ? 103.008 137.096 120.714 1.00 0.00 ? 330 G A "H5'"  1  
ATOM 10618  H "H5''" . G A 1 330 ? 102.632 135.766 119.916 1.00 0.00 ? 330 G A "H5''" 1  
ATOM 10619  H "H4'"  . G A 1 330 ? 105.028 136.584 120.059 1.00 0.00 ? 330 G A "H4'"  1  
ATOM 10620  H "H3'"  . G A 1 330 ? 104.302 133.846 119.992 1.00 0.00 ? 330 G A "H3'"  1  
ATOM 10621  H "H2'"  . G A 1 330 ? 106.518 133.255 120.118 1.00 0.00 ? 330 G A "H2'"  1  
ATOM 10622  H "HO2'" . G A 1 330 ? 106.939 135.410 118.803 1.00 0.00 ? 330 G A "HO2'" 1  
ATOM 10623  H "H1'"  . G A 1 330 ? 107.062 134.938 122.024 1.00 0.00 ? 330 G A "H1'"  1  
ATOM 10624  H H8     . G A 1 330 ? 103.858 133.810 123.092 1.00 0.00 ? 330 G A H8     1  
ATOM 10625  H H1     . G A 1 330 ? 108.189 129.353 124.039 1.00 0.00 ? 330 G A H1     1  
ATOM 10626  H H21    . G A 1 330 ? 110.062 129.873 122.993 1.00 0.00 ? 330 G A H21    1  
ATOM 10627  H H22    . G A 1 330 ? 110.223 131.296 122.084 1.00 0.00 ? 330 G A H22    1  
ATOM 10628  P P      . U A 1 331 ? 104.461 133.497 117.373 1.00 0.00 ? 331 U A P      1  
ATOM 10629  O OP1    . U A 1 331 ? 104.296 134.015 115.989 1.00 0.00 ? 331 U A OP1    1  
ATOM 10630  O OP2    . U A 1 331 ? 103.347 132.762 118.017 1.00 0.00 ? 331 U A OP2    1  
ATOM 10631  O "O5'"  . U A 1 331 ? 105.750 132.561 117.396 1.00 0.00 ? 331 U A "O5'"  1  
ATOM 10632  C "C5'"  . U A 1 331 ? 106.980 133.000 116.837 1.00 0.00 ? 331 U A "C5'"  1  
ATOM 10633  C "C4'"  . U A 1 331 ? 108.084 131.998 117.073 1.00 0.00 ? 331 U A "C4'"  1  
ATOM 10634  O "O4'"  . U A 1 331 ? 108.320 131.847 118.498 1.00 0.00 ? 331 U A "O4'"  1  
ATOM 10635  C "C3'"  . U A 1 331 ? 107.822 130.583 116.589 1.00 0.00 ? 331 U A "C3'"  1  
ATOM 10636  O "O3'"  . U A 1 331 ? 108.063 130.416 115.202 1.00 0.00 ? 331 U A "O3'"  1  
ATOM 10637  C "C2'"  . U A 1 331 ? 108.743 129.751 117.473 1.00 0.00 ? 331 U A "C2'"  1  
ATOM 10638  O "O2'"  . U A 1 331 ? 110.087 129.819 117.023 1.00 0.00 ? 331 U A "O2'"  1  
ATOM 10639  C "C1'"  . U A 1 331 ? 108.626 130.489 118.808 1.00 0.00 ? 331 U A "C1'"  1  
ATOM 10640  N N1     . U A 1 331 ? 107.582 129.907 119.683 1.00 0.00 ? 331 U A N1     1  
ATOM 10641  C C2     . U A 1 331 ? 107.886 128.724 120.333 1.00 0.00 ? 331 U A C2     1  
ATOM 10642  O O2     . U A 1 331 ? 108.959 128.159 120.214 1.00 0.00 ? 331 U A O2     1  
ATOM 10643  N N3     . U A 1 331 ? 106.889 128.224 121.133 1.00 0.00 ? 331 U A N3     1  
ATOM 10644  C C4     . U A 1 331 ? 105.641 128.773 121.347 1.00 0.00 ? 331 U A C4     1  
ATOM 10645  O O4     . U A 1 331 ? 104.849 128.198 122.097 1.00 0.00 ? 331 U A O4     1  
ATOM 10646  C C5     . U A 1 331 ? 105.395 129.993 120.642 1.00 0.00 ? 331 U A C5     1  
ATOM 10647  C C6     . U A 1 331 ? 106.350 130.503 119.859 1.00 0.00 ? 331 U A C6     1  
ATOM 10648  H "H5'"  . U A 1 331 ? 107.230 133.854 117.247 1.00 0.00 ? 331 U A "H5'"  1  
ATOM 10649  H "H5''" . U A 1 331 ? 106.866 133.126 115.873 1.00 0.00 ? 331 U A "H5''" 1  
ATOM 10650  H "H4'"  . U A 1 331 ? 108.904 132.331 116.649 1.00 0.00 ? 331 U A "H4'"  1  
ATOM 10651  H "H3'"  . U A 1 331 ? 106.891 130.343 116.783 1.00 0.00 ? 331 U A "H3'"  1  
ATOM 10652  H "H2'"  . U A 1 331 ? 108.429 128.824 117.548 1.00 0.00 ? 331 U A "H2'"  1  
ATOM 10653  H "HO2'" . U A 1 331 ? 110.637 129.229 117.576 1.00 0.00 ? 331 U A "HO2'" 1  
ATOM 10654  H "H1'"  . U A 1 331 ? 109.490 130.458 119.273 1.00 0.00 ? 331 U A "H1'"  1  
ATOM 10655  H H3     . U A 1 331 ? 107.084 127.387 121.602 1.00 0.00 ? 331 U A H3     1  
ATOM 10656  H H5     . U A 1 331 ? 104.534 130.452 120.737 1.00 0.00 ? 331 U A H5     1  
ATOM 10657  H H6     . U A 1 331 ? 106.156 131.340 119.387 1.00 0.00 ? 331 U A H6     1  
ATOM 10658  P P      . C A 1 332 ? 107.017 129.605 114.291 1.00 0.00 ? 332 C A P      1  
ATOM 10659  O OP1    . C A 1 332 ? 107.067 130.173 112.920 1.00 0.00 ? 332 C A OP1    1  
ATOM 10660  O OP2    . C A 1 332 ? 105.722 129.549 115.015 1.00 0.00 ? 332 C A OP2    1  
ATOM 10661  O "O5'"  . C A 1 332 ? 107.615 128.130 114.235 1.00 0.00 ? 332 C A "O5'"  1  
ATOM 10662  C "C5'"  . C A 1 332 ? 108.459 127.725 113.167 1.00 0.00 ? 332 C A "C5'"  1  
ATOM 10663  C "C4'"  . C A 1 332 ? 109.304 126.533 113.546 1.00 0.00 ? 332 C A "C4'"  1  
ATOM 10664  O "O4'"  . C A 1 332 ? 109.838 126.692 114.885 1.00 0.00 ? 332 C A "O4'"  1  
ATOM 10665  C "C3'"  . C A 1 332 ? 108.588 125.192 113.592 1.00 0.00 ? 332 C A "C3'"  1  
ATOM 10666  O "O3'"  . C A 1 332 ? 108.393 124.626 112.308 1.00 0.00 ? 332 C A "O3'"  1  
ATOM 10667  C "C2'"  . C A 1 332 ? 109.475 124.413 114.551 1.00 0.00 ? 332 C A "C2'"  1  
ATOM 10668  O "O2'"  . C A 1 332 ? 110.659 123.965 113.909 1.00 0.00 ? 332 C A "O2'"  1  
ATOM 10669  C "C1'"  . C A 1 332 ? 109.835 125.503 115.570 1.00 0.00 ? 332 C A "C1'"  1  
ATOM 10670  N N1     . C A 1 332 ? 108.840 125.601 116.666 1.00 0.00 ? 332 C A N1     1  
ATOM 10671  C C2     . C A 1 332 ? 108.970 124.737 117.761 1.00 0.00 ? 332 C A C2     1  
ATOM 10672  O O2     . C A 1 332 ? 109.905 123.921 117.782 1.00 0.00 ? 332 C A O2     1  
ATOM 10673  N N3     . C A 1 332 ? 108.076 124.806 118.774 1.00 0.00 ? 332 C A N3     1  
ATOM 10674  C C4     . C A 1 332 ? 107.081 125.691 118.728 1.00 0.00 ? 332 C A C4     1  
ATOM 10675  N N4     . C A 1 332 ? 106.222 125.723 119.750 1.00 0.00 ? 332 C A N4     1  
ATOM 10676  C C5     . C A 1 332 ? 106.921 126.582 117.630 1.00 0.00 ? 332 C A C5     1  
ATOM 10677  C C6     . C A 1 332 ? 107.812 126.506 116.634 1.00 0.00 ? 332 C A C6     1  
ATOM 10678  H "H5'"  . C A 1 332 ? 109.048 128.470 112.926 1.00 0.00 ? 332 C A "H5'"  1  
ATOM 10679  H "H5''" . C A 1 332 ? 107.905 127.491 112.394 1.00 0.00 ? 332 C A "H5''" 1  
ATOM 10680  H "H4'"  . C A 1 332 ? 110.053 126.465 112.918 1.00 0.00 ? 332 C A "H4'"  1  
ATOM 10681  H "H3'"  . C A 1 332 ? 107.700 125.313 113.989 1.00 0.00 ? 332 C A "H3'"  1  
ATOM 10682  H "H2'"  . C A 1 332 ? 108.987 123.674 114.969 1.00 0.00 ? 332 C A "H2'"  1  
ATOM 10683  H "HO2'" . C A 1 332 ? 111.205 123.470 114.554 1.00 0.00 ? 332 C A "HO2'" 1  
ATOM 10684  H "H1'"  . C A 1 332 ? 110.719 125.312 115.947 1.00 0.00 ? 332 C A "H1'"  1  
ATOM 10685  H H41    . C A 1 332 ? 106.335 125.107 120.504 1.00 0.00 ? 332 C A H41    1  
ATOM 10686  H H42    . C A 1 332 ? 105.480 126.362 119.746 1.00 0.00 ? 332 C A H42    1  
ATOM 10687  H H5     . C A 1 332 ? 106.186 127.230 117.605 1.00 0.00 ? 332 C A H5     1  
ATOM 10688  H H6     . C A 1 332 ? 107.719 127.110 115.869 1.00 0.00 ? 332 C A H6     1  
ATOM 10689  P P      . G A 1 333 ? 106.908 124.414 111.747 1.00 0.00 ? 333 G A P      1  
ATOM 10690  O OP1    . G A 1 333 ? 106.925 124.528 110.266 1.00 0.00 ? 333 G A OP1    1  
ATOM 10691  O OP2    . G A 1 333 ? 106.119 125.383 112.549 1.00 0.00 ? 333 G A OP2    1  
ATOM 10692  O "O5'"  . G A 1 333 ? 106.413 122.945 112.122 1.00 0.00 ? 333 G A "O5'"  1  
ATOM 10693  C "C5'"  . G A 1 333 ? 107.037 121.799 111.562 1.00 0.00 ? 333 G A "C5'"  1  
ATOM 10694  C "C4'"  . G A 1 333 ? 107.066 120.651 112.541 1.00 0.00 ? 333 G A "C4'"  1  
ATOM 10695  O "O4'"  . G A 1 333 ? 107.791 121.039 113.735 1.00 0.00 ? 333 G A "O4'"  1  
ATOM 10696  C "C3'"  . G A 1 333 ? 105.717 120.183 113.062 1.00 0.00 ? 333 G A "C3'"  1  
ATOM 10697  O "O3'"  . G A 1 333 ? 105.049 119.309 112.167 1.00 0.00 ? 333 G A "O3'"  1  
ATOM 10698  C "C2'"  . G A 1 333 ? 106.081 119.533 114.389 1.00 0.00 ? 333 G A "C2'"  1  
ATOM 10699  O "O2'"  . G A 1 333 ? 106.637 118.240 114.196 1.00 0.00 ? 333 G A "O2'"  1  
ATOM 10700  C "C1'"  . G A 1 333 ? 107.176 120.473 114.899 1.00 0.00 ? 333 G A "C1'"  1  
ATOM 10701  N N9     . G A 1 333 ? 106.634 121.533 115.770 1.00 0.00 ? 333 G A N9     1  
ATOM 10702  C C8     . G A 1 333 ? 106.495 122.867 115.467 1.00 0.00 ? 333 G A C8     1  
ATOM 10703  N N7     . G A 1 333 ? 105.985 123.564 116.448 1.00 0.00 ? 333 G A N7     1  
ATOM 10704  C C5     . G A 1 333 ? 105.776 122.634 117.457 1.00 0.00 ? 333 G A C5     1  
ATOM 10705  C C6     . G A 1 333 ? 105.244 122.800 118.763 1.00 0.00 ? 333 G A C6     1  
ATOM 10706  O O6     . G A 1 333 ? 104.836 123.833 119.302 1.00 0.00 ? 333 G A O6     1  
ATOM 10707  N N1     . G A 1 333 ? 105.210 121.595 119.459 1.00 0.00 ? 333 G A N1     1  
ATOM 10708  C C2     . G A 1 333 ? 105.634 120.386 118.962 1.00 0.00 ? 333 G A C2     1  
ATOM 10709  N N2     . G A 1 333 ? 105.520 119.332 119.785 1.00 0.00 ? 333 G A N2     1  
ATOM 10710  N N3     . G A 1 333 ? 106.130 120.219 117.748 1.00 0.00 ? 333 G A N3     1  
ATOM 10711  C C4     . G A 1 333 ? 106.173 121.377 117.056 1.00 0.00 ? 333 G A C4     1  
ATOM 10712  H "H5'"  . G A 1 333 ? 107.953 122.028 111.307 1.00 0.00 ? 333 G A "H5'"  1  
ATOM 10713  H "H5''" . G A 1 333 ? 106.540 121.526 110.762 1.00 0.00 ? 333 G A "H5''" 1  
ATOM 10714  H "H4'"  . G A 1 333 ? 107.526 119.890 112.121 1.00 0.00 ? 333 G A "H4'"  1  
ATOM 10715  H "H3'"  . G A 1 333 ? 105.149 120.964 113.232 1.00 0.00 ? 333 G A "H3'"  1  
ATOM 10716  H "H2'"  . G A 1 333 ? 105.315 119.511 115.002 1.00 0.00 ? 333 G A "H2'"  1  
ATOM 10717  H "HO2'" . G A 1 333 ? 106.797 117.827 115.072 1.00 0.00 ? 333 G A "HO2'" 1  
ATOM 10718  H "H1'"  . G A 1 333 ? 107.845 119.954 115.391 1.00 0.00 ? 333 G A "H1'"  1  
ATOM 10719  H H8     . G A 1 333 ? 106.750 123.254 114.605 1.00 0.00 ? 333 G A H8     1  
ATOM 10720  H H1     . G A 1 333 ? 104.855 121.612 120.372 1.00 0.00 ? 333 G A H1     1  
ATOM 10721  H H21    . G A 1 333 ? 105.153 119.448 120.687 1.00 0.00 ? 333 G A H21    1  
ATOM 10722  H H22    . G A 1 333 ? 105.807 118.443 119.484 1.00 0.00 ? 333 G A H22    1  
ATOM 10723  P P      . G A 1 334 ? 103.443 119.272 112.123 1.00 0.00 ? 334 G A P      1  
ATOM 10724  O OP1    . G A 1 334 ? 103.032 118.437 110.965 1.00 0.00 ? 334 G A OP1    1  
ATOM 10725  O OP2    . G A 1 334 ? 102.947 120.668 112.233 1.00 0.00 ? 334 G A OP2    1  
ATOM 10726  O "O5'"  . G A 1 334 ? 103.038 118.499 113.456 1.00 0.00 ? 334 G A "O5'"  1  
ATOM 10727  C "C5'"  . G A 1 334 ? 103.358 117.127 113.630 1.00 0.00 ? 334 G A "C5'"  1  
ATOM 10728  C "C4'"  . G A 1 334 ? 102.993 116.643 115.011 1.00 0.00 ? 334 G A "C4'"  1  
ATOM 10729  O "O4'"  . G A 1 334 ? 103.752 117.375 116.005 1.00 0.00 ? 334 G A "O4'"  1  
ATOM 10730  C "C3'"  . G A 1 334 ? 101.544 116.845 115.426 1.00 0.00 ? 334 G A "C3'"  1  
ATOM 10731  O "O3'"  . G A 1 334 ? 100.676 115.846 114.916 1.00 0.00 ? 334 G A "O3'"  1  
ATOM 10732  C "C2'"  . G A 1 334 ? 101.635 116.855 116.946 1.00 0.00 ? 334 G A "C2'"  1  
ATOM 10733  O "O2'"  . G A 1 334 ? 101.765 115.541 117.465 1.00 0.00 ? 334 G A "O2'"  1  
ATOM 10734  C "C1'"  . G A 1 334 ? 102.947 117.609 117.168 1.00 0.00 ? 334 G A "C1'"  1  
ATOM 10735  N N9     . G A 1 334 ? 102.730 119.052 117.379 1.00 0.00 ? 334 G A N9     1  
ATOM 10736  C C8     . G A 1 334 ? 103.026 120.074 116.511 1.00 0.00 ? 334 G A C8     1  
ATOM 10737  N N7     . G A 1 334 ? 102.720 121.254 116.982 1.00 0.00 ? 334 G A N7     1  
ATOM 10738  C C5     . G A 1 334 ? 102.188 120.995 118.237 1.00 0.00 ? 334 G A C5     1  
ATOM 10739  C C6     . G A 1 334 ? 101.678 121.882 119.220 1.00 0.00 ? 334 G A C6     1  
ATOM 10740  O O6     . G A 1 334 ? 101.592 123.114 119.176 1.00 0.00 ? 334 G A O6     1  
ATOM 10741  N N1     . G A 1 334 ? 101.241 121.197 120.348 1.00 0.00 ? 334 G A N1     1  
ATOM 10742  C C2     . G A 1 334 ? 101.282 119.834 120.512 1.00 0.00 ? 334 G A C2     1  
ATOM 10743  N N2     . G A 1 334 ? 100.812 119.358 121.673 1.00 0.00 ? 334 G A N2     1  
ATOM 10744  N N3     . G A 1 334 ? 101.756 118.997 119.603 1.00 0.00 ? 334 G A N3     1  
ATOM 10745  C C4     . G A 1 334 ? 102.187 119.641 118.498 1.00 0.00 ? 334 G A C4     1  
ATOM 10746  H "H5'"  . G A 1 334 ? 104.320 117.002 113.489 1.00 0.00 ? 334 G A "H5'"  1  
ATOM 10747  H "H5''" . G A 1 334 ? 102.867 116.599 112.963 1.00 0.00 ? 334 G A "H5''" 1  
ATOM 10748  H "H4'"  . G A 1 334 ? 103.213 115.690 115.081 1.00 0.00 ? 334 G A "H4'"  1  
ATOM 10749  H "H3'"  . G A 1 334 ? 101.241 117.723 115.118 1.00 0.00 ? 334 G A "H3'"  1  
ATOM 10750  H "H2'"  . G A 1 334 ? 100.877 117.331 117.348 1.00 0.00 ? 334 G A "H2'"  1  
ATOM 10751  H "HO2'" . G A 1 334 ? 101.761 115.582 118.443 1.00 0.00 ? 334 G A "HO2'" 1  
ATOM 10752  H "H1'"  . G A 1 334 ? 103.414 117.230 117.943 1.00 0.00 ? 334 G A "H1'"  1  
ATOM 10753  H H8     . G A 1 334 ? 103.428 119.935 115.629 1.00 0.00 ? 334 G A H8     1  
ATOM 10754  H H1     . G A 1 334 ? 100.870 121.732 121.084 1.00 0.00 ? 334 G A H1     1  
ATOM 10755  H H21    . G A 1 334 ? 100.462 119.971 122.351 1.00 0.00 ? 334 G A H21    1  
ATOM 10756  H H22    . G A 1 334 ? 100.818 118.392 121.845 1.00 0.00 ? 334 G A H22    1  
ATOM 10757  P P      . A A 1 335 ? 99.270  116.259 114.254 1.00 0.00 ? 335 A A P      1  
ATOM 10758  O OP1    . A A 1 335 ? 98.948  115.265 113.200 1.00 0.00 ? 335 A A OP1    1  
ATOM 10759  O OP2    . A A 1 335 ? 99.331  117.701 113.908 1.00 0.00 ? 335 A A OP2    1  
ATOM 10760  O "O5'"  . A A 1 335 ? 98.220  116.081 115.439 1.00 0.00 ? 335 A A "O5'"  1  
ATOM 10761  C "C5'"  . A A 1 335 ? 98.006  114.811 116.038 1.00 0.00 ? 335 A A "C5'"  1  
ATOM 10762  C "C4'"  . A A 1 335 ? 96.818  114.831 116.968 1.00 0.00 ? 335 A A "C4'"  1  
ATOM 10763  O "O4'"  . A A 1 335 ? 97.000  115.845 117.995 1.00 0.00 ? 335 A A "O4'"  1  
ATOM 10764  C "C3'"  . A A 1 335 ? 95.482  115.190 116.336 1.00 0.00 ? 335 A A "C3'"  1  
ATOM 10765  O "O3'"  . A A 1 335 ? 94.873  114.098 115.667 1.00 0.00 ? 335 A A "O3'"  1  
ATOM 10766  C "C2'"  . A A 1 335 ? 94.674  115.663 117.535 1.00 0.00 ? 335 A A "C2'"  1  
ATOM 10767  O "O2'"  . A A 1 335 ? 94.190  114.566 118.295 1.00 0.00 ? 335 A A "O2'"  1  
ATOM 10768  C "C1'"  . A A 1 335 ? 95.739  116.396 118.345 1.00 0.00 ? 335 A A "C1'"  1  
ATOM 10769  N N9     . A A 1 335 ? 95.740  117.847 118.078 1.00 0.00 ? 335 A A N9     1  
ATOM 10770  C C8     . A A 1 335 ? 96.467  118.532 117.136 1.00 0.00 ? 335 A A C8     1  
ATOM 10771  N N7     . A A 1 335 ? 96.253  119.824 117.140 1.00 0.00 ? 335 A A N7     1  
ATOM 10772  C C5     . A A 1 335 ? 95.321  120.005 118.153 1.00 0.00 ? 335 A A C5     1  
ATOM 10773  C C6     . A A 1 335 ? 94.683  121.150 118.660 1.00 0.00 ? 335 A A C6     1  
ATOM 10774  N N6     . A A 1 335 ? 94.896  122.383 118.195 1.00 0.00 ? 335 A A N6     1  
ATOM 10775  N N1     . A A 1 335 ? 93.807  120.985 119.674 1.00 0.00 ? 335 A A N1     1  
ATOM 10776  C C2     . A A 1 335 ? 93.592  119.748 120.141 1.00 0.00 ? 335 A A C2     1  
ATOM 10777  N N3     . A A 1 335 ? 94.131  118.595 119.748 1.00 0.00 ? 335 A A N3     1  
ATOM 10778  C C4     . A A 1 335 ? 94.996  118.795 118.738 1.00 0.00 ? 335 A A C4     1  
ATOM 10779  H "H5'"  . A A 1 335 ? 98.805  114.558 116.546 1.00 0.00 ? 335 A A "H5'"  1  
ATOM 10780  H "H5''" . A A 1 335 ? 97.851  114.147 115.335 1.00 0.00 ? 335 A A "H5''" 1  
ATOM 10781  H "H4'"  . A A 1 335 ? 96.740  113.955 117.400 1.00 0.00 ? 335 A A "H4'"  1  
ATOM 10782  H "H3'"  . A A 1 335 ? 95.610  115.939 115.717 1.00 0.00 ? 335 A A "H3'"  1  
ATOM 10783  H "H2'"  . A A 1 335 ? 93.950  116.267 117.265 1.00 0.00 ? 335 A A "H2'"  1  
ATOM 10784  H "HO2'" . A A 1 335 ? 93.672  114.908 119.053 1.00 0.00 ? 335 A A "HO2'" 1  
ATOM 10785  H "H1'"  . A A 1 335 ? 95.587  116.240 119.301 1.00 0.00 ? 335 A A "H1'"  1  
ATOM 10786  H H8     . A A 1 335 ? 97.089  118.094 116.517 1.00 0.00 ? 335 A A H8     1  
ATOM 10787  H H61    . A A 1 335 ? 94.421  123.145 118.590 1.00 0.00 ? 335 A A H61    1  
ATOM 10788  H H62    . A A 1 335 ? 95.527  122.528 117.460 1.00 0.00 ? 335 A A H62    1  
ATOM 10789  H H2     . A A 1 335 ? 92.948  119.682 120.877 1.00 0.00 ? 335 A A H2     1  
ATOM 10790  P P      . C A 1 336 ? 94.421  114.241 114.132 1.00 0.00 ? 336 C A P      1  
ATOM 10791  O OP1    . C A 1 336 ? 93.485  113.131 113.823 1.00 0.00 ? 336 C A OP1    1  
ATOM 10792  O OP2    . C A 1 336 ? 95.642  114.421 113.307 1.00 0.00 ? 336 C A OP2    1  
ATOM 10793  O "O5'"  . C A 1 336 ? 93.597  115.604 114.097 1.00 0.00 ? 336 C A "O5'"  1  
ATOM 10794  C "C5'"  . C A 1 336 ? 92.391  115.746 114.832 1.00 0.00 ? 336 C A "C5'"  1  
ATOM 10795  C "C4'"  . C A 1 336 ? 91.893  117.171 114.818 1.00 0.00 ? 336 C A "C4'"  1  
ATOM 10796  O "O4'"  . C A 1 336 ? 92.859  118.019 115.506 1.00 0.00 ? 336 C A "O4'"  1  
ATOM 10797  C "C3'"  . C A 1 336 ? 91.769  117.823 113.450 1.00 0.00 ? 336 C A "C3'"  1  
ATOM 10798  O "O3'"  . C A 1 336 ? 90.608  117.415 112.747 1.00 0.00 ? 336 C A "O3'"  1  
ATOM 10799  C "C2'"  . C A 1 336 ? 91.709  119.302 113.856 1.00 0.00 ? 336 C A "C2'"  1  
ATOM 10800  O "O2'"  . C A 1 336 ? 90.433  119.643 114.376 1.00 0.00 ? 336 C A "O2'"  1  
ATOM 10801  C "C1'"  . C A 1 336 ? 92.757  119.348 115.008 1.00 0.00 ? 336 C A "C1'"  1  
ATOM 10802  N N1     . C A 1 336 ? 94.093  119.790 114.538 1.00 0.00 ? 336 C A N1     1  
ATOM 10803  C C2     . C A 1 336 ? 94.361  121.164 114.491 1.00 0.00 ? 336 C A C2     1  
ATOM 10804  O O2     . C A 1 336 ? 93.480  121.965 114.841 1.00 0.00 ? 336 C A O2     1  
ATOM 10805  N N3     . C A 1 336 ? 95.571  121.594 114.066 1.00 0.00 ? 336 C A N3     1  
ATOM 10806  C C4     . C A 1 336 ? 96.500  120.713 113.696 1.00 0.00 ? 336 C A C4     1  
ATOM 10807  N N4     . C A 1 336 ? 97.680  121.183 113.284 1.00 0.00 ? 336 C A N4     1  
ATOM 10808  C C5     . C A 1 336 ? 96.260  119.310 113.731 1.00 0.00 ? 336 C A C5     1  
ATOM 10809  C C6     . C A 1 336 ? 95.059  118.897 114.154 1.00 0.00 ? 336 C A C6     1  
ATOM 10810  H "H5'"  . C A 1 336 ? 92.548  115.472 115.760 1.00 0.00 ? 336 C A "H5'"  1  
ATOM 10811  H "H5''" . C A 1 336 ? 91.707  115.165 114.439 1.00 0.00 ? 336 C A "H5''" 1  
ATOM 10812  H "H4'"  . C A 1 336 ? 91.035  117.210 115.289 1.00 0.00 ? 336 C A "H4'"  1  
ATOM 10813  H "H3'"  . C A 1 336 ? 92.583  117.649 112.933 1.00 0.00 ? 336 C A "H3'"  1  
ATOM 10814  H "H2'"  . C A 1 336 ? 91.965  119.888 113.113 1.00 0.00 ? 336 C A "H2'"  1  
ATOM 10815  H "HO2'" . C A 1 336 ? 90.171  120.521 114.032 1.00 0.00 ? 336 C A "HO2'" 1  
ATOM 10816  H "H1'"  . C A 1 336 ? 92.440  119.956 115.708 1.00 0.00 ? 336 C A "H1'"  1  
ATOM 10817  H H41    . C A 1 336 ? 97.842  122.149 113.260 1.00 0.00 ? 336 C A H41    1  
ATOM 10818  H H42    . C A 1 336 ? 98.384  120.561 113.004 1.00 0.00 ? 336 C A H42    1  
ATOM 10819  H H5     . C A 1 336 ? 96.949  118.670 113.457 1.00 0.00 ? 336 C A H5     1  
ATOM 10820  H H6     . C A 1 336 ? 94.874  117.936 114.185 1.00 0.00 ? 336 C A H6     1  
ATOM 10821  P P      . C A 1 337 ? 90.570  117.479 111.141 1.00 0.00 ? 337 C A P      1  
ATOM 10822  O OP1    . C A 1 337 ? 89.431  116.650 110.674 1.00 0.00 ? 337 C A OP1    1  
ATOM 10823  O OP2    . C A 1 337 ? 91.938  117.197 110.637 1.00 0.00 ? 337 C A OP2    1  
ATOM 10824  O "O5'"  . C A 1 337 ? 90.232  119.003 110.824 1.00 0.00 ? 337 C A "O5'"  1  
ATOM 10825  C "C5'"  . C A 1 337 ? 89.011  119.585 111.255 1.00 0.00 ? 337 C A "C5'"  1  
ATOM 10826  C "C4'"  . C A 1 337 ? 89.141  121.075 111.451 1.00 0.00 ? 337 C A "C4'"  1  
ATOM 10827  O "O4'"  . C A 1 337 ? 90.338  121.364 112.225 1.00 0.00 ? 337 C A "O4'"  1  
ATOM 10828  C "C3'"  . C A 1 337 ? 89.334  121.903 110.190 1.00 0.00 ? 337 C A "C3'"  1  
ATOM 10829  O "O3'"  . C A 1 337 ? 88.117  122.183 109.521 1.00 0.00 ? 337 C A "O3'"  1  
ATOM 10830  C "C2'"  . C A 1 337 ? 89.935  123.185 110.762 1.00 0.00 ? 337 C A "C2'"  1  
ATOM 10831  O "O2'"  . C A 1 337 ? 88.937  123.999 111.360 1.00 0.00 ? 337 C A "O2'"  1  
ATOM 10832  C "C1'"  . C A 1 337 ? 90.851  122.634 111.860 1.00 0.00 ? 337 C A "C1'"  1  
ATOM 10833  N N1     . C A 1 337 ? 92.253  122.478 111.399 1.00 0.00 ? 337 C A N1     1  
ATOM 10834  C C2     . C A 1 337 ? 93.081  123.607 111.395 1.00 0.00 ? 337 C A C2     1  
ATOM 10835  O O2     . C A 1 337 ? 92.623  124.696 111.773 1.00 0.00 ? 337 C A O2     1  
ATOM 10836  N N3     . C A 1 337 ? 94.363  123.492 110.980 1.00 0.00 ? 337 C A N3     1  
ATOM 10837  C C4     . C A 1 337 ? 94.832  122.311 110.578 1.00 0.00 ? 337 C A C4     1  
ATOM 10838  N N4     . C A 1 337 ? 96.104  122.245 110.176 1.00 0.00 ? 337 C A N4     1  
ATOM 10839  C C5     . C A 1 337 ? 94.016  121.145 110.569 1.00 0.00 ? 337 C A C5     1  
ATOM 10840  C C6     . C A 1 337 ? 92.749  121.270 110.983 1.00 0.00 ? 337 C A C6     1  
ATOM 10841  H "H5'"  . C A 1 337 ? 88.743  119.173 112.103 1.00 0.00 ? 337 C A "H5'"  1  
ATOM 10842  H "H5''" . C A 1 337 ? 88.320  119.410 110.582 1.00 0.00 ? 337 C A "H5''" 1  
ATOM 10843  H "H4'"  . C A 1 337 ? 88.358  121.398 111.943 1.00 0.00 ? 337 C A "H4'"  1  
ATOM 10844  H "H3'"  . C A 1 337 ? 89.991  121.462 109.611 1.00 0.00 ? 337 C A "H3'"  1  
ATOM 10845  H "H2'"  . C A 1 337 ? 90.445  123.676 110.084 1.00 0.00 ? 337 C A "H2'"  1  
ATOM 10846  H "HO2'" . C A 1 337 ? 89.104  124.935 111.125 1.00 0.00 ? 337 C A "HO2'" 1  
ATOM 10847  H "H1'"  . C A 1 337 ? 90.827  123.236 112.632 1.00 0.00 ? 337 C A "H1'"  1  
ATOM 10848  H H41    . C A 1 337 ? 96.662  123.050 110.183 1.00 0.00 ? 337 C A H41    1  
ATOM 10849  H H42    . C A 1 337 ? 96.478  121.391 109.875 1.00 0.00 ? 337 C A H42    1  
ATOM 10850  H H5     . C A 1 337 ? 94.370  120.280 110.272 1.00 0.00 ? 337 C A H5     1  
ATOM 10851  H H6     . C A 1 337 ? 92.172  120.479 110.985 1.00 0.00 ? 337 C A H6     1  
ATOM 10852  P P      . U A 1 338 ? 88.105  122.426 107.932 1.00 0.00 ? 338 U A P      1  
ATOM 10853  O OP1    . U A 1 338 ? 86.721  122.202 107.442 1.00 0.00 ? 338 U A OP1    1  
ATOM 10854  O OP2    . U A 1 338 ? 89.227  121.655 107.341 1.00 0.00 ? 338 U A OP2    1  
ATOM 10855  O "O5'"  . U A 1 338 ? 88.437  123.977 107.778 1.00 0.00 ? 338 U A "O5'"  1  
ATOM 10856  C "C5'"  . U A 1 338 ? 87.532  124.967 108.242 1.00 0.00 ? 338 U A "C5'"  1  
ATOM 10857  C "C4'"  . U A 1 338 ? 88.251  126.220 108.676 1.00 0.00 ? 338 U A "C4'"  1  
ATOM 10858  O "O4'"  . U A 1 338 ? 89.400  125.820 109.442 1.00 0.00 ? 338 U A "O4'"  1  
ATOM 10859  C "C3'"  . U A 1 338 ? 88.772  127.114 107.562 1.00 0.00 ? 338 U A "C3'"  1  
ATOM 10860  O "O3'"  . U A 1 338 ? 87.816  128.061 107.119 1.00 0.00 ? 338 U A "O3'"  1  
ATOM 10861  C "C2'"  . U A 1 338 ? 90.128  127.609 108.042 1.00 0.00 ? 338 U A "C2'"  1  
ATOM 10862  O "O2'"  . U A 1 338 ? 90.006  128.831 108.756 1.00 0.00 ? 338 U A "O2'"  1  
ATOM 10863  C "C1'"  . U A 1 338 ? 90.598  126.553 109.022 1.00 0.00 ? 338 U A "C1'"  1  
ATOM 10864  N N1     . U A 1 338 ? 91.561  125.606 108.410 1.00 0.00 ? 338 U A N1     1  
ATOM 10865  C C2     . U A 1 338 ? 92.901  125.941 108.469 1.00 0.00 ? 338 U A C2     1  
ATOM 10866  O O2     . U A 1 338 ? 93.309  126.962 108.995 1.00 0.00 ? 338 U A O2     1  
ATOM 10867  N N3     . U A 1 338 ? 93.754  125.034 107.890 1.00 0.00 ? 338 U A N3     1  
ATOM 10868  C C4     . U A 1 338 ? 93.414  123.851 107.269 1.00 0.00 ? 338 U A C4     1  
ATOM 10869  O O4     . U A 1 338 ? 94.302  123.141 106.794 1.00 0.00 ? 338 U A O4     1  
ATOM 10870  C C5     . U A 1 338 ? 92.011  123.570 107.245 1.00 0.00 ? 338 U A C5     1  
ATOM 10871  C C6     . U A 1 338 ? 91.158  124.435 107.803 1.00 0.00 ? 338 U A C6     1  
ATOM 10872  H "H5'"  . U A 1 338 ? 87.029  124.608 109.002 1.00 0.00 ? 338 U A "H5'"  1  
ATOM 10873  H "H5''" . U A 1 338 ? 86.907  125.191 107.521 1.00 0.00 ? 338 U A "H5''" 1  
ATOM 10874  H "H4'"  . U A 1 338 ? 87.648  126.753 109.233 1.00 0.00 ? 338 U A "H4'"  1  
ATOM 10875  H "H3'"  . U A 1 338 ? 88.918  126.575 106.757 1.00 0.00 ? 338 U A "H3'"  1  
ATOM 10876  H "H2'"  . U A 1 338 ? 90.765  127.685 107.302 1.00 0.00 ? 338 U A "H2'"  1  
ATOM 10877  H "HO2'" . U A 1 338 ? 90.902  129.164 108.974 1.00 0.00 ? 338 U A "HO2'" 1  
ATOM 10878  H "H1'"  . U A 1 338 ? 91.020  126.992 109.791 1.00 0.00 ? 338 U A "H1'"  1  
ATOM 10879  H H3     . U A 1 338 ? 94.709  125.252 107.921 1.00 0.00 ? 338 U A H3     1  
ATOM 10880  H H5     . U A 1 338 ? 91.680  122.749 106.824 1.00 0.00 ? 338 U A H5     1  
ATOM 10881  H H6     . U A 1 338 ? 90.203  124.220 107.773 1.00 0.00 ? 338 U A H6     1  
ATOM 10882  C "C5'"  . G A 1 1   ? 135.391 120.846 103.815 1.00 0.00 ? 1   G A "C5'"  2  
ATOM 10883  C "C4'"  . G A 1 1   ? 134.344 119.899 104.345 1.00 0.00 ? 1   G A "C4'"  2  
ATOM 10884  O "O4'"  . G A 1 1   ? 134.790 118.528 104.172 1.00 0.00 ? 1   G A "O4'"  2  
ATOM 10885  C "C3'"  . G A 1 1   ? 134.041 120.003 105.832 1.00 0.00 ? 1   G A "C3'"  2  
ATOM 10886  O "O3'"  . G A 1 1   ? 133.157 121.066 106.145 1.00 0.00 ? 1   G A "O3'"  2  
ATOM 10887  C "C2'"  . G A 1 1   ? 133.480 118.626 106.156 1.00 0.00 ? 1   G A "C2'"  2  
ATOM 10888  O "O2'"  . G A 1 1   ? 132.128 118.510 105.734 1.00 0.00 ? 1   G A "O2'"  2  
ATOM 10889  C "C1'"  . G A 1 1   ? 134.352 117.726 105.278 1.00 0.00 ? 1   G A "C1'"  2  
ATOM 10890  N N9     . G A 1 1   ? 135.505 117.182 106.019 1.00 0.00 ? 1   G A N9     2  
ATOM 10891  C C8     . G A 1 1   ? 136.824 117.549 105.892 1.00 0.00 ? 1   G A C8     2  
ATOM 10892  N N7     . G A 1 1   ? 137.621 116.882 106.684 1.00 0.00 ? 1   G A N7     2  
ATOM 10893  C C5     . G A 1 1   ? 136.778 116.025 107.376 1.00 0.00 ? 1   G A C5     2  
ATOM 10894  C C6     . G A 1 1   ? 137.068 115.060 108.376 1.00 0.00 ? 1   G A C6     2  
ATOM 10895  O O6     . G A 1 1   ? 138.164 114.761 108.862 1.00 0.00 ? 1   G A O6     2  
ATOM 10896  N N1     . G A 1 1   ? 135.918 114.408 108.809 1.00 0.00 ? 1   G A N1     2  
ATOM 10897  C C2     . G A 1 1   ? 134.649 114.657 108.344 1.00 0.00 ? 1   G A C2     2  
ATOM 10898  N N2     . G A 1 1   ? 133.662 113.926 108.884 1.00 0.00 ? 1   G A N2     2  
ATOM 10899  N N3     . G A 1 1   ? 134.364 115.553 107.412 1.00 0.00 ? 1   G A N3     2  
ATOM 10900  C C4     . G A 1 1   ? 135.470 116.196 106.978 1.00 0.00 ? 1   G A C4     2  
ATOM 10901  H "H4'"  . G A 1 1   ? 133.512 120.027 103.842 1.00 0.00 ? 1   G A "H4'"  2  
ATOM 10902  H "H3'"  . G A 1 1   ? 134.880 120.130 106.325 1.00 0.00 ? 1   G A "H3'"  2  
ATOM 10903  H "H2'"  . G A 1 1   ? 133.582 118.408 107.107 1.00 0.00 ? 1   G A "H2'"  2  
ATOM 10904  H "HO2'" . G A 1 1   ? 131.624 118.017 106.413 1.00 0.00 ? 1   G A "HO2'" 2  
ATOM 10905  H "H1'"  . G A 1 1   ? 133.810 116.990 104.929 1.00 0.00 ? 1   G A "H1'"  2  
ATOM 10906  H H8     . G A 1 1   ? 137.136 118.238 105.270 1.00 0.00 ? 1   G A H8     2  
ATOM 10907  H H1     . G A 1 1   ? 136.021 113.722 109.500 1.00 0.00 ? 1   G A H1     2  
ATOM 10908  H H21    . G A 1 1   ? 133.865 113.261 109.573 1.00 0.00 ? 1   G A H21    2  
ATOM 10909  H H22    . G A 1 1   ? 132.737 114.058 108.590 1.00 0.00 ? 1   G A H22    2  
ATOM 10910  P P      . G A 1 2   ? 133.187 121.739 107.604 1.00 0.00 ? 2   G A P      2  
ATOM 10911  O OP1    . G A 1 2   ? 132.220 122.866 107.611 1.00 0.00 ? 2   G A OP1    2  
ATOM 10912  O OP2    . G A 1 2   ? 134.604 121.987 107.968 1.00 0.00 ? 2   G A OP2    2  
ATOM 10913  O "O5'"  . G A 1 2   ? 132.622 120.601 108.565 1.00 0.00 ? 2   G A "O5'"  2  
ATOM 10914  C "C5'"  . G A 1 2   ? 131.249 120.245 108.546 1.00 0.00 ? 2   G A "C5'"  2  
ATOM 10915  C "C4'"  . G A 1 2   ? 130.956 119.111 109.499 1.00 0.00 ? 2   G A "C4'"  2  
ATOM 10916  O "O4'"  . G A 1 2   ? 131.752 117.951 109.144 1.00 0.00 ? 2   G A "O4'"  2  
ATOM 10917  C "C3'"  . G A 1 2   ? 131.298 119.364 110.959 1.00 0.00 ? 2   G A "C3'"  2  
ATOM 10918  O "O3'"  . G A 1 2   ? 130.318 120.136 111.633 1.00 0.00 ? 2   G A "O3'"  2  
ATOM 10919  C "C2'"  . G A 1 2   ? 131.449 117.953 111.513 1.00 0.00 ? 2   G A "C2'"  2  
ATOM 10920  O "O2'"  . G A 1 2   ? 130.184 117.354 111.749 1.00 0.00 ? 2   G A "O2'"  2  
ATOM 10921  C "C1'"  . G A 1 2   ? 132.126 117.236 110.343 1.00 0.00 ? 2   G A "C1'"  2  
ATOM 10922  N N9     . G A 1 2   ? 133.591 117.179 110.499 1.00 0.00 ? 2   G A N9     2  
ATOM 10923  C C8     . G A 1 2   ? 134.531 117.918 109.823 1.00 0.00 ? 2   G A C8     2  
ATOM 10924  N N7     . G A 1 2   ? 135.756 117.644 110.180 1.00 0.00 ? 2   G A N7     2  
ATOM 10925  C C5     . G A 1 2   ? 135.619 116.661 111.149 1.00 0.00 ? 2   G A C5     2  
ATOM 10926  C C6     . G A 1 2   ? 136.602 115.969 111.905 1.00 0.00 ? 2   G A C6     2  
ATOM 10927  O O6     . G A 1 2   ? 137.830 116.092 111.864 1.00 0.00 ? 2   G A O6     2  
ATOM 10928  N N1     . G A 1 2   ? 136.023 115.051 112.778 1.00 0.00 ? 2   G A N1     2  
ATOM 10929  C C2     . G A 1 2   ? 134.675 114.828 112.908 1.00 0.00 ? 2   G A C2     2  
ATOM 10930  N N2     . G A 1 2   ? 134.312 113.900 113.808 1.00 0.00 ? 2   G A N2     2  
ATOM 10931  N N3     . G A 1 2   ? 133.749 115.466 112.213 1.00 0.00 ? 2   G A N3     2  
ATOM 10932  C C4     . G A 1 2   ? 134.288 116.362 111.358 1.00 0.00 ? 2   G A C4     2  
ATOM 10933  H "H5'"  . G A 1 2   ? 131.001 119.970 107.637 1.00 0.00 ? 2   G A "H5'"  2  
ATOM 10934  H "H5''" . G A 1 2   ? 130.713 121.024 108.801 1.00 0.00 ? 2   G A "H5''" 2  
ATOM 10935  H "H4'"  . G A 1 2   ? 130.006 118.877 109.429 1.00 0.00 ? 2   G A "H4'"  2  
ATOM 10936  H "H3'"  . G A 1 2   ? 132.162 119.822 111.013 1.00 0.00 ? 2   G A "H3'"  2  
ATOM 10937  H "H2'"  . G A 1 2   ? 132.013 117.939 112.314 1.00 0.00 ? 2   G A "H2'"  2  
ATOM 10938  H "HO2'" . G A 1 2   ? 129.971 116.752 111.005 1.00 0.00 ? 2   G A "HO2'" 2  
ATOM 10939  H "H1'"  . G A 1 2   ? 131.769 116.328 110.265 1.00 0.00 ? 2   G A "H1'"  2  
ATOM 10940  H H8     . G A 1 2   ? 134.305 118.588 109.144 1.00 0.00 ? 2   G A H8     2  
ATOM 10941  H H1     . G A 1 2   ? 136.631 114.526 113.341 1.00 0.00 ? 2   G A H1     2  
ATOM 10942  H H21    . G A 1 2   ? 134.991 113.424 114.327 1.00 0.00 ? 2   G A H21    2  
ATOM 10943  H H22    . G A 1 2   ? 133.362 113.698 113.944 1.00 0.00 ? 2   G A H22    2  
ATOM 10944  P P      . U A 1 3   ? 130.731 121.035 112.900 1.00 0.00 ? 3   U A P      2  
ATOM 10945  O OP1    . U A 1 3   ? 129.539 121.815 113.319 1.00 0.00 ? 3   U A OP1    2  
ATOM 10946  O OP2    . U A 1 3   ? 131.994 121.743 112.567 1.00 0.00 ? 3   U A OP2    2  
ATOM 10947  O "O5'"  . U A 1 3   ? 131.049 119.969 114.040 1.00 0.00 ? 3   U A "O5'"  2  
ATOM 10948  C "C5'"  . U A 1 3   ? 130.025 119.148 114.575 1.00 0.00 ? 3   U A "C5'"  2  
ATOM 10949  C "C4'"  . U A 1 3   ? 130.572 118.145 115.565 1.00 0.00 ? 3   U A "C4'"  2  
ATOM 10950  O "O4'"  . U A 1 3   ? 131.509 117.257 114.900 1.00 0.00 ? 3   U A "O4'"  2  
ATOM 10951  C "C3'"  . U A 1 3   ? 131.367 118.719 116.728 1.00 0.00 ? 3   U A "C3'"  2  
ATOM 10952  O "O3'"  . U A 1 3   ? 130.545 119.239 117.759 1.00 0.00 ? 3   U A "O3'"  2  
ATOM 10953  C "C2'"  . U A 1 3   ? 132.218 117.535 117.163 1.00 0.00 ? 3   U A "C2'"  2  
ATOM 10954  O "O2'"  . U A 1 3   ? 131.461 116.610 117.930 1.00 0.00 ? 3   U A "O2'"  2  
ATOM 10955  C "C1'"  . U A 1 3   ? 132.566 116.897 115.817 1.00 0.00 ? 3   U A "C1'"  2  
ATOM 10956  N N1     . U A 1 3   ? 133.883 117.343 115.304 1.00 0.00 ? 3   U A N1     2  
ATOM 10957  C C2     . U A 1 3   ? 135.005 116.747 115.851 1.00 0.00 ? 3   U A C2     2  
ATOM 10958  O O2     . U A 1 3   ? 134.951 115.891 116.716 1.00 0.00 ? 3   U A O2     2  
ATOM 10959  N N3     . U A 1 3   ? 136.203 117.192 115.347 1.00 0.00 ? 3   U A N3     2  
ATOM 10960  C C4     . U A 1 3   ? 136.395 118.149 114.375 1.00 0.00 ? 3   U A C4     2  
ATOM 10961  O O4     . U A 1 3   ? 137.540 118.439 114.028 1.00 0.00 ? 3   U A O4     2  
ATOM 10962  C C5     . U A 1 3   ? 135.189 118.719 113.855 1.00 0.00 ? 3   U A C5     2  
ATOM 10963  C C6     . U A 1 3   ? 134.010 118.307 114.327 1.00 0.00 ? 3   U A C6     2  
ATOM 10964  H "H5'"  . U A 1 3   ? 129.586 118.665 113.844 1.00 0.00 ? 3   U A "H5'"  2  
ATOM 10965  H "H5''" . U A 1 3   ? 129.364 119.711 115.028 1.00 0.00 ? 3   U A "H5''" 2  
ATOM 10966  H "H4'"  . U A 1 3   ? 129.830 117.613 115.919 1.00 0.00 ? 3   U A "H4'"  2  
ATOM 10967  H "H3'"  . U A 1 3   ? 131.954 119.430 116.394 1.00 0.00 ? 3   U A "H3'"  2  
ATOM 10968  H "H2'"  . U A 1 3   ? 133.025 117.826 117.637 1.00 0.00 ? 3   U A "H2'"  2  
ATOM 10969  H "HO2'" . U A 1 3   ? 130.670 117.061 118.283 1.00 0.00 ? 3   U A "HO2'" 2  
ATOM 10970  H "H1'"  . U A 1 3   ? 132.568 115.921 115.909 1.00 0.00 ? 3   U A "H1'"  2  
ATOM 10971  H H3     . U A 1 3   ? 137.012 116.782 115.721 1.00 0.00 ? 3   U A H3     2  
ATOM 10972  H H5     . U A 1 3   ? 135.231 119.409 113.159 1.00 0.00 ? 3   U A H5     2  
ATOM 10973  H H6     . U A 1 3   ? 133.199 118.714 113.955 1.00 0.00 ? 3   U A H6     2  
ATOM 10974  P P      . A A 1 4   ? 131.079 120.428 118.697 1.00 0.00 ? 4   A A P      2  
ATOM 10975  O OP1    . A A 1 4   ? 129.961 120.856 119.576 1.00 0.00 ? 4   A A OP1    2  
ATOM 10976  O OP2    . A A 1 4   ? 131.758 121.427 117.833 1.00 0.00 ? 4   A A OP2    2  
ATOM 10977  O "O5'"  . A A 1 4   ? 132.183 119.731 119.610 1.00 0.00 ? 4   A A "O5'"  2  
ATOM 10978  C "C5'"  . A A 1 4   ? 131.823 118.762 120.583 1.00 0.00 ? 4   A A "C5'"  2  
ATOM 10979  C "C4'"  . A A 1 4   ? 133.038 118.149 121.231 1.00 0.00 ? 4   A A "C4'"  2  
ATOM 10980  O "O4'"  . A A 1 4   ? 133.823 117.442 120.234 1.00 0.00 ? 4   A A "O4'"  2  
ATOM 10981  C "C3'"  . A A 1 4   ? 134.024 119.124 121.857 1.00 0.00 ? 4   A A "C3'"  2  
ATOM 10982  O "O3'"  . A A 1 4   ? 133.612 119.586 123.132 1.00 0.00 ? 4   A A "O3'"  2  
ATOM 10983  C "C2'"  . A A 1 4   ? 135.314 118.317 121.887 1.00 0.00 ? 4   A A "C2'"  2  
ATOM 10984  O "O2'"  . A A 1 4   ? 135.315 117.386 122.961 1.00 0.00 ? 4   A A "O2'"  2  
ATOM 10985  C "C1'"  . A A 1 4   ? 135.226 117.551 120.567 1.00 0.00 ? 4   A A "C1'"  2  
ATOM 10986  N N9     . A A 1 4   ? 135.982 118.214 119.486 1.00 0.00 ? 4   A A N9     2  
ATOM 10987  C C8     . A A 1 4   ? 135.489 118.979 118.460 1.00 0.00 ? 4   A A C8     2  
ATOM 10988  N N7     . A A 1 4   ? 136.412 119.436 117.650 1.00 0.00 ? 4   A A N7     2  
ATOM 10989  C C5     . A A 1 4   ? 137.596 118.941 118.183 1.00 0.00 ? 4   A A C5     2  
ATOM 10990  C C6     . A A 1 4   ? 138.939 119.070 117.787 1.00 0.00 ? 4   A A C6     2  
ATOM 10991  N N6     . A A 1 4   ? 139.331 119.767 116.719 1.00 0.00 ? 4   A A N6     2  
ATOM 10992  N N1     . A A 1 4   ? 139.876 118.450 118.536 1.00 0.00 ? 4   A A N1     2  
ATOM 10993  C C2     . A A 1 4   ? 139.483 117.752 119.609 1.00 0.00 ? 4   A A C2     2  
ATOM 10994  N N3     . A A 1 4   ? 138.252 117.559 120.082 1.00 0.00 ? 4   A A N3     2  
ATOM 10995  C C4     . A A 1 4   ? 137.345 118.189 119.315 1.00 0.00 ? 4   A A C4     2  
ATOM 10996  H "H5'"  . A A 1 4   ? 131.299 118.056 120.152 1.00 0.00 ? 4   A A "H5'"  2  
ATOM 10997  H "H5''" . A A 1 4   ? 131.274 119.191 121.273 1.00 0.00 ? 4   A A "H5''" 2  
ATOM 10998  H "H4'"  . A A 1 4   ? 132.746 117.512 121.916 1.00 0.00 ? 4   A A "H4'"  2  
ATOM 10999  H "H3'"  . A A 1 4   ? 134.141 119.892 121.258 1.00 0.00 ? 4   A A "H3'"  2  
ATOM 11000  H "H2'"  . A A 1 4   ? 136.103 118.899 121.912 1.00 0.00 ? 4   A A "H2'"  2  
ATOM 11001  H "HO2'" . A A 1 4   ? 134.656 117.668 123.628 1.00 0.00 ? 4   A A "HO2'" 2  
ATOM 11002  H "H1'"  . A A 1 4   ? 135.571 116.639 120.693 1.00 0.00 ? 4   A A "H1'"  2  
ATOM 11003  H H8     . A A 1 4   ? 134.532 119.164 118.340 1.00 0.00 ? 4   A A H8     2  
ATOM 11004  H H61    . A A 1 4   ? 140.286 119.818 116.493 1.00 0.00 ? 4   A A H61    2  
ATOM 11005  H H62    . A A 1 4   ? 138.670 120.223 116.160 1.00 0.00 ? 4   A A H62    2  
ATOM 11006  H H2     . A A 1 4   ? 140.201 117.324 120.119 1.00 0.00 ? 4   A A H2     2  
ATOM 11007  P P      . G A 1 5   ? 134.114 121.015 123.674 1.00 0.00 ? 5   G A P      2  
ATOM 11008  O OP1    . G A 1 5   ? 133.425 121.287 124.961 1.00 0.00 ? 5   G A OP1    2  
ATOM 11009  O OP2    . G A 1 5   ? 134.007 121.992 122.562 1.00 0.00 ? 5   G A OP2    2  
ATOM 11010  O "O5'"  . G A 1 5   ? 135.661 120.788 123.984 1.00 0.00 ? 5   G A "O5'"  2  
ATOM 11011  C "C5'"  . G A 1 5   ? 136.076 119.930 125.036 1.00 0.00 ? 5   G A "C5'"  2  
ATOM 11012  C "C4'"  . G A 1 5   ? 137.576 119.763 125.056 1.00 0.00 ? 5   G A "C4'"  2  
ATOM 11013  O "O4'"  . G A 1 5   ? 138.018 119.165 123.809 1.00 0.00 ? 5   G A "O4'"  2  
ATOM 11014  C "C3'"  . G A 1 5   ? 138.390 121.043 125.165 1.00 0.00 ? 5   G A "C3'"  2  
ATOM 11015  O "O3'"  . G A 1 5   ? 138.461 121.545 126.489 1.00 0.00 ? 5   G A "O3'"  2  
ATOM 11016  C "C2'"  . G A 1 5   ? 139.738 120.627 124.596 1.00 0.00 ? 5   G A "C2'"  2  
ATOM 11017  O "O2'"  . G A 1 5   ? 140.491 119.884 125.544 1.00 0.00 ? 5   G A "O2'"  2  
ATOM 11018  C "C1'"  . G A 1 5   ? 139.316 119.697 123.457 1.00 0.00 ? 5   G A "C1'"  2  
ATOM 11019  N N9     . G A 1 5   ? 139.280 120.394 122.156 1.00 0.00 ? 5   G A N9     2  
ATOM 11020  C C8     . G A 1 5   ? 138.165 120.819 121.474 1.00 0.00 ? 5   G A C8     2  
ATOM 11021  N N7     . G A 1 5   ? 138.450 121.405 120.342 1.00 0.00 ? 5   G A N7     2  
ATOM 11022  C C5     . G A 1 5   ? 139.836 121.361 120.272 1.00 0.00 ? 5   G A C5     2  
ATOM 11023  C C6     . G A 1 5   ? 140.722 121.843 119.274 1.00 0.00 ? 5   G A C6     2  
ATOM 11024  O O6     . G A 1 5   ? 140.448 122.422 118.218 1.00 0.00 ? 5   G A O6     2  
ATOM 11025  N N1     . G A 1 5   ? 142.050 121.591 119.603 1.00 0.00 ? 5   G A N1     2  
ATOM 11026  C C2     . G A 1 5   ? 142.473 120.957 120.747 1.00 0.00 ? 5   G A C2     2  
ATOM 11027  N N2     . G A 1 5   ? 143.797 120.804 120.887 1.00 0.00 ? 5   G A N2     2  
ATOM 11028  N N3     . G A 1 5   ? 141.658 120.504 121.685 1.00 0.00 ? 5   G A N3     2  
ATOM 11029  C C4     . G A 1 5   ? 140.363 120.741 121.386 1.00 0.00 ? 5   G A C4     2  
ATOM 11030  H "H5'"  . G A 1 5   ? 135.656 119.053 124.920 1.00 0.00 ? 5   G A "H5'"  2  
ATOM 11031  H "H5''" . G A 1 5   ? 135.786 120.311 125.892 1.00 0.00 ? 5   G A "H5''" 2  
ATOM 11032  H "H4'"  . G A 1 5   ? 137.817 119.167 125.796 1.00 0.00 ? 5   G A "H4'"  2  
ATOM 11033  H "H3'"  . G A 1 5   ? 137.993 121.727 124.583 1.00 0.00 ? 5   G A "H3'"  2  
ATOM 11034  H "H2'"  . G A 1 5   ? 140.241 121.399 124.259 1.00 0.00 ? 5   G A "H2'"  2  
ATOM 11035  H "HO2'" . G A 1 5   ? 140.143 120.063 126.439 1.00 0.00 ? 5   G A "HO2'" 2  
ATOM 11036  H "H1'"  . G A 1 5   ? 139.936 118.941 123.405 1.00 0.00 ? 5   G A "H1'"  2  
ATOM 11037  H H8     . G A 1 5   ? 137.249 120.698 121.802 1.00 0.00 ? 5   G A H8     2  
ATOM 11038  H H1     . G A 1 5   ? 142.735 121.888 118.969 1.00 0.00 ? 5   G A H1     2  
ATOM 11039  H H21    . G A 1 5   ? 144.409 121.137 120.197 1.00 0.00 ? 5   G A H21    2  
ATOM 11040  H H22    . G A 1 5   ? 144.158 120.360 121.683 1.00 0.00 ? 5   G A H22    2  
ATOM 11041  P P      . A A 1 6   ? 138.677 123.114 126.746 1.00 0.00 ? 6   A A P      2  
ATOM 11042  O OP1    . A A 1 6   ? 138.563 123.363 128.205 1.00 0.00 ? 6   A A OP1    2  
ATOM 11043  O OP2    . A A 1 6   ? 137.806 123.860 125.804 1.00 0.00 ? 6   A A OP2    2  
ATOM 11044  O "O5'"  . A A 1 6   ? 140.193 123.370 126.320 1.00 0.00 ? 6   A A "O5'"  2  
ATOM 11045  C "C5'"  . A A 1 6   ? 141.264 122.795 127.057 1.00 0.00 ? 6   A A "C5'"  2  
ATOM 11046  C "C4'"  . A A 1 6   ? 142.594 123.052 126.395 1.00 0.00 ? 6   A A "C4'"  2  
ATOM 11047  O "O4'"  . A A 1 6   ? 142.616 122.436 125.081 1.00 0.00 ? 6   A A "O4'"  2  
ATOM 11048  C "C3'"  . A A 1 6   ? 142.932 124.510 126.127 1.00 0.00 ? 6   A A "C3'"  2  
ATOM 11049  O "O3'"  . A A 1 6   ? 143.411 125.190 127.275 1.00 0.00 ? 6   A A "O3'"  2  
ATOM 11050  C "C2'"  . A A 1 6   ? 143.956 124.411 125.004 1.00 0.00 ? 6   A A "C2'"  2  
ATOM 11051  O "O2'"  . A A 1 6   ? 145.234 124.046 125.503 1.00 0.00 ? 6   A A "O2'"  2  
ATOM 11052  C "C1'"  . A A 1 6   ? 143.394 123.252 124.180 1.00 0.00 ? 6   A A "C1'"  2  
ATOM 11053  N N9     . A A 1 6   ? 142.576 123.723 123.044 1.00 0.00 ? 6   A A N9     2  
ATOM 11054  C C8     . A A 1 6   ? 141.210 123.744 122.940 1.00 0.00 ? 6   A A C8     2  
ATOM 11055  N N7     . A A 1 6   ? 140.772 124.222 121.802 1.00 0.00 ? 6   A A N7     2  
ATOM 11056  C C5     . A A 1 6   ? 141.932 124.537 121.105 1.00 0.00 ? 6   A A C5     2  
ATOM 11057  C C6     . A A 1 6   ? 142.151 125.081 119.830 1.00 0.00 ? 6   A A C6     2  
ATOM 11058  N N6     . A A 1 6   ? 141.170 125.424 118.992 1.00 0.00 ? 6   A A N6     2  
ATOM 11059  N N1     . A A 1 6   ? 143.430 125.270 119.439 1.00 0.00 ? 6   A A N1     2  
ATOM 11060  C C2     . A A 1 6   ? 144.415 124.928 120.279 1.00 0.00 ? 6   A A C2     2  
ATOM 11061  N N3     . A A 1 6   ? 144.334 124.408 121.501 1.00 0.00 ? 6   A A N3     2  
ATOM 11062  C C4     . A A 1 6   ? 143.049 124.235 121.861 1.00 0.00 ? 6   A A C4     2  
ATOM 11063  H "H5'"  . A A 1 6   ? 141.121 121.827 127.125 1.00 0.00 ? 6   A A "H5'"  2  
ATOM 11064  H "H5''" . A A 1 6   ? 141.274 123.180 127.958 1.00 0.00 ? 6   A A "H5''" 2  
ATOM 11065  H "H4'"  . A A 1 6   ? 143.302 122.658 126.944 1.00 0.00 ? 6   A A "H4'"  2  
ATOM 11066  H "H3'"  . A A 1 6   ? 142.133 124.971 125.792 1.00 0.00 ? 6   A A "H3'"  2  
ATOM 11067  H "H2'"  . A A 1 6   ? 143.996 125.238 124.479 1.00 0.00 ? 6   A A "H2'"  2  
ATOM 11068  H "HO2'" . A A 1 6   ? 145.869 124.007 124.758 1.00 0.00 ? 6   A A "HO2'" 2  
ATOM 11069  H "H1'"  . A A 1 6   ? 144.134 122.702 123.845 1.00 0.00 ? 6   A A "H1'"  2  
ATOM 11070  H H8     . A A 1 6   ? 140.612 123.431 123.654 1.00 0.00 ? 6   A A H8     2  
ATOM 11071  H H61    . A A 1 6   ? 141.386 125.802 118.112 1.00 0.00 ? 6   A A H61    2  
ATOM 11072  H H62    . A A 1 6   ? 140.235 125.298 119.252 1.00 0.00 ? 6   A A H62    2  
ATOM 11073  H H2