data_6WLS
# 
_entry.id   6WLS 
# 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.329 
_audit_conform.dict_location   http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic 
# 
loop_
_database_2.database_id 
_database_2.database_code 
PDB   6WLS         
WWPDB D_1000248577 
EMDB  EMD-21840    
# 
loop_
_pdbx_database_related.db_name 
_pdbx_database_related.details 
_pdbx_database_related.db_id 
_pdbx_database_related.content_type 
EMDB    . EMD-21840 'associated EM volume' 
EMDB    . EMD-21831 'other EM volume'      
EMDB    . EMD-21832 'other EM volume'      
BIOISIS . EMD-21833 'other EM volume'      
EMDB    . EMD-21834 'other EM volume'      
EMDB    . EMD-21835 'other EM volume'      
EMDB    . EMD-21836 'other EM volume'      
EMDB    . EMD-21838 'other EM volume'      
EMDB    . EMD-21839 'other EM volume'      
EMDB    . EMD-21841 'other EM volume'      
EMDB    . EMD-21842 'other EM volume'      
# 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.status_code_sf                  ? 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.entry_id                        6WLS 
_pdbx_database_status.recvd_initial_deposition_date   2020-04-20 
_pdbx_database_status.SG_entry                        N 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.status_code_nmr_data            ? 
_pdbx_database_status.methods_development_category    ? 
_pdbx_database_status.pdb_format_compatible           Y 
# 
loop_
_audit_author.name 
_audit_author.pdbx_ordinal 
_audit_author.identifier_ORCID 
'Kappel, K.'      1  0000-0002-2129-199X 
'Zhang, K.'       2  ?                   
'Su, Z.'          3  ?                   
'Watkins, A.M.'   4  ?                   
'Kladwang, W.'    5  ?                   
'Li, S.'          6  ?                   
'Pintilie, G.'    7  ?                   
'Topkar, V.V.'    8  ?                   
'Rangan, R.'      9  ?                   
'Zheludev, I.N.'  10 ?                   
'Yesselman, J.D.' 11 ?                   
'Chiu, W.'        12 ?                   
'Das, R.'         13 ?                   
# 
_citation.abstract                  ? 
_citation.abstract_id_CAS           ? 
_citation.book_id_ISBN              ? 
_citation.book_publisher            ? 
_citation.book_publisher_city       ? 
_citation.book_title                ? 
_citation.coordinate_linkage        ? 
_citation.country                   US 
_citation.database_id_Medline       ? 
_citation.details                   ? 
_citation.id                        primary 
_citation.journal_abbrev            Nat.Methods 
_citation.journal_id_ASTM           ? 
_citation.journal_id_CSD            ? 
_citation.journal_id_ISSN           1548-7105 
_citation.journal_full              ? 
_citation.journal_issue             ? 
_citation.journal_volume            17 
_citation.language                  ? 
_citation.page_first                699 
_citation.page_last                 707 
_citation.title                     'Accelerated cryo-EM-guided determination of three-dimensional RNA-only structures.' 
_citation.year                      2020 
_citation.database_id_CSD           ? 
_citation.pdbx_database_id_DOI      10.1038/s41592-020-0878-9 
_citation.pdbx_database_id_PubMed   32616928 
_citation.unpublished_flag          ? 
# 
loop_
_citation_author.citation_id 
_citation_author.name 
_citation_author.ordinal 
_citation_author.identifier_ORCID 
primary 'Kappel, K.'      1  ? 
primary 'Zhang, K.'       2  ? 
primary 'Su, Z.'          3  ? 
primary 'Watkins, A.M.'   4  ? 
primary 'Kladwang, W.'    5  ? 
primary 'Li, S.'          6  ? 
primary 'Pintilie, G.'    7  ? 
primary 'Topkar, V.V.'    8  ? 
primary 'Rangan, R.'      9  ? 
primary 'Zheludev, I.N.'  10 ? 
primary 'Yesselman, J.D.' 11 ? 
primary 'Chiu, W.'        12 ? 
primary 'Das, R.'         13 ? 
# 
_entity.id                         1 
_entity.type                       polymer 
_entity.src_method                 syn 
_entity.pdbx_description           'RNA (388-MER)' 
_entity.formula_weight             125402.945 
_entity.pdbx_number_of_molecules   1 
_entity.pdbx_ec                    ? 
_entity.pdbx_mutation              ? 
_entity.pdbx_fragment              ? 
_entity.details                    ? 
# 
_entity_poly.entity_id                      1 
_entity_poly.type                           polyribonucleotide 
_entity_poly.nstd_linkage                   no 
_entity_poly.nstd_monomer                   no 
_entity_poly.pdbx_seq_one_letter_code       
;GGAGGGAAAAGUUAUCAGGCAUGCACCUGGUAGCUAGUCUUUAAACCAAUAGAUUGCAUCGGUUUAAAAGGCAAGACCGU
CAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGG
UAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUCA
CAGACUAAAUGUCGGUCGGGGAAGAUGUAUUCUUCUCAUAAGAUAUAGUCGGACCUCUCCUUAAUGGGAGCUAGCGGAUG
AAGUGAUGCAACACUGGAGCCGCUGGGAACUAAUUUGUAUGCGAAAGUAUAUUGAUUAGUUUUGGAGU
;
_entity_poly.pdbx_seq_one_letter_code_can   
;GGAGGGAAAAGUUAUCAGGCAUGCACCUGGUAGCUAGUCUUUAAACCAAUAGAUUGCAUCGGUUUAAAAGGCAAGACCGU
CAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGG
UAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUCA
CAGACUAAAUGUCGGUCGGGGAAGAUGUAUUCUUCUCAUAAGAUAUAGUCGGACCUCUCCUUAAUGGGAGCUAGCGGAUG
AAGUGAUGCAACACUGGAGCCGCUGGGAACUAAUUUGUAUGCGAAAGUAUAUUGAUUAGUUUUGGAGU
;
_entity_poly.pdbx_strand_id                 A 
_entity_poly.pdbx_target_identifier         ? 
# 
loop_
_entity_poly_seq.entity_id 
_entity_poly_seq.num 
_entity_poly_seq.mon_id 
_entity_poly_seq.hetero 
1 1   G n 
1 2   G n 
1 3   A n 
1 4   G n 
1 5   G n 
1 6   G n 
1 7   A n 
1 8   A n 
1 9   A n 
1 10  A n 
1 11  G n 
1 12  U n 
1 13  U n 
1 14  A n 
1 15  U n 
1 16  C n 
1 17  A n 
1 18  G n 
1 19  G n 
1 20  C n 
1 21  A n 
1 22  U n 
1 23  G n 
1 24  C n 
1 25  A n 
1 26  C n 
1 27  C n 
1 28  U n 
1 29  G n 
1 30  G n 
1 31  U n 
1 32  A n 
1 33  G n 
1 34  C n 
1 35  U n 
1 36  A n 
1 37  G n 
1 38  U n 
1 39  C n 
1 40  U n 
1 41  U n 
1 42  U n 
1 43  A n 
1 44  A n 
1 45  A n 
1 46  C n 
1 47  C n 
1 48  A n 
1 49  A n 
1 50  U n 
1 51  A n 
1 52  G n 
1 53  A n 
1 54  U n 
1 55  U n 
1 56  G n 
1 57  C n 
1 58  A n 
1 59  U n 
1 60  C n 
1 61  G n 
1 62  G n 
1 63  U n 
1 64  U n 
1 65  U n 
1 66  A n 
1 67  A n 
1 68  A n 
1 69  A n 
1 70  G n 
1 71  G n 
1 72  C n 
1 73  A n 
1 74  A n 
1 75  G n 
1 76  A n 
1 77  C n 
1 78  C n 
1 79  G n 
1 80  U n 
1 81  C n 
1 82  A n 
1 83  A n 
1 84  A n 
1 85  U n 
1 86  U n 
1 87  G n 
1 88  C n 
1 89  G n 
1 90  G n 
1 91  G n 
1 92  A n 
1 93  A n 
1 94  A n 
1 95  G n 
1 96  G n 
1 97  G n 
1 98  G n 
1 99  U n 
1 100 C n 
1 101 A n 
1 102 A n 
1 103 C n 
1 104 A n 
1 105 G n 
1 106 C n 
1 107 C n 
1 108 G n 
1 109 U n 
1 110 U n 
1 111 C n 
1 112 A n 
1 113 G n 
1 114 U n 
1 115 A n 
1 116 C n 
1 117 C n 
1 118 A n 
1 119 A n 
1 120 G n 
1 121 U n 
1 122 C n 
1 123 U n 
1 124 C n 
1 125 A n 
1 126 G n 
1 127 G n 
1 128 G n 
1 129 G n 
1 130 A n 
1 131 A n 
1 132 A n 
1 133 C n 
1 134 U n 
1 135 U n 
1 136 U n 
1 137 G n 
1 138 A n 
1 139 G n 
1 140 A n 
1 141 U n 
1 142 G n 
1 143 G n 
1 144 C n 
1 145 C n 
1 146 U n 
1 147 U n 
1 148 G n 
1 149 C n 
1 150 A n 
1 151 A n 
1 152 A n 
1 153 G n 
1 154 G n 
1 155 G n 
1 156 U n 
1 157 A n 
1 158 U n 
1 159 G n 
1 160 G n 
1 161 U n 
1 162 A n 
1 163 A n 
1 164 U n 
1 165 A n 
1 166 A n 
1 167 G n 
1 168 C n 
1 169 U n 
1 170 G n 
1 171 A n 
1 172 C n 
1 173 G n 
1 174 G n 
1 175 A n 
1 176 C n 
1 177 A n 
1 178 U n 
1 179 G n 
1 180 G n 
1 181 U n 
1 182 C n 
1 183 C n 
1 184 U n 
1 185 A n 
1 186 A n 
1 187 C n 
1 188 C n 
1 189 A n 
1 190 C n 
1 191 G n 
1 192 C n 
1 193 A n 
1 194 G n 
1 195 C n 
1 196 C n 
1 197 A n 
1 198 A n 
1 199 G n 
1 200 U n 
1 201 C n 
1 202 C n 
1 203 U n 
1 204 A n 
1 205 A n 
1 206 G n 
1 207 U n 
1 208 C n 
1 209 A n 
1 210 A n 
1 211 C n 
1 212 A n 
1 213 G n 
1 214 A n 
1 215 U n 
1 216 C n 
1 217 U n 
1 218 U n 
1 219 C n 
1 220 U n 
1 221 G n 
1 222 U n 
1 223 U n 
1 224 G n 
1 225 A n 
1 226 U n 
1 227 A n 
1 228 U n 
1 229 G n 
1 230 G n 
1 231 A n 
1 232 U n 
1 233 G n 
1 234 C n 
1 235 A n 
1 236 G n 
1 237 U n 
1 238 U n 
1 239 C n 
1 240 A n 
1 241 C n 
1 242 A n 
1 243 G n 
1 244 A n 
1 245 C n 
1 246 U n 
1 247 A n 
1 248 A n 
1 249 A n 
1 250 U n 
1 251 G n 
1 252 U n 
1 253 C n 
1 254 G n 
1 255 G n 
1 256 U n 
1 257 C n 
1 258 G n 
1 259 G n 
1 260 G n 
1 261 G n 
1 262 A n 
1 263 A n 
1 264 G n 
1 265 A n 
1 266 U n 
1 267 G n 
1 268 U n 
1 269 A n 
1 270 U n 
1 271 U n 
1 272 C n 
1 273 U n 
1 274 U n 
1 275 C n 
1 276 U n 
1 277 C n 
1 278 A n 
1 279 U n 
1 280 A n 
1 281 A n 
1 282 G n 
1 283 A n 
1 284 U n 
1 285 A n 
1 286 U n 
1 287 A n 
1 288 G n 
1 289 U n 
1 290 C n 
1 291 G n 
1 292 G n 
1 293 A n 
1 294 C n 
1 295 C n 
1 296 U n 
1 297 C n 
1 298 U n 
1 299 C n 
1 300 C n 
1 301 U n 
1 302 U n 
1 303 A n 
1 304 A n 
1 305 U n 
1 306 G n 
1 307 G n 
1 308 G n 
1 309 A n 
1 310 G n 
1 311 C n 
1 312 U n 
1 313 A n 
1 314 G n 
1 315 C n 
1 316 G n 
1 317 G n 
1 318 A n 
1 319 U n 
1 320 G n 
1 321 A n 
1 322 A n 
1 323 G n 
1 324 U n 
1 325 G n 
1 326 A n 
1 327 U n 
1 328 G n 
1 329 C n 
1 330 A n 
1 331 A n 
1 332 C n 
1 333 A n 
1 334 C n 
1 335 U n 
1 336 G n 
1 337 G n 
1 338 A n 
1 339 G n 
1 340 C n 
1 341 C n 
1 342 G n 
1 343 C n 
1 344 U n 
1 345 G n 
1 346 G n 
1 347 G n 
1 348 A n 
1 349 A n 
1 350 C n 
1 351 U n 
1 352 A n 
1 353 A n 
1 354 U n 
1 355 U n 
1 356 U n 
1 357 G n 
1 358 U n 
1 359 A n 
1 360 U n 
1 361 G n 
1 362 C n 
1 363 G n 
1 364 A n 
1 365 A n 
1 366 A n 
1 367 G n 
1 368 U n 
1 369 A n 
1 370 U n 
1 371 A n 
1 372 U n 
1 373 U n 
1 374 G n 
1 375 A n 
1 376 U n 
1 377 U n 
1 378 A n 
1 379 G n 
1 380 U n 
1 381 U n 
1 382 U n 
1 383 U n 
1 384 G n 
1 385 G n 
1 386 A n 
1 387 G n 
1 388 U n 
# 
_pdbx_entity_src_syn.entity_id              1 
_pdbx_entity_src_syn.pdbx_src_id            1 
_pdbx_entity_src_syn.pdbx_alt_source_flag   sample 
_pdbx_entity_src_syn.pdbx_beg_seq_num       1 
_pdbx_entity_src_syn.pdbx_end_seq_num       388 
_pdbx_entity_src_syn.organism_scientific    'Tetrahymena thermophila' 
_pdbx_entity_src_syn.organism_common_name   ? 
_pdbx_entity_src_syn.ncbi_taxonomy_id       5911 
_pdbx_entity_src_syn.details                ? 
# 
_struct_ref.id                         1 
_struct_ref.db_name                    GB 
_struct_ref.db_code                    X54512.1 
_struct_ref.pdbx_db_accession          10832 
_struct_ref.pdbx_db_isoform            ? 
_struct_ref.entity_id                  1 
_struct_ref.pdbx_seq_one_letter_code   
;GGAGGGAAAAGUUAUCAGGCAUGCACCUGGUAGCUAGUCUUUAAACCAAUAGAUUGCAUCGGUUUAAAAGGCAAGACCGU
CAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGG
UAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUCA
CAGACUAAAUGUCGGUCGGGGAAGAUGUAUUCUUCUCAUAAGAUAUAGUCGGACCUCUCCUUAAUGGGAGCUAGCGGAUG
AAGUGAUGCAACACUGGAGCCGCUGGGAACUAAUUUGUAUGCGAAAGUAUAUUGAUUAGUUUUGGAGU
;
_struct_ref.pdbx_align_begin           7030 
# 
_struct_ref_seq.align_id                      1 
_struct_ref_seq.ref_id                        1 
_struct_ref_seq.pdbx_PDB_id_code              6WLS 
_struct_ref_seq.pdbx_strand_id                A 
_struct_ref_seq.seq_align_beg                 1 
_struct_ref_seq.pdbx_seq_align_beg_ins_code   ? 
_struct_ref_seq.seq_align_end                 388 
_struct_ref_seq.pdbx_seq_align_end_ins_code   ? 
_struct_ref_seq.pdbx_db_accession             10832 
_struct_ref_seq.db_align_beg                  7030 
_struct_ref_seq.pdbx_db_align_beg_ins_code    ? 
_struct_ref_seq.db_align_end                  7417 
_struct_ref_seq.pdbx_db_align_end_ins_code    ? 
_struct_ref_seq.pdbx_auth_seq_align_beg       22 
_struct_ref_seq.pdbx_auth_seq_align_end       409 
# 
loop_
_chem_comp.id 
_chem_comp.type 
_chem_comp.mon_nstd_flag 
_chem_comp.name 
_chem_comp.pdbx_synonyms 
_chem_comp.formula 
_chem_comp.formula_weight 
A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O8 P'  323.197 
G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 
U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE"   ? 'C9 H13 N2 O9 P'  324.181 
# 
_exptl.absorpt_coefficient_mu     ? 
_exptl.absorpt_correction_T_max   ? 
_exptl.absorpt_correction_T_min   ? 
_exptl.absorpt_correction_type    ? 
_exptl.absorpt_process_details    ? 
_exptl.entry_id                   6WLS 
_exptl.crystals_number            ? 
_exptl.details                    ? 
_exptl.method                     'ELECTRON MICROSCOPY' 
_exptl.method_details             ? 
# 
_struct.entry_id                     6WLS 
_struct.title                        'Tetrahymena ribozyme models, 6.8 Angstrom resolution' 
_struct.pdbx_descriptor              'RNA (388-MER)' 
_struct.pdbx_model_details           ? 
_struct.pdbx_formula_weight          ? 
_struct.pdbx_formula_weight_method   ? 
_struct.pdbx_model_type_details      ? 
_struct.pdbx_CASP_flag               N 
# 
_struct_keywords.entry_id        6WLS 
_struct_keywords.text            'ribozyme, RNA' 
_struct_keywords.pdbx_keywords   RNA 
# 
_struct_asym.id                            A 
_struct_asym.pdbx_blank_PDB_chainid_flag   N 
_struct_asym.pdbx_modified                 N 
_struct_asym.entity_id                     1 
_struct_asym.details                       ? 
# 
loop_
_struct_conn.id 
_struct_conn.conn_type_id 
_struct_conn.pdbx_leaving_atom_flag 
_struct_conn.pdbx_PDB_id 
_struct_conn.ptnr1_label_asym_id 
_struct_conn.ptnr1_label_comp_id 
_struct_conn.ptnr1_label_seq_id 
_struct_conn.ptnr1_label_atom_id 
_struct_conn.pdbx_ptnr1_label_alt_id 
_struct_conn.pdbx_ptnr1_PDB_ins_code 
_struct_conn.pdbx_ptnr1_standard_comp_id 
_struct_conn.ptnr1_symmetry 
_struct_conn.ptnr2_label_asym_id 
_struct_conn.ptnr2_label_comp_id 
_struct_conn.ptnr2_label_seq_id 
_struct_conn.ptnr2_label_atom_id 
_struct_conn.pdbx_ptnr2_label_alt_id 
_struct_conn.pdbx_ptnr2_PDB_ins_code 
_struct_conn.ptnr1_auth_asym_id 
_struct_conn.ptnr1_auth_comp_id 
_struct_conn.ptnr1_auth_seq_id 
_struct_conn.ptnr2_auth_asym_id 
_struct_conn.ptnr2_auth_comp_id 
_struct_conn.ptnr2_auth_seq_id 
_struct_conn.ptnr2_symmetry 
_struct_conn.pdbx_ptnr3_label_atom_id 
_struct_conn.pdbx_ptnr3_label_seq_id 
_struct_conn.pdbx_ptnr3_label_comp_id 
_struct_conn.pdbx_ptnr3_label_asym_id 
_struct_conn.pdbx_ptnr3_label_alt_id 
_struct_conn.pdbx_ptnr3_PDB_ins_code 
_struct_conn.details 
_struct_conn.pdbx_dist_value 
_struct_conn.pdbx_value_order 
hydrog1   hydrog ? ? A G 1   N1 ? ? ? 1_555 A A 67  N7 ? ? A G 22  A A 88  1_555 ? ? ? ? ? ? TYPE_9_PAIR          ? ? 
hydrog2   hydrog ? ? A G 1   O6 ? ? ? 1_555 A A 67  N6 ? ? A G 22  A A 88  1_555 ? ? ? ? ? ? TYPE_9_PAIR          ? ? 
hydrog3   hydrog ? ? A G 2   N1 ? ? ? 1_555 A U 40  O4 ? ? A G 23  A U 61  1_555 ? ? ? ? ? ? 'G-U MISPAIR'        ? ? 
hydrog4   hydrog ? ? A G 2   N2 ? ? ? 1_555 A A 68  N7 ? ? A G 23  A A 89  1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ? ? 
hydrog5   hydrog ? ? A G 4   N1 ? ? ? 1_555 A A 73  N1 ? ? A G 25  A A 94  1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ? ? 
hydrog6   hydrog ? ? A A 7   N6 ? ? ? 1_555 A A 74  N7 ? ? A A 28  A A 95  1_555 ? ? ? ? ? ? 'A-A MISPAIR'        ? ? 
hydrog7   hydrog ? ? A A 9   N1 ? ? ? 1_555 A A 74  N6 ? ? A A 30  A A 95  1_555 ? ? ? ? ? ? 'A-A MISPAIR'        ? ? 
hydrog8   hydrog ? ? A A 10  N1 ? ? ? 1_555 A U 35  N3 ? ? A A 31  A U 56  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog9   hydrog ? ? A A 10  N6 ? ? ? 1_555 A U 35  O4 ? ? A A 31  A U 56  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog10  hydrog ? ? A G 11  N1 ? ? ? 1_555 A C 34  N3 ? ? A G 32  A C 55  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog11  hydrog ? ? A G 11  N2 ? ? ? 1_555 A C 34  O2 ? ? A G 32  A C 55  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog12  hydrog ? ? A G 11  O6 ? ? ? 1_555 A C 34  N4 ? ? A G 32  A C 55  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog13  hydrog ? ? A U 12  N3 ? ? ? 1_555 A G 33  O6 ? ? A U 33  A G 54  1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog14  hydrog ? ? A U 12  O2 ? ? ? 1_555 A G 33  N1 ? ? A U 33  A G 54  1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog15  hydrog ? ? A U 13  N3 ? ? ? 1_555 A A 32  N1 ? ? A U 34  A A 53  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog16  hydrog ? ? A U 13  O4 ? ? ? 1_555 A A 32  N6 ? ? A U 34  A A 53  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog17  hydrog ? ? A A 14  N1 ? ? ? 1_555 A U 31  N3 ? ? A A 35  A U 52  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog18  hydrog ? ? A A 14  N6 ? ? ? 1_555 A U 31  O4 ? ? A A 35  A U 52  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog19  hydrog ? ? A U 15  N3 ? ? ? 1_555 A G 30  O6 ? ? A U 36  A G 51  1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog20  hydrog ? ? A U 15  O2 ? ? ? 1_555 A G 30  N1 ? ? A U 36  A G 51  1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog21  hydrog ? ? A C 16  N3 ? ? ? 1_555 A G 29  N1 ? ? A C 37  A G 50  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog22  hydrog ? ? A C 16  N4 ? ? ? 1_555 A G 29  O6 ? ? A C 37  A G 50  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog23  hydrog ? ? A C 16  O2 ? ? ? 1_555 A G 29  N2 ? ? A C 37  A G 50  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog24  hydrog ? ? A A 17  N1 ? ? ? 1_555 A U 28  N3 ? ? A A 38  A U 49  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog25  hydrog ? ? A A 17  N6 ? ? ? 1_555 A U 28  O4 ? ? A A 38  A U 49  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog26  hydrog ? ? A G 18  N1 ? ? ? 1_555 A C 27  N3 ? ? A G 39  A C 48  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog27  hydrog ? ? A G 18  N2 ? ? ? 1_555 A C 27  O2 ? ? A G 39  A C 48  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog28  hydrog ? ? A G 18  O6 ? ? ? 1_555 A C 27  N4 ? ? A G 39  A C 48  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog29  hydrog ? ? A G 19  N1 ? ? ? 1_555 A C 26  N3 ? ? A G 40  A C 47  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog30  hydrog ? ? A G 19  N2 ? ? ? 1_555 A C 26  O2 ? ? A G 40  A C 47  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog31  hydrog ? ? A G 19  O6 ? ? ? 1_555 A C 26  N4 ? ? A G 40  A C 47  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog32  hydrog ? ? A C 20  N3 ? ? ? 1_555 A A 25  N6 ? ? A C 41  A A 46  1_555 ? ? ? ? ? ? 'C-A MISPAIR'        ? ? 
hydrog33  hydrog ? ? A U 22  N3 ? ? ? 1_555 A A 150 N1 ? ? A U 43  A A 171 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog34  hydrog ? ? A U 22  O4 ? ? ? 1_555 A A 150 N6 ? ? A U 43  A A 171 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog35  hydrog ? ? A G 23  N1 ? ? ? 1_555 A C 149 N3 ? ? A G 44  A C 170 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog36  hydrog ? ? A G 23  N2 ? ? ? 1_555 A C 149 O2 ? ? A G 44  A C 170 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog37  hydrog ? ? A G 23  O6 ? ? ? 1_555 A C 149 N4 ? ? A G 44  A C 170 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog38  hydrog ? ? A C 24  N3 ? ? ? 1_555 A G 148 N1 ? ? A C 45  A G 169 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog39  hydrog ? ? A C 24  N4 ? ? ? 1_555 A G 148 O6 ? ? A C 45  A G 169 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog40  hydrog ? ? A C 24  O2 ? ? ? 1_555 A G 148 N2 ? ? A C 45  A G 169 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog41  hydrog ? ? A A 36  N6 ? ? ? 1_555 A A 73  N3 ? ? A A 57  A A 94  1_555 ? ? ? ? ? ? 'A-A MISPAIR'        ? ? 
hydrog42  hydrog ? ? A G 37  N1 ? ? ? 1_555 A C 72  N3 ? ? A G 58  A C 93  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog43  hydrog ? ? A G 37  N2 ? ? ? 1_555 A C 72  O2 ? ? A G 58  A C 93  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog44  hydrog ? ? A G 37  O6 ? ? ? 1_555 A C 72  N4 ? ? A G 58  A C 93  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog45  hydrog ? ? A U 38  N3 ? ? ? 1_555 A G 71  O6 ? ? A U 59  A G 92  1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog46  hydrog ? ? A U 38  O2 ? ? ? 1_555 A G 71  N1 ? ? A U 59  A G 92  1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog47  hydrog ? ? A C 39  N3 ? ? ? 1_555 A G 70  N1 ? ? A C 60  A G 91  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog48  hydrog ? ? A C 39  N4 ? ? ? 1_555 A G 70  O6 ? ? A C 60  A G 91  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog49  hydrog ? ? A C 39  O2 ? ? ? 1_555 A G 70  N2 ? ? A C 60  A G 91  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog50  hydrog ? ? A U 40  N3 ? ? ? 1_555 A A 69  N1 ? ? A U 61  A A 90  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog51  hydrog ? ? A U 40  O4 ? ? ? 1_555 A A 69  N6 ? ? A U 61  A A 90  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog52  hydrog ? ? A U 41  N3 ? ? ? 1_555 A A 68  N1 ? ? A U 62  A A 89  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog53  hydrog ? ? A U 41  O4 ? ? ? 1_555 A A 68  N6 ? ? A U 62  A A 89  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog54  hydrog ? ? A U 42  N3 ? ? ? 1_555 A A 66  N1 ? ? A U 63  A A 87  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog55  hydrog ? ? A U 42  O4 ? ? ? 1_555 A A 66  N6 ? ? A U 63  A A 87  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog56  hydrog ? ? A U 42  O2 ? ? ? 1_555 A A 67  N6 ? ? A U 63  A A 88  1_555 ? ? ? ? ? ? 'U-A PAIR'           ? ? 
hydrog57  hydrog ? ? A A 43  N1 ? ? ? 1_555 A U 65  N3 ? ? A A 64  A U 86  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog58  hydrog ? ? A A 43  N6 ? ? ? 1_555 A U 65  O4 ? ? A A 64  A U 86  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog59  hydrog ? ? A A 44  N1 ? ? ? 1_555 A U 64  N3 ? ? A A 65  A U 85  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog60  hydrog ? ? A A 44  N6 ? ? ? 1_555 A U 64  O4 ? ? A A 65  A U 85  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog61  hydrog ? ? A A 45  N1 ? ? ? 1_555 A U 63  N3 ? ? A A 66  A U 84  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog62  hydrog ? ? A A 45  N6 ? ? ? 1_555 A U 63  O4 ? ? A A 66  A U 84  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog63  hydrog ? ? A C 46  N3 ? ? ? 1_555 A G 62  N1 ? ? A C 67  A G 83  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog64  hydrog ? ? A C 46  N4 ? ? ? 1_555 A G 62  O6 ? ? A C 67  A G 83  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog65  hydrog ? ? A C 46  O2 ? ? ? 1_555 A G 62  N2 ? ? A C 67  A G 83  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog66  hydrog ? ? A C 47  N3 ? ? ? 1_555 A G 61  N1 ? ? A C 68  A G 82  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog67  hydrog ? ? A C 47  N4 ? ? ? 1_555 A G 61  O6 ? ? A C 68  A G 82  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog68  hydrog ? ? A C 47  O2 ? ? ? 1_555 A G 61  N2 ? ? A C 68  A G 82  1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog69  hydrog ? ? A U 54  N3 ? ? ? 1_555 A A 331 N1 ? ? A U 75  A A 352 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog70  hydrog ? ? A U 54  O4 ? ? ? 1_555 A A 331 N6 ? ? A U 75  A A 352 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog71  hydrog ? ? A U 55  N3 ? ? ? 1_555 A A 330 N1 ? ? A U 76  A A 351 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog72  hydrog ? ? A U 55  O4 ? ? ? 1_555 A A 330 N6 ? ? A U 76  A A 351 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog73  hydrog ? ? A G 56  N1 ? ? ? 1_555 A C 329 N3 ? ? A G 77  A C 350 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog74  hydrog ? ? A G 56  N2 ? ? ? 1_555 A C 329 O2 ? ? A G 77  A C 350 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog75  hydrog ? ? A G 56  O6 ? ? ? 1_555 A C 329 N4 ? ? A G 77  A C 350 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog76  hydrog ? ? A C 57  N3 ? ? ? 1_555 A G 328 N1 ? ? A C 78  A G 349 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog77  hydrog ? ? A C 57  N4 ? ? ? 1_555 A G 328 O6 ? ? A C 78  A G 349 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog78  hydrog ? ? A C 57  O2 ? ? ? 1_555 A G 328 N2 ? ? A C 78  A G 349 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog79  hydrog ? ? A A 58  N1 ? ? ? 1_555 A U 327 N3 ? ? A A 79  A U 348 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog80  hydrog ? ? A A 58  N6 ? ? ? 1_555 A U 327 O4 ? ? A A 79  A U 348 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog81  hydrog ? ? A U 59  N3 ? ? ? 1_555 A A 326 N1 ? ? A U 80  A A 347 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog82  hydrog ? ? A U 59  O4 ? ? ? 1_555 A A 326 N6 ? ? A U 80  A A 347 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog83  hydrog ? ? A C 60  N3 ? ? ? 1_555 A G 325 N1 ? ? A C 81  A G 346 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog84  hydrog ? ? A C 60  N4 ? ? ? 1_555 A G 325 O6 ? ? A C 81  A G 346 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog85  hydrog ? ? A C 60  O2 ? ? ? 1_555 A G 325 N2 ? ? A C 81  A G 346 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog86  hydrog ? ? A G 75  N1 ? ? ? 1_555 A C 257 N3 ? ? A G 96  A C 278 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog87  hydrog ? ? A G 75  N2 ? ? ? 1_555 A C 257 O2 ? ? A G 96  A C 278 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog88  hydrog ? ? A G 75  O6 ? ? ? 1_555 A C 257 N4 ? ? A G 96  A C 278 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog89  hydrog ? ? A A 76  N1 ? ? ? 1_555 A U 256 N3 ? ? A A 97  A U 277 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog90  hydrog ? ? A A 76  N6 ? ? ? 1_555 A U 256 O4 ? ? A A 97  A U 277 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog91  hydrog ? ? A C 77  N3 ? ? ? 1_555 A G 255 N1 ? ? A C 98  A G 276 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog92  hydrog ? ? A C 77  N4 ? ? ? 1_555 A G 255 O6 ? ? A C 98  A G 276 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog93  hydrog ? ? A C 77  O2 ? ? ? 1_555 A G 255 N2 ? ? A C 98  A G 276 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog94  hydrog ? ? A C 78  N3 ? ? ? 1_555 A G 254 N1 ? ? A C 99  A G 275 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog95  hydrog ? ? A C 78  N4 ? ? ? 1_555 A G 254 O6 ? ? A C 99  A G 275 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog96  hydrog ? ? A C 78  O2 ? ? ? 1_555 A G 254 N2 ? ? A C 99  A G 275 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog97  hydrog ? ? A G 79  N1 ? ? ? 1_555 A C 253 N3 ? ? A G 100 A C 274 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog98  hydrog ? ? A G 79  N2 ? ? ? 1_555 A C 253 O2 ? ? A G 100 A C 274 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog99  hydrog ? ? A G 79  O6 ? ? ? 1_555 A C 253 N4 ? ? A G 100 A C 274 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog100 hydrog ? ? A U 80  N3 ? ? ? 1_555 A U 252 O4 ? ? A U 101 A U 273 1_555 ? ? ? ? ? ? TYPE_16_PAIR         ? ? 
hydrog101 hydrog ? ? A U 80  O2 ? ? ? 1_555 A U 252 N3 ? ? A U 101 A U 273 1_555 ? ? ? ? ? ? TYPE_16_PAIR         ? ? 
hydrog102 hydrog ? ? A C 81  N3 ? ? ? 1_555 A G 251 N1 ? ? A C 102 A G 272 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog103 hydrog ? ? A C 81  N4 ? ? ? 1_555 A G 251 O6 ? ? A C 102 A G 272 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog104 hydrog ? ? A C 81  O2 ? ? ? 1_555 A G 251 N2 ? ? A C 102 A G 272 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog105 hydrog ? ? A A 83  N1 ? ? ? 1_555 A C 234 N4 ? ? A A 104 A C 255 1_555 ? ? ? ? ? ? 'A-C MISPAIR'        ? ? 
hydrog106 hydrog ? ? A U 86  N3 ? ? ? 1_555 A A 193 N1 ? ? A U 107 A A 214 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog107 hydrog ? ? A U 86  O4 ? ? ? 1_555 A A 193 N6 ? ? A U 107 A A 214 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog108 hydrog ? ? A G 87  N1 ? ? ? 1_555 A C 192 N3 ? ? A G 108 A C 213 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog109 hydrog ? ? A G 87  N2 ? ? ? 1_555 A C 192 O2 ? ? A G 108 A C 213 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog110 hydrog ? ? A G 87  O6 ? ? ? 1_555 A C 192 N4 ? ? A G 108 A C 213 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog111 hydrog ? ? A C 88  N3 ? ? ? 1_555 A G 191 N1 ? ? A C 109 A G 212 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog112 hydrog ? ? A C 88  N4 ? ? ? 1_555 A G 191 O6 ? ? A C 109 A G 212 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog113 hydrog ? ? A C 88  O2 ? ? ? 1_555 A G 191 N2 ? ? A C 109 A G 212 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog114 hydrog ? ? A G 89  N1 ? ? ? 1_555 A C 190 N3 ? ? A G 110 A C 211 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog115 hydrog ? ? A G 89  N2 ? ? ? 1_555 A C 190 O2 ? ? A G 110 A C 211 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog116 hydrog ? ? A G 89  O6 ? ? ? 1_555 A C 190 N4 ? ? A G 110 A C 211 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog117 hydrog ? ? A G 90  N1 ? ? ? 1_555 A C 188 N3 ? ? A G 111 A C 209 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog118 hydrog ? ? A G 90  N2 ? ? ? 1_555 A C 188 O2 ? ? A G 111 A C 209 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog119 hydrog ? ? A G 90  O6 ? ? ? 1_555 A C 188 N4 ? ? A G 111 A C 209 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog120 hydrog ? ? A G 91  N1 ? ? ? 1_555 A C 187 N3 ? ? A G 112 A C 208 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog121 hydrog ? ? A G 91  N2 ? ? ? 1_555 A C 187 O2 ? ? A G 112 A C 208 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog122 hydrog ? ? A G 91  O6 ? ? ? 1_555 A C 187 N4 ? ? A G 112 A C 208 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog123 hydrog ? ? A A 92  N3 ? ? ? 1_555 A A 186 N6 ? ? A A 113 A A 207 1_555 ? ? ? ? ? ? 'A-A MISPAIR'        ? ? 
hydrog124 hydrog ? ? A A 94  N6 ? ? ? 1_555 A A 185 N3 ? ? A A 115 A A 206 1_555 ? ? ? ? ? ? 'A-A MISPAIR'        ? ? 
hydrog125 hydrog ? ? A G 95  N1 ? ? ? 1_555 A U 184 O2 ? ? A G 116 A U 205 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog126 hydrog ? ? A G 95  O6 ? ? ? 1_555 A U 184 N3 ? ? A G 116 A U 205 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog127 hydrog ? ? A G 96  N1 ? ? ? 1_555 A C 183 N3 ? ? A G 117 A C 204 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog128 hydrog ? ? A G 96  N2 ? ? ? 1_555 A C 183 O2 ? ? A G 117 A C 204 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog129 hydrog ? ? A G 96  O6 ? ? ? 1_555 A C 183 N4 ? ? A G 117 A C 204 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog130 hydrog ? ? A G 97  N1 ? ? ? 1_555 A C 182 N3 ? ? A G 118 A C 203 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog131 hydrog ? ? A G 97  N2 ? ? ? 1_555 A C 182 O2 ? ? A G 118 A C 203 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog132 hydrog ? ? A G 97  O6 ? ? ? 1_555 A C 182 N4 ? ? A G 118 A C 203 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog133 hydrog ? ? A G 98  N1 ? ? ? 1_555 A U 181 O2 ? ? A G 119 A U 202 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog134 hydrog ? ? A G 98  O6 ? ? ? 1_555 A U 181 N3 ? ? A G 119 A U 202 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog135 hydrog ? ? A U 99  N3 ? ? ? 1_555 A G 180 O6 ? ? A U 120 A G 201 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog136 hydrog ? ? A U 99  O2 ? ? ? 1_555 A G 180 N1 ? ? A U 120 A G 201 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog137 hydrog ? ? A C 100 N3 ? ? ? 1_555 A G 179 N1 ? ? A C 121 A G 200 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog138 hydrog ? ? A C 100 N4 ? ? ? 1_555 A G 179 O6 ? ? A C 121 A G 200 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog139 hydrog ? ? A C 100 O2 ? ? ? 1_555 A G 179 N2 ? ? A C 121 A G 200 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog140 hydrog ? ? A A 102 N3 ? ? ? 1_555 A A 104 N6 ? ? A A 123 A A 125 1_555 ? ? ? ? ? ? 'A-A MISPAIR'        ? ? 
hydrog141 hydrog ? ? A G 105 N1 ? ? ? 1_555 A A 175 N1 ? ? A G 126 A A 196 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ? ? 
hydrog142 hydrog ? ? A G 105 O6 ? ? ? 1_555 A A 175 N6 ? ? A G 126 A A 196 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ? ? 
hydrog143 hydrog ? ? A C 106 N3 ? ? ? 1_555 A G 174 N1 ? ? A C 127 A G 195 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog144 hydrog ? ? A C 106 N4 ? ? ? 1_555 A G 174 O6 ? ? A C 127 A G 195 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog145 hydrog ? ? A C 106 O2 ? ? ? 1_555 A G 174 N2 ? ? A C 127 A G 195 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog146 hydrog ? ? A C 107 N3 ? ? ? 1_555 A G 173 N1 ? ? A C 128 A G 194 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog147 hydrog ? ? A C 107 N4 ? ? ? 1_555 A G 173 O6 ? ? A C 128 A G 194 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog148 hydrog ? ? A C 107 O2 ? ? ? 1_555 A G 173 N2 ? ? A C 128 A G 194 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog149 hydrog ? ? A G 108 N1 ? ? ? 1_555 A C 172 N3 ? ? A G 129 A C 193 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog150 hydrog ? ? A G 108 N2 ? ? ? 1_555 A C 172 O2 ? ? A G 129 A C 193 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog151 hydrog ? ? A G 108 O6 ? ? ? 1_555 A C 172 N4 ? ? A G 129 A C 193 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog152 hydrog ? ? A U 110 N3 ? ? ? 1_555 A A 171 N1 ? ? A U 131 A A 192 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog153 hydrog ? ? A U 110 O4 ? ? ? 1_555 A A 171 N6 ? ? A U 131 A A 192 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog154 hydrog ? ? A C 111 N3 ? ? ? 1_555 A G 170 N1 ? ? A C 132 A G 191 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog155 hydrog ? ? A C 111 N4 ? ? ? 1_555 A G 170 O6 ? ? A C 132 A G 191 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog156 hydrog ? ? A C 111 O2 ? ? ? 1_555 A G 170 N2 ? ? A C 132 A G 191 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog157 hydrog ? ? A A 112 N1 ? ? ? 1_555 A U 169 N3 ? ? A A 133 A U 190 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog158 hydrog ? ? A A 112 N6 ? ? ? 1_555 A U 169 O4 ? ? A A 133 A U 190 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog159 hydrog ? ? A G 113 N1 ? ? ? 1_555 A C 168 N3 ? ? A G 134 A C 189 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog160 hydrog ? ? A G 113 N2 ? ? ? 1_555 A C 168 O2 ? ? A G 134 A C 189 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog161 hydrog ? ? A G 113 O6 ? ? ? 1_555 A C 168 N4 ? ? A G 134 A C 189 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog162 hydrog ? ? A U 114 N3 ? ? ? 1_555 A A 166 N1 ? ? A U 135 A A 187 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog163 hydrog ? ? A U 114 O4 ? ? ? 1_555 A A 166 N6 ? ? A U 135 A A 187 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog164 hydrog ? ? A A 115 N1 ? ? ? 1_555 A U 161 N3 ? ? A A 136 A U 182 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog165 hydrog ? ? A A 115 N6 ? ? ? 1_555 A U 161 O4 ? ? A A 136 A U 182 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog166 hydrog ? ? A C 116 N3 ? ? ? 1_555 A G 160 N1 ? ? A C 137 A G 181 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog167 hydrog ? ? A C 116 N4 ? ? ? 1_555 A G 160 O6 ? ? A C 137 A G 181 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog168 hydrog ? ? A C 116 O2 ? ? ? 1_555 A G 160 N2 ? ? A C 137 A G 181 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog169 hydrog ? ? A C 116 N3 ? ? ? 1_555 A U 161 N3 ? ? A C 137 A U 182 1_555 ? ? ? ? ? ? TYPE_18_PAIR         ? ? 
hydrog170 hydrog ? ? A C 116 N4 ? ? ? 1_555 A U 161 O4 ? ? A C 137 A U 182 1_555 ? ? ? ? ? ? TYPE_18_PAIR         ? ? 
hydrog171 hydrog ? ? A C 117 N3 ? ? ? 1_555 A G 159 N1 ? ? A C 138 A G 180 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog172 hydrog ? ? A C 117 N4 ? ? ? 1_555 A G 159 O6 ? ? A C 138 A G 180 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog173 hydrog ? ? A C 117 O2 ? ? ? 1_555 A G 159 N2 ? ? A C 138 A G 180 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog174 hydrog ? ? A A 119 N6 ? ? ? 1_555 A G 142 N3 ? ? A A 140 A G 163 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ? ? 
hydrog175 hydrog ? ? A A 119 N7 ? ? ? 1_555 A G 142 N2 ? ? A A 140 A G 163 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ? ? 
hydrog176 hydrog ? ? A G 120 N1 ? ? ? 1_555 A U 141 O2 ? ? A G 141 A U 162 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog177 hydrog ? ? A G 120 O6 ? ? ? 1_555 A U 141 N3 ? ? A G 141 A U 162 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog178 hydrog ? ? A U 121 N3 ? ? ? 1_555 A A 140 N1 ? ? A U 142 A A 161 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog179 hydrog ? ? A U 121 O4 ? ? ? 1_555 A A 140 N6 ? ? A U 142 A A 161 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog180 hydrog ? ? A C 122 N3 ? ? ? 1_555 A G 139 N1 ? ? A C 143 A G 160 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog181 hydrog ? ? A C 122 N4 ? ? ? 1_555 A G 139 O6 ? ? A C 143 A G 160 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog182 hydrog ? ? A C 122 O2 ? ? ? 1_555 A G 139 N2 ? ? A C 143 A G 160 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog183 hydrog ? ? A U 123 N3 ? ? ? 1_555 A A 138 N1 ? ? A U 144 A A 159 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog184 hydrog ? ? A U 123 O4 ? ? ? 1_555 A A 138 N6 ? ? A U 144 A A 159 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog185 hydrog ? ? A C 124 N3 ? ? ? 1_555 A G 137 N1 ? ? A C 145 A G 158 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog186 hydrog ? ? A C 124 N4 ? ? ? 1_555 A G 137 O6 ? ? A C 145 A G 158 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog187 hydrog ? ? A C 124 O2 ? ? ? 1_555 A G 137 N2 ? ? A C 145 A G 158 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog188 hydrog ? ? A A 125 N1 ? ? ? 1_555 A U 136 N3 ? ? A A 146 A U 157 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog189 hydrog ? ? A A 125 N6 ? ? ? 1_555 A U 136 O4 ? ? A A 146 A U 157 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog190 hydrog ? ? A G 126 N1 ? ? ? 1_555 A U 135 O2 ? ? A G 147 A U 156 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog191 hydrog ? ? A G 126 O6 ? ? ? 1_555 A U 135 N3 ? ? A G 147 A U 156 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog192 hydrog ? ? A G 127 N1 ? ? ? 1_555 A U 134 O2 ? ? A G 148 A U 155 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog193 hydrog ? ? A G 127 O6 ? ? ? 1_555 A U 134 N3 ? ? A G 148 A U 155 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog194 hydrog ? ? A G 128 N1 ? ? ? 1_555 A C 133 N3 ? ? A G 149 A C 154 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog195 hydrog ? ? A G 128 N2 ? ? ? 1_555 A C 133 O2 ? ? A G 149 A C 154 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog196 hydrog ? ? A G 128 O6 ? ? ? 1_555 A C 133 N4 ? ? A G 149 A C 154 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog197 hydrog ? ? A G 129 N2 ? ? ? 1_555 A A 132 N7 ? ? A G 150 A A 153 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ? ? 
hydrog198 hydrog ? ? A G 142 O6 ? ? ? 1_555 A A 157 N6 ? ? A G 163 A A 178 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ? ? 
hydrog199 hydrog ? ? A C 144 N3 ? ? ? 1_555 A G 154 N1 ? ? A C 165 A G 175 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog200 hydrog ? ? A C 144 N4 ? ? ? 1_555 A G 154 O6 ? ? A C 165 A G 175 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog201 hydrog ? ? A C 144 O2 ? ? ? 1_555 A G 154 N2 ? ? A C 165 A G 175 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog202 hydrog ? ? A C 145 N3 ? ? ? 1_555 A G 153 N1 ? ? A C 166 A G 174 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog203 hydrog ? ? A C 145 N4 ? ? ? 1_555 A G 153 O6 ? ? A C 166 A G 174 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog204 hydrog ? ? A C 145 O2 ? ? ? 1_555 A G 153 N2 ? ? A C 166 A G 174 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog205 hydrog ? ? A U 146 N3 ? ? ? 1_555 A A 152 N1 ? ? A U 167 A A 173 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog206 hydrog ? ? A U 146 O4 ? ? ? 1_555 A A 152 N6 ? ? A U 167 A A 173 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog207 hydrog ? ? A G 160 N2 ? ? ? 1_555 A A 165 N3 ? ? A G 181 A A 186 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ? ? 
hydrog208 hydrog ? ? A A 163 N3 ? ? ? 1_555 A G 191 N2 ? ? A A 184 A G 212 1_555 ? ? ? ? ? ? 'A-G MISPAIR'        ? ? 
hydrog209 hydrog ? ? A G 194 N1 ? ? ? 1_555 A U 237 O2 ? ? A G 215 A U 258 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog210 hydrog ? ? A G 194 O6 ? ? ? 1_555 A U 237 N3 ? ? A G 215 A U 258 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog211 hydrog ? ? A C 195 N3 ? ? ? 1_555 A G 236 N1 ? ? A C 216 A G 257 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog212 hydrog ? ? A C 195 N4 ? ? ? 1_555 A G 236 O6 ? ? A C 216 A G 257 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog213 hydrog ? ? A C 195 O2 ? ? ? 1_555 A G 236 N2 ? ? A C 216 A G 257 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog214 hydrog ? ? A A 198 N7 ? ? ? 1_555 A G 233 N2 ? ? A A 219 A G 254 1_555 ? ? ? ? ? ? 'A-G MISPAIR'        ? ? 
hydrog215 hydrog ? ? A G 199 N1 ? ? ? 1_555 A U 232 O2 ? ? A G 220 A U 253 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog216 hydrog ? ? A G 199 O6 ? ? ? 1_555 A U 232 N3 ? ? A G 220 A U 253 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog217 hydrog ? ? A U 200 N3 ? ? ? 1_555 A A 231 N1 ? ? A U 221 A A 252 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog218 hydrog ? ? A U 200 O4 ? ? ? 1_555 A A 231 N6 ? ? A U 221 A A 252 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog219 hydrog ? ? A C 201 N3 ? ? ? 1_555 A G 230 N1 ? ? A C 222 A G 251 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog220 hydrog ? ? A C 201 N4 ? ? ? 1_555 A G 230 O6 ? ? A C 222 A G 251 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog221 hydrog ? ? A C 201 O2 ? ? ? 1_555 A G 230 N2 ? ? A C 222 A G 251 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog222 hydrog ? ? A C 202 N3 ? ? ? 1_555 A G 229 N1 ? ? A C 223 A G 250 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog223 hydrog ? ? A C 202 N4 ? ? ? 1_555 A G 229 O6 ? ? A C 223 A G 250 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog224 hydrog ? ? A C 202 O2 ? ? ? 1_555 A G 229 N2 ? ? A C 223 A G 250 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog225 hydrog ? ? A U 203 N3 ? ? ? 1_555 A A 227 N7 ? ? A U 224 A A 248 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? 
hydrog226 hydrog ? ? A U 203 O2 ? ? ? 1_555 A A 227 N6 ? ? A U 224 A A 248 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? 
hydrog227 hydrog ? ? A A 205 N6 ? ? ? 1_555 A U 228 O4 ? ? A A 226 A U 249 1_555 ? ? ? ? ? ? 'A-U PAIR'           ? ? 
hydrog228 hydrog ? ? A G 206 N1 ? ? ? 1_555 A U 226 O2 ? ? A G 227 A U 247 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog229 hydrog ? ? A G 206 O6 ? ? ? 1_555 A U 226 N3 ? ? A G 227 A U 247 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog230 hydrog ? ? A G 206 N2 ? ? ? 1_555 A U 228 O4 ? ? A G 227 A U 249 1_555 ? ? ? ? ? ? 'G-U MISPAIR'        ? ? 
hydrog231 hydrog ? ? A U 207 N3 ? ? ? 1_555 A A 225 N1 ? ? A U 228 A A 246 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog232 hydrog ? ? A U 207 O4 ? ? ? 1_555 A A 225 N6 ? ? A U 228 A A 246 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog233 hydrog ? ? A C 208 N3 ? ? ? 1_555 A G 224 N1 ? ? A C 229 A G 245 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog234 hydrog ? ? A C 208 N4 ? ? ? 1_555 A G 224 O6 ? ? A C 229 A G 245 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog235 hydrog ? ? A C 208 O2 ? ? ? 1_555 A G 224 N2 ? ? A C 229 A G 245 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog236 hydrog ? ? A A 209 N1 ? ? ? 1_555 A U 223 N3 ? ? A A 230 A U 244 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog237 hydrog ? ? A A 209 N6 ? ? ? 1_555 A U 223 O4 ? ? A A 230 A U 244 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog238 hydrog ? ? A A 210 N1 ? ? ? 1_555 A U 222 N3 ? ? A A 231 A U 243 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog239 hydrog ? ? A A 210 N6 ? ? ? 1_555 A U 222 O4 ? ? A A 231 A U 243 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog240 hydrog ? ? A C 211 N3 ? ? ? 1_555 A G 221 N1 ? ? A C 232 A G 242 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog241 hydrog ? ? A C 211 N4 ? ? ? 1_555 A G 221 O6 ? ? A C 232 A G 242 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog242 hydrog ? ? A C 211 O2 ? ? ? 1_555 A G 221 N2 ? ? A C 232 A G 242 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog243 hydrog ? ? A A 212 N1 ? ? ? 1_555 A U 220 N3 ? ? A A 233 A U 241 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog244 hydrog ? ? A A 212 N6 ? ? ? 1_555 A U 220 O4 ? ? A A 233 A U 241 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog245 hydrog ? ? A G 213 N1 ? ? ? 1_555 A C 219 N3 ? ? A G 234 A C 240 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog246 hydrog ? ? A G 213 N2 ? ? ? 1_555 A C 219 O2 ? ? A G 234 A C 240 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog247 hydrog ? ? A G 213 O6 ? ? ? 1_555 A C 219 N4 ? ? A G 234 A C 240 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog248 hydrog ? ? A A 240 N1 ? ? ? 1_555 A G 292 N1 ? ? A A 261 A G 313 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ? ? 
hydrog249 hydrog ? ? A A 240 N6 ? ? ? 1_555 A G 292 O6 ? ? A A 261 A G 313 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ? ? 
hydrog250 hydrog ? ? A C 241 N3 ? ? ? 1_555 A G 291 N1 ? ? A C 262 A G 312 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog251 hydrog ? ? A C 241 N4 ? ? ? 1_555 A G 291 O6 ? ? A C 262 A G 312 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog252 hydrog ? ? A C 241 O2 ? ? ? 1_555 A G 291 N2 ? ? A C 262 A G 312 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog253 hydrog ? ? A G 243 N1 ? ? ? 1_555 A C 290 N3 ? ? A G 264 A C 311 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog254 hydrog ? ? A G 243 N2 ? ? ? 1_555 A C 290 O2 ? ? A G 264 A C 311 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog255 hydrog ? ? A G 243 O6 ? ? ? 1_555 A C 290 N4 ? ? A G 264 A C 311 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog256 hydrog ? ? A A 244 N1 ? ? ? 1_555 A U 289 N3 ? ? A A 265 A U 310 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog257 hydrog ? ? A A 244 N6 ? ? ? 1_555 A U 289 O4 ? ? A A 265 A U 310 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog258 hydrog ? ? A C 245 N3 ? ? ? 1_555 A G 288 N1 ? ? A C 266 A G 309 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog259 hydrog ? ? A C 245 N4 ? ? ? 1_555 A G 288 O6 ? ? A C 266 A G 309 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog260 hydrog ? ? A C 245 O2 ? ? ? 1_555 A G 288 N2 ? ? A C 266 A G 309 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog261 hydrog ? ? A U 246 N3 ? ? ? 1_555 A A 287 N1 ? ? A U 267 A A 308 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog262 hydrog ? ? A U 246 O4 ? ? ? 1_555 A A 287 N6 ? ? A U 267 A A 308 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog263 hydrog ? ? A A 247 N1 ? ? ? 1_555 A U 286 N3 ? ? A A 268 A U 307 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog264 hydrog ? ? A A 247 N6 ? ? ? 1_555 A U 286 O4 ? ? A A 268 A U 307 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog265 hydrog ? ? A G 258 N2 ? ? ? 1_555 A A 278 N1 ? ? A G 279 A A 299 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ? ? 
hydrog266 hydrog ? ? A G 258 N2 ? ? ? 1_555 A U 279 O2 ? ? A G 279 A U 300 1_555 ? ? ? ? ? ? 'G-U MISPAIR'        ? ? 
hydrog267 hydrog ? ? A G 259 N1 ? ? ? 1_555 A C 277 N3 ? ? A G 280 A C 298 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog268 hydrog ? ? A G 259 N2 ? ? ? 1_555 A C 277 O2 ? ? A G 280 A C 298 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog269 hydrog ? ? A G 259 O6 ? ? ? 1_555 A C 277 N4 ? ? A G 280 A C 298 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog270 hydrog ? ? A G 260 N1 ? ? ? 1_555 A U 276 O2 ? ? A G 281 A U 297 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog271 hydrog ? ? A G 260 O6 ? ? ? 1_555 A U 276 N3 ? ? A G 281 A U 297 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog272 hydrog ? ? A G 261 N1 ? ? ? 1_555 A C 275 N3 ? ? A G 282 A C 296 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog273 hydrog ? ? A G 261 N2 ? ? ? 1_555 A C 275 O2 ? ? A G 282 A C 296 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog274 hydrog ? ? A G 261 O6 ? ? ? 1_555 A C 275 N4 ? ? A G 282 A C 296 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog275 hydrog ? ? A A 262 N1 ? ? ? 1_555 A U 274 N3 ? ? A A 283 A U 295 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog276 hydrog ? ? A A 262 N6 ? ? ? 1_555 A U 274 O4 ? ? A A 283 A U 295 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog277 hydrog ? ? A A 263 N1 ? ? ? 1_555 A U 273 N3 ? ? A A 284 A U 294 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog278 hydrog ? ? A A 263 N6 ? ? ? 1_555 A U 273 O4 ? ? A A 284 A U 294 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog279 hydrog ? ? A G 264 N1 ? ? ? 1_555 A C 272 N3 ? ? A G 285 A C 293 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog280 hydrog ? ? A G 264 N2 ? ? ? 1_555 A C 272 O2 ? ? A G 285 A C 293 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog281 hydrog ? ? A G 264 O6 ? ? ? 1_555 A C 272 N4 ? ? A G 285 A C 293 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog282 hydrog ? ? A A 265 N1 ? ? ? 1_555 A U 271 N3 ? ? A A 286 A U 292 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog283 hydrog ? ? A A 265 N6 ? ? ? 1_555 A U 271 O4 ? ? A A 286 A U 292 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog284 hydrog ? ? A U 266 N3 ? ? ? 1_555 A U 270 O4 ? ? A U 287 A U 291 1_555 ? ? ? ? ? ? 'U-U MISPAIR'        ? ? 
hydrog285 hydrog ? ? A A 293 N6 ? ? ? 1_555 A A 386 N3 ? ? A A 314 A A 407 1_555 ? ? ? ? ? ? 'A-A MISPAIR'        ? ? 
hydrog286 hydrog ? ? A C 294 N3 ? ? ? 1_555 A G 385 N1 ? ? A C 315 A G 406 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog287 hydrog ? ? A C 294 N4 ? ? ? 1_555 A G 385 O6 ? ? A C 315 A G 406 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog288 hydrog ? ? A C 294 O2 ? ? ? 1_555 A G 385 N2 ? ? A C 315 A G 406 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog289 hydrog ? ? A C 295 N3 ? ? ? 1_555 A G 384 N1 ? ? A C 316 A G 405 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog290 hydrog ? ? A C 295 N4 ? ? ? 1_555 A G 384 O6 ? ? A C 316 A G 405 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog291 hydrog ? ? A C 295 O2 ? ? ? 1_555 A G 384 N2 ? ? A C 316 A G 405 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog292 hydrog ? ? A C 297 N3 ? ? ? 1_555 A G 310 N1 ? ? A C 318 A G 331 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog293 hydrog ? ? A C 297 N4 ? ? ? 1_555 A G 310 O6 ? ? A C 318 A G 331 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog294 hydrog ? ? A C 297 O2 ? ? ? 1_555 A G 310 N2 ? ? A C 318 A G 331 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog295 hydrog ? ? A U 298 N3 ? ? ? 1_555 A A 309 N1 ? ? A U 319 A A 330 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog296 hydrog ? ? A U 298 O4 ? ? ? 1_555 A A 309 N6 ? ? A U 319 A A 330 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog297 hydrog ? ? A C 299 N3 ? ? ? 1_555 A G 308 N1 ? ? A C 320 A G 329 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog298 hydrog ? ? A C 299 N4 ? ? ? 1_555 A G 308 O6 ? ? A C 320 A G 329 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog299 hydrog ? ? A C 299 O2 ? ? ? 1_555 A G 308 N2 ? ? A C 320 A G 329 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog300 hydrog ? ? A C 300 N3 ? ? ? 1_555 A G 307 N1 ? ? A C 321 A G 328 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog301 hydrog ? ? A C 300 N4 ? ? ? 1_555 A G 307 O6 ? ? A C 321 A G 328 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog302 hydrog ? ? A C 300 O2 ? ? ? 1_555 A G 307 N2 ? ? A C 321 A G 328 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog303 hydrog ? ? A U 301 N3 ? ? ? 1_555 A G 306 O6 ? ? A U 322 A G 327 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog304 hydrog ? ? A U 301 O2 ? ? ? 1_555 A G 306 N1 ? ? A U 322 A G 327 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog305 hydrog ? ? A C 311 N3 ? ? ? 1_555 A G 346 N1 ? ? A C 332 A G 367 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog306 hydrog ? ? A C 311 N4 ? ? ? 1_555 A G 346 O6 ? ? A C 332 A G 367 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog307 hydrog ? ? A C 311 O2 ? ? ? 1_555 A G 346 N2 ? ? A C 332 A G 367 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog308 hydrog ? ? A U 312 N3 ? ? ? 1_555 A G 345 O6 ? ? A U 333 A G 366 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog309 hydrog ? ? A U 312 O2 ? ? ? 1_555 A G 345 N1 ? ? A U 333 A G 366 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog310 hydrog ? ? A A 313 N1 ? ? ? 1_555 A U 344 N3 ? ? A A 334 A U 365 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog311 hydrog ? ? A A 313 N6 ? ? ? 1_555 A U 344 O4 ? ? A A 334 A U 365 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog312 hydrog ? ? A G 314 N1 ? ? ? 1_555 A C 343 N3 ? ? A G 335 A C 364 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog313 hydrog ? ? A G 314 N2 ? ? ? 1_555 A C 343 O2 ? ? A G 335 A C 364 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog314 hydrog ? ? A G 314 O6 ? ? ? 1_555 A C 343 N4 ? ? A G 335 A C 364 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog315 hydrog ? ? A C 315 N3 ? ? ? 1_555 A G 342 N1 ? ? A C 336 A G 363 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog316 hydrog ? ? A C 315 N4 ? ? ? 1_555 A G 342 O6 ? ? A C 336 A G 363 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog317 hydrog ? ? A C 315 O2 ? ? ? 1_555 A G 342 N2 ? ? A C 336 A G 363 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog318 hydrog ? ? A G 316 N1 ? ? ? 1_555 A C 341 N3 ? ? A G 337 A C 362 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog319 hydrog ? ? A G 316 N2 ? ? ? 1_555 A C 341 O2 ? ? A G 337 A C 362 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog320 hydrog ? ? A G 316 O6 ? ? ? 1_555 A C 341 N4 ? ? A G 337 A C 362 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog321 hydrog ? ? A G 317 N1 ? ? ? 1_555 A C 340 N3 ? ? A G 338 A C 361 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog322 hydrog ? ? A G 317 N2 ? ? ? 1_555 A C 340 O2 ? ? A G 338 A C 361 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog323 hydrog ? ? A G 317 O6 ? ? ? 1_555 A C 340 N4 ? ? A G 338 A C 361 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog324 hydrog ? ? A A 321 N6 ? ? ? 1_555 A G 336 N3 ? ? A A 342 A G 357 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ? ? 
hydrog325 hydrog ? ? A A 321 N7 ? ? ? 1_555 A G 336 N2 ? ? A A 342 A G 357 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ? ? 
hydrog326 hydrog ? ? A A 322 N1 ? ? ? 1_555 A U 335 N3 ? ? A A 343 A U 356 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog327 hydrog ? ? A A 322 N6 ? ? ? 1_555 A U 335 O4 ? ? A A 343 A U 356 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog328 hydrog ? ? A G 323 N1 ? ? ? 1_555 A C 334 N3 ? ? A G 344 A C 355 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog329 hydrog ? ? A G 323 N2 ? ? ? 1_555 A C 334 O2 ? ? A G 344 A C 355 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog330 hydrog ? ? A G 323 O6 ? ? ? 1_555 A C 334 N4 ? ? A G 344 A C 355 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog331 hydrog ? ? A U 324 N3 ? ? ? 1_555 A A 333 N1 ? ? A U 345 A A 354 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog332 hydrog ? ? A U 324 O4 ? ? ? 1_555 A A 333 N6 ? ? A U 345 A A 354 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog333 hydrog ? ? A A 348 N1 ? ? ? 1_555 A U 381 N3 ? ? A A 369 A U 402 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog334 hydrog ? ? A A 348 N6 ? ? ? 1_555 A U 381 O4 ? ? A A 369 A U 402 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog335 hydrog ? ? A A 349 N1 ? ? ? 1_555 A U 380 N3 ? ? A A 370 A U 401 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog336 hydrog ? ? A A 349 N6 ? ? ? 1_555 A U 380 O4 ? ? A A 370 A U 401 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog337 hydrog ? ? A C 350 N3 ? ? ? 1_555 A G 379 N1 ? ? A C 371 A G 400 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog338 hydrog ? ? A C 350 N4 ? ? ? 1_555 A G 379 O6 ? ? A C 371 A G 400 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog339 hydrog ? ? A C 350 O2 ? ? ? 1_555 A G 379 N2 ? ? A C 371 A G 400 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog340 hydrog ? ? A U 351 N3 ? ? ? 1_555 A A 378 N1 ? ? A U 372 A A 399 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog341 hydrog ? ? A U 351 O4 ? ? ? 1_555 A A 378 N6 ? ? A U 372 A A 399 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog342 hydrog ? ? A A 352 N1 ? ? ? 1_555 A U 377 N3 ? ? A A 373 A U 398 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog343 hydrog ? ? A A 352 N6 ? ? ? 1_555 A U 377 O4 ? ? A A 373 A U 398 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog344 hydrog ? ? A A 353 N1 ? ? ? 1_555 A U 376 N3 ? ? A A 374 A U 397 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog345 hydrog ? ? A A 353 N6 ? ? ? 1_555 A U 376 O4 ? ? A A 374 A U 397 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog346 hydrog ? ? A U 354 N3 ? ? ? 1_555 A A 375 N1 ? ? A U 375 A A 396 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog347 hydrog ? ? A U 354 O4 ? ? ? 1_555 A A 375 N6 ? ? A U 375 A A 396 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog348 hydrog ? ? A U 355 N3 ? ? ? 1_555 A G 374 O6 ? ? A U 376 A G 395 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog349 hydrog ? ? A U 355 O2 ? ? ? 1_555 A G 374 N1 ? ? A U 376 A G 395 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog350 hydrog ? ? A G 357 N1 ? ? ? 1_555 A U 372 O2 ? ? A G 378 A U 393 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog351 hydrog ? ? A G 357 O6 ? ? ? 1_555 A U 372 N3 ? ? A G 378 A U 393 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog352 hydrog ? ? A U 358 N3 ? ? ? 1_555 A A 371 N1 ? ? A U 379 A A 392 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog353 hydrog ? ? A U 358 O4 ? ? ? 1_555 A A 371 N6 ? ? A U 379 A A 392 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog354 hydrog ? ? A A 359 N1 ? ? ? 1_555 A U 370 N3 ? ? A A 380 A U 391 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog355 hydrog ? ? A A 359 N6 ? ? ? 1_555 A U 370 O4 ? ? A A 380 A U 391 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog356 hydrog ? ? A U 360 N3 ? ? ? 1_555 A A 369 N1 ? ? A U 381 A A 390 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog357 hydrog ? ? A U 360 O4 ? ? ? 1_555 A A 369 N6 ? ? A U 381 A A 390 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog358 hydrog ? ? A G 361 N1 ? ? ? 1_555 A U 368 O2 ? ? A G 382 A U 389 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog359 hydrog ? ? A G 361 O6 ? ? ? 1_555 A U 368 N3 ? ? A G 382 A U 389 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ? ? 
hydrog360 hydrog ? ? A C 362 N3 ? ? ? 1_555 A G 367 N1 ? ? A C 383 A G 388 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog361 hydrog ? ? A C 362 N4 ? ? ? 1_555 A G 367 O6 ? ? A C 383 A G 388 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog362 hydrog ? ? A C 362 O2 ? ? ? 1_555 A G 367 N2 ? ? A C 383 A G 388 1_555 ? ? ? ? ? ? WATSON-CRICK         ? ? 
hydrog363 hydrog ? ? A G 363 N2 ? ? ? 1_555 A A 366 N7 ? ? A G 384 A A 387 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ? ? 
# 
_struct_conn_type.id          hydrog 
_struct_conn_type.criteria    ? 
_struct_conn_type.reference   ? 
# 
_atom_sites.entry_id                    6WLS 
_atom_sites.Cartn_transf_matrix[1][1]   ? 
_atom_sites.Cartn_transf_matrix[1][2]   ? 
_atom_sites.Cartn_transf_matrix[1][3]   ? 
_atom_sites.Cartn_transf_matrix[2][1]   ? 
_atom_sites.Cartn_transf_matrix[2][2]   ? 
_atom_sites.Cartn_transf_matrix[2][3]   ? 
_atom_sites.Cartn_transf_matrix[3][1]   ? 
_atom_sites.Cartn_transf_matrix[3][2]   ? 
_atom_sites.Cartn_transf_matrix[3][3]   ? 
_atom_sites.Cartn_transf_vector[1]      ? 
_atom_sites.Cartn_transf_vector[2]      ? 
_atom_sites.Cartn_transf_vector[3]      ? 
_atom_sites.fract_transf_matrix[1][1]   1.000000 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   1.000000 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   1.000000 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
_atom_sites.solution_primary            ? 
_atom_sites.solution_secondary          ? 
_atom_sites.solution_hydrogens          ? 
_atom_sites.special_details             ? 
# 
loop_
_atom_type.symbol 
C 
H 
N 
O 
P 
# 
loop_
_atom_site.group_PDB 
_atom_site.id 
_atom_site.type_symbol 
_atom_site.label_atom_id 
_atom_site.label_alt_id 
_atom_site.label_comp_id 
_atom_site.label_asym_id 
_atom_site.label_entity_id 
_atom_site.label_seq_id 
_atom_site.pdbx_PDB_ins_code 
_atom_site.Cartn_x 
_atom_site.Cartn_y 
_atom_site.Cartn_z 
_atom_site.occupancy 
_atom_site.B_iso_or_equiv 
_atom_site.pdbx_formal_charge 
_atom_site.auth_seq_id 
_atom_site.auth_comp_id 
_atom_site.auth_asym_id 
_atom_site.auth_atom_id 
_atom_site.pdbx_PDB_model_num 
ATOM 1      C "C5'"  . G A 1 1   ? 64.472  102.112 83.241  1.00 0.00 ? 22  G A "C5'"  1  
ATOM 2      C "C4'"  . G A 1 1   ? 63.434  101.038 83.034  1.00 0.00 ? 22  G A "C4'"  1  
ATOM 3      O "O4'"  . G A 1 1   ? 62.958  101.142 81.657  1.00 0.00 ? 22  G A "O4'"  1  
ATOM 4      C "C3'"  . G A 1 1   ? 63.929  99.603  83.134  1.00 0.00 ? 22  G A "C3'"  1  
ATOM 5      O "O3'"  . G A 1 1   ? 64.056  99.154  84.473  1.00 0.00 ? 22  G A "O3'"  1  
ATOM 6      C "C2'"  . G A 1 1   ? 62.841  98.870  82.354  1.00 0.00 ? 22  G A "C2'"  1  
ATOM 7      O "O2'"  . G A 1 1   ? 61.656  98.733  83.125  1.00 0.00 ? 22  G A "O2'"  1  
ATOM 8      C "C1'"  . G A 1 1   ? 62.590  99.868  81.206  1.00 0.00 ? 22  G A "C1'"  1  
ATOM 9      N N9     . G A 1 1   ? 63.378  99.542  80.003  1.00 0.00 ? 22  G A N9     1  
ATOM 10     C C8     . G A 1 1   ? 64.352  100.311 79.412  1.00 0.00 ? 22  G A C8     1  
ATOM 11     N N7     . G A 1 1   ? 64.874  99.754  78.353  1.00 0.00 ? 22  G A N7     1  
ATOM 12     C C5     . G A 1 1   ? 64.206  98.544  78.237  1.00 0.00 ? 22  G A C5     1  
ATOM 13     C C6     . G A 1 1   ? 64.344  97.506  77.279  1.00 0.00 ? 22  G A C6     1  
ATOM 14     O O6     . G A 1 1   ? 65.109  97.449  76.310  1.00 0.00 ? 22  G A O6     1  
ATOM 15     N N1     . G A 1 1   ? 63.469  96.454  77.534  1.00 0.00 ? 22  G A N1     1  
ATOM 16     C C2     . G A 1 1   ? 62.576  96.406  78.577  1.00 0.00 ? 22  G A C2     1  
ATOM 17     N N2     . G A 1 1   ? 61.814  95.305  78.658  1.00 0.00 ? 22  G A N2     1  
ATOM 18     N N3     . G A 1 1   ? 62.439  97.366  79.476  1.00 0.00 ? 22  G A N3     1  
ATOM 19     C C4     . G A 1 1   ? 63.279  98.397  79.248  1.00 0.00 ? 22  G A C4     1  
ATOM 20     H "H4'"  . G A 1 1   ? 62.676  101.157 83.645  1.00 0.00 ? 22  G A "H4'"  1  
ATOM 21     H "H3'"  . G A 1 1   ? 64.787  99.492  82.676  1.00 0.00 ? 22  G A "H3'"  1  
ATOM 22     H "H2'"  . G A 1 1   ? 63.159  98.004  82.020  1.00 0.00 ? 22  G A "H2'"  1  
ATOM 23     H "HO2'" . G A 1 1   ? 61.883  98.812  84.075  1.00 0.00 ? 22  G A "HO2'" 1  
ATOM 24     H "H1'"  . G A 1 1   ? 61.636  99.873  80.980  1.00 0.00 ? 22  G A "H1'"  1  
ATOM 25     H H8     . G A 1 1   ? 64.626  101.189 79.750  1.00 0.00 ? 22  G A H8     1  
ATOM 26     H H1     . G A 1 1   ? 63.493  95.690  76.921  1.00 0.00 ? 22  G A H1     1  
ATOM 27     H H21    . G A 1 1   ? 61.910  94.589  77.996  1.00 0.00 ? 22  G A H21    1  
ATOM 28     H H22    . G A 1 1   ? 61.159  95.215  79.382  1.00 0.00 ? 22  G A H22    1  
ATOM 29     P P      . G A 1 2   ? 65.362  98.336  84.929  1.00 0.00 ? 23  G A P      1  
ATOM 30     O OP1    . G A 1 2   ? 65.389  98.303  86.414  1.00 0.00 ? 23  G A OP1    1  
ATOM 31     O OP2    . G A 1 2   ? 66.527  98.879  84.186  1.00 0.00 ? 23  G A OP2    1  
ATOM 32     O "O5'"  . G A 1 2   ? 65.092  96.855  84.408  1.00 0.00 ? 23  G A "O5'"  1  
ATOM 33     C "C5'"  . G A 1 2   ? 63.966  96.117  84.860  1.00 0.00 ? 23  G A "C5'"  1  
ATOM 34     C "C4'"  . G A 1 2   ? 63.568  95.051  83.870  1.00 0.00 ? 23  G A "C4'"  1  
ATOM 35     O "O4'"  . G A 1 2   ? 63.212  95.648  82.583  1.00 0.00 ? 23  G A "O4'"  1  
ATOM 36     C "C3'"  . G A 1 2   ? 64.639  94.027  83.526  1.00 0.00 ? 23  G A "C3'"  1  
ATOM 37     O "O3'"  . G A 1 2   ? 64.720  92.973  84.471  1.00 0.00 ? 23  G A "O3'"  1  
ATOM 38     C "C2'"  . G A 1 2   ? 64.203  93.583  82.136  1.00 0.00 ? 23  G A "C2'"  1  
ATOM 39     O "O2'"  . G A 1 2   ? 63.082  92.714  82.200  1.00 0.00 ? 23  G A "O2'"  1  
ATOM 40     C "C1'"  . G A 1 2   ? 63.776  94.914  81.538  1.00 0.00 ? 23  G A "C1'"  1  
ATOM 41     N N9     . G A 1 2   ? 64.919  95.672  80.996  1.00 0.00 ? 23  G A N9     1  
ATOM 42     C C8     . G A 1 2   ? 65.501  96.796  81.531  1.00 0.00 ? 23  G A C8     1  
ATOM 43     N N7     . G A 1 2   ? 66.500  97.245  80.820  1.00 0.00 ? 23  G A N7     1  
ATOM 44     C C5     . G A 1 2   ? 66.584  96.365  79.751  1.00 0.00 ? 23  G A C5     1  
ATOM 45     C C6     . G A 1 2   ? 67.477  96.339  78.648  1.00 0.00 ? 23  G A C6     1  
ATOM 46     O O6     . G A 1 2   ? 68.402  97.117  78.388  1.00 0.00 ? 23  G A O6     1  
ATOM 47     N N1     . G A 1 2   ? 67.209  95.272  77.796  1.00 0.00 ? 23  G A N1     1  
ATOM 48     C C2     . G A 1 2   ? 66.210  94.347  77.981  1.00 0.00 ? 23  G A C2     1  
ATOM 49     N N2     . G A 1 2   ? 66.108  93.387  77.049  1.00 0.00 ? 23  G A N2     1  
ATOM 50     N N3     . G A 1 2   ? 65.372  94.359  79.004  1.00 0.00 ? 23  G A N3     1  
ATOM 51     C C4     . G A 1 2   ? 65.615  95.388  79.844  1.00 0.00 ? 23  G A C4     1  
ATOM 52     H "H5'"  . G A 1 2   ? 63.212  96.730  84.989  1.00 0.00 ? 23  G A "H5'"  1  
ATOM 53     H "H5''" . G A 1 2   ? 64.184  95.694  85.716  1.00 0.00 ? 23  G A "H5''" 1  
ATOM 54     H "H4'"  . G A 1 2   ? 62.784  94.584  84.228  1.00 0.00 ? 23  G A "H4'"  1  
ATOM 55     H "H3'"  . G A 1 2   ? 65.512  94.466  83.459  1.00 0.00 ? 23  G A "H3'"  1  
ATOM 56     H "H2'"  . G A 1 2   ? 64.946  93.180  81.638  1.00 0.00 ? 23  G A "H2'"  1  
ATOM 57     H "HO2'" . G A 1 2   ? 63.124  92.199  83.033  1.00 0.00 ? 23  G A "HO2'" 1  
ATOM 58     H "H1'"  . G A 1 2   ? 63.121  94.758  80.826  1.00 0.00 ? 23  G A "H1'"  1  
ATOM 59     H H8     . G A 1 2   ? 65.198  97.219  82.361  1.00 0.00 ? 23  G A H8     1  
ATOM 60     H H1     . G A 1 2   ? 67.777  95.174  77.004  1.00 0.00 ? 23  G A H1     1  
ATOM 61     H H21    . G A 1 2   ? 66.725  93.371  76.289  1.00 0.00 ? 23  G A H21    1  
ATOM 62     H H22    . G A 1 2   ? 65.413  92.699  77.129  1.00 0.00 ? 23  G A H22    1  
ATOM 63     P P      . A A 1 3   ? 66.153  92.468  84.995  1.00 0.00 ? 24  A A P      1  
ATOM 64     O OP1    . A A 1 3   ? 65.925  91.394  85.994  1.00 0.00 ? 24  A A OP1    1  
ATOM 65     O OP2    . A A 1 3   ? 66.953  93.661  85.370  1.00 0.00 ? 24  A A OP2    1  
ATOM 66     O "O5'"  . A A 1 3   ? 66.824  91.810  83.708  1.00 0.00 ? 24  A A "O5'"  1  
ATOM 67     C "C5'"  . A A 1 3   ? 66.401  90.541  83.233  1.00 0.00 ? 24  A A "C5'"  1  
ATOM 68     C "C4'"  . A A 1 3   ? 65.748  90.646  81.878  1.00 0.00 ? 24  A A "C4'"  1  
ATOM 69     O "O4'"  . A A 1 3   ? 66.515  91.531  81.030  1.00 0.00 ? 24  A A "O4'"  1  
ATOM 70     C "C3'"  . A A 1 3   ? 65.649  89.353  81.083  1.00 0.00 ? 24  A A "C3'"  1  
ATOM 71     O "O3'"  . A A 1 3   ? 64.517  88.574  81.428  1.00 0.00 ? 24  A A "O3'"  1  
ATOM 72     C "C2'"  . A A 1 3   ? 65.615  89.813  79.638  1.00 0.00 ? 24  A A "C2'"  1  
ATOM 73     O "O2'"  . A A 1 3   ? 64.305  90.204  79.253  1.00 0.00 ? 24  A A "O2'"  1  
ATOM 74     C "C1'"  . A A 1 3   ? 66.502  91.049  79.688  1.00 0.00 ? 24  A A "C1'"  1  
ATOM 75     N N9     . A A 1 3   ? 67.882  90.761  79.252  1.00 0.00 ? 24  A A N9     1  
ATOM 76     C C8     . A A 1 3   ? 69.033  90.822  79.998  1.00 0.00 ? 24  A A C8     1  
ATOM 77     N N7     . A A 1 3   ? 70.114  90.507  79.329  1.00 0.00 ? 24  A A N7     1  
ATOM 78     C C5     . A A 1 3   ? 69.645  90.219  78.054  1.00 0.00 ? 24  A A C5     1  
ATOM 79     C C6     . A A 1 3   ? 70.295  89.819  76.873  1.00 0.00 ? 24  A A C6     1  
ATOM 80     N N6     . A A 1 3   ? 71.613  89.631  76.781  1.00 0.00 ? 24  A A N6     1  
ATOM 81     N N1     . A A 1 3   ? 69.535  89.614  75.776  1.00 0.00 ? 24  A A N1     1  
ATOM 82     C C2     . A A 1 3   ? 68.212  89.802  75.868  1.00 0.00 ? 24  A A C2     1  
ATOM 83     N N3     . A A 1 3   ? 67.487  90.176  76.920  1.00 0.00 ? 24  A A N3     1  
ATOM 84     C C4     . A A 1 3   ? 68.272  90.371  77.994  1.00 0.00 ? 24  A A C4     1  
ATOM 85     H "H5'"  . A A 1 3   ? 65.759  90.159  83.869  1.00 0.00 ? 24  A A "H5'"  1  
ATOM 86     H "H5''" . A A 1 3   ? 67.177  89.947  83.169  1.00 0.00 ? 24  A A "H5''" 1  
ATOM 87     H "H4'"  . A A 1 3   ? 64.847  91.017  81.991  1.00 0.00 ? 24  A A "H4'"  1  
ATOM 88     H "H3'"  . A A 1 3   ? 66.462  88.828  81.243  1.00 0.00 ? 24  A A "H3'"  1  
ATOM 89     H "H2'"  . A A 1 3   ? 65.984  89.134  79.036  1.00 0.00 ? 24  A A "H2'"  1  
ATOM 90     H "HO2'" . A A 1 3   ? 63.657  89.781  79.855  1.00 0.00 ? 24  A A "HO2'" 1  
ATOM 91     H "H1'"  . A A 1 3   ? 66.119  91.748  79.117  1.00 0.00 ? 24  A A "H1'"  1  
ATOM 92     H H8     . A A 1 3   ? 69.045  91.077  80.945  1.00 0.00 ? 24  A A H8     1  
ATOM 93     H H61    . A A 1 3   ? 72.010  89.352  75.930  1.00 0.00 ? 24  A A H61    1  
ATOM 94     H H62    . A A 1 3   ? 72.185  89.774  77.564  1.00 0.00 ? 24  A A H62    1  
ATOM 95     H H2     . A A 1 3   ? 67.706  89.640  75.044  1.00 0.00 ? 24  A A H2     1  
ATOM 96     P P      . G A 1 4   ? 64.682  87.008  81.750  1.00 0.00 ? 25  G A P      1  
ATOM 97     O OP1    . G A 1 4   ? 63.396  86.335  81.433  1.00 0.00 ? 25  G A OP1    1  
ATOM 98     O OP2    . G A 1 4   ? 65.263  86.878  83.110  1.00 0.00 ? 25  G A OP2    1  
ATOM 99     O "O5'"  . G A 1 4   ? 65.770  86.510  80.699  1.00 0.00 ? 25  G A "O5'"  1  
ATOM 100    C "C5'"  . G A 1 4   ? 65.438  86.344  79.328  1.00 0.00 ? 25  G A "C5'"  1  
ATOM 101    C "C4'"  . G A 1 4   ? 66.672  86.197  78.473  1.00 0.00 ? 25  G A "C4'"  1  
ATOM 102    O "O4'"  . G A 1 4   ? 67.558  87.321  78.687  1.00 0.00 ? 25  G A "O4'"  1  
ATOM 103    C "C3'"  . G A 1 4   ? 67.559  85.000  78.780  1.00 0.00 ? 25  G A "C3'"  1  
ATOM 104    O "O3'"  . G A 1 4   ? 67.079  83.795  78.208  1.00 0.00 ? 25  G A "O3'"  1  
ATOM 105    C "C2'"  . G A 1 4   ? 68.871  85.458  78.150  1.00 0.00 ? 25  G A "C2'"  1  
ATOM 106    O "O2'"  . G A 1 4   ? 68.812  85.394  76.733  1.00 0.00 ? 25  G A "O2'"  1  
ATOM 107    C "C1'"  . G A 1 4   ? 68.895  86.918  78.591  1.00 0.00 ? 25  G A "C1'"  1  
ATOM 108    N N9     . G A 1 4   ? 69.514  87.087  79.919  1.00 0.00 ? 25  G A N9     1  
ATOM 109    C C8     . G A 1 4   ? 68.874  87.341  81.109  1.00 0.00 ? 25  G A C8     1  
ATOM 110    N N7     . G A 1 4   ? 69.693  87.441  82.121  1.00 0.00 ? 25  G A N7     1  
ATOM 111    C C5     . G A 1 4   ? 70.949  87.241  81.567  1.00 0.00 ? 25  G A C5     1  
ATOM 112    C C6     . G A 1 4   ? 72.231  87.233  82.175  1.00 0.00 ? 25  G A C6     1  
ATOM 113    O O6     . G A 1 4   ? 72.521  87.407  83.364  1.00 0.00 ? 25  G A O6     1  
ATOM 114    N N1     . G A 1 4   ? 73.238  86.992  81.245  1.00 0.00 ? 25  G A N1     1  
ATOM 115    C C2     . G A 1 4   ? 73.038  86.784  79.902  1.00 0.00 ? 25  G A C2     1  
ATOM 116    N N2     . G A 1 4   ? 74.136  86.566  79.163  1.00 0.00 ? 25  G A N2     1  
ATOM 117    N N3     . G A 1 4   ? 71.848  86.789  79.323  1.00 0.00 ? 25  G A N3     1  
ATOM 118    C C4     . G A 1 4   ? 70.857  87.021  80.209  1.00 0.00 ? 25  G A C4     1  
ATOM 119    H "H5'"  . G A 1 4   ? 64.929  87.124  79.025  1.00 0.00 ? 25  G A "H5'"  1  
ATOM 120    H "H5''" . G A 1 4   ? 64.882  85.542  79.229  1.00 0.00 ? 25  G A "H5''" 1  
ATOM 121    H "H4'"  . G A 1 4   ? 66.410  86.165  77.528  1.00 0.00 ? 25  G A "H4'"  1  
ATOM 122    H "H3'"  . G A 1 4   ? 67.680  84.872  79.743  1.00 0.00 ? 25  G A "H3'"  1  
ATOM 123    H "H2'"  . G A 1 4   ? 69.634  84.956  78.505  1.00 0.00 ? 25  G A "H2'"  1  
ATOM 124    H "HO2'" . G A 1 4   ? 69.669  85.696  76.364  1.00 0.00 ? 25  G A "HO2'" 1  
ATOM 125    H "H1'"  . G A 1 4   ? 69.387  87.450  77.931  1.00 0.00 ? 25  G A "H1'"  1  
ATOM 126    H H8     . G A 1 4   ? 67.903  87.438  81.190  1.00 0.00 ? 25  G A H8     1  
ATOM 127    H H1     . G A 1 4   ? 74.160  86.968  81.576  1.00 0.00 ? 25  G A H1     1  
ATOM 128    H H21    . G A 1 4   ? 75.020  86.561  79.585  1.00 0.00 ? 25  G A H21    1  
ATOM 129    H H22    . G A 1 4   ? 74.054  86.412  78.198  1.00 0.00 ? 25  G A H22    1  
ATOM 130    P P      . G A 1 5   ? 67.058  82.442  79.076  1.00 0.00 ? 26  G A P      1  
ATOM 131    O OP1    . G A 1 5   ? 66.838  81.303  78.149  1.00 0.00 ? 26  G A OP1    1  
ATOM 132    O OP2    . G A 1 5   ? 66.135  82.645  80.222  1.00 0.00 ? 26  G A OP2    1  
ATOM 133    O "O5'"  . G A 1 5   ? 68.540  82.330  79.651  1.00 0.00 ? 26  G A "O5'"  1  
ATOM 134    C "C5'"  . G A 1 5   ? 69.646  82.133  78.783  1.00 0.00 ? 26  G A "C5'"  1  
ATOM 135    C "C4'"  . G A 1 5   ? 70.953  82.159  79.535  1.00 0.00 ? 26  G A "C4'"  1  
ATOM 136    O "O4'"  . G A 1 5   ? 71.143  83.431  80.202  1.00 0.00 ? 26  G A "O4'"  1  
ATOM 137    C "C3'"  . G A 1 5   ? 71.082  81.170  80.684  1.00 0.00 ? 26  G A "C3'"  1  
ATOM 138    O "O3'"  . G A 1 5   ? 71.255  79.833  80.246  1.00 0.00 ? 26  G A "O3'"  1  
ATOM 139    C "C2'"  . G A 1 5   ? 72.279  81.742  81.436  1.00 0.00 ? 26  G A "C2'"  1  
ATOM 140    O "O2'"  . G A 1 5   ? 73.499  81.410  80.790  1.00 0.00 ? 26  G A "O2'"  1  
ATOM 141    C "C1'"  . G A 1 5   ? 72.032  83.246  81.296  1.00 0.00 ? 26  G A "C1'"  1  
ATOM 142    N N9     . G A 1 5   ? 71.450  83.830  82.518  1.00 0.00 ? 26  G A N9     1  
ATOM 143    C C8     . G A 1 5   ? 70.141  84.193  82.725  1.00 0.00 ? 26  G A C8     1  
ATOM 144    N N7     . G A 1 5   ? 69.926  84.686  83.915  1.00 0.00 ? 26  G A N7     1  
ATOM 145    C C5     . G A 1 5   ? 71.168  84.646  84.532  1.00 0.00 ? 26  G A C5     1  
ATOM 146    C C6     . G A 1 5   ? 71.561  85.047  85.835  1.00 0.00 ? 26  G A C6     1  
ATOM 147    O O6     . G A 1 5   ? 70.865  85.536  86.733  1.00 0.00 ? 26  G A O6     1  
ATOM 148    N N1     . G A 1 5   ? 72.919  84.832  86.051  1.00 0.00 ? 26  G A N1     1  
ATOM 149    C C2     . G A 1 5   ? 73.788  84.298  85.131  1.00 0.00 ? 26  G A C2     1  
ATOM 150    N N2     . G A 1 5   ? 75.064  84.167  85.524  1.00 0.00 ? 26  G A N2     1  
ATOM 151    N N3     . G A 1 5   ? 73.435  83.920  83.913  1.00 0.00 ? 26  G A N3     1  
ATOM 152    C C4     . G A 1 5   ? 72.120  84.120  83.684  1.00 0.00 ? 26  G A C4     1  
ATOM 153    H "H5'"  . G A 1 5   ? 69.652  82.841  78.106  1.00 0.00 ? 26  G A "H5'"  1  
ATOM 154    H "H5''" . G A 1 5   ? 69.551  81.265  78.336  1.00 0.00 ? 26  G A "H5''" 1  
ATOM 155    H "H4'"  . G A 1 5   ? 71.685  82.006  78.901  1.00 0.00 ? 26  G A "H4'"  1  
ATOM 156    H "H3'"  . G A 1 5   ? 70.293  81.218  81.262  1.00 0.00 ? 26  G A "H3'"  1  
ATOM 157    H "H2'"  . G A 1 5   ? 72.278  81.464  82.376  1.00 0.00 ? 26  G A "H2'"  1  
ATOM 158    H "HO2'" . G A 1 5   ? 73.397  80.547  80.338  1.00 0.00 ? 26  G A "HO2'" 1  
ATOM 159    H "H1'"  . G A 1 5   ? 72.877  83.697  81.088  1.00 0.00 ? 26  G A "H1'"  1  
ATOM 160    H H8     . G A 1 5   ? 69.439  84.093  82.049  1.00 0.00 ? 26  G A H8     1  
ATOM 161    H H1     . G A 1 5   ? 73.281  85.081  86.927  1.00 0.00 ? 26  G A H1     1  
ATOM 162    H H21    . G A 1 5   ? 75.333  84.445  86.424  1.00 0.00 ? 26  G A H21    1  
ATOM 163    H H22    . G A 1 5   ? 75.730  83.792  84.909  1.00 0.00 ? 26  G A H22    1  
ATOM 164    P P      . G A 1 6   ? 70.765  78.611  81.168  1.00 0.00 ? 27  G A P      1  
ATOM 165    O OP1    . G A 1 6   ? 71.498  77.391  80.745  1.00 0.00 ? 27  G A OP1    1  
ATOM 166    O OP2    . G A 1 6   ? 69.280  78.609  81.175  1.00 0.00 ? 27  G A OP2    1  
ATOM 167    O "O5'"  . G A 1 6   ? 71.264  79.005  82.629  1.00 0.00 ? 27  G A "O5'"  1  
ATOM 168    C "C5'"  . G A 1 6   ? 71.963  78.069  83.437  1.00 0.00 ? 27  G A "C5'"  1  
ATOM 169    C "C4'"  . G A 1 6   ? 73.450  78.323  83.418  1.00 0.00 ? 27  G A "C4'"  1  
ATOM 170    O "O4'"  . G A 1 6   ? 73.692  79.705  83.750  1.00 0.00 ? 27  G A "O4'"  1  
ATOM 171    C "C3'"  . G A 1 6   ? 74.273  77.542  84.432  1.00 0.00 ? 27  G A "C3'"  1  
ATOM 172    O "O3'"  . G A 1 6   ? 74.584  76.229  83.997  1.00 0.00 ? 27  G A "O3'"  1  
ATOM 173    C "C2'"  . G A 1 6   ? 75.502  78.420  84.627  1.00 0.00 ? 27  G A "C2'"  1  
ATOM 174    O "O2'"  . G A 1 6   ? 76.447  78.224  83.585  1.00 0.00 ? 27  G A "O2'"  1  
ATOM 175    C "C1'"  . G A 1 6   ? 74.902  79.818  84.496  1.00 0.00 ? 27  G A "C1'"  1  
ATOM 176    N N9     . G A 1 6   ? 74.601  80.419  85.809  1.00 0.00 ? 27  G A N9     1  
ATOM 177    C C8     . G A 1 6   ? 73.398  80.410  86.472  1.00 0.00 ? 27  G A C8     1  
ATOM 178    N N7     . G A 1 6   ? 73.439  81.028  87.621  1.00 0.00 ? 27  G A N7     1  
ATOM 179    C C5     . G A 1 6   ? 74.750  81.472  87.724  1.00 0.00 ? 27  G A C5     1  
ATOM 180    C C6     . G A 1 6   ? 75.394  82.205  88.755  1.00 0.00 ? 27  G A C6     1  
ATOM 181    O O6     . G A 1 6   ? 74.918  82.622  89.816  1.00 0.00 ? 27  G A O6     1  
ATOM 182    N N1     . G A 1 6   ? 76.732  82.445  88.454  1.00 0.00 ? 27  G A N1     1  
ATOM 183    C C2     . G A 1 6   ? 77.369  82.031  87.310  1.00 0.00 ? 27  G A C2     1  
ATOM 184    N N2     . G A 1 6   ? 78.665  82.358  87.199  1.00 0.00 ? 27  G A N2     1  
ATOM 185    N N3     . G A 1 6   ? 76.780  81.348  86.342  1.00 0.00 ? 27  G A N3     1  
ATOM 186    C C4     . G A 1 6   ? 75.481  81.104  86.614  1.00 0.00 ? 27  G A C4     1  
ATOM 187    H "H5'"  . G A 1 6   ? 71.789  77.165  83.103  1.00 0.00 ? 27  G A "H5'"  1  
ATOM 188    H "H5''" . G A 1 6   ? 71.638  78.138  84.359  1.00 0.00 ? 27  G A "H5''" 1  
ATOM 189    H "H4'"  . G A 1 6   ? 73.802  78.148  82.520  1.00 0.00 ? 27  G A "H4'"  1  
ATOM 190    H "H3'"  . G A 1 6   ? 73.774  77.492  85.273  1.00 0.00 ? 27  G A "H3'"  1  
ATOM 191    H "H2'"  . G A 1 6   ? 75.903  78.284  85.512  1.00 0.00 ? 27  G A "H2'"  1  
ATOM 192    H "HO2'" . G A 1 6   ? 77.249  78.752  83.778  1.00 0.00 ? 27  G A "HO2'" 1  
ATOM 193    H "H1'"  . G A 1 6   ? 75.525  80.396  84.007  1.00 0.00 ? 27  G A "H1'"  1  
ATOM 194    H H8     . G A 1 6   ? 72.589  79.984  86.118  1.00 0.00 ? 27  G A H8     1  
ATOM 195    H H1     . G A 1 6   ? 77.258  82.947  89.111  1.00 0.00 ? 27  G A H1     1  
ATOM 196    H H21    . G A 1 6   ? 79.108  82.864  87.911  1.00 0.00 ? 27  G A H21    1  
ATOM 197    H H22    . G A 1 6   ? 79.172  82.090  86.403  1.00 0.00 ? 27  G A H22    1  
ATOM 198    P P      . A A 1 7   ? 74.213  74.965  84.919  1.00 0.00 ? 28  A A P      1  
ATOM 199    O OP1    . A A 1 7   ? 72.962  74.363  84.394  1.00 0.00 ? 28  A A OP1    1  
ATOM 200    O OP2    . A A 1 7   ? 74.282  75.395  86.338  1.00 0.00 ? 28  A A OP2    1  
ATOM 201    O "O5'"  . A A 1 7   ? 75.402  73.937  84.658  1.00 0.00 ? 28  A A "O5'"  1  
ATOM 202    C "C5'"  . A A 1 7   ? 75.791  73.592  83.337  1.00 0.00 ? 28  A A "C5'"  1  
ATOM 203    C "C4'"  . A A 1 7   ? 77.283  73.709  83.149  1.00 0.00 ? 28  A A "C4'"  1  
ATOM 204    O "O4'"  . A A 1 7   ? 77.690  75.003  83.663  1.00 0.00 ? 28  A A "O4'"  1  
ATOM 205    C "C3'"  . A A 1 7   ? 78.130  72.679  83.880  1.00 0.00 ? 28  A A "C3'"  1  
ATOM 206    O "O3'"  . A A 1 7   ? 79.376  72.437  83.250  1.00 0.00 ? 28  A A "O3'"  1  
ATOM 207    C "C2'"  . A A 1 7   ? 78.399  73.350  85.221  1.00 0.00 ? 28  A A "C2'"  1  
ATOM 208    O "O2'"  . A A 1 7   ? 79.632  72.916  85.776  1.00 0.00 ? 28  A A "O2'"  1  
ATOM 209    C "C1'"  . A A 1 7   ? 78.527  74.801  84.805  1.00 0.00 ? 28  A A "C1'"  1  
ATOM 210    N N9     . A A 1 7   ? 78.050  75.724  85.853  1.00 0.00 ? 28  A A N9     1  
ATOM 211    C C8     . A A 1 7   ? 76.884  75.650  86.575  1.00 0.00 ? 28  A A C8     1  
ATOM 212    N N7     . A A 1 7   ? 76.736  76.622  87.441  1.00 0.00 ? 28  A A N7     1  
ATOM 213    C C5     . A A 1 7   ? 77.882  77.389  87.279  1.00 0.00 ? 28  A A C5     1  
ATOM 214    C C6     . A A 1 7   ? 78.331  78.565  87.906  1.00 0.00 ? 28  A A C6     1  
ATOM 215    N N6     . A A 1 7   ? 77.651  79.200  88.863  1.00 0.00 ? 28  A A N6     1  
ATOM 216    N N1     . A A 1 7   ? 79.519  79.073  87.512  1.00 0.00 ? 28  A A N1     1  
ATOM 217    C C2     . A A 1 7   ? 80.202  78.436  86.552  1.00 0.00 ? 28  A A C2     1  
ATOM 218    N N3     . A A 1 7   ? 79.885  77.326  85.889  1.00 0.00 ? 28  A A N3     1  
ATOM 219    C C4     . A A 1 7   ? 78.699  76.847  86.305  1.00 0.00 ? 28  A A C4     1  
ATOM 220    H "H5'"  . A A 1 7   ? 75.342  74.191  82.704  1.00 0.00 ? 28  A A "H5'"  1  
ATOM 221    H "H5''" . A A 1 7   ? 75.517  72.670  83.152  1.00 0.00 ? 28  A A "H5''" 1  
ATOM 222    H "H4'"  . A A 1 7   ? 77.501  73.679  82.194  1.00 0.00 ? 28  A A "H4'"  1  
ATOM 223    H "H3'"  . A A 1 7   ? 77.654  71.828  83.986  1.00 0.00 ? 28  A A "H3'"  1  
ATOM 224    H "H2'"  . A A 1 7   ? 77.654  73.219  85.844  1.00 0.00 ? 28  A A "H2'"  1  
ATOM 225    H "HO2'" . A A 1 7   ? 79.797  73.407  86.608  1.00 0.00 ? 28  A A "HO2'" 1  
ATOM 226    H "H1'"  . A A 1 7   ? 79.465  74.999  84.599  1.00 0.00 ? 28  A A "H1'"  1  
ATOM 227    H H8     . A A 1 7   ? 76.223  74.936  86.454  1.00 0.00 ? 28  A A H8     1  
ATOM 228    H H61    . A A 1 7   ? 78.015  80.018  89.263  1.00 0.00 ? 28  A A H61    1  
ATOM 229    H H62    . A A 1 7   ? 76.787  78.850  89.164  1.00 0.00 ? 28  A A H62    1  
ATOM 230    H H2     . A A 1 7   ? 81.058  78.845  86.302  1.00 0.00 ? 28  A A H2     1  
ATOM 231    P P      . A A 1 8   ? 79.468  71.431  81.999  1.00 0.00 ? 29  A A P      1  
ATOM 232    O OP1    . A A 1 8   ? 78.784  72.067  80.846  1.00 0.00 ? 29  A A OP1    1  
ATOM 233    O OP2    . A A 1 8   ? 79.037  70.087  82.459  1.00 0.00 ? 29  A A OP2    1  
ATOM 234    O "O5'"  . A A 1 8   ? 81.026  71.364  81.673  1.00 0.00 ? 29  A A "O5'"  1  
ATOM 235    C "C5'"  . A A 1 8   ? 81.962  70.971  82.666  1.00 0.00 ? 29  A A "C5'"  1  
ATOM 236    C "C4'"  . A A 1 8   ? 83.072  71.982  82.811  1.00 0.00 ? 29  A A "C4'"  1  
ATOM 237    O "O4'"  . A A 1 8   ? 82.704  73.184  82.075  1.00 0.00 ? 29  A A "O4'"  1  
ATOM 238    C "C3'"  . A A 1 8   ? 83.383  72.432  84.230  1.00 0.00 ? 29  A A "C3'"  1  
ATOM 239    O "O3'"  . A A 1 8   ? 84.771  72.578  84.475  1.00 0.00 ? 29  A A "O3'"  1  
ATOM 240    C "C2'"  . A A 1 8   ? 82.700  73.810  84.304  1.00 0.00 ? 29  A A "C2'"  1  
ATOM 241    O "O2'"  . A A 1 8   ? 83.386  74.677  85.195  1.00 0.00 ? 29  A A "O2'"  1  
ATOM 242    C "C1'"  . A A 1 8   ? 82.884  74.323  82.875  1.00 0.00 ? 29  A A "C1'"  1  
ATOM 243    N N9     . A A 1 8   ? 81.868  75.328  82.511  1.00 0.00 ? 29  A A N9     1  
ATOM 244    C C8     . A A 1 8   ? 80.741  75.152  81.746  1.00 0.00 ? 29  A A C8     1  
ATOM 245    N N7     . A A 1 8   ? 80.028  76.240  81.597  1.00 0.00 ? 29  A A N7     1  
ATOM 246    C C5     . A A 1 8   ? 80.732  77.200  82.311  1.00 0.00 ? 29  A A C5     1  
ATOM 247    C C6     . A A 1 8   ? 80.499  78.568  82.543  1.00 0.00 ? 29  A A C6     1  
ATOM 248    N N6     . A A 1 8   ? 79.447  79.232  82.060  1.00 0.00 ? 29  A A N6     1  
ATOM 249    N N1     . A A 1 8   ? 81.396  79.238  83.298  1.00 0.00 ? 29  A A N1     1  
ATOM 250    C C2     . A A 1 8   ? 82.452  78.572  83.783  1.00 0.00 ? 29  A A C2     1  
ATOM 251    N N3     . A A 1 8   ? 82.778  77.290  83.634  1.00 0.00 ? 29  A A N3     1  
ATOM 252    C C4     . A A 1 8   ? 81.867  76.652  82.879  1.00 0.00 ? 29  A A C4     1  
ATOM 253    H "H5'"  . A A 1 8   ? 82.349  70.106  82.416  1.00 0.00 ? 29  A A "H5'"  1  
ATOM 254    H "H5''" . A A 1 8   ? 81.500  70.879  83.524  1.00 0.00 ? 29  A A "H5''" 1  
ATOM 255    H "H4'"  . A A 1 8   ? 83.888  71.618  82.408  1.00 0.00 ? 29  A A "H4'"  1  
ATOM 256    H "H3'"  . A A 1 8   ? 83.004  71.813  84.890  1.00 0.00 ? 29  A A "H3'"  1  
ATOM 257    H "H2'"  . A A 1 8   ? 81.751  73.728  84.534  1.00 0.00 ? 29  A A "H2'"  1  
ATOM 258    H "HO2'" . A A 1 8   ? 82.976  75.566  85.152  1.00 0.00 ? 29  A A "HO2'" 1  
ATOM 259    H "H1'"  . A A 1 8   ? 83.779  74.713  82.782  1.00 0.00 ? 29  A A "H1'"  1  
ATOM 260    H H8     . A A 1 8   ? 80.493  74.290  81.349  1.00 0.00 ? 29  A A H8     1  
ATOM 261    H H61    . A A 1 8   ? 79.338  80.186  82.256  1.00 0.00 ? 29  A A H61    1  
ATOM 262    H H62    . A A 1 8   ? 78.783  78.766  81.510  1.00 0.00 ? 29  A A H62    1  
ATOM 263    H H2     . A A 1 8   ? 83.072  79.104  84.325  1.00 0.00 ? 29  A A H2     1  
ATOM 264    P P      . A A 1 9   ? 85.386  72.182  85.906  1.00 0.00 ? 30  A A P      1  
ATOM 265    O OP1    . A A 1 9   ? 86.848  71.990  85.742  1.00 0.00 ? 30  A A OP1    1  
ATOM 266    O OP2    . A A 1 9   ? 84.560  71.086  86.473  1.00 0.00 ? 30  A A OP2    1  
ATOM 267    O "O5'"  . A A 1 9   ? 85.156  73.482  86.797  1.00 0.00 ? 30  A A "O5'"  1  
ATOM 268    C "C5'"  . A A 1 9   ? 85.975  74.631  86.636  1.00 0.00 ? 30  A A "C5'"  1  
ATOM 269    C "C4'"  . A A 1 9   ? 85.399  75.827  87.351  1.00 0.00 ? 30  A A "C4'"  1  
ATOM 270    O "O4'"  . A A 1 9   ? 84.043  76.079  86.911  1.00 0.00 ? 30  A A "O4'"  1  
ATOM 271    C "C3'"  . A A 1 9   ? 85.261  75.700  88.860  1.00 0.00 ? 30  A A "C3'"  1  
ATOM 272    O "O3'"  . A A 1 9   ? 86.494  75.844  89.544  1.00 0.00 ? 30  A A "O3'"  1  
ATOM 273    C "C2'"  . A A 1 9   ? 84.249  76.790  89.189  1.00 0.00 ? 30  A A "C2'"  1  
ATOM 274    O "O2'"  . A A 1 9   ? 84.860  78.072  89.206  1.00 0.00 ? 30  A A "O2'"  1  
ATOM 275    C "C1'"  . A A 1 9   ? 83.310  76.701  87.985  1.00 0.00 ? 30  A A "C1'"  1  
ATOM 276    N N9     . A A 1 9   ? 82.088  75.934  88.288  1.00 0.00 ? 30  A A N9     1  
ATOM 277    C C8     . A A 1 9   ? 81.666  74.757  87.719  1.00 0.00 ? 30  A A C8     1  
ATOM 278    N N7     . A A 1 9   ? 80.531  74.314  88.200  1.00 0.00 ? 30  A A N7     1  
ATOM 279    C C5     . A A 1 9   ? 80.179  75.262  89.151  1.00 0.00 ? 30  A A C5     1  
ATOM 280    C C6     . A A 1 9   ? 79.076  75.373  90.016  1.00 0.00 ? 30  A A C6     1  
ATOM 281    N N6     . A A 1 9   ? 78.083  74.482  90.066  1.00 0.00 ? 30  A A N6     1  
ATOM 282    N N1     . A A 1 9   ? 79.028  76.441  90.839  1.00 0.00 ? 30  A A N1     1  
ATOM 283    C C2     . A A 1 9   ? 80.024  77.335  90.790  1.00 0.00 ? 30  A A C2     1  
ATOM 284    N N3     . A A 1 9   ? 81.111  77.341  90.021  1.00 0.00 ? 30  A A N3     1  
ATOM 285    C C4     . A A 1 9   ? 81.129  76.265  89.215  1.00 0.00 ? 30  A A C4     1  
ATOM 286    H "H5'"  . A A 1 9   ? 86.053  74.837  85.680  1.00 0.00 ? 30  A A "H5'"  1  
ATOM 287    H "H5''" . A A 1 9   ? 86.866  74.442  86.995  1.00 0.00 ? 30  A A "H5''" 1  
ATOM 288    H "H4'"  . A A 1 9   ? 85.955  76.609  87.148  1.00 0.00 ? 30  A A "H4'"  1  
ATOM 289    H "H3'"  . A A 1 9   ? 84.873  74.826  89.078  1.00 0.00 ? 30  A A "H3'"  1  
ATOM 290    H "H2'"  . A A 1 9   ? 83.777  76.601  90.027  1.00 0.00 ? 30  A A "H2'"  1  
ATOM 291    H "HO2'" . A A 1 9   ? 84.811  78.436  90.114  1.00 0.00 ? 30  A A "HO2'" 1  
ATOM 292    H "H1'"  . A A 1 9   ? 83.065  77.606  87.696  1.00 0.00 ? 30  A A "H1'"  1  
ATOM 293    H H8     . A A 1 9   ? 82.169  74.291  87.018  1.00 0.00 ? 30  A A H8     1  
ATOM 294    H H61    . A A 1 9   ? 77.339  74.612  90.691  1.00 0.00 ? 30  A A H61    1  
ATOM 295    H H62    . A A 1 9   ? 78.097  73.699  89.477  1.00 0.00 ? 30  A A H62    1  
ATOM 296    H H2     . A A 1 9   ? 79.942  78.092  91.408  1.00 0.00 ? 30  A A H2     1  
ATOM 297    P P      . A A 1 10  ? 86.634  75.356  91.069  1.00 0.00 ? 31  A A P      1  
ATOM 298    O OP1    . A A 1 10  ? 88.075  75.138  91.352  1.00 0.00 ? 31  A A OP1    1  
ATOM 299    O OP2    . A A 1 10  ? 85.668  74.251  91.288  1.00 0.00 ? 31  A A OP2    1  
ATOM 300    O "O5'"  . A A 1 10  ? 86.148  76.611  91.922  1.00 0.00 ? 31  A A "O5'"  1  
ATOM 301    C "C5'"  . A A 1 10  ? 86.993  77.737  92.110  1.00 0.00 ? 31  A A "C5'"  1  
ATOM 302    C "C4'"  . A A 1 10  ? 86.201  79.017  92.184  1.00 0.00 ? 31  A A "C4'"  1  
ATOM 303    O "O4'"  . A A 1 10  ? 84.894  78.822  91.584  1.00 0.00 ? 31  A A "O4'"  1  
ATOM 304    C "C3'"  . A A 1 10  ? 85.894  79.533  93.581  1.00 0.00 ? 31  A A "C3'"  1  
ATOM 305    O "O3'"  . A A 1 10  ? 86.978  80.239  94.162  1.00 0.00 ? 31  A A "O3'"  1  
ATOM 306    C "C2'"  . A A 1 10  ? 84.659  80.392  93.356  1.00 0.00 ? 31  A A "C2'"  1  
ATOM 307    O "O2'"  . A A 1 10  ? 85.003  81.655  92.802  1.00 0.00 ? 31  A A "O2'"  1  
ATOM 308    C "C1'"  . A A 1 10  ? 83.909  79.576  92.300  1.00 0.00 ? 31  A A "C1'"  1  
ATOM 309    N N9     . A A 1 10  ? 82.903  78.681  92.904  1.00 0.00 ? 31  A A N9     1  
ATOM 310    C C8     . A A 1 10  ? 82.975  77.320  93.066  1.00 0.00 ? 31  A A C8     1  
ATOM 311    N N7     . A A 1 10  ? 81.917  76.800  93.639  1.00 0.00 ? 31  A A N7     1  
ATOM 312    C C5     . A A 1 10  ? 81.092  77.891  93.869  1.00 0.00 ? 31  A A C5     1  
ATOM 313    C C6     . A A 1 10  ? 79.817  78.010  94.450  1.00 0.00 ? 31  A A C6     1  
ATOM 314    N N6     . A A 1 10  ? 79.122  76.975  94.926  1.00 0.00 ? 31  A A N6     1  
ATOM 315    N N1     . A A 1 10  ? 79.274  79.244  94.527  1.00 0.00 ? 31  A A N1     1  
ATOM 316    C C2     . A A 1 10  ? 79.970  80.283  94.049  1.00 0.00 ? 31  A A C2     1  
ATOM 317    N N3     . A A 1 10  ? 81.174  80.298  93.481  1.00 0.00 ? 31  A A N3     1  
ATOM 318    C C4     . A A 1 10  ? 81.687  79.055  93.421  1.00 0.00 ? 31  A A C4     1  
ATOM 319    H "H5'"  . A A 1 10  ? 87.622  77.792  91.361  1.00 0.00 ? 31  A A "H5'"  1  
ATOM 320    H "H5''" . A A 1 10  ? 87.497  77.624  92.942  1.00 0.00 ? 31  A A "H5''" 1  
ATOM 321    H "H4'"  . A A 1 10  ? 86.679  79.716  91.687  1.00 0.00 ? 31  A A "H4'"  1  
ATOM 322    H "H3'"  . A A 1 10  ? 85.658  78.777  94.158  1.00 0.00 ? 31  A A "H3'"  1  
ATOM 323    H "H2'"  . A A 1 10  ? 84.131  80.487  94.177  1.00 0.00 ? 31  A A "H2'"  1  
ATOM 324    H "HO2'" . A A 1 10  ? 85.950  81.833  92.976  1.00 0.00 ? 31  A A "HO2'" 1  
ATOM 325    H "H1'"  . A A 1 10  ? 83.470  80.184  91.671  1.00 0.00 ? 31  A A "H1'"  1  
ATOM 326    H H8     . A A 1 10  ? 83.747  76.785  92.782  1.00 0.00 ? 31  A A H8     1  
ATOM 327    H H61    . A A 1 10  ? 78.237  77.120  95.322  1.00 0.00 ? 31  A A H61    1  
ATOM 328    H H62    . A A 1 10  ? 79.496  76.070  94.881  1.00 0.00 ? 31  A A H62    1  
ATOM 329    H H2     . A A 1 10  ? 79.532  81.156  94.130  1.00 0.00 ? 31  A A H2     1  
ATOM 330    P P      . G A 1 11  ? 87.134  80.308  95.761  1.00 0.00 ? 32  G A P      1  
ATOM 331    O OP1    . G A 1 11  ? 88.397  81.025  96.070  1.00 0.00 ? 32  G A OP1    1  
ATOM 332    O OP2    . G A 1 11  ? 86.912  78.942  96.303  1.00 0.00 ? 32  G A OP2    1  
ATOM 333    O "O5'"  . G A 1 11  ? 85.918  81.227  96.227  1.00 0.00 ? 32  G A "O5'"  1  
ATOM 334    C "C5'"  . G A 1 11  ? 85.919  82.622  95.968  1.00 0.00 ? 32  G A "C5'"  1  
ATOM 335    C "C4'"  . G A 1 11  ? 84.659  83.281  96.472  1.00 0.00 ? 32  G A "C4'"  1  
ATOM 336    O "O4'"  . G A 1 11  ? 83.504  82.702  95.813  1.00 0.00 ? 32  G A "O4'"  1  
ATOM 337    C "C3'"  . G A 1 11  ? 84.365  83.110  97.954  1.00 0.00 ? 32  G A "C3'"  1  
ATOM 338    O "O3'"  . G A 1 11  ? 85.109  83.995  98.775  1.00 0.00 ? 32  G A "O3'"  1  
ATOM 339    C "C2'"  . G A 1 11  ? 82.862  83.333  98.023  1.00 0.00 ? 32  G A "C2'"  1  
ATOM 340    O "O2'"  . G A 1 11  ? 82.541  84.716  97.964  1.00 0.00 ? 32  G A "O2'"  1  
ATOM 341    C "C1'"  . G A 1 11  ? 82.393  82.660  96.731  1.00 0.00 ? 32  G A "C1'"  1  
ATOM 342    N N9     . G A 1 11  ? 81.939  81.275  96.958  1.00 0.00 ? 32  G A N9     1  
ATOM 343    C C8     . G A 1 11  ? 82.600  80.118  96.627  1.00 0.00 ? 32  G A C8     1  
ATOM 344    N N7     . G A 1 11  ? 81.944  79.038  96.954  1.00 0.00 ? 32  G A N7     1  
ATOM 345    C C5     . G A 1 11  ? 80.777  79.511  97.540  1.00 0.00 ? 32  G A C5     1  
ATOM 346    C C6     . G A 1 11  ? 79.676  78.809  98.093  1.00 0.00 ? 32  G A C6     1  
ATOM 347    O O6     . G A 1 11  ? 79.505  77.587  98.177  1.00 0.00 ? 32  G A O6     1  
ATOM 348    N N1     . G A 1 11  ? 78.704  79.678  98.578  1.00 0.00 ? 32  G A N1     1  
ATOM 349    C C2     . G A 1 11  ? 78.784  81.050  98.541  1.00 0.00 ? 32  G A C2     1  
ATOM 350    N N2     . G A 1 11  ? 77.746  81.721  99.061  1.00 0.00 ? 32  G A N2     1  
ATOM 351    N N3     . G A 1 11  ? 79.804  81.717  98.028  1.00 0.00 ? 32  G A N3     1  
ATOM 352    C C4     . G A 1 11  ? 80.759  80.891  97.550  1.00 0.00 ? 32  G A C4     1  
ATOM 353    H "H5'"  . G A 1 11  ? 85.991  82.769  95.002  1.00 0.00 ? 32  G A "H5'"  1  
ATOM 354    H "H5''" . G A 1 11  ? 86.693  83.029  96.410  1.00 0.00 ? 32  G A "H5''" 1  
ATOM 355    H "H4'"  . G A 1 11  ? 84.697  84.239  96.264  1.00 0.00 ? 32  G A "H4'"  1  
ATOM 356    H "H3'"  . G A 1 11  ? 84.563  82.185  98.217  1.00 0.00 ? 32  G A "H3'"  1  
ATOM 357    H "H2'"  . G A 1 11  ? 82.468  82.904  98.812  1.00 0.00 ? 32  G A "H2'"  1  
ATOM 358    H "HO2'" . G A 1 11  ? 83.332  85.237  98.211  1.00 0.00 ? 32  G A "HO2'" 1  
ATOM 359    H "H1'"  . G A 1 11  ? 81.664  83.183  96.337  1.00 0.00 ? 32  G A "H1'"  1  
ATOM 360    H H8     . G A 1 11  ? 83.476  80.102  96.186  1.00 0.00 ? 32  G A H8     1  
ATOM 361    H H1     . G A 1 11  ? 77.905  79.281  98.981  1.00 0.00 ? 32  G A H1     1  
ATOM 362    H H21    . G A 1 11  ? 76.986  81.233  99.444  1.00 0.00 ? 32  G A H21    1  
ATOM 363    H H22    . G A 1 11  ? 77.747  82.701  99.062  1.00 0.00 ? 32  G A H22    1  
ATOM 364    P P      . U A 1 12  ? 85.554  83.545  100.253 1.00 0.00 ? 33  U A P      1  
ATOM 365    O OP1    . U A 1 12  ? 86.354  84.647  100.846 1.00 0.00 ? 33  U A OP1    1  
ATOM 366    O OP2    . U A 1 12  ? 86.133  82.182  100.163 1.00 0.00 ? 33  U A OP2    1  
ATOM 367    O "O5'"  . U A 1 12  ? 84.180  83.446  101.054 1.00 0.00 ? 33  U A "O5'"  1  
ATOM 368    C "C5'"  . U A 1 12  ? 83.402  84.606  101.313 1.00 0.00 ? 33  U A "C5'"  1  
ATOM 369    C "C4'"  . U A 1 12  ? 82.057  84.253  101.901 1.00 0.00 ? 33  U A "C4'"  1  
ATOM 370    O "O4'"  . U A 1 12  ? 81.309  83.431  100.968 1.00 0.00 ? 33  U A "O4'"  1  
ATOM 371    C "C3'"  . U A 1 12  ? 82.080  83.432  103.181 1.00 0.00 ? 33  U A "C3'"  1  
ATOM 372    O "O3'"  . U A 1 12  ? 82.327  84.213  104.337 1.00 0.00 ? 33  U A "O3'"  1  
ATOM 373    C "C2'"  . U A 1 12  ? 80.710  82.768  103.174 1.00 0.00 ? 33  U A "C2'"  1  
ATOM 374    O "O2'"  . U A 1 12  ? 79.696  83.673  103.589 1.00 0.00 ? 33  U A "O2'"  1  
ATOM 375    C "C1'"  . U A 1 12  ? 80.526  82.465  101.686 1.00 0.00 ? 33  U A "C1'"  1  
ATOM 376    N N1     . U A 1 12  ? 80.938  81.084  101.338 1.00 0.00 ? 33  U A N1     1  
ATOM 377    C C2     . U A 1 12  ? 80.060  80.064  101.657 1.00 0.00 ? 33  U A C2     1  
ATOM 378    O O2     . U A 1 12  ? 78.986  80.255  102.202 1.00 0.00 ? 33  U A O2     1  
ATOM 379    N N3     . U A 1 12  ? 80.484  78.802  101.316 1.00 0.00 ? 33  U A N3     1  
ATOM 380    C C4     . U A 1 12  ? 81.670  78.462  100.702 1.00 0.00 ? 33  U A C4     1  
ATOM 381    O O4     . U A 1 12  ? 81.907  77.277  100.461 1.00 0.00 ? 33  U A O4     1  
ATOM 382    C C5     . U A 1 12  ? 82.528  79.568  100.402 1.00 0.00 ? 33  U A C5     1  
ATOM 383    C C6     . U A 1 12  ? 82.139  80.806  100.721 1.00 0.00 ? 33  U A C6     1  
ATOM 384    H "H5'"  . U A 1 12  ? 83.265  85.093  100.474 1.00 0.00 ? 33  U A "H5'"  1  
ATOM 385    H "H5''" . U A 1 12  ? 83.884  85.180  101.943 1.00 0.00 ? 33  U A "H5''" 1  
ATOM 386    H "H4'"  . U A 1 12  ? 81.558  85.080  102.064 1.00 0.00 ? 33  U A "H4'"  1  
ATOM 387    H "H3'"  . U A 1 12  ? 82.770  82.739  103.106 1.00 0.00 ? 33  U A "H3'"  1  
ATOM 388    H "H2'"  . U A 1 12  ? 80.704  81.947  103.710 1.00 0.00 ? 33  U A "H2'"  1  
ATOM 389    H "HO2'" . U A 1 12  ? 79.060  83.199  104.163 1.00 0.00 ? 33  U A "HO2'" 1  
ATOM 390    H "H1'"  . U A 1 12  ? 79.584  82.593  101.441 1.00 0.00 ? 33  U A "H1'"  1  
ATOM 391    H H3     . U A 1 12  ? 79.877  78.065  101.534 1.00 0.00 ? 33  U A H3     1  
ATOM 392    H H5     . U A 1 12  ? 83.391  79.418  99.963  1.00 0.00 ? 33  U A H5     1  
ATOM 393    H H6     . U A 1 12  ? 82.745  81.546  100.505 1.00 0.00 ? 33  U A H6     1  
ATOM 394    P P      . U A 1 13  ? 82.953  83.536  105.653 1.00 0.00 ? 34  U A P      1  
ATOM 395    O OP1    . U A 1 13  ? 83.297  84.620  106.609 1.00 0.00 ? 34  U A OP1    1  
ATOM 396    O OP2    . U A 1 13  ? 84.001  82.577  105.221 1.00 0.00 ? 34  U A OP2    1  
ATOM 397    O "O5'"  . U A 1 13  ? 81.744  82.701  106.269 1.00 0.00 ? 34  U A "O5'"  1  
ATOM 398    C "C5'"  . U A 1 13  ? 80.619  83.356  106.835 1.00 0.00 ? 34  U A "C5'"  1  
ATOM 399    C "C4'"  . U A 1 13  ? 79.544  82.374  107.233 1.00 0.00 ? 34  U A "C4'"  1  
ATOM 400    O "O4'"  . U A 1 13  ? 79.088  81.640  106.068 1.00 0.00 ? 34  U A "O4'"  1  
ATOM 401    C "C3'"  . U A 1 13  ? 79.960  81.288  108.213 1.00 0.00 ? 34  U A "C3'"  1  
ATOM 402    O "O3'"  . U A 1 13  ? 79.993  81.738  109.557 1.00 0.00 ? 34  U A "O3'"  1  
ATOM 403    C "C2'"  . U A 1 13  ? 78.928  80.200  107.960 1.00 0.00 ? 34  U A "C2'"  1  
ATOM 404    O "O2'"  . U A 1 13  ? 77.689  80.509  108.581 1.00 0.00 ? 34  U A "O2'"  1  
ATOM 405    C "C1'"  . U A 1 13  ? 78.758  80.288  106.442 1.00 0.00 ? 34  U A "C1'"  1  
ATOM 406    N N1     . U A 1 13  ? 79.607  79.308  105.724 1.00 0.00 ? 34  U A N1     1  
ATOM 407    C C2     . U A 1 13  ? 79.141  78.009  105.640 1.00 0.00 ? 34  U A C2     1  
ATOM 408    O O2     . U A 1 13  ? 78.082  77.651  106.126 1.00 0.00 ? 34  U A O2     1  
ATOM 409    N N3     . U A 1 13  ? 79.958  77.138  104.967 1.00 0.00 ? 34  U A N3     1  
ATOM 410    C C4     . U A 1 13  ? 81.171  77.421  104.376 1.00 0.00 ? 34  U A C4     1  
ATOM 411    O O4     . U A 1 13  ? 81.793  76.525  103.805 1.00 0.00 ? 34  U A O4     1  
ATOM 412    C C5     . U A 1 13  ? 81.592  78.786  104.502 1.00 0.00 ? 34  U A C5     1  
ATOM 413    C C6     . U A 1 13  ? 80.813  79.655  105.152 1.00 0.00 ? 34  U A C6     1  
ATOM 414    H "H5'"  . U A 1 13  ? 80.249  83.983  106.178 1.00 0.00 ? 34  U A "H5'"  1  
ATOM 415    H "H5''" . U A 1 13  ? 80.905  83.855  107.628 1.00 0.00 ? 34  U A "H5''" 1  
ATOM 416    H "H4'"  . U A 1 13  ? 78.788  82.870  107.611 1.00 0.00 ? 34  U A "H4'"  1  
ATOM 417    H "H3'"  . U A 1 13  ? 80.846  80.952  107.966 1.00 0.00 ? 34  U A "H3'"  1  
ATOM 418    H "H2'"  . U A 1 13  ? 79.259  79.319  108.232 1.00 0.00 ? 34  U A "H2'"  1  
ATOM 419    H "HO2'" . U A 1 13  ? 77.842  81.171  109.289 1.00 0.00 ? 34  U A "HO2'" 1  
ATOM 420    H "H1'"  . U A 1 13  ? 77.819  80.134  106.210 1.00 0.00 ? 34  U A "H1'"  1  
ATOM 421    H H3     . U A 1 13  ? 79.647  76.211  104.895 1.00 0.00 ? 34  U A H3     1  
ATOM 422    H H5     . U A 1 13  ? 82.443  79.077  104.111 1.00 0.00 ? 34  U A H5     1  
ATOM 423    H H6     . U A 1 13  ? 81.123  80.581  105.224 1.00 0.00 ? 34  U A H6     1  
ATOM 424    P P      . A A 1 14  ? 80.963  81.030  110.625 1.00 0.00 ? 35  A A P      1  
ATOM 425    O OP1    . A A 1 14  ? 80.891  81.798  111.893 1.00 0.00 ? 35  A A OP1    1  
ATOM 426    O OP2    . A A 1 14  ? 82.280  80.809  109.974 1.00 0.00 ? 35  A A OP2    1  
ATOM 427    O "O5'"  . A A 1 14  ? 80.291  79.606  110.871 1.00 0.00 ? 35  A A "O5'"  1  
ATOM 428    C "C5'"  . A A 1 14  ? 79.025  79.497  111.503 1.00 0.00 ? 35  A A "C5'"  1  
ATOM 429    C "C4'"  . A A 1 14  ? 78.516  78.078  111.482 1.00 0.00 ? 35  A A "C4'"  1  
ATOM 430    O "O4'"  . A A 1 14  ? 78.327  77.643  110.110 1.00 0.00 ? 35  A A "O4'"  1  
ATOM 431    C "C3'"  . A A 1 14  ? 79.439  77.028  112.080 1.00 0.00 ? 35  A A "C3'"  1  
ATOM 432    O "O3'"  . A A 1 14  ? 79.401  76.997  113.497 1.00 0.00 ? 35  A A "O3'"  1  
ATOM 433    C "C2'"  . A A 1 14  ? 78.948  75.744  111.427 1.00 0.00 ? 35  A A "C2'"  1  
ATOM 434    O "O2'"  . A A 1 14  ? 77.763  75.272  112.047 1.00 0.00 ? 35  A A "O2'"  1  
ATOM 435    C "C1'"  . A A 1 14  ? 78.614  76.228  110.015 1.00 0.00 ? 35  A A "C1'"  1  
ATOM 436    N N9     . A A 1 14  ? 79.707  75.960  109.061 1.00 0.00 ? 35  A A N9     1  
ATOM 437    C C8     . A A 1 14  ? 80.631  76.847  108.568 1.00 0.00 ? 35  A A C8     1  
ATOM 438    N N7     . A A 1 14  ? 81.484  76.310  107.731 1.00 0.00 ? 35  A A N7     1  
ATOM 439    C C5     . A A 1 14  ? 81.096  74.978  107.668 1.00 0.00 ? 35  A A C5     1  
ATOM 440    C C6     . A A 1 14  ? 81.599  73.878  106.953 1.00 0.00 ? 35  A A C6     1  
ATOM 441    N N6     . A A 1 14  ? 82.648  73.946  106.131 1.00 0.00 ? 35  A A N6     1  
ATOM 442    N N1     . A A 1 14  ? 80.982  72.687  107.116 1.00 0.00 ? 35  A A N1     1  
ATOM 443    C C2     . A A 1 14  ? 79.931  72.617  107.942 1.00 0.00 ? 35  A A C2     1  
ATOM 444    N N3     . A A 1 14  ? 79.365  73.580  108.667 1.00 0.00 ? 35  A A N3     1  
ATOM 445    C C4     . A A 1 14  ? 80.004  74.749  108.483 1.00 0.00 ? 35  A A C4     1  
ATOM 446    H "H5'"  . A A 1 14  ? 78.384  80.074  111.037 1.00 0.00 ? 35  A A "H5'"  1  
ATOM 447    H "H5''" . A A 1 14  ? 79.104  79.795  112.433 1.00 0.00 ? 35  A A "H5''" 1  
ATOM 448    H "H4'"  . A A 1 14  ? 77.653  78.044  111.947 1.00 0.00 ? 35  A A "H4'"  1  
ATOM 449    H "H3'"  . A A 1 14  ? 80.359  77.206  111.786 1.00 0.00 ? 35  A A "H3'"  1  
ATOM 450    H "H2'"  . A A 1 14  ? 79.650  75.057  111.413 1.00 0.00 ? 35  A A "H2'"  1  
ATOM 451    H "HO2'" . A A 1 14  ? 77.499  74.424  111.630 1.00 0.00 ? 35  A A "HO2'" 1  
ATOM 452    H "H1'"  . A A 1 14  ? 77.795  75.786  109.705 1.00 0.00 ? 35  A A "H1'"  1  
ATOM 453    H H8     . A A 1 14  ? 80.652  77.796  108.818 1.00 0.00 ? 35  A A H8     1  
ATOM 454    H H61    . A A 1 14  ? 82.954  73.144  105.658 1.00 0.00 ? 35  A A H61    1  
ATOM 455    H H62    . A A 1 14  ? 83.112  74.798  105.997 1.00 0.00 ? 35  A A H62    1  
ATOM 456    H H2     . A A 1 14  ? 79.518  71.732  108.024 1.00 0.00 ? 35  A A H2     1  
ATOM 457    P P      . U A 1 15  ? 80.706  76.569  114.330 1.00 0.00 ? 36  U A P      1  
ATOM 458    O OP1    . U A 1 15  ? 80.387  76.690  115.777 1.00 0.00 ? 36  U A OP1    1  
ATOM 459    O OP2    . U A 1 15  ? 81.871  77.302  113.772 1.00 0.00 ? 36  U A OP2    1  
ATOM 460    O "O5'"  . U A 1 15  ? 80.887  75.022  113.995 1.00 0.00 ? 36  U A "O5'"  1  
ATOM 461    C "C5'"  . U A 1 15  ? 79.924  74.067  114.412 1.00 0.00 ? 36  U A "C5'"  1  
ATOM 462    C "C4'"  . U A 1 15  ? 80.172  72.716  113.787 1.00 0.00 ? 36  U A "C4'"  1  
ATOM 463    O "O4'"  . U A 1 15  ? 80.099  72.818  112.342 1.00 0.00 ? 36  U A "O4'"  1  
ATOM 464    C "C3'"  . U A 1 15  ? 81.537  72.098  114.046 1.00 0.00 ? 36  U A "C3'"  1  
ATOM 465    O "O3'"  . U A 1 15  ? 81.634  71.478  115.316 1.00 0.00 ? 36  U A "O3'"  1  
ATOM 466    C "C2'"  . U A 1 15  ? 81.690  71.132  112.880 1.00 0.00 ? 36  U A "C2'"  1  
ATOM 467    O "O2'"  . U A 1 15  ? 80.943  69.943  113.094 1.00 0.00 ? 36  U A "O2'"  1  
ATOM 468    C "C1'"  . U A 1 15  ? 81.048  71.923  111.740 1.00 0.00 ? 36  U A "C1'"  1  
ATOM 469    N N1     . U A 1 15  ? 82.048  72.673  110.941 1.00 0.00 ? 36  U A N1     1  
ATOM 470    C C2     . U A 1 15  ? 82.777  71.955  110.010 1.00 0.00 ? 36  U A C2     1  
ATOM 471    O O2     . U A 1 15  ? 82.629  70.760  109.827 1.00 0.00 ? 36  U A O2     1  
ATOM 472    N N3     . U A 1 15  ? 83.689  72.691  109.295 1.00 0.00 ? 36  U A N3     1  
ATOM 473    C C4     . U A 1 15  ? 83.947  74.039  109.409 1.00 0.00 ? 36  U A C4     1  
ATOM 474    O O4     . U A 1 15  ? 84.803  74.556  108.691 1.00 0.00 ? 36  U A O4     1  
ATOM 475    C C5     . U A 1 15  ? 83.155  74.717  110.392 1.00 0.00 ? 36  U A C5     1  
ATOM 476    C C6     . U A 1 15  ? 82.257  74.026  111.102 1.00 0.00 ? 36  U A C6     1  
ATOM 477    H "H5'"  . U A 1 15  ? 79.032  74.379  114.154 1.00 0.00 ? 36  U A "H5'"  1  
ATOM 478    H "H5''" . U A 1 15  ? 79.961  73.979  115.387 1.00 0.00 ? 36  U A "H5''" 1  
ATOM 479    H "H4'"  . U A 1 15  ? 79.479  72.093  114.096 1.00 0.00 ? 36  U A "H4'"  1  
ATOM 480    H "H3'"  . U A 1 15  ? 82.224  72.796  113.975 1.00 0.00 ? 36  U A "H3'"  1  
ATOM 481    H "H2'"  . U A 1 15  ? 82.633  70.939  112.693 1.00 0.00 ? 36  U A "H2'"  1  
ATOM 482    H "HO2'" . U A 1 15  ? 81.101  69.328  112.348 1.00 0.00 ? 36  U A "HO2'" 1  
ATOM 483    H "H1'"  . U A 1 15  ? 80.558  71.311  111.153 1.00 0.00 ? 36  U A "H1'"  1  
ATOM 484    H H3     . U A 1 15  ? 84.218  72.201  108.629 1.00 0.00 ? 36  U A H3     1  
ATOM 485    H H5     . U A 1 15  ? 83.268  75.679  110.540 1.00 0.00 ? 36  U A H5     1  
ATOM 486    H H6     . U A 1 15  ? 81.728  74.512  111.767 1.00 0.00 ? 36  U A H6     1  
ATOM 487    P P      . C A 1 16  ? 83.067  71.300  116.023 1.00 0.00 ? 37  C A P      1  
ATOM 488    O OP1    . C A 1 16  ? 82.837  70.854  117.420 1.00 0.00 ? 37  C A OP1    1  
ATOM 489    O OP2    . C A 1 16  ? 83.862  72.526  115.767 1.00 0.00 ? 37  C A OP2    1  
ATOM 490    O "O5'"  . C A 1 16  ? 83.743  70.098  115.228 1.00 0.00 ? 37  C A "O5'"  1  
ATOM 491    C "C5'"  . C A 1 16  ? 83.275  68.765  115.384 1.00 0.00 ? 37  C A "C5'"  1  
ATOM 492    C "C4'"  . C A 1 16  ? 83.995  67.810  114.462 1.00 0.00 ? 37  C A "C4'"  1  
ATOM 493    O "O4'"  . C A 1 16  ? 83.784  68.204  113.081 1.00 0.00 ? 37  C A "O4'"  1  
ATOM 494    C "C3'"  . C A 1 16  ? 85.508  67.755  114.604 1.00 0.00 ? 37  C A "C3'"  1  
ATOM 495    O "O3'"  . C A 1 16  ? 85.934  66.951  115.690 1.00 0.00 ? 37  C A "O3'"  1  
ATOM 496    C "C2'"  . C A 1 16  ? 85.950  67.228  113.246 1.00 0.00 ? 37  C A "C2'"  1  
ATOM 497    O "O2'"  . C A 1 16  ? 85.752  65.824  113.147 1.00 0.00 ? 37  C A "O2'"  1  
ATOM 498    C "C1'"  . C A 1 16  ? 84.967  67.935  112.310 1.00 0.00 ? 37  C A "C1'"  1  
ATOM 499    N N1     . C A 1 16  ? 85.531  69.185  111.742 1.00 0.00 ? 37  C A N1     1  
ATOM 500    C C2     . C A 1 16  ? 86.399  69.083  110.647 1.00 0.00 ? 37  C A C2     1  
ATOM 501    O O2     . C A 1 16  ? 86.670  67.964  110.189 1.00 0.00 ? 37  C A O2     1  
ATOM 502    N N3     . C A 1 16  ? 86.926  70.208  110.110 1.00 0.00 ? 37  C A N3     1  
ATOM 503    C C4     . C A 1 16  ? 86.619  71.400  110.621 1.00 0.00 ? 37  C A C4     1  
ATOM 504    N N4     . C A 1 16  ? 87.163  72.484  110.057 1.00 0.00 ? 37  C A N4     1  
ATOM 505    C C5     . C A 1 16  ? 85.742  71.535  111.732 1.00 0.00 ? 37  C A C5     1  
ATOM 506    C C6     . C A 1 16  ? 85.225  70.417  112.256 1.00 0.00 ? 37  C A C6     1  
ATOM 507    H "H5'"  . C A 1 16  ? 82.316  68.738  115.186 1.00 0.00 ? 37  C A "H5'"  1  
ATOM 508    H "H5''" . C A 1 16  ? 83.420  68.483  116.311 1.00 0.00 ? 37  C A "H5''" 1  
ATOM 509    H "H4'"  . C A 1 16  ? 83.631  66.910  114.593 1.00 0.00 ? 37  C A "H4'"  1  
ATOM 510    H "H3'"  . C A 1 16  ? 85.853  68.665  114.722 1.00 0.00 ? 37  C A "H3'"  1  
ATOM 511    H "H2'"  . C A 1 16  ? 86.878  67.478  113.046 1.00 0.00 ? 37  C A "H2'"  1  
ATOM 512    H "HO2'" . C A 1 16  ? 85.680  65.449  114.048 1.00 0.00 ? 37  C A "HO2'" 1  
ATOM 513    H "H1'"  . C A 1 16  ? 84.719  67.330  111.580 1.00 0.00 ? 37  C A "H1'"  1  
ATOM 514    H H41    . C A 1 16  ? 87.769  72.386  109.293 1.00 0.00 ? 37  C A H41    1  
ATOM 515    H H42    . C A 1 16  ? 86.958  73.374  110.409 1.00 0.00 ? 37  C A H42    1  
ATOM 516    H H5     . C A 1 16  ? 85.520  72.418  112.100 1.00 0.00 ? 37  C A H5     1  
ATOM 517    H H6     . C A 1 16  ? 84.618  70.490  113.020 1.00 0.00 ? 37  C A H6     1  
ATOM 518    P P      . A A 1 17  ? 87.360  67.219  116.383 1.00 0.00 ? 38  A A P      1  
ATOM 519    O OP1    . A A 1 17  ? 87.472  66.327  117.564 1.00 0.00 ? 38  A A OP1    1  
ATOM 520    O OP2    . A A 1 17  ? 87.522  68.683  116.552 1.00 0.00 ? 38  A A OP2    1  
ATOM 521    O "O5'"  . A A 1 17  ? 88.414  66.727  115.294 1.00 0.00 ? 38  A A "O5'"  1  
ATOM 522    C "C5'"  . A A 1 17  ? 88.528  65.353  114.957 1.00 0.00 ? 38  A A "C5'"  1  
ATOM 523    C "C4'"  . A A 1 17  ? 89.476  65.144  113.801 1.00 0.00 ? 38  A A "C4'"  1  
ATOM 524    O "O4'"  . A A 1 17  ? 88.982  65.842  112.628 1.00 0.00 ? 38  A A "O4'"  1  
ATOM 525    C "C3'"  . A A 1 17  ? 90.886  65.682  113.988 1.00 0.00 ? 38  A A "C3'"  1  
ATOM 526    O "O3'"  . A A 1 17  ? 91.703  64.834  114.780 1.00 0.00 ? 38  A A "O3'"  1  
ATOM 527    C "C2'"  . A A 1 17  ? 91.375  65.837  112.555 1.00 0.00 ? 38  A A "C2'"  1  
ATOM 528    O "O2'"  . A A 1 17  ? 91.760  64.586  112.003 1.00 0.00 ? 38  A A "O2'"  1  
ATOM 529    C "C1'"  . A A 1 17  ? 90.106  66.323  111.852 1.00 0.00 ? 38  A A "C1'"  1  
ATOM 530    N N9     . A A 1 17  ? 90.076  67.791  111.712 1.00 0.00 ? 38  A A N9     1  
ATOM 531    C C8     . A A 1 17  ? 89.352  68.694  112.450 1.00 0.00 ? 38  A A C8     1  
ATOM 532    N N7     . A A 1 17  ? 89.535  69.940  112.088 1.00 0.00 ? 38  A A N7     1  
ATOM 533    C C5     . A A 1 17  ? 90.441  69.852  111.040 1.00 0.00 ? 38  A A C5     1  
ATOM 534    C C6     . A A 1 17  ? 91.040  70.827  110.222 1.00 0.00 ? 38  A A C6     1  
ATOM 535    N N6     . A A 1 17  ? 90.807  72.136  110.338 1.00 0.00 ? 38  A A N6     1  
ATOM 536    N N1     . A A 1 17  ? 91.899  70.406  109.268 1.00 0.00 ? 38  A A N1     1  
ATOM 537    C C2     . A A 1 17  ? 92.134  69.092  109.152 1.00 0.00 ? 38  A A C2     1  
ATOM 538    N N3     . A A 1 17  ? 91.633  68.082  109.859 1.00 0.00 ? 38  A A N3     1  
ATOM 539    C C4     . A A 1 17  ? 90.783  68.535  110.798 1.00 0.00 ? 38  A A C4     1  
ATOM 540    H "H5'"  . A A 1 17  ? 87.644  65.010  114.710 1.00 0.00 ? 38  A A "H5'"  1  
ATOM 541    H "H5''" . A A 1 17  ? 88.857  64.857  115.734 1.00 0.00 ? 38  A A "H5''" 1  
ATOM 542    H "H4'"  . A A 1 17  ? 89.526  64.184  113.603 1.00 0.00 ? 38  A A "H4'"  1  
ATOM 543    H "H3'"  . A A 1 17  ? 90.839  66.566  114.409 1.00 0.00 ? 38  A A "H3'"  1  
ATOM 544    H "H2'"  . A A 1 17  ? 92.096  66.499  112.491 1.00 0.00 ? 38  A A "H2'"  1  
ATOM 545    H "HO2'" . A A 1 17  ? 91.933  63.955  112.731 1.00 0.00 ? 38  A A "HO2'" 1  
ATOM 546    H "H1'"  . A A 1 17  ? 90.048  65.909  110.965 1.00 0.00 ? 38  A A "H1'"  1  
ATOM 547    H H8     . A A 1 17  ? 88.754  68.431  113.180 1.00 0.00 ? 38  A A H8     1  
ATOM 548    H H61    . A A 1 17  ? 91.254  72.770  109.738 1.00 0.00 ? 38  A A H61    1  
ATOM 549    H H62    . A A 1 17  ? 90.187  72.466  111.023 1.00 0.00 ? 38  A A H62    1  
ATOM 550    H H2     . A A 1 17  ? 92.764  68.839  108.445 1.00 0.00 ? 38  A A H2     1  
ATOM 551    P P      . G A 1 18  ? 92.938  65.443  115.605 1.00 0.00 ? 39  G A P      1  
ATOM 552    O OP1    . G A 1 18  ? 93.530  64.353  116.421 1.00 0.00 ? 39  G A OP1    1  
ATOM 553    O OP2    . G A 1 18  ? 92.478  66.690  116.269 1.00 0.00 ? 39  G A OP2    1  
ATOM 554    O "O5'"  . G A 1 18  ? 93.993  65.846  114.481 1.00 0.00 ? 39  G A "O5'"  1  
ATOM 555    C "C5'"  . G A 1 18  ? 94.644  64.850  113.703 1.00 0.00 ? 39  G A "C5'"  1  
ATOM 556    C "C4'"  . G A 1 18  ? 95.482  65.462  112.610 1.00 0.00 ? 39  G A "C4'"  1  
ATOM 557    O "O4'"  . G A 1 18  ? 94.639  66.239  111.719 1.00 0.00 ? 39  G A "O4'"  1  
ATOM 558    C "C3'"  . G A 1 18  ? 96.552  66.448  113.059 1.00 0.00 ? 39  G A "C3'"  1  
ATOM 559    O "O3'"  . G A 1 18  ? 97.718  65.812  113.553 1.00 0.00 ? 39  G A "O3'"  1  
ATOM 560    C "C2'"  . G A 1 18  ? 96.792  67.274  111.803 1.00 0.00 ? 39  G A "C2'"  1  
ATOM 561    O "O2'"  . G A 1 18  ? 97.606  66.573  110.874 1.00 0.00 ? 39  G A "O2'"  1  
ATOM 562    C "C1'"  . G A 1 18  ? 95.375  67.385  111.236 1.00 0.00 ? 39  G A "C1'"  1  
ATOM 563    N N9     . G A 1 18  ? 94.720  68.651  111.622 1.00 0.00 ? 39  G A N9     1  
ATOM 564    C C8     . G A 1 18  ? 93.737  68.823  112.565 1.00 0.00 ? 39  G A C8     1  
ATOM 565    N N7     . G A 1 18  ? 93.353  70.065  112.685 1.00 0.00 ? 39  G A N7     1  
ATOM 566    C C5     . G A 1 18  ? 94.131  70.755  111.766 1.00 0.00 ? 39  G A C5     1  
ATOM 567    C C6     . G A 1 18  ? 94.165  72.137  111.443 1.00 0.00 ? 39  G A C6     1  
ATOM 568    O O6     . G A 1 18  ? 93.489  73.056  111.920 1.00 0.00 ? 39  G A O6     1  
ATOM 569    N N1     . G A 1 18  ? 95.102  72.408  110.453 1.00 0.00 ? 39  G A N1     1  
ATOM 570    C C2     . G A 1 18  ? 95.906  71.472  109.848 1.00 0.00 ? 39  G A C2     1  
ATOM 571    N N2     . G A 1 18  ? 96.751  71.926  108.912 1.00 0.00 ? 39  G A N2     1  
ATOM 572    N N3     . G A 1 18  ? 95.884  70.182  110.141 1.00 0.00 ? 39  G A N3     1  
ATOM 573    C C4     . G A 1 18  ? 94.981  69.896  111.101 1.00 0.00 ? 39  G A C4     1  
ATOM 574    H "H5'"  . G A 1 18  ? 93.969  64.266  113.301 1.00 0.00 ? 39  G A "H5'"  1  
ATOM 575    H "H5''" . G A 1 18  ? 95.223  64.315  114.287 1.00 0.00 ? 39  G A "H5''" 1  
ATOM 576    H "H4'"  . G A 1 18  ? 95.909  64.744  112.097 1.00 0.00 ? 39  G A "H4'"  1  
ATOM 577    H "H3'"  . G A 1 18  ? 96.181  67.028  113.757 1.00 0.00 ? 39  G A "H3'"  1  
ATOM 578    H "H2'"  . G A 1 18  ? 97.162  68.157  112.017 1.00 0.00 ? 39  G A "H2'"  1  
ATOM 579    H "HO2'" . G A 1 18  ? 97.773  67.149  110.099 1.00 0.00 ? 39  G A "HO2'" 1  
ATOM 580    H "H1'"  . G A 1 18  ? 95.409  67.320  110.259 1.00 0.00 ? 39  G A "H1'"  1  
ATOM 581    H H8     . G A 1 18  ? 93.360  68.089  113.094 1.00 0.00 ? 39  G A H8     1  
ATOM 582    H H1     . G A 1 18  ? 95.195  73.340  110.163 1.00 0.00 ? 39  G A H1     1  
ATOM 583    H H21    . G A 1 18  ? 96.773  72.881  108.691 1.00 0.00 ? 39  G A H21    1  
ATOM 584    H H22    . G A 1 18  ? 97.350  71.304  108.448 1.00 0.00 ? 39  G A H22    1  
ATOM 585    P P      . G A 1 19  ? 98.659  66.566  114.616 1.00 0.00 ? 40  G A P      1  
ATOM 586    O OP1    . G A 1 19  ? 99.724  65.621  115.041 1.00 0.00 ? 40  G A OP1    1  
ATOM 587    O OP2    . G A 1 19  ? 97.786  67.198  115.637 1.00 0.00 ? 40  G A OP2    1  
ATOM 588    O "O5'"  . G A 1 19  ? 99.344  67.728  113.768 1.00 0.00 ? 40  G A "O5'"  1  
ATOM 589    C "C5'"  . G A 1 19  ? 100.273 67.429  112.737 1.00 0.00 ? 40  G A "C5'"  1  
ATOM 590    C "C4'"  . G A 1 19  ? 100.687 68.669  111.985 1.00 0.00 ? 40  G A "C4'"  1  
ATOM 591    O "O4'"  . G A 1 19  ? 99.522  69.280  111.368 1.00 0.00 ? 40  G A "O4'"  1  
ATOM 592    C "C3'"  . G A 1 19  ? 101.292 69.787  112.821 1.00 0.00 ? 40  G A "C3'"  1  
ATOM 593    O "O3'"  . G A 1 19  ? 102.654 69.564  113.141 1.00 0.00 ? 40  G A "O3'"  1  
ATOM 594    C "C2'"  . G A 1 19  ? 101.061 71.015  111.951 1.00 0.00 ? 40  G A "C2'"  1  
ATOM 595    O "O2'"  . G A 1 19  ? 102.008 71.082  110.893 1.00 0.00 ? 40  G A "O2'"  1  
ATOM 596    C "C1'"  . G A 1 19  ? 99.681  70.718  111.363 1.00 0.00 ? 40  G A "C1'"  1  
ATOM 597    N N9     . G A 1 19  ? 98.602  71.381  112.118 1.00 0.00 ? 40  G A N9     1  
ATOM 598    C C8     . G A 1 19  ? 97.715  70.796  112.991 1.00 0.00 ? 40  G A C8     1  
ATOM 599    N N7     . G A 1 19  ? 96.869  71.643  113.507 1.00 0.00 ? 40  G A N7     1  
ATOM 600    C C5     . G A 1 19  ? 97.216  72.864  112.946 1.00 0.00 ? 40  G A C5     1  
ATOM 601    C C6     . G A 1 19  ? 96.655  74.154  113.129 1.00 0.00 ? 40  G A C6     1  
ATOM 602    O O6     . G A 1 19  ? 95.705  74.485  113.848 1.00 0.00 ? 40  G A O6     1  
ATOM 603    N N1     . G A 1 19  ? 97.313  75.112  112.363 1.00 0.00 ? 40  G A N1     1  
ATOM 604    C C2     . G A 1 19  ? 98.377  74.862  111.531 1.00 0.00 ? 40  G A C2     1  
ATOM 605    N N2     . G A 1 19  ? 98.880  75.918  110.874 1.00 0.00 ? 40  G A N2     1  
ATOM 606    N N3     . G A 1 19  ? 98.909  73.664  111.352 1.00 0.00 ? 40  G A N3     1  
ATOM 607    C C4     . G A 1 19  ? 98.285  72.719  112.085 1.00 0.00 ? 40  G A C4     1  
ATOM 608    H "H5'"  . G A 1 19  ? 99.863  66.797  112.110 1.00 0.00 ? 40  G A "H5'"  1  
ATOM 609    H "H5''" . G A 1 19  ? 101.069 67.016  113.133 1.00 0.00 ? 40  G A "H5''" 1  
ATOM 610    H "H4'"  . G A 1 19  ? 101.322 68.417  111.281 1.00 0.00 ? 40  G A "H4'"  1  
ATOM 611    H "H3'"  . G A 1 19  ? 100.777 69.881  113.651 1.00 0.00 ? 40  G A "H3'"  1  
ATOM 612    H "H2'"  . G A 1 19  ? 101.055 71.838  112.485 1.00 0.00 ? 40  G A "H2'"  1  
ATOM 613    H "HO2'" . G A 1 19  ? 101.854 71.902  110.379 1.00 0.00 ? 40  G A "HO2'" 1  
ATOM 614    H "H1'"  . G A 1 19  ? 99.654  71.013  110.430 1.00 0.00 ? 40  G A "H1'"  1  
ATOM 615    H H8     . G A 1 19  ? 97.717  69.838  113.202 1.00 0.00 ? 40  G A H8     1  
ATOM 616    H H1     . G A 1 19  ? 96.993  76.035  112.426 1.00 0.00 ? 40  G A H1     1  
ATOM 617    H H21    . G A 1 19  ? 98.491  76.807  111.001 1.00 0.00 ? 40  G A H21    1  
ATOM 618    H H22    . G A 1 19  ? 99.640  75.800  110.266 1.00 0.00 ? 40  G A H22    1  
ATOM 619    P P      . C A 1 20  ? 103.133 69.564  114.676 1.00 0.00 ? 41  C A P      1  
ATOM 620    O OP1    . C A 1 20  ? 104.507 69.003  114.728 1.00 0.00 ? 41  C A OP1    1  
ATOM 621    O OP2    . C A 1 20  ? 102.058 68.949  115.494 1.00 0.00 ? 41  C A OP2    1  
ATOM 622    O "O5'"  . C A 1 20  ? 103.218 71.110  115.053 1.00 0.00 ? 41  C A "O5'"  1  
ATOM 623    C "C5'"  . C A 1 20  ? 104.271 71.924  114.560 1.00 0.00 ? 41  C A "C5'"  1  
ATOM 624    C "C4'"  . C A 1 20  ? 104.064 73.377  114.914 1.00 0.00 ? 41  C A "C4'"  1  
ATOM 625    O "O4'"  . C A 1 20  ? 102.895 73.892  114.219 1.00 0.00 ? 41  C A "O4'"  1  
ATOM 626    C "C3'"  . C A 1 20  ? 103.795 73.678  116.380 1.00 0.00 ? 41  C A "C3'"  1  
ATOM 627    O "O3'"  . C A 1 20  ? 104.971 73.673  117.170 1.00 0.00 ? 41  C A "O3'"  1  
ATOM 628    C "C2'"  . C A 1 20  ? 103.138 75.052  116.291 1.00 0.00 ? 41  C A "C2'"  1  
ATOM 629    O "O2'"  . C A 1 20  ? 104.105 76.072  116.087 1.00 0.00 ? 41  C A "O2'"  1  
ATOM 630    C "C1'"  . C A 1 20  ? 102.297 74.900  115.025 1.00 0.00 ? 41  C A "C1'"  1  
ATOM 631    N N1     . C A 1 20  ? 100.890 74.536  115.324 1.00 0.00 ? 41  C A N1     1  
ATOM 632    C C2     . C A 1 20  ? 99.913  75.536  115.245 1.00 0.00 ? 41  C A C2     1  
ATOM 633    O O2     . C A 1 20  ? 100.249 76.689  114.931 1.00 0.00 ? 41  C A O2     1  
ATOM 634    N N3     . C A 1 20  ? 98.622  75.231  115.512 1.00 0.00 ? 41  C A N3     1  
ATOM 635    C C4     . C A 1 20  ? 98.287  73.986  115.848 1.00 0.00 ? 41  C A C4     1  
ATOM 636    N N4     . C A 1 20  ? 97.001  73.730  116.104 1.00 0.00 ? 41  C A N4     1  
ATOM 637    C C5     . C A 1 20  ? 99.255  72.946  115.938 1.00 0.00 ? 41  C A C5     1  
ATOM 638    C C6     . C A 1 20  ? 100.529 73.260  115.670 1.00 0.00 ? 41  C A C6     1  
ATOM 639    H "H5'"  . C A 1 20  ? 104.314 71.835  113.585 1.00 0.00 ? 41  C A "H5'"  1  
ATOM 640    H "H5''" . C A 1 20  ? 105.118 71.619  114.947 1.00 0.00 ? 41  C A "H5''" 1  
ATOM 641    H "H4'"  . C A 1 20  ? 104.852 73.885  114.629 1.00 0.00 ? 41  C A "H4'"  1  
ATOM 642    H "H3'"  . C A 1 20  ? 103.150 73.029  116.730 1.00 0.00 ? 41  C A "H3'"  1  
ATOM 643    H "H2'"  . C A 1 20  ? 102.580 75.234  117.075 1.00 0.00 ? 41  C A "H2'"  1  
ATOM 644    H "HO2'" . C A 1 20  ? 103.654 76.941  116.069 1.00 0.00 ? 41  C A "HO2'" 1  
ATOM 645    H "H1'"  . C A 1 20  ? 102.317 75.741  114.522 1.00 0.00 ? 41  C A "H1'"  1  
ATOM 646    H H41    . C A 1 20  ? 96.337  74.448  116.041 1.00 0.00 ? 41  C A H41    1  
ATOM 647    H H42    . C A 1 20  ? 96.722  72.825  116.353 1.00 0.00 ? 41  C A H42    1  
ATOM 648    H H5     . C A 1 20  ? 98.999  72.033  116.185 1.00 0.00 ? 41  C A H5     1  
ATOM 649    H H6     . C A 1 20  ? 101.210 72.559  115.727 1.00 0.00 ? 41  C A H6     1  
ATOM 650    P P      . A A 1 21  ? 104.919 73.097  118.665 1.00 0.00 ? 42  A A P      1  
ATOM 651    O OP1    . A A 1 21  ? 105.798 73.920  119.532 1.00 0.00 ? 42  A A OP1    1  
ATOM 652    O OP2    . A A 1 21  ? 105.222 71.657  118.468 1.00 0.00 ? 42  A A OP2    1  
ATOM 653    O "O5'"  . A A 1 21  ? 103.430 73.215  119.218 1.00 0.00 ? 42  A A "O5'"  1  
ATOM 654    C "C5'"  . A A 1 21  ? 102.943 72.313  120.201 1.00 0.00 ? 42  A A "C5'"  1  
ATOM 655    C "C4'"  . A A 1 21  ? 102.329 73.045  121.368 1.00 0.00 ? 42  A A "C4'"  1  
ATOM 656    O "O4'"  . A A 1 21  ? 102.173 74.457  121.018 1.00 0.00 ? 42  A A "O4'"  1  
ATOM 657    C "C3'"  . A A 1 21  ? 100.961 72.554  121.818 1.00 0.00 ? 42  A A "C3'"  1  
ATOM 658    O "O3'"  . A A 1 21  ? 100.743 72.717  123.208 1.00 0.00 ? 42  A A "O3'"  1  
ATOM 659    C "C2'"  . A A 1 21  ? 100.031 73.501  121.055 1.00 0.00 ? 42  A A "C2'"  1  
ATOM 660    O "O2'"  . A A 1 21  ? 98.783  73.641  121.718 1.00 0.00 ? 42  A A "O2'"  1  
ATOM 661    C "C1'"  . A A 1 21  ? 100.821 74.804  121.170 1.00 0.00 ? 42  A A "C1'"  1  
ATOM 662    N N9     . A A 1 21  ? 100.485 75.755  120.093 1.00 0.00 ? 42  A A N9     1  
ATOM 663    C C8     . A A 1 21  ? 99.667  75.548  119.009 1.00 0.00 ? 42  A A C8     1  
ATOM 664    N N7     . A A 1 21  ? 99.563  76.588  118.220 1.00 0.00 ? 42  A A N7     1  
ATOM 665    C C5     . A A 1 21  ? 100.366 77.546  118.823 1.00 0.00 ? 42  A A C5     1  
ATOM 666    C C6     . A A 1 21  ? 100.680 78.873  118.478 1.00 0.00 ? 42  A A C6     1  
ATOM 667    N N6     . A A 1 21  ? 100.202 79.489  117.395 1.00 0.00 ? 42  A A N6     1  
ATOM 668    N N1     . A A 1 21  ? 101.513 79.554  119.294 1.00 0.00 ? 42  A A N1     1  
ATOM 669    C C2     . A A 1 21  ? 101.993 78.936  120.381 1.00 0.00 ? 42  A A C2     1  
ATOM 670    N N3     . A A 1 21  ? 101.771 77.696  120.811 1.00 0.00 ? 42  A A N3     1  
ATOM 671    C C4     . A A 1 21  ? 100.939 77.046  119.977 1.00 0.00 ? 42  A A C4     1  
ATOM 672    H "H5'"  . A A 1 21  ? 103.686 71.762  120.525 1.00 0.00 ? 42  A A "H5'"  1  
ATOM 673    H "H5''" . A A 1 21  ? 102.267 71.732  119.796 1.00 0.00 ? 42  A A "H5''" 1  
ATOM 674    H "H4'"  . A A 1 21  ? 102.950 72.990  122.124 1.00 0.00 ? 42  A A "H4'"  1  
ATOM 675    H "H3'"  . A A 1 21  ? 100.799 71.618  121.575 1.00 0.00 ? 42  A A "H3'"  1  
ATOM 676    H "H2'"  . A A 1 21  ? 99.917  73.219  120.123 1.00 0.00 ? 42  A A "H2'"  1  
ATOM 677    H "HO2'" . A A 1 21  ? 98.199  74.216  121.181 1.00 0.00 ? 42  A A "HO2'" 1  
ATOM 678    H "H1'"  . A A 1 21  ? 100.640 75.219  122.040 1.00 0.00 ? 42  A A "H1'"  1  
ATOM 679    H H8     . A A 1 21  ? 99.204  74.700  118.841 1.00 0.00 ? 42  A A H8     1  
ATOM 680    H H61    . A A 1 21  ? 100.457 80.416  117.206 1.00 0.00 ? 42  A A H61    1  
ATOM 681    H H62    . A A 1 21  ? 99.596  79.015  116.788 1.00 0.00 ? 42  A A H62    1  
ATOM 682    H H2     . A A 1 21  ? 102.592 79.474  120.941 1.00 0.00 ? 42  A A H2     1  
ATOM 683    P P      . U A 1 22  ? 100.048 71.545  124.060 1.00 0.00 ? 43  U A P      1  
ATOM 684    O OP1    . U A 1 22  ? 100.781 71.414  125.345 1.00 0.00 ? 43  U A OP1    1  
ATOM 685    O OP2    . U A 1 22  ? 99.900  70.362  123.176 1.00 0.00 ? 43  U A OP2    1  
ATOM 686    O "O5'"  . U A 1 22  ? 98.594  72.110  124.378 1.00 0.00 ? 43  U A "O5'"  1  
ATOM 687    C "C5'"  . U A 1 22  ? 97.847  71.623  125.483 1.00 0.00 ? 43  U A "C5'"  1  
ATOM 688    C "C4'"  . U A 1 22  ? 96.904  72.670  126.021 1.00 0.00 ? 43  U A "C4'"  1  
ATOM 689    O "O4'"  . U A 1 22  ? 97.642  73.653  126.791 1.00 0.00 ? 43  U A "O4'"  1  
ATOM 690    C "C3'"  . U A 1 22  ? 96.159  73.498  124.984 1.00 0.00 ? 43  U A "C3'"  1  
ATOM 691    O "O3'"  . U A 1 22  ? 95.027  72.832  124.452 1.00 0.00 ? 43  U A "O3'"  1  
ATOM 692    C "C2'"  . U A 1 22  ? 95.816  74.764  125.755 1.00 0.00 ? 43  U A "C2'"  1  
ATOM 693    O "O2'"  . U A 1 22  ? 94.703  74.561  126.613 1.00 0.00 ? 43  U A "O2'"  1  
ATOM 694    C "C1'"  . U A 1 22  ? 97.072  74.952  126.607 1.00 0.00 ? 43  U A "C1'"  1  
ATOM 695    N N1     . U A 1 22  ? 98.054  75.863  125.971 1.00 0.00 ? 43  U A N1     1  
ATOM 696    C C2     . U A 1 22  ? 97.789  77.218  126.030 1.00 0.00 ? 43  U A C2     1  
ATOM 697    O O2     . U A 1 22  ? 96.802  77.680  126.574 1.00 0.00 ? 43  U A O2     1  
ATOM 698    N N3     . U A 1 22  ? 98.725  78.023  125.427 1.00 0.00 ? 43  U A N3     1  
ATOM 699    C C4     . U A 1 22  ? 99.876  77.619  124.783 1.00 0.00 ? 43  U A C4     1  
ATOM 700    O O4     . U A 1 22  ? 100.620 78.468  124.289 1.00 0.00 ? 43  U A O4     1  
ATOM 701    C C5     . U A 1 22  ? 100.085 76.205  124.761 1.00 0.00 ? 43  U A C5     1  
ATOM 702    C C6     . U A 1 22  ? 99.191  75.399  125.341 1.00 0.00 ? 43  U A C6     1  
ATOM 703    H "H5'"  . U A 1 22  ? 98.467  71.356  126.193 1.00 0.00 ? 43  U A "H5'"  1  
ATOM 704    H "H5''" . U A 1 22  ? 97.329  70.842  125.199 1.00 0.00 ? 43  U A "H5''" 1  
ATOM 705    H "H4'"  . U A 1 22  ? 96.249  72.235  126.607 1.00 0.00 ? 43  U A "H4'"  1  
ATOM 706    H "H3'"  . U A 1 22  ? 96.773  73.724  124.253 1.00 0.00 ? 43  U A "H3'"  1  
ATOM 707    H "H2'"  . U A 1 22  ? 95.677  75.526  125.152 1.00 0.00 ? 43  U A "H2'"  1  
ATOM 708    H "HO2'" . U A 1 22  ? 94.469  75.411  127.041 1.00 0.00 ? 43  U A "HO2'" 1  
ATOM 709    H "H1'"  . U A 1 22  ? 96.821  75.312  127.484 1.00 0.00 ? 43  U A "H1'"  1  
ATOM 710    H H3     . U A 1 22  ? 98.556  78.987  125.458 1.00 0.00 ? 43  U A H3     1  
ATOM 711    H H5     . U A 1 22  ? 100.879 75.829  124.324 1.00 0.00 ? 43  U A H5     1  
ATOM 712    H H6     . U A 1 22  ? 99.355  74.434  125.311 1.00 0.00 ? 43  U A H6     1  
ATOM 713    P P      . G A 1 23  ? 94.500  73.183  122.975 1.00 0.00 ? 44  G A P      1  
ATOM 714    O OP1    . G A 1 23  ? 93.389  72.253  122.649 1.00 0.00 ? 44  G A OP1    1  
ATOM 715    O OP2    . G A 1 23  ? 95.678  73.266  122.076 1.00 0.00 ? 44  G A OP2    1  
ATOM 716    O "O5'"  . G A 1 23  ? 93.889  74.647  123.121 1.00 0.00 ? 44  G A "O5'"  1  
ATOM 717    C "C5'"  . G A 1 23  ? 92.631  74.852  123.747 1.00 0.00 ? 44  G A "C5'"  1  
ATOM 718    C "C4'"  . G A 1 23  ? 92.276  76.318  123.811 1.00 0.00 ? 44  G A "C4'"  1  
ATOM 719    O "O4'"  . G A 1 23  ? 93.312  77.044  124.519 1.00 0.00 ? 44  G A "O4'"  1  
ATOM 720    C "C3'"  . G A 1 23  ? 92.166  77.037  122.475 1.00 0.00 ? 44  G A "C3'"  1  
ATOM 721    O "O3'"  . G A 1 23  ? 90.931  76.807  121.820 1.00 0.00 ? 44  G A "O3'"  1  
ATOM 722    C "C2'"  . G A 1 23  ? 92.391  78.491  122.861 1.00 0.00 ? 44  G A "C2'"  1  
ATOM 723    O "O2'"  . G A 1 23  ? 91.226  79.059  123.438 1.00 0.00 ? 44  G A "O2'"  1  
ATOM 724    C "C1'"  . G A 1 23  ? 93.465  78.358  123.943 1.00 0.00 ? 44  G A "C1'"  1  
ATOM 725    N N9     . G A 1 23  ? 94.825  78.553  123.402 1.00 0.00 ? 44  G A N9     1  
ATOM 726    C C8     . G A 1 23  ? 95.771  77.585  123.163 1.00 0.00 ? 44  G A C8     1  
ATOM 727    N N7     . G A 1 23  ? 96.885  78.065  122.682 1.00 0.00 ? 44  G A N7     1  
ATOM 728    C C5     . G A 1 23  ? 96.663  79.431  122.599 1.00 0.00 ? 44  G A C5     1  
ATOM 729    C C6     . G A 1 23  ? 97.512  80.475  122.147 1.00 0.00 ? 44  G A C6     1  
ATOM 730    O O6     . G A 1 23  ? 98.668  80.397  121.718 1.00 0.00 ? 44  G A O6     1  
ATOM 731    N N1     . G A 1 23  ? 96.888  81.717  122.231 1.00 0.00 ? 44  G A N1     1  
ATOM 732    C C2     . G A 1 23  ? 95.609  81.926  122.689 1.00 0.00 ? 44  G A C2     1  
ATOM 733    N N2     . G A 1 23  ? 95.180  83.198  122.695 1.00 0.00 ? 44  G A N2     1  
ATOM 734    N N3     . G A 1 23  ? 94.809  80.962  123.113 1.00 0.00 ? 44  G A N3     1  
ATOM 735    C C4     . G A 1 23  ? 95.395  79.749  123.038 1.00 0.00 ? 44  G A C4     1  
ATOM 736    H "H5'"  . G A 1 23  ? 92.661  74.491  124.656 1.00 0.00 ? 44  G A "H5'"  1  
ATOM 737    H "H5''" . G A 1 23  ? 91.940  74.378  123.238 1.00 0.00 ? 44  G A "H5''" 1  
ATOM 738    H "H4'"  . G A 1 23  ? 91.430  76.419  124.295 1.00 0.00 ? 44  G A "H4'"  1  
ATOM 739    H "H3'"  . G A 1 23  ? 92.899  76.744  121.891 1.00 0.00 ? 44  G A "H3'"  1  
ATOM 740    H "H2'"  . G A 1 23  ? 92.713  79.020  122.101 1.00 0.00 ? 44  G A "H2'"  1  
ATOM 741    H "HO2'" . G A 1 23  ? 91.384  80.008  123.615 1.00 0.00 ? 44  G A "HO2'" 1  
ATOM 742    H "H1'"  . G A 1 23  ? 93.299  79.013  124.652 1.00 0.00 ? 44  G A "H1'"  1  
ATOM 743    H H8     . G A 1 23  ? 95.626  76.632  123.337 1.00 0.00 ? 44  G A H8     1  
ATOM 744    H H1     . G A 1 23  ? 97.400  82.500  121.939 1.00 0.00 ? 44  G A H1     1  
ATOM 745    H H21    . G A 1 23  ? 95.767  83.918  122.384 1.00 0.00 ? 44  G A H21    1  
ATOM 746    H H22    . G A 1 23  ? 94.275  83.408  123.012 1.00 0.00 ? 44  G A H22    1  
ATOM 747    P P      . C A 1 24  ? 90.838  76.888  120.217 1.00 0.00 ? 45  C A P      1  
ATOM 748    O OP1    . C A 1 24  ? 89.462  76.500  119.816 1.00 0.00 ? 45  C A OP1    1  
ATOM 749    O OP2    . C A 1 24  ? 92.000  76.160  119.651 1.00 0.00 ? 45  C A OP2    1  
ATOM 750    O "O5'"  . C A 1 24  ? 91.024  78.440  119.898 1.00 0.00 ? 45  C A "O5'"  1  
ATOM 751    C "C5'"  . C A 1 24  ? 90.029  79.384  120.262 1.00 0.00 ? 45  C A "C5'"  1  
ATOM 752    C "C4'"  . C A 1 24  ? 90.472  80.798  119.980 1.00 0.00 ? 45  C A "C4'"  1  
ATOM 753    O "O4'"  . C A 1 24  ? 91.669  81.102  120.744 1.00 0.00 ? 45  C A "O4'"  1  
ATOM 754    C "C3'"  . C A 1 24  ? 90.865  81.103  118.544 1.00 0.00 ? 45  C A "C3'"  1  
ATOM 755    O "O3'"  . C A 1 24  ? 89.748  81.320  117.698 1.00 0.00 ? 45  C A "O3'"  1  
ATOM 756    C "C2'"  . C A 1 24  ? 91.762  82.323  118.696 1.00 0.00 ? 45  C A "C2'"  1  
ATOM 757    O "O2'"  . C A 1 24  ? 90.998  83.503  118.905 1.00 0.00 ? 45  C A "O2'"  1  
ATOM 758    C "C1'"  . C A 1 24  ? 92.518  81.988  119.983 1.00 0.00 ? 45  C A "C1'"  1  
ATOM 759    N N1     . C A 1 24  ? 93.840  81.371  119.714 1.00 0.00 ? 45  C A N1     1  
ATOM 760    C C2     . C A 1 24  ? 94.900  82.205  119.340 1.00 0.00 ? 45  C A C2     1  
ATOM 761    O O2     . C A 1 24  ? 94.706  83.425  119.243 1.00 0.00 ? 45  C A O2     1  
ATOM 762    N N3     . C A 1 24  ? 96.116  81.667  119.091 1.00 0.00 ? 45  C A N3     1  
ATOM 763    C C4     . C A 1 24  ? 96.301  80.350  119.200 1.00 0.00 ? 45  C A C4     1  
ATOM 764    N N4     . C A 1 24  ? 97.517  79.864  118.945 1.00 0.00 ? 45  C A N4     1  
ATOM 765    C C5     . C A 1 24  ? 95.243  79.475  119.578 1.00 0.00 ? 45  C A C5     1  
ATOM 766    C C6     . C A 1 24  ? 94.045  80.021  119.824 1.00 0.00 ? 45  C A C6     1  
ATOM 767    H "H5'"  . C A 1 24  ? 89.838  79.292  121.219 1.00 0.00 ? 45  C A "H5'"  1  
ATOM 768    H "H5''" . C A 1 24  ? 89.213  79.197  119.754 1.00 0.00 ? 45  C A "H5''" 1  
ATOM 769    H "H4'"  . C A 1 24  ? 89.759  81.413  120.252 1.00 0.00 ? 45  C A "H4'"  1  
ATOM 770    H "H3'"  . C A 1 24  ? 91.395  80.358  118.190 1.00 0.00 ? 45  C A "H3'"  1  
ATOM 771    H "H2'"  . C A 1 24  ? 92.373  82.418  117.936 1.00 0.00 ? 45  C A "H2'"  1  
ATOM 772    H "HO2'" . C A 1 24  ? 91.602  84.272  118.948 1.00 0.00 ? 45  C A "HO2'" 1  
ATOM 773    H "H1'"  . C A 1 24  ? 92.643  82.805  120.510 1.00 0.00 ? 45  C A "H1'"  1  
ATOM 774    H H41    . C A 1 24  ? 98.242  80.471  118.685 1.00 0.00 ? 45  C A H41    1  
ATOM 775    H H42    . C A 1 24  ? 97.684  78.902  119.017 1.00 0.00 ? 45  C A H42    1  
ATOM 776    H H5     . C A 1 24  ? 95.388  78.509  119.658 1.00 0.00 ? 45  C A H5     1  
ATOM 777    H H6     . C A 1 24  ? 93.304  79.433  120.086 1.00 0.00 ? 45  C A H6     1  
ATOM 778    P P      . A A 1 25  ? 89.889  81.127  116.108 1.00 0.00 ? 46  A A P      1  
ATOM 779    O OP1    . A A 1 25  ? 88.716  81.765  115.461 1.00 0.00 ? 46  A A OP1    1  
ATOM 780    O OP2    . A A 1 25  ? 90.186  79.696  115.844 1.00 0.00 ? 46  A A OP2    1  
ATOM 781    O "O5'"  . A A 1 25  ? 91.183  81.976  115.730 1.00 0.00 ? 46  A A "O5'"  1  
ATOM 782    C "C5'"  . A A 1 25  ? 91.157  83.395  115.753 1.00 0.00 ? 46  A A "C5'"  1  
ATOM 783    C "C4'"  . A A 1 25  ? 92.517  83.980  115.469 1.00 0.00 ? 46  A A "C4'"  1  
ATOM 784    O "O4'"  . A A 1 25  ? 93.475  83.533  116.466 1.00 0.00 ? 46  A A "O4'"  1  
ATOM 785    C "C3'"  . A A 1 25  ? 93.156  83.574  114.150 1.00 0.00 ? 46  A A "C3'"  1  
ATOM 786    O "O3'"  . A A 1 25  ? 92.684  84.331  113.049 1.00 0.00 ? 46  A A "O3'"  1  
ATOM 787    C "C2'"  . A A 1 25  ? 94.632  83.788  114.437 1.00 0.00 ? 46  A A "C2'"  1  
ATOM 788    O "O2'"  . A A 1 25  ? 94.972  85.166  114.383 1.00 0.00 ? 46  A A "O2'"  1  
ATOM 789    C "C1'"  . A A 1 25  ? 94.721  83.306  115.889 1.00 0.00 ? 46  A A "C1'"  1  
ATOM 790    N N9     . A A 1 25  ? 95.009  81.862  115.978 1.00 0.00 ? 46  A A N9     1  
ATOM 791    C C8     . A A 1 25  ? 94.146  80.847  116.311 1.00 0.00 ? 46  A A C8     1  
ATOM 792    N N7     . A A 1 25  ? 94.698  79.659  116.305 1.00 0.00 ? 46  A A N7     1  
ATOM 793    C C5     . A A 1 25  ? 96.016  79.907  115.943 1.00 0.00 ? 46  A A C5     1  
ATOM 794    C C6     . A A 1 25  ? 97.123  79.059  115.759 1.00 0.00 ? 46  A A C6     1  
ATOM 795    N N6     . A A 1 25  ? 97.075  77.735  115.919 1.00 0.00 ? 46  A A N6     1  
ATOM 796    N N1     . A A 1 25  ? 98.294  79.625  115.399 1.00 0.00 ? 46  A A N1     1  
ATOM 797    C C2     . A A 1 25  ? 98.342  80.954  115.237 1.00 0.00 ? 46  A A C2     1  
ATOM 798    N N3     . A A 1 25  ? 97.372  81.854  115.381 1.00 0.00 ? 46  A A N3     1  
ATOM 799    C C4     . A A 1 25  ? 96.221  81.259  115.739 1.00 0.00 ? 46  A A C4     1  
ATOM 800    H "H5'"  . A A 1 25  ? 90.859  83.695  116.638 1.00 0.00 ? 46  A A "H5'"  1  
ATOM 801    H "H5''" . A A 1 25  ? 90.524  83.715  115.078 1.00 0.00 ? 46  A A "H5''" 1  
ATOM 802    H "H4'"  . A A 1 25  ? 92.457  84.957  115.507 1.00 0.00 ? 46  A A "H4'"  1  
ATOM 803    H "H3'"  . A A 1 25  ? 92.991  82.620  113.993 1.00 0.00 ? 46  A A "H3'"  1  
ATOM 804    H "H2'"  . A A 1 25  ? 95.196  83.251  113.843 1.00 0.00 ? 46  A A "H2'"  1  
ATOM 805    H "HO2'" . A A 1 25  ? 95.934  85.263  114.538 1.00 0.00 ? 46  A A "HO2'" 1  
ATOM 806    H "H1'"  . A A 1 25  ? 95.421  83.808  116.357 1.00 0.00 ? 46  A A "H1'"  1  
ATOM 807    H H8     . A A 1 25  ? 93.203  80.998  116.533 1.00 0.00 ? 46  A A H8     1  
ATOM 808    H H61    . A A 1 25  ? 97.881  77.195  115.777 1.00 0.00 ? 46  A A H61    1  
ATOM 809    H H62    . A A 1 25  ? 96.236  77.302  116.181 1.00 0.00 ? 46  A A H62    1  
ATOM 810    H H2     . A A 1 25  ? 99.215  81.315  114.975 1.00 0.00 ? 46  A A H2     1  
ATOM 811    P P      . C A 1 26  ? 92.236  83.582  111.706 1.00 0.00 ? 47  C A P      1  
ATOM 812    O OP1    . C A 1 26  ? 91.535  84.546  110.820 1.00 0.00 ? 47  C A OP1    1  
ATOM 813    O OP2    . C A 1 26  ? 91.505  82.398  112.224 1.00 0.00 ? 47  C A OP2    1  
ATOM 814    O "O5'"  . C A 1 26  ? 93.533  83.066  110.942 1.00 0.00 ? 47  C A "O5'"  1  
ATOM 815    C "C5'"  . C A 1 26  ? 94.698  83.872  110.854 1.00 0.00 ? 47  C A "C5'"  1  
ATOM 816    C "C4'"  . C A 1 26  ? 95.876  83.094  110.322 1.00 0.00 ? 47  C A "C4'"  1  
ATOM 817    O "O4'"  . C A 1 26  ? 96.573  82.441  111.415 1.00 0.00 ? 47  C A "O4'"  1  
ATOM 818    C "C3'"  . C A 1 26  ? 95.551  81.959  109.360 1.00 0.00 ? 47  C A "C3'"  1  
ATOM 819    O "O3'"  . C A 1 26  ? 95.347  82.403  108.029 1.00 0.00 ? 47  C A "O3'"  1  
ATOM 820    C "C2'"  . C A 1 26  ? 96.751  81.036  109.519 1.00 0.00 ? 47  C A "C2'"  1  
ATOM 821    O "O2'"  . C A 1 26  ? 97.877  81.526  108.806 1.00 0.00 ? 47  C A "O2'"  1  
ATOM 822    C "C1'"  . C A 1 26  ? 97.028  81.149  111.019 1.00 0.00 ? 47  C A "C1'"  1  
ATOM 823    N N1     . C A 1 26  ? 96.334  80.094  111.800 1.00 0.00 ? 47  C A N1     1  
ATOM 824    C C2     . C A 1 26  ? 96.887  78.807  111.815 1.00 0.00 ? 47  C A C2     1  
ATOM 825    O O2     . C A 1 26  ? 97.929  78.586  111.179 1.00 0.00 ? 47  C A O2     1  
ATOM 826    N N3     . C A 1 26  ? 96.275  77.827  112.519 1.00 0.00 ? 47  C A N3     1  
ATOM 827    C C4     . C A 1 26  ? 95.156  78.090  113.193 1.00 0.00 ? 47  C A C4     1  
ATOM 828    N N4     . C A 1 26  ? 94.587  77.092  113.876 1.00 0.00 ? 47  C A N4     1  
ATOM 829    C C5     . C A 1 26  ? 94.570  79.386  113.200 1.00 0.00 ? 47  C A C5     1  
ATOM 830    C C6     . C A 1 26  ? 95.184  80.349  112.500 1.00 0.00 ? 47  C A C6     1  
ATOM 831    H "H5'"  . C A 1 26  ? 94.916  84.211  111.747 1.00 0.00 ? 47  C A "H5'"  1  
ATOM 832    H "H5''" . C A 1 26  ? 94.520  84.628  110.258 1.00 0.00 ? 47  C A "H5''" 1  
ATOM 833    H "H4'"  . C A 1 26  ? 96.491  83.716  109.880 1.00 0.00 ? 47  C A "H4'"  1  
ATOM 834    H "H3'"  . C A 1 26  ? 94.746  81.495  109.673 1.00 0.00 ? 47  C A "H3'"  1  
ATOM 835    H "H2'"  . C A 1 26  ? 96.533  80.115  109.263 1.00 0.00 ? 47  C A "H2'"  1  
ATOM 836    H "HO2'" . C A 1 26  ? 98.611  80.882  108.884 1.00 0.00 ? 47  C A "HO2'" 1  
ATOM 837    H "H1'"  . C A 1 26  ? 97.993  81.090  111.179 1.00 0.00 ? 47  C A "H1'"  1  
ATOM 838    H H41    . C A 1 26  ? 94.993  76.200  113.869 1.00 0.00 ? 47  C A H41    1  
ATOM 839    H H42    . C A 1 26  ? 93.764  77.252  114.383 1.00 0.00 ? 47  C A H42    1  
ATOM 840    H H5     . C A 1 26  ? 93.747  79.570  113.701 1.00 0.00 ? 47  C A H5     1  
ATOM 841    H H6     . C A 1 26  ? 94.797  81.247  112.492 1.00 0.00 ? 47  C A H6     1  
ATOM 842    P P      . C A 1 27  ? 94.343  81.608  107.060 1.00 0.00 ? 48  C A P      1  
ATOM 843    O OP1    . C A 1 27  ? 94.150  82.421  105.833 1.00 0.00 ? 48  C A OP1    1  
ATOM 844    O OP2    . C A 1 27  ? 93.162  81.194  107.857 1.00 0.00 ? 48  C A OP2    1  
ATOM 845    O "O5'"  . C A 1 27  ? 95.153  80.296  106.658 1.00 0.00 ? 48  C A "O5'"  1  
ATOM 846    C "C5'"  . C A 1 27  ? 96.308  80.373  105.838 1.00 0.00 ? 48  C A "C5'"  1  
ATOM 847    C "C4'"  . C A 1 27  ? 96.987  79.033  105.701 1.00 0.00 ? 48  C A "C4'"  1  
ATOM 848    O "O4'"  . C A 1 27  ? 97.424  78.566  107.005 1.00 0.00 ? 48  C A "O4'"  1  
ATOM 849    C "C3'"  . C A 1 27  ? 96.125  77.897  105.172 1.00 0.00 ? 48  C A "C3'"  1  
ATOM 850    O "O3'"  . C A 1 27  ? 96.011  77.902  103.757 1.00 0.00 ? 48  C A "O3'"  1  
ATOM 851    C "C2'"  . C A 1 27  ? 96.825  76.663  105.722 1.00 0.00 ? 48  C A "C2'"  1  
ATOM 852    O "O2'"  . C A 1 27  ? 97.983  76.344  104.963 1.00 0.00 ? 48  C A "O2'"  1  
ATOM 853    C "C1'"  . C A 1 27  ? 97.257  77.151  107.107 1.00 0.00 ? 48  C A "C1'"  1  
ATOM 854    N N1     . C A 1 27  ? 96.262  76.823  108.156 1.00 0.00 ? 48  C A N1     1  
ATOM 855    C C2     . C A 1 27  ? 96.217  75.511  108.644 1.00 0.00 ? 48  C A C2     1  
ATOM 856    O O2     . C A 1 27  ? 97.005  74.669  108.187 1.00 0.00 ? 48  C A O2     1  
ATOM 857    N N3     . C A 1 27  ? 95.318  75.187  109.601 1.00 0.00 ? 48  C A N3     1  
ATOM 858    C C4     . C A 1 27  ? 94.482  76.110  110.074 1.00 0.00 ? 48  C A C4     1  
ATOM 859    N N4     . C A 1 27  ? 93.613  75.744  111.019 1.00 0.00 ? 48  C A N4     1  
ATOM 860    C C5     . C A 1 27  ? 94.501  77.451  109.598 1.00 0.00 ? 48  C A C5     1  
ATOM 861    C C6     . C A 1 27  ? 95.396  77.762  108.653 1.00 0.00 ? 48  C A C6     1  
ATOM 862    H "H5'"  . C A 1 27  ? 96.938  81.012  106.234 1.00 0.00 ? 48  C A "H5'"  1  
ATOM 863    H "H5''" . C A 1 27  ? 96.049  80.692  104.949 1.00 0.00 ? 48  C A "H5''" 1  
ATOM 864    H "H4'"  . C A 1 27  ? 97.769  79.134  105.121 1.00 0.00 ? 48  C A "H4'"  1  
ATOM 865    H "H3'"  . C A 1 27  ? 95.230  77.961  105.566 1.00 0.00 ? 48  C A "H3'"  1  
ATOM 866    H "H2'"  . C A 1 27  ? 96.213  75.900  105.788 1.00 0.00 ? 48  C A "H2'"  1  
ATOM 867    H "HO2'" . C A 1 27  ? 98.374  75.517  105.312 1.00 0.00 ? 48  C A "HO2'" 1  
ATOM 868    H "H1'"  . C A 1 27  ? 98.119  76.748  107.340 1.00 0.00 ? 48  C A "H1'"  1  
ATOM 869    H H41    . C A 1 27  ? 93.602  74.819  111.344 1.00 0.00 ? 48  C A H41    1  
ATOM 870    H H42    . C A 1 27  ? 92.985  76.400  111.388 1.00 0.00 ? 48  C A H42    1  
ATOM 871    H H5     . C A 1 27  ? 93.884  78.126  109.953 1.00 0.00 ? 48  C A H5     1  
ATOM 872    H H6     . C A 1 27  ? 95.425  78.681  108.312 1.00 0.00 ? 48  C A H6     1  
ATOM 873    P P      . U A 1 28  ? 94.687  77.323  103.052 1.00 0.00 ? 49  U A P      1  
ATOM 874    O OP1    . U A 1 28  ? 94.724  77.706  101.618 1.00 0.00 ? 49  U A OP1    1  
ATOM 875    O OP2    . U A 1 28  ? 93.519  77.704  103.884 1.00 0.00 ? 49  U A OP2    1  
ATOM 876    O "O5'"  . U A 1 28  ? 94.864  75.742  103.145 1.00 0.00 ? 49  U A "O5'"  1  
ATOM 877    C "C5'"  . U A 1 28  ? 95.862  75.074  102.389 1.00 0.00 ? 49  U A "C5'"  1  
ATOM 878    C "C4'"  . U A 1 28  ? 95.903  73.599  102.702 1.00 0.00 ? 49  U A "C4'"  1  
ATOM 879    O "O4'"  . U A 1 28  ? 96.251  73.397  104.096 1.00 0.00 ? 49  U A "O4'"  1  
ATOM 880    C "C3'"  . U A 1 28  ? 94.594  72.841  102.535 1.00 0.00 ? 49  U A "C3'"  1  
ATOM 881    O "O3'"  . U A 1 28  ? 94.335  72.472  101.190 1.00 0.00 ? 49  U A "O3'"  1  
ATOM 882    C "C2'"  . U A 1 28  ? 94.774  71.654  103.469 1.00 0.00 ? 49  U A "C2'"  1  
ATOM 883    O "O2'"  . U A 1 28  ? 95.610  70.663  102.891 1.00 0.00 ? 49  U A "O2'"  1  
ATOM 884    C "C1'"  . U A 1 28  ? 95.511  72.301  104.644 1.00 0.00 ? 49  U A "C1'"  1  
ATOM 885    N N1     . U A 1 28  ? 94.581  72.791  105.690 1.00 0.00 ? 49  U A N1     1  
ATOM 886    C C2     . U A 1 28  ? 94.057  71.852  106.559 1.00 0.00 ? 49  U A C2     1  
ATOM 887    O O2     . U A 1 28  ? 94.326  70.665  106.498 1.00 0.00 ? 49  U A O2     1  
ATOM 888    N N3     . U A 1 28  ? 93.203  72.351  107.511 1.00 0.00 ? 49  U A N3     1  
ATOM 889    C C4     . U A 1 28  ? 92.823  73.667  107.680 1.00 0.00 ? 49  U A C4     1  
ATOM 890    O O4     . U A 1 28  ? 92.042  73.958  108.586 1.00 0.00 ? 49  U A O4     1  
ATOM 891    C C5     . U A 1 28  ? 93.404  74.582  106.745 1.00 0.00 ? 49  U A C5     1  
ATOM 892    C C6     . U A 1 28  ? 94.241  74.122  105.809 1.00 0.00 ? 49  U A C6     1  
ATOM 893    H "H5'"  . U A 1 28  ? 96.736  75.468  102.596 1.00 0.00 ? 49  U A "H5'"  1  
ATOM 894    H "H5''" . U A 1 28  ? 95.675  75.193  101.435 1.00 0.00 ? 49  U A "H5''" 1  
ATOM 895    H "H4'"  . U A 1 28  ? 96.586  73.176  102.140 1.00 0.00 ? 49  U A "H4'"  1  
ATOM 896    H "H3'"  . U A 1 28  ? 93.856  73.398  102.862 1.00 0.00 ? 49  U A "H3'"  1  
ATOM 897    H "H2'"  . U A 1 28  ? 93.911  71.282  103.750 1.00 0.00 ? 49  U A "H2'"  1  
ATOM 898    H "HO2'" . U A 1 28  ? 95.646  69.888  103.487 1.00 0.00 ? 49  U A "HO2'" 1  
ATOM 899    H "H1'"  . U A 1 28  ? 96.128  71.649  105.040 1.00 0.00 ? 49  U A "H1'"  1  
ATOM 900    H H3     . U A 1 28  ? 92.820  71.703  108.136 1.00 0.00 ? 49  U A H3     1  
ATOM 901    H H5     . U A 1 28  ? 93.191  75.537  106.793 1.00 0.00 ? 49  U A H5     1  
ATOM 902    H H6     . U A 1 28  ? 94.625  74.768  105.182 1.00 0.00 ? 49  U A H6     1  
ATOM 903    P P      . G A 1 29  ? 92.825  72.397  100.646 1.00 0.00 ? 50  G A P      1  
ATOM 904    O OP1    . G A 1 29  ? 92.873  72.249  99.169  1.00 0.00 ? 50  G A OP1    1  
ATOM 905    O OP2    . G A 1 29  ? 92.065  73.524  101.247 1.00 0.00 ? 50  G A OP2    1  
ATOM 906    O "O5'"  . G A 1 29  ? 92.260  71.040  101.260 1.00 0.00 ? 50  G A "O5'"  1  
ATOM 907    C "C5'"  . G A 1 29  ? 92.748  69.781  100.819 1.00 0.00 ? 50  G A "C5'"  1  
ATOM 908    C "C4'"  . G A 1 29  ? 92.244  68.656  101.686 1.00 0.00 ? 50  G A "C4'"  1  
ATOM 909    O "O4'"  . G A 1 29  ? 92.668  68.865  103.059 1.00 0.00 ? 50  G A "O4'"  1  
ATOM 910    C "C3'"  . G A 1 29  ? 90.732  68.515  101.784 1.00 0.00 ? 50  G A "C3'"  1  
ATOM 911    O "O3'"  . G A 1 29  ? 90.168  67.828  100.679 1.00 0.00 ? 50  G A "O3'"  1  
ATOM 912    C "C2'"  . G A 1 29  ? 90.551  67.789  103.110 1.00 0.00 ? 50  G A "C2'"  1  
ATOM 913    O "O2'"  . G A 1 29  ? 90.843  66.406  102.985 1.00 0.00 ? 50  G A "O2'"  1  
ATOM 914    C "C1'"  . G A 1 29  ? 91.631  68.451  103.968 1.00 0.00 ? 50  G A "C1'"  1  
ATOM 915    N N9     . G A 1 29  ? 91.106  69.591  104.742 1.00 0.00 ? 50  G A N9     1  
ATOM 916    C C8     . G A 1 29  ? 91.346  70.925  104.523 1.00 0.00 ? 50  G A C8     1  
ATOM 917    N N7     . G A 1 29  ? 90.738  71.703  105.380 1.00 0.00 ? 50  G A N7     1  
ATOM 918    C C5     . G A 1 29  ? 90.057  70.830  106.213 1.00 0.00 ? 50  G A C5     1  
ATOM 919    C C6     . G A 1 29  ? 89.221  71.088  107.331 1.00 0.00 ? 50  G A C6     1  
ATOM 920    O O6     . G A 1 29  ? 88.909  72.180  107.822 1.00 0.00 ? 50  G A O6     1  
ATOM 921    N N1     . G A 1 29  ? 88.732  69.912  107.889 1.00 0.00 ? 50  G A N1     1  
ATOM 922    C C2     . G A 1 29  ? 89.009  68.645  107.432 1.00 0.00 ? 50  G A C2     1  
ATOM 923    N N2     . G A 1 29  ? 88.444  67.632  108.102 1.00 0.00 ? 50  G A N2     1  
ATOM 924    N N3     . G A 1 29  ? 89.786  68.392  106.392 1.00 0.00 ? 50  G A N3     1  
ATOM 925    C C4     . G A 1 29  ? 90.273  69.521  105.834 1.00 0.00 ? 50  G A C4     1  
ATOM 926    H "H5'"  . G A 1 29  ? 93.727  69.792  100.845 1.00 0.00 ? 50  G A "H5'"  1  
ATOM 927    H "H5''" . G A 1 29  ? 92.455  69.632  99.896  1.00 0.00 ? 50  G A "H5''" 1  
ATOM 928    H "H4'"  . G A 1 29  ? 92.621  67.812  101.361 1.00 0.00 ? 50  G A "H4'"  1  
ATOM 929    H "H3'"  . G A 1 29  ? 90.330  69.406  101.847 1.00 0.00 ? 50  G A "H3'"  1  
ATOM 930    H "H2'"  . G A 1 29  ? 89.656  67.939  103.483 1.00 0.00 ? 50  G A "H2'"  1  
ATOM 931    H "HO2'" . G A 1 29  ? 90.788  66.150  102.042 1.00 0.00 ? 50  G A "HO2'" 1  
ATOM 932    H "H1'"  . G A 1 29  ? 92.010  67.787  104.581 1.00 0.00 ? 50  G A "H1'"  1  
ATOM 933    H H8     . G A 1 29  ? 91.916  71.261  103.800 1.00 0.00 ? 50  G A H8     1  
ATOM 934    H H1     . G A 1 29  ? 88.144  69.994  108.668 1.00 0.00 ? 50  G A H1     1  
ATOM 935    H H21    . G A 1 29  ? 87.867  67.813  108.873 1.00 0.00 ? 50  G A H21    1  
ATOM 936    H H22    . G A 1 29  ? 88.606  66.707  107.821 1.00 0.00 ? 50  G A H22    1  
ATOM 937    P P      . G A 1 30  ? 88.629  68.067  100.281 1.00 0.00 ? 51  G A P      1  
ATOM 938    O OP1    . G A 1 30  ? 88.385  67.411  98.970  1.00 0.00 ? 51  G A OP1    1  
ATOM 939    O OP2    . G A 1 30  ? 88.330  69.513  100.445 1.00 0.00 ? 51  G A OP2    1  
ATOM 940    O "O5'"  . G A 1 30  ? 87.814  67.267  101.393 1.00 0.00 ? 51  G A "O5'"  1  
ATOM 941    C "C5'"  . G A 1 30  ? 87.883  65.850  101.468 1.00 0.00 ? 51  G A "C5'"  1  
ATOM 942    C "C4'"  . G A 1 30  ? 86.990  65.309  102.556 1.00 0.00 ? 51  G A "C4'"  1  
ATOM 943    O "O4'"  . G A 1 30  ? 87.467  65.757  103.851 1.00 0.00 ? 51  G A "O4'"  1  
ATOM 944    C "C3'"  . G A 1 30  ? 85.539  65.766  102.516 1.00 0.00 ? 51  G A "C3'"  1  
ATOM 945    O "O3'"  . G A 1 30  ? 84.760  65.054  101.572 1.00 0.00 ? 51  G A "O3'"  1  
ATOM 946    C "C2'"  . G A 1 30  ? 85.088  65.565  103.956 1.00 0.00 ? 51  G A "C2'"  1  
ATOM 947    O "O2'"  . G A 1 30  ? 84.813  64.196  104.223 1.00 0.00 ? 51  G A "O2'"  1  
ATOM 948    C "C1'"  . G A 1 30  ? 86.342  65.980  104.729 1.00 0.00 ? 51  G A "C1'"  1  
ATOM 949    N N9     . G A 1 30  ? 86.290  67.390  105.156 1.00 0.00 ? 51  G A N9     1  
ATOM 950    C C8     . G A 1 30  ? 87.015  68.439  104.645 1.00 0.00 ? 51  G A C8     1  
ATOM 951    N N7     . G A 1 30  ? 86.751  69.577  105.229 1.00 0.00 ? 51  G A N7     1  
ATOM 952    C C5     . G A 1 30  ? 85.794  69.261  106.183 1.00 0.00 ? 51  G A C5     1  
ATOM 953    C C6     . G A 1 30  ? 85.127  70.085  107.124 1.00 0.00 ? 51  G A C6     1  
ATOM 954    O O6     . G A 1 30  ? 85.251  71.302  107.309 1.00 0.00 ? 51  G A O6     1  
ATOM 955    N N1     . G A 1 30  ? 84.231  69.356  107.902 1.00 0.00 ? 51  G A N1     1  
ATOM 956    C C2     . G A 1 30  ? 84.009  68.004  107.788 1.00 0.00 ? 51  G A C2     1  
ATOM 957    N N2     . G A 1 30  ? 83.105  67.478  108.629 1.00 0.00 ? 51  G A N2     1  
ATOM 958    N N3     . G A 1 30  ? 84.626  67.225  106.916 1.00 0.00 ? 51  G A N3     1  
ATOM 959    C C4     . G A 1 30  ? 85.498  67.915  106.150 1.00 0.00 ? 51  G A C4     1  
ATOM 960    H "H5'"  . G A 1 30  ? 88.808  65.584  101.652 1.00 0.00 ? 51  G A "H5'"  1  
ATOM 961    H "H5''" . G A 1 30  ? 87.607  65.469  100.608 1.00 0.00 ? 51  G A "H5''" 1  
ATOM 962    H "H4'"  . G A 1 30  ? 87.014  64.330  102.529 1.00 0.00 ? 51  G A "H4'"  1  
ATOM 963    H "H3'"  . G A 1 30  ? 85.509  66.722  102.302 1.00 0.00 ? 51  G A "H3'"  1  
ATOM 964    H "H2'"  . G A 1 30  ? 84.324  66.138  104.177 1.00 0.00 ? 51  G A "H2'"  1  
ATOM 965    H "HO2'" . G A 1 30  ? 84.468  64.114  105.136 1.00 0.00 ? 51  G A "HO2'" 1  
ATOM 966    H "H1'"  . G A 1 30  ? 86.444  65.404  105.516 1.00 0.00 ? 51  G A "H1'"  1  
ATOM 967    H H8     . G A 1 30  ? 87.664  68.346  103.918 1.00 0.00 ? 51  G A H8     1  
ATOM 968    H H1     . G A 1 30  ? 83.723  69.845  108.582 1.00 0.00 ? 51  G A H1     1  
ATOM 969    H H21    . G A 1 30  ? 82.644  68.049  109.278 1.00 0.00 ? 51  G A H21    1  
ATOM 970    H H22    . G A 1 30  ? 82.904  66.518  108.594 1.00 0.00 ? 51  G A H22    1  
ATOM 971    P P      . U A 1 31  ? 83.572  65.796  100.780 1.00 0.00 ? 52  U A P      1  
ATOM 972    O OP1    . U A 1 31  ? 83.078  64.877  99.725  1.00 0.00 ? 52  U A OP1    1  
ATOM 973    O OP2    . U A 1 31  ? 84.046  67.152  100.410 1.00 0.00 ? 52  U A OP2    1  
ATOM 974    O "O5'"  . U A 1 31  ? 82.424  65.956  101.872 1.00 0.00 ? 52  U A "O5'"  1  
ATOM 975    C "C5'"  . U A 1 31  ? 81.750  64.820  102.394 1.00 0.00 ? 52  U A "C5'"  1  
ATOM 976    C "C4'"  . U A 1 31  ? 80.771  65.202  103.475 1.00 0.00 ? 52  U A "C4'"  1  
ATOM 977    O "O4'"  . U A 1 31  ? 81.480  65.773  104.606 1.00 0.00 ? 52  U A "O4'"  1  
ATOM 978    C "C3'"  . U A 1 31  ? 79.746  66.265  103.108 1.00 0.00 ? 52  U A "C3'"  1  
ATOM 979    O "O3'"  . U A 1 31  ? 78.636  65.743  102.397 1.00 0.00 ? 52  U A "O3'"  1  
ATOM 980    C "C2'"  . U A 1 31  ? 79.379  66.856  104.461 1.00 0.00 ? 52  U A "C2'"  1  
ATOM 981    O "O2'"  . U A 1 31  ? 78.481  66.014  105.167 1.00 0.00 ? 52  U A "O2'"  1  
ATOM 982    C "C1'"  . U A 1 31  ? 80.733  66.846  105.175 1.00 0.00 ? 52  U A "C1'"  1  
ATOM 983    N N1     . U A 1 31  ? 81.475  68.118  104.992 1.00 0.00 ? 52  U A N1     1  
ATOM 984    C C2     . U A 1 31  ? 81.082  69.193  105.769 1.00 0.00 ? 52  U A C2     1  
ATOM 985    O O2     . U A 1 31  ? 80.172  69.134  106.578 1.00 0.00 ? 52  U A O2     1  
ATOM 986    N N3     . U A 1 31  ? 81.797  70.348  105.569 1.00 0.00 ? 52  U A N3     1  
ATOM 987    C C4     . U A 1 31  ? 82.842  70.538  104.687 1.00 0.00 ? 52  U A C4     1  
ATOM 988    O O4     . U A 1 31  ? 83.385  71.642  104.623 1.00 0.00 ? 52  U A O4     1  
ATOM 989    C C5     . U A 1 31  ? 83.193  69.383  103.918 1.00 0.00 ? 52  U A C5     1  
ATOM 990    C C6     . U A 1 31  ? 82.513  68.244  104.096 1.00 0.00 ? 52  U A C6     1  
ATOM 991    H "H5'"  . U A 1 31  ? 82.411  64.200  102.766 1.00 0.00 ? 52  U A "H5'"  1  
ATOM 992    H "H5''" . U A 1 31  ? 81.266  64.374  101.667 1.00 0.00 ? 52  U A "H5''" 1  
ATOM 993    H "H4'"  . U A 1 31  ? 80.297  64.395  103.770 1.00 0.00 ? 52  U A "H4'"  1  
ATOM 994    H "H3'"  . U A 1 31  ? 80.180  66.956  102.563 1.00 0.00 ? 52  U A "H3'"  1  
ATOM 995    H "H2'"  . U A 1 31  ? 79.029  67.768  104.373 1.00 0.00 ? 52  U A "H2'"  1  
ATOM 996    H "HO2'" . U A 1 31  ? 78.044  65.410  104.532 1.00 0.00 ? 52  U A "HO2'" 1  
ATOM 997    H "H1'"  . U A 1 31  ? 80.596  66.687  106.131 1.00 0.00 ? 52  U A "H1'"  1  
ATOM 998    H H3     . U A 1 31  ? 81.535  71.122  106.108 1.00 0.00 ? 52  U A H3     1  
ATOM 999    H H5     . U A 1 31  ? 83.924  69.427  103.268 1.00 0.00 ? 52  U A H5     1  
ATOM 1000   H H6     . U A 1 31  ? 82.772  67.469  103.556 1.00 0.00 ? 52  U A H6     1  
ATOM 1001   P P      . A A 1 32  ? 77.875  66.646  101.307 1.00 0.00 ? 53  A A P      1  
ATOM 1002   O OP1    . A A 1 32  ? 76.957  65.766  100.540 1.00 0.00 ? 53  A A OP1    1  
ATOM 1003   O OP2    . A A 1 32  ? 78.892  67.452  100.587 1.00 0.00 ? 53  A A OP2    1  
ATOM 1004   O "O5'"  . A A 1 32  ? 76.989  67.640  102.184 1.00 0.00 ? 53  A A "O5'"  1  
ATOM 1005   C "C5'"  . A A 1 32  ? 75.884  67.160  102.935 1.00 0.00 ? 53  A A "C5'"  1  
ATOM 1006   C "C4'"  . A A 1 32  ? 75.351  68.217  103.871 1.00 0.00 ? 53  A A "C4'"  1  
ATOM 1007   O "O4'"  . A A 1 32  ? 76.397  68.637  104.785 1.00 0.00 ? 53  A A "O4'"  1  
ATOM 1008   C "C3'"  . A A 1 32  ? 74.885  69.511  103.222 1.00 0.00 ? 53  A A "C3'"  1  
ATOM 1009   O "O3'"  . A A 1 32  ? 73.573  69.426  102.695 1.00 0.00 ? 53  A A "O3'"  1  
ATOM 1010   C "C2'"  . A A 1 32  ? 75.025  70.519  104.353 1.00 0.00 ? 53  A A "C2'"  1  
ATOM 1011   O "O2'"  . A A 1 32  ? 73.957  70.404  105.281 1.00 0.00 ? 53  A A "O2'"  1  
ATOM 1012   C "C1'"  . A A 1 32  ? 76.316  70.050  105.022 1.00 0.00 ? 53  A A "C1'"  1  
ATOM 1013   N N9     . A A 1 32  ? 77.505  70.745  104.489 1.00 0.00 ? 53  A A N9     1  
ATOM 1014   C C8     . A A 1 32  ? 78.458  70.252  103.633 1.00 0.00 ? 53  A A C8     1  
ATOM 1015   N N7     . A A 1 32  ? 79.399  71.115  103.337 1.00 0.00 ? 53  A A N7     1  
ATOM 1016   C C5     . A A 1 32  ? 79.042  72.253  104.046 1.00 0.00 ? 53  A A C5     1  
ATOM 1017   C C6     . A A 1 32  ? 79.635  73.523  104.160 1.00 0.00 ? 53  A A C6     1  
ATOM 1018   N N6     . A A 1 32  ? 80.758  73.874  103.530 1.00 0.00 ? 53  A A N6     1  
ATOM 1019   N N1     . A A 1 32  ? 79.024  74.432  104.951 1.00 0.00 ? 53  A A N1     1  
ATOM 1020   C C2     . A A 1 32  ? 77.898  74.083  105.581 1.00 0.00 ? 53  A A C2     1  
ATOM 1021   N N3     . A A 1 32  ? 77.247  72.921  105.555 1.00 0.00 ? 53  A A N3     1  
ATOM 1022   C C4     . A A 1 32  ? 77.877  72.039  104.761 1.00 0.00 ? 53  A A C4     1  
ATOM 1023   H "H5'"  . A A 1 32  ? 76.166  66.382  103.460 1.00 0.00 ? 53  A A "H5'"  1  
ATOM 1024   H "H5''" . A A 1 32  ? 75.171  66.889  102.321 1.00 0.00 ? 53  A A "H5''" 1  
ATOM 1025   H "H4'"  . A A 1 32  ? 74.609  67.836  104.388 1.00 0.00 ? 53  A A "H4'"  1  
ATOM 1026   H "H3'"  . A A 1 32  ? 75.505  69.750  102.501 1.00 0.00 ? 53  A A "H3'"  1  
ATOM 1027   H "H2'"  . A A 1 32  ? 75.111  71.434  104.010 1.00 0.00 ? 53  A A "H2'"  1  
ATOM 1028   H "HO2'" . A A 1 32  ? 73.207  69.942  104.851 1.00 0.00 ? 53  A A "HO2'" 1  
ATOM 1029   H "H1'"  . A A 1 32  ? 76.257  70.201  105.988 1.00 0.00 ? 53  A A "H1'"  1  
ATOM 1030   H H8     . A A 1 32  ? 78.435  69.339  103.275 1.00 0.00 ? 53  A A H8     1  
ATOM 1031   H H61    . A A 1 32  ? 81.124  74.778  103.648 1.00 0.00 ? 53  A A H61    1  
ATOM 1032   H H62    . A A 1 32  ? 81.218  73.230  102.952 1.00 0.00 ? 53  A A H62    1  
ATOM 1033   H H2     . A A 1 32  ? 77.495  74.777  106.143 1.00 0.00 ? 53  A A H2     1  
ATOM 1034   P P      . G A 1 33  ? 73.119  70.390  101.493 1.00 0.00 ? 54  G A P      1  
ATOM 1035   O OP1    . G A 1 33  ? 71.808  69.910  100.984 1.00 0.00 ? 54  G A OP1    1  
ATOM 1036   O OP2    . G A 1 33  ? 74.264  70.528  100.556 1.00 0.00 ? 54  G A OP2    1  
ATOM 1037   O "O5'"  . G A 1 33  ? 72.885  71.800  102.196 1.00 0.00 ? 54  G A "O5'"  1  
ATOM 1038   C "C5'"  . G A 1 33  ? 71.825  71.986  103.122 1.00 0.00 ? 54  G A "C5'"  1  
ATOM 1039   C "C4'"  . G A 1 33  ? 71.778  73.405  103.631 1.00 0.00 ? 54  G A "C4'"  1  
ATOM 1040   O "O4'"  . G A 1 33  ? 72.978  73.695  104.395 1.00 0.00 ? 54  G A "O4'"  1  
ATOM 1041   C "C3'"  . G A 1 33  ? 71.744  74.494  102.571 1.00 0.00 ? 54  G A "C3'"  1  
ATOM 1042   O "O3'"  . G A 1 33  ? 70.452  74.693  102.020 1.00 0.00 ? 54  G A "O3'"  1  
ATOM 1043   C "C2'"  . G A 1 33  ? 72.280  75.706  103.320 1.00 0.00 ? 54  G A "C2'"  1  
ATOM 1044   O "O2'"  . G A 1 33  ? 71.287  76.273  104.163 1.00 0.00 ? 54  G A "O2'"  1  
ATOM 1045   C "C1'"  . G A 1 33  ? 73.366  75.070  104.191 1.00 0.00 ? 54  G A "C1'"  1  
ATOM 1046   N N9     . G A 1 33  ? 74.696  75.139  103.559 1.00 0.00 ? 54  G A N9     1  
ATOM 1047   C C8     . G A 1 33  ? 75.416  74.102  103.019 1.00 0.00 ? 54  G A C8     1  
ATOM 1048   N N7     . G A 1 33  ? 76.569  74.475  102.530 1.00 0.00 ? 54  G A N7     1  
ATOM 1049   C C5     . G A 1 33  ? 76.613  75.842  102.761 1.00 0.00 ? 54  G A C5     1  
ATOM 1050   C C6     . G A 1 33  ? 77.617  76.795  102.450 1.00 0.00 ? 54  G A C6     1  
ATOM 1051   O O6     . G A 1 33  ? 78.704  76.614  101.891 1.00 0.00 ? 54  G A O6     1  
ATOM 1052   N N1     . G A 1 33  ? 77.254  78.073  102.862 1.00 0.00 ? 54  G A N1     1  
ATOM 1053   C C2     . G A 1 33  ? 76.078  78.397  103.492 1.00 0.00 ? 54  G A C2     1  
ATOM 1054   N N2     . G A 1 33  ? 75.907  79.687  103.813 1.00 0.00 ? 54  G A N2     1  
ATOM 1055   N N3     . G A 1 33  ? 75.134  77.516  103.788 1.00 0.00 ? 54  G A N3     1  
ATOM 1056   C C4     . G A 1 33  ? 75.465  76.269  103.395 1.00 0.00 ? 54  G A C4     1  
ATOM 1057   H "H5'"  . G A 1 33  ? 71.953  71.379  103.881 1.00 0.00 ? 54  G A "H5'"  1  
ATOM 1058   H "H5''" . G A 1 33  ? 70.976  71.776  102.683 1.00 0.00 ? 54  G A "H5''" 1  
ATOM 1059   H "H4'"  . G A 1 33  ? 70.996  73.508  104.215 1.00 0.00 ? 54  G A "H4'"  1  
ATOM 1060   H "H3'"  . G A 1 33  ? 72.368  74.262  101.851 1.00 0.00 ? 54  G A "H3'"  1  
ATOM 1061   H "H2'"  . G A 1 33  ? 72.658  76.371  102.705 1.00 0.00 ? 54  G A "H2'"  1  
ATOM 1062   H "HO2'" . G A 1 33  ? 71.642  77.091  104.568 1.00 0.00 ? 54  G A "HO2'" 1  
ATOM 1063   H "H1'"  . G A 1 33  ? 73.392  75.522  105.060 1.00 0.00 ? 54  G A "H1'"  1  
ATOM 1064   H H8     . G A 1 33  ? 75.098  73.175  103.001 1.00 0.00 ? 54  G A H8     1  
ATOM 1065   H H1     . G A 1 33  ? 77.890  78.798  102.689 1.00 0.00 ? 54  G A H1     1  
ATOM 1066   H H21    . G A 1 33  ? 76.602  80.343  103.598 1.00 0.00 ? 54  G A H21    1  
ATOM 1067   H H22    . G A 1 33  ? 75.085  79.976  104.264 1.00 0.00 ? 54  G A H22    1  
ATOM 1068   P P      . C A 1 34  ? 70.287  75.116  100.478 1.00 0.00 ? 55  C A P      1  
ATOM 1069   O OP1    . C A 1 34  ? 68.839  75.095  100.149 1.00 0.00 ? 55  C A OP1    1  
ATOM 1070   O OP2    . C A 1 34  ? 71.234  74.304  99.675  1.00 0.00 ? 55  C A OP2    1  
ATOM 1071   O "O5'"  . C A 1 34  ? 70.779  76.630  100.439 1.00 0.00 ? 55  C A "O5'"  1  
ATOM 1072   C "C5'"  . C A 1 34  ? 70.047  77.652  101.098 1.00 0.00 ? 55  C A "C5'"  1  
ATOM 1073   C "C4'"  . C A 1 34  ? 70.778  78.972  101.064 1.00 0.00 ? 55  C A "C4'"  1  
ATOM 1074   O "O4'"  . C A 1 34  ? 72.045  78.853  101.763 1.00 0.00 ? 55  C A "O4'"  1  
ATOM 1075   C "C3'"  . C A 1 34  ? 71.163  79.491  99.688  1.00 0.00 ? 55  C A "C3'"  1  
ATOM 1076   O "O3'"  . C A 1 34  ? 70.100  80.156  99.027  1.00 0.00 ? 55  C A "O3'"  1  
ATOM 1077   C "C2'"  . C A 1 34  ? 72.352  80.390  99.992  1.00 0.00 ? 55  C A "C2'"  1  
ATOM 1078   O "O2'"  . C A 1 34  ? 71.931  81.642  100.514 1.00 0.00 ? 55  C A "O2'"  1  
ATOM 1079   C "C1'"  . C A 1 34  ? 73.057  79.603  101.097 1.00 0.00 ? 55  C A "C1'"  1  
ATOM 1080   N N1     . C A 1 34  ? 74.105  78.698  100.563 1.00 0.00 ? 55  C A N1     1  
ATOM 1081   C C2     . C A 1 34  ? 75.326  79.257  100.165 1.00 0.00 ? 55  C A C2     1  
ATOM 1082   O O2     . C A 1 34  ? 75.495  80.481  100.268 1.00 0.00 ? 55  C A O2     1  
ATOM 1083   N N3     . C A 1 34  ? 76.298  78.453  99.676  1.00 0.00 ? 55  C A N3     1  
ATOM 1084   C C4     . C A 1 34  ? 76.093  77.141  99.574  1.00 0.00 ? 55  C A C4     1  
ATOM 1085   N N4     . C A 1 34  ? 77.081  76.386  99.086  1.00 0.00 ? 55  C A N4     1  
ATOM 1086   C C5     . C A 1 34  ? 74.863  76.542  99.970  1.00 0.00 ? 55  C A C5     1  
ATOM 1087   C C6     . C A 1 34  ? 73.909  77.346  100.454 1.00 0.00 ? 55  C A C6     1  
ATOM 1088   H "H5'"  . C A 1 34  ? 69.903  77.392  102.031 1.00 0.00 ? 55  C A "H5'"  1  
ATOM 1089   H "H5''" . C A 1 34  ? 69.178  77.758  100.657 1.00 0.00 ? 55  C A "H5''" 1  
ATOM 1090   H "H4'"  . C A 1 34  ? 70.228  79.647  101.514 1.00 0.00 ? 55  C A "H4'"  1  
ATOM 1091   H "H3'"  . C A 1 34  ? 71.464  78.739  99.134  1.00 0.00 ? 55  C A "H3'"  1  
ATOM 1092   H "H2'"  . C A 1 34  ? 72.930  80.501  99.206  1.00 0.00 ? 55  C A "H2'"  1  
ATOM 1093   H "HO2'" . C A 1 34  ? 70.991  81.789  100.275 1.00 0.00 ? 55  C A "HO2'" 1  
ATOM 1094   H "H1'"  . C A 1 34  ? 73.461  80.227  101.733 1.00 0.00 ? 55  C A "H1'"  1  
ATOM 1095   H H41    . C A 1 34  ? 77.925  76.803  98.814  1.00 0.00 ? 55  C A H41    1  
ATOM 1096   H H42    . C A 1 34  ? 76.960  75.418  98.999  1.00 0.00 ? 55  C A H42    1  
ATOM 1097   H H5     . C A 1 34  ? 74.721  75.575  99.891  1.00 0.00 ? 55  C A H5     1  
ATOM 1098   H H6     . C A 1 34  ? 73.056  76.954  100.731 1.00 0.00 ? 55  C A H6     1  
ATOM 1099   P P      . U A 1 35  ? 70.004  80.135  97.423  1.00 0.00 ? 56  U A P      1  
ATOM 1100   O OP1    . U A 1 35  ? 68.718  80.768  97.032  1.00 0.00 ? 56  U A OP1    1  
ATOM 1101   O OP2    . U A 1 35  ? 70.314  78.759  96.963  1.00 0.00 ? 56  U A OP2    1  
ATOM 1102   O "O5'"  . U A 1 35  ? 71.189  81.092  96.956  1.00 0.00 ? 56  U A "O5'"  1  
ATOM 1103   C "C5'"  . U A 1 35  ? 71.156  82.484  97.235  1.00 0.00 ? 56  U A "C5'"  1  
ATOM 1104   C "C4'"  . U A 1 35  ? 72.419  83.173  96.778  1.00 0.00 ? 56  U A "C4'"  1  
ATOM 1105   O "O4'"  . U A 1 35  ? 73.559  82.654  97.512  1.00 0.00 ? 56  U A "O4'"  1  
ATOM 1106   C "C3'"  . U A 1 35  ? 72.798  82.978  95.318  1.00 0.00 ? 56  U A "C3'"  1  
ATOM 1107   O "O3'"  . U A 1 35  ? 72.089  83.836  94.441  1.00 0.00 ? 56  U A "O3'"  1  
ATOM 1108   C "C2'"  . U A 1 35  ? 74.301  83.224  95.329  1.00 0.00 ? 56  U A "C2'"  1  
ATOM 1109   O "O2'"  . U A 1 35  ? 74.596  84.613  95.379  1.00 0.00 ? 56  U A "O2'"  1  
ATOM 1110   C "C1'"  . U A 1 35  ? 74.704  82.583  96.659  1.00 0.00 ? 56  U A "C1'"  1  
ATOM 1111   N N1     . U A 1 35  ? 75.144  81.177  96.495  1.00 0.00 ? 56  U A N1     1  
ATOM 1112   C C2     . U A 1 35  ? 76.412  80.967  95.987  1.00 0.00 ? 56  U A C2     1  
ATOM 1113   O O2     . U A 1 35  ? 77.162  81.876  95.677  1.00 0.00 ? 56  U A O2     1  
ATOM 1114   N N3     . U A 1 35  ? 76.777  79.649  95.853  1.00 0.00 ? 56  U A N3     1  
ATOM 1115   C C4     . U A 1 35  ? 76.018  78.542  96.170  1.00 0.00 ? 56  U A C4     1  
ATOM 1116   O O4     . U A 1 35  ? 76.488  77.418  95.990  1.00 0.00 ? 56  U A O4     1  
ATOM 1117   C C5     . U A 1 35  ? 74.718  78.835  96.690  1.00 0.00 ? 56  U A C5     1  
ATOM 1118   C C6     . U A 1 35  ? 74.338  80.109  96.831  1.00 0.00 ? 56  U A C6     1  
ATOM 1119   H "H5'"  . U A 1 35  ? 71.054  82.613  98.200  1.00 0.00 ? 56  U A "H5'"  1  
ATOM 1120   H "H5''" . U A 1 35  ? 70.390  82.885  96.774  1.00 0.00 ? 56  U A "H5''" 1  
ATOM 1121   H "H4'"  . U A 1 35  ? 72.335  84.133  96.958  1.00 0.00 ? 56  U A "H4'"  1  
ATOM 1122   H "H3'"  . U A 1 35  ? 72.629  82.047  95.063  1.00 0.00 ? 56  U A "H3'"  1  
ATOM 1123   H "H2'"  . U A 1 35  ? 74.742  82.786  94.572  1.00 0.00 ? 56  U A "H2'"  1  
ATOM 1124   H "HO2'" . U A 1 35  ? 75.564  84.735  95.301  1.00 0.00 ? 56  U A "HO2'" 1  
ATOM 1125   H "H1'"  . U A 1 35  ? 75.430  83.103  97.064  1.00 0.00 ? 56  U A "H1'"  1  
ATOM 1126   H H3     . U A 1 35  ? 77.671  79.479  95.494  1.00 0.00 ? 56  U A H3     1  
ATOM 1127   H H5     . U A 1 35  ? 74.113  78.106  96.941  1.00 0.00 ? 56  U A H5     1  
ATOM 1128   H H6     . U A 1 35  ? 73.443  80.284  97.189  1.00 0.00 ? 56  U A H6     1  
ATOM 1129   P P      . A A 1 36  ? 71.121  83.210  93.329  1.00 0.00 ? 57  A A P      1  
ATOM 1130   O OP1    . A A 1 36  ? 69.714  83.537  93.671  1.00 0.00 ? 57  A A OP1    1  
ATOM 1131   O OP2    . A A 1 36  ? 71.554  81.791  93.281  1.00 0.00 ? 57  A A OP2    1  
ATOM 1132   O "O5'"  . A A 1 36  ? 71.452  83.873  91.918  1.00 0.00 ? 57  A A "O5'"  1  
ATOM 1133   C "C5'"  . A A 1 36  ? 70.718  84.995  91.449  1.00 0.00 ? 57  A A "C5'"  1  
ATOM 1134   C "C4'"  . A A 1 36  ? 71.423  86.290  91.767  1.00 0.00 ? 57  A A "C4'"  1  
ATOM 1135   O "O4'"  . A A 1 36  ? 72.863  86.086  91.782  1.00 0.00 ? 57  A A "O4'"  1  
ATOM 1136   C "C3'"  . A A 1 36  ? 71.214  87.424  90.775  1.00 0.00 ? 57  A A "C3'"  1  
ATOM 1137   O "O3'"  . A A 1 36  ? 69.999  88.124  90.980  1.00 0.00 ? 57  A A "O3'"  1  
ATOM 1138   C "C2'"  . A A 1 36  ? 72.455  88.282  90.991  1.00 0.00 ? 57  A A "C2'"  1  
ATOM 1139   O "O2'"  . A A 1 36  ? 72.323  89.095  92.148  1.00 0.00 ? 57  A A "O2'"  1  
ATOM 1140   C "C1'"  . A A 1 36  ? 73.522  87.216  91.253  1.00 0.00 ? 57  A A "C1'"  1  
ATOM 1141   N N9     . A A 1 36  ? 74.216  86.809  90.016  1.00 0.00 ? 57  A A N9     1  
ATOM 1142   C C8     . A A 1 36  ? 74.246  85.566  89.435  1.00 0.00 ? 57  A A C8     1  
ATOM 1143   N N7     . A A 1 36  ? 74.953  85.515  88.333  1.00 0.00 ? 57  A A N7     1  
ATOM 1144   C C5     . A A 1 36  ? 75.421  86.812  88.177  1.00 0.00 ? 57  A A C5     1  
ATOM 1145   C C6     . A A 1 36  ? 76.233  87.416  87.199  1.00 0.00 ? 57  A A C6     1  
ATOM 1146   N N6     . A A 1 36  ? 76.735  86.763  86.149  1.00 0.00 ? 57  A A N6     1  
ATOM 1147   N N1     . A A 1 36  ? 76.512  88.730  87.338  1.00 0.00 ? 57  A A N1     1  
ATOM 1148   C C2     . A A 1 36  ? 76.007  89.385  88.392  1.00 0.00 ? 57  A A C2     1  
ATOM 1149   N N3     . A A 1 36  ? 75.234  88.928  89.375  1.00 0.00 ? 57  A A N3     1  
ATOM 1150   C C4     . A A 1 36  ? 74.975  87.620  89.206  1.00 0.00 ? 57  A A C4     1  
ATOM 1151   H "H5'"  . A A 1 36  ? 69.835  84.999  91.874  1.00 0.00 ? 57  A A "H5'"  1  
ATOM 1152   H "H5''" . A A 1 36  ? 70.606  84.922  90.479  1.00 0.00 ? 57  A A "H5''" 1  
ATOM 1153   H "H4'"  . A A 1 36  ? 71.136  86.589  92.655  1.00 0.00 ? 57  A A "H4'"  1  
ATOM 1154   H "H3'"  . A A 1 36  ? 71.227  87.064  89.863  1.00 0.00 ? 57  A A "H3'"  1  
ATOM 1155   H "H2'"  . A A 1 36  ? 72.667  88.813  90.195  1.00 0.00 ? 57  A A "H2'"  1  
ATOM 1156   H "HO2'" . A A 1 36  ? 73.114  89.668  92.226  1.00 0.00 ? 57  A A "HO2'" 1  
ATOM 1157   H "H1'"  . A A 1 36  ? 74.176  87.561  91.897  1.00 0.00 ? 57  A A "H1'"  1  
ATOM 1158   H H8     . A A 1 36  ? 73.782  84.788  89.809  1.00 0.00 ? 57  A A H8     1  
ATOM 1159   H H61    . A A 1 36  ? 77.295  87.238  85.500  1.00 0.00 ? 57  A A H61    1  
ATOM 1160   H H62    . A A 1 36  ? 76.546  85.810  86.028  1.00 0.00 ? 57  A A H62    1  
ATOM 1161   H H2     . A A 1 36  ? 76.239  90.336  88.446  1.00 0.00 ? 57  A A H2     1  
ATOM 1162   P P      . G A 1 37  ? 69.382  89.033  89.807  1.00 0.00 ? 58  G A P      1  
ATOM 1163   O OP1    . G A 1 37  ? 67.921  88.776  89.746  1.00 0.00 ? 58  G A OP1    1  
ATOM 1164   O OP2    . G A 1 37  ? 70.213  88.840  88.591  1.00 0.00 ? 58  G A OP2    1  
ATOM 1165   O "O5'"  . G A 1 37  ? 69.599  90.525  90.320  1.00 0.00 ? 58  G A "O5'"  1  
ATOM 1166   C "C5'"  . G A 1 37  ? 69.782  91.592  89.403  1.00 0.00 ? 58  G A "C5'"  1  
ATOM 1167   C "C4'"  . G A 1 37  ? 71.227  92.025  89.339  1.00 0.00 ? 58  G A "C4'"  1  
ATOM 1168   O "O4'"  . G A 1 37  ? 72.054  90.916  88.902  1.00 0.00 ? 58  G A "O4'"  1  
ATOM 1169   C "C3'"  . G A 1 37  ? 71.547  93.138  88.353  1.00 0.00 ? 58  G A "C3'"  1  
ATOM 1170   O "O3'"  . G A 1 37  ? 71.239  94.428  88.853  1.00 0.00 ? 58  G A "O3'"  1  
ATOM 1171   C "C2'"  . G A 1 37  ? 73.029  92.926  88.082  1.00 0.00 ? 58  G A "C2'"  1  
ATOM 1172   O "O2'"  . G A 1 37  ? 73.825  93.439  89.140  1.00 0.00 ? 58  G A "O2'"  1  
ATOM 1173   C "C1'"  . G A 1 37  ? 73.125  91.399  88.084  1.00 0.00 ? 58  G A "C1'"  1  
ATOM 1174   N N9     . G A 1 37  ? 73.034  90.834  86.726  1.00 0.00 ? 58  G A N9     1  
ATOM 1175   C C8     . G A 1 37  ? 71.971  90.164  86.172  1.00 0.00 ? 58  G A C8     1  
ATOM 1176   N N7     . G A 1 37  ? 72.187  89.780  84.943  1.00 0.00 ? 58  G A N7     1  
ATOM 1177   C C5     . G A 1 37  ? 73.472  90.225  84.667  1.00 0.00 ? 58  G A C5     1  
ATOM 1178   C C6     . G A 1 37  ? 74.252  90.106  83.488  1.00 0.00 ? 58  G A C6     1  
ATOM 1179   O O6     . G A 1 37  ? 73.954  89.563  82.418  1.00 0.00 ? 58  G A O6     1  
ATOM 1180   N N1     . G A 1 37  ? 75.501  90.701  83.638  1.00 0.00 ? 58  G A N1     1  
ATOM 1181   C C2     . G A 1 37  ? 75.943  91.331  84.775  1.00 0.00 ? 58  G A C2     1  
ATOM 1182   N N2     . G A 1 37  ? 77.181  91.845  84.728  1.00 0.00 ? 58  G A N2     1  
ATOM 1183   N N3     . G A 1 37  ? 75.225  91.450  85.880  1.00 0.00 ? 58  G A N3     1  
ATOM 1184   C C4     . G A 1 37  ? 74.009  90.879  85.756  1.00 0.00 ? 58  G A C4     1  
ATOM 1185   H "H5'"  . G A 1 37  ? 69.233  92.354  89.682  1.00 0.00 ? 58  G A "H5'"  1  
ATOM 1186   H "H5''" . G A 1 37  ? 69.496  91.302  88.511  1.00 0.00 ? 58  G A "H5''" 1  
ATOM 1187   H "H4'"  . G A 1 37  ? 71.516  92.301  90.234  1.00 0.00 ? 58  G A "H4'"  1  
ATOM 1188   H "H3'"  . G A 1 37  ? 71.045  92.987  87.524  1.00 0.00 ? 58  G A "H3'"  1  
ATOM 1189   H "H2'"  . G A 1 37  ? 73.294  93.300  87.215  1.00 0.00 ? 58  G A "H2'"  1  
ATOM 1190   H "HO2'" . G A 1 37  ? 74.617  93.877  88.764  1.00 0.00 ? 58  G A "HO2'" 1  
ATOM 1191   H "H1'"  . G A 1 37  ? 73.971  91.126  88.496  1.00 0.00 ? 58  G A "H1'"  1  
ATOM 1192   H H8     . G A 1 37  ? 71.133  89.988  86.652  1.00 0.00 ? 58  G A H8     1  
ATOM 1193   H H1     . G A 1 37  ? 76.111  90.667  82.871  1.00 0.00 ? 58  G A H1     1  
ATOM 1194   H H21    . G A 1 37  ? 77.718  91.762  83.913  1.00 0.00 ? 58  G A H21    1  
ATOM 1195   H H22    . G A 1 37  ? 77.550  92.307  85.511  1.00 0.00 ? 58  G A H22    1  
ATOM 1196   P P      . U A 1 38  ? 70.786  95.597  87.847  1.00 0.00 ? 59  U A P      1  
ATOM 1197   O OP1    . U A 1 38  ? 70.537  96.822  88.648  1.00 0.00 ? 59  U A OP1    1  
ATOM 1198   O OP2    . U A 1 38  ? 69.712  95.061  86.973  1.00 0.00 ? 59  U A OP2    1  
ATOM 1199   O "O5'"  . U A 1 38  ? 72.075  95.851  86.946  1.00 0.00 ? 59  U A "O5'"  1  
ATOM 1200   C "C5'"  . U A 1 38  ? 73.231  96.475  87.485  1.00 0.00 ? 59  U A "C5'"  1  
ATOM 1201   C "C4'"  . U A 1 38  ? 74.361  96.509  86.486  1.00 0.00 ? 59  U A "C4'"  1  
ATOM 1202   O "O4'"  . U A 1 38  ? 74.717  95.158  86.095  1.00 0.00 ? 59  U A "O4'"  1  
ATOM 1203   C "C3'"  . U A 1 38  ? 74.072  97.210  85.168  1.00 0.00 ? 59  U A "C3'"  1  
ATOM 1204   O "O3'"  . U A 1 38  ? 74.181  98.623  85.256  1.00 0.00 ? 59  U A "O3'"  1  
ATOM 1205   C "C2'"  . U A 1 38  ? 75.086  96.577  84.226  1.00 0.00 ? 59  U A "C2'"  1  
ATOM 1206   O "O2'"  . U A 1 38  ? 76.380  97.130  84.413  1.00 0.00 ? 59  U A "O2'"  1  
ATOM 1207   C "C1'"  . U A 1 38  ? 75.090  95.128  84.712  1.00 0.00 ? 59  U A "C1'"  1  
ATOM 1208   N N1     . U A 1 38  ? 74.163  94.270  83.934  1.00 0.00 ? 59  U A N1     1  
ATOM 1209   C C2     . U A 1 38  ? 74.586  93.859  82.683  1.00 0.00 ? 59  U A C2     1  
ATOM 1210   O O2     . U A 1 38  ? 75.665  94.169  82.210  1.00 0.00 ? 59  U A O2     1  
ATOM 1211   N N3     . U A 1 38  ? 73.697  93.066  81.999  1.00 0.00 ? 59  U A N3     1  
ATOM 1212   C C4     . U A 1 38  ? 72.453  92.651  82.428  1.00 0.00 ? 59  U A C4     1  
ATOM 1213   O O4     . U A 1 38  ? 71.768  91.938  81.693  1.00 0.00 ? 59  U A O4     1  
ATOM 1214   C C5     . U A 1 38  ? 72.084  93.114  83.730  1.00 0.00 ? 59  U A C5     1  
ATOM 1215   C C6     . U A 1 38  ? 72.930  93.885  84.418  1.00 0.00 ? 59  U A C6     1  
ATOM 1216   H "H5'"  . U A 1 38  ? 73.520  95.981  88.280  1.00 0.00 ? 59  U A "H5'"  1  
ATOM 1217   H "H5''" . U A 1 38  ? 73.006  97.394  87.743  1.00 0.00 ? 59  U A "H5''" 1  
ATOM 1218   H "H4'"  . U A 1 38  ? 75.141  96.933  86.906  1.00 0.00 ? 59  U A "H4'"  1  
ATOM 1219   H "H3'"  . U A 1 38  ? 73.168  96.976  84.872  1.00 0.00 ? 59  U A "H3'"  1  
ATOM 1220   H "H2'"  . U A 1 38  ? 74.795  96.641  83.291  1.00 0.00 ? 59  U A "H2'"  1  
ATOM 1221   H "HO2'" . U A 1 38  ? 76.295  97.997  84.862  1.00 0.00 ? 59  U A "HO2'" 1  
ATOM 1222   H "H1'"  . U A 1 38  ? 75.997  94.764  84.647  1.00 0.00 ? 59  U A "H1'"  1  
ATOM 1223   H H3     . U A 1 38  ? 73.976  92.765  81.110  1.00 0.00 ? 59  U A H3     1  
ATOM 1224   H H5     . U A 1 38  ? 71.216  92.867  84.115  1.00 0.00 ? 59  U A H5     1  
ATOM 1225   H H6     . U A 1 38  ? 72.655  94.191  85.307  1.00 0.00 ? 59  U A H6     1  
ATOM 1226   P P      . C A 1 39  ? 73.383  99.562  84.225  1.00 0.00 ? 60  C A P      1  
ATOM 1227   O OP1    . C A 1 39  ? 73.502  100.964 84.694  1.00 0.00 ? 60  C A OP1    1  
ATOM 1228   O OP2    . C A 1 39  ? 72.037  98.971  84.011  1.00 0.00 ? 60  C A OP2    1  
ATOM 1229   O "O5'"  . C A 1 39  ? 74.202  99.425  82.866  1.00 0.00 ? 60  C A "O5'"  1  
ATOM 1230   C "C5'"  . C A 1 39  ? 75.482  100.021 82.723  1.00 0.00 ? 60  C A "C5'"  1  
ATOM 1231   C "C4'"  . C A 1 39  ? 76.108  99.685  81.392  1.00 0.00 ? 60  C A "C4'"  1  
ATOM 1232   O "O4'"  . C A 1 39  ? 76.260  98.246  81.266  1.00 0.00 ? 60  C A "O4'"  1  
ATOM 1233   C "C3'"  . C A 1 39  ? 75.314  100.082 80.157  1.00 0.00 ? 60  C A "C3'"  1  
ATOM 1234   O "O3'"  . C A 1 39  ? 75.451  101.454 79.828  1.00 0.00 ? 60  C A "O3'"  1  
ATOM 1235   C "C2'"  . C A 1 39  ? 75.860  99.142  79.092  1.00 0.00 ? 60  C A "C2'"  1  
ATOM 1236   O "O2'"  . C A 1 39  ? 77.124  99.582  78.615  1.00 0.00 ? 60  C A "O2'"  1  
ATOM 1237   C "C1'"  . C A 1 39  ? 76.054  97.853  79.895  1.00 0.00 ? 60  C A "C1'"  1  
ATOM 1238   N N1     . C A 1 39  ? 74.897  96.930  79.767  1.00 0.00 ? 60  C A N1     1  
ATOM 1239   C C2     . C A 1 39  ? 74.802  96.142  78.613  1.00 0.00 ? 60  C A C2     1  
ATOM 1240   O O2     . C A 1 39  ? 75.678  96.237  77.740  1.00 0.00 ? 60  C A O2     1  
ATOM 1241   N N3     . C A 1 39  ? 73.758  95.293  78.473  1.00 0.00 ? 60  C A N3     1  
ATOM 1242   C C4     . C A 1 39  ? 72.831  95.210  79.426  1.00 0.00 ? 60  C A C4     1  
ATOM 1243   N N4     . C A 1 39  ? 71.818  94.358  79.243  1.00 0.00 ? 60  C A N4     1  
ATOM 1244   C C5     . C A 1 39  ? 72.900  95.999  80.608  1.00 0.00 ? 60  C A C5     1  
ATOM 1245   C C6     . C A 1 39  ? 73.937  96.834  80.739  1.00 0.00 ? 60  C A C6     1  
ATOM 1246   H "H5'"  . C A 1 39  ? 76.066  99.699  83.442  1.00 0.00 ? 60  C A "H5'"  1  
ATOM 1247   H "H5''" . C A 1 39  ? 75.392  100.994 82.797  1.00 0.00 ? 60  C A "H5''" 1  
ATOM 1248   H "H4'"  . C A 1 39  ? 76.995  100.100 81.346  1.00 0.00 ? 60  C A "H4'"  1  
ATOM 1249   H "H3'"  . C A 1 39  ? 74.366  99.881  80.308  1.00 0.00 ? 60  C A "H3'"  1  
ATOM 1250   H "H2'"  . C A 1 39  ? 75.220  99.016  78.361  1.00 0.00 ? 60  C A "H2'"  1  
ATOM 1251   H "HO2'" . C A 1 39  ? 77.410  98.996  77.885  1.00 0.00 ? 60  C A "HO2'" 1  
ATOM 1252   H "H1'"  . C A 1 39  ? 76.866  97.399  79.590  1.00 0.00 ? 60  C A "H1'"  1  
ATOM 1253   H H41    . C A 1 39  ? 71.774  93.818  78.427  1.00 0.00 ? 60  C A H41    1  
ATOM 1254   H H42    . C A 1 39  ? 71.120  94.275  79.927  1.00 0.00 ? 60  C A H42    1  
ATOM 1255   H H5     . C A 1 39  ? 72.213  95.932  81.305  1.00 0.00 ? 60  C A H5     1  
ATOM 1256   H H6     . C A 1 39  ? 74.002  97.386  81.544  1.00 0.00 ? 60  C A H6     1  
ATOM 1257   P P      . U A 1 40  ? 74.304  102.202 78.985  1.00 0.00 ? 61  U A P      1  
ATOM 1258   O OP1    . U A 1 40  ? 74.661  103.641 78.898  1.00 0.00 ? 61  U A OP1    1  
ATOM 1259   O OP2    . U A 1 40  ? 72.988  101.803 79.546  1.00 0.00 ? 61  U A OP2    1  
ATOM 1260   O "O5'"  . U A 1 40  ? 74.428  101.576 77.526  1.00 0.00 ? 61  U A "O5'"  1  
ATOM 1261   C "C5'"  . U A 1 40  ? 75.580  101.805 76.730  1.00 0.00 ? 61  U A "C5'"  1  
ATOM 1262   C "C4'"  . U A 1 40  ? 75.562  100.973 75.472  1.00 0.00 ? 61  U A "C4'"  1  
ATOM 1263   O "O4'"  . U A 1 40  ? 75.519  99.564  75.811  1.00 0.00 ? 61  U A "O4'"  1  
ATOM 1264   C "C3'"  . U A 1 40  ? 74.364  101.168 74.554  1.00 0.00 ? 61  U A "C3'"  1  
ATOM 1265   O "O3'"  . U A 1 40  ? 74.458  102.337 73.758  1.00 0.00 ? 61  U A "O3'"  1  
ATOM 1266   C "C2'"  . U A 1 40  ? 74.350  99.878  73.747  1.00 0.00 ? 61  U A "C2'"  1  
ATOM 1267   O "O2'"  . U A 1 40  ? 75.337  99.900  72.724  1.00 0.00 ? 61  U A "O2'"  1  
ATOM 1268   C "C1'"  . U A 1 40  ? 74.756  98.851  74.805  1.00 0.00 ? 61  U A "C1'"  1  
ATOM 1269   N N1     . U A 1 40  ? 73.584  98.164  75.400  1.00 0.00 ? 61  U A N1     1  
ATOM 1270   C C2     . U A 1 40  ? 73.005  97.149  74.661  1.00 0.00 ? 61  U A C2     1  
ATOM 1271   O O2     . U A 1 40  ? 73.415  96.807  73.564  1.00 0.00 ? 61  U A O2     1  
ATOM 1272   N N3     . U A 1 40  ? 71.924  96.542  75.251  1.00 0.00 ? 61  U A N3     1  
ATOM 1273   C C4     . U A 1 40  ? 71.371  96.839  76.479  1.00 0.00 ? 61  U A C4     1  
ATOM 1274   O O4     . U A 1 40  ? 70.393  96.200  76.872  1.00 0.00 ? 61  U A O4     1  
ATOM 1275   C C5     . U A 1 40  ? 72.021  97.899  77.187  1.00 0.00 ? 61  U A C5     1  
ATOM 1276   C C6     . U A 1 40  ? 73.077  98.506  76.636  1.00 0.00 ? 61  U A C6     1  
ATOM 1277   H "H5'"  . U A 1 40  ? 76.379  101.581 77.250  1.00 0.00 ? 61  U A "H5'"  1  
ATOM 1278   H "H5''" . U A 1 40  ? 75.615  102.753 76.484  1.00 0.00 ? 61  U A "H5''" 1  
ATOM 1279   H "H4'"  . U A 1 40  ? 76.382  101.151 74.962  1.00 0.00 ? 61  U A "H4'"  1  
ATOM 1280   H "H3'"  . U A 1 40  ? 73.549  101.215 75.097  1.00 0.00 ? 61  U A "H3'"  1  
ATOM 1281   H "H2'"  . U A 1 40  ? 73.460  99.688  73.385  1.00 0.00 ? 61  U A "H2'"  1  
ATOM 1282   H "HO2'" . U A 1 40  ? 75.243  99.097  72.173  1.00 0.00 ? 61  U A "HO2'" 1  
ATOM 1283   H "H1'"  . U A 1 40  ? 75.350  98.184  74.401  1.00 0.00 ? 61  U A "H1'"  1  
ATOM 1284   H H3     . U A 1 40  ? 71.498  95.820  74.743  1.00 0.00 ? 61  U A H3     1  
ATOM 1285   H H5     . U A 1 40  ? 71.696  98.176  78.068  1.00 0.00 ? 61  U A H5     1  
ATOM 1286   H H6     . U A 1 40  ? 73.504  99.229  77.139  1.00 0.00 ? 61  U A H6     1  
ATOM 1287   P P      . U A 1 41  ? 73.128  103.060 73.220  1.00 0.00 ? 62  U A P      1  
ATOM 1288   O OP1    . U A 1 41  ? 73.532  104.309 72.526  1.00 0.00 ? 62  U A OP1    1  
ATOM 1289   O OP2    . U A 1 41  ? 72.155  103.124 74.340  1.00 0.00 ? 62  U A OP2    1  
ATOM 1290   O "O5'"  . U A 1 41  ? 72.558  102.051 72.128  1.00 0.00 ? 62  U A "O5'"  1  
ATOM 1291   C "C5'"  . U A 1 41  ? 73.273  101.795 70.927  1.00 0.00 ? 62  U A "C5'"  1  
ATOM 1292   C "C4'"  . U A 1 41  ? 72.632  100.690 70.123  1.00 0.00 ? 62  U A "C4'"  1  
ATOM 1293   O "O4'"  . U A 1 41  ? 72.620  99.459  70.894  1.00 0.00 ? 62  U A "O4'"  1  
ATOM 1294   C "C3'"  . U A 1 41  ? 71.175  100.899 69.738  1.00 0.00 ? 62  U A "C3'"  1  
ATOM 1295   O "O3'"  . U A 1 41  ? 71.014  101.767 68.629  1.00 0.00 ? 62  U A "O3'"  1  
ATOM 1296   C "C2'"  . U A 1 41  ? 70.694  99.479  69.478  1.00 0.00 ? 62  U A "C2'"  1  
ATOM 1297   O "O2'"  . U A 1 41  ? 71.128  99.012  68.209  1.00 0.00 ? 62  U A "O2'"  1  
ATOM 1298   C "C1'"  . U A 1 41  ? 71.431  98.701  70.569  1.00 0.00 ? 62  U A "C1'"  1  
ATOM 1299   N N1     . U A 1 41  ? 70.587  98.484  71.770  1.00 0.00 ? 62  U A N1     1  
ATOM 1300   C C2     . U A 1 41  ? 69.643  97.477  71.704  1.00 0.00 ? 62  U A C2     1  
ATOM 1301   O O2     . U A 1 41  ? 69.482  96.779  70.717  1.00 0.00 ? 62  U A O2     1  
ATOM 1302   N N3     . U A 1 41  ? 68.886  97.311  72.838  1.00 0.00 ? 62  U A N3     1  
ATOM 1303   C C4     . U A 1 41  ? 68.972  98.034  74.008  1.00 0.00 ? 62  U A C4     1  
ATOM 1304   O O4     . U A 1 41  ? 68.217  97.764  74.944  1.00 0.00 ? 62  U A O4     1  
ATOM 1305   C C5     . U A 1 41  ? 69.971  99.059  74.006  1.00 0.00 ? 62  U A C5     1  
ATOM 1306   C C6     . U A 1 41  ? 70.723  99.242  72.915  1.00 0.00 ? 62  U A C6     1  
ATOM 1307   H "H5'"  . U A 1 41  ? 74.191  101.535 71.151  1.00 0.00 ? 62  U A "H5'"  1  
ATOM 1308   H "H5''" . U A 1 41  ? 73.292  102.612 70.387  1.00 0.00 ? 62  U A "H5''" 1  
ATOM 1309   H "H4'"  . U A 1 41  ? 73.158  100.548 69.308  1.00 0.00 ? 62  U A "H4'"  1  
ATOM 1310   H "H3'"  . U A 1 41  ? 70.689  101.266 70.507  1.00 0.00 ? 62  U A "H3'"  1  
ATOM 1311   H "H2'"  . U A 1 41  ? 69.721  99.404  69.577  1.00 0.00 ? 62  U A "H2'"  1  
ATOM 1312   H "HO2'" . U A 1 41  ? 70.731  98.133  68.038  1.00 0.00 ? 62  U A "HO2'" 1  
ATOM 1313   H "H1'"  . U A 1 41  ? 71.717  97.835  70.216  1.00 0.00 ? 62  U A "H1'"  1  
ATOM 1314   H H3     . U A 1 41  ? 68.210  96.603  72.812  1.00 0.00 ? 62  U A H3     1  
ATOM 1315   H H5     . U A 1 41  ? 70.103  99.621  74.797  1.00 0.00 ? 62  U A H5     1  
ATOM 1316   H H6     . U A 1 41  ? 71.399  99.949  72.938  1.00 0.00 ? 62  U A H6     1  
ATOM 1317   P P      . U A 1 42  ? 69.721  102.706 68.536  1.00 0.00 ? 63  U A P      1  
ATOM 1318   O OP1    . U A 1 42  ? 69.826  103.413 67.236  1.00 0.00 ? 63  U A OP1    1  
ATOM 1319   O OP2    . U A 1 42  ? 69.697  103.488 69.799  1.00 0.00 ? 63  U A OP2    1  
ATOM 1320   O "O5'"  . U A 1 42  ? 68.416  101.792 68.498  1.00 0.00 ? 63  U A "O5'"  1  
ATOM 1321   C "C5'"  . U A 1 42  ? 68.234  100.824 67.474  1.00 0.00 ? 63  U A "C5'"  1  
ATOM 1322   C "C4'"  . U A 1 42  ? 66.925  100.091 67.630  1.00 0.00 ? 63  U A "C4'"  1  
ATOM 1323   O "O4'"  . U A 1 42  ? 66.953  99.278  68.831  1.00 0.00 ? 63  U A "O4'"  1  
ATOM 1324   C "C3'"  . U A 1 42  ? 65.686  100.957 67.800  1.00 0.00 ? 63  U A "C3'"  1  
ATOM 1325   O "O3'"  . U A 1 42  ? 65.191  101.463 66.573  1.00 0.00 ? 63  U A "O3'"  1  
ATOM 1326   C "C2'"  . U A 1 42  ? 64.719  100.019 68.508  1.00 0.00 ? 63  U A "C2'"  1  
ATOM 1327   O "O2'"  . U A 1 42  ? 64.135  99.098  67.600  1.00 0.00 ? 63  U A "O2'"  1  
ATOM 1328   C "C1'"  . U A 1 42  ? 65.660  99.262  69.447  1.00 0.00 ? 63  U A "C1'"  1  
ATOM 1329   N N1     . U A 1 42  ? 65.723  99.875  70.796  1.00 0.00 ? 63  U A N1     1  
ATOM 1330   C C2     . U A 1 42  ? 64.657  99.636  71.645  1.00 0.00 ? 63  U A C2     1  
ATOM 1331   O O2     . U A 1 42  ? 63.695  98.959  71.331  1.00 0.00 ? 63  U A O2     1  
ATOM 1332   N N3     . U A 1 42  ? 64.759  100.221 72.883  1.00 0.00 ? 63  U A N3     1  
ATOM 1333   C C4     . U A 1 42  ? 65.793  101.004 73.351  1.00 0.00 ? 63  U A C4     1  
ATOM 1334   O O4     . U A 1 42  ? 65.735  101.461 74.493  1.00 0.00 ? 63  U A O4     1  
ATOM 1335   C C5     . U A 1 42  ? 66.859  101.207 72.419  1.00 0.00 ? 63  U A C5     1  
ATOM 1336   C C6     . U A 1 42  ? 66.786  100.648 71.206  1.00 0.00 ? 63  U A C6     1  
ATOM 1337   H "H5'"  . U A 1 42  ? 68.969  100.178 67.512  1.00 0.00 ? 63  U A "H5'"  1  
ATOM 1338   H "H5''" . U A 1 42  ? 68.246  101.273 66.603  1.00 0.00 ? 63  U A "H5''" 1  
ATOM 1339   H "H4'"  . U A 1 42  ? 66.796  99.505  66.854  1.00 0.00 ? 63  U A "H4'"  1  
ATOM 1340   H "H3'"  . U A 1 42  ? 65.899  101.708 68.394  1.00 0.00 ? 63  U A "H3'"  1  
ATOM 1341   H "H2'"  . U A 1 42  ? 64.038  100.515 69.010  1.00 0.00 ? 63  U A "H2'"  1  
ATOM 1342   H "HO2'" . U A 1 42  ? 64.219  99.448  66.690  1.00 0.00 ? 63  U A "HO2'" 1  
ATOM 1343   H "H1'"  . U A 1 42  ? 65.361  98.332  69.526  1.00 0.00 ? 63  U A "H1'"  1  
ATOM 1344   H H3     . U A 1 42  ? 64.014  100.067 73.501  1.00 0.00 ? 63  U A H3     1  
ATOM 1345   H H5     . U A 1 42  ? 67.635  101.752 72.668  1.00 0.00 ? 63  U A H5     1  
ATOM 1346   H H6     . U A 1 42  ? 67.528  100.802 70.587  1.00 0.00 ? 63  U A H6     1  
ATOM 1347   P P      . A A 1 43  ? 64.419  102.872 66.528  1.00 0.00 ? 64  A A P      1  
ATOM 1348   O OP1    . A A 1 43  ? 64.171  103.218 65.107  1.00 0.00 ? 64  A A OP1    1  
ATOM 1349   O OP2    . A A 1 43  ? 65.155  103.825 67.397  1.00 0.00 ? 64  A A OP2    1  
ATOM 1350   O "O5'"  . A A 1 43  ? 63.015  102.564 67.216  1.00 0.00 ? 64  A A "O5'"  1  
ATOM 1351   C "C5'"  . A A 1 43  ? 61.994  101.878 66.508  1.00 0.00 ? 64  A A "C5'"  1  
ATOM 1352   C "C4'"  . A A 1 43  ? 60.760  101.692 67.356  1.00 0.00 ? 64  A A "C4'"  1  
ATOM 1353   O "O4'"  . A A 1 43  ? 61.096  100.935 68.549  1.00 0.00 ? 64  A A "O4'"  1  
ATOM 1354   C "C3'"  . A A 1 43  ? 60.120  102.963 67.890  1.00 0.00 ? 64  A A "C3'"  1  
ATOM 1355   O "O3'"  . A A 1 43  ? 59.308  103.619 66.931  1.00 0.00 ? 64  A A "O3'"  1  
ATOM 1356   C "C2'"  . A A 1 43  ? 59.347  102.462 69.103  1.00 0.00 ? 64  A A "C2'"  1  
ATOM 1357   O "O2'"  . A A 1 43  ? 58.136  101.827 68.717  1.00 0.00 ? 64  A A "O2'"  1  
ATOM 1358   C "C1'"  . A A 1 43  ? 60.304  101.407 69.658  1.00 0.00 ? 64  A A "C1'"  1  
ATOM 1359   N N9     . A A 1 43  ? 61.162  101.943 70.731  1.00 0.00 ? 64  A A N9     1  
ATOM 1360   C C8     . A A 1 43  ? 62.489  102.289 70.659  1.00 0.00 ? 64  A A C8     1  
ATOM 1361   N N7     . A A 1 43  ? 62.979  102.740 71.787  1.00 0.00 ? 64  A A N7     1  
ATOM 1362   C C5     . A A 1 43  ? 61.903  102.689 72.663  1.00 0.00 ? 64  A A C5     1  
ATOM 1363   C C6     . A A 1 43  ? 61.770  103.031 74.021  1.00 0.00 ? 64  A A C6     1  
ATOM 1364   N N6     . A A 1 43  ? 62.768  103.516 74.764  1.00 0.00 ? 64  A A N6     1  
ATOM 1365   N N1     . A A 1 43  ? 60.561  102.858 74.596  1.00 0.00 ? 64  A A N1     1  
ATOM 1366   C C2     . A A 1 43  ? 59.559  102.374 73.851  1.00 0.00 ? 64  A A C2     1  
ATOM 1367   N N3     . A A 1 43  ? 59.562  102.016 72.569  1.00 0.00 ? 64  A A N3     1  
ATOM 1368   C C4     . A A 1 43  ? 60.778  102.201 72.026  1.00 0.00 ? 64  A A C4     1  
ATOM 1369   H "H5'"  . A A 1 43  ? 62.328  100.998 66.233  1.00 0.00 ? 64  A A "H5'"  1  
ATOM 1370   H "H5''" . A A 1 43  ? 61.757  102.392 65.708  1.00 0.00 ? 64  A A "H5''" 1  
ATOM 1371   H "H4'"  . A A 1 43  ? 60.093  101.191 66.841  1.00 0.00 ? 64  A A "H4'"  1  
ATOM 1372   H "H3'"  . A A 1 43  ? 60.823  103.576 68.190  1.00 0.00 ? 64  A A "H3'"  1  
ATOM 1373   H "H2'"  . A A 1 43  ? 59.190  103.179 69.750  1.00 0.00 ? 64  A A "H2'"  1  
ATOM 1374   H "HO2'" . A A 1 43  ? 57.630  101.590 69.520  1.00 0.00 ? 64  A A "HO2'" 1  
ATOM 1375   H "H1'"  . A A 1 43  ? 59.789  100.647 70.002  1.00 0.00 ? 64  A A "H1'"  1  
ATOM 1376   H H8     . A A 1 43  ? 63.020  102.207 69.839  1.00 0.00 ? 64  A A H8     1  
ATOM 1377   H H61    . A A 1 43  ? 62.615  103.737 75.706  1.00 0.00 ? 64  A A H61    1  
ATOM 1378   H H62    . A A 1 43  ? 63.655  103.649 74.367  1.00 0.00 ? 64  A A H62    1  
ATOM 1379   H H2     . A A 1 43  ? 58.703  102.267 74.316  1.00 0.00 ? 64  A A H2     1  
ATOM 1380   P P      . A A 1 44  ? 59.075  105.207 67.022  1.00 0.00 ? 65  A A P      1  
ATOM 1381   O OP1    . A A 1 44  ? 58.310  105.629 65.823  1.00 0.00 ? 65  A A OP1    1  
ATOM 1382   O OP2    . A A 1 44  ? 60.380  105.847 67.323  1.00 0.00 ? 65  A A OP2    1  
ATOM 1383   O "O5'"  . A A 1 44  ? 58.135  105.385 68.295  1.00 0.00 ? 65  A A "O5'"  1  
ATOM 1384   C "C5'"  . A A 1 44  ? 56.797  104.909 68.286  1.00 0.00 ? 65  A A "C5'"  1  
ATOM 1385   C "C4'"  . A A 1 44  ? 56.151  105.048 69.642  1.00 0.00 ? 65  A A "C4'"  1  
ATOM 1386   O "O4'"  . A A 1 44  ? 56.893  104.277 70.622  1.00 0.00 ? 65  A A "O4'"  1  
ATOM 1387   C "C3'"  . A A 1 44  ? 56.117  106.453 70.223  1.00 0.00 ? 65  A A "C3'"  1  
ATOM 1388   O "O3'"  . A A 1 44  ? 55.076  107.251 69.684  1.00 0.00 ? 65  A A "O3'"  1  
ATOM 1389   C "C2'"  . A A 1 44  ? 55.974  106.192 71.715  1.00 0.00 ? 65  A A "C2'"  1  
ATOM 1390   O "O2'"  . A A 1 44  ? 54.637  105.854 72.054  1.00 0.00 ? 65  A A "O2'"  1  
ATOM 1391   C "C1'"  . A A 1 44  ? 56.859  104.958 71.896  1.00 0.00 ? 65  A A "C1'"  1  
ATOM 1392   N N9     . A A 1 44  ? 58.218  105.310 72.351  1.00 0.00 ? 65  A A N9     1  
ATOM 1393   C C8     . A A 1 44  ? 59.372  105.352 71.611  1.00 0.00 ? 65  A A C8     1  
ATOM 1394   N N7     . A A 1 44  ? 60.430  105.702 72.301  1.00 0.00 ? 65  A A N7     1  
ATOM 1395   C C5     . A A 1 44  ? 59.941  105.906 73.582  1.00 0.00 ? 65  A A C5     1  
ATOM 1396   C C6     . A A 1 44  ? 60.560  106.292 74.784  1.00 0.00 ? 65  A A C6     1  
ATOM 1397   N N6     . A A 1 44  ? 61.865  106.557 74.891  1.00 0.00 ? 65  A A N6     1  
ATOM 1398   N N1     . A A 1 44  ? 59.786  106.404 75.883  1.00 0.00 ? 65  A A N1     1  
ATOM 1399   C C2     . A A 1 44  ? 58.476  106.140 75.775  1.00 0.00 ? 65  A A C2     1  
ATOM 1400   N N3     . A A 1 44  ? 57.780  105.768 74.704  1.00 0.00 ? 65  A A N3     1  
ATOM 1401   C C4     . A A 1 44  ? 58.579  105.667 73.628  1.00 0.00 ? 65  A A C4     1  
ATOM 1402   H "H5'"  . A A 1 44  ? 56.797  103.962 68.029  1.00 0.00 ? 65  A A "H5'"  1  
ATOM 1403   H "H5''" . A A 1 44  ? 56.279  105.418 67.630  1.00 0.00 ? 65  A A "H5''" 1  
ATOM 1404   H "H4'"  . A A 1 44  ? 55.234  104.704 69.592  1.00 0.00 ? 65  A A "H4'"  1  
ATOM 1405   H "H3'"  . A A 1 44  ? 56.978  106.891 70.056  1.00 0.00 ? 65  A A "H3'"  1  
ATOM 1406   H "H2'"  . A A 1 44  ? 56.301  106.949 72.246  1.00 0.00 ? 65  A A "H2'"  1  
ATOM 1407   H "HO2'" . A A 1 44  ? 54.564  105.773 73.027  1.00 0.00 ? 65  A A "HO2'" 1  
ATOM 1408   H "H1'"  . A A 1 44  ? 56.445  104.351 72.543  1.00 0.00 ? 65  A A "H1'"  1  
ATOM 1409   H H8     . A A 1 44  ? 59.402  105.139 70.654  1.00 0.00 ? 65  A A H8     1  
ATOM 1410   H H61    . A A 1 44  ? 62.241  106.823 75.757  1.00 0.00 ? 65  A A H61    1  
ATOM 1411   H H62    . A A 1 44  ? 62.447  106.483 74.106  1.00 0.00 ? 65  A A H62    1  
ATOM 1412   H H2     . A A 1 44  ? 57.959  106.236 76.603  1.00 0.00 ? 65  A A H2     1  
ATOM 1413   P P      . A A 1 45  ? 55.227  108.852 69.637  1.00 0.00 ? 66  A A P      1  
ATOM 1414   O OP1    . A A 1 45  ? 54.063  109.402 68.900  1.00 0.00 ? 66  A A OP1    1  
ATOM 1415   O OP2    . A A 1 45  ? 56.603  109.170 69.180  1.00 0.00 ? 66  A A OP2    1  
ATOM 1416   O "O5'"  . A A 1 45  ? 55.101  109.295 71.163  1.00 0.00 ? 66  A A "O5'"  1  
ATOM 1417   C "C5'"  . A A 1 45  ? 53.875  109.149 71.864  1.00 0.00 ? 66  A A "C5'"  1  
ATOM 1418   C "C4'"  . A A 1 45  ? 54.028  109.494 73.324  1.00 0.00 ? 66  A A "C4'"  1  
ATOM 1419   O "O4'"  . A A 1 45  ? 54.993  108.601 73.941  1.00 0.00 ? 66  A A "O4'"  1  
ATOM 1420   C "C3'"  . A A 1 45  ? 54.563  110.883 73.631  1.00 0.00 ? 66  A A "C3'"  1  
ATOM 1421   O "O3'"  . A A 1 45  ? 53.570  111.892 73.532  1.00 0.00 ? 66  A A "O3'"  1  
ATOM 1422   C "C2'"  . A A 1 45  ? 55.130  110.721 75.033  1.00 0.00 ? 66  A A "C2'"  1  
ATOM 1423   O "O2'"  . A A 1 45  ? 54.099  110.733 76.012  1.00 0.00 ? 66  A A "O2'"  1  
ATOM 1424   C "C1'"  . A A 1 45  ? 55.727  109.314 74.958  1.00 0.00 ? 66  A A "C1'"  1  
ATOM 1425   N N9     . A A 1 45  ? 57.171  109.339 74.662  1.00 0.00 ? 66  A A N9     1  
ATOM 1426   C C8     . A A 1 45  ? 57.792  109.065 73.470  1.00 0.00 ? 66  A A C8     1  
ATOM 1427   N N7     . A A 1 45  ? 59.098  109.169 73.515  1.00 0.00 ? 66  A A N7     1  
ATOM 1428   C C5     . A A 1 45  ? 59.356  109.539 74.828  1.00 0.00 ? 66  A A C5     1  
ATOM 1429   C C6     . A A 1 45  ? 60.550  109.807 75.520  1.00 0.00 ? 66  A A C6     1  
ATOM 1430   N N6     . A A 1 45  ? 61.759  109.745 74.960  1.00 0.00 ? 66  A A N6     1  
ATOM 1431   N N1     . A A 1 45  ? 60.458  110.148 76.824  1.00 0.00 ? 66  A A N1     1  
ATOM 1432   C C2     . A A 1 45  ? 59.244  110.213 77.387  1.00 0.00 ? 66  A A C2     1  
ATOM 1433   N N3     . A A 1 45  ? 58.050  109.982 76.842  1.00 0.00 ? 66  A A N3     1  
ATOM 1434   C C4     . A A 1 45  ? 58.177  109.646 75.545  1.00 0.00 ? 66  A A C4     1  
ATOM 1435   H "H5'"  . A A 1 45  ? 53.568  108.223 71.784  1.00 0.00 ? 66  A A "H5'"  1  
ATOM 1436   H "H5''" . A A 1 45  ? 53.205  109.743 71.465  1.00 0.00 ? 66  A A "H5''" 1  
ATOM 1437   H "H4'"  . A A 1 45  ? 53.161  109.381 73.771  1.00 0.00 ? 66  A A "H4'"  1  
ATOM 1438   H "H3'"  . A A 1 45  ? 55.294  111.092 73.011  1.00 0.00 ? 66  A A "H3'"  1  
ATOM 1439   H "H2'"  . A A 1 45  ? 55.819  111.392 75.224  1.00 0.00 ? 66  A A "H2'"  1  
ATOM 1440   H "HO2'" . A A 1 45  ? 54.506  110.703 76.903  1.00 0.00 ? 66  A A "HO2'" 1  
ATOM 1441   H "H1'"  . A A 1 45  ? 55.576  108.851 75.809  1.00 0.00 ? 66  A A "H1'"  1  
ATOM 1442   H H8     . A A 1 45  ? 57.303  108.814 72.656  1.00 0.00 ? 66  A A H8     1  
ATOM 1443   H H61    . A A 1 45  ? 62.557  109.943 75.493  1.00 0.00 ? 66  A A H61    1  
ATOM 1444   H H62    . A A 1 45  ? 61.850  109.500 74.016  1.00 0.00 ? 66  A A H62    1  
ATOM 1445   H H2     . A A 1 45  ? 59.232  110.464 78.334  1.00 0.00 ? 66  A A H2     1  
ATOM 1446   P P      . C A 1 46  ? 53.985  113.399 73.155  1.00 0.00 ? 67  C A P      1  
ATOM 1447   O OP1    . C A 1 46  ? 52.741  114.193 72.996  1.00 0.00 ? 67  C A OP1    1  
ATOM 1448   O OP2    . C A 1 46  ? 54.965  113.342 72.041  1.00 0.00 ? 67  C A OP2    1  
ATOM 1449   O "O5'"  . C A 1 46  ? 54.743  113.928 74.452  1.00 0.00 ? 67  C A "O5'"  1  
ATOM 1450   C "C5'"  . C A 1 46  ? 54.042  114.153 75.666  1.00 0.00 ? 67  C A "C5'"  1  
ATOM 1451   C "C4'"  . C A 1 46  ? 54.977  114.524 76.791  1.00 0.00 ? 67  C A "C4'"  1  
ATOM 1452   O "O4'"  . C A 1 46  ? 55.930  113.451 77.015  1.00 0.00 ? 67  C A "O4'"  1  
ATOM 1453   C "C3'"  . C A 1 46  ? 55.850  115.749 76.561  1.00 0.00 ? 67  C A "C3'"  1  
ATOM 1454   O "O3'"  . C A 1 46  ? 55.160  116.968 76.777  1.00 0.00 ? 67  C A "O3'"  1  
ATOM 1455   C "C2'"  . C A 1 46  ? 57.004  115.520 77.527  1.00 0.00 ? 67  C A "C2'"  1  
ATOM 1456   O "O2'"  . C A 1 46  ? 56.634  115.842 78.859  1.00 0.00 ? 67  C A "O2'"  1  
ATOM 1457   C "C1'"  . C A 1 46  ? 57.201  114.009 77.415  1.00 0.00 ? 67  C A "C1'"  1  
ATOM 1458   N N1     . C A 1 46  ? 58.270  113.648 76.452  1.00 0.00 ? 67  C A N1     1  
ATOM 1459   C C2     . C A 1 46  ? 59.604  113.774 76.862  1.00 0.00 ? 67  C A C2     1  
ATOM 1460   O O2     . C A 1 46  ? 59.850  114.181 78.007  1.00 0.00 ? 67  C A O2     1  
ATOM 1461   N N3     . C A 1 46  ? 60.599  113.451 76.004  1.00 0.00 ? 67  C A N3     1  
ATOM 1462   C C4     . C A 1 46  ? 60.306  113.016 74.778  1.00 0.00 ? 67  C A C4     1  
ATOM 1463   N N4     . C A 1 46  ? 61.321  112.711 73.964  1.00 0.00 ? 67  C A N4     1  
ATOM 1464   C C5     . C A 1 46  ? 58.963  112.879 74.331  1.00 0.00 ? 67  C A C5     1  
ATOM 1465   C C6     . C A 1 46  ? 57.988  113.198 75.189  1.00 0.00 ? 67  C A C6     1  
ATOM 1466   H "H5'"  . C A 1 46  ? 53.555  113.338 75.910  1.00 0.00 ? 67  C A "H5'"  1  
ATOM 1467   H "H5''" . C A 1 46  ? 53.400  114.881 75.533  1.00 0.00 ? 67  C A "H5''" 1  
ATOM 1468   H "H4'"  . C A 1 46  ? 54.453  114.657 77.607  1.00 0.00 ? 67  C A "H4'"  1  
ATOM 1469   H "H3'"  . C A 1 46  ? 56.192  115.732 75.643  1.00 0.00 ? 67  C A "H3'"  1  
ATOM 1470   H "H2'"  . C A 1 46  ? 57.809  116.008 77.247  1.00 0.00 ? 67  C A "H2'"  1  
ATOM 1471   H "HO2'" . C A 1 46  ? 57.412  115.731 79.443  1.00 0.00 ? 67  C A "HO2'" 1  
ATOM 1472   H "H1'"  . C A 1 46  ? 57.422  113.643 78.297  1.00 0.00 ? 67  C A "H1'"  1  
ATOM 1473   H H41    . C A 1 46  ? 62.245  112.808 74.276  1.00 0.00 ? 67  C A H41    1  
ATOM 1474   H H42    . C A 1 46  ? 61.141  112.388 73.057  1.00 0.00 ? 67  C A H42    1  
ATOM 1475   H H5     . C A 1 46  ? 58.760  112.556 73.428  1.00 0.00 ? 67  C A H5     1  
ATOM 1476   H H6     . C A 1 46  ? 57.057  113.109 74.901  1.00 0.00 ? 67  C A H6     1  
ATOM 1477   P P      . C A 1 47  ? 55.629  118.308 76.022  1.00 0.00 ? 68  C A P      1  
ATOM 1478   O OP1    . C A 1 47  ? 54.664  119.386 76.355  1.00 0.00 ? 68  C A OP1    1  
ATOM 1479   O OP2    . C A 1 47  ? 55.888  117.969 74.600  1.00 0.00 ? 68  C A OP2    1  
ATOM 1480   O "O5'"  . C A 1 47  ? 57.024  118.667 76.703  1.00 0.00 ? 68  C A "O5'"  1  
ATOM 1481   C "C5'"  . C A 1 47  ? 57.086  119.099 78.054  1.00 0.00 ? 68  C A "C5'"  1  
ATOM 1482   C "C4'"  . C A 1 47  ? 58.511  119.272 78.520  1.00 0.00 ? 68  C A "C4'"  1  
ATOM 1483   O "O4'"  . C A 1 47  ? 59.213  118.006 78.442  1.00 0.00 ? 68  C A "O4'"  1  
ATOM 1484   C "C3'"  . C A 1 47  ? 59.372  120.222 77.703  1.00 0.00 ? 68  C A "C3'"  1  
ATOM 1485   O "O3'"  . C A 1 47  ? 59.134  121.586 78.006  1.00 0.00 ? 68  C A "O3'"  1  
ATOM 1486   C "C2'"  . C A 1 47  ? 60.783  119.762 78.036  1.00 0.00 ? 68  C A "C2'"  1  
ATOM 1487   O "O2'"  . C A 1 47  ? 61.193  120.234 79.312  1.00 0.00 ? 68  C A "O2'"  1  
ATOM 1488   C "C1'"  . C A 1 47  ? 60.600  118.244 78.105  1.00 0.00 ? 68  C A "C1'"  1  
ATOM 1489   N N1     . C A 1 47  ? 60.969  117.573 76.834  1.00 0.00 ? 68  C A N1     1  
ATOM 1490   C C2     . C A 1 47  ? 62.328  117.384 76.552  1.00 0.00 ? 68  C A C2     1  
ATOM 1491   O O2     . C A 1 47  ? 63.176  117.778 77.367  1.00 0.00 ? 68  C A O2     1  
ATOM 1492   N N3     . C A 1 47  ? 62.693  116.774 75.400  1.00 0.00 ? 68  C A N3     1  
ATOM 1493   C C4     . C A 1 47  ? 61.761  116.360 74.541  1.00 0.00 ? 68  C A C4     1  
ATOM 1494   N N4     . C A 1 47  ? 62.166  115.764 73.416  1.00 0.00 ? 68  C A N4     1  
ATOM 1495   C C5     . C A 1 47  ? 60.371  116.540 74.797  1.00 0.00 ? 68  C A C5     1  
ATOM 1496   C C6     . C A 1 47  ? 60.024  117.141 75.941  1.00 0.00 ? 68  C A C6     1  
ATOM 1497   H "H5'"  . C A 1 47  ? 56.641  118.436 78.622  1.00 0.00 ? 68  C A "H5'"  1  
ATOM 1498   H "H5''" . C A 1 47  ? 56.616  119.956 78.136  1.00 0.00 ? 68  C A "H5''" 1  
ATOM 1499   H "H4'"  . C A 1 47  ? 58.503  119.574 79.454  1.00 0.00 ? 68  C A "H4'"  1  
ATOM 1500   H "H3'"  . C A 1 47  ? 59.202  120.071 76.750  1.00 0.00 ? 68  C A "H3'"  1  
ATOM 1501   H "H2'"  . C A 1 47  ? 61.420  120.013 77.334  1.00 0.00 ? 68  C A "H2'"  1  
ATOM 1502   H "HO2'" . C A 1 47  ? 60.633  120.997 79.564  1.00 0.00 ? 68  C A "HO2'" 1  
ATOM 1503   H "H1'"  . C A 1 47  ? 61.147  117.883 78.833  1.00 0.00 ? 68  C A "H1'"  1  
ATOM 1504   H H41    . C A 1 47  ? 63.124  115.644 73.244  1.00 0.00 ? 68  C A H41    1  
ATOM 1505   H H42    . C A 1 47  ? 61.506  115.449 72.765  1.00 0.00 ? 68  C A H42    1  
ATOM 1506   H H5     . C A 1 47  ? 59.695  116.230 74.160  1.00 0.00 ? 68  C A H5     1  
ATOM 1507   H H6     . C A 1 47  ? 59.074  117.275 76.134  1.00 0.00 ? 68  C A H6     1  
ATOM 1508   P P      . A A 1 48  ? 59.415  122.720 76.903  1.00 0.00 ? 69  A A P      1  
ATOM 1509   O OP1    . A A 1 48  ? 59.588  124.015 77.607  1.00 0.00 ? 69  A A OP1    1  
ATOM 1510   O OP2    . A A 1 48  ? 58.385  122.594 75.841  1.00 0.00 ? 69  A A OP2    1  
ATOM 1511   O "O5'"  . A A 1 48  ? 60.821  122.308 76.276  1.00 0.00 ? 69  A A "O5'"  1  
ATOM 1512   C "C5'"  . A A 1 48  ? 62.007  123.005 76.626  1.00 0.00 ? 69  A A "C5'"  1  
ATOM 1513   C "C4'"  . A A 1 48  ? 63.240  122.256 76.186  1.00 0.00 ? 69  A A "C4'"  1  
ATOM 1514   O "O4'"  . A A 1 48  ? 62.953  120.837 76.098  1.00 0.00 ? 69  A A "O4'"  1  
ATOM 1515   C "C3'"  . A A 1 48  ? 63.778  122.607 74.807  1.00 0.00 ? 69  A A "C3'"  1  
ATOM 1516   O "O3'"  . A A 1 48  ? 64.580  123.775 74.805  1.00 0.00 ? 69  A A "O3'"  1  
ATOM 1517   C "C2'"  . A A 1 48  ? 64.533  121.342 74.415  1.00 0.00 ? 69  A A "C2'"  1  
ATOM 1518   O "O2'"  . A A 1 48  ? 65.803  121.284 75.047  1.00 0.00 ? 69  A A "O2'"  1  
ATOM 1519   C "C1'"  . A A 1 48  ? 63.637  120.254 75.004  1.00 0.00 ? 69  A A "C1'"  1  
ATOM 1520   N N9     . A A 1 48  ? 62.652  119.753 74.026  1.00 0.00 ? 69  A A N9     1  
ATOM 1521   C C8     . A A 1 48  ? 61.288  119.903 74.049  1.00 0.00 ? 69  A A C8     1  
ATOM 1522   N N7     . A A 1 48  ? 60.677  119.344 73.034  1.00 0.00 ? 69  A A N7     1  
ATOM 1523   C C5     . A A 1 48  ? 61.708  118.787 72.291  1.00 0.00 ? 69  A A C5     1  
ATOM 1524   C C6     . A A 1 48  ? 61.722  118.052 71.092  1.00 0.00 ? 69  A A C6     1  
ATOM 1525   N N6     . A A 1 48  ? 60.623  117.740 70.402  1.00 0.00 ? 69  A A N6     1  
ATOM 1526   N N1     . A A 1 48  ? 62.919  117.644 70.619  1.00 0.00 ? 69  A A N1     1  
ATOM 1527   C C2     . A A 1 48  ? 64.023  117.957 71.310  1.00 0.00 ? 69  A A C2     1  
ATOM 1528   N N3     . A A 1 48  ? 64.138  118.641 72.447  1.00 0.00 ? 69  A A N3     1  
ATOM 1529   C C4     . A A 1 48  ? 62.930  119.032 72.890  1.00 0.00 ? 69  A A C4     1  
ATOM 1530   H "H5'"  . A A 1 48  ? 62.035  123.122 77.598  1.00 0.00 ? 69  A A "H5'"  1  
ATOM 1531   H "H5''" . A A 1 48  ? 61.999  123.886 76.198  1.00 0.00 ? 69  A A "H5''" 1  
ATOM 1532   H "H4'"  . A A 1 48  ? 63.949  122.395 76.848  1.00 0.00 ? 69  A A "H4'"  1  
ATOM 1533   H "H3'"  . A A 1 48  ? 63.025  122.735 74.191  1.00 0.00 ? 69  A A "H3'"  1  
ATOM 1534   H "H2'"  . A A 1 48  ? 64.607  121.255 73.441  1.00 0.00 ? 69  A A "H2'"  1  
ATOM 1535   H "HO2'" . A A 1 48  ? 65.901  122.059 75.638  1.00 0.00 ? 69  A A "HO2'" 1  
ATOM 1536   H "H1'"  . A A 1 48  ? 64.192  119.509 75.319  1.00 0.00 ? 69  A A "H1'"  1  
ATOM 1537   H H8     . A A 1 48  ? 60.814  120.385 74.760  1.00 0.00 ? 69  A A H8     1  
ATOM 1538   H H61    . A A 1 48  ? 60.695  117.224 69.572  1.00 0.00 ? 69  A A H61    1  
ATOM 1539   H H62    . A A 1 48  ? 59.743  118.025 70.726  1.00 0.00 ? 69  A A H62    1  
ATOM 1540   H H2     . A A 1 48  ? 64.866  117.637 70.924  1.00 0.00 ? 69  A A H2     1  
ATOM 1541   P P      . A A 1 49  ? 65.202  124.326 73.429  1.00 0.00 ? 70  A A P      1  
ATOM 1542   O OP1    . A A 1 49  ? 66.298  125.268 73.764  1.00 0.00 ? 70  A A OP1    1  
ATOM 1543   O OP2    . A A 1 49  ? 64.081  124.780 72.567  1.00 0.00 ? 70  A A OP2    1  
ATOM 1544   O "O5'"  . A A 1 49  ? 65.849  123.035 72.755  1.00 0.00 ? 70  A A "O5'"  1  
ATOM 1545   C "C5'"  . A A 1 49  ? 67.248  122.957 72.526  1.00 0.00 ? 70  A A "C5'"  1  
ATOM 1546   C "C4'"  . A A 1 49  ? 67.998  122.618 73.789  1.00 0.00 ? 70  A A "C4'"  1  
ATOM 1547   O "O4'"  . A A 1 49  ? 68.172  121.190 73.856  1.00 0.00 ? 70  A A "O4'"  1  
ATOM 1548   C "C3'"  . A A 1 49  ? 69.401  123.195 73.908  1.00 0.00 ? 70  A A "C3'"  1  
ATOM 1549   O "O3'"  . A A 1 49  ? 69.420  124.493 74.474  1.00 0.00 ? 70  A A "O3'"  1  
ATOM 1550   C "C2'"  . A A 1 49  ? 70.140  122.186 74.782  1.00 0.00 ? 70  A A "C2'"  1  
ATOM 1551   O "O2'"  . A A 1 49  ? 69.923  122.443 76.162  1.00 0.00 ? 70  A A "O2'"  1  
ATOM 1552   C "C1'"  . A A 1 49  ? 69.462  120.866 74.429  1.00 0.00 ? 70  A A "C1'"  1  
ATOM 1553   N N9     . A A 1 49  ? 70.241  120.085 73.450  1.00 0.00 ? 70  A A N9     1  
ATOM 1554   C C8     . A A 1 49  ? 69.783  119.445 72.325  1.00 0.00 ? 70  A A C8     1  
ATOM 1555   N N7     . A A 1 49  ? 70.721  118.829 71.648  1.00 0.00 ? 70  A A N7     1  
ATOM 1556   C C5     . A A 1 49  ? 71.876  119.080 72.377  1.00 0.00 ? 70  A A C5     1  
ATOM 1557   C C6     . A A 1 49  ? 73.216  118.700 72.187  1.00 0.00 ? 70  A A C6     1  
ATOM 1558   N N6     . A A 1 49  ? 73.637  117.957 71.161  1.00 0.00 ? 70  A A N6     1  
ATOM 1559   N N1     . A A 1 49  ? 74.122  119.117 73.098  1.00 0.00 ? 70  A A N1     1  
ATOM 1560   C C2     . A A 1 49  ? 73.701  119.863 74.127  1.00 0.00 ? 70  A A C2     1  
ATOM 1561   N N3     . A A 1 49  ? 72.470  120.283 74.413  1.00 0.00 ? 70  A A N3     1  
ATOM 1562   C C4     . A A 1 49  ? 71.594  119.852 73.488  1.00 0.00 ? 70  A A C4     1  
ATOM 1563   H "H5'"  . A A 1 49  ? 67.566  123.820 72.187  1.00 0.00 ? 70  A A "H5'"  1  
ATOM 1564   H "H5''" . A A 1 49  ? 67.425  122.266 71.854  1.00 0.00 ? 70  A A "H5''" 1  
ATOM 1565   H "H4'"  . A A 1 49  ? 67.473  122.919 74.560  1.00 0.00 ? 70  A A "H4'"  1  
ATOM 1566   H "H3'"  . A A 1 49  ? 69.820  123.204 73.021  1.00 0.00 ? 70  A A "H3'"  1  
ATOM 1567   H "H2'"  . A A 1 49  ? 71.095  122.154 74.564  1.00 0.00 ? 70  A A "H2'"  1  
ATOM 1568   H "HO2'" . A A 1 49  ? 70.738  122.221 76.659  1.00 0.00 ? 70  A A "HO2'" 1  
ATOM 1569   H "H1'"  . A A 1 49  ? 69.336  120.336 75.244  1.00 0.00 ? 70  A A "H1'"  1  
ATOM 1570   H H8     . A A 1 49  ? 68.841  119.448 72.052  1.00 0.00 ? 70  A A H8     1  
ATOM 1571   H H61    . A A 1 49  ? 74.586  117.724 71.082  1.00 0.00 ? 70  A A H61    1  
ATOM 1572   H H62    . A A 1 49  ? 72.998  117.643 70.488  1.00 0.00 ? 70  A A H62    1  
ATOM 1573   H H2     . A A 1 49  ? 74.397  120.139 74.760  1.00 0.00 ? 70  A A H2     1  
ATOM 1574   P P      . U A 1 50  ? 70.486  125.582 73.962  1.00 0.00 ? 71  U A P      1  
ATOM 1575   O OP1    . U A 1 50  ? 70.162  126.881 74.606  1.00 0.00 ? 71  U A OP1    1  
ATOM 1576   O OP2    . U A 1 50  ? 70.557  125.494 72.482  1.00 0.00 ? 71  U A OP2    1  
ATOM 1577   O "O5'"  . U A 1 50  ? 71.874  125.071 74.554  1.00 0.00 ? 71  U A "O5'"  1  
ATOM 1578   C "C5'"  . U A 1 50  ? 72.932  125.979 74.822  1.00 0.00 ? 71  U A "C5'"  1  
ATOM 1579   C "C4'"  . U A 1 50  ? 73.818  125.487 75.939  1.00 0.00 ? 71  U A "C4'"  1  
ATOM 1580   O "O4'"  . U A 1 50  ? 73.126  125.645 77.200  1.00 0.00 ? 71  U A "O4'"  1  
ATOM 1581   C "C3'"  . U A 1 50  ? 74.237  124.026 75.870  1.00 0.00 ? 71  U A "C3'"  1  
ATOM 1582   O "O3'"  . U A 1 50  ? 75.497  123.782 76.469  1.00 0.00 ? 71  U A "O3'"  1  
ATOM 1583   C "C2'"  . U A 1 50  ? 73.186  123.333 76.733  1.00 0.00 ? 71  U A "C2'"  1  
ATOM 1584   O "O2'"  . U A 1 50  ? 73.703  122.147 77.320  1.00 0.00 ? 71  U A "O2'"  1  
ATOM 1585   C "C1'"  . U A 1 50  ? 72.968  124.377 77.821  1.00 0.00 ? 71  U A "C1'"  1  
ATOM 1586   N N1     . U A 1 50  ? 71.596  124.328 78.382  1.00 0.00 ? 71  U A N1     1  
ATOM 1587   C C2     . U A 1 50  ? 71.428  123.656 79.578  1.00 0.00 ? 71  U A C2     1  
ATOM 1588   O O2     . U A 1 50  ? 72.345  123.117 80.174  1.00 0.00 ? 71  U A O2     1  
ATOM 1589   N N3     . U A 1 50  ? 70.142  123.637 80.060  1.00 0.00 ? 71  U A N3     1  
ATOM 1590   C C4     . U A 1 50  ? 69.028  124.206 79.480  1.00 0.00 ? 71  U A C4     1  
ATOM 1591   O O4     . U A 1 50  ? 67.935  124.101 80.039  1.00 0.00 ? 71  U A O4     1  
ATOM 1592   C C5     . U A 1 50  ? 69.278  124.885 78.245  1.00 0.00 ? 71  U A C5     1  
ATOM 1593   C C6     . U A 1 50  ? 70.521  124.920 77.754  1.00 0.00 ? 71  U A C6     1  
ATOM 1594   H "H5'"  . U A 1 50  ? 72.552  126.846 75.074  1.00 0.00 ? 71  U A "H5'"  1  
ATOM 1595   H "H5''" . U A 1 50  ? 73.471  126.089 74.012  1.00 0.00 ? 71  U A "H5''" 1  
ATOM 1596   H "H4'"  . U A 1 50  ? 74.637  126.024 75.952  1.00 0.00 ? 71  U A "H4'"  1  
ATOM 1597   H "H3'"  . U A 1 50  ? 74.149  123.709 74.947  1.00 0.00 ? 71  U A "H3'"  1  
ATOM 1598   H "H2'"  . U A 1 50  ? 72.365  123.158 76.228  1.00 0.00 ? 71  U A "H2'"  1  
ATOM 1599   H "HO2'" . U A 1 50  ? 73.009  121.738 77.878  1.00 0.00 ? 71  U A "HO2'" 1  
ATOM 1600   H "H1'"  . U A 1 50  ? 73.619  124.234 78.540  1.00 0.00 ? 71  U A "H1'"  1  
ATOM 1601   H H3     . U A 1 50  ? 70.001  123.165 80.907  1.00 0.00 ? 71  U A H3     1  
ATOM 1602   H H5     . U A 1 50  ? 68.543  125.320 77.764  1.00 0.00 ? 71  U A H5     1  
ATOM 1603   H H6     . U A 1 50  ? 70.665  125.389 76.907  1.00 0.00 ? 71  U A H6     1  
ATOM 1604   P P      . A A 1 51  ? 76.849  124.002 75.629  1.00 0.00 ? 72  A A P      1  
ATOM 1605   O OP1    . A A 1 51  ? 77.778  122.891 75.953  1.00 0.00 ? 72  A A OP1    1  
ATOM 1606   O OP2    . A A 1 51  ? 77.287  125.407 75.824  1.00 0.00 ? 72  A A OP2    1  
ATOM 1607   O "O5'"  . A A 1 51  ? 76.391  123.836 74.112  1.00 0.00 ? 72  A A "O5'"  1  
ATOM 1608   C "C5'"  . A A 1 51  ? 76.087  122.556 73.578  1.00 0.00 ? 72  A A "C5'"  1  
ATOM 1609   C "C4'"  . A A 1 51  ? 76.145  122.556 72.071  1.00 0.00 ? 72  A A "C4'"  1  
ATOM 1610   O "O4'"  . A A 1 51  ? 74.990  121.812 71.607  1.00 0.00 ? 72  A A "O4'"  1  
ATOM 1611   C "C3'"  . A A 1 51  ? 76.078  123.920 71.401  1.00 0.00 ? 72  A A "C3'"  1  
ATOM 1612   O "O3'"  . A A 1 51  ? 77.029  124.075 70.362  1.00 0.00 ? 72  A A "O3'"  1  
ATOM 1613   C "C2'"  . A A 1 51  ? 74.669  123.963 70.825  1.00 0.00 ? 72  A A "C2'"  1  
ATOM 1614   O "O2'"  . A A 1 51  ? 74.631  124.700 69.612  1.00 0.00 ? 72  A A "O2'"  1  
ATOM 1615   C "C1'"  . A A 1 51  ? 74.404  122.498 70.513  1.00 0.00 ? 72  A A "C1'"  1  
ATOM 1616   N N9     . A A 1 51  ? 72.961  122.201 70.424  1.00 0.00 ? 72  A A N9     1  
ATOM 1617   C C8     . A A 1 51  ? 71.941  122.735 71.171  1.00 0.00 ? 72  A A C8     1  
ATOM 1618   N N7     . A A 1 51  ? 70.757  122.271 70.859  1.00 0.00 ? 72  A A N7     1  
ATOM 1619   C C5     . A A 1 51  ? 71.013  121.368 69.835  1.00 0.00 ? 72  A A C5     1  
ATOM 1620   C C6     . A A 1 51  ? 70.172  120.539 69.072  1.00 0.00 ? 72  A A C6     1  
ATOM 1621   N N6     . A A 1 51  ? 68.848  120.484 69.226  1.00 0.00 ? 72  A A N6     1  
ATOM 1622   N N1     . A A 1 51  ? 70.746  119.759 68.130  1.00 0.00 ? 72  A A N1     1  
ATOM 1623   C C2     . A A 1 51  ? 72.075  119.815 67.974  1.00 0.00 ? 72  A A C2     1  
ATOM 1624   N N3     . A A 1 51  ? 72.969  120.552 68.630  1.00 0.00 ? 72  A A N3     1  
ATOM 1625   C C4     . A A 1 51  ? 72.366  121.316 69.558  1.00 0.00 ? 72  A A C4     1  
ATOM 1626   H "H5'"  . A A 1 51  ? 75.186  122.296 73.863  1.00 0.00 ? 72  A A "H5'"  1  
ATOM 1627   H "H5''" . A A 1 51  ? 76.732  121.904 73.923  1.00 0.00 ? 72  A A "H5''" 1  
ATOM 1628   H "H4'"  . A A 1 51  ? 76.972  122.115 71.785  1.00 0.00 ? 72  A A "H4'"  1  
ATOM 1629   H "H3'"  . A A 1 51  ? 76.160  124.618 72.084  1.00 0.00 ? 72  A A "H3'"  1  
ATOM 1630   H "H2'"  . A A 1 51  ? 74.024  124.307 71.479  1.00 0.00 ? 72  A A "H2'"  1  
ATOM 1631   H "HO2'" . A A 1 51  ? 73.709  124.719 69.280  1.00 0.00 ? 72  A A "HO2'" 1  
ATOM 1632   H "H1'"  . A A 1 51  ? 74.839  122.261 69.667  1.00 0.00 ? 72  A A "H1'"  1  
ATOM 1633   H H8     . A A 1 51  ? 72.086  123.404 71.874  1.00 0.00 ? 72  A A H8     1  
ATOM 1634   H H61    . A A 1 51  ? 68.313  119.885 68.663  1.00 0.00 ? 72  A A H61    1  
ATOM 1635   H H62    . A A 1 51  ? 68.409  121.040 69.903  1.00 0.00 ? 72  A A H62    1  
ATOM 1636   H H2     . A A 1 51  ? 72.442  119.230 67.278  1.00 0.00 ? 72  A A H2     1  
ATOM 1637   P P      . G A 1 52  ? 77.774  125.481 70.171  1.00 0.00 ? 73  G A P      1  
ATOM 1638   O OP1    . G A 1 52  ? 76.817  126.467 69.606  1.00 0.00 ? 73  G A OP1    1  
ATOM 1639   O OP2    . G A 1 52  ? 78.982  125.103 69.395  1.00 0.00 ? 73  G A OP2    1  
ATOM 1640   O "O5'"  . G A 1 52  ? 78.250  126.016 71.594  1.00 0.00 ? 73  G A "O5'"  1  
ATOM 1641   C "C5'"  . G A 1 52  ? 79.549  126.560 71.771  1.00 0.00 ? 73  G A "C5'"  1  
ATOM 1642   C "C4'"  . G A 1 52  ? 80.587  125.776 71.008  1.00 0.00 ? 73  G A "C4'"  1  
ATOM 1643   O "O4'"  . G A 1 52  ? 80.311  125.859 69.588  1.00 0.00 ? 73  G A "O4'"  1  
ATOM 1644   C "C3'"  . G A 1 52  ? 82.021  126.268 71.134  1.00 0.00 ? 73  G A "C3'"  1  
ATOM 1645   O "O3'"  . G A 1 52  ? 82.648  125.845 72.333  1.00 0.00 ? 73  G A "O3'"  1  
ATOM 1646   C "C2'"  . G A 1 52  ? 82.678  125.717 69.875  1.00 0.00 ? 73  G A "C2'"  1  
ATOM 1647   O "O2'"  . G A 1 52  ? 83.025  124.349 70.032  1.00 0.00 ? 73  G A "O2'"  1  
ATOM 1648   C "C1'"  . G A 1 52  ? 81.535  125.827 68.868  1.00 0.00 ? 73  G A "C1'"  1  
ATOM 1649   N N9     . G A 1 52  ? 81.649  127.036 68.030  1.00 0.00 ? 73  G A N9     1  
ATOM 1650   C C8     . G A 1 52  ? 80.939  128.206 68.158  1.00 0.00 ? 73  G A C8     1  
ATOM 1651   N N7     . G A 1 52  ? 81.260  129.101 67.263  1.00 0.00 ? 73  G A N7     1  
ATOM 1652   C C5     . G A 1 52  ? 82.241  128.486 66.499  1.00 0.00 ? 73  G A C5     1  
ATOM 1653   C C6     . G A 1 52  ? 82.971  128.967 65.381  1.00 0.00 ? 73  G A C6     1  
ATOM 1654   O O6     . G A 1 52  ? 82.893  130.068 64.825  1.00 0.00 ? 73  G A O6     1  
ATOM 1655   N N1     . G A 1 52  ? 83.870  128.015 64.908  1.00 0.00 ? 73  G A N1     1  
ATOM 1656   C C2     . G A 1 52  ? 84.045  126.762 65.442  1.00 0.00 ? 73  G A C2     1  
ATOM 1657   N N2     . G A 1 52  ? 84.961  125.983 64.847  1.00 0.00 ? 73  G A N2     1  
ATOM 1658   N N3     . G A 1 52  ? 83.371  126.302 66.484  1.00 0.00 ? 73  G A N3     1  
ATOM 1659   C C4     . G A 1 52  ? 82.493  127.211 66.958  1.00 0.00 ? 73  G A C4     1  
ATOM 1660   H "H5'"  . G A 1 52  ? 79.775  126.547 72.725  1.00 0.00 ? 73  G A "H5'"  1  
ATOM 1661   H "H5''" . G A 1 52  ? 79.552  127.489 71.456  1.00 0.00 ? 73  G A "H5''" 1  
ATOM 1662   H "H4'"  . G A 1 52  ? 80.547  124.837 71.285  1.00 0.00 ? 73  G A "H4'"  1  
ATOM 1663   H "H3'"  . G A 1 52  ? 82.027  127.247 71.096  1.00 0.00 ? 73  G A "H3'"  1  
ATOM 1664   H "H2'"  . G A 1 52  ? 83.449  126.259 69.605  1.00 0.00 ? 73  G A "H2'"  1  
ATOM 1665   H "HO2'" . G A 1 52  ? 84.001  124.263 70.007  1.00 0.00 ? 73  G A "HO2'" 1  
ATOM 1666   H "H1'"  . G A 1 52  ? 81.528  125.032 68.295  1.00 0.00 ? 73  G A "H1'"  1  
ATOM 1667   H H8     . G A 1 52  ? 80.261  128.354 68.849  1.00 0.00 ? 73  G A H8     1  
ATOM 1668   H H1     . G A 1 52  ? 84.419  128.260 64.134  1.00 0.00 ? 73  G A H1     1  
ATOM 1669   H H21    . G A 1 52  ? 85.464  126.316 64.076  1.00 0.00 ? 73  G A H21    1  
ATOM 1670   H H22    . G A 1 52  ? 85.129  125.078 65.185  1.00 0.00 ? 73  G A H22    1  
ATOM 1671   P P      . A A 1 53  ? 83.600  126.853 73.145  1.00 0.00 ? 74  A A P      1  
ATOM 1672   O OP1    . A A 1 53  ? 83.710  126.360 74.540  1.00 0.00 ? 74  A A OP1    1  
ATOM 1673   O OP2    . A A 1 53  ? 83.128  128.238 72.890  1.00 0.00 ? 74  A A OP2    1  
ATOM 1674   O "O5'"  . A A 1 53  ? 85.024  126.683 72.448  1.00 0.00 ? 74  A A "O5'"  1  
ATOM 1675   C "C5'"  . A A 1 53  ? 85.687  125.428 72.443  1.00 0.00 ? 74  A A "C5'"  1  
ATOM 1676   C "C4'"  . A A 1 53  ? 86.431  125.200 71.151  1.00 0.00 ? 74  A A "C4'"  1  
ATOM 1677   O "O4'"  . A A 1 53  ? 85.557  125.478 70.026  1.00 0.00 ? 74  A A "O4'"  1  
ATOM 1678   C "C3'"  . A A 1 53  ? 87.635  126.096 70.907  1.00 0.00 ? 74  A A "C3'"  1  
ATOM 1679   O "O3'"  . A A 1 53  ? 88.841  125.558 71.422  1.00 0.00 ? 74  A A "O3'"  1  
ATOM 1680   C "C2'"  . A A 1 53  ? 87.665  126.185 69.391  1.00 0.00 ? 74  A A "C2'"  1  
ATOM 1681   O "O2'"  . A A 1 53  ? 88.203  125.003 68.816  1.00 0.00 ? 74  A A "O2'"  1  
ATOM 1682   C "C1'"  . A A 1 53  ? 86.177  126.263 69.064  1.00 0.00 ? 74  A A "C1'"  1  
ATOM 1683   N N9     . A A 1 53  ? 85.653  127.637 69.182  1.00 0.00 ? 74  A A N9     1  
ATOM 1684   C C8     . A A 1 53  ? 84.989  128.199 70.244  1.00 0.00 ? 74  A A C8     1  
ATOM 1685   N N7     . A A 1 53  ? 84.645  129.448 70.052  1.00 0.00 ? 74  A A N7     1  
ATOM 1686   C C5     . A A 1 53  ? 85.114  129.729 68.775  1.00 0.00 ? 74  A A C5     1  
ATOM 1687   C C6     . A A 1 53  ? 85.065  130.890 67.983  1.00 0.00 ? 74  A A C6     1  
ATOM 1688   N N6     . A A 1 53  ? 84.498  132.032 68.377  1.00 0.00 ? 74  A A N6     1  
ATOM 1689   N N1     . A A 1 53  ? 85.627  130.837 66.756  1.00 0.00 ? 74  A A N1     1  
ATOM 1690   C C2     . A A 1 53  ? 86.196  129.692 66.360  1.00 0.00 ? 74  A A C2     1  
ATOM 1691   N N3     . A A 1 53  ? 86.304  128.536 67.013  1.00 0.00 ? 74  A A N3     1  
ATOM 1692   C C4     . A A 1 53  ? 85.736  128.623 68.229  1.00 0.00 ? 74  A A C4     1  
ATOM 1693   H "H5'"  . A A 1 53  ? 85.024  124.715 72.560  1.00 0.00 ? 74  A A "H5'"  1  
ATOM 1694   H "H5''" . A A 1 53  ? 86.323  125.398 73.187  1.00 0.00 ? 74  A A "H5''" 1  
ATOM 1695   H "H4'"  . A A 1 53  ? 86.719  124.264 71.109  1.00 0.00 ? 74  A A "H4'"  1  
ATOM 1696   H "H3'"  . A A 1 53  ? 87.489  126.985 71.294  1.00 0.00 ? 74  A A "H3'"  1  
ATOM 1697   H "H2'"  . A A 1 53  ? 88.141  126.987 69.087  1.00 0.00 ? 74  A A "H2'"  1  
ATOM 1698   H "HO2'" . A A 1 53  ? 88.801  124.578 69.465  1.00 0.00 ? 74  A A "HO2'" 1  
ATOM 1699   H "H1'"  . A A 1 53  ? 86.026  125.932 68.153  1.00 0.00 ? 74  A A "H1'"  1  
ATOM 1700   H H8     . A A 1 53  ? 84.791  127.710 71.071  1.00 0.00 ? 74  A A H8     1  
ATOM 1701   H H61    . A A 1 53  ? 84.495  132.810 67.780  1.00 0.00 ? 74  A A H61    1  
ATOM 1702   H H62    . A A 1 53  ? 84.084  132.094 69.263  1.00 0.00 ? 74  A A H62    1  
ATOM 1703   H H2     . A A 1 53  ? 86.589  129.706 65.462  1.00 0.00 ? 74  A A H2     1  
ATOM 1704   P P      . U A 1 54  ? 89.984  126.535 71.990  1.00 0.00 ? 75  U A P      1  
ATOM 1705   O OP1    . U A 1 54  ? 91.099  125.693 72.494  1.00 0.00 ? 75  U A OP1    1  
ATOM 1706   O OP2    . U A 1 54  ? 89.339  127.518 72.896  1.00 0.00 ? 75  U A OP2    1  
ATOM 1707   O "O5'"  . U A 1 54  ? 90.499  127.315 70.700  1.00 0.00 ? 75  U A "O5'"  1  
ATOM 1708   C "C5'"  . U A 1 54  ? 91.261  128.506 70.825  1.00 0.00 ? 75  U A "C5'"  1  
ATOM 1709   C "C4'"  . U A 1 54  ? 92.284  128.631 69.722  1.00 0.00 ? 75  U A "C4'"  1  
ATOM 1710   O "O4'"  . U A 1 54  ? 93.282  127.589 69.863  1.00 0.00 ? 75  U A "O4'"  1  
ATOM 1711   C "C3'"  . U A 1 54  ? 91.766  128.449 68.304  1.00 0.00 ? 75  U A "C3'"  1  
ATOM 1712   O "O3'"  . U A 1 54  ? 91.191  129.627 67.768  1.00 0.00 ? 75  U A "O3'"  1  
ATOM 1713   C "C2'"  . U A 1 54  ? 93.053  128.125 67.562  1.00 0.00 ? 75  U A "C2'"  1  
ATOM 1714   O "O2'"  . U A 1 54  ? 93.787  129.305 67.267  1.00 0.00 ? 75  U A "O2'"  1  
ATOM 1715   C "C1'"  . U A 1 54  ? 93.822  127.312 68.611  1.00 0.00 ? 75  U A "C1'"  1  
ATOM 1716   N N1     . U A 1 54  ? 93.707  125.851 68.386  1.00 0.00 ? 75  U A N1     1  
ATOM 1717   C C2     . U A 1 54  ? 94.371  125.327 67.292  1.00 0.00 ? 75  U A C2     1  
ATOM 1718   O O2     . U A 1 54  ? 95.032  126.006 66.526  1.00 0.00 ? 75  U A O2     1  
ATOM 1719   N N3     . U A 1 54  ? 94.236  123.970 67.124  1.00 0.00 ? 75  U A N3     1  
ATOM 1720   C C4     . U A 1 54  ? 93.520  123.101 67.919  1.00 0.00 ? 75  U A C4     1  
ATOM 1721   O O4     . U A 1 54  ? 93.494  121.902 67.633  1.00 0.00 ? 75  U A O4     1  
ATOM 1722   C C5     . U A 1 54  ? 92.859  123.713 69.031  1.00 0.00 ? 75  U A C5     1  
ATOM 1723   C C6     . U A 1 54  ? 92.975  125.031 69.219  1.00 0.00 ? 75  U A C6     1  
ATOM 1724   H "H5'"  . U A 1 54  ? 91.723  128.501 71.689  1.00 0.00 ? 75  U A "H5'"  1  
ATOM 1725   H "H5''" . U A 1 54  ? 90.658  129.278 70.788  1.00 0.00 ? 75  U A "H5''" 1  
ATOM 1726   H "H4'"  . U A 1 54  ? 92.724  129.503 69.788  1.00 0.00 ? 75  U A "H4'"  1  
ATOM 1727   H "H3'"  . U A 1 54  ? 91.122  127.714 68.228  1.00 0.00 ? 75  U A "H3'"  1  
ATOM 1728   H "H2'"  . U A 1 54  ? 92.880  127.595 66.757  1.00 0.00 ? 75  U A "H2'"  1  
ATOM 1729   H "HO2'" . U A 1 54  ? 94.608  129.060 66.792  1.00 0.00 ? 75  U A "HO2'" 1  
ATOM 1730   H "H1'"  . U A 1 54  ? 94.768  127.570 68.589  1.00 0.00 ? 75  U A "H1'"  1  
ATOM 1731   H H3     . U A 1 54  ? 94.698  123.578 66.354  1.00 0.00 ? 75  U A H3     1  
ATOM 1732   H H5     . U A 1 54  ? 92.328  123.169 69.650  1.00 0.00 ? 75  U A H5     1  
ATOM 1733   H H6     . U A 1 54  ? 92.513  125.427 69.987  1.00 0.00 ? 75  U A H6     1  
ATOM 1734   P P      . U A 1 55  ? 89.682  129.613 67.216  1.00 0.00 ? 76  U A P      1  
ATOM 1735   O OP1    . U A 1 55  ? 89.183  131.012 67.202  1.00 0.00 ? 76  U A OP1    1  
ATOM 1736   O OP2    . U A 1 55  ? 88.929  128.573 67.962  1.00 0.00 ? 76  U A OP2    1  
ATOM 1737   O "O5'"  . U A 1 55  ? 89.829  129.127 65.706  1.00 0.00 ? 76  U A "O5'"  1  
ATOM 1738   C "C5'"  . U A 1 55  ? 90.298  130.010 64.698  1.00 0.00 ? 76  U A "C5'"  1  
ATOM 1739   C "C4'"  . U A 1 55  ? 90.421  129.318 63.363  1.00 0.00 ? 76  U A "C4'"  1  
ATOM 1740   O "O4'"  . U A 1 55  ? 91.588  128.454 63.361  1.00 0.00 ? 76  U A "O4'"  1  
ATOM 1741   C "C3'"  . U A 1 55  ? 89.276  128.392 62.979  1.00 0.00 ? 76  U A "C3'"  1  
ATOM 1742   O "O3'"  . U A 1 55  ? 88.148  129.087 62.476  1.00 0.00 ? 76  U A "O3'"  1  
ATOM 1743   C "C2'"  . U A 1 55  ? 89.927  127.463 61.965  1.00 0.00 ? 76  U A "C2'"  1  
ATOM 1744   O "O2'"  . U A 1 55  ? 90.053  128.091 60.697  1.00 0.00 ? 76  U A "O2'"  1  
ATOM 1745   C "C1'"  . U A 1 55  ? 91.319  127.277 62.569  1.00 0.00 ? 76  U A "C1'"  1  
ATOM 1746   N N1     . U A 1 55  ? 91.416  126.048 63.390  1.00 0.00 ? 76  U A N1     1  
ATOM 1747   C C2     . U A 1 55  ? 91.555  124.848 62.719  1.00 0.00 ? 76  U A C2     1  
ATOM 1748   O O2     . U A 1 55  ? 91.599  124.767 61.503  1.00 0.00 ? 76  U A O2     1  
ATOM 1749   N N3     . U A 1 55  ? 91.641  123.737 63.520  1.00 0.00 ? 76  U A N3     1  
ATOM 1750   C C4     . U A 1 55  ? 91.604  123.699 64.899  1.00 0.00 ? 76  U A C4     1  
ATOM 1751   O O4     . U A 1 55  ? 91.694  122.617 65.477  1.00 0.00 ? 76  U A O4     1  
ATOM 1752   C C5     . U A 1 55  ? 91.460  124.978 65.526  1.00 0.00 ? 76  U A C5     1  
ATOM 1753   C C6     . U A 1 55  ? 91.373  126.076 64.769  1.00 0.00 ? 76  U A C6     1  
ATOM 1754   H "H5'"  . U A 1 55  ? 91.177  130.356 64.960  1.00 0.00 ? 76  U A "H5'"  1  
ATOM 1755   H "H5''" . U A 1 55  ? 89.673  130.759 64.612  1.00 0.00 ? 76  U A "H5''" 1  
ATOM 1756   H "H4'"  . U A 1 55  ? 90.529  129.995 62.663  1.00 0.00 ? 76  U A "H4'"  1  
ATOM 1757   H "H3'"  . U A 1 55  ? 89.007  127.872 63.766  1.00 0.00 ? 76  U A "H3'"  1  
ATOM 1758   H "H2'"  . U A 1 55  ? 89.447  126.609 61.900  1.00 0.00 ? 76  U A "H2'"  1  
ATOM 1759   H "HO2'" . U A 1 55  ? 90.412  127.445 60.055  1.00 0.00 ? 76  U A "HO2'" 1  
ATOM 1760   H "H1'"  . U A 1 55  ? 91.983  127.237 61.848  1.00 0.00 ? 76  U A "H1'"  1  
ATOM 1761   H H3     . U A 1 55  ? 91.740  122.875 63.063  1.00 0.00 ? 76  U A H3     1  
ATOM 1762   H H5     . U A 1 55  ? 91.423  125.047 66.503  1.00 0.00 ? 76  U A H5     1  
ATOM 1763   H H6     . U A 1 55  ? 91.274  126.938 65.222  1.00 0.00 ? 76  U A H6     1  
ATOM 1764   P P      . G A 1 56  ? 86.680  128.447 62.602  1.00 0.00 ? 77  G A P      1  
ATOM 1765   O OP1    . G A 1 56  ? 85.697  129.450 62.119  1.00 0.00 ? 77  G A OP1    1  
ATOM 1766   O OP2    . G A 1 56  ? 86.541  127.883 63.969  1.00 0.00 ? 77  G A OP2    1  
ATOM 1767   O "O5'"  . G A 1 56  ? 86.696  127.234 61.568  1.00 0.00 ? 77  G A "O5'"  1  
ATOM 1768   C "C5'"  . G A 1 56  ? 86.756  127.470 60.170  1.00 0.00 ? 77  G A "C5'"  1  
ATOM 1769   C "C4'"  . G A 1 56  ? 86.912  126.185 59.397  1.00 0.00 ? 77  G A "C4'"  1  
ATOM 1770   O "O4'"  . G A 1 56  ? 88.143  125.522 59.788  1.00 0.00 ? 77  G A "O4'"  1  
ATOM 1771   C "C3'"  . G A 1 56  ? 85.837  125.133 59.626  1.00 0.00 ? 77  G A "C3'"  1  
ATOM 1772   O "O3'"  . G A 1 56  ? 84.647  125.389 58.899  1.00 0.00 ? 77  G A "O3'"  1  
ATOM 1773   C "C2'"  . G A 1 56  ? 86.538  123.845 59.215  1.00 0.00 ? 77  G A "C2'"  1  
ATOM 1774   O "O2'"  . G A 1 56  ? 86.586  123.713 57.802  1.00 0.00 ? 77  G A "O2'"  1  
ATOM 1775   C "C1'"  . G A 1 56  ? 87.953  124.088 59.741  1.00 0.00 ? 77  G A "C1'"  1  
ATOM 1776   N N9     . G A 1 56  ? 88.171  123.467 61.061  1.00 0.00 ? 77  G A N9     1  
ATOM 1777   C C8     . G A 1 56  ? 88.212  124.098 62.281  1.00 0.00 ? 77  G A C8     1  
ATOM 1778   N N7     . G A 1 56  ? 88.423  123.279 63.275  1.00 0.00 ? 77  G A N7     1  
ATOM 1779   C C5     . G A 1 56  ? 88.529  122.032 62.677  1.00 0.00 ? 77  G A C5     1  
ATOM 1780   C C6     . G A 1 56  ? 88.759  120.753 63.249  1.00 0.00 ? 77  G A C6     1  
ATOM 1781   O O6     . G A 1 56  ? 88.919  120.461 64.439  1.00 0.00 ? 77  G A O6     1  
ATOM 1782   N N1     . G A 1 56  ? 88.795  119.756 62.279  1.00 0.00 ? 77  G A N1     1  
ATOM 1783   C C2     . G A 1 56  ? 88.629  119.962 60.931  1.00 0.00 ? 77  G A C2     1  
ATOM 1784   N N2     . G A 1 56  ? 88.696  118.873 60.150  1.00 0.00 ? 77  G A N2     1  
ATOM 1785   N N3     . G A 1 56  ? 88.415  121.148 60.385  1.00 0.00 ? 77  G A N3     1  
ATOM 1786   C C4     . G A 1 56  ? 88.376  122.130 61.310  1.00 0.00 ? 77  G A C4     1  
ATOM 1787   H "H5'"  . G A 1 56  ? 87.518  128.055 59.976  1.00 0.00 ? 77  G A "H5'"  1  
ATOM 1788   H "H5''" . G A 1 56  ? 85.931  127.916 59.884  1.00 0.00 ? 77  G A "H5''" 1  
ATOM 1789   H "H4'"  . G A 1 56  ? 86.955  126.392 58.440  1.00 0.00 ? 77  G A "H4'"  1  
ATOM 1790   H "H3'"  . G A 1 56  ? 85.626  125.092 60.583  1.00 0.00 ? 77  G A "H3'"  1  
ATOM 1791   H "H2'"  . G A 1 56  ? 86.127  123.062 59.639  1.00 0.00 ? 77  G A "H2'"  1  
ATOM 1792   H "HO2'" . G A 1 56  ? 86.978  122.845 57.576  1.00 0.00 ? 77  G A "HO2'" 1  
ATOM 1793   H "H1'"  . G A 1 56  ? 88.605  123.732 59.099  1.00 0.00 ? 77  G A "H1'"  1  
ATOM 1794   H H8     . G A 1 56  ? 88.094  125.063 62.394  1.00 0.00 ? 77  G A H8     1  
ATOM 1795   H H1     . G A 1 56  ? 88.949  118.837 62.583  1.00 0.00 ? 77  G A H1     1  
ATOM 1796   H H21    . G A 1 56  ? 88.855  117.992 60.546  1.00 0.00 ? 77  G A H21    1  
ATOM 1797   H H22    . G A 1 56  ? 88.585  118.958 59.179  1.00 0.00 ? 77  G A H22    1  
ATOM 1798   P P      . C A 1 57  ? 83.237  124.842 59.440  1.00 0.00 ? 78  C A P      1  
ATOM 1799   O OP1    . C A 1 57  ? 82.170  125.351 58.542  1.00 0.00 ? 78  C A OP1    1  
ATOM 1800   O OP2    . C A 1 57  ? 83.162  125.118 60.898  1.00 0.00 ? 78  C A OP2    1  
ATOM 1801   O "O5'"  . C A 1 57  ? 83.335  123.264 59.241  1.00 0.00 ? 78  C A "O5'"  1  
ATOM 1802   C "C5'"  . C A 1 57  ? 83.340  122.691 57.943  1.00 0.00 ? 78  C A "C5'"  1  
ATOM 1803   C "C4'"  . C A 1 57  ? 83.549  121.197 57.993  1.00 0.00 ? 78  C A "C4'"  1  
ATOM 1804   O "O4'"  . C A 1 57  ? 84.831  120.899 58.604  1.00 0.00 ? 78  C A "O4'"  1  
ATOM 1805   C "C3'"  . C A 1 57  ? 82.552  120.407 58.826  1.00 0.00 ? 78  C A "C3'"  1  
ATOM 1806   O "O3'"  . C A 1 57  ? 81.324  120.181 58.153  1.00 0.00 ? 78  C A "O3'"  1  
ATOM 1807   C "C2'"  . C A 1 57  ? 83.319  119.132 59.144  1.00 0.00 ? 78  C A "C2'"  1  
ATOM 1808   O "O2'"  . C A 1 57  ? 83.330  118.246 58.033  1.00 0.00 ? 78  C A "O2'"  1  
ATOM 1809   C "C1'"  . C A 1 57  ? 84.734  119.674 59.360  1.00 0.00 ? 78  C A "C1'"  1  
ATOM 1810   N N1     . C A 1 57  ? 85.034  119.908 60.794  1.00 0.00 ? 78  C A N1     1  
ATOM 1811   C C2     . C A 1 57  ? 85.382  118.807 61.588  1.00 0.00 ? 78  C A C2     1  
ATOM 1812   O O2     . C A 1 57  ? 85.427  117.678 61.074  1.00 0.00 ? 78  C A O2     1  
ATOM 1813   N N3     . C A 1 57  ? 85.661  118.991 62.899  1.00 0.00 ? 78  C A N3     1  
ATOM 1814   C C4     . C A 1 57  ? 85.605  120.215 63.427  1.00 0.00 ? 78  C A C4     1  
ATOM 1815   N N4     . C A 1 57  ? 85.889  120.351 64.724  1.00 0.00 ? 78  C A N4     1  
ATOM 1816   C C5     . C A 1 57  ? 85.255  121.352 62.648  1.00 0.00 ? 78  C A C5     1  
ATOM 1817   C C6     . C A 1 57  ? 84.981  121.157 61.353  1.00 0.00 ? 78  C A C6     1  
ATOM 1818   H "H5'"  . C A 1 57  ? 84.061  123.097 57.419  1.00 0.00 ? 78  C A "H5'"  1  
ATOM 1819   H "H5''" . C A 1 57  ? 82.483  122.878 57.507  1.00 0.00 ? 78  C A "H5''" 1  
ATOM 1820   H "H4'"  . C A 1 57  ? 83.546  120.847 57.077  1.00 0.00 ? 78  C A "H4'"  1  
ATOM 1821   H "H3'"  . C A 1 57  ? 82.375  120.892 59.660  1.00 0.00 ? 78  C A "H3'"  1  
ATOM 1822   H "H2'"  . C A 1 57  ? 82.975  118.696 59.951  1.00 0.00 ? 78  C A "H2'"  1  
ATOM 1823   H "HO2'" . C A 1 57  ? 82.596  118.484 57.428  1.00 0.00 ? 78  C A "HO2'" 1  
ATOM 1824   H "H1'"  . C A 1 57  ? 85.386  119.042 58.991  1.00 0.00 ? 78  C A "H1'"  1  
ATOM 1825   H H41    . C A 1 57  ? 86.129  119.563 65.258  1.00 0.00 ? 78  C A H41    1  
ATOM 1826   H H42    . C A 1 57  ? 85.856  121.235 65.143  1.00 0.00 ? 78  C A H42    1  
ATOM 1827   H H5     . C A 1 57  ? 85.217  122.248 63.044  1.00 0.00 ? 78  C A H5     1  
ATOM 1828   H H6     . C A 1 57  ? 84.739  121.929 60.799  1.00 0.00 ? 78  C A H6     1  
ATOM 1829   P P      . A A 1 58  ? 79.974  119.944 58.992  1.00 0.00 ? 79  A A P      1  
ATOM 1830   O OP1    . A A 1 58  ? 78.843  119.878 58.034  1.00 0.00 ? 79  A A OP1    1  
ATOM 1831   O OP2    . A A 1 58  ? 79.942  120.934 60.098  1.00 0.00 ? 79  A A OP2    1  
ATOM 1832   O "O5'"  . A A 1 58  ? 80.165  118.499 59.633  1.00 0.00 ? 79  A A "O5'"  1  
ATOM 1833   C "C5'"  . A A 1 58  ? 80.190  117.337 58.816  1.00 0.00 ? 79  A A "C5'"  1  
ATOM 1834   C "C4'"  . A A 1 58  ? 80.530  116.105 59.616  1.00 0.00 ? 79  A A "C4'"  1  
ATOM 1835   O "O4'"  . A A 1 58  ? 81.851  116.248 60.201  1.00 0.00 ? 79  A A "O4'"  1  
ATOM 1836   C "C3'"  . A A 1 58  ? 79.628  115.810 60.804  1.00 0.00 ? 79  A A "C3'"  1  
ATOM 1837   O "O3'"  . A A 1 58  ? 78.406  115.193 60.432  1.00 0.00 ? 79  A A "O3'"  1  
ATOM 1838   C "C2'"  . A A 1 58  ? 80.511  114.935 61.683  1.00 0.00 ? 79  A A "C2'"  1  
ATOM 1839   O "O2'"  . A A 1 58  ? 80.564  113.602 61.195  1.00 0.00 ? 79  A A "O2'"  1  
ATOM 1840   C "C1'"  . A A 1 58  ? 81.879  115.590 61.487  1.00 0.00 ? 79  A A "C1'"  1  
ATOM 1841   N N9     . A A 1 58  ? 82.203  116.538 62.571  1.00 0.00 ? 79  A A N9     1  
ATOM 1842   C C8     . A A 1 58  ? 82.156  117.909 62.534  1.00 0.00 ? 79  A A C8     1  
ATOM 1843   N N7     . A A 1 58  ? 82.503  118.481 63.661  1.00 0.00 ? 79  A A N7     1  
ATOM 1844   C C5     . A A 1 58  ? 82.797  117.414 64.498  1.00 0.00 ? 79  A A C5     1  
ATOM 1845   C C6     . A A 1 58  ? 83.226  117.349 65.835  1.00 0.00 ? 79  A A C6     1  
ATOM 1846   N N6     . A A 1 58  ? 83.444  118.424 66.597  1.00 0.00 ? 79  A A N6     1  
ATOM 1847   N N1     . A A 1 58  ? 83.430  116.126 66.373  1.00 0.00 ? 79  A A N1     1  
ATOM 1848   C C2     . A A 1 58  ? 83.213  115.047 65.610  1.00 0.00 ? 79  A A C2     1  
ATOM 1849   N N3     . A A 1 58  ? 82.809  114.979 64.344  1.00 0.00 ? 79  A A N3     1  
ATOM 1850   C C4     . A A 1 58  ? 82.615  116.212 63.840  1.00 0.00 ? 79  A A C4     1  
ATOM 1851   H "H5'"  . A A 1 58  ? 80.860  117.456 58.111  1.00 0.00 ? 79  A A "H5'"  1  
ATOM 1852   H "H5''" . A A 1 58  ? 79.310  117.217 58.404  1.00 0.00 ? 79  A A "H5''" 1  
ATOM 1853   H "H4'"  . A A 1 58  ? 80.529  115.328 59.017  1.00 0.00 ? 79  A A "H4'"  1  
ATOM 1854   H "H3'"  . A A 1 58  ? 79.434  116.647 61.276  1.00 0.00 ? 79  A A "H3'"  1  
ATOM 1855   H "H2'"  . A A 1 58  ? 80.229  114.968 62.622  1.00 0.00 ? 79  A A "H2'"  1  
ATOM 1856   H "HO2'" . A A 1 58  ? 81.093  113.058 61.815  1.00 0.00 ? 79  A A "HO2'" 1  
ATOM 1857   H "H1'"  . A A 1 58  ? 82.569  114.896 61.445  1.00 0.00 ? 79  A A "H1'"  1  
ATOM 1858   H H8     . A A 1 58  ? 81.888  118.415 61.738  1.00 0.00 ? 79  A A H8     1  
ATOM 1859   H H61    . A A 1 58  ? 83.744  118.317 67.523  1.00 0.00 ? 79  A A H61    1  
ATOM 1860   H H62    . A A 1 58  ? 83.304  119.323 66.229  1.00 0.00 ? 79  A A H62    1  
ATOM 1861   H H2     . A A 1 58  ? 83.375  114.185 66.047  1.00 0.00 ? 79  A A H2     1  
ATOM 1862   P P      . U A 1 59  ? 77.091  115.398 61.335  1.00 0.00 ? 80  U A P      1  
ATOM 1863   O OP1    . U A 1 59  ? 75.950  114.753 60.636  1.00 0.00 ? 80  U A OP1    1  
ATOM 1864   O OP2    . U A 1 59  ? 77.009  116.833 61.706  1.00 0.00 ? 80  U A OP2    1  
ATOM 1865   O "O5'"  . U A 1 59  ? 77.398  114.562 62.656  1.00 0.00 ? 80  U A "O5'"  1  
ATOM 1866   C "C5'"  . U A 1 59  ? 77.524  113.149 62.612  1.00 0.00 ? 80  U A "C5'"  1  
ATOM 1867   C "C4'"  . U A 1 59  ? 77.972  112.589 63.941  1.00 0.00 ? 80  U A "C4'"  1  
ATOM 1868   O "O4'"  . U A 1 59  ? 79.276  113.122 64.288  1.00 0.00 ? 80  U A "O4'"  1  
ATOM 1869   C "C3'"  . U A 1 59  ? 77.102  112.931 65.139  1.00 0.00 ? 80  U A "C3'"  1  
ATOM 1870   O "O3'"  . U A 1 59  ? 75.936  112.128 65.226  1.00 0.00 ? 80  U A "O3'"  1  
ATOM 1871   C "C2'"  . U A 1 59  ? 78.059  112.747 66.309  1.00 0.00 ? 80  U A "C2'"  1  
ATOM 1872   O "O2'"  . U A 1 59  ? 78.228  111.373 66.625  1.00 0.00 ? 80  U A "O2'"  1  
ATOM 1873   C "C1'"  . U A 1 59  ? 79.363  113.286 65.722  1.00 0.00 ? 80  U A "C1'"  1  
ATOM 1874   N N1     . U A 1 59  ? 79.601  114.705 66.083  1.00 0.00 ? 80  U A N1     1  
ATOM 1875   C C2     . U A 1 59  ? 80.077  114.960 67.355  1.00 0.00 ? 80  U A C2     1  
ATOM 1876   O O2     . U A 1 59  ? 80.302  114.083 68.170  1.00 0.00 ? 80  U A O2     1  
ATOM 1877   N N3     . U A 1 59  ? 80.280  116.286 67.644  1.00 0.00 ? 80  U A N3     1  
ATOM 1878   C C4     . U A 1 59  ? 80.062  117.363 66.812  1.00 0.00 ? 80  U A C4     1  
ATOM 1879   O O4     . U A 1 59  ? 80.294  118.502 67.221  1.00 0.00 ? 80  U A O4     1  
ATOM 1880   C C5     . U A 1 59  ? 79.570  117.022 65.512  1.00 0.00 ? 80  U A C5     1  
ATOM 1881   C C6     . U A 1 59  ? 79.363  115.739 65.203  1.00 0.00 ? 80  U A C6     1  
ATOM 1882   H "H5'"  . U A 1 59  ? 78.183  112.908 61.927  1.00 0.00 ? 80  U A "H5'"  1  
ATOM 1883   H "H5''" . U A 1 59  ? 76.658  112.757 62.375  1.00 0.00 ? 80  U A "H5''" 1  
ATOM 1884   H "H4'"  . U A 1 59  ? 78.038  111.614 63.866  1.00 0.00 ? 80  U A "H4'"  1  
ATOM 1885   H "H3'"  . U A 1 59  ? 76.837  113.875 65.087  1.00 0.00 ? 80  U A "H3'"  1  
ATOM 1886   H "H2'"  . U A 1 59  ? 77.776  113.266 67.091  1.00 0.00 ? 80  U A "H2'"  1  
ATOM 1887   H "HO2'" . U A 1 59  ? 78.808  111.294 67.408  1.00 0.00 ? 80  U A "HO2'" 1  
ATOM 1888   H "H1'"  . U A 1 59  ? 80.115  112.742 66.041  1.00 0.00 ? 80  U A "H1'"  1  
ATOM 1889   H H3     . U A 1 59  ? 80.617  116.490 68.543  1.00 0.00 ? 80  U A H3     1  
ATOM 1890   H H5     . U A 1 59  ? 79.387  117.726 64.854  1.00 0.00 ? 80  U A H5     1  
ATOM 1891   H H6     . U A 1 59  ? 79.025  115.532 64.308  1.00 0.00 ? 80  U A H6     1  
ATOM 1892   P P      . C A 1 60  ? 74.516  112.820 65.489  1.00 0.00 ? 81  C A P      1  
ATOM 1893   O OP1    . C A 1 60  ? 73.439  111.820 65.278  1.00 0.00 ? 81  C A OP1    1  
ATOM 1894   O OP2    . C A 1 60  ? 74.578  114.024 64.623  1.00 0.00 ? 81  C A OP2    1  
ATOM 1895   O "O5'"  . C A 1 60  ? 74.447  113.305 67.005  1.00 0.00 ? 81  C A "O5'"  1  
ATOM 1896   C "C5'"  . C A 1 60  ? 75.101  114.494 67.422  1.00 0.00 ? 81  C A "C5'"  1  
ATOM 1897   C "C4'"  . C A 1 60  ? 75.764  114.323 68.767  1.00 0.00 ? 81  C A "C4'"  1  
ATOM 1898   O "O4'"  . C A 1 60  ? 76.969  115.090 68.687  1.00 0.00 ? 81  C A "O4'"  1  
ATOM 1899   C "C3'"  . C A 1 60  ? 75.043  114.945 69.953  1.00 0.00 ? 81  C A "C3'"  1  
ATOM 1900   O "O3'"  . C A 1 60  ? 74.135  114.054 70.577  1.00 0.00 ? 81  C A "O3'"  1  
ATOM 1901   C "C2'"  . C A 1 60  ? 76.177  115.239 70.907  1.00 0.00 ? 81  C A "C2'"  1  
ATOM 1902   O "O2'"  . C A 1 60  ? 76.578  114.068 71.604  1.00 0.00 ? 81  C A "O2'"  1  
ATOM 1903   C "C1'"  . C A 1 60  ? 77.279  115.646 69.947  1.00 0.00 ? 81  C A "C1'"  1  
ATOM 1904   N N1     . C A 1 60  ? 77.356  117.117 69.769  1.00 0.00 ? 81  C A N1     1  
ATOM 1905   C C2     . C A 1 60  ? 77.889  117.886 70.810  1.00 0.00 ? 81  C A C2     1  
ATOM 1906   O O2     . C A 1 60  ? 78.278  117.321 71.844  1.00 0.00 ? 81  C A O2     1  
ATOM 1907   N N3     . C A 1 60  ? 77.971  119.230 70.673  1.00 0.00 ? 81  C A N3     1  
ATOM 1908   C C4     . C A 1 60  ? 77.546  119.813 69.553  1.00 0.00 ? 81  C A C4     1  
ATOM 1909   N N4     . C A 1 60  ? 77.646  121.142 69.461  1.00 0.00 ? 81  C A N4     1  
ATOM 1910   C C5     . C A 1 60  ? 76.998  119.060 68.476  1.00 0.00 ? 81  C A C5     1  
ATOM 1911   C C6     . C A 1 60  ? 76.924  117.732 68.623  1.00 0.00 ? 81  C A C6     1  
ATOM 1912   H "H5'"  . C A 1 60  ? 74.443  115.217 67.479  1.00 0.00 ? 81  C A "H5'"  1  
ATOM 1913   H "H5''" . C A 1 60  ? 75.782  114.733 66.758  1.00 0.00 ? 81  C A "H5''" 1  
ATOM 1914   H "H4'"  . C A 1 60  ? 75.985  113.394 68.982  1.00 0.00 ? 81  C A "H4'"  1  
ATOM 1915   H "H3'"  . C A 1 60  ? 74.567  115.763 69.699  1.00 0.00 ? 81  C A "H3'"  1  
ATOM 1916   H "H2'"  . C A 1 60  ? 75.948  115.966 71.522  1.00 0.00 ? 81  C A "H2'"  1  
ATOM 1917   H "HO2'" . C A 1 60  ? 75.804  113.477 71.708  1.00 0.00 ? 81  C A "HO2'" 1  
ATOM 1918   H "H1'"  . C A 1 60  ? 78.137  115.313 70.282  1.00 0.00 ? 81  C A "H1'"  1  
ATOM 1919   H H41    . C A 1 60  ? 78.023  121.657 70.205  1.00 0.00 ? 81  C A H41    1  
ATOM 1920   H H42    . C A 1 60  ? 77.342  121.601 68.651  1.00 0.00 ? 81  C A H42    1  
ATOM 1921   H H5     . C A 1 60  ? 76.689  119.499 67.656  1.00 0.00 ? 81  C A H5     1  
ATOM 1922   H H6     . C A 1 60  ? 76.550  117.196 67.893  1.00 0.00 ? 81  C A H6     1  
ATOM 1923   P P      . G A 1 61  ? 72.581  114.441 70.702  1.00 0.00 ? 82  G A P      1  
ATOM 1924   O OP1    . G A 1 61  ? 71.804  113.512 69.842  1.00 0.00 ? 82  G A OP1    1  
ATOM 1925   O OP2    . G A 1 61  ? 72.454  115.906 70.502  1.00 0.00 ? 82  G A OP2    1  
ATOM 1926   O "O5'"  . G A 1 61  ? 72.224  114.118 72.222  1.00 0.00 ? 82  G A "O5'"  1  
ATOM 1927   C "C5'"  . G A 1 61  ? 73.182  114.309 73.252  1.00 0.00 ? 82  G A "C5'"  1  
ATOM 1928   C "C4'"  . G A 1 61  ? 72.618  115.124 74.390  1.00 0.00 ? 82  G A "C4'"  1  
ATOM 1929   O "O4'"  . G A 1 61  ? 71.753  116.164 73.867  1.00 0.00 ? 82  G A "O4'"  1  
ATOM 1930   C "C3'"  . G A 1 61  ? 71.738  114.372 75.377  1.00 0.00 ? 82  G A "C3'"  1  
ATOM 1931   O "O3'"  . G A 1 61  ? 72.482  113.657 76.349  1.00 0.00 ? 82  G A "O3'"  1  
ATOM 1932   C "C2'"  . G A 1 61  ? 70.875  115.482 75.962  1.00 0.00 ? 82  G A "C2'"  1  
ATOM 1933   O "O2'"  . G A 1 61  ? 71.592  116.236 76.927  1.00 0.00 ? 82  G A "O2'"  1  
ATOM 1934   C "C1'"  . G A 1 61  ? 70.626  116.355 74.733  1.00 0.00 ? 82  G A "C1'"  1  
ATOM 1935   N N9     . G A 1 61  ? 69.376  115.995 74.037  1.00 0.00 ? 82  G A N9     1  
ATOM 1936   C C8     . G A 1 61  ? 69.251  115.338 72.837  1.00 0.00 ? 82  G A C8     1  
ATOM 1937   N N7     . G A 1 61  ? 68.008  115.162 72.475  1.00 0.00 ? 82  G A N7     1  
ATOM 1938   C C5     . G A 1 61  ? 67.269  115.734 73.500  1.00 0.00 ? 82  G A C5     1  
ATOM 1939   C C6     . G A 1 61  ? 65.864  115.847 73.666  1.00 0.00 ? 82  G A C6     1  
ATOM 1940   O O6     . G A 1 61  ? 64.964  115.450 72.916  1.00 0.00 ? 82  G A O6     1  
ATOM 1941   N N1     . G A 1 61  ? 65.538  116.503 74.850  1.00 0.00 ? 82  G A N1     1  
ATOM 1942   C C2     . G A 1 61  ? 66.449  116.985 75.760  1.00 0.00 ? 82  G A C2     1  
ATOM 1943   N N2     . G A 1 61  ? 65.942  117.588 76.844  1.00 0.00 ? 82  G A N2     1  
ATOM 1944   N N3     . G A 1 61  ? 67.761  116.886 75.616  1.00 0.00 ? 82  G A N3     1  
ATOM 1945   C C4     . G A 1 61  ? 68.097  116.253 74.472  1.00 0.00 ? 82  G A C4     1  
ATOM 1946   H "H5'"  . G A 1 61  ? 73.963  114.771 72.882  1.00 0.00 ? 82  G A "H5'"  1  
ATOM 1947   H "H5''" . G A 1 61  ? 73.463  113.433 73.593  1.00 0.00 ? 82  G A "H5''" 1  
ATOM 1948   H "H4'"  . G A 1 61  ? 73.358  115.540 74.878  1.00 0.00 ? 82  G A "H4'"  1  
ATOM 1949   H "H3'"  . G A 1 61  ? 71.166  113.746 74.886  1.00 0.00 ? 82  G A "H3'"  1  
ATOM 1950   H "H2'"  . G A 1 61  ? 70.035  115.127 76.326  1.00 0.00 ? 82  G A "H2'"  1  
ATOM 1951   H "HO2'" . G A 1 61  ? 72.354  115.707 77.243  1.00 0.00 ? 82  G A "HO2'" 1  
ATOM 1952   H "H1'"  . G A 1 61  ? 70.590  117.297 75.004  1.00 0.00 ? 82  G A "H1'"  1  
ATOM 1953   H H8     . G A 1 61  ? 70.016  115.035 72.306  1.00 0.00 ? 82  G A H8     1  
ATOM 1954   H H1     . G A 1 61  ? 64.587  116.626 75.049  1.00 0.00 ? 82  G A H1     1  
ATOM 1955   H H21    . G A 1 61  ? 64.972  117.665 76.958  1.00 0.00 ? 82  G A H21    1  
ATOM 1956   H H22    . G A 1 61  ? 66.544  117.952 77.528  1.00 0.00 ? 82  G A H22    1  
ATOM 1957   P P      . G A 1 62  ? 71.892  112.301 76.977  1.00 0.00 ? 83  G A P      1  
ATOM 1958   O OP1    . G A 1 62  ? 72.972  111.648 77.761  1.00 0.00 ? 83  G A OP1    1  
ATOM 1959   O OP2    . G A 1 62  ? 71.215  111.547 75.893  1.00 0.00 ? 83  G A OP2    1  
ATOM 1960   O "O5'"  . G A 1 62  ? 70.778  112.802 78.000  1.00 0.00 ? 83  G A "O5'"  1  
ATOM 1961   C "C5'"  . G A 1 62  ? 71.135  113.512 79.177  1.00 0.00 ? 83  G A "C5'"  1  
ATOM 1962   C "C4'"  . G A 1 62  ? 69.916  114.018 79.909  1.00 0.00 ? 83  G A "C4'"  1  
ATOM 1963   O "O4'"  . G A 1 62  ? 69.166  114.919 79.054  1.00 0.00 ? 83  G A "O4'"  1  
ATOM 1964   C "C3'"  . G A 1 62  ? 68.899  112.963 80.319  1.00 0.00 ? 83  G A "C3'"  1  
ATOM 1965   O "O3'"  . G A 1 62  ? 69.252  112.286 81.514  1.00 0.00 ? 83  G A "O3'"  1  
ATOM 1966   C "C2'"  . G A 1 62  ? 67.613  113.770 80.433  1.00 0.00 ? 83  G A "C2'"  1  
ATOM 1967   O "O2'"  . G A 1 62  ? 67.573  114.509 81.645  1.00 0.00 ? 83  G A "O2'"  1  
ATOM 1968   C "C1'"  . G A 1 62  ? 67.759  114.742 79.262  1.00 0.00 ? 83  G A "C1'"  1  
ATOM 1969   N N9     . G A 1 62  ? 67.108  114.240 78.037  1.00 0.00 ? 83  G A N9     1  
ATOM 1970   C C8     . G A 1 62  ? 67.723  113.758 76.908  1.00 0.00 ? 83  G A C8     1  
ATOM 1971   N N7     . G A 1 62  ? 66.880  113.385 75.983  1.00 0.00 ? 83  G A N7     1  
ATOM 1972   C C5     . G A 1 62  ? 65.632  113.634 76.536  1.00 0.00 ? 83  G A C5     1  
ATOM 1973   C C6     . G A 1 62  ? 64.333  113.430 76.004  1.00 0.00 ? 83  G A C6     1  
ATOM 1974   O O6     . G A 1 62  ? 64.015  112.973 74.900  1.00 0.00 ? 83  G A O6     1  
ATOM 1975   N N1     . G A 1 62  ? 63.344  113.822 76.901  1.00 0.00 ? 83  G A N1     1  
ATOM 1976   C C2     . G A 1 62  ? 63.574  114.342 78.152  1.00 0.00 ? 83  G A C2     1  
ATOM 1977   N N2     . G A 1 62  ? 62.489  114.659 78.875  1.00 0.00 ? 83  G A N2     1  
ATOM 1978   N N3     . G A 1 62  ? 64.781  114.536 78.659  1.00 0.00 ? 83  G A N3     1  
ATOM 1979   C C4     . G A 1 62  ? 65.754  114.163 77.804  1.00 0.00 ? 83  G A C4     1  
ATOM 1980   H "H5'"  . G A 1 62  ? 71.700  114.274 78.931  1.00 0.00 ? 83  G A "H5'"  1  
ATOM 1981   H "H5''" . G A 1 62  ? 71.640  112.917 79.768  1.00 0.00 ? 83  G A "H5''" 1  
ATOM 1982   H "H4'"  . G A 1 62  ? 70.206  114.505 80.708  1.00 0.00 ? 83  G A "H4'"  1  
ATOM 1983   H "H3'"  . G A 1 62  ? 68.805  112.309 79.596  1.00 0.00 ? 83  G A "H3'"  1  
ATOM 1984   H "H2'"  . G A 1 62  ? 66.822  113.200 80.328  1.00 0.00 ? 83  G A "H2'"  1  
ATOM 1985   H "HO2'" . G A 1 62  ? 66.708  114.965 81.711  1.00 0.00 ? 83  G A "HO2'" 1  
ATOM 1986   H "H1'"  . G A 1 62  ? 67.370  115.608 79.507  1.00 0.00 ? 83  G A "H1'"  1  
ATOM 1987   H H8     . G A 1 62  ? 68.696  113.699 76.803  1.00 0.00 ? 83  G A H8     1  
ATOM 1988   H H1     . G A 1 62  ? 62.412  113.716 76.618  1.00 0.00 ? 83  G A H1     1  
ATOM 1989   H H21    . G A 1 62  ? 61.593  114.518 78.505  1.00 0.00 ? 83  G A H21    1  
ATOM 1990   H H22    . G A 1 62  ? 62.594  115.034 79.774  1.00 0.00 ? 83  G A H22    1  
ATOM 1991   P P      . U A 1 63  ? 68.796  110.763 81.743  1.00 0.00 ? 84  U A P      1  
ATOM 1992   O OP1    . U A 1 63  ? 69.504  110.246 82.943  1.00 0.00 ? 84  U A OP1    1  
ATOM 1993   O OP2    . U A 1 63  ? 68.925  110.046 80.450  1.00 0.00 ? 84  U A OP2    1  
ATOM 1994   O "O5'"  . U A 1 63  ? 67.247  110.873 82.095  1.00 0.00 ? 84  U A "O5'"  1  
ATOM 1995   C "C5'"  . U A 1 63  ? 66.815  111.476 83.304  1.00 0.00 ? 84  U A "C5'"  1  
ATOM 1996   C "C4'"  . U A 1 63  ? 65.311  111.562 83.378  1.00 0.00 ? 84  U A "C4'"  1  
ATOM 1997   O "O4'"  . U A 1 63  ? 64.809  112.397 82.302  1.00 0.00 ? 84  U A "O4'"  1  
ATOM 1998   C "C3'"  . U A 1 63  ? 64.556  110.251 83.212  1.00 0.00 ? 84  U A "C3'"  1  
ATOM 1999   O "O3'"  . U A 1 63  ? 64.493  109.493 84.409  1.00 0.00 ? 84  U A "O3'"  1  
ATOM 2000   C "C2'"  . U A 1 63  ? 63.194  110.713 82.711  1.00 0.00 ? 84  U A "C2'"  1  
ATOM 2001   O "O2'"  . U A 1 63  ? 62.398  111.217 83.771  1.00 0.00 ? 84  U A "O2'"  1  
ATOM 2002   C "C1'"  . U A 1 63  ? 63.585  111.869 81.789  1.00 0.00 ? 84  U A "C1'"  1  
ATOM 2003   N N1     . U A 1 63  ? 63.765  111.433 80.383  1.00 0.00 ? 84  U A N1     1  
ATOM 2004   C C2     . U A 1 63  ? 62.620  111.218 79.639  1.00 0.00 ? 84  U A C2     1  
ATOM 2005   O O2     . U A 1 63  ? 61.497  111.371 80.087  1.00 0.00 ? 84  U A O2     1  
ATOM 2006   N N3     . U A 1 63  ? 62.834  110.815 78.345  1.00 0.00 ? 84  U A N3     1  
ATOM 2007   C C4     . U A 1 63  ? 64.050  110.610 77.728  1.00 0.00 ? 84  U A C4     1  
ATOM 2008   O O4     . U A 1 63  ? 64.077  110.245 76.550  1.00 0.00 ? 84  U A O4     1  
ATOM 2009   C C5     . U A 1 63  ? 65.190  110.853 78.558  1.00 0.00 ? 84  U A C5     1  
ATOM 2010   C C6     . U A 1 63  ? 65.011  111.245 79.823  1.00 0.00 ? 84  U A C6     1  
ATOM 2011   H "H5'"  . U A 1 63  ? 67.188  112.380 83.363  1.00 0.00 ? 84  U A "H5'"  1  
ATOM 2012   H "H5''" . U A 1 63  ? 67.141  110.945 84.061  1.00 0.00 ? 84  U A "H5''" 1  
ATOM 2013   H "H4'"  . U A 1 63  ? 65.061  111.965 84.236  1.00 0.00 ? 84  U A "H4'"  1  
ATOM 2014   H "H3'"  . U A 1 63  ? 64.989  109.715 82.515  1.00 0.00 ? 84  U A "H3'"  1  
ATOM 2015   H "H2'"  . U A 1 63  ? 62.733  110.003 82.217  1.00 0.00 ? 84  U A "H2'"  1  
ATOM 2016   H "HO2'" . U A 1 63  ? 61.505  111.429 83.429  1.00 0.00 ? 84  U A "HO2'" 1  
ATOM 2017   H "H1'"  . U A 1 63  ? 62.894  112.564 81.827  1.00 0.00 ? 84  U A "H1'"  1  
ATOM 2018   H H3     . U A 1 63  ? 62.036  110.657 77.799  1.00 0.00 ? 84  U A H3     1  
ATOM 2019   H H5     . U A 1 63  ? 66.095  110.731 78.200  1.00 0.00 ? 84  U A H5     1  
ATOM 2020   H H6     . U A 1 63  ? 65.806  111.403 80.370  1.00 0.00 ? 84  U A H6     1  
ATOM 2021   P P      . U A 1 64  ? 64.422  107.888 84.348  1.00 0.00 ? 85  U A P      1  
ATOM 2022   O OP1    . U A 1 64  ? 64.593  107.368 85.728  1.00 0.00 ? 85  U A OP1    1  
ATOM 2023   O OP2    . U A 1 64  ? 65.338  107.430 83.271  1.00 0.00 ? 85  U A OP2    1  
ATOM 2024   O "O5'"  . U A 1 64  ? 62.927  107.586 83.887  1.00 0.00 ? 85  U A "O5'"  1  
ATOM 2025   C "C5'"  . U A 1 64  ? 61.830  107.869 84.741  1.00 0.00 ? 85  U A "C5'"  1  
ATOM 2026   C "C4'"  . U A 1 64  ? 60.511  107.610 84.058  1.00 0.00 ? 85  U A "C4'"  1  
ATOM 2027   O "O4'"  . U A 1 64  ? 60.366  108.488 82.911  1.00 0.00 ? 85  U A "O4'"  1  
ATOM 2028   C "C3'"  . U A 1 64  ? 60.317  106.216 83.480  1.00 0.00 ? 85  U A "C3'"  1  
ATOM 2029   O "O3'"  . U A 1 64  ? 59.922  105.263 84.454  1.00 0.00 ? 85  U A "O3'"  1  
ATOM 2030   C "C2'"  . U A 1 64  ? 59.276  106.447 82.395  1.00 0.00 ? 85  U A "C2'"  1  
ATOM 2031   O "O2'"  . U A 1 64  ? 57.974  106.570 82.946  1.00 0.00 ? 85  U A "O2'"  1  
ATOM 2032   C "C1'"  . U A 1 64  ? 59.710  107.805 81.839  1.00 0.00 ? 85  U A "C1'"  1  
ATOM 2033   N N1     . U A 1 64  ? 60.623  107.671 80.678  1.00 0.00 ? 85  U A N1     1  
ATOM 2034   C C2     . U A 1 64  ? 60.049  107.364 79.458  1.00 0.00 ? 85  U A C2     1  
ATOM 2035   O O2     . U A 1 64  ? 58.851  107.201 79.309  1.00 0.00 ? 85  U A O2     1  
ATOM 2036   N N3     . U A 1 64  ? 60.931  107.251 78.411  1.00 0.00 ? 85  U A N3     1  
ATOM 2037   C C4     . U A 1 64  ? 62.300  107.411 78.456  1.00 0.00 ? 85  U A C4     1  
ATOM 2038   O O4     . U A 1 64  ? 62.958  107.276 77.423  1.00 0.00 ? 85  U A O4     1  
ATOM 2039   C C5     . U A 1 64  ? 62.822  107.730 79.750  1.00 0.00 ? 85  U A C5     1  
ATOM 2040   C C6     . U A 1 64  ? 61.986  107.847 80.787  1.00 0.00 ? 85  U A C6     1  
ATOM 2041   H "H5'"  . U A 1 64  ? 61.870  108.810 85.012  1.00 0.00 ? 85  U A "H5'"  1  
ATOM 2042   H "H5''" . U A 1 64  ? 61.892  107.303 85.539  1.00 0.00 ? 85  U A "H5''" 1  
ATOM 2043   H "H4'"  . U A 1 64  ? 59.786  107.794 84.692  1.00 0.00 ? 85  U A "H4'"  1  
ATOM 2044   H "H3'"  . U A 1 64  ? 61.155  105.920 83.065  1.00 0.00 ? 85  U A "H3'"  1  
ATOM 2045   H "H2'"  . U A 1 64  ? 59.314  105.751 81.706  1.00 0.00 ? 85  U A "H2'"  1  
ATOM 2046   H "HO2'" . U A 1 64  ? 57.323  106.636 82.218  1.00 0.00 ? 85  U A "HO2'" 1  
ATOM 2047   H "H1'"  . U A 1 64  ? 58.918  108.317 81.571  1.00 0.00 ? 85  U A "H1'"  1  
ATOM 2048   H H3     . U A 1 64  ? 60.545  107.033 77.538  1.00 0.00 ? 85  U A H3     1  
ATOM 2049   H H5     . U A 1 64  ? 63.785  107.862 79.874  1.00 0.00 ? 85  U A H5     1  
ATOM 2050   H H6     . U A 1 64  ? 62.368  108.064 81.660  1.00 0.00 ? 85  U A H6     1  
ATOM 2051   P P      . U A 1 65  ? 60.339  103.719 84.291  1.00 0.00 ? 86  U A P      1  
ATOM 2052   O OP1    . U A 1 65  ? 60.016  103.020 85.562  1.00 0.00 ? 86  U A OP1    1  
ATOM 2053   O OP2    . U A 1 65  ? 61.722  103.672 83.758  1.00 0.00 ? 86  U A OP2    1  
ATOM 2054   O "O5'"  . U A 1 65  ? 59.354  103.173 83.164  1.00 0.00 ? 86  U A "O5'"  1  
ATOM 2055   C "C5'"  . U A 1 65  ? 57.965  103.033 83.415  1.00 0.00 ? 86  U A "C5'"  1  
ATOM 2056   C "C4'"  . U A 1 65  ? 57.216  102.598 82.178  1.00 0.00 ? 86  U A "C4'"  1  
ATOM 2057   O "O4'"  . U A 1 65  ? 57.333  103.612 81.145  1.00 0.00 ? 86  U A "O4'"  1  
ATOM 2058   C "C3'"  . U A 1 65  ? 57.714  101.327 81.506  1.00 0.00 ? 86  U A "C3'"  1  
ATOM 2059   O "O3'"  . U A 1 65  ? 57.232  100.147 82.127  1.00 0.00 ? 86  U A "O3'"  1  
ATOM 2060   C "C2'"  . U A 1 65  ? 57.240  101.500 80.071  1.00 0.00 ? 86  U A "C2'"  1  
ATOM 2061   O "O2'"  . U A 1 65  ? 55.854  101.214 79.947  1.00 0.00 ? 86  U A "O2'"  1  
ATOM 2062   C "C1'"  . U A 1 65  ? 57.456  103.001 79.858  1.00 0.00 ? 86  U A "C1'"  1  
ATOM 2063   N N1     . U A 1 65  ? 58.784  103.299 79.271  1.00 0.00 ? 86  U A N1     1  
ATOM 2064   C C2     . U A 1 65  ? 58.929  103.104 77.910  1.00 0.00 ? 86  U A C2     1  
ATOM 2065   O O2     . U A 1 65  ? 58.028  102.707 77.194  1.00 0.00 ? 86  U A O2     1  
ATOM 2066   N N3     . U A 1 65  ? 60.176  103.394 77.410  1.00 0.00 ? 86  U A N3     1  
ATOM 2067   C C4     . U A 1 65  ? 61.270  103.849 78.116  1.00 0.00 ? 86  U A C4     1  
ATOM 2068   O O4     . U A 1 65  ? 62.327  104.063 77.519  1.00 0.00 ? 86  U A O4     1  
ATOM 2069   C C5     . U A 1 65  ? 61.045  104.027 79.517  1.00 0.00 ? 86  U A C5     1  
ATOM 2070   C C6     . U A 1 65  ? 59.841  103.753 80.030  1.00 0.00 ? 86  U A C6     1  
ATOM 2071   H "H5'"  . U A 1 65  ? 57.605  103.894 83.716  1.00 0.00 ? 86  U A "H5'"  1  
ATOM 2072   H "H5''" . U A 1 65  ? 57.831  102.365 84.118  1.00 0.00 ? 86  U A "H5''" 1  
ATOM 2073   H "H4'"  . U A 1 65  ? 56.269  102.486 82.406  1.00 0.00 ? 86  U A "H4'"  1  
ATOM 2074   H "H3'"  . U A 1 65  ? 58.695  101.319 81.521  1.00 0.00 ? 86  U A "H3'"  1  
ATOM 2075   H "H2'"  . U A 1 65  ? 57.777  100.969 79.446  1.00 0.00 ? 86  U A "H2'"  1  
ATOM 2076   H "HO2'" . U A 1 65  ? 55.602  101.255 79.002  1.00 0.00 ? 86  U A "HO2'" 1  
ATOM 2077   H "H1'"  . U A 1 65  ? 56.757  103.350 79.268  1.00 0.00 ? 86  U A "H1'"  1  
ATOM 2078   H H3     . U A 1 65  ? 60.301  103.264 76.447  1.00 0.00 ? 86  U A H3     1  
ATOM 2079   H H5     . U A 1 65  ? 61.768  104.347 80.097  1.00 0.00 ? 86  U A H5     1  
ATOM 2080   H H6     . U A 1 65  ? 59.714  103.882 80.993  1.00 0.00 ? 86  U A H6     1  
ATOM 2081   P P      . A A 1 66  ? 58.108  98.800  82.097  1.00 0.00 ? 87  A A P      1  
ATOM 2082   O OP1    . A A 1 66  ? 57.446  97.800  82.971  1.00 0.00 ? 87  A A OP1    1  
ATOM 2083   O OP2    . A A 1 66  ? 59.525  99.167  82.343  1.00 0.00 ? 87  A A OP2    1  
ATOM 2084   O "O5'"  . A A 1 66  ? 57.986  98.295  80.590  1.00 0.00 ? 87  A A "O5'"  1  
ATOM 2085   C "C5'"  . A A 1 66  ? 56.746  97.831  80.074  1.00 0.00 ? 87  A A "C5'"  1  
ATOM 2086   C "C4'"  . A A 1 66  ? 56.832  97.556  78.593  1.00 0.00 ? 87  A A "C4'"  1  
ATOM 2087   O "O4'"  . A A 1 66  ? 57.153  98.780  77.882  1.00 0.00 ? 87  A A "O4'"  1  
ATOM 2088   C "C3'"  . A A 1 66  ? 57.914  96.580  78.157  1.00 0.00 ? 87  A A "C3'"  1  
ATOM 2089   O "O3'"  . A A 1 66  ? 57.536  95.223  78.322  1.00 0.00 ? 87  A A "O3'"  1  
ATOM 2090   C "C2'"  . A A 1 66  ? 58.153  96.976  76.707  1.00 0.00 ? 87  A A "C2'"  1  
ATOM 2091   O "O2'"  . A A 1 66  ? 57.133  96.467  75.860  1.00 0.00 ? 87  A A "O2'"  1  
ATOM 2092   C "C1'"  . A A 1 66  ? 58.024  98.498  76.782  1.00 0.00 ? 87  A A "C1'"  1  
ATOM 2093   N N9     . A A 1 66  ? 59.331  99.158  76.959  1.00 0.00 ? 87  A A N9     1  
ATOM 2094   C C8     . A A 1 66  ? 59.839  99.732  78.097  1.00 0.00 ? 87  A A C8     1  
ATOM 2095   N N7     . A A 1 66  ? 61.036  100.244 77.944  1.00 0.00 ? 87  A A N7     1  
ATOM 2096   C C5     . A A 1 66  ? 61.337  99.990  76.613  1.00 0.00 ? 87  A A C5     1  
ATOM 2097   C C6     . A A 1 66  ? 62.465  100.282 75.825  1.00 0.00 ? 87  A A C6     1  
ATOM 2098   N N6     . A A 1 66  ? 63.543  100.920 76.283  1.00 0.00 ? 87  A A N6     1  
ATOM 2099   N N1     . A A 1 66  ? 62.446  99.892  74.531  1.00 0.00 ? 87  A A N1     1  
ATOM 2100   C C2     . A A 1 66  ? 61.363  99.252  74.071  1.00 0.00 ? 87  A A C2     1  
ATOM 2101   N N3     . A A 1 66  ? 60.245  98.920  74.712  1.00 0.00 ? 87  A A N3     1  
ATOM 2102   C C4     . A A 1 66  ? 60.296  99.323  75.993  1.00 0.00 ? 87  A A C4     1  
ATOM 2103   H "H5'"  . A A 1 66  ? 56.060  98.512  80.234  1.00 0.00 ? 87  A A "H5'"  1  
ATOM 2104   H "H5''" . A A 1 66  ? 56.493  97.007  80.540  1.00 0.00 ? 87  A A "H5''" 1  
ATOM 2105   H "H4'"  . A A 1 66  ? 55.962  97.225  78.284  1.00 0.00 ? 87  A A "H4'"  1  
ATOM 2106   H "H3'"  . A A 1 66  ? 58.729  96.750  78.674  1.00 0.00 ? 87  A A "H3'"  1  
ATOM 2107   H "H2'"  . A A 1 66  ? 59.045  96.706  76.402  1.00 0.00 ? 87  A A "H2'"  1  
ATOM 2108   H "HO2'" . A A 1 66  ? 56.683  95.723  76.314  1.00 0.00 ? 87  A A "HO2'" 1  
ATOM 2109   H "H1'"  . A A 1 66  ? 57.598  98.829  75.963  1.00 0.00 ? 87  A A "H1'"  1  
ATOM 2110   H H8     . A A 1 66  ? 59.353  99.757  78.948  1.00 0.00 ? 87  A A H8     1  
ATOM 2111   H H61    . A A 1 66  ? 64.299  101.097 75.685  1.00 0.00 ? 87  A A H61    1  
ATOM 2112   H H62    . A A 1 66  ? 63.579  101.214 77.217  1.00 0.00 ? 87  A A H62    1  
ATOM 2113   H H2     . A A 1 66  ? 61.399  98.989  73.126  1.00 0.00 ? 87  A A H2     1  
ATOM 2114   P P      . A A 1 67  ? 58.508  94.216  79.102  1.00 0.00 ? 88  A A P      1  
ATOM 2115   O OP1    . A A 1 67  ? 57.690  93.304  79.940  1.00 0.00 ? 88  A A OP1    1  
ATOM 2116   O OP2    . A A 1 67  ? 59.478  95.135  79.748  1.00 0.00 ? 88  A A OP2    1  
ATOM 2117   O "O5'"  . A A 1 67  ? 59.301  93.331  78.040  1.00 0.00 ? 88  A A "O5'"  1  
ATOM 2118   C "C5'"  . A A 1 67  ? 58.818  92.055  77.648  1.00 0.00 ? 88  A A "C5'"  1  
ATOM 2119   C "C4'"  . A A 1 67  ? 58.790  91.909  76.147  1.00 0.00 ? 88  A A "C4'"  1  
ATOM 2120   O "O4'"  . A A 1 67  ? 58.636  93.221  75.545  1.00 0.00 ? 88  A A "O4'"  1  
ATOM 2121   C "C3'"  . A A 1 67  ? 60.049  91.344  75.508  1.00 0.00 ? 88  A A "C3'"  1  
ATOM 2122   O "O3'"  . A A 1 67  ? 60.096  89.928  75.535  1.00 0.00 ? 88  A A "O3'"  1  
ATOM 2123   C "C2'"  . A A 1 67  ? 60.003  91.918  74.096  1.00 0.00 ? 88  A A "C2'"  1  
ATOM 2124   O "O2'"  . A A 1 67  ? 59.122  91.175  73.267  1.00 0.00 ? 88  A A "O2'"  1  
ATOM 2125   C "C1'"  . A A 1 67  ? 59.400  93.302  74.344  1.00 0.00 ? 88  A A "C1'"  1  
ATOM 2126   N N9     . A A 1 67  ? 60.436  94.337  74.521  1.00 0.00 ? 88  A A N9     1  
ATOM 2127   C C8     . A A 1 67  ? 60.767  95.013  75.669  1.00 0.00 ? 88  A A C8     1  
ATOM 2128   N N7     . A A 1 67  ? 61.737  95.880  75.512  1.00 0.00 ? 88  A A N7     1  
ATOM 2129   C C5     . A A 1 67  ? 62.069  95.768  74.168  1.00 0.00 ? 88  A A C5     1  
ATOM 2130   C C6     . A A 1 67  ? 63.026  96.421  73.372  1.00 0.00 ? 88  A A C6     1  
ATOM 2131   N N6     . A A 1 67  ? 63.861  97.355  73.833  1.00 0.00 ? 88  A A N6     1  
ATOM 2132   N N1     . A A 1 67  ? 63.099  96.076  72.068  1.00 0.00 ? 88  A A N1     1  
ATOM 2133   C C2     . A A 1 67  ? 62.262  95.139  71.604  1.00 0.00 ? 88  A A C2     1  
ATOM 2134   N N3     . A A 1 67  ? 61.321  94.456  72.253  1.00 0.00 ? 88  A A N3     1  
ATOM 2135   C C4     . A A 1 67  ? 61.276  94.821  73.547  1.00 0.00 ? 88  A A C4     1  
ATOM 2136   H "H5'"  . A A 1 67  ? 57.910  91.936  77.997  1.00 0.00 ? 88  A A "H5'"  1  
ATOM 2137   H "H5''" . A A 1 67  ? 59.398  91.362  78.026  1.00 0.00 ? 88  A A "H5''" 1  
ATOM 2138   H "H4'"  . A A 1 67  ? 58.026  91.352  75.890  1.00 0.00 ? 88  A A "H4'"  1  
ATOM 2139   H "H3'"  . A A 1 67  ? 60.833  91.700  75.978  1.00 0.00 ? 88  A A "H3'"  1  
ATOM 2140   H "H2'"  . A A 1 67  ? 60.900  91.985  73.707  1.00 0.00 ? 88  A A "H2'"  1  
ATOM 2141   H "HO2'" . A A 1 67  ? 59.118  91.572  72.371  1.00 0.00 ? 88  A A "HO2'" 1  
ATOM 2142   H "H1'"  . A A 1 67  ? 58.821  93.545  73.590  1.00 0.00 ? 88  A A "H1'"  1  
ATOM 2143   H H8     . A A 1 67  ? 60.319  94.861  76.528  1.00 0.00 ? 88  A A H8     1  
ATOM 2144   H H61    . A A 1 67  ? 64.508  97.775  73.229  1.00 0.00 ? 88  A A H61    1  
ATOM 2145   H H62    . A A 1 67  ? 63.826  97.621  74.776  1.00 0.00 ? 88  A A H62    1  
ATOM 2146   H H2     . A A 1 67  ? 62.355  94.925  70.652  1.00 0.00 ? 88  A A H2     1  
ATOM 2147   P P      . A A 1 68  ? 61.486  89.171  75.816  1.00 0.00 ? 89  A A P      1  
ATOM 2148   O OP1    . A A 1 68  ? 61.193  87.729  76.013  1.00 0.00 ? 89  A A OP1    1  
ATOM 2149   O OP2    . A A 1 68  ? 62.214  89.923  76.869  1.00 0.00 ? 89  A A OP2    1  
ATOM 2150   O "O5'"  . A A 1 68  ? 62.293  89.328  74.451  1.00 0.00 ? 89  A A "O5'"  1  
ATOM 2151   C "C5'"  . A A 1 68  ? 61.733  88.897  73.219  1.00 0.00 ? 89  A A "C5'"  1  
ATOM 2152   C "C4'"  . A A 1 68  ? 62.546  89.377  72.042  1.00 0.00 ? 89  A A "C4'"  1  
ATOM 2153   O "O4'"  . A A 1 68  ? 62.354  90.804  71.860  1.00 0.00 ? 89  A A "O4'"  1  
ATOM 2154   C "C3'"  . A A 1 68  ? 64.053  89.216  72.164  1.00 0.00 ? 89  A A "C3'"  1  
ATOM 2155   O "O3'"  . A A 1 68  ? 64.500  87.909  71.845  1.00 0.00 ? 89  A A "O3'"  1  
ATOM 2156   C "C2'"  . A A 1 68  ? 64.578  90.287  71.217  1.00 0.00 ? 89  A A "C2'"  1  
ATOM 2157   O "O2'"  . A A 1 68  ? 64.480  89.871  69.863  1.00 0.00 ? 89  A A "O2'"  1  
ATOM 2158   C "C1'"  . A A 1 68  ? 63.584  91.423  71.463  1.00 0.00 ? 89  A A "C1'"  1  
ATOM 2159   N N9     . A A 1 68  ? 64.050  92.359  72.503  1.00 0.00 ? 89  A A N9     1  
ATOM 2160   C C8     . A A 1 68  ? 63.620  92.458  73.803  1.00 0.00 ? 89  A A C8     1  
ATOM 2161   N N7     . A A 1 68  ? 64.229  93.392  74.491  1.00 0.00 ? 89  A A N7     1  
ATOM 2162   C C5     . A A 1 68  ? 65.123  93.944  73.584  1.00 0.00 ? 89  A A C5     1  
ATOM 2163   C C6     . A A 1 68  ? 66.065  94.983  73.695  1.00 0.00 ? 89  A A C6     1  
ATOM 2164   N N6     . A A 1 68  ? 66.273  95.676  74.816  1.00 0.00 ? 89  A A N6     1  
ATOM 2165   N N1     . A A 1 68  ? 66.798  95.285  72.602  1.00 0.00 ? 89  A A N1     1  
ATOM 2166   C C2     . A A 1 68  ? 66.592  94.588  71.478  1.00 0.00 ? 89  A A C2     1  
ATOM 2167   N N3     . A A 1 68  ? 65.736  93.594  71.251  1.00 0.00 ? 89  A A N3     1  
ATOM 2168   C C4     . A A 1 68  ? 65.024  93.317  72.356  1.00 0.00 ? 89  A A C4     1  
ATOM 2169   H "H5'"  . A A 1 68  ? 60.820  89.248  73.141  1.00 0.00 ? 89  A A "H5'"  1  
ATOM 2170   H "H5''" . A A 1 68  ? 61.700  87.919  73.207  1.00 0.00 ? 89  A A "H5''" 1  
ATOM 2171   H "H4'"  . A A 1 68  ? 62.241  88.909  71.236  1.00 0.00 ? 89  A A "H4'"  1  
ATOM 2172   H "H3'"  . A A 1 68  ? 64.328  89.435  73.080  1.00 0.00 ? 89  A A "H3'"  1  
ATOM 2173   H "H2'"  . A A 1 68  ? 65.492  90.556  71.450  1.00 0.00 ? 89  A A "H2'"  1  
ATOM 2174   H "HO2'" . A A 1 68  ? 64.403  88.895  69.834  1.00 0.00 ? 89  A A "HO2'" 1  
ATOM 2175   H "H1'"  . A A 1 68  ? 63.436  91.913  70.625  1.00 0.00 ? 89  A A "H1'"  1  
ATOM 2176   H H8     . A A 1 68  ? 62.921  91.886  74.181  1.00 0.00 ? 89  A A H8     1  
ATOM 2177   H H61    . A A 1 68  ? 66.946  96.391  74.834  1.00 0.00 ? 89  A A H61    1  
ATOM 2178   H H62    . A A 1 68  ? 65.752  95.474  75.622  1.00 0.00 ? 89  A A H62    1  
ATOM 2179   H H2     . A A 1 68  ? 67.149  94.848  70.714  1.00 0.00 ? 89  A A H2     1  
ATOM 2180   P P      . A A 1 69  ? 65.819  87.312  72.546  1.00 0.00 ? 90  A A P      1  
ATOM 2181   O OP1    . A A 1 69  ? 65.884  85.861  72.243  1.00 0.00 ? 90  A A OP1    1  
ATOM 2182   O OP2    . A A 1 69  ? 65.836  87.770  73.958  1.00 0.00 ? 90  A A OP2    1  
ATOM 2183   O "O5'"  . A A 1 69  ? 67.018  88.031  71.781  1.00 0.00 ? 90  A A "O5'"  1  
ATOM 2184   C "C5'"  . A A 1 69  ? 67.291  87.740  70.418  1.00 0.00 ? 90  A A "C5'"  1  
ATOM 2185   C "C4'"  . A A 1 69  ? 68.399  88.606  69.876  1.00 0.00 ? 90  A A "C4'"  1  
ATOM 2186   O "O4'"  . A A 1 69  ? 68.003  90.001  69.927  1.00 0.00 ? 90  A A "O4'"  1  
ATOM 2187   C "C3'"  . A A 1 69  ? 69.713  88.567  70.644  1.00 0.00 ? 90  A A "C3'"  1  
ATOM 2188   O "O3'"  . A A 1 69  ? 70.520  87.451  70.304  1.00 0.00 ? 90  A A "O3'"  1  
ATOM 2189   C "C2'"  . A A 1 69  ? 70.343  89.907  70.293  1.00 0.00 ? 90  A A "C2'"  1  
ATOM 2190   O "O2'"  . A A 1 69  ? 70.912  89.884  68.992  1.00 0.00 ? 90  A A "O2'"  1  
ATOM 2191   C "C1'"  . A A 1 69  ? 69.120  90.826  70.284  1.00 0.00 ? 90  A A "C1'"  1  
ATOM 2192   N N9     . A A 1 69  ? 68.893  91.458  71.597  1.00 0.00 ? 90  A A N9     1  
ATOM 2193   C C8     . A A 1 69  ? 67.939  91.138  72.533  1.00 0.00 ? 90  A A C8     1  
ATOM 2194   N N7     . A A 1 69  ? 67.984  91.884  73.610  1.00 0.00 ? 90  A A N7     1  
ATOM 2195   C C5     . A A 1 69  ? 69.037  92.755  73.368  1.00 0.00 ? 90  A A C5     1  
ATOM 2196   C C6     . A A 1 69  ? 69.598  93.798  74.126  1.00 0.00 ? 90  A A C6     1  
ATOM 2197   N N6     . A A 1 69  ? 69.157  94.154  75.335  1.00 0.00 ? 90  A A N6     1  
ATOM 2198   N N1     . A A 1 69  ? 70.642  94.471  73.595  1.00 0.00 ? 90  A A N1     1  
ATOM 2199   C C2     . A A 1 69  ? 71.087  94.113  72.383  1.00 0.00 ? 90  A A C2     1  
ATOM 2200   N N3     . A A 1 69  ? 70.643  93.152  71.574  1.00 0.00 ? 90  A A N3     1  
ATOM 2201   C C4     . A A 1 69  ? 69.605  92.503  72.133  1.00 0.00 ? 90  A A C4     1  
ATOM 2202   H "H5'"  . A A 1 69  ? 66.480  87.891  69.888  1.00 0.00 ? 90  A A "H5'"  1  
ATOM 2203   H "H5''" . A A 1 69  ? 67.553  86.798  70.337  1.00 0.00 ? 90  A A "H5''" 1  
ATOM 2204   H "H4'"  . A A 1 69  ? 68.570  88.357  68.943  1.00 0.00 ? 90  A A "H4'"  1  
ATOM 2205   H "H3'"  . A A 1 69  ? 69.522  88.543  71.605  1.00 0.00 ? 90  A A "H3'"  1  
ATOM 2206   H "H2'"  . A A 1 69  ? 70.997  90.184  70.969  1.00 0.00 ? 90  A A "H2'"  1  
ATOM 2207   H "HO2'" . A A 1 69  ? 71.064  88.952  68.727  1.00 0.00 ? 90  A A "HO2'" 1  
ATOM 2208   H "H1'"  . A A 1 69  ? 69.241  91.520  69.604  1.00 0.00 ? 90  A A "H1'"  1  
ATOM 2209   H H8     . A A 1 69  ? 67.284  90.417  72.409  1.00 0.00 ? 90  A A H8     1  
ATOM 2210   H H61    . A A 1 69  ? 69.589  94.890  75.817  1.00 0.00 ? 90  A A H61    1  
ATOM 2211   H H62    . A A 1 69  ? 68.400  93.681  75.740  1.00 0.00 ? 90  A A H62    1  
ATOM 2212   H H2     . A A 1 69  ? 71.845  94.631  72.043  1.00 0.00 ? 90  A A H2     1  
ATOM 2213   P P      . G A 1 70  ? 71.483  86.786  71.406  1.00 0.00 ? 91  G A P      1  
ATOM 2214   O OP1    . G A 1 70  ? 71.969  85.490  70.868  1.00 0.00 ? 91  G A OP1    1  
ATOM 2215   O OP2    . G A 1 70  ? 70.779  86.820  72.713  1.00 0.00 ? 91  G A OP2    1  
ATOM 2216   O "O5'"  . G A 1 70  ? 72.723  87.782  71.487  1.00 0.00 ? 91  G A "O5'"  1  
ATOM 2217   C "C5'"  . G A 1 70  ? 73.621  87.917  70.396  1.00 0.00 ? 91  G A "C5'"  1  
ATOM 2218   C "C4'"  . G A 1 70  ? 74.563  89.081  70.594  1.00 0.00 ? 91  G A "C4'"  1  
ATOM 2219   O "O4'"  . G A 1 70  ? 73.800  90.307  70.753  1.00 0.00 ? 91  G A "O4'"  1  
ATOM 2220   C "C3'"  . G A 1 70  ? 75.439  89.027  71.836  1.00 0.00 ? 91  G A "C3'"  1  
ATOM 2221   O "O3'"  . G A 1 70  ? 76.593  88.221  71.665  1.00 0.00 ? 91  G A "O3'"  1  
ATOM 2222   C "C2'"  . G A 1 70  ? 75.753  90.496  72.084  1.00 0.00 ? 91  G A "C2'"  1  
ATOM 2223   O "O2'"  . G A 1 70  ? 76.751  90.969  71.191  1.00 0.00 ? 91  G A "O2'"  1  
ATOM 2224   C "C1'"  . G A 1 70  ? 74.418  91.156  71.733  1.00 0.00 ? 91  G A "C1'"  1  
ATOM 2225   N N9     . G A 1 70  ? 73.555  91.326  72.916  1.00 0.00 ? 91  G A N9     1  
ATOM 2226   C C8     . G A 1 70  ? 72.408  90.629  73.216  1.00 0.00 ? 91  G A C8     1  
ATOM 2227   N N7     . G A 1 70  ? 71.856  91.004  74.338  1.00 0.00 ? 91  G A N7     1  
ATOM 2228   C C5     . G A 1 70  ? 72.688  92.010  74.808  1.00 0.00 ? 91  G A C5     1  
ATOM 2229   C C6     . G A 1 70  ? 72.603  92.796  75.986  1.00 0.00 ? 91  G A C6     1  
ATOM 2230   O O6     . G A 1 70  ? 71.746  92.760  76.877  1.00 0.00 ? 91  G A O6     1  
ATOM 2231   N N1     . G A 1 70  ? 73.657  93.702  76.075  1.00 0.00 ? 91  G A N1     1  
ATOM 2232   C C2     . G A 1 70  ? 74.663  93.833  75.150  1.00 0.00 ? 91  G A C2     1  
ATOM 2233   N N2     . G A 1 70  ? 75.593  94.765  75.411  1.00 0.00 ? 91  G A N2     1  
ATOM 2234   N N3     . G A 1 70  ? 74.754  93.106  74.049  1.00 0.00 ? 91  G A N3     1  
ATOM 2235   C C4     . G A 1 70  ? 73.741  92.221  73.943  1.00 0.00 ? 91  G A C4     1  
ATOM 2236   H "H5'"  . G A 1 70  ? 73.109  88.055  69.573  1.00 0.00 ? 91  G A "H5'"  1  
ATOM 2237   H "H5''" . G A 1 70  ? 74.147  87.092  70.312  1.00 0.00 ? 91  G A "H5''" 1  
ATOM 2238   H "H4'"  . G A 1 70  ? 75.135  89.163  69.803  1.00 0.00 ? 91  G A "H4'"  1  
ATOM 2239   H "H3'"  . G A 1 70  ? 74.913  88.679  72.585  1.00 0.00 ? 91  G A "H3'"  1  
ATOM 2240   H "H2'"  . G A 1 70  ? 75.997  90.658  73.019  1.00 0.00 ? 91  G A "H2'"  1  
ATOM 2241   H "HO2'" . G A 1 70  ? 77.246  90.204  70.833  1.00 0.00 ? 91  G A "HO2'" 1  
ATOM 2242   H "H1'"  . G A 1 70  ? 74.585  92.031  71.323  1.00 0.00 ? 91  G A "H1'"  1  
ATOM 2243   H H8     . G A 1 70  ? 72.040  89.921  72.646  1.00 0.00 ? 91  G A H8     1  
ATOM 2244   H H1     . G A 1 70  ? 73.680  94.289  76.859  1.00 0.00 ? 91  G A H1     1  
ATOM 2245   H H21    . G A 1 70  ? 75.533  95.307  76.224  1.00 0.00 ? 91  G A H21    1  
ATOM 2246   H H22    . G A 1 70  ? 76.336  94.903  74.785  1.00 0.00 ? 91  G A H22    1  
ATOM 2247   P P      . G A 1 71  ? 77.311  87.558  72.941  1.00 0.00 ? 92  G A P      1  
ATOM 2248   O OP1    . G A 1 71  ? 78.326  86.591  72.448  1.00 0.00 ? 92  G A OP1    1  
ATOM 2249   O OP2    . G A 1 71  ? 76.253  87.101  73.877  1.00 0.00 ? 92  G A OP2    1  
ATOM 2250   O "O5'"  . G A 1 71  ? 78.082  88.775  73.623  1.00 0.00 ? 92  G A "O5'"  1  
ATOM 2251   C "C5'"  . G A 1 71  ? 79.169  89.410  72.967  1.00 0.00 ? 92  G A "C5'"  1  
ATOM 2252   C "C4'"  . G A 1 71  ? 79.755  90.517  73.807  1.00 0.00 ? 92  G A "C4'"  1  
ATOM 2253   O "O4'"  . G A 1 71  ? 78.765  91.563  73.997  1.00 0.00 ? 92  G A "O4'"  1  
ATOM 2254   C "C3'"  . G A 1 71  ? 80.167  90.136  75.221  1.00 0.00 ? 92  G A "C3'"  1  
ATOM 2255   O "O3'"  . G A 1 71  ? 81.426  89.487  75.273  1.00 0.00 ? 92  G A "O3'"  1  
ATOM 2256   C "C2'"  . G A 1 71  ? 80.138  91.473  75.948  1.00 0.00 ? 92  G A "C2'"  1  
ATOM 2257   O "O2'"  . G A 1 71  ? 81.290  92.248  75.647  1.00 0.00 ? 92  G A "O2'"  1  
ATOM 2258   C "C1'"  . G A 1 71  ? 78.915  92.138  75.315  1.00 0.00 ? 92  G A "C1'"  1  
ATOM 2259   N N9     . G A 1 71  ? 77.694  91.929  76.116  1.00 0.00 ? 92  G A N9     1  
ATOM 2260   C C8     . G A 1 71  ? 76.621  91.128  75.804  1.00 0.00 ? 92  G A C8     1  
ATOM 2261   N N7     . G A 1 71  ? 75.684  91.148  76.712  1.00 0.00 ? 92  G A N7     1  
ATOM 2262   C C5     . G A 1 71  ? 76.165  92.012  77.683  1.00 0.00 ? 92  G A C5     1  
ATOM 2263   C C6     . G A 1 71  ? 75.590  92.430  78.911  1.00 0.00 ? 92  G A C6     1  
ATOM 2264   O O6     . G A 1 71  ? 74.501  92.106  79.400  1.00 0.00 ? 92  G A O6     1  
ATOM 2265   N N1     . G A 1 71  ? 76.419  93.315  79.594  1.00 0.00 ? 92  G A N1     1  
ATOM 2266   C C2     . G A 1 71  ? 77.647  93.744  79.151  1.00 0.00 ? 92  G A C2     1  
ATOM 2267   N N2     . G A 1 71  ? 78.302  94.602  79.949  1.00 0.00 ? 92  G A N2     1  
ATOM 2268   N N3     . G A 1 71  ? 78.195  93.364  78.009  1.00 0.00 ? 92  G A N3     1  
ATOM 2269   C C4     . G A 1 71  ? 77.406  92.504  77.331  1.00 0.00 ? 92  G A C4     1  
ATOM 2270   H "H5'"  . G A 1 71  ? 78.856  89.782  72.117  1.00 0.00 ? 92  G A "H5'"  1  
ATOM 2271   H "H5''" . G A 1 71  ? 79.866  88.743  72.786  1.00 0.00 ? 92  G A "H5''" 1  
ATOM 2272   H "H4'"  . G A 1 71  ? 80.529  90.894  73.341  1.00 0.00 ? 92  G A "H4'"  1  
ATOM 2273   H "H3'"  . G A 1 71  ? 79.486  89.548  75.607  1.00 0.00 ? 92  G A "H3'"  1  
ATOM 2274   H "H2'"  . G A 1 71  ? 80.023  91.354  76.914  1.00 0.00 ? 92  G A "H2'"  1  
ATOM 2275   H "HO2'" . G A 1 71  ? 81.993  91.658  75.308  1.00 0.00 ? 92  G A "HO2'" 1  
ATOM 2276   H "H1'"  . G A 1 71  ? 79.080  93.099  75.216  1.00 0.00 ? 92  G A "H1'"  1  
ATOM 2277   H H8     . G A 1 71  ? 76.563  90.599  74.981  1.00 0.00 ? 92  G A H8     1  
ATOM 2278   H H1     . G A 1 71  ? 76.102  93.658  80.454  1.00 0.00 ? 92  G A H1     1  
ATOM 2279   H H21    . G A 1 71  ? 77.901  94.888  80.796  1.00 0.00 ? 92  G A H21    1  
ATOM 2280   H H22    . G A 1 71  ? 79.182  94.943  79.685  1.00 0.00 ? 92  G A H22    1  
ATOM 2281   P P      . C A 1 72  ? 81.702  88.347  76.372  1.00 0.00 ? 93  C A P      1  
ATOM 2282   O OP1    . C A 1 72  ? 83.041  87.764  76.105  1.00 0.00 ? 93  C A OP1    1  
ATOM 2283   O OP2    . C A 1 72  ? 80.513  87.459  76.422  1.00 0.00 ? 93  C A OP2    1  
ATOM 2284   O "O5'"  . C A 1 72  ? 81.779  89.147  77.748  1.00 0.00 ? 93  C A "O5'"  1  
ATOM 2285   C "C5'"  . C A 1 72  ? 82.826  90.071  77.997  1.00 0.00 ? 93  C A "C5'"  1  
ATOM 2286   C "C4'"  . C A 1 72  ? 82.631  90.798  79.306  1.00 0.00 ? 93  C A "C4'"  1  
ATOM 2287   O "O4'"  . C A 1 72  ? 81.418  91.593  79.251  1.00 0.00 ? 93  C A "O4'"  1  
ATOM 2288   C "C3'"  . C A 1 72  ? 82.446  89.923  80.537  1.00 0.00 ? 93  C A "C3'"  1  
ATOM 2289   O "O3'"  . C A 1 72  ? 83.671  89.446  81.067  1.00 0.00 ? 93  C A "O3'"  1  
ATOM 2290   C "C2'"  . C A 1 72  ? 81.685  90.839  81.483  1.00 0.00 ? 93  C A "C2'"  1  
ATOM 2291   O "O2'"  . C A 1 72  ? 82.552  91.781  82.098  1.00 0.00 ? 93  C A "O2'"  1  
ATOM 2292   C "C1'"  . C A 1 72  ? 80.757  91.576  80.516  1.00 0.00 ? 93  C A "C1'"  1  
ATOM 2293   N N1     . C A 1 72  ? 79.431  90.923  80.398  1.00 0.00 ? 93  C A N1     1  
ATOM 2294   C C2     . C A 1 72  ? 78.510  91.094  81.439  1.00 0.00 ? 93  C A C2     1  
ATOM 2295   O O2     . C A 1 72  ? 78.827  91.780  82.422  1.00 0.00 ? 93  C A O2     1  
ATOM 2296   N N3     . C A 1 72  ? 77.294  90.507  81.356  1.00 0.00 ? 93  C A N3     1  
ATOM 2297   C C4     . C A 1 72  ? 76.976  89.774  80.289  1.00 0.00 ? 93  C A C4     1  
ATOM 2298   N N4     . C A 1 72  ? 75.765  89.214  80.250  1.00 0.00 ? 93  C A N4     1  
ATOM 2299   C C5     . C A 1 72  ? 77.892  89.580  79.215  1.00 0.00 ? 93  C A C5     1  
ATOM 2300   C C6     . C A 1 72  ? 79.091  90.166  79.308  1.00 0.00 ? 93  C A C6     1  
ATOM 2301   H "H5'"  . C A 1 72  ? 82.854  90.726  77.269  1.00 0.00 ? 93  C A "H5'"  1  
ATOM 2302   H "H5''" . C A 1 72  ? 83.677  89.587  78.024  1.00 0.00 ? 93  C A "H5''" 1  
ATOM 2303   H "H4'"  . C A 1 72  ? 83.395  91.393  79.451  1.00 0.00 ? 93  C A "H4'"  1  
ATOM 2304   H "H3'"  . C A 1 72  ? 81.877  89.158  80.305  1.00 0.00 ? 93  C A "H3'"  1  
ATOM 2305   H "H2'"  . C A 1 72  ? 81.175  90.328  82.147  1.00 0.00 ? 93  C A "H2'"  1  
ATOM 2306   H "HO2'" . C A 1 72  ? 83.474  91.453  82.040  1.00 0.00 ? 93  C A "HO2'" 1  
ATOM 2307   H "H1'"  . C A 1 72  ? 80.637  92.502  80.820  1.00 0.00 ? 93  C A "H1'"  1  
ATOM 2308   H H41    . C A 1 72  ? 75.139  89.349  80.992  1.00 0.00 ? 93  C A H41    1  
ATOM 2309   H H42    . C A 1 72  ? 75.503  88.670  79.480  1.00 0.00 ? 93  C A H42    1  
ATOM 2310   H H5     . C A 1 72  ? 77.649  89.040  78.434  1.00 0.00 ? 93  C A H5     1  
ATOM 2311   H H6     . C A 1 72  ? 79.733  90.045  78.579  1.00 0.00 ? 93  C A H6     1  
ATOM 2312   P P      . A A 1 73  ? 83.721  88.047  81.856  1.00 0.00 ? 94  A A P      1  
ATOM 2313   O OP1    . A A 1 73  ? 85.069  87.907  82.462  1.00 0.00 ? 94  A A OP1    1  
ATOM 2314   O OP2    . A A 1 73  ? 83.210  86.989  80.949  1.00 0.00 ? 94  A A OP2    1  
ATOM 2315   O "O5'"  . A A 1 73  ? 82.667  88.233  83.037  1.00 0.00 ? 94  A A "O5'"  1  
ATOM 2316   C "C5'"  . A A 1 73  ? 82.945  89.091  84.134  1.00 0.00 ? 94  A A "C5'"  1  
ATOM 2317   C "C4'"  . A A 1 73  ? 81.717  89.330  84.975  1.00 0.00 ? 94  A A "C4'"  1  
ATOM 2318   O "O4'"  . A A 1 73  ? 80.637  89.787  84.131  1.00 0.00 ? 94  A A "O4'"  1  
ATOM 2319   C "C3'"  . A A 1 73  ? 81.132  88.107  85.665  1.00 0.00 ? 94  A A "C3'"  1  
ATOM 2320   O "O3'"  . A A 1 73  ? 81.731  87.837  86.920  1.00 0.00 ? 94  A A "O3'"  1  
ATOM 2321   C "C2'"  . A A 1 73  ? 79.668  88.474  85.783  1.00 0.00 ? 94  A A "C2'"  1  
ATOM 2322   O "O2'"  . A A 1 73  ? 79.453  89.392  86.845  1.00 0.00 ? 94  A A "O2'"  1  
ATOM 2323   C "C1'"  . A A 1 73  ? 79.433  89.187  84.451  1.00 0.00 ? 94  A A "C1'"  1  
ATOM 2324   N N9     . A A 1 73  ? 79.072  88.246  83.373  1.00 0.00 ? 94  A A N9     1  
ATOM 2325   C C8     . A A 1 73  ? 79.874  87.768  82.366  1.00 0.00 ? 94  A A C8     1  
ATOM 2326   N N7     . A A 1 73  ? 79.265  86.940  81.554  1.00 0.00 ? 94  A A N7     1  
ATOM 2327   C C5     . A A 1 73  ? 77.974  86.867  82.059  1.00 0.00 ? 94  A A C5     1  
ATOM 2328   C C6     . A A 1 73  ? 76.834  86.155  81.646  1.00 0.00 ? 94  A A C6     1  
ATOM 2329   N N6     . A A 1 73  ? 76.812  85.345  80.585  1.00 0.00 ? 94  A A N6     1  
ATOM 2330   N N1     . A A 1 73  ? 75.704  86.303  82.369  1.00 0.00 ? 94  A A N1     1  
ATOM 2331   C C2     . A A 1 73  ? 75.726  87.115  83.434  1.00 0.00 ? 94  A A C2     1  
ATOM 2332   N N3     . A A 1 73  ? 76.733  87.837  83.921  1.00 0.00 ? 94  A A N3     1  
ATOM 2333   C C4     . A A 1 73  ? 77.842  87.666  83.179  1.00 0.00 ? 94  A A C4     1  
ATOM 2334   H "H5'"  . A A 1 73  ? 83.270  89.951  83.793  1.00 0.00 ? 94  A A "H5'"  1  
ATOM 2335   H "H5''" . A A 1 73  ? 83.641  88.685  84.691  1.00 0.00 ? 94  A A "H5''" 1  
ATOM 2336   H "H4'"  . A A 1 73  ? 81.918  90.021  85.641  1.00 0.00 ? 94  A A "H4'"  1  
ATOM 2337   H "H3'"  . A A 1 73  ? 81.222  87.330  85.073  1.00 0.00 ? 94  A A "H3'"  1  
ATOM 2338   H "H2'"  . A A 1 73  ? 79.104  87.678  85.870  1.00 0.00 ? 94  A A "H2'"  1  
ATOM 2339   H "HO2'" . A A 1 73  ? 78.529  89.303  87.160  1.00 0.00 ? 94  A A "HO2'" 1  
ATOM 2340   H "H1'"  . A A 1 73  ? 78.719  89.850  84.558  1.00 0.00 ? 94  A A "H1'"  1  
ATOM 2341   H H8     . A A 1 73  ? 80.815  88.022  82.265  1.00 0.00 ? 94  A A H8     1  
ATOM 2342   H H61    . A A 1 73  ? 75.986  84.874  80.345  1.00 0.00 ? 94  A A H61    1  
ATOM 2343   H H62    . A A 1 73  ? 77.620  85.221  80.044  1.00 0.00 ? 94  A A H62    1  
ATOM 2344   H H2     . A A 1 73  ? 74.880  87.188  83.925  1.00 0.00 ? 94  A A H2     1  
ATOM 2345   P P      . A A 1 74  ? 81.447  86.439  87.652  1.00 0.00 ? 95  A A P      1  
ATOM 2346   O OP1    . A A 1 74  ? 82.454  86.239  88.723  1.00 0.00 ? 95  A A OP1    1  
ATOM 2347   O OP2    . A A 1 74  ? 81.383  85.486  86.516  1.00 0.00 ? 95  A A OP2    1  
ATOM 2348   O "O5'"  . A A 1 74  ? 80.006  86.491  88.332  1.00 0.00 ? 95  A A "O5'"  1  
ATOM 2349   C "C5'"  . A A 1 74  ? 79.353  85.300  88.745  1.00 0.00 ? 95  A A "C5'"  1  
ATOM 2350   C "C4'"  . A A 1 74  ? 78.807  85.425  90.145  1.00 0.00 ? 95  A A "C4'"  1  
ATOM 2351   O "O4'"  . A A 1 74  ? 77.952  84.285  90.478  1.00 0.00 ? 95  A A "O4'"  1  
ATOM 2352   C "C3'"  . A A 1 74  ? 79.839  85.520  91.258  1.00 0.00 ? 95  A A "C3'"  1  
ATOM 2353   O "O3'"  . A A 1 74  ? 79.426  86.351  92.329  1.00 0.00 ? 95  A A "O3'"  1  
ATOM 2354   C "C2'"  . A A 1 74  ? 79.882  84.092  91.809  1.00 0.00 ? 95  A A "C2'"  1  
ATOM 2355   O "O2'"  . A A 1 74  ? 80.249  84.081  93.181  1.00 0.00 ? 95  A A "O2'"  1  
ATOM 2356   C "C1'"  . A A 1 74  ? 78.428  83.695  91.676  1.00 0.00 ? 95  A A "C1'"  1  
ATOM 2357   N N9     . A A 1 74  ? 78.259  82.235  91.552  1.00 0.00 ? 95  A A N9     1  
ATOM 2358   C C8     . A A 1 74  ? 79.136  81.327  91.012  1.00 0.00 ? 95  A A C8     1  
ATOM 2359   N N7     . A A 1 74  ? 78.703  80.091  91.044  1.00 0.00 ? 95  A A N7     1  
ATOM 2360   C C5     . A A 1 74  ? 77.456  80.190  91.646  1.00 0.00 ? 95  A A C5     1  
ATOM 2361   C C6     . A A 1 74  ? 76.481  79.230  91.970  1.00 0.00 ? 95  A A C6     1  
ATOM 2362   N N6     . A A 1 74  ? 76.618  77.925  91.725  1.00 0.00 ? 95  A A N6     1  
ATOM 2363   N N1     . A A 1 74  ? 75.348  79.661  92.565  1.00 0.00 ? 95  A A N1     1  
ATOM 2364   C C2     . A A 1 74  ? 75.211  80.970  92.812  1.00 0.00 ? 95  A A C2     1  
ATOM 2365   N N3     . A A 1 74  ? 76.054  81.967  92.554  1.00 0.00 ? 95  A A N3     1  
ATOM 2366   C C4     . A A 1 74  ? 77.171  81.505  91.964  1.00 0.00 ? 95  A A C4     1  
ATOM 2367   H "H5'"  . A A 1 74  ? 79.992  84.557  88.717  1.00 0.00 ? 95  A A "H5'"  1  
ATOM 2368   H "H5''" . A A 1 74  ? 78.615  85.109  88.130  1.00 0.00 ? 95  A A "H5''" 1  
ATOM 2369   H "H4'"  . A A 1 74  ? 78.252  86.233  90.158  1.00 0.00 ? 95  A A "H4'"  1  
ATOM 2370   H "H3'"  . A A 1 74  ? 80.712  85.826  90.932  1.00 0.00 ? 95  A A "H3'"  1  
ATOM 2371   H "H2'"  . A A 1 74  ? 80.467  83.517  91.272  1.00 0.00 ? 95  A A "H2'"  1  
ATOM 2372   H "HO2'" . A A 1 74  ? 81.217  83.951  93.251  1.00 0.00 ? 95  A A "HO2'" 1  
ATOM 2373   H "H1'"  . A A 1 74  ? 77.930  84.017  92.458  1.00 0.00 ? 95  A A "H1'"  1  
ATOM 2374   H H8     . A A 1 74  ? 80.006  81.580  90.638  1.00 0.00 ? 95  A A H8     1  
ATOM 2375   H H61    . A A 1 74  ? 75.903  77.302  91.974  1.00 0.00 ? 95  A A H61    1  
ATOM 2376   H H62    . A A 1 74  ? 77.431  77.589  91.294  1.00 0.00 ? 95  A A H62    1  
ATOM 2377   H H2     . A A 1 74  ? 74.371  81.231  93.245  1.00 0.00 ? 95  A A H2     1  
ATOM 2378   P P      . G A 1 75  ? 80.469  87.364  93.014  1.00 0.00 ? 96  G A P      1  
ATOM 2379   O OP1    . G A 1 75  ? 81.393  86.570  93.864  1.00 0.00 ? 96  G A OP1    1  
ATOM 2380   O OP2    . G A 1 75  ? 79.697  88.481  93.614  1.00 0.00 ? 96  G A OP2    1  
ATOM 2381   O "O5'"  . G A 1 75  ? 81.305  87.945  91.788  1.00 0.00 ? 96  G A "O5'"  1  
ATOM 2382   C "C5'"  . G A 1 75  ? 81.390  89.343  91.562  1.00 0.00 ? 96  G A "C5'"  1  
ATOM 2383   C "C4'"  . G A 1 75  ? 80.197  89.854  90.792  1.00 0.00 ? 96  G A "C4'"  1  
ATOM 2384   O "O4'"  . G A 1 75  ? 79.051  89.960  91.676  1.00 0.00 ? 96  G A "O4'"  1  
ATOM 2385   C "C3'"  . G A 1 75  ? 80.333  91.246  90.194  1.00 0.00 ? 96  G A "C3'"  1  
ATOM 2386   O "O3'"  . G A 1 75  ? 81.057  91.256  88.975  1.00 0.00 ? 96  G A "O3'"  1  
ATOM 2387   C "C2'"  . G A 1 75  ? 78.885  91.689  90.049  1.00 0.00 ? 96  G A "C2'"  1  
ATOM 2388   O "O2'"  . G A 1 75  ? 78.277  91.097  88.911  1.00 0.00 ? 96  G A "O2'"  1  
ATOM 2389   C "C1'"  . G A 1 75  ? 78.259  91.097  91.312  1.00 0.00 ? 96  G A "C1'"  1  
ATOM 2390   N N9     . G A 1 75  ? 78.206  92.073  92.417  1.00 0.00 ? 96  G A N9     1  
ATOM 2391   C C8     . G A 1 75  ? 78.985  92.089  93.548  1.00 0.00 ? 96  G A C8     1  
ATOM 2392   N N7     . G A 1 75  ? 78.706  93.082  94.350  1.00 0.00 ? 96  G A N7     1  
ATOM 2393   C C5     . G A 1 75  ? 77.680  93.761  93.708  1.00 0.00 ? 96  G A C5     1  
ATOM 2394   C C6     . G A 1 75  ? 76.966  94.926  94.095  1.00 0.00 ? 96  G A C6     1  
ATOM 2395   O O6     . G A 1 75  ? 77.103  95.609  95.117  1.00 0.00 ? 96  G A O6     1  
ATOM 2396   N N1     . G A 1 75  ? 76.008  95.276  93.150  1.00 0.00 ? 96  G A N1     1  
ATOM 2397   C C2     . G A 1 75  ? 75.766  94.596  91.982  1.00 0.00 ? 96  G A C2     1  
ATOM 2398   N N2     . G A 1 75  ? 74.797  95.089  91.195  1.00 0.00 ? 96  G A N2     1  
ATOM 2399   N N3     . G A 1 75  ? 76.424  93.510  91.610  1.00 0.00 ? 96  G A N3     1  
ATOM 2400   C C4     . G A 1 75  ? 77.360  93.152  92.513  1.00 0.00 ? 96  G A C4     1  
ATOM 2401   H "H5'"  . G A 1 75  ? 82.206  89.538  91.056  1.00 0.00 ? 96  G A "H5'"  1  
ATOM 2402   H "H5''" . G A 1 75  ? 81.434  89.805  92.427  1.00 0.00 ? 96  G A "H5''" 1  
ATOM 2403   H "H4'"  . G A 1 75  ? 79.988  89.218  90.075  1.00 0.00 ? 96  G A "H4'"  1  
ATOM 2404   H "H3'"  . G A 1 75  ? 80.784  91.830  90.839  1.00 0.00 ? 96  G A "H3'"  1  
ATOM 2405   H "H2'"  . G A 1 75  ? 78.808  92.666  90.035  1.00 0.00 ? 96  G A "H2'"  1  
ATOM 2406   H "HO2'" . G A 1 75  ? 78.978  90.797  88.295  1.00 0.00 ? 96  G A "HO2'" 1  
ATOM 2407   H "H1'"  . G A 1 75  ? 77.351  90.785  91.109  1.00 0.00 ? 96  G A "H1'"  1  
ATOM 2408   H H8     . G A 1 75  ? 79.680  91.424  93.736  1.00 0.00 ? 96  G A H8     1  
ATOM 2409   H H1     . G A 1 75  ? 75.464  96.072  93.334  1.00 0.00 ? 96  G A H1     1  
ATOM 2410   H H21    . G A 1 75  ? 74.306  95.891  91.463  1.00 0.00 ? 96  G A H21    1  
ATOM 2411   H H22    . G A 1 75  ? 74.581  94.644  90.348  1.00 0.00 ? 96  G A H22    1  
ATOM 2412   P P      . A A 1 76  ? 81.864  92.573  88.527  1.00 0.00 ? 97  A A P      1  
ATOM 2413   O OP1    . A A 1 76  ? 82.602  92.257  87.278  1.00 0.00 ? 97  A A OP1    1  
ATOM 2414   O OP2    . A A 1 76  ? 82.603  93.084  89.708  1.00 0.00 ? 97  A A OP2    1  
ATOM 2415   O "O5'"  . A A 1 76  ? 80.719  93.623  88.170  1.00 0.00 ? 97  A A "O5'"  1  
ATOM 2416   C "C5'"  . A A 1 76  ? 79.955  93.492  86.981  1.00 0.00 ? 97  A A "C5'"  1  
ATOM 2417   C "C4'"  . A A 1 76  ? 78.917  94.580  86.866  1.00 0.00 ? 97  A A "C4'"  1  
ATOM 2418   O "O4'"  . A A 1 76  ? 78.016  94.522  88.003  1.00 0.00 ? 97  A A "O4'"  1  
ATOM 2419   C "C3'"  . A A 1 76  ? 79.444  96.007  86.883  1.00 0.00 ? 97  A A "C3'"  1  
ATOM 2420   O "O3'"  . A A 1 76  ? 79.959  96.422  85.629  1.00 0.00 ? 97  A A "O3'"  1  
ATOM 2421   C "C2'"  . A A 1 76  ? 78.228  96.805  87.336  1.00 0.00 ? 97  A A "C2'"  1  
ATOM 2422   O "O2'"  . A A 1 76  ? 77.307  96.990  86.272  1.00 0.00 ? 97  A A "O2'"  1  
ATOM 2423   C "C1'"  . A A 1 76  ? 77.610  95.858  88.368  1.00 0.00 ? 97  A A "C1'"  1  
ATOM 2424   N N9     . A A 1 76  ? 78.028  96.186  89.744  1.00 0.00 ? 97  A A N9     1  
ATOM 2425   C C8     . A A 1 76  ? 78.939  95.528  90.531  1.00 0.00 ? 97  A A C8     1  
ATOM 2426   N N7     . A A 1 76  ? 79.098  96.062  91.716  1.00 0.00 ? 97  A A N7     1  
ATOM 2427   C C5     . A A 1 76  ? 78.232  97.147  91.712  1.00 0.00 ? 97  A A C5     1  
ATOM 2428   C C6     . A A 1 76  ? 77.931  98.122  92.678  1.00 0.00 ? 97  A A C6     1  
ATOM 2429   N N6     . A A 1 76  ? 78.494  98.164  93.888  1.00 0.00 ? 97  A A N6     1  
ATOM 2430   N N1     . A A 1 76  ? 77.022  99.067  92.357  1.00 0.00 ? 97  A A N1     1  
ATOM 2431   C C2     . A A 1 76  ? 76.455  99.025  91.144  1.00 0.00 ? 97  A A C2     1  
ATOM 2432   N N3     . A A 1 76  ? 76.656  98.161  90.152  1.00 0.00 ? 97  A A N3     1  
ATOM 2433   C C4     . A A 1 76  ? 77.566  97.235  90.503  1.00 0.00 ? 97  A A C4     1  
ATOM 2434   H "H5'"  . A A 1 76  ? 79.504  92.620  86.984  1.00 0.00 ? 97  A A "H5'"  1  
ATOM 2435   H "H5''" . A A 1 76  ? 80.554  93.538  86.206  1.00 0.00 ? 97  A A "H5''" 1  
ATOM 2436   H "H4'"  . A A 1 76  ? 78.401  94.443  86.045  1.00 0.00 ? 97  A A "H4'"  1  
ATOM 2437   H "H3'"  . A A 1 76  ? 80.147  96.083  87.561  1.00 0.00 ? 97  A A "H3'"  1  
ATOM 2438   H "H2'"  . A A 1 76  ? 78.489  97.658  87.745  1.00 0.00 ? 97  A A "H2'"  1  
ATOM 2439   H "HO2'" . A A 1 76  ? 77.772  96.857  85.420  1.00 0.00 ? 97  A A "HO2'" 1  
ATOM 2440   H "H1'"  . A A 1 76  ? 76.633  95.899  88.302  1.00 0.00 ? 97  A A "H1'"  1  
ATOM 2441   H H8     . A A 1 76  ? 79.425  94.731  90.232  1.00 0.00 ? 97  A A H8     1  
ATOM 2442   H H61    . A A 1 76  ? 78.244  98.869  94.522  1.00 0.00 ? 97  A A H61    1  
ATOM 2443   H H62    . A A 1 76  ? 79.157  97.489  94.145  1.00 0.00 ? 97  A A H62    1  
ATOM 2444   H H2     . A A 1 76  ? 75.803  99.733  90.959  1.00 0.00 ? 97  A A H2     1  
ATOM 2445   P P      . C A 1 77  ? 81.122  97.526  85.577  1.00 0.00 ? 98  C A P      1  
ATOM 2446   O OP1    . C A 1 77  ? 82.340  96.923  84.980  1.00 0.00 ? 98  C A OP1    1  
ATOM 2447   O OP2    . C A 1 77  ? 81.159  98.024  86.975  1.00 0.00 ? 98  C A OP2    1  
ATOM 2448   O "O5'"  . C A 1 77  ? 80.657  98.727  84.637  1.00 0.00 ? 98  C A "O5'"  1  
ATOM 2449   C "C5'"  . C A 1 77  ? 81.236  100.020 84.779  1.00 0.00 ? 98  C A "C5'"  1  
ATOM 2450   C "C4'"  . C A 1 77  ? 80.222  100.992 85.328  1.00 0.00 ? 98  C A "C4'"  1  
ATOM 2451   O "O4'"  . C A 1 77  ? 79.568  100.401 86.479  1.00 0.00 ? 98  C A "O4'"  1  
ATOM 2452   C "C3'"  . C A 1 77  ? 80.786  102.291 85.863  1.00 0.00 ? 98  C A "C3'"  1  
ATOM 2453   O "O3'"  . C A 1 77  ? 80.931  103.222 84.806  1.00 0.00 ? 98  C A "O3'"  1  
ATOM 2454   C "C2'"  . C A 1 77  ? 79.690  102.738 86.812  1.00 0.00 ? 98  C A "C2'"  1  
ATOM 2455   O "O2'"  . C A 1 77  ? 78.596  103.260 86.087  1.00 0.00 ? 98  C A "O2'"  1  
ATOM 2456   C "C1'"  . C A 1 77  ? 79.281  101.404 87.434  1.00 0.00 ? 98  C A "C1'"  1  
ATOM 2457   N N1     . C A 1 77  ? 79.990  101.055 88.668  1.00 0.00 ? 98  C A N1     1  
ATOM 2458   C C2     . C A 1 77  ? 79.645  101.692 89.860  1.00 0.00 ? 98  C A C2     1  
ATOM 2459   O O2     . C A 1 77  ? 78.776  102.569 89.848  1.00 0.00 ? 98  C A O2     1  
ATOM 2460   N N3     . C A 1 77  ? 80.266  101.337 91.001  1.00 0.00 ? 98  C A N3     1  
ATOM 2461   C C4     . C A 1 77  ? 81.203  100.394 90.980  1.00 0.00 ? 98  C A C4     1  
ATOM 2462   N N4     . C A 1 77  ? 81.784  100.078 92.140  1.00 0.00 ? 98  C A N4     1  
ATOM 2463   C C5     . C A 1 77  ? 81.586  99.734  89.776  1.00 0.00 ? 98  C A C5     1  
ATOM 2464   C C6     . C A 1 77  ? 80.961  100.097 88.652  1.00 0.00 ? 98  C A C6     1  
ATOM 2465   H "H5'"  . C A 1 77  ? 81.547  100.328 83.902  1.00 0.00 ? 98  C A "H5'"  1  
ATOM 2466   H "H5''" . C A 1 77  ? 82.002  99.963  85.388  1.00 0.00 ? 98  C A "H5''" 1  
ATOM 2467   H "H4'"  . C A 1 77  ? 79.552  101.174 84.637  1.00 0.00 ? 98  C A "H4'"  1  
ATOM 2468   H "H3'"  . C A 1 77  ? 81.649  102.118 86.293  1.00 0.00 ? 98  C A "H3'"  1  
ATOM 2469   H "H2'"  . C A 1 77  ? 80.031  103.370 87.479  1.00 0.00 ? 98  C A "H2'"  1  
ATOM 2470   H "HO2'" . C A 1 77  ? 77.900  103.542 86.715  1.00 0.00 ? 98  C A "HO2'" 1  
ATOM 2471   H "H1'"  . C A 1 77  ? 78.322  101.422 87.629  1.00 0.00 ? 98  C A "H1'"  1  
ATOM 2472   H H41    . C A 1 77  ? 81.514  100.535 92.963  1.00 0.00 ? 98  C A H41    1  
ATOM 2473   H H42    . C A 1 77  ? 82.478  99.387  92.166  1.00 0.00 ? 98  C A H42    1  
ATOM 2474   H H5     . C A 1 77  ? 82.278  99.041  89.775  1.00 0.00 ? 98  C A H5     1  
ATOM 2475   H H6     . C A 1 77  ? 81.207  99.657  87.812  1.00 0.00 ? 98  C A H6     1  
ATOM 2476   P P      . C A 1 78  ? 81.963  104.440 84.965  1.00 0.00 ? 99  C A P      1  
ATOM 2477   O OP1    . C A 1 78  ? 81.859  105.266 83.731  1.00 0.00 ? 99  C A OP1    1  
ATOM 2478   O OP2    . C A 1 78  ? 83.283  103.881 85.362  1.00 0.00 ? 99  C A OP2    1  
ATOM 2479   O "O5'"  . C A 1 78  ? 81.383  105.287 86.189  1.00 0.00 ? 99  C A "O5'"  1  
ATOM 2480   C "C5'"  . C A 1 78  ? 80.264  106.156 86.014  1.00 0.00 ? 99  C A "C5'"  1  
ATOM 2481   C "C4'"  . C A 1 78  ? 80.053  107.003 87.248  1.00 0.00 ? 99  C A "C4'"  1  
ATOM 2482   O "O4'"  . C A 1 78  ? 79.684  106.167 88.373  1.00 0.00 ? 99  C A "O4'"  1  
ATOM 2483   C "C3'"  . C A 1 78  ? 81.258  107.764 87.755  1.00 0.00 ? 99  C A "C3'"  1  
ATOM 2484   O "O3'"  . C A 1 78  ? 81.422  108.973 87.030  1.00 0.00 ? 99  C A "O3'"  1  
ATOM 2485   C "C2'"  . C A 1 78  ? 80.874  108.048 89.203  1.00 0.00 ? 99  C A "C2'"  1  
ATOM 2486   O "O2'"  . C A 1 78  ? 80.060  109.190 89.347  1.00 0.00 ? 99  C A "O2'"  1  
ATOM 2487   C "C1'"  . C A 1 78  ? 80.088  106.792 89.576  1.00 0.00 ? 99  C A "C1'"  1  
ATOM 2488   N N1     . C A 1 78  ? 80.895  105.849 90.349  1.00 0.00 ? 99  C A N1     1  
ATOM 2489   C C2     . C A 1 78  ? 81.061  106.069 91.716  1.00 0.00 ? 99  C A C2     1  
ATOM 2490   O O2     . C A 1 78  ? 80.518  107.047 92.235  1.00 0.00 ? 99  C A O2     1  
ATOM 2491   N N3     . C A 1 78  ? 81.814  105.216 92.437  1.00 0.00 ? 99  C A N3     1  
ATOM 2492   C C4     . C A 1 78  ? 82.390  104.175 91.842  1.00 0.00 ? 99  C A C4     1  
ATOM 2493   N N4     . C A 1 78  ? 83.132  103.365 92.594  1.00 0.00 ? 99  C A N4     1  
ATOM 2494   C C5     . C A 1 78  ? 82.232  103.919 90.450  1.00 0.00 ? 99  C A C5     1  
ATOM 2495   C C6     . C A 1 78  ? 81.484  104.775 89.748  1.00 0.00 ? 99  C A C6     1  
ATOM 2496   H "H5'"  . C A 1 78  ? 79.466  105.615 85.844  1.00 0.00 ? 99  C A "H5'"  1  
ATOM 2497   H "H5''" . C A 1 78  ? 80.428  106.735 85.242  1.00 0.00 ? 99  C A "H5''" 1  
ATOM 2498   H "H4'"  . C A 1 78  ? 79.326  107.634 87.075  1.00 0.00 ? 99  C A "H4'"  1  
ATOM 2499   H "H3'"  . C A 1 78  ? 82.056  107.203 87.667  1.00 0.00 ? 99  C A "H3'"  1  
ATOM 2500   H "H2'"  . C A 1 78  ? 81.666  108.115 89.776  1.00 0.00 ? 99  C A "H2'"  1  
ATOM 2501   H "HO2'" . C A 1 78  ? 79.850  109.316 90.296  1.00 0.00 ? 99  C A "HO2'" 1  
ATOM 2502   H "H1'"  . C A 1 78  ? 79.297  107.050 90.095  1.00 0.00 ? 99  C A "H1'"  1  
ATOM 2503   H H41    . C A 1 78  ? 83.238  103.545 93.552  1.00 0.00 ? 99  C A H41    1  
ATOM 2504   H H42    . C A 1 78  ? 83.572  102.588 92.190  1.00 0.00 ? 99  C A H42    1  
ATOM 2505   H H5     . C A 1 78  ? 82.656  103.143 90.025  1.00 0.00 ? 99  C A H5     1  
ATOM 2506   H H6     . C A 1 78  ? 81.360  104.619 88.788  1.00 0.00 ? 99  C A H6     1  
ATOM 2507   P P      . G A 1 79  ? 82.589  110.000 87.447  1.00 0.00 ? 100 G A P      1  
ATOM 2508   O OP1    . G A 1 79  ? 82.121  111.373 87.112  1.00 0.00 ? 100 G A OP1    1  
ATOM 2509   O OP2    . G A 1 79  ? 83.885  109.507 86.888  1.00 0.00 ? 100 G A OP2    1  
ATOM 2510   O "O5'"  . G A 1 79  ? 82.622  109.894 89.038  1.00 0.00 ? 100 G A "O5'"  1  
ATOM 2511   C "C5'"  . G A 1 79  ? 83.649  110.512 89.801  1.00 0.00 ? 100 G A "C5'"  1  
ATOM 2512   C "C4'"  . G A 1 79  ? 83.163  110.783 91.200  1.00 0.00 ? 100 G A "C4'"  1  
ATOM 2513   O "O4'"  . G A 1 79  ? 82.704  109.555 91.816  1.00 0.00 ? 100 G A "O4'"  1  
ATOM 2514   C "C3'"  . G A 1 79  ? 84.222  111.317 92.142  1.00 0.00 ? 100 G A "C3'"  1  
ATOM 2515   O "O3'"  . G A 1 79  ? 84.271  112.734 92.018  1.00 0.00 ? 100 G A "O3'"  1  
ATOM 2516   C "C2'"  . G A 1 79  ? 83.698  110.906 93.513  1.00 0.00 ? 100 G A "C2'"  1  
ATOM 2517   O "O2'"  . G A 1 79  ? 82.786  111.853 94.027  1.00 0.00 ? 100 G A "O2'"  1  
ATOM 2518   C "C1'"  . G A 1 79  ? 82.962  109.597 93.204  1.00 0.00 ? 100 G A "C1'"  1  
ATOM 2519   N N9     . G A 1 79  ? 83.698  108.391 93.553  1.00 0.00 ? 100 G A N9     1  
ATOM 2520   C C8     . G A 1 79  ? 83.888  107.306 92.749  1.00 0.00 ? 100 G A C8     1  
ATOM 2521   N N7     . G A 1 79  ? 84.580  106.362 93.315  1.00 0.00 ? 100 G A N7     1  
ATOM 2522   C C5     . G A 1 79  ? 84.865  106.860 94.569  1.00 0.00 ? 100 G A C5     1  
ATOM 2523   C C6     . G A 1 79  ? 85.587  106.285 95.616  1.00 0.00 ? 100 G A C6     1  
ATOM 2524   O O6     . G A 1 79  ? 86.146  105.189 95.642  1.00 0.00 ? 100 G A O6     1  
ATOM 2525   N N1     . G A 1 79  ? 85.633  107.121 96.719  1.00 0.00 ? 100 G A N1     1  
ATOM 2526   C C2     . G A 1 79  ? 85.056  108.358 96.785  1.00 0.00 ? 100 G A C2     1  
ATOM 2527   N N2     . G A 1 79  ? 85.201  109.020 97.936  1.00 0.00 ? 100 G A N2     1  
ATOM 2528   N N3     . G A 1 79  ? 84.380  108.912 95.798  1.00 0.00 ? 100 G A N3     1  
ATOM 2529   C C4     . G A 1 79  ? 84.324  108.111 94.731  1.00 0.00 ? 100 G A C4     1  
ATOM 2530   H "H5'"  . G A 1 79  ? 83.905  111.355 89.370  1.00 0.00 ? 100 G A "H5'"  1  
ATOM 2531   H "H5''" . G A 1 79  ? 84.428  109.919 89.829  1.00 0.00 ? 100 G A "H5''" 1  
ATOM 2532   H "H4'"  . G A 1 79  ? 82.413  111.412 91.160  1.00 0.00 ? 100 G A "H4'"  1  
ATOM 2533   H "H3'"  . G A 1 79  ? 85.085  110.910 91.919  1.00 0.00 ? 100 G A "H3'"  1  
ATOM 2534   H "H2'"  . G A 1 79  ? 84.430  110.733 94.141  1.00 0.00 ? 100 G A "H2'"  1  
ATOM 2535   H "HO2'" . G A 1 79  ? 82.918  112.707 93.566  1.00 0.00 ? 100 G A "HO2'" 1  
ATOM 2536   H "H1'"  . G A 1 79  ? 82.107  109.582 93.684  1.00 0.00 ? 100 G A "H1'"  1  
ATOM 2537   H H8     . G A 1 79  ? 83.535  107.243 91.837  1.00 0.00 ? 100 G A H8     1  
ATOM 2538   H H1     . G A 1 79  ? 86.115  106.802 97.510  1.00 0.00 ? 100 G A H1     1  
ATOM 2539   H H21    . G A 1 79  ? 85.702  108.617 98.677  1.00 0.00 ? 100 G A H21    1  
ATOM 2540   H H22    . G A 1 79  ? 84.807  109.912 98.042  1.00 0.00 ? 100 G A H22    1  
ATOM 2541   P P      . U A 1 80  ? 85.687  113.495 92.012  1.00 0.00 ? 101 U A P      1  
ATOM 2542   O OP1    . U A 1 80  ? 85.426  114.948 91.849  1.00 0.00 ? 101 U A OP1    1  
ATOM 2543   O OP2    . U A 1 80  ? 86.579  112.797 91.052  1.00 0.00 ? 101 U A OP2    1  
ATOM 2544   O "O5'"  . U A 1 80  ? 86.258  113.257 93.479  1.00 0.00 ? 101 U A "O5'"  1  
ATOM 2545   C "C5'"  . U A 1 80  ? 85.501  113.616 94.625  1.00 0.00 ? 101 U A "C5'"  1  
ATOM 2546   C "C4'"  . U A 1 80  ? 86.145  113.122 95.896  1.00 0.00 ? 101 U A "C4'"  1  
ATOM 2547   O "O4'"  . U A 1 80  ? 85.933  111.694 96.050  1.00 0.00 ? 101 U A "O4'"  1  
ATOM 2548   C "C3'"  . U A 1 80  ? 87.661  113.222 95.962  1.00 0.00 ? 101 U A "C3'"  1  
ATOM 2549   O "O3'"  . U A 1 80  ? 88.119  114.541 96.203  1.00 0.00 ? 101 U A "O3'"  1  
ATOM 2550   C "C2'"  . U A 1 80  ? 87.960  112.226 97.064  1.00 0.00 ? 101 U A "C2'"  1  
ATOM 2551   O "O2'"  . U A 1 80  ? 87.599  112.743 98.337  1.00 0.00 ? 101 U A "O2'"  1  
ATOM 2552   C "C1'"  . U A 1 80  ? 87.000  111.098 96.678  1.00 0.00 ? 101 U A "C1'"  1  
ATOM 2553   N N1     . U A 1 80  ? 87.589  110.176 95.677  1.00 0.00 ? 101 U A N1     1  
ATOM 2554   C C2     . U A 1 80  ? 88.482  109.228 96.141  1.00 0.00 ? 101 U A C2     1  
ATOM 2555   O O2     . U A 1 80  ? 88.794  109.124 97.314  1.00 0.00 ? 101 U A O2     1  
ATOM 2556   N N3     . U A 1 80  ? 89.001  108.396 95.178  1.00 0.00 ? 101 U A N3     1  
ATOM 2557   C C4     . U A 1 80  ? 88.726  108.415 93.827  1.00 0.00 ? 101 U A C4     1  
ATOM 2558   O O4     . U A 1 80  ? 89.277  107.598 93.088  1.00 0.00 ? 101 U A O4     1  
ATOM 2559   C C5     . U A 1 80  ? 87.795  109.422 93.420  1.00 0.00 ? 101 U A C5     1  
ATOM 2560   C C6     . U A 1 80  ? 87.273  110.244 94.336  1.00 0.00 ? 101 U A C6     1  
ATOM 2561   H "H5'"  . U A 1 80  ? 84.604  113.227 94.549  1.00 0.00 ? 101 U A "H5'"  1  
ATOM 2562   H "H5''" . U A 1 80  ? 85.423  114.592 94.664  1.00 0.00 ? 101 U A "H5''" 1  
ATOM 2563   H "H4'"  . U A 1 80  ? 85.735  113.582 96.658  1.00 0.00 ? 101 U A "H4'"  1  
ATOM 2564   H "H3'"  . U A 1 80  ? 88.042  112.907 95.117  1.00 0.00 ? 101 U A "H3'"  1  
ATOM 2565   H "H2'"  . U A 1 80  ? 88.896  111.937 97.043  1.00 0.00 ? 101 U A "H2'"  1  
ATOM 2566   H "HO2'" . U A 1 80  ? 87.867  112.103 99.030  1.00 0.00 ? 101 U A "HO2'" 1  
ATOM 2567   H "H1'"  . U A 1 80  ? 86.757  110.591 97.482  1.00 0.00 ? 101 U A "H1'"  1  
ATOM 2568   H H3     . U A 1 80  ? 89.636  107.717 95.486  1.00 0.00 ? 101 U A H3     1  
ATOM 2569   H H5     . U A 1 80  ? 87.541  109.507 92.477  1.00 0.00 ? 101 U A H5     1  
ATOM 2570   H H6     . U A 1 80  ? 86.639  110.925 94.032  1.00 0.00 ? 101 U A H6     1  
ATOM 2571   P P      . C A 1 81  ? 89.036  115.271 95.114  1.00 0.00 ? 102 C A P      1  
ATOM 2572   O OP1    . C A 1 81  ? 89.565  116.535 95.688  1.00 0.00 ? 102 C A OP1    1  
ATOM 2573   O OP2    . C A 1 81  ? 88.149  115.320 93.925  1.00 0.00 ? 102 C A OP2    1  
ATOM 2574   O "O5'"  . C A 1 81  ? 90.271  114.336 94.768  1.00 0.00 ? 102 C A "O5'"  1  
ATOM 2575   C "C5'"  . C A 1 81  ? 91.585  114.716 95.113  1.00 0.00 ? 102 C A "C5'"  1  
ATOM 2576   C "C4'"  . C A 1 81  ? 91.903  114.272 96.511  1.00 0.00 ? 102 C A "C4'"  1  
ATOM 2577   O "O4'"  . C A 1 81  ? 91.009  113.196 96.855  1.00 0.00 ? 102 C A "O4'"  1  
ATOM 2578   C "C3'"  . C A 1 81  ? 93.314  113.736 96.666  1.00 0.00 ? 102 C A "C3'"  1  
ATOM 2579   O "O3'"  . C A 1 81  ? 94.110  114.769 97.205  1.00 0.00 ? 102 C A "O3'"  1  
ATOM 2580   C "C2'"  . C A 1 81  ? 93.145  112.624 97.680  1.00 0.00 ? 102 C A "C2'"  1  
ATOM 2581   O "O2'"  . C A 1 81  ? 93.179  113.073 99.013  1.00 0.00 ? 102 C A "O2'"  1  
ATOM 2582   C "C1'"  . C A 1 81  ? 91.759  112.104 97.314  1.00 0.00 ? 102 C A "C1'"  1  
ATOM 2583   N N1     . C A 1 81  ? 91.835  111.189 96.195  1.00 0.00 ? 102 C A N1     1  
ATOM 2584   C C2     . C A 1 81  ? 92.599  110.052 96.305  1.00 0.00 ? 102 C A C2     1  
ATOM 2585   O O2     . C A 1 81  ? 93.218  109.855 97.361  1.00 0.00 ? 102 C A O2     1  
ATOM 2586   N N3     . C A 1 81  ? 92.655  109.191 95.268  1.00 0.00 ? 102 C A N3     1  
ATOM 2587   C C4     . C A 1 81  ? 91.970  109.453 94.156  1.00 0.00 ? 102 C A C4     1  
ATOM 2588   N N4     . C A 1 81  ? 92.043  108.592 93.149  1.00 0.00 ? 102 C A N4     1  
ATOM 2589   C C5     . C A 1 81  ? 91.181  110.618 94.025  1.00 0.00 ? 102 C A C5     1  
ATOM 2590   C C6     . C A 1 81  ? 91.149  111.455 95.054  1.00 0.00 ? 102 C A C6     1  
ATOM 2591   H "H5'"  . C A 1 81  ? 91.663  115.690 95.049  1.00 0.00 ? 102 C A "H5'"  1  
ATOM 2592   H "H5''" . C A 1 81  ? 92.212  114.303 94.483  1.00 0.00 ? 102 C A "H5''" 1  
ATOM 2593   H "H4'"  . C A 1 81  ? 91.761  115.025 97.120  1.00 0.00 ? 102 C A "H4'"  1  
ATOM 2594   H "H3'"  . C A 1 81  ? 93.646  113.439 95.792  1.00 0.00 ? 102 C A "H3'"  1  
ATOM 2595   H "H2'"  . C A 1 81  ? 93.802  111.911 97.543  1.00 0.00 ? 102 C A "H2'"  1  
ATOM 2596   H "HO2'" . C A 1 81  ? 93.681  112.430 99.553  1.00 0.00 ? 102 C A "HO2'" 1  
ATOM 2597   H "H1'"  . C A 1 81  ? 91.367  111.657 98.092  1.00 0.00 ? 102 C A "H1'"  1  
ATOM 2598   H H41    . C A 1 81  ? 92.593  107.785 93.233  1.00 0.00 ? 102 C A H41    1  
ATOM 2599   H H42    . C A 1 81  ? 91.548  108.764 92.321  1.00 0.00 ? 102 C A H42    1  
ATOM 2600   H H5     . C A 1 81  ? 90.675  110.799 93.205  1.00 0.00 ? 102 C A H5     1  
ATOM 2601   H H6     . C A 1 81  ? 90.607  112.269 94.984  1.00 0.00 ? 102 C A H6     1  
ATOM 2602   P P      . A A 1 82  ? 94.486  116.024 96.298  1.00 0.00 ? 103 A A P      1  
ATOM 2603   O OP1    . A A 1 82  ? 94.634  117.164 97.229  1.00 0.00 ? 103 A A OP1    1  
ATOM 2604   O OP2    . A A 1 82  ? 93.560  116.123 95.151  1.00 0.00 ? 103 A A OP2    1  
ATOM 2605   O "O5'"  . A A 1 82  ? 95.903  115.630 95.697  1.00 0.00 ? 103 A A "O5'"  1  
ATOM 2606   C "C5'"  . A A 1 82  ? 97.045  115.574 96.533  1.00 0.00 ? 103 A A "C5'"  1  
ATOM 2607   C "C4'"  . A A 1 82  ? 97.646  114.204 96.478  1.00 0.00 ? 103 A A "C4'"  1  
ATOM 2608   O "O4'"  . A A 1 82  ? 96.659  113.274 95.995  1.00 0.00 ? 103 A A "O4'"  1  
ATOM 2609   C "C3'"  . A A 1 82  ? 98.796  114.001 95.515  1.00 0.00 ? 103 A A "C3'"  1  
ATOM 2610   O "O3'"  . A A 1 82  ? 100.020 114.259 96.215  1.00 0.00 ? 103 A A "O3'"  1  
ATOM 2611   C "C2'"  . A A 1 82  ? 98.771  112.479 95.306  1.00 0.00 ? 103 A A "C2'"  1  
ATOM 2612   O "O2'"  . A A 1 82  ? 99.575  111.796 96.237  1.00 0.00 ? 103 A A "O2'"  1  
ATOM 2613   C "C1'"  . A A 1 82  ? 97.334  112.100 95.657  1.00 0.00 ? 103 A A "C1'"  1  
ATOM 2614   N N9     . A A 1 82  ? 96.589  111.285 94.695  1.00 0.00 ? 103 A A N9     1  
ATOM 2615   C C8     . A A 1 82  ? 95.525  111.570 93.888  1.00 0.00 ? 103 A A C8     1  
ATOM 2616   N N7     . A A 1 82  ? 95.098  110.537 93.195  1.00 0.00 ? 103 A A N7     1  
ATOM 2617   C C5     . A A 1 82  ? 95.954  109.506 93.563  1.00 0.00 ? 103 A A C5     1  
ATOM 2618   C C6     . A A 1 82  ? 96.050  108.134 93.178  1.00 0.00 ? 103 A A C6     1  
ATOM 2619   N N6     . A A 1 82  ? 95.239  107.517 92.305  1.00 0.00 ? 103 A A N6     1  
ATOM 2620   N N1     . A A 1 82  ? 97.032  107.405 93.734  1.00 0.00 ? 103 A A N1     1  
ATOM 2621   C C2     . A A 1 82  ? 97.847  107.993 94.604  1.00 0.00 ? 103 A A C2     1  
ATOM 2622   N N3     . A A 1 82  ? 97.860  109.245 95.040  1.00 0.00 ? 103 A A N3     1  
ATOM 2623   C C4     . A A 1 82  ? 96.879  109.957 94.475  1.00 0.00 ? 103 A A C4     1  
ATOM 2624   H "H5'"  . A A 1 82  ? 96.780  115.785 97.453  1.00 0.00 ? 103 A A "H5'"  1  
ATOM 2625   H "H5''" . A A 1 82  ? 97.699  116.237 96.229  1.00 0.00 ? 103 A A "H5''" 1  
ATOM 2626   H "H4'"  . A A 1 82  ? 97.921  113.943 97.382  1.00 0.00 ? 103 A A "H4'"  1  
ATOM 2627   H "H3'"  . A A 1 82  ? 98.684  114.604 94.750  1.00 0.00 ? 103 A A "H3'"  1  
ATOM 2628   H "H2'"  . A A 1 82  ? 99.013  112.239 94.388  1.00 0.00 ? 103 A A "H2'"  1  
ATOM 2629   H "HO2'" . A A 1 82  ? 99.003  111.435 96.946  1.00 0.00 ? 103 A A "HO2'" 1  
ATOM 2630   H "H1'"  . A A 1 82  ? 97.325  111.607 96.505  1.00 0.00 ? 103 A A "H1'"  1  
ATOM 2631   H H8     . A A 1 82  ? 95.110  112.458 93.837  1.00 0.00 ? 103 A A H8     1  
ATOM 2632   H H61    . A A 1 82  ? 95.375  106.569 92.097  1.00 0.00 ? 103 A A H61    1  
ATOM 2633   H H62    . A A 1 82  ? 94.510  108.012 91.878  1.00 0.00 ? 103 A A H62    1  
ATOM 2634   H H2     . A A 1 82  ? 98.543  107.411 94.975  1.00 0.00 ? 103 A A H2     1  
ATOM 2635   P P      . A A 1 83  ? 101.060 115.347 95.650  1.00 0.00 ? 104 A A P      1  
ATOM 2636   O OP1    . A A 1 83  ? 100.289 116.540 95.219  1.00 0.00 ? 104 A A OP1    1  
ATOM 2637   O OP2    . A A 1 83  ? 101.959 114.666 94.686  1.00 0.00 ? 104 A A OP2    1  
ATOM 2638   O "O5'"  . A A 1 83  ? 101.923 115.752 96.927  1.00 0.00 ? 104 A A "O5'"  1  
ATOM 2639   C "C5'"  . A A 1 83  ? 101.350 116.504 97.986  1.00 0.00 ? 104 A A "C5'"  1  
ATOM 2640   C "C4'"  . A A 1 83  ? 101.794 115.992 99.333  1.00 0.00 ? 104 A A "C4'"  1  
ATOM 2641   O "O4'"  . A A 1 83  ? 100.881 114.964 99.818  1.00 0.00 ? 104 A A "O4'"  1  
ATOM 2642   C "C3'"  . A A 1 83  ? 103.192 115.394 99.392  1.00 0.00 ? 104 A A "C3'"  1  
ATOM 2643   O "O3'"  . A A 1 83  ? 103.808 115.548 100.659 1.00 0.00 ? 104 A A "O3'"  1  
ATOM 2644   C "C2'"  . A A 1 83  ? 102.922 113.894 99.277  1.00 0.00 ? 104 A A "C2'"  1  
ATOM 2645   O "O2'"  . A A 1 83  ? 103.951 113.137 99.899  1.00 0.00 ? 104 A A "O2'"  1  
ATOM 2646   C "C1'"  . A A 1 83  ? 101.657 113.780 100.087 1.00 0.00 ? 104 A A "C1'"  1  
ATOM 2647   N N9     . A A 1 83  ? 100.870 112.587 99.725  1.00 0.00 ? 104 A A N9     1  
ATOM 2648   C C8     . A A 1 83  ? 100.893 111.887 98.543  1.00 0.00 ? 104 A A C8     1  
ATOM 2649   N N7     . A A 1 83  ? 100.075 110.864 98.519  1.00 0.00 ? 104 A A N7     1  
ATOM 2650   C C5     . A A 1 83  ? 99.472  110.890 99.769  1.00 0.00 ? 104 A A C5     1  
ATOM 2651   C C6     . A A 1 83  ? 98.502  110.068 100.370 1.00 0.00 ? 104 A A C6     1  
ATOM 2652   N N6     . A A 1 83  ? 97.949  109.013 99.766  1.00 0.00 ? 104 A A N6     1  
ATOM 2653   N N1     . A A 1 83  ? 98.117  110.368 101.629 1.00 0.00 ? 104 A A N1     1  
ATOM 2654   C C2     . A A 1 83  ? 98.672  111.425 102.235 1.00 0.00 ? 104 A A C2     1  
ATOM 2655   N N3     . A A 1 83  ? 99.590  112.272 101.774 1.00 0.00 ? 104 A A N3     1  
ATOM 2656   C C4     . A A 1 83  ? 99.952  111.946 100.521 1.00 0.00 ? 104 A A C4     1  
ATOM 2657   H "H5'"  . A A 1 83  ? 100.373 116.445 97.928  1.00 0.00 ? 104 A A "H5'"  1  
ATOM 2658   H "H5''" . A A 1 83  ? 101.619 117.442 97.896  1.00 0.00 ? 104 A A "H5''" 1  
ATOM 2659   H "H4'"  . A A 1 83  ? 101.793 116.736 99.971  1.00 0.00 ? 104 A A "H4'"  1  
ATOM 2660   H "H3'"  . A A 1 83  ? 103.700 115.688 98.607  1.00 0.00 ? 104 A A "H3'"  1  
ATOM 2661   H "H2'"  . A A 1 83  ? 102.785 113.624 98.345  1.00 0.00 ? 104 A A "H2'"  1  
ATOM 2662   H "HO2'" . A A 1 83  ? 104.199 112.394 99.311  1.00 0.00 ? 104 A A "HO2'" 1  
ATOM 2663   H "H1'"  . A A 1 83  ? 101.883 113.745 101.041 1.00 0.00 ? 104 A A "H1'"  1  
ATOM 2664   H H8     . A A 1 83  ? 101.469 112.130 97.788  1.00 0.00 ? 104 A A H8     1  
ATOM 2665   H H61    . A A 1 83  ? 97.277  108.476 100.237 1.00 0.00 ? 104 A A H61    1  
ATOM 2666   H H62    . A A 1 83  ? 98.213  108.776 98.853  1.00 0.00 ? 104 A A H62    1  
ATOM 2667   H H2     . A A 1 83  ? 98.358  111.600 103.147 1.00 0.00 ? 104 A A H2     1  
ATOM 2668   P P      . A A 1 84  ? 104.745 116.820 100.952 1.00 0.00 ? 105 A A P      1  
ATOM 2669   O OP1    . A A 1 84  ? 103.904 118.040 100.874 1.00 0.00 ? 105 A A OP1    1  
ATOM 2670   O OP2    . A A 1 84  ? 105.955 116.706 100.099 1.00 0.00 ? 105 A A OP2    1  
ATOM 2671   O "O5'"  . A A 1 84  ? 105.193 116.626 102.469 1.00 0.00 ? 105 A A "O5'"  1  
ATOM 2672   C "C5'"  . A A 1 84  ? 104.234 116.377 103.486 1.00 0.00 ? 105 A A "C5'"  1  
ATOM 2673   C "C4'"  . A A 1 84  ? 104.485 115.059 104.173 1.00 0.00 ? 105 A A "C4'"  1  
ATOM 2674   O "O4'"  . A A 1 84  ? 103.705 113.979 103.643 1.00 0.00 ? 105 A A "O4'"  1  
ATOM 2675   C "C3'"  . A A 1 84  ? 105.904 114.517 104.081 1.00 0.00 ? 105 A A "C3'"  1  
ATOM 2676   O "O3'"  . A A 1 84  ? 106.823 115.228 104.891 1.00 0.00 ? 105 A A "O3'"  1  
ATOM 2677   C "C2'"  . A A 1 84  ? 105.715 113.075 104.535 1.00 0.00 ? 105 A A "C2'"  1  
ATOM 2678   O "O2'"  . A A 1 84  ? 105.639 112.987 105.950 1.00 0.00 ? 105 A A "O2'"  1  
ATOM 2679   C "C1'"  . A A 1 84  ? 104.338 112.745 103.940 1.00 0.00 ? 105 A A "C1'"  1  
ATOM 2680   N N9     . A A 1 84  ? 104.443 111.950 102.702 1.00 0.00 ? 105 A A N9     1  
ATOM 2681   C C8     . A A 1 84  ? 105.470 111.938 101.791 1.00 0.00 ? 105 A A C8     1  
ATOM 2682   N N7     . A A 1 84  ? 105.275 111.122 100.785 1.00 0.00 ? 105 A A N7     1  
ATOM 2683   C C5     . A A 1 84  ? 104.035 110.557 101.050 1.00 0.00 ? 105 A A C5     1  
ATOM 2684   C C6     . A A 1 84  ? 103.259 109.609 100.360 1.00 0.00 ? 105 A A C6     1  
ATOM 2685   N N6     . A A 1 84  ? 103.635 109.039 99.212  1.00 0.00 ? 105 A A N6     1  
ATOM 2686   N N1     . A A 1 84  ? 102.070 109.261 100.896 1.00 0.00 ? 105 A A N1     1  
ATOM 2687   C C2     . A A 1 84  ? 101.693 109.832 102.047 1.00 0.00 ? 105 A A C2     1  
ATOM 2688   N N3     . A A 1 84  ? 102.333 110.733 102.788 1.00 0.00 ? 105 A A N3     1  
ATOM 2689   C C4     . A A 1 84  ? 103.513 111.057 102.228 1.00 0.00 ? 105 A A C4     1  
ATOM 2690   H "H5'"  . A A 1 84  ? 103.340 116.364 103.086 1.00 0.00 ? 105 A A "H5'"  1  
ATOM 2691   H "H5''" . A A 1 84  ? 104.276 117.097 104.150 1.00 0.00 ? 105 A A "H5''" 1  
ATOM 2692   H "H4'"  . A A 1 84  ? 104.250 115.145 105.121 1.00 0.00 ? 105 A A "H4'"  1  
ATOM 2693   H "H3'"  . A A 1 84  ? 106.192 114.529 103.144 1.00 0.00 ? 105 A A "H3'"  1  
ATOM 2694   H "H2'"  . A A 1 84  ? 106.412 112.490 104.171 1.00 0.00 ? 105 A A "H2'"  1  
ATOM 2695   H "HO2'" . A A 1 84  ? 105.338 112.088 106.197 1.00 0.00 ? 105 A A "HO2'" 1  
ATOM 2696   H "H1'"  . A A 1 84  ? 103.807 112.252 104.601 1.00 0.00 ? 105 A A "H1'"  1  
ATOM 2697   H H8     . A A 1 84  ? 106.275 112.490 101.884 1.00 0.00 ? 105 A A H8     1  
ATOM 2698   H H61    . A A 1 84  ? 103.050 108.384 98.777  1.00 0.00 ? 105 A A H61    1  
ATOM 2699   H H62    . A A 1 84  ? 104.493 109.276 98.805  1.00 0.00 ? 105 A A H62    1  
ATOM 2700   H H2     . A A 1 84  ? 100.822 109.545 102.393 1.00 0.00 ? 105 A A H2     1  
ATOM 2701   P P      . U A 1 85  ? 108.271 114.608 105.181 1.00 0.00 ? 106 U A P      1  
ATOM 2702   O OP1    . U A 1 85  ? 108.185 113.707 106.358 1.00 0.00 ? 106 U A OP1    1  
ATOM 2703   O OP2    . U A 1 85  ? 109.134 115.815 105.241 1.00 0.00 ? 106 U A OP2    1  
ATOM 2704   O "O5'"  . U A 1 85  ? 108.726 113.739 103.926 1.00 0.00 ? 106 U A "O5'"  1  
ATOM 2705   C "C5'"  . U A 1 85  ? 108.672 114.271 102.611 1.00 0.00 ? 106 U A "C5'"  1  
ATOM 2706   C "C4'"  . U A 1 85  ? 110.046 114.379 101.997 1.00 0.00 ? 106 U A "C4'"  1  
ATOM 2707   O "O4'"  . U A 1 85  ? 110.761 115.489 102.606 1.00 0.00 ? 106 U A "O4'"  1  
ATOM 2708   C "C3'"  . U A 1 85  ? 110.962 113.180 102.190 1.00 0.00 ? 106 U A "C3'"  1  
ATOM 2709   O "O3'"  . U A 1 85  ? 110.769 112.172 101.214 1.00 0.00 ? 106 U A "O3'"  1  
ATOM 2710   C "C2'"  . U A 1 85  ? 112.342 113.800 102.042 1.00 0.00 ? 106 U A "C2'"  1  
ATOM 2711   O "O2'"  . U A 1 85  ? 112.667 114.013 100.675 1.00 0.00 ? 106 U A "O2'"  1  
ATOM 2712   C "C1'"  . U A 1 85  ? 112.134 115.152 102.724 1.00 0.00 ? 106 U A "C1'"  1  
ATOM 2713   N N1     . U A 1 85  ? 112.512 115.123 104.157 1.00 0.00 ? 106 U A N1     1  
ATOM 2714   C C2     . U A 1 85  ? 113.854 115.260 104.459 1.00 0.00 ? 106 U A C2     1  
ATOM 2715   O O2     . U A 1 85  ? 114.716 115.402 103.610 1.00 0.00 ? 106 U A O2     1  
ATOM 2716   N N3     . U A 1 85  ? 114.156 115.228 105.799 1.00 0.00 ? 106 U A N3     1  
ATOM 2717   C C4     . U A 1 85  ? 113.274 115.075 106.847 1.00 0.00 ? 106 U A C4     1  
ATOM 2718   O O4     . U A 1 85  ? 113.703 115.065 108.002 1.00 0.00 ? 106 U A O4     1  
ATOM 2719   C C5     . U A 1 85  ? 111.903 114.938 106.460 1.00 0.00 ? 106 U A C5     1  
ATOM 2720   C C6     . U A 1 85  ? 111.580 114.967 105.162 1.00 0.00 ? 106 U A C6     1  
ATOM 2721   H "H5'"  . U A 1 85  ? 108.266 115.163 102.644 1.00 0.00 ? 106 U A "H5'"  1  
ATOM 2722   H "H5''" . U A 1 85  ? 108.118 113.688 102.052 1.00 0.00 ? 106 U A "H5''" 1  
ATOM 2723   H "H4'"  . U A 1 85  ? 109.954 114.556 101.038 1.00 0.00 ? 106 U A "H4'"  1  
ATOM 2724   H "H3'"  . U A 1 85  ? 110.852 112.789 103.081 1.00 0.00 ? 106 U A "H3'"  1  
ATOM 2725   H "H2'"  . U A 1 85  ? 113.026 113.267 102.498 1.00 0.00 ? 106 U A "H2'"  1  
ATOM 2726   H "HO2'" . U A 1 85  ? 112.224 113.328 100.132 1.00 0.00 ? 106 U A "HO2'" 1  
ATOM 2727   H "H1'"  . U A 1 85  ? 112.668 115.832 102.261 1.00 0.00 ? 106 U A "H1'"  1  
ATOM 2728   H H3     . U A 1 85  ? 115.102 115.324 106.035 1.00 0.00 ? 106 U A H3     1  
ATOM 2729   H H5     . U A 1 85  ? 111.207 114.825 107.140 1.00 0.00 ? 106 U A H5     1  
ATOM 2730   H H6     . U A 1 85  ? 110.636 114.871 104.923 1.00 0.00 ? 106 U A H6     1  
ATOM 2731   P P      . U A 1 86  ? 111.199 110.655 101.521 1.00 0.00 ? 107 U A P      1  
ATOM 2732   O OP1    . U A 1 86  ? 110.734 109.808 100.393 1.00 0.00 ? 107 U A OP1    1  
ATOM 2733   O OP2    . U A 1 86  ? 110.777 110.329 102.906 1.00 0.00 ? 107 U A OP2    1  
ATOM 2734   O "O5'"  . U A 1 86  ? 112.790 110.692 101.486 1.00 0.00 ? 107 U A "O5'"  1  
ATOM 2735   C "C5'"  . U A 1 86  ? 113.581 110.142 102.547 1.00 0.00 ? 107 U A "C5'"  1  
ATOM 2736   C "C4'"  . U A 1 86  ? 113.218 110.744 103.893 1.00 0.00 ? 107 U A "C4'"  1  
ATOM 2737   O "O4'"  . U A 1 86  ? 111.872 110.408 104.300 1.00 0.00 ? 107 U A "O4'"  1  
ATOM 2738   C "C3'"  . U A 1 86  ? 114.085 110.248 105.032 1.00 0.00 ? 107 U A "C3'"  1  
ATOM 2739   O "O3'"  . U A 1 86  ? 115.270 111.019 105.051 1.00 0.00 ? 107 U A "O3'"  1  
ATOM 2740   C "C2'"  . U A 1 86  ? 113.225 110.577 106.233 1.00 0.00 ? 107 U A "C2'"  1  
ATOM 2741   O "O2'"  . U A 1 86  ? 113.276 111.971 106.443 1.00 0.00 ? 107 U A "O2'"  1  
ATOM 2742   C "C1'"  . U A 1 86  ? 111.828 110.254 105.706 1.00 0.00 ? 107 U A "C1'"  1  
ATOM 2743   N N1     . U A 1 86  ? 111.230 108.941 106.027 1.00 0.00 ? 107 U A N1     1  
ATOM 2744   C C2     . U A 1 86  ? 111.038 108.571 107.359 1.00 0.00 ? 107 U A C2     1  
ATOM 2745   O O2     . U A 1 86  ? 111.433 109.214 108.305 1.00 0.00 ? 107 U A O2     1  
ATOM 2746   N N3     . U A 1 86  ? 110.358 107.397 107.546 1.00 0.00 ? 107 U A N3     1  
ATOM 2747   C C4     . U A 1 86  ? 109.870 106.572 106.575 1.00 0.00 ? 107 U A C4     1  
ATOM 2748   O O4     . U A 1 86  ? 109.138 105.640 106.897 1.00 0.00 ? 107 U A O4     1  
ATOM 2749   C C5     . U A 1 86  ? 110.155 106.982 105.245 1.00 0.00 ? 107 U A C5     1  
ATOM 2750   C C6     . U A 1 86  ? 110.812 108.118 105.022 1.00 0.00 ? 107 U A C6     1  
ATOM 2751   H "H5'"  . U A 1 86  ? 114.528 110.319 102.364 1.00 0.00 ? 107 U A "H5'"  1  
ATOM 2752   H "H5''" . U A 1 86  ? 113.437 109.174 102.585 1.00 0.00 ? 107 U A "H5''" 1  
ATOM 2753   H "H4'"  . U A 1 86  ? 113.272 111.720 103.826 1.00 0.00 ? 107 U A "H4'"  1  
ATOM 2754   H "H3'"  . U A 1 86  ? 114.275 109.295 104.902 1.00 0.00 ? 107 U A "H3'"  1  
ATOM 2755   H "H2'"  . U A 1 86  ? 113.490 110.056 107.019 1.00 0.00 ? 107 U A "H2'"  1  
ATOM 2756   H "HO2'" . U A 1 86  ? 113.326 112.146 107.406 1.00 0.00 ? 107 U A "HO2'" 1  
ATOM 2757   H "H1'"  . U A 1 86  ? 111.195 110.924 106.038 1.00 0.00 ? 107 U A "H1'"  1  
ATOM 2758   H H3     . U A 1 86  ? 110.208 107.122 108.474 1.00 0.00 ? 107 U A H3     1  
ATOM 2759   H H5     . U A 1 86  ? 109.869 106.432 104.486 1.00 0.00 ? 107 U A H5     1  
ATOM 2760   H H6     . U A 1 86  ? 110.993 108.368 104.092 1.00 0.00 ? 107 U A H6     1  
ATOM 2761   P P      . G A 1 87  ? 116.142 111.100 106.393 1.00 0.00 ? 108 G A P      1  
ATOM 2762   O OP1    . G A 1 87  ? 115.531 112.144 107.268 1.00 0.00 ? 108 G A OP1    1  
ATOM 2763   O OP2    . G A 1 87  ? 117.563 111.239 105.976 1.00 0.00 ? 108 G A OP2    1  
ATOM 2764   O "O5'"  . G A 1 87  ? 115.913 109.661 107.045 1.00 0.00 ? 108 G A "O5'"  1  
ATOM 2765   C "C5'"  . G A 1 87  ? 116.996 108.751 107.268 1.00 0.00 ? 108 G A "C5'"  1  
ATOM 2766   C "C4'"  . G A 1 87  ? 117.067 108.371 108.732 1.00 0.00 ? 108 G A "C4'"  1  
ATOM 2767   O "O4'"  . G A 1 87  ? 115.733 108.421 109.285 1.00 0.00 ? 108 G A "O4'"  1  
ATOM 2768   C "C3'"  . G A 1 87  ? 117.579 106.973 109.036 1.00 0.00 ? 108 G A "C3'"  1  
ATOM 2769   O "O3'"  . G A 1 87  ? 118.990 106.927 109.193 1.00 0.00 ? 108 G A "O3'"  1  
ATOM 2770   C "C2'"  . G A 1 87  ? 116.878 106.649 110.341 1.00 0.00 ? 108 G A "C2'"  1  
ATOM 2771   O "O2'"  . G A 1 87  ? 117.519 107.247 111.446 1.00 0.00 ? 108 G A "O2'"  1  
ATOM 2772   C "C1'"  . G A 1 87  ? 115.516 107.303 110.113 1.00 0.00 ? 108 G A "C1'"  1  
ATOM 2773   N N9     . G A 1 87  ? 114.560 106.436 109.437 1.00 0.00 ? 108 G A N9     1  
ATOM 2774   C C8     . G A 1 87  ? 114.039 106.595 108.178 1.00 0.00 ? 108 G A C8     1  
ATOM 2775   N N7     . G A 1 87  ? 113.215 105.641 107.841 1.00 0.00 ? 108 G A N7     1  
ATOM 2776   C C5     . G A 1 87  ? 113.195 104.803 108.944 1.00 0.00 ? 108 G A C5     1  
ATOM 2777   C C6     . G A 1 87  ? 112.504 103.595 109.165 1.00 0.00 ? 108 G A C6     1  
ATOM 2778   O O6     . G A 1 87  ? 111.763 102.978 108.399 1.00 0.00 ? 108 G A O6     1  
ATOM 2779   N N1     . G A 1 87  ? 112.751 103.093 110.431 1.00 0.00 ? 108 G A N1     1  
ATOM 2780   C C2     . G A 1 87  ? 113.581 103.668 111.356 1.00 0.00 ? 108 G A C2     1  
ATOM 2781   N N2     . G A 1 87  ? 113.712 103.042 112.531 1.00 0.00 ? 108 G A N2     1  
ATOM 2782   N N3     . G A 1 87  ? 114.247 104.778 111.151 1.00 0.00 ? 108 G A N3     1  
ATOM 2783   C C4     . G A 1 87  ? 114.009 105.290 109.938 1.00 0.00 ? 108 G A C4     1  
ATOM 2784   H "H5'"  . G A 1 87  ? 117.835 109.177 106.995 1.00 0.00 ? 108 G A "H5'"  1  
ATOM 2785   H "H5''" . G A 1 87  ? 116.855 107.947 106.724 1.00 0.00 ? 108 G A "H5''" 1  
ATOM 2786   H "H4'"  . G A 1 87  ? 117.638 109.016 109.199 1.00 0.00 ? 108 G A "H4'"  1  
ATOM 2787   H "H3'"  . G A 1 87  ? 117.315 106.370 108.311 1.00 0.00 ? 108 G A "H3'"  1  
ATOM 2788   H "H2'"  . G A 1 87  ? 116.779 105.682 110.465 1.00 0.00 ? 108 G A "H2'"  1  
ATOM 2789   H "HO2'" . G A 1 87  ? 117.033 107.011 112.263 1.00 0.00 ? 108 G A "HO2'" 1  
ATOM 2790   H "H1'"  . G A 1 87  ? 115.137 107.578 110.974 1.00 0.00 ? 108 G A "H1'"  1  
ATOM 2791   H H8     . G A 1 87  ? 114.259 107.349 107.591 1.00 0.00 ? 108 G A H8     1  
ATOM 2792   H H1     . G A 1 87  ? 112.298 102.262 110.682 1.00 0.00 ? 108 G A H1     1  
ATOM 2793   H H21    . G A 1 87  ? 113.221 102.211 112.705 1.00 0.00 ? 108 G A H21    1  
ATOM 2794   H H22    . G A 1 87  ? 114.299 103.415 113.222 1.00 0.00 ? 108 G A H22    1  
ATOM 2795   P P      . C A 1 88  ? 119.868 106.046 108.180 1.00 0.00 ? 109 C A P      1  
ATOM 2796   O OP1    . C A 1 88  ? 121.303 106.163 108.553 1.00 0.00 ? 109 C A OP1    1  
ATOM 2797   O OP2    . C A 1 88  ? 119.415 106.346 106.791 1.00 0.00 ? 109 C A OP2    1  
ATOM 2798   O "O5'"  . C A 1 88  ? 119.460 104.539 108.460 1.00 0.00 ? 109 C A "O5'"  1  
ATOM 2799   C "C5'"  . C A 1 88  ? 118.106 104.139 108.473 1.00 0.00 ? 109 C A "C5'"  1  
ATOM 2800   C "C4'"  . C A 1 88  ? 117.830 103.375 109.735 1.00 0.00 ? 109 C A "C4'"  1  
ATOM 2801   O "O4'"  . C A 1 88  ? 116.423 103.468 110.055 1.00 0.00 ? 109 C A "O4'"  1  
ATOM 2802   C "C3'"  . C A 1 88  ? 118.121 101.884 109.697 1.00 0.00 ? 109 C A "C3'"  1  
ATOM 2803   O "O3'"  . C A 1 88  ? 119.500 101.593 109.929 1.00 0.00 ? 109 C A "O3'"  1  
ATOM 2804   C "C2'"  . C A 1 88  ? 117.240 101.416 110.835 1.00 0.00 ? 109 C A "C2'"  1  
ATOM 2805   O "O2'"  . C A 1 88  ? 117.772 101.831 112.081 1.00 0.00 ? 109 C A "O2'"  1  
ATOM 2806   C "C1'"  . C A 1 88  ? 115.980 102.232 110.558 1.00 0.00 ? 109 C A "C1'"  1  
ATOM 2807   N N1     . C A 1 88  ? 115.135 101.626 109.532 1.00 0.00 ? 109 C A N1     1  
ATOM 2808   C C2     . C A 1 88  ? 114.285 100.591 109.888 1.00 0.00 ? 109 C A C2     1  
ATOM 2809   O O2     . C A 1 88  ? 114.238 100.242 111.084 1.00 0.00 ? 109 C A O2     1  
ATOM 2810   N N3     . C A 1 88  ? 113.531 99.992  108.936 1.00 0.00 ? 109 C A N3     1  
ATOM 2811   C C4     . C A 1 88  ? 113.609 100.403 107.670 1.00 0.00 ? 109 C A C4     1  
ATOM 2812   N N4     . C A 1 88  ? 112.876 99.766  106.761 1.00 0.00 ? 109 C A N4     1  
ATOM 2813   C C5     . C A 1 88  ? 114.449 101.483 107.281 1.00 0.00 ? 109 C A C5     1  
ATOM 2814   C C6     . C A 1 88  ? 115.191 102.059 108.237 1.00 0.00 ? 109 C A C6     1  
ATOM 2815   H "H5'"  . C A 1 88  ? 117.932 103.575 107.689 1.00 0.00 ? 109 C A "H5'"  1  
ATOM 2816   H "H5''" . C A 1 88  ? 117.536 104.935 108.426 1.00 0.00 ? 109 C A "H5''" 1  
ATOM 2817   H "H4'"  . C A 1 88  ? 118.351 103.771 110.464 1.00 0.00 ? 109 C A "H4'"  1  
ATOM 2818   H "H3'"  . C A 1 88  ? 117.856 101.526 108.824 1.00 0.00 ? 109 C A "H3'"  1  
ATOM 2819   H "H2'"  . C A 1 88  ? 117.094 100.448 110.800 1.00 0.00 ? 109 C A "H2'"  1  
ATOM 2820   H "HO2'" . C A 1 88  ? 118.722 102.039 111.970 1.00 0.00 ? 109 C A "HO2'" 1  
ATOM 2821   H "H1'"  . C A 1 88  ? 115.466 102.323 111.388 1.00 0.00 ? 109 C A "H1'"  1  
ATOM 2822   H H41    . C A 1 88  ? 112.302 99.019  107.031 1.00 0.00 ? 109 C A H41    1  
ATOM 2823   H H42    . C A 1 88  ? 112.910 100.043 105.822 1.00 0.00 ? 109 C A H42    1  
ATOM 2824   H H5     . C A 1 88  ? 114.481 101.793 106.352 1.00 0.00 ? 109 C A H5     1  
ATOM 2825   H H6     . C A 1 88  ? 115.776 102.805 107.993 1.00 0.00 ? 109 C A H6     1  
ATOM 2826   P P      . G A 1 89  ? 120.094 100.151 109.519 1.00 0.00 ? 110 G A P      1  
ATOM 2827   O OP1    . G A 1 89  ? 121.502 100.260 109.060 1.00 0.00 ? 110 G A OP1    1  
ATOM 2828   O OP2    . G A 1 89  ? 119.079 99.560  108.616 1.00 0.00 ? 110 G A OP2    1  
ATOM 2829   O "O5'"  . G A 1 89  ? 120.114 99.350  110.895 1.00 0.00 ? 110 G A "O5'"  1  
ATOM 2830   C "C5'"  . G A 1 89  ? 120.147 97.940  110.895 1.00 0.00 ? 110 G A "C5'"  1  
ATOM 2831   C "C4'"  . G A 1 89  ? 119.156 97.374  111.886 1.00 0.00 ? 110 G A "C4'"  1  
ATOM 2832   O "O4'"  . G A 1 89  ? 117.851 98.017  111.812 1.00 0.00 ? 110 G A "O4'"  1  
ATOM 2833   C "C3'"  . G A 1 89  ? 118.872 95.933  111.555 1.00 0.00 ? 110 G A "C3'"  1  
ATOM 2834   O "O3'"  . G A 1 89  ? 119.876 95.126  112.119 1.00 0.00 ? 110 G A "O3'"  1  
ATOM 2835   C "C2'"  . G A 1 89  ? 117.497 95.712  112.155 1.00 0.00 ? 110 G A "C2'"  1  
ATOM 2836   O "O2'"  . G A 1 89  ? 117.577 95.574  113.555 1.00 0.00 ? 110 G A "O2'"  1  
ATOM 2837   C "C1'"  . G A 1 89  ? 116.820 97.036  111.816 1.00 0.00 ? 110 G A "C1'"  1  
ATOM 2838   N N9     . G A 1 89  ? 116.202 97.047  110.492 1.00 0.00 ? 110 G A N9     1  
ATOM 2839   C C8     . G A 1 89  ? 116.519 97.911  109.476 1.00 0.00 ? 110 G A C8     1  
ATOM 2840   N N7     . G A 1 89  ? 115.837 97.698  108.386 1.00 0.00 ? 110 G A N7     1  
ATOM 2841   C C5     . G A 1 89  ? 115.022 96.625  108.699 1.00 0.00 ? 110 G A C5     1  
ATOM 2842   C C6     . G A 1 89  ? 114.091 95.947  107.899 1.00 0.00 ? 110 G A C6     1  
ATOM 2843   O O6     . G A 1 89  ? 113.826 96.144  106.721 1.00 0.00 ? 110 G A O6     1  
ATOM 2844   N N1     . G A 1 89  ? 113.451 94.939  108.597 1.00 0.00 ? 110 G A N1     1  
ATOM 2845   C C2     . G A 1 89  ? 113.699 94.618  109.903 1.00 0.00 ? 110 G A C2     1  
ATOM 2846   N N2     . G A 1 89  ? 112.955 93.621  110.411 1.00 0.00 ? 110 G A N2     1  
ATOM 2847   N N3     . G A 1 89  ? 114.602 95.230  110.661 1.00 0.00 ? 110 G A N3     1  
ATOM 2848   C C4     . G A 1 89  ? 115.219 96.219  109.999 1.00 0.00 ? 110 G A C4     1  
ATOM 2849   H "H5'"  . G A 1 89  ? 121.049 97.640  111.132 1.00 0.00 ? 110 G A "H5'"  1  
ATOM 2850   H "H5''" . G A 1 89  ? 119.928 97.613  109.997 1.00 0.00 ? 110 G A "H5''" 1  
ATOM 2851   H "H4'"  . G A 1 89  ? 119.499 97.513  112.794 1.00 0.00 ? 110 G A "H4'"  1  
ATOM 2852   H "H3'"  . G A 1 89  ? 118.839 95.828  110.583 1.00 0.00 ? 110 G A "H3'"  1  
ATOM 2853   H "H2'"  . G A 1 89  ? 117.041 94.952  111.737 1.00 0.00 ? 110 G A "H2'"  1  
ATOM 2854   H "HO2'" . G A 1 89  ? 116.675 95.433  113.915 1.00 0.00 ? 110 G A "HO2'" 1  
ATOM 2855   H "H1'"  . G A 1 89  ? 116.133 97.232  112.487 1.00 0.00 ? 110 G A "H1'"  1  
ATOM 2856   H H8     . G A 1 89  ? 117.189 98.621  109.561 1.00 0.00 ? 110 G A H8     1  
ATOM 2857   H H1     . G A 1 89  ? 112.773 94.417  108.121 1.00 0.00 ? 110 G A H1     1  
ATOM 2858   H H21    . G A 1 89  ? 112.289 93.169  109.853 1.00 0.00 ? 110 G A H21    1  
ATOM 2859   H H22    . G A 1 89  ? 113.079 93.344  111.344 1.00 0.00 ? 110 G A H22    1  
ATOM 2860   P P      . G A 1 90  ? 120.321 93.779  111.376 1.00 0.00 ? 111 G A P      1  
ATOM 2861   O OP1    . G A 1 90  ? 121.560 93.343  112.068 1.00 0.00 ? 111 G A OP1    1  
ATOM 2862   O OP2    . G A 1 90  ? 120.361 94.121  109.930 1.00 0.00 ? 111 G A OP2    1  
ATOM 2863   O "O5'"  . G A 1 90  ? 119.214 92.663  111.617 1.00 0.00 ? 111 G A "O5'"  1  
ATOM 2864   C "C5'"  . G A 1 90  ? 118.872 91.755  110.586 1.00 0.00 ? 111 G A "C5'"  1  
ATOM 2865   C "C4'"  . G A 1 90  ? 117.640 90.989  110.969 1.00 0.00 ? 111 G A "C4'"  1  
ATOM 2866   O "O4'"  . G A 1 90  ? 116.485 91.843  110.810 1.00 0.00 ? 111 G A "O4'"  1  
ATOM 2867   C "C3'"  . G A 1 90  ? 117.370 89.792  110.083 1.00 0.00 ? 111 G A "C3'"  1  
ATOM 2868   O "O3'"  . G A 1 90  ? 118.097 88.673  110.577 1.00 0.00 ? 111 G A "O3'"  1  
ATOM 2869   C "C2'"  . G A 1 90  ? 115.859 89.646  110.194 1.00 0.00 ? 111 G A "C2'"  1  
ATOM 2870   O "O2'"  . G A 1 90  ? 115.443 89.042  111.400 1.00 0.00 ? 111 G A "O2'"  1  
ATOM 2871   C "C1'"  . G A 1 90  ? 115.424 91.107  110.232 1.00 0.00 ? 111 G A "C1'"  1  
ATOM 2872   N N9     . G A 1 90  ? 115.193 91.651  108.907 1.00 0.00 ? 111 G A N9     1  
ATOM 2873   C C8     . G A 1 90  ? 115.764 92.773  108.376 1.00 0.00 ? 111 G A C8     1  
ATOM 2874   N N7     . G A 1 90  ? 115.403 92.993  107.147 1.00 0.00 ? 111 G A N7     1  
ATOM 2875   C C5     . G A 1 90  ? 114.541 91.951  106.860 1.00 0.00 ? 111 G A C5     1  
ATOM 2876   C C6     . G A 1 90  ? 113.860 91.650  105.674 1.00 0.00 ? 111 G A C6     1  
ATOM 2877   O O6     . G A 1 90  ? 113.898 92.249  104.596 1.00 0.00 ? 111 G A O6     1  
ATOM 2878   N N1     . G A 1 90  ? 113.073 90.516  105.814 1.00 0.00 ? 111 G A N1     1  
ATOM 2879   C C2     . G A 1 90  ? 112.974 89.771  106.953 1.00 0.00 ? 111 G A C2     1  
ATOM 2880   N N2     . G A 1 90  ? 112.147 88.717  106.898 1.00 0.00 ? 111 G A N2     1  
ATOM 2881   N N3     . G A 1 90  ? 113.633 90.036  108.066 1.00 0.00 ? 111 G A N3     1  
ATOM 2882   C C4     . G A 1 90  ? 114.388 91.132  107.946 1.00 0.00 ? 111 G A C4     1  
ATOM 2883   H "H5'"  . G A 1 90  ? 119.618 91.136  110.445 1.00 0.00 ? 111 G A "H5'"  1  
ATOM 2884   H "H5''" . G A 1 90  ? 118.710 92.256  109.759 1.00 0.00 ? 111 G A "H5''" 1  
ATOM 2885   H "H4'"  . G A 1 90  ? 117.714 90.716  111.907 1.00 0.00 ? 111 G A "H4'"  1  
ATOM 2886   H "H3'"  . G A 1 90  ? 117.633 90.005  109.164 1.00 0.00 ? 111 G A "H3'"  1  
ATOM 2887   H "H2'"  . G A 1 90  ? 115.486 89.168  109.424 1.00 0.00 ? 111 G A "H2'"  1  
ATOM 2888   H "HO2'" . G A 1 90  ? 114.464 88.979  111.403 1.00 0.00 ? 111 G A "HO2'" 1  
ATOM 2889   H "H1'"  . G A 1 90  ? 114.604 91.190  110.763 1.00 0.00 ? 111 G A "H1'"  1  
ATOM 2890   H H8     . G A 1 90  ? 116.383 93.351  108.867 1.00 0.00 ? 111 G A H8     1  
ATOM 2891   H H1     . G A 1 90  ? 112.552 90.229  105.036 1.00 0.00 ? 111 G A H1     1  
ATOM 2892   H H21    . G A 1 90  ? 111.656 88.517  106.073 1.00 0.00 ? 111 G A H21    1  
ATOM 2893   H H22    . G A 1 90  ? 112.032 88.144  107.684 1.00 0.00 ? 111 G A H22    1  
ATOM 2894   P P      . G A 1 91  ? 118.950 87.769  109.557 1.00 0.00 ? 112 G A P      1  
ATOM 2895   O OP1    . G A 1 91  ? 119.900 86.904  110.323 1.00 0.00 ? 112 G A OP1    1  
ATOM 2896   O OP2    . G A 1 91  ? 119.476 88.688  108.495 1.00 0.00 ? 112 G A OP2    1  
ATOM 2897   O "O5'"  . G A 1 91  ? 117.842 86.840  108.885 1.00 0.00 ? 112 G A "O5'"  1  
ATOM 2898   C "C5'"  . G A 1 91  ? 117.006 86.021  109.682 1.00 0.00 ? 112 G A "C5'"  1  
ATOM 2899   C "C4'"  . G A 1 91  ? 115.883 85.493  108.847 1.00 0.00 ? 112 G A "C4'"  1  
ATOM 2900   O "O4'"  . G A 1 91  ? 115.184 86.619  108.274 1.00 0.00 ? 112 G A "O4'"  1  
ATOM 2901   C "C3'"  . G A 1 91  ? 116.315 84.719  107.615 1.00 0.00 ? 112 G A "C3'"  1  
ATOM 2902   O "O3'"  . G A 1 91  ? 116.620 83.367  107.952 1.00 0.00 ? 112 G A "O3'"  1  
ATOM 2903   C "C2'"  . G A 1 91  ? 115.089 84.830  106.703 1.00 0.00 ? 112 G A "C2'"  1  
ATOM 2904   O "O2'"  . G A 1 91  ? 114.055 83.885  106.926 1.00 0.00 ? 112 G A "O2'"  1  
ATOM 2905   C "C1'"  . G A 1 91  ? 114.559 86.211  107.069 1.00 0.00 ? 112 G A "C1'"  1  
ATOM 2906   N N9     . G A 1 91  ? 114.827 87.192  106.038 1.00 0.00 ? 112 G A N9     1  
ATOM 2907   C C8     . G A 1 91  ? 115.680 88.266  106.102 1.00 0.00 ? 112 G A C8     1  
ATOM 2908   N N7     . G A 1 91  ? 115.666 88.989  105.018 1.00 0.00 ? 112 G A N7     1  
ATOM 2909   C C5     . G A 1 91  ? 114.756 88.343  104.188 1.00 0.00 ? 112 G A C5     1  
ATOM 2910   C C6     . G A 1 91  ? 114.325 88.663  102.877 1.00 0.00 ? 112 G A C6     1  
ATOM 2911   O O6     . G A 1 91  ? 114.661 89.617  102.172 1.00 0.00 ? 112 G A O6     1  
ATOM 2912   N N1     . G A 1 91  ? 113.414 87.735  102.400 1.00 0.00 ? 112 G A N1     1  
ATOM 2913   C C2     . G A 1 91  ? 112.976 86.645  103.092 1.00 0.00 ? 112 G A C2     1  
ATOM 2914   N N2     . G A 1 91  ? 112.120 85.866  102.447 1.00 0.00 ? 112 G A N2     1  
ATOM 2915   N N3     . G A 1 91  ? 113.356 86.340  104.323 1.00 0.00 ? 112 G A N3     1  
ATOM 2916   C C4     . G A 1 91  ? 114.244 87.228  104.803 1.00 0.00 ? 112 G A C4     1  
ATOM 2917   H "H5'"  . G A 1 91  ? 116.652 86.552  110.425 1.00 0.00 ? 112 G A "H5'"  1  
ATOM 2918   H "H5''" . G A 1 91  ? 117.535 85.279  110.043 1.00 0.00 ? 112 G A "H5''" 1  
ATOM 2919   H "H4'"  . G A 1 91  ? 115.272 84.984  109.420 1.00 0.00 ? 112 G A "H4'"  1  
ATOM 2920   H "H3'"  . G A 1 91  ? 117.097 85.155  107.219 1.00 0.00 ? 112 G A "H3'"  1  
ATOM 2921   H "H2'"  . G A 1 91  ? 115.343 84.806  105.756 1.00 0.00 ? 112 G A "H2'"  1  
ATOM 2922   H "HO2'" . G A 1 91  ? 114.424 83.119  107.414 1.00 0.00 ? 112 G A "HO2'" 1  
ATOM 2923   H "H1'"  . G A 1 91  ? 113.593 86.158  107.225 1.00 0.00 ? 112 G A "H1'"  1  
ATOM 2924   H H8     . G A 1 91  ? 116.236 88.474  106.881 1.00 0.00 ? 112 G A H8     1  
ATOM 2925   H H1     . G A 1 91  ? 113.057 87.873  101.497 1.00 0.00 ? 112 G A H1     1  
ATOM 2926   H H21    . G A 1 91  ? 111.839 86.092  101.535 1.00 0.00 ? 112 G A H21    1  
ATOM 2927   H H22    . G A 1 91  ? 111.767 85.060  102.880 1.00 0.00 ? 112 G A H22    1  
ATOM 2928   P P      . A A 1 92  ? 117.572 82.508  106.993 1.00 0.00 ? 113 A A P      1  
ATOM 2929   O OP1    . A A 1 92  ? 116.793 81.297  106.643 1.00 0.00 ? 113 A A OP1    1  
ATOM 2930   O OP2    . A A 1 92  ? 118.858 82.376  107.736 1.00 0.00 ? 113 A A OP2    1  
ATOM 2931   O "O5'"  . A A 1 92  ? 117.819 83.317  105.651 1.00 0.00 ? 113 A A "O5'"  1  
ATOM 2932   C "C5'"  . A A 1 92  ? 118.145 82.641  104.454 1.00 0.00 ? 113 A A "C5'"  1  
ATOM 2933   C "C4'"  . A A 1 92  ? 116.923 82.520  103.590 1.00 0.00 ? 113 A A "C4'"  1  
ATOM 2934   O "O4'"  . A A 1 92  ? 116.057 83.651  103.833 1.00 0.00 ? 113 A A "O4'"  1  
ATOM 2935   C "C3'"  . A A 1 92  ? 117.240 82.513  102.104 1.00 0.00 ? 113 A A "C3'"  1  
ATOM 2936   O "O3'"  . A A 1 92  ? 117.313 81.165  101.651 1.00 0.00 ? 113 A A "O3'"  1  
ATOM 2937   C "C2'"  . A A 1 92  ? 116.082 83.304  101.512 1.00 0.00 ? 113 A A "C2'"  1  
ATOM 2938   O "O2'"  . A A 1 92  ? 114.932 82.504  101.304 1.00 0.00 ? 113 A A "O2'"  1  
ATOM 2939   C "C1'"  . A A 1 92  ? 115.827 84.328  102.625 1.00 0.00 ? 113 A A "C1'"  1  
ATOM 2940   N N9     . A A 1 92  ? 116.726 85.475  102.653 1.00 0.00 ? 113 A A N9     1  
ATOM 2941   C C8     . A A 1 92  ? 117.644 85.740  103.643 1.00 0.00 ? 113 A A C8     1  
ATOM 2942   N N7     . A A 1 92  ? 118.325 86.836  103.452 1.00 0.00 ? 113 A A N7     1  
ATOM 2943   C C5     . A A 1 92  ? 117.828 87.330  102.256 1.00 0.00 ? 113 A A C5     1  
ATOM 2944   C C6     . A A 1 92  ? 118.143 88.471  101.513 1.00 0.00 ? 113 A A C6     1  
ATOM 2945   N N6     . A A 1 92  ? 119.072 89.353  101.886 1.00 0.00 ? 113 A A N6     1  
ATOM 2946   N N1     . A A 1 92  ? 117.463 88.680  100.363 1.00 0.00 ? 113 A A N1     1  
ATOM 2947   C C2     . A A 1 92  ? 116.527 87.789  100.001 1.00 0.00 ? 113 A A C2     1  
ATOM 2948   N N3     . A A 1 92  ? 116.143 86.674  100.620 1.00 0.00 ? 113 A A N3     1  
ATOM 2949   C C4     . A A 1 92  ? 116.842 86.500  101.752 1.00 0.00 ? 113 A A C4     1  
ATOM 2950   H "H5'"  . A A 1 92  ? 118.490 81.749  104.672 1.00 0.00 ? 113 A A "H5'"  1  
ATOM 2951   H "H5''" . A A 1 92  ? 118.841 83.143  103.981 1.00 0.00 ? 113 A A "H5''" 1  
ATOM 2952   H "H4'"  . A A 1 92  ? 116.449 81.694  103.823 1.00 0.00 ? 113 A A "H4'"  1  
ATOM 2953   H "H3'"  . A A 1 92  ? 118.089 82.982  101.956 1.00 0.00 ? 113 A A "H3'"  1  
ATOM 2954   H "H2'"  . A A 1 92  ? 116.346 83.765  100.688 1.00 0.00 ? 113 A A "H2'"  1  
ATOM 2955   H "HO2'" . A A 1 92  ? 115.200 81.563  101.278 1.00 0.00 ? 113 A A "HO2'" 1  
ATOM 2956   H "H1'"  . A A 1 92  ? 114.913 84.673  102.548 1.00 0.00 ? 113 A A "H1'"  1  
ATOM 2957   H H8     . A A 1 92  ? 117.773 85.157  104.421 1.00 0.00 ? 113 A A H8     1  
ATOM 2958   H H61    . A A 1 92  ? 119.253 90.139  101.329 1.00 0.00 ? 113 A A H61    1  
ATOM 2959   H H62    . A A 1 92  ? 119.573 89.217  102.716 1.00 0.00 ? 113 A A H62    1  
ATOM 2960   H H2     . A A 1 92  ? 116.061 87.986  99.162  1.00 0.00 ? 113 A A H2     1  
ATOM 2961   P P      . A A 1 93  ? 118.733 80.417  101.604 1.00 0.00 ? 114 A A P      1  
ATOM 2962   O OP1    . A A 1 93  ? 118.498 78.984  101.893 1.00 0.00 ? 114 A A OP1    1  
ATOM 2963   O OP2    . A A 1 93  ? 119.711 81.178  102.413 1.00 0.00 ? 114 A A OP2    1  
ATOM 2964   O "O5'"  . A A 1 93  ? 119.168 80.562  100.085 1.00 0.00 ? 114 A A "O5'"  1  
ATOM 2965   C "C5'"  . A A 1 93  ? 118.735 79.618  99.111  1.00 0.00 ? 114 A A "C5'"  1  
ATOM 2966   C "C4'"  . A A 1 93  ? 117.225 79.615  99.009  1.00 0.00 ? 114 A A "C4'"  1  
ATOM 2967   O "O4'"  . A A 1 93  ? 116.721 80.974  99.044  1.00 0.00 ? 114 A A "O4'"  1  
ATOM 2968   C "C3'"  . A A 1 93  ? 116.697 79.013  97.718  1.00 0.00 ? 114 A A "C3'"  1  
ATOM 2969   O "O3'"  . A A 1 93  ? 116.536 77.607  97.872  1.00 0.00 ? 114 A A "O3'"  1  
ATOM 2970   C "C2'"  . A A 1 93  ? 115.365 79.732  97.528  1.00 0.00 ? 114 A A "C2'"  1  
ATOM 2971   O "O2'"  . A A 1 93  ? 114.316 79.143  98.264  1.00 0.00 ? 114 A A "O2'"  1  
ATOM 2972   C "C1'"  . A A 1 93  ? 115.664 81.113  98.115  1.00 0.00 ? 114 A A "C1'"  1  
ATOM 2973   N N9     . A A 1 93  ? 116.040 82.159  97.161  1.00 0.00 ? 114 A A N9     1  
ATOM 2974   C C8     . A A 1 93  ? 116.842 83.241  97.421  1.00 0.00 ? 114 A A C8     1  
ATOM 2975   N N7     . A A 1 93  ? 116.981 84.057  96.406  1.00 0.00 ? 114 A A N7     1  
ATOM 2976   C C5     . A A 1 93  ? 116.231 83.466  95.402  1.00 0.00 ? 114 A A C5     1  
ATOM 2977   C C6     . A A 1 93  ? 115.967 83.847  94.070  1.00 0.00 ? 114 A A C6     1  
ATOM 2978   N N6     . A A 1 93  ? 116.433 84.967  93.511  1.00 0.00 ? 114 A A N6     1  
ATOM 2979   N N1     . A A 1 93  ? 115.189 83.030  93.327  1.00 0.00 ? 114 A A N1     1  
ATOM 2980   C C2     . A A 1 93  ? 114.704 81.916  93.895  1.00 0.00 ? 114 A A C2     1  
ATOM 2981   N N3     . A A 1 93  ? 114.873 81.456  95.139  1.00 0.00 ? 114 A A N3     1  
ATOM 2982   C C4     . A A 1 93  ? 115.657 82.287  95.848  1.00 0.00 ? 114 A A C4     1  
ATOM 2983   H "H5'"  . A A 1 93  ? 119.049 78.727  99.371  1.00 0.00 ? 114 A A "H5'"  1  
ATOM 2984   H "H5''" . A A 1 93  ? 119.123 79.853  98.243  1.00 0.00 ? 114 A A "H5''" 1  
ATOM 2985   H "H4'"  . A A 1 93  ? 116.855 79.123  99.771  1.00 0.00 ? 114 A A "H4'"  1  
ATOM 2986   H "H3'"  . A A 1 93  ? 117.323 79.214  96.990  1.00 0.00 ? 114 A A "H3'"  1  
ATOM 2987   H "H2'"  . A A 1 93  ? 115.127 79.805  96.578  1.00 0.00 ? 114 A A "H2'"  1  
ATOM 2988   H "HO2'" . A A 1 93  ? 113.491 79.646  98.102  1.00 0.00 ? 114 A A "HO2'" 1  
ATOM 2989   H "H1'"  . A A 1 93  ? 114.877 81.437  98.605  1.00 0.00 ? 114 A A "H1'"  1  
ATOM 2990   H H8     . A A 1 93  ? 117.264 83.394  98.293  1.00 0.00 ? 114 A A H8     1  
ATOM 2991   H H61    . A A 1 93  ? 116.208 85.181  92.582  1.00 0.00 ? 114 A A H61    1  
ATOM 2992   H H62    . A A 1 93  ? 116.999 85.575  94.030  1.00 0.00 ? 114 A A H62    1  
ATOM 2993   H H2     . A A 1 93  ? 114.145 81.359  93.313  1.00 0.00 ? 114 A A H2     1  
ATOM 2994   P P      . A A 1 94  ? 117.710 76.616  97.403  1.00 0.00 ? 115 A A P      1  
ATOM 2995   O OP1    . A A 1 94  ? 117.137 75.255  97.318  1.00 0.00 ? 115 A A OP1    1  
ATOM 2996   O OP2    . A A 1 94  ? 118.896 76.851  98.257  1.00 0.00 ? 115 A A OP2    1  
ATOM 2997   O "O5'"  . A A 1 94  ? 118.043 77.100  95.925  1.00 0.00 ? 115 A A "O5'"  1  
ATOM 2998   C "C5'"  . A A 1 94  ? 117.414 76.485  94.807  1.00 0.00 ? 115 A A "C5'"  1  
ATOM 2999   C "C4'"  . A A 1 94  ? 117.682 77.271  93.549  1.00 0.00 ? 115 A A "C4'"  1  
ATOM 3000   O "O4'"  . A A 1 94  ? 117.138 78.604  93.708  1.00 0.00 ? 115 A A "O4'"  1  
ATOM 3001   C "C3'"  . A A 1 94  ? 119.139 77.511  93.183  1.00 0.00 ? 115 A A "C3'"  1  
ATOM 3002   O "O3'"  . A A 1 94  ? 119.699 76.390  92.494  1.00 0.00 ? 115 A A "O3'"  1  
ATOM 3003   C "C2'"  . A A 1 94  ? 119.027 78.730  92.276  1.00 0.00 ? 115 A A "C2'"  1  
ATOM 3004   O "O2'"  . A A 1 94  ? 118.579 78.399  90.975  1.00 0.00 ? 115 A A "O2'"  1  
ATOM 3005   C "C1'"  . A A 1 94  ? 117.936 79.532  92.990  1.00 0.00 ? 115 A A "C1'"  1  
ATOM 3006   N N9     . A A 1 94  ? 118.439 80.540  93.930  1.00 0.00 ? 115 A A N9     1  
ATOM 3007   C C8     . A A 1 94  ? 118.495 80.454  95.302  1.00 0.00 ? 115 A A C8     1  
ATOM 3008   N N7     . A A 1 94  ? 118.972 81.530  95.880  1.00 0.00 ? 115 A A N7     1  
ATOM 3009   C C5     . A A 1 94  ? 119.254 82.383  94.821  1.00 0.00 ? 115 A A C5     1  
ATOM 3010   C C6     . A A 1 94  ? 119.773 83.690  94.769  1.00 0.00 ? 115 A A C6     1  
ATOM 3011   N N6     . A A 1 94  ? 120.105 84.402  95.847  1.00 0.00 ? 115 A A N6     1  
ATOM 3012   N N1     . A A 1 94  ? 119.938 84.252  93.551  1.00 0.00 ? 115 A A N1     1  
ATOM 3013   C C2     . A A 1 94  ? 119.595 83.547  92.465  1.00 0.00 ? 115 A A C2     1  
ATOM 3014   N N3     . A A 1 94  ? 119.089 82.317  92.385  1.00 0.00 ? 115 A A N3     1  
ATOM 3015   C C4     . A A 1 94  ? 118.940 81.782  93.613  1.00 0.00 ? 115 A A C4     1  
ATOM 3016   H "H5'"  . A A 1 94  ? 116.449 76.443  94.968  1.00 0.00 ? 115 A A "H5'"  1  
ATOM 3017   H "H5''" . A A 1 94  ? 117.760 75.575  94.705  1.00 0.00 ? 115 A A "H5''" 1  
ATOM 3018   H "H4'"  . A A 1 94  ? 117.241 76.826  92.795  1.00 0.00 ? 115 A A "H4'"  1  
ATOM 3019   H "H3'"  . A A 1 94  ? 119.651 77.689  94.000  1.00 0.00 ? 115 A A "H3'"  1  
ATOM 3020   H "H2'"  . A A 1 94  ? 119.869 79.231  92.241  1.00 0.00 ? 115 A A "H2'"  1  
ATOM 3021   H "HO2'" . A A 1 94  ? 118.526 79.217  90.438  1.00 0.00 ? 115 A A "HO2'" 1  
ATOM 3022   H "H1'"  . A A 1 94  ? 117.377 79.986  92.324  1.00 0.00 ? 115 A A "H1'"  1  
ATOM 3023   H H8     . A A 1 94  ? 118.204 79.663  95.803  1.00 0.00 ? 115 A A H8     1  
ATOM 3024   H H61    . A A 1 94  ? 120.457 85.312  95.744  1.00 0.00 ? 115 A A H61    1  
ATOM 3025   H H62    . A A 1 94  ? 119.995 84.018  96.742  1.00 0.00 ? 115 A A H62    1  
ATOM 3026   H H2     . A A 1 94  ? 119.737 84.000  91.607  1.00 0.00 ? 115 A A H2     1  
ATOM 3027   P P      . G A 1 95  ? 121.219 75.934  92.792  1.00 0.00 ? 116 G A P      1  
ATOM 3028   O OP1    . G A 1 95  ? 121.380 74.533  92.333  1.00 0.00 ? 116 G A OP1    1  
ATOM 3029   O OP2    . G A 1 95  ? 121.548 76.285  94.195  1.00 0.00 ? 116 G A OP2    1  
ATOM 3030   O "O5'"  . G A 1 95  ? 122.098 76.867  91.849  1.00 0.00 ? 116 G A "O5'"  1  
ATOM 3031   C "C5'"  . G A 1 95  ? 122.132 76.659  90.443  1.00 0.00 ? 116 G A "C5'"  1  
ATOM 3032   C "C4'"  . G A 1 95  ? 122.867 77.789  89.777  1.00 0.00 ? 116 G A "C4'"  1  
ATOM 3033   O "O4'"  . G A 1 95  ? 122.116 79.022  89.967  1.00 0.00 ? 116 G A "O4'"  1  
ATOM 3034   C "C3'"  . G A 1 95  ? 124.228 78.091  90.380  1.00 0.00 ? 116 G A "C3'"  1  
ATOM 3035   O "O3'"  . G A 1 95  ? 125.251 77.238  89.884  1.00 0.00 ? 116 G A "O3'"  1  
ATOM 3036   C "C2'"  . G A 1 95  ? 124.412 79.555  90.011  1.00 0.00 ? 116 G A "C2'"  1  
ATOM 3037   O "O2'"  . G A 1 95  ? 124.780 79.761  88.658  1.00 0.00 ? 116 G A "O2'"  1  
ATOM 3038   C "C1'"  . G A 1 95  ? 123.003 80.088  90.276  1.00 0.00 ? 116 G A "C1'"  1  
ATOM 3039   N N9     . G A 1 95  ? 122.834 80.405  91.692  1.00 0.00 ? 116 G A N9     1  
ATOM 3040   C C8     . G A 1 95  ? 122.477 79.526  92.685  1.00 0.00 ? 116 G A C8     1  
ATOM 3041   N N7     . G A 1 95  ? 122.463 80.067  93.871  1.00 0.00 ? 116 G A N7     1  
ATOM 3042   C C5     . G A 1 95  ? 122.819 81.388  93.650  1.00 0.00 ? 116 G A C5     1  
ATOM 3043   C C6     . G A 1 95  ? 122.980 82.449  94.567  1.00 0.00 ? 116 G A C6     1  
ATOM 3044   O O6     . G A 1 95  ? 122.843 82.435  95.796  1.00 0.00 ? 116 G A O6     1  
ATOM 3045   N N1     . G A 1 95  ? 123.346 83.626  93.924  1.00 0.00 ? 116 G A N1     1  
ATOM 3046   C C2     . G A 1 95  ? 123.536 83.760  92.572  1.00 0.00 ? 116 G A C2     1  
ATOM 3047   N N2     . G A 1 95  ? 123.887 84.979  92.146  1.00 0.00 ? 116 G A N2     1  
ATOM 3048   N N3     . G A 1 95  ? 123.392 82.772  91.702  1.00 0.00 ? 116 G A N3     1  
ATOM 3049   C C4     . G A 1 95  ? 123.036 81.621  92.308  1.00 0.00 ? 116 G A C4     1  
ATOM 3050   H "H5'"  . G A 1 95  ? 121.214 76.614  90.104  1.00 0.00 ? 116 G A "H5'"  1  
ATOM 3051   H "H5''" . G A 1 95  ? 122.584 75.810  90.255  1.00 0.00 ? 116 G A "H5''" 1  
ATOM 3052   H "H4'"  . G A 1 95  ? 122.939 77.599  88.818  1.00 0.00 ? 116 G A "H4'"  1  
ATOM 3053   H "H3'"  . G A 1 95  ? 124.174 77.999  91.353  1.00 0.00 ? 116 G A "H3'"  1  
ATOM 3054   H "H2'"  . G A 1 95  ? 125.050 79.999  90.608  1.00 0.00 ? 116 G A "H2'"  1  
ATOM 3055   H "HO2'" . G A 1 95  ? 125.451 80.473  88.615  1.00 0.00 ? 116 G A "HO2'" 1  
ATOM 3056   H "H1'"  . G A 1 95  ? 122.846 80.886  89.728  1.00 0.00 ? 116 G A "H1'"  1  
ATOM 3057   H H8     . G A 1 95  ? 122.263 78.584  92.518  1.00 0.00 ? 116 G A H8     1  
ATOM 3058   H H1     . G A 1 95  ? 123.480 84.420  94.483  1.00 0.00 ? 116 G A H1     1  
ATOM 3059   H H21    . G A 1 95  ? 123.995 85.712  92.786  1.00 0.00 ? 116 G A H21    1  
ATOM 3060   H H22    . G A 1 95  ? 124.037 85.140  91.190  1.00 0.00 ? 116 G A H22    1  
ATOM 3061   P P      . G A 1 96  ? 126.188 77.738  88.686  1.00 0.00 ? 117 G A P      1  
ATOM 3062   O OP1    . G A 1 96  ? 125.273 78.012  87.553  1.00 0.00 ? 117 G A OP1    1  
ATOM 3063   O OP2    . G A 1 96  ? 127.237 76.702  88.539  1.00 0.00 ? 117 G A OP2    1  
ATOM 3064   O "O5'"  . G A 1 96  ? 126.881 79.104  89.104  1.00 0.00 ? 117 G A "O5'"  1  
ATOM 3065   C "C5'"  . G A 1 96  ? 128.065 79.536  88.443  1.00 0.00 ? 117 G A "C5'"  1  
ATOM 3066   C "C4'"  . G A 1 96  ? 128.343 80.986  88.748  1.00 0.00 ? 117 G A "C4'"  1  
ATOM 3067   O "O4'"  . G A 1 96  ? 127.205 81.595  89.424  1.00 0.00 ? 117 G A "O4'"  1  
ATOM 3068   C "C3'"  . G A 1 96  ? 129.485 81.251  89.711  1.00 0.00 ? 117 G A "C3'"  1  
ATOM 3069   O "O3'"  . G A 1 96  ? 130.765 81.090  89.114  1.00 0.00 ? 117 G A "O3'"  1  
ATOM 3070   C "C2'"  . G A 1 96  ? 129.187 82.683  90.122  1.00 0.00 ? 117 G A "C2'"  1  
ATOM 3071   O "O2'"  . G A 1 96  ? 129.516 83.616  89.106  1.00 0.00 ? 117 G A "O2'"  1  
ATOM 3072   C "C1'"  . G A 1 96  ? 127.668 82.612  90.313  1.00 0.00 ? 117 G A "C1'"  1  
ATOM 3073   N N9     . G A 1 96  ? 127.299 82.247  91.687  1.00 0.00 ? 117 G A N9     1  
ATOM 3074   C C8     . G A 1 96  ? 126.878 81.018  92.133  1.00 0.00 ? 117 G A C8     1  
ATOM 3075   N N7     . G A 1 96  ? 126.652 80.986  93.420  1.00 0.00 ? 117 G A N7     1  
ATOM 3076   C C5     . G A 1 96  ? 126.932 82.275  93.854  1.00 0.00 ? 117 G A C5     1  
ATOM 3077   C C6     . G A 1 96  ? 126.878 82.836  95.154  1.00 0.00 ? 117 G A C6     1  
ATOM 3078   O O6     . G A 1 96  ? 126.559 82.293  96.218  1.00 0.00 ? 117 G A O6     1  
ATOM 3079   N N1     . G A 1 96  ? 127.246 84.177  95.150  1.00 0.00 ? 117 G A N1     1  
ATOM 3080   C C2     . G A 1 96  ? 127.616 84.887  94.039  1.00 0.00 ? 117 G A C2     1  
ATOM 3081   N N2     . G A 1 96  ? 127.935 86.174  94.246  1.00 0.00 ? 117 G A N2     1  
ATOM 3082   N N3     . G A 1 96  ? 127.674 84.377  92.817  1.00 0.00 ? 117 G A N3     1  
ATOM 3083   C C4     . G A 1 96  ? 127.323 83.073  92.798  1.00 0.00 ? 117 G A C4     1  
ATOM 3084   H "H5'"  . G A 1 96  ? 127.951 79.421  87.477  1.00 0.00 ? 117 G A "H5'"  1  
ATOM 3085   H "H5''" . G A 1 96  ? 128.819 78.987  88.743  1.00 0.00 ? 117 G A "H5''" 1  
ATOM 3086   H "H4'"  . G A 1 96  ? 128.499 81.463  87.905  1.00 0.00 ? 117 G A "H4'"  1  
ATOM 3087   H "H3'"  . G A 1 96  ? 129.410 80.643  90.474  1.00 0.00 ? 117 G A "H3'"  1  
ATOM 3088   H "H2'"  . G A 1 96  ? 129.626 82.913  90.968  1.00 0.00 ? 117 G A "H2'"  1  
ATOM 3089   H "HO2'" . G A 1 96  ? 129.921 84.407  89.520  1.00 0.00 ? 117 G A "HO2'" 1  
ATOM 3090   H "H1'"  . G A 1 96  ? 127.268 83.479  90.087  1.00 0.00 ? 117 G A "H1'"  1  
ATOM 3091   H H8     . G A 1 96  ? 126.764 80.240  91.546  1.00 0.00 ? 117 G A H8     1  
ATOM 3092   H H1     . G A 1 96  ? 127.238 84.647  96.009  1.00 0.00 ? 117 G A H1     1  
ATOM 3093   H H21    . G A 1 96  ? 127.893 86.553  95.149  1.00 0.00 ? 117 G A H21    1  
ATOM 3094   H H22    . G A 1 96  ? 128.210 86.737  93.492  1.00 0.00 ? 117 G A H22    1  
ATOM 3095   P P      . G A 1 97  ? 131.983 80.507  89.994  1.00 0.00 ? 118 G A P      1  
ATOM 3096   O OP1    . G A 1 97  ? 132.952 79.880  89.068  1.00 0.00 ? 118 G A OP1    1  
ATOM 3097   O OP2    . G A 1 97  ? 131.417 79.707  91.119  1.00 0.00 ? 118 G A OP2    1  
ATOM 3098   O "O5'"  . G A 1 97  ? 132.665 81.815  90.594  1.00 0.00 ? 118 G A "O5'"  1  
ATOM 3099   C "C5'"  . G A 1 97  ? 132.988 82.916  89.746  1.00 0.00 ? 118 G A "C5'"  1  
ATOM 3100   C "C4'"  . G A 1 97  ? 132.916 84.214  90.518  1.00 0.00 ? 118 G A "C4'"  1  
ATOM 3101   O "O4'"  . G A 1 97  ? 131.547 84.443  90.967  1.00 0.00 ? 118 G A "O4'"  1  
ATOM 3102   C "C3'"  . G A 1 97  ? 133.724 84.261  91.807  1.00 0.00 ? 118 G A "C3'"  1  
ATOM 3103   O "O3'"  . G A 1 97  ? 135.104 84.522  91.585  1.00 0.00 ? 118 G A "O3'"  1  
ATOM 3104   C "C2'"  . G A 1 97  ? 133.010 85.367  92.570  1.00 0.00 ? 118 G A "C2'"  1  
ATOM 3105   O "O2'"  . G A 1 97  ? 133.289 86.657  92.053  1.00 0.00 ? 118 G A "O2'"  1  
ATOM 3106   C "C1'"  . G A 1 97  ? 131.555 84.993  92.284  1.00 0.00 ? 118 G A "C1'"  1  
ATOM 3107   N N9     . G A 1 97  ? 131.061 83.976  93.217  1.00 0.00 ? 118 G A N9     1  
ATOM 3108   C C8     . G A 1 97  ? 130.675 82.688  92.919  1.00 0.00 ? 118 G A C8     1  
ATOM 3109   N N7     . G A 1 97  ? 130.282 82.011  93.966  1.00 0.00 ? 118 G A N7     1  
ATOM 3110   C C5     . G A 1 97  ? 130.412 82.902  95.020  1.00 0.00 ? 118 G A C5     1  
ATOM 3111   C C6     . G A 1 97  ? 130.137 82.732  96.400  1.00 0.00 ? 118 G A C6     1  
ATOM 3112   O O6     . G A 1 97  ? 129.691 81.728  96.986  1.00 0.00 ? 118 G A O6     1  
ATOM 3113   N N1     . G A 1 97  ? 130.427 83.889  97.122  1.00 0.00 ? 118 G A N1     1  
ATOM 3114   C C2     . G A 1 97  ? 130.914 85.058  96.582  1.00 0.00 ? 118 G A C2     1  
ATOM 3115   N N2     . G A 1 97  ? 131.148 86.057  97.436  1.00 0.00 ? 118 G A N2     1  
ATOM 3116   N N3     . G A 1 97  ? 131.162 85.230  95.296  1.00 0.00 ? 118 G A N3     1  
ATOM 3117   C C4     . G A 1 97  ? 130.893 84.120  94.578  1.00 0.00 ? 118 G A C4     1  
ATOM 3118   H "H5'"  . G A 1 97  ? 132.355 82.942  88.999  1.00 0.00 ? 118 G A "H5'"  1  
ATOM 3119   H "H5''" . G A 1 97  ? 133.894 82.793  89.394  1.00 0.00 ? 118 G A "H5''" 1  
ATOM 3120   H "H4'"  . G A 1 97  ? 133.185 84.950  89.929  1.00 0.00 ? 118 G A "H4'"  1  
ATOM 3121   H "H3'"  . G A 1 97  ? 133.630 83.407  92.277  1.00 0.00 ? 118 G A "H3'"  1  
ATOM 3122   H "H2'"  . G A 1 97  ? 133.204 85.325  93.529  1.00 0.00 ? 118 G A "H2'"  1  
ATOM 3123   H "HO2'" . G A 1 97  ? 134.115 86.619  91.527  1.00 0.00 ? 118 G A "HO2'" 1  
ATOM 3124   H "H1'"  . G A 1 97  ? 130.995 85.795  92.341  1.00 0.00 ? 118 G A "H1'"  1  
ATOM 3125   H H8     . G A 1 97  ? 130.696 82.317  92.013  1.00 0.00 ? 118 G A H8     1  
ATOM 3126   H H1     . G A 1 97  ? 130.274 83.864  98.089  1.00 0.00 ? 118 G A H1     1  
ATOM 3127   H H21    . G A 1 97  ? 130.967 85.941  98.391  1.00 0.00 ? 118 G A H21    1  
ATOM 3128   H H22    . G A 1 97  ? 131.502 86.910  97.107  1.00 0.00 ? 118 G A H22    1  
ATOM 3129   P P      . G A 1 98  ? 136.206 83.771  92.487  1.00 0.00 ? 119 G A P      1  
ATOM 3130   O OP1    . G A 1 98  ? 137.509 83.858  91.784  1.00 0.00 ? 119 G A OP1    1  
ATOM 3131   O OP2    . G A 1 98  ? 135.652 82.434  92.840  1.00 0.00 ? 119 G A OP2    1  
ATOM 3132   O "O5'"  . G A 1 98  ? 136.281 84.653  93.817  1.00 0.00 ? 119 G A "O5'"  1  
ATOM 3133   C "C5'"  . G A 1 98  ? 136.819 85.975  93.785  1.00 0.00 ? 119 G A "C5'"  1  
ATOM 3134   C "C4'"  . G A 1 98  ? 136.768 86.608  95.156  1.00 0.00 ? 119 G A "C4'"  1  
ATOM 3135   O "O4'"  . G A 1 98  ? 135.387 86.843  95.544  1.00 0.00 ? 119 G A "O4'"  1  
ATOM 3136   C "C3'"  . G A 1 98  ? 137.350 85.780  96.286  1.00 0.00 ? 119 G A "C3'"  1  
ATOM 3137   O "O3'"  . G A 1 98  ? 138.750 85.967  96.382  1.00 0.00 ? 119 G A "O3'"  1  
ATOM 3138   C "C2'"  . G A 1 98  ? 136.627 86.358  97.491  1.00 0.00 ? 119 G A "C2'"  1  
ATOM 3139   O "O2'"  . G A 1 98  ? 137.160 87.610  97.877  1.00 0.00 ? 119 G A "O2'"  1  
ATOM 3140   C "C1'"  . G A 1 98  ? 135.217 86.533  96.922  1.00 0.00 ? 119 G A "C1'"  1  
ATOM 3141   N N9     . G A 1 98  ? 134.445 85.295  96.994  1.00 0.00 ? 119 G A N9     1  
ATOM 3142   C C8     . G A 1 98  ? 133.975 84.580  95.927  1.00 0.00 ? 119 G A C8     1  
ATOM 3143   N N7     . G A 1 98  ? 133.340 83.496  96.272  1.00 0.00 ? 119 G A N7     1  
ATOM 3144   C C5     . G A 1 98  ? 133.392 83.494  97.655  1.00 0.00 ? 119 G A C5     1  
ATOM 3145   C C6     . G A 1 98  ? 132.889 82.560  98.576  1.00 0.00 ? 119 G A C6     1  
ATOM 3146   O O6     . G A 1 98  ? 132.283 81.504  98.349  1.00 0.00 ? 119 G A O6     1  
ATOM 3147   N N1     . G A 1 98  ? 133.162 82.938  99.882  1.00 0.00 ? 119 G A N1     1  
ATOM 3148   C C2     . G A 1 98  ? 133.836 84.069  100.254 1.00 0.00 ? 119 G A C2     1  
ATOM 3149   N N2     . G A 1 98  ? 133.991 84.256  101.574 1.00 0.00 ? 119 G A N2     1  
ATOM 3150   N N3     . G A 1 98  ? 134.320 84.952  99.396  1.00 0.00 ? 119 G A N3     1  
ATOM 3151   C C4     . G A 1 98  ? 134.061 84.605  98.121  1.00 0.00 ? 119 G A C4     1  
ATOM 3152   H "H5'"  . G A 1 98  ? 136.300 86.518  93.155  1.00 0.00 ? 119 G A "H5'"  1  
ATOM 3153   H "H5''" . G A 1 98  ? 137.749 85.934  93.479  1.00 0.00 ? 119 G A "H5''" 1  
ATOM 3154   H "H4'"  . G A 1 98  ? 137.236 87.468  95.126  1.00 0.00 ? 119 G A "H4'"  1  
ATOM 3155   H "H3'"  . G A 1 98  ? 137.147 84.835  96.130  1.00 0.00 ? 119 G A "H3'"  1  
ATOM 3156   H "H2'"  . G A 1 98  ? 136.617 85.727  98.241  1.00 0.00 ? 119 G A "H2'"  1  
ATOM 3157   H "HO2'" . G A 1 98  ? 137.192 87.655  98.855  1.00 0.00 ? 119 G A "HO2'" 1  
ATOM 3158   H "H1'"  . G A 1 98  ? 134.753 87.241  97.415  1.00 0.00 ? 119 G A "H1'"  1  
ATOM 3159   H H8     . G A 1 98  ? 134.103 84.855  94.995  1.00 0.00 ? 119 G A H8     1  
ATOM 3160   H H1     . G A 1 98  ? 132.846 82.343  100.595 1.00 0.00 ? 119 G A H1     1  
ATOM 3161   H H21    . G A 1 98  ? 133.634 83.602  102.209 1.00 0.00 ? 119 G A H21    1  
ATOM 3162   H H22    . G A 1 98  ? 134.464 85.049  101.903 1.00 0.00 ? 119 G A H22    1  
ATOM 3163   P P      . U A 1 99  ? 139.699 84.749  96.828  1.00 0.00 ? 120 U A P      1  
ATOM 3164   O OP1    . U A 1 99  ? 141.076 85.277  96.998  1.00 0.00 ? 120 U A OP1    1  
ATOM 3165   O OP2    . U A 1 99  ? 139.456 83.615  95.901  1.00 0.00 ? 120 U A OP2    1  
ATOM 3166   O "O5'"  . U A 1 99  ? 139.147 84.337  98.265  1.00 0.00 ? 120 U A "O5'"  1  
ATOM 3167   C "C5'"  . U A 1 99  ? 139.340 85.182  99.389  1.00 0.00 ? 120 U A "C5'"  1  
ATOM 3168   C "C4'"  . U A 1 99  ? 138.906 84.512  100.670 1.00 0.00 ? 120 U A "C4'"  1  
ATOM 3169   O "O4'"  . U A 1 99  ? 137.481 84.248  100.638 1.00 0.00 ? 120 U A "O4'"  1  
ATOM 3170   C "C3'"  . U A 1 99  ? 139.516 83.147  100.952 1.00 0.00 ? 120 U A "C3'"  1  
ATOM 3171   O "O3'"  . U A 1 99  ? 140.826 83.225  101.483 1.00 0.00 ? 120 U A "O3'"  1  
ATOM 3172   C "C2'"  . U A 1 99  ? 138.504 82.532  101.906 1.00 0.00 ? 120 U A "C2'"  1  
ATOM 3173   O "O2'"  . U A 1 99  ? 138.659 83.045  103.222 1.00 0.00 ? 120 U A "O2'"  1  
ATOM 3174   C "C1'"  . U A 1 99  ? 137.191 83.049  101.320 1.00 0.00 ? 120 U A "C1'"  1  
ATOM 3175   N N1     . U A 1 99  ? 136.581 82.086  100.370 1.00 0.00 ? 120 U A N1     1  
ATOM 3176   C C2     . U A 1 99  ? 135.905 81.009  100.912 1.00 0.00 ? 120 U A C2     1  
ATOM 3177   O O2     . U A 1 99  ? 135.795 80.827  102.112 1.00 0.00 ? 120 U A O2     1  
ATOM 3178   N N3     . U A 1 99  ? 135.357 80.145  99.996  1.00 0.00 ? 120 U A N3     1  
ATOM 3179   C C4     . U A 1 99  ? 135.414 80.243  98.622  1.00 0.00 ? 120 U A C4     1  
ATOM 3180   O O4     . U A 1 99  ? 134.869 79.381  97.931  1.00 0.00 ? 120 U A O4     1  
ATOM 3181   C C5     . U A 1 99  ? 136.129 81.382  98.133  1.00 0.00 ? 120 U A C5     1  
ATOM 3182   C C6     . U A 1 99  ? 136.672 82.240  99.003  1.00 0.00 ? 120 U A C6     1  
ATOM 3183   H "H5'"  . U A 1 99  ? 138.818 86.002  99.266  1.00 0.00 ? 120 U A "H5'"  1  
ATOM 3184   H "H5''" . U A 1 99  ? 140.289 85.414  99.456  1.00 0.00 ? 120 U A "H5''" 1  
ATOM 3185   H "H4'"  . U A 1 99  ? 139.098 85.111  101.420 1.00 0.00 ? 120 U A "H4'"  1  
ATOM 3186   H "H3'"  . U A 1 99  ? 139.534 82.625  100.124 1.00 0.00 ? 120 U A "H3'"  1  
ATOM 3187   H "H2'"  . U A 1 99  ? 138.545 81.553  101.891 1.00 0.00 ? 120 U A "H2'"  1  
ATOM 3188   H "HO2'" . U A 1 99  ? 138.712 82.296  103.852 1.00 0.00 ? 120 U A "HO2'" 1  
ATOM 3189   H "H1'"  . U A 1 99  ? 136.561 83.229  102.049 1.00 0.00 ? 120 U A "H1'"  1  
ATOM 3190   H H3     . U A 1 99  ? 134.873 79.374  100.359 1.00 0.00 ? 120 U A H3     1  
ATOM 3191   H H5     . U A 1 99  ? 136.218 81.532  97.169  1.00 0.00 ? 120 U A H5     1  
ATOM 3192   H H6     . U A 1 99  ? 137.156 83.011  98.644  1.00 0.00 ? 120 U A H6     1  
ATOM 3193   P P      . C A 1 100 ? 141.830 81.978  101.346 1.00 0.00 ? 121 C A P      1  
ATOM 3194   O OP1    . C A 1 100 ? 143.181 82.427  101.772 1.00 0.00 ? 121 C A OP1    1  
ATOM 3195   O OP2    . C A 1 100 ? 141.646 81.384  99.998  1.00 0.00 ? 121 C A OP2    1  
ATOM 3196   O "O5'"  . C A 1 100 ? 141.297 80.933  102.423 1.00 0.00 ? 121 C A "O5'"  1  
ATOM 3197   C "C5'"  . C A 1 100 ? 141.383 81.209  103.813 1.00 0.00 ? 121 C A "C5'"  1  
ATOM 3198   C "C4'"  . C A 1 100 ? 140.593 80.215  104.629 1.00 0.00 ? 121 C A "C4'"  1  
ATOM 3199   O "O4'"  . C A 1 100 ? 139.223 80.184  104.160 1.00 0.00 ? 121 C A "O4'"  1  
ATOM 3200   C "C3'"  . C A 1 100 ? 140.985 78.754  104.468 1.00 0.00 ? 121 C A "C3'"  1  
ATOM 3201   O "O3'"  . C A 1 100 ? 142.152 78.411  105.194 1.00 0.00 ? 121 C A "O3'"  1  
ATOM 3202   C "C2'"  . C A 1 100 ? 139.760 78.066  105.053 1.00 0.00 ? 121 C A "C2'"  1  
ATOM 3203   O "O2'"  . C A 1 100 ? 139.709 78.217  106.464 1.00 0.00 ? 121 C A "O2'"  1  
ATOM 3204   C "C1'"  . C A 1 100 ? 138.683 78.914  104.392 1.00 0.00 ? 121 C A "C1'"  1  
ATOM 3205   N N1     . C A 1 100 ? 138.219 78.335  103.107 1.00 0.00 ? 121 C A N1     1  
ATOM 3206   C C2     . C A 1 100 ? 137.326 77.257  103.148 1.00 0.00 ? 121 C A C2     1  
ATOM 3207   O O2     . C A 1 100 ? 136.953 76.820  104.247 1.00 0.00 ? 121 C A O2     1  
ATOM 3208   N N3     . C A 1 100 ? 136.887 76.711  101.990 1.00 0.00 ? 121 C A N3     1  
ATOM 3209   C C4     . C A 1 100 ? 137.304 77.199  100.822 1.00 0.00 ? 121 C A C4     1  
ATOM 3210   N N4     . C A 1 100 ? 136.844 76.628  99.705  1.00 0.00 ? 121 C A N4     1  
ATOM 3211   C C5     . C A 1 100 ? 138.211 78.293  100.746 1.00 0.00 ? 121 C A C5     1  
ATOM 3212   C C6     . C A 1 100 ? 138.637 78.826  101.898 1.00 0.00 ? 121 C A C6     1  
ATOM 3213   H "H5'"  . C A 1 100 ? 141.036 82.109  103.982 1.00 0.00 ? 121 C A "H5'"  1  
ATOM 3214   H "H5''" . C A 1 100 ? 142.323 81.172  104.088 1.00 0.00 ? 121 C A "H5''" 1  
ATOM 3215   H "H4'"  . C A 1 100 ? 140.604 80.498  105.567 1.00 0.00 ? 121 C A "H4'"  1  
ATOM 3216   H "H3'"  . C A 1 100 ? 141.061 78.543  103.514 1.00 0.00 ? 121 C A "H3'"  1  
ATOM 3217   H "H2'"  . C A 1 100 ? 139.717 77.124  104.787 1.00 0.00 ? 121 C A "H2'"  1  
ATOM 3218   H "HO2'" . C A 1 100 ? 139.170 77.492  106.844 1.00 0.00 ? 121 C A "HO2'" 1  
ATOM 3219   H "H1'"  . C A 1 100 ? 137.923 79.003  105.004 1.00 0.00 ? 121 C A "H1'"  1  
ATOM 3220   H H41    . C A 1 100 ? 136.220 75.874  99.761  1.00 0.00 ? 121 C A H41    1  
ATOM 3221   H H42    . C A 1 100 ? 137.131 76.963  98.831  1.00 0.00 ? 121 C A H42    1  
ATOM 3222   H H5     . C A 1 100 ? 138.511 78.645  99.882  1.00 0.00 ? 121 C A H5     1  
ATOM 3223   H H6     . C A 1 100 ? 139.262 79.579  101.867 1.00 0.00 ? 121 C A H6     1  
ATOM 3224   P P      . A A 1 101 ? 143.098 77.215  104.687 1.00 0.00 ? 122 A A P      1  
ATOM 3225   O OP1    . A A 1 101 ? 144.358 77.259  105.471 1.00 0.00 ? 122 A A OP1    1  
ATOM 3226   O OP2    . A A 1 101 ? 143.154 77.270  103.204 1.00 0.00 ? 122 A A OP2    1  
ATOM 3227   O "O5'"  . A A 1 101 ? 142.306 75.896  105.100 1.00 0.00 ? 122 A A "O5'"  1  
ATOM 3228   C "C5'"  . A A 1 101 ? 142.014 75.617  106.461 1.00 0.00 ? 122 A A "C5'"  1  
ATOM 3229   C "C4'"  . A A 1 101 ? 141.055 74.461  106.597 1.00 0.00 ? 122 A A "C4'"  1  
ATOM 3230   O "O4'"  . A A 1 101 ? 139.842 74.752  105.857 1.00 0.00 ? 122 A A "O4'"  1  
ATOM 3231   C "C3'"  . A A 1 101 ? 141.516 73.139  106.003 1.00 0.00 ? 122 A A "C3'"  1  
ATOM 3232   O "O3'"  . A A 1 101 ? 142.416 72.436  106.842 1.00 0.00 ? 122 A A "O3'"  1  
ATOM 3233   C "C2'"  . A A 1 101 ? 140.190 72.412  105.836 1.00 0.00 ? 122 A A "C2'"  1  
ATOM 3234   O "O2'"  . A A 1 101 ? 139.723 71.901  107.076 1.00 0.00 ? 122 A A "O2'"  1  
ATOM 3235   C "C1'"  . A A 1 101 ? 139.284 73.563  105.391 1.00 0.00 ? 122 A A "C1'"  1  
ATOM 3236   N N9     . A A 1 101 ? 139.181 73.654  103.922 1.00 0.00 ? 122 A A N9     1  
ATOM 3237   C C8     . A A 1 101 ? 139.857 74.500  103.079 1.00 0.00 ? 122 A A C8     1  
ATOM 3238   N N7     . A A 1 101 ? 139.551 74.343  101.815 1.00 0.00 ? 122 A A N7     1  
ATOM 3239   C C5     . A A 1 101 ? 138.608 73.324  101.825 1.00 0.00 ? 122 A A C5     1  
ATOM 3240   C C6     . A A 1 101 ? 137.888 72.690  100.797 1.00 0.00 ? 122 A A C6     1  
ATOM 3241   N N6     . A A 1 101 ? 138.013 73.001  99.505  1.00 0.00 ? 122 A A N6     1  
ATOM 3242   N N1     . A A 1 101 ? 137.026 71.711  101.146 1.00 0.00 ? 122 A A N1     1  
ATOM 3243   C C2     . A A 1 101 ? 136.901 71.397  102.442 1.00 0.00 ? 122 A A C2     1  
ATOM 3244   N N3     . A A 1 101 ? 137.521 71.921  103.497 1.00 0.00 ? 122 A A N3     1  
ATOM 3245   C C4     . A A 1 101 ? 138.371 72.890  103.116 1.00 0.00 ? 122 A A C4     1  
ATOM 3246   H "H5'"  . A A 1 101 ? 141.615 76.413  106.873 1.00 0.00 ? 122 A A "H5'"  1  
ATOM 3247   H "H5''" . A A 1 101 ? 142.846 75.399  106.930 1.00 0.00 ? 122 A A "H5''" 1  
ATOM 3248   H "H4'"  . A A 1 101 ? 140.833 74.343  107.545 1.00 0.00 ? 122 A A "H4'"  1  
ATOM 3249   H "H3'"  . A A 1 101 ? 141.915 73.304  105.122 1.00 0.00 ? 122 A A "H3'"  1  
ATOM 3250   H "H2'"  . A A 1 101 ? 140.248 71.711  105.153 1.00 0.00 ? 122 A A "H2'"  1  
ATOM 3251   H "HO2'" . A A 1 101 ? 139.883 70.935  107.103 1.00 0.00 ? 122 A A "HO2'" 1  
ATOM 3252   H "H1'"  . A A 1 101 ? 138.390 73.441  105.774 1.00 0.00 ? 122 A A "H1'"  1  
ATOM 3253   H H8     . A A 1 101 ? 140.510 75.161  103.393 1.00 0.00 ? 122 A A H8     1  
ATOM 3254   H H61    . A A 1 101 ? 137.483 72.523  98.832  1.00 0.00 ? 122 A A H61    1  
ATOM 3255   H H62    . A A 1 101 ? 138.632 73.708  99.228  1.00 0.00 ? 122 A A H62    1  
ATOM 3256   H H2     . A A 1 101 ? 136.262 70.681  102.641 1.00 0.00 ? 122 A A H2     1  
ATOM 3257   P P      . A A 1 102 ? 142.238 72.486  108.439 1.00 0.00 ? 123 A A P      1  
ATOM 3258   O OP1    . A A 1 102 ? 143.154 71.483  109.036 1.00 0.00 ? 123 A A OP1    1  
ATOM 3259   O OP2    . A A 1 102 ? 140.785 72.426  108.741 1.00 0.00 ? 123 A A OP2    1  
ATOM 3260   O "O5'"  . A A 1 102 ? 142.764 73.936  108.840 1.00 0.00 ? 123 A A "O5'"  1  
ATOM 3261   C "C5'"  . A A 1 102 ? 142.739 74.373  110.191 1.00 0.00 ? 123 A A "C5'"  1  
ATOM 3262   C "C4'"  . A A 1 102 ? 141.766 75.508  110.388 1.00 0.00 ? 123 A A "C4'"  1  
ATOM 3263   O "O4'"  . A A 1 102 ? 140.953 75.650  109.199 1.00 0.00 ? 123 A A "O4'"  1  
ATOM 3264   C "C3'"  . A A 1 102 ? 140.726 75.313  111.482 1.00 0.00 ? 123 A A "C3'"  1  
ATOM 3265   O "O3'"  . A A 1 102 ? 141.233 75.567  112.780 1.00 0.00 ? 123 A A "O3'"  1  
ATOM 3266   C "C2'"  . A A 1 102 ? 139.606 76.229  111.028 1.00 0.00 ? 123 A A "C2'"  1  
ATOM 3267   O "O2'"  . A A 1 102 ? 139.913 77.589  111.295 1.00 0.00 ? 123 A A "O2'"  1  
ATOM 3268   C "C1'"  . A A 1 102 ? 139.639 75.989  109.531 1.00 0.00 ? 123 A A "C1'"  1  
ATOM 3269   N N9     . A A 1 102 ? 138.727 74.905  109.120 1.00 0.00 ? 123 A A N9     1  
ATOM 3270   C C8     . A A 1 102 ? 138.837 73.563  109.388 1.00 0.00 ? 123 A A C8     1  
ATOM 3271   N N7     . A A 1 102 ? 137.865 72.842  108.886 1.00 0.00 ? 123 A A N7     1  
ATOM 3272   C C5     . A A 1 102 ? 137.059 73.771  108.244 1.00 0.00 ? 123 A A C5     1  
ATOM 3273   C C6     . A A 1 102 ? 135.864 73.645  107.513 1.00 0.00 ? 123 A A C6     1  
ATOM 3274   N N6     . A A 1 102 ? 135.247 72.480  107.299 1.00 0.00 ? 123 A A N6     1  
ATOM 3275   N N1     . A A 1 102 ? 135.317 74.769  107.003 1.00 0.00 ? 123 A A N1     1  
ATOM 3276   C C2     . A A 1 102 ? 135.935 75.938  107.218 1.00 0.00 ? 123 A A C2     1  
ATOM 3277   N N3     . A A 1 102 ? 137.060 76.184  107.886 1.00 0.00 ? 123 A A N3     1  
ATOM 3278   C C4     . A A 1 102 ? 137.578 75.045  108.380 1.00 0.00 ? 123 A A C4     1  
ATOM 3279   H "H5'"  . A A 1 102 ? 143.636 74.674  110.446 1.00 0.00 ? 123 A A "H5'"  1  
ATOM 3280   H "H5''" . A A 1 102 ? 142.478 73.624  110.765 1.00 0.00 ? 123 A A "H5''" 1  
ATOM 3281   H "H4'"  . A A 1 102 ? 142.269 76.336  110.536 1.00 0.00 ? 123 A A "H4'"  1  
ATOM 3282   H "H3'"  . A A 1 102 ? 140.411 74.384  111.464 1.00 0.00 ? 123 A A "H3'"  1  
ATOM 3283   H "H2'"  . A A 1 102 ? 138.746 75.966  111.420 1.00 0.00 ? 123 A A "H2'"  1  
ATOM 3284   H "HO2'" . A A 1 102 ? 140.637 77.874  110.700 1.00 0.00 ? 123 A A "HO2'" 1  
ATOM 3285   H "H1'"  . A A 1 102 ? 139.394 76.816  109.063 1.00 0.00 ? 123 A A "H1'"  1  
ATOM 3286   H H8     . A A 1 102 ? 139.575 73.179  109.908 1.00 0.00 ? 123 A A H8     1  
ATOM 3287   H H61    . A A 1 102 ? 134.415 72.455  106.781 1.00 0.00 ? 123 A A H61    1  
ATOM 3288   H H62    . A A 1 102 ? 135.626 71.651  107.659 1.00 0.00 ? 123 A A H62    1  
ATOM 3289   H H2     . A A 1 102 ? 135.498 76.723  106.827 1.00 0.00 ? 123 A A H2     1  
ATOM 3290   P P      . C A 1 103 ? 141.339 77.077  113.309 1.00 0.00 ? 124 C A P      1  
ATOM 3291   O OP1    . C A 1 103 ? 142.065 77.896  112.306 1.00 0.00 ? 124 C A OP1    1  
ATOM 3292   O OP2    . C A 1 103 ? 141.911 76.903  114.668 1.00 0.00 ? 124 C A OP2    1  
ATOM 3293   O "O5'"  . C A 1 103 ? 139.871 77.677  113.465 1.00 0.00 ? 124 C A "O5'"  1  
ATOM 3294   C "C5'"  . C A 1 103 ? 139.658 79.080  113.512 1.00 0.00 ? 124 C A "C5'"  1  
ATOM 3295   C "C4'"  . C A 1 103 ? 140.910 79.846  113.161 1.00 0.00 ? 124 C A "C4'"  1  
ATOM 3296   O "O4'"  . C A 1 103 ? 141.277 79.543  111.791 1.00 0.00 ? 124 C A "O4'"  1  
ATOM 3297   C "C3'"  . C A 1 103 ? 140.797 81.362  113.185 1.00 0.00 ? 124 C A "C3'"  1  
ATOM 3298   O "O3'"  . C A 1 103 ? 140.890 81.903  114.492 1.00 0.00 ? 124 C A "O3'"  1  
ATOM 3299   C "C2'"  . C A 1 103 ? 141.916 81.801  112.247 1.00 0.00 ? 124 C A "C2'"  1  
ATOM 3300   O "O2'"  . C A 1 103 ? 143.175 81.783  112.903 1.00 0.00 ? 124 C A "O2'"  1  
ATOM 3301   C "C1'"  . C A 1 103 ? 141.886 80.689  111.195 1.00 0.00 ? 124 C A "C1'"  1  
ATOM 3302   N N1     . C A 1 103 ? 141.122 81.079  109.984 1.00 0.00 ? 124 C A N1     1  
ATOM 3303   C C2     . C A 1 103 ? 141.459 82.277  109.342 1.00 0.00 ? 124 C A C2     1  
ATOM 3304   O O2     . C A 1 103 ? 142.379 82.972  109.800 1.00 0.00 ? 124 C A O2     1  
ATOM 3305   N N3     . C A 1 103 ? 140.778 82.655  108.236 1.00 0.00 ? 124 C A N3     1  
ATOM 3306   C C4     . C A 1 103 ? 139.794 81.891  107.764 1.00 0.00 ? 124 C A C4     1  
ATOM 3307   N N4     . C A 1 103 ? 139.149 82.305  106.670 1.00 0.00 ? 124 C A N4     1  
ATOM 3308   C C5     . C A 1 103 ? 139.426 80.669  108.394 1.00 0.00 ? 124 C A C5     1  
ATOM 3309   C C6     . C A 1 103 ? 140.107 80.304  109.486 1.00 0.00 ? 124 C A C6     1  
ATOM 3310   H "H5'"  . C A 1 103 ? 139.374 79.329  114.417 1.00 0.00 ? 124 C A "H5'"  1  
ATOM 3311   H "H5''" . C A 1 103 ? 138.950 79.317  112.878 1.00 0.00 ? 124 C A "H5''" 1  
ATOM 3312   H "H4'"  . C A 1 103 ? 141.642 79.573  113.752 1.00 0.00 ? 124 C A "H4'"  1  
ATOM 3313   H "H3'"  . C A 1 103 ? 139.937 81.619  112.792 1.00 0.00 ? 124 C A "H3'"  1  
ATOM 3314   H "H2'"  . C A 1 103 ? 141.728 82.676  111.849 1.00 0.00 ? 124 C A "H2'"  1  
ATOM 3315   H "HO2'" . C A 1 103 ? 143.864 82.099  112.283 1.00 0.00 ? 124 C A "HO2'" 1  
ATOM 3316   H "H1'"  . C A 1 103 ? 142.804 80.461  110.941 1.00 0.00 ? 124 C A "H1'"  1  
ATOM 3317   H H41    . C A 1 103 ? 139.404 83.147  106.240 1.00 0.00 ? 124 C A H41    1  
ATOM 3318   H H42    . C A 1 103 ? 138.420 81.765  106.298 1.00 0.00 ? 124 C A H42    1  
ATOM 3319   H H5     . C A 1 103 ? 138.700 80.113  108.039 1.00 0.00 ? 124 C A H5     1  
ATOM 3320   H H6     . C A 1 103 ? 139.869 79.466  109.934 1.00 0.00 ? 124 C A H6     1  
ATOM 3321   P P      . A A 1 104 ? 139.605 82.580  115.180 1.00 0.00 ? 125 A A P      1  
ATOM 3322   O OP1    . A A 1 104 ? 140.083 83.640  116.103 1.00 0.00 ? 125 A A OP1    1  
ATOM 3323   O OP2    . A A 1 104 ? 138.734 81.495  115.695 1.00 0.00 ? 125 A A OP2    1  
ATOM 3324   O "O5'"  . A A 1 104 ? 138.848 83.286  113.968 1.00 0.00 ? 125 A A "O5'"  1  
ATOM 3325   C "C5'"  . A A 1 104 ? 139.377 84.455  113.359 1.00 0.00 ? 125 A A "C5'"  1  
ATOM 3326   C "C4'"  . A A 1 104 ? 138.641 84.798  112.088 1.00 0.00 ? 125 A A "C4'"  1  
ATOM 3327   O "O4'"  . A A 1 104 ? 138.866 83.784  111.079 1.00 0.00 ? 125 A A "O4'"  1  
ATOM 3328   C "C3'"  . A A 1 104 ? 137.126 84.871  112.193 1.00 0.00 ? 125 A A "C3'"  1  
ATOM 3329   O "O3'"  . A A 1 104 ? 136.666 86.086  112.759 1.00 0.00 ? 125 A A "O3'"  1  
ATOM 3330   C "C2'"  . A A 1 104 ? 136.681 84.680  110.752 1.00 0.00 ? 125 A A "C2'"  1  
ATOM 3331   O "O2'"  . A A 1 104 ? 136.775 85.894  110.020 1.00 0.00 ? 125 A A "O2'"  1  
ATOM 3332   C "C1'"  . A A 1 104 ? 137.733 83.708  110.236 1.00 0.00 ? 125 A A "C1'"  1  
ATOM 3333   N N9     . A A 1 104 ? 137.237 82.320  110.199 1.00 0.00 ? 125 A A N9     1  
ATOM 3334   C C8     . A A 1 104 ? 137.579 81.278  111.026 1.00 0.00 ? 125 A A C8     1  
ATOM 3335   N N7     . A A 1 104 ? 136.966 80.155  110.744 1.00 0.00 ? 125 A A N7     1  
ATOM 3336   C C5     . A A 1 104 ? 136.165 80.477  109.656 1.00 0.00 ? 125 A A C5     1  
ATOM 3337   C C6     . A A 1 104 ? 135.267 79.719  108.884 1.00 0.00 ? 125 A A C6     1  
ATOM 3338   N N6     . A A 1 104 ? 135.014 78.427  109.100 1.00 0.00 ? 125 A A N6     1  
ATOM 3339   N N1     . A A 1 104 ? 134.629 80.343  107.870 1.00 0.00 ? 125 A A N1     1  
ATOM 3340   C C2     . A A 1 104 ? 134.883 81.640  107.654 1.00 0.00 ? 125 A A C2     1  
ATOM 3341   N N3     . A A 1 104 ? 135.704 82.457  108.309 1.00 0.00 ? 125 A A N3     1  
ATOM 3342   C C4     . A A 1 104 ? 136.322 81.807  109.311 1.00 0.00 ? 125 A A C4     1  
ATOM 3343   H "H5'"  . A A 1 104 ? 140.323 84.307  113.151 1.00 0.00 ? 125 A A "H5'"  1  
ATOM 3344   H "H5''" . A A 1 104 ? 139.301 85.204  113.985 1.00 0.00 ? 125 A A "H5''" 1  
ATOM 3345   H "H4'"  . A A 1 104 ? 138.978 85.659  111.760 1.00 0.00 ? 125 A A "H4'"  1  
ATOM 3346   H "H3'"  . A A 1 104 ? 136.801 84.121  112.735 1.00 0.00 ? 125 A A "H3'"  1  
ATOM 3347   H "H2'"  . A A 1 104 ? 135.781 84.294  110.702 1.00 0.00 ? 125 A A "H2'"  1  
ATOM 3348   H "HO2'" . A A 1 104 ? 136.446 85.742  109.109 1.00 0.00 ? 125 A A "HO2'" 1  
ATOM 3349   H "H1'"  . A A 1 104 ? 138.013 83.979  109.336 1.00 0.00 ? 125 A A "H1'"  1  
ATOM 3350   H H8     . A A 1 104 ? 138.222 81.367  111.761 1.00 0.00 ? 125 A A H8     1  
ATOM 3351   H H61    . A A 1 104 ? 134.376 77.950  108.527 1.00 0.00 ? 125 A A H61    1  
ATOM 3352   H H62    . A A 1 104 ? 135.465 77.953  109.830 1.00 0.00 ? 125 A A H62    1  
ATOM 3353   H H2     . A A 1 104 ? 134.394 82.045  106.907 1.00 0.00 ? 125 A A H2     1  
ATOM 3354   P P      . G A 1 105 ? 135.613 86.064  113.973 1.00 0.00 ? 126 G A P      1  
ATOM 3355   O OP1    . G A 1 105 ? 135.134 87.453  114.192 1.00 0.00 ? 126 G A OP1    1  
ATOM 3356   O OP2    . G A 1 105 ? 136.225 85.312  115.098 1.00 0.00 ? 126 G A OP2    1  
ATOM 3357   O "O5'"  . G A 1 105 ? 134.394 85.205  113.412 1.00 0.00 ? 126 G A "O5'"  1  
ATOM 3358   C "C5'"  . G A 1 105 ? 133.583 85.695  112.354 1.00 0.00 ? 126 G A "C5'"  1  
ATOM 3359   C "C4'"  . G A 1 105 ? 132.696 84.614  111.789 1.00 0.00 ? 126 G A "C4'"  1  
ATOM 3360   O "O4'"  . G A 1 105 ? 133.510 83.586  111.164 1.00 0.00 ? 126 G A "O4'"  1  
ATOM 3361   C "C3'"  . G A 1 105 ? 131.867 83.834  112.799 1.00 0.00 ? 126 G A "C3'"  1  
ATOM 3362   O "O3'"  . G A 1 105 ? 130.687 84.515  113.189 1.00 0.00 ? 126 G A "O3'"  1  
ATOM 3363   C "C2'"  . G A 1 105 ? 131.610 82.527  112.057 1.00 0.00 ? 126 G A "C2'"  1  
ATOM 3364   O "O2'"  . G A 1 105 ? 130.587 82.680  111.083 1.00 0.00 ? 126 G A "O2'"  1  
ATOM 3365   C "C1'"  . G A 1 105 ? 132.939 82.302  111.340 1.00 0.00 ? 126 G A "C1'"  1  
ATOM 3366   N N9     . G A 1 105 ? 133.881 81.511  112.154 1.00 0.00 ? 126 G A N9     1  
ATOM 3367   C C8     . G A 1 105 ? 134.898 81.987  112.946 1.00 0.00 ? 126 G A C8     1  
ATOM 3368   N N7     . G A 1 105 ? 135.567 81.040  113.546 1.00 0.00 ? 126 G A N7     1  
ATOM 3369   C C5     . G A 1 105 ? 134.955 79.868  113.126 1.00 0.00 ? 126 G A C5     1  
ATOM 3370   C C6     . G A 1 105 ? 135.242 78.516  113.445 1.00 0.00 ? 126 G A C6     1  
ATOM 3371   O O6     . G A 1 105 ? 136.125 78.070  114.187 1.00 0.00 ? 126 G A O6     1  
ATOM 3372   N N1     . G A 1 105 ? 134.375 77.641  112.798 1.00 0.00 ? 126 G A N1     1  
ATOM 3373   C C2     . G A 1 105 ? 133.360 78.018  111.953 1.00 0.00 ? 126 G A C2     1  
ATOM 3374   N N2     . G A 1 105 ? 132.627 77.028  111.423 1.00 0.00 ? 126 G A N2     1  
ATOM 3375   N N3     . G A 1 105 ? 133.082 79.275  111.648 1.00 0.00 ? 126 G A N3     1  
ATOM 3376   C C4     . G A 1 105 ? 133.913 80.141  112.266 1.00 0.00 ? 126 G A C4     1  
ATOM 3377   H "H5'"  . G A 1 105 ? 134.160 86.041  111.642 1.00 0.00 ? 126 G A "H5'"  1  
ATOM 3378   H "H5''" . G A 1 105 ? 133.022 86.424  112.693 1.00 0.00 ? 126 G A "H5''" 1  
ATOM 3379   H "H4'"  . G A 1 105 ? 132.097 85.004  111.118 1.00 0.00 ? 126 G A "H4'"  1  
ATOM 3380   H "H3'"  . G A 1 105 ? 132.408 83.648  113.594 1.00 0.00 ? 126 G A "H3'"  1  
ATOM 3381   H "H2'"  . G A 1 105 ? 131.413 81.794  112.677 1.00 0.00 ? 126 G A "H2'"  1  
ATOM 3382   H "HO2'" . G A 1 105 ? 130.450 81.824  110.627 1.00 0.00 ? 126 G A "HO2'" 1  
ATOM 3383   H "H1'"  . G A 1 105 ? 132.777 81.843  110.489 1.00 0.00 ? 126 G A "H1'"  1  
ATOM 3384   H H8     . G A 1 105 ? 135.102 82.940  113.050 1.00 0.00 ? 126 G A H8     1  
ATOM 3385   H H1     . G A 1 105 ? 134.499 76.682  112.960 1.00 0.00 ? 126 G A H1     1  
ATOM 3386   H H21    . G A 1 105 ? 132.827 76.095  111.644 1.00 0.00 ? 126 G A H21    1  
ATOM 3387   H H22    . G A 1 105 ? 131.889 77.237  110.813 1.00 0.00 ? 126 G A H22    1  
ATOM 3388   P P      . C A 1 106 ? 130.087 84.310  114.665 1.00 0.00 ? 127 C A P      1  
ATOM 3389   O OP1    . C A 1 106 ? 128.920 85.216  114.817 1.00 0.00 ? 127 C A OP1    1  
ATOM 3390   O OP2    . C A 1 106 ? 131.209 84.392  115.634 1.00 0.00 ? 127 C A OP2    1  
ATOM 3391   O "O5'"  . C A 1 106 ? 129.549 82.811  114.659 1.00 0.00 ? 127 C A "O5'"  1  
ATOM 3392   C "C5'"  . C A 1 106 ? 128.561 82.395  113.729 1.00 0.00 ? 127 C A "C5'"  1  
ATOM 3393   C "C4'"  . C A 1 106 ? 128.230 80.930  113.885 1.00 0.00 ? 127 C A "C4'"  1  
ATOM 3394   O "O4'"  . C A 1 106 ? 129.339 80.110  113.421 1.00 0.00 ? 127 C A "O4'"  1  
ATOM 3395   C "C3'"  . C A 1 106 ? 128.006 80.442  115.308 1.00 0.00 ? 127 C A "C3'"  1  
ATOM 3396   O "O3'"  . C A 1 106 ? 126.719 80.764  115.806 1.00 0.00 ? 127 C A "O3'"  1  
ATOM 3397   C "C2'"  . C A 1 106 ? 128.274 78.953  115.170 1.00 0.00 ? 127 C A "C2'"  1  
ATOM 3398   O "O2'"  . C A 1 106 ? 127.180 78.287  114.555 1.00 0.00 ? 127 C A "O2'"  1  
ATOM 3399   C "C1'"  . C A 1 106 ? 129.465 78.964  114.209 1.00 0.00 ? 127 C A "C1'"  1  
ATOM 3400   N N1     . C A 1 106 ? 130.764 79.032  114.922 1.00 0.00 ? 127 C A N1     1  
ATOM 3401   C C2     . C A 1 106 ? 131.288 77.852  115.465 1.00 0.00 ? 127 C A C2     1  
ATOM 3402   O O2     . C A 1 106 ? 130.655 76.792  115.336 1.00 0.00 ? 127 C A O2     1  
ATOM 3403   N N3     . C A 1 106 ? 132.471 77.887  116.120 1.00 0.00 ? 127 C A N3     1  
ATOM 3404   C C4     . C A 1 106 ? 133.131 79.037  116.246 1.00 0.00 ? 127 C A C4     1  
ATOM 3405   N N4     . C A 1 106 ? 134.295 79.025  116.900 1.00 0.00 ? 127 C A N4     1  
ATOM 3406   C C5     . C A 1 106 ? 132.626 80.254  115.706 1.00 0.00 ? 127 C A C5     1  
ATOM 3407   C C6     . C A 1 106 ? 131.455 80.208  115.059 1.00 0.00 ? 127 C A C6     1  
ATOM 3408   H "H5'"  . C A 1 106 ? 128.891 82.553  112.820 1.00 0.00 ? 127 C A "H5'"  1  
ATOM 3409   H "H5''" . C A 1 106 ? 127.747 82.923  113.869 1.00 0.00 ? 127 C A "H5''" 1  
ATOM 3410   H "H4'"  . C A 1 106 ? 127.440 80.727  113.343 1.00 0.00 ? 127 C A "H4'"  1  
ATOM 3411   H "H3'"  . C A 1 106 ? 128.680 80.841  115.896 1.00 0.00 ? 127 C A "H3'"  1  
ATOM 3412   H "H2'"  . C A 1 106 ? 128.506 78.549  116.032 1.00 0.00 ? 127 C A "H2'"  1  
ATOM 3413   H "HO2'" . C A 1 106 ? 126.367 78.817  114.691 1.00 0.00 ? 127 C A "HO2'" 1  
ATOM 3414   H "H1'"  . C A 1 106 ? 129.439 78.156  113.654 1.00 0.00 ? 127 C A "H1'"  1  
ATOM 3415   H H41    . C A 1 106 ? 134.639 78.185  117.272 1.00 0.00 ? 127 C A H41    1  
ATOM 3416   H H42    . C A 1 106 ? 134.805 79.854  117.010 1.00 0.00 ? 127 C A H42    1  
ATOM 3417   H H5     . C A 1 106 ? 133.120 81.095  115.803 1.00 0.00 ? 127 C A H5     1  
ATOM 3418   H H6     . C A 1 106 ? 131.091 81.033  114.681 1.00 0.00 ? 127 C A H6     1  
ATOM 3419   P P      . C A 1 107 ? 126.517 81.101  117.365 1.00 0.00 ? 128 C A P      1  
ATOM 3420   O OP1    . C A 1 107 ? 125.088 81.448  117.578 1.00 0.00 ? 128 C A OP1    1  
ATOM 3421   O OP2    . C A 1 107 ? 127.572 82.063  117.770 1.00 0.00 ? 128 C A OP2    1  
ATOM 3422   O "O5'"  . C A 1 107 ? 126.802 79.716  118.099 1.00 0.00 ? 128 C A "O5'"  1  
ATOM 3423   C "C5'"  . C A 1 107 ? 126.048 78.556  117.787 1.00 0.00 ? 128 C A "C5'"  1  
ATOM 3424   C "C4'"  . C A 1 107 ? 126.676 77.311  118.363 1.00 0.00 ? 128 C A "C4'"  1  
ATOM 3425   O "O4'"  . C A 1 107 ? 127.993 77.076  117.811 1.00 0.00 ? 128 C A "O4'"  1  
ATOM 3426   C "C3'"  . C A 1 107 ? 126.937 77.323  119.860 1.00 0.00 ? 128 C A "C3'"  1  
ATOM 3427   O "O3'"  . C A 1 107 ? 125.771 77.077  120.627 1.00 0.00 ? 128 C A "O3'"  1  
ATOM 3428   C "C2'"  . C A 1 107 ? 127.993 76.237  119.993 1.00 0.00 ? 128 C A "C2'"  1  
ATOM 3429   O "O2'"  . C A 1 107 ? 127.415 74.943  119.894 1.00 0.00 ? 128 C A "O2'"  1  
ATOM 3430   C "C1'"  . C A 1 107 ? 128.834 76.507  118.763 1.00 0.00 ? 128 C A "C1'"  1  
ATOM 3431   N N1     . C A 1 107 ? 129.930 77.472  119.031 1.00 0.00 ? 128 C A N1     1  
ATOM 3432   C C2     . C A 1 107 ? 131.001 77.056  119.830 1.00 0.00 ? 128 C A C2     1  
ATOM 3433   O O2     . C A 1 107 ? 131.004 75.903  120.289 1.00 0.00 ? 128 C A O2     1  
ATOM 3434   N N3     . C A 1 107 ? 132.013 77.916  120.090 1.00 0.00 ? 128 C A N3     1  
ATOM 3435   C C4     . C A 1 107 ? 131.988 79.149  119.585 1.00 0.00 ? 128 C A C4     1  
ATOM 3436   N N4     . C A 1 107 ? 133.008 79.963  119.868 1.00 0.00 ? 128 C A N4     1  
ATOM 3437   C C5     . C A 1 107 ? 130.913 79.603  118.770 1.00 0.00 ? 128 C A C5     1  
ATOM 3438   C C6     . C A 1 107 ? 129.917 78.743  118.520 1.00 0.00 ? 128 C A C6     1  
ATOM 3439   H "H5'"  . C A 1 107 ? 125.992 78.464  116.811 1.00 0.00 ? 128 C A "H5'"  1  
ATOM 3440   H "H5''" . C A 1 107 ? 125.143 78.655  118.150 1.00 0.00 ? 128 C A "H5''" 1  
ATOM 3441   H "H4'"  . C A 1 107 ? 126.112 76.541  118.139 1.00 0.00 ? 128 C A "H4'"  1  
ATOM 3442   H "H3'"  . C A 1 107 ? 127.323 78.187  120.114 1.00 0.00 ? 128 C A "H3'"  1  
ATOM 3443   H "H2'"  . C A 1 107 ? 128.510 76.340  120.820 1.00 0.00 ? 128 C A "H2'"  1  
ATOM 3444   H "HO2'" . C A 1 107 ? 126.455 75.006  120.079 1.00 0.00 ? 128 C A "HO2'" 1  
ATOM 3445   H "H1'"  . C A 1 107 ? 129.213 75.665  118.441 1.00 0.00 ? 128 C A "H1'"  1  
ATOM 3446   H H41    . C A 1 107 ? 133.745 79.647  120.430 1.00 0.00 ? 128 C A H41    1  
ATOM 3447   H H42    . C A 1 107 ? 133.018 80.876  119.512 1.00 0.00 ? 128 C A H42    1  
ATOM 3448   H H5     . C A 1 107 ? 130.903 80.512  118.403 1.00 0.00 ? 128 C A H5     1  
ATOM 3449   H H6     . C A 1 107 ? 129.169 79.037  117.960 1.00 0.00 ? 128 C A H6     1  
ATOM 3450   P P      . G A 1 108 ? 125.888 76.770  122.201 1.00 0.00 ? 129 G A P      1  
ATOM 3451   O OP1    . G A 1 108 ? 124.592 76.208  122.658 1.00 0.00 ? 129 G A OP1    1  
ATOM 3452   O OP2    . G A 1 108 ? 126.439 77.978  122.865 1.00 0.00 ? 129 G A OP2    1  
ATOM 3453   O "O5'"  . G A 1 108 ? 126.984 75.616  122.289 1.00 0.00 ? 129 G A "O5'"  1  
ATOM 3454   C "C5'"  . G A 1 108 ? 126.713 74.406  122.980 1.00 0.00 ? 129 G A "C5'"  1  
ATOM 3455   C "C4'"  . G A 1 108 ? 127.941 73.886  123.688 1.00 0.00 ? 129 G A "C4'"  1  
ATOM 3456   O "O4'"  . G A 1 108 ? 129.158 74.381  123.075 1.00 0.00 ? 129 G A "O4'"  1  
ATOM 3457   C "C3'"  . G A 1 108 ? 128.103 74.308  125.140 1.00 0.00 ? 129 G A "C3'"  1  
ATOM 3458   O "O3'"  . G A 1 108 ? 127.217 73.630  126.016 1.00 0.00 ? 129 G A "O3'"  1  
ATOM 3459   C "C2'"  . G A 1 108 ? 129.580 74.045  125.385 1.00 0.00 ? 129 G A "C2'"  1  
ATOM 3460   O "O2'"  . G A 1 108 ? 129.824 72.667  125.630 1.00 0.00 ? 129 G A "O2'"  1  
ATOM 3461   C "C1'"  . G A 1 108 ? 130.152 74.429  124.024 1.00 0.00 ? 129 G A "C1'"  1  
ATOM 3462   N N9     . G A 1 108 ? 130.718 75.791  124.025 1.00 0.00 ? 129 G A N9     1  
ATOM 3463   C C8     . G A 1 108 ? 130.212 76.902  123.396 1.00 0.00 ? 129 G A C8     1  
ATOM 3464   N N7     . G A 1 108 ? 130.939 77.971  123.577 1.00 0.00 ? 129 G A N7     1  
ATOM 3465   C C5     . G A 1 108 ? 131.989 77.541  124.376 1.00 0.00 ? 129 G A C5     1  
ATOM 3466   C C6     . G A 1 108 ? 133.096 78.255  124.904 1.00 0.00 ? 129 G A C6     1  
ATOM 3467   O O6     . G A 1 108 ? 133.378 79.451  124.763 1.00 0.00 ? 129 G A O6     1  
ATOM 3468   N N1     . G A 1 108 ? 133.923 77.432  125.662 1.00 0.00 ? 129 G A N1     1  
ATOM 3469   C C2     . G A 1 108 ? 133.711 76.094  125.887 1.00 0.00 ? 129 G A C2     1  
ATOM 3470   N N2     . G A 1 108 ? 134.620 75.467  126.648 1.00 0.00 ? 129 G A N2     1  
ATOM 3471   N N3     . G A 1 108 ? 132.683 75.417  125.402 1.00 0.00 ? 129 G A N3     1  
ATOM 3472   C C4     . G A 1 108 ? 131.868 76.197  124.662 1.00 0.00 ? 129 G A C4     1  
ATOM 3473   H "H5'"  . G A 1 108 ? 126.404 73.733  122.339 1.00 0.00 ? 129 G A "H5'"  1  
ATOM 3474   H "H5''" . G A 1 108 ? 126.007 74.566  123.641 1.00 0.00 ? 129 G A "H5''" 1  
ATOM 3475   H "H4'"  . G A 1 108 ? 127.948 72.907  123.632 1.00 0.00 ? 129 G A "H4'"  1  
ATOM 3476   H "H3'"  . G A 1 108 ? 127.928 75.268  125.217 1.00 0.00 ? 129 G A "H3'"  1  
ATOM 3477   H "H2'"  . G A 1 108 ? 129.932 74.609  126.104 1.00 0.00 ? 129 G A "H2'"  1  
ATOM 3478   H "HO2'" . G A 1 108 ? 129.002 72.253  125.966 1.00 0.00 ? 129 G A "HO2'" 1  
ATOM 3479   H "H1'"  . G A 1 108 ? 130.847 73.787  123.770 1.00 0.00 ? 129 G A "H1'"  1  
ATOM 3480   H H8     . G A 1 108 ? 129.389 76.894  122.863 1.00 0.00 ? 129 G A H8     1  
ATOM 3481   H H1     . G A 1 108 ? 134.715 77.842  126.068 1.00 0.00 ? 129 G A H1     1  
ATOM 3482   H H21    . G A 1 108 ? 135.384 75.961  127.011 1.00 0.00 ? 129 G A H21    1  
ATOM 3483   H H22    . G A 1 108 ? 134.521 74.511  126.842 1.00 0.00 ? 129 G A H22    1  
ATOM 3484   P P      . U A 1 109 ? 126.045 74.438  126.762 1.00 0.00 ? 130 U A P      1  
ATOM 3485   O OP1    . U A 1 109 ? 125.732 73.729  128.029 1.00 0.00 ? 130 U A OP1    1  
ATOM 3486   O OP2    . U A 1 109 ? 124.963 74.692  125.776 1.00 0.00 ? 130 U A OP2    1  
ATOM 3487   O "O5'"  . U A 1 109 ? 126.714 75.835  127.130 1.00 0.00 ? 130 U A "O5'"  1  
ATOM 3488   C "C5'"  . U A 1 109 ? 125.937 76.901  127.656 1.00 0.00 ? 130 U A "C5'"  1  
ATOM 3489   C "C4'"  . U A 1 109 ? 126.800 77.943  128.323 1.00 0.00 ? 130 U A "C4'"  1  
ATOM 3490   O "O4'"  . U A 1 109 ? 127.388 78.785  127.292 1.00 0.00 ? 130 U A "O4'"  1  
ATOM 3491   C "C3'"  . U A 1 109 ? 126.082 78.924  129.237 1.00 0.00 ? 130 U A "C3'"  1  
ATOM 3492   O "O3'"  . U A 1 109 ? 125.808 78.387  130.519 1.00 0.00 ? 130 U A "O3'"  1  
ATOM 3493   C "C2'"  . U A 1 109 ? 127.019 80.118  129.243 1.00 0.00 ? 130 U A "C2'"  1  
ATOM 3494   O "O2'"  . U A 1 109 ? 128.129 79.897  130.102 1.00 0.00 ? 130 U A "O2'"  1  
ATOM 3495   C "C1'"  . U A 1 109 ? 127.495 80.114  127.790 1.00 0.00 ? 130 U A "C1'"  1  
ATOM 3496   N N1     . U A 1 109 ? 126.681 81.007  126.930 1.00 0.00 ? 130 U A N1     1  
ATOM 3497   C C2     . U A 1 109 ? 126.957 82.361  126.987 1.00 0.00 ? 130 U A C2     1  
ATOM 3498   O O2     . U A 1 109 ? 127.823 82.834  127.702 1.00 0.00 ? 130 U A O2     1  
ATOM 3499   N N3     . U A 1 109 ? 126.180 83.149  126.173 1.00 0.00 ? 130 U A N3     1  
ATOM 3500   C C4     . U A 1 109 ? 125.176 82.733  125.326 1.00 0.00 ? 130 U A C4     1  
ATOM 3501   O O4     . U A 1 109 ? 124.565 83.568  124.657 1.00 0.00 ? 130 U A O4     1  
ATOM 3502   C C5     . U A 1 109 ? 124.946 81.320  125.318 1.00 0.00 ? 130 U A C5     1  
ATOM 3503   C C6     . U A 1 109 ? 125.689 80.530  126.100 1.00 0.00 ? 130 U A C6     1  
ATOM 3504   H "H5'"  . U A 1 109 ? 125.306 76.541  128.314 1.00 0.00 ? 130 U A "H5'"  1  
ATOM 3505   H "H5''" . U A 1 109 ? 125.435 77.321  126.928 1.00 0.00 ? 130 U A "H5''" 1  
ATOM 3506   H "H4'"  . U A 1 109 ? 127.512 77.492  128.822 1.00 0.00 ? 130 U A "H4'"  1  
ATOM 3507   H "H3'"  . U A 1 109 ? 125.233 79.187  128.825 1.00 0.00 ? 130 U A "H3'"  1  
ATOM 3508   H "H2'"  . U A 1 109 ? 126.545 80.946  129.470 1.00 0.00 ? 130 U A "H2'"  1  
ATOM 3509   H "HO2'" . U A 1 109 ? 128.353 80.737  130.556 1.00 0.00 ? 130 U A "HO2'" 1  
ATOM 3510   H "H1'"  . U A 1 109 ? 128.433 80.397  127.757 1.00 0.00 ? 130 U A "H1'"  1  
ATOM 3511   H H3     . U A 1 109 ? 126.359 84.112  126.199 1.00 0.00 ? 130 U A H3     1  
ATOM 3512   H H5     . U A 1 109 ? 124.251 80.936  124.744 1.00 0.00 ? 130 U A H5     1  
ATOM 3513   H H6     . U A 1 109 ? 125.512 79.567  126.077 1.00 0.00 ? 130 U A H6     1  
ATOM 3514   P P      . U A 1 110 ? 126.610 78.815  131.811 1.00 0.00 ? 131 U A P      1  
ATOM 3515   O OP1    . U A 1 110 ? 125.864 78.409  133.029 1.00 0.00 ? 131 U A OP1    1  
ATOM 3516   O OP2    . U A 1 110 ? 126.905 80.250  131.574 1.00 0.00 ? 131 U A OP2    1  
ATOM 3517   O "O5'"  . U A 1 110 ? 127.989 78.017  131.789 1.00 0.00 ? 131 U A "O5'"  1  
ATOM 3518   C "C5'"  . U A 1 110 ? 128.336 77.115  132.838 1.00 0.00 ? 131 U A "C5'"  1  
ATOM 3519   C "C4'"  . U A 1 110 ? 129.828 76.863  132.848 1.00 0.00 ? 131 U A "C4'"  1  
ATOM 3520   O "O4'"  . U A 1 110 ? 130.259 76.407  131.536 1.00 0.00 ? 131 U A "O4'"  1  
ATOM 3521   C "C3'"  . U A 1 110 ? 130.690 78.084  133.119 1.00 0.00 ? 131 U A "C3'"  1  
ATOM 3522   O "O3'"  . U A 1 110 ? 130.822 78.284  134.519 1.00 0.00 ? 131 U A "O3'"  1  
ATOM 3523   C "C2'"  . U A 1 110 ? 132.014 77.686  132.488 1.00 0.00 ? 131 U A "C2'"  1  
ATOM 3524   O "O2'"  . U A 1 110 ? 132.771 76.817  133.306 1.00 0.00 ? 131 U A "O2'"  1  
ATOM 3525   C "C1'"  . U A 1 110 ? 131.540 76.936  131.244 1.00 0.00 ? 131 U A "C1'"  1  
ATOM 3526   N N1     . U A 1 110 ? 131.426 77.772  130.040 1.00 0.00 ? 131 U A N1     1  
ATOM 3527   C C2     . U A 1 110 ? 132.422 78.696  129.803 1.00 0.00 ? 131 U A C2     1  
ATOM 3528   O O2     . U A 1 110 ? 133.373 78.849  130.546 1.00 0.00 ? 131 U A O2     1  
ATOM 3529   N N3     . U A 1 110 ? 132.264 79.435  128.663 1.00 0.00 ? 131 U A N3     1  
ATOM 3530   C C4     . U A 1 110 ? 131.238 79.352  127.751 1.00 0.00 ? 131 U A C4     1  
ATOM 3531   O O4     . U A 1 110 ? 131.259 80.077  126.752 1.00 0.00 ? 131 U A O4     1  
ATOM 3532   C C5     . U A 1 110 ? 130.240 78.376  128.064 1.00 0.00 ? 131 U A C5     1  
ATOM 3533   C C6     . U A 1 110 ? 130.366 77.638  129.172 1.00 0.00 ? 131 U A C6     1  
ATOM 3534   H "H5'"  . U A 1 110 ? 127.860 76.269  132.701 1.00 0.00 ? 131 U A "H5'"  1  
ATOM 3535   H "H5''" . U A 1 110 ? 128.061 77.502  133.695 1.00 0.00 ? 131 U A "H5''" 1  
ATOM 3536   H "H4'"  . U A 1 110 ? 130.027 76.166  133.507 1.00 0.00 ? 131 U A "H4'"  1  
ATOM 3537   H "H3'"  . U A 1 110 ? 130.282 78.866  132.695 1.00 0.00 ? 131 U A "H3'"  1  
ATOM 3538   H "H2'"  . U A 1 110 ? 132.542 78.472  132.234 1.00 0.00 ? 131 U A "H2'"  1  
ATOM 3539   H "HO2'" . U A 1 110 ? 132.455 76.893  134.231 1.00 0.00 ? 131 U A "HO2'" 1  
ATOM 3540   H "H1'"  . U A 1 110 ? 132.163 76.203  131.051 1.00 0.00 ? 131 U A "H1'"  1  
ATOM 3541   H H3     . U A 1 110 ? 132.958 80.101  128.475 1.00 0.00 ? 131 U A H3     1  
ATOM 3542   H H5     . U A 1 110 ? 129.472 78.248  127.470 1.00 0.00 ? 131 U A H5     1  
ATOM 3543   H H6     . U A 1 110 ? 129.670 76.978  129.363 1.00 0.00 ? 131 U A H6     1  
ATOM 3544   P P      . C A 1 111 ? 130.068 79.524  135.213 1.00 0.00 ? 132 C A P      1  
ATOM 3545   O OP1    . C A 1 111 ? 129.782 79.149  136.622 1.00 0.00 ? 132 C A OP1    1  
ATOM 3546   O OP2    . C A 1 111 ? 128.948 79.915  134.320 1.00 0.00 ? 132 C A OP2    1  
ATOM 3547   O "O5'"  . C A 1 111 ? 131.147 80.699  135.213 1.00 0.00 ? 132 C A "O5'"  1  
ATOM 3548   C "C5'"  . C A 1 111 ? 132.058 80.836  136.301 1.00 0.00 ? 132 C A "C5'"  1  
ATOM 3549   C "C4'"  . C A 1 111 ? 133.225 81.732  135.931 1.00 0.00 ? 132 C A "C4'"  1  
ATOM 3550   O "O4'"  . C A 1 111 ? 133.893 81.206  134.749 1.00 0.00 ? 132 C A "O4'"  1  
ATOM 3551   C "C3'"  . C A 1 111 ? 132.945 83.180  135.552 1.00 0.00 ? 132 C A "C3'"  1  
ATOM 3552   O "O3'"  . C A 1 111 ? 132.469 83.977  136.660 1.00 0.00 ? 132 C A "O3'"  1  
ATOM 3553   C "C2'"  . C A 1 111 ? 134.223 83.563  134.804 1.00 0.00 ? 132 C A "C2'"  1  
ATOM 3554   O "O2'"  . C A 1 111 ? 135.353 83.878  135.584 1.00 0.00 ? 132 C A "O2'"  1  
ATOM 3555   C "C1'"  . C A 1 111 ? 134.527 82.272  134.050 1.00 0.00 ? 132 C A "C1'"  1  
ATOM 3556   N N1     . C A 1 111 ? 134.033 82.321  132.668 1.00 0.00 ? 132 C A N1     1  
ATOM 3557   C C2     . C A 1 111 ? 134.602 83.261  131.794 1.00 0.00 ? 132 C A C2     1  
ATOM 3558   O O2     . C A 1 111 ? 135.500 84.010  132.218 1.00 0.00 ? 132 C A O2     1  
ATOM 3559   N N3     . C A 1 111 ? 134.160 83.332  130.520 1.00 0.00 ? 132 C A N3     1  
ATOM 3560   C C4     . C A 1 111 ? 133.189 82.512  130.108 1.00 0.00 ? 132 C A C4     1  
ATOM 3561   N N4     . C A 1 111 ? 132.782 82.610  128.838 1.00 0.00 ? 132 C A N4     1  
ATOM 3562   C C5     . C A 1 111 ? 132.591 81.553  130.978 1.00 0.00 ? 132 C A C5     1  
ATOM 3563   C C6     . C A 1 111 ? 133.041 81.489  132.234 1.00 0.00 ? 132 C A C6     1  
ATOM 3564   H "H5'"  . C A 1 111 ? 132.396 79.951  136.548 1.00 0.00 ? 132 C A "H5'"  1  
ATOM 3565   H "H5''" . C A 1 111 ? 131.585 81.223  137.066 1.00 0.00 ? 132 C A "H5''" 1  
ATOM 3566   H "H4'"  . C A 1 111 ? 133.861 81.744  136.677 1.00 0.00 ? 132 C A "H4'"  1  
ATOM 3567   H "H3'"  . C A 1 111 ? 132.280 83.203  134.834 1.00 0.00 ? 132 C A "H3'"  1  
ATOM 3568   H "H2'"  . C A 1 111 ? 134.065 84.302  134.181 1.00 0.00 ? 132 C A "H2'"  1  
ATOM 3569   H "HO2'" . C A 1 111 ? 136.098 84.104  134.990 1.00 0.00 ? 132 C A "HO2'" 1  
ATOM 3570   H "H1'"  . C A 1 111 ? 135.495 82.118  134.051 1.00 0.00 ? 132 C A "H1'"  1  
ATOM 3571   H H41    . C A 1 111 ? 133.195 83.269  128.241 1.00 0.00 ? 132 C A H41    1  
ATOM 3572   H H42    . C A 1 111 ? 132.071 82.024  128.505 1.00 0.00 ? 132 C A H42    1  
ATOM 3573   H H5     . C A 1 111 ? 131.875 80.961  130.663 1.00 0.00 ? 132 C A H5     1  
ATOM 3574   H H6     . C A 1 111 ? 132.643 80.836  132.847 1.00 0.00 ? 132 C A H6     1  
ATOM 3575   P P      . A A 1 112 ? 133.462 84.914  137.528 1.00 0.00 ? 133 A A P      1  
ATOM 3576   O OP1    . A A 1 112 ? 134.790 84.258  137.707 1.00 0.00 ? 133 A A OP1    1  
ATOM 3577   O OP2    . A A 1 112 ? 132.637 85.269  138.722 1.00 0.00 ? 133 A A OP2    1  
ATOM 3578   O "O5'"  . A A 1 112 ? 133.660 86.279  136.722 1.00 0.00 ? 133 A A "O5'"  1  
ATOM 3579   C "C5'"  . A A 1 112 ? 133.831 86.287  135.315 1.00 0.00 ? 133 A A "C5'"  1  
ATOM 3580   C "C4'"  . A A 1 112 ? 135.180 86.866  134.927 1.00 0.00 ? 133 A A "C4'"  1  
ATOM 3581   O "O4'"  . A A 1 112 ? 135.636 86.202  133.724 1.00 0.00 ? 133 A A "O4'"  1  
ATOM 3582   C "C3'"  . A A 1 112 ? 135.193 88.365  134.642 1.00 0.00 ? 133 A A "C3'"  1  
ATOM 3583   O "O3'"  . A A 1 112 ? 135.757 89.073  135.737 1.00 0.00 ? 133 A A "O3'"  1  
ATOM 3584   C "C2'"  . A A 1 112 ? 136.154 88.490  133.464 1.00 0.00 ? 133 A A "C2'"  1  
ATOM 3585   O "O2'"  . A A 1 112 ? 137.501 88.616  133.878 1.00 0.00 ? 133 A A "O2'"  1  
ATOM 3586   C "C1'"  . A A 1 112 ? 135.947 87.159  132.741 1.00 0.00 ? 133 A A "C1'"  1  
ATOM 3587   N N9     . A A 1 112 ? 134.842 87.143  131.791 1.00 0.00 ? 133 A A N9     1  
ATOM 3588   C C8     . A A 1 112 ? 133.692 86.398  131.895 1.00 0.00 ? 133 A A C8     1  
ATOM 3589   N N7     . A A 1 112 ? 132.875 86.542  130.887 1.00 0.00 ? 133 A A N7     1  
ATOM 3590   C C5     . A A 1 112 ? 133.524 87.449  130.065 1.00 0.00 ? 133 A A C5     1  
ATOM 3591   C C6     . A A 1 112 ? 133.176 88.009  128.843 1.00 0.00 ? 133 A A C6     1  
ATOM 3592   N N6     . A A 1 112 ? 132.043 87.711  128.198 1.00 0.00 ? 133 A A N6     1  
ATOM 3593   N N1     . A A 1 112 ? 134.034 88.893  128.290 1.00 0.00 ? 133 A A N1     1  
ATOM 3594   C C2     . A A 1 112 ? 135.172 89.174  128.937 1.00 0.00 ? 133 A A C2     1  
ATOM 3595   N N3     . A A 1 112 ? 135.616 88.702  130.095 1.00 0.00 ? 133 A A N3     1  
ATOM 3596   C C4     . A A 1 112 ? 134.734 87.834  130.614 1.00 0.00 ? 133 A A C4     1  
ATOM 3597   H "H5'"  . A A 1 112 ? 133.121 86.827  134.909 1.00 0.00 ? 133 A A "H5'"  1  
ATOM 3598   H "H5''" . A A 1 112 ? 133.766 85.369  134.978 1.00 0.00 ? 133 A A "H5''" 1  
ATOM 3599   H "H4'"  . A A 1 112 ? 135.817 86.702  135.654 1.00 0.00 ? 133 A A "H4'"  1  
ATOM 3600   H "H3'"  . A A 1 112 ? 134.276 88.668  134.473 1.00 0.00 ? 133 A A "H3'"  1  
ATOM 3601   H "H2'"  . A A 1 112 ? 135.899 89.223  132.867 1.00 0.00 ? 133 A A "H2'"  1  
ATOM 3602   H "HO2'" . A A 1 112 ? 138.071 88.691  133.085 1.00 0.00 ? 133 A A "HO2'" 1  
ATOM 3603   H "H1'"  . A A 1 112 ? 136.765 86.920  132.258 1.00 0.00 ? 133 A A "H1'"  1  
ATOM 3604   H H8     . A A 1 112 ? 133.505 85.807  132.655 1.00 0.00 ? 133 A A H8     1  
ATOM 3605   H H61    . A A 1 112 ? 131.846 88.130  127.333 1.00 0.00 ? 133 A A H61    1  
ATOM 3606   H H62    . A A 1 112 ? 131.411 87.071  128.587 1.00 0.00 ? 133 A A H62    1  
ATOM 3607   H H2     . A A 1 112 ? 135.759 89.820  128.492 1.00 0.00 ? 133 A A H2     1  
ATOM 3608   P P      . G A 1 113 ? 134.828 89.578  136.938 1.00 0.00 ? 134 G A P      1  
ATOM 3609   O OP1    . G A 1 113 ? 135.368 88.921  138.160 1.00 0.00 ? 134 G A OP1    1  
ATOM 3610   O OP2    . G A 1 113 ? 133.420 89.377  136.551 1.00 0.00 ? 134 G A OP2    1  
ATOM 3611   O "O5'"  . G A 1 113 ? 135.134 91.136  137.018 1.00 0.00 ? 134 G A "O5'"  1  
ATOM 3612   C "C5'"  . G A 1 113 ? 134.447 92.074  136.210 1.00 0.00 ? 134 G A "C5'"  1  
ATOM 3613   C "C4'"  . G A 1 113 ? 135.234 92.363  134.953 1.00 0.00 ? 134 G A "C4'"  1  
ATOM 3614   O "O4'"  . G A 1 113 ? 135.150 91.235  134.046 1.00 0.00 ? 134 G A "O4'"  1  
ATOM 3615   C "C3'"  . G A 1 113 ? 134.695 93.539  134.162 1.00 0.00 ? 134 G A "C3'"  1  
ATOM 3616   O "O3'"  . G A 1 113 ? 135.346 94.707  134.643 1.00 0.00 ? 134 G A "O3'"  1  
ATOM 3617   C "C2'"  . G A 1 113 ? 135.102 93.225  132.726 1.00 0.00 ? 134 G A "C2'"  1  
ATOM 3618   O "O2'"  . G A 1 113 ? 136.382 93.700  132.388 1.00 0.00 ? 134 G A "O2'"  1  
ATOM 3619   C "C1'"  . G A 1 113 ? 135.075 91.696  132.708 1.00 0.00 ? 134 G A "C1'"  1  
ATOM 3620   N N9     . G A 1 113 ? 133.869 91.132  132.118 1.00 0.00 ? 134 G A N9     1  
ATOM 3621   C C8     . G A 1 113 ? 133.065 90.184  132.694 1.00 0.00 ? 134 G A C8     1  
ATOM 3622   N N7     . G A 1 113 ? 132.046 89.851  131.950 1.00 0.00 ? 134 G A N7     1  
ATOM 3623   C C5     . G A 1 113 ? 132.181 90.629  130.809 1.00 0.00 ? 134 G A C5     1  
ATOM 3624   C C6     . G A 1 113 ? 131.368 90.698  129.652 1.00 0.00 ? 134 G A C6     1  
ATOM 3625   O O6     . G A 1 113 ? 130.331 90.073  129.408 1.00 0.00 ? 134 G A O6     1  
ATOM 3626   N N1     . G A 1 113 ? 131.871 91.603  128.724 1.00 0.00 ? 134 G A N1     1  
ATOM 3627   C C2     . G A 1 113 ? 133.007 92.355  128.884 1.00 0.00 ? 134 G A C2     1  
ATOM 3628   N N2     . G A 1 113 ? 133.329 93.156  127.843 1.00 0.00 ? 134 G A N2     1  
ATOM 3629   N N3     . G A 1 113 ? 133.772 92.316  129.975 1.00 0.00 ? 134 G A N3     1  
ATOM 3630   C C4     . G A 1 113 ? 133.303 91.429  130.890 1.00 0.00 ? 134 G A C4     1  
ATOM 3631   H "H5'"  . G A 1 113 ? 134.321 92.902  136.717 1.00 0.00 ? 134 G A "H5'"  1  
ATOM 3632   H "H5''" . G A 1 113 ? 133.570 91.707  135.972 1.00 0.00 ? 134 G A "H5''" 1  
ATOM 3633   H "H4'"  . G A 1 113 ? 136.174 92.506  135.193 1.00 0.00 ? 134 G A "H4'"  1  
ATOM 3634   H "H3'"  . G A 1 113 ? 133.724 93.586  134.278 1.00 0.00 ? 134 G A "H3'"  1  
ATOM 3635   H "H2'"  . G A 1 113 ? 134.437 93.551  132.085 1.00 0.00 ? 134 G A "H2'"  1  
ATOM 3636   H "HO2'" . G A 1 113 ? 136.573 93.463  131.456 1.00 0.00 ? 134 G A "HO2'" 1  
ATOM 3637   H "H1'"  . G A 1 113 ? 135.849 91.361  132.208 1.00 0.00 ? 134 G A "H1'"  1  
ATOM 3638   H H8     . G A 1 113 ? 133.238 89.792  133.575 1.00 0.00 ? 134 G A H8     1  
ATOM 3639   H H1     . G A 1 113 ? 131.368 91.711  127.889 1.00 0.00 ? 134 G A H1     1  
ATOM 3640   H H21    . G A 1 113 ? 132.763 93.179  127.045 1.00 0.00 ? 134 G A H21    1  
ATOM 3641   H H22    . G A 1 113 ? 134.133 93.717  127.888 1.00 0.00 ? 134 G A H22    1  
ATOM 3642   P P      . U A 1 114 ? 134.750 96.161  134.305 1.00 0.00 ? 135 U A P      1  
ATOM 3643   O OP1    . U A 1 114 ? 135.273 97.118  135.313 1.00 0.00 ? 135 U A OP1    1  
ATOM 3644   O OP2    . U A 1 114 ? 133.284 96.023  134.116 1.00 0.00 ? 135 U A OP2    1  
ATOM 3645   O "O5'"  . U A 1 114 ? 135.397 96.525  132.896 1.00 0.00 ? 135 U A "O5'"  1  
ATOM 3646   C "C5'"  . U A 1 114 ? 135.652 97.875  132.538 1.00 0.00 ? 135 U A "C5'"  1  
ATOM 3647   C "C4'"  . U A 1 114 ? 134.887 98.277  131.301 1.00 0.00 ? 135 U A "C4'"  1  
ATOM 3648   O "O4'"  . U A 1 114 ? 134.620 97.097  130.498 1.00 0.00 ? 135 U A "O4'"  1  
ATOM 3649   C "C3'"  . U A 1 114 ? 133.510 98.880  131.531 1.00 0.00 ? 135 U A "C3'"  1  
ATOM 3650   O "O3'"  . U A 1 114 ? 133.560 100.238 131.933 1.00 0.00 ? 135 U A "O3'"  1  
ATOM 3651   C "C2'"  . U A 1 114 ? 132.825 98.632  130.195 1.00 0.00 ? 135 U A "C2'"  1  
ATOM 3652   O "O2'"  . U A 1 114 ? 133.259 99.562  129.213 1.00 0.00 ? 135 U A "O2'"  1  
ATOM 3653   C "C1'"  . U A 1 114 ? 133.370 97.247  129.861 1.00 0.00 ? 135 U A "C1'"  1  
ATOM 3654   N N1     . U A 1 114 ? 132.437 96.165  130.258 1.00 0.00 ? 135 U A N1     1  
ATOM 3655   C C2     . U A 1 114 ? 131.439 95.831  129.360 1.00 0.00 ? 135 U A C2     1  
ATOM 3656   O O2     . U A 1 114 ? 131.304 96.381  128.281 1.00 0.00 ? 135 U A O2     1  
ATOM 3657   N N3     . U A 1 114 ? 130.600 94.824  129.769 1.00 0.00 ? 135 U A N3     1  
ATOM 3658   C C4     . U A 1 114 ? 130.652 94.130  130.959 1.00 0.00 ? 135 U A C4     1  
ATOM 3659   O O4     . U A 1 114 ? 129.821 93.248  131.181 1.00 0.00 ? 135 U A O4     1  
ATOM 3660   C C5     . U A 1 114 ? 131.709 94.528  131.838 1.00 0.00 ? 135 U A C5     1  
ATOM 3661   C C6     . U A 1 114 ? 132.542 95.505  131.464 1.00 0.00 ? 135 U A C6     1  
ATOM 3662   H "H5'"  . U A 1 114 ? 136.611 97.985  132.369 1.00 0.00 ? 135 U A "H5'"  1  
ATOM 3663   H "H5''" . U A 1 114 ? 135.389 98.458  133.279 1.00 0.00 ? 135 U A "H5''" 1  
ATOM 3664   H "H4'"  . U A 1 114 ? 135.433 98.902  130.781 1.00 0.00 ? 135 U A "H4'"  1  
ATOM 3665   H "H3'"  . U A 1 114 ? 133.048 98.372  132.229 1.00 0.00 ? 135 U A "H3'"  1  
ATOM 3666   H "H2'"  . U A 1 114 ? 131.849 98.631  130.286 1.00 0.00 ? 135 U A "H2'"  1  
ATOM 3667   H "HO2'" . U A 1 114 ? 132.972 100.462 129.477 1.00 0.00 ? 135 U A "HO2'" 1  
ATOM 3668   H "H1'"  . U A 1 114 ? 133.541 97.191  128.897 1.00 0.00 ? 135 U A "H1'"  1  
ATOM 3669   H H3     . U A 1 114 ? 129.886 94.572  129.147 1.00 0.00 ? 135 U A H3     1  
ATOM 3670   H H5     . U A 1 114 ? 131.822 94.087  132.706 1.00 0.00 ? 135 U A H5     1  
ATOM 3671   H H6     . U A 1 114 ? 133.256 95.760  132.083 1.00 0.00 ? 135 U A H6     1  
ATOM 3672   P P      . A A 1 115 ? 132.807 100.699 133.268 1.00 0.00 ? 136 A A P      1  
ATOM 3673   O OP1    . A A 1 115 ? 133.383 101.986 133.730 1.00 0.00 ? 136 A A OP1    1  
ATOM 3674   O OP2    . A A 1 115 ? 132.911 99.496  134.132 1.00 0.00 ? 136 A A OP2    1  
ATOM 3675   O "O5'"  . A A 1 115 ? 131.265 100.937 132.940 1.00 0.00 ? 136 A A "O5'"  1  
ATOM 3676   C "C5'"  . A A 1 115 ? 130.817 102.221 132.494 1.00 0.00 ? 136 A A "C5'"  1  
ATOM 3677   C "C4'"  . A A 1 115 ? 129.783 102.089 131.387 1.00 0.00 ? 136 A A "C4'"  1  
ATOM 3678   O "O4'"  . A A 1 115 ? 129.785 100.746 130.825 1.00 0.00 ? 136 A A "O4'"  1  
ATOM 3679   C "C3'"  . A A 1 115 ? 128.341 102.281 131.805 1.00 0.00 ? 136 A A "C3'"  1  
ATOM 3680   O "O3'"  . A A 1 115 ? 128.030 103.654 131.938 1.00 0.00 ? 136 A A "O3'"  1  
ATOM 3681   C "C2'"  . A A 1 115 ? 127.601 101.639 130.643 1.00 0.00 ? 136 A A "C2'"  1  
ATOM 3682   O "O2'"  . A A 1 115 ? 127.606 102.480 129.507 1.00 0.00 ? 136 A A "O2'"  1  
ATOM 3683   C "C1'"  . A A 1 115 ? 128.477 100.414 130.379 1.00 0.00 ? 136 A A "C1'"  1  
ATOM 3684   N N9     . A A 1 115 ? 128.044 99.214  131.093 1.00 0.00 ? 136 A A N9     1  
ATOM 3685   C C8     . A A 1 115 ? 128.736 98.540  132.061 1.00 0.00 ? 136 A A C8     1  
ATOM 3686   N N7     . A A 1 115 ? 128.112 97.486  132.521 1.00 0.00 ? 136 A A N7     1  
ATOM 3687   C C5     . A A 1 115 ? 126.922 97.467  131.813 1.00 0.00 ? 136 A A C5     1  
ATOM 3688   C C6     . A A 1 115 ? 125.821 96.595  131.841 1.00 0.00 ? 136 A A C6     1  
ATOM 3689   N N6     . A A 1 115 ? 125.734 95.541  132.648 1.00 0.00 ? 136 A A N6     1  
ATOM 3690   N N1     . A A 1 115 ? 124.797 96.852  131.007 1.00 0.00 ? 136 A A N1     1  
ATOM 3691   C C2     . A A 1 115 ? 124.884 97.914  130.204 1.00 0.00 ? 136 A A C2     1  
ATOM 3692   N N3     . A A 1 115 ? 125.861 98.811  130.091 1.00 0.00 ? 136 A A N3     1  
ATOM 3693   C C4     . A A 1 115 ? 126.864 98.525  130.930 1.00 0.00 ? 136 A A C4     1  
ATOM 3694   H "H5'"  . A A 1 115 ? 131.585 102.730 132.159 1.00 0.00 ? 136 A A "H5'"  1  
ATOM 3695   H "H5''" . A A 1 115 ? 130.420 102.703 133.250 1.00 0.00 ? 136 A A "H5''" 1  
ATOM 3696   H "H4'"  . A A 1 115 ? 130.000 102.722 130.673 1.00 0.00 ? 136 A A "H4'"  1  
ATOM 3697   H "H3'"  . A A 1 115 ? 128.186 101.816 132.654 1.00 0.00 ? 136 A A "H3'"  1  
ATOM 3698   H "H2'"  . A A 1 115 ? 126.692 101.375 130.899 1.00 0.00 ? 136 A A "H2'"  1  
ATOM 3699   H "HO2'" . A A 1 115 ? 127.792 103.399 129.793 1.00 0.00 ? 136 A A "HO2'" 1  
ATOM 3700   H "H1'"  . A A 1 115 ? 128.484 100.219 129.418 1.00 0.00 ? 136 A A "H1'"  1  
ATOM 3701   H H8     . A A 1 115 ? 129.622 98.818  132.378 1.00 0.00 ? 136 A A H8     1  
ATOM 3702   H H61    . A A 1 115 ? 124.938 94.970  132.625 1.00 0.00 ? 136 A A H61    1  
ATOM 3703   H H62    . A A 1 115 ? 126.468 95.333  133.263 1.00 0.00 ? 136 A A H62    1  
ATOM 3704   H H2     . A A 1 115 ? 124.116 98.052  129.612 1.00 0.00 ? 136 A A H2     1  
ATOM 3705   P P      . C A 1 116 ? 127.178 104.135 133.200 1.00 0.00 ? 137 C A P      1  
ATOM 3706   O OP1    . C A 1 116 ? 126.602 105.473 132.899 1.00 0.00 ? 137 C A OP1    1  
ATOM 3707   O OP2    . C A 1 116 ? 128.033 103.942 134.402 1.00 0.00 ? 137 C A OP2    1  
ATOM 3708   O "O5'"  . C A 1 116 ? 126.007 103.063 133.263 1.00 0.00 ? 137 C A "O5'"  1  
ATOM 3709   C "C5'"  . C A 1 116 ? 124.636 103.447 133.214 1.00 0.00 ? 137 C A "C5'"  1  
ATOM 3710   C "C4'"  . C A 1 116 ? 123.991 102.915 131.951 1.00 0.00 ? 137 C A "C4'"  1  
ATOM 3711   O "O4'"  . C A 1 116 ? 124.577 101.644 131.581 1.00 0.00 ? 137 C A "O4'"  1  
ATOM 3712   C "C3'"  . C A 1 116 ? 122.500 102.659 132.067 1.00 0.00 ? 137 C A "C3'"  1  
ATOM 3713   O "O3'"  . C A 1 116 ? 121.834 103.825 131.661 1.00 0.00 ? 137 C A "O3'"  1  
ATOM 3714   C "C2'"  . C A 1 116 ? 122.270 101.544 131.065 1.00 0.00 ? 137 C A "C2'"  1  
ATOM 3715   O "O2'"  . C A 1 116 ? 122.203 102.083 129.762 1.00 0.00 ? 137 C A "O2'"  1  
ATOM 3716   C "C1'"  . C A 1 116 ? 123.560 100.734 131.218 1.00 0.00 ? 137 C A "C1'"  1  
ATOM 3717   N N1     . C A 1 116 ? 123.582 99.659  132.221 1.00 0.00 ? 137 C A N1     1  
ATOM 3718   C C2     . C A 1 116 ? 122.668 98.605  132.151 1.00 0.00 ? 137 C A C2     1  
ATOM 3719   O O2     . C A 1 116 ? 121.801 98.615  131.268 1.00 0.00 ? 137 C A O2     1  
ATOM 3720   N N3     . C A 1 116 ? 122.755 97.606  133.048 1.00 0.00 ? 137 C A N3     1  
ATOM 3721   C C4     . C A 1 116 ? 123.686 97.641  133.994 1.00 0.00 ? 137 C A C4     1  
ATOM 3722   N N4     . C A 1 116 ? 123.742 96.635  134.851 1.00 0.00 ? 137 C A N4     1  
ATOM 3723   C C5     . C A 1 116 ? 124.609 98.709  134.107 1.00 0.00 ? 137 C A C5     1  
ATOM 3724   C C6     . C A 1 116 ? 124.525 99.685  133.211 1.00 0.00 ? 137 C A C6     1  
ATOM 3725   H "H5'"  . C A 1 116 ? 124.578 104.426 133.229 1.00 0.00 ? 137 C A "H5'"  1  
ATOM 3726   H "H5''" . C A 1 116 ? 124.174 103.088 133.999 1.00 0.00 ? 137 C A "H5''" 1  
ATOM 3727   H "H4'"  . C A 1 116 ? 124.145 103.553 131.224 1.00 0.00 ? 137 C A "H4'"  1  
ATOM 3728   H "H3'"  . C A 1 116 ? 122.284 102.420 132.993 1.00 0.00 ? 137 C A "H3'"  1  
ATOM 3729   H "H2'"  . C A 1 116 ? 121.479 101.014 131.295 1.00 0.00 ? 137 C A "H2'"  1  
ATOM 3730   H "HO2'" . C A 1 116 ? 121.999 103.039 129.821 1.00 0.00 ? 137 C A "HO2'" 1  
ATOM 3731   H "H1'"  . C A 1 116 ? 123.782 100.317 130.360 1.00 0.00 ? 137 C A "H1'"  1  
ATOM 3732   H H41    . C A 1 116 ? 123.107 95.892  134.777 1.00 0.00 ? 137 C A H41    1  
ATOM 3733   H H42    . C A 1 116 ? 124.420 96.631  135.559 1.00 0.00 ? 137 C A H42    1  
ATOM 3734   H H5     . C A 1 116 ? 125.285 98.725  134.816 1.00 0.00 ? 137 C A H5     1  
ATOM 3735   H H6     . C A 1 116 ? 125.152 100.434 133.269 1.00 0.00 ? 137 C A H6     1  
ATOM 3736   P P      . C A 1 117 ? 120.909 104.603 132.705 1.00 0.00 ? 138 C A P      1  
ATOM 3737   O OP1    . C A 1 117 ? 120.579 105.939 132.127 1.00 0.00 ? 138 C A OP1    1  
ATOM 3738   O OP2    . C A 1 117 ? 121.599 104.519 134.021 1.00 0.00 ? 138 C A OP2    1  
ATOM 3739   O "O5'"  . C A 1 117 ? 119.584 103.717 132.758 1.00 0.00 ? 138 C A "O5'"  1  
ATOM 3740   C "C5'"  . C A 1 117 ? 118.965 103.294 131.556 1.00 0.00 ? 138 C A "C5'"  1  
ATOM 3741   C "C4'"  . C A 1 117 ? 118.128 102.076 131.806 1.00 0.00 ? 138 C A "C4'"  1  
ATOM 3742   O "O4'"  . C A 1 117 ? 118.930 100.998 132.292 1.00 0.00 ? 138 C A "O4'"  1  
ATOM 3743   C "C3'"  . C A 1 117 ? 117.030 102.230 132.828 1.00 0.00 ? 138 C A "C3'"  1  
ATOM 3744   O "O3'"  . C A 1 117 ? 115.968 102.762 132.042 1.00 0.00 ? 138 C A "O3'"  1  
ATOM 3745   C "C2'"  . C A 1 117 ? 116.798 100.798 133.334 1.00 0.00 ? 138 C A "C2'"  1  
ATOM 3746   O "O2'"  . C A 1 117 ? 115.729 100.153 132.689 1.00 0.00 ? 138 C A "O2'"  1  
ATOM 3747   C "C1'"  . C A 1 117 ? 118.086 100.080 132.918 1.00 0.00 ? 138 C A "C1'"  1  
ATOM 3748   N N1     . C A 1 117 ? 118.873 99.357  133.904 1.00 0.00 ? 138 C A N1     1  
ATOM 3749   C C2     . C A 1 117 ? 118.523 98.033  134.211 1.00 0.00 ? 138 C A C2     1  
ATOM 3750   O O2     . C A 1 117 ? 117.493 97.558  133.735 1.00 0.00 ? 138 C A O2     1  
ATOM 3751   N N3     . C A 1 117 ? 119.322 97.311  135.017 1.00 0.00 ? 138 C A N3     1  
ATOM 3752   C C4     . C A 1 117 ? 120.426 97.867  135.526 1.00 0.00 ? 138 C A C4     1  
ATOM 3753   N N4     . C A 1 117 ? 121.223 97.115  136.278 1.00 0.00 ? 138 C A N4     1  
ATOM 3754   C C5     . C A 1 117 ? 120.770 99.232  135.276 1.00 0.00 ? 138 C A C5     1  
ATOM 3755   C C6     . C A 1 117 ? 119.969 99.936  134.473 1.00 0.00 ? 138 C A C6     1  
ATOM 3756   H "H5'"  . C A 1 117 ? 119.657 103.090 130.895 1.00 0.00 ? 138 C A "H5'"  1  
ATOM 3757   H "H5''" . C A 1 117 ? 118.400 104.019 131.215 1.00 0.00 ? 138 C A "H5''" 1  
ATOM 3758   H "H4'"  . C A 1 117 ? 117.716 101.797 130.962 1.00 0.00 ? 138 C A "H4'"  1  
ATOM 3759   H "H3'"  . C A 1 117 ? 117.338 102.820 133.548 1.00 0.00 ? 138 C A "H3'"  1  
ATOM 3760   H "H2'"  . C A 1 117 ? 116.679 100.777 134.307 1.00 0.00 ? 138 C A "H2'"  1  
ATOM 3761   H "HO2'" . C A 1 117 ? 116.084 99.558  131.997 1.00 0.00 ? 138 C A "HO2'" 1  
ATOM 3762   H "H1'"  . C A 1 117 ? 117.877 99.422  132.223 1.00 0.00 ? 138 C A "H1'"  1  
ATOM 3763   H H41    . C A 1 117 ? 120.995 96.176  136.446 1.00 0.00 ? 138 C A H41    1  
ATOM 3764   H H42    . C A 1 117 ? 122.039 97.498  136.663 1.00 0.00 ? 138 C A H42    1  
ATOM 3765   H H5     . C A 1 117 ? 121.566 99.637  135.677 1.00 0.00 ? 138 C A H5     1  
ATOM 3766   H H6     . C A 1 117 ? 120.188 100.872 134.290 1.00 0.00 ? 138 C A H6     1  
ATOM 3767   P P      . A A 1 118 ? 114.735 103.492 132.759 1.00 0.00 ? 139 A A P      1  
ATOM 3768   O OP1    . A A 1 118 ? 115.010 104.940 132.624 1.00 0.00 ? 139 A A OP1    1  
ATOM 3769   O OP2    . A A 1 118 ? 114.612 102.883 134.105 1.00 0.00 ? 139 A A OP2    1  
ATOM 3770   O "O5'"  . A A 1 118 ? 113.399 103.144 131.978 1.00 0.00 ? 139 A A "O5'"  1  
ATOM 3771   C "C5'"  . A A 1 118 ? 112.921 103.999 130.958 1.00 0.00 ? 139 A A "C5'"  1  
ATOM 3772   C "C4'"  . A A 1 118 ? 113.892 104.051 129.797 1.00 0.00 ? 139 A A "C4'"  1  
ATOM 3773   O "O4'"  . A A 1 118 ? 114.801 102.914 129.834 1.00 0.00 ? 139 A A "O4'"  1  
ATOM 3774   C "C3'"  . A A 1 118 ? 113.185 103.934 128.460 1.00 0.00 ? 139 A A "C3'"  1  
ATOM 3775   O "O3'"  . A A 1 118 ? 112.786 105.213 128.047 1.00 0.00 ? 139 A A "O3'"  1  
ATOM 3776   C "C2'"  . A A 1 118 ? 114.223 103.295 127.562 1.00 0.00 ? 139 A A "C2'"  1  
ATOM 3777   O "O2'"  . A A 1 118 ? 115.121 104.241 127.028 1.00 0.00 ? 139 A A "O2'"  1  
ATOM 3778   C "C1'"  . A A 1 118 ? 114.898 102.330 128.541 1.00 0.00 ? 139 A A "C1'"  1  
ATOM 3779   N N9     . A A 1 118 ? 114.199 101.056 128.623 1.00 0.00 ? 139 A A N9     1  
ATOM 3780   C C8     . A A 1 118 ? 114.254 100.148 129.645 1.00 0.00 ? 139 A A C8     1  
ATOM 3781   N N7     . A A 1 118 ? 113.434 99.143  129.500 1.00 0.00 ? 139 A A N7     1  
ATOM 3782   C C5     . A A 1 118 ? 112.813 99.396  128.288 1.00 0.00 ? 139 A A C5     1  
ATOM 3783   C C6     . A A 1 118 ? 111.816 98.714  127.583 1.00 0.00 ? 139 A A C6     1  
ATOM 3784   N N6     . A A 1 118 ? 111.228 97.605  128.023 1.00 0.00 ? 139 A A N6     1  
ATOM 3785   N N1     . A A 1 118 ? 111.427 99.224  126.396 1.00 0.00 ? 139 A A N1     1  
ATOM 3786   C C2     . A A 1 118 ? 112.007 100.350 125.967 1.00 0.00 ? 139 A A C2     1  
ATOM 3787   N N3     . A A 1 118 ? 112.942 101.091 126.550 1.00 0.00 ? 139 A A N3     1  
ATOM 3788   C C4     . A A 1 118 ? 113.302 100.553 127.723 1.00 0.00 ? 139 A A C4     1  
ATOM 3789   H "H5'"  . A A 1 118 ? 112.805 104.900 131.324 1.00 0.00 ? 139 A A "H5'"  1  
ATOM 3790   H "H5''" . A A 1 118 ? 112.054 103.669 130.642 1.00 0.00 ? 139 A A "H5''" 1  
ATOM 3791   H "H4'"  . A A 1 118 ? 114.421 104.874 129.862 1.00 0.00 ? 139 A A "H4'"  1  
ATOM 3792   H "H3'"  . A A 1 118 ? 112.416 103.333 128.556 1.00 0.00 ? 139 A A "H3'"  1  
ATOM 3793   H "H2'"  . A A 1 118 ? 113.806 102.763 126.852 1.00 0.00 ? 139 A A "H2'"  1  
ATOM 3794   H "HO2'" . A A 1 118 ? 114.715 105.131 127.081 1.00 0.00 ? 139 A A "HO2'" 1  
ATOM 3795   H "H1'"  . A A 1 118 ? 115.826 102.177 128.260 1.00 0.00 ? 139 A A "H1'"  1  
ATOM 3796   H H8     . A A 1 118 ? 114.842 100.251 130.422 1.00 0.00 ? 139 A A H8     1  
ATOM 3797   H H61    . A A 1 118 ? 110.528 97.175  127.487 1.00 0.00 ? 139 A A H61    1  
ATOM 3798   H H62    . A A 1 118 ? 111.495 97.214  128.882 1.00 0.00 ? 139 A A H62    1  
ATOM 3799   H H2     . A A 1 118 ? 111.696 100.674 125.096 1.00 0.00 ? 139 A A H2     1  
ATOM 3800   P P      . A A 1 119 ? 111.300 105.680 128.368 1.00 0.00 ? 140 A A P      1  
ATOM 3801   O OP1    . A A 1 119 ? 111.125 107.097 127.969 1.00 0.00 ? 140 A A OP1    1  
ATOM 3802   O OP2    . A A 1 119 ? 111.042 105.287 129.770 1.00 0.00 ? 140 A A OP2    1  
ATOM 3803   O "O5'"  . A A 1 119 ? 110.417 104.741 127.429 1.00 0.00 ? 140 A A "O5'"  1  
ATOM 3804   C "C5'"  . A A 1 119 ? 110.705 104.646 126.042 1.00 0.00 ? 140 A A "C5'"  1  
ATOM 3805   C "C4'"  . A A 1 119 ? 109.756 103.690 125.366 1.00 0.00 ? 140 A A "C4'"  1  
ATOM 3806   O "O4'"  . A A 1 119 ? 110.083 102.325 125.699 1.00 0.00 ? 140 A A "O4'"  1  
ATOM 3807   C "C3'"  . A A 1 119 ? 108.301 103.817 125.741 1.00 0.00 ? 140 A A "C3'"  1  
ATOM 3808   O "O3'"  . A A 1 119 ? 107.729 104.876 125.009 1.00 0.00 ? 140 A A "O3'"  1  
ATOM 3809   C "C2'"  . A A 1 119 ? 107.740 102.464 125.324 1.00 0.00 ? 140 A A "C2'"  1  
ATOM 3810   O "O2'"  . A A 1 119 ? 107.406 102.390 123.953 1.00 0.00 ? 140 A A "O2'"  1  
ATOM 3811   C "C1'"  . A A 1 119 ? 108.917 101.530 125.618 1.00 0.00 ? 140 A A "C1'"  1  
ATOM 3812   N N9     . A A 1 119 ? 108.807 100.802 126.874 1.00 0.00 ? 140 A A N9     1  
ATOM 3813   C C8     . A A 1 119 ? 109.657 100.919 127.936 1.00 0.00 ? 140 A A C8     1  
ATOM 3814   N N7     . A A 1 119 ? 109.355 100.145 128.943 1.00 0.00 ? 140 A A N7     1  
ATOM 3815   C C5     . A A 1 119 ? 108.218 99.479  128.521 1.00 0.00 ? 140 A A C5     1  
ATOM 3816   C C6     . A A 1 119 ? 107.404 98.523  129.148 1.00 0.00 ? 140 A A C6     1  
ATOM 3817   N N6     . A A 1 119 ? 107.638 98.060  130.383 1.00 0.00 ? 140 A A N6     1  
ATOM 3818   N N1     . A A 1 119 ? 106.335 98.055  128.461 1.00 0.00 ? 140 A A N1     1  
ATOM 3819   C C2     . A A 1 119 ? 106.114 98.534  127.225 1.00 0.00 ? 140 A A C2     1  
ATOM 3820   N N3     . A A 1 119 ? 106.812 99.436  126.529 1.00 0.00 ? 140 A A N3     1  
ATOM 3821   C C4     . A A 1 119 ? 107.865 99.873  127.244 1.00 0.00 ? 140 A A C4     1  
ATOM 3822   H "H5'"  . A A 1 119 ? 111.625 104.329 125.926 1.00 0.00 ? 140 A A "H5'"  1  
ATOM 3823   H "H5''" . A A 1 119 ? 110.620 105.533 125.635 1.00 0.00 ? 140 A A "H5''" 1  
ATOM 3824   H "H4'"  . A A 1 119 ? 109.834 103.799 124.395 1.00 0.00 ? 140 A A "H4'"  1  
ATOM 3825   H "H3'"  . A A 1 119 ? 108.231 103.975 126.706 1.00 0.00 ? 140 A A "H3'"  1  
ATOM 3826   H "H2'"  . A A 1 119 ? 106.972 102.206 125.876 1.00 0.00 ? 140 A A "H2'"  1  
ATOM 3827   H "HO2'" . A A 1 119 ? 107.298 103.299 123.602 1.00 0.00 ? 140 A A "HO2'" 1  
ATOM 3828   H "H1'"  . A A 1 119 ? 109.005 100.877 124.892 1.00 0.00 ? 140 A A "H1'"  1  
ATOM 3829   H H8     . A A 1 119 ? 110.429 101.523 127.937 1.00 0.00 ? 140 A A H8     1  
ATOM 3830   H H61    . A A 1 119 ? 107.040 97.392  130.778 1.00 0.00 ? 140 A A H61    1  
ATOM 3831   H H62    . A A 1 119 ? 108.409 98.390  130.892 1.00 0.00 ? 140 A A H62    1  
ATOM 3832   H H2     . A A 1 119 ? 105.327 98.169  126.770 1.00 0.00 ? 140 A A H2     1  
ATOM 3833   P P      . G A 1 120 ? 106.848 105.978 125.767 1.00 0.00 ? 141 G A P      1  
ATOM 3834   O OP1    . G A 1 120 ? 106.632 107.056 124.771 1.00 0.00 ? 141 G A OP1    1  
ATOM 3835   O OP2    . G A 1 120 ? 107.582 106.271 127.020 1.00 0.00 ? 141 G A OP2    1  
ATOM 3836   O "O5'"  . G A 1 120 ? 105.430 105.356 126.120 1.00 0.00 ? 141 G A "O5'"  1  
ATOM 3837   C "C5'"  . G A 1 120 ? 104.617 104.834 125.087 1.00 0.00 ? 141 G A "C5'"  1  
ATOM 3838   C "C4'"  . G A 1 120 ? 103.853 103.647 125.587 1.00 0.00 ? 141 G A "C4'"  1  
ATOM 3839   O "O4'"  . G A 1 120 ? 104.811 102.650 126.013 1.00 0.00 ? 141 G A "O4'"  1  
ATOM 3840   C "C3'"  . G A 1 120 ? 103.004 103.864 126.822 1.00 0.00 ? 141 G A "C3'"  1  
ATOM 3841   O "O3'"  . G A 1 120 ? 101.730 104.383 126.499 1.00 0.00 ? 141 G A "O3'"  1  
ATOM 3842   C "C2'"  . G A 1 120 ? 102.878 102.445 127.329 1.00 0.00 ? 141 G A "C2'"  1  
ATOM 3843   O "O2'"  . G A 1 120 ? 102.024 101.680 126.495 1.00 0.00 ? 141 G A "O2'"  1  
ATOM 3844   C "C1'"  . G A 1 120 ? 104.316 101.974 127.153 1.00 0.00 ? 141 G A "C1'"  1  
ATOM 3845   N N9     . G A 1 120 ? 105.166 102.335 128.282 1.00 0.00 ? 141 G A N9     1  
ATOM 3846   C C8     . G A 1 120 ? 106.197 103.246 128.286 1.00 0.00 ? 141 G A C8     1  
ATOM 3847   N N7     . G A 1 120 ? 106.813 103.322 129.438 1.00 0.00 ? 141 G A N7     1  
ATOM 3848   C C5     . G A 1 120 ? 106.144 102.413 130.251 1.00 0.00 ? 141 G A C5     1  
ATOM 3849   C C6     . G A 1 120 ? 106.365 102.059 131.600 1.00 0.00 ? 141 G A C6     1  
ATOM 3850   O O6     . G A 1 120 ? 107.234 102.475 132.363 1.00 0.00 ? 141 G A O6     1  
ATOM 3851   N N1     . G A 1 120 ? 105.439 101.115 132.039 1.00 0.00 ? 141 G A N1     1  
ATOM 3852   C C2     . G A 1 120 ? 104.428 100.577 131.266 1.00 0.00 ? 141 G A C2     1  
ATOM 3853   N N2     . G A 1 120 ? 103.619 99.686  131.853 1.00 0.00 ? 141 G A N2     1  
ATOM 3854   N N3     . G A 1 120 ? 104.221 100.890 130.002 1.00 0.00 ? 141 G A N3     1  
ATOM 3855   C C4     . G A 1 120 ? 105.110 101.810 129.558 1.00 0.00 ? 141 G A C4     1  
ATOM 3856   H "H5'"  . G A 1 120 ? 105.185 104.571 124.334 1.00 0.00 ? 141 G A "H5'"  1  
ATOM 3857   H "H5''" . G A 1 120 ? 103.992 105.530 124.789 1.00 0.00 ? 141 G A "H5''" 1  
ATOM 3858   H "H4'"  . G A 1 120 ? 103.307 103.290 124.854 1.00 0.00 ? 141 G A "H4'"  1  
ATOM 3859   H "H3'"  . G A 1 120 ? 103.467 104.479 127.427 1.00 0.00 ? 141 G A "H3'"  1  
ATOM 3860   H "H2'"  . G A 1 120 ? 102.589 102.422 128.266 1.00 0.00 ? 141 G A "H2'"  1  
ATOM 3861   H "HO2'" . G A 1 120 ? 101.458 102.287 125.974 1.00 0.00 ? 141 G A "HO2'" 1  
ATOM 3862   H "H1'"  . G A 1 120 ? 104.328 101.001 127.038 1.00 0.00 ? 141 G A "H1'"  1  
ATOM 3863   H H8     . G A 1 120 ? 106.450 103.777 127.503 1.00 0.00 ? 141 G A H8     1  
ATOM 3864   H H1     . G A 1 120 ? 105.511 100.813 132.968 1.00 0.00 ? 141 G A H1     1  
ATOM 3865   H H21    . G A 1 120 ? 103.756 99.439  132.790 1.00 0.00 ? 141 G A H21    1  
ATOM 3866   H H22    . G A 1 120 ? 102.887 99.279  131.342 1.00 0.00 ? 141 G A H22    1  
ATOM 3867   P P      . U A 1 121 ? 101.015 105.382 127.520 1.00 0.00 ? 142 U A P      1  
ATOM 3868   O OP1    . U A 1 121 ? 99.719  105.764 126.901 1.00 0.00 ? 142 U A OP1    1  
ATOM 3869   O OP2    . U A 1 121 ? 101.986 106.423 127.920 1.00 0.00 ? 142 U A OP2    1  
ATOM 3870   O "O5'"  . U A 1 121 ? 100.747 104.487 128.802 1.00 0.00 ? 142 U A "O5'"  1  
ATOM 3871   C "C5'"  . U A 1 121 ? 99.841  103.408 128.715 1.00 0.00 ? 142 U A "C5'"  1  
ATOM 3872   C "C4'"  . U A 1 121 ? 99.623  102.796 130.065 1.00 0.00 ? 142 U A "C4'"  1  
ATOM 3873   O "O4'"  . U A 1 121 ? 100.820 102.111 130.497 1.00 0.00 ? 142 U A "O4'"  1  
ATOM 3874   C "C3'"  . U A 1 121 ? 99.369  103.779 131.176 1.00 0.00 ? 142 U A "C3'"  1  
ATOM 3875   O "O3'"  . U A 1 121 ? 98.018  104.144 131.170 1.00 0.00 ? 142 U A "O3'"  1  
ATOM 3876   C "C2'"  . U A 1 121 ? 99.667  102.928 132.386 1.00 0.00 ? 142 U A "C2'"  1  
ATOM 3877   O "O2'"  . U A 1 121 ? 98.589  102.042 132.598 1.00 0.00 ? 142 U A "O2'"  1  
ATOM 3878   C "C1'"  . U A 1 121 ? 100.894 102.157 131.905 1.00 0.00 ? 142 U A "C1'"  1  
ATOM 3879   N N1     . U A 1 121 ? 102.149 102.820 132.254 1.00 0.00 ? 142 U A N1     1  
ATOM 3880   C C2     . U A 1 121 ? 102.697 102.552 133.487 1.00 0.00 ? 142 U A C2     1  
ATOM 3881   O O2     . U A 1 121 ? 102.151 101.830 134.310 1.00 0.00 ? 142 U A O2     1  
ATOM 3882   N N3     . U A 1 121 ? 103.902 103.164 133.732 1.00 0.00 ? 142 U A N3     1  
ATOM 3883   C C4     . U A 1 121 ? 104.583 104.000 132.887 1.00 0.00 ? 142 U A C4     1  
ATOM 3884   O O4     . U A 1 121 ? 105.735 104.326 133.167 1.00 0.00 ? 142 U A O4     1  
ATOM 3885   C C5     . U A 1 121 ? 103.917 104.255 131.645 1.00 0.00 ? 142 U A C5     1  
ATOM 3886   C C6     . U A 1 121 ? 102.755 103.665 131.380 1.00 0.00 ? 142 U A C6     1  
ATOM 3887   H "H5'"  . U A 1 121 ? 100.205 102.734 128.103 1.00 0.00 ? 142 U A "H5'"  1  
ATOM 3888   H "H5''" . U A 1 121 ? 98.988  103.734 128.361 1.00 0.00 ? 142 U A "H5''" 1  
ATOM 3889   H "H4'"  . U A 1 121 ? 98.893  102.147 130.004 1.00 0.00 ? 142 U A "H4'"  1  
ATOM 3890   H "H3'"  . U A 1 121 ? 99.947  104.560 131.053 1.00 0.00 ? 142 U A "H3'"  1  
ATOM 3891   H "H2'"  . U A 1 121 ? 99.871  103.478 133.170 1.00 0.00 ? 142 U A "H2'"  1  
ATOM 3892   H "HO2'" . U A 1 121 ? 98.780  101.488 133.385 1.00 0.00 ? 142 U A "HO2'" 1  
ATOM 3893   H "H1'"  . U A 1 121 ? 100.885 101.258 132.297 1.00 0.00 ? 142 U A "H1'"  1  
ATOM 3894   H H3     . U A 1 121 ? 104.316 102.982 134.601 1.00 0.00 ? 142 U A H3     1  
ATOM 3895   H H5     . U A 1 121 ? 104.316 104.862 130.987 1.00 0.00 ? 142 U A H5     1  
ATOM 3896   H H6     . U A 1 121 ? 102.327 103.862 130.522 1.00 0.00 ? 142 U A H6     1  
ATOM 3897   P P      . C A 1 122 ? 97.626  105.617 131.600 1.00 0.00 ? 143 C A P      1  
ATOM 3898   O OP1    . C A 1 122 ? 96.232  105.866 131.171 1.00 0.00 ? 143 C A OP1    1  
ATOM 3899   O OP2    . C A 1 122 ? 98.719  106.467 131.091 1.00 0.00 ? 143 C A OP2    1  
ATOM 3900   O "O5'"  . C A 1 122 ? 97.727  105.579 133.186 1.00 0.00 ? 143 C A "O5'"  1  
ATOM 3901   C "C5'"  . C A 1 122 ? 96.993  104.614 133.918 1.00 0.00 ? 143 C A "C5'"  1  
ATOM 3902   C "C4'"  . C A 1 122 ? 97.500  104.531 135.327 1.00 0.00 ? 143 C A "C4'"  1  
ATOM 3903   O "O4'"  . C A 1 122 ? 98.871  104.105 135.303 1.00 0.00 ? 143 C A "O4'"  1  
ATOM 3904   C "C3'"  . C A 1 122 ? 97.520  105.832 136.096 1.00 0.00 ? 143 C A "C3'"  1  
ATOM 3905   O "O3'"  . C A 1 122 ? 96.250  105.989 136.712 1.00 0.00 ? 143 C A "O3'"  1  
ATOM 3906   C "C2'"  . C A 1 122 ? 98.583  105.568 137.152 1.00 0.00 ? 143 C A "C2'"  1  
ATOM 3907   O "O2'"  . C A 1 122 ? 98.053  104.914 138.279 1.00 0.00 ? 143 C A "O2'"  1  
ATOM 3908   C "C1'"  . C A 1 122 ? 99.536  104.619 136.423 1.00 0.00 ? 143 C A "C1'"  1  
ATOM 3909   N N1     . C A 1 122 ? 100.760 105.248 135.954 1.00 0.00 ? 143 C A N1     1  
ATOM 3910   C C2     . C A 1 122 ? 101.796 105.414 136.854 1.00 0.00 ? 143 C A C2     1  
ATOM 3911   O O2     . C A 1 122 ? 101.647 104.997 137.999 1.00 0.00 ? 143 C A O2     1  
ATOM 3912   N N3     . C A 1 122 ? 102.936 106.015 136.458 1.00 0.00 ? 143 C A N3     1  
ATOM 3913   C C4     . C A 1 122 ? 103.060 106.437 135.199 1.00 0.00 ? 143 C A C4     1  
ATOM 3914   N N4     . C A 1 122 ? 104.198 107.044 134.845 1.00 0.00 ? 143 C A N4     1  
ATOM 3915   C C5     . C A 1 122 ? 102.017 106.259 134.243 1.00 0.00 ? 143 C A C5     1  
ATOM 3916   C C6     . C A 1 122 ? 100.891 105.667 134.664 1.00 0.00 ? 143 C A C6     1  
ATOM 3917   H "H5'"  . C A 1 122 ? 97.089  103.742 133.481 1.00 0.00 ? 143 C A "H5'"  1  
ATOM 3918   H "H5''" . C A 1 122 ? 96.048  104.868 133.923 1.00 0.00 ? 143 C A "H5''" 1  
ATOM 3919   H "H4'"  . C A 1 122 ? 96.965  103.872 135.816 1.00 0.00 ? 143 C A "H4'"  1  
ATOM 3920   H "H3'"  . C A 1 122 ? 97.721  106.568 135.481 1.00 0.00 ? 143 C A "H3'"  1  
ATOM 3921   H "H2'"  . C A 1 122 ? 99.048  106.392 137.405 1.00 0.00 ? 143 C A "H2'"  1  
ATOM 3922   H "HO2'" . C A 1 122 ? 98.457  105.292 139.088 1.00 0.00 ? 143 C A "HO2'" 1  
ATOM 3923   H "H1'"  . C A 1 122 ? 99.775  103.881 137.021 1.00 0.00 ? 143 C A "H1'"  1  
ATOM 3924   H H41    . C A 1 122 ? 104.912 107.168 135.505 1.00 0.00 ? 143 C A H41    1  
ATOM 3925   H H42    . C A 1 122 ? 104.318 107.364 133.928 1.00 0.00 ? 143 C A H42    1  
ATOM 3926   H H5     . C A 1 122 ? 102.121 106.558 133.315 1.00 0.00 ? 143 C A H5     1  
ATOM 3927   H H6     . C A 1 122 ? 100.160 105.534 134.026 1.00 0.00 ? 143 C A H6     1  
ATOM 3928   P P      . U A 1 123 ? 95.662  107.452 136.970 1.00 0.00 ? 144 U A P      1  
ATOM 3929   O OP1    . U A 1 123 ? 94.250  107.298 137.390 1.00 0.00 ? 144 U A OP1    1  
ATOM 3930   O OP2    . U A 1 123 ? 95.977  108.274 135.785 1.00 0.00 ? 144 U A OP2    1  
ATOM 3931   O "O5'"  . U A 1 123 ? 96.521  107.987 138.193 1.00 0.00 ? 144 U A "O5'"  1  
ATOM 3932   C "C5'"  . U A 1 123 ? 96.291  107.482 139.489 1.00 0.00 ? 144 U A "C5'"  1  
ATOM 3933   C "C4'"  . U A 1 123 ? 97.407  107.877 140.403 1.00 0.00 ? 144 U A "C4'"  1  
ATOM 3934   O "O4'"  . U A 1 123 ? 98.650  107.328 139.917 1.00 0.00 ? 144 U A "O4'"  1  
ATOM 3935   C "C3'"  . U A 1 123 ? 97.713  109.356 140.490 1.00 0.00 ? 144 U A "C3'"  1  
ATOM 3936   O "O3'"  . U A 1 123 ? 96.795  109.993 141.358 1.00 0.00 ? 144 U A "O3'"  1  
ATOM 3937   C "C2'"  . U A 1 123 ? 99.113  109.337 141.087 1.00 0.00 ? 144 U A "C2'"  1  
ATOM 3938   O "O2'"  . U A 1 123 ? 99.136  109.103 142.485 1.00 0.00 ? 144 U A "O2'"  1  
ATOM 3939   C "C1'"  . U A 1 123 ? 99.725  108.136 140.368 1.00 0.00 ? 144 U A "C1'"  1  
ATOM 3940   N N1     . U A 1 123 ? 100.527 108.541 139.210 1.00 0.00 ? 144 U A N1     1  
ATOM 3941   C C2     . U A 1 123 ? 101.832 108.948 139.429 1.00 0.00 ? 144 U A C2     1  
ATOM 3942   O O2     . U A 1 123 ? 102.333 109.004 140.532 1.00 0.00 ? 144 U A O2     1  
ATOM 3943   N N3     . U A 1 123 ? 102.523 109.294 138.306 1.00 0.00 ? 144 U A N3     1  
ATOM 3944   C C4     . U A 1 123 ? 102.057 109.277 137.012 1.00 0.00 ? 144 U A C4     1  
ATOM 3945   O O4     . U A 1 123 ? 102.822 109.560 136.093 1.00 0.00 ? 144 U A O4     1  
ATOM 3946   C C5     . U A 1 123 ? 100.699 108.859 136.870 1.00 0.00 ? 144 U A C5     1  
ATOM 3947   C C6     . U A 1 123 ? 100.000 108.511 137.948 1.00 0.00 ? 144 U A C6     1  
ATOM 3948   H "H5'"  . U A 1 123 ? 96.228  106.505 139.445 1.00 0.00 ? 144 U A "H5'"  1  
ATOM 3949   H "H5''" . U A 1 123 ? 95.444  107.842 139.827 1.00 0.00 ? 144 U A "H5''" 1  
ATOM 3950   H "H4'"  . U A 1 123 ? 97.227  107.515 141.296 1.00 0.00 ? 144 U A "H4'"  1  
ATOM 3951   H "H3'"  . U A 1 123 ? 97.668  109.749 139.594 1.00 0.00 ? 144 U A "H3'"  1  
ATOM 3952   H "H2'"  . U A 1 123 ? 99.605  110.158 140.873 1.00 0.00 ? 144 U A "H2'"  1  
ATOM 3953   H "HO2'" . U A 1 123 ? 99.815  109.679 142.895 1.00 0.00 ? 144 U A "HO2'" 1  
ATOM 3954   H "H1'"  . U A 1 123 ? 100.287 107.636 140.997 1.00 0.00 ? 144 U A "H1'"  1  
ATOM 3955   H H3     . U A 1 123 ? 103.449 109.585 138.436 1.00 0.00 ? 144 U A H3     1  
ATOM 3956   H H5     . U A 1 123 ? 100.283 108.826 135.983 1.00 0.00 ? 144 U A H5     1  
ATOM 3957   H H6     . U A 1 123 ? 99.070  108.230 137.821 1.00 0.00 ? 144 U A H6     1  
ATOM 3958   P P      . C A 1 124 ? 96.526  111.567 141.217 1.00 0.00 ? 145 C A P      1  
ATOM 3959   O OP1    . C A 1 124 ? 95.451  111.865 142.189 1.00 0.00 ? 145 C A OP1    1  
ATOM 3960   O OP2    . C A 1 124 ? 96.343  111.907 139.785 1.00 0.00 ? 145 C A OP2    1  
ATOM 3961   O "O5'"  . C A 1 124 ? 97.857  112.243 141.755 1.00 0.00 ? 145 C A "O5'"  1  
ATOM 3962   C "C5'"  . C A 1 124 ? 98.120  112.237 143.139 1.00 0.00 ? 145 C A "C5'"  1  
ATOM 3963   C "C4'"  . C A 1 124 ? 99.479  112.795 143.414 1.00 0.00 ? 145 C A "C4'"  1  
ATOM 3964   O "O4'"  . C A 1 124 ? 100.465 111.974 142.751 1.00 0.00 ? 145 C A "O4'"  1  
ATOM 3965   C "C3'"  . C A 1 124 ? 99.772  114.185 142.882 1.00 0.00 ? 145 C A "C3'"  1  
ATOM 3966   O "O3'"  . C A 1 124 ? 99.221  115.190 143.732 1.00 0.00 ? 145 C A "O3'"  1  
ATOM 3967   C "C2'"  . C A 1 124 ? 101.293 114.179 142.923 1.00 0.00 ? 145 C A "C2'"  1  
ATOM 3968   O "O2'"  . C A 1 124 ? 101.821 114.296 144.232 1.00 0.00 ? 145 C A "O2'"  1  
ATOM 3969   C "C1'"  . C A 1 124 ? 101.583 112.771 142.405 1.00 0.00 ? 145 C A "C1'"  1  
ATOM 3970   N N1     . C A 1 124 ? 101.728 112.760 140.945 1.00 0.00 ? 145 C A N1     1  
ATOM 3971   C C2     . C A 1 124 ? 102.944 113.162 140.389 1.00 0.00 ? 145 C A C2     1  
ATOM 3972   O O2     . C A 1 124 ? 103.861 113.501 141.146 1.00 0.00 ? 145 C A O2     1  
ATOM 3973   N N3     . C A 1 124 ? 103.084 113.178 139.044 1.00 0.00 ? 145 C A N3     1  
ATOM 3974   C C4     . C A 1 124 ? 102.063 112.820 138.267 1.00 0.00 ? 145 C A C4     1  
ATOM 3975   N N4     . C A 1 124 ? 102.229 112.877 136.946 1.00 0.00 ? 145 C A N4     1  
ATOM 3976   C C5     . C A 1 124 ? 100.817 112.393 138.805 1.00 0.00 ? 145 C A C5     1  
ATOM 3977   C C6     . C A 1 124 ? 100.695 112.378 140.139 1.00 0.00 ? 145 C A C6     1  
ATOM 3978   H "H5'"  . C A 1 124 ? 98.068  111.316 143.470 1.00 0.00 ? 145 C A "H5'"  1  
ATOM 3979   H "H5''" . C A 1 124 ? 97.442  112.779 143.595 1.00 0.00 ? 145 C A "H5''" 1  
ATOM 3980   H "H4'"  . C A 1 124 ? 99.637  112.777 144.380 1.00 0.00 ? 145 C A "H4'"  1  
ATOM 3981   H "H3'"  . C A 1 124 ? 99.403  114.271 141.978 1.00 0.00 ? 145 C A "H3'"  1  
ATOM 3982   H "H2'"  . C A 1 124 ? 101.669 114.869 142.339 1.00 0.00 ? 145 C A "H2'"  1  
ATOM 3983   H "HO2'" . C A 1 124 ? 102.799 114.284 144.184 1.00 0.00 ? 145 C A "HO2'" 1  
ATOM 3984   H "H1'"  . C A 1 124 ? 102.403 112.437 142.825 1.00 0.00 ? 145 C A "H1'"  1  
ATOM 3985   H H41    . C A 1 124 ? 103.085 113.175 136.573 1.00 0.00 ? 145 C A H41    1  
ATOM 3986   H H42    . C A 1 124 ? 101.496 112.620 136.349 1.00 0.00 ? 145 C A H42    1  
ATOM 3987   H H5     . C A 1 124 ? 100.079 112.118 138.223 1.00 0.00 ? 145 C A H5     1  
ATOM 3988   H H6     . C A 1 124 ? 99.845  112.088 140.533 1.00 0.00 ? 145 C A H6     1  
ATOM 3989   P P      . A A 1 125 ? 98.775  116.614 143.112 1.00 0.00 ? 146 A A P      1  
ATOM 3990   O OP1    . A A 1 125 ? 97.542  117.088 143.797 1.00 0.00 ? 146 A A OP1    1  
ATOM 3991   O OP2    . A A 1 125 ? 98.770  116.448 141.637 1.00 0.00 ? 146 A A OP2    1  
ATOM 3992   O "O5'"  . A A 1 125 ? 99.958  117.598 143.530 1.00 0.00 ? 146 A A "O5'"  1  
ATOM 3993   C "C5'"  . A A 1 125 ? 100.491 118.528 142.604 1.00 0.00 ? 146 A A "C5'"  1  
ATOM 3994   C "C4'"  . A A 1 125 ? 101.987 118.389 142.544 1.00 0.00 ? 146 A A "C4'"  1  
ATOM 3995   O "O4'"  . A A 1 125 ? 102.326 117.018 142.210 1.00 0.00 ? 146 A A "O4'"  1  
ATOM 3996   C "C3'"  . A A 1 125 ? 102.660 119.199 141.453 1.00 0.00 ? 146 A A "C3'"  1  
ATOM 3997   O "O3'"  . A A 1 125 ? 102.894 120.515 141.880 1.00 0.00 ? 146 A A "O3'"  1  
ATOM 3998   C "C2'"  . A A 1 125 ? 103.956 118.437 141.260 1.00 0.00 ? 146 A A "C2'"  1  
ATOM 3999   O "O2'"  . A A 1 125 ? 104.918 118.679 142.264 1.00 0.00 ? 146 A A "O2'"  1  
ATOM 4000   C "C1'"  . A A 1 125 ? 103.435 117.005 141.325 1.00 0.00 ? 146 A A "C1'"  1  
ATOM 4001   N N9     . A A 1 125 ? 102.936 116.683 139.999 1.00 0.00 ? 146 A A N9     1  
ATOM 4002   C C8     . A A 1 125 ? 101.675 116.335 139.594 1.00 0.00 ? 146 A A C8     1  
ATOM 4003   N N7     . A A 1 125 ? 101.569 116.165 138.302 1.00 0.00 ? 146 A A N7     1  
ATOM 4004   C C5     . A A 1 125 ? 102.855 116.403 137.832 1.00 0.00 ? 146 A A C5     1  
ATOM 4005   C C6     . A A 1 125 ? 103.410 116.383 136.552 1.00 0.00 ? 146 A A C6     1  
ATOM 4006   N N6     . A A 1 125 ? 102.708 116.090 135.456 1.00 0.00 ? 146 A A N6     1  
ATOM 4007   N N1     . A A 1 125 ? 104.722 116.676 136.428 1.00 0.00 ? 146 A A N1     1  
ATOM 4008   C C2     . A A 1 125 ? 105.413 116.971 137.530 1.00 0.00 ? 146 A A C2     1  
ATOM 4009   N N3     . A A 1 125 ? 105.005 117.016 138.788 1.00 0.00 ? 146 A A N3     1  
ATOM 4010   C C4     . A A 1 125 ? 103.701 116.716 138.868 1.00 0.00 ? 146 A A C4     1  
ATOM 4011   H "H5'"  . A A 1 125 ? 100.251 119.435 142.888 1.00 0.00 ? 146 A A "H5'"  1  
ATOM 4012   H "H5''" . A A 1 125 ? 100.104 118.357 141.720 1.00 0.00 ? 146 A A "H5''" 1  
ATOM 4013   H "H4'"  . A A 1 125 ? 102.362 118.609 143.422 1.00 0.00 ? 146 A A "H4'"  1  
ATOM 4014   H "H3'"  . A A 1 125 ? 102.089 119.199 140.654 1.00 0.00 ? 146 A A "H3'"  1  
ATOM 4015   H "H2'"  . A A 1 125 ? 104.342 118.602 140.375 1.00 0.00 ? 146 A A "H2'"  1  
ATOM 4016   H "HO2'" . A A 1 125 ? 105.720 118.153 142.068 1.00 0.00 ? 146 A A "HO2'" 1  
ATOM 4017   H "H1'"  . A A 1 125 ? 104.160 116.406 141.605 1.00 0.00 ? 146 A A "H1'"  1  
ATOM 4018   H H8     . A A 1 125 ? 100.919 116.235 140.210 1.00 0.00 ? 146 A A H8     1  
ATOM 4019   H H61    . A A 1 125 ? 103.147 116.091 134.579 1.00 0.00 ? 146 A A H61    1  
ATOM 4020   H H62    . A A 1 125 ? 101.754 115.875 135.528 1.00 0.00 ? 146 A A H62    1  
ATOM 4021   H H2     . A A 1 125 ? 106.360 117.185 137.386 1.00 0.00 ? 146 A A H2     1  
ATOM 4022   P P      . G A 1 126 ? 101.829 121.655 141.530 1.00 0.00 ? 147 G A P      1  
ATOM 4023   O OP1    . G A 1 126 ? 101.599 122.261 142.859 1.00 0.00 ? 147 G A OP1    1  
ATOM 4024   O OP2    . G A 1 126 ? 100.671 121.167 140.722 1.00 0.00 ? 147 G A OP2    1  
ATOM 4025   O "O5'"  . G A 1 126 ? 102.658 122.678 140.644 1.00 0.00 ? 147 G A "O5'"  1  
ATOM 4026   C "C5'"  . G A 1 126 ? 103.757 123.357 141.213 1.00 0.00 ? 147 G A "C5'"  1  
ATOM 4027   C "C4'"  . G A 1 126 ? 104.881 123.461 140.227 1.00 0.00 ? 147 G A "C4'"  1  
ATOM 4028   O "O4'"  . G A 1 126 ? 105.401 122.138 139.891 1.00 0.00 ? 147 G A "O4'"  1  
ATOM 4029   C "C3'"  . G A 1 126 ? 104.498 124.018 138.880 1.00 0.00 ? 147 G A "C3'"  1  
ATOM 4030   O "O3'"  . G A 1 126 ? 104.292 125.418 138.907 1.00 0.00 ? 147 G A "O3'"  1  
ATOM 4031   C "C2'"  . G A 1 126 ? 105.699 123.576 138.065 1.00 0.00 ? 147 G A "C2'"  1  
ATOM 4032   O "O2'"  . G A 1 126 ? 106.879 124.264 138.459 1.00 0.00 ? 147 G A "O2'"  1  
ATOM 4033   C "C1'"  . G A 1 126 ? 105.809 122.121 138.524 1.00 0.00 ? 147 G A "C1'"  1  
ATOM 4034   N N9     . G A 1 126 ? 104.888 121.260 137.781 1.00 0.00 ? 147 G A N9     1  
ATOM 4035   C C8     . G A 1 126 ? 103.721 120.713 138.255 1.00 0.00 ? 147 G A C8     1  
ATOM 4036   N N7     . G A 1 126 ? 103.063 120.039 137.352 1.00 0.00 ? 147 G A N7     1  
ATOM 4037   C C5     . G A 1 126 ? 103.846 120.134 136.216 1.00 0.00 ? 147 G A C5     1  
ATOM 4038   C C6     . G A 1 126 ? 103.633 119.619 134.928 1.00 0.00 ? 147 G A C6     1  
ATOM 4039   O O6     . G A 1 126 ? 102.664 118.980 134.501 1.00 0.00 ? 147 G A O6     1  
ATOM 4040   N N1     . G A 1 126 ? 104.682 119.925 134.088 1.00 0.00 ? 147 G A N1     1  
ATOM 4041   C C2     . G A 1 126 ? 105.785 120.643 134.442 1.00 0.00 ? 147 G A C2     1  
ATOM 4042   N N2     . G A 1 126 ? 106.693 120.819 133.492 1.00 0.00 ? 147 G A N2     1  
ATOM 4043   N N3     . G A 1 126 ? 105.987 121.154 135.636 1.00 0.00 ? 147 G A N3     1  
ATOM 4044   C C4     . G A 1 126 ? 104.987 120.863 136.471 1.00 0.00 ? 147 G A C4     1  
ATOM 4045   H "H5'"  . G A 1 126 ? 104.060 122.867 142.006 1.00 0.00 ? 147 G A "H5'"  1  
ATOM 4046   H "H5''" . G A 1 126 ? 103.473 124.256 141.484 1.00 0.00 ? 147 G A "H5''" 1  
ATOM 4047   H "H4'"  . G A 1 126 ? 105.605 123.987 140.625 1.00 0.00 ? 147 G A "H4'"  1  
ATOM 4048   H "H3'"  . G A 1 126 ? 103.680 123.577 138.571 1.00 0.00 ? 147 G A "H3'"  1  
ATOM 4049   H "H2'"  . G A 1 126 ? 105.533 123.666 137.103 1.00 0.00 ? 147 G A "H2'"  1  
ATOM 4050   H "HO2'" . G A 1 126 ? 107.629 123.951 137.910 1.00 0.00 ? 147 G A "HO2'" 1  
ATOM 4051   H "H1'"  . G A 1 126 ? 106.729 121.808 138.400 1.00 0.00 ? 147 G A "H1'"  1  
ATOM 4052   H H8     . G A 1 126 ? 103.409 120.825 139.177 1.00 0.00 ? 147 G A H8     1  
ATOM 4053   H H1     . G A 1 126 ? 104.629 119.600 133.165 1.00 0.00 ? 147 G A H1     1  
ATOM 4054   H H21    . G A 1 126 ? 106.551 120.442 132.599 1.00 0.00 ? 147 G A H21    1  
ATOM 4055   H H22    . G A 1 126 ? 107.510 121.327 133.683 1.00 0.00 ? 147 G A H22    1  
ATOM 4056   P P      . G A 1 127 ? 103.266 126.062 137.857 1.00 0.00 ? 148 G A P      1  
ATOM 4057   O OP1    . G A 1 127 ? 103.167 127.525 138.087 1.00 0.00 ? 148 G A OP1    1  
ATOM 4058   O OP2    . G A 1 127 ? 102.045 125.219 137.872 1.00 0.00 ? 148 G A OP2    1  
ATOM 4059   O "O5'"  . G A 1 127 ? 103.970 125.857 136.449 1.00 0.00 ? 148 G A "O5'"  1  
ATOM 4060   C "C5'"  . G A 1 127 ? 105.167 126.549 136.142 1.00 0.00 ? 148 G A "C5'"  1  
ATOM 4061   C "C4'"  . G A 1 127 ? 105.447 126.431 134.679 1.00 0.00 ? 148 G A "C4'"  1  
ATOM 4062   O "O4'"  . G A 1 127 ? 105.832 125.067 134.374 1.00 0.00 ? 148 G A "O4'"  1  
ATOM 4063   C "C3'"  . G A 1 127 ? 104.200 126.644 133.855 1.00 0.00 ? 148 G A "C3'"  1  
ATOM 4064   O "O3'"  . G A 1 127 ? 103.949 128.013 133.648 1.00 0.00 ? 148 G A "O3'"  1  
ATOM 4065   C "C2'"  . G A 1 127 ? 104.517 125.883 132.578 1.00 0.00 ? 148 G A "C2'"  1  
ATOM 4066   O "O2'"  . G A 1 127 ? 105.361 126.591 131.702 1.00 0.00 ? 148 G A "O2'"  1  
ATOM 4067   C "C1'"  . G A 1 127 ? 105.247 124.666 133.142 1.00 0.00 ? 148 G A "C1'"  1  
ATOM 4068   N N9     . G A 1 127 ? 104.304 123.583 133.404 1.00 0.00 ? 148 G A N9     1  
ATOM 4069   C C8     . G A 1 127 ? 103.835 123.162 134.622 1.00 0.00 ? 148 G A C8     1  
ATOM 4070   N N7     . G A 1 127 ? 102.949 122.215 134.525 1.00 0.00 ? 148 G A N7     1  
ATOM 4071   C C5     . G A 1 127 ? 102.836 121.991 133.160 1.00 0.00 ? 148 G A C5     1  
ATOM 4072   C C6     . G A 1 127 ? 102.013 121.091 132.448 1.00 0.00 ? 148 G A C6     1  
ATOM 4073   O O6     . G A 1 127 ? 101.186 120.282 132.887 1.00 0.00 ? 148 G A O6     1  
ATOM 4074   N N1     . G A 1 127 ? 102.223 121.188 131.085 1.00 0.00 ? 148 G A N1     1  
ATOM 4075   C C2     . G A 1 127 ? 103.116 122.031 130.484 1.00 0.00 ? 148 G A C2     1  
ATOM 4076   N N2     . G A 1 127 ? 103.201 121.938 129.145 1.00 0.00 ? 148 G A N2     1  
ATOM 4077   N N3     . G A 1 127 ? 103.876 122.890 131.138 1.00 0.00 ? 148 G A N3     1  
ATOM 4078   C C4     . G A 1 127 ? 103.683 122.814 132.462 1.00 0.00 ? 148 G A C4     1  
ATOM 4079   H "H5'"  . G A 1 127 ? 105.903 126.161 136.660 1.00 0.00 ? 148 G A "H5'"  1  
ATOM 4080   H "H5''" . G A 1 127 ? 105.065 127.490 136.391 1.00 0.00 ? 148 G A "H5''" 1  
ATOM 4081   H "H4'"  . G A 1 127 ? 106.184 127.033 134.448 1.00 0.00 ? 148 G A "H4'"  1  
ATOM 4082   H "H3'"  . G A 1 127 ? 103.438 126.230 134.310 1.00 0.00 ? 148 G A "H3'"  1  
ATOM 4083   H "H2'"  . G A 1 127 ? 103.701 125.601 132.115 1.00 0.00 ? 148 G A "H2'"  1  
ATOM 4084   H "HO2'" . G A 1 127 ? 105.522 126.045 130.905 1.00 0.00 ? 148 G A "HO2'" 1  
ATOM 4085   H "H1'"  . G A 1 127 ? 105.933 124.372 132.506 1.00 0.00 ? 148 G A "H1'"  1  
ATOM 4086   H H8     . G A 1 127 ? 104.130 123.538 135.478 1.00 0.00 ? 148 G A H8     1  
ATOM 4087   H H1     . G A 1 127 ? 101.689 120.606 130.505 1.00 0.00 ? 148 G A H1     1  
ATOM 4088   H H21    . G A 1 127 ? 102.638 121.301 128.660 1.00 0.00 ? 148 G A H21    1  
ATOM 4089   H H22    . G A 1 127 ? 103.827 122.509 128.653 1.00 0.00 ? 148 G A H22    1  
ATOM 4090   P P      . G A 1 128 ? 102.447 128.491 133.396 1.00 0.00 ? 149 G A P      1  
ATOM 4091   O OP1    . G A 1 128 ? 102.421 129.965 133.235 1.00 0.00 ? 149 G A OP1    1  
ATOM 4092   O OP2    . G A 1 128 ? 101.602 127.845 134.432 1.00 0.00 ? 149 G A OP2    1  
ATOM 4093   O "O5'"  . G A 1 128 ? 102.103 127.856 131.986 1.00 0.00 ? 149 G A "O5'"  1  
ATOM 4094   C "C5'"  . G A 1 128 ? 102.883 128.175 130.847 1.00 0.00 ? 149 G A "C5'"  1  
ATOM 4095   C "C4'"  . G A 1 128 ? 102.257 127.568 129.636 1.00 0.00 ? 149 G A "C4'"  1  
ATOM 4096   O "O4'"  . G A 1 128 ? 102.474 126.141 129.611 1.00 0.00 ? 149 G A "O4'"  1  
ATOM 4097   C "C3'"  . G A 1 128 ? 100.761 127.694 129.673 1.00 0.00 ? 149 G A "C3'"  1  
ATOM 4098   O "O3'"  . G A 1 128 ? 100.397 128.952 129.205 1.00 0.00 ? 149 G A "O3'"  1  
ATOM 4099   C "C2'"  . G A 1 128 ? 100.312 126.591 128.743 1.00 0.00 ? 149 G A "C2'"  1  
ATOM 4100   O "O2'"  . G A 1 128 ? 100.380 126.991 127.394 1.00 0.00 ? 149 G A "O2'"  1  
ATOM 4101   C "C1'"  . G A 1 128 ? 101.333 125.502 129.076 1.00 0.00 ? 149 G A "C1'"  1  
ATOM 4102   N N9     . G A 1 128 ? 100.822 124.596 130.091 1.00 0.00 ? 149 G A N9     1  
ATOM 4103   C C8     . G A 1 128 ? 101.096 124.602 131.434 1.00 0.00 ? 149 G A C8     1  
ATOM 4104   N N7     . G A 1 128 ? 100.487 123.650 132.081 1.00 0.00 ? 149 G A N7     1  
ATOM 4105   C C5     . G A 1 128 ? 99.762  122.988 131.105 1.00 0.00 ? 149 G A C5     1  
ATOM 4106   C C6     . G A 1 128 ? 98.897  121.872 131.197 1.00 0.00 ? 149 G A C6     1  
ATOM 4107   O O6     . G A 1 128 ? 98.557  121.234 132.202 1.00 0.00 ? 149 G A O6     1  
ATOM 4108   N N1     . G A 1 128 ? 98.399  121.513 129.953 1.00 0.00 ? 149 G A N1     1  
ATOM 4109   C C2     . G A 1 128 ? 98.690  122.149 128.774 1.00 0.00 ? 149 G A C2     1  
ATOM 4110   N N2     . G A 1 128 ? 98.153  121.634 127.658 1.00 0.00 ? 149 G A N2     1  
ATOM 4111   N N3     . G A 1 128 ? 99.462  123.208 128.686 1.00 0.00 ? 149 G A N3     1  
ATOM 4112   C C4     . G A 1 128 ? 99.965  123.564 129.876 1.00 0.00 ? 149 G A C4     1  
ATOM 4113   H "H5'"  . G A 1 128 ? 103.790 127.823 130.971 1.00 0.00 ? 149 G A "H5'"  1  
ATOM 4114   H "H5''" . G A 1 128 ? 102.928 129.149 130.752 1.00 0.00 ? 149 G A "H5''" 1  
ATOM 4115   H "H4'"  . G A 1 128 ? 102.667 127.959 128.836 1.00 0.00 ? 149 G A "H4'"  1  
ATOM 4116   H "H3'"  . G A 1 128 ? 100.449 127.556 130.592 1.00 0.00 ? 149 G A "H3'"  1  
ATOM 4117   H "H2'"  . G A 1 128 ? 99.419  126.264 128.979 1.00 0.00 ? 149 G A "H2'"  1  
ATOM 4118   H "HO2'" . G A 1 128 ? 99.595  126.645 126.920 1.00 0.00 ? 149 G A "HO2'" 1  
ATOM 4119   H "H1'"  . G A 1 128 ? 101.554 125.003 128.263 1.00 0.00 ? 149 G A "H1'"  1  
ATOM 4120   H H8     . G A 1 128 ? 101.694 125.249 131.864 1.00 0.00 ? 149 G A H8     1  
ATOM 4121   H H1     . G A 1 128 ? 97.791  120.744 129.916 1.00 0.00 ? 149 G A H1     1  
ATOM 4122   H H21    . G A 1 128 ? 97.575  120.844 127.709 1.00 0.00 ? 149 G A H21    1  
ATOM 4123   H H22    . G A 1 128 ? 98.340  122.046 126.789 1.00 0.00 ? 149 G A H22    1  
ATOM 4124   P P      . G A 1 129 ? 100.431 129.392 127.674 1.00 0.00 ? 150 G A P      1  
ATOM 4125   O OP1    . G A 1 129 ? 101.559 128.605 127.156 1.00 0.00 ? 150 G A OP1    1  
ATOM 4126   O OP2    . G A 1 129 ? 100.524 130.884 127.747 1.00 0.00 ? 150 G A OP2    1  
ATOM 4127   O "O5'"  . G A 1 129 ? 99.121  128.966 126.893 1.00 0.00 ? 150 G A "O5'"  1  
ATOM 4128   C "C5'"  . G A 1 129 ? 97.852  129.146 127.480 1.00 0.00 ? 150 G A "C5'"  1  
ATOM 4129   C "C4'"  . G A 1 129 ? 96.907  128.114 126.948 1.00 0.00 ? 150 G A "C4'"  1  
ATOM 4130   O "O4'"  . G A 1 129 ? 97.370  126.814 127.383 1.00 0.00 ? 150 G A "O4'"  1  
ATOM 4131   C "C3'"  . G A 1 129 ? 95.495  128.162 127.510 1.00 0.00 ? 150 G A "C3'"  1  
ATOM 4132   O "O3'"  . G A 1 129 ? 94.700  129.162 126.883 1.00 0.00 ? 150 G A "O3'"  1  
ATOM 4133   C "C2'"  . G A 1 129 ? 94.999  126.756 127.214 1.00 0.00 ? 150 G A "C2'"  1  
ATOM 4134   O "O2'"  . G A 1 129 ? 94.592  126.579 125.875 1.00 0.00 ? 150 G A "O2'"  1  
ATOM 4135   C "C1'"  . G A 1 129 ? 96.260  125.941 127.497 1.00 0.00 ? 150 G A "C1'"  1  
ATOM 4136   N N9     . G A 1 129 ? 96.233  125.411 128.847 1.00 0.00 ? 150 G A N9     1  
ATOM 4137   C C8     . G A 1 129 ? 96.998  125.791 129.914 1.00 0.00 ? 150 G A C8     1  
ATOM 4138   N N7     . G A 1 129 ? 96.699  125.148 131.009 1.00 0.00 ? 150 G A N7     1  
ATOM 4139   C C5     . G A 1 129 ? 95.682  124.289 130.629 1.00 0.00 ? 150 G A C5     1  
ATOM 4140   C C6     . G A 1 129 ? 94.952  123.350 131.385 1.00 0.00 ? 150 G A C6     1  
ATOM 4141   O O6     . G A 1 129 ? 95.030  123.107 132.589 1.00 0.00 ? 150 G A O6     1  
ATOM 4142   N N1     . G A 1 129 ? 94.044  122.664 130.594 1.00 0.00 ? 150 G A N1     1  
ATOM 4143   C C2     . G A 1 129 ? 93.850  122.872 129.250 1.00 0.00 ? 150 G A C2     1  
ATOM 4144   N N2     . G A 1 129 ? 92.941  122.095 128.643 1.00 0.00 ? 150 G A N2     1  
ATOM 4145   N N3     . G A 1 129 ? 94.504  123.769 128.548 1.00 0.00 ? 150 G A N3     1  
ATOM 4146   C C4     . G A 1 129 ? 95.401  124.432 129.294 1.00 0.00 ? 150 G A C4     1  
ATOM 4147   H "H5'"  . G A 1 129 ? 97.526  130.045 127.267 1.00 0.00 ? 150 G A "H5'"  1  
ATOM 4148   H "H5''" . G A 1 129 ? 97.935  129.059 128.453 1.00 0.00 ? 150 G A "H5''" 1  
ATOM 4149   H "H4'"  . G A 1 129 ? 96.912  128.155 125.969 1.00 0.00 ? 150 G A "H4'"  1  
ATOM 4150   H "H3'"  . G A 1 129 ? 95.538  128.334 128.473 1.00 0.00 ? 150 G A "H3'"  1  
ATOM 4151   H "H2'"  . G A 1 129 ? 94.283  126.490 127.830 1.00 0.00 ? 150 G A "H2'"  1  
ATOM 4152   H "HO2'" . G A 1 129 ? 93.782  126.027 125.858 1.00 0.00 ? 150 G A "HO2'" 1  
ATOM 4153   H "H1'"  . G A 1 129 ? 96.330  125.210 126.848 1.00 0.00 ? 150 G A "H1'"  1  
ATOM 4154   H H8     . G A 1 129 ? 97.695  126.479 129.867 1.00 0.00 ? 150 G A H8     1  
ATOM 4155   H H1     . G A 1 129 ? 93.497  121.978 131.032 1.00 0.00 ? 150 G A H1     1  
ATOM 4156   H H21    . G A 1 129 ? 92.446  121.422 129.156 1.00 0.00 ? 150 G A H21    1  
ATOM 4157   H H22    . G A 1 129 ? 92.768  122.200 127.684 1.00 0.00 ? 150 G A H22    1  
ATOM 4158   P P      . A A 1 130 ? 93.823  130.166 127.792 1.00 0.00 ? 151 A A P      1  
ATOM 4159   O OP1    . A A 1 130 ? 93.748  131.474 127.082 1.00 0.00 ? 151 A A OP1    1  
ATOM 4160   O OP2    . A A 1 130 ? 94.328  130.114 129.206 1.00 0.00 ? 151 A A OP2    1  
ATOM 4161   O "O5'"  . A A 1 130 ? 92.382  129.507 127.768 1.00 0.00 ? 151 A A "O5'"  1  
ATOM 4162   C "C5'"  . A A 1 130 ? 91.469  129.712 128.828 1.00 0.00 ? 151 A A "C5'"  1  
ATOM 4163   C "C4'"  . A A 1 130 ? 90.319  128.775 128.648 1.00 0.00 ? 151 A A "C4'"  1  
ATOM 4164   O "O4'"  . A A 1 130 ? 89.867  128.962 127.288 1.00 0.00 ? 151 A A "O4'"  1  
ATOM 4165   C "C3'"  . A A 1 130 ? 90.709  127.308 128.742 1.00 0.00 ? 151 A A "C3'"  1  
ATOM 4166   O "O3'"  . A A 1 130 ? 90.547  126.857 130.090 1.00 0.00 ? 151 A A "O3'"  1  
ATOM 4167   C "C2'"  . A A 1 130 ? 89.748  126.636 127.770 1.00 0.00 ? 151 A A "C2'"  1  
ATOM 4168   O "O2'"  . A A 1 130 ? 88.502  126.348 128.348 1.00 0.00 ? 151 A A "O2'"  1  
ATOM 4169   C "C1'"  . A A 1 130 ? 89.576  127.719 126.701 1.00 0.00 ? 151 A A "C1'"  1  
ATOM 4170   N N9     . A A 1 130 ? 90.442  127.566 125.543 1.00 0.00 ? 151 A A N9     1  
ATOM 4171   C C8     . A A 1 130 ? 91.781  127.810 125.436 1.00 0.00 ? 151 A A C8     1  
ATOM 4172   N N7     . A A 1 130 ? 92.274  127.515 124.262 1.00 0.00 ? 151 A A N7     1  
ATOM 4173   C C5     . A A 1 130 ? 91.176  127.060 123.547 1.00 0.00 ? 151 A A C5     1  
ATOM 4174   C C6     . A A 1 130 ? 91.031  126.580 122.241 1.00 0.00 ? 151 A A C6     1  
ATOM 4175   N N6     . A A 1 130 ? 92.042  126.446 121.388 1.00 0.00 ? 151 A A N6     1  
ATOM 4176   N N1     . A A 1 130 ? 89.799  126.227 121.835 1.00 0.00 ? 151 A A N1     1  
ATOM 4177   C C2     . A A 1 130 ? 88.793  126.338 122.697 1.00 0.00 ? 151 A A C2     1  
ATOM 4178   N N3     . A A 1 130 ? 88.805  126.760 123.952 1.00 0.00 ? 151 A A N3     1  
ATOM 4179   C C4     . A A 1 130 ? 90.044  127.108 124.319 1.00 0.00 ? 151 A A C4     1  
ATOM 4180   H "H5'"  . A A 1 130 ? 91.161  130.641 128.810 1.00 0.00 ? 151 A A "H5'"  1  
ATOM 4181   H "H5''" . A A 1 130 ? 91.922  129.543 129.679 1.00 0.00 ? 151 A A "H5''" 1  
ATOM 4182   H "H4'"  . A A 1 130 ? 89.613  129.012 129.286 1.00 0.00 ? 151 A A "H4'"  1  
ATOM 4183   H "H3'"  . A A 1 130 ? 91.638  127.203 128.446 1.00 0.00 ? 151 A A "H3'"  1  
ATOM 4184   H "H2'"  . A A 1 130 ? 90.143  125.830 127.374 1.00 0.00 ? 151 A A "H2'"  1  
ATOM 4185   H "HO2'" . A A 1 130 ? 88.202  125.471 128.033 1.00 0.00 ? 151 A A "HO2'" 1  
ATOM 4186   H "H1'"  . A A 1 130 ? 88.646  127.723 126.390 1.00 0.00 ? 151 A A "H1'"  1  
ATOM 4187   H H8     . A A 1 130 ? 92.324  128.162 126.172 1.00 0.00 ? 151 A A H8     1  
ATOM 4188   H H61    . A A 1 130 ? 91.880  126.095 120.485 1.00 0.00 ? 151 A A H61    1  
ATOM 4189   H H62    . A A 1 130 ? 92.950  126.696 121.659 1.00 0.00 ? 151 A A H62    1  
ATOM 4190   H H2     . A A 1 130 ? 87.916  126.068 122.352 1.00 0.00 ? 151 A A H2     1  
ATOM 4191   P P      . A A 1 131 ? 91.117  125.416 130.534 1.00 0.00 ? 152 A A P      1  
ATOM 4192   O OP1    . A A 1 131 ? 90.587  125.060 131.881 1.00 0.00 ? 152 A A OP1    1  
ATOM 4193   O OP2    . A A 1 131 ? 92.583  125.373 130.304 1.00 0.00 ? 152 A A OP2    1  
ATOM 4194   O "O5'"  . A A 1 131 ? 90.421  124.422 129.518 1.00 0.00 ? 152 A A "O5'"  1  
ATOM 4195   C "C5'"  . A A 1 131 ? 89.110  123.988 129.776 1.00 0.00 ? 152 A A "C5'"  1  
ATOM 4196   C "C4'"  . A A 1 131 ? 88.595  123.221 128.609 1.00 0.00 ? 152 A A "C4'"  1  
ATOM 4197   O "O4'"  . A A 1 131 ? 88.727  124.037 127.424 1.00 0.00 ? 152 A A "O4'"  1  
ATOM 4198   C "C3'"  . A A 1 131 ? 89.375  121.970 128.278 1.00 0.00 ? 152 A A "C3'"  1  
ATOM 4199   O "O3'"  . A A 1 131 ? 88.950  120.922 129.112 1.00 0.00 ? 152 A A "O3'"  1  
ATOM 4200   C "C2'"  . A A 1 131 ? 88.993  121.750 126.823 1.00 0.00 ? 152 A A "C2'"  1  
ATOM 4201   O "O2'"  . A A 1 131 ? 87.738  121.115 126.633 1.00 0.00 ? 152 A A "O2'"  1  
ATOM 4202   C "C1'"  . A A 1 131 ? 88.985  123.197 126.318 1.00 0.00 ? 152 A A "C1'"  1  
ATOM 4203   N N9     . A A 1 131 ? 90.289  123.570 125.786 1.00 0.00 ? 152 A A N9     1  
ATOM 4204   C C8     . A A 1 131 ? 91.435  123.958 126.435 1.00 0.00 ? 152 A A C8     1  
ATOM 4205   N N7     . A A 1 131 ? 92.444  124.155 125.629 1.00 0.00 ? 152 A A N7     1  
ATOM 4206   C C5     . A A 1 131 ? 91.919  123.889 124.373 1.00 0.00 ? 152 A A C5     1  
ATOM 4207   C C6     . A A 1 131 ? 92.474  123.894 123.099 1.00 0.00 ? 152 A A C6     1  
ATOM 4208   N N6     . A A 1 131 ? 93.757  124.153 122.850 1.00 0.00 ? 152 A A N6     1  
ATOM 4209   N N1     . A A 1 131 ? 91.666  123.600 122.063 1.00 0.00 ? 152 A A N1     1  
ATOM 4210   C C2     . A A 1 131 ? 90.399  123.300 122.308 1.00 0.00 ? 152 A A C2     1  
ATOM 4211   N N3     . A A 1 131 ? 89.769  123.238 123.456 1.00 0.00 ? 152 A A N3     1  
ATOM 4212   C C4     . A A 1 131 ? 90.595  123.550 124.459 1.00 0.00 ? 152 A A C4     1  
ATOM 4213   H "H5'"  . A A 1 131 ? 88.540  124.768 129.939 1.00 0.00 ? 152 A A "H5'"  1  
ATOM 4214   H "H5''" . A A 1 131 ? 89.111  123.420 130.574 1.00 0.00 ? 152 A A "H5''" 1  
ATOM 4215   H "H4'"  . A A 1 131 ? 87.649  123.013 128.759 1.00 0.00 ? 152 A A "H4'"  1  
ATOM 4216   H "H3'"  . A A 1 131 ? 90.332  122.147 128.395 1.00 0.00 ? 152 A A "H3'"  1  
ATOM 4217   H "H2'"  . A A 1 131 ? 89.691  121.259 126.339 1.00 0.00 ? 152 A A "H2'"  1  
ATOM 4218   H "HO2'" . A A 1 131 ? 87.574  121.014 125.673 1.00 0.00 ? 152 A A "HO2'" 1  
ATOM 4219   H "H1'"  . A A 1 131 ? 88.298  123.297 125.626 1.00 0.00 ? 152 A A "H1'"  1  
ATOM 4220   H H8     . A A 1 131 ? 91.495  124.070 127.407 1.00 0.00 ? 152 A A H8     1  
ATOM 4221   H H61    . A A 1 131 ? 94.092  124.130 121.929 1.00 0.00 ? 152 A A H61    1  
ATOM 4222   H H62    . A A 1 131 ? 94.366  124.369 123.587 1.00 0.00 ? 152 A A H62    1  
ATOM 4223   H H2     . A A 1 131 ? 89.856  123.093 121.518 1.00 0.00 ? 152 A A H2     1  
ATOM 4224   P P      . A A 1 132 ? 89.895  119.673 129.325 1.00 0.00 ? 153 A A P      1  
ATOM 4225   O OP1    . A A 1 132 ? 89.152  118.692 130.136 1.00 0.00 ? 153 A A OP1    1  
ATOM 4226   O OP2    . A A 1 132 ? 91.218  120.151 129.779 1.00 0.00 ? 153 A A OP2    1  
ATOM 4227   O "O5'"  . A A 1 132 ? 89.991  119.089 127.863 1.00 0.00 ? 153 A A "O5'"  1  
ATOM 4228   C "C5'"  . A A 1 132 ? 88.860  118.493 127.267 1.00 0.00 ? 153 A A "C5'"  1  
ATOM 4229   C "C4'"  . A A 1 132 ? 89.221  118.010 125.901 1.00 0.00 ? 153 A A "C4'"  1  
ATOM 4230   O "O4'"  . A A 1 132 ? 89.676  119.162 125.143 1.00 0.00 ? 153 A A "O4'"  1  
ATOM 4231   C "C3'"  . A A 1 132 ? 90.381  117.023 125.842 1.00 0.00 ? 153 A A "C3'"  1  
ATOM 4232   O "O3'"  . A A 1 132 ? 89.926  115.673 125.983 1.00 0.00 ? 153 A A "O3'"  1  
ATOM 4233   C "C2'"  . A A 1 132 ? 90.915  117.257 124.437 1.00 0.00 ? 153 A A "C2'"  1  
ATOM 4234   O "O2'"  . A A 1 132 ? 90.120  116.554 123.496 1.00 0.00 ? 153 A A "O2'"  1  
ATOM 4235   C "C1'"  . A A 1 132 ? 90.743  118.778 124.292 1.00 0.00 ? 153 A A "C1'"  1  
ATOM 4236   N N9     . A A 1 132 ? 91.929  119.563 124.661 1.00 0.00 ? 153 A A N9     1  
ATOM 4237   C C8     . A A 1 132 ? 92.469  119.771 125.914 1.00 0.00 ? 153 A A C8     1  
ATOM 4238   N N7     . A A 1 132 ? 93.557  120.503 125.907 1.00 0.00 ? 153 A A N7     1  
ATOM 4239   C C5     . A A 1 132 ? 93.747  120.797 124.566 1.00 0.00 ? 153 A A C5     1  
ATOM 4240   C C6     . A A 1 132 ? 94.737  121.509 123.897 1.00 0.00 ? 153 A A C6     1  
ATOM 4241   N N6     . A A 1 132 ? 95.791  122.045 124.509 1.00 0.00 ? 153 A A N6     1  
ATOM 4242   N N1     . A A 1 132 ? 94.624  121.642 122.559 1.00 0.00 ? 153 A A N1     1  
ATOM 4243   C C2     . A A 1 132 ? 93.594  121.066 121.946 1.00 0.00 ? 153 A A C2     1  
ATOM 4244   N N3     . A A 1 132 ? 92.611  120.346 122.459 1.00 0.00 ? 153 A A N3     1  
ATOM 4245   C C4     . A A 1 132 ? 92.745  120.247 123.790 1.00 0.00 ? 153 A A C4     1  
ATOM 4246   H "H5'"  . A A 1 132 ? 88.141  119.155 127.213 1.00 0.00 ? 153 A A "H5'"  1  
ATOM 4247   H "H5''" . A A 1 132 ? 88.563  117.742 127.824 1.00 0.00 ? 153 A A "H5''" 1  
ATOM 4248   H "H4'"  . A A 1 132 ? 88.425  117.622 125.480 1.00 0.00 ? 153 A A "H4'"  1  
ATOM 4249   H "H3'"  . A A 1 132 ? 91.021  117.236 126.553 1.00 0.00 ? 153 A A "H3'"  1  
ATOM 4250   H "H2'"  . A A 1 132 ? 91.865  117.027 124.372 1.00 0.00 ? 153 A A "H2'"  1  
ATOM 4251   H "HO2'" . A A 1 132 ? 90.704  116.164 122.813 1.00 0.00 ? 153 A A "HO2'" 1  
ATOM 4252   H "H1'"  . A A 1 132 ? 90.511  118.991 123.363 1.00 0.00 ? 153 A A "H1'"  1  
ATOM 4253   H H8     . A A 1 132 ? 92.076  119.405 126.735 1.00 0.00 ? 153 A A H8     1  
ATOM 4254   H H61    . A A 1 132 ? 96.466  122.527 123.989 1.00 0.00 ? 153 A A H61    1  
ATOM 4255   H H62    . A A 1 132 ? 95.889  121.958 125.481 1.00 0.00 ? 153 A A H62    1  
ATOM 4256   H H2     . A A 1 132 ? 93.559  121.194 120.975 1.00 0.00 ? 153 A A H2     1  
ATOM 4257   P P      . C A 1 133 ? 90.993  114.487 126.134 1.00 0.00 ? 154 C A P      1  
ATOM 4258   O OP1    . C A 1 133 ? 91.955  114.714 125.025 1.00 0.00 ? 154 C A OP1    1  
ATOM 4259   O OP2    . C A 1 133 ? 90.221  113.216 126.190 1.00 0.00 ? 154 C A OP2    1  
ATOM 4260   O "O5'"  . C A 1 133 ? 91.726  114.621 127.544 1.00 0.00 ? 154 C A "O5'"  1  
ATOM 4261   C "C5'"  . C A 1 133 ? 93.114  114.365 127.695 1.00 0.00 ? 154 C A "C5'"  1  
ATOM 4262   C "C4'"  . C A 1 133 ? 93.902  115.295 126.811 1.00 0.00 ? 154 C A "C4'"  1  
ATOM 4263   O "O4'"  . C A 1 133 ? 93.597  116.659 127.190 1.00 0.00 ? 154 C A "O4'"  1  
ATOM 4264   C "C3'"  . C A 1 133 ? 95.408  115.195 126.949 1.00 0.00 ? 154 C A "C3'"  1  
ATOM 4265   O "O3'"  . C A 1 133 ? 95.953  114.170 126.131 1.00 0.00 ? 154 C A "O3'"  1  
ATOM 4266   C "C2'"  . C A 1 133 ? 95.857  116.568 126.481 1.00 0.00 ? 154 C A "C2'"  1  
ATOM 4267   O "O2'"  . C A 1 133 ? 95.868  116.664 125.072 1.00 0.00 ? 154 C A "O2'"  1  
ATOM 4268   C "C1'"  . C A 1 133 ? 94.753  117.459 127.049 1.00 0.00 ? 154 C A "C1'"  1  
ATOM 4269   N N1     . C A 1 133 ? 95.062  118.069 128.355 1.00 0.00 ? 154 C A N1     1  
ATOM 4270   C C2     . C A 1 133 ? 95.651  119.339 128.391 1.00 0.00 ? 154 C A C2     1  
ATOM 4271   O O2     . C A 1 133 ? 95.928  119.909 127.332 1.00 0.00 ? 154 C A O2     1  
ATOM 4272   N N3     . C A 1 133 ? 95.907  119.920 129.577 1.00 0.00 ? 154 C A N3     1  
ATOM 4273   C C4     . C A 1 133 ? 95.614  119.288 130.702 1.00 0.00 ? 154 C A C4     1  
ATOM 4274   N N4     . C A 1 133 ? 95.891  119.922 131.848 1.00 0.00 ? 154 C A N4     1  
ATOM 4275   C C5     . C A 1 133 ? 95.029  117.988 130.706 1.00 0.00 ? 154 C A C5     1  
ATOM 4276   C C6     . C A 1 133 ? 94.772  117.420 129.517 1.00 0.00 ? 154 C A C6     1  
ATOM 4277   H "H5'"  . C A 1 133 ? 93.296  113.434 127.450 1.00 0.00 ? 154 C A "H5'"  1  
ATOM 4278   H "H5''" . C A 1 133 ? 93.363  114.504 128.633 1.00 0.00 ? 154 C A "H5''" 1  
ATOM 4279   H "H4'"  . C A 1 133 ? 93.635  115.147 125.881 1.00 0.00 ? 154 C A "H4'"  1  
ATOM 4280   H "H3'"  . C A 1 133 ? 95.637  115.022 127.887 1.00 0.00 ? 154 C A "H3'"  1  
ATOM 4281   H "H2'"  . C A 1 133 ? 96.726  116.811 126.863 1.00 0.00 ? 154 C A "H2'"  1  
ATOM 4282   H "HO2'" . C A 1 133 ? 96.162  117.562 124.815 1.00 0.00 ? 154 C A "HO2'" 1  
ATOM 4283   H "H1'"  . C A 1 133 ? 94.563  118.181 126.413 1.00 0.00 ? 154 C A "H1'"  1  
ATOM 4284   H H41    . C A 1 133 ? 96.292  120.817 131.827 1.00 0.00 ? 154 C A H41    1  
ATOM 4285   H H42    . C A 1 133 ? 95.691  119.494 132.706 1.00 0.00 ? 154 C A H42    1  
ATOM 4286   H H5     . C A 1 133 ? 94.821  117.526 131.545 1.00 0.00 ? 154 C A H5     1  
ATOM 4287   H H6     . C A 1 133 ? 94.370  116.526 129.496 1.00 0.00 ? 154 C A H6     1  
ATOM 4288   P P      . U A 1 134 ? 97.472  113.705 126.354 1.00 0.00 ? 155 U A P      1  
ATOM 4289   O OP1    . U A 1 134 ? 97.850  112.886 125.194 1.00 0.00 ? 155 U A OP1    1  
ATOM 4290   O OP2    . U A 1 134 ? 97.607  113.156 127.723 1.00 0.00 ? 155 U A OP2    1  
ATOM 4291   O "O5'"  . U A 1 134 ? 98.318  115.046 126.275 1.00 0.00 ? 155 U A "O5'"  1  
ATOM 4292   C "C5'"  . U A 1 134 ? 98.607  115.647 125.024 1.00 0.00 ? 155 U A "C5'"  1  
ATOM 4293   C "C4'"  . U A 1 134 ? 99.551  116.803 125.214 1.00 0.00 ? 155 U A "C4'"  1  
ATOM 4294   O "O4'"  . U A 1 134 ? 98.930  117.778 126.086 1.00 0.00 ? 155 U A "O4'"  1  
ATOM 4295   C "C3'"  . U A 1 134 ? 100.845 116.452 125.923 1.00 0.00 ? 155 U A "C3'"  1  
ATOM 4296   O "O3'"  . U A 1 134 ? 101.788 115.969 124.984 1.00 0.00 ? 155 U A "O3'"  1  
ATOM 4297   C "C2'"  . U A 1 134 ? 101.273 117.785 126.524 1.00 0.00 ? 155 U A "C2'"  1  
ATOM 4298   O "O2'"  . U A 1 134 ? 101.964 118.619 125.609 1.00 0.00 ? 155 U A "O2'"  1  
ATOM 4299   C "C1'"  . U A 1 134 ? 99.918  118.398 126.891 1.00 0.00 ? 155 U A "C1'"  1  
ATOM 4300   N N1     . U A 1 134 ? 99.550  118.229 128.306 1.00 0.00 ? 155 U A N1     1  
ATOM 4301   C C2     . U A 1 134 ? 100.125 119.099 129.211 1.00 0.00 ? 155 U A C2     1  
ATOM 4302   O O2     . U A 1 134 ? 100.887 119.994 128.879 1.00 0.00 ? 155 U A O2     1  
ATOM 4303   N N3     . U A 1 134 ? 99.775  118.892 130.521 1.00 0.00 ? 155 U A N3     1  
ATOM 4304   C C4     . U A 1 134 ? 98.920  117.932 131.012 1.00 0.00 ? 155 U A C4     1  
ATOM 4305   O O4     . U A 1 134 ? 98.770  117.827 132.242 1.00 0.00 ? 155 U A O4     1  
ATOM 4306   C C5     . U A 1 134 ? 98.344  117.079 130.005 1.00 0.00 ? 155 U A C5     1  
ATOM 4307   C C6     . U A 1 134 ? 98.676  117.251 128.719 1.00 0.00 ? 155 U A C6     1  
ATOM 4308   H "H5'"  . U A 1 134 ? 97.772  115.963 124.620 1.00 0.00 ? 155 U A "H5'"  1  
ATOM 4309   H "H5''" . U A 1 134 ? 99.015  114.978 124.435 1.00 0.00 ? 155 U A "H5''" 1  
ATOM 4310   H "H4'"  . U A 1 134 ? 99.728  117.214 124.342 1.00 0.00 ? 155 U A "H4'"  1  
ATOM 4311   H "H3'"  . U A 1 134 ? 100.661 115.779 126.612 1.00 0.00 ? 155 U A "H3'"  1  
ATOM 4312   H "H2'"  . U A 1 134 ? 101.804 117.657 127.339 1.00 0.00 ? 155 U A "H2'"  1  
ATOM 4313   H "HO2'" . U A 1 134 ? 102.704 119.060 126.077 1.00 0.00 ? 155 U A "HO2'" 1  
ATOM 4314   H "H1'"  . U A 1 134 ? 99.932  119.356 126.686 1.00 0.00 ? 155 U A "H1'"  1  
ATOM 4315   H H3     . U A 1 134 ? 100.179 119.493 131.181 1.00 0.00 ? 155 U A H3     1  
ATOM 4316   H H5     . U A 1 134 ? 97.711  116.374 130.257 1.00 0.00 ? 155 U A H5     1  
ATOM 4317   H H6     . U A 1 134 ? 98.268  116.655 128.059 1.00 0.00 ? 155 U A H6     1  
ATOM 4318   P P      . U A 1 135 ? 103.097 115.212 125.500 1.00 0.00 ? 156 U A P      1  
ATOM 4319   O OP1    . U A 1 135 ? 103.926 114.930 124.313 1.00 0.00 ? 156 U A OP1    1  
ATOM 4320   O OP2    . U A 1 135 ? 102.682 114.102 126.380 1.00 0.00 ? 156 U A OP2    1  
ATOM 4321   O "O5'"  . U A 1 135 ? 103.868 116.314 126.335 1.00 0.00 ? 156 U A "O5'"  1  
ATOM 4322   C "C5'"  . U A 1 135 ? 104.660 117.264 125.662 1.00 0.00 ? 156 U A "C5'"  1  
ATOM 4323   C "C4'"  . U A 1 135 ? 105.526 117.965 126.641 1.00 0.00 ? 156 U A "C4'"  1  
ATOM 4324   O "O4'"  . U A 1 135 ? 104.663 118.696 127.529 1.00 0.00 ? 156 U A "O4'"  1  
ATOM 4325   C "C3'"  . U A 1 135 ? 106.290 117.020 127.535 1.00 0.00 ? 156 U A "C3'"  1  
ATOM 4326   O "O3'"  . U A 1 135 ? 107.542 116.741 126.945 1.00 0.00 ? 156 U A "O3'"  1  
ATOM 4327   C "C2'"  . U A 1 135 ? 106.490 117.844 128.788 1.00 0.00 ? 156 U A "C2'"  1  
ATOM 4328   O "O2'"  . U A 1 135 ? 107.620 118.672 128.646 1.00 0.00 ? 156 U A "O2'"  1  
ATOM 4329   C "C1'"  . U A 1 135 ? 105.191 118.656 128.835 1.00 0.00 ? 156 U A "C1'"  1  
ATOM 4330   N N1     . U A 1 135 ? 104.146 118.141 129.736 1.00 0.00 ? 156 U A N1     1  
ATOM 4331   C C2     . U A 1 135 ? 104.117 118.639 131.032 1.00 0.00 ? 156 U A C2     1  
ATOM 4332   O O2     . U A 1 135 ? 104.928 119.443 131.454 1.00 0.00 ? 156 U A O2     1  
ATOM 4333   N N3     . U A 1 135 ? 103.102 118.162 131.818 1.00 0.00 ? 156 U A N3     1  
ATOM 4334   C C4     . U A 1 135 ? 102.132 117.260 131.459 1.00 0.00 ? 156 U A C4     1  
ATOM 4335   O O4     . U A 1 135 ? 101.254 116.969 132.277 1.00 0.00 ? 156 U A O4     1  
ATOM 4336   C C5     . U A 1 135 ? 102.232 116.771 130.113 1.00 0.00 ? 156 U A C5     1  
ATOM 4337   C C6     . U A 1 135 ? 103.213 117.217 129.317 1.00 0.00 ? 156 U A C6     1  
ATOM 4338   H "H5'"  . U A 1 135 ? 104.073 117.906 125.210 1.00 0.00 ? 156 U A "H5'"  1  
ATOM 4339   H "H5''" . U A 1 135 ? 105.210 116.807 124.993 1.00 0.00 ? 156 U A "H5''" 1  
ATOM 4340   H "H4'"  . U A 1 135 ? 106.112 118.584 126.158 1.00 0.00 ? 156 U A "H4'"  1  
ATOM 4341   H "H3'"  . U A 1 135 ? 105.768 116.202 127.661 1.00 0.00 ? 156 U A "H3'"  1  
ATOM 4342   H "H2'"  . U A 1 135 ? 106.540 117.279 129.586 1.00 0.00 ? 156 U A "H2'"  1  
ATOM 4343   H "HO2'" . U A 1 135 ? 108.111 118.689 129.496 1.00 0.00 ? 156 U A "HO2'" 1  
ATOM 4344   H "H1'"  . U A 1 135 ? 105.394 119.574 129.112 1.00 0.00 ? 156 U A "H1'"  1  
ATOM 4345   H H3     . U A 1 135 ? 103.065 118.501 132.737 1.00 0.00 ? 156 U A H3     1  
ATOM 4346   H H5     . U A 1 135 ? 101.587 116.114 129.777 1.00 0.00 ? 156 U A H5     1  
ATOM 4347   H H6     . U A 1 135 ? 103.257 116.864 128.405 1.00 0.00 ? 156 U A H6     1  
ATOM 4348   P P      . U A 1 136 ? 108.407 115.500 127.474 1.00 0.00 ? 157 U A P      1  
ATOM 4349   O OP1    . U A 1 136 ? 109.539 115.320 126.543 1.00 0.00 ? 157 U A OP1    1  
ATOM 4350   O OP2    . U A 1 136 ? 107.465 114.378 127.699 1.00 0.00 ? 157 U A OP2    1  
ATOM 4351   O "O5'"  . U A 1 136 ? 108.987 115.994 128.872 1.00 0.00 ? 157 U A "O5'"  1  
ATOM 4352   C "C5'"  . U A 1 136 ? 110.011 116.968 128.896 1.00 0.00 ? 157 U A "C5'"  1  
ATOM 4353   C "C4'"  . U A 1 136 ? 110.292 117.401 130.306 1.00 0.00 ? 157 U A "C4'"  1  
ATOM 4354   O "O4'"  . U A 1 136 ? 109.150 118.106 130.843 1.00 0.00 ? 157 U A "O4'"  1  
ATOM 4355   C "C3'"  . U A 1 136 ? 110.548 116.285 131.294 1.00 0.00 ? 157 U A "C3'"  1  
ATOM 4356   O "O3'"  . U A 1 136 ? 111.914 115.976 131.276 1.00 0.00 ? 157 U A "O3'"  1  
ATOM 4357   C "C2'"  . U A 1 136 ? 110.252 116.973 132.607 1.00 0.00 ? 157 U A "C2'"  1  
ATOM 4358   O "O2'"  . U A 1 136 ? 111.362 117.760 132.961 1.00 0.00 ? 157 U A "O2'"  1  
ATOM 4359   C "C1'"  . U A 1 136 ? 109.063 117.858 132.228 1.00 0.00 ? 157 U A "C1'"  1  
ATOM 4360   N N1     . U A 1 136 ? 107.779 117.203 132.468 1.00 0.00 ? 157 U A N1     1  
ATOM 4361   C C2     . U A 1 136 ? 107.194 117.363 133.689 1.00 0.00 ? 157 U A C2     1  
ATOM 4362   O O2     . U A 1 136 ? 107.719 117.978 134.581 1.00 0.00 ? 157 U A O2     1  
ATOM 4363   N N3     . U A 1 136 ? 105.975 116.764 133.827 1.00 0.00 ? 157 U A N3     1  
ATOM 4364   C C4     . U A 1 136 ? 105.319 116.023 132.876 1.00 0.00 ? 157 U A C4     1  
ATOM 4365   O O4     . U A 1 136 ? 104.253 115.480 133.153 1.00 0.00 ? 157 U A O4     1  
ATOM 4366   C C5     . U A 1 136 ? 106.016 115.894 131.643 1.00 0.00 ? 157 U A C5     1  
ATOM 4367   C C6     . U A 1 136 ? 107.190 116.471 131.491 1.00 0.00 ? 157 U A C6     1  
ATOM 4368   H "H5'"  . U A 1 136 ? 109.729 117.742 128.365 1.00 0.00 ? 157 U A "H5'"  1  
ATOM 4369   H "H5''" . U A 1 136 ? 110.824 116.587 128.503 1.00 0.00 ? 157 U A "H5''" 1  
ATOM 4370   H "H4'"  . U A 1 136 ? 111.063 118.007 130.302 1.00 0.00 ? 157 U A "H4'"  1  
ATOM 4371   H "H3'"  . U A 1 136 ? 110.002 115.508 131.049 1.00 0.00 ? 157 U A "H3'"  1  
ATOM 4372   H "H2'"  . U A 1 136 ? 109.998 116.329 133.300 1.00 0.00 ? 157 U A "H2'"  1  
ATOM 4373   H "HO2'" . U A 1 136 ? 111.175 118.209 133.812 1.00 0.00 ? 157 U A "HO2'" 1  
ATOM 4374   H "H1'"  . U A 1 136 ? 109.103 118.689 132.746 1.00 0.00 ? 157 U A "H1'"  1  
ATOM 4375   H H3     . U A 1 136 ? 105.529 116.877 134.692 1.00 0.00 ? 157 U A H3     1  
ATOM 4376   H H5     . U A 1 136 ? 105.624 115.378 130.907 1.00 0.00 ? 157 U A H5     1  
ATOM 4377   H H6     . U A 1 136 ? 107.645 116.363 130.632 1.00 0.00 ? 157 U A H6     1  
ATOM 4378   P P      . G A 1 137 ? 112.452 114.816 132.214 1.00 0.00 ? 158 G A P      1  
ATOM 4379   O OP1    . G A 1 137 ? 113.927 114.883 132.237 1.00 0.00 ? 158 G A OP1    1  
ATOM 4380   O OP2    . G A 1 137 ? 111.768 113.591 131.751 1.00 0.00 ? 158 G A OP2    1  
ATOM 4381   O "O5'"  . G A 1 137 ? 111.938 115.190 133.671 1.00 0.00 ? 158 G A "O5'"  1  
ATOM 4382   C "C5'"  . G A 1 137 ? 112.796 115.872 134.587 1.00 0.00 ? 158 G A "C5'"  1  
ATOM 4383   C "C4'"  . G A 1 137 ? 112.279 115.760 136.007 1.00 0.00 ? 158 G A "C4'"  1  
ATOM 4384   O "O4'"  . G A 1 137 ? 110.965 116.354 136.079 1.00 0.00 ? 158 G A "O4'"  1  
ATOM 4385   C "C3'"  . G A 1 137 ? 112.088 114.372 136.595 1.00 0.00 ? 158 G A "C3'"  1  
ATOM 4386   O "O3'"  . G A 1 137 ? 113.315 113.889 137.136 1.00 0.00 ? 158 G A "O3'"  1  
ATOM 4387   C "C2'"  . G A 1 137 ? 111.128 114.671 137.728 1.00 0.00 ? 158 G A "C2'"  1  
ATOM 4388   O "O2'"  . G A 1 137 ? 111.816 115.297 138.789 1.00 0.00 ? 158 G A "O2'"  1  
ATOM 4389   C "C1'"  . G A 1 137 ? 110.218 115.713 137.084 1.00 0.00 ? 158 G A "C1'"  1  
ATOM 4390   N N9     . G A 1 137 ? 109.007 115.195 136.472 1.00 0.00 ? 158 G A N9     1  
ATOM 4391   C C8     . G A 1 137 ? 108.752 115.066 135.135 1.00 0.00 ? 158 G A C8     1  
ATOM 4392   N N7     . G A 1 137 ? 107.547 114.628 134.886 1.00 0.00 ? 158 G A N7     1  
ATOM 4393   C C5     . G A 1 137 ? 106.986 114.442 136.139 1.00 0.00 ? 158 G A C5     1  
ATOM 4394   C C6     . G A 1 137 ? 105.697 113.990 136.516 1.00 0.00 ? 158 G A C6     1  
ATOM 4395   O O6     . G A 1 137 ? 104.768 113.654 135.798 1.00 0.00 ? 158 G A O6     1  
ATOM 4396   N N1     . G A 1 137 ? 105.542 113.957 137.887 1.00 0.00 ? 158 G A N1     1  
ATOM 4397   C C2     . G A 1 137 ? 106.499 114.317 138.785 1.00 0.00 ? 158 G A C2     1  
ATOM 4398   N N2     . G A 1 137 ? 106.164 114.238 140.072 1.00 0.00 ? 158 G A N2     1  
ATOM 4399   N N3     . G A 1 137 ? 107.708 114.737 138.452 1.00 0.00 ? 158 G A N3     1  
ATOM 4400   C C4     . G A 1 137 ? 107.878 114.776 137.124 1.00 0.00 ? 158 G A C4     1  
ATOM 4401   H "H5'"  . G A 1 137 ? 112.847 116.816 134.335 1.00 0.00 ? 158 G A "H5'"  1  
ATOM 4402   H "H5''" . G A 1 137 ? 113.692 115.479 134.538 1.00 0.00 ? 158 G A "H5''" 1  
ATOM 4403   H "H4'"  . G A 1 137 ? 112.886 116.246 136.605 1.00 0.00 ? 158 G A "H4'"  1  
ATOM 4404   H "H3'"  . G A 1 137 ? 111.761 113.768 135.896 1.00 0.00 ? 158 G A "H3'"  1  
ATOM 4405   H "H2'"  . G A 1 137 ? 110.648 113.865 138.015 1.00 0.00 ? 158 G A "H2'"  1  
ATOM 4406   H "HO2'" . G A 1 137 ? 111.484 114.940 139.641 1.00 0.00 ? 158 G A "HO2'" 1  
ATOM 4407   H "H1'"  . G A 1 137 ? 109.952 116.375 137.757 1.00 0.00 ? 158 G A "H1'"  1  
ATOM 4408   H H8     . G A 1 137 ? 109.399 115.290 134.435 1.00 0.00 ? 158 G A H8     1  
ATOM 4409   H H1     . G A 1 137 ? 104.680 113.652 138.240 1.00 0.00 ? 158 G A H1     1  
ATOM 4410   H H21    . G A 1 137 ? 105.271 113.927 140.328 1.00 0.00 ? 158 G A H21    1  
ATOM 4411   H H22    . G A 1 137 ? 106.811 114.488 140.763 1.00 0.00 ? 158 G A H22    1  
ATOM 4412   P P      . A A 1 138 ? 113.500 112.317 137.430 1.00 0.00 ? 159 A A P      1  
ATOM 4413   O OP1    . A A 1 138 ? 114.900 112.088 137.882 1.00 0.00 ? 159 A A OP1    1  
ATOM 4414   O OP2    . A A 1 138 ? 113.003 111.596 136.234 1.00 0.00 ? 159 A A OP2    1  
ATOM 4415   O "O5'"  . A A 1 138 ? 112.530 112.035 138.671 1.00 0.00 ? 159 A A "O5'"  1  
ATOM 4416   C "C5'"  . A A 1 138 ? 112.881 112.473 139.985 1.00 0.00 ? 159 A A "C5'"  1  
ATOM 4417   C "C4'"  . A A 1 138 ? 111.769 112.180 140.968 1.00 0.00 ? 159 A A "C4'"  1  
ATOM 4418   O "O4'"  . A A 1 138 ? 110.571 112.884 140.574 1.00 0.00 ? 159 A A "O4'"  1  
ATOM 4419   C "C3'"  . A A 1 138 ? 111.331 110.732 141.104 1.00 0.00 ? 159 A A "C3'"  1  
ATOM 4420   O "O3'"  . A A 1 138 ? 112.155 110.065 142.052 1.00 0.00 ? 159 A A "O3'"  1  
ATOM 4421   C "C2'"  . A A 1 138 ? 109.919 110.875 141.652 1.00 0.00 ? 159 A A "C2'"  1  
ATOM 4422   O "O2'"  . A A 1 138 ? 109.902 111.134 143.041 1.00 0.00 ? 159 A A "O2'"  1  
ATOM 4423   C "C1'"  . A A 1 138 ? 109.434 112.123 140.925 1.00 0.00 ? 159 A A "C1'"  1  
ATOM 4424   N N9     . A A 1 138 ? 108.706 111.851 139.701 1.00 0.00 ? 159 A A N9     1  
ATOM 4425   C C8     . A A 1 138 ? 109.180 112.007 138.433 1.00 0.00 ? 159 A A C8     1  
ATOM 4426   N N7     . A A 1 138 ? 108.290 111.766 137.506 1.00 0.00 ? 159 A A N7     1  
ATOM 4427   C C5     . A A 1 138 ? 107.158 111.396 138.216 1.00 0.00 ? 159 A A C5     1  
ATOM 4428   C C6     . A A 1 138 ? 105.875 111.015 137.809 1.00 0.00 ? 159 A A C6     1  
ATOM 4429   N N6     . A A 1 138 ? 105.506 110.922 136.539 1.00 0.00 ? 159 A A N6     1  
ATOM 4430   N N1     . A A 1 138 ? 104.974 110.720 138.761 1.00 0.00 ? 159 A A N1     1  
ATOM 4431   C C2     . A A 1 138 ? 105.356 110.795 140.033 1.00 0.00 ? 159 A A C2     1  
ATOM 4432   N N3     . A A 1 138 ? 106.539 111.134 140.543 1.00 0.00 ? 159 A A N3     1  
ATOM 4433   C C4     . A A 1 138 ? 107.406 111.429 139.568 1.00 0.00 ? 159 A A C4     1  
ATOM 4434   H "H5'"  . A A 1 138 ? 113.050 113.438 139.967 1.00 0.00 ? 159 A A "H5'"  1  
ATOM 4435   H "H5''" . A A 1 138 ? 113.696 112.012 140.270 1.00 0.00 ? 159 A A "H5''" 1  
ATOM 4436   H "H4'"  . A A 1 138 ? 112.043 112.487 141.857 1.00 0.00 ? 159 A A "H4'"  1  
ATOM 4437   H "H3'"  . A A 1 138 ? 111.385 110.295 140.228 1.00 0.00 ? 159 A A "H3'"  1  
ATOM 4438   H "H2'"  . A A 1 138 ? 109.368 110.094 141.432 1.00 0.00 ? 159 A A "H2'"  1  
ATOM 4439   H "HO2'" . A A 1 138 ? 110.759 110.859 143.428 1.00 0.00 ? 159 A A "HO2'" 1  
ATOM 4440   H "H1'"  . A A 1 138 ? 108.855 112.643 141.522 1.00 0.00 ? 159 A A "H1'"  1  
ATOM 4441   H H8     . A A 1 138 ? 110.097 112.292 138.235 1.00 0.00 ? 159 A A H8     1  
ATOM 4442   H H61    . A A 1 138 ? 104.594 110.644 136.313 1.00 0.00 ? 159 A A H61    1  
ATOM 4443   H H62    . A A 1 138 ? 106.146 111.130 135.826 1.00 0.00 ? 159 A A H62    1  
ATOM 4444   H H2     . A A 1 138 ? 104.665 110.569 140.689 1.00 0.00 ? 159 A A H2     1  
ATOM 4445   P P      . G A 1 139 ? 112.398 108.487 141.908 1.00 0.00 ? 160 G A P      1  
ATOM 4446   O OP1    . G A 1 139 ? 113.533 108.084 142.782 1.00 0.00 ? 160 G A OP1    1  
ATOM 4447   O OP2    . G A 1 139 ? 112.438 108.187 140.452 1.00 0.00 ? 160 G A OP2    1  
ATOM 4448   O "O5'"  . G A 1 139 ? 111.065 107.828 142.462 1.00 0.00 ? 160 G A "O5'"  1  
ATOM 4449   C "C5'"  . G A 1 139 ? 110.799 107.744 143.852 1.00 0.00 ? 160 G A "C5'"  1  
ATOM 4450   C "C4'"  . G A 1 139 ? 109.415 107.194 144.051 1.00 0.00 ? 160 G A "C4'"  1  
ATOM 4451   O "O4'"  . G A 1 139 ? 108.490 108.104 143.399 1.00 0.00 ? 160 G A "O4'"  1  
ATOM 4452   C "C3'"  . G A 1 139 ? 109.177 105.872 143.338 1.00 0.00 ? 160 G A "C3'"  1  
ATOM 4453   O "O3'"  . G A 1 139 ? 109.628 104.767 144.111 1.00 0.00 ? 160 G A "O3'"  1  
ATOM 4454   C "C2'"  . G A 1 139 ? 107.672 105.894 143.102 1.00 0.00 ? 160 G A "C2'"  1  
ATOM 4455   O "O2'"  . G A 1 139 ? 106.899 105.547 144.231 1.00 0.00 ? 160 G A "O2'"  1  
ATOM 4456   C "C1'"  . G A 1 139 ? 107.451 107.371 142.779 1.00 0.00 ? 160 G A "C1'"  1  
ATOM 4457   N N9     . G A 1 139 ? 107.466 107.661 141.349 1.00 0.00 ? 160 G A N9     1  
ATOM 4458   C C8     . G A 1 139 ? 108.441 108.290 140.620 1.00 0.00 ? 160 G A C8     1  
ATOM 4459   N N7     . G A 1 139 ? 108.142 108.393 139.354 1.00 0.00 ? 160 G A N7     1  
ATOM 4460   C C5     . G A 1 139 ? 106.896 107.789 139.249 1.00 0.00 ? 160 G A C5     1  
ATOM 4461   C C6     . G A 1 139 ? 106.058 107.588 138.126 1.00 0.00 ? 160 G A C6     1  
ATOM 4462   O O6     . G A 1 139 ? 106.251 107.903 136.952 1.00 0.00 ? 160 G A O6     1  
ATOM 4463   N N1     . G A 1 139 ? 104.885 106.940 138.477 1.00 0.00 ? 160 G A N1     1  
ATOM 4464   C C2     . G A 1 139 ? 104.562 106.536 139.741 1.00 0.00 ? 160 G A C2     1  
ATOM 4465   N N2     . G A 1 139 ? 103.385 105.929 139.888 1.00 0.00 ? 160 G A N2     1  
ATOM 4466   N N3     . G A 1 139 ? 105.333 106.710 140.788 1.00 0.00 ? 160 G A N3     1  
ATOM 4467   C C4     . G A 1 139 ? 106.473 107.340 140.474 1.00 0.00 ? 160 G A C4     1  
ATOM 4468   H "H5'"  . G A 1 139 ? 110.870 108.638 144.247 1.00 0.00 ? 160 G A "H5'"  1  
ATOM 4469   H "H5''" . G A 1 139 ? 111.462 107.157 144.270 1.00 0.00 ? 160 G A "H5''" 1  
ATOM 4470   H "H4'"  . G A 1 139 ? 109.225 107.152 145.011 1.00 0.00 ? 160 G A "H4'"  1  
ATOM 4471   H "H3'"  . G A 1 139 ? 109.641 105.883 142.476 1.00 0.00 ? 160 G A "H3'"  1  
ATOM 4472   H "H2'"  . G A 1 139 ? 107.420 105.332 142.340 1.00 0.00 ? 160 G A "H2'"  1  
ATOM 4473   H "HO2'" . G A 1 139 ? 105.949 105.585 143.991 1.00 0.00 ? 160 G A "HO2'" 1  
ATOM 4474   H "H1'"  . G A 1 139 ? 106.590 107.660 143.151 1.00 0.00 ? 160 G A "H1'"  1  
ATOM 4475   H H8     . G A 1 139 ? 109.273 108.630 141.006 1.00 0.00 ? 160 G A H8     1  
ATOM 4476   H H1     . G A 1 139 ? 104.239 106.759 137.761 1.00 0.00 ? 160 G A H1     1  
ATOM 4477   H H21    . G A 1 139 ? 102.801 105.793 139.112 1.00 0.00 ? 160 G A H21    1  
ATOM 4478   H H22    . G A 1 139 ? 103.102 105.618 140.773 1.00 0.00 ? 160 G A H22    1  
ATOM 4479   P P      . A A 1 140 ? 110.473 103.597 143.398 1.00 0.00 ? 161 A A P      1  
ATOM 4480   O OP1    . A A 1 140 ? 111.287 102.920 144.455 1.00 0.00 ? 161 A A OP1    1  
ATOM 4481   O OP2    . A A 1 140 ? 111.153 104.185 142.208 1.00 0.00 ? 161 A A OP2    1  
ATOM 4482   O "O5'"  . A A 1 140 ? 109.356 102.593 142.863 1.00 0.00 ? 161 A A "O5'"  1  
ATOM 4483   C "C5'"  . A A 1 140 ? 108.386 102.079 143.762 1.00 0.00 ? 161 A A "C5'"  1  
ATOM 4484   C "C4'"  . A A 1 140 ? 107.068 101.894 143.067 1.00 0.00 ? 161 A A "C4'"  1  
ATOM 4485   O "O4'"  . A A 1 140 ? 106.677 103.123 142.415 1.00 0.00 ? 161 A A "O4'"  1  
ATOM 4486   C "C3'"  . A A 1 140 ? 107.072 100.907 141.927 1.00 0.00 ? 161 A A "C3'"  1  
ATOM 4487   O "O3'"  . A A 1 140 ? 106.907 99.602  142.412 1.00 0.00 ? 161 A A "O3'"  1  
ATOM 4488   C "C2'"  . A A 1 140 ? 105.826 101.295 141.151 1.00 0.00 ? 161 A A "C2'"  1  
ATOM 4489   O "O2'"  . A A 1 140 ? 104.654 100.697 141.667 1.00 0.00 ? 161 A A "O2'"  1  
ATOM 4490   C "C1'"  . A A 1 140 ? 105.813 102.813 141.333 1.00 0.00 ? 161 A A "C1'"  1  
ATOM 4491   N N9     . A A 1 140 ? 106.313 103.455 140.127 1.00 0.00 ? 161 A A N9     1  
ATOM 4492   C C8     . A A 1 140 ? 107.500 104.105 139.902 1.00 0.00 ? 161 A A C8     1  
ATOM 4493   N N7     . A A 1 140 ? 107.622 104.562 138.681 1.00 0.00 ? 161 A A N7     1  
ATOM 4494   C C5     . A A 1 140 ? 106.436 104.180 138.065 1.00 0.00 ? 161 A A C5     1  
ATOM 4495   C C6     . A A 1 140 ? 105.947 104.352 136.768 1.00 0.00 ? 161 A A C6     1  
ATOM 4496   N N6     . A A 1 140 ? 106.618 104.977 135.810 1.00 0.00 ? 161 A A N6     1  
ATOM 4497   N N1     . A A 1 140 ? 104.729 103.852 136.481 1.00 0.00 ? 161 A A N1     1  
ATOM 4498   C C2     . A A 1 140 ? 104.063 103.216 137.443 1.00 0.00 ? 161 A A C2     1  
ATOM 4499   N N3     . A A 1 140 ? 104.417 102.985 138.696 1.00 0.00 ? 161 A A N3     1  
ATOM 4500   C C4     . A A 1 140 ? 105.628 103.501 138.945 1.00 0.00 ? 161 A A C4     1  
ATOM 4501   H "H5'"  . A A 1 140 ? 108.277 102.706 144.508 1.00 0.00 ? 161 A A "H5'"  1  
ATOM 4502   H "H5''" . A A 1 140 ? 108.696 101.218 144.110 1.00 0.00 ? 161 A A "H5''" 1  
ATOM 4503   H "H4'"  . A A 1 140 ? 106.388 101.660 143.733 1.00 0.00 ? 161 A A "H4'"  1  
ATOM 4504   H "H3'"  . A A 1 140 ? 107.916 100.987 141.436 1.00 0.00 ? 161 A A "H3'"  1  
ATOM 4505   H "H2'"  . A A 1 140 ? 105.924 101.104 140.196 1.00 0.00 ? 161 A A "H2'"  1  
ATOM 4506   H "HO2'" . A A 1 140 ? 103.887 100.984 141.128 1.00 0.00 ? 161 A A "HO2'" 1  
ATOM 4507   H "H1'"  . A A 1 140 ? 104.899 103.109 141.530 1.00 0.00 ? 161 A A "H1'"  1  
ATOM 4508   H H8     . A A 1 140 ? 108.191 104.221 140.587 1.00 0.00 ? 161 A A H8     1  
ATOM 4509   H H61    . A A 1 140 ? 106.226 105.067 134.916 1.00 0.00 ? 161 A A H61    1  
ATOM 4510   H H62    . A A 1 140 ? 107.505 105.348 135.994 1.00 0.00 ? 161 A A H62    1  
ATOM 4511   H H2     . A A 1 140 ? 103.184 102.869 137.183 1.00 0.00 ? 161 A A H2     1  
ATOM 4512   P P      . U A 1 141 ? 107.312 98.385  141.474 1.00 0.00 ? 162 U A P      1  
ATOM 4513   O OP1    . U A 1 141 ? 107.084 97.123  142.220 1.00 0.00 ? 162 U A OP1    1  
ATOM 4514   O OP2    . U A 1 141 ? 108.676 98.723  140.968 1.00 0.00 ? 162 U A OP2    1  
ATOM 4515   O "O5'"  . U A 1 141 ? 106.267 98.465  140.287 1.00 0.00 ? 162 U A "O5'"  1  
ATOM 4516   C "C5'"  . U A 1 141 ? 104.945 98.065  140.508 1.00 0.00 ? 162 U A "C5'"  1  
ATOM 4517   C "C4'"  . U A 1 141 ? 104.215 98.014  139.207 1.00 0.00 ? 162 U A "C4'"  1  
ATOM 4518   O "O4'"  . U A 1 141 ? 104.144 99.354  138.651 1.00 0.00 ? 162 U A "O4'"  1  
ATOM 4519   C "C3'"  . U A 1 141 ? 104.907 97.217  138.123 1.00 0.00 ? 162 U A "C3'"  1  
ATOM 4520   O "O3'"  . U A 1 141 ? 104.628 95.838  138.229 1.00 0.00 ? 162 U A "O3'"  1  
ATOM 4521   C "C2'"  . U A 1 141 ? 104.270 97.806  136.880 1.00 0.00 ? 162 U A "C2'"  1  
ATOM 4522   O "O2'"  . U A 1 141 ? 102.969 97.286  136.682 1.00 0.00 ? 162 U A "O2'"  1  
ATOM 4523   C "C1'"  . U A 1 141 ? 104.250 99.293  137.241 1.00 0.00 ? 162 U A "C1'"  1  
ATOM 4524   N N1     . U A 1 141 ? 105.498 99.974  136.884 1.00 0.00 ? 162 U A N1     1  
ATOM 4525   C C2     . U A 1 141 ? 105.654 100.424 135.597 1.00 0.00 ? 162 U A C2     1  
ATOM 4526   O O2     . U A 1 141 ? 104.808 100.283 134.748 1.00 0.00 ? 162 U A O2     1  
ATOM 4527   N N3     . U A 1 141 ? 106.847 101.056 135.344 1.00 0.00 ? 162 U A N3     1  
ATOM 4528   C C4     . U A 1 141 ? 107.874 101.273 136.241 1.00 0.00 ? 162 U A C4     1  
ATOM 4529   O O4     . U A 1 141 ? 108.908 101.847 135.873 1.00 0.00 ? 162 U A O4     1  
ATOM 4530   C C5     . U A 1 141 ? 107.626 100.769 137.551 1.00 0.00 ? 162 U A C5     1  
ATOM 4531   C C6     . U A 1 141 ? 106.476 100.151 137.820 1.00 0.00 ? 162 U A C6     1  
ATOM 4532   H "H5'"  . U A 1 141 ? 104.513 98.706  141.111 1.00 0.00 ? 162 U A "H5'"  1  
ATOM 4533   H "H5''" . U A 1 141 ? 104.945 97.180  140.929 1.00 0.00 ? 162 U A "H5''" 1  
ATOM 4534   H "H4'"  . U A 1 141 ? 103.308 97.681  139.367 1.00 0.00 ? 162 U A "H4'"  1  
ATOM 4535   H "H3'"  . U A 1 141 ? 105.873 97.367  138.180 1.00 0.00 ? 162 U A "H3'"  1  
ATOM 4536   H "H2'"  . U A 1 141 ? 104.836 97.679  136.090 1.00 0.00 ? 162 U A "H2'"  1  
ATOM 4537   H "HO2'" . U A 1 141 ? 102.585 97.684  135.873 1.00 0.00 ? 162 U A "HO2'" 1  
ATOM 4538   H "H1'"  . U A 1 141 ? 103.502 99.726  136.779 1.00 0.00 ? 162 U A "H1'"  1  
ATOM 4539   H H3     . U A 1 141 ? 106.982 101.384 134.431 1.00 0.00 ? 162 U A H3     1  
ATOM 4540   H H5     . U A 1 141 ? 108.297 100.877 138.257 1.00 0.00 ? 162 U A H5     1  
ATOM 4541   H H6     . U A 1 141 ? 106.337 99.818  138.730 1.00 0.00 ? 162 U A H6     1  
ATOM 4542   P P      . G A 1 142 ? 105.718 94.772  137.736 1.00 0.00 ? 163 G A P      1  
ATOM 4543   O OP1    . G A 1 142 ? 105.062 93.448  137.869 1.00 0.00 ? 163 G A OP1    1  
ATOM 4544   O OP2    . G A 1 142 ? 106.988 95.082  138.497 1.00 0.00 ? 163 G A OP2    1  
ATOM 4545   O "O5'"  . G A 1 142 ? 106.020 95.017  136.188 1.00 0.00 ? 163 G A "O5'"  1  
ATOM 4546   C "C5'"  . G A 1 142 ? 105.006 94.864  135.197 1.00 0.00 ? 163 G A "C5'"  1  
ATOM 4547   C "C4'"  . G A 1 142 ? 105.475 95.445  133.881 1.00 0.00 ? 163 G A "C4'"  1  
ATOM 4548   O "O4'"  . G A 1 142 ? 105.958 96.785  134.107 1.00 0.00 ? 163 G A "O4'"  1  
ATOM 4549   C "C3'"  . G A 1 142 ? 106.616 94.709  133.196 1.00 0.00 ? 163 G A "C3'"  1  
ATOM 4550   O "O3'"  . G A 1 142 ? 106.038 93.799  132.271 1.00 0.00 ? 163 G A "O3'"  1  
ATOM 4551   C "C2'"  . G A 1 142 ? 107.293 95.819  132.404 1.00 0.00 ? 163 G A "C2'"  1  
ATOM 4552   O "O2'"  . G A 1 142 ? 106.578 96.071  131.206 1.00 0.00 ? 163 G A "O2'"  1  
ATOM 4553   C "C1'"  . G A 1 142 ? 107.115 97.019  133.335 1.00 0.00 ? 163 G A "C1'"  1  
ATOM 4554   N N9     . G A 1 142 ? 108.197 97.288  134.267 1.00 0.00 ? 163 G A N9     1  
ATOM 4555   C C8     . G A 1 142 ? 108.334 96.766  135.539 1.00 0.00 ? 163 G A C8     1  
ATOM 4556   N N7     . G A 1 142 ? 109.325 97.291  136.211 1.00 0.00 ? 163 G A N7     1  
ATOM 4557   C C5     . G A 1 142 ? 109.901 98.191  135.314 1.00 0.00 ? 163 G A C5     1  
ATOM 4558   C C6     . G A 1 142 ? 111.021 99.068  135.474 1.00 0.00 ? 163 G A C6     1  
ATOM 4559   O O6     . G A 1 142 ? 111.738 99.236  136.476 1.00 0.00 ? 163 G A O6     1  
ATOM 4560   N N1     . G A 1 142 ? 111.272 99.787  134.304 1.00 0.00 ? 163 G A N1     1  
ATOM 4561   C C2     . G A 1 142 ? 110.549 99.683  133.135 1.00 0.00 ? 163 G A C2     1  
ATOM 4562   N N2     . G A 1 142 ? 110.967 100.461 132.128 1.00 0.00 ? 163 G A N2     1  
ATOM 4563   N N3     . G A 1 142 ? 109.500 98.878  132.970 1.00 0.00 ? 163 G A N3     1  
ATOM 4564   C C4     . G A 1 142 ? 109.233 98.170  134.093 1.00 0.00 ? 163 G A C4     1  
ATOM 4565   H "H5'"  . G A 1 142 ? 104.195 95.326  135.494 1.00 0.00 ? 163 G A "H5'"  1  
ATOM 4566   H "H5''" . G A 1 142 ? 104.807 93.910  135.087 1.00 0.00 ? 163 G A "H5''" 1  
ATOM 4567   H "H4'"  . G A 1 142 ? 104.717 95.474  133.259 1.00 0.00 ? 163 G A "H4'"  1  
ATOM 4568   H "H3'"  . G A 1 142 ? 107.155 94.250  133.872 1.00 0.00 ? 163 G A "H3'"  1  
ATOM 4569   H "H2'"  . G A 1 142 ? 108.237 95.618  132.239 1.00 0.00 ? 163 G A "H2'"  1  
ATOM 4570   H "HO2'" . G A 1 142 ? 106.020 95.292  130.998 1.00 0.00 ? 163 G A "HO2'" 1  
ATOM 4571   H "H1'"  . G A 1 142 ? 106.987 97.830  132.800 1.00 0.00 ? 163 G A "H1'"  1  
ATOM 4572   H H8     . G A 1 142 ? 107.731 96.088  135.911 1.00 0.00 ? 163 G A H8     1  
ATOM 4573   H H1     . G A 1 142 ? 112.026 100.414 134.320 1.00 0.00 ? 163 G A H1     1  
ATOM 4574   H H21    . G A 1 142 ? 111.738 101.053 132.251 1.00 0.00 ? 163 G A H21    1  
ATOM 4575   H H22    . G A 1 142 ? 110.501 100.438 131.266 1.00 0.00 ? 163 G A H22    1  
ATOM 4576   P P      . G A 1 143 ? 106.848 92.503  131.804 1.00 0.00 ? 164 G A P      1  
ATOM 4577   O OP1    . G A 1 143 ? 105.926 91.788  130.886 1.00 0.00 ? 164 G A OP1    1  
ATOM 4578   O OP2    . G A 1 143 ? 107.406 91.814  132.988 1.00 0.00 ? 164 G A OP2    1  
ATOM 4579   O "O5'"  . G A 1 143 ? 108.065 93.056  130.962 1.00 0.00 ? 164 G A "O5'"  1  
ATOM 4580   C "C5'"  . G A 1 143 ? 107.877 93.557  129.652 1.00 0.00 ? 164 G A "C5'"  1  
ATOM 4581   C "C4'"  . G A 1 143 ? 109.204 93.939  129.106 1.00 0.00 ? 164 G A "C4'"  1  
ATOM 4582   O "O4'"  . G A 1 143 ? 109.700 95.003  129.932 1.00 0.00 ? 164 G A "O4'"  1  
ATOM 4583   C "C3'"  . G A 1 143 ? 110.182 92.779  129.198 1.00 0.00 ? 164 G A "C3'"  1  
ATOM 4584   O "O3'"  . G A 1 143 ? 110.209 92.195  127.876 1.00 0.00 ? 164 G A "O3'"  1  
ATOM 4585   C "C2'"  . G A 1 143 ? 111.467 93.408  129.725 1.00 0.00 ? 164 G A "C2'"  1  
ATOM 4586   O "O2'"  . G A 1 143 ? 112.354 93.790  128.703 1.00 0.00 ? 164 G A "O2'"  1  
ATOM 4587   C "C1'"  . G A 1 143 ? 110.957 94.668  130.441 1.00 0.00 ? 164 G A "C1'"  1  
ATOM 4588   N N9     . G A 1 143 ? 110.828 94.680  131.891 1.00 0.00 ? 164 G A N9     1  
ATOM 4589   C C8     . G A 1 143 ? 109.914 93.996  132.645 1.00 0.00 ? 164 G A C8     1  
ATOM 4590   N N7     . G A 1 143 ? 109.982 94.282  133.916 1.00 0.00 ? 164 G A N7     1  
ATOM 4591   C C5     . G A 1 143 ? 111.029 95.187  134.008 1.00 0.00 ? 164 G A C5     1  
ATOM 4592   C C6     . G A 1 143 ? 111.584 95.855  135.145 1.00 0.00 ? 164 G A C6     1  
ATOM 4593   O O6     . G A 1 143 ? 111.253 95.775  136.353 1.00 0.00 ? 164 G A O6     1  
ATOM 4594   N N1     . G A 1 143 ? 112.620 96.700  134.770 1.00 0.00 ? 164 G A N1     1  
ATOM 4595   C C2     . G A 1 143 ? 113.061 96.887  133.479 1.00 0.00 ? 164 G A C2     1  
ATOM 4596   N N2     . G A 1 143 ? 114.050 97.779  133.313 1.00 0.00 ? 164 G A N2     1  
ATOM 4597   N N3     . G A 1 143 ? 112.570 96.258  132.431 1.00 0.00 ? 164 G A N3     1  
ATOM 4598   C C4     . G A 1 143 ? 111.564 95.435  132.764 1.00 0.00 ? 164 G A C4     1  
ATOM 4599   H "H5'"  . G A 1 143 ? 107.280 94.333  129.689 1.00 0.00 ? 164 G A "H5'"  1  
ATOM 4600   H "H5''" . G A 1 143 ? 107.462 92.860  129.102 1.00 0.00 ? 164 G A "H5''" 1  
ATOM 4601   H "H4'"  . G A 1 143 ? 109.089 94.247  128.182 1.00 0.00 ? 164 G A "H4'"  1  
ATOM 4602   H "H3'"  . G A 1 143 ? 109.874 92.152  129.885 1.00 0.00 ? 164 G A "H3'"  1  
ATOM 4603   H "H2'"  . G A 1 143 ? 111.914 92.822  130.372 1.00 0.00 ? 164 G A "H2'"  1  
ATOM 4604   H "HO2'" . G A 1 143 ? 112.128 93.302  127.884 1.00 0.00 ? 164 G A "HO2'" 1  
ATOM 4605   H "H1'"  . G A 1 143 ? 111.542 95.424  130.229 1.00 0.00 ? 164 G A "H1'"  1  
ATOM 4606   H H8     . G A 1 143 ? 109.260 93.372  132.267 1.00 0.00 ? 164 G A H8     1  
ATOM 4607   H H1     . G A 1 143 ? 113.071 97.201  135.481 1.00 0.00 ? 164 G A H1     1  
ATOM 4608   H H21    . G A 1 143 ? 114.422 98.252  134.085 1.00 0.00 ? 164 G A H21    1  
ATOM 4609   H H22    . G A 1 143 ? 114.401 97.959  132.415 1.00 0.00 ? 164 G A H22    1  
ATOM 4610   P P      . C A 1 144 ? 109.776 90.665  127.675 1.00 0.00 ? 165 C A P      1  
ATOM 4611   O OP1    . C A 1 144 ? 109.861 90.465  126.210 1.00 0.00 ? 165 C A OP1    1  
ATOM 4612   O OP2    . C A 1 144 ? 108.458 90.521  128.345 1.00 0.00 ? 165 C A OP2    1  
ATOM 4613   O "O5'"  . C A 1 144 ? 110.815 89.723  128.435 1.00 0.00 ? 165 C A "O5'"  1  
ATOM 4614   C "C5'"  . C A 1 144 ? 112.076 89.401  127.868 1.00 0.00 ? 165 C A "C5'"  1  
ATOM 4615   C "C4'"  . C A 1 144 ? 112.529 88.051  128.353 1.00 0.00 ? 165 C A "C4'"  1  
ATOM 4616   O "O4'"  . C A 1 144 ? 112.285 87.985  129.786 1.00 0.00 ? 165 C A "O4'"  1  
ATOM 4617   C "C3'"  . C A 1 144 ? 111.751 86.860  127.811 1.00 0.00 ? 165 C A "C3'"  1  
ATOM 4618   O "O3'"  . C A 1 144 ? 112.198 86.439  126.526 1.00 0.00 ? 165 C A "O3'"  1  
ATOM 4619   C "C2'"  . C A 1 144 ? 112.027 85.811  128.877 1.00 0.00 ? 165 C A "C2'"  1  
ATOM 4620   O "O2'"  . C A 1 144 ? 113.311 85.231  128.752 1.00 0.00 ? 165 C A "O2'"  1  
ATOM 4621   C "C1'"  . C A 1 144 ? 111.929 86.657  130.151 1.00 0.00 ? 165 C A "C1'"  1  
ATOM 4622   N N1     . C A 1 144 ? 110.546 86.666  130.660 1.00 0.00 ? 165 C A N1     1  
ATOM 4623   C C2     . C A 1 144 ? 110.183 85.758  131.661 1.00 0.00 ? 165 C A C2     1  
ATOM 4624   O O2     . C A 1 144 ? 111.042 85.021  132.138 1.00 0.00 ? 165 C A O2     1  
ATOM 4625   N N3     . C A 1 144 ? 108.905 85.717  132.085 1.00 0.00 ? 165 C A N3     1  
ATOM 4626   C C4     . C A 1 144 ? 108.000 86.540  131.556 1.00 0.00 ? 165 C A C4     1  
ATOM 4627   N N4     . C A 1 144 ? 106.741 86.443  131.991 1.00 0.00 ? 165 C A N4     1  
ATOM 4628   C C5     . C A 1 144 ? 108.344 87.492  130.557 1.00 0.00 ? 165 C A C5     1  
ATOM 4629   C C6     . C A 1 144 ? 109.618 87.524  130.142 1.00 0.00 ? 165 C A C6     1  
ATOM 4630   H "H5'"  . C A 1 144 ? 112.727 90.085  128.129 1.00 0.00 ? 165 C A "H5'"  1  
ATOM 4631   H "H5''" . C A 1 144 ? 111.994 89.393  126.891 1.00 0.00 ? 165 C A "H5''" 1  
ATOM 4632   H "H4'"  . C A 1 144 ? 113.487 87.957  128.175 1.00 0.00 ? 165 C A "H4'"  1  
ATOM 4633   H "H3'"  . C A 1 144 ? 110.800 87.092  127.759 1.00 0.00 ? 165 C A "H3'"  1  
ATOM 4634   H "H2'"  . C A 1 144 ? 111.333 85.120  128.888 1.00 0.00 ? 165 C A "H2'"  1  
ATOM 4635   H "HO2'" . C A 1 144 ? 113.431 84.567  129.462 1.00 0.00 ? 165 C A "HO2'" 1  
ATOM 4636   H "H1'"  . C A 1 144 ? 112.539 86.295  130.825 1.00 0.00 ? 165 C A "H1'"  1  
ATOM 4637   H H41    . C A 1 144 ? 106.508 85.782  132.675 1.00 0.00 ? 165 C A H41    1  
ATOM 4638   H H42    . C A 1 144 ? 106.049 87.033  131.623 1.00 0.00 ? 165 C A H42    1  
ATOM 4639   H H5     . C A 1 144 ? 107.675 88.104  130.187 1.00 0.00 ? 165 C A H5     1  
ATOM 4640   H H6     . C A 1 144 ? 109.874 88.171  129.456 1.00 0.00 ? 165 C A H6     1  
ATOM 4641   P P      . C A 1 145 ? 111.139 85.824  125.472 1.00 0.00 ? 166 C A P      1  
ATOM 4642   O OP1    . C A 1 145 ? 111.806 85.809  124.148 1.00 0.00 ? 166 C A OP1    1  
ATOM 4643   O OP2    . C A 1 145 ? 109.847 86.528  125.635 1.00 0.00 ? 166 C A OP2    1  
ATOM 4644   O "O5'"  . C A 1 145 ? 110.912 84.325  125.960 1.00 0.00 ? 166 C A "O5'"  1  
ATOM 4645   C "C5'"  . C A 1 145 ? 111.976 83.382  125.905 1.00 0.00 ? 166 C A "C5'"  1  
ATOM 4646   C "C4'"  . C A 1 145 ? 111.572 82.068  126.547 1.00 0.00 ? 166 C A "C4'"  1  
ATOM 4647   O "O4'"  . C A 1 145 ? 111.419 82.228  127.979 1.00 0.00 ? 166 C A "O4'"  1  
ATOM 4648   C "C3'"  . C A 1 145 ? 110.258 81.461  126.095 1.00 0.00 ? 166 C A "C3'"  1  
ATOM 4649   O "O3'"  . C A 1 145 ? 110.428 80.665  124.943 1.00 0.00 ? 166 C A "O3'"  1  
ATOM 4650   C "C2'"  . C A 1 145 ? 109.923 80.535  127.243 1.00 0.00 ? 166 C A "C2'"  1  
ATOM 4651   O "O2'"  . C A 1 145 ? 110.627 79.317  127.120 1.00 0.00 ? 166 C A "O2'"  1  
ATOM 4652   C "C1'"  . C A 1 145 ? 110.402 81.359  128.439 1.00 0.00 ? 166 C A "C1'"  1  
ATOM 4653   N N1     . C A 1 145 ? 109.320 82.188  128.960 1.00 0.00 ? 166 C A N1     1  
ATOM 4654   C C2     . C A 1 145 ? 108.446 81.646  129.902 1.00 0.00 ? 166 C A C2     1  
ATOM 4655   O O2     . C A 1 145 ? 108.601 80.463  130.263 1.00 0.00 ? 166 C A O2     1  
ATOM 4656   N N3     . C A 1 145 ? 107.448 82.410  130.386 1.00 0.00 ? 166 C A N3     1  
ATOM 4657   C C4     . C A 1 145 ? 107.295 83.659  129.951 1.00 0.00 ? 166 C A C4     1  
ATOM 4658   N N4     . C A 1 145 ? 106.274 84.362  130.437 1.00 0.00 ? 166 C A N4     1  
ATOM 4659   C C5     . C A 1 145 ? 108.172 84.237  128.992 1.00 0.00 ? 166 C A C5     1  
ATOM 4660   C C6     . C A 1 145 ? 109.162 83.474  128.528 1.00 0.00 ? 166 C A C6     1  
ATOM 4661   H "H5'"  . C A 1 145 ? 112.753 83.749  126.376 1.00 0.00 ? 166 C A "H5'"  1  
ATOM 4662   H "H5''" . C A 1 145 ? 112.216 83.225  124.967 1.00 0.00 ? 166 C A "H5''" 1  
ATOM 4663   H "H4'"  . C A 1 145 ? 112.275 81.408  126.380 1.00 0.00 ? 166 C A "H4'"  1  
ATOM 4664   H "H3'"  . C A 1 145 ? 109.616 82.177  125.913 1.00 0.00 ? 166 C A "H3'"  1  
ATOM 4665   H "H2'"  . C A 1 145 ? 108.955 80.396  127.321 1.00 0.00 ? 166 C A "H2'"  1  
ATOM 4666   H "HO2'" . C A 1 145 ? 110.395 78.735  127.872 1.00 0.00 ? 166 C A "HO2'" 1  
ATOM 4667   H "H1'"  . C A 1 145 ? 110.732 80.753  129.135 1.00 0.00 ? 166 C A "H1'"  1  
ATOM 4668   H H41    . C A 1 145 ? 105.667 83.957  131.091 1.00 0.00 ? 166 C A H41    1  
ATOM 4669   H H42    . C A 1 145 ? 106.130 85.285  130.140 1.00 0.00 ? 166 C A H42    1  
ATOM 4670   H H5     . C A 1 145 ? 108.053 85.161  128.687 1.00 0.00 ? 166 C A H5     1  
ATOM 4671   H H6     . C A 1 145 ? 109.778 83.850  127.867 1.00 0.00 ? 166 C A H6     1  
ATOM 4672   P P      . U A 1 146 ? 109.160 79.917  124.298 1.00 0.00 ? 167 U A P      1  
ATOM 4673   O OP1    . U A 1 146 ? 108.600 78.984  125.309 1.00 0.00 ? 167 U A OP1    1  
ATOM 4674   O OP2    . U A 1 146 ? 109.556 79.398  122.965 1.00 0.00 ? 167 U A OP2    1  
ATOM 4675   O "O5'"  . U A 1 146 ? 108.115 81.096  124.084 1.00 0.00 ? 167 U A "O5'"  1  
ATOM 4676   C "C5'"  . U A 1 146 ? 108.179 81.946  122.938 1.00 0.00 ? 167 U A "C5'"  1  
ATOM 4677   C "C4'"  . U A 1 146 ? 107.408 83.219  123.200 1.00 0.00 ? 167 U A "C4'"  1  
ATOM 4678   O "O4'"  . U A 1 146 ? 106.200 82.841  123.908 1.00 0.00 ? 167 U A "O4'"  1  
ATOM 4679   C "C3'"  . U A 1 146 ? 108.093 84.244  124.099 1.00 0.00 ? 167 U A "C3'"  1  
ATOM 4680   O "O3'"  . U A 1 146 ? 108.983 85.092  123.354 1.00 0.00 ? 167 U A "O3'"  1  
ATOM 4681   C "C2'"  . U A 1 146 ? 106.944 84.906  124.864 1.00 0.00 ? 167 U A "C2'"  1  
ATOM 4682   O "O2'"  . U A 1 146 ? 106.276 85.976  124.240 1.00 0.00 ? 167 U A "O2'"  1  
ATOM 4683   C "C1'"  . U A 1 146 ? 105.932 83.768  124.945 1.00 0.00 ? 167 U A "C1'"  1  
ATOM 4684   N N1     . U A 1 146 ? 105.841 83.035  126.211 1.00 0.00 ? 167 U A N1     1  
ATOM 4685   C C2     . U A 1 146 ? 104.940 83.498  127.150 1.00 0.00 ? 167 U A C2     1  
ATOM 4686   O O2     . U A 1 146 ? 104.301 84.528  127.003 1.00 0.00 ? 167 U A O2     1  
ATOM 4687   N N3     . U A 1 146 ? 104.818 82.716  128.264 1.00 0.00 ? 167 U A N3     1  
ATOM 4688   C C4     . U A 1 146 ? 105.510 81.556  128.536 1.00 0.00 ? 167 U A C4     1  
ATOM 4689   O O4     . U A 1 146 ? 105.250 80.924  129.559 1.00 0.00 ? 167 U A O4     1  
ATOM 4690   C C5     . U A 1 146 ? 106.465 81.177  127.539 1.00 0.00 ? 167 U A C5     1  
ATOM 4691   C C6     . U A 1 146 ? 106.594 81.914  126.441 1.00 0.00 ? 167 U A C6     1  
ATOM 4692   H "H5'"  . U A 1 146 ? 107.794 81.473  122.169 1.00 0.00 ? 167 U A "H5'"  1  
ATOM 4693   H "H5''" . U A 1 146 ? 109.117 82.155  122.748 1.00 0.00 ? 167 U A "H5''" 1  
ATOM 4694   H "H4'"  . U A 1 146 ? 107.183 83.635  122.342 1.00 0.00 ? 167 U A "H4'"  1  
ATOM 4695   H "H3'"  . U A 1 146 ? 108.589 83.775  124.802 1.00 0.00 ? 167 U A "H3'"  1  
ATOM 4696   H "H2'"  . U A 1 146 ? 107.228 85.205  125.753 1.00 0.00 ? 167 U A "H2'"  1  
ATOM 4697   H "HO2'" . U A 1 146 ? 105.569 86.302  124.837 1.00 0.00 ? 167 U A "HO2'" 1  
ATOM 4698   H "H1'"  . U A 1 146 ? 105.036 84.117  124.757 1.00 0.00 ? 167 U A "H1'"  1  
ATOM 4699   H H3     . U A 1 146 ? 104.173 83.014  128.937 1.00 0.00 ? 167 U A H3     1  
ATOM 4700   H H5     . U A 1 146 ? 107.019 80.379  127.664 1.00 0.00 ? 167 U A H5     1  
ATOM 4701   H H6     . U A 1 146 ? 107.256 81.631  125.776 1.00 0.00 ? 167 U A H6     1  
ATOM 4702   P P      . U A 1 147 ? 108.862 85.185  121.754 1.00 0.00 ? 168 U A P      1  
ATOM 4703   O OP1    . U A 1 147 ? 109.118 83.834  121.193 1.00 0.00 ? 168 U A OP1    1  
ATOM 4704   O OP2    . U A 1 147 ? 109.681 86.337  121.298 1.00 0.00 ? 168 U A OP2    1  
ATOM 4705   O "O5'"  . U A 1 147 ? 107.329 85.541  121.504 1.00 0.00 ? 168 U A "O5'"  1  
ATOM 4706   C "C5'"  . U A 1 147 ? 106.722 85.306  120.243 1.00 0.00 ? 168 U A "C5'"  1  
ATOM 4707   C "C4'"  . U A 1 147 ? 107.210 86.281  119.200 1.00 0.00 ? 168 U A "C4'"  1  
ATOM 4708   O "O4'"  . U A 1 147 ? 108.476 86.848  119.598 1.00 0.00 ? 168 U A "O4'"  1  
ATOM 4709   C "C3'"  . U A 1 147 ? 107.540 85.695  117.836 1.00 0.00 ? 168 U A "C3'"  1  
ATOM 4710   O "O3'"  . U A 1 147 ? 107.507 86.657  116.797 1.00 0.00 ? 168 U A "O3'"  1  
ATOM 4711   C "C2'"  . U A 1 147 ? 108.981 85.232  118.047 1.00 0.00 ? 168 U A "C2'"  1  
ATOM 4712   O "O2'"  . U A 1 147 ? 109.646 85.039  116.807 1.00 0.00 ? 168 U A "O2'"  1  
ATOM 4713   C "C1'"  . U A 1 147 ? 109.518 86.480  118.749 1.00 0.00 ? 168 U A "C1'"  1  
ATOM 4714   N N1     . U A 1 147 ? 110.747 86.201  119.531 1.00 0.00 ? 168 U A N1     1  
ATOM 4715   C C2     . U A 1 147 ? 111.646 87.240  119.685 1.00 0.00 ? 168 U A C2     1  
ATOM 4716   O O2     . U A 1 147 ? 111.468 88.350  119.213 1.00 0.00 ? 168 U A O2     1  
ATOM 4717   N N3     . U A 1 147 ? 112.768 86.936  120.416 1.00 0.00 ? 168 U A N3     1  
ATOM 4718   C C4     . U A 1 147 ? 113.079 85.725  120.997 1.00 0.00 ? 168 U A C4     1  
ATOM 4719   O O4     . U A 1 147 ? 114.133 85.609  121.625 1.00 0.00 ? 168 U A O4     1  
ATOM 4720   C C5     . U A 1 147 ? 112.104 84.697  120.797 1.00 0.00 ? 168 U A C5     1  
ATOM 4721   C C6     . U A 1 147 ? 111.001 84.967  120.090 1.00 0.00 ? 168 U A C6     1  
ATOM 4722   H "H5'"  . U A 1 147 ? 105.751 85.396  120.334 1.00 0.00 ? 168 U A "H5'"  1  
ATOM 4723   H "H5''" . U A 1 147 ? 106.933 84.395  119.950 1.00 0.00 ? 168 U A "H5''" 1  
ATOM 4724   H "H4'"  . U A 1 147 ? 106.556 87.005  119.114 1.00 0.00 ? 168 U A "H4'"  1  
ATOM 4725   H "H3'"  . U A 1 147 ? 106.967 84.917  117.672 1.00 0.00 ? 168 U A "H3'"  1  
ATOM 4726   H "H2'"  . U A 1 147 ? 109.023 84.431  118.609 1.00 0.00 ? 168 U A "H2'"  1  
ATOM 4727   H "HO2'" . U A 1 147 ? 110.558 84.722  116.980 1.00 0.00 ? 168 U A "HO2'" 1  
ATOM 4728   H "H1'"  . U A 1 147 ? 109.709 87.170  118.079 1.00 0.00 ? 168 U A "H1'"  1  
ATOM 4729   H H3     . U A 1 147 ? 113.419 87.658  120.537 1.00 0.00 ? 168 U A H3     1  
ATOM 4730   H H5     . U A 1 147 ? 112.243 83.804  121.176 1.00 0.00 ? 168 U A H5     1  
ATOM 4731   H H6     . U A 1 147 ? 110.350 84.246  119.966 1.00 0.00 ? 168 U A H6     1  
ATOM 4732   P P      . G A 1 148 ? 106.480 86.476  115.580 1.00 0.00 ? 169 G A P      1  
ATOM 4733   O OP1    . G A 1 148 ? 106.411 85.039  115.210 1.00 0.00 ? 169 G A OP1    1  
ATOM 4734   O OP2    . G A 1 148 ? 106.974 87.466  114.590 1.00 0.00 ? 169 G A OP2    1  
ATOM 4735   O "O5'"  . G A 1 148 ? 105.028 86.934  116.052 1.00 0.00 ? 169 G A "O5'"  1  
ATOM 4736   C "C5'"  . G A 1 148 ? 104.865 87.994  116.982 1.00 0.00 ? 169 G A "C5'"  1  
ATOM 4737   C "C4'"  . G A 1 148 ? 103.416 88.393  117.117 1.00 0.00 ? 169 G A "C4'"  1  
ATOM 4738   O "O4'"  . G A 1 148 ? 102.595 87.560  116.258 1.00 0.00 ? 169 G A "O4'"  1  
ATOM 4739   C "C3'"  . G A 1 148 ? 102.802 88.221  118.498 1.00 0.00 ? 169 G A "C3'"  1  
ATOM 4740   O "O3'"  . G A 1 148 ? 103.105 89.290  119.378 1.00 0.00 ? 169 G A "O3'"  1  
ATOM 4741   C "C2'"  . G A 1 148 ? 101.318 88.088  118.187 1.00 0.00 ? 169 G A "C2'"  1  
ATOM 4742   O "O2'"  . G A 1 148 ? 100.733 89.353  117.913 1.00 0.00 ? 169 G A "O2'"  1  
ATOM 4743   C "C1'"  . G A 1 148 ? 101.349 87.266  116.899 1.00 0.00 ? 169 G A "C1'"  1  
ATOM 4744   N N9     . G A 1 148 ? 101.229 85.817  117.158 1.00 0.00 ? 169 G A N9     1  
ATOM 4745   C C8     . G A 1 148 ? 102.222 84.873  117.074 1.00 0.00 ? 169 G A C8     1  
ATOM 4746   N N7     . G A 1 148 ? 101.810 83.669  117.365 1.00 0.00 ? 169 G A N7     1  
ATOM 4747   C C5     . G A 1 148 ? 100.465 83.827  117.660 1.00 0.00 ? 169 G A C5     1  
ATOM 4748   C C6     . G A 1 148 ? 99.489  82.872  118.049 1.00 0.00 ? 169 G A C6     1  
ATOM 4749   O O6     . G A 1 148 ? 99.626  81.655  118.211 1.00 0.00 ? 169 G A O6     1  
ATOM 4750   N N1     . G A 1 148 ? 98.247  83.463  118.250 1.00 0.00 ? 169 G A N1     1  
ATOM 4751   C C2     . G A 1 148 ? 97.975  84.801  118.099 1.00 0.00 ? 169 G A C2     1  
ATOM 4752   N N2     . G A 1 148 ? 96.712  85.184  118.341 1.00 0.00 ? 169 G A N2     1  
ATOM 4753   N N3     . G A 1 148 ? 98.874  85.702  117.740 1.00 0.00 ? 169 G A N3     1  
ATOM 4754   C C4     . G A 1 148 ? 100.089 85.149  117.538 1.00 0.00 ? 169 G A C4     1  
ATOM 4755   H "H5'"  . G A 1 148 ? 105.382 88.768  116.679 1.00 0.00 ? 169 G A "H5'"  1  
ATOM 4756   H "H5''" . G A 1 148 ? 105.200 87.707  117.858 1.00 0.00 ? 169 G A "H5''" 1  
ATOM 4757   H "H4'"  . G A 1 148 ? 103.317 89.329  116.842 1.00 0.00 ? 169 G A "H4'"  1  
ATOM 4758   H "H3'"  . G A 1 148 ? 103.124 87.381  118.891 1.00 0.00 ? 169 G A "H3'"  1  
ATOM 4759   H "H2'"  . G A 1 148 ? 100.841 87.616  118.901 1.00 0.00 ? 169 G A "H2'"  1  
ATOM 4760   H "HO2'" . G A 1 148 ? 99.768  89.239  117.790 1.00 0.00 ? 169 G A "HO2'" 1  
ATOM 4761   H "H1'"  . G A 1 148 ? 100.618 87.553  116.311 1.00 0.00 ? 169 G A "H1'"  1  
ATOM 4762   H H8     . G A 1 148 ? 103.146 85.079  116.820 1.00 0.00 ? 169 G A H8     1  
ATOM 4763   H H1     . G A 1 148 ? 97.508  82.877  118.521 1.00 0.00 ? 169 G A H1     1  
ATOM 4764   H H21    . G A 1 148 ? 96.039  84.523  118.607 1.00 0.00 ? 169 G A H21    1  
ATOM 4765   H H22    . G A 1 148 ? 96.459  86.126  118.250 1.00 0.00 ? 169 G A H22    1  
ATOM 4766   P P      . C A 1 149 ? 103.213 89.031  120.959 1.00 0.00 ? 170 C A P      1  
ATOM 4767   O OP1    . C A 1 149 ? 103.797 90.242  121.585 1.00 0.00 ? 170 C A OP1    1  
ATOM 4768   O OP2    . C A 1 149 ? 103.863 87.711  121.165 1.00 0.00 ? 170 C A OP2    1  
ATOM 4769   O "O5'"  . C A 1 149 ? 101.697 88.911  121.434 1.00 0.00 ? 170 C A "O5'"  1  
ATOM 4770   C "C5'"  . C A 1 149 ? 100.833 90.037  121.406 1.00 0.00 ? 170 C A "C5'"  1  
ATOM 4771   C "C4'"  . C A 1 149 ? 99.412  89.659  121.743 1.00 0.00 ? 170 C A "C4'"  1  
ATOM 4772   O "O4'"  . C A 1 149 ? 98.911  88.705  120.769 1.00 0.00 ? 170 C A "O4'"  1  
ATOM 4773   C "C3'"  . C A 1 149 ? 99.202  88.968  123.083 1.00 0.00 ? 170 C A "C3'"  1  
ATOM 4774   O "O3'"  . C A 1 149 ? 99.130  89.875  124.168 1.00 0.00 ? 170 C A "O3'"  1  
ATOM 4775   C "C2'"  . C A 1 149 ? 97.918  88.185  122.854 1.00 0.00 ? 170 C A "C2'"  1  
ATOM 4776   O "O2'"  . C A 1 149 ? 96.778  89.030  122.931 1.00 0.00 ? 170 C A "O2'"  1  
ATOM 4777   C "C1'"  . C A 1 149 ? 98.094  87.723  121.407 1.00 0.00 ? 170 C A "C1'"  1  
ATOM 4778   N N1     . C A 1 149 ? 98.726  86.382  121.316 1.00 0.00 ? 170 C A N1     1  
ATOM 4779   C C2     . C A 1 149 ? 97.929  85.255  121.548 1.00 0.00 ? 170 C A C2     1  
ATOM 4780   O O2     . C A 1 149 ? 96.728  85.407  121.822 1.00 0.00 ? 170 C A O2     1  
ATOM 4781   N N3     . C A 1 149 ? 98.481  84.022  121.472 1.00 0.00 ? 170 C A N3     1  
ATOM 4782   C C4     . C A 1 149 ? 99.774  83.886  121.178 1.00 0.00 ? 170 C A C4     1  
ATOM 4783   N N4     . C A 1 149 ? 100.274 82.649  121.113 1.00 0.00 ? 170 C A N4     1  
ATOM 4784   C C5     . C A 1 149 ? 100.610 85.012  120.937 1.00 0.00 ? 170 C A C5     1  
ATOM 4785   C C6     . C A 1 149 ? 100.053 86.227  121.015 1.00 0.00 ? 170 C A C6     1  
ATOM 4786   H "H5'"  . C A 1 149 ? 100.855 90.433  120.509 1.00 0.00 ? 170 C A "H5'"  1  
ATOM 4787   H "H5''" . C A 1 149 ? 101.151 90.700  122.055 1.00 0.00 ? 170 C A "H5''" 1  
ATOM 4788   H "H4'"  . C A 1 149 ? 98.856  90.466  121.712 1.00 0.00 ? 170 C A "H4'"  1  
ATOM 4789   H "H3'"  . C A 1 149 ? 99.937  88.339  123.237 1.00 0.00 ? 170 C A "H3'"  1  
ATOM 4790   H "H2'"  . C A 1 149 ? 97.846  87.423  123.467 1.00 0.00 ? 170 C A "H2'"  1  
ATOM 4791   H "HO2'" . C A 1 149 ? 97.019  89.845  123.419 1.00 0.00 ? 170 C A "HO2'" 1  
ATOM 4792   H "H1'"  . C A 1 149 ? 97.220  87.700  120.962 1.00 0.00 ? 170 C A "H1'"  1  
ATOM 4793   H H41    . C A 1 149 ? 99.696  81.877  121.281 1.00 0.00 ? 170 C A H41    1  
ATOM 4794   H H42    . C A 1 149 ? 101.221 82.517  120.899 1.00 0.00 ? 170 C A H42    1  
ATOM 4795   H H5     . C A 1 149 ? 101.560 84.902  120.720 1.00 0.00 ? 170 C A H5     1  
ATOM 4796   H H6     . C A 1 149 ? 100.612 87.014  120.853 1.00 0.00 ? 170 C A H6     1  
ATOM 4797   P P      . A A 1 150 ? 99.634  89.430  125.628 1.00 0.00 ? 171 A A P      1  
ATOM 4798   O OP1    . A A 1 150 ? 99.617  90.625  126.506 1.00 0.00 ? 171 A A OP1    1  
ATOM 4799   O OP2    . A A 1 150 ? 100.891 88.657  125.464 1.00 0.00 ? 171 A A OP2    1  
ATOM 4800   O "O5'"  . A A 1 150 ? 98.505  88.428  126.137 1.00 0.00 ? 171 A A "O5'"  1  
ATOM 4801   C "C5'"  . A A 1 150 ? 97.195  88.893  126.423 1.00 0.00 ? 171 A A "C5'"  1  
ATOM 4802   C "C4'"  . A A 1 150 ? 96.262  87.753  126.752 1.00 0.00 ? 171 A A "C4'"  1  
ATOM 4803   O "O4'"  . A A 1 150 ? 96.145  86.868  125.607 1.00 0.00 ? 171 A A "O4'"  1  
ATOM 4804   C "C3'"  . A A 1 150 ? 96.700  86.838  127.886 1.00 0.00 ? 171 A A "C3'"  1  
ATOM 4805   O "O3'"  . A A 1 150 ? 96.402  87.364  129.168 1.00 0.00 ? 171 A A "O3'"  1  
ATOM 4806   C "C2'"  . A A 1 150 ? 95.963  85.544  127.571 1.00 0.00 ? 171 A A "C2'"  1  
ATOM 4807   O "O2'"  . A A 1 150 ? 94.597  85.622  127.952 1.00 0.00 ? 171 A A "O2'"  1  
ATOM 4808   C "C1'"  . A A 1 150 ? 96.052  85.506  126.043 1.00 0.00 ? 171 A A "C1'"  1  
ATOM 4809   N N9     . A A 1 150 ? 97.210  84.722  125.573 1.00 0.00 ? 171 A A N9     1  
ATOM 4810   C C8     . A A 1 150 ? 98.386  85.188  125.040 1.00 0.00 ? 171 A A C8     1  
ATOM 4811   N N7     . A A 1 150 ? 99.229  84.243  124.713 1.00 0.00 ? 171 A A N7     1  
ATOM 4812   C C5     . A A 1 150 ? 98.566  83.071  125.052 1.00 0.00 ? 171 A A C5     1  
ATOM 4813   C C6     . A A 1 150 ? 98.925  81.715  124.952 1.00 0.00 ? 171 A A C6     1  
ATOM 4814   N N6     . A A 1 150 ? 100.093 81.294  124.462 1.00 0.00 ? 171 A A N6     1  
ATOM 4815   N N1     . A A 1 150 ? 98.034  80.796  125.380 1.00 0.00 ? 171 A A N1     1  
ATOM 4816   C C2     . A A 1 150 ? 96.862  81.218  125.872 1.00 0.00 ? 171 A A C2     1  
ATOM 4817   N N3     . A A 1 150 ? 96.410  82.462  126.016 1.00 0.00 ? 171 A A N3     1  
ATOM 4818   C C4     . A A 1 150 ? 97.322  83.353  125.583 1.00 0.00 ? 171 A A C4     1  
ATOM 4819   H "H5'"  . A A 1 150 ? 96.847  89.373  125.644 1.00 0.00 ? 171 A A "H5'"  1  
ATOM 4820   H "H5''" . A A 1 150 ? 97.231  89.505  127.188 1.00 0.00 ? 171 A A "H5''" 1  
ATOM 4821   H "H4'"  . A A 1 150 ? 95.377  88.118  126.963 1.00 0.00 ? 171 A A "H4'"  1  
ATOM 4822   H "H3'"  . A A 1 150 ? 97.665  86.682  127.818 1.00 0.00 ? 171 A A "H3'"  1  
ATOM 4823   H "H2'"  . A A 1 150 ? 96.410  84.768  127.973 1.00 0.00 ? 171 A A "H2'"  1  
ATOM 4824   H "HO2'" . A A 1 150 ? 94.327  84.768  128.345 1.00 0.00 ? 171 A A "HO2'" 1  
ATOM 4825   H "H1'"  . A A 1 150 ? 95.228  85.122  125.679 1.00 0.00 ? 171 A A "H1'"  1  
ATOM 4826   H H8     . A A 1 150 ? 98.577  86.142  124.919 1.00 0.00 ? 171 A A H8     1  
ATOM 4827   H H61    . A A 1 150 ? 100.288 80.334  124.417 1.00 0.00 ? 171 A A H61    1  
ATOM 4828   H H62    . A A 1 150 ? 100.755 81.943  124.145 1.00 0.00 ? 171 A A H62    1  
ATOM 4829   H H2     . A A 1 150 ? 96.250  80.513  126.168 1.00 0.00 ? 171 A A H2     1  
ATOM 4830   P P      . A A 1 151 ? 97.416  87.129  130.392 1.00 0.00 ? 172 A A P      1  
ATOM 4831   O OP1    . A A 1 151 ? 97.134  88.156  131.427 1.00 0.00 ? 172 A A OP1    1  
ATOM 4832   O OP2    . A A 1 151 ? 98.787  87.003  129.837 1.00 0.00 ? 172 A A OP2    1  
ATOM 4833   O "O5'"  . A A 1 151 ? 96.990  85.709  130.978 1.00 0.00 ? 172 A A "O5'"  1  
ATOM 4834   C "C5'"  . A A 1 151 ? 95.630  85.416  131.261 1.00 0.00 ? 172 A A "C5'"  1  
ATOM 4835   C "C4'"  . A A 1 151 ? 95.348  83.938  131.153 1.00 0.00 ? 172 A A "C4'"  1  
ATOM 4836   O "O4'"  . A A 1 151 ? 95.562  83.504  129.782 1.00 0.00 ? 172 A A "O4'"  1  
ATOM 4837   C "C3'"  . A A 1 151 ? 96.243  83.026  131.978 1.00 0.00 ? 172 A A "C3'"  1  
ATOM 4838   O "O3'"  . A A 1 151 ? 95.821  82.905  133.326 1.00 0.00 ? 172 A A "O3'"  1  
ATOM 4839   C "C2'"  . A A 1 151 ? 96.197  81.734  131.180 1.00 0.00 ? 172 A A "C2'"  1  
ATOM 4840   O "O2'"  . A A 1 151 ? 94.985  81.030  131.411 1.00 0.00 ? 172 A A "O2'"  1  
ATOM 4841   C "C1'"  . A A 1 151 ? 96.197  82.268  129.750 1.00 0.00 ? 172 A A "C1'"  1  
ATOM 4842   N N9     . A A 1 151 ? 97.564  82.440  129.221 1.00 0.00 ? 172 A A N9     1  
ATOM 4843   C C8     . A A 1 151 ? 98.281  83.604  129.098 1.00 0.00 ? 172 A A C8     1  
ATOM 4844   N N7     . A A 1 151 ? 99.477  83.437  128.590 1.00 0.00 ? 172 A A N7     1  
ATOM 4845   C C5     . A A 1 151 ? 99.554  82.070  128.362 1.00 0.00 ? 172 A A C5     1  
ATOM 4846   C C6     . A A 1 151 ? 100.569 81.254  127.832 1.00 0.00 ? 172 A A C6     1  
ATOM 4847   N N6     . A A 1 151 ? 101.751 81.716  127.420 1.00 0.00 ? 172 A A N6     1  
ATOM 4848   N N1     . A A 1 151 ? 100.325 79.928  127.740 1.00 0.00 ? 172 A A N1     1  
ATOM 4849   C C2     . A A 1 151 ? 99.140  79.464  128.154 1.00 0.00 ? 172 A A C2     1  
ATOM 4850   N N3     . A A 1 151 ? 98.108  80.130  128.668 1.00 0.00 ? 172 A A N3     1  
ATOM 4851   C C4     . A A 1 151 ? 98.383  81.444  128.746 1.00 0.00 ? 172 A A C4     1  
ATOM 4852   H "H5'"  . A A 1 151 ? 95.060  85.897  130.626 1.00 0.00 ? 172 A A "H5'"  1  
ATOM 4853   H "H5''" . A A 1 151 ? 95.420  85.716  132.170 1.00 0.00 ? 172 A A "H5''" 1  
ATOM 4854   H "H4'"  . A A 1 151 ? 94.414  83.775  131.400 1.00 0.00 ? 172 A A "H4'"  1  
ATOM 4855   H "H3'"  . A A 1 151 ? 97.158  83.380  131.971 1.00 0.00 ? 172 A A "H3'"  1  
ATOM 4856   H "H2'"  . A A 1 151 ? 96.982  81.175  131.355 1.00 0.00 ? 172 A A "H2'"  1  
ATOM 4857   H "HO2'" . A A 1 151 ? 94.991  80.205  130.881 1.00 0.00 ? 172 A A "HO2'" 1  
ATOM 4858   H "H1'"  . A A 1 151 ? 95.698  81.652  129.172 1.00 0.00 ? 172 A A "H1'"  1  
ATOM 4859   H H8     . A A 1 151 ? 97.931  84.480  129.366 1.00 0.00 ? 172 A A H8     1  
ATOM 4860   H H61    . A A 1 151 ? 102.421 81.097  127.059 1.00 0.00 ? 172 A A H61    1  
ATOM 4861   H H62    . A A 1 151 ? 101.950 82.674  127.477 1.00 0.00 ? 172 A A H62    1  
ATOM 4862   H H2     . A A 1 151 ? 99.013  78.495  128.066 1.00 0.00 ? 172 A A H2     1  
ATOM 4863   P P      . A A 1 152 ? 96.907  82.927  134.502 1.00 0.00 ? 173 A A P      1  
ATOM 4864   O OP1    . A A 1 152 ? 96.315  83.580  135.696 1.00 0.00 ? 173 A A OP1    1  
ATOM 4865   O OP2    . A A 1 152 ? 98.089  83.535  133.842 1.00 0.00 ? 173 A A OP2    1  
ATOM 4866   O "O5'"  . A A 1 152 ? 97.279  81.427  134.893 1.00 0.00 ? 173 A A "O5'"  1  
ATOM 4867   C "C5'"  . A A 1 152 ? 96.386  80.358  134.615 1.00 0.00 ? 173 A A "C5'"  1  
ATOM 4868   C "C4'"  . A A 1 152 ? 97.120  79.142  134.109 1.00 0.00 ? 173 A A "C4'"  1  
ATOM 4869   O "O4'"  . A A 1 152 ? 97.469  79.355  132.714 1.00 0.00 ? 173 A A "O4'"  1  
ATOM 4870   C "C3'"  . A A 1 152 ? 98.436  78.820  134.802 1.00 0.00 ? 173 A A "C3'"  1  
ATOM 4871   O "O3'"  . A A 1 152 ? 98.281  77.951  135.910 1.00 0.00 ? 173 A A "O3'"  1  
ATOM 4872   C "C2'"  . A A 1 152 ? 99.269  78.165  133.705 1.00 0.00 ? 173 A A "C2'"  1  
ATOM 4873   O "O2'"  . A A 1 152 ? 98.921  76.798  133.540 1.00 0.00 ? 173 A A "O2'"  1  
ATOM 4874   C "C1'"  . A A 1 152 ? 98.819  78.942  132.463 1.00 0.00 ? 173 A A "C1'"  1  
ATOM 4875   N N9     . A A 1 152 ? 99.648  80.140  132.228 1.00 0.00 ? 173 A A N9     1  
ATOM 4876   C C8     . A A 1 152 ? 99.498  81.391  132.774 1.00 0.00 ? 173 A A C8     1  
ATOM 4877   N N7     . A A 1 152 ? 100.395 82.255  132.369 1.00 0.00 ? 173 A A N7     1  
ATOM 4878   C C5     . A A 1 152 ? 101.192 81.525  131.498 1.00 0.00 ? 173 A A C5     1  
ATOM 4879   C C6     . A A 1 152 ? 102.321 81.868  130.732 1.00 0.00 ? 173 A A C6     1  
ATOM 4880   N N6     . A A 1 152 ? 102.867 83.087  130.724 1.00 0.00 ? 173 A A N6     1  
ATOM 4881   N N1     . A A 1 152 ? 102.878 80.905  129.966 1.00 0.00 ? 173 A A N1     1  
ATOM 4882   C C2     . A A 1 152 ? 102.331 79.683  129.975 1.00 0.00 ? 173 A A C2     1  
ATOM 4883   N N3     . A A 1 152 ? 101.272 79.239  130.650 1.00 0.00 ? 173 A A N3     1  
ATOM 4884   C C4     . A A 1 152 ? 100.743 80.221  131.401 1.00 0.00 ? 173 A A C4     1  
ATOM 4885   H "H5'"  . A A 1 152 ? 95.742  80.648  133.935 1.00 0.00 ? 173 A A "H5'"  1  
ATOM 4886   H "H5''" . A A 1 152 ? 95.902  80.123  135.433 1.00 0.00 ? 173 A A "H5''" 1  
ATOM 4887   H "H4'"  . A A 1 152 ? 96.531  78.360  134.166 1.00 0.00 ? 173 A A "H4'"  1  
ATOM 4888   H "H3'"  . A A 1 152 ? 98.858  79.652  135.102 1.00 0.00 ? 173 A A "H3'"  1  
ATOM 4889   H "H2'"  . A A 1 152 ? 100.229 78.278  133.867 1.00 0.00 ? 173 A A "H2'"  1  
ATOM 4890   H "HO2'" . A A 1 152 ? 99.473  76.412  132.830 1.00 0.00 ? 173 A A "HO2'" 1  
ATOM 4891   H "H1'"  . A A 1 152 ? 98.862  78.356  131.679 1.00 0.00 ? 173 A A "H1'"  1  
ATOM 4892   H H8     . A A 1 152 ? 98.785  81.617  133.408 1.00 0.00 ? 173 A A H8     1  
ATOM 4893   H H61    . A A 1 152 ? 103.654 83.266  130.169 1.00 0.00 ? 173 A A H61    1  
ATOM 4894   H H62    . A A 1 152 ? 102.480 83.801  131.271 1.00 0.00 ? 173 A A H62    1  
ATOM 4895   H H2     . A A 1 152 ? 102.772 79.020  129.404 1.00 0.00 ? 173 A A H2     1  
ATOM 4896   P P      . G A 1 153 ? 98.258  78.545  137.403 1.00 0.00 ? 174 G A P      1  
ATOM 4897   O OP1    . G A 1 153 ? 98.245  77.403  138.353 1.00 0.00 ? 174 G A OP1    1  
ATOM 4898   O OP2    . G A 1 153 ? 97.186  79.571  137.474 1.00 0.00 ? 174 G A OP2    1  
ATOM 4899   O "O5'"  . G A 1 153 ? 99.660  79.287  137.545 1.00 0.00 ? 174 G A "O5'"  1  
ATOM 4900   C "C5'"  . G A 1 153 ? 100.656 78.762  138.414 1.00 0.00 ? 174 G A "C5'"  1  
ATOM 4901   C "C4'"  . G A 1 153 ? 101.804 78.193  137.620 1.00 0.00 ? 174 G A "C4'"  1  
ATOM 4902   O "O4'"  . G A 1 153 ? 101.633 78.481  136.207 1.00 0.00 ? 174 G A "O4'"  1  
ATOM 4903   C "C3'"  . G A 1 153 ? 103.173 78.777  137.911 1.00 0.00 ? 174 G A "C3'"  1  
ATOM 4904   O "O3'"  . G A 1 153 ? 103.737 78.300  139.121 1.00 0.00 ? 174 G A "O3'"  1  
ATOM 4905   C "C2'"  . G A 1 153 ? 103.952 78.328  136.687 1.00 0.00 ? 174 G A "C2'"  1  
ATOM 4906   O "O2'"  . G A 1 153 ? 104.328 76.966  136.740 1.00 0.00 ? 174 G A "O2'"  1  
ATOM 4907   C "C1'"  . G A 1 153 ? 102.912 78.540  135.585 1.00 0.00 ? 174 G A "C1'"  1  
ATOM 4908   N N9     . G A 1 153 ? 103.066 79.841  134.948 1.00 0.00 ? 174 G A N9     1  
ATOM 4909   C C8     . G A 1 153 ? 102.355 80.982  135.210 1.00 0.00 ? 174 G A C8     1  
ATOM 4910   N N7     . G A 1 153 ? 102.720 81.991  134.472 1.00 0.00 ? 174 G A N7     1  
ATOM 4911   C C5     . G A 1 153 ? 103.734 81.485  133.676 1.00 0.00 ? 174 G A C5     1  
ATOM 4912   C C6     . G A 1 153 ? 104.514 82.111  132.687 1.00 0.00 ? 174 G A C6     1  
ATOM 4913   O O6     . G A 1 153 ? 104.451 83.278  132.285 1.00 0.00 ? 174 G A O6     1  
ATOM 4914   N N1     . G A 1 153 ? 105.450 81.238  132.143 1.00 0.00 ? 174 G A N1     1  
ATOM 4915   C C2     . G A 1 153 ? 105.604 79.927  132.501 1.00 0.00 ? 174 G A C2     1  
ATOM 4916   N N2     . G A 1 153 ? 106.564 79.242  131.856 1.00 0.00 ? 174 G A N2     1  
ATOM 4917   N N3     . G A 1 153 ? 104.875 79.328  133.421 1.00 0.00 ? 174 G A N3     1  
ATOM 4918   C C4     . G A 1 153 ? 103.964 80.162  133.964 1.00 0.00 ? 174 G A C4     1  
ATOM 4919   H "H5'"  . G A 1 153 ? 100.259 78.058  138.967 1.00 0.00 ? 174 G A "H5'"  1  
ATOM 4920   H "H5''" . G A 1 153 ? 100.984 79.478  138.996 1.00 0.00 ? 174 G A "H5''" 1  
ATOM 4921   H "H4'"  . G A 1 153 ? 101.822 77.220  137.741 1.00 0.00 ? 174 G A "H4'"  1  
ATOM 4922   H "H3'"  . G A 1 153 ? 103.104 79.752  137.954 1.00 0.00 ? 174 G A "H3'"  1  
ATOM 4923   H "H2'"  . G A 1 153 ? 104.734 78.897  136.529 1.00 0.00 ? 174 G A "H2'"  1  
ATOM 4924   H "HO2'" . G A 1 153 ? 104.297 76.663  137.672 1.00 0.00 ? 174 G A "HO2'" 1  
ATOM 4925   H "H1'"  . G A 1 153 ? 102.997 77.830  134.915 1.00 0.00 ? 174 G A "H1'"  1  
ATOM 4926   H H8     . G A 1 153 ? 101.645 81.036  135.882 1.00 0.00 ? 174 G A H8     1  
ATOM 4927   H H1     . G A 1 153 ? 106.045 81.593  131.451 1.00 0.00 ? 174 G A H1     1  
ATOM 4928   H H21    . G A 1 153 ? 107.110 79.682  131.172 1.00 0.00 ? 174 G A H21    1  
ATOM 4929   H H22    . G A 1 153 ? 106.721 78.297  132.071 1.00 0.00 ? 174 G A H22    1  
ATOM 4930   P P      . G A 1 154 ? 104.311 79.357  140.182 1.00 0.00 ? 175 G A P      1  
ATOM 4931   O OP1    . G A 1 154 ? 104.358 78.717  141.519 1.00 0.00 ? 175 G A OP1    1  
ATOM 4932   O OP2    . G A 1 154 ? 103.496 80.580  139.984 1.00 0.00 ? 175 G A OP2    1  
ATOM 4933   O "O5'"  . G A 1 154 ? 105.806 79.655  139.706 1.00 0.00 ? 175 G A "O5'"  1  
ATOM 4934   C "C5'"  . G A 1 154 ? 106.872 78.793  140.089 1.00 0.00 ? 175 G A "C5'"  1  
ATOM 4935   C "C4'"  . G A 1 154 ? 107.927 78.756  139.012 1.00 0.00 ? 175 G A "C4'"  1  
ATOM 4936   O "O4'"  . G A 1 154 ? 107.263 78.643  137.727 1.00 0.00 ? 175 G A "O4'"  1  
ATOM 4937   C "C3'"  . G A 1 154 ? 108.768 80.008  138.857 1.00 0.00 ? 175 G A "C3'"  1  
ATOM 4938   O "O3'"  . G A 1 154 ? 109.855 79.996  139.765 1.00 0.00 ? 175 G A "O3'"  1  
ATOM 4939   C "C2'"  . G A 1 154 ? 109.259 79.878  137.427 1.00 0.00 ? 175 G A "C2'"  1  
ATOM 4940   O "O2'"  . G A 1 154 ? 110.321 78.954  137.313 1.00 0.00 ? 175 G A "O2'"  1  
ATOM 4941   C "C1'"  . G A 1 154 ? 108.006 79.339  136.739 1.00 0.00 ? 175 G A "C1'"  1  
ATOM 4942   N N9     . G A 1 154 ? 107.183 80.427  136.221 1.00 0.00 ? 175 G A N9     1  
ATOM 4943   C C8     . G A 1 154 ? 105.864 80.704  136.492 1.00 0.00 ? 175 G A C8     1  
ATOM 4944   N N7     . G A 1 154 ? 105.435 81.781  135.892 1.00 0.00 ? 175 G A N7     1  
ATOM 4945   C C5     . G A 1 154 ? 106.537 82.238  135.184 1.00 0.00 ? 175 G A C5     1  
ATOM 4946   C C6     . G A 1 154 ? 106.697 83.379  134.361 1.00 0.00 ? 175 G A C6     1  
ATOM 4947   O O6     . G A 1 154 ? 105.871 84.254  134.093 1.00 0.00 ? 175 G A O6     1  
ATOM 4948   N N1     . G A 1 154 ? 107.979 83.456  133.831 1.00 0.00 ? 175 G A N1     1  
ATOM 4949   C C2     . G A 1 154 ? 108.981 82.558  134.071 1.00 0.00 ? 175 G A C2     1  
ATOM 4950   N N2     . G A 1 154 ? 110.144 82.795  133.463 1.00 0.00 ? 175 G A N2     1  
ATOM 4951   N N3     . G A 1 154 ? 108.854 81.499  134.848 1.00 0.00 ? 175 G A N3     1  
ATOM 4952   C C4     . G A 1 154 ? 107.615 81.403  135.366 1.00 0.00 ? 175 G A C4     1  
ATOM 4953   H "H5'"  . G A 1 154 ? 106.518 77.892  140.236 1.00 0.00 ? 175 G A "H5'"  1  
ATOM 4954   H "H5''" . G A 1 154 ? 107.265 79.121  140.926 1.00 0.00 ? 175 G A "H5''" 1  
ATOM 4955   H "H4'"  . G A 1 154 ? 108.501 77.973  139.155 1.00 0.00 ? 175 G A "H4'"  1  
ATOM 4956   H "H3'"  . G A 1 154 ? 108.204 80.794  139.010 1.00 0.00 ? 175 G A "H3'"  1  
ATOM 4957   H "H2'"  . G A 1 154 ? 109.505 80.749  137.051 1.00 0.00 ? 175 G A "H2'"  1  
ATOM 4958   H "HO2'" . G A 1 154 ? 110.603 78.905  136.376 1.00 0.00 ? 175 G A "HO2'" 1  
ATOM 4959   H "H1'"  . G A 1 154 ? 108.266 78.739  136.009 1.00 0.00 ? 175 G A "H1'"  1  
ATOM 4960   H H8     . G A 1 154 ? 105.302 80.152  137.074 1.00 0.00 ? 175 G A H8     1  
ATOM 4961   H H1     . G A 1 154 ? 108.177 84.212  133.239 1.00 0.00 ? 175 G A H1     1  
ATOM 4962   H H21    . G A 1 154 ? 110.246 83.578  132.884 1.00 0.00 ? 175 G A H21    1  
ATOM 4963   H H22    . G A 1 154 ? 110.899 82.183  133.594 1.00 0.00 ? 175 G A H22    1  
ATOM 4964   P P      . G A 1 155 ? 110.068 81.233  140.759 1.00 0.00 ? 176 G A P      1  
ATOM 4965   O OP1    . G A 1 155 ? 111.138 80.805  141.707 1.00 0.00 ? 176 G A OP1    1  
ATOM 4966   O OP2    . G A 1 155 ? 108.711 81.570  141.281 1.00 0.00 ? 176 G A OP2    1  
ATOM 4967   O "O5'"  . G A 1 155 ? 110.612 82.482  139.927 1.00 0.00 ? 176 G A "O5'"  1  
ATOM 4968   C "C5'"  . G A 1 155 ? 109.810 83.108  138.926 1.00 0.00 ? 176 G A "C5'"  1  
ATOM 4969   C "C4'"  . G A 1 155 ? 110.645 84.070  138.109 1.00 0.00 ? 176 G A "C4'"  1  
ATOM 4970   O "O4'"  . G A 1 155 ? 110.091 84.169  136.773 1.00 0.00 ? 176 G A "O4'"  1  
ATOM 4971   C "C3'"  . G A 1 155 ? 110.676 85.504  138.608 1.00 0.00 ? 176 G A "C3'"  1  
ATOM 4972   O "O3'"  . G A 1 155 ? 111.695 85.664  139.583 1.00 0.00 ? 176 G A "O3'"  1  
ATOM 4973   C "C2'"  . G A 1 155 ? 111.036 86.268  137.346 1.00 0.00 ? 176 G A "C2'"  1  
ATOM 4974   O "O2'"  . G A 1 155 ? 112.422 86.163  137.101 1.00 0.00 ? 176 G A "O2'"  1  
ATOM 4975   C "C1'"  . G A 1 155 ? 110.265 85.484  136.280 1.00 0.00 ? 176 G A "C1'"  1  
ATOM 4976   N N9     . G A 1 155 ? 108.946 86.028  135.955 1.00 0.00 ? 176 G A N9     1  
ATOM 4977   C C8     . G A 1 155 ? 107.728 85.522  136.338 1.00 0.00 ? 176 G A C8     1  
ATOM 4978   N N7     . G A 1 155 ? 106.720 86.226  135.899 1.00 0.00 ? 176 G A N7     1  
ATOM 4979   C C5     . G A 1 155 ? 107.308 87.256  135.184 1.00 0.00 ? 176 G A C5     1  
ATOM 4980   C C6     . G A 1 155 ? 106.722 88.328  134.489 1.00 0.00 ? 176 G A C6     1  
ATOM 4981   O O6     . G A 1 155 ? 105.519 88.597  134.366 1.00 0.00 ? 176 G A O6     1  
ATOM 4982   N N1     . G A 1 155 ? 107.683 89.137  133.895 1.00 0.00 ? 176 G A N1     1  
ATOM 4983   C C2     . G A 1 155 ? 109.039 88.931  133.964 1.00 0.00 ? 176 G A C2     1  
ATOM 4984   N N2     . G A 1 155 ? 109.808 89.799  133.306 1.00 0.00 ? 176 G A N2     1  
ATOM 4985   N N3     . G A 1 155 ? 109.599 87.942  134.622 1.00 0.00 ? 176 G A N3     1  
ATOM 4986   C C4     . G A 1 155 ? 108.682 87.147  135.203 1.00 0.00 ? 176 G A C4     1  
ATOM 4987   H "H5'"  . G A 1 155 ? 109.077 83.591  139.359 1.00 0.00 ? 176 G A "H5'"  1  
ATOM 4988   H "H5''" . G A 1 155 ? 109.435 82.417  138.340 1.00 0.00 ? 176 G A "H5''" 1  
ATOM 4989   H "H4'"  . G A 1 155 ? 111.562 83.725  138.054 1.00 0.00 ? 176 G A "H4'"  1  
ATOM 4990   H "H3'"  . G A 1 155 ? 109.801 85.732  138.985 1.00 0.00 ? 176 G A "H3'"  1  
ATOM 4991   H "H2'"  . G A 1 155 ? 110.732 87.199  137.390 1.00 0.00 ? 176 G A "H2'"  1  
ATOM 4992   H "HO2'" . G A 1 155 ? 112.640 86.661  136.285 1.00 0.00 ? 176 G A "HO2'" 1  
ATOM 4993   H "H1'"  . G A 1 155 ? 110.793 85.451  135.455 1.00 0.00 ? 176 G A "H1'"  1  
ATOM 4994   H H8     . G A 1 155 ? 107.624 84.715  136.885 1.00 0.00 ? 176 G A H8     1  
ATOM 4995   H H1     . G A 1 155 ? 107.366 89.915  133.390 1.00 0.00 ? 176 G A H1     1  
ATOM 4996   H H21    . G A 1 155 ? 109.403 90.540  132.811 1.00 0.00 ? 176 G A H21    1  
ATOM 4997   H H22    . G A 1 155 ? 110.783 89.694  133.316 1.00 0.00 ? 176 G A H22    1  
ATOM 4998   P P      . U A 1 156 ? 111.635 86.907  140.597 1.00 0.00 ? 177 U A P      1  
ATOM 4999   O OP1    . U A 1 156 ? 112.929 86.996  141.313 1.00 0.00 ? 177 U A OP1    1  
ATOM 5000   O OP2    . U A 1 156 ? 110.373 86.817  141.374 1.00 0.00 ? 177 U A OP2    1  
ATOM 5001   O "O5'"  . U A 1 156 ? 111.540 88.156  139.630 1.00 0.00 ? 177 U A "O5'"  1  
ATOM 5002   C "C5'"  . U A 1 156 ? 112.682 88.616  138.933 1.00 0.00 ? 177 U A "C5'"  1  
ATOM 5003   C "C4'"  . U A 1 156 ? 112.423 90.001  138.436 1.00 0.00 ? 177 U A "C4'"  1  
ATOM 5004   O "O4'"  . U A 1 156 ? 111.412 89.940  137.400 1.00 0.00 ? 177 U A "O4'"  1  
ATOM 5005   C "C3'"  . U A 1 156 ? 111.835 90.881  139.522 1.00 0.00 ? 177 U A "C3'"  1  
ATOM 5006   O "O3'"  . U A 1 156 ? 112.879 91.505  140.263 1.00 0.00 ? 177 U A "O3'"  1  
ATOM 5007   C "C2'"  . U A 1 156 ? 110.999 91.871  138.722 1.00 0.00 ? 177 U A "C2'"  1  
ATOM 5008   O "O2'"  . U A 1 156 ? 111.741 92.949  138.191 1.00 0.00 ? 177 U A "O2'"  1  
ATOM 5009   C "C1'"  . U A 1 156 ? 110.483 90.989  137.582 1.00 0.00 ? 177 U A "C1'"  1  
ATOM 5010   N N1     . U A 1 156 ? 109.172 90.389  137.854 1.00 0.00 ? 177 U A N1     1  
ATOM 5011   C C2     . U A 1 156 ? 108.110 91.241  138.058 1.00 0.00 ? 177 U A C2     1  
ATOM 5012   O O2     . U A 1 156 ? 108.218 92.460  138.013 1.00 0.00 ? 177 U A O2     1  
ATOM 5013   N N3     . U A 1 156 ? 106.915 90.621  138.321 1.00 0.00 ? 177 U A N3     1  
ATOM 5014   C C4     . U A 1 156 ? 106.686 89.269  138.397 1.00 0.00 ? 177 U A C4     1  
ATOM 5015   O O4     . U A 1 156 ? 105.558 88.864  138.682 1.00 0.00 ? 177 U A O4     1  
ATOM 5016   C C5     . U A 1 156 ? 107.835 88.455  138.161 1.00 0.00 ? 177 U A C5     1  
ATOM 5017   C C6     . U A 1 156 ? 109.009 89.029  137.904 1.00 0.00 ? 177 U A C6     1  
ATOM 5018   H "H5'"  . U A 1 156 ? 112.863 88.012  138.182 1.00 0.00 ? 177 U A "H5'"  1  
ATOM 5019   H "H5''" . U A 1 156 ? 113.450 88.610  139.542 1.00 0.00 ? 177 U A "H5''" 1  
ATOM 5020   H "H4'"  . U A 1 156 ? 113.252 90.362  138.062 1.00 0.00 ? 177 U A "H4'"  1  
ATOM 5021   H "H3'"  . U A 1 156 ? 111.273 90.336  140.110 1.00 0.00 ? 177 U A "H3'"  1  
ATOM 5022   H "H2'"  . U A 1 156 ? 110.243 92.208  139.244 1.00 0.00 ? 177 U A "H2'"  1  
ATOM 5023   H "HO2'" . U A 1 156 ? 111.135 93.538  137.692 1.00 0.00 ? 177 U A "HO2'" 1  
ATOM 5024   H "H1'"  . U A 1 156 ? 110.421 91.523  136.762 1.00 0.00 ? 177 U A "H1'"  1  
ATOM 5025   H H3     . U A 1 156 ? 106.143 91.205  138.472 1.00 0.00 ? 177 U A H3     1  
ATOM 5026   H H5     . U A 1 156 ? 107.761 87.478  138.188 1.00 0.00 ? 177 U A H5     1  
ATOM 5027   H H6     . U A 1 156 ? 109.780 88.445  137.748 1.00 0.00 ? 177 U A H6     1  
ATOM 5028   P P      . A A 1 157 ? 113.211 91.005  141.749 1.00 0.00 ? 178 A A P      1  
ATOM 5029   O OP1    . A A 1 157 ? 113.284 89.526  141.702 1.00 0.00 ? 178 A A OP1    1  
ATOM 5030   O OP2    . A A 1 157 ? 112.249 91.658  142.664 1.00 0.00 ? 178 A A OP2    1  
ATOM 5031   O "O5'"  . A A 1 157 ? 114.666 91.601  142.033 1.00 0.00 ? 178 A A "O5'"  1  
ATOM 5032   C "C5'"  . A A 1 157 ? 115.844 90.797  141.877 1.00 0.00 ? 178 A A "C5'"  1  
ATOM 5033   C "C4'"  . A A 1 157 ? 116.988 91.632  141.333 1.00 0.00 ? 178 A A "C4'"  1  
ATOM 5034   O "O4'"  . A A 1 157 ? 116.525 92.280  140.132 1.00 0.00 ? 178 A A "O4'"  1  
ATOM 5035   C "C3'"  . A A 1 157 ? 117.495 92.767  142.224 1.00 0.00 ? 178 A A "C3'"  1  
ATOM 5036   O "O3'"  . A A 1 157 ? 118.686 92.389  142.918 1.00 0.00 ? 178 A A "O3'"  1  
ATOM 5037   C "C2'"  . A A 1 157 ? 117.981 93.830  141.236 1.00 0.00 ? 178 A A "C2'"  1  
ATOM 5038   O "O2'"  . A A 1 157 ? 119.379 93.792  141.056 1.00 0.00 ? 178 A A "O2'"  1  
ATOM 5039   C "C1'"  . A A 1 157 ? 117.278 93.449  139.934 1.00 0.00 ? 178 A A "C1'"  1  
ATOM 5040   N N9     . A A 1 157 ? 116.429 94.474  139.344 1.00 0.00 ? 178 A A N9     1  
ATOM 5041   C C8     . A A 1 157 ? 115.091 94.440  139.065 1.00 0.00 ? 178 A A C8     1  
ATOM 5042   N N7     . A A 1 157 ? 114.648 95.528  138.482 1.00 0.00 ? 178 A A N7     1  
ATOM 5043   C C5     . A A 1 157 ? 115.776 96.334  138.383 1.00 0.00 ? 178 A A C5     1  
ATOM 5044   C C6     . A A 1 157 ? 115.982 97.623  137.854 1.00 0.00 ? 178 A A C6     1  
ATOM 5045   N N6     . A A 1 157 ? 115.023 98.359  137.289 1.00 0.00 ? 178 A A N6     1  
ATOM 5046   N N1     . A A 1 157 ? 117.227 98.135  137.923 1.00 0.00 ? 178 A A N1     1  
ATOM 5047   C C2     . A A 1 157 ? 118.190 97.397  138.479 1.00 0.00 ? 178 A A C2     1  
ATOM 5048   N N3     . A A 1 157 ? 118.122 96.179  139.003 1.00 0.00 ? 178 A A N3     1  
ATOM 5049   C C4     . A A 1 157 ? 116.873 95.699  138.921 1.00 0.00 ? 178 A A C4     1  
ATOM 5050   H "H5'"  . A A 1 157 ? 115.651 90.064  141.257 1.00 0.00 ? 178 A A "H5'"  1  
ATOM 5051   H "H5''" . A A 1 157 ? 116.095 90.423  142.747 1.00 0.00 ? 178 A A "H5''" 1  
ATOM 5052   H "H4'"  . A A 1 157 ? 117.742 91.041  141.126 1.00 0.00 ? 178 A A "H4'"  1  
ATOM 5053   H "H3'"  . A A 1 157 ? 116.794 93.008  142.865 1.00 0.00 ? 178 A A "H3'"  1  
ATOM 5054   H "H2'"  . A A 1 157 ? 117.681 94.727  141.497 1.00 0.00 ? 178 A A "H2'"  1  
ATOM 5055   H "HO2'" . A A 1 157 ? 119.636 94.490  140.418 1.00 0.00 ? 178 A A "HO2'" 1  
ATOM 5056   H "H1'"  . A A 1 157 ? 117.948 93.200  139.262 1.00 0.00 ? 178 A A "H1'"  1  
ATOM 5057   H H8     . A A 1 157 ? 114.518 93.673  139.273 1.00 0.00 ? 178 A A H8     1  
ATOM 5058   H H61    . A A 1 157 ? 115.233 99.248  136.936 1.00 0.00 ? 178 A A H61    1  
ATOM 5059   H H62    . A A 1 157 ? 114.109 98.009  137.225 1.00 0.00 ? 178 A A H62    1  
ATOM 5060   H H2     . A A 1 157 ? 119.077 97.815  138.502 1.00 0.00 ? 178 A A H2     1  
ATOM 5061   P P      . U A 1 158 ? 118.625 91.391  144.172 1.00 0.00 ? 179 U A P      1  
ATOM 5062   O OP1    . U A 1 158 ? 117.240 91.308  144.691 1.00 0.00 ? 179 U A OP1    1  
ATOM 5063   O OP2    . U A 1 158 ? 119.726 91.806  145.073 1.00 0.00 ? 179 U A OP2    1  
ATOM 5064   O "O5'"  . U A 1 158 ? 119.020 89.984  143.545 1.00 0.00 ? 179 U A "O5'"  1  
ATOM 5065   C "C5'"  . U A 1 158 ? 119.766 89.930  142.342 1.00 0.00 ? 179 U A "C5'"  1  
ATOM 5066   C "C4'"  . U A 1 158 ? 120.351 88.556  142.146 1.00 0.00 ? 179 U A "C4'"  1  
ATOM 5067   O "O4'"  . U A 1 158 ? 121.259 88.267  143.225 1.00 0.00 ? 179 U A "O4'"  1  
ATOM 5068   C "C3'"  . U A 1 158 ? 119.398 87.380  142.183 1.00 0.00 ? 179 U A "C3'"  1  
ATOM 5069   O "O3'"  . U A 1 158 ? 118.675 87.319  140.951 1.00 0.00 ? 179 U A "O3'"  1  
ATOM 5070   C "C2'"  . U A 1 158 ? 120.313 86.196  142.517 1.00 0.00 ? 179 U A "C2'"  1  
ATOM 5071   O "O2'"  . U A 1 158 ? 120.879 85.511  141.422 1.00 0.00 ? 179 U A "O2'"  1  
ATOM 5072   C "C1'"  . U A 1 158 ? 121.442 86.869  143.312 1.00 0.00 ? 179 U A "C1'"  1  
ATOM 5073   N N1     . U A 1 158 ? 121.546 86.487  144.729 1.00 0.00 ? 179 U A N1     1  
ATOM 5074   C C2     . U A 1 158 ? 122.403 87.235  145.534 1.00 0.00 ? 179 U A C2     1  
ATOM 5075   O O2     . U A 1 158 ? 122.991 88.232  145.141 1.00 0.00 ? 179 U A O2     1  
ATOM 5076   N N3     . U A 1 158 ? 122.542 86.773  146.819 1.00 0.00 ? 179 U A N3     1  
ATOM 5077   C C4     . U A 1 158 ? 121.921 85.673  147.377 1.00 0.00 ? 179 U A C4     1  
ATOM 5078   O O4     . U A 1 158 ? 122.226 85.328  148.519 1.00 0.00 ? 179 U A O4     1  
ATOM 5079   C C5     . U A 1 158 ? 121.021 84.977  146.499 1.00 0.00 ? 179 U A C5     1  
ATOM 5080   C C6     . U A 1 158 ? 120.864 85.401  145.240 1.00 0.00 ? 179 U A C6     1  
ATOM 5081   H "H5'"  . U A 1 158 ? 120.488 90.591  142.383 1.00 0.00 ? 179 U A "H5'"  1  
ATOM 5082   H "H5''" . U A 1 158 ? 119.176 90.146  141.589 1.00 0.00 ? 179 U A "H5''" 1  
ATOM 5083   H "H4'"  . U A 1 158 ? 120.842 88.541  141.299 1.00 0.00 ? 179 U A "H4'"  1  
ATOM 5084   H "H3'"  . U A 1 158 ? 118.788 87.481  142.943 1.00 0.00 ? 179 U A "H3'"  1  
ATOM 5085   H "H2'"  . U A 1 158 ? 119.862 85.545  143.094 1.00 0.00 ? 179 U A "H2'"  1  
ATOM 5086   H "HO2'" . U A 1 158 ? 121.441 84.781  141.757 1.00 0.00 ? 179 U A "HO2'" 1  
ATOM 5087   H "H1'"  . U A 1 158 ? 122.303 86.663  142.889 1.00 0.00 ? 179 U A "H1'"  1  
ATOM 5088   H H3     . U A 1 158 ? 123.148 87.277  147.400 1.00 0.00 ? 179 U A H3     1  
ATOM 5089   H H5     . U A 1 158 ? 120.524 84.195  146.819 1.00 0.00 ? 179 U A H5     1  
ATOM 5090   H H6     . U A 1 158 ? 120.245 84.906  144.664 1.00 0.00 ? 179 U A H6     1  
ATOM 5091   P P      . G A 1 159 ? 119.448 87.534  139.567 1.00 0.00 ? 180 G A P      1  
ATOM 5092   O OP1    . G A 1 159 ? 120.729 86.793  139.714 1.00 0.00 ? 180 G A OP1    1  
ATOM 5093   O OP2    . G A 1 159 ? 119.461 88.996  139.320 1.00 0.00 ? 180 G A OP2    1  
ATOM 5094   O "O5'"  . G A 1 159 ? 118.603 86.865  138.385 1.00 0.00 ? 180 G A "O5'"  1  
ATOM 5095   C "C5'"  . G A 1 159 ? 117.170 86.759  138.469 1.00 0.00 ? 180 G A "C5'"  1  
ATOM 5096   C "C4'"  . G A 1 159 ? 116.494 87.801  137.592 1.00 0.00 ? 180 G A "C4'"  1  
ATOM 5097   O "O4'"  . G A 1 159 ? 116.742 89.133  138.088 1.00 0.00 ? 180 G A "O4'"  1  
ATOM 5098   C "C3'"  . G A 1 159 ? 116.942 87.841  136.150 1.00 0.00 ? 180 G A "C3'"  1  
ATOM 5099   O "O3'"  . G A 1 159 ? 116.169 86.872  135.469 1.00 0.00 ? 180 G A "O3'"  1  
ATOM 5100   C "C2'"  . G A 1 159 ? 116.576 89.258  135.708 1.00 0.00 ? 180 G A "C2'"  1  
ATOM 5101   O "O2'"  . G A 1 159 ? 115.251 89.353  135.221 1.00 0.00 ? 180 G A "O2'"  1  
ATOM 5102   C "C1'"  . G A 1 159 ? 116.688 90.048  137.015 1.00 0.00 ? 180 G A "C1'"  1  
ATOM 5103   N N9     . G A 1 159 ? 117.836 90.931  137.128 1.00 0.00 ? 180 G A N9     1  
ATOM 5104   C C8     . G A 1 159 ? 119.005 90.672  137.796 1.00 0.00 ? 180 G A C8     1  
ATOM 5105   N N7     . G A 1 159 ? 119.824 91.681  137.803 1.00 0.00 ? 180 G A N7     1  
ATOM 5106   C C5     . G A 1 159 ? 119.160 92.661  137.082 1.00 0.00 ? 180 G A C5     1  
ATOM 5107   C C6     . G A 1 159 ? 119.541 93.977  136.781 1.00 0.00 ? 180 G A C6     1  
ATOM 5108   O O6     . G A 1 159 ? 120.564 94.570  137.118 1.00 0.00 ? 180 G A O6     1  
ATOM 5109   N N1     . G A 1 159 ? 118.588 94.624  136.006 1.00 0.00 ? 180 G A N1     1  
ATOM 5110   C C2     . G A 1 159 ? 117.413 94.074  135.585 1.00 0.00 ? 180 G A C2     1  
ATOM 5111   N N2     . G A 1 159 ? 116.644 94.862  134.822 1.00 0.00 ? 180 G A N2     1  
ATOM 5112   N N3     . G A 1 159 ? 117.025 92.845  135.882 1.00 0.00 ? 180 G A N3     1  
ATOM 5113   C C4     . G A 1 159 ? 117.945 92.201  136.631 1.00 0.00 ? 180 G A C4     1  
ATOM 5114   H "H5'"  . G A 1 159 ? 116.892 86.890  139.398 1.00 0.00 ? 180 G A "H5'"  1  
ATOM 5115   H "H5''" . G A 1 159 ? 116.898 85.864  138.176 1.00 0.00 ? 180 G A "H5''" 1  
ATOM 5116   H "H4'"  . G A 1 159 ? 115.527 87.644  137.603 1.00 0.00 ? 180 G A "H4'"  1  
ATOM 5117   H "H3'"  . G A 1 159 ? 117.903 87.654  136.106 1.00 0.00 ? 180 G A "H3'"  1  
ATOM 5118   H "H2'"  . G A 1 159 ? 117.215 89.607  135.050 1.00 0.00 ? 180 G A "H2'"  1  
ATOM 5119   H "HO2'" . G A 1 159 ? 115.075 90.280  134.954 1.00 0.00 ? 180 G A "HO2'" 1  
ATOM 5120   H "H1'"  . G A 1 159 ? 115.885 90.595  137.135 1.00 0.00 ? 180 G A "H1'"  1  
ATOM 5121   H H8     . G A 1 159 ? 119.200 89.816  138.234 1.00 0.00 ? 180 G A H8     1  
ATOM 5122   H H1     . G A 1 159 ? 118.778 95.549  135.741 1.00 0.00 ? 180 G A H1     1  
ATOM 5123   H H21    . G A 1 159 ? 116.934 95.771  134.603 1.00 0.00 ? 180 G A H21    1  
ATOM 5124   H H22    . G A 1 159 ? 115.788 94.528  134.479 1.00 0.00 ? 180 G A H22    1  
ATOM 5125   P P      . G A 1 160 ? 116.561 86.441  133.987 1.00 0.00 ? 181 G A P      1  
ATOM 5126   O OP1    . G A 1 160 ? 115.615 85.384  133.512 1.00 0.00 ? 181 G A OP1    1  
ATOM 5127   O OP2    . G A 1 160 ? 118.020 86.164  134.029 1.00 0.00 ? 181 G A OP2    1  
ATOM 5128   O "O5'"  . G A 1 160 ? 116.334 87.775  133.163 1.00 0.00 ? 181 G A "O5'"  1  
ATOM 5129   C "C5'"  . G A 1 160 ? 117.416 88.427  132.539 1.00 0.00 ? 181 G A "C5'"  1  
ATOM 5130   C "C4'"  . G A 1 160 ? 116.934 89.693  131.874 1.00 0.00 ? 181 G A "C4'"  1  
ATOM 5131   O "O4'"  . G A 1 160 ? 116.938 90.787  132.829 1.00 0.00 ? 181 G A "O4'"  1  
ATOM 5132   C "C3'"  . G A 1 160 ? 117.771 90.150  130.692 1.00 0.00 ? 181 G A "C3'"  1  
ATOM 5133   O "O3'"  . G A 1 160 ? 117.181 89.529  129.543 1.00 0.00 ? 181 G A "O3'"  1  
ATOM 5134   C "C2'"  . G A 1 160 ? 117.588 91.667  130.719 1.00 0.00 ? 181 G A "C2'"  1  
ATOM 5135   O "O2'"  . G A 1 160 ? 116.387 92.039  130.087 1.00 0.00 ? 181 G A "O2'"  1  
ATOM 5136   C "C1'"  . G A 1 160 ? 117.444 91.953  132.223 1.00 0.00 ? 181 G A "C1'"  1  
ATOM 5137   N N9     . G A 1 160 ? 118.639 92.319  132.978 1.00 0.00 ? 181 G A N9     1  
ATOM 5138   C C8     . G A 1 160 ? 119.329 91.498  133.836 1.00 0.00 ? 181 G A C8     1  
ATOM 5139   N N7     . G A 1 160 ? 120.337 92.091  134.411 1.00 0.00 ? 181 G A N7     1  
ATOM 5140   C C5     . G A 1 160 ? 120.317 93.380  133.895 1.00 0.00 ? 181 G A C5     1  
ATOM 5141   C C6     . G A 1 160 ? 121.167 94.482  134.155 1.00 0.00 ? 181 G A C6     1  
ATOM 5142   O O6     . G A 1 160 ? 122.138 94.533  134.902 1.00 0.00 ? 181 G A O6     1  
ATOM 5143   N N1     . G A 1 160 ? 120.793 95.604  133.437 1.00 0.00 ? 181 G A N1     1  
ATOM 5144   C C2     . G A 1 160 ? 119.738 95.663  132.573 1.00 0.00 ? 181 G A C2     1  
ATOM 5145   N N2     . G A 1 160 ? 119.549 96.852  131.972 1.00 0.00 ? 181 G A N2     1  
ATOM 5146   N N3     . G A 1 160 ? 118.931 94.639  132.316 1.00 0.00 ? 181 G A N3     1  
ATOM 5147   C C4     . G A 1 160 ? 119.277 93.537  133.008 1.00 0.00 ? 181 G A C4     1  
ATOM 5148   H "H5'"  . G A 1 160 ? 117.809 87.826  131.872 1.00 0.00 ? 181 G A "H5'"  1  
ATOM 5149   H "H5''" . G A 1 160 ? 118.093 88.641  133.215 1.00 0.00 ? 181 G A "H5''" 1  
ATOM 5150   H "H4'"  . G A 1 160 ? 116.017 89.554  131.555 1.00 0.00 ? 181 G A "H4'"  1  
ATOM 5151   H "H3'"  . G A 1 160 ? 118.701 89.883  130.835 1.00 0.00 ? 181 G A "H3'"  1  
ATOM 5152   H "H2'"  . G A 1 160 ? 118.362 92.129  130.334 1.00 0.00 ? 181 G A "H2'"  1  
ATOM 5153   H "HO2'" . G A 1 160 ? 116.542 92.849  129.559 1.00 0.00 ? 181 G A "HO2'" 1  
ATOM 5154   H "H1'"  . G A 1 160 ? 116.804 92.682  132.356 1.00 0.00 ? 181 G A "H1'"  1  
ATOM 5155   H H8     . G A 1 160 ? 119.087 90.564  134.003 1.00 0.00 ? 181 G A H8     1  
ATOM 5156   H H1     . G A 1 160 ? 121.327 96.417  133.558 1.00 0.00 ? 181 G A H1     1  
ATOM 5157   H H21    . G A 1 160 ? 120.147 97.603  132.165 1.00 0.00 ? 181 G A H21    1  
ATOM 5158   H H22    . G A 1 160 ? 118.810 96.967  131.337 1.00 0.00 ? 181 G A H22    1  
ATOM 5159   P P      . U A 1 161 ? 117.743 89.832  128.071 1.00 0.00 ? 182 U A P      1  
ATOM 5160   O OP1    . U A 1 161 ? 116.758 89.267  127.091 1.00 0.00 ? 182 U A OP1    1  
ATOM 5161   O OP2    . U A 1 161 ? 119.150 89.373  128.030 1.00 0.00 ? 182 U A OP2    1  
ATOM 5162   O "O5'"  . U A 1 161 ? 117.723 91.426  128.006 1.00 0.00 ? 182 U A "O5'"  1  
ATOM 5163   C "C5'"  . U A 1 161 ? 117.817 92.135  126.759 1.00 0.00 ? 182 U A "C5'"  1  
ATOM 5164   C "C4'"  . U A 1 161 ? 118.297 93.533  127.027 1.00 0.00 ? 182 U A "C4'"  1  
ATOM 5165   O "O4'"  . U A 1 161 ? 118.968 93.476  128.295 1.00 0.00 ? 182 U A "O4'"  1  
ATOM 5166   C "C3'"  . U A 1 161 ? 119.318 94.074  126.027 1.00 0.00 ? 182 U A "C3'"  1  
ATOM 5167   O "O3'"  . U A 1 161 ? 118.864 95.137  125.162 1.00 0.00 ? 182 U A "O3'"  1  
ATOM 5168   C "C2'"  . U A 1 161 ? 120.369 94.781  126.895 1.00 0.00 ? 182 U A "C2'"  1  
ATOM 5169   O "O2'"  . U A 1 161 ? 120.407 96.171  126.721 1.00 0.00 ? 182 U A "O2'"  1  
ATOM 5170   C "C1'"  . U A 1 161 ? 119.902 94.503  128.320 1.00 0.00 ? 182 U A "C1'"  1  
ATOM 5171   N N1     . U A 1 161 ? 120.913 94.248  129.345 1.00 0.00 ? 182 U A N1     1  
ATOM 5172   C C2     . U A 1 161 ? 121.644 95.344  129.769 1.00 0.00 ? 182 U A C2     1  
ATOM 5173   O O2     . U A 1 161 ? 121.524 96.453  129.267 1.00 0.00 ? 182 U A O2     1  
ATOM 5174   N N3     . U A 1 161 ? 122.522 95.095  130.792 1.00 0.00 ? 182 U A N3     1  
ATOM 5175   C C4     . U A 1 161 ? 122.742 93.887  131.410 1.00 0.00 ? 182 U A C4     1  
ATOM 5176   O O4     . U A 1 161 ? 123.470 93.849  132.397 1.00 0.00 ? 182 U A O4     1  
ATOM 5177   C C5     . U A 1 161 ? 121.975 92.792  130.882 1.00 0.00 ? 182 U A C5     1  
ATOM 5178   C C6     . U A 1 161 ? 121.106 93.007  129.891 1.00 0.00 ? 182 U A C6     1  
ATOM 5179   H "H5'"  . U A 1 161 ? 116.933 92.155  126.335 1.00 0.00 ? 182 U A "H5'"  1  
ATOM 5180   H "H5''" . U A 1 161 ? 118.445 91.666  126.170 1.00 0.00 ? 182 U A "H5''" 1  
ATOM 5181   H "H4'"  . U A 1 161 ? 117.523 94.130  127.070 1.00 0.00 ? 182 U A "H4'"  1  
ATOM 5182   H "H3'"  . U A 1 161 ? 119.627 93.342  125.454 1.00 0.00 ? 182 U A "H3'"  1  
ATOM 5183   H "H2'"  . U A 1 161 ? 121.261 94.400  126.760 1.00 0.00 ? 182 U A "H2'"  1  
ATOM 5184   H "HO2'" . U A 1 161 ? 119.988 96.395  125.864 1.00 0.00 ? 182 U A "HO2'" 1  
ATOM 5185   H "H1'"  . U A 1 161 ? 119.376 95.264  128.641 1.00 0.00 ? 182 U A "H1'"  1  
ATOM 5186   H H3     . U A 1 161 ? 123.047 95.858  131.111 1.00 0.00 ? 182 U A H3     1  
ATOM 5187   H H5     . U A 1 161 ? 122.088 91.890  131.247 1.00 0.00 ? 182 U A H5     1  
ATOM 5188   H H6     . U A 1 161 ? 120.599 92.241  129.552 1.00 0.00 ? 182 U A H6     1  
ATOM 5189   P P      . A A 1 162 ? 117.706 94.849  124.091 1.00 0.00 ? 183 A A P      1  
ATOM 5190   O OP1    . A A 1 162 ? 116.755 96.007  124.129 1.00 0.00 ? 183 A A OP1    1  
ATOM 5191   O OP2    . A A 1 162 ? 117.200 93.497  124.402 1.00 0.00 ? 183 A A OP2    1  
ATOM 5192   O "O5'"  . A A 1 162 ? 118.341 94.821  122.631 1.00 0.00 ? 183 A A "O5'"  1  
ATOM 5193   C "C5'"  . A A 1 162 ? 118.244 93.645  121.829 1.00 0.00 ? 183 A A "C5'"  1  
ATOM 5194   C "C4'"  . A A 1 162 ? 118.109 93.993  120.362 1.00 0.00 ? 183 A A "C4'"  1  
ATOM 5195   O "O4'"  . A A 1 162 ? 117.711 92.848  119.555 1.00 0.00 ? 183 A A "O4'"  1  
ATOM 5196   C "C3'"  . A A 1 162 ? 117.049 95.003  120.020 1.00 0.00 ? 183 A A "C3'"  1  
ATOM 5197   O "O3'"  . A A 1 162 ? 117.403 96.314  120.388 1.00 0.00 ? 183 A A "O3'"  1  
ATOM 5198   C "C2'"  . A A 1 162 ? 116.930 94.837  118.515 1.00 0.00 ? 183 A A "C2'"  1  
ATOM 5199   O "O2'"  . A A 1 162 ? 117.955 95.567  117.887 1.00 0.00 ? 183 A A "O2'"  1  
ATOM 5200   C "C1'"  . A A 1 162 ? 117.118 93.320  118.350 1.00 0.00 ? 183 A A "C1'"  1  
ATOM 5201   N N9     . A A 1 162 ? 115.875 92.572  118.099 1.00 0.00 ? 183 A A N9     1  
ATOM 5202   C C8     . A A 1 162 ? 114.887 92.221  118.994 1.00 0.00 ? 183 A A C8     1  
ATOM 5203   N N7     . A A 1 162 ? 113.900 91.528  118.458 1.00 0.00 ? 183 A A N7     1  
ATOM 5204   C C5     . A A 1 162 ? 114.260 91.412  117.123 1.00 0.00 ? 183 A A C5     1  
ATOM 5205   C C6     . A A 1 162 ? 113.643 90.763  116.013 1.00 0.00 ? 183 A A C6     1  
ATOM 5206   N N6     . A A 1 162 ? 112.493 90.081  116.084 1.00 0.00 ? 183 A A N6     1  
ATOM 5207   N N1     . A A 1 162 ? 114.268 90.841  114.817 1.00 0.00 ? 183 A A N1     1  
ATOM 5208   C C2     . A A 1 162 ? 115.427 91.519  114.744 1.00 0.00 ? 183 A A C2     1  
ATOM 5209   N N3     . A A 1 162 ? 116.105 92.160  115.709 1.00 0.00 ? 183 A A N3     1  
ATOM 5210   C C4     . A A 1 162 ? 115.465 92.063  116.884 1.00 0.00 ? 183 A A C4     1  
ATOM 5211   H "H5'"  . A A 1 162 ? 117.459 93.129  122.112 1.00 0.00 ? 183 A A "H5'"  1  
ATOM 5212   H "H5''" . A A 1 162 ? 119.047 93.101  121.959 1.00 0.00 ? 183 A A "H5''" 1  
ATOM 5213   H "H4'"  . A A 1 162 ? 118.976 94.306  120.030 1.00 0.00 ? 183 A A "H4'"  1  
ATOM 5214   H "H3'"  . A A 1 162 ? 116.213 94.756  120.468 1.00 0.00 ? 183 A A "H3'"  1  
ATOM 5215   H "H2'"  . A A 1 162 ? 116.037 95.080  118.196 1.00 0.00 ? 183 A A "H2'"  1  
ATOM 5216   H "HO2'" . A A 1 162 ? 117.593 95.999  117.087 1.00 0.00 ? 183 A A "HO2'" 1  
ATOM 5217   H "H1'"  . A A 1 162 ? 117.734 93.145  117.606 1.00 0.00 ? 183 A A "H1'"  1  
ATOM 5218   H H8     . A A 1 162 ? 114.915 92.466  119.944 1.00 0.00 ? 183 A A H8     1  
ATOM 5219   H H61    . A A 1 162 ? 112.127 89.654  115.281 1.00 0.00 ? 183 A A H61    1  
ATOM 5220   H H62    . A A 1 162 ? 112.017 90.007  116.937 1.00 0.00 ? 183 A A H62    1  
ATOM 5221   H H2     . A A 1 162 ? 115.834 91.549  113.853 1.00 0.00 ? 183 A A H2     1  
ATOM 5222   P P      . A A 1 163 ? 116.249 97.279  120.925 1.00 0.00 ? 184 A A P      1  
ATOM 5223   O OP1    . A A 1 163 ? 116.710 97.769  122.238 1.00 0.00 ? 184 A A OP1    1  
ATOM 5224   O OP2    . A A 1 163 ? 114.960 96.530  120.873 1.00 0.00 ? 184 A A OP2    1  
ATOM 5225   O "O5'"  . A A 1 163 ? 116.175 98.442  119.820 1.00 0.00 ? 184 A A "O5'"  1  
ATOM 5226   C "C5'"  . A A 1 163 ? 117.274 98.747  118.943 1.00 0.00 ? 184 A A "C5'"  1  
ATOM 5227   C "C4'"  . A A 1 163 ? 116.805 98.916  117.491 1.00 0.00 ? 184 A A "C4'"  1  
ATOM 5228   O "O4'"  . A A 1 163 ? 116.565 97.630  116.872 1.00 0.00 ? 184 A A "O4'"  1  
ATOM 5229   C "C3'"  . A A 1 163 ? 115.558 99.751  117.216 1.00 0.00 ? 184 A A "C3'"  1  
ATOM 5230   O "O3'"  . A A 1 163 ? 115.953 101.116 117.047 1.00 0.00 ? 184 A A "O3'"  1  
ATOM 5231   C "C2'"  . A A 1 163 ? 115.013 99.167  115.900 1.00 0.00 ? 184 A A "C2'"  1  
ATOM 5232   O "O2'"  . A A 1 163 ? 115.531 99.735  114.723 1.00 0.00 ? 184 A A "O2'"  1  
ATOM 5233   C "C1'"  . A A 1 163 ? 115.488 97.718  115.950 1.00 0.00 ? 184 A A "C1'"  1  
ATOM 5234   N N9     . A A 1 163 ? 114.473 96.757  116.374 1.00 0.00 ? 184 A A N9     1  
ATOM 5235   C C8     . A A 1 163 ? 114.160 96.429  117.666 1.00 0.00 ? 184 A A C8     1  
ATOM 5236   N N7     . A A 1 163 ? 113.285 95.463  117.770 1.00 0.00 ? 184 A A N7     1  
ATOM 5237   C C5     . A A 1 163 ? 112.981 95.152  116.455 1.00 0.00 ? 184 A A C5     1  
ATOM 5238   C C6     . A A 1 163 ? 112.126 94.206  115.899 1.00 0.00 ? 184 A A C6     1  
ATOM 5239   N N6     . A A 1 163 ? 111.410 93.351  116.636 1.00 0.00 ? 184 A A N6     1  
ATOM 5240   N N1     . A A 1 163 ? 112.030 94.153  114.552 1.00 0.00 ? 184 A A N1     1  
ATOM 5241   C C2     . A A 1 163 ? 112.765 95.002  113.831 1.00 0.00 ? 184 A A C2     1  
ATOM 5242   N N3     . A A 1 163 ? 113.618 95.940  114.244 1.00 0.00 ? 184 A A N3     1  
ATOM 5243   C C4     . A A 1 163 ? 113.682 95.961  115.583 1.00 0.00 ? 184 A A C4     1  
ATOM 5244   H "H5'"  . A A 1 163 ? 117.929 98.019  118.985 1.00 0.00 ? 184 A A "H5'"  1  
ATOM 5245   H "H5''" . A A 1 163 ? 117.702 99.576  119.240 1.00 0.00 ? 184 A A "H5''" 1  
ATOM 5246   H "H4'"  . A A 1 163 ? 117.505 99.378  116.984 1.00 0.00 ? 184 A A "H4'"  1  
ATOM 5247   H "H3'"  . A A 1 163 ? 114.933 99.648  117.962 1.00 0.00 ? 184 A A "H3'"  1  
ATOM 5248   H "H2'"  . A A 1 163 ? 114.033 99.201  115.872 1.00 0.00 ? 184 A A "H2'"  1  
ATOM 5249   H "HO2'" . A A 1 163 ? 114.806 99.832  114.070 1.00 0.00 ? 184 A A "HO2'" 1  
ATOM 5250   H "H1'"  . A A 1 163 ? 115.811 97.450  115.064 1.00 0.00 ? 184 A A "H1'"  1  
ATOM 5251   H H8     . A A 1 163 ? 114.568 96.866  118.443 1.00 0.00 ? 184 A A H8     1  
ATOM 5252   H H61    . A A 1 163 ? 110.826 92.696  116.198 1.00 0.00 ? 184 A A H61    1  
ATOM 5253   H H62    . A A 1 163 ? 111.470 93.377  117.613 1.00 0.00 ? 184 A A H62    1  
ATOM 5254   H H2     . A A 1 163 ? 112.663 94.923  112.859 1.00 0.00 ? 184 A A H2     1  
ATOM 5255   P P      . U A 1 164 ? 114.893 102.302 117.261 1.00 0.00 ? 185 U A P      1  
ATOM 5256   O OP1    . U A 1 164 ? 113.645 101.876 116.587 1.00 0.00 ? 185 U A OP1    1  
ATOM 5257   O OP2    . U A 1 164 ? 115.563 103.571 116.847 1.00 0.00 ? 185 U A OP2    1  
ATOM 5258   O "O5'"  . U A 1 164 ? 114.653 102.327 118.842 1.00 0.00 ? 185 U A "O5'"  1  
ATOM 5259   C "C5'"  . U A 1 164 ? 115.720 102.663 119.740 1.00 0.00 ? 185 U A "C5'"  1  
ATOM 5260   C "C4'"  . U A 1 164 ? 115.189 103.374 120.975 1.00 0.00 ? 185 U A "C4'"  1  
ATOM 5261   O "O4'"  . U A 1 164 ? 114.196 104.337 120.571 1.00 0.00 ? 185 U A "O4'"  1  
ATOM 5262   C "C3'"  . U A 1 164 ? 114.481 102.536 122.028 1.00 0.00 ? 185 U A "C3'"  1  
ATOM 5263   O "O3'"  . U A 1 164 ? 115.424 102.142 123.016 1.00 0.00 ? 185 U A "O3'"  1  
ATOM 5264   C "C2'"  . U A 1 164 ? 113.578 103.552 122.733 1.00 0.00 ? 185 U A "C2'"  1  
ATOM 5265   O "O2'"  . U A 1 164 ? 114.158 104.163 123.860 1.00 0.00 ? 185 U A "O2'"  1  
ATOM 5266   C "C1'"  . U A 1 164 ? 113.364 104.622 121.668 1.00 0.00 ? 185 U A "C1'"  1  
ATOM 5267   N N1     . U A 1 164 ? 111.971 104.648 121.232 1.00 0.00 ? 185 U A N1     1  
ATOM 5268   C C2     . U A 1 164 ? 111.288 105.844 121.377 1.00 0.00 ? 185 U A C2     1  
ATOM 5269   O O2     . U A 1 164 ? 111.823 106.861 121.809 1.00 0.00 ? 185 U A O2     1  
ATOM 5270   N N3     . U A 1 164 ? 109.957 105.799 121.004 1.00 0.00 ? 185 U A N3     1  
ATOM 5271   C C4     . U A 1 164 ? 109.254 104.688 120.518 1.00 0.00 ? 185 U A C4     1  
ATOM 5272   O O4     . U A 1 164 ? 108.032 104.774 120.293 1.00 0.00 ? 185 U A O4     1  
ATOM 5273   C C5     . U A 1 164 ? 110.052 103.494 120.380 1.00 0.00 ? 185 U A C5     1  
ATOM 5274   C C6     . U A 1 164 ? 111.352 103.519 120.729 1.00 0.00 ? 185 U A C6     1  
ATOM 5275   H "H5'"  . U A 1 164 ? 116.356 103.247 119.277 1.00 0.00 ? 185 U A "H5'"  1  
ATOM 5276   H "H5''" . U A 1 164 ? 116.180 101.841 120.012 1.00 0.00 ? 185 U A "H5''" 1  
ATOM 5277   H "H4'"  . U A 1 164 ? 115.931 103.838 121.415 1.00 0.00 ? 185 U A "H4'"  1  
ATOM 5278   H "H3'"  . U A 1 164 ? 114.071 101.756 121.599 1.00 0.00 ? 185 U A "H3'"  1  
ATOM 5279   H "H2'"  . U A 1 164 ? 112.715 103.157 122.977 1.00 0.00 ? 185 U A "H2'"  1  
ATOM 5280   H "HO2'" . U A 1 164 ? 114.902 103.608 124.176 1.00 0.00 ? 185 U A "HO2'" 1  
ATOM 5281   H "H1'"  . U A 1 164 ? 113.620 105.495 122.032 1.00 0.00 ? 185 U A "H1'"  1  
ATOM 5282   H H3     . U A 1 164 ? 109.452 106.633 121.091 1.00 0.00 ? 185 U A H3     1  
ATOM 5283   H H5     . U A 1 164 ? 109.650 102.669 120.035 1.00 0.00 ? 185 U A H5     1  
ATOM 5284   H H6     . U A 1 164 ? 111.868 102.694 120.626 1.00 0.00 ? 185 U A H6     1  
ATOM 5285   P P      . A A 1 165 ? 116.023 100.661 123.028 1.00 0.00 ? 186 A A P      1  
ATOM 5286   O OP1    . A A 1 165 ? 117.424 100.789 122.553 1.00 0.00 ? 186 A A OP1    1  
ATOM 5287   O OP2    . A A 1 165 ? 115.080 99.739  122.347 1.00 0.00 ? 186 A A OP2    1  
ATOM 5288   O "O5'"  . A A 1 165 ? 116.045 100.273 124.566 1.00 0.00 ? 186 A A "O5'"  1  
ATOM 5289   C "C5'"  . A A 1 165 ? 116.331 101.264 125.532 1.00 0.00 ? 186 A A "C5'"  1  
ATOM 5290   C "C4'"  . A A 1 165 ? 117.419 100.788 126.451 1.00 0.00 ? 186 A A "C4'"  1  
ATOM 5291   O "O4'"  . A A 1 165 ? 116.867 100.029 127.554 1.00 0.00 ? 186 A A "O4'"  1  
ATOM 5292   C "C3'"  . A A 1 165 ? 118.481 99.912  125.807 1.00 0.00 ? 186 A A "C3'"  1  
ATOM 5293   O "O3'"  . A A 1 165 ? 119.437 100.795 125.211 1.00 0.00 ? 186 A A "O3'"  1  
ATOM 5294   C "C2'"  . A A 1 165 ? 118.990 99.132  127.024 1.00 0.00 ? 186 A A "C2'"  1  
ATOM 5295   O "O2'"  . A A 1 165 ? 119.899 99.868  127.818 1.00 0.00 ? 186 A A "O2'"  1  
ATOM 5296   C "C1'"  . A A 1 165 ? 117.703 98.931  127.835 1.00 0.00 ? 186 A A "C1'"  1  
ATOM 5297   N N9     . A A 1 165 ? 116.927 97.749  127.492 1.00 0.00 ? 186 A A N9     1  
ATOM 5298   C C8     . A A 1 165 ? 116.298 97.486  126.299 1.00 0.00 ? 186 A A C8     1  
ATOM 5299   N N7     . A A 1 165 ? 115.618 96.364  126.292 1.00 0.00 ? 186 A A N7     1  
ATOM 5300   C C5     . A A 1 165 ? 115.823 95.849  127.566 1.00 0.00 ? 186 A A C5     1  
ATOM 5301   C C6     . A A 1 165 ? 115.351 94.687  128.195 1.00 0.00 ? 186 A A C6     1  
ATOM 5302   N N6     . A A 1 165 ? 114.564 93.804  127.609 1.00 0.00 ? 186 A A N6     1  
ATOM 5303   N N1     . A A 1 165 ? 115.719 94.468  129.463 1.00 0.00 ? 186 A A N1     1  
ATOM 5304   C C2     . A A 1 165 ? 116.517 95.368  130.060 1.00 0.00 ? 186 A A C2     1  
ATOM 5305   N N3     . A A 1 165 ? 117.037 96.505  129.573 1.00 0.00 ? 186 A A N3     1  
ATOM 5306   C C4     . A A 1 165 ? 116.640 96.687  128.309 1.00 0.00 ? 186 A A C4     1  
ATOM 5307   H "H5'"  . A A 1 165 ? 115.519 101.449 126.048 1.00 0.00 ? 186 A A "H5'"  1  
ATOM 5308   H "H5''" . A A 1 165 ? 116.614 102.082 125.078 1.00 0.00 ? 186 A A "H5''" 1  
ATOM 5309   H "H4'"  . A A 1 165 ? 117.890 101.565 126.815 1.00 0.00 ? 186 A A "H4'"  1  
ATOM 5310   H "H3'"  . A A 1 165 ? 118.055 99.323  125.148 1.00 0.00 ? 186 A A "H3'"  1  
ATOM 5311   H "H2'"  . A A 1 165 ? 119.380 98.272  126.762 1.00 0.00 ? 186 A A "H2'"  1  
ATOM 5312   H "HO2'" . A A 1 165 ? 120.618 99.271  128.114 1.00 0.00 ? 186 A A "HO2'" 1  
ATOM 5313   H "H1'"  . A A 1 165 ? 117.924 98.876  128.789 1.00 0.00 ? 186 A A "H1'"  1  
ATOM 5314   H H8     . A A 1 165 ? 116.347 98.086  125.524 1.00 0.00 ? 186 A A H8     1  
ATOM 5315   H H61    . A A 1 165 ? 114.264 93.013  128.103 1.00 0.00 ? 186 A A H61    1  
ATOM 5316   H H62    . A A 1 165 ? 114.278 93.940  126.682 1.00 0.00 ? 186 A A H62    1  
ATOM 5317   H H2     . A A 1 165 ? 116.753 95.160  130.988 1.00 0.00 ? 186 A A H2     1  
ATOM 5318   P P      . A A 1 166 ? 120.769 100.192 124.553 1.00 0.00 ? 187 A A P      1  
ATOM 5319   O OP1    . A A 1 166 ? 121.546 101.295 123.936 1.00 0.00 ? 187 A A OP1    1  
ATOM 5320   O OP2    . A A 1 166 ? 120.242 99.098  123.699 1.00 0.00 ? 187 A A OP2    1  
ATOM 5321   O "O5'"  . A A 1 166 ? 121.664 99.536  125.696 1.00 0.00 ? 187 A A "O5'"  1  
ATOM 5322   C "C5'"  . A A 1 166 ? 122.058 98.173  125.621 1.00 0.00 ? 187 A A "C5'"  1  
ATOM 5323   C "C4'"  . A A 1 166 ? 123.339 98.008  124.843 1.00 0.00 ? 187 A A "C4'"  1  
ATOM 5324   O "O4'"  . A A 1 166 ? 124.466 97.988  125.764 1.00 0.00 ? 187 A A "O4'"  1  
ATOM 5325   C "C3'"  . A A 1 166 ? 123.480 96.713  124.058 1.00 0.00 ? 187 A A "C3'"  1  
ATOM 5326   O "O3'"  . A A 1 166 ? 122.796 96.739  122.817 1.00 0.00 ? 187 A A "O3'"  1  
ATOM 5327   C "C2'"  . A A 1 166 ? 124.992 96.570  123.934 1.00 0.00 ? 187 A A "C2'"  1  
ATOM 5328   O "O2'"  . A A 1 166 ? 125.504 97.388  122.893 1.00 0.00 ? 187 A A "O2'"  1  
ATOM 5329   C "C1'"  . A A 1 166 ? 125.460 97.127  125.279 1.00 0.00 ? 187 A A "C1'"  1  
ATOM 5330   N N9     . A A 1 166 ? 125.701 96.060  126.269 1.00 0.00 ? 187 A A N9     1  
ATOM 5331   C C8     . A A 1 166 ? 125.035 94.866  126.403 1.00 0.00 ? 187 A A C8     1  
ATOM 5332   N N7     . A A 1 166 ? 125.480 94.120  127.383 1.00 0.00 ? 187 A A N7     1  
ATOM 5333   C C5     . A A 1 166 ? 126.508 94.872  127.934 1.00 0.00 ? 187 A A C5     1  
ATOM 5334   C C6     . A A 1 166 ? 127.383 94.637  129.010 1.00 0.00 ? 187 A A C6     1  
ATOM 5335   N N6     . A A 1 166 ? 127.360 93.529  129.754 1.00 0.00 ? 187 A A N6     1  
ATOM 5336   N N1     . A A 1 166 ? 128.294 95.590  129.299 1.00 0.00 ? 187 A A N1     1  
ATOM 5337   C C2     . A A 1 166 ? 128.318 96.702  128.553 1.00 0.00 ? 187 A A C2     1  
ATOM 5338   N N3     . A A 1 166 ? 127.550 97.038  127.519 1.00 0.00 ? 187 A A N3     1  
ATOM 5339   C C4     . A A 1 166 ? 126.655 96.069  127.257 1.00 0.00 ? 187 A A C4     1  
ATOM 5340   H "H5'"  . A A 1 166 ? 121.349 97.659  125.182 1.00 0.00 ? 187 A A "H5'"  1  
ATOM 5341   H "H5''" . A A 1 166 ? 122.188 97.827  126.528 1.00 0.00 ? 187 A A "H5''" 1  
ATOM 5342   H "H4'"  . A A 1 166 ? 123.443 98.764  124.228 1.00 0.00 ? 187 A A "H4'"  1  
ATOM 5343   H "H3'"  . A A 1 166 ? 123.136 95.971  124.598 1.00 0.00 ? 187 A A "H3'"  1  
ATOM 5344   H "H2'"  . A A 1 166 ? 125.257 95.632  123.823 1.00 0.00 ? 187 A A "H2'"  1  
ATOM 5345   H "HO2'" . A A 1 166 ? 126.472 97.254  122.828 1.00 0.00 ? 187 A A "HO2'" 1  
ATOM 5346   H "H1'"  . A A 1 166 ? 126.283 97.644  125.149 1.00 0.00 ? 187 A A "H1'"  1  
ATOM 5347   H H8     . A A 1 166 ? 124.296 94.597  125.818 1.00 0.00 ? 187 A A H8     1  
ATOM 5348   H H61    . A A 1 166 ? 127.996 93.421  130.492 1.00 0.00 ? 187 A A H61    1  
ATOM 5349   H H62    . A A 1 166 ? 126.707 92.823  129.563 1.00 0.00 ? 187 A A H62    1  
ATOM 5350   H H2     . A A 1 166 ? 128.998 97.363  128.804 1.00 0.00 ? 187 A A H2     1  
ATOM 5351   P P      . G A 1 167 ? 122.255 95.375  122.164 1.00 0.00 ? 188 G A P      1  
ATOM 5352   O OP1    . G A 1 167 ? 121.045 95.695  121.364 1.00 0.00 ? 188 G A OP1    1  
ATOM 5353   O OP2    . G A 1 167 ? 122.175 94.352  123.237 1.00 0.00 ? 188 G A OP2    1  
ATOM 5354   O "O5'"  . G A 1 167 ? 123.411 94.943  121.156 1.00 0.00 ? 188 G A "O5'"  1  
ATOM 5355   C "C5'"  . G A 1 167 ? 123.132 94.110  120.041 1.00 0.00 ? 188 G A "C5'"  1  
ATOM 5356   C "C4'"  . G A 1 167 ? 124.382 93.796  119.257 1.00 0.00 ? 188 G A "C4'"  1  
ATOM 5357   O "O4'"  . G A 1 167 ? 124.877 95.005  118.629 1.00 0.00 ? 188 G A "O4'"  1  
ATOM 5358   C "C3'"  . G A 1 167 ? 125.565 93.283  120.064 1.00 0.00 ? 188 G A "C3'"  1  
ATOM 5359   O "O3'"  . G A 1 167 ? 125.495 91.891  120.324 1.00 0.00 ? 188 G A "O3'"  1  
ATOM 5360   C "C2'"  . G A 1 167 ? 126.742 93.641  119.169 1.00 0.00 ? 188 G A "C2'"  1  
ATOM 5361   O "O2'"  . G A 1 167 ? 126.864 92.728  118.088 1.00 0.00 ? 188 G A "O2'"  1  
ATOM 5362   C "C1'"  . G A 1 167 ? 126.296 95.003  118.628 1.00 0.00 ? 188 G A "C1'"  1  
ATOM 5363   N N9     . G A 1 167 ? 126.768 96.117  119.471 1.00 0.00 ? 188 G A N9     1  
ATOM 5364   C C8     . G A 1 167 ? 125.998 97.022  120.161 1.00 0.00 ? 188 G A C8     1  
ATOM 5365   N N7     . G A 1 167 ? 126.705 97.900  120.821 1.00 0.00 ? 188 G A N7     1  
ATOM 5366   C C5     . G A 1 167 ? 128.021 97.553  120.551 1.00 0.00 ? 188 G A C5     1  
ATOM 5367   C C6     . G A 1 167 ? 129.235 98.141  120.991 1.00 0.00 ? 188 G A C6     1  
ATOM 5368   O O6     . G A 1 167 ? 129.394 99.119  121.731 1.00 0.00 ? 188 G A O6     1  
ATOM 5369   N N1     . G A 1 167 ? 130.343 97.474  120.478 1.00 0.00 ? 188 G A N1     1  
ATOM 5370   C C2     . G A 1 167 ? 130.291 96.380  119.650 1.00 0.00 ? 188 G A C2     1  
ATOM 5371   N N2     . G A 1 167 ? 131.469 95.872  119.258 1.00 0.00 ? 188 G A N2     1  
ATOM 5372   N N3     . G A 1 167 ? 129.166 95.822  119.233 1.00 0.00 ? 188 G A N3     1  
ATOM 5373   C C4     . G A 1 167 ? 128.078 96.455  119.719 1.00 0.00 ? 188 G A C4     1  
ATOM 5374   H "H5'"  . G A 1 167 ? 122.492 94.564  119.454 1.00 0.00 ? 188 G A "H5'"  1  
ATOM 5375   H "H5''" . G A 1 167 ? 122.735 93.272  120.359 1.00 0.00 ? 188 G A "H5''" 1  
ATOM 5376   H "H4'"  . G A 1 167 ? 124.166 93.143  118.558 1.00 0.00 ? 188 G A "H4'"  1  
ATOM 5377   H "H3'"  . G A 1 167 ? 125.634 93.765  120.914 1.00 0.00 ? 188 G A "H3'"  1  
ATOM 5378   H "H2'"  . G A 1 167 ? 127.575 93.711  119.681 1.00 0.00 ? 188 G A "H2'"  1  
ATOM 5379   H "HO2'" . G A 1 167 ? 127.647 92.972  117.551 1.00 0.00 ? 188 G A "HO2'" 1  
ATOM 5380   H "H1'"  . G A 1 167 ? 126.633 95.118  117.715 1.00 0.00 ? 188 G A "H1'"  1  
ATOM 5381   H H8     . G A 1 167 ? 125.019 97.012  120.158 1.00 0.00 ? 188 G A H8     1  
ATOM 5382   H H1     . G A 1 167 ? 131.228 97.812  120.730 1.00 0.00 ? 188 G A H1     1  
ATOM 5383   H H21    . G A 1 167 ? 132.307 96.280  119.563 1.00 0.00 ? 188 G A H21    1  
ATOM 5384   H H22    . G A 1 167 ? 131.494 95.091  118.666 1.00 0.00 ? 188 G A H22    1  
ATOM 5385   P P      . C A 1 168 ? 125.897 91.319  121.770 1.00 0.00 ? 189 C A P      1  
ATOM 5386   O OP1    . C A 1 168 ? 125.780 89.840  121.728 1.00 0.00 ? 189 C A OP1    1  
ATOM 5387   O OP2    . C A 1 168 ? 125.144 92.086  122.795 1.00 0.00 ? 189 C A OP2    1  
ATOM 5388   O "O5'"  . C A 1 168 ? 127.441 91.686  121.915 1.00 0.00 ? 189 C A "O5'"  1  
ATOM 5389   C "C5'"  . C A 1 168 ? 128.375 91.260  120.936 1.00 0.00 ? 189 C A "C5'"  1  
ATOM 5390   C "C4'"  . C A 1 168 ? 129.615 92.137  120.933 1.00 0.00 ? 189 C A "C4'"  1  
ATOM 5391   O "O4'"  . C A 1 168 ? 129.376 93.233  121.874 1.00 0.00 ? 189 C A "O4'"  1  
ATOM 5392   C "C3'"  . C A 1 168 ? 130.906 91.480  121.420 1.00 0.00 ? 189 C A "C3'"  1  
ATOM 5393   O "O3'"  . C A 1 168 ? 131.591 90.785  120.367 1.00 0.00 ? 189 C A "O3'"  1  
ATOM 5394   C "C2'"  . C A 1 168 ? 131.613 92.626  122.135 1.00 0.00 ? 189 C A "C2'"  1  
ATOM 5395   O "O2'"  . C A 1 168 ? 132.221 93.563  121.270 1.00 0.00 ? 189 C A "O2'"  1  
ATOM 5396   C "C1'"  . C A 1 168 ? 130.421 93.289  122.829 1.00 0.00 ? 189 C A "C1'"  1  
ATOM 5397   N N1     . C A 1 168 ? 129.952 92.536  124.005 1.00 0.00 ? 189 C A N1     1  
ATOM 5398   C C2     . C A 1 168 ? 130.725 92.511  125.171 1.00 0.00 ? 189 C A C2     1  
ATOM 5399   O O2     . C A 1 168 ? 131.764 93.203  125.234 1.00 0.00 ? 189 C A O2     1  
ATOM 5400   N N3     . C A 1 168 ? 130.318 91.733  126.205 1.00 0.00 ? 189 C A N3     1  
ATOM 5401   C C4     . C A 1 168 ? 129.190 91.020  126.103 1.00 0.00 ? 189 C A C4     1  
ATOM 5402   N N4     . C A 1 168 ? 128.846 90.237  127.119 1.00 0.00 ? 189 C A N4     1  
ATOM 5403   C C5     . C A 1 168 ? 128.367 91.077  124.950 1.00 0.00 ? 189 C A C5     1  
ATOM 5404   C C6     . C A 1 168 ? 128.778 91.841  123.940 1.00 0.00 ? 189 C A C6     1  
ATOM 5405   H "H5'"  . C A 1 168 ? 127.951 91.298  120.053 1.00 0.00 ? 189 C A "H5'"  1  
ATOM 5406   H "H5''" . C A 1 168 ? 128.637 90.335  121.125 1.00 0.00 ? 189 C A "H5''" 1  
ATOM 5407   H "H4'"  . C A 1 168 ? 129.748 92.492  120.030 1.00 0.00 ? 189 C A "H4'"  1  
ATOM 5408   H "H3'"  . C A 1 168 ? 130.696 90.853  122.144 1.00 0.00 ? 189 C A "H3'"  1  
ATOM 5409   H "H2'"  . C A 1 168 ? 132.270 92.294  122.782 1.00 0.00 ? 189 C A "H2'"  1  
ATOM 5410   H "HO2'" . C A 1 168 ? 131.637 94.345  121.186 1.00 0.00 ? 189 C A "HO2'" 1  
ATOM 5411   H "H1'"  . C A 1 168 ? 130.674 94.193  123.109 1.00 0.00 ? 189 C A "H1'"  1  
ATOM 5412   H H41    . C A 1 168 ? 129.414 90.190  127.916 1.00 0.00 ? 189 C A H41    1  
ATOM 5413   H H42    . C A 1 168 ? 128.024 89.705  127.070 1.00 0.00 ? 189 C A H42    1  
ATOM 5414   H H5     . C A 1 168 ? 127.527 90.575  124.901 1.00 0.00 ? 189 C A H5     1  
ATOM 5415   H H6     . C A 1 168 ? 128.225 91.894  123.134 1.00 0.00 ? 189 C A H6     1  
ATOM 5416   P P      . U A 1 169 ? 132.863 91.442  119.634 1.00 0.00 ? 190 U A P      1  
ATOM 5417   O OP1    . U A 1 169 ? 132.428 92.698  118.954 1.00 0.00 ? 190 U A OP1    1  
ATOM 5418   O OP2    . U A 1 169 ? 133.484 90.355  118.836 1.00 0.00 ? 190 U A OP2    1  
ATOM 5419   O "O5'"  . U A 1 169 ? 133.873 91.806  120.813 1.00 0.00 ? 190 U A "O5'"  1  
ATOM 5420   C "C5'"  . U A 1 169 ? 134.828 92.857  120.646 1.00 0.00 ? 190 U A "C5'"  1  
ATOM 5421   C "C4'"  . U A 1 169 ? 135.873 92.800  121.728 1.00 0.00 ? 190 U A "C4'"  1  
ATOM 5422   O "O4'"  . U A 1 169 ? 135.238 93.014  123.018 1.00 0.00 ? 190 U A "O4'"  1  
ATOM 5423   C "C3'"  . U A 1 169 ? 136.588 91.470  121.875 1.00 0.00 ? 190 U A "C3'"  1  
ATOM 5424   O "O3'"  . U A 1 169 ? 137.675 91.351  120.967 1.00 0.00 ? 190 U A "O3'"  1  
ATOM 5425   C "C2'"  . U A 1 169 ? 137.064 91.543  123.316 1.00 0.00 ? 190 U A "C2'"  1  
ATOM 5426   O "O2'"  . U A 1 169 ? 138.198 92.375  123.476 1.00 0.00 ? 190 U A "O2'"  1  
ATOM 5427   C "C1'"  . U A 1 169 ? 135.835 92.169  123.983 1.00 0.00 ? 190 U A "C1'"  1  
ATOM 5428   N N1     . U A 1 169 ? 134.850 91.141  124.330 1.00 0.00 ? 190 U A N1     1  
ATOM 5429   C C2     . U A 1 169 ? 134.971 90.514  125.555 1.00 0.00 ? 190 U A C2     1  
ATOM 5430   O O2     . U A 1 169 ? 135.872 90.766  126.345 1.00 0.00 ? 190 U A O2     1  
ATOM 5431   N N3     . U A 1 169 ? 133.999 89.579  125.815 1.00 0.00 ? 190 U A N3     1  
ATOM 5432   C C4     . U A 1 169 ? 132.949 89.213  124.987 1.00 0.00 ? 190 U A C4     1  
ATOM 5433   O O4     . U A 1 169 ? 132.110 88.400  125.384 1.00 0.00 ? 190 U A O4     1  
ATOM 5434   C C5     . U A 1 169 ? 132.917 89.894  123.732 1.00 0.00 ? 190 U A C5     1  
ATOM 5435   C C6     . U A 1 169 ? 133.841 90.812  123.457 1.00 0.00 ? 190 U A C6     1  
ATOM 5436   H "H5'"  . U A 1 169 ? 134.363 93.719  120.684 1.00 0.00 ? 190 U A "H5'"  1  
ATOM 5437   H "H5''" . U A 1 169 ? 135.258 92.762  119.771 1.00 0.00 ? 190 U A "H5''" 1  
ATOM 5438   H "H4'"  . U A 1 169 ? 136.530 93.511  121.571 1.00 0.00 ? 190 U A "H4'"  1  
ATOM 5439   H "H3'"  . U A 1 169 ? 135.951 90.742  121.723 1.00 0.00 ? 190 U A "H3'"  1  
ATOM 5440   H "H2'"  . U A 1 169 ? 137.231 90.651  123.685 1.00 0.00 ? 190 U A "H2'"  1  
ATOM 5441   H "HO2'" . U A 1 169 ? 138.457 92.383  124.421 1.00 0.00 ? 190 U A "HO2'" 1  
ATOM 5442   H "H1'"  . U A 1 169 ? 136.117 92.651  124.789 1.00 0.00 ? 190 U A "H1'"  1  
ATOM 5443   H H3     . U A 1 169 ? 134.056 89.120  126.680 1.00 0.00 ? 190 U A H3     1  
ATOM 5444   H H5     . U A 1 169 ? 132.217 89.689  123.077 1.00 0.00 ? 190 U A H5     1  
ATOM 5445   H H6     . U A 1 169 ? 133.796 91.262  122.589 1.00 0.00 ? 190 U A H6     1  
ATOM 5446   P P      . G A 1 170 ? 138.501 89.981  120.905 1.00 0.00 ? 191 G A P      1  
ATOM 5447   O OP1    . G A 1 170 ? 139.588 90.139  119.904 1.00 0.00 ? 191 G A OP1    1  
ATOM 5448   O OP2    . G A 1 170 ? 137.508 88.891  120.750 1.00 0.00 ? 191 G A OP2    1  
ATOM 5449   O "O5'"  . G A 1 170 ? 139.153 89.897  122.355 1.00 0.00 ? 191 G A "O5'"  1  
ATOM 5450   C "C5'"  . G A 1 170 ? 139.564 88.659  122.907 1.00 0.00 ? 191 G A "C5'"  1  
ATOM 5451   C "C4'"  . G A 1 170 ? 139.845 88.824  124.380 1.00 0.00 ? 191 G A "C4'"  1  
ATOM 5452   O "O4'"  . G A 1 170 ? 138.636 89.285  125.053 1.00 0.00 ? 191 G A "O4'"  1  
ATOM 5453   C "C3'"  . G A 1 170 ? 140.207 87.541  125.103 1.00 0.00 ? 191 G A "C3'"  1  
ATOM 5454   O "O3'"  . G A 1 170 ? 141.592 87.238  124.966 1.00 0.00 ? 191 G A "O3'"  1  
ATOM 5455   C "C2'"  . G A 1 170 ? 139.815 87.874  126.534 1.00 0.00 ? 191 G A "C2'"  1  
ATOM 5456   O "O2'"  . G A 1 170 ? 140.754 88.730  127.152 1.00 0.00 ? 191 G A "O2'"  1  
ATOM 5457   C "C1'"  . G A 1 170 ? 138.504 88.626  126.306 1.00 0.00 ? 191 G A "C1'"  1  
ATOM 5458   N N9     . G A 1 170 ? 137.360 87.723  126.211 1.00 0.00 ? 191 G A N9     1  
ATOM 5459   C C8     . G A 1 170 ? 136.495 87.610  125.153 1.00 0.00 ? 191 G A C8     1  
ATOM 5460   N N7     . G A 1 170 ? 135.574 86.706  125.338 1.00 0.00 ? 191 G A N7     1  
ATOM 5461   C C5     . G A 1 170 ? 135.842 86.191  126.598 1.00 0.00 ? 191 G A C5     1  
ATOM 5462   C C6     . G A 1 170 ? 135.176 85.176  127.337 1.00 0.00 ? 191 G A C6     1  
ATOM 5463   O O6     . G A 1 170 ? 134.189 84.507  127.011 1.00 0.00 ? 191 G A O6     1  
ATOM 5464   N N1     . G A 1 170 ? 135.776 84.965  128.572 1.00 0.00 ? 191 G A N1     1  
ATOM 5465   C C2     . G A 1 170 ? 136.872 85.639  129.039 1.00 0.00 ? 191 G A C2     1  
ATOM 5466   N N2     . G A 1 170 ? 137.289 85.285  130.262 1.00 0.00 ? 191 G A N2     1  
ATOM 5467   N N3     . G A 1 170 ? 137.509 86.587  128.359 1.00 0.00 ? 191 G A N3     1  
ATOM 5468   C C4     . G A 1 170 ? 136.941 86.811  127.155 1.00 0.00 ? 191 G A C4     1  
ATOM 5469   H "H5'"  . G A 1 170 ? 140.374 88.356  122.446 1.00 0.00 ? 191 G A "H5'"  1  
ATOM 5470   H "H5''" . G A 1 170 ? 138.853 87.998  122.774 1.00 0.00 ? 191 G A "H5''" 1  
ATOM 5471   H "H4'"  . G A 1 170 ? 140.552 89.492  124.496 1.00 0.00 ? 191 G A "H4'"  1  
ATOM 5472   H "H3'"  . G A 1 170 ? 139.667 86.806  124.745 1.00 0.00 ? 191 G A "H3'"  1  
ATOM 5473   H "H2'"  . G A 1 170 ? 139.669 87.064  127.066 1.00 0.00 ? 191 G A "H2'"  1  
ATOM 5474   H "HO2'" . G A 1 170 ? 140.462 88.918  128.068 1.00 0.00 ? 191 G A "HO2'" 1  
ATOM 5475   H "H1'"  . G A 1 170 ? 138.359 89.261  127.039 1.00 0.00 ? 191 G A "H1'"  1  
ATOM 5476   H H8     . G A 1 170 ? 136.562 88.151  124.338 1.00 0.00 ? 191 G A H8     1  
ATOM 5477   H H1     . G A 1 170 ? 135.382 84.280  129.153 1.00 0.00 ? 191 G A H1     1  
ATOM 5478   H H21    . G A 1 170 ? 136.818 84.585  130.761 1.00 0.00 ? 191 G A H21    1  
ATOM 5479   H H22    . G A 1 170 ? 138.070 85.725  130.660 1.00 0.00 ? 191 G A H22    1  
ATOM 5480   P P      . A A 1 171 ? 142.053 85.722  124.698 1.00 0.00 ? 192 A A P      1  
ATOM 5481   O OP1    . A A 1 171 ? 143.459 85.719  124.229 1.00 0.00 ? 192 A A OP1    1  
ATOM 5482   O OP2    . A A 1 171 ? 141.002 85.090  123.866 1.00 0.00 ? 192 A A OP2    1  
ATOM 5483   O "O5'"  . A A 1 171 ? 142.008 85.041  126.135 1.00 0.00 ? 192 A A "O5'"  1  
ATOM 5484   C "C5'"  . A A 1 171 ? 140.812 85.064  126.896 1.00 0.00 ? 192 A A "C5'"  1  
ATOM 5485   C "C4'"  . A A 1 171 ? 140.890 84.103  128.051 1.00 0.00 ? 192 A A "C4'"  1  
ATOM 5486   O "O4'"  . A A 1 171 ? 139.616 84.156  128.746 1.00 0.00 ? 192 A A "O4'"  1  
ATOM 5487   C "C3'"  . A A 1 171 ? 141.080 82.648  127.648 1.00 0.00 ? 192 A A "C3'"  1  
ATOM 5488   O "O3'"  . A A 1 171 ? 142.465 82.318  127.660 1.00 0.00 ? 192 A A "O3'"  1  
ATOM 5489   C "C2'"  . A A 1 171 ? 140.298 81.901  128.722 1.00 0.00 ? 192 A A "C2'"  1  
ATOM 5490   O "O2'"  . A A 1 171 ? 141.030 81.740  129.921 1.00 0.00 ? 192 A A "O2'"  1  
ATOM 5491   C "C1'"  . A A 1 171 ? 139.121 82.848  128.949 1.00 0.00 ? 192 A A "C1'"  1  
ATOM 5492   N N9     . A A 1 171 ? 138.005 82.665  128.020 1.00 0.00 ? 192 A A N9     1  
ATOM 5493   C C8     . A A 1 171 ? 137.828 83.278  126.805 1.00 0.00 ? 192 A A C8     1  
ATOM 5494   N N7     . A A 1 171 ? 136.720 82.936  126.196 1.00 0.00 ? 192 A A N7     1  
ATOM 5495   C C5     . A A 1 171 ? 136.129 82.034  127.068 1.00 0.00 ? 192 A A C5     1  
ATOM 5496   C C6     . A A 1 171 ? 134.930 81.304  127.002 1.00 0.00 ? 192 A A C6     1  
ATOM 5497   N N6     . A A 1 171 ? 134.068 81.374  125.981 1.00 0.00 ? 192 A A N6     1  
ATOM 5498   N N1     . A A 1 171 ? 134.640 80.488  128.038 1.00 0.00 ? 192 A A N1     1  
ATOM 5499   C C2     . A A 1 171 ? 135.497 80.419  129.060 1.00 0.00 ? 192 A A C2     1  
ATOM 5500   N N3     . A A 1 171 ? 136.652 81.051  129.236 1.00 0.00 ? 192 A A N3     1  
ATOM 5501   C C4     . A A 1 171 ? 136.913 81.853  128.191 1.00 0.00 ? 192 A A C4     1  
ATOM 5502   H "H5'"  . A A 1 171 ? 140.060 84.817  126.319 1.00 0.00 ? 192 A A "H5'"  1  
ATOM 5503   H "H5''" . A A 1 171 ? 140.668 85.972  127.238 1.00 0.00 ? 192 A A "H5''" 1  
ATOM 5504   H "H4'"  . A A 1 171 ? 141.613 84.385  128.650 1.00 0.00 ? 192 A A "H4'"  1  
ATOM 5505   H "H3'"  . A A 1 171 ? 140.697 82.509  126.755 1.00 0.00 ? 192 A A "H3'"  1  
ATOM 5506   H "H2'"  . A A 1 171 ? 139.972 81.037  128.394 1.00 0.00 ? 192 A A "H2'"  1  
ATOM 5507   H "HO2'" . A A 1 171 ? 141.985 81.850  129.729 1.00 0.00 ? 192 A A "HO2'" 1  
ATOM 5508   H "H1'"  . A A 1 171 ? 138.781 82.734  129.861 1.00 0.00 ? 192 A A "H1'"  1  
ATOM 5509   H H8     . A A 1 171 ? 138.472 83.915  126.427 1.00 0.00 ? 192 A A H8     1  
ATOM 5510   H H61    . A A 1 171 ? 133.247 80.839  125.997 1.00 0.00 ? 192 A A H61    1  
ATOM 5511   H H62    . A A 1 171 ? 134.257 81.960  125.219 1.00 0.00 ? 192 A A H62    1  
ATOM 5512   H H2     . A A 1 171 ? 135.236 79.812  129.784 1.00 0.00 ? 192 A A H2     1  
ATOM 5513   P P      . C A 1 172 ? 143.068 81.317  126.557 1.00 0.00 ? 193 C A P      1  
ATOM 5514   O OP1    . C A 1 172 ? 144.539 81.251  126.752 1.00 0.00 ? 193 C A OP1    1  
ATOM 5515   O OP2    . C A 1 172 ? 142.520 81.707  125.233 1.00 0.00 ? 193 C A OP2    1  
ATOM 5516   O "O5'"  . C A 1 172 ? 142.456 79.899  126.946 1.00 0.00 ? 193 C A "O5'"  1  
ATOM 5517   C "C5'"  . C A 1 172 ? 142.590 79.383  128.261 1.00 0.00 ? 193 C A "C5'"  1  
ATOM 5518   C "C4'"  . C A 1 172 ? 141.609 78.265  128.523 1.00 0.00 ? 193 C A "C4'"  1  
ATOM 5519   O "O4'"  . C A 1 172 ? 140.282 78.831  128.644 1.00 0.00 ? 193 C A "O4'"  1  
ATOM 5520   C "C3'"  . C A 1 172 ? 141.453 77.236  127.415 1.00 0.00 ? 193 C A "C3'"  1  
ATOM 5521   O "O3'"  . C A 1 172 ? 142.493 76.273  127.405 1.00 0.00 ? 193 C A "O3'"  1  
ATOM 5522   C "C2'"  . C A 1 172 ? 140.113 76.631  127.812 1.00 0.00 ? 193 C A "C2'"  1  
ATOM 5523   O "O2'"  . C A 1 172 ? 140.251 75.757  128.923 1.00 0.00 ? 193 C A "O2'"  1  
ATOM 5524   C "C1'"  . C A 1 172 ? 139.349 77.881  128.245 1.00 0.00 ? 193 C A "C1'"  1  
ATOM 5525   N N1     . C A 1 172 ? 138.526 78.447  127.148 1.00 0.00 ? 193 C A N1     1  
ATOM 5526   C C2     . C A 1 172 ? 137.224 77.960  126.974 1.00 0.00 ? 193 C A C2     1  
ATOM 5527   O O2     . C A 1 172 ? 136.801 77.077  127.735 1.00 0.00 ? 193 C A O2     1  
ATOM 5528   N N3     . C A 1 172 ? 136.452 78.459  125.980 1.00 0.00 ? 193 C A N3     1  
ATOM 5529   C C4     . C A 1 172 ? 136.932 79.407  125.176 1.00 0.00 ? 193 C A C4     1  
ATOM 5530   N N4     . C A 1 172 ? 136.134 79.871  124.209 1.00 0.00 ? 193 C A N4     1  
ATOM 5531   C C5     . C A 1 172 ? 138.250 79.923  125.326 1.00 0.00 ? 193 C A C5     1  
ATOM 5532   C C6     . C A 1 172 ? 139.003 79.422  126.312 1.00 0.00 ? 193 C A C6     1  
ATOM 5533   H "H5'"  . C A 1 172 ? 142.432 80.104  128.905 1.00 0.00 ? 193 C A "H5'"  1  
ATOM 5534   H "H5''" . C A 1 172 ? 143.501 79.042  128.379 1.00 0.00 ? 193 C A "H5''" 1  
ATOM 5535   H "H4'"  . C A 1 172 ? 141.852 77.824  129.363 1.00 0.00 ? 193 C A "H4'"  1  
ATOM 5536   H "H3'"  . C A 1 172 ? 141.375 77.697  126.554 1.00 0.00 ? 193 C A "H3'"  1  
ATOM 5537   H "H2'"  . C A 1 172 ? 139.682 76.186  127.053 1.00 0.00 ? 193 C A "H2'"  1  
ATOM 5538   H "HO2'" . C A 1 172 ? 141.148 75.365  128.912 1.00 0.00 ? 193 C A "HO2'" 1  
ATOM 5539   H "H1'"  . C A 1 172 ? 138.771 77.658  129.005 1.00 0.00 ? 193 C A "H1'"  1  
ATOM 5540   H H41    . C A 1 172 ? 135.227 79.513  124.108 1.00 0.00 ? 193 C A H41    1  
ATOM 5541   H H42    . C A 1 172 ? 136.457 80.567  123.601 1.00 0.00 ? 193 C A H42    1  
ATOM 5542   H H5     . C A 1 172 ? 138.593 80.620  124.729 1.00 0.00 ? 193 C A H5     1  
ATOM 5543   H H6     . C A 1 172 ? 139.914 79.763  126.432 1.00 0.00 ? 193 C A H6     1  
ATOM 5544   P P      . G A 1 173 ? 143.065 75.715  126.010 1.00 0.00 ? 194 G A P      1  
ATOM 5545   O OP1    . G A 1 173 ? 144.400 75.116  126.265 1.00 0.00 ? 194 G A OP1    1  
ATOM 5546   O OP2    . G A 1 173 ? 142.925 76.788  124.993 1.00 0.00 ? 194 G A OP2    1  
ATOM 5547   O "O5'"  . G A 1 173 ? 142.062 74.538  125.625 1.00 0.00 ? 194 G A "O5'"  1  
ATOM 5548   C "C5'"  . G A 1 173 ? 141.233 74.633  124.477 1.00 0.00 ? 194 G A "C5'"  1  
ATOM 5549   C "C4'"  . G A 1 173 ? 139.798 74.297  124.799 1.00 0.00 ? 194 G A "C4'"  1  
ATOM 5550   O "O4'"  . G A 1 173 ? 139.070 75.535  125.002 1.00 0.00 ? 194 G A "O4'"  1  
ATOM 5551   C "C3'"  . G A 1 173 ? 139.009 73.608  123.695 1.00 0.00 ? 194 G A "C3'"  1  
ATOM 5552   O "O3'"  . G A 1 173 ? 139.238 72.211  123.640 1.00 0.00 ? 194 G A "O3'"  1  
ATOM 5553   C "C2'"  . G A 1 173 ? 137.596 73.891  124.184 1.00 0.00 ? 194 G A "C2'"  1  
ATOM 5554   O "O2'"  . G A 1 173 ? 137.263 73.073  125.296 1.00 0.00 ? 194 G A "O2'"  1  
ATOM 5555   C "C1'"  . G A 1 173 ? 137.747 75.341  124.647 1.00 0.00 ? 194 G A "C1'"  1  
ATOM 5556   N N9     . G A 1 173 ? 137.430 76.302  123.574 1.00 0.00 ? 194 G A N9     1  
ATOM 5557   C C8     . G A 1 173 ? 138.232 77.313  123.101 1.00 0.00 ? 194 G A C8     1  
ATOM 5558   N N7     . G A 1 173 ? 137.676 78.003  122.142 1.00 0.00 ? 194 G A N7     1  
ATOM 5559   C C5     . G A 1 173 ? 136.433 77.412  121.970 1.00 0.00 ? 194 G A C5     1  
ATOM 5560   C C6     . G A 1 173 ? 135.381 77.725  121.071 1.00 0.00 ? 194 G A C6     1  
ATOM 5561   O O6     . G A 1 173 ? 135.338 78.620  120.218 1.00 0.00 ? 194 G A O6     1  
ATOM 5562   N N1     . G A 1 173 ? 134.294 76.871  121.233 1.00 0.00 ? 194 G A N1     1  
ATOM 5563   C C2     . G A 1 173 ? 134.227 75.845  122.144 1.00 0.00 ? 194 G A C2     1  
ATOM 5564   N N2     . G A 1 173 ? 133.094 75.128  122.152 1.00 0.00 ? 194 G A N2     1  
ATOM 5565   N N3     . G A 1 173 ? 135.200 75.542  122.988 1.00 0.00 ? 194 G A N3     1  
ATOM 5566   C C4     . G A 1 173 ? 136.265 76.360  122.846 1.00 0.00 ? 194 G A C4     1  
ATOM 5567   H "H5'"  . G A 1 173 ? 141.561 74.012  123.793 1.00 0.00 ? 194 G A "H5'"  1  
ATOM 5568   H "H5''" . G A 1 173 ? 141.277 75.547  124.125 1.00 0.00 ? 194 G A "H5''" 1  
ATOM 5569   H "H4'"  . G A 1 173 ? 139.774 73.765  125.622 1.00 0.00 ? 194 G A "H4'"  1  
ATOM 5570   H "H3'"  . G A 1 173 ? 139.174 74.068  122.847 1.00 0.00 ? 194 G A "H3'"  1  
ATOM 5571   H "H2'"  . G A 1 173 ? 136.942 73.804  123.460 1.00 0.00 ? 194 G A "H2'"  1  
ATOM 5572   H "HO2'" . G A 1 173 ? 137.794 72.250  125.258 1.00 0.00 ? 194 G A "HO2'" 1  
ATOM 5573   H "H1'"  . G A 1 173 ? 137.157 75.501  125.413 1.00 0.00 ? 194 G A "H1'"  1  
ATOM 5574   H H8     . G A 1 173 ? 139.129 77.499  123.448 1.00 0.00 ? 194 G A H8     1  
ATOM 5575   H H1     . G A 1 173 ? 133.518 77.014  120.652 1.00 0.00 ? 194 G A H1     1  
ATOM 5576   H H21    . G A 1 173 ? 132.369 75.346  121.529 1.00 0.00 ? 194 G A H21    1  
ATOM 5577   H H22    . G A 1 173 ? 132.989 74.383  122.781 1.00 0.00 ? 194 G A H22    1  
ATOM 5578   P P      . G A 1 174 ? 139.239 71.448  122.226 1.00 0.00 ? 195 G A P      1  
ATOM 5579   O OP1    . G A 1 174 ? 139.788 70.084  122.438 1.00 0.00 ? 195 G A OP1    1  
ATOM 5580   O OP2    . G A 1 174 ? 139.866 72.343  121.220 1.00 0.00 ? 195 G A OP2    1  
ATOM 5581   O "O5'"  . G A 1 174 ? 137.694 71.305  121.863 1.00 0.00 ? 195 G A "O5'"  1  
ATOM 5582   C "C5'"  . G A 1 174 ? 136.769 70.781  122.804 1.00 0.00 ? 195 G A "C5'"  1  
ATOM 5583   C "C4'"  . G A 1 174 ? 135.383 70.674  122.219 1.00 0.00 ? 195 G A "C4'"  1  
ATOM 5584   O "O4'"  . G A 1 174 ? 134.746 71.979  122.204 1.00 0.00 ? 195 G A "O4'"  1  
ATOM 5585   C "C3'"  . G A 1 174 ? 135.304 70.219  120.769 1.00 0.00 ? 195 G A "C3'"  1  
ATOM 5586   O "O3'"  . G A 1 174 ? 135.397 68.812  120.625 1.00 0.00 ? 195 G A "O3'"  1  
ATOM 5587   C "C2'"  . G A 1 174 ? 133.975 70.805  120.316 1.00 0.00 ? 195 G A "C2'"  1  
ATOM 5588   O "O2'"  . G A 1 174 ? 132.882 70.034  120.793 1.00 0.00 ? 195 G A "O2'"  1  
ATOM 5589   C "C1'"  . G A 1 174 ? 133.989 72.153  121.034 1.00 0.00 ? 195 G A "C1'"  1  
ATOM 5590   N N9     . G A 1 174 ? 134.654 73.201  120.236 1.00 0.00 ? 195 G A N9     1  
ATOM 5591   C C8     . G A 1 174 ? 135.955 73.628  120.346 1.00 0.00 ? 195 G A C8     1  
ATOM 5592   N N7     . G A 1 174 ? 136.258 74.576  119.501 1.00 0.00 ? 195 G A N7     1  
ATOM 5593   C C5     . G A 1 174 ? 135.086 74.786  118.788 1.00 0.00 ? 195 G A C5     1  
ATOM 5594   C C6     . G A 1 174 ? 134.802 75.693  117.734 1.00 0.00 ? 195 G A C6     1  
ATOM 5595   O O6     . G A 1 174 ? 135.555 76.518  117.204 1.00 0.00 ? 195 G A O6     1  
ATOM 5596   N N1     . G A 1 174 ? 133.485 75.575  117.299 1.00 0.00 ? 195 G A N1     1  
ATOM 5597   C C2     . G A 1 174 ? 132.561 74.698  117.810 1.00 0.00 ? 195 G A C2     1  
ATOM 5598   N N2     . G A 1 174 ? 131.338 74.733  117.259 1.00 0.00 ? 195 G A N2     1  
ATOM 5599   N N3     . G A 1 174 ? 132.813 73.848  118.793 1.00 0.00 ? 195 G A N3     1  
ATOM 5600   C C4     . G A 1 174 ? 134.086 73.946  119.229 1.00 0.00 ? 195 G A C4     1  
ATOM 5601   H "H5'"  . G A 1 174 ? 136.741 71.370  123.587 1.00 0.00 ? 195 G A "H5'"  1  
ATOM 5602   H "H5''" . G A 1 174 ? 137.068 69.890  123.085 1.00 0.00 ? 195 G A "H5''" 1  
ATOM 5603   H "H4'"  . G A 1 174 ? 134.850 70.069  122.777 1.00 0.00 ? 195 G A "H4'"  1  
ATOM 5604   H "H3'"  . G A 1 174 ? 136.029 70.636  120.262 1.00 0.00 ? 195 G A "H3'"  1  
ATOM 5605   H "H2'"  . G A 1 174 ? 133.945 70.915  119.342 1.00 0.00 ? 195 G A "H2'"  1  
ATOM 5606   H "HO2'" . G A 1 174 ? 133.202 69.139  121.031 1.00 0.00 ? 195 G A "HO2'" 1  
ATOM 5607   H "H1'"  . G A 1 174 ? 133.068 72.428  121.229 1.00 0.00 ? 195 G A "H1'"  1  
ATOM 5608   H H8     . G A 1 174 ? 136.592 73.261  120.994 1.00 0.00 ? 195 G A H8     1  
ATOM 5609   H H1     . G A 1 174 ? 133.197 76.165  116.570 1.00 0.00 ? 195 G A H1     1  
ATOM 5610   H H21    . G A 1 174 ? 131.144 75.359  116.532 1.00 0.00 ? 195 G A H21    1  
ATOM 5611   H H22    . G A 1 174 ? 130.638 74.129  117.584 1.00 0.00 ? 195 G A H22    1  
ATOM 5612   P P      . A A 1 175 ? 136.104 68.178  119.328 1.00 0.00 ? 196 A A P      1  
ATOM 5613   O OP1    . A A 1 175 ? 136.138 66.704  119.496 1.00 0.00 ? 196 A A OP1    1  
ATOM 5614   O OP2    . A A 1 175 ? 137.367 68.919  119.084 1.00 0.00 ? 196 A A OP2    1  
ATOM 5615   O "O5'"  . A A 1 175 ? 135.098 68.516  118.139 1.00 0.00 ? 196 A A "O5'"  1  
ATOM 5616   C "C5'"  . A A 1 175 ? 133.818 67.906  118.071 1.00 0.00 ? 196 A A "C5'"  1  
ATOM 5617   C "C4'"  . A A 1 175 ? 132.941 68.570  117.039 1.00 0.00 ? 196 A A "C4'"  1  
ATOM 5618   O "O4'"  . A A 1 175 ? 132.778 69.982  117.344 1.00 0.00 ? 196 A A "O4'"  1  
ATOM 5619   C "C3'"  . A A 1 175 ? 133.469 68.565  115.613 1.00 0.00 ? 196 A A "C3'"  1  
ATOM 5620   O "O3'"  . A A 1 175 ? 133.290 67.320  114.960 1.00 0.00 ? 196 A A "O3'"  1  
ATOM 5621   C "C2'"  . A A 1 175 ? 132.675 69.697  114.978 1.00 0.00 ? 196 A A "C2'"  1  
ATOM 5622   O "O2'"  . A A 1 175 ? 131.347 69.291  114.682 1.00 0.00 ? 196 A A "O2'"  1  
ATOM 5623   C "C1'"  . A A 1 175 ? 132.649 70.705  116.120 1.00 0.00 ? 196 A A "C1'"  1  
ATOM 5624   N N9     . A A 1 175 ? 133.728 71.705  116.004 1.00 0.00 ? 196 A A N9     1  
ATOM 5625   C C8     . A A 1 175 ? 134.949 71.707  116.632 1.00 0.00 ? 196 A A C8     1  
ATOM 5626   N N7     . A A 1 175 ? 135.699 72.736  116.327 1.00 0.00 ? 196 A A N7     1  
ATOM 5627   C C5     . A A 1 175 ? 134.920 73.463  115.436 1.00 0.00 ? 196 A A C5     1  
ATOM 5628   C C6     . A A 1 175 ? 135.146 74.666  114.744 1.00 0.00 ? 196 A A C6     1  
ATOM 5629   N N6     . A A 1 175 ? 136.271 75.378  114.844 1.00 0.00 ? 196 A A N6     1  
ATOM 5630   N N1     . A A 1 175 ? 134.165 75.118  113.933 1.00 0.00 ? 196 A A N1     1  
ATOM 5631   C C2     . A A 1 175 ? 133.037 74.404  113.832 1.00 0.00 ? 196 A A C2     1  
ATOM 5632   N N3     . A A 1 175 ? 132.708 73.262  114.430 1.00 0.00 ? 196 A A N3     1  
ATOM 5633   C C4     . A A 1 175 ? 133.705 72.839  115.228 1.00 0.00 ? 196 A A C4     1  
ATOM 5634   H "H5'"  . A A 1 175 ? 133.385 67.973  118.948 1.00 0.00 ? 196 A A "H5'"  1  
ATOM 5635   H "H5''" . A A 1 175 ? 133.925 66.961  117.839 1.00 0.00 ? 196 A A "H5''" 1  
ATOM 5636   H "H4'"  . A A 1 175 ? 132.059 68.143  117.050 1.00 0.00 ? 196 A A "H4'"  1  
ATOM 5637   H "H3'"  . A A 1 175 ? 134.421 68.801  115.621 1.00 0.00 ? 196 A A "H3'"  1  
ATOM 5638   H "H2'"  . A A 1 175 ? 133.130 70.056  114.188 1.00 0.00 ? 196 A A "H2'"  1  
ATOM 5639   H "HO2'" . A A 1 175 ? 131.331 68.319  114.557 1.00 0.00 ? 196 A A "HO2'" 1  
ATOM 5640   H "H1'"  . A A 1 175 ? 131.781 71.161  116.132 1.00 0.00 ? 196 A A "H1'"  1  
ATOM 5641   H H8     . A A 1 175 ? 135.233 71.003  117.253 1.00 0.00 ? 196 A A H8     1  
ATOM 5642   H H61    . A A 1 175 ? 136.371 76.211  114.336 1.00 0.00 ? 196 A A H61    1  
ATOM 5643   H H62    . A A 1 175 ? 136.996 75.070  115.427 1.00 0.00 ? 196 A A H62    1  
ATOM 5644   H H2     . A A 1 175 ? 132.357 74.775  113.231 1.00 0.00 ? 196 A A H2     1  
ATOM 5645   P P      . C A 1 176 ? 134.294 66.871  113.787 1.00 0.00 ? 197 C A P      1  
ATOM 5646   O OP1    . C A 1 176 ? 133.826 65.566  113.256 1.00 0.00 ? 197 C A OP1    1  
ATOM 5647   O OP2    . C A 1 176 ? 135.683 67.000  114.295 1.00 0.00 ? 197 C A OP2    1  
ATOM 5648   O "O5'"  . C A 1 176 ? 134.079 67.969  112.653 1.00 0.00 ? 197 C A "O5'"  1  
ATOM 5649   C "C5'"  . C A 1 176 ? 132.840 68.079  111.969 1.00 0.00 ? 197 C A "C5'"  1  
ATOM 5650   C "C4'"  . C A 1 176 ? 132.834 69.245  111.011 1.00 0.00 ? 197 C A "C4'"  1  
ATOM 5651   O "O4'"  . C A 1 176 ? 132.974 70.484  111.750 1.00 0.00 ? 197 C A "O4'"  1  
ATOM 5652   C "C3'"  . C A 1 176 ? 133.969 69.287  109.999 1.00 0.00 ? 197 C A "C3'"  1  
ATOM 5653   O "O3'"  . C A 1 176 ? 133.759 68.422  108.897 1.00 0.00 ? 197 C A "O3'"  1  
ATOM 5654   C "C2'"  . C A 1 176 ? 133.999 70.755  109.608 1.00 0.00 ? 197 C A "C2'"  1  
ATOM 5655   O "O2'"  . C A 1 176 ? 132.968 71.062  108.681 1.00 0.00 ? 197 C A "O2'"  1  
ATOM 5656   C "C1'"  . C A 1 176 ? 133.688 71.422  110.943 1.00 0.00 ? 197 C A "C1'"  1  
ATOM 5657   N N1     . C A 1 176 ? 134.915 71.864  111.651 1.00 0.00 ? 197 C A N1     1  
ATOM 5658   C C2     . C A 1 176 ? 135.413 73.145  111.381 1.00 0.00 ? 197 C A C2     1  
ATOM 5659   O O2     . C A 1 176 ? 134.820 73.866  110.563 1.00 0.00 ? 197 C A O2     1  
ATOM 5660   N N3     . C A 1 176 ? 136.530 73.573  112.013 1.00 0.00 ? 197 C A N3     1  
ATOM 5661   C C4     . C A 1 176 ? 137.148 72.779  112.887 1.00 0.00 ? 197 C A C4     1  
ATOM 5662   N N4     . C A 1 176 ? 138.247 73.244  113.487 1.00 0.00 ? 197 C A N4     1  
ATOM 5663   C C5     . C A 1 176 ? 136.668 71.472  113.183 1.00 0.00 ? 197 C A C5     1  
ATOM 5664   C C6     . C A 1 176 ? 135.562 71.060  112.552 1.00 0.00 ? 197 C A C6     1  
ATOM 5665   H "H5'"  . C A 1 176 ? 132.123 68.201  112.626 1.00 0.00 ? 197 C A "H5'"  1  
ATOM 5666   H "H5''" . C A 1 176 ? 132.678 67.253  111.468 1.00 0.00 ? 197 C A "H5''" 1  
ATOM 5667   H "H4'"  . C A 1 176 ? 131.979 69.254  110.532 1.00 0.00 ? 197 C A "H4'"  1  
ATOM 5668   H "H3'"  . C A 1 176 ? 134.809 69.055  110.447 1.00 0.00 ? 197 C A "H3'"  1  
ATOM 5669   H "H2'"  . C A 1 176 ? 134.880 71.017  109.269 1.00 0.00 ? 197 C A "H2'"  1  
ATOM 5670   H "HO2'" . C A 1 176 ? 132.685 70.238  108.233 1.00 0.00 ? 197 C A "HO2'" 1  
ATOM 5671   H "H1'"  . C A 1 176 ? 133.104 72.193  110.789 1.00 0.00 ? 197 C A "H1'"  1  
ATOM 5672   H H41    . C A 1 176 ? 138.576 74.144  113.280 1.00 0.00 ? 197 C A H41    1  
ATOM 5673   H H42    . C A 1 176 ? 138.725 72.684  114.134 1.00 0.00 ? 197 C A H42    1  
ATOM 5674   H H5     . C A 1 176 ? 137.129 70.896  113.828 1.00 0.00 ? 197 C A H5     1  
ATOM 5675   H H6     . C A 1 176 ? 135.215 70.164  112.743 1.00 0.00 ? 197 C A H6     1  
ATOM 5676   P P      . A A 1 177 ? 135.012 67.850  108.068 1.00 0.00 ? 198 A A P      1  
ATOM 5677   O OP1    . A A 1 177 ? 134.552 66.670  107.294 1.00 0.00 ? 198 A A OP1    1  
ATOM 5678   O OP2    . A A 1 177 ? 136.158 67.714  109.002 1.00 0.00 ? 198 A A OP2    1  
ATOM 5679   O "O5'"  . A A 1 177 ? 135.354 69.014  107.035 1.00 0.00 ? 198 A A "O5'"  1  
ATOM 5680   C "C5'"  . A A 1 177 ? 134.426 69.392  106.029 1.00 0.00 ? 198 A A "C5'"  1  
ATOM 5681   C "C4'"  . A A 1 177 ? 134.701 68.682  104.727 1.00 0.00 ? 198 A A "C4'"  1  
ATOM 5682   O "O4'"  . A A 1 177 ? 135.982 69.106  104.192 1.00 0.00 ? 198 A A "O4'"  1  
ATOM 5683   C "C3'"  . A A 1 177 ? 134.743 67.163  104.791 1.00 0.00 ? 198 A A "C3'"  1  
ATOM 5684   O "O3'"  . A A 1 177 ? 134.297 66.545  103.597 1.00 0.00 ? 198 A A "O3'"  1  
ATOM 5685   C "C2'"  . A A 1 177 ? 136.235 66.865  104.934 1.00 0.00 ? 198 A A "C2'"  1  
ATOM 5686   O "O2'"  . A A 1 177 ? 136.563 65.600  104.377 1.00 0.00 ? 198 A A "O2'"  1  
ATOM 5687   C "C1'"  . A A 1 177 ? 136.832 67.963  104.068 1.00 0.00 ? 198 A A "C1'"  1  
ATOM 5688   N N9     . A A 1 177 ? 138.177 68.361  104.523 1.00 0.00 ? 198 A A N9     1  
ATOM 5689   C C8     . A A 1 177 ? 138.685 68.314  105.798 1.00 0.00 ? 198 A A C8     1  
ATOM 5690   N N7     . A A 1 177 ? 139.921 68.738  105.891 1.00 0.00 ? 198 A A N7     1  
ATOM 5691   C C5     . A A 1 177 ? 140.251 69.089  104.589 1.00 0.00 ? 198 A A C5     1  
ATOM 5692   C C6     . A A 1 177 ? 141.425 69.611  104.017 1.00 0.00 ? 198 A A C6     1  
ATOM 5693   N N6     . A A 1 177 ? 142.532 69.880  104.714 1.00 0.00 ? 198 A A N6     1  
ATOM 5694   N N1     . A A 1 177 ? 141.425 69.848  102.688 1.00 0.00 ? 198 A A N1     1  
ATOM 5695   C C2     . A A 1 177 ? 140.316 69.577  101.988 1.00 0.00 ? 198 A A C2     1  
ATOM 5696   N N3     . A A 1 177 ? 139.153 69.087  102.411 1.00 0.00 ? 198 A A N3     1  
ATOM 5697   C C4     . A A 1 177 ? 139.187 68.861  103.737 1.00 0.00 ? 198 A A C4     1  
ATOM 5698   H "H5'"  . A A 1 177 ? 134.487 70.360  105.884 1.00 0.00 ? 198 A A "H5'"  1  
ATOM 5699   H "H5''" . A A 1 177 ? 133.520 69.171  106.329 1.00 0.00 ? 198 A A "H5''" 1  
ATOM 5700   H "H4'"  . A A 1 177 ? 133.997 68.914  104.085 1.00 0.00 ? 198 A A "H4'"  1  
ATOM 5701   H "H3'"  . A A 1 177 ? 134.281 66.863  105.602 1.00 0.00 ? 198 A A "H3'"  1  
ATOM 5702   H "H2'"  . A A 1 177 ? 136.529 66.939  105.866 1.00 0.00 ? 198 A A "H2'"  1  
ATOM 5703   H "HO2'" . A A 1 177 ? 137.524 65.443  104.488 1.00 0.00 ? 198 A A "HO2'" 1  
ATOM 5704   H "H1'"  . A A 1 177 ? 136.880 67.655  103.138 1.00 0.00 ? 198 A A "H1'"  1  
ATOM 5705   H H8     . A A 1 177 ? 138.170 67.993  106.568 1.00 0.00 ? 198 A A H8     1  
ATOM 5706   H H61    . A A 1 177 ? 143.321 70.243  104.259 1.00 0.00 ? 198 A A H61    1  
ATOM 5707   H H62    . A A 1 177 ? 142.555 69.716  105.680 1.00 0.00 ? 198 A A H62    1  
ATOM 5708   H H2     . A A 1 177 ? 140.367 69.767  101.027 1.00 0.00 ? 198 A A H2     1  
ATOM 5709   P P      . U A 1 178 ? 133.901 67.449  102.336 1.00 0.00 ? 199 U A P      1  
ATOM 5710   O OP1    . U A 1 178 ? 134.990 68.425  102.078 1.00 0.00 ? 199 U A OP1    1  
ATOM 5711   O OP2    . U A 1 178 ? 132.548 67.939  102.700 1.00 0.00 ? 199 U A OP2    1  
ATOM 5712   O "O5'"  . U A 1 178 ? 133.760 66.517  101.052 1.00 0.00 ? 199 U A "O5'"  1  
ATOM 5713   C "C5'"  . U A 1 178 ? 132.489 66.048  100.628 1.00 0.00 ? 199 U A "C5'"  1  
ATOM 5714   C "C4'"  . U A 1 178 ? 132.001 66.788  99.407  1.00 0.00 ? 199 U A "C4'"  1  
ATOM 5715   O "O4'"  . U A 1 178 ? 132.243 65.980  98.217  1.00 0.00 ? 199 U A "O4'"  1  
ATOM 5716   C "C3'"  . U A 1 178 ? 130.511 67.089  99.357  1.00 0.00 ? 199 U A "C3'"  1  
ATOM 5717   O "O3'"  . U A 1 178 ? 130.154 68.245  100.093 1.00 0.00 ? 199 U A "O3'"  1  
ATOM 5718   C "C2'"  . U A 1 178 ? 130.260 67.234  97.870  1.00 0.00 ? 199 U A "C2'"  1  
ATOM 5719   O "O2'"  . U A 1 178 ? 130.693 68.502  97.397  1.00 0.00 ? 199 U A "O2'"  1  
ATOM 5720   C "C1'"  . U A 1 178 ? 131.179 66.147  97.304  1.00 0.00 ? 199 U A "C1'"  1  
ATOM 5721   N N1     . U A 1 178 ? 130.482 64.848  97.147  1.00 0.00 ? 199 U A N1     1  
ATOM 5722   C C2     . U A 1 178 ? 129.641 64.710  96.058  1.00 0.00 ? 199 U A C2     1  
ATOM 5723   O O2     . U A 1 178 ? 129.457 65.597  95.243  1.00 0.00 ? 199 U A O2     1  
ATOM 5724   N N3     . U A 1 178 ? 129.018 63.491  95.953  1.00 0.00 ? 199 U A N3     1  
ATOM 5725   C C4     . U A 1 178 ? 129.146 62.415  96.807  1.00 0.00 ? 199 U A C4     1  
ATOM 5726   O O4     . U A 1 178 ? 128.516 61.382  96.576  1.00 0.00 ? 199 U A O4     1  
ATOM 5727   C C5     . U A 1 178 ? 130.032 62.630  97.910  1.00 0.00 ? 199 U A C5     1  
ATOM 5728   C C6     . U A 1 178 ? 130.652 63.807  98.035  1.00 0.00 ? 199 U A C6     1  
ATOM 5729   H "H5'"  . U A 1 178 ? 131.844 66.171  101.355 1.00 0.00 ? 199 U A "H5'"  1  
ATOM 5730   H "H5''" . U A 1 178 ? 132.555 65.093  100.417 1.00 0.00 ? 199 U A "H5''" 1  
ATOM 5731   H "H4'"  . U A 1 178 ? 132.496 67.628  99.322  1.00 0.00 ? 199 U A "H4'"  1  
ATOM 5732   H "H3'"  . U A 1 178 ? 130.005 66.322  99.698  1.00 0.00 ? 199 U A "H3'"  1  
ATOM 5733   H "H2'"  . U A 1 178 ? 129.321 67.066  97.645  1.00 0.00 ? 199 U A "H2'"  1  
ATOM 5734   H "HO2'" . U A 1 178 ? 130.490 68.572  96.440  1.00 0.00 ? 199 U A "HO2'" 1  
ATOM 5735   H "H1'"  . U A 1 178 ? 131.524 66.438  96.433  1.00 0.00 ? 199 U A "H1'"  1  
ATOM 5736   H H3     . U A 1 178 ? 128.417 63.372  95.189  1.00 0.00 ? 199 U A H3     1  
ATOM 5737   H H5     . U A 1 178 ? 130.183 61.918  98.567  1.00 0.00 ? 199 U A H5     1  
ATOM 5738   H H6     . U A 1 178 ? 131.253 63.929  98.799  1.00 0.00 ? 199 U A H6     1  
ATOM 5739   P P      . G A 1 179 ? 128.607 68.606  100.333 1.00 0.00 ? 200 G A P      1  
ATOM 5740   O OP1    . G A 1 179 ? 127.877 67.343  100.612 1.00 0.00 ? 200 G A OP1    1  
ATOM 5741   O OP2    . G A 1 179 ? 128.161 69.481  99.219  1.00 0.00 ? 200 G A OP2    1  
ATOM 5742   O "O5'"  . G A 1 179 ? 128.616 69.475  101.669 1.00 0.00 ? 200 G A "O5'"  1  
ATOM 5743   C "C5'"  . G A 1 179 ? 128.896 68.877  102.926 1.00 0.00 ? 200 G A "C5'"  1  
ATOM 5744   C "C4'"  . G A 1 179 ? 129.899 69.684  103.713 1.00 0.00 ? 200 G A "C4'"  1  
ATOM 5745   O "O4'"  . G A 1 179 ? 131.231 69.705  103.163 1.00 0.00 ? 200 G A "O4'"  1  
ATOM 5746   C "C3'"  . G A 1 179 ? 129.626 71.178  103.807 1.00 0.00 ? 200 G A "C3'"  1  
ATOM 5747   O "O3'"  . G A 1 179 ? 128.490 71.484  104.598 1.00 0.00 ? 200 G A "O3'"  1  
ATOM 5748   C "C2'"  . G A 1 179 ? 130.932 71.664  104.420 1.00 0.00 ? 200 G A "C2'"  1  
ATOM 5749   O "O2'"  . G A 1 179 ? 131.001 71.351  105.804 1.00 0.00 ? 200 G A "O2'"  1  
ATOM 5750   C "C1'"  . G A 1 179 ? 131.953 70.808  103.661 1.00 0.00 ? 200 G A "C1'"  1  
ATOM 5751   N N9     . G A 1 179 ? 132.524 71.520  102.502 1.00 0.00 ? 200 G A N9     1  
ATOM 5752   C C8     . G A 1 179 ? 132.223 71.328  101.176 1.00 0.00 ? 200 G A C8     1  
ATOM 5753   N N7     . G A 1 179 ? 132.895 72.111  100.377 1.00 0.00 ? 200 G A N7     1  
ATOM 5754   C C5     . G A 1 179 ? 133.688 72.869  101.227 1.00 0.00 ? 200 G A C5     1  
ATOM 5755   C C6     . G A 1 179 ? 134.629 73.891  100.938 1.00 0.00 ? 200 G A C6     1  
ATOM 5756   O O6     . G A 1 179 ? 134.961 74.344  99.837  1.00 0.00 ? 200 G A O6     1  
ATOM 5757   N N1     . G A 1 179 ? 135.211 74.394  102.098 1.00 0.00 ? 200 G A N1     1  
ATOM 5758   C C2     . G A 1 179 ? 134.923 73.970  103.372 1.00 0.00 ? 200 G A C2     1  
ATOM 5759   N N2     . G A 1 179 ? 135.588 74.577  104.367 1.00 0.00 ? 200 G A N2     1  
ATOM 5760   N N3     . G A 1 179 ? 134.048 73.019  103.654 1.00 0.00 ? 200 G A N3     1  
ATOM 5761   C C4     . G A 1 179 ? 133.472 72.517  102.542 1.00 0.00 ? 200 G A C4     1  
ATOM 5762   H "H5'"  . G A 1 179 ? 129.255 67.977  102.779 1.00 0.00 ? 200 G A "H5'"  1  
ATOM 5763   H "H5''" . G A 1 179 ? 128.065 68.809  103.440 1.00 0.00 ? 200 G A "H5''" 1  
ATOM 5764   H "H4'"  . G A 1 179 ? 129.904 69.304  104.617 1.00 0.00 ? 200 G A "H4'"  1  
ATOM 5765   H "H3'"  . G A 1 179 ? 129.516 71.576  102.920 1.00 0.00 ? 200 G A "H3'"  1  
ATOM 5766   H "H2'"  . G A 1 179 ? 131.071 72.621  104.257 1.00 0.00 ? 200 G A "H2'"  1  
ATOM 5767   H "HO2'" . G A 1 179 ? 131.303 72.143  106.296 1.00 0.00 ? 200 G A "HO2'" 1  
ATOM 5768   H "H1'"  . G A 1 179 ? 132.675 70.543  104.269 1.00 0.00 ? 200 G A "H1'"  1  
ATOM 5769   H H8     . G A 1 179 ? 131.570 70.668  100.860 1.00 0.00 ? 200 G A H8     1  
ATOM 5770   H H1     . G A 1 179 ? 135.876 75.106  101.995 1.00 0.00 ? 200 G A H1     1  
ATOM 5771   H H21    . G A 1 179 ? 136.238 75.283  104.166 1.00 0.00 ? 200 G A H21    1  
ATOM 5772   H H22    . G A 1 179 ? 135.424 74.316  105.297 1.00 0.00 ? 200 G A H22    1  
ATOM 5773   P P      . G A 1 180 ? 127.728 72.886  104.408 1.00 0.00 ? 201 G A P      1  
ATOM 5774   O OP1    . G A 1 180 ? 126.416 72.795  105.099 1.00 0.00 ? 201 G A OP1    1  
ATOM 5775   O OP2    . G A 1 180 ? 127.777 73.244  102.968 1.00 0.00 ? 201 G A OP2    1  
ATOM 5776   O "O5'"  . G A 1 180 ? 128.633 73.928  105.206 1.00 0.00 ? 201 G A "O5'"  1  
ATOM 5777   C "C5'"  . G A 1 180 ? 128.842 73.792  106.603 1.00 0.00 ? 201 G A "C5'"  1  
ATOM 5778   C "C4'"  . G A 1 180 ? 130.072 74.540  107.055 1.00 0.00 ? 201 G A "C4'"  1  
ATOM 5779   O "O4'"  . G A 1 180 ? 131.215 74.227  106.222 1.00 0.00 ? 201 G A "O4'"  1  
ATOM 5780   C "C3'"  . G A 1 180 ? 129.984 76.058  107.010 1.00 0.00 ? 201 G A "C3'"  1  
ATOM 5781   O "O3'"  . G A 1 180 ? 129.260 76.602  108.101 1.00 0.00 ? 201 G A "O3'"  1  
ATOM 5782   C "C2'"  . G A 1 180 ? 131.449 76.457  107.037 1.00 0.00 ? 201 G A "C2'"  1  
ATOM 5783   O "O2'"  . G A 1 180 ? 131.978 76.389  108.354 1.00 0.00 ? 201 G A "O2'"  1  
ATOM 5784   C "C1'"  . G A 1 180 ? 132.078 75.354  106.193 1.00 0.00 ? 201 G A "C1'"  1  
ATOM 5785   N N9     . G A 1 180 ? 132.325 75.790  104.805 1.00 0.00 ? 201 G A N9     1  
ATOM 5786   C C8     . G A 1 180 ? 131.817 75.234  103.656 1.00 0.00 ? 201 G A C8     1  
ATOM 5787   N N7     . G A 1 180 ? 132.218 75.840  102.571 1.00 0.00 ? 201 G A N7     1  
ATOM 5788   C C5     . G A 1 180 ? 133.040 76.858  103.031 1.00 0.00 ? 201 G A C5     1  
ATOM 5789   C C6     . G A 1 180 ? 133.763 77.849  102.318 1.00 0.00 ? 201 G A C6     1  
ATOM 5790   O O6     . G A 1 180 ? 133.823 78.029  101.096 1.00 0.00 ? 201 G A O6     1  
ATOM 5791   N N1     . G A 1 180 ? 134.471 78.685  103.176 1.00 0.00 ? 201 G A N1     1  
ATOM 5792   C C2     . G A 1 180 ? 134.481 78.582  104.546 1.00 0.00 ? 201 G A C2     1  
ATOM 5793   N N2     . G A 1 180 ? 135.225 79.483  105.206 1.00 0.00 ? 201 G A N2     1  
ATOM 5794   N N3     . G A 1 180 ? 133.811 77.663  105.223 1.00 0.00 ? 201 G A N3     1  
ATOM 5795   C C4     . G A 1 180 ? 133.117 76.842  104.408 1.00 0.00 ? 201 G A C4     1  
ATOM 5796   H "H5'"  . G A 1 180 ? 128.947 72.842  106.820 1.00 0.00 ? 201 G A "H5'"  1  
ATOM 5797   H "H5''" . G A 1 180 ? 128.060 74.143  107.079 1.00 0.00 ? 201 G A "H5''" 1  
ATOM 5798   H "H4'"  . G A 1 180 ? 130.263 74.259  107.975 1.00 0.00 ? 201 G A "H4'"  1  
ATOM 5799   H "H3'"  . G A 1 180 ? 129.573 76.355  106.173 1.00 0.00 ? 201 G A "H3'"  1  
ATOM 5800   H "H2'"  . G A 1 180 ? 131.588 77.340  106.636 1.00 0.00 ? 201 G A "H2'"  1  
ATOM 5801   H "HO2'" . G A 1 180 ? 132.952 76.488  108.312 1.00 0.00 ? 201 G A "HO2'" 1  
ATOM 5802   H "H1'"  . G A 1 180 ? 132.923 75.072  106.601 1.00 0.00 ? 201 G A "H1'"  1  
ATOM 5803   H H8     . G A 1 180 ? 131.215 74.461  103.650 1.00 0.00 ? 201 G A H8     1  
ATOM 5804   H H1     . G A 1 180 ? 135.002 79.402  102.771 1.00 0.00 ? 201 G A H1     1  
ATOM 5805   H H21    . G A 1 180 ? 135.724 80.166  104.712 1.00 0.00 ? 201 G A H21    1  
ATOM 5806   H H22    . G A 1 180 ? 135.271 79.458  106.185 1.00 0.00 ? 201 G A H22    1  
ATOM 5807   P P      . U A 1 181 ? 128.342 77.905  107.891 1.00 0.00 ? 202 U A P      1  
ATOM 5808   O OP1    . U A 1 181 ? 128.047 78.480  109.228 1.00 0.00 ? 202 U A OP1    1  
ATOM 5809   O OP2    . U A 1 181 ? 127.224 77.537  106.987 1.00 0.00 ? 202 U A OP2    1  
ATOM 5810   O "O5'"  . U A 1 181 ? 129.290 78.922  107.116 1.00 0.00 ? 202 U A "O5'"  1  
ATOM 5811   C "C5'"  . U A 1 181 ? 130.393 79.504  107.789 1.00 0.00 ? 202 U A "C5'"  1  
ATOM 5812   C "C4'"  . U A 1 181 ? 131.021 80.600  106.965 1.00 0.00 ? 202 U A "C4'"  1  
ATOM 5813   O "O4'"  . U A 1 181 ? 131.678 80.031  105.812 1.00 0.00 ? 202 U A "O4'"  1  
ATOM 5814   C "C3'"  . U A 1 181 ? 130.111 81.652  106.348 1.00 0.00 ? 202 U A "C3'"  1  
ATOM 5815   O "O3'"  . U A 1 181 ? 129.763 82.644  107.312 1.00 0.00 ? 202 U A "O3'"  1  
ATOM 5816   C "C2'"  . U A 1 181 ? 131.017 82.255  105.280 1.00 0.00 ? 202 U A "C2'"  1  
ATOM 5817   O "O2'"  . U A 1 181 ? 131.866 83.265  105.792 1.00 0.00 ? 202 U A "O2'"  1  
ATOM 5818   C "C1'"  . U A 1 181 ? 131.861 81.050  104.857 1.00 0.00 ? 202 U A "C1'"  1  
ATOM 5819   N N1     . U A 1 181 ? 131.536 80.523  103.534 1.00 0.00 ? 202 U A N1     1  
ATOM 5820   C C2     . U A 1 181 ? 132.087 81.175  102.466 1.00 0.00 ? 202 U A C2     1  
ATOM 5821   O O2     . U A 1 181 ? 132.780 82.170  102.593 1.00 0.00 ? 202 U A O2     1  
ATOM 5822   N N3     . U A 1 181 ? 131.796 80.632  101.242 1.00 0.00 ? 202 U A N3     1  
ATOM 5823   C C4     . U A 1 181 ? 131.013 79.527  100.991 1.00 0.00 ? 202 U A C4     1  
ATOM 5824   O O4     . U A 1 181 ? 130.929 79.092  99.835  1.00 0.00 ? 202 U A O4     1  
ATOM 5825   C C5     . U A 1 181 ? 130.456 78.922  102.165 1.00 0.00 ? 202 U A C5     1  
ATOM 5826   C C6     . U A 1 181 ? 130.736 79.431  103.368 1.00 0.00 ? 202 U A C6     1  
ATOM 5827   H "H5'"  . U A 1 181 ? 131.063 78.810  107.965 1.00 0.00 ? 202 U A "H5'"  1  
ATOM 5828   H "H5''" . U A 1 181 ? 130.086 79.876  108.642 1.00 0.00 ? 202 U A "H5''" 1  
ATOM 5829   H "H4'"  . U A 1 181 ? 131.686 81.064  107.512 1.00 0.00 ? 202 U A "H4'"  1  
ATOM 5830   H "H3'"  . U A 1 181 ? 129.305 81.216  106.002 1.00 0.00 ? 202 U A "H3'"  1  
ATOM 5831   H "H2'"  . U A 1 181 ? 130.501 82.588  104.517 1.00 0.00 ? 202 U A "H2'"  1  
ATOM 5832   H "HO2'" . U A 1 181 ? 131.921 83.996  105.142 1.00 0.00 ? 202 U A "HO2'" 1  
ATOM 5833   H "H1'"  . U A 1 181 ? 132.808 81.300  104.865 1.00 0.00 ? 202 U A "H1'"  1  
ATOM 5834   H H3     . U A 1 181 ? 132.185 81.081  100.463 1.00 0.00 ? 202 U A H3     1  
ATOM 5835   H H5     . U A 1 181 ? 129.874 78.138  102.086 1.00 0.00 ? 202 U A H5     1  
ATOM 5836   H H6     . U A 1 181 ? 130.342 78.998  104.152 1.00 0.00 ? 202 U A H6     1  
ATOM 5837   P P      . C A 1 182 ? 128.696 83.782  106.938 1.00 0.00 ? 203 C A P      1  
ATOM 5838   O OP1    . C A 1 182 ? 128.460 84.601  108.147 1.00 0.00 ? 203 C A OP1    1  
ATOM 5839   O OP2    . C A 1 182 ? 127.554 83.124  106.271 1.00 0.00 ? 203 C A OP2    1  
ATOM 5840   O "O5'"  . C A 1 182 ? 129.443 84.668  105.848 1.00 0.00 ? 203 C A "O5'"  1  
ATOM 5841   C "C5'"  . C A 1 182 ? 130.342 85.704  106.229 1.00 0.00 ? 203 C A "C5'"  1  
ATOM 5842   C "C4'"  . C A 1 182 ? 130.791 86.470  105.005 1.00 0.00 ? 203 C A "C4'"  1  
ATOM 5843   O "O4'"  . C A 1 182 ? 131.507 85.566  104.122 1.00 0.00 ? 203 C A "O4'"  1  
ATOM 5844   C "C3'"  . C A 1 182 ? 129.669 86.996  104.127 1.00 0.00 ? 203 C A "C3'"  1  
ATOM 5845   O "O3'"  . C A 1 182 ? 129.164 88.231  104.593 1.00 0.00 ? 203 C A "O3'"  1  
ATOM 5846   C "C2'"  . C A 1 182 ? 130.360 87.159  102.786 1.00 0.00 ? 203 C A "C2'"  1  
ATOM 5847   O "O2'"  . C A 1 182 ? 131.151 88.323  102.732 1.00 0.00 ? 203 C A "O2'"  1  
ATOM 5848   C "C1'"  . C A 1 182 ? 131.259 85.925  102.772 1.00 0.00 ? 203 C A "C1'"  1  
ATOM 5849   N N1     . C A 1 182 ? 130.625 84.790  102.088 1.00 0.00 ? 203 C A N1     1  
ATOM 5850   C C2     . C A 1 182 ? 130.604 84.791  100.702 1.00 0.00 ? 203 C A C2     1  
ATOM 5851   O O2     . C A 1 182 ? 131.131 85.734  100.105 1.00 0.00 ? 203 C A O2     1  
ATOM 5852   N N3     . C A 1 182 ? 130.015 83.772  100.047 1.00 0.00 ? 203 C A N3     1  
ATOM 5853   C C4     . C A 1 182 ? 129.466 82.769  100.732 1.00 0.00 ? 203 C A C4     1  
ATOM 5854   N N4     . C A 1 182 ? 128.897 81.780  100.035 1.00 0.00 ? 203 C A N4     1  
ATOM 5855   C C5     . C A 1 182 ? 129.479 82.738  102.154 1.00 0.00 ? 203 C A C5     1  
ATOM 5856   C C6     . C A 1 182 ? 130.065 83.758  102.786 1.00 0.00 ? 203 C A C6     1  
ATOM 5857   H "H5'"  . C A 1 182 ? 131.118 85.305  106.676 1.00 0.00 ? 203 C A "H5'"  1  
ATOM 5858   H "H5''" . C A 1 182 ? 129.889 86.308  106.852 1.00 0.00 ? 203 C A "H5''" 1  
ATOM 5859   H "H4'"  . C A 1 182 ? 131.392 87.190  105.288 1.00 0.00 ? 203 C A "H4'"  1  
ATOM 5860   H "H3'"  . C A 1 182 ? 128.946 86.336  104.096 1.00 0.00 ? 203 C A "H3'"  1  
ATOM 5861   H "H2'"  . C A 1 182 ? 129.717 87.133  102.048 1.00 0.00 ? 203 C A "H2'"  1  
ATOM 5862   H "HO2'" . C A 1 182 ? 130.854 88.944  103.428 1.00 0.00 ? 203 C A "HO2'" 1  
ATOM 5863   H "H1'"  . C A 1 182 ? 132.103 86.147  102.328 1.00 0.00 ? 203 C A "H1'"  1  
ATOM 5864   H H41    . C A 1 182 ? 128.893 81.809  99.055  1.00 0.00 ? 203 C A H41    1  
ATOM 5865   H H42    . C A 1 182 ? 128.483 81.026  100.505 1.00 0.00 ? 203 C A H42    1  
ATOM 5866   H H5     . C A 1 182 ? 129.075 81.994  102.649 1.00 0.00 ? 203 C A H5     1  
ATOM 5867   H H6     . C A 1 182 ? 130.086 83.759  103.765 1.00 0.00 ? 203 C A H6     1  
ATOM 5868   P P      . C A 1 183 ? 127.614 88.571  104.380 1.00 0.00 ? 204 C A P      1  
ATOM 5869   O OP1    . C A 1 183 ? 127.273 89.705  105.271 1.00 0.00 ? 204 C A OP1    1  
ATOM 5870   O OP2    . C A 1 183 ? 126.860 87.302  104.482 1.00 0.00 ? 204 C A OP2    1  
ATOM 5871   O "O5'"  . C A 1 183 ? 127.511 89.068  102.878 1.00 0.00 ? 204 C A "O5'"  1  
ATOM 5872   C "C5'"  . C A 1 183 ? 128.154 90.261  102.499 1.00 0.00 ? 204 C A "C5'"  1  
ATOM 5873   C "C4'"  . C A 1 183 ? 128.247 90.354  101.008 1.00 0.00 ? 204 C A "C4'"  1  
ATOM 5874   O "O4'"  . C A 1 183 ? 129.015 89.248  100.467 1.00 0.00 ? 204 C A "O4'"  1  
ATOM 5875   C "C3'"  . C A 1 183 ? 126.938 90.271  100.266 1.00 0.00 ? 204 C A "C3'"  1  
ATOM 5876   O "O3'"  . C A 1 183 ? 126.283 91.526  100.389 1.00 0.00 ? 204 C A "O3'"  1  
ATOM 5877   C "C2'"  . C A 1 183 ? 127.441 89.963  98.858  1.00 0.00 ? 204 C A "C2'"  1  
ATOM 5878   O "O2'"  . C A 1 183 ? 128.030 91.094  98.255  1.00 0.00 ? 204 C A "O2'"  1  
ATOM 5879   C "C1'"  . C A 1 183 ? 128.563 88.966  99.152  1.00 0.00 ? 204 C A "C1'"  1  
ATOM 5880   N N1     . C A 1 183 ? 128.109 87.572  99.113  1.00 0.00 ? 204 C A N1     1  
ATOM 5881   C C2     . C A 1 183 ? 127.805 86.989  97.875  1.00 0.00 ? 204 C A C2     1  
ATOM 5882   O O2     . C A 1 183 ? 127.941 87.658  96.843  1.00 0.00 ? 204 C A O2     1  
ATOM 5883   N N3     . C A 1 183 ? 127.375 85.709  97.836  1.00 0.00 ? 204 C A N3     1  
ATOM 5884   C C4     . C A 1 183 ? 127.247 85.015  98.972  1.00 0.00 ? 204 C A C4     1  
ATOM 5885   N N4     . C A 1 183 ? 126.814 83.752  98.881  1.00 0.00 ? 204 C A N4     1  
ATOM 5886   C C5     . C A 1 183 ? 127.553 85.581  100.244 1.00 0.00 ? 204 C A C5     1  
ATOM 5887   C C6     . C A 1 183 ? 127.978 86.849  100.269 1.00 0.00 ? 204 C A C6     1  
ATOM 5888   H "H5'"  . C A 1 183 ? 129.054 90.276  102.887 1.00 0.00 ? 204 C A "H5'"  1  
ATOM 5889   H "H5''" . C A 1 183 ? 127.644 91.022  102.845 1.00 0.00 ? 204 C A "H5''" 1  
ATOM 5890   H "H4'"  . C A 1 183 ? 128.700 91.189  100.773 1.00 0.00 ? 204 C A "H4'"  1  
ATOM 5891   H "H3'"  . C A 1 183 ? 126.400 89.542  100.639 1.00 0.00 ? 204 C A "H3'"  1  
ATOM 5892   H "H2'"  . C A 1 183 ? 126.730 89.588  98.297  1.00 0.00 ? 204 C A "H2'"  1  
ATOM 5893   H "HO2'" . C A 1 183 ? 128.338 90.854  97.357  1.00 0.00 ? 204 C A "HO2'" 1  
ATOM 5894   H "H1'"  . C A 1 183 ? 129.282 89.089  98.499  1.00 0.00 ? 204 C A "H1'"  1  
ATOM 5895   H H41    . C A 1 183 ? 126.605 83.368  98.004  1.00 0.00 ? 204 C A H41    1  
ATOM 5896   H H42    . C A 1 183 ? 126.708 83.212  99.690  1.00 0.00 ? 204 C A H42    1  
ATOM 5897   H H5     . C A 1 183 ? 127.458 85.059  101.069 1.00 0.00 ? 204 C A H5     1  
ATOM 5898   H H6     . C A 1 183 ? 128.194 87.258  101.132 1.00 0.00 ? 204 C A H6     1  
ATOM 5899   P P      . U A 1 184 ? 124.688 91.604  100.249 1.00 0.00 ? 205 U A P      1  
ATOM 5900   O OP1    . U A 1 184 ? 124.197 92.484  101.342 1.00 0.00 ? 205 U A OP1    1  
ATOM 5901   O OP2    . U A 1 184 ? 124.202 90.201  100.175 1.00 0.00 ? 205 U A OP2    1  
ATOM 5902   O "O5'"  . U A 1 184 ? 124.320 92.285  98.861  1.00 0.00 ? 205 U A "O5'"  1  
ATOM 5903   C "C5'"  . U A 1 184 ? 123.568 91.564  97.900  1.00 0.00 ? 205 U A "C5'"  1  
ATOM 5904   C "C4'"  . U A 1 184 ? 124.406 91.350  96.666  1.00 0.00 ? 205 U A "C4'"  1  
ATOM 5905   O "O4'"  . U A 1 184 ? 125.303 90.242  96.883  1.00 0.00 ? 205 U A "O4'"  1  
ATOM 5906   C "C3'"  . U A 1 184 ? 123.604 91.051  95.421  1.00 0.00 ? 205 U A "C3'"  1  
ATOM 5907   O "O3'"  . U A 1 184 ? 123.451 92.288  94.736  1.00 0.00 ? 205 U A "O3'"  1  
ATOM 5908   C "C2'"  . U A 1 184 ? 124.486 90.066  94.657  1.00 0.00 ? 205 U A "C2'"  1  
ATOM 5909   O "O2'"  . U A 1 184 ? 125.410 90.702  93.798  1.00 0.00 ? 205 U A "O2'"  1  
ATOM 5910   C "C1'"  . U A 1 184 ? 125.241 89.359  95.793  1.00 0.00 ? 205 U A "C1'"  1  
ATOM 5911   N N1     . U A 1 184 ? 124.677 88.103  96.302  1.00 0.00 ? 205 U A N1     1  
ATOM 5912   C C2     . U A 1 184 ? 124.573 87.026  95.446  1.00 0.00 ? 205 U A C2     1  
ATOM 5913   O O2     . U A 1 184 ? 124.885 87.076  94.267  1.00 0.00 ? 205 U A O2     1  
ATOM 5914   N N3     . U A 1 184 ? 124.084 85.881  96.021  1.00 0.00 ? 205 U A N3     1  
ATOM 5915   C C4     . U A 1 184 ? 123.697 85.714  97.337  1.00 0.00 ? 205 U A C4     1  
ATOM 5916   O O4     . U A 1 184 ? 123.316 84.603  97.720  1.00 0.00 ? 205 U A O4     1  
ATOM 5917   C C5     . U A 1 184 ? 123.820 86.884  98.149  1.00 0.00 ? 205 U A C5     1  
ATOM 5918   C C6     . U A 1 184 ? 124.291 88.008  97.618  1.00 0.00 ? 205 U A C6     1  
ATOM 5919   H "H5'"  . U A 1 184 ? 122.763 92.076  97.677  1.00 0.00 ? 205 U A "H5'"  1  
ATOM 5920   H "H5''" . U A 1 184 ? 123.304 90.702  98.282  1.00 0.00 ? 205 U A "H5''" 1  
ATOM 5921   H "H4'"  . U A 1 184 ? 124.931 92.159  96.497  1.00 0.00 ? 205 U A "H4'"  1  
ATOM 5922   H "H3'"  . U A 1 184 ? 122.746 90.656  95.676  1.00 0.00 ? 205 U A "H3'"  1  
ATOM 5923   H "H2'"  . U A 1 184 ? 123.949 89.412  94.163  1.00 0.00 ? 205 U A "H2'"  1  
ATOM 5924   H "HO2'" . U A 1 184 ? 125.101 91.615  93.617  1.00 0.00 ? 205 U A "HO2'" 1  
ATOM 5925   H "H1'"  . U A 1 184 ? 126.153 89.155  95.496  1.00 0.00 ? 205 U A "H1'"  1  
ATOM 5926   H H3     . U A 1 184 ? 124.001 85.101  95.435  1.00 0.00 ? 205 U A H3     1  
ATOM 5927   H H5     . U A 1 184 ? 123.559 86.858  99.094  1.00 0.00 ? 205 U A H5     1  
ATOM 5928   H H6     . U A 1 184 ? 124.363 88.793  98.197  1.00 0.00 ? 205 U A H6     1  
ATOM 5929   P P      . A A 1 185 ? 122.290 93.299  95.184  1.00 0.00 ? 206 A A P      1  
ATOM 5930   O OP1    . A A 1 185 ? 122.072 94.299  94.110  1.00 0.00 ? 206 A A OP1    1  
ATOM 5931   O OP2    . A A 1 185 ? 122.604 93.763  96.557  1.00 0.00 ? 206 A A OP2    1  
ATOM 5932   O "O5'"  . A A 1 185 ? 121.024 92.337  95.224  1.00 0.00 ? 206 A A "O5'"  1  
ATOM 5933   C "C5'"  . A A 1 185 ? 120.586 91.698  94.026  1.00 0.00 ? 206 A A "C5'"  1  
ATOM 5934   C "C4'"  . A A 1 185 ? 119.676 90.527  94.334  1.00 0.00 ? 206 A A "C4'"  1  
ATOM 5935   O "O4'"  . A A 1 185 ? 120.402 89.457  94.975  1.00 0.00 ? 206 A A "O4'"  1  
ATOM 5936   C "C3'"  . A A 1 185 ? 118.530 90.787  95.285  1.00 0.00 ? 206 A A "C3'"  1  
ATOM 5937   O "O3'"  . A A 1 185 ? 117.459 91.365  94.576  1.00 0.00 ? 206 A A "O3'"  1  
ATOM 5938   C "C2'"  . A A 1 185 ? 118.146 89.382  95.700  1.00 0.00 ? 206 A A "C2'"  1  
ATOM 5939   O "O2'"  . A A 1 185 ? 117.382 88.760  94.702  1.00 0.00 ? 206 A A "O2'"  1  
ATOM 5940   C "C1'"  . A A 1 185 ? 119.505 88.697  95.758  1.00 0.00 ? 206 A A "C1'"  1  
ATOM 5941   N N9     . A A 1 185 ? 120.023 88.652  97.108  1.00 0.00 ? 206 A A N9     1  
ATOM 5942   C C8     . A A 1 185 ? 120.692 89.629  97.796  1.00 0.00 ? 206 A A C8     1  
ATOM 5943   N N7     . A A 1 185 ? 121.063 89.265  98.999  1.00 0.00 ? 206 A A N7     1  
ATOM 5944   C C5     . A A 1 185 ? 120.601 87.959  99.110  1.00 0.00 ? 206 A A C5     1  
ATOM 5945   C C6     . A A 1 185 ? 120.684 87.001  100.144 1.00 0.00 ? 206 A A C6     1  
ATOM 5946   N N6     . A A 1 185 ? 121.310 87.214  101.306 1.00 0.00 ? 206 A A N6     1  
ATOM 5947   N N1     . A A 1 185 ? 120.102 85.801  99.933  1.00 0.00 ? 206 A A N1     1  
ATOM 5948   C C2     . A A 1 185 ? 119.493 85.579  98.757  1.00 0.00 ? 206 A A C2     1  
ATOM 5949   N N3     . A A 1 185 ? 119.361 86.390  97.708  1.00 0.00 ? 206 A A N3     1  
ATOM 5950   C C4     . A A 1 185 ? 119.943 87.577  97.954  1.00 0.00 ? 206 A A C4     1  
ATOM 5951   H "H5'"  . A A 1 185 ? 121.369 91.376  93.530  1.00 0.00 ? 206 A A "H5'"  1  
ATOM 5952   H "H5''" . A A 1 185 ? 120.102 92.347  93.475  1.00 0.00 ? 206 A A "H5''" 1  
ATOM 5953   H "H4'"  . A A 1 185 ? 119.305 90.185  93.492  1.00 0.00 ? 206 A A "H4'"  1  
ATOM 5954   H "H3'"  . A A 1 185 ? 118.838 91.380  96.003  1.00 0.00 ? 206 A A "H3'"  1  
ATOM 5955   H "H2'"  . A A 1 185 ? 117.692 89.376  96.570  1.00 0.00 ? 206 A A "H2'"  1  
ATOM 5956   H "HO2'" . A A 1 185 ? 117.000 89.447  94.119  1.00 0.00 ? 206 A A "HO2'" 1  
ATOM 5957   H "H1'"  . A A 1 185 ? 119.426 87.787  95.403  1.00 0.00 ? 206 A A "H1'"  1  
ATOM 5958   H H8     . A A 1 185 ? 120.880 90.515  97.423  1.00 0.00 ? 206 A A H8     1  
ATOM 5959   H H61    . A A 1 185 ? 121.340 86.506  101.984 1.00 0.00 ? 206 A A H61    1  
ATOM 5960   H H62    . A A 1 185 ? 121.739 88.076  101.481 1.00 0.00 ? 206 A A H62    1  
ATOM 5961   H H2     . A A 1 185 ? 119.086 84.692  98.656  1.00 0.00 ? 206 A A H2     1  
ATOM 5962   P P      . A A 1 186 ? 116.123 91.745  95.359  1.00 0.00 ? 207 A A P      1  
ATOM 5963   O OP1    . A A 1 186 ? 115.752 93.125  94.955  1.00 0.00 ? 207 A A OP1    1  
ATOM 5964   O OP2    . A A 1 186 ? 116.390 91.442  96.795  1.00 0.00 ? 207 A A OP2    1  
ATOM 5965   O "O5'"  . A A 1 186 ? 115.038 90.734  94.765  1.00 0.00 ? 207 A A "O5'"  1  
ATOM 5966   C "C5'"  . A A 1 186 ? 114.753 90.706  93.365  1.00 0.00 ? 207 A A "C5'"  1  
ATOM 5967   C "C4'"  . A A 1 186 ? 113.949 89.472  93.010  1.00 0.00 ? 207 A A "C4'"  1  
ATOM 5968   O "O4'"  . A A 1 186 ? 114.707 88.270  93.329  1.00 0.00 ? 207 A A "O4'"  1  
ATOM 5969   C "C3'"  . A A 1 186 ? 112.652 89.277  93.771  1.00 0.00 ? 207 A A "C3'"  1  
ATOM 5970   O "O3'"  . A A 1 186 ? 111.630 90.075  93.197  1.00 0.00 ? 207 A A "O3'"  1  
ATOM 5971   C "C2'"  . A A 1 186 ? 112.416 87.778  93.591  1.00 0.00 ? 207 A A "C2'"  1  
ATOM 5972   O "O2'"  . A A 1 186 ? 112.016 87.416  92.282  1.00 0.00 ? 207 A A "O2'"  1  
ATOM 5973   C "C1'"  . A A 1 186 ? 113.830 87.246  93.768  1.00 0.00 ? 207 A A "C1'"  1  
ATOM 5974   N N9     . A A 1 186 ? 114.159 86.933  95.151  1.00 0.00 ? 207 A A N9     1  
ATOM 5975   C C8     . A A 1 186 ? 114.873 87.688  96.038  1.00 0.00 ? 207 A A C8     1  
ATOM 5976   N N7     . A A 1 186 ? 115.073 87.099  97.188  1.00 0.00 ? 207 A A N7     1  
ATOM 5977   C C5     . A A 1 186 ? 114.433 85.878  97.051  1.00 0.00 ? 207 A A C5     1  
ATOM 5978   C C6     . A A 1 186 ? 114.289 84.776  97.920  1.00 0.00 ? 207 A A C6     1  
ATOM 5979   N N6     . A A 1 186 ? 114.831 84.712  99.138  1.00 0.00 ? 207 A A N6     1  
ATOM 5980   N N1     . A A 1 186 ? 113.570 83.726  97.484  1.00 0.00 ? 207 A A N1     1  
ATOM 5981   C C2     . A A 1 186 ? 113.040 83.784  96.254  1.00 0.00 ? 207 A A C2     1  
ATOM 5982   N N3     . A A 1 186 ? 113.122 84.754  95.342  1.00 0.00 ? 207 A A N3     1  
ATOM 5983   C C4     . A A 1 186 ? 113.841 85.779  95.809  1.00 0.00 ? 207 A A C4     1  
ATOM 5984   H "H5'"  . A A 1 186 ? 115.598 90.702  92.867  1.00 0.00 ? 207 A A "H5'"  1  
ATOM 5985   H "H5''" . A A 1 186 ? 114.245 91.508  93.125  1.00 0.00 ? 207 A A "H5''" 1  
ATOM 5986   H "H4'"  . A A 1 186 ? 113.763 89.479  92.048  1.00 0.00 ? 207 A A "H4'"  1  
ATOM 5987   H "H3'"  . A A 1 186 ? 112.793 89.517  94.711  1.00 0.00 ? 207 A A "H3'"  1  
ATOM 5988   H "H2'"  . A A 1 186 ? 111.776 87.433  94.248  1.00 0.00 ? 207 A A "H2'"  1  
ATOM 5989   H "HO2'" . A A 1 186 ? 111.886 86.445  92.246  1.00 0.00 ? 207 A A "HO2'" 1  
ATOM 5990   H "H1'"  . A A 1 186 ? 113.945 86.438  93.225  1.00 0.00 ? 207 A A "H1'"  1  
ATOM 5991   H H8     . A A 1 186 ? 115.213 88.583  95.829  1.00 0.00 ? 207 A A H8     1  
ATOM 5992   H H61    . A A 1 186 ? 114.702 83.911  99.691  1.00 0.00 ? 207 A A H61    1  
ATOM 5993   H H62    . A A 1 186 ? 115.359 85.463  99.480  1.00 0.00 ? 207 A A H62    1  
ATOM 5994   H H2     . A A 1 186 ? 112.517 83.000  95.988  1.00 0.00 ? 207 A A H2     1  
ATOM 5995   P P      . C A 1 187 ? 110.276 90.337  94.014  1.00 0.00 ? 208 C A P      1  
ATOM 5996   O OP1    . C A 1 187 ? 109.185 90.304  93.009  1.00 0.00 ? 208 C A OP1    1  
ATOM 5997   O OP2    . C A 1 187 ? 110.523 91.561  94.824  1.00 0.00 ? 208 C A OP2    1  
ATOM 5998   O "O5'"  . C A 1 187 ? 110.026 89.122  95.004  1.00 0.00 ? 208 C A "O5'"  1  
ATOM 5999   C "C5'"  . C A 1 187 ? 108.988 88.195  94.739  1.00 0.00 ? 208 C A "C5'"  1  
ATOM 6000   C "C4'"  . C A 1 187 ? 108.872 87.227  95.880  1.00 0.00 ? 208 C A "C4'"  1  
ATOM 6001   O "O4'"  . C A 1 187 ? 110.199 86.745  96.183  1.00 0.00 ? 208 C A "O4'"  1  
ATOM 6002   C "C3'"  . C A 1 187 ? 108.357 87.824  97.181  1.00 0.00 ? 208 C A "C3'"  1  
ATOM 6003   O "O3'"  . C A 1 187 ? 106.931 87.743  97.214  1.00 0.00 ? 208 C A "O3'"  1  
ATOM 6004   C "C2'"  . C A 1 187 ? 108.992 86.916  98.223  1.00 0.00 ? 208 C A "C2'"  1  
ATOM 6005   O "O2'"  . C A 1 187 ? 108.282 85.715  98.425  1.00 0.00 ? 208 C A "O2'"  1  
ATOM 6006   C "C1'"  . C A 1 187 ? 110.343 86.608  97.578  1.00 0.00 ? 208 C A "C1'"  1  
ATOM 6007   N N1     . C A 1 187 ? 111.364 87.551  98.020  1.00 0.00 ? 208 C A N1     1  
ATOM 6008   C C2     . C A 1 187 ? 111.996 87.313  99.240  1.00 0.00 ? 208 C A C2     1  
ATOM 6009   O O2     . C A 1 187 ? 111.703 86.278  99.864  1.00 0.00 ? 208 C A O2     1  
ATOM 6010   N N3     . C A 1 187 ? 112.903 88.205  99.697  1.00 0.00 ? 208 C A N3     1  
ATOM 6011   C C4     . C A 1 187 ? 113.189 89.291  98.973  1.00 0.00 ? 208 C A C4     1  
ATOM 6012   N N4     . C A 1 187 ? 114.068 90.164  99.469  1.00 0.00 ? 208 C A N4     1  
ATOM 6013   C C5     . C A 1 187 ? 112.578 89.538  97.704  1.00 0.00 ? 208 C A C5     1  
ATOM 6014   C C6     . C A 1 187 ? 111.680 88.650  97.272  1.00 0.00 ? 208 C A C6     1  
ATOM 6015   H "H5'"  . C A 1 187 ? 109.193 87.713  93.910  1.00 0.00 ? 208 C A "H5'"  1  
ATOM 6016   H "H5''" . C A 1 187 ? 108.146 88.682  94.625  1.00 0.00 ? 208 C A "H5''" 1  
ATOM 6017   H "H4'"  . C A 1 187 ? 108.302 86.481  95.602  1.00 0.00 ? 208 C A "H4'"  1  
ATOM 6018   H "H3'"  . C A 1 187 ? 108.655 88.755  97.251  1.00 0.00 ? 208 C A "H3'"  1  
ATOM 6019   H "H2'"  . C A 1 187 ? 109.124 87.383  99.074  1.00 0.00 ? 208 C A "H2'"  1  
ATOM 6020   H "HO2'" . C A 1 187 ? 108.743 85.181  99.104  1.00 0.00 ? 208 C A "HO2'" 1  
ATOM 6021   H "H1'"  . C A 1 187 ? 110.609 85.694  97.809  1.00 0.00 ? 208 C A "H1'"  1  
ATOM 6022   H H41    . C A 1 187 ? 114.482 89.998  100.341 1.00 0.00 ? 208 C A H41    1  
ATOM 6023   H H42    . C A 1 187 ? 114.298 90.968  98.960  1.00 0.00 ? 208 C A H42    1  
ATOM 6024   H H5     . C A 1 187 ? 112.811 90.327  97.173  1.00 0.00 ? 208 C A H5     1  
ATOM 6025   H H6     . C A 1 187 ? 111.249 88.798  96.405  1.00 0.00 ? 208 C A H6     1  
ATOM 6026   P P      . C A 1 188 ? 106.098 88.562  98.317  1.00 0.00 ? 209 C A P      1  
ATOM 6027   O OP1    . C A 1 188 ? 104.733 88.001  98.265  1.00 0.00 ? 209 C A OP1    1  
ATOM 6028   O OP2    . C A 1 188 ? 106.300 90.012  98.089  1.00 0.00 ? 209 C A OP2    1  
ATOM 6029   O "O5'"  . C A 1 188 ? 106.749 88.116  99.700  1.00 0.00 ? 209 C A "O5'"  1  
ATOM 6030   C "C5'"  . C A 1 188 ? 106.543 86.802  100.178 1.00 0.00 ? 209 C A "C5'"  1  
ATOM 6031   C "C4'"  . C A 1 188 ? 107.007 86.685  101.596 1.00 0.00 ? 209 C A "C4'"  1  
ATOM 6032   O "O4'"  . C A 1 188 ? 108.438 86.845  101.670 1.00 0.00 ? 209 C A "O4'"  1  
ATOM 6033   C "C3'"  . C A 1 188 ? 106.499 87.756  102.526 1.00 0.00 ? 209 C A "C3'"  1  
ATOM 6034   O "O3'"  . C A 1 188 ? 105.175 87.456  102.908 1.00 0.00 ? 209 C A "O3'"  1  
ATOM 6035   C "C2'"  . C A 1 188 ? 107.471 87.646  103.688 1.00 0.00 ? 209 C A "C2'"  1  
ATOM 6036   O "O2'"  . C A 1 188 ? 107.146 86.584  104.557 1.00 0.00 ? 209 C A "O2'"  1  
ATOM 6037   C "C1'"  . C A 1 188 ? 108.781 87.326  102.960 1.00 0.00 ? 209 C A "C1'"  1  
ATOM 6038   N N1     . C A 1 188 ? 109.651 88.500  102.803 1.00 0.00 ? 209 C A N1     1  
ATOM 6039   C C2     . C A 1 188 ? 110.471 88.888  103.875 1.00 0.00 ? 209 C A C2     1  
ATOM 6040   O O2     . C A 1 188 ? 110.461 88.211  104.912 1.00 0.00 ? 209 C A O2     1  
ATOM 6041   N N3     . C A 1 188 ? 111.244 89.989  103.750 1.00 0.00 ? 209 C A N3     1  
ATOM 6042   C C4     . C A 1 188 ? 111.220 90.696  102.613 1.00 0.00 ? 209 C A C4     1  
ATOM 6043   N N4     . C A 1 188 ? 111.962 91.800  102.535 1.00 0.00 ? 209 C A N4     1  
ATOM 6044   C C5     . C A 1 188 ? 110.421 90.307  101.500 1.00 0.00 ? 209 C A C5     1  
ATOM 6045   C C6     . C A 1 188 ? 109.660 89.214  101.636 1.00 0.00 ? 209 C A C6     1  
ATOM 6046   H "H5'"  . C A 1 188 ? 107.043 86.175  99.614  1.00 0.00 ? 209 C A "H5'"  1  
ATOM 6047   H "H5''" . C A 1 188 ? 105.589 86.588  100.127 1.00 0.00 ? 209 C A "H5''" 1  
ATOM 6048   H "H4'"  . C A 1 188 ? 106.774 85.795  101.930 1.00 0.00 ? 209 C A "H4'"  1  
ATOM 6049   H "H3'"  . C A 1 188 ? 106.545 88.625  102.076 1.00 0.00 ? 209 C A "H3'"  1  
ATOM 6050   H "H2'"  . C A 1 188 ? 107.545 88.493  104.175 1.00 0.00 ? 209 C A "H2'"  1  
ATOM 6051   H "HO2'" . C A 1 188 ? 107.800 86.555  105.285 1.00 0.00 ? 209 C A "HO2'" 1  
ATOM 6052   H "H1'"  . C A 1 188 ? 109.265 86.633  103.455 1.00 0.00 ? 209 C A "H1'"  1  
ATOM 6053   H H41    . C A 1 188 ? 112.508 92.077  103.301 1.00 0.00 ? 209 C A H41    1  
ATOM 6054   H H42    . C A 1 188 ? 111.962 92.334  101.714 1.00 0.00 ? 209 C A H42    1  
ATOM 6055   H H5     . C A 1 188 ? 110.429 90.820  100.664 1.00 0.00 ? 209 C A H5     1  
ATOM 6056   H H6     . C A 1 188 ? 109.102 88.929  100.884 1.00 0.00 ? 209 C A H6     1  
ATOM 6057   P P      . A A 1 189 ? 103.938 88.077  102.091 1.00 0.00 ? 210 A A P      1  
ATOM 6058   O OP1    . A A 1 189 ? 103.506 87.081  101.080 1.00 0.00 ? 210 A A OP1    1  
ATOM 6059   O OP2    . A A 1 189 ? 104.314 89.447  101.658 1.00 0.00 ? 210 A A OP2    1  
ATOM 6060   O "O5'"  . A A 1 189 ? 102.783 88.206  103.181 1.00 0.00 ? 210 A A "O5'"  1  
ATOM 6061   C "C5'"  . A A 1 189 ? 101.832 89.258  103.115 1.00 0.00 ? 210 A A "C5'"  1  
ATOM 6062   C "C4'"  . A A 1 189 ? 101.651 89.927  104.455 1.00 0.00 ? 210 A A "C4'"  1  
ATOM 6063   O "O4'"  . A A 1 189 ? 100.757 89.124  105.288 1.00 0.00 ? 210 A A "O4'"  1  
ATOM 6064   C "C3'"  . A A 1 189 ? 102.916 90.138  105.272 1.00 0.00 ? 210 A A "C3'"  1  
ATOM 6065   O "O3'"  . A A 1 189 ? 103.007 91.439  105.827 1.00 0.00 ? 210 A A "O3'"  1  
ATOM 6066   C "C2'"  . A A 1 189 ? 102.913 88.959  106.247 1.00 0.00 ? 210 A A "C2'"  1  
ATOM 6067   O "O2'"  . A A 1 189 ? 103.514 89.312  107.484 1.00 0.00 ? 210 A A "O2'"  1  
ATOM 6068   C "C1'"  . A A 1 189 ? 101.422 88.723  106.485 1.00 0.00 ? 210 A A "C1'"  1  
ATOM 6069   N N9     . A A 1 189 ? 101.116 87.300  106.727 1.00 0.00 ? 210 A A N9     1  
ATOM 6070   C C8     . A A 1 189 ? 101.453 86.220  105.950 1.00 0.00 ? 210 A A C8     1  
ATOM 6071   N N7     . A A 1 189 ? 101.038 85.073  106.429 1.00 0.00 ? 210 A A N7     1  
ATOM 6072   C C5     . A A 1 189 ? 100.382 85.421  107.602 1.00 0.00 ? 210 A A C5     1  
ATOM 6073   C C6     . A A 1 189 ? 99.716  84.657  108.576 1.00 0.00 ? 210 A A C6     1  
ATOM 6074   N N6     . A A 1 189 ? 99.597  83.328  108.522 1.00 0.00 ? 210 A A N6     1  
ATOM 6075   N N1     . A A 1 189 ? 99.170  85.312  109.623 1.00 0.00 ? 210 A A N1     1  
ATOM 6076   C C2     . A A 1 189 ? 99.289  86.645  109.679 1.00 0.00 ? 210 A A C2     1  
ATOM 6077   N N3     . A A 1 189 ? 99.890  87.472  108.826 1.00 0.00 ? 210 A A N3     1  
ATOM 6078   C C4     . A A 1 189 ? 100.423 86.789  107.798 1.00 0.00 ? 210 A A C4     1  
ATOM 6079   H "H5'"  . A A 1 189 ? 100.971 88.893  102.821 1.00 0.00 ? 210 A A "H5'"  1  
ATOM 6080   H "H5''" . A A 1 189 ? 102.135 89.924  102.464 1.00 0.00 ? 210 A A "H5''" 1  
ATOM 6081   H "H4'"  . A A 1 189 ? 101.250 90.811  104.317 1.00 0.00 ? 210 A A "H4'"  1  
ATOM 6082   H "H3'"  . A A 1 189 ? 103.696 90.057  104.683 1.00 0.00 ? 210 A A "H3'"  1  
ATOM 6083   H "H2'"  . A A 1 189 ? 103.333 88.166  105.853 1.00 0.00 ? 210 A A "H2'"  1  
ATOM 6084   H "HO2'" . A A 1 189 ? 103.494 88.536  108.081 1.00 0.00 ? 210 A A "HO2'" 1  
ATOM 6085   H "H1'"  . A A 1 189 ? 101.126 89.256  107.253 1.00 0.00 ? 210 A A "H1'"  1  
ATOM 6086   H H8     . A A 1 189 ? 101.959 86.299  105.113 1.00 0.00 ? 210 A A H8     1  
ATOM 6087   H H61    . A A 1 189 ? 99.120  82.850  109.232 1.00 0.00 ? 210 A A H61    1  
ATOM 6088   H H62    . A A 1 189 ? 99.985  82.832  107.772 1.00 0.00 ? 210 A A H62    1  
ATOM 6089   H H2     . A A 1 189 ? 98.876  87.072  110.459 1.00 0.00 ? 210 A A H2     1  
ATOM 6090   P P      . C A 1 190 ? 103.918 92.544  105.110 1.00 0.00 ? 211 C A P      1  
ATOM 6091   O OP1    . C A 1 190 ? 103.313 93.885  105.318 1.00 0.00 ? 211 C A OP1    1  
ATOM 6092   O OP2    . C A 1 190 ? 104.053 92.008  103.732 1.00 0.00 ? 211 C A OP2    1  
ATOM 6093   O "O5'"  . C A 1 190 ? 105.360 92.546  105.782 1.00 0.00 ? 211 C A "O5'"  1  
ATOM 6094   C "C5'"  . C A 1 190 ? 106.240 91.450  105.626 1.00 0.00 ? 211 C A "C5'"  1  
ATOM 6095   C "C4'"  . C A 1 190 ? 106.565 90.861  106.976 1.00 0.00 ? 211 C A "C4'"  1  
ATOM 6096   O "O4'"  . C A 1 190 ? 107.897 90.291  106.921 1.00 0.00 ? 211 C A "O4'"  1  
ATOM 6097   C "C3'"  . C A 1 190 ? 106.585 91.881  108.107 1.00 0.00 ? 211 C A "C3'"  1  
ATOM 6098   O "O3'"  . C A 1 190 ? 105.341 91.865  108.804 1.00 0.00 ? 211 C A "O3'"  1  
ATOM 6099   C "C2'"  . C A 1 190 ? 107.722 91.397  108.995 1.00 0.00 ? 211 C A "C2'"  1  
ATOM 6100   O "O2'"  . C A 1 190 ? 107.312 90.393  109.900 1.00 0.00 ? 211 C A "O2'"  1  
ATOM 6101   C "C1'"  . C A 1 190 ? 108.692 90.828  107.957 1.00 0.00 ? 211 C A "C1'"  1  
ATOM 6102   N N1     . C A 1 190 ? 109.576 91.809  107.308 1.00 0.00 ? 211 C A N1     1  
ATOM 6103   C C2     . C A 1 190 ? 110.630 92.410  108.026 1.00 0.00 ? 211 C A C2     1  
ATOM 6104   O O2     . C A 1 190 ? 110.800 92.125  109.222 1.00 0.00 ? 211 C A O2     1  
ATOM 6105   N N3     . C A 1 190 ? 111.431 93.286  107.387 1.00 0.00 ? 211 C A N3     1  
ATOM 6106   C C4     . C A 1 190 ? 111.217 93.569  106.102 1.00 0.00 ? 211 C A C4     1  
ATOM 6107   N N4     . C A 1 190 ? 112.035 94.428  105.512 1.00 0.00 ? 211 C A N4     1  
ATOM 6108   C C5     . C A 1 190 ? 110.155 92.980  105.362 1.00 0.00 ? 211 C A C5     1  
ATOM 6109   C C6     . C A 1 190 ? 109.370 92.118  105.995 1.00 0.00 ? 211 C A C6     1  
ATOM 6110   H "H5'"  . C A 1 190 ? 107.061 91.758  105.189 1.00 0.00 ? 211 C A "H5'"  1  
ATOM 6111   H "H5''" . C A 1 190 ? 105.810 90.773  105.061 1.00 0.00 ? 211 C A "H5''" 1  
ATOM 6112   H "H4'"  . C A 1 190 ? 105.915 90.155  107.176 1.00 0.00 ? 211 C A "H4'"  1  
ATOM 6113   H "H3'"  . C A 1 190 ? 106.761 92.771  107.737 1.00 0.00 ? 211 C A "H3'"  1  
ATOM 6114   H "H2'"  . C A 1 190 ? 108.150 92.140  109.467 1.00 0.00 ? 211 C A "H2'"  1  
ATOM 6115   H "HO2'" . C A 1 190 ? 108.080 90.119  110.445 1.00 0.00 ? 211 C A "HO2'" 1  
ATOM 6116   H "H1'"  . C A 1 190 ? 109.259 90.152  108.383 1.00 0.00 ? 211 C A "H1'"  1  
ATOM 6117   H H41    . C A 1 190 ? 112.769 94.832  106.019 1.00 0.00 ? 211 C A H41    1  
ATOM 6118   H H42    . C A 1 190 ? 111.904 94.657  104.569 1.00 0.00 ? 211 C A H42    1  
ATOM 6119   H H5     . C A 1 190 ? 110.010 93.203  104.418 1.00 0.00 ? 211 C A H5     1  
ATOM 6120   H H6     . C A 1 190 ? 108.633 91.700  105.503 1.00 0.00 ? 211 C A H6     1  
ATOM 6121   P P      . G A 1 191 ? 104.673 93.247  109.308 1.00 0.00 ? 212 G A P      1  
ATOM 6122   O OP1    . G A 1 191 ? 103.272 92.870  109.640 1.00 0.00 ? 212 G A OP1    1  
ATOM 6123   O OP2    . G A 1 191 ? 104.909 94.346  108.307 1.00 0.00 ? 212 G A OP2    1  
ATOM 6124   O "O5'"  . G A 1 191 ? 105.482 93.629  110.646 1.00 0.00 ? 212 G A "O5'"  1  
ATOM 6125   C "C5'"  . G A 1 191 ? 105.801 92.648  111.634 1.00 0.00 ? 212 G A "C5'"  1  
ATOM 6126   C "C4'"  . G A 1 191 ? 107.116 92.978  112.316 1.00 0.00 ? 212 G A "C4'"  1  
ATOM 6127   O "O4'"  . G A 1 191 ? 108.225 92.866  111.378 1.00 0.00 ? 212 G A "O4'"  1  
ATOM 6128   C "C3'"  . G A 1 191 ? 107.263 94.382  112.860 1.00 0.00 ? 212 G A "C3'"  1  
ATOM 6129   O "O3'"  . G A 1 191 ? 106.675 94.536  114.130 1.00 0.00 ? 212 G A "O3'"  1  
ATOM 6130   C "C2'"  . G A 1 191 ? 108.775 94.539  112.970 1.00 0.00 ? 212 G A "C2'"  1  
ATOM 6131   O "O2'"  . G A 1 191 ? 109.318 93.952  114.136 1.00 0.00 ? 212 G A "O2'"  1  
ATOM 6132   C "C1'"  . G A 1 191 ? 109.247 93.810  111.712 1.00 0.00 ? 212 G A "C1'"  1  
ATOM 6133   N N9     . G A 1 191 ? 109.430 94.706  110.567 1.00 0.00 ? 212 G A N9     1  
ATOM 6134   C C8     . G A 1 191 ? 108.693 94.700  109.410 1.00 0.00 ? 212 G A C8     1  
ATOM 6135   N N7     . G A 1 191 ? 109.057 95.618  108.559 1.00 0.00 ? 212 G A N7     1  
ATOM 6136   C C5     . G A 1 191 ? 110.102 96.276  109.189 1.00 0.00 ? 212 G A C5     1  
ATOM 6137   C C6     . G A 1 191 ? 110.877 97.364  108.750 1.00 0.00 ? 212 G A C6     1  
ATOM 6138   O O6     . G A 1 191 ? 110.786 97.990  107.699 1.00 0.00 ? 212 G A O6     1  
ATOM 6139   N N1     . G A 1 191 ? 111.832 97.722  109.682 1.00 0.00 ? 212 G A N1     1  
ATOM 6140   C C2     . G A 1 191 ? 112.014 97.116  110.891 1.00 0.00 ? 212 G A C2     1  
ATOM 6141   N N2     . G A 1 191 ? 113.000 97.623  111.652 1.00 0.00 ? 212 G A N2     1  
ATOM 6142   N N3     . G A 1 191 ? 111.285 96.093  111.328 1.00 0.00 ? 212 G A N3     1  
ATOM 6143   C C4     . G A 1 191 ? 110.353 95.727  110.428 1.00 0.00 ? 212 G A C4     1  
ATOM 6144   H "H5'"  . G A 1 191 ? 105.866 91.769  111.205 1.00 0.00 ? 212 G A "H5'"  1  
ATOM 6145   H "H5''" . G A 1 191 ? 105.083 92.623  112.302 1.00 0.00 ? 212 G A "H5''" 1  
ATOM 6146   H "H4'"  . G A 1 191 ? 107.263 92.341  113.047 1.00 0.00 ? 212 G A "H4'"  1  
ATOM 6147   H "H3'"  . G A 1 191 ? 106.853 95.014  112.235 1.00 0.00 ? 212 G A "H3'"  1  
ATOM 6148   H "H2'"  . G A 1 191 ? 109.045 95.479  112.902 1.00 0.00 ? 212 G A "H2'"  1  
ATOM 6149   H "HO2'" . G A 1 191 ? 110.288 94.089  114.142 1.00 0.00 ? 212 G A "HO2'" 1  
ATOM 6150   H "H1'"  . G A 1 191 ? 110.093 93.351  111.897 1.00 0.00 ? 212 G A "H1'"  1  
ATOM 6151   H H8     . G A 1 191 ? 107.966 94.066  109.240 1.00 0.00 ? 212 G A H8     1  
ATOM 6152   H H1     . G A 1 191 ? 112.422 98.470  109.455 1.00 0.00 ? 212 G A H1     1  
ATOM 6153   H H21    . G A 1 191 ? 113.536 98.376  111.326 1.00 0.00 ? 212 G A H21    1  
ATOM 6154   H H22    . G A 1 191 ? 113.185 97.238  112.534 1.00 0.00 ? 212 G A H22    1  
ATOM 6155   P P      . C A 1 192 ? 106.356 96.012  114.657 1.00 0.00 ? 213 C A P      1  
ATOM 6156   O OP1    . C A 1 192 ? 105.912 95.964  116.066 1.00 0.00 ? 213 C A OP1    1  
ATOM 6157   O OP2    . C A 1 192 ? 105.477 96.599  113.610 1.00 0.00 ? 213 C A OP2    1  
ATOM 6158   O "O5'"  . C A 1 192 ? 107.768 96.747  114.692 1.00 0.00 ? 213 C A "O5'"  1  
ATOM 6159   C "C5'"  . C A 1 192 ? 108.653 96.521  115.775 1.00 0.00 ? 213 C A "C5'"  1  
ATOM 6160   C "C4'"  . C A 1 192 ? 109.620 97.667  115.915 1.00 0.00 ? 213 C A "C4'"  1  
ATOM 6161   O "O4'"  . C A 1 192 ? 110.599 97.639  114.839 1.00 0.00 ? 213 C A "O4'"  1  
ATOM 6162   C "C3'"  . C A 1 192 ? 109.051 99.071  115.811 1.00 0.00 ? 213 C A "C3'"  1  
ATOM 6163   O "O3'"  . C A 1 192 ? 108.386 99.494  116.990 1.00 0.00 ? 213 C A "O3'"  1  
ATOM 6164   C "C2'"  . C A 1 192 ? 110.321 99.876  115.580 1.00 0.00 ? 213 C A "C2'"  1  
ATOM 6165   O "O2'"  . C A 1 192 ? 111.067 100.086 116.766 1.00 0.00 ? 213 C A "O2'"  1  
ATOM 6166   C "C1'"  . C A 1 192 ? 111.078 98.956  114.617 1.00 0.00 ? 213 C A "C1'"  1  
ATOM 6167   N N1     . C A 1 192 ? 110.820 99.325  113.216 1.00 0.00 ? 213 C A N1     1  
ATOM 6168   C C2     . C A 1 192 ? 111.530 100.391 112.676 1.00 0.00 ? 213 C A C2     1  
ATOM 6169   O O2     . C A 1 192 ? 112.338 100.990 113.401 1.00 0.00 ? 213 C A O2     1  
ATOM 6170   N N3     . C A 1 192 ? 111.326 100.741 111.389 1.00 0.00 ? 213 C A N3     1  
ATOM 6171   C C4     . C A 1 192 ? 110.459 100.063 110.647 1.00 0.00 ? 213 C A C4     1  
ATOM 6172   N N4     . C A 1 192 ? 110.329 100.417 109.375 1.00 0.00 ? 213 C A N4     1  
ATOM 6173   C C5     . C A 1 192 ? 109.697 98.984  111.176 1.00 0.00 ? 213 C A C5     1  
ATOM 6174   C C6     . C A 1 192 ? 109.909 98.649  112.456 1.00 0.00 ? 213 C A C6     1  
ATOM 6175   H "H5'"  . C A 1 192 ? 109.148 95.690  115.615 1.00 0.00 ? 213 C A "H5'"  1  
ATOM 6176   H "H5''" . C A 1 192 ? 108.132 96.428  116.599 1.00 0.00 ? 213 C A "H5''" 1  
ATOM 6177   H "H4'"  . C A 1 192 ? 110.091 97.579  116.769 1.00 0.00 ? 213 C A "H4'"  1  
ATOM 6178   H "H3'"  . C A 1 192 ? 108.423 99.109  115.058 1.00 0.00 ? 213 C A "H3'"  1  
ATOM 6179   H "H2'"  . C A 1 192 ? 110.128 100.728 115.136 1.00 0.00 ? 213 C A "H2'"  1  
ATOM 6180   H "HO2'" . C A 1 192 ? 110.480 99.955  117.540 1.00 0.00 ? 213 C A "HO2'" 1  
ATOM 6181   H "H1'"  . C A 1 192 ? 112.037 99.010  114.806 1.00 0.00 ? 213 C A "H1'"  1  
ATOM 6182   H H41    . C A 1 192 ? 110.863 101.156 109.014 1.00 0.00 ? 213 C A H41    1  
ATOM 6183   H H42    . C A 1 192 ? 109.700 99.940  108.795 1.00 0.00 ? 213 C A H42    1  
ATOM 6184   H H5     . C A 1 192 ? 109.046 98.503  110.625 1.00 0.00 ? 213 C A H5     1  
ATOM 6185   H H6     . C A 1 192 ? 109.397 97.909  112.842 1.00 0.00 ? 213 C A H6     1  
ATOM 6186   P P      . A A 1 193 ? 106.902 100.114 116.889 1.00 0.00 ? 214 A A P      1  
ATOM 6187   O OP1    . A A 1 193 ? 106.325 99.944  118.239 1.00 0.00 ? 214 A A OP1    1  
ATOM 6188   O OP2    . A A 1 193 ? 106.206 99.521  115.707 1.00 0.00 ? 214 A A OP2    1  
ATOM 6189   O "O5'"  . A A 1 193 ? 107.121 101.676 116.663 1.00 0.00 ? 214 A A "O5'"  1  
ATOM 6190   C "C5'"  . A A 1 193 ? 107.674 102.479 117.692 1.00 0.00 ? 214 A A "C5'"  1  
ATOM 6191   C "C4'"  . A A 1 193 ? 108.502 103.579 117.089 1.00 0.00 ? 214 A A "C4'"  1  
ATOM 6192   O "O4'"  . A A 1 193 ? 109.282 102.974 116.029 1.00 0.00 ? 214 A A "O4'"  1  
ATOM 6193   C "C3'"  . A A 1 193 ? 107.750 104.669 116.338 1.00 0.00 ? 214 A A "C3'"  1  
ATOM 6194   O "O3'"  . A A 1 193 ? 107.219 105.684 117.180 1.00 0.00 ? 214 A A "O3'"  1  
ATOM 6195   C "C2'"  . A A 1 193 ? 108.834 105.228 115.421 1.00 0.00 ? 214 A A "C2'"  1  
ATOM 6196   O "O2'"  . A A 1 193 ? 109.705 106.178 115.992 1.00 0.00 ? 214 A A "O2'"  1  
ATOM 6197   C "C1'"  . A A 1 193 ? 109.633 103.972 115.088 1.00 0.00 ? 214 A A "C1'"  1  
ATOM 6198   N N9     . A A 1 193 ? 109.386 103.532 113.714 1.00 0.00 ? 214 A A N9     1  
ATOM 6199   C C8     . A A 1 193 ? 108.757 102.450 113.139 1.00 0.00 ? 214 A A C8     1  
ATOM 6200   N N7     . A A 1 193 ? 108.765 102.481 111.826 1.00 0.00 ? 214 A A N7     1  
ATOM 6201   C C5     . A A 1 193 ? 109.445 103.658 111.525 1.00 0.00 ? 214 A A C5     1  
ATOM 6202   C C6     . A A 1 193 ? 109.786 104.293 110.310 1.00 0.00 ? 214 A A C6     1  
ATOM 6203   N N6     . A A 1 193 ? 109.487 103.831 109.108 1.00 0.00 ? 214 A A N6     1  
ATOM 6204   N N1     . A A 1 193 ? 110.457 105.462 110.377 1.00 0.00 ? 214 A A N1     1  
ATOM 6205   C C2     . A A 1 193 ? 110.758 105.959 111.583 1.00 0.00 ? 214 A A C2     1  
ATOM 6206   N N3     . A A 1 193 ? 110.493 105.470 112.782 1.00 0.00 ? 214 A A N3     1  
ATOM 6207   C C4     . A A 1 193 ? 109.831 104.303 112.677 1.00 0.00 ? 214 A A C4     1  
ATOM 6208   H "H5'"  . A A 1 193 ? 108.234 101.919 118.270 1.00 0.00 ? 214 A A "H5'"  1  
ATOM 6209   H "H5''" . A A 1 193 ? 106.948 102.862 118.226 1.00 0.00 ? 214 A A "H5''" 1  
ATOM 6210   H "H4'"  . A A 1 193 ? 109.089 103.949 117.780 1.00 0.00 ? 214 A A "H4'"  1  
ATOM 6211   H "H3'"  . A A 1 193 ? 107.015 104.263 115.831 1.00 0.00 ? 214 A A "H3'"  1  
ATOM 6212   H "H2'"  . A A 1 193 ? 108.451 105.603 114.599 1.00 0.00 ? 214 A A "H2'"  1  
ATOM 6213   H "HO2'" . A A 1 193 ? 110.354 106.462 115.315 1.00 0.00 ? 214 A A "HO2'" 1  
ATOM 6214   H "H1'"  . A A 1 193 ? 110.588 104.151 115.214 1.00 0.00 ? 214 A A "H1'"  1  
ATOM 6215   H H8     . A A 1 193 ? 108.341 101.727 113.656 1.00 0.00 ? 214 A A H8     1  
ATOM 6216   H H61    . A A 1 193 ? 109.753 104.334 108.309 1.00 0.00 ? 214 A A H61    1  
ATOM 6217   H H62    . A A 1 193 ? 109.001 102.984 109.014 1.00 0.00 ? 214 A A H62    1  
ATOM 6218   H H2     . A A 1 193 ? 111.245 106.809 111.574 1.00 0.00 ? 214 A A H2     1  
ATOM 6219   P P      . G A 1 194 ? 108.184 106.783 117.828 1.00 0.00 ? 215 G A P      1  
ATOM 6220   O OP1    . G A 1 194 ? 109.490 106.130 118.024 1.00 0.00 ? 215 G A OP1    1  
ATOM 6221   O OP2    . G A 1 194 ? 107.452 107.335 118.994 1.00 0.00 ? 215 G A OP2    1  
ATOM 6222   O "O5'"  . G A 1 194 ? 108.395 107.970 116.801 1.00 0.00 ? 215 G A "O5'"  1  
ATOM 6223   C "C5'"  . G A 1 194 ? 107.295 108.559 116.112 1.00 0.00 ? 215 G A "C5'"  1  
ATOM 6224   C "C4'"  . G A 1 194 ? 107.818 109.370 114.963 1.00 0.00 ? 215 G A "C4'"  1  
ATOM 6225   O "O4'"  . G A 1 194 ? 108.392 108.466 113.985 1.00 0.00 ? 215 G A "O4'"  1  
ATOM 6226   C "C3'"  . G A 1 194 ? 106.692 110.100 114.248 1.00 0.00 ? 215 G A "C3'"  1  
ATOM 6227   O "O3'"  . G A 1 194 ? 106.568 111.410 114.791 1.00 0.00 ? 215 G A "O3'"  1  
ATOM 6228   C "C2'"  . G A 1 194 ? 107.129 110.115 112.788 1.00 0.00 ? 215 G A "C2'"  1  
ATOM 6229   O "O2'"  . G A 1 194 ? 107.896 111.260 112.485 1.00 0.00 ? 215 G A "O2'"  1  
ATOM 6230   C "C1'"  . G A 1 194 ? 107.964 108.829 112.683 1.00 0.00 ? 215 G A "C1'"  1  
ATOM 6231   N N9     . G A 1 194 ? 107.292 107.666 112.116 1.00 0.00 ? 215 G A N9     1  
ATOM 6232   C C8     . G A 1 194 ? 106.755 106.633 112.830 1.00 0.00 ? 215 G A C8     1  
ATOM 6233   N N7     . G A 1 194 ? 106.251 105.700 112.076 1.00 0.00 ? 215 G A N7     1  
ATOM 6234   C C5     . G A 1 194 ? 106.457 106.157 110.784 1.00 0.00 ? 215 G A C5     1  
ATOM 6235   C C6     . G A 1 194 ? 106.120 105.565 109.548 1.00 0.00 ? 215 G A C6     1  
ATOM 6236   O O6     . G A 1 194 ? 105.543 104.487 109.344 1.00 0.00 ? 215 G A O6     1  
ATOM 6237   N N1     . G A 1 194 ? 106.521 106.350 108.477 1.00 0.00 ? 215 G A N1     1  
ATOM 6238   C C2     . G A 1 194 ? 107.164 107.546 108.589 1.00 0.00 ? 215 G A C2     1  
ATOM 6239   N N2     . G A 1 194 ? 107.498 108.127 107.431 1.00 0.00 ? 215 G A N2     1  
ATOM 6240   N N3     . G A 1 194 ? 107.469 108.122 109.742 1.00 0.00 ? 215 G A N3     1  
ATOM 6241   C C4     . G A 1 194 ? 107.093 107.371 110.792 1.00 0.00 ? 215 G A C4     1  
ATOM 6242   H "H5'"  . G A 1 194 ? 106.797 109.130 116.734 1.00 0.00 ? 215 G A "H5'"  1  
ATOM 6243   H "H5''" . G A 1 194 ? 106.704 107.849 115.788 1.00 0.00 ? 215 G A "H5''" 1  
ATOM 6244   H "H4'"  . G A 1 194 ? 108.511 109.980 115.293 1.00 0.00 ? 215 G A "H4'"  1  
ATOM 6245   H "H3'"  . G A 1 194 ? 105.861 109.592 114.355 1.00 0.00 ? 215 G A "H3'"  1  
ATOM 6246   H "H2'"  . G A 1 194 ? 106.362 110.025 112.182 1.00 0.00 ? 215 G A "H2'"  1  
ATOM 6247   H "HO2'" . G A 1 194 ? 107.638 111.591 111.599 1.00 0.00 ? 215 G A "HO2'" 1  
ATOM 6248   H "H1'"  . G A 1 194 ? 108.758 109.000 112.135 1.00 0.00 ? 215 G A "H1'"  1  
ATOM 6249   H H8     . G A 1 194 ? 106.759 106.592 113.808 1.00 0.00 ? 215 G A H8     1  
ATOM 6250   H H1     . G A 1 194 ? 106.328 106.020 107.575 1.00 0.00 ? 215 G A H1     1  
ATOM 6251   H H21    . G A 1 194 ? 107.270 107.698 106.580 1.00 0.00 ? 215 G A H21    1  
ATOM 6252   H H22    . G A 1 194 ? 107.972 108.985 107.433 1.00 0.00 ? 215 G A H22    1  
ATOM 6253   P P      . C A 1 195 ? 105.273 112.295 114.455 1.00 0.00 ? 216 C A P      1  
ATOM 6254   O OP1    . C A 1 195 ? 105.574 113.651 114.993 1.00 0.00 ? 216 C A OP1    1  
ATOM 6255   O OP2    . C A 1 195 ? 104.024 111.595 114.884 1.00 0.00 ? 216 C A OP2    1  
ATOM 6256   O "O5'"  . C A 1 195 ? 105.272 112.357 112.860 1.00 0.00 ? 216 C A "O5'"  1  
ATOM 6257   C "C5'"  . C A 1 195 ? 106.073 113.307 112.176 1.00 0.00 ? 216 C A "C5'"  1  
ATOM 6258   C "C4'"  . C A 1 195 ? 105.815 113.260 110.691 1.00 0.00 ? 216 C A "C4'"  1  
ATOM 6259   O "O4'"  . C A 1 195 ? 106.264 112.003 110.131 1.00 0.00 ? 216 C A "O4'"  1  
ATOM 6260   C "C3'"  . C A 1 195 ? 104.375 113.345 110.240 1.00 0.00 ? 216 C A "C3'"  1  
ATOM 6261   O "O3'"  . C A 1 195 ? 103.928 114.685 110.280 1.00 0.00 ? 216 C A "O3'"  1  
ATOM 6262   C "C2'"  . C A 1 195 ? 104.485 112.846 108.808 1.00 0.00 ? 216 C A "C2'"  1  
ATOM 6263   O "O2'"  . C A 1 195 ? 104.983 113.841 107.941 1.00 0.00 ? 216 C A "O2'"  1  
ATOM 6264   C "C1'"  . C A 1 195 ? 105.526 111.731 108.953 1.00 0.00 ? 216 C A "C1'"  1  
ATOM 6265   N N1     . C A 1 195 ? 104.912 110.409 109.100 1.00 0.00 ? 216 C A N1     1  
ATOM 6266   C C2     . C A 1 195 ? 104.565 109.671 107.954 1.00 0.00 ? 216 C A C2     1  
ATOM 6267   O O2     . C A 1 195 ? 104.841 110.112 106.829 1.00 0.00 ? 216 C A O2     1  
ATOM 6268   N N3     . C A 1 195 ? 103.949 108.492 108.102 1.00 0.00 ? 216 C A N3     1  
ATOM 6269   C C4     . C A 1 195 ? 103.700 108.021 109.316 1.00 0.00 ? 216 C A C4     1  
ATOM 6270   N N4     . C A 1 195 ? 103.081 106.851 109.405 1.00 0.00 ? 216 C A N4     1  
ATOM 6271   C C5     . C A 1 195 ? 104.071 108.726 110.491 1.00 0.00 ? 216 C A C5     1  
ATOM 6272   C C6     . C A 1 195 ? 104.667 109.903 110.341 1.00 0.00 ? 216 C A C6     1  
ATOM 6273   H "H5'"  . C A 1 195 ? 107.017 113.111 112.349 1.00 0.00 ? 216 C A "H5'"  1  
ATOM 6274   H "H5''" . C A 1 195 ? 105.865 114.203 112.513 1.00 0.00 ? 216 C A "H5''" 1  
ATOM 6275   H "H4'"  . C A 1 195 ? 106.313 113.984 110.260 1.00 0.00 ? 216 C A "H4'"  1  
ATOM 6276   H "H3'"  . C A 1 195 ? 103.821 112.781 110.819 1.00 0.00 ? 216 C A "H3'"  1  
ATOM 6277   H "H2'"  . C A 1 195 ? 103.631 112.489 108.488 1.00 0.00 ? 216 C A "H2'"  1  
ATOM 6278   H "HO2'" . C A 1 195 ? 104.857 114.720 108.355 1.00 0.00 ? 216 C A "HO2'" 1  
ATOM 6279   H "H1'"  . C A 1 195 ? 106.109 111.732 108.166 1.00 0.00 ? 216 C A "H1'"  1  
ATOM 6280   H H41    . C A 1 195 ? 102.825 106.367 108.591 1.00 0.00 ? 216 C A H41    1  
ATOM 6281   H H42    . C A 1 195 ? 102.880 106.470 110.285 1.00 0.00 ? 216 C A H42    1  
ATOM 6282   H H5     . C A 1 195 ? 103.896 108.355 111.381 1.00 0.00 ? 216 C A H5     1  
ATOM 6283   H H6     . C A 1 195 ? 104.932 110.406 111.139 1.00 0.00 ? 216 C A H6     1  
ATOM 6284   P P      . C A 1 196 ? 102.370 114.986 110.507 1.00 0.00 ? 217 C A P      1  
ATOM 6285   O OP1    . C A 1 196 ? 102.251 116.444 110.737 1.00 0.00 ? 217 C A OP1    1  
ATOM 6286   O OP2    . C A 1 196 ? 101.945 114.044 111.567 1.00 0.00 ? 217 C A OP2    1  
ATOM 6287   O "O5'"  . C A 1 196 ? 101.582 114.678 109.165 1.00 0.00 ? 217 C A "O5'"  1  
ATOM 6288   C "C5'"  . C A 1 196 ? 101.872 115.438 108.009 1.00 0.00 ? 217 C A "C5'"  1  
ATOM 6289   C "C4'"  . C A 1 196 ? 101.222 114.840 106.797 1.00 0.00 ? 217 C A "C4'"  1  
ATOM 6290   O "O4'"  . C A 1 196 ? 101.737 113.511 106.582 1.00 0.00 ? 217 C A "O4'"  1  
ATOM 6291   C "C3'"  . C A 1 196 ? 99.718  114.676 106.816 1.00 0.00 ? 217 C A "C3'"  1  
ATOM 6292   O "O3'"  . C A 1 196 ? 99.119  115.932 106.500 1.00 0.00 ? 217 C A "O3'"  1  
ATOM 6293   C "C2'"  . C A 1 196 ? 99.512  113.598 105.749 1.00 0.00 ? 217 C A "C2'"  1  
ATOM 6294   O "O2'"  . C A 1 196 ? 99.541  114.086 104.421 1.00 0.00 ? 217 C A "O2'"  1  
ATOM 6295   C "C1'"  . C A 1 196 ? 100.744 112.713 105.971 1.00 0.00 ? 217 C A "C1'"  1  
ATOM 6296   N N1     . C A 1 196 ? 100.555 111.517 106.811 1.00 0.00 ? 217 C A N1     1  
ATOM 6297   C C2     . C A 1 196 ? 99.624  110.551 106.426 1.00 0.00 ? 217 C A C2     1  
ATOM 6298   O O2     . C A 1 196 ? 98.980  110.724 105.383 1.00 0.00 ? 217 C A O2     1  
ATOM 6299   N N3     . C A 1 196 ? 99.451  109.451 107.198 1.00 0.00 ? 217 C A N3     1  
ATOM 6300   C C4     . C A 1 196 ? 100.170 109.300 108.311 1.00 0.00 ? 217 C A C4     1  
ATOM 6301   N N4     . C A 1 196 ? 99.950  108.219 109.048 1.00 0.00 ? 217 C A N4     1  
ATOM 6302   C C5     . C A 1 196 ? 101.138 110.256 108.718 1.00 0.00 ? 217 C A C5     1  
ATOM 6303   C C6     . C A 1 196 ? 101.293 111.342 107.950 1.00 0.00 ? 217 C A C6     1  
ATOM 6304   H "H5'"  . C A 1 196 ? 102.843 115.464 107.878 1.00 0.00 ? 217 C A "H5'"  1  
ATOM 6305   H "H5''" . C A 1 196 ? 101.540 116.351 108.136 1.00 0.00 ? 217 C A "H5''" 1  
ATOM 6306   H "H4'"  . C A 1 196 ? 101.437 115.394 106.017 1.00 0.00 ? 217 C A "H4'"  1  
ATOM 6307   H "H3'"  . C A 1 196 ? 99.439  114.359 107.699 1.00 0.00 ? 217 C A "H3'"  1  
ATOM 6308   H "H2'"  . C A 1 196 ? 98.686  113.094 105.905 1.00 0.00 ? 217 C A "H2'"  1  
ATOM 6309   H "HO2'" . C A 1 196 ? 100.424 113.907 104.035 1.00 0.00 ? 217 C A "HO2'" 1  
ATOM 6310   H "H1'"  . C A 1 196 ? 101.080 112.406 105.103 1.00 0.00 ? 217 C A "H1'"  1  
ATOM 6311   H H41    . C A 1 196 ? 99.276  107.564 108.768 1.00 0.00 ? 217 C A H41    1  
ATOM 6312   H H42    . C A 1 196 ? 100.461 108.076 109.870 1.00 0.00 ? 217 C A H42    1  
ATOM 6313   H H5     . C A 1 196 ? 101.673 110.122 109.529 1.00 0.00 ? 217 C A H5     1  
ATOM 6314   H H6     . C A 1 196 ? 101.954 112.015 108.212 1.00 0.00 ? 217 C A H6     1  
ATOM 6315   P P      . A A 1 197 ? 97.545  116.033 106.227 1.00 0.00 ? 218 A A P      1  
ATOM 6316   O OP1    . A A 1 197 ? 97.258  117.467 106.052 1.00 0.00 ? 218 A A OP1    1  
ATOM 6317   O OP2    . A A 1 197 ? 96.793  115.264 107.237 1.00 0.00 ? 218 A A OP2    1  
ATOM 6318   O "O5'"  . A A 1 197 ? 97.367  115.343 104.811 1.00 0.00 ? 218 A A "O5'"  1  
ATOM 6319   C "C5'"  . A A 1 197 ? 97.676  116.066 103.643 1.00 0.00 ? 218 A A "C5'"  1  
ATOM 6320   C "C4'"  . A A 1 197 ? 96.650  115.798 102.586 1.00 0.00 ? 218 A A "C4'"  1  
ATOM 6321   O "O4'"  . A A 1 197 ? 96.892  114.494 102.003 1.00 0.00 ? 218 A A "O4'"  1  
ATOM 6322   C "C3'"  . A A 1 197 ? 95.220  115.705 103.079 1.00 0.00 ? 218 A A "C3'"  1  
ATOM 6323   O "O3'"  . A A 1 197 ? 94.623  116.970 103.296 1.00 0.00 ? 218 A A "O3'"  1  
ATOM 6324   C "C2'"  . A A 1 197 ? 94.564  114.927 101.951 1.00 0.00 ? 218 A A "C2'"  1  
ATOM 6325   O "O2'"  . A A 1 197 ? 94.313  115.715 100.803 1.00 0.00 ? 218 A A "O2'"  1  
ATOM 6326   C "C1'"  . A A 1 197 ? 95.655  113.899 101.649 1.00 0.00 ? 218 A A "C1'"  1  
ATOM 6327   N N9     . A A 1 197 ? 95.506  112.697 102.458 1.00 0.00 ? 218 A A N9     1  
ATOM 6328   C C8     . A A 1 197 ? 95.757  112.548 103.801 1.00 0.00 ? 218 A A C8     1  
ATOM 6329   N N7     . A A 1 197 ? 95.537  111.339 104.251 1.00 0.00 ? 218 A A N7     1  
ATOM 6330   C C5     . A A 1 197 ? 95.113  110.645 103.131 1.00 0.00 ? 218 A A C5     1  
ATOM 6331   C C6     . A A 1 197 ? 94.733  109.316 102.946 1.00 0.00 ? 218 A A C6     1  
ATOM 6332   N N6     . A A 1 197 ? 94.739  108.406 103.924 1.00 0.00 ? 218 A A N6     1  
ATOM 6333   N N1     . A A 1 197 ? 94.349  108.941 101.707 1.00 0.00 ? 218 A A N1     1  
ATOM 6334   C C2     . A A 1 197 ? 94.370  109.858 100.726 1.00 0.00 ? 218 A A C2     1  
ATOM 6335   N N3     . A A 1 197 ? 94.721  111.139 100.775 1.00 0.00 ? 218 A A N3     1  
ATOM 6336   C C4     . A A 1 197 ? 95.085  111.471 102.021 1.00 0.00 ? 218 A A C4     1  
ATOM 6337   H "H5'"  . A A 1 197 ? 98.561  115.793 103.322 1.00 0.00 ? 218 A A "H5'"  1  
ATOM 6338   H "H5''" . A A 1 197 ? 97.695  117.022 103.853 1.00 0.00 ? 218 A A "H5''" 1  
ATOM 6339   H "H4'"  . A A 1 197 ? 96.728  116.481 101.889 1.00 0.00 ? 218 A A "H4'"  1  
ATOM 6340   H "H3'"  . A A 1 197 ? 95.202  115.194 103.917 1.00 0.00 ? 218 A A "H3'"  1  
ATOM 6341   H "H2'"  . A A 1 197 ? 93.743  114.481 102.251 1.00 0.00 ? 218 A A "H2'"  1  
ATOM 6342   H "HO2'" . A A 1 197 ? 93.892  115.154 100.118 1.00 0.00 ? 218 A A "HO2'" 1  
ATOM 6343   H "H1'"  . A A 1 197 ? 95.626  113.661 100.699 1.00 0.00 ? 218 A A "H1'"  1  
ATOM 6344   H H8     . A A 1 197 ? 96.072  113.282 104.369 1.00 0.00 ? 218 A A H8     1  
ATOM 6345   H H61    . A A 1 197 ? 94.468  107.483 103.734 1.00 0.00 ? 218 A A H61    1  
ATOM 6346   H H62    . A A 1 197 ? 95.014  108.659 104.828 1.00 0.00 ? 218 A A H62    1  
ATOM 6347   H H2     . A A 1 197 ? 94.082  109.533 99.846  1.00 0.00 ? 218 A A H2     1  
ATOM 6348   P P      . A A 1 198 ? 93.336  117.077 104.244 1.00 0.00 ? 219 A A P      1  
ATOM 6349   O OP1    . A A 1 198 ? 93.534  118.228 105.143 1.00 0.00 ? 219 A A OP1    1  
ATOM 6350   O OP2    . A A 1 198 ? 93.073  115.751 104.831 1.00 0.00 ? 219 A A OP2    1  
ATOM 6351   O "O5'"  . A A 1 198 ? 92.161  117.387 103.221 1.00 0.00 ? 219 A A "O5'"  1  
ATOM 6352   C "C5'"  . A A 1 198 ? 90.828  117.025 103.535 1.00 0.00 ? 219 A A "C5'"  1  
ATOM 6353   C "C4'"  . A A 1 198 ? 90.300  116.072 102.504 1.00 0.00 ? 219 A A "C4'"  1  
ATOM 6354   O "O4'"  . A A 1 198 ? 91.351  115.142 102.164 1.00 0.00 ? 219 A A "O4'"  1  
ATOM 6355   C "C3'"  . A A 1 198 ? 89.132  115.216 102.971 1.00 0.00 ? 219 A A "C3'"  1  
ATOM 6356   O "O3'"  . A A 1 198 ? 87.879  115.880 102.750 1.00 0.00 ? 219 A A "O3'"  1  
ATOM 6357   C "C2'"  . A A 1 198 ? 89.284  113.968 102.109 1.00 0.00 ? 219 A A "C2'"  1  
ATOM 6358   O "O2'"  . A A 1 198 ? 88.745  114.123 100.822 1.00 0.00 ? 219 A A "O2'"  1  
ATOM 6359   C "C1'"  . A A 1 198 ? 90.800  113.857 101.977 1.00 0.00 ? 219 A A "C1'"  1  
ATOM 6360   N N9     . A A 1 198 ? 91.370  112.970 102.980 1.00 0.00 ? 219 A A N9     1  
ATOM 6361   C C8     . A A 1 198 ? 92.222  113.277 104.008 1.00 0.00 ? 219 A A C8     1  
ATOM 6362   N N7     . A A 1 198 ? 92.518  112.256 104.769 1.00 0.00 ? 219 A A N7     1  
ATOM 6363   C C5     . A A 1 198 ? 91.819  111.211 104.198 1.00 0.00 ? 219 A A C5     1  
ATOM 6364   C C6     . A A 1 198 ? 91.707  109.875 104.547 1.00 0.00 ? 219 A A C6     1  
ATOM 6365   N N6     . A A 1 198 ? 92.284  109.346 105.621 1.00 0.00 ? 219 A A N6     1  
ATOM 6366   N N1     . A A 1 198 ? 90.957  109.085 103.758 1.00 0.00 ? 219 A A N1     1  
ATOM 6367   C C2     . A A 1 198 ? 90.345  109.633 102.695 1.00 0.00 ? 219 A A C2     1  
ATOM 6368   N N3     . A A 1 198 ? 90.356  110.889 102.278 1.00 0.00 ? 219 A A N3     1  
ATOM 6369   C C4     . A A 1 198 ? 91.123  111.632 103.084 1.00 0.00 ? 219 A A C4     1  
ATOM 6370   H "H5'"  . A A 1 198 ? 90.273  117.833 103.557 1.00 0.00 ? 219 A A "H5'"  1  
ATOM 6371   H "H5''" . A A 1 198 ? 90.810  116.603 104.420 1.00 0.00 ? 219 A A "H5''" 1  
ATOM 6372   H "H4'"  . A A 1 198 ? 90.038  116.581 101.708 1.00 0.00 ? 219 A A "H4'"  1  
ATOM 6373   H "H3'"  . A A 1 198 ? 89.242  115.015 103.925 1.00 0.00 ? 219 A A "H3'"  1  
ATOM 6374   H "H2'"  . A A 1 198 ? 88.906  113.179 102.552 1.00 0.00 ? 219 A A "H2'"  1  
ATOM 6375   H "HO2'" . A A 1 198 ? 88.873  113.292 100.321 1.00 0.00 ? 219 A A "HO2'" 1  
ATOM 6376   H "H1'"  . A A 1 198 ? 91.026  113.528 101.082 1.00 0.00 ? 219 A A "H1'"  1  
ATOM 6377   H H8     . A A 1 198 ? 92.572  114.178 104.162 1.00 0.00 ? 219 A A H8     1  
ATOM 6378   H H61    . A A 1 198 ? 92.161  108.395 105.824 1.00 0.00 ? 219 A A H61    1  
ATOM 6379   H H62    . A A 1 198 ? 92.834  109.904 106.208 1.00 0.00 ? 219 A A H62    1  
ATOM 6380   H H2     . A A 1 198 ? 89.814  109.013 102.152 1.00 0.00 ? 219 A A H2     1  
ATOM 6381   P P      . G A 1 199 ? 86.931  116.206 103.999 1.00 0.00 ? 220 G A P      1  
ATOM 6382   O OP1    . G A 1 199 ? 85.725  116.903 103.462 1.00 0.00 ? 220 G A OP1    1  
ATOM 6383   O OP2    . G A 1 199 ? 87.789  116.899 105.005 1.00 0.00 ? 220 G A OP2    1  
ATOM 6384   O "O5'"  . G A 1 199 ? 86.449  114.840 104.654 1.00 0.00 ? 220 G A "O5'"  1  
ATOM 6385   C "C5'"  . G A 1 199 ? 85.637  113.937 103.917 1.00 0.00 ? 220 G A "C5'"  1  
ATOM 6386   C "C4'"  . G A 1 199 ? 85.757  112.556 104.489 1.00 0.00 ? 220 G A "C4'"  1  
ATOM 6387   O "O4'"  . G A 1 199 ? 87.159  112.180 104.504 1.00 0.00 ? 220 G A "O4'"  1  
ATOM 6388   C "C3'"  . G A 1 199 ? 85.374  112.434 105.948 1.00 0.00 ? 220 G A "C3'"  1  
ATOM 6389   O "O3'"  . G A 1 199 ? 83.948  112.427 106.098 1.00 0.00 ? 220 G A "O3'"  1  
ATOM 6390   C "C2'"  . G A 1 199 ? 86.082  111.132 106.318 1.00 0.00 ? 220 G A "C2'"  1  
ATOM 6391   O "O2'"  . G A 1 199 ? 85.484  109.972 105.758 1.00 0.00 ? 220 G A "O2'"  1  
ATOM 6392   C "C1'"  . G A 1 199 ? 87.409  111.314 105.595 1.00 0.00 ? 220 G A "C1'"  1  
ATOM 6393   N N9     . G A 1 199 ? 88.434  111.916 106.426 1.00 0.00 ? 220 G A N9     1  
ATOM 6394   C C8     . G A 1 199 ? 88.948  113.173 106.306 1.00 0.00 ? 220 G A C8     1  
ATOM 6395   N N7     . G A 1 199 ? 89.848  113.442 107.205 1.00 0.00 ? 220 G A N7     1  
ATOM 6396   C C5     . G A 1 199 ? 89.929  112.287 107.960 1.00 0.00 ? 220 G A C5     1  
ATOM 6397   C C6     . G A 1 199 ? 90.721  111.988 109.095 1.00 0.00 ? 220 G A C6     1  
ATOM 6398   O O6     . G A 1 199 ? 91.529  112.703 109.683 1.00 0.00 ? 220 G A O6     1  
ATOM 6399   N N1     . G A 1 199 ? 90.487  110.712 109.553 1.00 0.00 ? 220 G A N1     1  
ATOM 6400   C C2     . G A 1 199 ? 89.596  109.837 109.001 1.00 0.00 ? 220 G A C2     1  
ATOM 6401   N N2     . G A 1 199 ? 89.502  108.647 109.617 1.00 0.00 ? 220 G A N2     1  
ATOM 6402   N N3     . G A 1 199 ? 88.852  110.102 107.940 1.00 0.00 ? 220 G A N3     1  
ATOM 6403   C C4     . G A 1 199 ? 89.067  111.337 107.482 1.00 0.00 ? 220 G A C4     1  
ATOM 6404   H "H5'"  . G A 1 199 ? 85.928  113.936 102.981 1.00 0.00 ? 220 G A "H5'"  1  
ATOM 6405   H "H5''" . G A 1 199 ? 84.705  114.236 103.964 1.00 0.00 ? 220 G A "H5''" 1  
ATOM 6406   H "H4'"  . G A 1 199 ? 85.258  111.933 103.921 1.00 0.00 ? 220 G A "H4'"  1  
ATOM 6407   H "H3'"  . G A 1 199 ? 85.765  113.180 106.446 1.00 0.00 ? 220 G A "H3'"  1  
ATOM 6408   H "H2'"  . G A 1 199 ? 86.166  111.032 107.290 1.00 0.00 ? 220 G A "H2'"  1  
ATOM 6409   H "HO2'" . G A 1 199 ? 84.560  110.180 105.504 1.00 0.00 ? 220 G A "HO2'" 1  
ATOM 6410   H "H1'"  . G A 1 199 ? 87.729  110.444 105.278 1.00 0.00 ? 220 G A "H1'"  1  
ATOM 6411   H H8     . G A 1 199 ? 88.669  113.809 105.616 1.00 0.00 ? 220 G A H8     1  
ATOM 6412   H H1     . G A 1 199 ? 90.997  110.409 110.333 1.00 0.00 ? 220 G A H1     1  
ATOM 6413   H H21    . G A 1 199 ? 90.054  108.454 110.403 1.00 0.00 ? 220 G A H21    1  
ATOM 6414   H H22    . G A 1 199 ? 88.878  107.970 109.280 1.00 0.00 ? 220 G A H22    1  
ATOM 6415   P P      . U A 1 200 ? 83.274  113.124 107.393 1.00 0.00 ? 221 U A P      1  
ATOM 6416   O OP1    . U A 1 200 ? 81.811  112.886 107.329 1.00 0.00 ? 221 U A OP1    1  
ATOM 6417   O OP2    . U A 1 200 ? 83.787  114.515 107.489 1.00 0.00 ? 221 U A OP2    1  
ATOM 6418   O "O5'"  . U A 1 200 ? 83.851  112.289 108.619 1.00 0.00 ? 221 U A "O5'"  1  
ATOM 6419   C "C5'"  . U A 1 200 ? 83.560  110.901 108.722 1.00 0.00 ? 221 U A "C5'"  1  
ATOM 6420   C "C4'"  . U A 1 200 ? 84.061  110.356 110.030 1.00 0.00 ? 221 U A "C4'"  1  
ATOM 6421   O "O4'"  . U A 1 200 ? 85.491  110.154 109.984 1.00 0.00 ? 221 U A "O4'"  1  
ATOM 6422   C "C3'"  . U A 1 200 ? 83.823  111.265 111.219 1.00 0.00 ? 221 U A "C3'"  1  
ATOM 6423   O "O3'"  . U A 1 200 ? 82.514  111.045 111.716 1.00 0.00 ? 221 U A "O3'"  1  
ATOM 6424   C "C2'"  . U A 1 200 ? 84.910  110.821 112.193 1.00 0.00 ? 221 U A "C2'"  1  
ATOM 6425   O "O2'"  . U A 1 200 ? 84.573  109.678 112.946 1.00 0.00 ? 221 U A "O2'"  1  
ATOM 6426   C "C1'"  . U A 1 200 ? 86.051  110.473 111.238 1.00 0.00 ? 221 U A "C1'"  1  
ATOM 6427   N N1     . U A 1 200 ? 86.938  111.609 111.031 1.00 0.00 ? 221 U A N1     1  
ATOM 6428   C C2     . U A 1 200 ? 87.898  111.822 111.964 1.00 0.00 ? 221 U A C2     1  
ATOM 6429   O O2     . U A 1 200 ? 88.018  111.121 112.943 1.00 0.00 ? 221 U A O2     1  
ATOM 6430   N N3     . U A 1 200 ? 88.714  112.885 111.713 1.00 0.00 ? 221 U A N3     1  
ATOM 6431   C C4     . U A 1 200 ? 88.653  113.732 110.639 1.00 0.00 ? 221 U A C4     1  
ATOM 6432   O O4     . U A 1 200 ? 89.508  114.604 110.508 1.00 0.00 ? 221 U A O4     1  
ATOM 6433   C C5     . U A 1 200 ? 87.605  113.441 109.712 1.00 0.00 ? 221 U A C5     1  
ATOM 6434   C C6     . U A 1 200 ? 86.804  112.412 109.938 1.00 0.00 ? 221 U A C6     1  
ATOM 6435   H "H5'"  . U A 1 200 ? 83.994  110.428 107.981 1.00 0.00 ? 221 U A "H5'"  1  
ATOM 6436   H "H5''" . U A 1 200 ? 82.591  110.771 108.660 1.00 0.00 ? 221 U A "H5''" 1  
ATOM 6437   H "H4'"  . U A 1 200 ? 83.631  109.492 110.198 1.00 0.00 ? 221 U A "H4'"  1  
ATOM 6438   H "H3'"  . U A 1 200 ? 83.945  112.196 110.942 1.00 0.00 ? 221 U A "H3'"  1  
ATOM 6439   H "H2'"  . U A 1 200 ? 85.177  111.550 112.791 1.00 0.00 ? 221 U A "H2'"  1  
ATOM 6440   H "HO2'" . U A 1 200 ? 85.319  109.458 113.544 1.00 0.00 ? 221 U A "HO2'" 1  
ATOM 6441   H "H1'"  . U A 1 200 ? 86.558  109.718 111.605 1.00 0.00 ? 221 U A "H1'"  1  
ATOM 6442   H H3     . U A 1 200 ? 89.417  113.058 112.372 1.00 0.00 ? 221 U A H3     1  
ATOM 6443   H H5     . U A 1 200 ? 87.481  114.001 108.917 1.00 0.00 ? 221 U A H5     1  
ATOM 6444   H H6     . U A 1 200 ? 86.093  112.234 109.289 1.00 0.00 ? 221 U A H6     1  
ATOM 6445   P P      . C A 1 201 ? 81.800  112.176 112.588 1.00 0.00 ? 222 C A P      1  
ATOM 6446   O OP1    . C A 1 201 ? 80.478  111.611 112.928 1.00 0.00 ? 222 C A OP1    1  
ATOM 6447   O OP2    . C A 1 201 ? 81.878  113.470 111.853 1.00 0.00 ? 222 C A OP2    1  
ATOM 6448   O "O5'"  . C A 1 201 ? 82.691  112.258 113.906 1.00 0.00 ? 222 C A "O5'"  1  
ATOM 6449   C "C5'"  . C A 1 201 ? 82.502  111.311 114.944 1.00 0.00 ? 222 C A "C5'"  1  
ATOM 6450   C "C4'"  . C A 1 201 ? 83.370  111.640 116.128 1.00 0.00 ? 222 C A "C4'"  1  
ATOM 6451   O "O4'"  . C A 1 201 ? 84.741  111.605 115.689 1.00 0.00 ? 222 C A "O4'"  1  
ATOM 6452   C "C3'"  . C A 1 201 ? 83.214  113.030 116.720 1.00 0.00 ? 222 C A "C3'"  1  
ATOM 6453   O "O3'"  . C A 1 201 ? 82.156  113.101 117.669 1.00 0.00 ? 222 C A "O3'"  1  
ATOM 6454   C "C2'"  . C A 1 201 ? 84.556  113.241 117.402 1.00 0.00 ? 222 C A "C2'"  1  
ATOM 6455   O "O2'"  . C A 1 201 ? 84.650  112.652 118.684 1.00 0.00 ? 222 C A "O2'"  1  
ATOM 6456   C "C1'"  . C A 1 201 ? 85.500  112.558 116.412 1.00 0.00 ? 222 C A "C1'"  1  
ATOM 6457   N N1     . C A 1 201 ? 86.056  113.510 115.445 1.00 0.00 ? 222 C A N1     1  
ATOM 6458   C C2     . C A 1 201 ? 87.260  114.161 115.745 1.00 0.00 ? 222 C A C2     1  
ATOM 6459   O O2     . C A 1 201 ? 87.855  113.865 116.783 1.00 0.00 ? 222 C A O2     1  
ATOM 6460   N N3     . C A 1 201 ? 87.738  115.082 114.888 1.00 0.00 ? 222 C A N3     1  
ATOM 6461   C C4     . C A 1 201 ? 87.080  115.346 113.751 1.00 0.00 ? 222 C A C4     1  
ATOM 6462   N N4     . C A 1 201 ? 87.584  116.277 112.932 1.00 0.00 ? 222 C A N4     1  
ATOM 6463   C C5     . C A 1 201 ? 85.874  114.671 113.406 1.00 0.00 ? 222 C A C5     1  
ATOM 6464   C C6     . C A 1 201 ? 85.401  113.771 114.275 1.00 0.00 ? 222 C A C6     1  
ATOM 6465   H "H5'"  . C A 1 201 ? 82.731  110.419 114.608 1.00 0.00 ? 222 C A "H5'"  1  
ATOM 6466   H "H5''" . C A 1 201 ? 81.561  111.318 115.215 1.00 0.00 ? 222 C A "H5''" 1  
ATOM 6467   H "H4'"  . C A 1 201 ? 83.225  110.964 116.822 1.00 0.00 ? 222 C A "H4'"  1  
ATOM 6468   H "H3'"  . C A 1 201 ? 83.045  113.671 115.998 1.00 0.00 ? 222 C A "H3'"  1  
ATOM 6469   H "H2'"  . C A 1 201 ? 84.787  114.192 117.451 1.00 0.00 ? 222 C A "H2'"  1  
ATOM 6470   H "HO2'" . C A 1 201 ? 85.132  113.260 119.281 1.00 0.00 ? 222 C A "HO2'" 1  
ATOM 6471   H "H1'"  . C A 1 201 ? 86.227  112.126 116.906 1.00 0.00 ? 222 C A "H1'"  1  
ATOM 6472   H H41    . C A 1 201 ? 88.412  116.743 113.171 1.00 0.00 ? 222 C A H41    1  
ATOM 6473   H H42    . C A 1 201 ? 87.125  116.492 112.094 1.00 0.00 ? 222 C A H42    1  
ATOM 6474   H H5     . C A 1 201 ? 85.412  114.858 112.562 1.00 0.00 ? 222 C A H5     1  
ATOM 6475   H H6     . C A 1 201 ? 84.573  113.295 114.058 1.00 0.00 ? 222 C A H6     1  
ATOM 6476   P P      . C A 1 202 ? 81.581  114.537 118.100 1.00 0.00 ? 223 C A P      1  
ATOM 6477   O OP1    . C A 1 202 ? 80.390  114.324 118.963 1.00 0.00 ? 223 C A OP1    1  
ATOM 6478   O OP2    . C A 1 202 ? 81.441  115.306 116.831 1.00 0.00 ? 223 C A OP2    1  
ATOM 6479   O "O5'"  . C A 1 202 ? 82.749  115.180 118.985 1.00 0.00 ? 223 C A "O5'"  1  
ATOM 6480   C "C5'"  . C A 1 202 ? 83.032  114.665 120.284 1.00 0.00 ? 223 C A "C5'"  1  
ATOM 6481   C "C4'"  . C A 1 202 ? 84.213  115.374 120.922 1.00 0.00 ? 223 C A "C4'"  1  
ATOM 6482   O "O4'"  . C A 1 202 ? 85.414  115.148 120.141 1.00 0.00 ? 223 C A "O4'"  1  
ATOM 6483   C "C3'"  . C A 1 202 ? 84.155  116.886 121.082 1.00 0.00 ? 223 C A "C3'"  1  
ATOM 6484   O "O3'"  . C A 1 202 ? 83.408  117.276 122.230 1.00 0.00 ? 223 C A "O3'"  1  
ATOM 6485   C "C2'"  . C A 1 202 ? 85.630  117.231 121.262 1.00 0.00 ? 223 C A "C2'"  1  
ATOM 6486   O "O2'"  . C A 1 202 ? 86.147  116.988 122.558 1.00 0.00 ? 223 C A "O2'"  1  
ATOM 6487   C "C1'"  . C A 1 202 ? 86.275  116.276 120.264 1.00 0.00 ? 223 C A "C1'"  1  
ATOM 6488   N N1     . C A 1 202 ? 86.404  116.886 118.936 1.00 0.00 ? 223 C A N1     1  
ATOM 6489   C C2     . C A 1 202 ? 87.278  117.959 118.747 1.00 0.00 ? 223 C A C2     1  
ATOM 6490   O O2     . C A 1 202 ? 87.909  118.408 119.710 1.00 0.00 ? 223 C A O2     1  
ATOM 6491   N N3     . C A 1 202 ? 87.406  118.488 117.519 1.00 0.00 ? 223 C A N3     1  
ATOM 6492   C C4     . C A 1 202 ? 86.696  118.001 116.513 1.00 0.00 ? 223 C A C4     1  
ATOM 6493   N N4     . C A 1 202 ? 86.849  118.556 115.330 1.00 0.00 ? 223 C A N4     1  
ATOM 6494   C C5     . C A 1 202 ? 85.791  116.926 116.678 1.00 0.00 ? 223 C A C5     1  
ATOM 6495   C C6     . C A 1 202 ? 85.678  116.402 117.894 1.00 0.00 ? 223 C A C6     1  
ATOM 6496   H "H5'"  . C A 1 202 ? 83.233  113.708 120.212 1.00 0.00 ? 223 C A "H5'"  1  
ATOM 6497   H "H5''" . C A 1 202 ? 82.243  114.783 120.853 1.00 0.00 ? 223 C A "H5''" 1  
ATOM 6498   H "H4'"  . C A 1 202 ? 84.350  115.011 121.822 1.00 0.00 ? 223 C A "H4'"  1  
ATOM 6499   H "H3'"  . C A 1 202 ? 83.754  117.281 120.281 1.00 0.00 ? 223 C A "H3'"  1  
ATOM 6500   H "H2'"  . C A 1 202 ? 85.814  118.158 121.005 1.00 0.00 ? 223 C A "H2'"  1  
ATOM 6501   H "HO2'" . C A 1 202 ? 87.094  117.237 122.577 1.00 0.00 ? 223 C A "HO2'" 1  
ATOM 6502   H "H1'"  . C A 1 202 ? 87.158  116.011 120.596 1.00 0.00 ? 223 C A "H1'"  1  
ATOM 6503   H H41    . C A 1 202 ? 87.473  119.304 115.217 1.00 0.00 ? 223 C A H41    1  
ATOM 6504   H H42    . C A 1 202 ? 86.341  118.221 114.563 1.00 0.00 ? 223 C A H42    1  
ATOM 6505   H H5     . C A 1 202 ? 85.271  116.579 115.922 1.00 0.00 ? 223 C A H5     1  
ATOM 6506   H H6     . C A 1 202 ? 85.057  115.657 118.031 1.00 0.00 ? 223 C A H6     1  
ATOM 6507   P P      . U A 1 203 ? 83.287  118.830 122.607 1.00 0.00 ? 224 U A P      1  
ATOM 6508   O OP1    . U A 1 203 ? 83.228  118.861 124.089 1.00 0.00 ? 224 U A OP1    1  
ATOM 6509   O OP2    . U A 1 203 ? 82.135  119.325 121.791 1.00 0.00 ? 224 U A OP2    1  
ATOM 6510   O "O5'"  . U A 1 203 ? 84.631  119.572 122.197 1.00 0.00 ? 224 U A "O5'"  1  
ATOM 6511   C "C5'"  . U A 1 203 ? 85.591  119.859 123.195 1.00 0.00 ? 224 U A "C5'"  1  
ATOM 6512   C "C4'"  . U A 1 203 ? 86.359  121.109 122.864 1.00 0.00 ? 224 U A "C4'"  1  
ATOM 6513   O "O4'"  . U A 1 203 ? 86.910  121.013 121.524 1.00 0.00 ? 224 U A "O4'"  1  
ATOM 6514   C "C3'"  . U A 1 203 ? 85.594  122.416 122.829 1.00 0.00 ? 224 U A "C3'"  1  
ATOM 6515   O "O3'"  . U A 1 203 ? 85.370  122.928 124.148 1.00 0.00 ? 224 U A "O3'"  1  
ATOM 6516   C "C2'"  . U A 1 203 ? 86.585  123.288 122.070 1.00 0.00 ? 224 U A "C2'"  1  
ATOM 6517   O "O2'"  . U A 1 203 ? 87.679  123.633 122.897 1.00 0.00 ? 224 U A "O2'"  1  
ATOM 6518   C "C1'"  . U A 1 203 ? 87.075  122.318 120.991 1.00 0.00 ? 224 U A "C1'"  1  
ATOM 6519   N N1     . U A 1 203 ? 86.366  122.390 119.697 1.00 0.00 ? 224 U A N1     1  
ATOM 6520   C C2     . U A 1 203 ? 86.241  123.634 119.060 1.00 0.00 ? 224 U A C2     1  
ATOM 6521   O O2     . U A 1 203 ? 86.678  124.672 119.520 1.00 0.00 ? 224 U A O2     1  
ATOM 6522   N N3     . U A 1 203 ? 85.582  123.611 117.856 1.00 0.00 ? 224 U A N3     1  
ATOM 6523   C C4     . U A 1 203 ? 85.048  122.507 117.223 1.00 0.00 ? 224 U A C4     1  
ATOM 6524   O O4     . U A 1 203 ? 84.480  122.648 116.137 1.00 0.00 ? 224 U A O4     1  
ATOM 6525   C C5     . U A 1 203 ? 85.211  121.270 117.933 1.00 0.00 ? 224 U A C5     1  
ATOM 6526   C C6     . U A 1 203 ? 85.846  121.252 119.116 1.00 0.00 ? 224 U A C6     1  
ATOM 6527   H "H5'"  . U A 1 203 ? 86.214  119.105 123.266 1.00 0.00 ? 224 U A "H5'"  1  
ATOM 6528   H "H5''" . U A 1 203 ? 85.134  119.978 124.053 1.00 0.00 ? 224 U A "H5''" 1  
ATOM 6529   H "H4'"  . U A 1 203 ? 87.096  121.205 123.502 1.00 0.00 ? 224 U A "H4'"  1  
ATOM 6530   H "H3'"  . U A 1 203 ? 84.737  122.277 122.375 1.00 0.00 ? 224 U A "H3'"  1  
ATOM 6531   H "H2'"  . U A 1 203 ? 86.149  124.078 121.689 1.00 0.00 ? 224 U A "H2'"  1  
ATOM 6532   H "HO2'" . U A 1 203 ? 87.419  123.517 123.835 1.00 0.00 ? 224 U A "HO2'" 1  
ATOM 6533   H "H1'"  . U A 1 203 ? 88.026  122.482 120.818 1.00 0.00 ? 224 U A "H1'"  1  
ATOM 6534   H H3     . U A 1 203 ? 85.479  124.471 117.399 1.00 0.00 ? 224 U A H3     1  
ATOM 6535   H H5     . U A 1 203 ? 84.862  120.434 117.558 1.00 0.00 ? 224 U A H5     1  
ATOM 6536   H H6     . U A 1 203 ? 85.939  120.391 119.573 1.00 0.00 ? 224 U A H6     1  
ATOM 6537   P P      . A A 1 204 ? 83.897  123.445 124.573 1.00 0.00 ? 225 A A P      1  
ATOM 6538   O OP1    . A A 1 204 ? 83.867  123.481 126.061 1.00 0.00 ? 225 A A OP1    1  
ATOM 6539   O OP2    . A A 1 204 ? 82.863  122.668 123.835 1.00 0.00 ? 225 A A OP2    1  
ATOM 6540   O "O5'"  . A A 1 204 ? 83.802  124.931 124.003 1.00 0.00 ? 225 A A "O5'"  1  
ATOM 6541   C "C5'"  . A A 1 204 ? 84.820  125.901 124.272 1.00 0.00 ? 225 A A "C5'"  1  
ATOM 6542   C "C4'"  . A A 1 204 ? 84.721  127.044 123.280 1.00 0.00 ? 225 A A "C4'"  1  
ATOM 6543   O "O4'"  . A A 1 204 ? 84.774  126.504 121.947 1.00 0.00 ? 225 A A "O4'"  1  
ATOM 6544   C "C3'"  . A A 1 204 ? 83.441  127.877 123.331 1.00 0.00 ? 225 A A "C3'"  1  
ATOM 6545   O "O3'"  . A A 1 204 ? 83.723  129.007 124.181 1.00 0.00 ? 225 A A "O3'"  1  
ATOM 6546   C "C2'"  . A A 1 204 ? 83.173  128.281 121.869 1.00 0.00 ? 225 A A "C2'"  1  
ATOM 6547   O "O2'"  . A A 1 204 ? 83.386  129.638 121.565 1.00 0.00 ? 225 A A "O2'"  1  
ATOM 6548   C "C1'"  . A A 1 204 ? 84.152  127.407 121.076 1.00 0.00 ? 225 A A "C1'"  1  
ATOM 6549   N N9     . A A 1 204 ? 83.636  126.689 119.915 1.00 0.00 ? 225 A A N9     1  
ATOM 6550   C C8     . A A 1 204 ? 82.598  125.799 119.818 1.00 0.00 ? 225 A A C8     1  
ATOM 6551   N N7     . A A 1 204 ? 82.375  125.385 118.591 1.00 0.00 ? 225 A A N7     1  
ATOM 6552   C C5     . A A 1 204 ? 83.338  126.041 117.836 1.00 0.00 ? 225 A A C5     1  
ATOM 6553   C C6     . A A 1 204 ? 83.615  126.054 116.462 1.00 0.00 ? 225 A A C6     1  
ATOM 6554   N N6     . A A 1 204 ? 82.906  125.375 115.559 1.00 0.00 ? 225 A A N6     1  
ATOM 6555   N N1     . A A 1 204 ? 84.649  126.811 116.035 1.00 0.00 ? 225 A A N1     1  
ATOM 6556   C C2     . A A 1 204 ? 85.342  127.513 116.941 1.00 0.00 ? 225 A A C2     1  
ATOM 6557   N N3     . A A 1 204 ? 85.169  127.593 118.256 1.00 0.00 ? 225 A A N3     1  
ATOM 6558   C C4     . A A 1 204 ? 84.135  126.828 118.643 1.00 0.00 ? 225 A A C4     1  
ATOM 6559   H "H5'"  . A A 1 204 ? 85.698  125.472 124.198 1.00 0.00 ? 225 A A "H5'"  1  
ATOM 6560   H "H5''" . A A 1 204 ? 84.705  126.241 125.184 1.00 0.00 ? 225 A A "H5''" 1  
ATOM 6561   H "H4'"  . A A 1 204 ? 85.480  127.648 123.417 1.00 0.00 ? 225 A A "H4'"  1  
ATOM 6562   H "H3'"  . A A 1 204 ? 82.710  127.323 123.676 1.00 0.00 ? 225 A A "H3'"  1  
ATOM 6563   H "H2'"  . A A 1 204 ? 82.269  128.025 121.586 1.00 0.00 ? 225 A A "H2'"  1  
ATOM 6564   H "HO2'" . A A 1 204 ? 82.679  129.943 120.961 1.00 0.00 ? 225 A A "HO2'" 1  
ATOM 6565   H "H1'"  . A A 1 204 ? 84.894  127.961 120.753 1.00 0.00 ? 225 A A "H1'"  1  
ATOM 6566   H H8     . A A 1 204 ? 82.067  125.503 120.588 1.00 0.00 ? 225 A A H8     1  
ATOM 6567   H H61    . A A 1 204 ? 83.140  125.428 114.611 1.00 0.00 ? 225 A A H61    1  
ATOM 6568   H H62    . A A 1 204 ? 82.151  124.819 115.846 1.00 0.00 ? 225 A A H62    1  
ATOM 6569   H H2     . A A 1 204 ? 86.084  128.042 116.583 1.00 0.00 ? 225 A A H2     1  
ATOM 6570   P P      . A A 1 205 ? 82.570  130.067 124.570 1.00 0.00 ? 226 A A P      1  
ATOM 6571   O OP1    . A A 1 205 ? 81.702  129.451 125.607 1.00 0.00 ? 226 A A OP1    1  
ATOM 6572   O OP2    . A A 1 205 ? 81.961  130.610 123.330 1.00 0.00 ? 226 A A OP2    1  
ATOM 6573   O "O5'"  . A A 1 205 ? 83.400  131.236 125.264 1.00 0.00 ? 226 A A "O5'"  1  
ATOM 6574   C "C5'"  . A A 1 205 ? 83.860  132.353 124.519 1.00 0.00 ? 226 A A "C5'"  1  
ATOM 6575   C "C4'"  . A A 1 205 ? 85.359  132.483 124.642 1.00 0.00 ? 226 A A "C4'"  1  
ATOM 6576   O "O4'"  . A A 1 205 ? 85.988  131.337 124.010 1.00 0.00 ? 226 A A "O4'"  1  
ATOM 6577   C "C3'"  . A A 1 205 ? 85.948  133.687 123.920 1.00 0.00 ? 226 A A "C3'"  1  
ATOM 6578   O "O3'"  . A A 1 205 ? 85.981  134.828 124.766 1.00 0.00 ? 226 A A "O3'"  1  
ATOM 6579   C "C2'"  . A A 1 205 ? 87.367  133.233 123.615 1.00 0.00 ? 226 A A "C2'"  1  
ATOM 6580   O "O2'"  . A A 1 205 ? 88.237  133.383 124.718 1.00 0.00 ? 226 A A "O2'"  1  
ATOM 6581   C "C1'"  . A A 1 205 ? 87.146  131.752 123.302 1.00 0.00 ? 226 A A "C1'"  1  
ATOM 6582   N N9     . A A 1 205 ? 86.912  131.532 121.879 1.00 0.00 ? 226 A A N9     1  
ATOM 6583   C C8     . A A 1 205 ? 85.833  130.941 121.281 1.00 0.00 ? 226 A A C8     1  
ATOM 6584   N N7     . A A 1 205 ? 85.898  130.915 119.976 1.00 0.00 ? 226 A A N7     1  
ATOM 6585   C C5     . A A 1 205 ? 87.104  131.523 119.700 1.00 0.00 ? 226 A A C5     1  
ATOM 6586   C C6     . A A 1 205 ? 87.745  131.802 118.503 1.00 0.00 ? 226 A A C6     1  
ATOM 6587   N N6     . A A 1 205 ? 87.224  131.504 117.316 1.00 0.00 ? 226 A A N6     1  
ATOM 6588   N N1     . A A 1 205 ? 88.951  132.409 118.560 1.00 0.00 ? 226 A A N1     1  
ATOM 6589   C C2     . A A 1 205 ? 89.453  132.719 119.765 1.00 0.00 ? 226 A A C2     1  
ATOM 6590   N N3     . A A 1 205 ? 88.931  132.513 120.969 1.00 0.00 ? 226 A A N3     1  
ATOM 6591   C C4     . A A 1 205 ? 87.744  131.901 120.861 1.00 0.00 ? 226 A A C4     1  
ATOM 6592   H "H5'"  . A A 1 205 ? 83.430  133.164 124.860 1.00 0.00 ? 226 A A "H5'"  1  
ATOM 6593   H "H5''" . A A 1 205 ? 83.616  132.234 123.578 1.00 0.00 ? 226 A A "H5''" 1  
ATOM 6594   H "H4'"  . A A 1 205 ? 85.599  132.502 125.592 1.00 0.00 ? 226 A A "H4'"  1  
ATOM 6595   H "H3'"  . A A 1 205 ? 85.413  133.876 123.120 1.00 0.00 ? 226 A A "H3'"  1  
ATOM 6596   H "H2'"  . A A 1 205 ? 87.725  133.682 122.823 1.00 0.00 ? 226 A A "H2'"  1  
ATOM 6597   H "HO2'" . A A 1 205 ? 87.850  134.031 125.342 1.00 0.00 ? 226 A A "HO2'" 1  
ATOM 6598   H "H1'"  . A A 1 205 ? 87.928  131.237 123.593 1.00 0.00 ? 226 A A "H1'"  1  
ATOM 6599   H H8     . A A 1 205 ? 85.076  130.575 121.788 1.00 0.00 ? 226 A A H8     1  
ATOM 6600   H H61    . A A 1 205 ? 87.715  131.723 116.496 1.00 0.00 ? 226 A A H61    1  
ATOM 6601   H H62    . A A 1 205 ? 86.351  131.063 117.259 1.00 0.00 ? 226 A A H62    1  
ATOM 6602   H H2     . A A 1 205 ? 90.329  133.160 119.757 1.00 0.00 ? 226 A A H2     1  
ATOM 6603   P P      . G A 1 206 ? 85.242  136.173 124.304 1.00 0.00 ? 227 G A P      1  
ATOM 6604   O OP1    . G A 1 206 ? 85.899  137.264 125.074 1.00 0.00 ? 227 G A OP1    1  
ATOM 6605   O OP2    . G A 1 206 ? 83.779  135.934 124.444 1.00 0.00 ? 227 G A OP2    1  
ATOM 6606   O "O5'"  . G A 1 206 ? 85.487  136.393 122.750 1.00 0.00 ? 227 G A "O5'"  1  
ATOM 6607   C "C5'"  . G A 1 206 ? 86.319  137.447 122.290 1.00 0.00 ? 227 G A "C5'"  1  
ATOM 6608   C "C4'"  . G A 1 206 ? 86.387  137.422 120.790 1.00 0.00 ? 227 G A "C4'"  1  
ATOM 6609   O "O4'"  . G A 1 206 ? 86.727  136.071 120.391 1.00 0.00 ? 227 G A "O4'"  1  
ATOM 6610   C "C3'"  . G A 1 206 ? 85.070  137.721 120.092 1.00 0.00 ? 227 G A "C3'"  1  
ATOM 6611   O "O3'"  . G A 1 206 ? 84.970  139.134 119.886 1.00 0.00 ? 227 G A "O3'"  1  
ATOM 6612   C "C2'"  . G A 1 206 ? 85.254  136.972 118.784 1.00 0.00 ? 227 G A "C2'"  1  
ATOM 6613   O "O2'"  . G A 1 206 ? 86.123  137.674 117.929 1.00 0.00 ? 227 G A "O2'"  1  
ATOM 6614   C "C1'"  . G A 1 206 ? 85.974  135.711 119.262 1.00 0.00 ? 227 G A "C1'"  1  
ATOM 6615   N N9     . G A 1 206 ? 85.089  134.626 119.653 1.00 0.00 ? 227 G A N9     1  
ATOM 6616   C C8     . G A 1 206 ? 84.607  134.363 120.907 1.00 0.00 ? 227 G A C8     1  
ATOM 6617   N N7     . G A 1 206 ? 83.822  133.322 120.945 1.00 0.00 ? 227 G A N7     1  
ATOM 6618   C C5     . G A 1 206 ? 83.796  132.869 119.634 1.00 0.00 ? 227 G A C5     1  
ATOM 6619   C C6     . G A 1 206 ? 83.112  131.776 119.049 1.00 0.00 ? 227 G A C6     1  
ATOM 6620   O O6     . G A 1 206 ? 82.361  130.947 119.584 1.00 0.00 ? 227 G A O6     1  
ATOM 6621   N N1     . G A 1 206 ? 83.362  131.696 117.691 1.00 0.00 ? 227 G A N1     1  
ATOM 6622   C C2     . G A 1 206 ? 84.155  132.559 116.983 1.00 0.00 ? 227 G A C2     1  
ATOM 6623   N N2     . G A 1 206 ? 84.252  132.331 115.672 1.00 0.00 ? 227 G A N2     1  
ATOM 6624   N N3     . G A 1 206 ? 84.798  133.570 117.514 1.00 0.00 ? 227 G A N3     1  
ATOM 6625   C C4     . G A 1 206 ? 84.575  133.667 118.831 1.00 0.00 ? 227 G A C4     1  
ATOM 6626   H "H5'"  . G A 1 206 ? 87.214  137.334 122.669 1.00 0.00 ? 227 G A "H5'"  1  
ATOM 6627   H "H5''" . G A 1 206 ? 85.948  138.302 122.595 1.00 0.00 ? 227 G A "H5''" 1  
ATOM 6628   H "H4'"  . G A 1 206 ? 87.086  138.044 120.495 1.00 0.00 ? 227 G A "H4'"  1  
ATOM 6629   H "H3'"  . G A 1 206 ? 84.331  137.387 120.642 1.00 0.00 ? 227 G A "H3'"  1  
ATOM 6630   H "H2'"  . G A 1 206 ? 84.394  136.778 118.356 1.00 0.00 ? 227 G A "H2'"  1  
ATOM 6631   H "HO2'" . G A 1 206 ? 86.224  137.171 117.094 1.00 0.00 ? 227 G A "HO2'" 1  
ATOM 6632   H "H1'"  . G A 1 206 ? 86.565  135.383 118.552 1.00 0.00 ? 227 G A "H1'"  1  
ATOM 6633   H H8     . G A 1 206 ? 84.823  134.904 121.695 1.00 0.00 ? 227 G A H8     1  
ATOM 6634   H H1     . G A 1 206 ? 82.936  130.963 117.198 1.00 0.00 ? 227 G A H1     1  
ATOM 6635   H H21    . G A 1 206 ? 83.775  131.577 115.266 1.00 0.00 ? 227 G A H21    1  
ATOM 6636   H H22    . G A 1 206 ? 84.802  132.919 115.112 1.00 0.00 ? 227 G A H22    1  
ATOM 6637   P P      . U A 1 207 ? 83.525  139.853 119.807 1.00 0.00 ? 228 U A P      1  
ATOM 6638   O OP1    . U A 1 207 ? 83.777  141.291 119.543 1.00 0.00 ? 228 U A OP1    1  
ATOM 6639   O OP2    . U A 1 207 ? 82.755  139.459 121.023 1.00 0.00 ? 228 U A OP2    1  
ATOM 6640   O "O5'"  . U A 1 207 ? 82.850  139.238 118.494 1.00 0.00 ? 228 U A "O5'"  1  
ATOM 6641   C "C5'"  . U A 1 207 ? 83.370  139.582 117.217 1.00 0.00 ? 228 U A "C5'"  1  
ATOM 6642   C "C4'"  . U A 1 207 ? 83.038  138.537 116.190 1.00 0.00 ? 228 U A "C4'"  1  
ATOM 6643   O "O4'"  . U A 1 207 ? 83.445  137.231 116.639 1.00 0.00 ? 228 U A "O4'"  1  
ATOM 6644   C "C3'"  . U A 1 207 ? 81.574  138.332 115.909 1.00 0.00 ? 228 U A "C3'"  1  
ATOM 6645   O "O3'"  . U A 1 207 ? 81.136  139.368 115.072 1.00 0.00 ? 228 U A "O3'"  1  
ATOM 6646   C "C2'"  . U A 1 207 ? 81.610  137.012 115.172 1.00 0.00 ? 228 U A "C2'"  1  
ATOM 6647   O "O2'"  . U A 1 207 ? 82.130  137.192 113.871 1.00 0.00 ? 228 U A "O2'"  1  
ATOM 6648   C "C1'"  . U A 1 207 ? 82.630  136.254 116.017 1.00 0.00 ? 228 U A "C1'"  1  
ATOM 6649   N N1     . U A 1 207 ? 82.005  135.447 117.070 1.00 0.00 ? 228 U A N1     1  
ATOM 6650   C C2     . U A 1 207 ? 81.428  134.240 116.699 1.00 0.00 ? 228 U A C2     1  
ATOM 6651   O O2     . U A 1 207 ? 81.418  133.837 115.554 1.00 0.00 ? 228 U A O2     1  
ATOM 6652   N N3     . U A 1 207 ? 80.864  133.524 117.725 1.00 0.00 ? 228 U A N3     1  
ATOM 6653   C C4     . U A 1 207 ? 80.818  133.881 119.058 1.00 0.00 ? 228 U A C4     1  
ATOM 6654   O O4     . U A 1 207 ? 80.339  133.093 119.881 1.00 0.00 ? 228 U A O4     1  
ATOM 6655   C C5     . U A 1 207 ? 81.434  135.148 119.358 1.00 0.00 ? 228 U A C5     1  
ATOM 6656   C C6     . U A 1 207 ? 81.993  135.867 118.376 1.00 0.00 ? 228 U A C6     1  
ATOM 6657   H "H5'"  . U A 1 207 ? 84.344  139.670 117.283 1.00 0.00 ? 228 U A "H5'"  1  
ATOM 6658   H "H5''" . U A 1 207 ? 82.990  140.440 116.937 1.00 0.00 ? 228 U A "H5''" 1  
ATOM 6659   H "H4'"  . U A 1 207 ? 83.519  138.743 115.362 1.00 0.00 ? 228 U A "H4'"  1  
ATOM 6660   H "H3'"  . U A 1 207 ? 81.082  138.320 116.755 1.00 0.00 ? 228 U A "H3'"  1  
ATOM 6661   H "H2'"  . U A 1 207 ? 80.729  136.582 115.163 1.00 0.00 ? 228 U A "H2'"  1  
ATOM 6662   H "HO2'" . U A 1 207 ? 82.051  138.138 113.624 1.00 0.00 ? 228 U A "HO2'" 1  
ATOM 6663   H "H1'"  . U A 1 207 ? 83.160  135.668 115.436 1.00 0.00 ? 228 U A "H1'"  1  
ATOM 6664   H H3     . U A 1 207 ? 80.448  132.670 117.483 1.00 0.00 ? 228 U A H3     1  
ATOM 6665   H H5     . U A 1 207 ? 81.446  135.484 120.278 1.00 0.00 ? 228 U A H5     1  
ATOM 6666   H H6     . U A 1 207 ? 82.401  136.723 118.613 1.00 0.00 ? 228 U A H6     1  
ATOM 6667   P P      . C A 1 208 ? 79.826  140.186 115.473 1.00 0.00 ? 229 C A P      1  
ATOM 6668   O OP1    . C A 1 208 ? 79.981  141.561 114.915 1.00 0.00 ? 229 C A OP1    1  
ATOM 6669   O OP2    . C A 1 208 ? 79.646  139.997 116.942 1.00 0.00 ? 229 C A OP2    1  
ATOM 6670   O "O5'"  . C A 1 208 ? 78.679  139.416 114.684 1.00 0.00 ? 229 C A "O5'"  1  
ATOM 6671   C "C5'"  . C A 1 208 ? 78.815  139.191 113.292 1.00 0.00 ? 229 C A "C5'"  1  
ATOM 6672   C "C4'"  . C A 1 208 ? 78.005  137.999 112.875 1.00 0.00 ? 229 C A "C4'"  1  
ATOM 6673   O "O4'"  . C A 1 208 ? 78.547  136.792 113.452 1.00 0.00 ? 229 C A "O4'"  1  
ATOM 6674   C "C3'"  . C A 1 208 ? 76.567  137.970 113.338 1.00 0.00 ? 229 C A "C3'"  1  
ATOM 6675   O "O3'"  . C A 1 208 ? 75.773  138.803 112.508 1.00 0.00 ? 229 C A "O3'"  1  
ATOM 6676   C "C2'"  . C A 1 208 ? 76.215  136.507 113.130 1.00 0.00 ? 229 C A "C2'"  1  
ATOM 6677   O "O2'"  . C A 1 208 ? 75.978  136.241 111.766 1.00 0.00 ? 229 C A "O2'"  1  
ATOM 6678   C "C1'"  . C A 1 208 ? 77.521  135.820 113.524 1.00 0.00 ? 229 C A "C1'"  1  
ATOM 6679   N N1     . C A 1 208 ? 77.538  135.227 114.862 1.00 0.00 ? 229 C A N1     1  
ATOM 6680   C C2     . C A 1 208 ? 76.757  134.079 115.127 1.00 0.00 ? 229 C A C2     1  
ATOM 6681   O O2     . C A 1 208 ? 76.021  133.623 114.239 1.00 0.00 ? 229 C A O2     1  
ATOM 6682   N N3     . C A 1 208 ? 76.828  133.499 116.351 1.00 0.00 ? 229 C A N3     1  
ATOM 6683   C C4     . C A 1 208 ? 77.615  134.024 117.293 1.00 0.00 ? 229 C A C4     1  
ATOM 6684   N N4     . C A 1 208 ? 77.664  133.409 118.481 1.00 0.00 ? 229 C A N4     1  
ATOM 6685   C C5     . C A 1 208 ? 78.391  135.202 117.059 1.00 0.00 ? 229 C A C5     1  
ATOM 6686   C C6     . C A 1 208 ? 78.321  135.766 115.841 1.00 0.00 ? 229 C A C6     1  
ATOM 6687   H "H5'"  . C A 1 208 ? 79.761  139.036 113.086 1.00 0.00 ? 229 C A "H5'"  1  
ATOM 6688   H "H5''" . C A 1 208 ? 78.507  139.985 112.808 1.00 0.00 ? 229 C A "H5''" 1  
ATOM 6689   H "H4'"  . C A 1 208 ? 78.041  137.921 111.899 1.00 0.00 ? 229 C A "H4'"  1  
ATOM 6690   H "H3'"  . C A 1 208 ? 76.521  138.267 114.270 1.00 0.00 ? 229 C A "H3'"  1  
ATOM 6691   H "H2'"  . C A 1 208 ? 75.462  136.237 113.694 1.00 0.00 ? 229 C A "H2'"  1  
ATOM 6692   H "HO2'" . C A 1 208 ? 75.776  137.082 111.306 1.00 0.00 ? 229 C A "HO2'" 1  
ATOM 6693   H "H1'"  . C A 1 208 ? 77.718  135.108 112.878 1.00 0.00 ? 229 C A "H1'"  1  
ATOM 6694   H H41    . C A 1 208 ? 77.133  132.600 118.636 1.00 0.00 ? 229 C A H41    1  
ATOM 6695   H H42    . C A 1 208 ? 78.231  133.767 119.194 1.00 0.00 ? 229 C A H42    1  
ATOM 6696   H H5     . C A 1 208 ? 78.956  135.586 117.762 1.00 0.00 ? 229 C A H5     1  
ATOM 6697   H H6     . C A 1 208 ? 78.846  136.572 115.664 1.00 0.00 ? 229 C A H6     1  
ATOM 6698   P P      . A A 1 209 ? 74.511  139.569 113.139 1.00 0.00 ? 230 A A P      1  
ATOM 6699   O OP1    . A A 1 209 ? 74.101  140.635 112.189 1.00 0.00 ? 230 A A OP1    1  
ATOM 6700   O OP2    . A A 1 209 ? 74.853  139.928 114.537 1.00 0.00 ? 230 A A OP2    1  
ATOM 6701   O "O5'"  . A A 1 209 ? 73.384  138.446 113.193 1.00 0.00 ? 230 A A "O5'"  1  
ATOM 6702   C "C5'"  . A A 1 209 ? 72.792  137.964 111.996 1.00 0.00 ? 230 A A "C5'"  1  
ATOM 6703   C "C4'"  . A A 1 209 ? 71.866  136.815 112.295 1.00 0.00 ? 230 A A "C4'"  1  
ATOM 6704   O "O4'"  . A A 1 209 ? 72.644  135.658 112.704 1.00 0.00 ? 230 A A "O4'"  1  
ATOM 6705   C "C3'"  . A A 1 209 ? 70.914  137.039 113.457 1.00 0.00 ? 230 A A "C3'"  1  
ATOM 6706   O "O3'"  . A A 1 209 ? 69.762  137.799 113.111 1.00 0.00 ? 230 A A "O3'"  1  
ATOM 6707   C "C2'"  . A A 1 209 ? 70.583  135.609 113.858 1.00 0.00 ? 230 A A "C2'"  1  
ATOM 6708   O "O2'"  . A A 1 209 ? 69.640  134.984 113.001 1.00 0.00 ? 230 A A "O2'"  1  
ATOM 6709   C "C1'"  . A A 1 209 ? 71.962  134.962 113.737 1.00 0.00 ? 230 A A "C1'"  1  
ATOM 6710   N N9     . A A 1 209 ? 72.704  135.169 114.975 1.00 0.00 ? 230 A A N9     1  
ATOM 6711   C C8     . A A 1 209 ? 73.640  136.133 115.258 1.00 0.00 ? 230 A A C8     1  
ATOM 6712   N N7     . A A 1 209 ? 74.089  136.088 116.487 1.00 0.00 ? 230 A A N7     1  
ATOM 6713   C C5     . A A 1 209 ? 73.411  135.016 117.048 1.00 0.00 ? 230 A A C5     1  
ATOM 6714   C C6     . A A 1 209 ? 73.429  134.451 118.335 1.00 0.00 ? 230 A A C6     1  
ATOM 6715   N N6     . A A 1 209 ? 74.180  134.905 119.336 1.00 0.00 ? 230 A A N6     1  
ATOM 6716   N N1     . A A 1 209 ? 72.629  133.388 118.568 1.00 0.00 ? 230 A A N1     1  
ATOM 6717   C C2     . A A 1 209 ? 71.862  132.933 117.563 1.00 0.00 ? 230 A A C2     1  
ATOM 6718   N N3     . A A 1 209 ? 71.757  133.380 116.315 1.00 0.00 ? 230 A A N3     1  
ATOM 6719   C C4     . A A 1 209 ? 72.566  134.434 116.123 1.00 0.00 ? 230 A A C4     1  
ATOM 6720   H "H5'"  . A A 1 209 ? 73.499  137.666 111.385 1.00 0.00 ? 230 A A "H5'"  1  
ATOM 6721   H "H5''" . A A 1 209 ? 72.289  138.689 111.570 1.00 0.00 ? 230 A A "H5''" 1  
ATOM 6722   H "H4'"  . A A 1 209 ? 71.364  136.591 111.482 1.00 0.00 ? 230 A A "H4'"  1  
ATOM 6723   H "H3'"  . A A 1 209 ? 71.391  137.498 114.181 1.00 0.00 ? 230 A A "H3'"  1  
ATOM 6724   H "H2'"  . A A 1 209 ? 70.284  135.557 114.790 1.00 0.00 ? 230 A A "H2'"  1  
ATOM 6725   H "HO2'" . A A 1 209 ? 69.476  134.072 113.319 1.00 0.00 ? 230 A A "HO2'" 1  
ATOM 6726   H "H1'"  . A A 1 209 ? 71.857  134.006 113.547 1.00 0.00 ? 230 A A "H1'"  1  
ATOM 6727   H H8     . A A 1 209 ? 73.939  136.798 114.603 1.00 0.00 ? 230 A A H8     1  
ATOM 6728   H H61    . A A 1 209 ? 74.145  134.468 120.213 1.00 0.00 ? 230 A A H61    1  
ATOM 6729   H H62    . A A 1 209 ? 74.770  135.674 119.196 1.00 0.00 ? 230 A A H62    1  
ATOM 6730   H H2     . A A 1 209 ? 71.300  132.160 117.783 1.00 0.00 ? 230 A A H2     1  
ATOM 6731   P P      . A A 1 210 ? 68.982  138.608 114.258 1.00 0.00 ? 231 A A P      1  
ATOM 6732   O OP1    . A A 1 210 ? 68.140  139.668 113.645 1.00 0.00 ? 231 A A OP1    1  
ATOM 6733   O OP2    . A A 1 210 ? 69.983  138.974 115.291 1.00 0.00 ? 231 A A OP2    1  
ATOM 6734   O "O5'"  . A A 1 210 ? 68.034  137.508 114.907 1.00 0.00 ? 231 A A "O5'"  1  
ATOM 6735   C "C5'"  . A A 1 210 ? 67.498  136.440 114.127 1.00 0.00 ? 231 A A "C5'"  1  
ATOM 6736   C "C4'"  . A A 1 210 ? 67.036  135.338 115.043 1.00 0.00 ? 231 A A "C4'"  1  
ATOM 6737   O "O4'"  . A A 1 210 ? 68.186  134.754 115.715 1.00 0.00 ? 231 A A "O4'"  1  
ATOM 6738   C "C3'"  . A A 1 210 ? 66.137  135.835 116.169 1.00 0.00 ? 231 A A "C3'"  1  
ATOM 6739   O "O3'"  . A A 1 210 ? 64.787  135.881 115.715 1.00 0.00 ? 231 A A "O3'"  1  
ATOM 6740   C "C2'"  . A A 1 210 ? 66.374  134.795 117.257 1.00 0.00 ? 231 A A "C2'"  1  
ATOM 6741   O "O2'"  . A A 1 210 ? 65.644  133.597 117.057 1.00 0.00 ? 231 A A "O2'"  1  
ATOM 6742   C "C1'"  . A A 1 210 ? 67.869  134.516 117.078 1.00 0.00 ? 231 A A "C1'"  1  
ATOM 6743   N N9     . A A 1 210 ? 68.727  135.369 117.899 1.00 0.00 ? 231 A A N9     1  
ATOM 6744   C C8     . A A 1 210 ? 69.304  136.566 117.556 1.00 0.00 ? 231 A A C8     1  
ATOM 6745   N N7     . A A 1 210 ? 70.061  137.078 118.496 1.00 0.00 ? 231 A A N7     1  
ATOM 6746   C C5     . A A 1 210 ? 69.970  136.160 119.531 1.00 0.00 ? 231 A A C5     1  
ATOM 6747   C C6     . A A 1 210 ? 70.550  136.114 120.809 1.00 0.00 ? 231 A A C6     1  
ATOM 6748   N N6     . A A 1 210 ? 71.383  137.043 121.279 1.00 0.00 ? 231 A A N6     1  
ATOM 6749   N N1     . A A 1 210 ? 70.244  135.067 121.599 1.00 0.00 ? 231 A A N1     1  
ATOM 6750   C C2     . A A 1 210 ? 69.416  134.130 121.125 1.00 0.00 ? 231 A A C2     1  
ATOM 6751   N N3     . A A 1 210 ? 68.814  134.056 119.944 1.00 0.00 ? 231 A A N3     1  
ATOM 6752   C C4     . A A 1 210 ? 69.138  135.113 119.183 1.00 0.00 ? 231 A A C4     1  
ATOM 6753   H "H5'"  . A A 1 210 ? 68.192  136.105 113.522 1.00 0.00 ? 231 A A "H5'"  1  
ATOM 6754   H "H5''" . A A 1 210 ? 66.747  136.776 113.597 1.00 0.00 ? 231 A A "H5''" 1  
ATOM 6755   H "H4'"  . A A 1 210 ? 66.591  134.647 114.509 1.00 0.00 ? 231 A A "H4'"  1  
ATOM 6756   H "H3'"  . A A 1 210 ? 66.442  136.722 116.456 1.00 0.00 ? 231 A A "H3'"  1  
ATOM 6757   H "H2'"  . A A 1 210 ? 66.195  135.160 118.149 1.00 0.00 ? 231 A A "H2'"  1  
ATOM 6758   H "HO2'" . A A 1 210 ? 65.842  132.977 117.788 1.00 0.00 ? 231 A A "HO2'" 1  
ATOM 6759   H "H1'"  . A A 1 210 ? 68.054  133.578 117.300 1.00 0.00 ? 231 A A "H1'"  1  
ATOM 6760   H H8     . A A 1 210 ? 69.167  136.997 116.685 1.00 0.00 ? 231 A A H8     1  
ATOM 6761   H H61    . A A 1 210 ? 71.760  136.953 122.179 1.00 0.00 ? 231 A A H61    1  
ATOM 6762   H H62    . A A 1 210 ? 71.621  137.815 120.723 1.00 0.00 ? 231 A A H62    1  
ATOM 6763   H H2     . A A 1 210 ? 69.226  133.392 121.742 1.00 0.00 ? 231 A A H2     1  
ATOM 6764   P P      . C A 1 211 ? 63.678  136.666 116.563 1.00 0.00 ? 232 C A P      1  
ATOM 6765   O OP1    . C A 1 211 ? 63.185  135.725 117.594 1.00 0.00 ? 232 C A OP1    1  
ATOM 6766   O OP2    . C A 1 211 ? 62.728  137.260 115.591 1.00 0.00 ? 232 C A OP2    1  
ATOM 6767   O "O5'"  . C A 1 211 ? 64.477  137.832 117.289 1.00 0.00 ? 232 C A "O5'"  1  
ATOM 6768   C "C5'"  . C A 1 211 ? 63.992  138.377 118.509 1.00 0.00 ? 232 C A "C5'"  1  
ATOM 6769   C "C4'"  . C A 1 211 ? 63.943  137.311 119.578 1.00 0.00 ? 232 C A "C4'"  1  
ATOM 6770   O "O4'"  . C A 1 211 ? 65.268  136.742 119.762 1.00 0.00 ? 232 C A "O4'"  1  
ATOM 6771   C "C3'"  . C A 1 211 ? 63.515  137.772 120.960 1.00 0.00 ? 232 C A "C3'"  1  
ATOM 6772   O "O3'"  . C A 1 211 ? 62.092  137.785 121.022 1.00 0.00 ? 232 C A "O3'"  1  
ATOM 6773   C "C2'"  . C A 1 211 ? 64.178  136.721 121.842 1.00 0.00 ? 232 C A "C2'"  1  
ATOM 6774   O "O2'"  . C A 1 211 ? 63.508  135.471 121.802 1.00 0.00 ? 232 C A "O2'"  1  
ATOM 6775   C "C1'"  . C A 1 211 ? 65.535  136.590 121.145 1.00 0.00 ? 232 C A "C1'"  1  
ATOM 6776   N N1     . C A 1 211 ? 66.480  137.659 121.512 1.00 0.00 ? 232 C A N1     1  
ATOM 6777   C C2     . C A 1 211 ? 67.115  137.631 122.753 1.00 0.00 ? 232 C A C2     1  
ATOM 6778   O O2     . C A 1 211 ? 66.882  136.694 123.522 1.00 0.00 ? 232 C A O2     1  
ATOM 6779   N N3     . C A 1 211 ? 67.964  138.629 123.081 1.00 0.00 ? 232 C A N3     1  
ATOM 6780   C C4     . C A 1 211 ? 68.191  139.621 122.222 1.00 0.00 ? 232 C A C4     1  
ATOM 6781   N N4     . C A 1 211 ? 69.030  140.584 122.594 1.00 0.00 ? 232 C A N4     1  
ATOM 6782   C C5     . C A 1 211 ? 67.568  139.670 120.949 1.00 0.00 ? 232 C A C5     1  
ATOM 6783   C C6     . C A 1 211 ? 66.729  138.678 120.637 1.00 0.00 ? 232 C A C6     1  
ATOM 6784   H "H5'"  . C A 1 211 ? 63.092  138.739 118.362 1.00 0.00 ? 232 C A "H5'"  1  
ATOM 6785   H "H5''" . C A 1 211 ? 64.586  139.103 118.793 1.00 0.00 ? 232 C A "H5''" 1  
ATOM 6786   H "H4'"  . C A 1 211 ? 63.330  136.604 119.291 1.00 0.00 ? 232 C A "H4'"  1  
ATOM 6787   H "H3'"  . C A 1 211 ? 63.885  138.662 121.133 1.00 0.00 ? 232 C A "H3'"  1  
ATOM 6788   H "H2'"  . C A 1 211 ? 64.273  137.036 122.763 1.00 0.00 ? 232 C A "H2'"  1  
ATOM 6789   H "HO2'" . C A 1 211 ? 63.976  134.838 122.385 1.00 0.00 ? 232 C A "HO2'" 1  
ATOM 6790   H "H1'"  . C A 1 211 ? 65.930  135.722 121.371 1.00 0.00 ? 232 C A "H1'"  1  
ATOM 6791   H H41    . C A 1 211 ? 69.456  140.548 123.475 1.00 0.00 ? 232 C A H41    1  
ATOM 6792   H H42    . C A 1 211 ? 69.219  141.329 121.986 1.00 0.00 ? 232 C A H42    1  
ATOM 6793   H H5     . C A 1 211 ? 67.747  140.403 120.323 1.00 0.00 ? 232 C A H5     1  
ATOM 6794   H H6     . C A 1 211 ? 66.286  138.690 119.763 1.00 0.00 ? 232 C A H6     1  
ATOM 6795   P P      . A A 1 212 ? 61.340  137.595 122.429 1.00 0.00 ? 233 A A P      1  
ATOM 6796   O OP1    . A A 1 212 ? 61.776  136.295 123.008 1.00 0.00 ? 233 A A OP1    1  
ATOM 6797   O OP2    . A A 1 212 ? 59.893  137.815 122.147 1.00 0.00 ? 233 A A OP2    1  
ATOM 6798   O "O5'"  . A A 1 212 ? 61.832  138.810 123.354 1.00 0.00 ? 233 A A "O5'"  1  
ATOM 6799   C "C5'"  . A A 1 212 ? 63.182  138.918 123.788 1.00 0.00 ? 233 A A "C5'"  1  
ATOM 6800   C "C4'"  . A A 1 212 ? 63.280  139.099 125.300 1.00 0.00 ? 233 A A "C4'"  1  
ATOM 6801   O "O4'"  . A A 1 212 ? 64.595  138.592 125.691 1.00 0.00 ? 233 A A "O4'"  1  
ATOM 6802   C "C3'"  . A A 1 212 ? 63.236  140.529 125.848 1.00 0.00 ? 233 A A "C3'"  1  
ATOM 6803   O "O3'"  . A A 1 212 ? 61.953  141.014 126.216 1.00 0.00 ? 233 A A "O3'"  1  
ATOM 6804   C "C2'"  . A A 1 212 ? 64.112  140.422 127.086 1.00 0.00 ? 233 A A "C2'"  1  
ATOM 6805   O "O2'"  . A A 1 212 ? 63.439  139.849 128.179 1.00 0.00 ? 233 A A "O2'"  1  
ATOM 6806   C "C1'"  . A A 1 212 ? 65.216  139.495 126.587 1.00 0.00 ? 233 A A "C1'"  1  
ATOM 6807   N N9     . A A 1 212 ? 66.237  140.240 125.844 1.00 0.00 ? 233 A A N9     1  
ATOM 6808   C C8     . A A 1 212 ? 66.121  140.806 124.594 1.00 0.00 ? 233 A A C8     1  
ATOM 6809   N N7     . A A 1 212 ? 67.193  141.443 124.199 1.00 0.00 ? 233 A A N7     1  
ATOM 6810   C C5     . A A 1 212 ? 68.082  141.273 125.245 1.00 0.00 ? 233 A A C5     1  
ATOM 6811   C C6     . A A 1 212 ? 69.393  141.709 125.430 1.00 0.00 ? 233 A A C6     1  
ATOM 6812   N N6     . A A 1 212 ? 70.061  142.431 124.535 1.00 0.00 ? 233 A A N6     1  
ATOM 6813   N N1     . A A 1 212 ? 70.007  141.379 126.582 1.00 0.00 ? 233 A A N1     1  
ATOM 6814   C C2     . A A 1 212 ? 69.324  140.661 127.486 1.00 0.00 ? 233 A A C2     1  
ATOM 6815   N N3     . A A 1 212 ? 68.081  140.192 127.429 1.00 0.00 ? 233 A A N3     1  
ATOM 6816   C C4     . A A 1 212 ? 67.507  140.534 126.266 1.00 0.00 ? 233 A A C4     1  
ATOM 6817   H "H5'"  . A A 1 212 ? 63.597  139.691 123.349 1.00 0.00 ? 233 A A "H5'"  1  
ATOM 6818   H "H5''" . A A 1 212 ? 63.666  138.106 123.532 1.00 0.00 ? 233 A A "H5''" 1  
ATOM 6819   H "H4'"  . A A 1 212 ? 62.569  138.577 125.729 1.00 0.00 ? 233 A A "H4'"  1  
ATOM 6820   H "H3'"  . A A 1 212 ? 63.604  141.142 125.178 1.00 0.00 ? 233 A A "H3'"  1  
ATOM 6821   H "H2'"  . A A 1 212 ? 64.498  141.289 127.327 1.00 0.00 ? 233 A A "H2'"  1  
ATOM 6822   H "HO2'" . A A 1 212 ? 64.049  139.806 128.944 1.00 0.00 ? 233 A A "HO2'" 1  
ATOM 6823   H "H1'"  . A A 1 212 ? 65.626  139.036 127.351 1.00 0.00 ? 233 A A "H1'"  1  
ATOM 6824   H H8     . A A 1 212 ? 65.302  140.747 124.056 1.00 0.00 ? 233 A A H8     1  
ATOM 6825   H H61    . A A 1 212 ? 70.982  142.711 124.718 1.00 0.00 ? 233 A A H61    1  
ATOM 6826   H H62    . A A 1 212 ? 69.633  142.681 123.689 1.00 0.00 ? 233 A A H62    1  
ATOM 6827   H H2     . A A 1 212 ? 69.815  140.451 128.308 1.00 0.00 ? 233 A A H2     1  
ATOM 6828   P P      . G A 1 213 ? 61.761  142.593 126.493 1.00 0.00 ? 234 G A P      1  
ATOM 6829   O OP1    . G A 1 213 ? 60.514  142.826 127.260 1.00 0.00 ? 234 G A OP1    1  
ATOM 6830   O OP2    . G A 1 213 ? 61.952  143.269 125.185 1.00 0.00 ? 234 G A OP2    1  
ATOM 6831   O "O5'"  . G A 1 213 ? 62.973  143.010 127.445 1.00 0.00 ? 234 G A "O5'"  1  
ATOM 6832   C "C5'"  . G A 1 213 ? 62.914  142.771 128.846 1.00 0.00 ? 234 G A "C5'"  1  
ATOM 6833   C "C4'"  . G A 1 213 ? 64.205  143.193 129.518 1.00 0.00 ? 234 G A "C4'"  1  
ATOM 6834   O "O4'"  . G A 1 213 ? 65.341  142.634 128.800 1.00 0.00 ? 234 G A "O4'"  1  
ATOM 6835   C "C3'"  . G A 1 213 ? 64.526  144.677 129.546 1.00 0.00 ? 234 G A "C3'"  1  
ATOM 6836   O "O3'"  . G A 1 213 ? 63.838  145.347 130.595 1.00 0.00 ? 234 G A "O3'"  1  
ATOM 6837   C "C2'"  . G A 1 213 ? 66.022  144.659 129.831 1.00 0.00 ? 234 G A "C2'"  1  
ATOM 6838   O "O2'"  . G A 1 213 ? 66.302  144.398 131.192 1.00 0.00 ? 234 G A "O2'"  1  
ATOM 6839   C "C1'"  . G A 1 213 ? 66.480  143.473 128.982 1.00 0.00 ? 234 G A "C1'"  1  
ATOM 6840   N N9     . G A 1 213 ? 66.998  143.883 127.673 1.00 0.00 ? 234 G A N9     1  
ATOM 6841   C C8     . G A 1 213 ? 66.358  143.801 126.457 1.00 0.00 ? 234 G A C8     1  
ATOM 6842   N N7     . G A 1 213 ? 67.076  144.255 125.463 1.00 0.00 ? 234 G A N7     1  
ATOM 6843   C C5     . G A 1 213 ? 68.266  144.663 126.052 1.00 0.00 ? 234 G A C5     1  
ATOM 6844   C C6     . G A 1 213 ? 69.429  145.237 125.473 1.00 0.00 ? 234 G A C6     1  
ATOM 6845   O O6     . G A 1 213 ? 69.646  145.503 124.286 1.00 0.00 ? 234 G A O6     1  
ATOM 6846   N N1     . G A 1 213 ? 70.401  145.498 126.428 1.00 0.00 ? 234 G A N1     1  
ATOM 6847   C C2     . G A 1 213 ? 70.280  145.240 127.771 1.00 0.00 ? 234 G A C2     1  
ATOM 6848   N N2     . G A 1 213 ? 71.340  145.558 128.530 1.00 0.00 ? 234 G A N2     1  
ATOM 6849   N N3     . G A 1 213 ? 69.201  144.704 128.329 1.00 0.00 ? 234 G A N3     1  
ATOM 6850   C C4     . G A 1 213 ? 68.238  144.442 127.418 1.00 0.00 ? 234 G A C4     1  
ATOM 6851   H "H5'"  . G A 1 213 ? 62.763  141.815 129.002 1.00 0.00 ? 234 G A "H5'"  1  
ATOM 6852   H "H5''" . G A 1 213 ? 62.167  143.278 129.227 1.00 0.00 ? 234 G A "H5''" 1  
ATOM 6853   H "H4'"  . G A 1 213 ? 64.210  142.851 130.437 1.00 0.00 ? 234 G A "H4'"  1  
ATOM 6854   H "H3'"  . G A 1 213 ? 64.282  145.074 128.685 1.00 0.00 ? 234 G A "H3'"  1  
ATOM 6855   H "H2'"  . G A 1 213 ? 66.454  145.485 129.531 1.00 0.00 ? 234 G A "H2'"  1  
ATOM 6856   H "HO2'" . G A 1 213 ? 65.504  144.596 131.725 1.00 0.00 ? 234 G A "HO2'" 1  
ATOM 6857   H "H1'"  . G A 1 213 ? 67.173  142.976 129.462 1.00 0.00 ? 234 G A "H1'"  1  
ATOM 6858   H H8     . G A 1 213 ? 65.454  143.438 126.347 1.00 0.00 ? 234 G A H8     1  
ATOM 6859   H H1     . G A 1 213 ? 71.239  145.898 126.117 1.00 0.00 ? 234 G A H1     1  
ATOM 6860   H H21    . G A 1 213 ? 72.137  145.953 128.120 1.00 0.00 ? 234 G A H21    1  
ATOM 6861   H H22    . G A 1 213 ? 71.317  145.395 129.496 1.00 0.00 ? 234 G A H22    1  
ATOM 6862   P P      . A A 1 214 ? 63.351  146.858 130.388 1.00 0.00 ? 235 A A P      1  
ATOM 6863   O OP1    . A A 1 214 ? 62.446  147.233 131.503 1.00 0.00 ? 235 A A OP1    1  
ATOM 6864   O OP2    . A A 1 214 ? 62.834  146.844 128.996 1.00 0.00 ? 235 A A OP2    1  
ATOM 6865   O "O5'"  . A A 1 214 ? 64.617  147.824 130.433 1.00 0.00 ? 235 A A "O5'"  1  
ATOM 6866   C "C5'"  . A A 1 214 ? 65.558  147.743 131.494 1.00 0.00 ? 235 A A "C5'"  1  
ATOM 6867   C "C4'"  . A A 1 214 ? 66.931  148.184 131.051 1.00 0.00 ? 235 A A "C4'"  1  
ATOM 6868   O "O4'"  . A A 1 214 ? 67.486  147.332 130.009 1.00 0.00 ? 235 A A "O4'"  1  
ATOM 6869   C "C3'"  . A A 1 214 ? 67.018  149.565 130.420 1.00 0.00 ? 235 A A "C3'"  1  
ATOM 6870   O "O3'"  . A A 1 214 ? 66.988  150.613 131.374 1.00 0.00 ? 235 A A "O3'"  1  
ATOM 6871   C "C2'"  . A A 1 214 ? 68.337  149.456 129.681 1.00 0.00 ? 235 A A "C2'"  1  
ATOM 6872   O "O2'"  . A A 1 214 ? 69.436  149.516 130.578 1.00 0.00 ? 235 A A "O2'"  1  
ATOM 6873   C "C1'"  . A A 1 214 ? 68.231  148.038 129.108 1.00 0.00 ? 235 A A "C1'"  1  
ATOM 6874   N N9     . A A 1 214 ? 67.495  148.008 127.830 1.00 0.00 ? 235 A A N9     1  
ATOM 6875   C C8     . A A 1 214 ? 66.166  147.731 127.627 1.00 0.00 ? 235 A A C8     1  
ATOM 6876   N N7     . A A 1 214 ? 65.801  147.783 126.370 1.00 0.00 ? 235 A A N7     1  
ATOM 6877   C C5     . A A 1 214 ? 66.969  148.117 125.697 1.00 0.00 ? 235 A A C5     1  
ATOM 6878   C C6     . A A 1 214 ? 67.251  148.324 124.336 1.00 0.00 ? 235 A A C6     1  
ATOM 6879   N N6     . A A 1 214 ? 66.339  148.223 123.366 1.00 0.00 ? 235 A A N6     1  
ATOM 6880   N N1     . A A 1 214 ? 68.519  148.645 123.999 1.00 0.00 ? 235 A A N1     1  
ATOM 6881   C C2     . A A 1 214 ? 69.435  148.748 124.971 1.00 0.00 ? 235 A A C2     1  
ATOM 6882   N N3     . A A 1 214 ? 69.291  148.576 126.283 1.00 0.00 ? 235 A A N3     1  
ATOM 6883   C C4     . A A 1 214 ? 68.019  148.259 126.585 1.00 0.00 ? 235 A A C4     1  
ATOM 6884   H "H5'"  . A A 1 214 ? 65.606  146.817 131.809 1.00 0.00 ? 235 A A "H5'"  1  
ATOM 6885   H "H5''" . A A 1 214 ? 65.260  148.316 132.230 1.00 0.00 ? 235 A A "H5''" 1  
ATOM 6886   H "H4'"  . A A 1 214 ? 67.510  148.159 131.841 1.00 0.00 ? 235 A A "H4'"  1  
ATOM 6887   H "H3'"  . A A 1 214 ? 66.296  149.701 129.770 1.00 0.00 ? 235 A A "H3'"  1  
ATOM 6888   H "H2'"  . A A 1 214 ? 68.409  150.129 128.972 1.00 0.00 ? 235 A A "H2'"  1  
ATOM 6889   H "HO2'" . A A 1 214 ? 69.150  149.962 131.403 1.00 0.00 ? 235 A A "HO2'" 1  
ATOM 6890   H "H1'"  . A A 1 214 ? 69.131  147.671 128.975 1.00 0.00 ? 235 A A "H1'"  1  
ATOM 6891   H H8     . A A 1 214 ? 65.547  147.515 128.356 1.00 0.00 ? 235 A A H8     1  
ATOM 6892   H H61    . A A 1 214 ? 66.596  148.379 122.433 1.00 0.00 ? 235 A A H61    1  
ATOM 6893   H H62    . A A 1 214 ? 65.413  147.991 123.587 1.00 0.00 ? 235 A A H62    1  
ATOM 6894   H H2     . A A 1 214 ? 70.339  148.983 124.674 1.00 0.00 ? 235 A A H2     1  
ATOM 6895   P P      . U A 1 215 ? 65.745  151.631 131.416 1.00 0.00 ? 236 U A P      1  
ATOM 6896   O OP1    . U A 1 215 ? 65.290  151.743 132.825 1.00 0.00 ? 236 U A OP1    1  
ATOM 6897   O OP2    . U A 1 215 ? 64.781  151.222 130.364 1.00 0.00 ? 236 U A OP2    1  
ATOM 6898   O "O5'"  . U A 1 215 ? 66.378  153.029 130.989 1.00 0.00 ? 236 U A "O5'"  1  
ATOM 6899   C "C5'"  . U A 1 215 ? 65.556  154.095 130.538 1.00 0.00 ? 236 U A "C5'"  1  
ATOM 6900   C "C4'"  . U A 1 215 ? 66.326  155.066 129.678 1.00 0.00 ? 236 U A "C4'"  1  
ATOM 6901   O "O4'"  . U A 1 215 ? 67.485  155.584 130.375 1.00 0.00 ? 236 U A "O4'"  1  
ATOM 6902   C "C3'"  . U A 1 215 ? 66.917  154.503 128.395 1.00 0.00 ? 236 U A "C3'"  1  
ATOM 6903   O "O3'"  . U A 1 215 ? 65.957  154.342 127.366 1.00 0.00 ? 236 U A "O3'"  1  
ATOM 6904   C "C2'"  . U A 1 215 ? 67.994  155.525 128.068 1.00 0.00 ? 236 U A "C2'"  1  
ATOM 6905   O "O2'"  . U A 1 215 ? 67.435  156.692 127.482 1.00 0.00 ? 236 U A "O2'"  1  
ATOM 6906   C "C1'"  . U A 1 215 ? 68.511  155.864 129.463 1.00 0.00 ? 236 U A "C1'"  1  
ATOM 6907   N N1     . U A 1 215 ? 69.697  155.055 129.835 1.00 0.00 ? 236 U A N1     1  
ATOM 6908   C C2     . U A 1 215 ? 70.905  155.404 129.259 1.00 0.00 ? 236 U A C2     1  
ATOM 6909   O O2     . U A 1 215 ? 71.026  156.330 128.476 1.00 0.00 ? 236 U A O2     1  
ATOM 6910   N N3     . U A 1 215 ? 71.975  154.628 129.633 1.00 0.00 ? 236 U A N3     1  
ATOM 6911   C C4     . U A 1 215 ? 71.964  153.561 130.505 1.00 0.00 ? 236 U A C4     1  
ATOM 6912   O O4     . U A 1 215 ? 73.014  152.961 130.740 1.00 0.00 ? 236 U A O4     1  
ATOM 6913   C C5     . U A 1 215 ? 70.681  153.258 131.063 1.00 0.00 ? 236 U A C5     1  
ATOM 6914   C C6     . U A 1 215 ? 69.622  153.998 130.717 1.00 0.00 ? 236 U A C6     1  
ATOM 6915   H "H5'"  . U A 1 215 ? 65.196  154.572 131.315 1.00 0.00 ? 236 U A "H5'"  1  
ATOM 6916   H "H5''" . U A 1 215 ? 64.813  153.727 130.016 1.00 0.00 ? 236 U A "H5''" 1  
ATOM 6917   H "H4'"  . U A 1 215 ? 65.728  155.808 129.451 1.00 0.00 ? 236 U A "H4'"  1  
ATOM 6918   H "H3'"  . U A 1 215 ? 67.342  153.639 128.576 1.00 0.00 ? 236 U A "H3'"  1  
ATOM 6919   H "H2'"  . U A 1 215 ? 68.697  155.139 127.506 1.00 0.00 ? 236 U A "H2'"  1  
ATOM 6920   H "HO2'" . U A 1 215 ? 68.155  157.327 127.285 1.00 0.00 ? 236 U A "HO2'" 1  
ATOM 6921   H "H1'"  . U A 1 215 ? 68.743  156.816 129.499 1.00 0.00 ? 236 U A "H1'"  1  
ATOM 6922   H H3     . U A 1 215 ? 72.840  154.858 129.235 1.00 0.00 ? 236 U A H3     1  
ATOM 6923   H H5     . U A 1 215 ? 70.580  152.514 131.694 1.00 0.00 ? 236 U A H5     1  
ATOM 6924   H H6     . U A 1 215 ? 68.756  153.770 131.111 1.00 0.00 ? 236 U A H6     1  
ATOM 6925   P P      . C A 1 216 ? 66.036  153.078 126.376 1.00 0.00 ? 237 C A P      1  
ATOM 6926   O OP1    . C A 1 216 ? 64.830  153.098 125.510 1.00 0.00 ? 237 C A OP1    1  
ATOM 6927   O OP2    . C A 1 216 ? 66.335  151.873 127.190 1.00 0.00 ? 237 C A OP2    1  
ATOM 6928   O "O5'"  . C A 1 216 ? 67.304  153.383 125.462 1.00 0.00 ? 237 C A "O5'"  1  
ATOM 6929   C "C5'"  . C A 1 216 ? 67.355  154.546 124.649 1.00 0.00 ? 237 C A "C5'"  1  
ATOM 6930   C "C4'"  . C A 1 216 ? 68.749  154.804 124.132 1.00 0.00 ? 237 C A "C4'"  1  
ATOM 6931   O "O4'"  . C A 1 216 ? 69.628  155.108 125.239 1.00 0.00 ? 237 C A "O4'"  1  
ATOM 6932   C "C3'"  . C A 1 216 ? 69.443  153.629 123.462 1.00 0.00 ? 237 C A "C3'"  1  
ATOM 6933   O "O3'"  . C A 1 216 ? 69.078  153.474 122.101 1.00 0.00 ? 237 C A "O3'"  1  
ATOM 6934   C "C2'"  . C A 1 216 ? 70.904  154.016 123.608 1.00 0.00 ? 237 C A "C2'"  1  
ATOM 6935   O "O2'"  . C A 1 216 ? 71.260  155.039 122.689 1.00 0.00 ? 237 C A "O2'"  1  
ATOM 6936   C "C1'"  . C A 1 216 ? 70.910  154.586 125.027 1.00 0.00 ? 237 C A "C1'"  1  
ATOM 6937   N N1     . C A 1 216 ? 71.123  153.537 126.055 1.00 0.00 ? 237 C A N1     1  
ATOM 6938   C C2     . C A 1 216 ? 72.436  153.241 126.440 1.00 0.00 ? 237 C A C2     1  
ATOM 6939   O O2     . C A 1 216 ? 73.376  153.858 125.915 1.00 0.00 ? 237 C A O2     1  
ATOM 6940   N N3     . C A 1 216 ? 72.658  152.289 127.375 1.00 0.00 ? 237 C A N3     1  
ATOM 6941   C C4     . C A 1 216 ? 71.632  151.640 127.924 1.00 0.00 ? 237 C A C4     1  
ATOM 6942   N N4     . C A 1 216 ? 71.898  150.709 128.843 1.00 0.00 ? 237 C A N4     1  
ATOM 6943   C C5     . C A 1 216 ? 70.285  151.917 127.554 1.00 0.00 ? 237 C A C5     1  
ATOM 6944   C C6     . C A 1 216 ? 70.078  152.861 126.629 1.00 0.00 ? 237 C A C6     1  
ATOM 6945   H "H5'"  . C A 1 216 ? 67.062  155.318 125.178 1.00 0.00 ? 237 C A "H5'"  1  
ATOM 6946   H "H5''" . C A 1 216 ? 66.748  154.431 123.888 1.00 0.00 ? 237 C A "H5''" 1  
ATOM 6947   H "H4'"  . C A 1 216 ? 68.736  155.561 123.510 1.00 0.00 ? 237 C A "H4'"  1  
ATOM 6948   H "H3'"  . C A 1 216 ? 69.267  152.791 123.938 1.00 0.00 ? 237 C A "H3'"  1  
ATOM 6949   H "H2'"  . C A 1 216 ? 71.491  153.236 123.527 1.00 0.00 ? 237 C A "H2'"  1  
ATOM 6950   H "HO2'" . C A 1 216 ? 72.215  155.235 122.783 1.00 0.00 ? 237 C A "HO2'" 1  
ATOM 6951   H "H1'"  . C A 1 216 ? 71.615  155.262 125.099 1.00 0.00 ? 237 C A "H1'"  1  
ATOM 6952   H H41    . C A 1 216 ? 72.827  150.520 129.095 1.00 0.00 ? 237 C A H41    1  
ATOM 6953   H H42    . C A 1 216 ? 71.166  150.214 129.265 1.00 0.00 ? 237 C A H42    1  
ATOM 6954   H H5     . C A 1 216 ? 69.537  151.435 127.964 1.00 0.00 ? 237 C A H5     1  
ATOM 6955   H H6     . C A 1 216 ? 69.159  153.067 126.360 1.00 0.00 ? 237 C A H6     1  
ATOM 6956   P P      . U A 1 217 ? 69.070  152.015 121.427 1.00 0.00 ? 238 U A P      1  
ATOM 6957   O OP1    . U A 1 217 ? 68.437  152.130 120.088 1.00 0.00 ? 238 U A OP1    1  
ATOM 6958   O OP2    . U A 1 217 ? 68.523  151.055 122.418 1.00 0.00 ? 238 U A OP2    1  
ATOM 6959   O "O5'"  . U A 1 217 ? 70.613  151.680 121.216 1.00 0.00 ? 238 U A "O5'"  1  
ATOM 6960   C "C5'"  . U A 1 217 ? 71.449  152.540 120.456 1.00 0.00 ? 238 U A "C5'"  1  
ATOM 6961   C "C4'"  . U A 1 217 ? 72.883  152.072 120.462 1.00 0.00 ? 238 U A "C4'"  1  
ATOM 6962   O "O4'"  . U A 1 217 ? 73.361  152.062 121.844 1.00 0.00 ? 238 U A "O4'"  1  
ATOM 6963   C "C3'"  . U A 1 217 ? 73.135  150.677 119.911 1.00 0.00 ? 238 U A "C3'"  1  
ATOM 6964   O "O3'"  . U A 1 217 ? 74.285  150.606 119.087 1.00 0.00 ? 238 U A "O3'"  1  
ATOM 6965   C "C2'"  . U A 1 217 ? 73.374  149.857 121.175 1.00 0.00 ? 238 U A "C2'"  1  
ATOM 6966   O "O2'"  . U A 1 217 ? 74.257  148.772 120.925 1.00 0.00 ? 238 U A "O2'"  1  
ATOM 6967   C "C1'"  . U A 1 217 ? 74.079  150.877 122.066 1.00 0.00 ? 238 U A "C1'"  1  
ATOM 6968   N N1     . U A 1 217 ? 74.033  150.499 123.499 1.00 0.00 ? 238 U A N1     1  
ATOM 6969   C C2     . U A 1 217 ? 75.146  150.794 124.266 1.00 0.00 ? 238 U A C2     1  
ATOM 6970   O O2     . U A 1 217 ? 76.137  151.341 123.816 1.00 0.00 ? 238 U A O2     1  
ATOM 6971   N N3     . U A 1 217 ? 75.058  150.426 125.586 1.00 0.00 ? 238 U A N3     1  
ATOM 6972   C C4     . U A 1 217 ? 73.995  149.806 126.208 1.00 0.00 ? 238 U A C4     1  
ATOM 6973   O O4     . U A 1 217 ? 74.070  149.538 127.408 1.00 0.00 ? 238 U A O4     1  
ATOM 6974   C C5     . U A 1 217 ? 72.880  149.532 125.354 1.00 0.00 ? 238 U A C5     1  
ATOM 6975   C C6     . U A 1 217 ? 72.938  149.880 124.064 1.00 0.00 ? 238 U A C6     1  
ATOM 6976   H "H5'"  . U A 1 217 ? 71.407  153.443 120.835 1.00 0.00 ? 238 U A "H5'"  1  
ATOM 6977   H "H5''" . U A 1 217 ? 71.126  152.566 119.532 1.00 0.00 ? 238 U A "H5''" 1  
ATOM 6978   H "H4'"  . U A 1 217 ? 73.429  152.713 119.962 1.00 0.00 ? 238 U A "H4'"  1  
ATOM 6979   H "H3'"  . U A 1 217 ? 72.361  150.344 119.411 1.00 0.00 ? 238 U A "H3'"  1  
ATOM 6980   H "H2'"  . U A 1 217 ? 72.531  149.554 121.571 1.00 0.00 ? 238 U A "H2'"  1  
ATOM 6981   H "HO2'" . U A 1 217 ? 73.842  147.943 121.243 1.00 0.00 ? 238 U A "HO2'" 1  
ATOM 6982   H "H1'"  . U A 1 217 ? 75.014  150.963 121.783 1.00 0.00 ? 238 U A "H1'"  1  
ATOM 6983   H H3     . U A 1 217 ? 75.836  150.626 126.147 1.00 0.00 ? 238 U A H3     1  
ATOM 6984   H H5     . U A 1 217 ? 72.080  149.093 125.712 1.00 0.00 ? 238 U A H5     1  
ATOM 6985   H H6     . U A 1 217 ? 72.163  149.681 123.501 1.00 0.00 ? 238 U A H6     1  
ATOM 6986   P P      . U A 1 218 ? 74.530  149.326 118.147 1.00 0.00 ? 239 U A P      1  
ATOM 6987   O OP1    . U A 1 218 ? 75.140  149.798 116.877 1.00 0.00 ? 239 U A OP1    1  
ATOM 6988   O OP2    . U A 1 218 ? 73.273  148.537 118.109 1.00 0.00 ? 239 U A OP2    1  
ATOM 6989   O "O5'"  . U A 1 218 ? 75.623  148.474 118.932 1.00 0.00 ? 239 U A "O5'"  1  
ATOM 6990   C "C5'"  . U A 1 218 ? 76.859  148.133 118.322 1.00 0.00 ? 239 U A "C5'"  1  
ATOM 6991   C "C4'"  . U A 1 218 ? 78.027  148.412 119.235 1.00 0.00 ? 239 U A "C4'"  1  
ATOM 6992   O "O4'"  . U A 1 218 ? 78.305  149.842 119.215 1.00 0.00 ? 239 U A "O4'"  1  
ATOM 6993   C "C3'"  . U A 1 218 ? 77.840  148.035 120.697 1.00 0.00 ? 239 U A "C3'"  1  
ATOM 6994   O "O3'"  . U A 1 218 ? 79.031  147.569 121.305 1.00 0.00 ? 239 U A "O3'"  1  
ATOM 6995   C "C2'"  . U A 1 218 ? 77.460  149.364 121.346 1.00 0.00 ? 239 U A "C2'"  1  
ATOM 6996   O "O2'"  . U A 1 218 ? 77.864  149.406 122.708 1.00 0.00 ? 239 U A "O2'"  1  
ATOM 6997   C "C1'"  . U A 1 218 ? 78.308  150.344 120.546 1.00 0.00 ? 239 U A "C1'"  1  
ATOM 6998   N N1     . U A 1 218 ? 77.736  151.712 120.544 1.00 0.00 ? 239 U A N1     1  
ATOM 6999   C C2     . U A 1 218 ? 78.212  152.597 121.494 1.00 0.00 ? 239 U A C2     1  
ATOM 7000   O O2     . U A 1 218 ? 79.065  152.300 122.312 1.00 0.00 ? 239 U A O2     1  
ATOM 7001   N N3     . U A 1 218 ? 77.654  153.851 121.453 1.00 0.00 ? 239 U A N3     1  
ATOM 7002   C C4     . U A 1 218 ? 76.688  154.304 120.580 1.00 0.00 ? 239 U A C4     1  
ATOM 7003   O O4     . U A 1 218 ? 76.286  155.465 120.673 1.00 0.00 ? 239 U A O4     1  
ATOM 7004   C C5     . U A 1 218 ? 76.243  153.335 119.626 1.00 0.00 ? 239 U A C5     1  
ATOM 7005   C C6     . U A 1 218 ? 76.770  152.106 119.642 1.00 0.00 ? 239 U A C6     1  
ATOM 7006   H "H5'"  . U A 1 218 ? 76.964  148.656 117.500 1.00 0.00 ? 239 U A "H5'"  1  
ATOM 7007   H "H5''" . U A 1 218 ? 76.851  147.180 118.096 1.00 0.00 ? 239 U A "H5''" 1  
ATOM 7008   H "H4'"  . U A 1 218 ? 78.816  147.948 118.888 1.00 0.00 ? 239 U A "H4'"  1  
ATOM 7009   H "H3'"  . U A 1 218 ? 77.137  147.362 120.809 1.00 0.00 ? 239 U A "H3'"  1  
ATOM 7010   H "H2'"  . U A 1 218 ? 76.503  149.552 121.247 1.00 0.00 ? 239 U A "H2'"  1  
ATOM 7011   H "HO2'" . U A 1 218 ? 77.362  150.110 123.168 1.00 0.00 ? 239 U A "HO2'" 1  
ATOM 7012   H "H1'"  . U A 1 218 ? 79.213  150.371 120.924 1.00 0.00 ? 239 U A "H1'"  1  
ATOM 7013   H H3     . U A 1 218 ? 77.978  154.494 122.118 1.00 0.00 ? 239 U A H3     1  
ATOM 7014   H H5     . U A 1 218 ? 75.558  153.571 118.966 1.00 0.00 ? 239 U A H5     1  
ATOM 7015   H H6     . U A 1 218 ? 76.448  151.461 118.980 1.00 0.00 ? 239 U A H6     1  
ATOM 7016   P P      . C A 1 219 ? 79.007  146.253 122.228 1.00 0.00 ? 240 C A P      1  
ATOM 7017   O OP1    . C A 1 219 ? 80.412  145.847 122.485 1.00 0.00 ? 240 C A OP1    1  
ATOM 7018   O OP2    . C A 1 219 ? 78.062  145.282 121.621 1.00 0.00 ? 240 C A OP2    1  
ATOM 7019   O "O5'"  . C A 1 219 ? 78.380  146.759 123.606 1.00 0.00 ? 240 C A "O5'"  1  
ATOM 7020   C "C5'"  . C A 1 219 ? 79.138  147.507 124.557 1.00 0.00 ? 240 C A "C5'"  1  
ATOM 7021   C "C4'"  . C A 1 219 ? 78.573  147.273 125.936 1.00 0.00 ? 240 C A "C4'"  1  
ATOM 7022   O "O4'"  . C A 1 219 ? 77.342  148.038 126.021 1.00 0.00 ? 240 C A "O4'"  1  
ATOM 7023   C "C3'"  . C A 1 219 ? 78.173  145.851 126.329 1.00 0.00 ? 240 C A "C3'"  1  
ATOM 7024   O "O3'"  . C A 1 219 ? 79.260  145.083 126.873 1.00 0.00 ? 240 C A "O3'"  1  
ATOM 7025   C "C2'"  . C A 1 219 ? 77.119  146.138 127.389 1.00 0.00 ? 240 C A "C2'"  1  
ATOM 7026   O "O2'"  . C A 1 219 ? 77.694  146.578 128.611 1.00 0.00 ? 240 C A "O2'"  1  
ATOM 7027   C "C1'"  . C A 1 219 ? 76.372  147.302 126.735 1.00 0.00 ? 240 C A "C1'"  1  
ATOM 7028   N N1     . C A 1 219 ? 75.351  146.869 125.772 1.00 0.00 ? 240 C A N1     1  
ATOM 7029   C C2     . C A 1 219 ? 74.169  146.293 126.250 1.00 0.00 ? 240 C A C2     1  
ATOM 7030   O O2     . C A 1 219 ? 74.030  146.131 127.471 1.00 0.00 ? 240 C A O2     1  
ATOM 7031   N N3     . C A 1 219 ? 73.214  145.917 125.376 1.00 0.00 ? 240 C A N3     1  
ATOM 7032   C C4     . C A 1 219 ? 73.412  146.081 124.069 1.00 0.00 ? 240 C A C4     1  
ATOM 7033   N N4     . C A 1 219 ? 72.438  145.689 123.245 1.00 0.00 ? 240 C A N4     1  
ATOM 7034   C C5     . C A 1 219 ? 74.614  146.653 123.550 1.00 0.00 ? 240 C A C5     1  
ATOM 7035   C C6     . C A 1 219 ? 75.546  147.032 124.431 1.00 0.00 ? 240 C A C6     1  
ATOM 7036   H "H5'"  . C A 1 219 ? 79.089  148.458 124.326 1.00 0.00 ? 240 C A "H5'"  1  
ATOM 7037   H "H5''" . C A 1 219 ? 80.074  147.217 124.518 1.00 0.00 ? 240 C A "H5''" 1  
ATOM 7038   H "H4'"  . C A 1 219 ? 79.219  147.591 126.601 1.00 0.00 ? 240 C A "H4'"  1  
ATOM 7039   H "H3'"  . C A 1 219 ? 77.817  145.386 125.543 1.00 0.00 ? 240 C A "H3'"  1  
ATOM 7040   H "H2'"  . C A 1 219 ? 76.534  145.364 127.532 1.00 0.00 ? 240 C A "H2'"  1  
ATOM 7041   H "HO2'" . C A 1 219 ? 78.634  146.309 128.636 1.00 0.00 ? 240 C A "HO2'" 1  
ATOM 7042   H "H1'"  . C A 1 219 ? 75.944  147.842 127.431 1.00 0.00 ? 240 C A "H1'"  1  
ATOM 7043   H H41    . C A 1 219 ? 71.616  145.296 123.607 1.00 0.00 ? 240 C A H41    1  
ATOM 7044   H H42    . C A 1 219 ? 72.544  145.793 122.276 1.00 0.00 ? 240 C A H42    1  
ATOM 7045   H H5     . C A 1 219 ? 74.748  146.764 122.585 1.00 0.00 ? 240 C A H5     1  
ATOM 7046   H H6     . C A 1 219 ? 76.378  147.425 124.097 1.00 0.00 ? 240 C A H6     1  
ATOM 7047   P P      . U A 1 220 ? 79.186  143.468 126.880 1.00 0.00 ? 241 U A P      1  
ATOM 7048   O OP1    . U A 1 220 ? 80.492  142.973 127.390 1.00 0.00 ? 241 U A OP1    1  
ATOM 7049   O OP2    . U A 1 220 ? 78.687  143.002 125.563 1.00 0.00 ? 241 U A OP2    1  
ATOM 7050   O "O5'"  . U A 1 220 ? 78.065  143.118 127.957 1.00 0.00 ? 241 U A "O5'"  1  
ATOM 7051   C "C5'"  . U A 1 220 ? 78.336  143.223 129.355 1.00 0.00 ? 241 U A "C5'"  1  
ATOM 7052   C "C4'"  . U A 1 220 ? 77.118  142.844 130.172 1.00 0.00 ? 241 U A "C4'"  1  
ATOM 7053   O "O4'"  . U A 1 220 ? 76.032  143.780 129.899 1.00 0.00 ? 241 U A "O4'"  1  
ATOM 7054   C "C3'"  . U A 1 220 ? 76.480  141.498 129.873 1.00 0.00 ? 241 U A "C3'"  1  
ATOM 7055   O "O3'"  . U A 1 220 ? 77.134  140.402 130.473 1.00 0.00 ? 241 U A "O3'"  1  
ATOM 7056   C "C2'"  . U A 1 220 ? 75.098  141.699 130.454 1.00 0.00 ? 241 U A "C2'"  1  
ATOM 7057   O "O2'"  . U A 1 220 ? 75.097  141.734 131.865 1.00 0.00 ? 241 U A "O2'"  1  
ATOM 7058   C "C1'"  . U A 1 220 ? 74.793  143.084 129.905 1.00 0.00 ? 241 U A "C1'"  1  
ATOM 7059   N N1     . U A 1 220 ? 74.353  142.925 128.517 1.00 0.00 ? 241 U A N1     1  
ATOM 7060   C C2     . U A 1 220 ? 73.191  142.229 128.316 1.00 0.00 ? 241 U A C2     1  
ATOM 7061   O O2     . U A 1 220 ? 72.538  141.776 129.229 1.00 0.00 ? 241 U A O2     1  
ATOM 7062   N N3     . U A 1 220 ? 72.826  142.068 127.010 1.00 0.00 ? 241 U A N3     1  
ATOM 7063   C C4     . U A 1 220 ? 73.500  142.526 125.905 1.00 0.00 ? 241 U A C4     1  
ATOM 7064   O O4     . U A 1 220 ? 73.064  142.263 124.782 1.00 0.00 ? 241 U A O4     1  
ATOM 7065   C C5     . U A 1 220 ? 74.699  143.252 126.197 1.00 0.00 ? 241 U A C5     1  
ATOM 7066   C C6     . U A 1 220 ? 75.070  143.425 127.465 1.00 0.00 ? 241 U A C6     1  
ATOM 7067   H "H5'"  . U A 1 220 ? 78.592  144.145 129.561 1.00 0.00 ? 241 U A "H5'"  1  
ATOM 7068   H "H5''" . U A 1 220 ? 79.078  142.624 129.582 1.00 0.00 ? 241 U A "H5''" 1  
ATOM 7069   H "H4'"  . U A 1 220 ? 77.347  142.893 131.123 1.00 0.00 ? 241 U A "H4'"  1  
ATOM 7070   H "H3'"  . U A 1 220 ? 76.462  141.356 128.904 1.00 0.00 ? 241 U A "H3'"  1  
ATOM 7071   H "H2'"  . U A 1 220 ? 74.468  141.026 130.121 1.00 0.00 ? 241 U A "H2'"  1  
ATOM 7072   H "HO2'" . U A 1 220 ? 74.179  141.865 132.180 1.00 0.00 ? 241 U A "HO2'" 1  
ATOM 7073   H "H1'"  . U A 1 220 ? 74.102  143.506 130.459 1.00 0.00 ? 241 U A "H1'"  1  
ATOM 7074   H H3     . U A 1 220 ? 71.997  141.572 126.848 1.00 0.00 ? 241 U A H3     1  
ATOM 7075   H H5     . U A 1 220 ? 75.241  143.620 125.469 1.00 0.00 ? 241 U A H5     1  
ATOM 7076   H H6     . U A 1 220 ? 75.895  143.925 127.636 1.00 0.00 ? 241 U A H6     1  
ATOM 7077   P P      . G A 1 221 ? 77.245  139.027 129.656 1.00 0.00 ? 242 G A P      1  
ATOM 7078   O OP1    . G A 1 221 ? 78.239  138.189 130.361 1.00 0.00 ? 242 G A OP1    1  
ATOM 7079   O OP2    . G A 1 221 ? 77.442  139.366 128.233 1.00 0.00 ? 242 G A OP2    1  
ATOM 7080   O "O5'"  . G A 1 221 ? 75.809  138.350 129.762 1.00 0.00 ? 242 G A "O5'"  1  
ATOM 7081   C "C5'"  . G A 1 221 ? 75.389  137.729 130.975 1.00 0.00 ? 242 G A "C5'"  1  
ATOM 7082   C "C4'"  . G A 1 221 ? 74.108  136.961 130.754 1.00 0.00 ? 242 G A "C4'"  1  
ATOM 7083   O "O4'"  . G A 1 221 ? 73.124  137.858 130.199 1.00 0.00 ? 242 G A "O4'"  1  
ATOM 7084   C "C3'"  . G A 1 221 ? 74.217  135.790 129.789 1.00 0.00 ? 242 G A "C3'"  1  
ATOM 7085   O "O3'"  . G A 1 221 ? 74.488  134.616 130.565 1.00 0.00 ? 242 G A "O3'"  1  
ATOM 7086   C "C2'"  . G A 1 221 ? 72.846  135.744 129.104 1.00 0.00 ? 242 G A "C2'"  1  
ATOM 7087   O "O2'"  . G A 1 221 ? 71.900  134.867 129.678 1.00 0.00 ? 242 G A "O2'"  1  
ATOM 7088   C "C1'"  . G A 1 221 ? 72.365  137.190 129.224 1.00 0.00 ? 242 G A "C1'"  1  
ATOM 7089   N N9     . G A 1 221 ? 72.429  137.987 128.014 1.00 0.00 ? 242 G A N9     1  
ATOM 7090   C C8     . G A 1 221 ? 73.273  139.040 127.760 1.00 0.00 ? 242 G A C8     1  
ATOM 7091   N N7     . G A 1 221 ? 73.031  139.617 126.619 1.00 0.00 ? 242 G A N7     1  
ATOM 7092   C C5     . G A 1 221 ? 71.979  138.886 126.085 1.00 0.00 ? 242 G A C5     1  
ATOM 7093   C C6     . G A 1 221 ? 71.267  139.043 124.868 1.00 0.00 ? 242 G A C6     1  
ATOM 7094   O O6     . G A 1 221 ? 71.405  139.911 124.004 1.00 0.00 ? 242 G A O6     1  
ATOM 7095   N N1     . G A 1 221 ? 70.292  138.068 124.713 1.00 0.00 ? 242 G A N1     1  
ATOM 7096   C C2     . G A 1 221 ? 70.024  137.080 125.621 1.00 0.00 ? 242 G A C2     1  
ATOM 7097   N N2     . G A 1 221 ? 69.056  136.233 125.289 1.00 0.00 ? 242 G A N2     1  
ATOM 7098   N N3     . G A 1 221 ? 70.661  136.935 126.767 1.00 0.00 ? 242 G A N3     1  
ATOM 7099   C C4     . G A 1 221 ? 71.620  137.862 126.930 1.00 0.00 ? 242 G A C4     1  
ATOM 7100   H "H5'"  . G A 1 221 ? 75.246  138.420 131.655 1.00 0.00 ? 242 G A "H5'"  1  
ATOM 7101   H "H5''" . G A 1 221 ? 76.092  137.119 131.281 1.00 0.00 ? 242 G A "H5''" 1  
ATOM 7102   H "H4'"  . G A 1 221 ? 73.790  136.620 131.617 1.00 0.00 ? 242 G A "H4'"  1  
ATOM 7103   H "H3'"  . G A 1 221 ? 74.928  135.972 129.141 1.00 0.00 ? 242 G A "H3'"  1  
ATOM 7104   H "H2'"  . G A 1 221 ? 72.928  135.544 128.148 1.00 0.00 ? 242 G A "H2'"  1  
ATOM 7105   H "HO2'" . G A 1 221 ? 71.403  134.421 128.960 1.00 0.00 ? 242 G A "HO2'" 1  
ATOM 7106   H "H1'"  . G A 1 221 ? 71.434  137.200 129.531 1.00 0.00 ? 242 G A "H1'"  1  
ATOM 7107   H H8     . G A 1 221 ? 73.973  139.336 128.378 1.00 0.00 ? 242 G A H8     1  
ATOM 7108   H H1     . G A 1 221 ? 69.757  138.088 123.892 1.00 0.00 ? 242 G A H1     1  
ATOM 7109   H H21    . G A 1 221 ? 68.580  136.337 124.439 1.00 0.00 ? 242 G A H21    1  
ATOM 7110   H H22    . G A 1 221 ? 68.818  135.501 125.896 1.00 0.00 ? 242 G A H22    1  
ATOM 7111   P P      . U A 1 222 ? 75.014  133.275 129.851 1.00 0.00 ? 243 U A P      1  
ATOM 7112   O OP1    . U A 1 222 ? 75.426  132.325 130.918 1.00 0.00 ? 243 U A OP1    1  
ATOM 7113   O OP2    . U A 1 222 ? 75.997  133.684 128.819 1.00 0.00 ? 243 U A OP2    1  
ATOM 7114   O "O5'"  . U A 1 222 ? 73.719  132.691 129.133 1.00 0.00 ? 243 U A "O5'"  1  
ATOM 7115   C "C5'"  . U A 1 222 ? 72.699  132.058 129.890 1.00 0.00 ? 243 U A "C5'"  1  
ATOM 7116   C "C4'"  . U A 1 222 ? 71.598  131.598 128.979 1.00 0.00 ? 243 U A "C4'"  1  
ATOM 7117   O "O4'"  . U A 1 222 ? 70.938  132.750 128.412 1.00 0.00 ? 243 U A "O4'"  1  
ATOM 7118   C "C3'"  . U A 1 222 ? 72.085  130.826 127.772 1.00 0.00 ? 243 U A "C3'"  1  
ATOM 7119   O "O3'"  . U A 1 222 ? 72.235  129.465 128.103 1.00 0.00 ? 243 U A "O3'"  1  
ATOM 7120   C "C2'"  . U A 1 222 ? 70.963  131.029 126.772 1.00 0.00 ? 243 U A "C2'"  1  
ATOM 7121   O "O2'"  . U A 1 222 ? 69.885  130.145 126.980 1.00 0.00 ? 243 U A "O2'"  1  
ATOM 7122   C "C1'"  . U A 1 222 ? 70.539  132.464 127.085 1.00 0.00 ? 243 U A "C1'"  1  
ATOM 7123   N N1     . U A 1 222 ? 71.162  133.460 126.205 1.00 0.00 ? 243 U A N1     1  
ATOM 7124   C C2     . U A 1 222 ? 70.611  133.656 124.952 1.00 0.00 ? 243 U A C2     1  
ATOM 7125   O O2     . U A 1 222 ? 69.660  133.011 124.535 1.00 0.00 ? 243 U A O2     1  
ATOM 7126   N N3     . U A 1 222 ? 71.222  134.631 124.195 1.00 0.00 ? 243 U A N3     1  
ATOM 7127   C C4     . U A 1 222 ? 72.305  135.403 124.560 1.00 0.00 ? 243 U A C4     1  
ATOM 7128   O O4     . U A 1 222 ? 72.667  136.319 123.824 1.00 0.00 ? 243 U A O4     1  
ATOM 7129   C C5     . U A 1 222 ? 72.830  135.118 125.860 1.00 0.00 ? 243 U A C5     1  
ATOM 7130   C C6     . U A 1 222 ? 72.253  134.182 126.618 1.00 0.00 ? 243 U A C6     1  
ATOM 7131   H "H5'"  . U A 1 222 ? 72.344  132.694 130.546 1.00 0.00 ? 243 U A "H5'"  1  
ATOM 7132   H "H5''" . U A 1 222 ? 73.081  131.290 130.364 1.00 0.00 ? 243 U A "H5''" 1  
ATOM 7133   H "H4'"  . U A 1 222 ? 70.950  131.080 129.501 1.00 0.00 ? 243 U A "H4'"  1  
ATOM 7134   H "H3'"  . U A 1 222 ? 72.935  131.204 127.469 1.00 0.00 ? 243 U A "H3'"  1  
ATOM 7135   H "H2'"  . U A 1 222 ? 71.289  130.970 125.849 1.00 0.00 ? 243 U A "H2'"  1  
ATOM 7136   H "HO2'" . U A 1 222 ? 69.552  129.836 126.111 1.00 0.00 ? 243 U A "HO2'" 1  
ATOM 7137   H "H1'"  . U A 1 222 ? 69.564  132.537 127.003 1.00 0.00 ? 243 U A "H1'"  1  
ATOM 7138   H H3     . U A 1 222 ? 70.847  134.791 123.304 1.00 0.00 ? 243 U A H3     1  
ATOM 7139   H H5     . U A 1 222 ? 73.610  135.607 126.195 1.00 0.00 ? 243 U A H5     1  
ATOM 7140   H H6     . U A 1 222 ? 72.635  134.008 127.502 1.00 0.00 ? 243 U A H6     1  
ATOM 7141   P P      . U A 1 223 ? 73.335  128.594 127.338 1.00 0.00 ? 244 U A P      1  
ATOM 7142   O OP1    . U A 1 223 ? 73.519  127.310 128.065 1.00 0.00 ? 244 U A OP1    1  
ATOM 7143   O OP2    . U A 1 223 ? 74.493  129.496 127.144 1.00 0.00 ? 244 U A OP2    1  
ATOM 7144   O "O5'"  . U A 1 223 ? 72.660  128.298 125.924 1.00 0.00 ? 244 U A "O5'"  1  
ATOM 7145   C "C5'"  . U A 1 223 ? 71.455  127.558 125.853 1.00 0.00 ? 244 U A "C5'"  1  
ATOM 7146   C "C4'"  . U A 1 223 ? 70.729  127.854 124.572 1.00 0.00 ? 244 U A "C4'"  1  
ATOM 7147   O "O4'"  . U A 1 223 ? 70.513  129.277 124.467 1.00 0.00 ? 244 U A "O4'"  1  
ATOM 7148   C "C3'"  . U A 1 223 ? 71.452  127.528 123.281 1.00 0.00 ? 244 U A "C3'"  1  
ATOM 7149   O "O3'"  . U A 1 223 ? 71.308  126.159 122.971 1.00 0.00 ? 244 U A "O3'"  1  
ATOM 7150   C "C2'"  . U A 1 223 ? 70.704  128.383 122.266 1.00 0.00 ? 244 U A "C2'"  1  
ATOM 7151   O "O2'"  . U A 1 223 ? 69.515  127.782 121.787 1.00 0.00 ? 244 U A "O2'"  1  
ATOM 7152   C "C1'"  . U A 1 223 ? 70.385  129.626 123.099 1.00 0.00 ? 244 U A "C1'"  1  
ATOM 7153   N N1     . U A 1 223 ? 71.258  130.774 122.824 1.00 0.00 ? 244 U A N1     1  
ATOM 7154   C C2     . U A 1 223 ? 71.120  131.393 121.604 1.00 0.00 ? 244 U A C2     1  
ATOM 7155   O O2     . U A 1 223 ? 70.346  131.001 120.760 1.00 0.00 ? 244 U A O2     1  
ATOM 7156   N N3     . U A 1 223 ? 71.924  132.486 121.404 1.00 0.00 ? 244 U A N3     1  
ATOM 7157   C C4     . U A 1 223 ? 72.839  133.002 122.281 1.00 0.00 ? 244 U A C4     1  
ATOM 7158   O O4     . U A 1 223 ? 73.419  134.047 121.997 1.00 0.00 ? 244 U A O4     1  
ATOM 7159   C C5     . U A 1 223 ? 72.949  132.290 123.516 1.00 0.00 ? 244 U A C5     1  
ATOM 7160   C C6     . U A 1 223 ? 72.169  131.225 123.739 1.00 0.00 ? 244 U A C6     1  
ATOM 7161   H "H5'"  . U A 1 223 ? 70.886  127.798 126.615 1.00 0.00 ? 244 U A "H5'"  1  
ATOM 7162   H "H5''" . U A 1 223 ? 71.663  126.601 125.898 1.00 0.00 ? 244 U A "H5''" 1  
ATOM 7163   H "H4'"  . U A 1 223 ? 69.862  127.397 124.586 1.00 0.00 ? 244 U A "H4'"  1  
ATOM 7164   H "H3'"  . U A 1 223 ? 72.399  127.762 123.373 1.00 0.00 ? 244 U A "H3'"  1  
ATOM 7165   H "H2'"  . U A 1 223 ? 71.282  128.639 121.516 1.00 0.00 ? 244 U A "H2'"  1  
ATOM 7166   H "HO2'" . U A 1 223 ? 69.558  126.816 121.948 1.00 0.00 ? 244 U A "HO2'" 1  
ATOM 7167   H "H1'"  . U A 1 223 ? 69.457  129.896 122.932 1.00 0.00 ? 244 U A "H1'"  1  
ATOM 7168   H H3     . U A 1 223 ? 71.834  132.943 120.542 1.00 0.00 ? 244 U A H3     1  
ATOM 7169   H H5     . U A 1 223 ? 73.590  132.580 124.197 1.00 0.00 ? 244 U A H5     1  
ATOM 7170   H H6     . U A 1 223 ? 72.267  130.756 124.593 1.00 0.00 ? 244 U A H6     1  
ATOM 7171   P P      . G A 1 224 ? 72.611  125.289 122.673 1.00 0.00 ? 245 G A P      1  
ATOM 7172   O OP1    . G A 1 224 ? 72.395  123.902 123.156 1.00 0.00 ? 245 G A OP1    1  
ATOM 7173   O OP2    . G A 1 224 ? 73.751  126.079 123.195 1.00 0.00 ? 245 G A OP2    1  
ATOM 7174   O "O5'"  . G A 1 224 ? 72.692  125.271 121.087 1.00 0.00 ? 245 G A "O5'"  1  
ATOM 7175   C "C5'"  . G A 1 224 ? 71.647  124.706 120.314 1.00 0.00 ? 245 G A "C5'"  1  
ATOM 7176   C "C4'"  . G A 1 224 ? 71.600  125.365 118.966 1.00 0.00 ? 245 G A "C4'"  1  
ATOM 7177   O "O4'"  . G A 1 224 ? 71.246  126.760 119.142 1.00 0.00 ? 245 G A "O4'"  1  
ATOM 7178   C "C3'"  . G A 1 224 ? 72.929  125.442 118.242 1.00 0.00 ? 245 G A "C3'"  1  
ATOM 7179   O "O3'"  . G A 1 224 ? 73.260  124.243 117.573 1.00 0.00 ? 245 G A "O3'"  1  
ATOM 7180   C "C2'"  . G A 1 224 ? 72.693  126.579 117.263 1.00 0.00 ? 245 G A "C2'"  1  
ATOM 7181   O "O2'"  . G A 1 224 ? 71.961  126.170 116.123 1.00 0.00 ? 245 G A "O2'"  1  
ATOM 7182   C "C1'"  . G A 1 224 ? 71.879  127.539 118.131 1.00 0.00 ? 245 G A "C1'"  1  
ATOM 7183   N N9     . G A 1 224 ? 72.715  128.543 118.777 1.00 0.00 ? 245 G A N9     1  
ATOM 7184   C C8     . G A 1 224 ? 73.011  128.639 120.112 1.00 0.00 ? 245 G A C8     1  
ATOM 7185   N N7     . G A 1 224 ? 73.764  129.663 120.399 1.00 0.00 ? 245 G A N7     1  
ATOM 7186   C C5     . G A 1 224 ? 73.986  130.277 119.176 1.00 0.00 ? 245 G A C5     1  
ATOM 7187   C C6     . G A 1 224 ? 74.722  131.437 118.861 1.00 0.00 ? 245 G A C6     1  
ATOM 7188   O O6     . G A 1 224 ? 75.332  132.194 119.624 1.00 0.00 ? 245 G A O6     1  
ATOM 7189   N N1     . G A 1 224 ? 74.700  131.698 117.495 1.00 0.00 ? 245 G A N1     1  
ATOM 7190   C C2     . G A 1 224 ? 74.046  130.942 116.554 1.00 0.00 ? 245 G A C2     1  
ATOM 7191   N N2     . G A 1 224 ? 74.154  131.361 115.282 1.00 0.00 ? 245 G A N2     1  
ATOM 7192   N N3     . G A 1 224 ? 73.343  129.862 116.840 1.00 0.00 ? 245 G A N3     1  
ATOM 7193   C C4     . G A 1 224 ? 73.357  129.590 118.161 1.00 0.00 ? 245 G A C4     1  
ATOM 7194   H "H5'"  . G A 1 224 ? 70.796  124.838 120.782 1.00 0.00 ? 245 G A "H5'"  1  
ATOM 7195   H "H5''" . G A 1 224 ? 71.808  123.745 120.211 1.00 0.00 ? 245 G A "H5''" 1  
ATOM 7196   H "H4'"  . G A 1 224 ? 70.915  124.922 118.421 1.00 0.00 ? 245 G A "H4'"  1  
ATOM 7197   H "H3'"  . G A 1 224 ? 73.635  125.654 118.886 1.00 0.00 ? 245 G A "H3'"  1  
ATOM 7198   H "H2'"  . G A 1 224 ? 73.534  127.012 117.004 1.00 0.00 ? 245 G A "H2'"  1  
ATOM 7199   H "HO2'" . G A 1 224 ? 71.838  126.939 115.528 1.00 0.00 ? 245 G A "HO2'" 1  
ATOM 7200   H "H1'"  . G A 1 224 ? 71.202  127.983 117.579 1.00 0.00 ? 245 G A "H1'"  1  
ATOM 7201   H H8     . G A 1 224 ? 72.684  128.006 120.786 1.00 0.00 ? 245 G A H8     1  
ATOM 7202   H H1     . G A 1 224 ? 75.192  132.487 117.183 1.00 0.00 ? 245 G A H1     1  
ATOM 7203   H H21    . G A 1 224 ? 74.675  132.162 115.070 1.00 0.00 ? 245 G A H21    1  
ATOM 7204   H H22    . G A 1 224 ? 73.709  130.863 114.564 1.00 0.00 ? 245 G A H22    1  
ATOM 7205   P P      . A A 1 225 ? 74.785  123.980 117.164 1.00 0.00 ? 246 A A P      1  
ATOM 7206   O OP1    . A A 1 225 ? 74.860  122.672 116.478 1.00 0.00 ? 246 A A OP1    1  
ATOM 7207   O OP2    . A A 1 225 ? 75.600  124.225 118.384 1.00 0.00 ? 246 A A OP2    1  
ATOM 7208   O "O5'"  . A A 1 225 ? 75.102  125.131 116.109 1.00 0.00 ? 246 A A "O5'"  1  
ATOM 7209   C "C5'"  . A A 1 225 ? 74.480  125.137 114.830 1.00 0.00 ? 246 A A "C5'"  1  
ATOM 7210   C "C4'"  . A A 1 225 ? 75.266  126.004 113.881 1.00 0.00 ? 246 A A "C4'"  1  
ATOM 7211   O "O4'"  . A A 1 225 ? 75.180  127.380 114.310 1.00 0.00 ? 246 A A "O4'"  1  
ATOM 7212   C "C3'"  . A A 1 225 ? 76.749  125.683 113.811 1.00 0.00 ? 246 A A "C3'"  1  
ATOM 7213   O "O3'"  . A A 1 225 ? 76.918  124.724 112.774 1.00 0.00 ? 246 A A "O3'"  1  
ATOM 7214   C "C2'"  . A A 1 225 ? 77.357  127.023 113.423 1.00 0.00 ? 246 A A "C2'"  1  
ATOM 7215   O "O2'"  . A A 1 225 ? 77.277  127.248 112.038 1.00 0.00 ? 246 A A "O2'"  1  
ATOM 7216   C "C1'"  . A A 1 225 ? 76.429  128.010 114.131 1.00 0.00 ? 246 A A "C1'"  1  
ATOM 7217   N N9     . A A 1 225 ? 76.876  128.447 115.443 1.00 0.00 ? 246 A A N9     1  
ATOM 7218   C C8     . A A 1 225 ? 76.560  127.880 116.645 1.00 0.00 ? 246 A A C8     1  
ATOM 7219   N N7     . A A 1 225 ? 77.064  128.510 117.676 1.00 0.00 ? 246 A A N7     1  
ATOM 7220   C C5     . A A 1 225 ? 77.769  129.558 117.108 1.00 0.00 ? 246 A A C5     1  
ATOM 7221   C C6     . A A 1 225 ? 78.529  130.595 117.671 1.00 0.00 ? 246 A A C6     1  
ATOM 7222   N N6     . A A 1 225 ? 78.705  130.757 118.983 1.00 0.00 ? 246 A A N6     1  
ATOM 7223   N N1     . A A 1 225 ? 79.106  131.474 116.828 1.00 0.00 ? 246 A A N1     1  
ATOM 7224   C C2     . A A 1 225 ? 78.923  131.313 115.514 1.00 0.00 ? 246 A A C2     1  
ATOM 7225   N N3     . A A 1 225 ? 78.229  130.382 114.866 1.00 0.00 ? 246 A A N3     1  
ATOM 7226   C C4     . A A 1 225 ? 77.672  129.526 115.733 1.00 0.00 ? 246 A A C4     1  
ATOM 7227   H "H5'"  . A A 1 225 ? 73.566  125.483 114.918 1.00 0.00 ? 246 A A "H5'"  1  
ATOM 7228   H "H5''" . A A 1 225 ? 74.440  124.219 114.489 1.00 0.00 ? 246 A A "H5''" 1  
ATOM 7229   H "H4'"  . A A 1 225 ? 74.880  125.922 112.984 1.00 0.00 ? 246 A A "H4'"  1  
ATOM 7230   H "H3'"  . A A 1 225 ? 77.046  125.343 114.681 1.00 0.00 ? 246 A A "H3'"  1  
ATOM 7231   H "H2'"  . A A 1 225 ? 78.277  127.107 113.747 1.00 0.00 ? 246 A A "H2'"  1  
ATOM 7232   H "HO2'" . A A 1 225 ? 77.677  128.118 111.833 1.00 0.00 ? 246 A A "HO2'" 1  
ATOM 7233   H "H1'"  . A A 1 225 ? 76.313  128.807 113.571 1.00 0.00 ? 246 A A "H1'"  1  
ATOM 7234   H H8     . A A 1 225 ? 76.000  127.078 116.729 1.00 0.00 ? 246 A A H8     1  
ATOM 7235   H H61    . A A 1 225 ? 79.244  131.505 119.316 1.00 0.00 ? 246 A A H61    1  
ATOM 7236   H H62    . A A 1 225 ? 78.295  130.131 119.615 1.00 0.00 ? 246 A A H62    1  
ATOM 7237   H H2     . A A 1 225 ? 79.364  131.980 114.947 1.00 0.00 ? 246 A A H2     1  
ATOM 7238   P P      . U A 1 226 ? 78.340  124.014 112.539 1.00 0.00 ? 247 U A P      1  
ATOM 7239   O OP1    . U A 1 226 ? 78.279  123.465 111.157 1.00 0.00 ? 247 U A OP1    1  
ATOM 7240   O OP2    . U A 1 226 ? 78.616  123.096 113.672 1.00 0.00 ? 247 U A OP2    1  
ATOM 7241   O "O5'"  . U A 1 226 ? 79.402  125.211 112.580 1.00 0.00 ? 247 U A "O5'"  1  
ATOM 7242   C "C5'"  . U A 1 226 ? 79.712  125.959 111.396 1.00 0.00 ? 247 U A "C5'"  1  
ATOM 7243   C "C4'"  . U A 1 226 ? 80.672  127.098 111.694 1.00 0.00 ? 247 U A "C4'"  1  
ATOM 7244   O "O4'"  . U A 1 226 ? 80.168  127.920 112.771 1.00 0.00 ? 247 U A "O4'"  1  
ATOM 7245   C "C3'"  . U A 1 226 ? 82.035  126.726 112.228 1.00 0.00 ? 247 U A "C3'"  1  
ATOM 7246   O "O3'"  . U A 1 226 ? 82.886  126.317 111.202 1.00 0.00 ? 247 U A "O3'"  1  
ATOM 7247   C "C2'"  . U A 1 226 ? 82.537  128.049 112.757 1.00 0.00 ? 247 U A "C2'"  1  
ATOM 7248   O "O2'"  . U A 1 226 ? 82.978  128.859 111.701 1.00 0.00 ? 247 U A "O2'"  1  
ATOM 7249   C "C1'"  . U A 1 226 ? 81.254  128.638 113.328 1.00 0.00 ? 247 U A "C1'"  1  
ATOM 7250   N N1     . U A 1 226 ? 81.205  128.581 114.794 1.00 0.00 ? 247 U A N1     1  
ATOM 7251   C C2     . U A 1 226 ? 81.874  129.593 115.454 1.00 0.00 ? 247 U A C2     1  
ATOM 7252   O O2     . U A 1 226 ? 82.504  130.454 114.865 1.00 0.00 ? 247 U A O2     1  
ATOM 7253   N N3     . U A 1 226 ? 81.786  129.566 116.821 1.00 0.00 ? 247 U A N3     1  
ATOM 7254   C C4     . U A 1 226 ? 81.120  128.650 117.583 1.00 0.00 ? 247 U A C4     1  
ATOM 7255   O O4     . U A 1 226 ? 81.065  128.812 118.810 1.00 0.00 ? 247 U A O4     1  
ATOM 7256   C C5     . U A 1 226 ? 80.473  127.610 116.832 1.00 0.00 ? 247 U A C5     1  
ATOM 7257   C C6     . U A 1 226 ? 80.536  127.610 115.493 1.00 0.00 ? 247 U A C6     1  
ATOM 7258   H "H5'"  . U A 1 226 ? 78.883  126.328 111.025 1.00 0.00 ? 247 U A "H5'"  1  
ATOM 7259   H "H5''" . U A 1 226 ? 80.120  125.360 110.736 1.00 0.00 ? 247 U A "H5''" 1  
ATOM 7260   H "H4'"  . U A 1 226 ? 80.759  127.655 110.893 1.00 0.00 ? 247 U A "H4'"  1  
ATOM 7261   H "H3'"  . U A 1 226 ? 81.938  126.009 112.889 1.00 0.00 ? 247 U A "H3'"  1  
ATOM 7262   H "H2'"  . U A 1 226 ? 83.226  127.923 113.442 1.00 0.00 ? 247 U A "H2'"  1  
ATOM 7263   H "HO2'" . U A 1 226 ? 83.297  129.710 112.066 1.00 0.00 ? 247 U A "HO2'" 1  
ATOM 7264   H "H1'"  . U A 1 226 ? 81.173  129.571 113.041 1.00 0.00 ? 247 U A "H1'"  1  
ATOM 7265   H H3     . U A 1 226 ? 82.252  130.280 117.302 1.00 0.00 ? 247 U A H3     1  
ATOM 7266   H H5     . U A 1 226 ? 79.984  126.898 117.294 1.00 0.00 ? 247 U A H5     1  
ATOM 7267   H H6     . U A 1 226 ? 80.084  126.885 115.013 1.00 0.00 ? 247 U A H6     1  
ATOM 7268   P P      . A A 1 227 ? 83.343  124.784 111.111 1.00 0.00 ? 248 A A P      1  
ATOM 7269   O OP1    . A A 1 227 ? 83.316  124.441 109.667 1.00 0.00 ? 248 A A OP1    1  
ATOM 7270   O OP2    . A A 1 227 ? 82.458  124.045 112.053 1.00 0.00 ? 248 A A OP2    1  
ATOM 7271   O "O5'"  . A A 1 227 ? 84.844  124.656 111.622 1.00 0.00 ? 248 A A "O5'"  1  
ATOM 7272   C "C5'"  . A A 1 227 ? 85.946  124.738 110.719 1.00 0.00 ? 248 A A "C5'"  1  
ATOM 7273   C "C4'"  . A A 1 227 ? 86.840  125.884 111.114 1.00 0.00 ? 248 A A "C4'"  1  
ATOM 7274   O "O4'"  . A A 1 227 ? 86.499  126.332 112.447 1.00 0.00 ? 248 A A "O4'"  1  
ATOM 7275   C "C3'"  . A A 1 227 ? 88.332  125.603 111.192 1.00 0.00 ? 248 A A "C3'"  1  
ATOM 7276   O "O3'"  . A A 1 227 ? 88.797  125.671 109.840 1.00 0.00 ? 248 A A "O3'"  1  
ATOM 7277   C "C2'"  . A A 1 227 ? 88.823  126.747 112.081 1.00 0.00 ? 248 A A "C2'"  1  
ATOM 7278   O "O2'"  . A A 1 227 ? 88.960  127.949 111.377 1.00 0.00 ? 248 A A "O2'"  1  
ATOM 7279   C "C1'"  . A A 1 227 ? 87.627  126.971 113.009 1.00 0.00 ? 248 A A "C1'"  1  
ATOM 7280   N N9     . A A 1 227 ? 87.803  126.545 114.394 1.00 0.00 ? 248 A A N9     1  
ATOM 7281   C C8     . A A 1 227 ? 87.502  125.348 114.980 1.00 0.00 ? 248 A A C8     1  
ATOM 7282   N N7     . A A 1 227 ? 87.752  125.316 116.266 1.00 0.00 ? 248 A A N7     1  
ATOM 7283   C C5     . A A 1 227 ? 88.261  126.578 116.539 1.00 0.00 ? 248 A A C5     1  
ATOM 7284   C C6     . A A 1 227 ? 88.696  127.190 117.730 1.00 0.00 ? 248 A A C6     1  
ATOM 7285   N N6     . A A 1 227 ? 88.689  126.584 118.917 1.00 0.00 ? 248 A A N6     1  
ATOM 7286   N N1     . A A 1 227 ? 89.139  128.465 117.658 1.00 0.00 ? 248 A A N1     1  
ATOM 7287   C C2     . A A 1 227 ? 89.135  129.073 116.466 1.00 0.00 ? 248 A A C2     1  
ATOM 7288   N N3     . A A 1 227 ? 88.744  128.607 115.283 1.00 0.00 ? 248 A A N3     1  
ATOM 7289   C C4     . A A 1 227 ? 88.310  127.339 115.391 1.00 0.00 ? 248 A A C4     1  
ATOM 7290   H "H5'"  . A A 1 227 ? 85.606  124.877 109.810 1.00 0.00 ? 248 A A "H5'"  1  
ATOM 7291   H "H5''" . A A 1 227 ? 86.448  123.896 110.748 1.00 0.00 ? 248 A A "H5''" 1  
ATOM 7292   H "H4'"  . A A 1 227 ? 86.705  126.624 110.485 1.00 0.00 ? 248 A A "H4'"  1  
ATOM 7293   H "H3'"  . A A 1 227 ? 88.473  124.725 111.604 1.00 0.00 ? 248 A A "H3'"  1  
ATOM 7294   H "H2'"  . A A 1 227 ? 89.654  126.510 112.544 1.00 0.00 ? 248 A A "H2'"  1  
ATOM 7295   H "HO2'" . A A 1 227 ? 89.025  127.750 110.420 1.00 0.00 ? 248 A A "HO2'" 1  
ATOM 7296   H "H1'"  . A A 1 227 ? 87.398  127.923 113.021 1.00 0.00 ? 248 A A "H1'"  1  
ATOM 7297   H H8     . A A 1 227 ? 87.130  124.585 114.489 1.00 0.00 ? 248 A A H8     1  
ATOM 7298   H H61    . A A 1 227 ? 88.999  127.063 119.715 1.00 0.00 ? 248 A A H61    1  
ATOM 7299   H H62    . A A 1 227 ? 88.372  125.659 118.995 1.00 0.00 ? 248 A A H62    1  
ATOM 7300   H H2     . A A 1 227 ? 89.466  129.994 116.466 1.00 0.00 ? 248 A A H2     1  
ATOM 7301   P P      . U A 1 228 ? 90.320  126.069 109.506 1.00 0.00 ? 249 U A P      1  
ATOM 7302   O OP1    . U A 1 228 ? 90.541  125.733 108.072 1.00 0.00 ? 249 U A OP1    1  
ATOM 7303   O OP2    . U A 1 228 ? 91.195  125.458 110.540 1.00 0.00 ? 249 U A OP2    1  
ATOM 7304   O "O5'"  . U A 1 228 ? 90.378  127.659 109.658 1.00 0.00 ? 249 U A "O5'"  1  
ATOM 7305   C "C5'"  . U A 1 228 ? 91.566  128.371 109.313 1.00 0.00 ? 249 U A "C5'"  1  
ATOM 7306   C "C4'"  . U A 1 228 ? 92.182  129.041 110.529 1.00 0.00 ? 249 U A "C4'"  1  
ATOM 7307   O "O4'"  . U A 1 228 ? 91.584  130.343 110.785 1.00 0.00 ? 249 U A "O4'"  1  
ATOM 7308   C "C3'"  . U A 1 228 ? 92.039  128.290 111.839 1.00 0.00 ? 249 U A "C3'"  1  
ATOM 7309   O "O3'"  . U A 1 228 ? 92.884  127.127 111.860 1.00 0.00 ? 249 U A "O3'"  1  
ATOM 7310   C "C2'"  . U A 1 228 ? 92.231  129.400 112.872 1.00 0.00 ? 249 U A "C2'"  1  
ATOM 7311   O "O2'"  . U A 1 228 ? 93.578  129.750 113.107 1.00 0.00 ? 249 U A "O2'"  1  
ATOM 7312   C "C1'"  . U A 1 228 ? 91.526  130.578 112.187 1.00 0.00 ? 249 U A "C1'"  1  
ATOM 7313   N N1     . U A 1 228 ? 90.110  130.726 112.558 1.00 0.00 ? 249 U A N1     1  
ATOM 7314   C C2     . U A 1 228 ? 89.803  131.142 113.839 1.00 0.00 ? 249 U A C2     1  
ATOM 7315   O O2     . U A 1 228 ? 90.651  131.456 114.655 1.00 0.00 ? 249 U A O2     1  
ATOM 7316   N N3     . U A 1 228 ? 88.457  131.188 114.122 1.00 0.00 ? 249 U A N3     1  
ATOM 7317   C C4     . U A 1 228 ? 87.414  130.875 113.267 1.00 0.00 ? 249 U A C4     1  
ATOM 7318   O O4     . U A 1 228 ? 86.262  130.829 113.705 1.00 0.00 ? 249 U A O4     1  
ATOM 7319   C C5     . U A 1 228 ? 87.822  130.497 111.950 1.00 0.00 ? 249 U A C5     1  
ATOM 7320   C C6     . U A 1 228 ? 89.121  130.438 111.651 1.00 0.00 ? 249 U A C6     1  
ATOM 7321   H "H5'"  . U A 1 228 ? 91.345  129.055 108.646 1.00 0.00 ? 249 U A "H5'"  1  
ATOM 7322   H "H5''" . U A 1 228 ? 92.213  127.745 108.928 1.00 0.00 ? 249 U A "H5''" 1  
ATOM 7323   H "H4'"  . U A 1 228 ? 93.138  129.173 110.366 1.00 0.00 ? 249 U A "H4'"  1  
ATOM 7324   H "H3'"  . U A 1 228 ? 91.101  128.029 111.960 1.00 0.00 ? 249 U A "H3'"  1  
ATOM 7325   H "H2'"  . U A 1 228 ? 91.791  129.180 113.720 1.00 0.00 ? 249 U A "H2'"  1  
ATOM 7326   H "HO2'" . U A 1 228 ? 93.610  130.462 113.779 1.00 0.00 ? 249 U A "HO2'" 1  
ATOM 7327   H "H1'"  . U A 1 228 ? 91.995  131.408 112.413 1.00 0.00 ? 249 U A "H1'"  1  
ATOM 7328   H H3     . U A 1 228 ? 88.211  131.471 115.026 1.00 0.00 ? 249 U A H3     1  
ATOM 7329   H H5     . U A 1 228 ? 87.151  130.282 111.268 1.00 0.00 ? 249 U A H5     1  
ATOM 7330   H H6     . U A 1 228 ? 89.370  130.174 110.742 1.00 0.00 ? 249 U A H6     1  
ATOM 7331   P P      . G A 1 229 ? 94.052  127.018 112.950 1.00 0.00 ? 250 G A P      1  
ATOM 7332   O OP1    . G A 1 229 ? 93.570  127.777 114.131 1.00 0.00 ? 250 G A OP1    1  
ATOM 7333   O OP2    . G A 1 229 ? 95.301  127.455 112.249 1.00 0.00 ? 250 G A OP2    1  
ATOM 7334   O "O5'"  . G A 1 229 ? 94.219  125.489 113.379 1.00 0.00 ? 250 G A "O5'"  1  
ATOM 7335   C "C5'"  . G A 1 229 ? 95.339  125.072 114.160 1.00 0.00 ? 250 G A "C5'"  1  
ATOM 7336   C "C4'"  . G A 1 229 ? 94.917  124.829 115.586 1.00 0.00 ? 250 G A "C4'"  1  
ATOM 7337   O "O4'"  . G A 1 229 ? 93.516  125.192 115.704 1.00 0.00 ? 250 G A "O4'"  1  
ATOM 7338   C "C3'"  . G A 1 229 ? 94.913  123.387 116.059 1.00 0.00 ? 250 G A "C3'"  1  
ATOM 7339   O "O3'"  . G A 1 229 ? 96.196  122.981 116.479 1.00 0.00 ? 250 G A "O3'"  1  
ATOM 7340   C "C2'"  . G A 1 229 ? 93.948  123.460 117.231 1.00 0.00 ? 250 G A "C2'"  1  
ATOM 7341   O "O2'"  . G A 1 229 ? 94.489  124.151 118.340 1.00 0.00 ? 250 G A "O2'"  1  
ATOM 7342   C "C1'"  . G A 1 229 ? 92.858  124.321 116.617 1.00 0.00 ? 250 G A "C1'"  1  
ATOM 7343   N N9     . G A 1 229 ? 91.931  123.509 115.850 1.00 0.00 ? 250 G A N9     1  
ATOM 7344   C C8     . G A 1 229 ? 91.765  123.527 114.490 1.00 0.00 ? 250 G A C8     1  
ATOM 7345   N N7     . G A 1 229 ? 90.876  122.675 114.071 1.00 0.00 ? 250 G A N7     1  
ATOM 7346   C C5     . G A 1 229 ? 90.431  122.052 115.232 1.00 0.00 ? 250 G A C5     1  
ATOM 7347   C C6     . G A 1 229 ? 89.480  121.019 115.404 1.00 0.00 ? 250 G A C6     1  
ATOM 7348   O O6     . G A 1 229 ? 88.848  120.414 114.535 1.00 0.00 ? 250 G A O6     1  
ATOM 7349   N N1     . G A 1 229 ? 89.305  120.695 116.754 1.00 0.00 ? 250 G A N1     1  
ATOM 7350   C C2     . G A 1 229 ? 89.979  121.284 117.795 1.00 0.00 ? 250 G A C2     1  
ATOM 7351   N N2     . G A 1 229 ? 89.655  120.845 119.027 1.00 0.00 ? 250 G A N2     1  
ATOM 7352   N N3     . G A 1 229 ? 90.899  122.236 117.639 1.00 0.00 ? 250 G A N3     1  
ATOM 7353   C C4     . G A 1 229 ? 91.066  122.568 116.337 1.00 0.00 ? 250 G A C4     1  
ATOM 7354   H "H5'"  . G A 1 229 ? 96.025  125.770 114.133 1.00 0.00 ? 250 G A "H5'"  1  
ATOM 7355   H "H5''" . G A 1 229 ? 95.705  124.248 113.777 1.00 0.00 ? 250 G A "H5''" 1  
ATOM 7356   H "H4'"  . G A 1 229 ? 95.458  125.394 116.177 1.00 0.00 ? 250 G A "H4'"  1  
ATOM 7357   H "H3'"  . G A 1 229 ? 94.601  122.812 115.330 1.00 0.00 ? 250 G A "H3'"  1  
ATOM 7358   H "H2'"  . G A 1 229 ? 93.633  122.569 117.495 1.00 0.00 ? 250 G A "H2'"  1  
ATOM 7359   H "HO2'" . G A 1 229 ? 95.466  124.168 118.261 1.00 0.00 ? 250 G A "HO2'" 1  
ATOM 7360   H "H1'"  . G A 1 229 ? 92.380  124.799 117.329 1.00 0.00 ? 250 G A "H1'"  1  
ATOM 7361   H H8     . G A 1 229 ? 92.261  124.123 113.893 1.00 0.00 ? 250 G A H8     1  
ATOM 7362   H H1     . G A 1 229 ? 88.652  119.996 116.971 1.00 0.00 ? 250 G A H1     1  
ATOM 7363   H H21    . G A 1 229 ? 88.977  120.145 119.138 1.00 0.00 ? 250 G A H21    1  
ATOM 7364   H H22    . G A 1 229 ? 90.095  121.225 119.815 1.00 0.00 ? 250 G A H22    1  
ATOM 7365   P P      . G A 1 230 ? 96.685  121.483 116.175 1.00 0.00 ? 251 G A P      1  
ATOM 7366   O OP1    . G A 1 230 ? 98.135  121.462 116.492 1.00 0.00 ? 251 G A OP1    1  
ATOM 7367   O OP2    . G A 1 230 ? 96.205  121.132 114.808 1.00 0.00 ? 251 G A OP2    1  
ATOM 7368   O "O5'"  . G A 1 230 ? 95.928  120.572 117.249 1.00 0.00 ? 251 G A "O5'"  1  
ATOM 7369   C "C5'"  . G A 1 230 ? 96.296  120.600 118.637 1.00 0.00 ? 251 G A "C5'"  1  
ATOM 7370   C "C4'"  . G A 1 230 ? 95.550  119.526 119.397 1.00 0.00 ? 251 G A "C4'"  1  
ATOM 7371   O "O4'"  . G A 1 230 ? 94.125  119.816 119.421 1.00 0.00 ? 251 G A "O4'"  1  
ATOM 7372   C "C3'"  . G A 1 230 ? 95.628  118.164 118.747 1.00 0.00 ? 251 G A "C3'"  1  
ATOM 7373   O "O3'"  . G A 1 230 ? 96.813  117.510 119.116 1.00 0.00 ? 251 G A "O3'"  1  
ATOM 7374   C "C2'"  . G A 1 230 ? 94.388  117.473 119.286 1.00 0.00 ? 251 G A "C2'"  1  
ATOM 7375   O "O2'"  . G A 1 230 ? 94.542  116.971 120.602 1.00 0.00 ? 251 G A "O2'"  1  
ATOM 7376   C "C1'"  . G A 1 230 ? 93.382  118.621 119.236 1.00 0.00 ? 251 G A "C1'"  1  
ATOM 7377   N N9     . G A 1 230 ? 92.762  118.695 117.923 1.00 0.00 ? 251 G A N9     1  
ATOM 7378   C C8     . G A 1 230 ? 93.163  119.469 116.872 1.00 0.00 ? 251 G A C8     1  
ATOM 7379   N N7     . G A 1 230 ? 92.444  119.293 115.803 1.00 0.00 ? 251 G A N7     1  
ATOM 7380   C C5     . G A 1 230 ? 91.507  118.347 116.178 1.00 0.00 ? 251 G A C5     1  
ATOM 7381   C C6     . G A 1 230 ? 90.468  117.753 115.435 1.00 0.00 ? 251 G A C6     1  
ATOM 7382   O O6     . G A 1 230 ? 90.166  117.931 114.250 1.00 0.00 ? 251 G A O6     1  
ATOM 7383   N N1     . G A 1 230 ? 89.743  116.859 116.206 1.00 0.00 ? 251 G A N1     1  
ATOM 7384   C C2     . G A 1 230 ? 89.994  116.576 117.516 1.00 0.00 ? 251 G A C2     1  
ATOM 7385   N N2     . G A 1 230 ? 89.169  115.710 118.099 1.00 0.00 ? 251 G A N2     1  
ATOM 7386   N N3     . G A 1 230 ? 90.977  117.108 118.212 1.00 0.00 ? 251 G A N3     1  
ATOM 7387   C C4     . G A 1 230 ? 91.683  117.981 117.487 1.00 0.00 ? 251 G A C4     1  
ATOM 7388   H "H5'"  . G A 1 230 ? 96.077  121.479 119.009 1.00 0.00 ? 251 G A "H5'"  1  
ATOM 7389   H "H5''" . G A 1 230 ? 97.260  120.451 118.715 1.00 0.00 ? 251 G A "H5''" 1  
ATOM 7390   H "H4'"  . G A 1 230 ? 95.878  119.504 120.321 1.00 0.00 ? 251 G A "H4'"  1  
ATOM 7391   H "H3'"  . G A 1 230 ? 95.584  118.268 117.775 1.00 0.00 ? 251 G A "H3'"  1  
ATOM 7392   H "H2'"  . G A 1 230 ? 94.082  116.762 118.685 1.00 0.00 ? 251 G A "H2'"  1  
ATOM 7393   H "HO2'" . G A 1 230 ? 94.130  117.597 121.234 1.00 0.00 ? 251 G A "HO2'" 1  
ATOM 7394   H "H1'"  . G A 1 230 ? 92.701  118.489 119.929 1.00 0.00 ? 251 G A "H1'"  1  
ATOM 7395   H H8     . G A 1 230 ? 93.919  120.091 116.916 1.00 0.00 ? 251 G A H8     1  
ATOM 7396   H H1     . G A 1 230 ? 88.993  116.394 115.776 1.00 0.00 ? 251 G A H1     1  
ATOM 7397   H H21    . G A 1 230 ? 88.435  115.308 117.591 1.00 0.00 ? 251 G A H21    1  
ATOM 7398   H H22    . G A 1 230 ? 89.296  115.471 119.042 1.00 0.00 ? 251 G A H22    1  
ATOM 7399   P P      . A A 1 231 ? 97.389  116.372 118.171 1.00 0.00 ? 252 A A P      1  
ATOM 7400   O OP1    . A A 1 231 ? 98.649  115.929 118.806 1.00 0.00 ? 252 A A OP1    1  
ATOM 7401   O OP2    . A A 1 231 ? 97.399  116.869 116.768 1.00 0.00 ? 252 A A OP2    1  
ATOM 7402   O "O5'"  . A A 1 231 ? 96.292  115.224 118.285 1.00 0.00 ? 252 A A "O5'"  1  
ATOM 7403   C "C5'"  . A A 1 231 ? 95.916  114.689 119.554 1.00 0.00 ? 252 A A "C5'"  1  
ATOM 7404   C "C4'"  . A A 1 231 ? 94.849  113.635 119.381 1.00 0.00 ? 252 A A "C4'"  1  
ATOM 7405   O "O4'"  . A A 1 231 ? 93.635  114.255 118.913 1.00 0.00 ? 252 A A "O4'"  1  
ATOM 7406   C "C3'"  . A A 1 231 ? 95.147  112.559 118.355 1.00 0.00 ? 252 A A "C3'"  1  
ATOM 7407   O "O3'"  . A A 1 231 ? 95.884  111.509 118.959 1.00 0.00 ? 252 A A "O3'"  1  
ATOM 7408   C "C2'"  . A A 1 231 ? 93.761  112.073 117.969 1.00 0.00 ? 252 A A "C2'"  1  
ATOM 7409   O "O2'"  . A A 1 231 ? 93.283  111.104 118.872 1.00 0.00 ? 252 A A "O2'"  1  
ATOM 7410   C "C1'"  . A A 1 231 ? 92.937  113.351 118.088 1.00 0.00 ? 252 A A "C1'"  1  
ATOM 7411   N N9     . A A 1 231 ? 92.722  114.005 116.813 1.00 0.00 ? 252 A A N9     1  
ATOM 7412   C C8     . A A 1 231 ? 93.321  115.139 116.361 1.00 0.00 ? 252 A A C8     1  
ATOM 7413   N N7     . A A 1 231 ? 92.938  115.496 115.166 1.00 0.00 ? 252 A A N7     1  
ATOM 7414   C C5     . A A 1 231 ? 92.026  114.523 114.808 1.00 0.00 ? 252 A A C5     1  
ATOM 7415   C C6     . A A 1 231 ? 91.279  114.326 113.650 1.00 0.00 ? 252 A A C6     1  
ATOM 7416   N N6     . A A 1 231 ? 91.353  115.125 112.588 1.00 0.00 ? 252 A A N6     1  
ATOM 7417   N N1     . A A 1 231 ? 90.450  113.266 113.613 1.00 0.00 ? 252 A A N1     1  
ATOM 7418   C C2     . A A 1 231 ? 90.398  112.464 114.676 1.00 0.00 ? 252 A A C2     1  
ATOM 7419   N N3     . A A 1 231 ? 91.068  112.539 115.822 1.00 0.00 ? 252 A A N3     1  
ATOM 7420   C C4     . A A 1 231 ? 91.877  113.606 115.818 1.00 0.00 ? 252 A A C4     1  
ATOM 7421   H "H5'"  . A A 1 231 ? 95.576  115.414 120.118 1.00 0.00 ? 252 A A "H5'"  1  
ATOM 7422   H "H5''" . A A 1 231 ? 96.704  114.296 119.982 1.00 0.00 ? 252 A A "H5''" 1  
ATOM 7423   H "H4'"  . A A 1 231 ? 94.680  113.211 120.249 1.00 0.00 ? 252 A A "H4'"  1  
ATOM 7424   H "H3'"  . A A 1 231 ? 95.649  112.953 117.612 1.00 0.00 ? 252 A A "H3'"  1  
ATOM 7425   H "H2'"  . A A 1 231 ? 93.739  111.746 117.046 1.00 0.00 ? 252 A A "H2'"  1  
ATOM 7426   H "HO2'" . A A 1 231 ? 92.390  110.816 118.588 1.00 0.00 ? 252 A A "HO2'" 1  
ATOM 7427   H "H1'"  . A A 1 231 ? 92.067  113.142 118.491 1.00 0.00 ? 252 A A "H1'"  1  
ATOM 7428   H H8     . A A 1 231 ? 93.977  115.644 116.887 1.00 0.00 ? 252 A A H8     1  
ATOM 7429   H H61    . A A 1 231 ? 90.807  114.937 111.796 1.00 0.00 ? 252 A A H61    1  
ATOM 7430   H H62    . A A 1 231 ? 91.951  115.900 112.599 1.00 0.00 ? 252 A A H62    1  
ATOM 7431   H H2     . A A 1 231 ? 89.776  111.709 114.603 1.00 0.00 ? 252 A A H2     1  
ATOM 7432   P P      . U A 1 232 ? 96.920  110.667 118.080 1.00 0.00 ? 253 U A P      1  
ATOM 7433   O OP1    . U A 1 232 ? 97.466  109.618 118.969 1.00 0.00 ? 253 U A OP1    1  
ATOM 7434   O OP2    . U A 1 232 ? 97.843  111.651 117.459 1.00 0.00 ? 253 U A OP2    1  
ATOM 7435   O "O5'"  . U A 1 232 ? 96.009  109.978 116.958 1.00 0.00 ? 253 U A "O5'"  1  
ATOM 7436   C "C5'"  . U A 1 232 ? 95.065  108.973 117.314 1.00 0.00 ? 253 U A "C5'"  1  
ATOM 7437   C "C4'"  . U A 1 232 ? 94.078  108.711 116.192 1.00 0.00 ? 253 U A "C4'"  1  
ATOM 7438   O "O4'"  . U A 1 232 ? 93.374  109.929 115.843 1.00 0.00 ? 253 U A "O4'"  1  
ATOM 7439   C "C3'"  . U A 1 232 ? 94.585  108.242 114.839 1.00 0.00 ? 253 U A "C3'"  1  
ATOM 7440   O "O3'"  . U A 1 232 ? 94.839  106.853 114.843 1.00 0.00 ? 253 U A "O3'"  1  
ATOM 7441   C "C2'"  . U A 1 232 ? 93.359  108.477 113.971 1.00 0.00 ? 253 U A "C2'"  1  
ATOM 7442   O "O2'"  . U A 1 232 ? 92.388  107.477 114.124 1.00 0.00 ? 253 U A "O2'"  1  
ATOM 7443   C "C1'"  . U A 1 232 ? 92.792  109.763 114.563 1.00 0.00 ? 253 U A "C1'"  1  
ATOM 7444   N N1     . U A 1 232 ? 93.137  110.895 113.702 1.00 0.00 ? 253 U A N1     1  
ATOM 7445   C C2     . U A 1 232 ? 92.432  111.016 112.523 1.00 0.00 ? 253 U A C2     1  
ATOM 7446   O O2     . U A 1 232 ? 91.535  110.260 112.208 1.00 0.00 ? 253 U A O2     1  
ATOM 7447   N N3     . U A 1 232 ? 92.820  112.051 111.726 1.00 0.00 ? 253 U A N3     1  
ATOM 7448   C C4     . U A 1 232 ? 93.817  112.955 111.980 1.00 0.00 ? 253 U A C4     1  
ATOM 7449   O O4     . U A 1 232 ? 94.152  113.747 111.098 1.00 0.00 ? 253 U A O4     1  
ATOM 7450   C C5     . U A 1 232 ? 94.477  112.775 113.235 1.00 0.00 ? 253 U A C5     1  
ATOM 7451   C C6     . U A 1 232 ? 94.121  111.777 114.032 1.00 0.00 ? 253 U A C6     1  
ATOM 7452   H "H5'"  . U A 1 232 ? 94.572  109.263 118.111 1.00 0.00 ? 253 U A "H5'"  1  
ATOM 7453   H "H5''" . U A 1 232 ? 95.542  108.142 117.520 1.00 0.00 ? 253 U A "H5''" 1  
ATOM 7454   H "H4'"  . U A 1 232 ? 93.422  108.049 116.495 1.00 0.00 ? 253 U A "H4'"  1  
ATOM 7455   H "H3'"  . U A 1 232 ? 95.401  108.732 114.613 1.00 0.00 ? 253 U A "H3'"  1  
ATOM 7456   H "H2'"  . U A 1 232 ? 93.601  108.587 113.029 1.00 0.00 ? 253 U A "H2'"  1  
ATOM 7457   H "HO2'" . U A 1 232 ? 91.625  107.681 113.543 1.00 0.00 ? 253 U A "HO2'" 1  
ATOM 7458   H "H1'"  . U A 1 232 ? 91.817  109.677 114.650 1.00 0.00 ? 253 U A "H1'"  1  
ATOM 7459   H H3     . U A 1 232 ? 92.334  112.155 110.881 1.00 0.00 ? 253 U A H3     1  
ATOM 7460   H H5     . U A 1 232 ? 95.192  113.388 113.508 1.00 0.00 ? 253 U A H5     1  
ATOM 7461   H H6     . U A 1 232 ? 94.593  111.681 114.886 1.00 0.00 ? 253 U A H6     1  
ATOM 7462   P P      . G A 1 233 ? 95.805  106.221 113.734 1.00 0.00 ? 254 G A P      1  
ATOM 7463   O OP1    . G A 1 233 ? 95.705  104.747 113.926 1.00 0.00 ? 254 G A OP1    1  
ATOM 7464   O OP2    . G A 1 233 ? 97.101  106.898 113.884 1.00 0.00 ? 254 G A OP2    1  
ATOM 7465   O "O5'"  . G A 1 233 ? 95.248  106.585 112.293 1.00 0.00 ? 254 G A "O5'"  1  
ATOM 7466   C "C5'"  . G A 1 233 ? 93.975  106.123 111.890 1.00 0.00 ? 254 G A "C5'"  1  
ATOM 7467   C "C4'"  . G A 1 233 ? 93.666  106.607 110.505 1.00 0.00 ? 254 G A "C4'"  1  
ATOM 7468   O "O4'"  . G A 1 233 ? 93.434  108.036 110.532 1.00 0.00 ? 254 G A "O4'"  1  
ATOM 7469   C "C3'"  . G A 1 233 ? 94.798  106.463 109.519 1.00 0.00 ? 254 G A "C3'"  1  
ATOM 7470   O "O3'"  . G A 1 233 ? 94.870  105.161 109.011 1.00 0.00 ? 254 G A "O3'"  1  
ATOM 7471   C "C2'"  . G A 1 233 ? 94.400  107.460 108.457 1.00 0.00 ? 254 G A "C2'"  1  
ATOM 7472   O "O2'"  . G A 1 233 ? 93.369  106.955 107.630 1.00 0.00 ? 254 G A "O2'"  1  
ATOM 7473   C "C1'"  . G A 1 233 ? 93.927  108.616 109.336 1.00 0.00 ? 254 G A "C1'"  1  
ATOM 7474   N N9     . G A 1 233 ? 95.040  109.476 109.708 1.00 0.00 ? 254 G A N9     1  
ATOM 7475   C C8     . G A 1 233 ? 95.973  109.255 110.691 1.00 0.00 ? 254 G A C8     1  
ATOM 7476   N N7     . G A 1 233 ? 96.843  110.223 110.793 1.00 0.00 ? 254 G A N7     1  
ATOM 7477   C C5     . G A 1 233 ? 96.456  111.129 109.820 1.00 0.00 ? 254 G A C5     1  
ATOM 7478   C C6     . G A 1 233 ? 97.000  112.366 109.470 1.00 0.00 ? 254 G A C6     1  
ATOM 7479   O O6     . G A 1 233 ? 97.960  112.940 109.965 1.00 0.00 ? 254 G A O6     1  
ATOM 7480   N N1     . G A 1 233 ? 96.300  112.955 108.431 1.00 0.00 ? 254 G A N1     1  
ATOM 7481   C C2     . G A 1 233 ? 95.208  112.414 107.811 1.00 0.00 ? 254 G A C2     1  
ATOM 7482   N N2     . G A 1 233 ? 94.659  113.139 106.831 1.00 0.00 ? 254 G A N2     1  
ATOM 7483   N N3     . G A 1 233 ? 94.688  111.254 108.131 1.00 0.00 ? 254 G A N3     1  
ATOM 7484   C C4     . G A 1 233 ? 95.355  110.674 109.137 1.00 0.00 ? 254 G A C4     1  
ATOM 7485   H "H5'"  . G A 1 233 ? 93.300  106.457 112.517 1.00 0.00 ? 254 G A "H5'"  1  
ATOM 7486   H "H5''" . G A 1 233 ? 93.970  105.142 111.909 1.00 0.00 ? 254 G A "H5''" 1  
ATOM 7487   H "H4'"  . G A 1 233 ? 92.855  106.157 110.187 1.00 0.00 ? 254 G A "H4'"  1  
ATOM 7488   H "H3'"  . G A 1 233 ? 95.640  106.696 109.961 1.00 0.00 ? 254 G A "H3'"  1  
ATOM 7489   H "H2'"  . G A 1 233 ? 95.173  107.752 107.930 1.00 0.00 ? 254 G A "H2'"  1  
ATOM 7490   H "HO2'" . G A 1 233 ? 93.350  105.978 107.705 1.00 0.00 ? 254 G A "HO2'" 1  
ATOM 7491   H "H1'"  . G A 1 233 ? 93.245  109.133 108.857 1.00 0.00 ? 254 G A "H1'"  1  
ATOM 7492   H H8     . G A 1 233 ? 95.986  108.455 111.259 1.00 0.00 ? 254 G A H8     1  
ATOM 7493   H H1     . G A 1 233 ? 96.614  113.829 108.117 1.00 0.00 ? 254 G A H1     1  
ATOM 7494   H H21    . G A 1 233 ? 95.042  114.007 106.587 1.00 0.00 ? 254 G A H21    1  
ATOM 7495   H H22    . G A 1 233 ? 93.871  112.800 106.355 1.00 0.00 ? 254 G A H22    1  
ATOM 7496   P P      . C A 1 234 ? 96.118  104.263 109.407 1.00 0.00 ? 255 C A P      1  
ATOM 7497   O OP1    . C A 1 234 ? 95.698  103.553 110.651 1.00 0.00 ? 255 C A OP1    1  
ATOM 7498   O OP2    . C A 1 234 ? 97.356  105.084 109.410 1.00 0.00 ? 255 C A OP2    1  
ATOM 7499   O "O5'"  . C A 1 234 ? 96.227  103.265 108.185 1.00 0.00 ? 255 C A "O5'"  1  
ATOM 7500   C "C5'"  . C A 1 234 ? 95.134  102.451 107.875 1.00 0.00 ? 255 C A "C5'"  1  
ATOM 7501   C "C4'"  . C A 1 234 ? 95.073  102.218 106.399 1.00 0.00 ? 255 C A "C4'"  1  
ATOM 7502   O "O4'"  . C A 1 234 ? 95.046  103.493 105.711 1.00 0.00 ? 255 C A "O4'"  1  
ATOM 7503   C "C3'"  . C A 1 234 ? 96.230  101.477 105.737 1.00 0.00 ? 255 C A "C3'"  1  
ATOM 7504   O "O3'"  . C A 1 234 ? 96.174  100.059 106.054 1.00 0.00 ? 255 C A "O3'"  1  
ATOM 7505   C "C2'"  . C A 1 234 ? 95.974  101.841 104.271 1.00 0.00 ? 255 C A "C2'"  1  
ATOM 7506   O "O2'"  . C A 1 234 ? 94.890  101.101 103.711 1.00 0.00 ? 255 C A "O2'"  1  
ATOM 7507   C "C1'"  . C A 1 234 ? 95.538  103.308 104.391 1.00 0.00 ? 255 C A "C1'"  1  
ATOM 7508   N N1     . C A 1 234 ? 96.608  104.286 104.166 1.00 0.00 ? 255 C A N1     1  
ATOM 7509   C C2     . C A 1 234 ? 96.613  105.037 102.965 1.00 0.00 ? 255 C A C2     1  
ATOM 7510   O O2     . C A 1 234 ? 95.803  104.758 102.067 1.00 0.00 ? 255 C A O2     1  
ATOM 7511   N N3     . C A 1 234 ? 97.509  106.038 102.818 1.00 0.00 ? 255 C A N3     1  
ATOM 7512   C C4     . C A 1 234 ? 98.390  106.288 103.786 1.00 0.00 ? 255 C A C4     1  
ATOM 7513   N N4     . C A 1 234 ? 99.202  107.325 103.627 1.00 0.00 ? 255 C A N4     1  
ATOM 7514   C C5     . C A 1 234 ? 98.463  105.491 104.973 1.00 0.00 ? 255 C A C5     1  
ATOM 7515   C C6     . C A 1 234 ? 97.562  104.505 105.118 1.00 0.00 ? 255 C A C6     1  
ATOM 7516   H "H5'"  . C A 1 234 ? 94.312  102.890 108.176 1.00 0.00 ? 255 C A "H5'"  1  
ATOM 7517   H "H5''" . C A 1 234 ? 95.231  101.595 108.342 1.00 0.00 ? 255 C A "H5''" 1  
ATOM 7518   H "H4'"  . C A 1 234 ? 94.251  101.725 106.192 1.00 0.00 ? 255 C A "H4'"  1  
ATOM 7519   H "H3'"  . C A 1 234 ? 97.077  101.862 106.042 1.00 0.00 ? 255 C A "H3'"  1  
ATOM 7520   H "H2'"  . C A 1 234 ? 96.785  101.743 103.729 1.00 0.00 ? 255 C A "H2'"  1  
ATOM 7521   H "HO2'" . C A 1 234 ? 95.119  100.843 102.794 1.00 0.00 ? 255 C A "HO2'" 1  
ATOM 7522   H "H1'"  . C A 1 234 ? 94.822  103.486 103.748 1.00 0.00 ? 255 C A "H1'"  1  
ATOM 7523   H H41    . C A 1 234 ? 99.141  107.875 102.817 1.00 0.00 ? 255 C A H41    1  
ATOM 7524   H H42    . C A 1 234 ? 99.862  107.542 104.317 1.00 0.00 ? 255 C A H42    1  
ATOM 7525   H H5     . C A 1 234 ? 99.145  105.661 105.656 1.00 0.00 ? 255 C A H5     1  
ATOM 7526   H H6     . C A 1 234 ? 97.595  103.950 105.923 1.00 0.00 ? 255 C A H6     1  
ATOM 7527   P P      . A A 1 235 ? 96.517  98.948  104.940 1.00 0.00 ? 256 A A P      1  
ATOM 7528   O OP1    . A A 1 235 ? 95.305  98.821  104.125 1.00 0.00 ? 256 A A OP1    1  
ATOM 7529   O OP2    . A A 1 235 ? 97.075  97.762  105.603 1.00 0.00 ? 256 A A OP2    1  
ATOM 7530   O "O5'"  . A A 1 235 ? 97.661  99.605  104.053 1.00 0.00 ? 256 A A "O5'"  1  
ATOM 7531   C "C5'"  . A A 1 235 ? 98.941  98.998  103.925 1.00 0.00 ? 256 A A "C5'"  1  
ATOM 7532   C "C4'"  . A A 1 235 ? 99.078  98.420  102.549 1.00 0.00 ? 256 A A "C4'"  1  
ATOM 7533   O "O4'"  . A A 1 235 ? 97.888  97.635  102.376 1.00 0.00 ? 256 A A "O4'"  1  
ATOM 7534   C "C3'"  . A A 1 235 ? 99.061  99.423  101.400 1.00 0.00 ? 256 A A "C3'"  1  
ATOM 7535   O "O3'"  . A A 1 235 ? 100.370 99.673  100.851 1.00 0.00 ? 256 A A "O3'"  1  
ATOM 7536   C "C2'"  . A A 1 235 ? 98.365  98.650  100.282 1.00 0.00 ? 256 A A "C2'"  1  
ATOM 7537   O "O2'"  . A A 1 235 ? 99.313  97.983  99.491  1.00 0.00 ? 256 A A "O2'"  1  
ATOM 7538   C "C1'"  . A A 1 235 ? 97.577  97.570  101.019 1.00 0.00 ? 256 A A "C1'"  1  
ATOM 7539   N N9     . A A 1 235 ? 96.128  97.560  100.873 1.00 0.00 ? 256 A A N9     1  
ATOM 7540   C C8     . A A 1 235 ? 95.374  97.859  99.771  1.00 0.00 ? 256 A A C8     1  
ATOM 7541   N N7     . A A 1 235 ? 94.082  97.666  99.942  1.00 0.00 ? 256 A A N7     1  
ATOM 7542   C C5     . A A 1 235 ? 93.981  97.228  101.262 1.00 0.00 ? 256 A A C5     1  
ATOM 7543   C C6     . A A 1 235 ? 92.872  96.837  102.073 1.00 0.00 ? 256 A A C6     1  
ATOM 7544   N N6     . A A 1 235 ? 91.599  96.826  101.659 1.00 0.00 ? 256 A A N6     1  
ATOM 7545   N N1     . A A 1 235 ? 93.131  96.452  103.347 1.00 0.00 ? 256 A A N1     1  
ATOM 7546   C C2     . A A 1 235 ? 94.402  96.456  103.772 1.00 0.00 ? 256 A A C2     1  
ATOM 7547   N N3     . A A 1 235 ? 95.517  96.798  103.114 1.00 0.00 ? 256 A A N3     1  
ATOM 7548   C C4     . A A 1 235 ? 95.233  97.175  101.850 1.00 0.00 ? 256 A A C4     1  
ATOM 7549   H "H5'"  . A A 1 235 ? 99.029  98.292  104.598 1.00 0.00 ? 256 A A "H5'"  1  
ATOM 7550   H "H5''" . A A 1 235 ? 99.634  99.673  104.079 1.00 0.00 ? 256 A A "H5''" 1  
ATOM 7551   H "H4'"  . A A 1 235 ? 99.884  97.863  102.518 1.00 0.00 ? 256 A A "H4'"  1  
ATOM 7552   H "H3'"  . A A 1 235 ? 98.679  100.268 101.716 1.00 0.00 ? 256 A A "H3'"  1  
ATOM 7553   H "H2'"  . A A 1 235 ? 97.781  99.232  99.753  1.00 0.00 ? 256 A A "H2'"  1  
ATOM 7554   H "HO2'" . A A 1 235 ? 100.189 98.404  99.622  1.00 0.00 ? 256 A A "HO2'" 1  
ATOM 7555   H "H1'"  . A A 1 235 ? 97.888  96.685  100.730 1.00 0.00 ? 256 A A "H1'"  1  
ATOM 7556   H H8     . A A 1 235 ? 95.760  98.173  98.925  1.00 0.00 ? 256 A A H8     1  
ATOM 7557   H H61    . A A 1 235 ? 90.886  96.547  102.270 1.00 0.00 ? 256 A A H61    1  
ATOM 7558   H H62    . A A 1 235 ? 91.379  97.100  100.743 1.00 0.00 ? 256 A A H62    1  
ATOM 7559   H H2     . A A 1 235 ? 94.534  96.165  104.698 1.00 0.00 ? 256 A A H2     1  
ATOM 7560   P P      . G A 1 236 ? 101.323 100.764 101.536 1.00 0.00 ? 257 G A P      1  
ATOM 7561   O OP1    . G A 1 236 ? 102.672 100.721 100.915 1.00 0.00 ? 257 G A OP1    1  
ATOM 7562   O OP2    . G A 1 236 ? 101.197 100.570 102.989 1.00 0.00 ? 257 G A OP2    1  
ATOM 7563   O "O5'"  . G A 1 236 ? 100.762 102.221 101.215 1.00 0.00 ? 257 G A "O5'"  1  
ATOM 7564   C "C5'"  . G A 1 236 ? 100.372 102.625 99.894  1.00 0.00 ? 257 G A "C5'"  1  
ATOM 7565   C "C4'"  . G A 1 236 ? 100.738 104.088 99.660  1.00 0.00 ? 257 G A "C4'"  1  
ATOM 7566   O "O4'"  . G A 1 236 ? 100.121 104.954 100.652 1.00 0.00 ? 257 G A "O4'"  1  
ATOM 7567   C "C3'"  . G A 1 236 ? 102.233 104.380 99.716  1.00 0.00 ? 257 G A "C3'"  1  
ATOM 7568   O "O3'"  . G A 1 236 ? 102.838 104.147 98.439  1.00 0.00 ? 257 G A "O3'"  1  
ATOM 7569   C "C2'"  . G A 1 236 ? 102.251 105.840 100.152 1.00 0.00 ? 257 G A "C2'"  1  
ATOM 7570   O "O2'"  . G A 1 236 ? 101.964 106.701 99.068  1.00 0.00 ? 257 G A "O2'"  1  
ATOM 7571   C "C1'"  . G A 1 236 ? 101.076 105.879 101.131 1.00 0.00 ? 257 G A "C1'"  1  
ATOM 7572   N N9     . G A 1 236 ? 101.365 105.448 102.484 1.00 0.00 ? 257 G A N9     1  
ATOM 7573   C C8     . G A 1 236 ? 101.119 104.194 102.961 1.00 0.00 ? 257 G A C8     1  
ATOM 7574   N N7     . G A 1 236 ? 101.359 104.077 104.232 1.00 0.00 ? 257 G A N7     1  
ATOM 7575   C C5     . G A 1 236 ? 101.817 105.323 104.611 1.00 0.00 ? 257 G A C5     1  
ATOM 7576   C C6     . G A 1 236 ? 102.217 105.783 105.869 1.00 0.00 ? 257 G A C6     1  
ATOM 7577   O O6     . G A 1 236 ? 102.227 105.168 106.938 1.00 0.00 ? 257 G A O6     1  
ATOM 7578   N N1     . G A 1 236 ? 102.631 107.103 105.819 1.00 0.00 ? 257 G A N1     1  
ATOM 7579   C C2     . G A 1 236 ? 102.636 107.874 104.694 1.00 0.00 ? 257 G A C2     1  
ATOM 7580   N N2     . G A 1 236 ? 103.066 109.119 104.851 1.00 0.00 ? 257 G A N2     1  
ATOM 7581   N N3     . G A 1 236 ? 102.250 107.454 103.504 1.00 0.00 ? 257 G A N3     1  
ATOM 7582   C C4     . G A 1 236 ? 101.856 106.174 103.536 1.00 0.00 ? 257 G A C4     1  
ATOM 7583   H "H5'"  . G A 1 236 ? 99.404  102.506 99.795  1.00 0.00 ? 257 G A "H5'"  1  
ATOM 7584   H "H5''" . G A 1 236 ? 100.832 102.060 99.238  1.00 0.00 ? 257 G A "H5''" 1  
ATOM 7585   H "H4'"  . G A 1 236 ? 100.413 104.358 98.775  1.00 0.00 ? 257 G A "H4'"  1  
ATOM 7586   H "H3'"  . G A 1 236 ? 102.646 103.813 100.398 1.00 0.00 ? 257 G A "H3'"  1  
ATOM 7587   H "H2'"  . G A 1 236 ? 103.099 106.075 100.587 1.00 0.00 ? 257 G A "H2'"  1  
ATOM 7588   H "HO2'" . G A 1 236 ? 102.128 106.224 98.227  1.00 0.00 ? 257 G A "HO2'" 1  
ATOM 7589   H "H1'"  . G A 1 236 ? 100.723 106.791 101.181 1.00 0.00 ? 257 G A "H1'"  1  
ATOM 7590   H H8     . G A 1 236 ? 100.776 103.463 102.408 1.00 0.00 ? 257 G A H8     1  
ATOM 7591   H H1     . G A 1 236 ? 102.942 107.513 106.652 1.00 0.00 ? 257 G A H1     1  
ATOM 7592   H H21    . G A 1 236 ? 103.354 109.435 105.733 1.00 0.00 ? 257 G A H21    1  
ATOM 7593   H H22    . G A 1 236 ? 103.098 109.727 104.081 1.00 0.00 ? 257 G A H22    1  
ATOM 7594   P P      . U A 1 237 ? 104.282 103.452 98.355  1.00 0.00 ? 258 U A P      1  
ATOM 7595   O OP1    . U A 1 237 ? 104.895 103.904 97.079  1.00 0.00 ? 258 U A OP1    1  
ATOM 7596   O OP2    . U A 1 237 ? 104.160 101.995 98.642  1.00 0.00 ? 258 U A OP2    1  
ATOM 7597   O "O5'"  . U A 1 237 ? 105.088 104.167 99.524  1.00 0.00 ? 258 U A "O5'"  1  
ATOM 7598   C "C5'"  . U A 1 237 ? 105.471 105.523 99.373  1.00 0.00 ? 258 U A "C5'"  1  
ATOM 7599   C "C4'"  . U A 1 237 ? 106.236 106.005 100.577 1.00 0.00 ? 258 U A "C4'"  1  
ATOM 7600   O "O4'"  . U A 1 237 ? 105.350 106.333 101.677 1.00 0.00 ? 258 U A "O4'"  1  
ATOM 7601   C "C3'"  . U A 1 237 ? 107.221 105.047 101.205 1.00 0.00 ? 258 U A "C3'"  1  
ATOM 7602   O "O3'"  . U A 1 237 ? 108.241 104.708 100.253 1.00 0.00 ? 258 U A "O3'"  1  
ATOM 7603   C "C2'"  . U A 1 237 ? 107.482 105.737 102.546 1.00 0.00 ? 258 U A "C2'"  1  
ATOM 7604   O "O2'"  . U A 1 237 ? 108.265 106.906 102.525 1.00 0.00 ? 258 U A "O2'"  1  
ATOM 7605   C "C1'"  . U A 1 237 ? 106.068 106.216 102.899 1.00 0.00 ? 258 U A "C1'"  1  
ATOM 7606   N N1     . U A 1 237 ? 105.375 105.260 103.766 1.00 0.00 ? 258 U A N1     1  
ATOM 7607   C C2     . U A 1 237 ? 105.394 105.506 105.125 1.00 0.00 ? 258 U A C2     1  
ATOM 7608   O O2     . U A 1 237 ? 105.859 106.525 105.605 1.00 0.00 ? 258 U A O2     1  
ATOM 7609   N N3     . U A 1 237 ? 104.836 104.519 105.896 1.00 0.00 ? 258 U A N3     1  
ATOM 7610   C C4     . U A 1 237 ? 104.254 103.352 105.444 1.00 0.00 ? 258 U A C4     1  
ATOM 7611   O O4     . U A 1 237 ? 103.925 102.488 106.253 1.00 0.00 ? 258 U A O4     1  
ATOM 7612   C C5     . U A 1 237 ? 104.218 103.213 104.023 1.00 0.00 ? 258 U A C5     1  
ATOM 7613   C C6     . U A 1 237 ? 104.766 104.147 103.254 1.00 0.00 ? 258 U A C6     1  
ATOM 7614   H "H5'"  . U A 1 237 ? 104.667 106.072 99.259  1.00 0.00 ? 258 U A "H5'"  1  
ATOM 7615   H "H5''" . U A 1 237 ? 106.035 105.611 98.575  1.00 0.00 ? 258 U A "H5''" 1  
ATOM 7616   H "H4'"  . U A 1 237 ? 106.730 106.816 100.334 1.00 0.00 ? 258 U A "H4'"  1  
ATOM 7617   H "H3'"  . U A 1 237 ? 106.746 104.246 101.506 1.00 0.00 ? 258 U A "H3'"  1  
ATOM 7618   H "H2'"  . U A 1 237 ? 107.873 105.119 103.198 1.00 0.00 ? 258 U A "H2'"  1  
ATOM 7619   H "HO2'" . U A 1 237 ? 108.787 106.927 101.695 1.00 0.00 ? 258 U A "HO2'" 1  
ATOM 7620   H "H1'"  . U A 1 237 ? 106.124 107.089 103.344 1.00 0.00 ? 258 U A "H1'"  1  
ATOM 7621   H H3     . U A 1 237 ? 104.856 104.659 106.865 1.00 0.00 ? 258 U A H3     1  
ATOM 7622   H H5     . U A 1 237 ? 103.789 102.432 103.614 1.00 0.00 ? 258 U A H5     1  
ATOM 7623   H H6     . U A 1 237 ? 104.725 104.022 102.282 1.00 0.00 ? 258 U A H6     1  
ATOM 7624   P P      . U A 1 238 ? 109.298 103.542 100.579 1.00 0.00 ? 259 U A P      1  
ATOM 7625   O OP1    . U A 1 238 ? 109.288 103.309 102.045 1.00 0.00 ? 259 U A OP1    1  
ATOM 7626   O OP2    . U A 1 238 ? 110.574 103.876 99.897  1.00 0.00 ? 259 U A OP2    1  
ATOM 7627   O "O5'"  . U A 1 238 ? 108.682 102.255 99.870  1.00 0.00 ? 259 U A "O5'"  1  
ATOM 7628   C "C5'"  . U A 1 238 ? 108.523 101.037 100.582 1.00 0.00 ? 259 U A "C5'"  1  
ATOM 7629   C "C4'"  . U A 1 238 ? 107.722 100.031 99.792  1.00 0.00 ? 259 U A "C4'"  1  
ATOM 7630   O "O4'"  . U A 1 238 ? 106.663 100.723 99.084  1.00 0.00 ? 259 U A "O4'"  1  
ATOM 7631   C "C3'"  . U A 1 238 ? 108.466 99.302  98.685  1.00 0.00 ? 259 U A "C3'"  1  
ATOM 7632   O "O3'"  . U A 1 238 ? 109.223 98.202  99.158  1.00 0.00 ? 259 U A "O3'"  1  
ATOM 7633   C "C2'"  . U A 1 238 ? 107.308 98.837  97.807  1.00 0.00 ? 259 U A "C2'"  1  
ATOM 7634   O "O2'"  . U A 1 238 ? 106.673 97.692  98.357  1.00 0.00 ? 259 U A "O2'"  1  
ATOM 7635   C "C1'"  . U A 1 238 ? 106.351 100.024 97.900  1.00 0.00 ? 259 U A "C1'"  1  
ATOM 7636   N N1     . U A 1 238 ? 106.487 100.948 96.748  1.00 0.00 ? 259 U A N1     1  
ATOM 7637   C C2     . U A 1 238 ? 105.888 100.569 95.561  1.00 0.00 ? 259 U A C2     1  
ATOM 7638   O O2     . U A 1 238 ? 105.266 99.529  95.432  1.00 0.00 ? 259 U A O2     1  
ATOM 7639   N N3     . U A 1 238 ? 106.040 101.455 94.522  1.00 0.00 ? 259 U A N3     1  
ATOM 7640   C C4     . U A 1 238 ? 106.716 102.656 94.546  1.00 0.00 ? 259 U A C4     1  
ATOM 7641   O O4     . U A 1 238 ? 106.764 103.343 93.524  1.00 0.00 ? 259 U A O4     1  
ATOM 7642   C C5     . U A 1 238 ? 107.310 102.983 95.806  1.00 0.00 ? 259 U A C5     1  
ATOM 7643   C C6     . U A 1 238 ? 107.177 102.139 96.834  1.00 0.00 ? 259 U A C6     1  
ATOM 7644   H "H5'"  . U A 1 238 ? 108.062 101.219 101.427 1.00 0.00 ? 259 U A "H5'"  1  
ATOM 7645   H "H5''" . U A 1 238 ? 109.407 100.660 100.773 1.00 0.00 ? 259 U A "H5''" 1  
ATOM 7646   H "H4'"  . U A 1 238 ? 107.327 99.385  100.413 1.00 0.00 ? 259 U A "H4'"  1  
ATOM 7647   H "H3'"  . U A 1 238 ? 109.017 99.943  98.190  1.00 0.00 ? 259 U A "H3'"  1  
ATOM 7648   H "H2'"  . U A 1 238 ? 107.596 98.683  96.884  1.00 0.00 ? 259 U A "H2'"  1  
ATOM 7649   H "HO2'" . U A 1 238 ? 105.936 97.423  97.769  1.00 0.00 ? 259 U A "HO2'" 1  
ATOM 7650   H "H1'"  . U A 1 238 ? 105.429 99.693  97.943  1.00 0.00 ? 259 U A "H1'"  1  
ATOM 7651   H H3     . U A 1 238 ? 105.622 101.205 93.672  1.00 0.00 ? 259 U A H3     1  
ATOM 7652   H H5     . U A 1 238 ? 107.810 103.819 95.914  1.00 0.00 ? 259 U A H5     1  
ATOM 7653   H H6     . U A 1 238 ? 107.594 102.385 97.685  1.00 0.00 ? 259 U A H6     1  
ATOM 7654   P P      . C A 1 239 ? 110.531 97.716  98.360  1.00 0.00 ? 260 C A P      1  
ATOM 7655   O OP1    . C A 1 239 ? 110.838 96.327  98.785  1.00 0.00 ? 260 C A OP1    1  
ATOM 7656   O OP2    . C A 1 239 ? 111.568 98.770  98.491  1.00 0.00 ? 260 C A OP2    1  
ATOM 7657   O "O5'"  . C A 1 239 ? 110.061 97.672  96.839  1.00 0.00 ? 260 C A "O5'"  1  
ATOM 7658   C "C5'"  . C A 1 239 ? 109.367 96.547  96.321  1.00 0.00 ? 260 C A "C5'"  1  
ATOM 7659   C "C4'"  . C A 1 239 ? 108.965 96.754  94.881  1.00 0.00 ? 260 C A "C4'"  1  
ATOM 7660   O "O4'"  . C A 1 239 ? 108.584 98.156  94.734  1.00 0.00 ? 260 C A "O4'"  1  
ATOM 7661   C "C3'"  . C A 1 239 ? 110.042 96.489  93.840  1.00 0.00 ? 260 C A "C3'"  1  
ATOM 7662   O "O3'"  . C A 1 239 ? 109.525 95.956  92.634  1.00 0.00 ? 260 C A "O3'"  1  
ATOM 7663   C "C2'"  . C A 1 239 ? 110.611 97.871  93.582  1.00 0.00 ? 260 C A "C2'"  1  
ATOM 7664   O "O2'"  . C A 1 239 ? 111.112 97.981  92.258  1.00 0.00 ? 260 C A "O2'"  1  
ATOM 7665   C "C1'"  . C A 1 239 ? 109.368 98.744  93.715  1.00 0.00 ? 260 C A "C1'"  1  
ATOM 7666   N N1     . C A 1 239 ? 109.697 100.136 94.111  1.00 0.00 ? 260 C A N1     1  
ATOM 7667   C C2     . C A 1 239 ? 109.535 101.153 93.163  1.00 0.00 ? 260 C A C2     1  
ATOM 7668   O O2     . C A 1 239 ? 109.125 100.864 92.028  1.00 0.00 ? 260 C A O2     1  
ATOM 7669   N N3     . C A 1 239 ? 109.828 102.431 93.499  1.00 0.00 ? 260 C A N3     1  
ATOM 7670   C C4     . C A 1 239 ? 110.267 102.715 94.725  1.00 0.00 ? 260 C A C4     1  
ATOM 7671   N N4     . C A 1 239 ? 110.543 103.990 95.012  1.00 0.00 ? 260 C A N4     1  
ATOM 7672   C C5     . C A 1 239 ? 110.443 101.704 95.712  1.00 0.00 ? 260 C A C5     1  
ATOM 7673   C C6     . C A 1 239 ? 110.149 100.444 95.368  1.00 0.00 ? 260 C A C6     1  
ATOM 7674   H "H5'"  . C A 1 239 ? 108.563 96.393  96.859  1.00 0.00 ? 260 C A "H5'"  1  
ATOM 7675   H "H5''" . C A 1 239 ? 109.947 95.759  96.381  1.00 0.00 ? 260 C A "H5''" 1  
ATOM 7676   H "H4'"  . C A 1 239 ? 108.202 96.174  94.681  1.00 0.00 ? 260 C A "H4'"  1  
ATOM 7677   H "H3'"  . C A 1 239 ? 110.741 95.927  94.234  1.00 0.00 ? 260 C A "H3'"  1  
ATOM 7678   H "H2'"  . C A 1 239 ? 111.289 98.109  94.247  1.00 0.00 ? 260 C A "H2'"  1  
ATOM 7679   H "HO2'" . C A 1 239 ? 110.445 98.432  91.700  1.00 0.00 ? 260 C A "HO2'" 1  
ATOM 7680   H "H1'"  . C A 1 239 ? 108.888 98.753  92.861  1.00 0.00 ? 260 C A "H1'"  1  
ATOM 7681   H H41    . C A 1 239 ? 110.421 104.683 94.330  1.00 0.00 ? 260 C A H41    1  
ATOM 7682   H H42    . C A 1 239 ? 110.867 104.231 95.905  1.00 0.00 ? 260 C A H42    1  
ATOM 7683   H H5     . C A 1 239 ? 110.765 101.923 96.611  1.00 0.00 ? 260 C A H5     1  
ATOM 7684   H H6     . C A 1 239 ? 110.263 99.734  96.033  1.00 0.00 ? 260 C A H6     1  
ATOM 7685   P P      . A A 1 240 ? 110.506 95.205  91.612  1.00 0.00 ? 261 A A P      1  
ATOM 7686   O OP1    . A A 1 240 ? 109.700 94.596  90.525  1.00 0.00 ? 261 A A OP1    1  
ATOM 7687   O OP2    . A A 1 240 ? 111.305 94.334  92.510  1.00 0.00 ? 261 A A OP2    1  
ATOM 7688   O "O5'"  . A A 1 240 ? 111.492 96.272  90.957  1.00 0.00 ? 261 A A "O5'"  1  
ATOM 7689   C "C5'"  . A A 1 240 ? 112.039 96.061  89.664  1.00 0.00 ? 261 A A "C5'"  1  
ATOM 7690   C "C4'"  . A A 1 240 ? 113.525 95.806  89.726  1.00 0.00 ? 261 A A "C4'"  1  
ATOM 7691   O "O4'"  . A A 1 240 ? 113.982 95.469  88.402  1.00 0.00 ? 261 A A "O4'"  1  
ATOM 7692   C "C3'"  . A A 1 240 ? 114.387 96.985  90.151  1.00 0.00 ? 261 A A "C3'"  1  
ATOM 7693   O "O3'"  . A A 1 240 ? 114.561 97.067  91.555  1.00 0.00 ? 261 A A "O3'"  1  
ATOM 7694   C "C2'"  . A A 1 240 ? 115.716 96.704  89.471  1.00 0.00 ? 261 A A "C2'"  1  
ATOM 7695   O "O2'"  . A A 1 240 ? 116.486 95.769  90.213  1.00 0.00 ? 261 A A "O2'"  1  
ATOM 7696   C "C1'"  . A A 1 240 ? 115.268 96.047  88.167  1.00 0.00 ? 261 A A "C1'"  1  
ATOM 7697   N N9     . A A 1 240 ? 115.155 97.021  87.065  1.00 0.00 ? 261 A A N9     1  
ATOM 7698   C C8     . A A 1 240 ? 114.011 97.562  86.530  1.00 0.00 ? 261 A A C8     1  
ATOM 7699   N N7     . A A 1 240 ? 114.233 98.405  85.552  1.00 0.00 ? 261 A A N7     1  
ATOM 7700   C C5     . A A 1 240 ? 115.616 98.422  85.433  1.00 0.00 ? 261 A A C5     1  
ATOM 7701   C C6     . A A 1 240 ? 116.484 99.118  84.574  1.00 0.00 ? 261 A A C6     1  
ATOM 7702   N N6     . A A 1 240 ? 116.070 99.970  83.634  1.00 0.00 ? 261 A A N6     1  
ATOM 7703   N N1     . A A 1 240 ? 117.811 98.909  84.718  1.00 0.00 ? 261 A A N1     1  
ATOM 7704   C C2     . A A 1 240 ? 118.228 98.055  85.661  1.00 0.00 ? 261 A A C2     1  
ATOM 7705   N N3     . A A 1 240 ? 117.510 97.342  86.527  1.00 0.00 ? 261 A A N3     1  
ATOM 7706   C C4     . A A 1 240 ? 116.196 97.574  86.359  1.00 0.00 ? 261 A A C4     1  
ATOM 7707   H "H5'"  . A A 1 240 ? 111.874 96.855  89.113  1.00 0.00 ? 261 A A "H5'"  1  
ATOM 7708   H "H5''" . A A 1 240 ? 111.599 95.289  89.252  1.00 0.00 ? 261 A A "H5''" 1  
ATOM 7709   H "H4'"  . A A 1 240 ? 113.707 95.049  90.321  1.00 0.00 ? 261 A A "H4'"  1  
ATOM 7710   H "H3'"  . A A 1 240 ? 114.000 97.825  89.826  1.00 0.00 ? 261 A A "H3'"  1  
ATOM 7711   H "H2'"  . A A 1 240 ? 116.214 97.530  89.300  1.00 0.00 ? 261 A A "H2'"  1  
ATOM 7712   H "HO2'" . A A 1 240 ? 117.333 95.612  89.746  1.00 0.00 ? 261 A A "HO2'" 1  
ATOM 7713   H "H1'"  . A A 1 240 ? 115.907 95.346  87.919  1.00 0.00 ? 261 A A "H1'"  1  
ATOM 7714   H H8     . A A 1 240 ? 113.112 97.338  86.851  1.00 0.00 ? 261 A A H8     1  
ATOM 7715   H H61    . A A 1 240 ? 116.724 100.427 83.064  1.00 0.00 ? 261 A A H61    1  
ATOM 7716   H H62    . A A 1 240 ? 115.112 100.137 83.512  1.00 0.00 ? 261 A A H62    1  
ATOM 7717   H H2     . A A 1 240 ? 119.199 97.938  85.724  1.00 0.00 ? 261 A A H2     1  
ATOM 7718   P P      . C A 1 241 ? 114.326 98.461  92.318  1.00 0.00 ? 262 C A P      1  
ATOM 7719   O OP1    . C A 1 241 ? 114.128 98.167  93.761  1.00 0.00 ? 262 C A OP1    1  
ATOM 7720   O OP2    . C A 1 241 ? 113.291 99.224  91.577  1.00 0.00 ? 262 C A OP2    1  
ATOM 7721   O "O5'"  . C A 1 241 ? 115.714 99.227  92.159  1.00 0.00 ? 262 C A "O5'"  1  
ATOM 7722   C "C5'"  . C A 1 241 ? 116.533 99.495  93.286  1.00 0.00 ? 262 C A "C5'"  1  
ATOM 7723   C "C4'"  . C A 1 241 ? 117.129 100.880 93.226  1.00 0.00 ? 262 C A "C4'"  1  
ATOM 7724   O "O4'"  . C A 1 241 ? 118.009 100.953 92.080  1.00 0.00 ? 262 C A "O4'"  1  
ATOM 7725   C "C3'"  . C A 1 241 ? 116.148 102.023 93.014  1.00 0.00 ? 262 C A "C3'"  1  
ATOM 7726   O "O3'"  . C A 1 241 ? 115.539 102.458 94.218  1.00 0.00 ? 262 C A "O3'"  1  
ATOM 7727   C "C2'"  . C A 1 241 ? 117.012 103.091 92.372  1.00 0.00 ? 262 C A "C2'"  1  
ATOM 7728   O "O2'"  . C A 1 241 ? 117.796 103.771 93.341  1.00 0.00 ? 262 C A "O2'"  1  
ATOM 7729   C "C1'"  . C A 1 241 ? 117.943 102.257 91.480  1.00 0.00 ? 262 C A "C1'"  1  
ATOM 7730   N N1     . C A 1 241 ? 117.427 102.123 90.095  1.00 0.00 ? 262 C A N1     1  
ATOM 7731   C C2     . C A 1 241 ? 117.561 103.214 89.228  1.00 0.00 ? 262 C A C2     1  
ATOM 7732   O O2     . C A 1 241 ? 118.103 104.252 89.639  1.00 0.00 ? 262 C A O2     1  
ATOM 7733   N N3     . C A 1 241 ? 117.100 103.118 87.960  1.00 0.00 ? 262 C A N3     1  
ATOM 7734   C C4     . C A 1 241 ? 116.521 101.992 87.543  1.00 0.00 ? 262 C A C4     1  
ATOM 7735   N N4     . C A 1 241 ? 116.080 101.943 86.283  1.00 0.00 ? 262 C A N4     1  
ATOM 7736   C C5     . C A 1 241 ? 116.369 100.866 88.400  1.00 0.00 ? 262 C A C5     1  
ATOM 7737   C C6     . C A 1 241 ? 116.831 100.972 89.652  1.00 0.00 ? 262 C A C6     1  
ATOM 7738   H "H5'"  . C A 1 241 ? 117.258 98.836  93.318  1.00 0.00 ? 262 C A "H5'"  1  
ATOM 7739   H "H5''" . C A 1 241 ? 115.993 99.415  94.100  1.00 0.00 ? 262 C A "H5''" 1  
ATOM 7740   H "H4'"  . C A 1 241 ? 117.651 101.056 94.036  1.00 0.00 ? 262 C A "H4'"  1  
ATOM 7741   H "H3'"  . C A 1 241 ? 115.452 101.743 92.384  1.00 0.00 ? 262 C A "H3'"  1  
ATOM 7742   H "H2'"  . C A 1 241 ? 116.475 103.713 91.839  1.00 0.00 ? 262 C A "H2'"  1  
ATOM 7743   H "HO2'" . C A 1 241 ? 117.399 104.649 93.514  1.00 0.00 ? 262 C A "HO2'" 1  
ATOM 7744   H "H1'"  . C A 1 241 ? 118.829 102.675 91.459  1.00 0.00 ? 262 C A "H1'"  1  
ATOM 7745   H H41    . C A 1 241 ? 116.186 102.721 85.696  1.00 0.00 ? 262 C A H41    1  
ATOM 7746   H H42    . C A 1 241 ? 115.651 101.130 85.947  1.00 0.00 ? 262 C A H42    1  
ATOM 7747   H H5     . C A 1 241 ? 115.943 100.042 88.084  1.00 0.00 ? 262 C A H5     1  
ATOM 7748   H H6     . C A 1 241 ? 116.736 100.208 90.257  1.00 0.00 ? 262 C A H6     1  
ATOM 7749   P P      . A A 1 242 ? 113.961 102.762 94.260  1.00 0.00 ? 263 A A P      1  
ATOM 7750   O OP1    . A A 1 242 ? 113.242 101.464 94.296  1.00 0.00 ? 263 A A OP1    1  
ATOM 7751   O OP2    . A A 1 242 ? 113.653 103.743 93.190  1.00 0.00 ? 263 A A OP2    1  
ATOM 7752   O "O5'"  . A A 1 242 ? 113.746 103.483 95.665  1.00 0.00 ? 263 A A "O5'"  1  
ATOM 7753   C "C5'"  . A A 1 242 ? 113.692 104.899 95.757  1.00 0.00 ? 263 A A "C5'"  1  
ATOM 7754   C "C4'"  . A A 1 242 ? 114.676 105.426 96.771  1.00 0.00 ? 263 A A "C4'"  1  
ATOM 7755   O "O4'"  . A A 1 242 ? 114.160 105.132 98.108  1.00 0.00 ? 263 A A "O4'"  1  
ATOM 7756   C "C3'"  . A A 1 242 ? 116.074 104.828 96.719  1.00 0.00 ? 263 A A "C3'"  1  
ATOM 7757   O "O3'"  . A A 1 242 ? 117.078 105.727 97.155  1.00 0.00 ? 263 A A "O3'"  1  
ATOM 7758   C "C2'"  . A A 1 242 ? 115.964 103.680 97.717  1.00 0.00 ? 263 A A "C2'"  1  
ATOM 7759   O "O2'"  . A A 1 242 ? 117.235 103.342 98.255  1.00 0.00 ? 263 A A "O2'"  1  
ATOM 7760   C "C1'"  . A A 1 242 ? 115.112 104.355 98.788  1.00 0.00 ? 263 A A "C1'"  1  
ATOM 7761   N N9     . A A 1 242 ? 114.361 103.379 99.600  1.00 0.00 ? 263 A A N9     1  
ATOM 7762   C C8     . A A 1 242 ? 114.077 102.070 99.296  1.00 0.00 ? 263 A A C8     1  
ATOM 7763   N N7     . A A 1 242 ? 113.388 101.450 100.221 1.00 0.00 ? 263 A A N7     1  
ATOM 7764   C C5     . A A 1 242 ? 113.204 102.415 101.202 1.00 0.00 ? 263 A A C5     1  
ATOM 7765   C C6     . A A 1 242 ? 112.548 102.389 102.446 1.00 0.00 ? 263 A A C6     1  
ATOM 7766   N N6     . A A 1 242 ? 111.932 101.311 102.935 1.00 0.00 ? 263 A A N6     1  
ATOM 7767   N N1     . A A 1 242 ? 112.550 103.522 103.181 1.00 0.00 ? 263 A A N1     1  
ATOM 7768   C C2     . A A 1 242 ? 113.169 104.604 102.691 1.00 0.00 ? 263 A A C2     1  
ATOM 7769   N N3     . A A 1 242 ? 113.818 104.752 101.538 1.00 0.00 ? 263 A A N3     1  
ATOM 7770   C C4     . A A 1 242 ? 113.799 103.607 100.832 1.00 0.00 ? 263 A A C4     1  
ATOM 7771   H "H5'"  . A A 1 242 ? 112.787 105.169 96.019  1.00 0.00 ? 263 A A "H5'"  1  
ATOM 7772   H "H5''" . A A 1 242 ? 113.899 105.285 94.880  1.00 0.00 ? 263 A A "H5''" 1  
ATOM 7773   H "H4'"  . A A 1 242 ? 114.745 106.400 96.679  1.00 0.00 ? 263 A A "H4'"  1  
ATOM 7774   H "H3'"  . A A 1 242 ? 116.301 104.503 95.822  1.00 0.00 ? 263 A A "H3'"  1  
ATOM 7775   H "H2'"  . A A 1 242 ? 115.518 102.901 97.322  1.00 0.00 ? 263 A A "H2'"  1  
ATOM 7776   H "HO2'" . A A 1 242 ? 117.126 102.604 98.890  1.00 0.00 ? 263 A A "HO2'" 1  
ATOM 7777   H "H1'"  . A A 1 242 ? 115.688 104.892 99.373  1.00 0.00 ? 263 A A "H1'"  1  
ATOM 7778   H H8     . A A 1 242 ? 114.364 101.639 98.463  1.00 0.00 ? 263 A A H8     1  
ATOM 7779   H H61    . A A 1 242 ? 111.491 101.353 103.810 1.00 0.00 ? 263 A A H61    1  
ATOM 7780   H H62    . A A 1 242 ? 111.918 100.478 102.420 1.00 0.00 ? 263 A A H62    1  
ATOM 7781   H H2     . A A 1 242 ? 113.141 105.400 103.263 1.00 0.00 ? 263 A A H2     1  
ATOM 7782   P P      . G A 1 243 ? 117.809 106.696 96.102  1.00 0.00 ? 264 G A P      1  
ATOM 7783   O OP1    . G A 1 243 ? 119.259 106.373 96.108  1.00 0.00 ? 264 G A OP1    1  
ATOM 7784   O OP2    . G A 1 243 ? 117.365 108.087 96.373  1.00 0.00 ? 264 G A OP2    1  
ATOM 7785   O "O5'"  . G A 1 243 ? 117.213 106.254 94.694  1.00 0.00 ? 264 G A "O5'"  1  
ATOM 7786   C "C5'"  . G A 1 243 ? 116.039 106.850 94.154  1.00 0.00 ? 264 G A "C5'"  1  
ATOM 7787   C "C4'"  . G A 1 243 ? 116.426 107.980 93.235  1.00 0.00 ? 264 G A "C4'"  1  
ATOM 7788   O "O4'"  . G A 1 243 ? 116.856 107.399 91.987  1.00 0.00 ? 264 G A "O4'"  1  
ATOM 7789   C "C3'"  . G A 1 243 ? 115.317 108.934 92.832  1.00 0.00 ? 264 G A "C3'"  1  
ATOM 7790   O "O3'"  . G A 1 243 ? 115.176 109.982 93.782  1.00 0.00 ? 264 G A "O3'"  1  
ATOM 7791   C "C2'"  . G A 1 243 ? 115.805 109.486 91.498  1.00 0.00 ? 264 G A "C2'"  1  
ATOM 7792   O "O2'"  . G A 1 243 ? 116.660 110.587 91.687  1.00 0.00 ? 264 G A "O2'"  1  
ATOM 7793   C "C1'"  . G A 1 243 ? 116.613 108.317 90.937  1.00 0.00 ? 264 G A "C1'"  1  
ATOM 7794   N N9     . G A 1 243 ? 115.997 107.600 89.834  1.00 0.00 ? 264 G A N9     1  
ATOM 7795   C C8     . G A 1 243 ? 115.741 106.258 89.783  1.00 0.00 ? 264 G A C8     1  
ATOM 7796   N N7     . G A 1 243 ? 115.207 105.880 88.657  1.00 0.00 ? 264 G A N7     1  
ATOM 7797   C C5     . G A 1 243 ? 115.104 107.045 87.924  1.00 0.00 ? 264 G A C5     1  
ATOM 7798   C C6     . G A 1 243 ? 114.613 107.243 86.635  1.00 0.00 ? 264 G A C6     1  
ATOM 7799   O O6     . G A 1 243 ? 114.156 106.408 85.861  1.00 0.00 ? 264 G A O6     1  
ATOM 7800   N N1     . G A 1 243 ? 114.694 108.569 86.257  1.00 0.00 ? 264 G A N1     1  
ATOM 7801   C C2     . G A 1 243 ? 115.198 109.571 87.038  1.00 0.00 ? 264 G A C2     1  
ATOM 7802   N N2     . G A 1 243 ? 115.210 110.790 86.491  1.00 0.00 ? 264 G A N2     1  
ATOM 7803   N N3     . G A 1 243 ? 115.654 109.397 88.265  1.00 0.00 ? 264 G A N3     1  
ATOM 7804   C C4     . G A 1 243 ? 115.581 108.116 88.638  1.00 0.00 ? 264 G A C4     1  
ATOM 7805   H "H5'"  . G A 1 243 ? 115.483 107.189 94.886  1.00 0.00 ? 264 G A "H5'"  1  
ATOM 7806   H "H5''" . G A 1 243 ? 115.535 106.172 93.657  1.00 0.00 ? 264 G A "H5''" 1  
ATOM 7807   H "H4'"  . G A 1 243 ? 117.164 108.481 93.642  1.00 0.00 ? 264 G A "H4'"  1  
ATOM 7808   H "H3'"  . G A 1 243 ? 114.478 108.437 92.753  1.00 0.00 ? 264 G A "H3'"  1  
ATOM 7809   H "H2'"  . G A 1 243 ? 115.055 109.705 90.903  1.00 0.00 ? 264 G A "H2'"  1  
ATOM 7810   H "HO2'" . G A 1 243 ? 116.954 110.917 90.811  1.00 0.00 ? 264 G A "HO2'" 1  
ATOM 7811   H "H1'"  . G A 1 243 ? 117.486 108.641 90.631  1.00 0.00 ? 264 G A "H1'"  1  
ATOM 7812   H H8     . G A 1 243 ? 115.940 105.641 90.518  1.00 0.00 ? 264 G A H8     1  
ATOM 7813   H H1     . G A 1 243 ? 114.366 108.809 85.365  1.00 0.00 ? 264 G A H1     1  
ATOM 7814   H H21    . G A 1 243 ? 114.873 110.925 85.580  1.00 0.00 ? 264 G A H21    1  
ATOM 7815   H H22    . G A 1 243 ? 115.558 111.552 86.999  1.00 0.00 ? 264 G A H22    1  
ATOM 7816   P P      . A A 1 244 ? 113.919 110.976 93.675  1.00 0.00 ? 265 A A P      1  
ATOM 7817   O OP1    . A A 1 244 ? 114.012 111.953 94.784  1.00 0.00 ? 265 A A OP1    1  
ATOM 7818   O OP2    . A A 1 244 ? 112.686 110.174 93.501  1.00 0.00 ? 265 A A OP2    1  
ATOM 7819   O "O5'"  . A A 1 244 ? 114.140 111.734 92.297  1.00 0.00 ? 265 A A "O5'"  1  
ATOM 7820   C "C5'"  . A A 1 244 ? 115.073 112.793 92.195  1.00 0.00 ? 265 A A "C5'"  1  
ATOM 7821   C "C4'"  . A A 1 244 ? 114.681 113.698 91.070  1.00 0.00 ? 265 A A "C4'"  1  
ATOM 7822   O "O4'"  . A A 1 244 ? 114.988 113.079 89.803  1.00 0.00 ? 265 A A "O4'"  1  
ATOM 7823   C "C3'"  . A A 1 244 ? 113.197 113.982 91.038  1.00 0.00 ? 265 A A "C3'"  1  
ATOM 7824   O "O3'"  . A A 1 244 ? 112.977 115.123 91.857  1.00 0.00 ? 265 A A "O3'"  1  
ATOM 7825   C "C2'"  . A A 1 244 ? 112.957 114.286 89.567  1.00 0.00 ? 265 A A "C2'"  1  
ATOM 7826   O "O2'"  . A A 1 244 ? 113.287 115.615 89.245  1.00 0.00 ? 265 A A "O2'"  1  
ATOM 7827   C "C1'"  . A A 1 244 ? 113.959 113.357 88.882  1.00 0.00 ? 265 A A "C1'"  1  
ATOM 7828   N N9     . A A 1 244 ? 113.378 112.087 88.488  1.00 0.00 ? 265 A A N9     1  
ATOM 7829   C C8     . A A 1 244 ? 113.410 110.904 89.178  1.00 0.00 ? 265 A A C8     1  
ATOM 7830   N N7     . A A 1 244 ? 112.840 109.904 88.543  1.00 0.00 ? 265 A A N7     1  
ATOM 7831   C C5     . A A 1 244 ? 112.388 110.476 87.365  1.00 0.00 ? 265 A A C5     1  
ATOM 7832   C C6     . A A 1 244 ? 111.708 109.943 86.256  1.00 0.00 ? 265 A A C6     1  
ATOM 7833   N N6     . A A 1 244 ? 111.345 108.661 86.154  1.00 0.00 ? 265 A A N6     1  
ATOM 7834   N N1     . A A 1 244 ? 111.403 110.784 85.249  1.00 0.00 ? 265 A A N1     1  
ATOM 7835   C C2     . A A 1 244 ? 111.766 112.070 85.355  1.00 0.00 ? 265 A A C2     1  
ATOM 7836   N N3     . A A 1 244 ? 112.414 112.690 86.343  1.00 0.00 ? 265 A A N3     1  
ATOM 7837   C C4     . A A 1 244 ? 112.701 111.825 87.324  1.00 0.00 ? 265 A A C4     1  
ATOM 7838   H "H5'"  . A A 1 244 ? 115.964 112.420 92.030  1.00 0.00 ? 265 A A "H5'"  1  
ATOM 7839   H "H5''" . A A 1 244 ? 115.085 113.291 93.038  1.00 0.00 ? 265 A A "H5''" 1  
ATOM 7840   H "H4'"  . A A 1 244 ? 115.189 114.534 91.143  1.00 0.00 ? 265 A A "H4'"  1  
ATOM 7841   H "H3'"  . A A 1 244 ? 112.712 113.194 91.363  1.00 0.00 ? 265 A A "H3'"  1  
ATOM 7842   H "H2'"  . A A 1 244 ? 112.039 114.072 89.299  1.00 0.00 ? 265 A A "H2'"  1  
ATOM 7843   H "HO2'" . A A 1 244 ? 113.118 115.764 88.291  1.00 0.00 ? 265 A A "HO2'" 1  
ATOM 7844   H "H1'"  . A A 1 244 ? 114.326 113.801 88.089  1.00 0.00 ? 265 A A "H1'"  1  
ATOM 7845   H H8     . A A 1 244 ? 113.830 110.809 90.059  1.00 0.00 ? 265 A A H8     1  
ATOM 7846   H H61    . A A 1 244 ? 110.869 108.349 85.357  1.00 0.00 ? 265 A A H61    1  
ATOM 7847   H H62    . A A 1 244 ? 111.557 108.032 86.875  1.00 0.00 ? 265 A A H62    1  
ATOM 7848   H H2     . A A 1 244 ? 111.521 112.638 84.593  1.00 0.00 ? 265 A A H2     1  
ATOM 7849   P P      . C A 1 245 ? 111.503 115.747 92.001  1.00 0.00 ? 266 C A P      1  
ATOM 7850   O OP1    . C A 1 245 ? 111.700 117.207 92.223  1.00 0.00 ? 266 C A OP1    1  
ATOM 7851   O OP2    . C A 1 245 ? 110.745 114.947 92.998  1.00 0.00 ? 266 C A OP2    1  
ATOM 7852   O "O5'"  . C A 1 245 ? 110.814 115.550 90.573  1.00 0.00 ? 266 C A "O5'"  1  
ATOM 7853   C "C5'"  . C A 1 245 ? 110.711 116.638 89.652  1.00 0.00 ? 266 C A "C5'"  1  
ATOM 7854   C "C4'"  . C A 1 245 ? 109.779 116.290 88.513  1.00 0.00 ? 266 C A "C4'"  1  
ATOM 7855   O "O4'"  . C A 1 245 ? 110.221 115.071 87.869  1.00 0.00 ? 266 C A "O4'"  1  
ATOM 7856   C "C3'"  . C A 1 245 ? 108.350 115.968 88.895  1.00 0.00 ? 266 C A "C3'"  1  
ATOM 7857   O "O3'"  . C A 1 245 ? 107.602 117.156 89.057  1.00 0.00 ? 266 C A "O3'"  1  
ATOM 7858   C "C2'"  . C A 1 245 ? 107.842 115.166 87.699  1.00 0.00 ? 266 C A "C2'"  1  
ATOM 7859   O "O2'"  . C A 1 245 ? 107.297 115.950 86.660  1.00 0.00 ? 266 C A "O2'"  1  
ATOM 7860   C "C1'"  . C A 1 245 ? 109.116 114.472 87.220  1.00 0.00 ? 266 C A "C1'"  1  
ATOM 7861   N N1     . C A 1 245 ? 109.141 113.023 87.448  1.00 0.00 ? 266 C A N1     1  
ATOM 7862   C C2     . C A 1 245 ? 108.669 112.203 86.432  1.00 0.00 ? 266 C A C2     1  
ATOM 7863   O O2     . C A 1 245 ? 108.227 112.727 85.402  1.00 0.00 ? 266 C A O2     1  
ATOM 7864   N N3     . C A 1 245 ? 108.710 110.868 86.585  1.00 0.00 ? 266 C A N3     1  
ATOM 7865   C C4     . C A 1 245 ? 109.192 110.343 87.704  1.00 0.00 ? 266 C A C4     1  
ATOM 7866   N N4     . C A 1 245 ? 109.243 109.008 87.774  1.00 0.00 ? 266 C A N4     1  
ATOM 7867   C C5     . C A 1 245 ? 109.656 111.158 88.782  1.00 0.00 ? 266 C A C5     1  
ATOM 7868   C C6     . C A 1 245 ? 109.611 112.484 88.613  1.00 0.00 ? 266 C A C6     1  
ATOM 7869   H "H5'"  . C A 1 245 ? 111.602 116.842 89.296  1.00 0.00 ? 266 C A "H5'"  1  
ATOM 7870   H "H5''" . C A 1 245 ? 110.370 117.426 90.127  1.00 0.00 ? 266 C A "H5''" 1  
ATOM 7871   H "H4'"  . C A 1 245 ? 109.796 117.019 87.858  1.00 0.00 ? 266 C A "H4'"  1  
ATOM 7872   H "H3'"  . C A 1 245 ? 108.347 115.447 89.726  1.00 0.00 ? 266 C A "H3'"  1  
ATOM 7873   H "H2'"  . C A 1 245 ? 107.196 114.484 87.974  1.00 0.00 ? 266 C A "H2'"  1  
ATOM 7874   H "HO2'" . C A 1 245 ? 106.502 115.502 86.304  1.00 0.00 ? 266 C A "HO2'" 1  
ATOM 7875   H "H1'"  . C A 1 245 ? 109.228 114.634 86.260  1.00 0.00 ? 266 C A "H1'"  1  
ATOM 7876   H H41    . C A 1 245 ? 108.933 108.465 87.018  1.00 0.00 ? 266 C A H41    1  
ATOM 7877   H H42    . C A 1 245 ? 109.591 108.574 88.580  1.00 0.00 ? 266 C A H42    1  
ATOM 7878   H H5     . C A 1 245 ? 109.994 110.760 89.611  1.00 0.00 ? 266 C A H5     1  
ATOM 7879   H H6     . C A 1 245 ? 109.924 113.064 89.337  1.00 0.00 ? 266 C A H6     1  
ATOM 7880   P P      . U A 1 246 ? 106.125 117.061 89.655  1.00 0.00 ? 267 U A P      1  
ATOM 7881   O OP1    . U A 1 246 ? 105.561 118.437 89.719  1.00 0.00 ? 267 U A OP1    1  
ATOM 7882   O OP2    . U A 1 246 ? 106.216 116.240 90.895  1.00 0.00 ? 267 U A OP2    1  
ATOM 7883   O "O5'"  . U A 1 246 ? 105.292 116.316 88.522  1.00 0.00 ? 267 U A "O5'"  1  
ATOM 7884   C "C5'"  . U A 1 246 ? 104.645 117.110 87.543  1.00 0.00 ? 267 U A "C5'"  1  
ATOM 7885   C "C4'"  . U A 1 246 ? 103.560 116.353 86.835  1.00 0.00 ? 267 U A "C4'"  1  
ATOM 7886   O "O4'"  . U A 1 246 ? 104.125 115.451 85.852  1.00 0.00 ? 267 U A "O4'"  1  
ATOM 7887   C "C3'"  . U A 1 246 ? 102.614 115.458 87.612  1.00 0.00 ? 267 U A "C3'"  1  
ATOM 7888   O "O3'"  . U A 1 246 ? 101.748 116.157 88.513  1.00 0.00 ? 267 U A "O3'"  1  
ATOM 7889   C "C2'"  . U A 1 246 ? 101.979 114.699 86.464  1.00 0.00 ? 267 U A "C2'"  1  
ATOM 7890   O "O2'"  . U A 1 246 ? 101.153 115.522 85.660  1.00 0.00 ? 267 U A "O2'"  1  
ATOM 7891   C "C1'"  . U A 1 246 ? 103.228 114.374 85.643  1.00 0.00 ? 267 U A "C1'"  1  
ATOM 7892   N N1     . U A 1 246 ? 103.865 113.145 86.134  1.00 0.00 ? 267 U A N1     1  
ATOM 7893   C C2     . U A 1 246 ? 103.353 111.944 85.683  1.00 0.00 ? 267 U A C2     1  
ATOM 7894   O O2     . U A 1 246 ? 102.410 111.880 84.921  1.00 0.00 ? 267 U A O2     1  
ATOM 7895   N N3     . U A 1 246 ? 103.983 110.824 86.159  1.00 0.00 ? 267 U A N3     1  
ATOM 7896   C C4     . U A 1 246 ? 105.062 110.784 87.014  1.00 0.00 ? 267 U A C4     1  
ATOM 7897   O O4     . U A 1 246 ? 105.635 109.713 87.204  1.00 0.00 ? 267 U A O4     1  
ATOM 7898   C C5     . U A 1 246 ? 105.522 112.069 87.454  1.00 0.00 ? 267 U A C5     1  
ATOM 7899   C C6     . U A 1 246 ? 104.927 113.179 87.006  1.00 0.00 ? 267 U A C6     1  
ATOM 7900   H "H5'"  . U A 1 246 ? 105.307 117.406 86.885  1.00 0.00 ? 267 U A "H5'"  1  
ATOM 7901   H "H5''" . U A 1 246 ? 104.251 117.894 87.978  1.00 0.00 ? 267 U A "H5''" 1  
ATOM 7902   H "H4'"  . U A 1 246 ? 102.979 116.993 86.371  1.00 0.00 ? 267 U A "H4'"  1  
ATOM 7903   H "H3'"  . U A 1 246 ? 103.135 114.807 88.125  1.00 0.00 ? 267 U A "H3'"  1  
ATOM 7904   H "H2'"  . U A 1 246 ? 101.487 113.914 86.782  1.00 0.00 ? 267 U A "H2'"  1  
ATOM 7905   H "HO2'" . U A 1 246 ? 100.771 114.982 84.938  1.00 0.00 ? 267 U A "HO2'" 1  
ATOM 7906   H "H1'"  . U A 1 246 ? 102.977 114.272 84.702  1.00 0.00 ? 267 U A "H1'"  1  
ATOM 7907   H H3     . U A 1 246 ? 103.628 109.963 85.860  1.00 0.00 ? 267 U A H3     1  
ATOM 7908   H H5     . U A 1 246 ? 106.272 112.135 88.083  1.00 0.00 ? 267 U A H5     1  
ATOM 7909   H H6     . U A 1 246 ? 105.264 114.041 87.326  1.00 0.00 ? 267 U A H6     1  
ATOM 7910   P P      . A A 1 247 ? 100.262 116.620 88.084  1.00 0.00 ? 268 A A P      1  
ATOM 7911   O OP1    . A A 1 247 ? 100.409 117.675 87.060  1.00 0.00 ? 268 A A OP1    1  
ATOM 7912   O OP2    . A A 1 247 ? 99.590  116.935 89.379  1.00 0.00 ? 268 A A OP2    1  
ATOM 7913   O "O5'"  . A A 1 247 ? 99.526  115.370 87.427  1.00 0.00 ? 268 A A "O5'"  1  
ATOM 7914   C "C5'"  . A A 1 247 ? 98.467  115.579 86.496  1.00 0.00 ? 268 A A "C5'"  1  
ATOM 7915   C "C4'"  . A A 1 247 ? 97.875  114.254 86.054  1.00 0.00 ? 268 A A "C4'"  1  
ATOM 7916   O "O4'"  . A A 1 247 ? 98.968  113.342 85.780  1.00 0.00 ? 268 A A "O4'"  1  
ATOM 7917   C "C3'"  . A A 1 247 ? 96.999  113.498 87.048  1.00 0.00 ? 268 A A "C3'"  1  
ATOM 7918   O "O3'"  . A A 1 247 ? 95.654  113.930 86.881  1.00 0.00 ? 268 A A "O3'"  1  
ATOM 7919   C "C2'"  . A A 1 247 ? 97.120  112.069 86.538  1.00 0.00 ? 268 A A "C2'"  1  
ATOM 7920   O "O2'"  . A A 1 247 ? 96.286  111.848 85.418  1.00 0.00 ? 268 A A "O2'"  1  
ATOM 7921   C "C1'"  . A A 1 247 ? 98.576  112.024 86.084  1.00 0.00 ? 268 A A "C1'"  1  
ATOM 7922   N N9     . A A 1 247 ? 99.521  111.499 87.060  1.00 0.00 ? 268 A A N9     1  
ATOM 7923   C C8     . A A 1 247 ? 100.195 112.166 88.045  1.00 0.00 ? 268 A A C8     1  
ATOM 7924   N N7     . A A 1 247 ? 101.020 111.410 88.725  1.00 0.00 ? 268 A A N7     1  
ATOM 7925   C C5     . A A 1 247 ? 100.865 110.159 88.156  1.00 0.00 ? 268 A A C5     1  
ATOM 7926   C C6     . A A 1 247 ? 101.464 108.918 88.423  1.00 0.00 ? 268 A A C6     1  
ATOM 7927   N N6     . A A 1 247 ? 102.380 108.729 89.359  1.00 0.00 ? 268 A A N6     1  
ATOM 7928   N N1     . A A 1 247 ? 101.081 107.861 87.681  1.00 0.00 ? 268 A A N1     1  
ATOM 7929   C C2     . A A 1 247 ? 100.160 108.058 86.726  1.00 0.00 ? 268 A A C2     1  
ATOM 7930   N N3     . A A 1 247 ? 99.531  109.179 86.372  1.00 0.00 ? 268 A A N3     1  
ATOM 7931   C C4     . A A 1 247 ? 99.935  110.201 87.139  1.00 0.00 ? 268 A A C4     1  
ATOM 7932   H "H5'"  . A A 1 247 ? 98.816  116.058 85.717  1.00 0.00 ? 268 A A "H5'"  1  
ATOM 7933   H "H5''" . A A 1 247 ? 97.771  116.123 86.920  1.00 0.00 ? 268 A A "H5''" 1  
ATOM 7934   H "H4'"  . A A 1 247 ? 97.352  114.398 85.239  1.00 0.00 ? 268 A A "H4'"  1  
ATOM 7935   H "H3'"  . A A 1 247 ? 97.323  113.671 87.958  1.00 0.00 ? 268 A A "H3'"  1  
ATOM 7936   H "H2'"  . A A 1 247 ? 96.948  111.418 87.250  1.00 0.00 ? 268 A A "H2'"  1  
ATOM 7937   H "HO2'" . A A 1 247 ? 95.588  112.535 85.401  1.00 0.00 ? 268 A A "HO2'" 1  
ATOM 7938   H "H1'"  . A A 1 247 ? 98.649  111.476 85.275  1.00 0.00 ? 268 A A "H1'"  1  
ATOM 7939   H H8     . A A 1 247 ? 100.080 113.125 88.220  1.00 0.00 ? 268 A A H8     1  
ATOM 7940   H H61    . A A 1 247 ? 102.765 107.837 89.497  1.00 0.00 ? 268 A A H61    1  
ATOM 7941   H H62    . A A 1 247 ? 102.679 109.480 89.914  1.00 0.00 ? 268 A A H62    1  
ATOM 7942   H H2     . A A 1 247 ? 99.913  107.258 86.216  1.00 0.00 ? 268 A A H2     1  
ATOM 7943   P P      . A A 1 248 ? 94.558  113.619 88.014  1.00 0.00 ? 269 A A P      1  
ATOM 7944   O OP1    . A A 1 248 ? 93.605  114.756 88.058  1.00 0.00 ? 269 A A OP1    1  
ATOM 7945   O OP2    . A A 1 248 ? 95.275  113.214 89.249  1.00 0.00 ? 269 A A OP2    1  
ATOM 7946   O "O5'"  . A A 1 248 ? 93.780  112.344 87.457  1.00 0.00 ? 269 A A "O5'"  1  
ATOM 7947   C "C5'"  . A A 1 248 ? 93.340  111.318 88.334  1.00 0.00 ? 269 A A "C5'"  1  
ATOM 7948   C "C4'"  . A A 1 248 ? 93.946  109.985 87.975  1.00 0.00 ? 269 A A "C4'"  1  
ATOM 7949   O "O4'"  . A A 1 248 ? 95.371  110.149 87.776  1.00 0.00 ? 269 A A "O4'"  1  
ATOM 7950   C "C3'"  . A A 1 248 ? 93.840  108.897 89.034  1.00 0.00 ? 269 A A "C3'"  1  
ATOM 7951   O "O3'"  . A A 1 248 ? 92.596  108.218 89.008  1.00 0.00 ? 269 A A "O3'"  1  
ATOM 7952   C "C2'"  . A A 1 248 ? 95.006  107.992 88.645  1.00 0.00 ? 269 A A "C2'"  1  
ATOM 7953   O "O2'"  . A A 1 248 ? 94.680  107.186 87.522  1.00 0.00 ? 269 A A "O2'"  1  
ATOM 7954   C "C1'"  . A A 1 248 ? 96.057  109.016 88.232  1.00 0.00 ? 269 A A "C1'"  1  
ATOM 7955   N N9     . A A 1 248 ? 96.932  109.399 89.356  1.00 0.00 ? 269 A A N9     1  
ATOM 7956   C C8     . A A 1 248 ? 96.961  110.593 90.035  1.00 0.00 ? 269 A A C8     1  
ATOM 7957   N N7     . A A 1 248 ? 97.854  110.635 90.993  1.00 0.00 ? 269 A A N7     1  
ATOM 7958   C C5     . A A 1 248 ? 98.455  109.384 90.943  1.00 0.00 ? 269 A A C5     1  
ATOM 7959   C C6     . A A 1 248 ? 99.484  108.797 91.700  1.00 0.00 ? 269 A A C6     1  
ATOM 7960   N N6     . A A 1 248 ? 100.115 109.419 92.699  1.00 0.00 ? 269 A A N6     1  
ATOM 7961   N N1     . A A 1 248 ? 99.847  107.533 91.393  1.00 0.00 ? 269 A A N1     1  
ATOM 7962   C C2     . A A 1 248 ? 99.214  106.909 90.392  1.00 0.00 ? 269 A A C2     1  
ATOM 7963   N N3     . A A 1 248 ? 98.234  107.355 89.609  1.00 0.00 ? 269 A A N3     1  
ATOM 7964   C C4     . A A 1 248 ? 97.897  108.614 89.940  1.00 0.00 ? 269 A A C4     1  
ATOM 7965   H "H5'"  . A A 1 248 ? 92.363  111.250 88.281  1.00 0.00 ? 269 A A "H5'"  1  
ATOM 7966   H "H5''" . A A 1 248 ? 93.594  111.549 89.251  1.00 0.00 ? 269 A A "H5''" 1  
ATOM 7967   H "H4'"  . A A 1 248 ? 93.538  109.664 87.144  1.00 0.00 ? 269 A A "H4'"  1  
ATOM 7968   H "H3'"  . A A 1 248 ? 94.007  109.290 89.916  1.00 0.00 ? 269 A A "H3'"  1  
ATOM 7969   H "H2'"  . A A 1 248 ? 95.310  107.452 89.405  1.00 0.00 ? 269 A A "H2'"  1  
ATOM 7970   H "HO2'" . A A 1 248 ? 95.008  106.276 87.678  1.00 0.00 ? 269 A A "HO2'" 1  
ATOM 7971   H "H1'"  . A A 1 248 ? 96.603  108.649 87.504  1.00 0.00 ? 269 A A "H1'"  1  
ATOM 7972   H H8     . A A 1 248 ? 96.368  111.344 89.822  1.00 0.00 ? 269 A A H8     1  
ATOM 7973   H H61    . A A 1 248 ? 100.826 108.957 93.192  1.00 0.00 ? 269 A A H61    1  
ATOM 7974   H H62    . A A 1 248 ? 99.869  110.336 92.939  1.00 0.00 ? 269 A A H62    1  
ATOM 7975   H H2     . A A 1 248 ? 99.514  105.994 90.210  1.00 0.00 ? 269 A A H2     1  
ATOM 7976   P P      . A A 1 249 ? 92.375  106.935 89.941  1.00 0.00 ? 270 A A P      1  
ATOM 7977   O OP1    . A A 1 249 ? 90.926  106.622 90.000  1.00 0.00 ? 270 A A OP1    1  
ATOM 7978   O OP2    . A A 1 249 ? 93.098  107.308 91.183  1.00 0.00 ? 270 A A OP2    1  
ATOM 7979   O "O5'"  . A A 1 249 ? 93.124  105.687 89.292  1.00 0.00 ? 270 A A "O5'"  1  
ATOM 7980   C "C5'"  . A A 1 249 ? 92.709  105.157 88.042  1.00 0.00 ? 270 A A "C5'"  1  
ATOM 7981   C "C4'"  . A A 1 249 ? 93.581  104.005 87.611  1.00 0.00 ? 270 A A "C4'"  1  
ATOM 7982   O "O4'"  . A A 1 249 ? 94.979  104.391 87.702  1.00 0.00 ? 270 A A "O4'"  1  
ATOM 7983   C "C3'"  . A A 1 249 ? 93.500  102.750 88.467  1.00 0.00 ? 270 A A "C3'"  1  
ATOM 7984   O "O3'"  . A A 1 249 ? 92.352  101.965 88.194  1.00 0.00 ? 270 A A "O3'"  1  
ATOM 7985   C "C2'"  . A A 1 249 ? 94.811  102.050 88.134  1.00 0.00 ? 270 A A "C2'"  1  
ATOM 7986   O "O2'"  . A A 1 249 ? 94.735  101.381 86.884  1.00 0.00 ? 270 A A "O2'"  1  
ATOM 7987   C "C1'"  . A A 1 249 ? 95.758  103.242 88.006  1.00 0.00 ? 270 A A "C1'"  1  
ATOM 7988   N N9     . A A 1 249 ? 96.531  103.474 89.241  1.00 0.00 ? 270 A A N9     1  
ATOM 7989   C C8     . A A 1 249 ? 96.427  104.528 90.116  1.00 0.00 ? 270 A A C8     1  
ATOM 7990   N N7     . A A 1 249 ? 97.254  104.455 91.130  1.00 0.00 ? 270 A A N7     1  
ATOM 7991   C C5     . A A 1 249 ? 97.950  103.275 90.909  1.00 0.00 ? 270 A A C5     1  
ATOM 7992   C C6     . A A 1 249 ? 98.972  102.629 91.627  1.00 0.00 ? 270 A A C6     1  
ATOM 7993   N N6     . A A 1 249 ? 99.491  103.102 92.762  1.00 0.00 ? 270 A A N6     1  
ATOM 7994   N N1     . A A 1 249 ? 99.448  101.465 91.134  1.00 0.00 ? 270 A A N1     1  
ATOM 7995   C C2     . A A 1 249 ? 98.927  100.990 89.995  1.00 0.00 ? 270 A A C2     1  
ATOM 7996   N N3     . A A 1 249 ? 97.966  101.505 89.231  1.00 0.00 ? 270 A A N3     1  
ATOM 7997   C C4     . A A 1 249 ? 97.514  102.661 89.749  1.00 0.00 ? 270 A A C4     1  
ATOM 7998   H "H5'"  . A A 1 249 ? 92.756  105.864 87.364  1.00 0.00 ? 270 A A "H5'"  1  
ATOM 7999   H "H5''" . A A 1 249 ? 91.783  104.847 88.116  1.00 0.00 ? 270 A A "H5''" 1  
ATOM 8000   H "H4'"  . A A 1 249 ? 93.372  103.769 86.683  1.00 0.00 ? 270 A A "H4'"  1  
ATOM 8001   H "H3'"  . A A 1 249 ? 93.501  102.998 89.416  1.00 0.00 ? 270 A A "H3'"  1  
ATOM 8002   H "H2'"  . A A 1 249 ? 95.089  101.445 88.854  1.00 0.00 ? 270 A A "H2'"  1  
ATOM 8003   H "HO2'" . A A 1 249 ? 95.593  100.944 86.703  1.00 0.00 ? 270 A A "HO2'" 1  
ATOM 8004   H "H1'"  . A A 1 249 ? 96.375  103.090 87.258  1.00 0.00 ? 270 A A "H1'"  1  
ATOM 8005   H H8     . A A 1 249 ? 95.793  105.265 89.993  1.00 0.00 ? 270 A A H8     1  
ATOM 8006   H H61    . A A 1 249 ? 100.204 102.606 93.218  1.00 0.00 ? 270 A A H61    1  
ATOM 8007   H H62    . A A 1 249 ? 99.162  103.944 93.138  1.00 0.00 ? 270 A A H62    1  
ATOM 8008   H H2     . A A 1 249 ? 99.306  100.143 89.680  1.00 0.00 ? 270 A A H2     1  
ATOM 8009   P P      . U A 1 250 ? 91.298  101.641 89.362  1.00 0.00 ? 271 U A P      1  
ATOM 8010   O OP1    . U A 1 250 ? 89.987  101.345 88.730  1.00 0.00 ? 271 U A OP1    1  
ATOM 8011   O OP2    . U A 1 250 ? 91.396  102.716 90.381  1.00 0.00 ? 271 U A OP2    1  
ATOM 8012   O "O5'"  . U A 1 250 ? 91.846  100.297 90.011  1.00 0.00 ? 271 U A "O5'"  1  
ATOM 8013   C "C5'"  . U A 1 250 ? 90.968  99.370  90.638  1.00 0.00 ? 271 U A "C5'"  1  
ATOM 8014   C "C4'"  . U A 1 250 ? 91.655  98.033  90.795  1.00 0.00 ? 271 U A "C4'"  1  
ATOM 8015   O "O4'"  . U A 1 250 ? 92.806  98.015  89.901  1.00 0.00 ? 271 U A "O4'"  1  
ATOM 8016   C "C3'"  . U A 1 250 ? 92.303  97.799  92.152  1.00 0.00 ? 271 U A "C3'"  1  
ATOM 8017   O "O3'"  . U A 1 250 ? 91.470  97.386  93.195  1.00 0.00 ? 271 U A "O3'"  1  
ATOM 8018   C "C2'"  . U A 1 250 ? 93.418  96.856  91.777  1.00 0.00 ? 271 U A "C2'"  1  
ATOM 8019   O "O2'"  . U A 1 250 ? 93.004  95.580  91.320  1.00 0.00 ? 271 U A "O2'"  1  
ATOM 8020   C "C1'"  . U A 1 250 ? 93.969  97.693  90.644  1.00 0.00 ? 271 U A "C1'"  1  
ATOM 8021   N N1     . U A 1 250 ? 94.423  98.937  91.283  1.00 0.00 ? 271 U A N1     1  
ATOM 8022   C C2     . U A 1 250 ? 95.356  98.822  92.289  1.00 0.00 ? 271 U A C2     1  
ATOM 8023   O O2     . U A 1 250 ? 95.848  97.743  92.613  1.00 0.00 ? 271 U A O2     1  
ATOM 8024   N N3     . U A 1 250 ? 95.689  100.007 92.912  1.00 0.00 ? 271 U A N3     1  
ATOM 8025   C C4     . U A 1 250 ? 95.193  101.259 92.633  1.00 0.00 ? 271 U A C4     1  
ATOM 8026   O O4     . U A 1 250 ? 95.540  102.215 93.329  1.00 0.00 ? 271 U A O4     1  
ATOM 8027   C C5     . U A 1 250 ? 94.254  101.297 91.566  1.00 0.00 ? 271 U A C5     1  
ATOM 8028   C C6     . U A 1 250 ? 93.917  100.169 90.936  1.00 0.00 ? 271 U A C6     1  
ATOM 8029   H "H5'"  . U A 1 250 ? 90.163  99.268  90.087  1.00 0.00 ? 271 U A "H5'"  1  
ATOM 8030   H "H5''" . U A 1 250 ? 90.711  99.716  91.518  1.00 0.00 ? 271 U A "H5''" 1  
ATOM 8031   H "H4'"  . U A 1 250 ? 91.026  97.324  90.543  1.00 0.00 ? 271 U A "H4'"  1  
ATOM 8032   H "H3'"  . U A 1 250 ? 92.741  98.625  92.448  1.00 0.00 ? 271 U A "H3'"  1  
ATOM 8033   H "H2'"  . U A 1 250 ? 94.057  96.747  92.511  1.00 0.00 ? 271 U A "H2'"  1  
ATOM 8034   H "HO2'" . U A 1 250 ? 93.797  95.045  91.104  1.00 0.00 ? 271 U A "HO2'" 1  
ATOM 8035   H "H1'"  . U A 1 250 ? 94.693  97.202  90.203  1.00 0.00 ? 271 U A "H1'"  1  
ATOM 8036   H H3     . U A 1 250 ? 96.351  99.952  93.632  1.00 0.00 ? 271 U A H3     1  
ATOM 8037   H H5     . U A 1 250 ? 93.853  102.149 91.292  1.00 0.00 ? 271 U A H5     1  
ATOM 8038   H H6     . U A 1 250 ? 93.265  100.230 90.206  1.00 0.00 ? 271 U A H6     1  
ATOM 8039   P P      . G A 1 251 ? 91.218  98.385  94.422  1.00 0.00 ? 272 G A P      1  
ATOM 8040   O OP1    . G A 1 251 ? 90.682  97.483  95.468  1.00 0.00 ? 272 G A OP1    1  
ATOM 8041   O OP2    . G A 1 251 ? 90.421  99.552  93.942  1.00 0.00 ? 272 G A OP2    1  
ATOM 8042   O "O5'"  . G A 1 251 ? 92.643  98.924  94.896  1.00 0.00 ? 272 G A "O5'"  1  
ATOM 8043   C "C5'"  . G A 1 251 ? 93.295  98.364  96.041  1.00 0.00 ? 272 G A "C5'"  1  
ATOM 8044   C "C4'"  . G A 1 251 ? 93.944  99.435  96.911  1.00 0.00 ? 272 G A "C4'"  1  
ATOM 8045   O "O4'"  . G A 1 251 ? 94.774  100.309 96.106  1.00 0.00 ? 272 G A "O4'"  1  
ATOM 8046   C "C3'"  . G A 1 251 ? 93.053  100.407 97.666  1.00 0.00 ? 272 G A "C3'"  1  
ATOM 8047   O "O3'"  . G A 1 251 ? 92.570  99.856  98.877  1.00 0.00 ? 272 G A "O3'"  1  
ATOM 8048   C "C2'"  . G A 1 251 ? 94.058  101.486 98.005  1.00 0.00 ? 272 G A "C2'"  1  
ATOM 8049   O "O2'"  . G A 1 251 ? 94.960  101.050 99.000  1.00 0.00 ? 272 G A "O2'"  1  
ATOM 8050   C "C1'"  . G A 1 251 ? 94.791  101.602 96.677  1.00 0.00 ? 272 G A "C1'"  1  
ATOM 8051   N N9     . G A 1 251 ? 94.031  102.470 95.795  1.00 0.00 ? 272 G A N9     1  
ATOM 8052   C C8     . G A 1 251 ? 93.309  102.085 94.701  1.00 0.00 ? 272 G A C8     1  
ATOM 8053   N N7     . G A 1 251 ? 92.691  103.071 94.118  1.00 0.00 ? 272 G A N7     1  
ATOM 8054   C C5     . G A 1 251 ? 93.024  104.176 94.881  1.00 0.00 ? 272 G A C5     1  
ATOM 8055   C C6     . G A 1 251 ? 92.625  105.508 94.753  1.00 0.00 ? 272 G A C6     1  
ATOM 8056   O O6     . G A 1 251 ? 91.872  106.001 93.913  1.00 0.00 ? 272 G A O6     1  
ATOM 8057   N N1     . G A 1 251 ? 93.185  106.302 95.740  1.00 0.00 ? 272 G A N1     1  
ATOM 8058   C C2     . G A 1 251 ? 94.027  105.859 96.729  1.00 0.00 ? 272 G A C2     1  
ATOM 8059   N N2     . G A 1 251 ? 94.474  106.797 97.583  1.00 0.00 ? 272 G A N2     1  
ATOM 8060   N N3     . G A 1 251 ? 94.404  104.604 96.865  1.00 0.00 ? 272 G A N3     1  
ATOM 8061   C C4     . G A 1 251 ? 93.867  103.822 95.912  1.00 0.00 ? 272 G A C4     1  
ATOM 8062   H "H5'"  . G A 1 251 ? 93.988  97.739  95.741  1.00 0.00 ? 272 G A "H5'"  1  
ATOM 8063   H "H5''" . G A 1 251 ? 92.636  97.876  96.578  1.00 0.00 ? 272 G A "H5''" 1  
ATOM 8064   H "H4'"  . G A 1 251 ? 94.510  98.999  97.584  1.00 0.00 ? 272 G A "H4'"  1  
ATOM 8065   H "H3'"  . G A 1 251 ? 92.297  100.660 97.097  1.00 0.00 ? 272 G A "H3'"  1  
ATOM 8066   H "H2'"  . G A 1 251 ? 93.616  102.324 98.258  1.00 0.00 ? 272 G A "H2'"  1  
ATOM 8067   H "HO2'" . G A 1 251 ? 95.128  101.789 99.622  1.00 0.00 ? 272 G A "HO2'" 1  
ATOM 8068   H "H1'"  . G A 1 251 ? 95.692  101.957 96.832  1.00 0.00 ? 272 G A "H1'"  1  
ATOM 8069   H H8     . G A 1 251 ? 93.263  101.158 94.386  1.00 0.00 ? 272 G A H8     1  
ATOM 8070   H H1     . G A 1 251 ? 92.960  107.256 95.729  1.00 0.00 ? 272 G A H1     1  
ATOM 8071   H H21    . G A 1 251 ? 94.193  107.731 97.481  1.00 0.00 ? 272 G A H21    1  
ATOM 8072   H H22    . G A 1 251 ? 95.082  106.548 98.310  1.00 0.00 ? 272 G A H22    1  
ATOM 8073   P P      . U A 1 252 ? 91.221  100.423 99.541  1.00 0.00 ? 273 U A P      1  
ATOM 8074   O OP1    . U A 1 252 ? 90.844  99.521  100.658 1.00 0.00 ? 273 U A OP1    1  
ATOM 8075   O OP2    . U A 1 252 ? 90.249  100.687 98.450  1.00 0.00 ? 273 U A OP2    1  
ATOM 8076   O "O5'"  . U A 1 252 ? 91.657  101.823 100.163 1.00 0.00 ? 273 U A "O5'"  1  
ATOM 8077   C "C5'"  . U A 1 252 ? 92.429  101.884 101.353 1.00 0.00 ? 273 U A "C5'"  1  
ATOM 8078   C "C4'"  . U A 1 252 ? 92.695  103.308 101.773 1.00 0.00 ? 273 U A "C4'"  1  
ATOM 8079   O "O4'"  . U A 1 252 ? 93.272  104.031 100.649 1.00 0.00 ? 273 U A "O4'"  1  
ATOM 8080   C "C3'"  . U A 1 252 ? 91.477  104.129 102.167 1.00 0.00 ? 273 U A "C3'"  1  
ATOM 8081   O "O3'"  . U A 1 252 ? 91.080  103.921 103.511 1.00 0.00 ? 273 U A "O3'"  1  
ATOM 8082   C "C2'"  . U A 1 252 ? 91.928  105.553 101.879 1.00 0.00 ? 273 U A "C2'"  1  
ATOM 8083   O "O2'"  . U A 1 252 ? 92.778  106.041 102.907 1.00 0.00 ? 273 U A "O2'"  1  
ATOM 8084   C "C1'"  . U A 1 252 ? 92.748  105.353 100.605 1.00 0.00 ? 273 U A "C1'"  1  
ATOM 8085   N N1     . U A 1 252 ? 91.925  105.487 99.379  1.00 0.00 ? 273 U A N1     1  
ATOM 8086   C C2     . U A 1 252 ? 91.425  106.743 99.089  1.00 0.00 ? 273 U A C2     1  
ATOM 8087   O O2     . U A 1 252 ? 91.632  107.720 99.788  1.00 0.00 ? 273 U A O2     1  
ATOM 8088   N N3     . U A 1 252 ? 90.669  106.820 97.945  1.00 0.00 ? 273 U A N3     1  
ATOM 8089   C C4     . U A 1 252 ? 90.366  105.792 97.078  1.00 0.00 ? 273 U A C4     1  
ATOM 8090   O O4     . U A 1 252 ? 89.670  106.021 96.088  1.00 0.00 ? 273 U A O4     1  
ATOM 8091   C C5     . U A 1 252 ? 90.917  104.522 97.441  1.00 0.00 ? 273 U A C5     1  
ATOM 8092   C C6     . U A 1 252 ? 91.657  104.419 98.549  1.00 0.00 ? 273 U A C6     1  
ATOM 8093   H "H5'"  . U A 1 252 ? 93.285  101.430 101.202 1.00 0.00 ? 273 U A "H5'"  1  
ATOM 8094   H "H5''" . U A 1 252 ? 91.946  101.425 102.071 1.00 0.00 ? 273 U A "H5''" 1  
ATOM 8095   H "H4'"  . U A 1 252 ? 93.331  103.305 102.517 1.00 0.00 ? 273 U A "H4'"  1  
ATOM 8096   H "H3'"  . U A 1 252 ? 90.730  103.906 101.573 1.00 0.00 ? 273 U A "H3'"  1  
ATOM 8097   H "H2'"  . U A 1 252 ? 91.165  106.148 101.727 1.00 0.00 ? 273 U A "H2'"  1  
ATOM 8098   H "HO2'" . U A 1 252 ? 93.224  106.856 102.593 1.00 0.00 ? 273 U A "HO2'" 1  
ATOM 8099   H "H1'"  . U A 1 252 ? 93.474  106.011 100.582 1.00 0.00 ? 273 U A "H1'"  1  
ATOM 8100   H H3     . U A 1 252 ? 90.305  107.701 97.721  1.00 0.00 ? 273 U A H3     1  
ATOM 8101   H H5     . U A 1 252 ? 90.753  103.734 96.880  1.00 0.00 ? 273 U A H5     1  
ATOM 8102   H H6     . U A 1 252 ? 92.022  103.539 98.776  1.00 0.00 ? 273 U A H6     1  
ATOM 8103   P P      . C A 1 253 ? 89.655  103.262 103.826 1.00 0.00 ? 274 C A P      1  
ATOM 8104   O OP1    . C A 1 253 ? 89.855  102.031 104.633 1.00 0.00 ? 274 C A OP1    1  
ATOM 8105   O OP2    . C A 1 253 ? 89.041  103.162 102.477 1.00 0.00 ? 274 C A OP2    1  
ATOM 8106   O "O5'"  . C A 1 253 ? 88.789  104.277 104.687 1.00 0.00 ? 274 C A "O5'"  1  
ATOM 8107   C "C5'"  . C A 1 253 ? 89.281  105.559 105.004 1.00 0.00 ? 274 C A "C5'"  1  
ATOM 8108   C "C4'"  . C A 1 253 ? 88.369  106.608 104.431 1.00 0.00 ? 274 C A "C4'"  1  
ATOM 8109   O "O4'"  . C A 1 253 ? 88.864  107.014 103.136 1.00 0.00 ? 274 C A "O4'"  1  
ATOM 8110   C "C3'"  . C A 1 253 ? 86.960  106.162 104.111 1.00 0.00 ? 274 C A "C3'"  1  
ATOM 8111   O "O3'"  . C A 1 253 ? 86.141  106.194 105.254 1.00 0.00 ? 274 C A "O3'"  1  
ATOM 8112   C "C2'"  . C A 1 253 ? 86.506  107.234 103.140 1.00 0.00 ? 274 C A "C2'"  1  
ATOM 8113   O "O2'"  . C A 1 253 ? 86.129  108.433 103.798 1.00 0.00 ? 274 C A "O2'"  1  
ATOM 8114   C "C1'"  . C A 1 253 ? 87.779  107.434 102.325 1.00 0.00 ? 274 C A "C1'"  1  
ATOM 8115   N N1     . C A 1 253 ? 87.784  106.609 101.117 1.00 0.00 ? 274 C A N1     1  
ATOM 8116   C C2     . C A 1 253 ? 86.898  106.918 100.072 1.00 0.00 ? 274 C A C2     1  
ATOM 8117   O O2     . C A 1 253 ? 86.108  107.849 100.212 1.00 0.00 ? 274 C A O2     1  
ATOM 8118   N N3     . C A 1 253 ? 86.926  106.181 98.947  1.00 0.00 ? 274 C A N3     1  
ATOM 8119   C C4     . C A 1 253 ? 87.783  105.164 98.839  1.00 0.00 ? 274 C A C4     1  
ATOM 8120   N N4     . C A 1 253 ? 87.793  104.473 97.698  1.00 0.00 ? 274 C A N4     1  
ATOM 8121   C C5     . C A 1 253 ? 88.678  104.810 99.900  1.00 0.00 ? 274 C A C5     1  
ATOM 8122   C C6     . C A 1 253 ? 88.646  105.554 101.006 1.00 0.00 ? 274 C A C6     1  
ATOM 8123   H "H5'"  . C A 1 253 ? 90.181  105.656 104.631 1.00 0.00 ? 274 C A "H5'"  1  
ATOM 8124   H "H5''" . C A 1 253 ? 89.327  105.651 105.979 1.00 0.00 ? 274 C A "H5''" 1  
ATOM 8125   H "H4'"  . C A 1 253 ? 88.365  107.382 105.030 1.00 0.00 ? 274 C A "H4'"  1  
ATOM 8126   H "H3'"  . C A 1 253 ? 86.983  105.253 103.743 1.00 0.00 ? 274 C A "H3'"  1  
ATOM 8127   H "H2'"  . C A 1 253 ? 85.788  106.910 102.560 1.00 0.00 ? 274 C A "H2'"  1  
ATOM 8128   H "HO2'" . C A 1 253 ? 85.846  109.089 103.130 1.00 0.00 ? 274 C A "HO2'" 1  
ATOM 8129   H "H1'"  . C A 1 253 ? 87.859  108.379 102.080 1.00 0.00 ? 274 C A "H1'"  1  
ATOM 8130   H H41    . C A 1 253 ? 87.183  104.721 96.972  1.00 0.00 ? 274 C A H41    1  
ATOM 8131   H H42    . C A 1 253 ? 88.410  103.722 97.586  1.00 0.00 ? 274 C A H42    1  
ATOM 8132   H H5     . C A 1 253 ? 89.291  104.050 99.814  1.00 0.00 ? 274 C A H5     1  
ATOM 8133   H H6     . C A 1 253 ? 89.250  105.329 101.745 1.00 0.00 ? 274 C A H6     1  
ATOM 8134   P P      . G A 1 254 ? 84.675  105.589 105.164 1.00 0.00 ? 275 G A P      1  
ATOM 8135   O OP1    . G A 1 254 ? 84.054  105.921 106.471 1.00 0.00 ? 275 G A OP1    1  
ATOM 8136   O OP2    . G A 1 254 ? 84.791  104.173 104.719 1.00 0.00 ? 275 G A OP2    1  
ATOM 8137   O "O5'"  . G A 1 254 ? 83.986  106.437 104.012 1.00 0.00 ? 275 G A "O5'"  1  
ATOM 8138   C "C5'"  . G A 1 254 ? 82.926  105.896 103.262 1.00 0.00 ? 275 G A "C5'"  1  
ATOM 8139   C "C4'"  . G A 1 254 ? 82.440  106.909 102.267 1.00 0.00 ? 275 G A "C4'"  1  
ATOM 8140   O "O4'"  . G A 1 254 ? 83.456  107.123 101.246 1.00 0.00 ? 275 G A "O4'"  1  
ATOM 8141   C "C3'"  . G A 1 254 ? 81.224  106.476 101.477 1.00 0.00 ? 275 G A "C3'"  1  
ATOM 8142   O "O3'"  . G A 1 254 ? 80.045  106.656 102.258 1.00 0.00 ? 275 G A "O3'"  1  
ATOM 8143   C "C2'"  . G A 1 254 ? 81.322  107.377 100.245 1.00 0.00 ? 275 G A "C2'"  1  
ATOM 8144   O "O2'"  . G A 1 254 ? 80.893  108.706 100.417 1.00 0.00 ? 275 G A "O2'"  1  
ATOM 8145   C "C1'"  . G A 1 254 ? 82.832  107.367 99.992  1.00 0.00 ? 275 G A "C1'"  1  
ATOM 8146   N N9     . G A 1 254 ? 83.138  106.263 99.092  1.00 0.00 ? 275 G A N9     1  
ATOM 8147   C C8     . G A 1 254 ? 83.893  105.143 99.356  1.00 0.00 ? 275 G A C8     1  
ATOM 8148   N N7     . G A 1 254 ? 83.889  104.281 98.374  1.00 0.00 ? 275 G A N7     1  
ATOM 8149   C C5     . G A 1 254 ? 83.108  104.883 97.395  1.00 0.00 ? 275 G A C5     1  
ATOM 8150   C C6     . G A 1 254 ? 82.724  104.419 96.106  1.00 0.00 ? 275 G A C6     1  
ATOM 8151   O O6     . G A 1 254 ? 82.977  103.329 95.572  1.00 0.00 ? 275 G A O6     1  
ATOM 8152   N N1     . G A 1 254 ? 81.940  105.362 95.432  1.00 0.00 ? 275 G A N1     1  
ATOM 8153   C C2     . G A 1 254 ? 81.553  106.579 95.947  1.00 0.00 ? 275 G A C2     1  
ATOM 8154   N N2     . G A 1 254 ? 80.809  107.352 95.143  1.00 0.00 ? 275 G A N2     1  
ATOM 8155   N N3     . G A 1 254 ? 81.877  107.006 97.157  1.00 0.00 ? 275 G A N3     1  
ATOM 8156   C C4     . G A 1 254 ? 82.657  106.117 97.817  1.00 0.00 ? 275 G A C4     1  
ATOM 8157   H "H5'"  . G A 1 254 ? 82.198  105.647 103.869 1.00 0.00 ? 275 G A "H5'"  1  
ATOM 8158   H "H5''" . G A 1 254 ? 83.240  105.092 102.796 1.00 0.00 ? 275 G A "H5''" 1  
ATOM 8159   H "H4'"  . G A 1 254 ? 82.274  107.755 102.732 1.00 0.00 ? 275 G A "H4'"  1  
ATOM 8160   H "H3'"  . G A 1 254 ? 81.327  105.536 101.218 1.00 0.00 ? 275 G A "H3'"  1  
ATOM 8161   H "H2'"  . G A 1 254 ? 80.853  106.987 99.477  1.00 0.00 ? 275 G A "H2'"  1  
ATOM 8162   H "HO2'" . G A 1 254 ? 80.999  109.187 99.570  1.00 0.00 ? 275 G A "HO2'" 1  
ATOM 8163   H "H1'"  . G A 1 254 ? 83.102  108.226 99.608  1.00 0.00 ? 275 G A "H1'"  1  
ATOM 8164   H H8     . G A 1 254 ? 84.369  104.994 100.201 1.00 0.00 ? 275 G A H8     1  
ATOM 8165   H H1     . G A 1 254 ? 81.643  105.137 94.525  1.00 0.00 ? 275 G A H1     1  
ATOM 8166   H H21    . G A 1 254 ? 80.566  107.040 94.246  1.00 0.00 ? 275 G A H21    1  
ATOM 8167   H H22    . G A 1 254 ? 80.506  108.231 95.452  1.00 0.00 ? 275 G A H22    1  
ATOM 8168   P P      . G A 1 255 ? 78.954  105.476 102.347 1.00 0.00 ? 276 G A P      1  
ATOM 8169   O OP1    . G A 1 255 ? 78.122  105.788 103.537 1.00 0.00 ? 276 G A OP1    1  
ATOM 8170   O OP2    . G A 1 255 ? 79.615  104.151 102.241 1.00 0.00 ? 276 G A OP2    1  
ATOM 8171   O "O5'"  . G A 1 255 ? 78.111  105.677 101.020 1.00 0.00 ? 276 G A "O5'"  1  
ATOM 8172   C "C5'"  . G A 1 255 ? 77.779  106.985 100.576 1.00 0.00 ? 276 G A "C5'"  1  
ATOM 8173   C "C4'"  . G A 1 255 ? 77.314  106.949 99.151  1.00 0.00 ? 276 G A "C4'"  1  
ATOM 8174   O "O4'"  . G A 1 255 ? 78.442  106.828 98.243  1.00 0.00 ? 276 G A "O4'"  1  
ATOM 8175   C "C3'"  . G A 1 255 ? 76.438  105.759 98.807  1.00 0.00 ? 276 G A "C3'"  1  
ATOM 8176   O "O3'"  . G A 1 255 ? 75.085  105.937 99.245  1.00 0.00 ? 276 G A "O3'"  1  
ATOM 8177   C "C2'"  . G A 1 255 ? 76.554  105.738 97.292  1.00 0.00 ? 276 G A "C2'"  1  
ATOM 8178   O "O2'"  . G A 1 255 ? 75.701  106.685 96.700  1.00 0.00 ? 276 G A "O2'"  1  
ATOM 8179   C "C1'"  . G A 1 255 ? 78.017  106.149 97.077  1.00 0.00 ? 276 G A "C1'"  1  
ATOM 8180   N N9     . G A 1 255 ? 78.894  105.002 96.845  1.00 0.00 ? 276 G A N9     1  
ATOM 8181   C C8     . G A 1 255 ? 79.758  104.418 97.739  1.00 0.00 ? 276 G A C8     1  
ATOM 8182   N N7     . G A 1 255 ? 80.392  103.382 97.241  1.00 0.00 ? 276 G A N7     1  
ATOM 8183   C C5     . G A 1 255 ? 79.922  103.281 95.938  1.00 0.00 ? 276 G A C5     1  
ATOM 8184   C C6     . G A 1 255 ? 80.247  102.343 94.898  1.00 0.00 ? 276 G A C6     1  
ATOM 8185   O O6     . G A 1 255 ? 81.038  101.392 94.928  1.00 0.00 ? 276 G A O6     1  
ATOM 8186   N N1     . G A 1 255 ? 79.530  102.607 93.735  1.00 0.00 ? 276 G A N1     1  
ATOM 8187   C C2     . G A 1 255 ? 78.623  103.633 93.580  1.00 0.00 ? 276 G A C2     1  
ATOM 8188   N N2     . G A 1 255 ? 78.019  103.719 92.376  1.00 0.00 ? 276 G A N2     1  
ATOM 8189   N N3     . G A 1 255 ? 78.320  104.511 94.531  1.00 0.00 ? 276 G A N3     1  
ATOM 8190   C C4     . G A 1 255 ? 79.000  104.276 95.673  1.00 0.00 ? 276 G A C4     1  
ATOM 8191   H "H5'"  . G A 1 255 ? 78.571  107.559 100.652 1.00 0.00 ? 276 G A "H5'"  1  
ATOM 8192   H "H5''" . G A 1 255 ? 77.069  107.347 101.147 1.00 0.00 ? 276 G A "H5''" 1  
ATOM 8193   H "H4'"  . G A 1 255 ? 76.843  107.785 98.949  1.00 0.00 ? 276 G A "H4'"  1  
ATOM 8194   H "H3'"  . G A 1 255 ? 76.811  104.955 99.220  1.00 0.00 ? 276 G A "H3'"  1  
ATOM 8195   H "H2'"  . G A 1 255 ? 76.402  104.838 96.933  1.00 0.00 ? 276 G A "H2'"  1  
ATOM 8196   H "HO2'" . G A 1 255 ? 75.301  106.294 95.894  1.00 0.00 ? 276 G A "HO2'" 1  
ATOM 8197   H "H1'"  . G A 1 255 ? 78.076  106.759 96.312  1.00 0.00 ? 276 G A "H1'"  1  
ATOM 8198   H H8     . G A 1 255 ? 79.886  104.739 98.656  1.00 0.00 ? 276 G A H8     1  
ATOM 8199   H H1     . G A 1 255 ? 79.684  102.016 92.969  1.00 0.00 ? 276 G A H1     1  
ATOM 8200   H H21    . G A 1 255 ? 78.236  103.076 91.670  1.00 0.00 ? 276 G A H21    1  
ATOM 8201   H H22    . G A 1 255 ? 77.360  104.425 92.207  1.00 0.00 ? 276 G A H22    1  
ATOM 8202   P P      . U A 1 256 ? 74.166  104.658 99.568  1.00 0.00 ? 277 U A P      1  
ATOM 8203   O OP1    . U A 1 256 ? 73.131  105.071 100.550 1.00 0.00 ? 277 U A OP1    1  
ATOM 8204   O OP2    . U A 1 256 ? 75.062  103.517 99.881  1.00 0.00 ? 277 U A OP2    1  
ATOM 8205   O "O5'"  . U A 1 256 ? 73.439  104.348 98.184  1.00 0.00 ? 277 U A "O5'"  1  
ATOM 8206   C "C5'"  . U A 1 256 ? 72.762  105.373 97.471  1.00 0.00 ? 277 U A "C5'"  1  
ATOM 8207   C "C4'"  . U A 1 256 ? 72.570  105.006 96.020  1.00 0.00 ? 277 U A "C4'"  1  
ATOM 8208   O "O4'"  . U A 1 256 ? 73.853  104.982 95.341  1.00 0.00 ? 277 U A "O4'"  1  
ATOM 8209   C "C3'"  . U A 1 256 ? 71.982  103.630 95.749  1.00 0.00 ? 277 U A "C3'"  1  
ATOM 8210   O "O3'"  . U A 1 256 ? 70.568  103.599 95.859  1.00 0.00 ? 277 U A "O3'"  1  
ATOM 8211   C "C2'"  . U A 1 256 ? 72.491  103.321 94.348  1.00 0.00 ? 277 U A "C2'"  1  
ATOM 8212   O "O2'"  . U A 1 256 ? 71.737  104.010 93.362  1.00 0.00 ? 277 U A "O2'"  1  
ATOM 8213   C "C1'"  . U A 1 256 ? 73.900  103.911 94.399  1.00 0.00 ? 277 U A "C1'"  1  
ATOM 8214   N N1     . U A 1 256 ? 74.916  102.913 94.811  1.00 0.00 ? 277 U A N1     1  
ATOM 8215   C C2     . U A 1 256 ? 75.333  102.006 93.854  1.00 0.00 ? 277 U A C2     1  
ATOM 8216   O O2     . U A 1 256 ? 74.907  102.000 92.712  1.00 0.00 ? 277 U A O2     1  
ATOM 8217   N N3     . U A 1 256 ? 76.273  101.100 94.279  1.00 0.00 ? 277 U A N3     1  
ATOM 8218   C C4     . U A 1 256 ? 76.829  101.007 95.538  1.00 0.00 ? 277 U A C4     1  
ATOM 8219   O O4     . U A 1 256 ? 77.665  100.133 95.766  1.00 0.00 ? 277 U A O4     1  
ATOM 8220   C C5     . U A 1 256 ? 76.349  101.978 96.476  1.00 0.00 ? 277 U A C5     1  
ATOM 8221   C C6     . U A 1 256 ? 75.435  102.871 96.087  1.00 0.00 ? 277 U A C6     1  
ATOM 8222   H "H5'"  . U A 1 256 ? 73.287  106.199 97.525  1.00 0.00 ? 277 U A "H5'"  1  
ATOM 8223   H "H5''" . U A 1 256 ? 71.884  105.523 97.881  1.00 0.00 ? 277 U A "H5''" 1  
ATOM 8224   H "H4'"  . U A 1 256 ? 71.999  105.684 95.598  1.00 0.00 ? 277 U A "H4'"  1  
ATOM 8225   H "H3'"  . U A 1 256 ? 72.365  102.986 96.380  1.00 0.00 ? 277 U A "H3'"  1  
ATOM 8226   H "H2'"  . U A 1 256 ? 72.514  102.355 94.178  1.00 0.00 ? 277 U A "H2'"  1  
ATOM 8227   H "HO2'" . U A 1 256 ? 70.875  104.274 93.746  1.00 0.00 ? 277 U A "HO2'" 1  
ATOM 8228   H "H1'"  . U A 1 256 ? 74.137  104.268 93.517  1.00 0.00 ? 277 U A "H1'"  1  
ATOM 8229   H H3     . U A 1 256 ? 76.582  100.449 93.616  1.00 0.00 ? 277 U A H3     1  
ATOM 8230   H H5     . U A 1 256 ? 76.691  101.984 97.395  1.00 0.00 ? 277 U A H5     1  
ATOM 8231   H H6     . U A 1 256 ? 75.123  103.522 96.748  1.00 0.00 ? 277 U A H6     1  
ATOM 8232   P P      . C A 1 257 ? 69.821  102.254 96.322  1.00 0.00 ? 278 C A P      1  
ATOM 8233   O OP1    . C A 1 257 ? 68.383  102.573 96.524  1.00 0.00 ? 278 C A OP1    1  
ATOM 8234   O OP2    . C A 1 257 ? 70.601  101.652 97.431  1.00 0.00 ? 278 C A OP2    1  
ATOM 8235   O "O5'"  . C A 1 257 ? 69.938  101.294 95.057  1.00 0.00 ? 278 C A "O5'"  1  
ATOM 8236   C "C5'"  . C A 1 257 ? 69.259  101.594 93.846  1.00 0.00 ? 278 C A "C5'"  1  
ATOM 8237   C "C4'"  . C A 1 257 ? 69.637  100.636 92.743  1.00 0.00 ? 278 C A "C4'"  1  
ATOM 8238   O "O4'"  . C A 1 257 ? 71.057  100.738 92.465  1.00 0.00 ? 278 C A "O4'"  1  
ATOM 8239   C "C3'"  . C A 1 257 ? 69.421  99.159  93.035  1.00 0.00 ? 278 C A "C3'"  1  
ATOM 8240   O "O3'"  . C A 1 257 ? 68.079  98.745  92.842  1.00 0.00 ? 278 C A "O3'"  1  
ATOM 8241   C "C2'"  . C A 1 257 ? 70.408  98.485  92.092  1.00 0.00 ? 278 C A "C2'"  1  
ATOM 8242   O "O2'"  . C A 1 257 ? 69.911  98.452  90.763  1.00 0.00 ? 278 C A "O2'"  1  
ATOM 8243   C "C1'"  . C A 1 257 ? 71.594  99.451  92.154  1.00 0.00 ? 278 C A "C1'"  1  
ATOM 8244   N N1     . C A 1 257 ? 72.600  99.043  93.167  1.00 0.00 ? 278 C A N1     1  
ATOM 8245   C C2     . C A 1 257 ? 73.468  97.990  92.853  1.00 0.00 ? 278 C A C2     1  
ATOM 8246   O O2     . C A 1 257 ? 73.373  97.432  91.750  1.00 0.00 ? 278 C A O2     1  
ATOM 8247   N N3     . C A 1 257 ? 74.396  97.599  93.759  1.00 0.00 ? 278 C A N3     1  
ATOM 8248   C C4     . C A 1 257 ? 74.478  98.215  94.939  1.00 0.00 ? 278 C A C4     1  
ATOM 8249   N N4     . C A 1 257 ? 75.407  97.795  95.801  1.00 0.00 ? 278 C A N4     1  
ATOM 8250   C C5     . C A 1 257 ? 73.609  99.286  95.286  1.00 0.00 ? 278 C A C5     1  
ATOM 8251   C C6     . C A 1 257 ? 72.696  99.665  94.383  1.00 0.00 ? 278 C A C6     1  
ATOM 8252   H "H5'"  . C A 1 257 ? 69.487  102.505 93.569  1.00 0.00 ? 278 C A "H5'"  1  
ATOM 8253   H "H5''" . C A 1 257 ? 68.293  101.538 94.001  1.00 0.00 ? 278 C A "H5''" 1  
ATOM 8254   H "H4'"  . C A 1 257 ? 69.135  100.875 91.935  1.00 0.00 ? 278 C A "H4'"  1  
ATOM 8255   H "H3'"  . C A 1 257 ? 69.684  98.972  93.961  1.00 0.00 ? 278 C A "H3'"  1  
ATOM 8256   H "H2'"  . C A 1 257 ? 70.659  97.592  92.409  1.00 0.00 ? 278 C A "H2'"  1  
ATOM 8257   H "HO2'" . C A 1 257 ? 70.134  97.587  90.361  1.00 0.00 ? 278 C A "HO2'" 1  
ATOM 8258   H "H1'"  . C A 1 257 ? 72.021  99.498  91.272  1.00 0.00 ? 278 C A "H1'"  1  
ATOM 8259   H H41    . C A 1 257 ? 76.002  97.055  95.559  1.00 0.00 ? 278 C A H41    1  
ATOM 8260   H H42    . C A 1 257 ? 75.493  98.227  96.676  1.00 0.00 ? 278 C A H42    1  
ATOM 8261   H H5     . C A 1 257 ? 73.677  99.733  96.158  1.00 0.00 ? 278 C A H5     1  
ATOM 8262   H H6     . C A 1 257 ? 72.090  100.401 94.604  1.00 0.00 ? 278 C A H6     1  
ATOM 8263   P P      . G A 1 258 ? 67.388  97.732  93.882  1.00 0.00 ? 279 G A P      1  
ATOM 8264   O OP1    . G A 1 258 ? 66.182  97.156  93.233  1.00 0.00 ? 279 G A OP1    1  
ATOM 8265   O OP2    . G A 1 258 ? 67.257  98.430  95.186  1.00 0.00 ? 279 G A OP2    1  
ATOM 8266   O "O5'"  . G A 1 258 ? 68.459  96.564  94.053  1.00 0.00 ? 279 G A "O5'"  1  
ATOM 8267   C "C5'"  . G A 1 258 ? 68.963  96.220  95.335  1.00 0.00 ? 279 G A "C5'"  1  
ATOM 8268   C "C4'"  . G A 1 258 ? 70.074  95.203  95.239  1.00 0.00 ? 279 G A "C4'"  1  
ATOM 8269   O "O4'"  . G A 1 258 ? 71.311  95.913  95.055  1.00 0.00 ? 279 G A "O4'"  1  
ATOM 8270   C "C3'"  . G A 1 258 ? 70.297  94.340  96.472  1.00 0.00 ? 279 G A "C3'"  1  
ATOM 8271   O "O3'"  . G A 1 258 ? 69.459  93.198  96.507  1.00 0.00 ? 279 G A "O3'"  1  
ATOM 8272   C "C2'"  . G A 1 258 ? 71.726  93.888  96.296  1.00 0.00 ? 279 G A "C2'"  1  
ATOM 8273   O "O2'"  . G A 1 258 ? 71.824  92.860  95.321  1.00 0.00 ? 279 G A "O2'"  1  
ATOM 8274   C "C1'"  . G A 1 258 ? 72.353  95.161  95.754  1.00 0.00 ? 279 G A "C1'"  1  
ATOM 8275   N N9     . G A 1 258 ? 73.028  95.941  96.808  1.00 0.00 ? 279 G A N9     1  
ATOM 8276   C C8     . G A 1 258 ? 72.586  97.100  97.398  1.00 0.00 ? 279 G A C8     1  
ATOM 8277   N N7     . G A 1 258 ? 73.405  97.561  98.303  1.00 0.00 ? 279 G A N7     1  
ATOM 8278   C C5     . G A 1 258 ? 74.452  96.651  98.314  1.00 0.00 ? 279 G A C5     1  
ATOM 8279   C C6     . G A 1 258 ? 75.637  96.622  99.094  1.00 0.00 ? 279 G A C6     1  
ATOM 8280   O O6     . G A 1 258 ? 76.010  97.423  99.959  1.00 0.00 ? 279 G A O6     1  
ATOM 8281   N N1     . G A 1 258 ? 76.429  95.520  98.783  1.00 0.00 ? 279 G A N1     1  
ATOM 8282   C C2     . G A 1 258 ? 76.119  94.567  97.844  1.00 0.00 ? 279 G A C2     1  
ATOM 8283   N N2     . G A 1 258 ? 77.009  93.576  97.685  1.00 0.00 ? 279 G A N2     1  
ATOM 8284   N N3     . G A 1 258 ? 75.018  94.583  97.111  1.00 0.00 ? 279 G A N3     1  
ATOM 8285   C C4     . G A 1 258 ? 74.236  95.644  97.397  1.00 0.00 ? 279 G A C4     1  
ATOM 8286   H "H5'"  . G A 1 258 ? 68.235  95.848  95.876  1.00 0.00 ? 279 G A "H5'"  1  
ATOM 8287   H "H5''" . G A 1 258 ? 69.305  97.028  95.772  1.00 0.00 ? 279 G A "H5''" 1  
ATOM 8288   H "H4'"  . G A 1 258 ? 69.907  94.623  94.467  1.00 0.00 ? 279 G A "H4'"  1  
ATOM 8289   H "H3'"  . G A 1 258 ? 70.233  94.901  97.272  1.00 0.00 ? 279 G A "H3'"  1  
ATOM 8290   H "H2'"  . G A 1 258 ? 72.125  93.618  97.150  1.00 0.00 ? 279 G A "H2'"  1  
ATOM 8291   H "HO2'" . G A 1 258 ? 70.926  92.639  94.998  1.00 0.00 ? 279 G A "HO2'" 1  
ATOM 8292   H "H1'"  . G A 1 258 ? 72.999  94.933  95.052  1.00 0.00 ? 279 G A "H1'"  1  
ATOM 8293   H H8     . G A 1 258 ? 71.741  97.538  97.162  1.00 0.00 ? 279 G A H8     1  
ATOM 8294   H H1     . G A 1 258 ? 77.271  95.418  99.274  1.00 0.00 ? 279 G A H1     1  
ATOM 8295   H H21    . G A 1 258 ? 77.827  93.558  98.224  1.00 0.00 ? 279 G A H21    1  
ATOM 8296   H H22    . G A 1 258 ? 76.842  92.867  97.029  1.00 0.00 ? 279 G A H22    1  
ATOM 8297   P P      . G A 1 259 ? 69.433  92.276  97.819  1.00 0.00 ? 280 G A P      1  
ATOM 8298   O OP1    . G A 1 259 ? 68.240  91.393  97.771  1.00 0.00 ? 280 G A OP1    1  
ATOM 8299   O OP2    . G A 1 259 ? 69.568  93.269  98.915  1.00 0.00 ? 280 G A OP2    1  
ATOM 8300   O "O5'"  . G A 1 259 ? 70.729  91.351  97.830  1.00 0.00 ? 280 G A "O5'"  1  
ATOM 8301   C "C5'"  . G A 1 259 ? 70.992  90.449  96.766  1.00 0.00 ? 280 G A "C5'"  1  
ATOM 8302   C "C4'"  . G A 1 259 ? 72.101  89.487  97.115  1.00 0.00 ? 280 G A "C4'"  1  
ATOM 8303   O "O4'"  . G A 1 259 ? 73.378  90.178  97.085  1.00 0.00 ? 280 G A "O4'"  1  
ATOM 8304   C "C3'"  . G A 1 259 ? 72.042  88.877  98.507  1.00 0.00 ? 280 G A "C3'"  1  
ATOM 8305   O "O3'"  . G A 1 259 ? 71.139  87.790  98.598  1.00 0.00 ? 280 G A "O3'"  1  
ATOM 8306   C "C2'"  . G A 1 259 ? 73.493  88.491  98.763  1.00 0.00 ? 280 G A "C2'"  1  
ATOM 8307   O "O2'"  . G A 1 259 ? 73.834  87.292  98.082  1.00 0.00 ? 280 G A "O2'"  1  
ATOM 8308   C "C1'"  . G A 1 259 ? 74.239  89.659  98.113  1.00 0.00 ? 280 G A "C1'"  1  
ATOM 8309   N N9     . G A 1 259 ? 74.585  90.708  99.092  1.00 0.00 ? 280 G A N9     1  
ATOM 8310   C C8     . G A 1 259 ? 74.019  91.953  99.212  1.00 0.00 ? 280 G A C8     1  
ATOM 8311   N N7     . G A 1 259 ? 74.540  92.664  100.176 1.00 0.00 ? 280 G A N7     1  
ATOM 8312   C C5     . G A 1 259 ? 75.508  91.837  100.726 1.00 0.00 ? 280 G A C5     1  
ATOM 8313   C C6     . G A 1 259 ? 76.399  92.060  101.807 1.00 0.00 ? 280 G A C6     1  
ATOM 8314   O O6     . G A 1 259 ? 76.517  93.068  102.515 1.00 0.00 ? 280 G A O6     1  
ATOM 8315   N N1     . G A 1 259 ? 77.216  90.955  102.033 1.00 0.00 ? 280 G A N1     1  
ATOM 8316   C C2     . G A 1 259 ? 77.178  89.787  101.314 1.00 0.00 ? 280 G A C2     1  
ATOM 8317   N N2     . G A 1 259 ? 78.045  88.832  101.684 1.00 0.00 ? 280 G A N2     1  
ATOM 8318   N N3     . G A 1 259 ? 76.350  89.565  100.307 1.00 0.00 ? 280 G A N3     1  
ATOM 8319   C C4     . G A 1 259 ? 75.551  90.626  100.069 1.00 0.00 ? 280 G A C4     1  
ATOM 8320   H "H5'"  . G A 1 259 ? 71.251  90.960  95.971  1.00 0.00 ? 280 G A "H5'"  1  
ATOM 8321   H "H5''" . G A 1 259 ? 70.178  89.940  96.568  1.00 0.00 ? 280 G A "H5''" 1  
ATOM 8322   H "H4'"  . G A 1 259 ? 72.115  88.764  96.452  1.00 0.00 ? 280 G A "H4'"  1  
ATOM 8323   H "H3'"  . G A 1 259 ? 71.777  89.569  99.150  1.00 0.00 ? 280 G A "H3'"  1  
ATOM 8324   H "H2'"  . G A 1 259 ? 73.686  88.431  99.722  1.00 0.00 ? 280 G A "H2'"  1  
ATOM 8325   H "HO2'" . G A 1 259 ? 73.013  86.805  97.863  1.00 0.00 ? 280 G A "HO2'" 1  
ATOM 8326   H "H1'"  . G A 1 259 ? 75.056  89.326  97.687  1.00 0.00 ? 280 G A "H1'"  1  
ATOM 8327   H H8     . G A 1 259 ? 73.298  92.278  98.632  1.00 0.00 ? 280 G A H8     1  
ATOM 8328   H H1     . G A 1 259 ? 77.867  91.019  102.763 1.00 0.00 ? 280 G A H1     1  
ATOM 8329   H H21    . G A 1 259 ? 78.661  88.988  102.430 1.00 0.00 ? 280 G A H21    1  
ATOM 8330   H H22    . G A 1 259 ? 78.065  87.976  101.205 1.00 0.00 ? 280 G A H22    1  
ATOM 8331   P P      . G A 1 260 ? 70.513  87.375  100.020 1.00 0.00 ? 281 G A P      1  
ATOM 8332   O OP1    . G A 1 260 ? 69.515  86.301  99.789  1.00 0.00 ? 281 G A OP1    1  
ATOM 8333   O OP2    . G A 1 260 ? 70.105  88.620  100.722 1.00 0.00 ? 281 G A OP2    1  
ATOM 8334   O "O5'"  . G A 1 260 ? 71.744  86.743  100.814 1.00 0.00 ? 281 G A "O5'"  1  
ATOM 8335   C "C5'"  . G A 1 260 ? 72.234  85.451  100.488 1.00 0.00 ? 281 G A "C5'"  1  
ATOM 8336   C "C4'"  . G A 1 260 ? 73.336  85.025  101.425 1.00 0.00 ? 281 G A "C4'"  1  
ATOM 8337   O "O4'"  . G A 1 260 ? 74.451  85.949  101.328 1.00 0.00 ? 281 G A "O4'"  1  
ATOM 8338   C "C3'"  . G A 1 260 ? 72.988  85.020  102.906 1.00 0.00 ? 281 G A "C3'"  1  
ATOM 8339   O "O3'"  . G A 1 260 ? 72.237  83.882  103.294 1.00 0.00 ? 281 G A "O3'"  1  
ATOM 8340   C "C2'"  . G A 1 260 ? 74.356  85.103  103.570 1.00 0.00 ? 281 G A "C2'"  1  
ATOM 8341   O "O2'"  . G A 1 260 ? 75.012  83.843  103.558 1.00 0.00 ? 281 G A "O2'"  1  
ATOM 8342   C "C1'"  . G A 1 260 ? 75.093  86.056  102.627 1.00 0.00 ? 281 G A "C1'"  1  
ATOM 8343   N N9     . G A 1 260 ? 75.083  87.445  103.124 1.00 0.00 ? 281 G A N9     1  
ATOM 8344   C C8     . G A 1 260 ? 74.336  88.494  102.644 1.00 0.00 ? 281 G A C8     1  
ATOM 8345   N N7     . G A 1 260 ? 74.544  89.609  103.289 1.00 0.00 ? 281 G A N7     1  
ATOM 8346   C C5     . G A 1 260 ? 75.485  89.278  104.254 1.00 0.00 ? 281 G A C5     1  
ATOM 8347   C C6     . G A 1 260 ? 76.097  90.078  105.255 1.00 0.00 ? 281 G A C6     1  
ATOM 8348   O O6     . G A 1 260 ? 75.924  91.278  105.494 1.00 0.00 ? 281 G A O6     1  
ATOM 8349   N N1     . G A 1 260 ? 76.994  89.340  106.022 1.00 0.00 ? 281 G A N1     1  
ATOM 8350   C C2     . G A 1 260 ? 77.266  88.005  105.849 1.00 0.00 ? 281 G A C2     1  
ATOM 8351   N N2     . G A 1 260 ? 78.164  87.467  106.689 1.00 0.00 ? 281 G A N2     1  
ATOM 8352   N N3     . G A 1 260 ? 76.703  87.249  104.922 1.00 0.00 ? 281 G A N3     1  
ATOM 8353   C C4     . G A 1 260 ? 75.828  87.946  104.165 1.00 0.00 ? 281 G A C4     1  
ATOM 8354   H "H5'"  . G A 1 260 ? 72.581  85.462  99.571  1.00 0.00 ? 281 G A "H5'"  1  
ATOM 8355   H "H5''" . G A 1 260 ? 71.498  84.807  100.544 1.00 0.00 ? 281 G A "H5''" 1  
ATOM 8356   H "H4'"  . G A 1 260 ? 73.643  84.131  101.166 1.00 0.00 ? 281 G A "H4'"  1  
ATOM 8357   H "H3'"  . G A 1 260 ? 72.478  85.830  103.120 1.00 0.00 ? 281 G A "H3'"  1  
ATOM 8358   H "H2'"  . G A 1 260 ? 74.295  85.472  104.476 1.00 0.00 ? 281 G A "H2'"  1  
ATOM 8359   H "HO2'" . G A 1 260 ? 75.864  83.924  104.035 1.00 0.00 ? 281 G A "HO2'" 1  
ATOM 8360   H "H1'"  . G A 1 260 ? 76.020  85.756  102.518 1.00 0.00 ? 281 G A "H1'"  1  
ATOM 8361   H H8     . G A 1 260 ? 73.712  88.415  101.892 1.00 0.00 ? 281 G A H8     1  
ATOM 8362   H H1     . G A 1 260 ? 77.466  89.812  106.738 1.00 0.00 ? 281 G A H1     1  
ATOM 8363   H H21    . G A 1 260 ? 78.585  88.020  107.380 1.00 0.00 ? 281 G A H21    1  
ATOM 8364   H H22    . G A 1 260 ? 78.399  86.517  106.615 1.00 0.00 ? 281 G A H22    1  
ATOM 8365   P P      . G A 1 261 ? 71.197  83.980  104.516 1.00 0.00 ? 282 G A P      1  
ATOM 8366   O OP1    . G A 1 261 ? 70.531  82.658  104.661 1.00 0.00 ? 282 G A OP1    1  
ATOM 8367   O OP2    . G A 1 261 ? 70.372  85.199  104.322 1.00 0.00 ? 282 G A OP2    1  
ATOM 8368   O "O5'"  . G A 1 261 ? 72.121  84.209  105.792 1.00 0.00 ? 282 G A "O5'"  1  
ATOM 8369   C "C5'"  . G A 1 261 ? 72.986  83.185  106.258 1.00 0.00 ? 282 G A "C5'"  1  
ATOM 8370   C "C4'"  . G A 1 261 ? 73.850  83.665  107.399 1.00 0.00 ? 282 G A "C4'"  1  
ATOM 8371   O "O4'"  . G A 1 261 ? 74.704  84.747  106.949 1.00 0.00 ? 282 G A "O4'"  1  
ATOM 8372   C "C3'"  . G A 1 261 ? 73.111  84.250  108.594 1.00 0.00 ? 282 G A "C3'"  1  
ATOM 8373   O "O3'"  . G A 1 261 ? 72.583  83.257  109.459 1.00 0.00 ? 282 G A "O3'"  1  
ATOM 8374   C "C2'"  . G A 1 261 ? 74.172  85.123  109.246 1.00 0.00 ? 282 G A "C2'"  1  
ATOM 8375   O "O2'"  . G A 1 261 ? 75.090  84.345  109.999 1.00 0.00 ? 282 G A "O2'"  1  
ATOM 8376   C "C1'"  . G A 1 261 ? 74.892  85.692  108.021 1.00 0.00 ? 282 G A "C1'"  1  
ATOM 8377   N N9     . G A 1 261 ? 74.385  87.026  107.648 1.00 0.00 ? 282 G A N9     1  
ATOM 8378   C C8     . G A 1 261 ? 73.561  87.337  106.594 1.00 0.00 ? 282 G A C8     1  
ATOM 8379   N N7     . G A 1 261 ? 73.284  88.610  106.519 1.00 0.00 ? 282 G A N7     1  
ATOM 8380   C C5     . G A 1 261 ? 73.963  89.175  107.587 1.00 0.00 ? 282 G A C5     1  
ATOM 8381   C C6     . G A 1 261 ? 74.040  90.524  108.019 1.00 0.00 ? 282 G A C6     1  
ATOM 8382   O O6     . G A 1 261 ? 73.505  91.523  107.524 1.00 0.00 ? 282 G A O6     1  
ATOM 8383   N N1     . G A 1 261 ? 74.841  90.656  109.150 1.00 0.00 ? 282 G A N1     1  
ATOM 8384   C C2     . G A 1 261 ? 75.487  89.622  109.784 1.00 0.00 ? 282 G A C2     1  
ATOM 8385   N N2     . G A 1 261 ? 76.215  89.946  110.862 1.00 0.00 ? 282 G A N2     1  
ATOM 8386   N N3     . G A 1 261 ? 75.422  88.360  109.391 1.00 0.00 ? 282 G A N3     1  
ATOM 8387   C C4     . G A 1 261 ? 74.650  88.211  108.297 1.00 0.00 ? 282 G A C4     1  
ATOM 8388   H "H5'"  . G A 1 261 ? 73.564  82.893  105.522 1.00 0.00 ? 282 G A "H5'"  1  
ATOM 8389   H "H5''" . G A 1 261 ? 72.448  82.423  106.562 1.00 0.00 ? 282 G A "H5''" 1  
ATOM 8390   H "H4'"  . G A 1 261 ? 74.413  82.923  107.707 1.00 0.00 ? 282 G A "H4'"  1  
ATOM 8391   H "H3'"  . G A 1 261 ? 72.380  84.818  108.274 1.00 0.00 ? 282 G A "H3'"  1  
ATOM 8392   H "H2'"  . G A 1 261 ? 73.772  85.835  109.787 1.00 0.00 ? 282 G A "H2'"  1  
ATOM 8393   H "HO2'" . G A 1 261 ? 74.682  83.478  110.206 1.00 0.00 ? 282 G A "HO2'" 1  
ATOM 8394   H "H1'"  . G A 1 261 ? 75.854  85.747  108.205 1.00 0.00 ? 282 G A "H1'"  1  
ATOM 8395   H H8     . G A 1 261 ? 73.218  86.672  105.961 1.00 0.00 ? 282 G A H8     1  
ATOM 8396   H H1     . G A 1 261 ? 74.953  91.557  109.520 1.00 0.00 ? 282 G A H1     1  
ATOM 8397   H H21    . G A 1 261 ? 76.268  90.879  111.159 1.00 0.00 ? 282 G A H21    1  
ATOM 8398   H H22    . G A 1 261 ? 76.697  89.250  111.355 1.00 0.00 ? 282 G A H22    1  
ATOM 8399   P P      . A A 1 262 ? 71.273  83.567  110.337 1.00 0.00 ? 283 A A P      1  
ATOM 8400   O OP1    . A A 1 262 ? 70.871  82.313  111.019 1.00 0.00 ? 283 A A OP1    1  
ATOM 8401   O OP2    . A A 1 262 ? 70.298  84.279  109.474 1.00 0.00 ? 283 A A OP2    1  
ATOM 8402   O "O5'"  . A A 1 262 ? 71.787  84.590  111.446 1.00 0.00 ? 283 A A "O5'"  1  
ATOM 8403   C "C5'"  . A A 1 262 ? 72.700  84.176  112.453 1.00 0.00 ? 283 A A "C5'"  1  
ATOM 8404   C "C4'"  . A A 1 262 ? 73.136  85.334  113.314 1.00 0.00 ? 283 A A "C4'"  1  
ATOM 8405   O "O4'"  . A A 1 262 ? 73.830  86.317  112.502 1.00 0.00 ? 283 A A "O4'"  1  
ATOM 8406   C "C3'"  . A A 1 262 ? 72.022  86.124  113.984 1.00 0.00 ? 283 A A "C3'"  1  
ATOM 8407   O "O3'"  . A A 1 262 ? 71.522  85.497  115.151 1.00 0.00 ? 283 A A "O3'"  1  
ATOM 8408   C "C2'"  . A A 1 262 ? 72.683  87.470  114.248 1.00 0.00 ? 283 A A "C2'"  1  
ATOM 8409   O "O2'"  . A A 1 262 ? 73.533  87.412  115.384 1.00 0.00 ? 283 A A "O2'"  1  
ATOM 8410   C "C1'"  . A A 1 262 ? 73.541  87.640  112.995 1.00 0.00 ? 283 A A "C1'"  1  
ATOM 8411   N N9     . A A 1 262 ? 72.867  88.454  111.964 1.00 0.00 ? 283 A A N9     1  
ATOM 8412   C C8     . A A 1 262 ? 72.249  88.021  110.816 1.00 0.00 ? 283 A A C8     1  
ATOM 8413   N N7     . A A 1 262 ? 71.737  88.987  110.096 1.00 0.00 ? 283 A A N7     1  
ATOM 8414   C C5     . A A 1 262 ? 72.036  90.135  110.817 1.00 0.00 ? 283 A A C5     1  
ATOM 8415   C C6     . A A 1 262 ? 71.765  91.496  110.587 1.00 0.00 ? 283 A A C6     1  
ATOM 8416   N N6     . A A 1 262 ? 71.106  91.950  109.519 1.00 0.00 ? 283 A A N6     1  
ATOM 8417   N N1     . A A 1 262 ? 72.201  92.388  111.504 1.00 0.00 ? 283 A A N1     1  
ATOM 8418   C C2     . A A 1 262 ? 72.864  91.935  112.575 1.00 0.00 ? 283 A A C2     1  
ATOM 8419   N N3     . A A 1 262 ? 73.179  90.682  112.901 1.00 0.00 ? 283 A A N3     1  
ATOM 8420   C C4     . A A 1 262 ? 72.731  89.823  111.971 1.00 0.00 ? 283 A A C4     1  
ATOM 8421   H "H5'"  . A A 1 262 ? 73.489  83.780  112.025 1.00 0.00 ? 283 A A "H5'"  1  
ATOM 8422   H "H5''" . A A 1 262 ? 72.271  83.500  113.017 1.00 0.00 ? 283 A A "H5''" 1  
ATOM 8423   H "H4'"  . A A 1 262 ? 73.748  85.003  114.005 1.00 0.00 ? 283 A A "H4'"  1  
ATOM 8424   H "H3'"  . A A 1 262 ? 71.287  86.247  113.346 1.00 0.00 ? 283 A A "H3'"  1  
ATOM 8425   H "H2'"  . A A 1 262 ? 72.018  88.187  114.328 1.00 0.00 ? 283 A A "H2'"  1  
ATOM 8426   H "HO2'" . A A 1 262 ? 73.279  86.643  115.934 1.00 0.00 ? 283 A A "HO2'" 1  
ATOM 8427   H "H1'"  . A A 1 262 ? 74.392  88.061  113.236 1.00 0.00 ? 283 A A "H1'"  1  
ATOM 8428   H H8     . A A 1 262 ? 72.198  87.076  110.560 1.00 0.00 ? 283 A A H8     1  
ATOM 8429   H H61    . A A 1 262 ? 70.947  92.912  109.413 1.00 0.00 ? 283 A A H61    1  
ATOM 8430   H H62    . A A 1 262 ? 70.780  91.322  108.841 1.00 0.00 ? 283 A A H62    1  
ATOM 8431   H H2     . A A 1 262 ? 73.160  92.620  113.209 1.00 0.00 ? 283 A A H2     1  
ATOM 8432   P P      . A A 1 263 ? 70.005  85.751  115.619 1.00 0.00 ? 284 A A P      1  
ATOM 8433   O OP1    . A A 1 263 ? 69.724  84.861  116.774 1.00 0.00 ? 284 A A OP1    1  
ATOM 8434   O OP2    . A A 1 263 ? 69.137  85.689  114.416 1.00 0.00 ? 284 A A OP2    1  
ATOM 8435   O "O5'"  . A A 1 263 ? 70.012  87.255  116.145 1.00 0.00 ? 284 A A "O5'"  1  
ATOM 8436   C "C5'"  . A A 1 263 ? 70.716  87.611  117.325 1.00 0.00 ? 284 A A "C5'"  1  
ATOM 8437   C "C4'"  . A A 1 263 ? 70.685  89.100  117.559 1.00 0.00 ? 284 A A "C4'"  1  
ATOM 8438   O "O4'"  . A A 1 263 ? 71.330  89.785  116.455 1.00 0.00 ? 284 A A "O4'"  1  
ATOM 8439   C "C3'"  . A A 1 263 ? 69.306  89.737  117.636 1.00 0.00 ? 284 A A "C3'"  1  
ATOM 8440   O "O3'"  . A A 1 263 ? 68.683  89.564  118.897 1.00 0.00 ? 284 A A "O3'"  1  
ATOM 8441   C "C2'"  . A A 1 263 ? 69.592  91.192  117.291 1.00 0.00 ? 284 A A "C2'"  1  
ATOM 8442   O "O2'"  . A A 1 263 ? 70.144  91.886  118.399 1.00 0.00 ? 284 A A "O2'"  1  
ATOM 8443   C "C1'"  . A A 1 263 ? 70.667  91.043  116.213 1.00 0.00 ? 284 A A "C1'"  1  
ATOM 8444   N N9     . A A 1 263 ? 70.102  91.101  114.851 1.00 0.00 ? 284 A A N9     1  
ATOM 8445   C C8     . A A 1 263 ? 69.880  90.057  113.986 1.00 0.00 ? 284 A A C8     1  
ATOM 8446   N N7     . A A 1 263 ? 69.363  90.424  112.840 1.00 0.00 ? 284 A A N7     1  
ATOM 8447   C C5     . A A 1 263 ? 69.236  91.802  112.957 1.00 0.00 ? 284 A A C5     1  
ATOM 8448   C C6     . A A 1 263 ? 68.752  92.787  112.077 1.00 0.00 ? 284 A A C6     1  
ATOM 8449   N N6     . A A 1 263 ? 68.283  92.522  110.854 1.00 0.00 ? 284 A A N6     1  
ATOM 8450   N N1     . A A 1 263 ? 68.761  94.069  112.502 1.00 0.00 ? 284 A A N1     1  
ATOM 8451   C C2     . A A 1 263 ? 69.230  94.334  113.728 1.00 0.00 ? 284 A A C2     1  
ATOM 8452   N N3     . A A 1 263 ? 69.712  93.496  114.643 1.00 0.00 ? 284 A A N3     1  
ATOM 8453   C C4     . A A 1 263 ? 69.687  92.230  114.191 1.00 0.00 ? 284 A A C4     1  
ATOM 8454   H "H5'"  . A A 1 263 ? 71.646  87.318  117.244 1.00 0.00 ? 284 A A "H5'"  1  
ATOM 8455   H "H5''" . A A 1 263 ? 70.305  87.159  118.092 1.00 0.00 ? 284 A A "H5''" 1  
ATOM 8456   H "H4'"  . A A 1 263 ? 71.172  89.302  118.386 1.00 0.00 ? 284 A A "H4'"  1  
ATOM 8457   H "H3'"  . A A 1 263 ? 68.734  89.349  116.939 1.00 0.00 ? 284 A A "H3'"  1  
ATOM 8458   H "H2'"  . A A 1 263 ? 68.795  91.643  116.940 1.00 0.00 ? 284 A A "H2'"  1  
ATOM 8459   H "HO2'" . A A 1 263 ? 70.248  92.831  118.165 1.00 0.00 ? 284 A A "HO2'" 1  
ATOM 8460   H "H1'"  . A A 1 263 ? 71.334  91.754  116.320 1.00 0.00 ? 284 A A "H1'"  1  
ATOM 8461   H H8     . A A 1 263 ? 70.088  89.126  114.204 1.00 0.00 ? 284 A A H8     1  
ATOM 8462   H H61    . A A 1 263 ? 67.958  93.251  110.286 1.00 0.00 ? 284 A A H61    1  
ATOM 8463   H H62    . A A 1 263 ? 68.266  91.600  110.525 1.00 0.00 ? 284 A A H62    1  
ATOM 8464   H H2     . A A 1 263 ? 69.217  95.279  113.987 1.00 0.00 ? 284 A A H2     1  
ATOM 8465   P P      . G A 1 264 ? 67.080  89.566  119.014 1.00 0.00 ? 285 G A P      1  
ATOM 8466   O OP1    . G A 1 264 ? 66.721  89.237  120.418 1.00 0.00 ? 285 G A OP1    1  
ATOM 8467   O OP2    . G A 1 264 ? 66.536  88.744  117.905 1.00 0.00 ? 285 G A OP2    1  
ATOM 8468   O "O5'"  . G A 1 264 ? 66.677  91.085  118.747 1.00 0.00 ? 285 G A "O5'"  1  
ATOM 8469   C "C5'"  . G A 1 264 ? 67.008  92.102  119.679 1.00 0.00 ? 285 G A "C5'"  1  
ATOM 8470   C "C4'"  . G A 1 264 ? 66.631  93.470  119.165 1.00 0.00 ? 285 G A "C4'"  1  
ATOM 8471   O "O4'"  . G A 1 264 ? 67.351  93.748  117.935 1.00 0.00 ? 285 G A "O4'"  1  
ATOM 8472   C "C3'"  . G A 1 264 ? 65.170  93.662  118.791 1.00 0.00 ? 285 G A "C3'"  1  
ATOM 8473   O "O3'"  . G A 1 264 ? 64.335  93.892  119.912 1.00 0.00 ? 285 G A "O3'"  1  
ATOM 8474   C "C2'"  . G A 1 264 ? 65.225  94.834  117.821 1.00 0.00 ? 285 G A "C2'"  1  
ATOM 8475   O "O2'"  . G A 1 264 ? 65.373  96.066  118.511 1.00 0.00 ? 285 G A "O2'"  1  
ATOM 8476   C "C1'"  . G A 1 264 ? 66.517  94.535  117.057 1.00 0.00 ? 285 G A "C1'"  1  
ATOM 8477   N N9     . G A 1 264 ? 66.261  93.834  115.785 1.00 0.00 ? 285 G A N9     1  
ATOM 8478   C C8     . G A 1 264 ? 66.470  92.504  115.513 1.00 0.00 ? 285 G A C8     1  
ATOM 8479   N N7     . G A 1 264 ? 66.149  92.174  114.291 1.00 0.00 ? 285 G A N7     1  
ATOM 8480   C C5     . G A 1 264 ? 65.698  93.356  113.722 1.00 0.00 ? 285 G A C5     1  
ATOM 8481   C C6     . G A 1 264 ? 65.213  93.621  112.417 1.00 0.00 ? 285 G A C6     1  
ATOM 8482   O O6     . G A 1 264 ? 65.081  92.837  111.469 1.00 0.00 ? 285 G A O6     1  
ATOM 8483   N N1     . G A 1 264 ? 64.862  94.959  112.262 1.00 0.00 ? 285 G A N1     1  
ATOM 8484   C C2     . G A 1 264 ? 64.965  95.920  113.240 1.00 0.00 ? 285 G A C2     1  
ATOM 8485   N N2     . G A 1 264 ? 64.577  97.158  112.900 1.00 0.00 ? 285 G A N2     1  
ATOM 8486   N N3     . G A 1 264 ? 65.416  95.684  114.461 1.00 0.00 ? 285 G A N3     1  
ATOM 8487   C C4     . G A 1 264 ? 65.761  94.392  114.632 1.00 0.00 ? 285 G A C4     1  
ATOM 8488   H "H5'"  . G A 1 264 ? 67.973  92.078  119.849 1.00 0.00 ? 285 G A "H5'"  1  
ATOM 8489   H "H5''" . G A 1 264 ? 66.531  91.935  120.519 1.00 0.00 ? 285 G A "H5''" 1  
ATOM 8490   H "H4'"  . G A 1 264 ? 66.878  94.139  119.835 1.00 0.00 ? 285 G A "H4'"  1  
ATOM 8491   H "H3'"  . G A 1 264 ? 64.852  92.867  118.312 1.00 0.00 ? 285 G A "H3'"  1  
ATOM 8492   H "H2'"  . G A 1 264 ? 64.451  94.844  117.222 1.00 0.00 ? 285 G A "H2'"  1  
ATOM 8493   H "HO2'" . G A 1 264 ? 65.361  96.800  117.861 1.00 0.00 ? 285 G A "HO2'" 1  
ATOM 8494   H "H1'"  . G A 1 264 ? 66.991  95.375  116.877 1.00 0.00 ? 285 G A "H1'"  1  
ATOM 8495   H H8     . G A 1 264 ? 66.827  91.867  116.167 1.00 0.00 ? 285 G A H8     1  
ATOM 8496   H H1     . G A 1 264 ? 64.516  95.237  111.387 1.00 0.00 ? 285 G A H1     1  
ATOM 8497   H H21    . G A 1 264 ? 64.243  97.340  111.998 1.00 0.00 ? 285 G A H21    1  
ATOM 8498   H H22    . G A 1 264 ? 64.627  97.885  113.557 1.00 0.00 ? 285 G A H22    1  
ATOM 8499   P P      . A A 1 265 ? 62.783  93.479  119.863 1.00 0.00 ? 286 A A P      1  
ATOM 8500   O OP1    . A A 1 265 ? 62.199  93.716  121.208 1.00 0.00 ? 286 A A OP1    1  
ATOM 8501   O OP2    . A A 1 265 ? 62.684  92.133  119.246 1.00 0.00 ? 286 A A OP2    1  
ATOM 8502   O "O5'"  . A A 1 265 ? 62.137  94.531  118.855 1.00 0.00 ? 286 A A "O5'"  1  
ATOM 8503   C "C5'"  . A A 1 265 ? 62.041  95.906  119.198 1.00 0.00 ? 286 A A "C5'"  1  
ATOM 8504   C "C4'"  . A A 1 265 ? 61.510  96.727  118.049 1.00 0.00 ? 286 A A "C4'"  1  
ATOM 8505   O "O4'"  . A A 1 265 ? 62.415  96.635  116.919 1.00 0.00 ? 286 A A "O4'"  1  
ATOM 8506   C "C3'"  . A A 1 265 ? 60.166  96.294  117.483 1.00 0.00 ? 286 A A "C3'"  1  
ATOM 8507   O "O3'"  . A A 1 265 ? 59.067  96.734  118.264 1.00 0.00 ? 286 A A "O3'"  1  
ATOM 8508   C "C2'"  . A A 1 265 ? 60.191  96.881  116.079 1.00 0.00 ? 286 A A "C2'"  1  
ATOM 8509   O "O2'"  . A A 1 265 ? 59.909  98.273  116.097 1.00 0.00 ? 286 A A "O2'"  1  
ATOM 8510   C "C1'"  . A A 1 265 ? 61.657  96.677  115.690 1.00 0.00 ? 286 A A "C1'"  1  
ATOM 8511   N N9     . A A 1 265 ? 61.857  95.452  114.894 1.00 0.00 ? 286 A A N9     1  
ATOM 8512   C C8     . A A 1 265 ? 62.380  94.251  115.308 1.00 0.00 ? 286 A A C8     1  
ATOM 8513   N N7     . A A 1 265 ? 62.431  93.343  114.366 1.00 0.00 ? 286 A A N7     1  
ATOM 8514   C C5     . A A 1 265 ? 61.903  93.988  113.255 1.00 0.00 ? 286 A A C5     1  
ATOM 8515   C C6     . A A 1 265 ? 61.684  93.567  111.931 1.00 0.00 ? 286 A A C6     1  
ATOM 8516   N N6     . A A 1 265 ? 61.978  92.343  111.485 1.00 0.00 ? 286 A A N6     1  
ATOM 8517   N N1     . A A 1 265 ? 61.144  94.455  111.070 1.00 0.00 ? 286 A A N1     1  
ATOM 8518   C C2     . A A 1 265 ? 60.848  95.682  111.516 1.00 0.00 ? 286 A A C2     1  
ATOM 8519   N N3     . A A 1 265 ? 61.008  96.196  112.734 1.00 0.00 ? 286 A A N3     1  
ATOM 8520   C C4     . A A 1 265 ? 61.547  95.286  113.566 1.00 0.00 ? 286 A A C4     1  
ATOM 8521   H "H5'"  . A A 1 265 ? 62.929  96.237  119.444 1.00 0.00 ? 286 A A "H5'"  1  
ATOM 8522   H "H5''" . A A 1 265 ? 61.439  96.002  119.965 1.00 0.00 ? 286 A A "H5''" 1  
ATOM 8523   H "H4'"  . A A 1 265 ? 61.449  97.664  118.331 1.00 0.00 ? 286 A A "H4'"  1  
ATOM 8524   H "H3'"  . A A 1 265 ? 60.144  95.315  117.422 1.00 0.00 ? 286 A A "H3'"  1  
ATOM 8525   H "H2'"  . A A 1 265 ? 59.591  96.395  115.476 1.00 0.00 ? 286 A A "H2'"  1  
ATOM 8526   H "HO2'" . A A 1 265 ? 59.454  98.494  116.936 1.00 0.00 ? 286 A A "HO2'" 1  
ATOM 8527   H "H1'"  . A A 1 265 ? 61.969  97.453  115.178 1.00 0.00 ? 286 A A "H1'"  1  
ATOM 8528   H H8     . A A 1 265 ? 62.687  94.088  116.225 1.00 0.00 ? 286 A A H8     1  
ATOM 8529   H H61    . A A 1 265 ? 61.801  92.107  110.550 1.00 0.00 ? 286 A A H61    1  
ATOM 8530   H H62    . A A 1 265 ? 62.372  91.681  112.091 1.00 0.00 ? 286 A A H62    1  
ATOM 8531   H H2     . A A 1 265 ? 60.458  96.289  110.853 1.00 0.00 ? 286 A A H2     1  
ATOM 8532   P P      . U A 1 266 ? 57.678  95.925  118.233 1.00 0.00 ? 287 U A P      1  
ATOM 8533   O OP1    . U A 1 266 ? 56.909  96.284  119.452 1.00 0.00 ? 287 U A OP1    1  
ATOM 8534   O OP2    . U A 1 266 ? 57.984  94.500  117.951 1.00 0.00 ? 287 U A OP2    1  
ATOM 8535   O "O5'"  . U A 1 266 ? 56.912  96.525  116.972 1.00 0.00 ? 287 U A "O5'"  1  
ATOM 8536   C "C5'"  . U A 1 266 ? 56.318  97.813  117.024 1.00 0.00 ? 287 U A "C5'"  1  
ATOM 8537   C "C4'"  . U A 1 266 ? 55.563  98.129  115.757 1.00 0.00 ? 287 U A "C4'"  1  
ATOM 8538   O "O4'"  . U A 1 266 ? 56.496  98.221  114.650 1.00 0.00 ? 287 U A "O4'"  1  
ATOM 8539   C "C3'"  . U A 1 266 ? 54.557  97.085  115.296 1.00 0.00 ? 287 U A "C3'"  1  
ATOM 8540   O "O3'"  . U A 1 266 ? 53.316  97.176  115.972 1.00 0.00 ? 287 U A "O3'"  1  
ATOM 8541   C "C2'"  . U A 1 266 ? 54.457  97.366  113.805 1.00 0.00 ? 287 U A "C2'"  1  
ATOM 8542   O "O2'"  . U A 1 266 ? 53.631  98.493  113.548 1.00 0.00 ? 287 U A "O2'"  1  
ATOM 8543   C "C1'"  . U A 1 266 ? 55.904  97.721  113.468 1.00 0.00 ? 287 U A "C1'"  1  
ATOM 8544   N N1     . U A 1 266 ? 56.685  96.540  113.027 1.00 0.00 ? 287 U A N1     1  
ATOM 8545   C C2     . U A 1 266 ? 56.519  96.127  111.718 1.00 0.00 ? 287 U A C2     1  
ATOM 8546   O O2     . U A 1 266 ? 55.773  96.686  110.933 1.00 0.00 ? 287 U A O2     1  
ATOM 8547   N N3     . U A 1 266 ? 57.262  95.031  111.354 1.00 0.00 ? 287 U A N3     1  
ATOM 8548   C C4     . U A 1 266 ? 58.135  94.318  112.146 1.00 0.00 ? 287 U A C4     1  
ATOM 8549   O O4     . U A 1 266 ? 58.731  93.350  111.671 1.00 0.00 ? 287 U A O4     1  
ATOM 8550   C C5     . U A 1 266 ? 58.257  94.802  113.488 1.00 0.00 ? 287 U A C5     1  
ATOM 8551   C C6     . U A 1 266 ? 57.546  95.868  113.869 1.00 0.00 ? 287 U A C6     1  
ATOM 8552   H "H5'"  . U A 1 266 ? 57.020  98.484  117.153 1.00 0.00 ? 287 U A "H5'"  1  
ATOM 8553   H "H5''" . U A 1 266 ? 55.698  97.849  117.782 1.00 0.00 ? 287 U A "H5''" 1  
ATOM 8554   H "H4'"  . U A 1 266 ? 55.110  98.991  115.866 1.00 0.00 ? 287 U A "H4'"  1  
ATOM 8555   H "H3'"  . U A 1 266 ? 54.937  96.192  115.429 1.00 0.00 ? 287 U A "H3'"  1  
ATOM 8556   H "H2'"  . U A 1 266 ? 54.155  96.576  113.310 1.00 0.00 ? 287 U A "H2'"  1  
ATOM 8557   H "HO2'" . U A 1 266 ? 53.589  98.644  112.580 1.00 0.00 ? 287 U A "HO2'" 1  
ATOM 8558   H "H1'"  . U A 1 266 ? 55.914  98.399  112.761 1.00 0.00 ? 287 U A "H1'"  1  
ATOM 8559   H H3     . U A 1 266 ? 57.159  94.722  110.430 1.00 0.00 ? 287 U A H3     1  
ATOM 8560   H H5     . U A 1 266 ? 58.857  94.355  114.121 1.00 0.00 ? 287 U A H5     1  
ATOM 8561   H H6     . U A 1 266 ? 57.645  96.179  114.792 1.00 0.00 ? 287 U A H6     1  
ATOM 8562   P P      . G A 1 267 ? 52.660  95.869  116.639 1.00 0.00 ? 288 G A P      1  
ATOM 8563   O OP1    . G A 1 267 ? 51.293  96.225  117.100 1.00 0.00 ? 288 G A OP1    1  
ATOM 8564   O OP2    . G A 1 267 ? 53.638  95.307  117.605 1.00 0.00 ? 288 G A OP2    1  
ATOM 8565   O "O5'"  . G A 1 267 ? 52.520  94.845  115.426 1.00 0.00 ? 288 G A "O5'"  1  
ATOM 8566   C "C5'"  . G A 1 267 ? 51.675  95.134  114.323 1.00 0.00 ? 288 G A "C5'"  1  
ATOM 8567   C "C4'"  . G A 1 267 ? 51.977  94.241  113.145 1.00 0.00 ? 288 G A "C4'"  1  
ATOM 8568   O "O4'"  . G A 1 267 ? 53.360  94.451  112.758 1.00 0.00 ? 288 G A "O4'"  1  
ATOM 8569   C "C3'"  . G A 1 267 ? 51.864  92.745  113.396 1.00 0.00 ? 288 G A "C3'"  1  
ATOM 8570   O "O3'"  . G A 1 267 ? 50.567  92.236  113.135 1.00 0.00 ? 288 G A "O3'"  1  
ATOM 8571   C "C2'"  . G A 1 267 ? 52.832  92.173  112.368 1.00 0.00 ? 288 G A "C2'"  1  
ATOM 8572   O "O2'"  . G A 1 267 ? 52.239  92.116  111.078 1.00 0.00 ? 288 G A "O2'"  1  
ATOM 8573   C "C1'"  . G A 1 267 ? 53.939  93.220  112.347 1.00 0.00 ? 288 G A "C1'"  1  
ATOM 8574   N N9     . G A 1 267 ? 55.044  92.879  113.263 1.00 0.00 ? 288 G A N9     1  
ATOM 8575   C C8     . G A 1 267 ? 55.195  93.278  114.569 1.00 0.00 ? 288 G A C8     1  
ATOM 8576   N N7     . G A 1 267 ? 56.280  92.814  115.126 1.00 0.00 ? 288 G A N7     1  
ATOM 8577   C C5     . G A 1 267 ? 56.883  92.062  114.128 1.00 0.00 ? 288 G A C5     1  
ATOM 8578   C C6     . G A 1 267 ? 58.090  91.315  114.141 1.00 0.00 ? 288 G A C6     1  
ATOM 8579   O O6     . G A 1 267 ? 58.893  91.166  115.069 1.00 0.00 ? 288 G A O6     1  
ATOM 8580   N N1     . G A 1 267 ? 58.328  90.704  112.913 1.00 0.00 ? 288 G A N1     1  
ATOM 8581   C C2     . G A 1 267 ? 57.510  90.798  111.814 1.00 0.00 ? 288 G A C2     1  
ATOM 8582   N N2     . G A 1 267 ? 57.908  90.136  110.717 1.00 0.00 ? 288 G A N2     1  
ATOM 8583   N N3     . G A 1 267 ? 56.383  91.490  111.789 1.00 0.00 ? 288 G A N3     1  
ATOM 8584   C C4     . G A 1 267 ? 56.133  92.091  112.971 1.00 0.00 ? 288 G A C4     1  
ATOM 8585   H "H5'"  . G A 1 267 ? 51.803  96.068  114.057 1.00 0.00 ? 288 G A "H5'"  1  
ATOM 8586   H "H5''" . G A 1 267 ? 50.741  95.004  114.592 1.00 0.00 ? 288 G A "H5''" 1  
ATOM 8587   H "H4'"  . G A 1 267 ? 51.386  94.486  112.402 1.00 0.00 ? 288 G A "H4'"  1  
ATOM 8588   H "H3'"  . G A 1 267 ? 52.193  92.544  114.296 1.00 0.00 ? 288 G A "H3'"  1  
ATOM 8589   H "H2'"  . G A 1 267 ? 53.178  91.300  112.647 1.00 0.00 ? 288 G A "H2'"  1  
ATOM 8590   H "HO2'" . G A 1 267 ? 52.923  91.860  110.424 1.00 0.00 ? 288 G A "HO2'" 1  
ATOM 8591   H "H1'"  . G A 1 267 ? 54.287  93.309  111.435 1.00 0.00 ? 288 G A "H1'"  1  
ATOM 8592   H H8     . G A 1 267 ? 54.554  93.853  115.036 1.00 0.00 ? 288 G A H8     1  
ATOM 8593   H H1     . G A 1 267 ? 59.143  90.166  112.829 1.00 0.00 ? 288 G A H1     1  
ATOM 8594   H H21    . G A 1 267 ? 58.742  89.621  110.728 1.00 0.00 ? 288 G A H21    1  
ATOM 8595   H H22    . G A 1 267 ? 57.364  90.166  109.902 1.00 0.00 ? 288 G A H22    1  
ATOM 8596   P P      . U A 1 268 ? 50.149  90.796  113.704 1.00 0.00 ? 289 U A P      1  
ATOM 8597   O OP1    . U A 1 268 ? 48.802  90.444  113.186 1.00 0.00 ? 289 U A OP1    1  
ATOM 8598   O OP2    . U A 1 268 ? 50.356  90.952  115.165 1.00 0.00 ? 289 U A OP2    1  
ATOM 8599   O "O5'"  . U A 1 268 ? 51.182  89.707  113.172 1.00 0.00 ? 289 U A "O5'"  1  
ATOM 8600   C "C5'"  . U A 1 268 ? 50.840  88.329  113.145 1.00 0.00 ? 289 U A "C5'"  1  
ATOM 8601   C "C4'"  . U A 1 268 ? 50.987  87.746  111.761 1.00 0.00 ? 289 U A "C4'"  1  
ATOM 8602   O "O4'"  . U A 1 268 ? 49.919  88.239  110.906 1.00 0.00 ? 289 U A "O4'"  1  
ATOM 8603   C "C3'"  . U A 1 268 ? 52.260  88.109  111.012 1.00 0.00 ? 289 U A "C3'"  1  
ATOM 8604   O "O3'"  . U A 1 268 ? 53.371  87.318  111.392 1.00 0.00 ? 289 U A "O3'"  1  
ATOM 8605   C "C2'"  . U A 1 268 ? 51.850  87.916  109.556 1.00 0.00 ? 289 U A "C2'"  1  
ATOM 8606   O "O2'"  . U A 1 268 ? 51.899  86.545  109.186 1.00 0.00 ? 289 U A "O2'"  1  
ATOM 8607   C "C1'"  . U A 1 268 ? 50.385  88.373  109.593 1.00 0.00 ? 289 U A "C1'"  1  
ATOM 8608   N N1     . U A 1 268 ? 50.225  89.784  109.168 1.00 0.00 ? 289 U A N1     1  
ATOM 8609   C C2     . U A 1 268 ? 50.463  90.072  107.836 1.00 0.00 ? 289 U A C2     1  
ATOM 8610   O O2     . U A 1 268 ? 50.791  89.228  107.021 1.00 0.00 ? 289 U A O2     1  
ATOM 8611   N N3     . U A 1 268 ? 50.302  91.391  107.488 1.00 0.00 ? 289 U A N3     1  
ATOM 8612   C C4     . U A 1 268 ? 49.937  92.431  108.315 1.00 0.00 ? 289 U A C4     1  
ATOM 8613   O O4     . U A 1 268 ? 49.835  93.567  107.849 1.00 0.00 ? 289 U A O4     1  
ATOM 8614   C C5     . U A 1 268 ? 49.707  92.059  109.678 1.00 0.00 ? 289 U A C5     1  
ATOM 8615   C C6     . U A 1 268 ? 49.855  90.782  110.044 1.00 0.00 ? 289 U A C6     1  
ATOM 8616   H "H5'"  . U A 1 268 ? 49.911  88.225  113.438 1.00 0.00 ? 289 U A "H5'"  1  
ATOM 8617   H "H5''" . U A 1 268 ? 51.427  87.842  113.760 1.00 0.00 ? 289 U A "H5''" 1  
ATOM 8618   H "H4'"  . U A 1 268 ? 50.921  86.771  111.818 1.00 0.00 ? 289 U A "H4'"  1  
ATOM 8619   H "H3'"  . U A 1 268 ? 52.472  89.054  111.163 1.00 0.00 ? 289 U A "H3'"  1  
ATOM 8620   H "H2'"  . U A 1 268 ? 52.386  88.473  108.955 1.00 0.00 ? 289 U A "H2'"  1  
ATOM 8621   H "HO2'" . U A 1 268 ? 52.697  86.391  108.637 1.00 0.00 ? 289 U A "HO2'" 1  
ATOM 8622   H "H1'"  . U A 1 268 ? 49.852  87.794  109.008 1.00 0.00 ? 289 U A "H1'"  1  
ATOM 8623   H H3     . U A 1 268 ? 50.466  91.617  106.549 1.00 0.00 ? 289 U A H3     1  
ATOM 8624   H H5     . U A 1 268 ? 49.442  92.735  110.336 1.00 0.00 ? 289 U A H5     1  
ATOM 8625   H H6     . U A 1 268 ? 49.693  90.553  110.982 1.00 0.00 ? 289 U A H6     1  
ATOM 8626   P P      . A A 1 269 ? 54.785  88.010  111.716 1.00 0.00 ? 290 A A P      1  
ATOM 8627   O OP1    . A A 1 269 ? 55.596  87.052  112.509 1.00 0.00 ? 290 A A OP1    1  
ATOM 8628   O OP2    . A A 1 269 ? 54.520  89.368  112.253 1.00 0.00 ? 290 A A OP2    1  
ATOM 8629   O "O5'"  . A A 1 269 ? 55.471  88.171  110.287 1.00 0.00 ? 290 A A "O5'"  1  
ATOM 8630   C "C5'"  . A A 1 269 ? 55.981  87.043  109.592 1.00 0.00 ? 290 A A "C5'"  1  
ATOM 8631   C "C4'"  . A A 1 269 ? 55.680  87.119  108.116 1.00 0.00 ? 290 A A "C4'"  1  
ATOM 8632   O "O4'"  . A A 1 269 ? 54.330  87.624  107.926 1.00 0.00 ? 290 A A "O4'"  1  
ATOM 8633   C "C3'"  . A A 1 269 ? 56.551  88.067  107.305 1.00 0.00 ? 290 A A "C3'"  1  
ATOM 8634   O "O3'"  . A A 1 269 ? 57.707  87.443  106.776 1.00 0.00 ? 290 A A "O3'"  1  
ATOM 8635   C "C2'"  . A A 1 269 ? 55.617  88.489  106.184 1.00 0.00 ? 290 A A "C2'"  1  
ATOM 8636   O "O2'"  . A A 1 269 ? 55.520  87.480  105.189 1.00 0.00 ? 290 A A "O2'"  1  
ATOM 8637   C "C1'"  . A A 1 269 ? 54.279  88.592  106.911 1.00 0.00 ? 290 A A "C1'"  1  
ATOM 8638   N N9     . A A 1 269 ? 54.083  89.918  107.528 1.00 0.00 ? 290 A A N9     1  
ATOM 8639   C C8     . A A 1 269 ? 54.307  90.283  108.833 1.00 0.00 ? 290 A A C8     1  
ATOM 8640   N N7     . A A 1 269 ? 54.039  91.540  109.083 1.00 0.00 ? 290 A A N7     1  
ATOM 8641   C C5     . A A 1 269 ? 53.608  92.039  107.861 1.00 0.00 ? 290 A A C5     1  
ATOM 8642   C C6     . A A 1 269 ? 53.173  93.314  107.459 1.00 0.00 ? 290 A A C6     1  
ATOM 8643   N N6     . A A 1 269 ? 53.100  94.364  108.279 1.00 0.00 ? 290 A A N6     1  
ATOM 8644   N N1     . A A 1 269 ? 52.813  93.476  106.167 1.00 0.00 ? 290 A A N1     1  
ATOM 8645   C C2     . A A 1 269 ? 52.887  92.423  105.343 1.00 0.00 ? 290 A A C2     1  
ATOM 8646   N N3     . A A 1 269 ? 53.279  91.178  105.604 1.00 0.00 ? 290 A A N3     1  
ATOM 8647   C C4     . A A 1 269 ? 53.630  91.050  106.896 1.00 0.00 ? 290 A A C4     1  
ATOM 8648   H "H5'"  . A A 1 269 ? 55.575  86.230  109.959 1.00 0.00 ? 290 A A "H5'"  1  
ATOM 8649   H "H5''" . A A 1 269 ? 56.952  87.000  109.718 1.00 0.00 ? 290 A A "H5''" 1  
ATOM 8650   H "H4'"  . A A 1 269 ? 55.741  86.222  107.726 1.00 0.00 ? 290 A A "H4'"  1  
ATOM 8651   H "H3'"  . A A 1 269 ? 56.821  88.842  107.842 1.00 0.00 ? 290 A A "H3'"  1  
ATOM 8652   H "H2'"  . A A 1 269 ? 55.881  89.352  105.802 1.00 0.00 ? 290 A A "H2'"  1  
ATOM 8653   H "HO2'" . A A 1 269 ? 54.911  87.785  104.485 1.00 0.00 ? 290 A A "HO2'" 1  
ATOM 8654   H "H1'"  . A A 1 269 ? 53.550  88.415  106.279 1.00 0.00 ? 290 A A "H1'"  1  
ATOM 8655   H H8     . A A 1 269 ? 54.639  89.660  109.514 1.00 0.00 ? 290 A A H8     1  
ATOM 8656   H H61    . A A 1 269 ? 52.788  95.230  107.940 1.00 0.00 ? 290 A A H61    1  
ATOM 8657   H H62    . A A 1 269 ? 53.355  94.270  109.221 1.00 0.00 ? 290 A A H62    1  
ATOM 8658   H H2     . A A 1 269 ? 52.615  92.594  104.417 1.00 0.00 ? 290 A A H2     1  
ATOM 8659   P P      . U A 1 270 ? 59.066  88.282  106.593 1.00 0.00 ? 291 U A P      1  
ATOM 8660   O OP1    . U A 1 270 ? 60.117  87.353  106.104 1.00 0.00 ? 291 U A OP1    1  
ATOM 8661   O OP2    . U A 1 270 ? 59.295  89.061  107.835 1.00 0.00 ? 291 U A OP2    1  
ATOM 8662   O "O5'"  . U A 1 270 ? 58.730  89.307  105.421 1.00 0.00 ? 291 U A "O5'"  1  
ATOM 8663   C "C5'"  . U A 1 270 ? 58.568  88.860  104.084 1.00 0.00 ? 291 U A "C5'"  1  
ATOM 8664   C "C4'"  . U A 1 270 ? 57.812  89.863  103.248 1.00 0.00 ? 291 U A "C4'"  1  
ATOM 8665   O "O4'"  . U A 1 270 ? 56.618  90.248  103.968 1.00 0.00 ? 291 U A "O4'"  1  
ATOM 8666   C "C3'"  . U A 1 270 ? 58.525  91.178  102.972 1.00 0.00 ? 291 U A "C3'"  1  
ATOM 8667   O "O3'"  . U A 1 270 ? 59.321  91.141  101.801 1.00 0.00 ? 291 U A "O3'"  1  
ATOM 8668   C "C2'"  . U A 1 270 ? 57.378  92.163  102.855 1.00 0.00 ? 291 U A "C2'"  1  
ATOM 8669   O "O2'"  . U A 1 270 ? 56.780  92.106  101.567 1.00 0.00 ? 291 U A "O2'"  1  
ATOM 8670   C "C1'"  . U A 1 270 ? 56.390  91.625  103.875 1.00 0.00 ? 291 U A "C1'"  1  
ATOM 8671   N N1     . U A 1 270 ? 56.564  92.248  105.210 1.00 0.00 ? 291 U A N1     1  
ATOM 8672   C C2     . U A 1 270 ? 56.081  93.533  105.374 1.00 0.00 ? 291 U A C2     1  
ATOM 8673   O O2     . U A 1 270 ? 55.530  94.156  104.484 1.00 0.00 ? 291 U A O2     1  
ATOM 8674   N N3     . U A 1 270 ? 56.264  94.068  106.626 1.00 0.00 ? 291 U A N3     1  
ATOM 8675   C C4     . U A 1 270 ? 56.869  93.465  107.708 1.00 0.00 ? 291 U A C4     1  
ATOM 8676   O O4     . U A 1 270 ? 56.958  94.081  108.771 1.00 0.00 ? 291 U A O4     1  
ATOM 8677   C C5     . U A 1 270 ? 57.344  92.137  107.464 1.00 0.00 ? 291 U A C5     1  
ATOM 8678   C C6     . U A 1 270 ? 57.178  91.591  106.255 1.00 0.00 ? 291 U A C6     1  
ATOM 8679   H "H5'"  . U A 1 270 ? 58.076  88.012  104.088 1.00 0.00 ? 291 U A "H5'"  1  
ATOM 8680   H "H5''" . U A 1 270 ? 59.452  88.714  103.686 1.00 0.00 ? 291 U A "H5''" 1  
ATOM 8681   H "H4'"  . U A 1 270 ? 57.549  89.461  102.395 1.00 0.00 ? 291 U A "H4'"  1  
ATOM 8682   H "H3'"  . U A 1 270 ? 59.089  91.416  103.737 1.00 0.00 ? 291 U A "H3'"  1  
ATOM 8683   H "H2'"  . U A 1 270 ? 57.661  93.073  103.082 1.00 0.00 ? 291 U A "H2'"  1  
ATOM 8684   H "HO2'" . U A 1 270 ? 57.422  91.722  100.934 1.00 0.00 ? 291 U A "HO2'" 1  
ATOM 8685   H "H1'"  . U A 1 270 ? 55.476  91.789  103.557 1.00 0.00 ? 291 U A "H1'"  1  
ATOM 8686   H H3     . U A 1 270 ? 55.930  94.979  106.764 1.00 0.00 ? 291 U A H3     1  
ATOM 8687   H H5     . U A 1 270 ? 57.786  91.633  108.179 1.00 0.00 ? 291 U A H5     1  
ATOM 8688   H H6     . U A 1 270 ? 57.512  90.682  106.114 1.00 0.00 ? 291 U A H6     1  
ATOM 8689   P P      . U A 1 271 ? 60.767  91.843  101.784 1.00 0.00 ? 292 U A P      1  
ATOM 8690   O OP1    . U A 1 271 ? 61.094  92.187  100.376 1.00 0.00 ? 292 U A OP1    1  
ATOM 8691   O OP2    . U A 1 271 ? 61.699  90.994  102.567 1.00 0.00 ? 292 U A OP2    1  
ATOM 8692   O "O5'"  . U A 1 271 ? 60.545  93.203  102.585 1.00 0.00 ? 292 U A "O5'"  1  
ATOM 8693   C "C5'"  . U A 1 271 ? 59.825  94.280  102.009 1.00 0.00 ? 292 U A "C5'"  1  
ATOM 8694   C "C4'"  . U A 1 271 ? 59.553  95.371  103.015 1.00 0.00 ? 292 U A "C4'"  1  
ATOM 8695   O "O4'"  . U A 1 271 ? 58.805  94.835  104.138 1.00 0.00 ? 292 U A "O4'"  1  
ATOM 8696   C "C3'"  . U A 1 271 ? 60.775  96.010  103.656 1.00 0.00 ? 292 U A "C3'"  1  
ATOM 8697   O "O3'"  . U A 1 271 ? 61.367  97.012  102.847 1.00 0.00 ? 292 U A "O3'"  1  
ATOM 8698   C "C2'"  . U A 1 271 ? 60.221  96.536  104.974 1.00 0.00 ? 292 U A "C2'"  1  
ATOM 8699   O "O2'"  . U A 1 271 ? 59.497  97.741  104.784 1.00 0.00 ? 292 U A "O2'"  1  
ATOM 8700   C "C1'"  . U A 1 271 ? 59.245  95.424  105.359 1.00 0.00 ? 292 U A "C1'"  1  
ATOM 8701   N N1     . U A 1 271 ? 59.873  94.399  106.228 1.00 0.00 ? 292 U A N1     1  
ATOM 8702   C C2     . U A 1 271 ? 60.036  94.717  107.564 1.00 0.00 ? 292 U A C2     1  
ATOM 8703   O O2     . U A 1 271 ? 59.689  95.784  108.041 1.00 0.00 ? 292 U A O2     1  
ATOM 8704   N N3     . U A 1 271 ? 60.621  93.739  108.330 1.00 0.00 ? 292 U A N3     1  
ATOM 8705   C C4     . U A 1 271 ? 61.053  92.499  107.906 1.00 0.00 ? 292 U A C4     1  
ATOM 8706   O O4     . U A 1 271 ? 61.561  91.727  108.720 1.00 0.00 ? 292 U A O4     1  
ATOM 8707   C C5     . U A 1 271 ? 60.852  92.239  106.515 1.00 0.00 ? 292 U A C5     1  
ATOM 8708   C C6     . U A 1 271 ? 60.283  93.174  105.746 1.00 0.00 ? 292 U A C6     1  
ATOM 8709   H "H5'"  . U A 1 271 ? 58.969  93.944  101.665 1.00 0.00 ? 292 U A "H5'"  1  
ATOM 8710   H "H5''" . U A 1 271 ? 60.344  94.652  101.267 1.00 0.00 ? 292 U A "H5''" 1  
ATOM 8711   H "H4'"  . U A 1 271 ? 59.020  96.071  102.582 1.00 0.00 ? 292 U A "H4'"  1  
ATOM 8712   H "H3'"  . U A 1 271 ? 61.441  95.315  103.844 1.00 0.00 ? 292 U A "H3'"  1  
ATOM 8713   H "H2'"  . U A 1 271 ? 60.929  96.640  105.645 1.00 0.00 ? 292 U A "H2'"  1  
ATOM 8714   H "HO2'" . U A 1 271 ? 59.766  98.144  103.932 1.00 0.00 ? 292 U A "HO2'" 1  
ATOM 8715   H "H1'"  . U A 1 271 ? 58.476  95.814  105.825 1.00 0.00 ? 292 U A "H1'"  1  
ATOM 8716   H H3     . U A 1 271 ? 60.745  93.944  109.279 1.00 0.00 ? 292 U A H3     1  
ATOM 8717   H H5     . U A 1 271 ? 61.129  91.381  106.127 1.00 0.00 ? 292 U A H5     1  
ATOM 8718   H H6     . U A 1 271 ? 60.158  92.973  104.796 1.00 0.00 ? 292 U A H6     1  
ATOM 8719   P P      . C A 1 272 ? 62.950  97.273  102.909 1.00 0.00 ? 293 C A P      1  
ATOM 8720   O OP1    . C A 1 272 ? 63.312  98.175  101.786 1.00 0.00 ? 293 C A OP1    1  
ATOM 8721   O OP2    . C A 1 272 ? 63.629  95.960  103.044 1.00 0.00 ? 293 C A OP2    1  
ATOM 8722   O "O5'"  . C A 1 272 ? 63.156  98.078  104.270 1.00 0.00 ? 293 C A "O5'"  1  
ATOM 8723   C "C5'"  . C A 1 272 ? 62.671  99.404  104.414 1.00 0.00 ? 293 C A "C5'"  1  
ATOM 8724   C "C4'"  . C A 1 272 ? 62.815  99.899  105.832 1.00 0.00 ? 293 C A "C4'"  1  
ATOM 8725   O "O4'"  . C A 1 272 ? 62.058  99.048  106.731 1.00 0.00 ? 293 C A "O4'"  1  
ATOM 8726   C "C3'"  . C A 1 272 ? 64.222  99.885  106.409 1.00 0.00 ? 293 C A "C3'"  1  
ATOM 8727   O "O3'"  . C A 1 272 ? 64.993  101.009 106.017 1.00 0.00 ? 293 C A "O3'"  1  
ATOM 8728   C "C2'"  . C A 1 272 ? 63.969  99.812  107.907 1.00 0.00 ? 293 C A "C2'"  1  
ATOM 8729   O "O2'"  . C A 1 272 ? 63.600  101.079 108.429 1.00 0.00 ? 293 C A "O2'"  1  
ATOM 8730   C "C1'"  . C A 1 272 ? 62.757  98.879  107.965 1.00 0.00 ? 293 C A "C1'"  1  
ATOM 8731   N N1     . C A 1 272 ? 63.146  97.460  108.153 1.00 0.00 ? 293 C A N1     1  
ATOM 8732   C C2     . C A 1 272 ? 63.516  97.037  109.437 1.00 0.00 ? 293 C A C2     1  
ATOM 8733   O O2     . C A 1 272 ? 63.507  97.853  110.370 1.00 0.00 ? 293 C A O2     1  
ATOM 8734   N N3     . C A 1 272 ? 63.875  95.748  109.636 1.00 0.00 ? 293 C A N3     1  
ATOM 8735   C C4     . C A 1 272 ? 63.876  94.890  108.616 1.00 0.00 ? 293 C A C4     1  
ATOM 8736   N N4     . C A 1 272 ? 64.239  93.627  108.859 1.00 0.00 ? 293 C A N4     1  
ATOM 8737   C C5     . C A 1 272 ? 63.509  95.288  107.301 1.00 0.00 ? 293 C A C5     1  
ATOM 8738   C C6     . C A 1 272 ? 63.153  96.565  107.117 1.00 0.00 ? 293 C A C6     1  
ATOM 8739   H "H5'"  . C A 1 272 ? 61.726  99.429  104.162 1.00 0.00 ? 293 C A "H5'"  1  
ATOM 8740   H "H5''" . C A 1 272 ? 63.177  99.994  103.817 1.00 0.00 ? 293 C A "H5''" 1  
ATOM 8741   H "H4'"  . C A 1 272 ? 62.460  100.812 105.883 1.00 0.00 ? 293 C A "H4'"  1  
ATOM 8742   H "H3'"  . C A 1 272 ? 64.680  99.067  106.120 1.00 0.00 ? 293 C A "H3'"  1  
ATOM 8743   H "H2'"  . C A 1 272 ? 64.737  99.431  108.385 1.00 0.00 ? 293 C A "H2'"  1  
ATOM 8744   H "HO2'" . C A 1 272 ? 63.501  101.006 109.402 1.00 0.00 ? 293 C A "HO2'" 1  
ATOM 8745   H "H1'"  . C A 1 272 ? 62.169  99.154  108.700 1.00 0.00 ? 293 C A "H1'"  1  
ATOM 8746   H H41    . C A 1 272 ? 64.492  93.356  109.766 1.00 0.00 ? 293 C A H41    1  
ATOM 8747   H H42    . C A 1 272 ? 64.251  92.972  108.131 1.00 0.00 ? 293 C A H42    1  
ATOM 8748   H H5     . C A 1 272 ? 63.513  94.650  106.557 1.00 0.00 ? 293 C A H5     1  
ATOM 8749   H H6     . C A 1 272 ? 62.896  96.859  106.217 1.00 0.00 ? 293 C A H6     1  
ATOM 8750   P P      . U A 1 273 ? 66.591  100.892 105.894 1.00 0.00 ? 294 U A P      1  
ATOM 8751   O OP1    . U A 1 273 ? 67.097  102.136 105.263 1.00 0.00 ? 294 U A OP1    1  
ATOM 8752   O OP2    . U A 1 273 ? 66.909  99.576  105.282 1.00 0.00 ? 294 U A OP2    1  
ATOM 8753   O "O5'"  . U A 1 273 ? 67.091  100.865 107.406 1.00 0.00 ? 294 U A "O5'"  1  
ATOM 8754   C "C5'"  . U A 1 273 ? 66.963  102.009 108.236 1.00 0.00 ? 294 U A "C5'"  1  
ATOM 8755   C "C4'"  . U A 1 273 ? 67.394  101.720 109.654 1.00 0.00 ? 294 U A "C4'"  1  
ATOM 8756   O "O4'"  . U A 1 273 ? 66.543  100.694 110.229 1.00 0.00 ? 294 U A "O4'"  1  
ATOM 8757   C "C3'"  . U A 1 273 ? 68.803  101.173 109.828 1.00 0.00 ? 294 U A "C3'"  1  
ATOM 8758   O "O3'"  . U A 1 273 ? 69.796  102.184 109.807 1.00 0.00 ? 294 U A "O3'"  1  
ATOM 8759   C "C2'"  . U A 1 273 ? 68.711  100.436 111.158 1.00 0.00 ? 294 U A "C2'"  1  
ATOM 8760   O "O2'"  . U A 1 273 ? 68.758  101.339 112.253 1.00 0.00 ? 294 U A "O2'"  1  
ATOM 8761   C "C1'"  . U A 1 273 ? 67.308  99.830  111.073 1.00 0.00 ? 294 U A "C1'"  1  
ATOM 8762   N N1     . U A 1 273 ? 67.322  98.454  110.522 1.00 0.00 ? 294 U A N1     1  
ATOM 8763   C C2     . U A 1 273 ? 67.713  97.437  111.374 1.00 0.00 ? 294 U A C2     1  
ATOM 8764   O O2     . U A 1 273 ? 68.037  97.627  112.533 1.00 0.00 ? 294 U A O2     1  
ATOM 8765   N N3     . U A 1 273 ? 67.710  96.179  110.821 1.00 0.00 ? 294 U A N3     1  
ATOM 8766   C C4     . U A 1 273 ? 67.366  95.840  109.531 1.00 0.00 ? 294 U A C4     1  
ATOM 8767   O O4     . U A 1 273 ? 67.415  94.659  109.181 1.00 0.00 ? 294 U A O4     1  
ATOM 8768   C C5     . U A 1 273 ? 66.973  96.942  108.707 1.00 0.00 ? 294 U A C5     1  
ATOM 8769   C C6     . U A 1 273 ? 66.965  98.176  109.219 1.00 0.00 ? 294 U A C6     1  
ATOM 8770   H "H5'"  . U A 1 273 ? 66.028  102.298 108.240 1.00 0.00 ? 294 U A "H5'"  1  
ATOM 8771   H "H5''" . U A 1 273 ? 67.521  102.730 107.875 1.00 0.00 ? 294 U A "H5''" 1  
ATOM 8772   H "H4'"  . U A 1 273 ? 67.305  102.541 110.181 1.00 0.00 ? 294 U A "H4'"  1  
ATOM 8773   H "H3'"  . U A 1 273 ? 68.987  100.526 109.115 1.00 0.00 ? 294 U A "H3'"  1  
ATOM 8774   H "H2'"  . U A 1 273 ? 69.397  99.740  111.231 1.00 0.00 ? 294 U A "H2'"  1  
ATOM 8775   H "HO2'" . U A 1 273 ? 68.782  100.827 113.087 1.00 0.00 ? 294 U A "HO2'" 1  
ATOM 8776   H "H1'"  . U A 1 273 ? 66.906  99.816  111.965 1.00 0.00 ? 294 U A "H1'"  1  
ATOM 8777   H H3     . U A 1 273 ? 67.985  95.444  111.408 1.00 0.00 ? 294 U A H3     1  
ATOM 8778   H H5     . U A 1 273 ? 66.710  96.791  107.773 1.00 0.00 ? 294 U A H5     1  
ATOM 8779   H H6     . U A 1 273 ? 66.693  98.912  108.635 1.00 0.00 ? 294 U A H6     1  
ATOM 8780   P P      . U A 1 274 ? 71.279  101.851 109.280 1.00 0.00 ? 295 U A P      1  
ATOM 8781   O OP1    . U A 1 274 ? 72.027  103.130 109.178 1.00 0.00 ? 295 U A OP1    1  
ATOM 8782   O OP2    . U A 1 274 ? 71.155  100.975 108.088 1.00 0.00 ? 295 U A OP2    1  
ATOM 8783   O "O5'"  . U A 1 274 ? 71.923  100.996 110.458 1.00 0.00 ? 295 U A "O5'"  1  
ATOM 8784   C "C5'"  . U A 1 274 ? 72.202  101.584 111.720 1.00 0.00 ? 295 U A "C5'"  1  
ATOM 8785   C "C4'"  . U A 1 274 ? 72.701  100.563 112.712 1.00 0.00 ? 295 U A "C4'"  1  
ATOM 8786   O "O4'"  . U A 1 274 ? 71.677  99.564  112.952 1.00 0.00 ? 295 U A "O4'"  1  
ATOM 8787   C "C3'"  . U A 1 274 ? 73.916  99.753  112.287 1.00 0.00 ? 295 U A "C3'"  1  
ATOM 8788   O "O3'"  . U A 1 274 ? 75.139  100.442 112.483 1.00 0.00 ? 295 U A "O3'"  1  
ATOM 8789   C "C2'"  . U A 1 274 ? 73.785  98.492  113.128 1.00 0.00 ? 295 U A "C2'"  1  
ATOM 8790   O "O2'"  . U A 1 274 ? 74.210  98.715  114.466 1.00 0.00 ? 295 U A "O2'"  1  
ATOM 8791   C "C1'"  . U A 1 274 ? 72.271  98.275  113.117 1.00 0.00 ? 295 U A "C1'"  1  
ATOM 8792   N N1     . U A 1 274 ? 71.840  97.364  112.029 1.00 0.00 ? 295 U A N1     1  
ATOM 8793   C C2     . U A 1 274 ? 72.030  96.008  112.229 1.00 0.00 ? 295 U A C2     1  
ATOM 8794   O O2     . U A 1 274 ? 72.527  95.548  113.242 1.00 0.00 ? 295 U A O2     1  
ATOM 8795   N N3     . U A 1 274 ? 71.616  95.204  111.197 1.00 0.00 ? 295 U A N3     1  
ATOM 8796   C C4     . U A 1 274 ? 71.044  95.604  110.007 1.00 0.00 ? 295 U A C4     1  
ATOM 8797   O O4     . U A 1 274 ? 70.725  94.756  109.173 1.00 0.00 ? 295 U A O4     1  
ATOM 8798   C C5     . U A 1 274 ? 70.878  97.019  109.870 1.00 0.00 ? 295 U A C5     1  
ATOM 8799   C C6     . U A 1 274 ? 71.272  97.826  110.862 1.00 0.00 ? 295 U A C6     1  
ATOM 8800   H "H5'"  . U A 1 274 ? 71.383  101.995 112.069 1.00 0.00 ? 295 U A "H5'"  1  
ATOM 8801   H "H5''" . U A 1 274 ? 72.885  102.277 111.604 1.00 0.00 ? 295 U A "H5''" 1  
ATOM 8802   H "H4'"  . U A 1 274 ? 72.904  101.020 113.556 1.00 0.00 ? 295 U A "H4'"  1  
ATOM 8803   H "H3'"  . U A 1 274 ? 73.829  99.517  111.340 1.00 0.00 ? 295 U A "H3'"  1  
ATOM 8804   H "H2'"  . U A 1 274 ? 74.257  97.736  112.719 1.00 0.00 ? 295 U A "H2'"  1  
ATOM 8805   H "HO2'" . U A 1 274 ? 74.191  97.867  114.952 1.00 0.00 ? 295 U A "HO2'" 1  
ATOM 8806   H "H1'"  . U A 1 274 ? 71.989  97.902  113.980 1.00 0.00 ? 295 U A "H1'"  1  
ATOM 8807   H H3     . U A 1 274 ? 71.742  94.239  111.317 1.00 0.00 ? 295 U A H3     1  
ATOM 8808   H H5     . U A 1 274 ? 70.479  97.393  109.057 1.00 0.00 ? 295 U A H5     1  
ATOM 8809   H H6     . U A 1 274 ? 71.148  98.789  110.744 1.00 0.00 ? 295 U A H6     1  
ATOM 8810   P P      . C A 1 275 ? 76.394  100.156 111.521 1.00 0.00 ? 296 C A P      1  
ATOM 8811   O OP1    . C A 1 275 ? 77.440  101.166 111.818 1.00 0.00 ? 296 C A OP1    1  
ATOM 8812   O OP2    . C A 1 275 ? 75.886  100.010 110.134 1.00 0.00 ? 296 C A OP2    1  
ATOM 8813   O "O5'"  . C A 1 275 ? 76.932  98.736  112.002 1.00 0.00 ? 296 C A "O5'"  1  
ATOM 8814   C "C5'"  . C A 1 275 ? 77.538  98.577  113.276 1.00 0.00 ? 296 C A "C5'"  1  
ATOM 8815   C "C4'"  . C A 1 275 ? 77.892  97.137  113.551 1.00 0.00 ? 296 C A "C4'"  1  
ATOM 8816   O "O4'"  . C A 1 275 ? 76.684  96.332  113.591 1.00 0.00 ? 296 C A "O4'"  1  
ATOM 8817   C "C3'"  . C A 1 275 ? 78.759  96.448  112.507 1.00 0.00 ? 296 C A "C3'"  1  
ATOM 8818   O "O3'"  . C A 1 275 ? 80.138  96.742  112.651 1.00 0.00 ? 296 C A "O3'"  1  
ATOM 8819   C "C2'"  . C A 1 275 ? 78.424  94.979  112.714 1.00 0.00 ? 296 C A "C2'"  1  
ATOM 8820   O "O2'"  . C A 1 275 ? 79.100  94.448  113.845 1.00 0.00 ? 296 C A "O2'"  1  
ATOM 8821   C "C1'"  . C A 1 275 ? 76.926  95.045  113.018 1.00 0.00 ? 296 C A "C1'"  1  
ATOM 8822   N N1     . C A 1 275 ? 76.095  94.861  111.802 1.00 0.00 ? 296 C A N1     1  
ATOM 8823   C C2     . C A 1 275 ? 75.908  93.562  111.316 1.00 0.00 ? 296 C A C2     1  
ATOM 8824   O O2     . C A 1 275 ? 76.439  92.610  111.909 1.00 0.00 ? 296 C A O2     1  
ATOM 8825   N N3     . C A 1 275 ? 75.155  93.365  110.210 1.00 0.00 ? 296 C A N3     1  
ATOM 8826   C C4     . C A 1 275 ? 74.595  94.405  109.589 1.00 0.00 ? 296 C A C4     1  
ATOM 8827   N N4     . C A 1 275 ? 73.861  94.164  108.501 1.00 0.00 ? 296 C A N4     1  
ATOM 8828   C C5     . C A 1 275 ? 74.768  95.737  110.058 1.00 0.00 ? 296 C A C5     1  
ATOM 8829   C C6     . C A 1 275 ? 75.515  95.920  111.154 1.00 0.00 ? 296 C A C6     1  
ATOM 8830   H "H5'"  . C A 1 275 ? 76.918  98.892  113.966 1.00 0.00 ? 296 C A "H5'"  1  
ATOM 8831   H "H5''" . C A 1 275 ? 78.355  99.119  113.309 1.00 0.00 ? 296 C A "H5''" 1  
ATOM 8832   H "H4'"  . C A 1 275 ? 78.340  97.083  114.420 1.00 0.00 ? 296 C A "H4'"  1  
ATOM 8833   H "H3'"  . C A 1 275 ? 78.464  96.721  111.613 1.00 0.00 ? 296 C A "H3'"  1  
ATOM 8834   H "H2'"  . C A 1 275 ? 78.601  94.451  111.906 1.00 0.00 ? 296 C A "H2'"  1  
ATOM 8835   H "HO2'" . C A 1 275 ? 78.916  93.488  113.906 1.00 0.00 ? 296 C A "HO2'" 1  
ATOM 8836   H "H1'"  . C A 1 275 ? 76.696  94.358  113.677 1.00 0.00 ? 296 C A "H1'"  1  
ATOM 8837   H H41    . C A 1 275 ? 73.745  93.244  108.182 1.00 0.00 ? 296 C A H41    1  
ATOM 8838   H H42    . C A 1 275 ? 73.436  94.906  108.023 1.00 0.00 ? 296 C A H42    1  
ATOM 8839   H H5     . C A 1 275 ? 74.353  96.495  109.595 1.00 0.00 ? 296 C A H5     1  
ATOM 8840   H H6     . C A 1 275 ? 75.644  96.829  111.492 1.00 0.00 ? 296 C A H6     1  
ATOM 8841   P P      . U A 1 276 ? 81.089  96.816  111.358 1.00 0.00 ? 297 U A P      1  
ATOM 8842   O OP1    . U A 1 276 ? 82.422  97.304  111.793 1.00 0.00 ? 297 U A OP1    1  
ATOM 8843   O OP2    . U A 1 276 ? 80.354  97.536  110.288 1.00 0.00 ? 297 U A OP2    1  
ATOM 8844   O "O5'"  . U A 1 276 ? 81.244  95.294  110.908 1.00 0.00 ? 297 U A "O5'"  1  
ATOM 8845   C "C5'"  . U A 1 276 ? 81.911  94.353  111.737 1.00 0.00 ? 297 U A "C5'"  1  
ATOM 8846   C "C4'"  . U A 1 276 ? 81.691  92.938  111.261 1.00 0.00 ? 297 U A "C4'"  1  
ATOM 8847   O "O4'"  . U A 1 276 ? 80.274  92.628  111.271 1.00 0.00 ? 297 U A "O4'"  1  
ATOM 8848   C "C3'"  . U A 1 276 ? 82.126  92.635  109.836 1.00 0.00 ? 297 U A "C3'"  1  
ATOM 8849   O "O3'"  . U A 1 276 ? 83.511  92.359  109.725 1.00 0.00 ? 297 U A "O3'"  1  
ATOM 8850   C "C2'"  . U A 1 276 ? 81.236  91.457  109.460 1.00 0.00 ? 297 U A "C2'"  1  
ATOM 8851   O "O2'"  . U A 1 276 ? 81.715  90.248  110.029 1.00 0.00 ? 297 U A "O2'"  1  
ATOM 8852   C "C1'"  . U A 1 276 ? 79.921  91.841  110.141 1.00 0.00 ? 297 U A "C1'"  1  
ATOM 8853   N N1     . U A 1 276 ? 79.019  92.598  109.240 1.00 0.00 ? 297 U A N1     1  
ATOM 8854   C C2     . U A 1 276 ? 78.300  91.869  108.309 1.00 0.00 ? 297 U A C2     1  
ATOM 8855   O O2     . U A 1 276 ? 78.380  90.656  108.207 1.00 0.00 ? 297 U A O2     1  
ATOM 8856   N N3     . U A 1 276 ? 77.479  92.611  107.498 1.00 0.00 ? 297 U A N3     1  
ATOM 8857   C C4     . U A 1 276 ? 77.304  93.979  107.517 1.00 0.00 ? 297 U A C4     1  
ATOM 8858   O O4     . U A 1 276 ? 76.527  94.501  106.717 1.00 0.00 ? 297 U A O4     1  
ATOM 8859   C C5     . U A 1 276 ? 78.079  94.666  108.505 1.00 0.00 ? 297 U A C5     1  
ATOM 8860   C C6     . U A 1 276 ? 78.887  93.968  109.310 1.00 0.00 ? 297 U A C6     1  
ATOM 8861   H "H5'"  . U A 1 276 ? 81.574  94.438  112.653 1.00 0.00 ? 297 U A "H5'"  1  
ATOM 8862   H "H5''" . U A 1 276 ? 82.871  94.546  111.730 1.00 0.00 ? 297 U A "H5''" 1  
ATOM 8863   H "H4'"  . U A 1 276 ? 82.155  92.328  111.871 1.00 0.00 ? 297 U A "H4'"  1  
ATOM 8864   H "H3'"  . U A 1 276 ? 81.905  93.399  109.263 1.00 0.00 ? 297 U A "H3'"  1  
ATOM 8865   H "H2'"  . U A 1 276 ? 81.128  91.385  108.488 1.00 0.00 ? 297 U A "H2'"  1  
ATOM 8866   H "HO2'" . U A 1 276 ? 82.660  90.360  110.265 1.00 0.00 ? 297 U A "HO2'" 1  
ATOM 8867   H "H1'"  . U A 1 276 ? 79.464  91.029  110.447 1.00 0.00 ? 297 U A "H1'"  1  
ATOM 8868   H H3     . U A 1 276 ? 76.962  92.114  106.830 1.00 0.00 ? 297 U A H3     1  
ATOM 8869   H H5     . U A 1 276 ? 78.016  95.641  108.591 1.00 0.00 ? 297 U A H5     1  
ATOM 8870   H H6     . U A 1 276 ? 79.406  94.461  109.977 1.00 0.00 ? 297 U A H6     1  
ATOM 8871   P P      . C A 1 277 ? 84.316  92.767  108.394 1.00 0.00 ? 298 C A P      1  
ATOM 8872   O OP1    . C A 1 277 ? 85.768  92.724  108.704 1.00 0.00 ? 298 C A OP1    1  
ATOM 8873   O OP2    . C A 1 277 ? 83.716  94.013  107.857 1.00 0.00 ? 298 C A OP2    1  
ATOM 8874   O "O5'"  . C A 1 277 ? 83.995  91.586  107.374 1.00 0.00 ? 298 C A "O5'"  1  
ATOM 8875   C "C5'"  . C A 1 277 ? 84.554  90.292  107.555 1.00 0.00 ? 298 C A "C5'"  1  
ATOM 8876   C "C4'"  . C A 1 277 ? 83.936  89.284  106.618 1.00 0.00 ? 298 C A "C4'"  1  
ATOM 8877   O "O4'"  . C A 1 277 ? 82.506  89.204  106.851 1.00 0.00 ? 298 C A "O4'"  1  
ATOM 8878   C "C3'"  . C A 1 277 ? 84.054  89.587  105.132 1.00 0.00 ? 298 C A "C3'"  1  
ATOM 8879   O "O3'"  . C A 1 277 ? 85.301  89.197  104.583 1.00 0.00 ? 298 C A "O3'"  1  
ATOM 8880   C "C2'"  . C A 1 277 ? 82.867  88.836  104.545 1.00 0.00 ? 298 C A "C2'"  1  
ATOM 8881   O "O2'"  . C A 1 277 ? 83.138  87.445  104.441 1.00 0.00 ? 298 C A "O2'"  1  
ATOM 8882   C "C1'"  . C A 1 277 ? 81.803  89.056  105.622 1.00 0.00 ? 298 C A "C1'"  1  
ATOM 8883   N N1     . C A 1 277 ? 80.960  90.245  105.347 1.00 0.00 ? 298 C A N1     1  
ATOM 8884   C C2     . C A 1 277 ? 79.925  90.124  104.412 1.00 0.00 ? 298 C A C2     1  
ATOM 8885   O O2     . C A 1 277 ? 79.745  89.037  103.844 1.00 0.00 ? 298 C A O2     1  
ATOM 8886   N N3     . C A 1 277 ? 79.142  91.194  104.143 1.00 0.00 ? 298 C A N3     1  
ATOM 8887   C C4     . C A 1 277 ? 79.356  92.353  104.766 1.00 0.00 ? 298 C A C4     1  
ATOM 8888   N N4     . C A 1 277 ? 78.558  93.381  104.470 1.00 0.00 ? 298 C A N4     1  
ATOM 8889   C C5     . C A 1 277 ? 80.399  92.508  105.722 1.00 0.00 ? 298 C A C5     1  
ATOM 8890   C C6     . C A 1 277 ? 81.168  91.442  105.980 1.00 0.00 ? 298 C A C6     1  
ATOM 8891   H "H5'"  . C A 1 277 ? 84.403  90.006  108.480 1.00 0.00 ? 298 C A "H5'"  1  
ATOM 8892   H "H5''" . C A 1 277 ? 85.519  90.336  107.387 1.00 0.00 ? 298 C A "H5''" 1  
ATOM 8893   H "H4'"  . C A 1 277 ? 84.336  88.406  106.795 1.00 0.00 ? 298 C A "H4'"  1  
ATOM 8894   H "H3'"  . C A 1 277 ? 83.926  90.549  104.989 1.00 0.00 ? 298 C A "H3'"  1  
ATOM 8895   H "H2'"  . C A 1 277 ? 82.590  89.217  103.684 1.00 0.00 ? 298 C A "H2'"  1  
ATOM 8896   H "HO2'" . C A 1 277 ? 84.108  87.306  104.463 1.00 0.00 ? 298 C A "HO2'" 1  
ATOM 8897   H "H1'"  . C A 1 277 ? 81.233  88.261  105.683 1.00 0.00 ? 298 C A "H1'"  1  
ATOM 8898   H H41    . C A 1 277 ? 77.841  93.271  103.809 1.00 0.00 ? 298 C A H41    1  
ATOM 8899   H H42    . C A 1 277 ? 78.690  94.246  104.910 1.00 0.00 ? 298 C A H42    1  
ATOM 8900   H H5     . C A 1 277 ? 80.548  93.364  106.176 1.00 0.00 ? 298 C A H5     1  
ATOM 8901   H H6     . C A 1 277 ? 81.891  91.529  106.634 1.00 0.00 ? 298 C A H6     1  
ATOM 8902   P P      . A A 1 278 ? 86.024  90.119  103.482 1.00 0.00 ? 299 A A P      1  
ATOM 8903   O OP1    . A A 1 278 ? 87.430  89.663  103.350 1.00 0.00 ? 299 A A OP1    1  
ATOM 8904   O OP2    . A A 1 278 ? 85.740  91.538  103.813 1.00 0.00 ? 299 A A OP2    1  
ATOM 8905   O "O5'"  . A A 1 278 ? 85.262  89.768  102.127 1.00 0.00 ? 299 A A "O5'"  1  
ATOM 8906   C "C5'"  . A A 1 278 ? 85.474  88.526  101.472 1.00 0.00 ? 299 A A "C5'"  1  
ATOM 8907   C "C4'"  . A A 1 278 ? 84.478  88.308  100.361 1.00 0.00 ? 299 A A "C4'"  1  
ATOM 8908   O "O4'"  . A A 1 278 ? 83.138  88.359  100.918 1.00 0.00 ? 299 A A "O4'"  1  
ATOM 8909   C "C3'"  . A A 1 278 ? 84.445  89.373  99.276  1.00 0.00 ? 299 A A "C3'"  1  
ATOM 8910   O "O3'"  . A A 1 278 ? 85.463  89.207  98.304  1.00 0.00 ? 299 A A "O3'"  1  
ATOM 8911   C "C2'"  . A A 1 278 ? 83.064  89.147  98.690  1.00 0.00 ? 299 A A "C2'"  1  
ATOM 8912   O "O2'"  . A A 1 278 ? 83.033  87.983  97.877  1.00 0.00 ? 299 A A "O2'"  1  
ATOM 8913   C "C1'"  . A A 1 278 ? 82.248  88.895  99.962  1.00 0.00 ? 299 A A "C1'"  1  
ATOM 8914   N N9     . A A 1 278 ? 81.661  90.136  100.501 1.00 0.00 ? 299 A A N9     1  
ATOM 8915   C C8     . A A 1 278 ? 82.084  90.871  101.581 1.00 0.00 ? 299 A A C8     1  
ATOM 8916   N N7     . A A 1 278 ? 81.354  91.933  101.817 1.00 0.00 ? 299 A A N7     1  
ATOM 8917   C C5     . A A 1 278 ? 80.383  91.896  100.826 1.00 0.00 ? 299 A A C5     1  
ATOM 8918   C C6     . A A 1 278 ? 79.302  92.745  100.527 1.00 0.00 ? 299 A A C6     1  
ATOM 8919   N N6     . A A 1 278 ? 79.009  93.844  101.226 1.00 0.00 ? 299 A A N6     1  
ATOM 8920   N N1     . A A 1 278 ? 78.525  92.424  99.471  1.00 0.00 ? 299 A A N1     1  
ATOM 8921   C C2     . A A 1 278 ? 78.819  91.322  98.769  1.00 0.00 ? 299 A A C2     1  
ATOM 8922   N N3     . A A 1 278 ? 79.806  90.447  98.952  1.00 0.00 ? 299 A A N3     1  
ATOM 8923   C C4     . A A 1 278 ? 80.560  90.795  100.009 1.00 0.00 ? 299 A A C4     1  
ATOM 8924   H "H5'"  . A A 1 278 ? 85.388  87.801  102.126 1.00 0.00 ? 299 A A "H5'"  1  
ATOM 8925   H "H5''" . A A 1 278 ? 86.379  88.511  101.098 1.00 0.00 ? 299 A A "H5''" 1  
ATOM 8926   H "H4'"  . A A 1 278 ? 84.633  87.425  99.965  1.00 0.00 ? 299 A A "H4'"  1  
ATOM 8927   H "H3'"  . A A 1 278 ? 84.486  90.260  99.694  1.00 0.00 ? 299 A A "H3'"  1  
ATOM 8928   H "H2'"  . A A 1 278 ? 82.745  89.937  98.206  1.00 0.00 ? 299 A A "H2'"  1  
ATOM 8929   H "HO2'" . A A 1 278 ? 82.138  87.887  97.492  1.00 0.00 ? 299 A A "HO2'" 1  
ATOM 8930   H "H1'"  . A A 1 278 ? 81.533  88.253  99.769  1.00 0.00 ? 299 A A "H1'"  1  
ATOM 8931   H H8     . A A 1 278 ? 82.862  90.624  102.125 1.00 0.00 ? 299 A A H8     1  
ATOM 8932   H H61    . A A 1 278 ? 78.241  94.397  100.969 1.00 0.00 ? 299 A A H61    1  
ATOM 8933   H H62    . A A 1 278 ? 79.558  94.096  101.997 1.00 0.00 ? 299 A A H62    1  
ATOM 8934   H H2     . A A 1 278 ? 78.225  91.134  98.012  1.00 0.00 ? 299 A A H2     1  
ATOM 8935   P P      . U A 1 279 ? 86.193  90.492  97.671  1.00 0.00 ? 300 U A P      1  
ATOM 8936   O OP1    . U A 1 279 ? 87.102  90.020  96.595  1.00 0.00 ? 300 U A OP1    1  
ATOM 8937   O OP2    . U A 1 279 ? 86.737  91.306  98.787  1.00 0.00 ? 300 U A OP2    1  
ATOM 8938   O "O5'"  . U A 1 279 ? 85.009  91.312  96.992  1.00 0.00 ? 300 U A "O5'"  1  
ATOM 8939   C "C5'"  . U A 1 279 ? 84.355  90.824  95.830  1.00 0.00 ? 300 U A "C5'"  1  
ATOM 8940   C "C4'"  . U A 1 279 ? 83.185  91.694  95.442  1.00 0.00 ? 300 U A "C4'"  1  
ATOM 8941   O "O4'"  . U A 1 279 ? 82.226  91.740  96.540  1.00 0.00 ? 300 U A "O4'"  1  
ATOM 8942   C "C3'"  . U A 1 279 ? 83.488  93.170  95.234  1.00 0.00 ? 300 U A "C3'"  1  
ATOM 8943   O "O3'"  . U A 1 279 ? 84.100  93.440  93.985  1.00 0.00 ? 300 U A "O3'"  1  
ATOM 8944   C "C2'"  . U A 1 279 ? 82.071  93.732  95.303  1.00 0.00 ? 300 U A "C2'"  1  
ATOM 8945   O "O2'"  . U A 1 279 ? 81.331  93.407  94.135  1.00 0.00 ? 300 U A "O2'"  1  
ATOM 8946   C "C1'"  . U A 1 279 ? 81.528  92.947  96.485  1.00 0.00 ? 300 U A "C1'"  1  
ATOM 8947   N N1     . U A 1 279 ? 81.716  93.662  97.770  1.00 0.00 ? 300 U A N1     1  
ATOM 8948   C C2     . U A 1 279 ? 80.796  94.645  98.086  1.00 0.00 ? 300 U A C2     1  
ATOM 8949   O O2     . U A 1 279 ? 79.859  94.936  97.363  1.00 0.00 ? 300 U A O2     1  
ATOM 8950   N N3     . U A 1 279 ? 81.010  95.279  99.285  1.00 0.00 ? 300 U A N3     1  
ATOM 8951   C C4     . U A 1 279 ? 82.028  95.039  100.183 1.00 0.00 ? 300 U A C4     1  
ATOM 8952   O O4     . U A 1 279 ? 82.085  95.698  101.223 1.00 0.00 ? 300 U A O4     1  
ATOM 8953   C C5     . U A 1 279 ? 82.941  94.010  99.791  1.00 0.00 ? 300 U A C5     1  
ATOM 8954   C C6     . U A 1 279 ? 82.756  93.375  98.629  1.00 0.00 ? 300 U A C6     1  
ATOM 8955   H "H5'"  . U A 1 279 ? 84.033  89.915  96.004  1.00 0.00 ? 300 U A "H5'"  1  
ATOM 8956   H "H5''" . U A 1 279 ? 84.995  90.801  95.089  1.00 0.00 ? 300 U A "H5''" 1  
ATOM 8957   H "H4'"  . U A 1 279 ? 82.751  91.306  94.655  1.00 0.00 ? 300 U A "H4'"  1  
ATOM 8958   H "H3'"  . U A 1 279 ? 84.021  93.500  95.987  1.00 0.00 ? 300 U A "H3'"  1  
ATOM 8959   H "H2'"  . U A 1 279 ? 82.075  94.697  95.472  1.00 0.00 ? 300 U A "H2'"  1  
ATOM 8960   H "HO2'" . U A 1 279 ? 80.723  94.147  93.926  1.00 0.00 ? 300 U A "HO2'" 1  
ATOM 8961   H "H1'"  . U A 1 279 ? 80.572  92.775  96.346  1.00 0.00 ? 300 U A "H1'"  1  
ATOM 8962   H H3     . U A 1 279 ? 80.369  95.980  99.528  1.00 0.00 ? 300 U A H3     1  
ATOM 8963   H H5     . U A 1 279 ? 83.695  93.772  100.370 1.00 0.00 ? 300 U A H5     1  
ATOM 8964   H H6     . U A 1 279 ? 83.395  92.675  98.383  1.00 0.00 ? 300 U A H6     1  
ATOM 8965   P P      . A A 1 280 ? 85.595  94.016  93.942  1.00 0.00 ? 301 A A P      1  
ATOM 8966   O OP1    . A A 1 280 ? 85.748  95.046  95.000  1.00 0.00 ? 301 A A OP1    1  
ATOM 8967   O OP2    . A A 1 280 ? 85.755  94.398  92.517  1.00 0.00 ? 301 A A OP2    1  
ATOM 8968   O "O5'"  . A A 1 280 ? 86.619  92.835  94.253  1.00 0.00 ? 301 A A "O5'"  1  
ATOM 8969   C "C5'"  . A A 1 280 ? 87.852  93.093  94.908  1.00 0.00 ? 301 A A "C5'"  1  
ATOM 8970   C "C4'"  . A A 1 280 ? 88.992  92.354  94.254  1.00 0.00 ? 301 A A "C4'"  1  
ATOM 8971   O "O4'"  . A A 1 280 ? 88.889  92.542  92.813  1.00 0.00 ? 301 A A "O4'"  1  
ATOM 8972   C "C3'"  . A A 1 280 ? 90.391  92.806  94.645  1.00 0.00 ? 301 A A "C3'"  1  
ATOM 8973   O "O3'"  . A A 1 280 ? 91.327  91.742  94.683  1.00 0.00 ? 301 A A "O3'"  1  
ATOM 8974   C "C2'"  . A A 1 280 ? 90.789  93.759  93.520  1.00 0.00 ? 301 A A "C2'"  1  
ATOM 8975   O "O2'"  . A A 1 280 ? 92.188  93.717  93.280  1.00 0.00 ? 301 A A "O2'"  1  
ATOM 8976   C "C1'"  . A A 1 280 ? 90.075  93.168  92.306  1.00 0.00 ? 301 A A "C1'"  1  
ATOM 8977   N N9     . A A 1 280 ? 89.678  94.205  91.335  1.00 0.00 ? 301 A A N9     1  
ATOM 8978   C C8     . A A 1 280 ? 89.112  95.430  91.592  1.00 0.00 ? 301 A A C8     1  
ATOM 8979   N N7     . A A 1 280 ? 88.870  96.137  90.516  1.00 0.00 ? 301 A A N7     1  
ATOM 8980   C C5     . A A 1 280 ? 89.305  95.324  89.478  1.00 0.00 ? 301 A A C5     1  
ATOM 8981   C C6     . A A 1 280 ? 89.323  95.496  88.083  1.00 0.00 ? 301 A A C6     1  
ATOM 8982   N N6     . A A 1 280 ? 88.876  96.593  87.467  1.00 0.00 ? 301 A A N6     1  
ATOM 8983   N N1     . A A 1 280 ? 89.824  94.492  87.332  1.00 0.00 ? 301 A A N1     1  
ATOM 8984   C C2     . A A 1 280 ? 90.274  93.392  87.949  1.00 0.00 ? 301 A A C2     1  
ATOM 8985   N N3     . A A 1 280 ? 90.310  93.113  89.250  1.00 0.00 ? 301 A A N3     1  
ATOM 8986   C C4     . A A 1 280 ? 89.805  94.132  89.969  1.00 0.00 ? 301 A A C4     1  
ATOM 8987   H "H5'"  . A A 1 280 ? 87.782  92.808  95.844  1.00 0.00 ? 301 A A "H5'"  1  
ATOM 8988   H "H5''" . A A 1 280 ? 88.035  94.054  94.880  1.00 0.00 ? 301 A A "H5''" 1  
ATOM 8989   H "H4'"  . A A 1 280 ? 88.905  91.396  94.441  1.00 0.00 ? 301 A A "H4'"  1  
ATOM 8990   H "H3'"  . A A 1 280 ? 90.381  93.255  95.516  1.00 0.00 ? 301 A A "H3'"  1  
ATOM 8991   H "H2'"  . A A 1 280 ? 90.478  94.672  93.696  1.00 0.00 ? 301 A A "H2'"  1  
ATOM 8992   H "HO2'" . A A 1 280 ? 92.409  94.357  92.572  1.00 0.00 ? 301 A A "HO2'" 1  
ATOM 8993   H "H1'"  . A A 1 280 ? 90.663  92.518  91.866  1.00 0.00 ? 301 A A "H1'"  1  
ATOM 8994   H H8     . A A 1 280 ? 88.909  95.747  92.497  1.00 0.00 ? 301 A A H8     1  
ATOM 8995   H H61    . A A 1 280 ? 88.914  96.656  86.489  1.00 0.00 ? 301 A A H61    1  
ATOM 8996   H H62    . A A 1 280 ? 88.507  97.334  87.991  1.00 0.00 ? 301 A A H62    1  
ATOM 8997   H H2     . A A 1 280 ? 90.627  92.693  87.359  1.00 0.00 ? 301 A A H2     1  
ATOM 8998   P P      . A A 1 281 ? 91.582  90.938  96.051  1.00 0.00 ? 302 A A P      1  
ATOM 8999   O OP1    . A A 1 281 ? 90.493  91.283  96.998  1.00 0.00 ? 302 A A OP1    1  
ATOM 9000   O OP2    . A A 1 281 ? 92.996  91.149  96.451  1.00 0.00 ? 302 A A OP2    1  
ATOM 9001   O "O5'"  . A A 1 281 ? 91.411  89.409  95.637  1.00 0.00 ? 302 A A "O5'"  1  
ATOM 9002   C "C5'"  . A A 1 281 ? 90.494  88.567  96.321  1.00 0.00 ? 302 A A "C5'"  1  
ATOM 9003   C "C4'"  . A A 1 281 ? 90.121  87.365  95.491  1.00 0.00 ? 302 A A "C4'"  1  
ATOM 9004   O "O4'"  . A A 1 281 ? 89.116  87.751  94.516  1.00 0.00 ? 302 A A "O4'"  1  
ATOM 9005   C "C3'"  . A A 1 281 ? 91.239  86.754  94.661  1.00 0.00 ? 302 A A "C3'"  1  
ATOM 9006   O "O3'"  . A A 1 281 ? 92.034  85.835  95.391  1.00 0.00 ? 302 A A "O3'"  1  
ATOM 9007   C "C2'"  . A A 1 281 ? 90.499  86.092  93.512  1.00 0.00 ? 302 A A "C2'"  1  
ATOM 9008   O "O2'"  . A A 1 281 ? 89.988  84.823  93.892  1.00 0.00 ? 302 A A "O2'"  1  
ATOM 9009   C "C1'"  . A A 1 281 ? 89.327  87.056  93.303  1.00 0.00 ? 302 A A "C1'"  1  
ATOM 9010   N N9     . A A 1 281 ? 89.603  88.047  92.246  1.00 0.00 ? 302 A A N9     1  
ATOM 9011   C C8     . A A 1 281 ? 89.688  89.412  92.369  1.00 0.00 ? 302 A A C8     1  
ATOM 9012   N N7     . A A 1 281 ? 89.948  90.030  91.244  1.00 0.00 ? 302 A A N7     1  
ATOM 9013   C C5     . A A 1 281 ? 90.042  89.003  90.314  1.00 0.00 ? 302 A A C5     1  
ATOM 9014   C C6     . A A 1 281 ? 90.300  88.997  88.932  1.00 0.00 ? 302 A A C6     1  
ATOM 9015   N N6     . A A 1 281 ? 90.522  90.101  88.216  1.00 0.00 ? 302 A A N6     1  
ATOM 9016   N N1     . A A 1 281 ? 90.325  87.802  88.303  1.00 0.00 ? 302 A A N1     1  
ATOM 9017   C C2     . A A 1 281 ? 90.102  86.694  89.021  1.00 0.00 ? 302 A A C2     1  
ATOM 9018   N N3     . A A 1 281 ? 89.849  86.572  90.322  1.00 0.00 ? 302 A A N3     1  
ATOM 9019   C C4     . A A 1 281 ? 89.832  87.777  90.918  1.00 0.00 ? 302 A A C4     1  
ATOM 9020   H "H5'"  . A A 1 281 ? 89.683  89.078  96.527  1.00 0.00 ? 302 A A "H5'"  1  
ATOM 9021   H "H5''" . A A 1 281 ? 90.901  88.264  97.158  1.00 0.00 ? 302 A A "H5''" 1  
ATOM 9022   H "H4'"  . A A 1 281 ? 89.745  86.673  96.075  1.00 0.00 ? 302 A A "H4'"  1  
ATOM 9023   H "H3'"  . A A 1 281 ? 91.813  87.470  94.316  1.00 0.00 ? 302 A A "H3'"  1  
ATOM 9024   H "H2'"  . A A 1 281 ? 91.060  86.033  92.710  1.00 0.00 ? 302 A A "H2'"  1  
ATOM 9025   H "HO2'" . A A 1 281 ? 89.518  84.428  93.129  1.00 0.00 ? 302 A A "HO2'" 1  
ATOM 9026   H "H1'"  . A A 1 281 ? 88.523  86.545  93.069  1.00 0.00 ? 302 A A "H1'"  1  
ATOM 9027   H H8     . A A 1 281 ? 89.565  89.881  93.221  1.00 0.00 ? 302 A A H8     1  
ATOM 9028   H H61    . A A 1 281 ? 90.697  90.034  87.253  1.00 0.00 ? 302 A A H61    1  
ATOM 9029   H H62    . A A 1 281 ? 90.509  90.979  88.651  1.00 0.00 ? 302 A A H62    1  
ATOM 9030   H H2     . A A 1 281 ? 90.131  85.853  88.517  1.00 0.00 ? 302 A A H2     1  
ATOM 9031   P P      . G A 1 282 ? 93.631  86.007  95.438  1.00 0.00 ? 303 G A P      1  
ATOM 9032   O OP1    . G A 1 282 ? 94.217  84.735  95.934  1.00 0.00 ? 303 G A OP1    1  
ATOM 9033   O OP2    . G A 1 282 ? 93.936  87.279  96.140  1.00 0.00 ? 303 G A OP2    1  
ATOM 9034   O "O5'"  . G A 1 282 ? 94.046  86.176  93.909  1.00 0.00 ? 303 G A "O5'"  1  
ATOM 9035   C "C5'"  . G A 1 282 ? 93.923  85.095  92.996  1.00 0.00 ? 303 G A "C5'"  1  
ATOM 9036   C "C4'"  . G A 1 282 ? 94.111  85.550  91.570  1.00 0.00 ? 303 G A "C4'"  1  
ATOM 9037   O "O4'"  . G A 1 282 ? 93.065  86.482  91.194  1.00 0.00 ? 303 G A "O4'"  1  
ATOM 9038   C "C3'"  . G A 1 282 ? 95.372  86.354  91.287  1.00 0.00 ? 303 G A "C3'"  1  
ATOM 9039   O "O3'"  . G A 1 282 ? 96.535  85.548  91.203  1.00 0.00 ? 303 G A "O3'"  1  
ATOM 9040   C "C2'"  . G A 1 282 ? 95.010  87.042  89.985  1.00 0.00 ? 303 G A "C2'"  1  
ATOM 9041   O "O2'"  . G A 1 282 ? 95.081  86.141  88.889  1.00 0.00 ? 303 G A "O2'"  1  
ATOM 9042   C "C1'"  . G A 1 282 ? 93.562  87.394  90.255  1.00 0.00 ? 303 G A "C1'"  1  
ATOM 9043   N N9     . G A 1 282 ? 93.414  88.757  90.798  1.00 0.00 ? 303 G A N9     1  
ATOM 9044   C C8     . G A 1 282 ? 93.178  89.111  92.105  1.00 0.00 ? 303 G A C8     1  
ATOM 9045   N N7     . G A 1 282 ? 93.094  90.402  92.280  1.00 0.00 ? 303 G A N7     1  
ATOM 9046   C C5     . G A 1 282 ? 93.287  90.934  91.014  1.00 0.00 ? 303 G A C5     1  
ATOM 9047   C C6     . G A 1 282 ? 93.306  92.284  90.576  1.00 0.00 ? 303 G A C6     1  
ATOM 9048   O O6     . G A 1 282 ? 93.150  93.312  91.244  1.00 0.00 ? 303 G A O6     1  
ATOM 9049   N N1     . G A 1 282 ? 93.534  92.375  89.206  1.00 0.00 ? 303 G A N1     1  
ATOM 9050   C C2     . G A 1 282 ? 93.721  91.306  88.365  1.00 0.00 ? 303 G A C2     1  
ATOM 9051   N N2     . G A 1 282 ? 93.928  91.595  87.071  1.00 0.00 ? 303 G A N2     1  
ATOM 9052   N N3     . G A 1 282 ? 93.705  90.043  88.760  1.00 0.00 ? 303 G A N3     1  
ATOM 9053   C C4     . G A 1 282 ? 93.486  89.932  90.087  1.00 0.00 ? 303 G A C4     1  
ATOM 9054   H "H5'"  . G A 1 282 ? 93.033  84.696  93.090  1.00 0.00 ? 303 G A "H5'"  1  
ATOM 9055   H "H5''" . G A 1 282 ? 94.600  84.419  93.209  1.00 0.00 ? 303 G A "H5''" 1  
ATOM 9056   H "H4'"  . G A 1 282 ? 94.091  84.771  90.975  1.00 0.00 ? 303 G A "H4'"  1  
ATOM 9057   H "H3'"  . G A 1 282 ? 95.500  87.032  91.981  1.00 0.00 ? 303 G A "H3'"  1  
ATOM 9058   H "H2'"  . G A 1 282 ? 95.560  87.840  89.835  1.00 0.00 ? 303 G A "H2'"  1  
ATOM 9059   H "HO2'" . G A 1 282 ? 94.845  86.619  88.067  1.00 0.00 ? 303 G A "HO2'" 1  
ATOM 9060   H "H1'"  . G A 1 282 ? 93.047  87.316  89.425  1.00 0.00 ? 303 G A "H1'"  1  
ATOM 9061   H H8     . G A 1 282 ? 93.081  88.461  92.831  1.00 0.00 ? 303 G A H8     1  
ATOM 9062   H H1     . G A 1 282 ? 93.563  93.273  88.814  1.00 0.00 ? 303 G A H1     1  
ATOM 9063   H H21    . G A 1 282 ? 93.941  92.528  86.771  1.00 0.00 ? 303 G A H21    1  
ATOM 9064   H H22    . G A 1 282 ? 94.068  90.872  86.424  1.00 0.00 ? 303 G A H22    1  
ATOM 9065   P P      . A A 1 283 ? 97.902  86.029  91.898  1.00 0.00 ? 304 A A P      1  
ATOM 9066   O OP1    . A A 1 283 ? 98.909  84.952  91.727  1.00 0.00 ? 304 A A OP1    1  
ATOM 9067   O OP2    . A A 1 283 ? 97.577  86.521  93.260  1.00 0.00 ? 304 A A OP2    1  
ATOM 9068   O "O5'"  . A A 1 283 ? 98.361  87.277  91.020  1.00 0.00 ? 304 A A "O5'"  1  
ATOM 9069   C "C5'"  . A A 1 283 ? 98.590  87.143  89.625  1.00 0.00 ? 304 A A "C5'"  1  
ATOM 9070   C "C4'"  . A A 1 283 ? 98.640  88.486  88.940  1.00 0.00 ? 304 A A "C4'"  1  
ATOM 9071   O "O4'"  . A A 1 283 ? 97.341  89.131  89.027  1.00 0.00 ? 304 A A "O4'"  1  
ATOM 9072   C "C3'"  . A A 1 283 ? 99.603  89.503  89.534  1.00 0.00 ? 304 A A "C3'"  1  
ATOM 9073   O "O3'"  . A A 1 283 ? 100.930 89.354  89.060  1.00 0.00 ? 304 A A "O3'"  1  
ATOM 9074   C "C2'"  . A A 1 283 ? 98.972  90.830  89.137  1.00 0.00 ? 304 A A "C2'"  1  
ATOM 9075   O "O2'"  . A A 1 283 ? 99.248  91.145  87.779  1.00 0.00 ? 304 A A "O2'"  1  
ATOM 9076   C "C1'"  . A A 1 283 ? 97.482  90.510  89.282  1.00 0.00 ? 304 A A "C1'"  1  
ATOM 9077   N N9     . A A 1 283 ? 96.986  90.781  90.644  1.00 0.00 ? 304 A A N9     1  
ATOM 9078   C C8     . A A 1 283 ? 96.767  89.881  91.658  1.00 0.00 ? 304 A A C8     1  
ATOM 9079   N N7     . A A 1 283 ? 96.320  90.427  92.762  1.00 0.00 ? 304 A A N7     1  
ATOM 9080   C C5     . A A 1 283 ? 96.239  91.778  92.456  1.00 0.00 ? 304 A A C5     1  
ATOM 9081   C C6     . A A 1 283 ? 95.832  92.896  93.206  1.00 0.00 ? 304 A A C6     1  
ATOM 9082   N N6     . A A 1 283 ? 95.415  92.827  94.472  1.00 0.00 ? 304 A A N6     1  
ATOM 9083   N N1     . A A 1 283 ? 95.870  94.104  92.604  1.00 0.00 ? 304 A A N1     1  
ATOM 9084   C C2     . A A 1 283 ? 96.289  94.175  91.334  1.00 0.00 ? 304 A A C2     1  
ATOM 9085   N N3     . A A 1 283 ? 96.695  93.198  90.526  1.00 0.00 ? 304 A A N3     1  
ATOM 9086   C C4     . A A 1 283 ? 96.646  92.010  91.156  1.00 0.00 ? 304 A A C4     1  
ATOM 9087   H "H5'"  . A A 1 283 ? 97.867  86.611  89.232  1.00 0.00 ? 304 A A "H5'"  1  
ATOM 9088   H "H5''" . A A 1 283 ? 99.441  86.680  89.483  1.00 0.00 ? 304 A A "H5''" 1  
ATOM 9089   H "H4'"  . A A 1 283 ? 98.865  88.351  87.996  1.00 0.00 ? 304 A A "H4'"  1  
ATOM 9090   H "H3'"  . A A 1 283 ? 99.600  89.421  90.512  1.00 0.00 ? 304 A A "H3'"  1  
ATOM 9091   H "H2'"  . A A 1 283 ? 99.245  91.552  89.740  1.00 0.00 ? 304 A A "H2'"  1  
ATOM 9092   H "HO2'" . A A 1 283 ? 98.883  92.031  87.578  1.00 0.00 ? 304 A A "HO2'" 1  
ATOM 9093   H "H1'"  . A A 1 283 ? 96.970  91.041  88.636  1.00 0.00 ? 304 A A "H1'"  1  
ATOM 9094   H H8     . A A 1 283 ? 96.930  88.919  91.565  1.00 0.00 ? 304 A A H8     1  
ATOM 9095   H H61    . A A 1 283 ? 95.144  93.642  94.944  1.00 0.00 ? 304 A A H61    1  
ATOM 9096   H H62    . A A 1 283 ? 95.378  91.961  94.929  1.00 0.00 ? 304 A A H62    1  
ATOM 9097   H H2     . A A 1 283 ? 96.298  95.074  90.943  1.00 0.00 ? 304 A A H2     1  
ATOM 9098   P P      . U A 1 284 ? 102.172 89.553  90.059  1.00 0.00 ? 305 U A P      1  
ATOM 9099   O OP1    . U A 1 284 ? 103.401 89.090  89.364  1.00 0.00 ? 305 U A OP1    1  
ATOM 9100   O OP2    . U A 1 284 ? 101.805 88.963  91.371  1.00 0.00 ? 305 U A OP2    1  
ATOM 9101   O "O5'"  . U A 1 284 ? 102.273 91.133  90.239  1.00 0.00 ? 305 U A "O5'"  1  
ATOM 9102   C "C5'"  . U A 1 284 ? 102.429 91.986  89.115  1.00 0.00 ? 305 U A "C5'"  1  
ATOM 9103   C "C4'"  . U A 1 284 ? 101.942 93.384  89.406  1.00 0.00 ? 305 U A "C4'"  1  
ATOM 9104   O "O4'"  . U A 1 284 ? 100.553 93.355  89.806  1.00 0.00 ? 305 U A "O4'"  1  
ATOM 9105   C "C3'"  . U A 1 284 ? 102.608 94.097  90.573  1.00 0.00 ? 305 U A "C3'"  1  
ATOM 9106   O "O3'"  . U A 1 284 ? 103.883 94.621  90.247  1.00 0.00 ? 305 U A "O3'"  1  
ATOM 9107   C "C2'"  . U A 1 284 ? 101.587 95.158  90.914  1.00 0.00 ? 305 U A "C2'"  1  
ATOM 9108   O "O2'"  . U A 1 284 ? 101.614 96.220  89.971  1.00 0.00 ? 305 U A "O2'"  1  
ATOM 9109   C "C1'"  . U A 1 284 ? 100.305 94.369  90.749  1.00 0.00 ? 305 U A "C1'"  1  
ATOM 9110   N N1     . U A 1 284 ? 99.853  93.757  92.022  1.00 0.00 ? 305 U A N1     1  
ATOM 9111   C C2     . U A 1 284 ? 99.181  94.575  92.910  1.00 0.00 ? 305 U A C2     1  
ATOM 9112   O O2     . U A 1 284 ? 98.951  95.752  92.690  1.00 0.00 ? 305 U A O2     1  
ATOM 9113   N N3     . U A 1 284 ? 98.780  93.966  94.074  1.00 0.00 ? 305 U A N3     1  
ATOM 9114   C C4     . U A 1 284 ? 98.980  92.651  94.436  1.00 0.00 ? 305 U A C4     1  
ATOM 9115   O O4     . U A 1 284 ? 98.558  92.252  95.523  1.00 0.00 ? 305 U A O4     1  
ATOM 9116   C C5     . U A 1 284 ? 99.682  91.864  93.468  1.00 0.00 ? 305 U A C5     1  
ATOM 9117   C C6     . U A 1 284 ? 100.082 92.432  92.326  1.00 0.00 ? 305 U A C6     1  
ATOM 9118   H "H5'"  . U A 1 284 ? 101.918 91.621  88.363  1.00 0.00 ? 305 U A "H5'"  1  
ATOM 9119   H "H5''" . U A 1 284 ? 103.377 92.023  88.871  1.00 0.00 ? 305 U A "H5''" 1  
ATOM 9120   H "H4'"  . U A 1 284 ? 102.038 93.936  88.602  1.00 0.00 ? 305 U A "H4'"  1  
ATOM 9121   H "H3'"  . U A 1 284 ? 102.698 93.484  91.332  1.00 0.00 ? 305 U A "H3'"  1  
ATOM 9122   H "H2'"  . U A 1 284 ? 101.701 95.485  91.830  1.00 0.00 ? 305 U A "H2'"  1  
ATOM 9123   H "HO2'" . U A 1 284 ? 102.522 96.303  89.610  1.00 0.00 ? 305 U A "HO2'" 1  
ATOM 9124   H "H1'"  . U A 1 284 ? 99.604  94.961  90.406  1.00 0.00 ? 305 U A "H1'"  1  
ATOM 9125   H H3     . U A 1 284 ? 98.302  94.529  94.719  1.00 0.00 ? 305 U A H3     1  
ATOM 9126   H H5     . U A 1 284 ? 99.867  90.918  93.642  1.00 0.00 ? 305 U A H5     1  
ATOM 9127   H H6     . U A 1 284 ? 100.561 91.873  91.680  1.00 0.00 ? 305 U A H6     1  
ATOM 9128   P P      . A A 1 285 ? 105.092 94.525  91.302  1.00 0.00 ? 306 A A P      1  
ATOM 9129   O OP1    . A A 1 285 ? 106.368 94.561  90.544  1.00 0.00 ? 306 A A OP1    1  
ATOM 9130   O OP2    . A A 1 285 ? 104.813 93.391  92.218  1.00 0.00 ? 306 A A OP2    1  
ATOM 9131   O "O5'"  . A A 1 285 ? 104.979 95.875  92.141  1.00 0.00 ? 306 A A "O5'"  1  
ATOM 9132   C "C5'"  . A A 1 285 ? 105.380 97.117  91.581  1.00 0.00 ? 306 A A "C5'"  1  
ATOM 9133   C "C4'"  . A A 1 285 ? 104.210 98.054  91.414  1.00 0.00 ? 306 A A "C4'"  1  
ATOM 9134   O "O4'"  . A A 1 285 ? 102.947 97.363  91.623  1.00 0.00 ? 306 A A "O4'"  1  
ATOM 9135   C "C3'"  . A A 1 285 ? 104.135 99.210  92.400  1.00 0.00 ? 306 A A "C3'"  1  
ATOM 9136   O "O3'"  . A A 1 285 ? 105.001 100.280 92.067  1.00 0.00 ? 306 A A "O3'"  1  
ATOM 9137   C "C2'"  . A A 1 285 ? 102.690 99.613  92.183  1.00 0.00 ? 306 A A "C2'"  1  
ATOM 9138   O "O2'"  . A A 1 285 ? 102.521 100.274 90.937  1.00 0.00 ? 306 A A "O2'"  1  
ATOM 9139   C "C1'"  . A A 1 285 ? 102.019 98.243  92.123  1.00 0.00 ? 306 A A "C1'"  1  
ATOM 9140   N N9     . A A 1 285 ? 101.624 97.759  93.459  1.00 0.00 ? 306 A A N9     1  
ATOM 9141   C C8     . A A 1 285 ? 102.241 96.804  94.228  1.00 0.00 ? 306 A A C8     1  
ATOM 9142   N N7     . A A 1 285 ? 101.651 96.587  95.377  1.00 0.00 ? 306 A A N7     1  
ATOM 9143   C C5     . A A 1 285 ? 100.571 97.459  95.366  1.00 0.00 ? 306 A A C5     1  
ATOM 9144   C C6     . A A 1 285 ? 99.550  97.715  96.300  1.00 0.00 ? 306 A A C6     1  
ATOM 9145   N N6     . A A 1 285 ? 99.449  97.092  97.475  1.00 0.00 ? 306 A A N6     1  
ATOM 9146   N N1     . A A 1 285 ? 98.626  98.647  95.980  1.00 0.00 ? 306 A A N1     1  
ATOM 9147   C C2     . A A 1 285 ? 98.727  99.273  94.801  1.00 0.00 ? 306 A A C2     1  
ATOM 9148   N N3     . A A 1 285 ? 99.638  99.119  93.842  1.00 0.00 ? 306 A A N3     1  
ATOM 9149   C C4     . A A 1 285 ? 100.542 98.187  94.191  1.00 0.00 ? 306 A A C4     1  
ATOM 9150   H "H5'"  . A A 1 285 ? 105.788 96.956  90.705  1.00 0.00 ? 306 A A "H5'"  1  
ATOM 9151   H "H5''" . A A 1 285 ? 106.043 97.535  92.170  1.00 0.00 ? 306 A A "H5''" 1  
ATOM 9152   H "H4'"  . A A 1 285 ? 104.238 98.415  90.504  1.00 0.00 ? 306 A A "H4'"  1  
ATOM 9153   H "H3'"  . A A 1 285 ? 104.287 98.952  93.334  1.00 0.00 ? 306 A A "H3'"  1  
ATOM 9154   H "H2'"  . A A 1 285 ? 102.351 100.152 92.929  1.00 0.00 ? 306 A A "H2'"  1  
ATOM 9155   H "HO2'" . A A 1 285 ? 101.635 100.690 90.915  1.00 0.00 ? 306 A A "HO2'" 1  
ATOM 9156   H "H1'"  . A A 1 285 ? 101.228 98.293  91.546  1.00 0.00 ? 306 A A "H1'"  1  
ATOM 9157   H H8     . A A 1 285 ? 103.050 96.327  93.944  1.00 0.00 ? 306 A A H8     1  
ATOM 9158   H H61    . A A 1 285 ? 98.715  97.313  98.086  1.00 0.00 ? 306 A A H61    1  
ATOM 9159   H H62    . A A 1 285 ? 100.108 96.412  97.728  1.00 0.00 ? 306 A A H62    1  
ATOM 9160   H H2     . A A 1 285 ? 98.032  99.940  94.618  1.00 0.00 ? 306 A A H2     1  
ATOM 9161   P P      . U A 1 286 ? 105.610 100.395 90.584  1.00 0.00 ? 307 U A P      1  
ATOM 9162   O OP1    . U A 1 286 ? 106.508 99.234  90.364  1.00 0.00 ? 307 U A OP1    1  
ATOM 9163   O OP2    . U A 1 286 ? 106.134 101.773 90.409  1.00 0.00 ? 307 U A OP2    1  
ATOM 9164   O "O5'"  . U A 1 286 ? 104.348 100.226 89.638  1.00 0.00 ? 307 U A "O5'"  1  
ATOM 9165   C "C5'"  . U A 1 286 ? 104.497 99.617  88.376  1.00 0.00 ? 307 U A "C5'"  1  
ATOM 9166   C "C4'"  . U A 1 286 ? 103.224 99.741  87.613  1.00 0.00 ? 307 U A "C4'"  1  
ATOM 9167   O "O4'"  . U A 1 286 ? 102.228 100.333 88.477  1.00 0.00 ? 307 U A "O4'"  1  
ATOM 9168   C "C3'"  . U A 1 286 ? 103.356 100.699 86.447  1.00 0.00 ? 307 U A "C3'"  1  
ATOM 9169   O "O3'"  . U A 1 286 ? 103.794 99.981  85.301  1.00 0.00 ? 307 U A "O3'"  1  
ATOM 9170   C "C2'"  . U A 1 286 ? 101.943 101.232 86.310  1.00 0.00 ? 307 U A "C2'"  1  
ATOM 9171   O "O2'"  . U A 1 286 ? 101.088 100.335 85.636  1.00 0.00 ? 307 U A "O2'"  1  
ATOM 9172   C "C1'"  . U A 1 286 ? 101.541 101.352 87.779  1.00 0.00 ? 307 U A "C1'"  1  
ATOM 9173   N N1     . U A 1 286 ? 101.932 102.631 88.382  1.00 0.00 ? 307 U A N1     1  
ATOM 9174   C C2     . U A 1 286 ? 101.089 103.728 88.220  1.00 0.00 ? 307 U A C2     1  
ATOM 9175   O O2     . U A 1 286 ? 100.030 103.681 87.621  1.00 0.00 ? 307 U A O2     1  
ATOM 9176   N N3     . U A 1 286 ? 101.529 104.890 88.798  1.00 0.00 ? 307 U A N3     1  
ATOM 9177   C C4     . U A 1 286 ? 102.687 105.061 89.507  1.00 0.00 ? 307 U A C4     1  
ATOM 9178   O O4     . U A 1 286 ? 102.902 106.140 90.042  1.00 0.00 ? 307 U A O4     1  
ATOM 9179   C C5     . U A 1 286 ? 103.500 103.884 89.633  1.00 0.00 ? 307 U A C5     1  
ATOM 9180   C C6     . U A 1 286 ? 103.102 102.740 89.078  1.00 0.00 ? 307 U A C6     1  
ATOM 9181   H "H5'"  . U A 1 286 ? 104.724 98.672  88.503  1.00 0.00 ? 307 U A "H5'"  1  
ATOM 9182   H "H5''" . U A 1 286 ? 105.225 100.059 87.892  1.00 0.00 ? 307 U A "H5''" 1  
ATOM 9183   H "H4'"  . U A 1 286 ? 102.931 98.847  87.340  1.00 0.00 ? 307 U A "H4'"  1  
ATOM 9184   H "H3'"  . U A 1 286 ? 103.988 101.409 86.684  1.00 0.00 ? 307 U A "H3'"  1  
ATOM 9185   H "H2'"  . U A 1 286 ? 101.932 102.114 85.884  1.00 0.00 ? 307 U A "H2'"  1  
ATOM 9186   H "HO2'" . U A 1 286 ? 101.631 99.703  85.118  1.00 0.00 ? 307 U A "HO2'" 1  
ATOM 9187   H "H1'"  . U A 1 286 ? 100.569 101.249 87.857  1.00 0.00 ? 307 U A "H1'"  1  
ATOM 9188   H H3     . U A 1 286 ? 100.956 105.677 88.688  1.00 0.00 ? 307 U A H3     1  
ATOM 9189   H H5     . U A 1 286 ? 104.347 103.920 90.125  1.00 0.00 ? 307 U A H5     1  
ATOM 9190   H H6     . U A 1 286 ? 103.680 101.956 89.180  1.00 0.00 ? 307 U A H6     1  
ATOM 9191   P P      . A A 1 287 ? 104.776 100.685 84.248  1.00 0.00 ? 308 A A P      1  
ATOM 9192   O OP1    . A A 1 287 ? 105.296 99.591  83.392  1.00 0.00 ? 308 A A OP1    1  
ATOM 9193   O OP2    . A A 1 287 ? 105.733 101.573 84.984  1.00 0.00 ? 308 A A OP2    1  
ATOM 9194   O "O5'"  . A A 1 287 ? 103.800 101.566 83.345  1.00 0.00 ? 308 A A "O5'"  1  
ATOM 9195   C "C5'"  . A A 1 287 ? 102.826 100.955 82.499  1.00 0.00 ? 308 A A "C5'"  1  
ATOM 9196   C "C4'"  . A A 1 287 ? 101.734 101.949 82.146  1.00 0.00 ? 308 A A "C4'"  1  
ATOM 9197   O "O4'"  . A A 1 287 ? 101.178 102.482 83.379  1.00 0.00 ? 308 A A "O4'"  1  
ATOM 9198   C "C3'"  . A A 1 287 ? 102.146 103.174 81.333  1.00 0.00 ? 308 A A "C3'"  1  
ATOM 9199   O "O3'"  . A A 1 287 ? 102.057 102.926 79.932  1.00 0.00 ? 308 A A "O3'"  1  
ATOM 9200   C "C2'"  . A A 1 287 ? 101.143 104.235 81.787  1.00 0.00 ? 308 A A "C2'"  1  
ATOM 9201   O "O2'"  . A A 1 287 ? 99.882  104.164 81.140  1.00 0.00 ? 308 A A "O2'"  1  
ATOM 9202   C "C1'"  . A A 1 287 ? 101.006 103.887 83.268  1.00 0.00 ? 308 A A "C1'"  1  
ATOM 9203   N N9     . A A 1 287 ? 102.036 104.496 84.104  1.00 0.00 ? 308 A A N9     1  
ATOM 9204   C C8     . A A 1 287 ? 103.010 103.819 84.792  1.00 0.00 ? 308 A A C8     1  
ATOM 9205   N N7     . A A 1 287 ? 103.808 104.589 85.476  1.00 0.00 ? 308 A A N7     1  
ATOM 9206   C C5     . A A 1 287 ? 103.332 105.862 85.221  1.00 0.00 ? 308 A A C5     1  
ATOM 9207   C C6     . A A 1 287 ? 103.755 107.107 85.653  1.00 0.00 ? 308 A A C6     1  
ATOM 9208   N N6     . A A 1 287 ? 104.788 107.271 86.476  1.00 0.00 ? 308 A A N6     1  
ATOM 9209   N N1     . A A 1 287 ? 103.080 108.192 85.212  1.00 0.00 ? 308 A A N1     1  
ATOM 9210   C C2     . A A 1 287 ? 102.041 108.003 84.379  1.00 0.00 ? 308 A A C2     1  
ATOM 9211   N N3     . A A 1 287 ? 101.543 106.867 83.904  1.00 0.00 ? 308 A A N3     1  
ATOM 9212   C C4     . A A 1 287 ? 102.244 105.820 84.369  1.00 0.00 ? 308 A A C4     1  
ATOM 9213   H "H5'"  . A A 1 287 ? 102.436 100.186 82.966  1.00 0.00 ? 308 A A "H5'"  1  
ATOM 9214   H "H5''" . A A 1 287 ? 103.265 100.641 81.680  1.00 0.00 ? 308 A A "H5''" 1  
ATOM 9215   H "H4'"  . A A 1 287 ? 101.032 101.483 81.644  1.00 0.00 ? 308 A A "H4'"  1  
ATOM 9216   H "H3'"  . A A 1 287 ? 103.064 103.424 81.569  1.00 0.00 ? 308 A A "H3'"  1  
ATOM 9217   H "H2'"  . A A 1 287 ? 101.513 105.139 81.701  1.00 0.00 ? 308 A A "H2'"  1  
ATOM 9218   H "HO2'" . A A 1 287 ? 99.305  104.875 81.487  1.00 0.00 ? 308 A A "HO2'" 1  
ATOM 9219   H "H1'"  . A A 1 287 ? 100.125 104.177 83.590  1.00 0.00 ? 308 A A "H1'"  1  
ATOM 9220   H H8     . A A 1 287 ? 103.096 102.843 84.771  1.00 0.00 ? 308 A A H8     1  
ATOM 9221   H H61    . A A 1 287 ? 105.051 108.173 86.756  1.00 0.00 ? 308 A A H61    1  
ATOM 9222   H H62    . A A 1 287 ? 105.284 106.492 86.801  1.00 0.00 ? 308 A A H62    1  
ATOM 9223   H H2     . A A 1 287 ? 101.588 108.820 84.081  1.00 0.00 ? 308 A A H2     1  
ATOM 9224   P P      . G A 1 288 ? 103.363 103.086 79.012  1.00 0.00 ? 309 G A P      1  
ATOM 9225   O OP1    . G A 1 288 ? 102.930 102.879 77.603  1.00 0.00 ? 309 G A OP1    1  
ATOM 9226   O OP2    . G A 1 288 ? 104.439 102.239 79.590  1.00 0.00 ? 309 G A OP2    1  
ATOM 9227   O "O5'"  . G A 1 288 ? 103.783 104.615 79.175  1.00 0.00 ? 309 G A "O5'"  1  
ATOM 9228   C "C5'"  . G A 1 288 ? 103.079 105.633 78.471  1.00 0.00 ? 309 G A "C5'"  1  
ATOM 9229   C "C4'"  . G A 1 288 ? 103.544 107.007 78.900  1.00 0.00 ? 309 G A "C4'"  1  
ATOM 9230   O "O4'"  . G A 1 288 ? 103.363 107.168 80.336  1.00 0.00 ? 309 G A "O4'"  1  
ATOM 9231   C "C3'"  . G A 1 288 ? 105.019 107.323 78.741  1.00 0.00 ? 309 G A "C3'"  1  
ATOM 9232   O "O3'"  . G A 1 288 ? 105.390 107.618 77.403  1.00 0.00 ? 309 G A "O3'"  1  
ATOM 9233   C "C2'"  . G A 1 288 ? 105.159 108.545 79.631  1.00 0.00 ? 309 G A "C2'"  1  
ATOM 9234   O "O2'"  . G A 1 288 ? 104.679 109.713 78.997  1.00 0.00 ? 309 G A "O2'"  1  
ATOM 9235   C "C1'"  . G A 1 288 ? 104.266 108.155 80.811  1.00 0.00 ? 309 G A "C1'"  1  
ATOM 9236   N N9     . G A 1 288 ? 105.061 107.608 81.902  1.00 0.00 ? 309 G A N9     1  
ATOM 9237   C C8     . G A 1 288 ? 105.428 106.306 82.126  1.00 0.00 ? 309 G A C8     1  
ATOM 9238   N N7     . G A 1 288 ? 106.186 106.167 83.181  1.00 0.00 ? 309 G A N7     1  
ATOM 9239   C C5     . G A 1 288 ? 106.318 107.453 83.681  1.00 0.00 ? 309 G A C5     1  
ATOM 9240   C C6     . G A 1 288 ? 107.031 107.948 84.817  1.00 0.00 ? 309 G A C6     1  
ATOM 9241   O O6     . G A 1 288 ? 107.727 107.326 85.637  1.00 0.00 ? 309 G A O6     1  
ATOM 9242   N N1     . G A 1 288 ? 106.872 109.320 84.950  1.00 0.00 ? 309 G A N1     1  
ATOM 9243   C C2     . G A 1 288 ? 106.134 110.115 84.110  1.00 0.00 ? 309 G A C2     1  
ATOM 9244   N N2     . G A 1 288 ? 106.085 111.421 84.407  1.00 0.00 ? 309 G A N2     1  
ATOM 9245   N N3     . G A 1 288 ? 105.486 109.670 83.057  1.00 0.00 ? 309 G A N3     1  
ATOM 9246   C C4     . G A 1 288 ? 105.617 108.345 82.905  1.00 0.00 ? 309 G A C4     1  
ATOM 9247   H "H5'"  . G A 1 288 ? 102.121 105.541 78.651  1.00 0.00 ? 309 G A "H5'"  1  
ATOM 9248   H "H5''" . G A 1 288 ? 103.234 105.521 77.509  1.00 0.00 ? 309 G A "H5''" 1  
ATOM 9249   H "H4'"  . G A 1 288 ? 103.008 107.683 78.436  1.00 0.00 ? 309 G A "H4'"  1  
ATOM 9250   H "H3'"  . G A 1 288 ? 105.547 106.559 79.055  1.00 0.00 ? 309 G A "H3'"  1  
ATOM 9251   H "H2'"  . G A 1 288 ? 106.081 108.660 79.943  1.00 0.00 ? 309 G A "H2'"  1  
ATOM 9252   H "HO2'" . G A 1 288 ? 104.788 110.474 79.604  1.00 0.00 ? 309 G A "HO2'" 1  
ATOM 9253   H "H1'"  . G A 1 288 ? 103.767 108.940 81.116  1.00 0.00 ? 309 G A "H1'"  1  
ATOM 9254   H H8     . G A 1 288 ? 105.156 105.558 81.555  1.00 0.00 ? 309 G A H8     1  
ATOM 9255   H H1     . G A 1 288 ? 107.325 109.754 85.704  1.00 0.00 ? 309 G A H1     1  
ATOM 9256   H H21    . G A 1 288 ? 106.562 111.766 85.189  1.00 0.00 ? 309 G A H21    1  
ATOM 9257   H H22    . G A 1 288 ? 105.569 112.033 83.840  1.00 0.00 ? 309 G A H22    1  
ATOM 9258   P P      . U A 1 289 ? 106.946 107.729 77.031  1.00 0.00 ? 310 U A P      1  
ATOM 9259   O OP1    . U A 1 289 ? 107.009 108.021 75.586  1.00 0.00 ? 310 U A OP1    1  
ATOM 9260   O OP2    . U A 1 289 ? 107.687 106.561 77.580  1.00 0.00 ? 310 U A OP2    1  
ATOM 9261   O "O5'"  . U A 1 289 ? 107.424 109.034 77.806  1.00 0.00 ? 310 U A "O5'"  1  
ATOM 9262   C "C5'"  . U A 1 289 ? 107.287 110.305 77.199  1.00 0.00 ? 310 U A "C5'"  1  
ATOM 9263   C "C4'"  . U A 1 289 ? 108.310 111.260 77.745  1.00 0.00 ? 310 U A "C4'"  1  
ATOM 9264   O "O4'"  . U A 1 289 ? 107.957 111.617 79.106  1.00 0.00 ? 310 U A "O4'"  1  
ATOM 9265   C "C3'"  . U A 1 289 ? 109.724 110.743 77.901  1.00 0.00 ? 310 U A "C3'"  1  
ATOM 9266   O "O3'"  . U A 1 289 ? 110.481 110.682 76.714  1.00 0.00 ? 310 U A "O3'"  1  
ATOM 9267   C "C2'"  . U A 1 289 ? 110.289 111.778 78.850  1.00 0.00 ? 310 U A "C2'"  1  
ATOM 9268   O "O2'"  . U A 1 289 ? 110.525 113.021 78.216  1.00 0.00 ? 310 U A "O2'"  1  
ATOM 9269   C "C1'"  . U A 1 289 ? 109.142 111.867 79.849  1.00 0.00 ? 310 U A "C1'"  1  
ATOM 9270   N N1     . U A 1 289 ? 109.300 110.798 80.842  1.00 0.00 ? 310 U A N1     1  
ATOM 9271   C C2     . U A 1 289 ? 109.938 111.117 82.019  1.00 0.00 ? 310 U A C2     1  
ATOM 9272   O O2     . U A 1 289 ? 110.305 112.252 82.288  1.00 0.00 ? 310 U A O2     1  
ATOM 9273   N N3     . U A 1 289 ? 110.125 110.067 82.879  1.00 0.00 ? 310 U A N3     1  
ATOM 9274   C C4     . U A 1 289 ? 109.735 108.765 82.693  1.00 0.00 ? 310 U A C4     1  
ATOM 9275   O O4     . U A 1 289 ? 110.031 107.921 83.540  1.00 0.00 ? 310 U A O4     1  
ATOM 9276   C C5     . U A 1 289 ? 109.051 108.521 81.461  1.00 0.00 ? 310 U A C5     1  
ATOM 9277   C C6     . U A 1 289 ? 108.861 109.522 80.601  1.00 0.00 ? 310 U A C6     1  
ATOM 9278   H "H5'"  . U A 1 289 ? 106.387 110.649 77.378  1.00 0.00 ? 310 U A "H5'"  1  
ATOM 9279   H "H5''" . U A 1 289 ? 107.407 110.213 76.230  1.00 0.00 ? 310 U A "H5''" 1  
ATOM 9280   H "H4'"  . U A 1 289 ? 108.313 112.069 77.192  1.00 0.00 ? 310 U A "H4'"  1  
ATOM 9281   H "H3'"  . U A 1 289 ? 109.698 109.843 78.286  1.00 0.00 ? 310 U A "H3'"  1  
ATOM 9282   H "H2'"  . U A 1 289 ? 111.098 111.454 79.296  1.00 0.00 ? 310 U A "H2'"  1  
ATOM 9283   H "HO2'" . U A 1 289 ? 110.580 112.880 77.248  1.00 0.00 ? 310 U A "HO2'" 1  
ATOM 9284   H "H1'"  . U A 1 289 ? 109.152 112.751 80.273  1.00 0.00 ? 310 U A "H1'"  1  
ATOM 9285   H H3     . U A 1 289 ? 110.590 110.268 83.718  1.00 0.00 ? 310 U A H3     1  
ATOM 9286   H H5     . U A 1 289 ? 108.723 107.622 81.248  1.00 0.00 ? 310 U A H5     1  
ATOM 9287   H H6     . U A 1 289 ? 108.392 109.324 79.764  1.00 0.00 ? 310 U A H6     1  
ATOM 9288   P P      . C A 1 290 ? 111.882 109.908 76.735  1.00 0.00 ? 311 C A P      1  
ATOM 9289   O OP1    . C A 1 290 ? 112.495 110.157 75.406  1.00 0.00 ? 311 C A OP1    1  
ATOM 9290   O OP2    . C A 1 290 ? 111.635 108.508 77.180  1.00 0.00 ? 311 C A OP2    1  
ATOM 9291   O "O5'"  . C A 1 290 ? 112.687 110.639 77.909  1.00 0.00 ? 311 C A "O5'"  1  
ATOM 9292   C "C5'"  . C A 1 290 ? 113.929 111.289 77.658  1.00 0.00 ? 311 C A "C5'"  1  
ATOM 9293   C "C4'"  . C A 1 290 ? 114.510 111.901 78.928  1.00 0.00 ? 311 C A "C4'"  1  
ATOM 9294   O "O4'"  . C A 1 290 ? 113.525 112.005 79.993  1.00 0.00 ? 311 C A "O4'"  1  
ATOM 9295   C "C3'"  . C A 1 290 ? 115.600 111.100 79.607  1.00 0.00 ? 311 C A "C3'"  1  
ATOM 9296   O "O3'"  . C A 1 290 ? 116.813 111.165 78.915  1.00 0.00 ? 311 C A "O3'"  1  
ATOM 9297   C "C2'"  . C A 1 290 ? 115.664 111.766 80.962  1.00 0.00 ? 311 C A "C2'"  1  
ATOM 9298   O "O2'"  . C A 1 290 ? 116.220 113.064 80.877  1.00 0.00 ? 311 C A "O2'"  1  
ATOM 9299   C "C1'"  . C A 1 290 ? 114.174 111.850 81.262  1.00 0.00 ? 311 C A "C1'"  1  
ATOM 9300   N N1     . C A 1 290 ? 113.757 110.561 81.849  1.00 0.00 ? 311 C A N1     1  
ATOM 9301   C C2     . C A 1 290 ? 114.223 110.218 83.124  1.00 0.00 ? 311 C A C2     1  
ATOM 9302   O O2     . C A 1 290 ? 114.958 111.016 83.726  1.00 0.00 ? 311 C A O2     1  
ATOM 9303   N N3     . C A 1 290 ? 113.869 109.026 83.656  1.00 0.00 ? 311 C A N3     1  
ATOM 9304   C C4     . C A 1 290 ? 113.087 108.195 82.967  1.00 0.00 ? 311 C A C4     1  
ATOM 9305   N N4     . C A 1 290 ? 112.772 107.038 83.519  1.00 0.00 ? 311 C A N4     1  
ATOM 9306   C C5     . C A 1 290 ? 112.599 108.517 81.675  1.00 0.00 ? 311 C A C5     1  
ATOM 9307   C C6     . C A 1 290 ? 112.948 109.699 81.159  1.00 0.00 ? 311 C A C6     1  
ATOM 9308   H "H5'"  . C A 1 290 ? 113.789 111.999 76.995  1.00 0.00 ? 311 C A "H5'"  1  
ATOM 9309   H "H5''" . C A 1 290 ? 114.566 110.637 77.296  1.00 0.00 ? 311 C A "H5''" 1  
ATOM 9310   H "H4'"  . C A 1 290 ? 114.827 112.805 78.727  1.00 0.00 ? 311 C A "H4'"  1  
ATOM 9311   H "H3'"  . C A 1 290 ? 115.317 110.164 79.682  1.00 0.00 ? 311 C A "H3'"  1  
ATOM 9312   H "H2'"  . C A 1 290 ? 116.143 111.212 81.612  1.00 0.00 ? 311 C A "H2'"  1  
ATOM 9313   H "HO2'" . C A 1 290 ? 116.731 113.139 80.045  1.00 0.00 ? 311 C A "HO2'" 1  
ATOM 9314   H "H1'"  . C A 1 290 ? 114.011 112.597 81.874  1.00 0.00 ? 311 C A "H1'"  1  
ATOM 9315   H H41    . C A 1 290 ? 113.112 106.811 84.410  1.00 0.00 ? 311 C A H41    1  
ATOM 9316   H H42    . C A 1 290 ? 112.199 106.406 83.036  1.00 0.00 ? 311 C A H42    1  
ATOM 9317   H H5     . C A 1 290 ? 112.025 107.897 81.178  1.00 0.00 ? 311 C A H5     1  
ATOM 9318   H H6     . C A 1 290 ? 112.622 109.942 80.267  1.00 0.00 ? 311 C A H6     1  
ATOM 9319   P P      . G A 1 291 ? 117.750 109.864 78.800  1.00 0.00 ? 312 G A P      1  
ATOM 9320   O OP1    . G A 1 291 ? 118.747 110.107 77.726  1.00 0.00 ? 312 G A OP1    1  
ATOM 9321   O OP2    . G A 1 291 ? 116.871 108.670 78.729  1.00 0.00 ? 312 G A OP2    1  
ATOM 9322   O "O5'"  . G A 1 291 ? 118.526 109.824 80.192  1.00 0.00 ? 312 G A "O5'"  1  
ATOM 9323   C "C5'"  . G A 1 291 ? 119.211 110.968 80.678  1.00 0.00 ? 312 G A "C5'"  1  
ATOM 9324   C "C4'"  . G A 1 291 ? 119.486 110.862 82.158  1.00 0.00 ? 312 G A "C4'"  1  
ATOM 9325   O "O4'"  . G A 1 291 ? 118.262 110.611 82.922  1.00 0.00 ? 312 G A "O4'"  1  
ATOM 9326   C "C3'"  . G A 1 291 ? 120.395 109.721 82.588  1.00 0.00 ? 312 G A "C3'"  1  
ATOM 9327   O "O3'"  . G A 1 291 ? 121.760 109.957 82.285  1.00 0.00 ? 312 G A "O3'"  1  
ATOM 9328   C "C2'"  . G A 1 291 ? 120.071 109.628 84.074  1.00 0.00 ? 312 G A "C2'"  1  
ATOM 9329   O "O2'"  . G A 1 291 ? 120.668 110.692 84.799  1.00 0.00 ? 312 G A "O2'"  1  
ATOM 9330   C "C1'"  . G A 1 291 ? 118.550 109.823 84.048  1.00 0.00 ? 312 G A "C1'"  1  
ATOM 9331   N N9     . G A 1 291 ? 117.827 108.543 83.929  1.00 0.00 ? 312 G A N9     1  
ATOM 9332   C C8     . G A 1 291 ? 117.007 108.144 82.901  1.00 0.00 ? 312 G A C8     1  
ATOM 9333   N N7     . G A 1 291 ? 116.505 106.952 83.078  1.00 0.00 ? 312 G A N7     1  
ATOM 9334   C C5     . G A 1 291 ? 117.025 106.538 84.296  1.00 0.00 ? 312 G A C5     1  
ATOM 9335   C C6     . G A 1 291 ? 116.839 105.327 85.012  1.00 0.00 ? 312 G A C6     1  
ATOM 9336   O O6     . G A 1 291 ? 116.152 104.346 84.701  1.00 0.00 ? 312 G A O6     1  
ATOM 9337   N N1     . G A 1 291 ? 117.552 105.322 86.207  1.00 0.00 ? 312 G A N1     1  
ATOM 9338   C C2     . G A 1 291 ? 118.345 106.350 86.656  1.00 0.00 ? 312 G A C2     1  
ATOM 9339   N N2     . G A 1 291 ? 118.955 106.160 87.835  1.00 0.00 ? 312 G A N2     1  
ATOM 9340   N N3     . G A 1 291 ? 118.527 107.484 85.998  1.00 0.00 ? 312 G A N3     1  
ATOM 9341   C C4     . G A 1 291 ? 117.843 107.509 84.835  1.00 0.00 ? 312 G A C4     1  
ATOM 9342   H "H5'"  . G A 1 291 ? 118.665 111.764 80.510  1.00 0.00 ? 312 G A "H5'"  1  
ATOM 9343   H "H5''" . G A 1 291 ? 120.062 111.058 80.200  1.00 0.00 ? 312 G A "H5''" 1  
ATOM 9344   H "H4'"  . G A 1 291 ? 119.868 111.709 82.470  1.00 0.00 ? 312 G A "H4'"  1  
ATOM 9345   H "H3'"  . G A 1 291 ? 120.114 108.899 82.136  1.00 0.00 ? 312 G A "H3'"  1  
ATOM 9346   H "H2'"  . G A 1 291 ? 120.319 108.753 84.441  1.00 0.00 ? 312 G A "H2'"  1  
ATOM 9347   H "HO2'" . G A 1 291 ? 120.463 110.584 85.752  1.00 0.00 ? 312 G A "HO2'" 1  
ATOM 9348   H "H1'"  . G A 1 291 ? 118.266 110.284 84.866  1.00 0.00 ? 312 G A "H1'"  1  
ATOM 9349   H H8     . G A 1 291 ? 116.817 108.697 82.115  1.00 0.00 ? 312 G A H8     1  
ATOM 9350   H H1     . G A 1 291 ? 117.483 104.523 86.770  1.00 0.00 ? 312 G A H1     1  
ATOM 9351   H H21    . G A 1 291 ? 118.825 105.324 88.328  1.00 0.00 ? 312 G A H21    1  
ATOM 9352   H H22    . G A 1 291 ? 119.534 106.860 88.205  1.00 0.00 ? 312 G A H22    1  
ATOM 9353   P P      . G A 1 292 ? 122.675 108.769 81.708  1.00 0.00 ? 313 G A P      1  
ATOM 9354   O OP1    . G A 1 292 ? 124.018 109.327 81.405  1.00 0.00 ? 313 G A OP1    1  
ATOM 9355   O OP2    . G A 1 292 ? 121.911 108.076 80.640  1.00 0.00 ? 313 G A OP2    1  
ATOM 9356   O "O5'"  . G A 1 292 ? 122.825 107.765 82.937  1.00 0.00 ? 313 G A "O5'"  1  
ATOM 9357   C "C5'"  . G A 1 292 ? 123.574 108.128 84.087  1.00 0.00 ? 313 G A "C5'"  1  
ATOM 9358   C "C4'"  . G A 1 292 ? 123.436 107.102 85.184  1.00 0.00 ? 313 G A "C4'"  1  
ATOM 9359   O "O4'"  . G A 1 292 ? 122.011 106.921 85.484  1.00 0.00 ? 313 G A "O4'"  1  
ATOM 9360   C "C3'"  . G A 1 292 ? 123.860 105.684 84.831  1.00 0.00 ? 313 G A "C3'"  1  
ATOM 9361   O "O3'"  . G A 1 292 ? 125.246 105.458 85.019  1.00 0.00 ? 313 G A "O3'"  1  
ATOM 9362   C "C2'"  . G A 1 292 ? 123.170 104.887 85.902  1.00 0.00 ? 313 G A "C2'"  1  
ATOM 9363   O "O2'"  . G A 1 292 ? 123.791 105.075 87.165  1.00 0.00 ? 313 G A "O2'"  1  
ATOM 9364   C "C1'"  . G A 1 292 ? 121.799 105.589 85.876  1.00 0.00 ? 313 G A "C1'"  1  
ATOM 9365   N N9     . G A 1 292 ? 120.864 104.947 84.932  1.00 0.00 ? 313 G A N9     1  
ATOM 9366   C C8     . G A 1 292 ? 120.428 105.442 83.727  1.00 0.00 ? 313 G A C8     1  
ATOM 9367   N N7     . G A 1 292 ? 119.598 104.643 83.113  1.00 0.00 ? 313 G A N7     1  
ATOM 9368   C C5     . G A 1 292 ? 119.479 103.553 83.963  1.00 0.00 ? 313 G A C5     1  
ATOM 9369   C C6     . G A 1 292 ? 118.716 102.364 83.832  1.00 0.00 ? 313 G A C6     1  
ATOM 9370   O O6     . G A 1 292 ? 117.968 102.027 82.907  1.00 0.00 ? 313 G A O6     1  
ATOM 9371   N N1     . G A 1 292 ? 118.886 101.523 84.927  1.00 0.00 ? 313 G A N1     1  
ATOM 9372   C C2     . G A 1 292 ? 119.689 101.790 86.010  1.00 0.00 ? 313 G A C2     1  
ATOM 9373   N N2     . G A 1 292 ? 119.724 100.854 86.970  1.00 0.00 ? 313 G A N2     1  
ATOM 9374   N N3     . G A 1 292 ? 120.405 102.894 86.144  1.00 0.00 ? 313 G A N3     1  
ATOM 9375   C C4     . G A 1 292 ? 120.254 103.725 85.091  1.00 0.00 ? 313 G A C4     1  
ATOM 9376   H "H5'"  . G A 1 292 ? 123.256 108.994 84.416  1.00 0.00 ? 313 G A "H5'"  1  
ATOM 9377   H "H5''" . G A 1 292 ? 124.520 108.208 83.841  1.00 0.00 ? 313 G A "H5''" 1  
ATOM 9378   H "H4'"  . G A 1 292 ? 123.898 107.430 85.985  1.00 0.00 ? 313 G A "H4'"  1  
ATOM 9379   H "H3'"  . G A 1 292 ? 123.489 105.447 83.956  1.00 0.00 ? 313 G A "H3'"  1  
ATOM 9380   H "H2'"  . G A 1 292 ? 123.113 103.938 85.663  1.00 0.00 ? 313 G A "H2'"  1  
ATOM 9381   H "HO2'" . G A 1 292 ? 123.356 104.494 87.824  1.00 0.00 ? 313 G A "HO2'" 1  
ATOM 9382   H "H1'"  . G A 1 292 ? 121.411 105.581 86.776  1.00 0.00 ? 313 G A "H1'"  1  
ATOM 9383   H H8     . G A 1 292 ? 120.710 106.308 83.364  1.00 0.00 ? 313 G A H8     1  
ATOM 9384   H H1     . G A 1 292 ? 118.395 100.674 84.924  1.00 0.00 ? 313 G A H1     1  
ATOM 9385   H H21    . G A 1 292 ? 119.196 100.034 86.878  1.00 0.00 ? 313 G A H21    1  
ATOM 9386   H H22    . G A 1 292 ? 120.279 100.990 87.766  1.00 0.00 ? 313 G A H22    1  
ATOM 9387   P P      . A A 1 293 ? 126.077 104.662 83.904  1.00 0.00 ? 314 A A P      1  
ATOM 9388   O OP1    . A A 1 293 ? 127.326 105.407 83.606  1.00 0.00 ? 314 A A OP1    1  
ATOM 9389   O OP2    . A A 1 293 ? 125.070 104.457 82.833  1.00 0.00 ? 314 A A OP2    1  
ATOM 9390   O "O5'"  . A A 1 293 ? 126.481 103.231 84.479  1.00 0.00 ? 314 A A "O5'"  1  
ATOM 9391   C "C5'"  . A A 1 293 ? 125.568 102.145 84.438  1.00 0.00 ? 314 A A "C5'"  1  
ATOM 9392   C "C4'"  . A A 1 293 ? 125.759 101.307 83.198  1.00 0.00 ? 314 A A "C4'"  1  
ATOM 9393   O "O4'"  . A A 1 293 ? 125.695 102.152 82.026  1.00 0.00 ? 314 A A "O4'"  1  
ATOM 9394   C "C3'"  . A A 1 293 ? 127.100 100.601 83.070  1.00 0.00 ? 314 A A "C3'"  1  
ATOM 9395   O "O3'"  . A A 1 293 ? 127.147 99.367  83.764  1.00 0.00 ? 314 A A "O3'"  1  
ATOM 9396   C "C2'"  . A A 1 293 ? 127.166 100.362 81.590  1.00 0.00 ? 314 A A "C2'"  1  
ATOM 9397   O "O2'"  . A A 1 293 ? 126.340 99.272  81.207  1.00 0.00 ? 314 A A "O2'"  1  
ATOM 9398   C "C1'"  . A A 1 293 ? 126.564 101.655 81.057  1.00 0.00 ? 314 A A "C1'"  1  
ATOM 9399   N N9     . A A 1 293 ? 127.595 102.669 80.765  1.00 0.00 ? 314 A A N9     1  
ATOM 9400   C C8     . A A 1 293 ? 127.670 103.956 81.237  1.00 0.00 ? 314 A A C8     1  
ATOM 9401   N N7     . A A 1 293 ? 128.710 104.621 80.797  1.00 0.00 ? 314 A A N7     1  
ATOM 9402   C C5     . A A 1 293 ? 129.365 103.710 79.979  1.00 0.00 ? 314 A A C5     1  
ATOM 9403   C C6     . A A 1 293 ? 130.540 103.801 79.211  1.00 0.00 ? 314 A A C6     1  
ATOM 9404   N N6     . A A 1 293 ? 131.296 104.899 79.142  1.00 0.00 ? 314 A A N6     1  
ATOM 9405   N N1     . A A 1 293 ? 130.918 102.710 78.510  1.00 0.00 ? 314 A A N1     1  
ATOM 9406   C C2     . A A 1 293 ? 130.161 101.608 78.580  1.00 0.00 ? 314 A A C2     1  
ATOM 9407   N N3     . A A 1 293 ? 129.037 101.402 79.264  1.00 0.00 ? 314 A A N3     1  
ATOM 9408   C C4     . A A 1 293 ? 128.689 102.505 79.951  1.00 0.00 ? 314 A A C4     1  
ATOM 9409   H "H5'"  . A A 1 293 ? 124.653 102.495 84.449  1.00 0.00 ? 314 A A "H5'"  1  
ATOM 9410   H "H5''" . A A 1 293 ? 125.704 101.582 85.228  1.00 0.00 ? 314 A A "H5''" 1  
ATOM 9411   H "H4'"  . A A 1 293 ? 125.044 100.639 83.150  1.00 0.00 ? 314 A A "H4'"  1  
ATOM 9412   H "H3'"  . A A 1 293 ? 127.846 101.165 83.367  1.00 0.00 ? 314 A A "H3'"  1  
ATOM 9413   H "H2'"  . A A 1 293 ? 128.090 100.242 81.286  1.00 0.00 ? 314 A A "H2'"  1  
ATOM 9414   H "HO2'" . A A 1 293 ? 126.408 99.146  80.238  1.00 0.00 ? 314 A A "HO2'" 1  
ATOM 9415   H "H1'"  . A A 1 293 ? 126.053 101.464 80.242  1.00 0.00 ? 314 A A "H1'"  1  
ATOM 9416   H H8     . A A 1 293 ? 127.007 104.343 81.847  1.00 0.00 ? 314 A A H8     1  
ATOM 9417   H H61    . A A 1 293 ? 132.106 104.902 78.589  1.00 0.00 ? 314 A A H61    1  
ATOM 9418   H H62    . A A 1 293 ? 131.041 105.702 79.642  1.00 0.00 ? 314 A A H62    1  
ATOM 9419   H H2     . A A 1 293 ? 130.478 100.845 78.053  1.00 0.00 ? 314 A A H2     1  
ATOM 9420   P P      . C A 1 294 ? 128.152 99.174  85.002  1.00 0.00 ? 315 C A P      1  
ATOM 9421   O OP1    . C A 1 294 ? 128.054 97.764  85.459  1.00 0.00 ? 315 C A OP1    1  
ATOM 9422   O OP2    . C A 1 294 ? 127.911 100.276 85.968  1.00 0.00 ? 315 C A OP2    1  
ATOM 9423   O "O5'"  . C A 1 294 ? 129.594 99.385  84.365  1.00 0.00 ? 315 C A "O5'"  1  
ATOM 9424   C "C5'"  . C A 1 294 ? 130.295 98.300  83.765  1.00 0.00 ? 315 C A "C5'"  1  
ATOM 9425   C "C4'"  . C A 1 294 ? 131.629 98.771  83.250  1.00 0.00 ? 315 C A "C4'"  1  
ATOM 9426   O "O4'"  . C A 1 294 ? 131.418 99.770  82.220  1.00 0.00 ? 315 C A "O4'"  1  
ATOM 9427   C "C3'"  . C A 1 294 ? 132.492 99.462  84.283  1.00 0.00 ? 315 C A "C3'"  1  
ATOM 9428   O "O3'"  . C A 1 294 ? 133.233 98.490  84.995  1.00 0.00 ? 315 C A "O3'"  1  
ATOM 9429   C "C2'"  . C A 1 294 ? 133.386 100.336 83.420  1.00 0.00 ? 315 C A "C2'"  1  
ATOM 9430   O "O2'"  . C A 1 294 ? 134.455 99.609  82.855  1.00 0.00 ? 315 C A "O2'"  1  
ATOM 9431   C "C1'"  . C A 1 294 ? 132.411 100.776 82.323  1.00 0.00 ? 315 C A "C1'"  1  
ATOM 9432   N N1     . C A 1 294 ? 131.748 102.054 82.627  1.00 0.00 ? 315 C A N1     1  
ATOM 9433   C C2     . C A 1 294 ? 132.423 103.251 82.366  1.00 0.00 ? 315 C A C2     1  
ATOM 9434   O O2     . C A 1 294 ? 133.556 103.206 81.861  1.00 0.00 ? 315 C A O2     1  
ATOM 9435   N N3     . C A 1 294 ? 131.820 104.425 82.669  1.00 0.00 ? 315 C A N3     1  
ATOM 9436   C C4     . C A 1 294 ? 130.599 104.430 83.202  1.00 0.00 ? 315 C A C4     1  
ATOM 9437   N N4     . C A 1 294 ? 130.048 105.609 83.495  1.00 0.00 ? 315 C A N4     1  
ATOM 9438   C C5     . C A 1 294 ? 129.888 103.224 83.466  1.00 0.00 ? 315 C A C5     1  
ATOM 9439   C C6     . C A 1 294 ? 130.493 102.072 83.168  1.00 0.00 ? 315 C A C6     1  
ATOM 9440   H "H5'"  . C A 1 294 ? 129.759 97.945  83.025  1.00 0.00 ? 315 C A "H5'"  1  
ATOM 9441   H "H5''" . C A 1 294 ? 130.425 97.595  84.433  1.00 0.00 ? 315 C A "H5''" 1  
ATOM 9442   H "H4'"  . C A 1 294 ? 132.106 98.007  82.863  1.00 0.00 ? 315 C A "H4'"  1  
ATOM 9443   H "H3'"  . C A 1 294 ? 131.920 99.979  84.888  1.00 0.00 ? 315 C A "H3'"  1  
ATOM 9444   H "H2'"  . C A 1 294 ? 133.711 101.116 83.916  1.00 0.00 ? 315 C A "H2'"  1  
ATOM 9445   H "HO2'" . C A 1 294 ? 134.999 100.214 82.309  1.00 0.00 ? 315 C A "HO2'" 1  
ATOM 9446   H "H1'"  . C A 1 294 ? 132.898 100.859 81.477  1.00 0.00 ? 315 C A "H1'"  1  
ATOM 9447   H H41    . C A 1 294 ? 130.540 106.438 83.315  1.00 0.00 ? 315 C A H41    1  
ATOM 9448   H H42    . C A 1 294 ? 129.152 105.646 83.888  1.00 0.00 ? 315 C A H42    1  
ATOM 9449   H H5     . C A 1 294 ? 128.987 103.241 83.851  1.00 0.00 ? 315 C A H5     1  
ATOM 9450   H H6     . C A 1 294 ? 130.022 101.231 83.341  1.00 0.00 ? 315 C A H6     1  
ATOM 9451   P P      . C A 1 295 ? 133.897 98.883  86.394  1.00 0.00 ? 316 C A P      1  
ATOM 9452   O OP1    . C A 1 295 ? 134.495 97.644  86.940  1.00 0.00 ? 316 C A OP1    1  
ATOM 9453   O OP2    . C A 1 295 ? 132.891 99.637  87.193  1.00 0.00 ? 316 C A OP2    1  
ATOM 9454   O "O5'"  . C A 1 295 ? 135.060 99.906  86.003  1.00 0.00 ? 316 C A "O5'"  1  
ATOM 9455   C "C5'"  . C A 1 295 ? 136.296 99.452  85.436  1.00 0.00 ? 316 C A "C5'"  1  
ATOM 9456   C "C4'"  . C A 1 295 ? 137.325 100.568 85.448  1.00 0.00 ? 316 C A "C4'"  1  
ATOM 9457   O "O4'"  . C A 1 295 ? 136.877 101.648 84.588  1.00 0.00 ? 316 C A "O4'"  1  
ATOM 9458   C "C3'"  . C A 1 295 ? 137.550 101.211 86.805  1.00 0.00 ? 316 C A "C3'"  1  
ATOM 9459   O "O3'"  . C A 1 295 ? 138.555 100.482 87.503  1.00 0.00 ? 316 C A "O3'"  1  
ATOM 9460   C "C2'"  . C A 1 295 ? 138.022 102.612 86.432  1.00 0.00 ? 316 C A "C2'"  1  
ATOM 9461   O "O2'"  . C A 1 295 ? 139.403 102.656 86.129  1.00 0.00 ? 316 C A "O2'"  1  
ATOM 9462   C "C1'"  . C A 1 295 ? 137.189 102.894 85.179  1.00 0.00 ? 316 C A "C1'"  1  
ATOM 9463   N N1     . C A 1 295 ? 135.924 103.596 85.449  1.00 0.00 ? 316 C A N1     1  
ATOM 9464   C C2     . C A 1 295 ? 135.957 104.970 85.583  1.00 0.00 ? 316 C A C2     1  
ATOM 9465   O O2     . C A 1 295 ? 137.043 105.548 85.451  1.00 0.00 ? 316 C A O2     1  
ATOM 9466   N N3     . C A 1 295 ? 134.811 105.636 85.856  1.00 0.00 ? 316 C A N3     1  
ATOM 9467   C C4     . C A 1 295 ? 133.664 104.971 85.985  1.00 0.00 ? 316 C A C4     1  
ATOM 9468   N N4     . C A 1 295 ? 132.568 105.674 86.266  1.00 0.00 ? 316 C A N4     1  
ATOM 9469   C C5     . C A 1 295 ? 133.597 103.560 85.837  1.00 0.00 ? 316 C A C5     1  
ATOM 9470   C C6     . C A 1 295 ? 134.742 102.915 85.571  1.00 0.00 ? 316 C A C6     1  
ATOM 9471   H "H5'"  . C A 1 295 ? 136.137 99.161  84.515  1.00 0.00 ? 316 C A "H5'"  1  
ATOM 9472   H "H5''" . C A 1 295 ? 136.628 98.693  85.959  1.00 0.00 ? 316 C A "H5''" 1  
ATOM 9473   H "H4'"  . C A 1 295 ? 138.174 100.218 85.105  1.00 0.00 ? 316 C A "H4'"  1  
ATOM 9474   H "H3'"  . C A 1 295 ? 136.707 101.217 87.303  1.00 0.00 ? 316 C A "H3'"  1  
ATOM 9475   H "H2'"  . C A 1 295 ? 137.796 103.263 87.128  1.00 0.00 ? 316 C A "H2'"  1  
ATOM 9476   H "HO2'" . C A 1 295 ? 139.650 103.575 85.898  1.00 0.00 ? 316 C A "HO2'" 1  
ATOM 9477   H "H1'"  . C A 1 295 ? 137.719 103.432 84.554  1.00 0.00 ? 316 C A "H1'"  1  
ATOM 9478   H H41    . C A 1 295 ? 132.623 106.647 86.371  1.00 0.00 ? 316 C A H41    1  
ATOM 9479   H H42    . C A 1 295 ? 131.707 105.218 86.369  1.00 0.00 ? 316 C A H42    1  
ATOM 9480   H H5     . C A 1 295 ? 132.747 103.079 85.923  1.00 0.00 ? 316 C A H5     1  
ATOM 9481   H H6     . C A 1 295 ? 134.724 101.942 85.464  1.00 0.00 ? 316 C A H6     1  
ATOM 9482   P P      . U A 1 296 ? 139.301 101.156 88.752  1.00 0.00 ? 317 U A P      1  
ATOM 9483   O OP1    . U A 1 296 ? 140.559 100.416 89.022  1.00 0.00 ? 317 U A OP1    1  
ATOM 9484   O OP2    . U A 1 296 ? 138.235 101.194 89.785  1.00 0.00 ? 317 U A OP2    1  
ATOM 9485   O "O5'"  . U A 1 296 ? 139.682 102.658 88.381  1.00 0.00 ? 317 U A "O5'"  1  
ATOM 9486   C "C5'"  . U A 1 296 ? 140.095 103.574 89.384  1.00 0.00 ? 317 U A "C5'"  1  
ATOM 9487   C "C4'"  . U A 1 296 ? 140.578 104.873 88.786  1.00 0.00 ? 317 U A "C4'"  1  
ATOM 9488   O "O4'"  . U A 1 296 ? 139.552 105.418 87.942  1.00 0.00 ? 317 U A "O4'"  1  
ATOM 9489   C "C3'"  . U A 1 296 ? 140.859 106.000 89.769  1.00 0.00 ? 317 U A "C3'"  1  
ATOM 9490   O "O3'"  . U A 1 296 ? 142.120 105.881 90.402  1.00 0.00 ? 317 U A "O3'"  1  
ATOM 9491   C "C2'"  . U A 1 296 ? 140.728 107.246 88.894  1.00 0.00 ? 317 U A "C2'"  1  
ATOM 9492   O "O2'"  . U A 1 296 ? 141.917 107.483 88.153  1.00 0.00 ? 317 U A "O2'"  1  
ATOM 9493   C "C1'"  . U A 1 296 ? 139.625 106.835 87.936  1.00 0.00 ? 317 U A "C1'"  1  
ATOM 9494   N N1     . U A 1 296 ? 138.305 107.387 88.327  1.00 0.00 ? 317 U A N1     1  
ATOM 9495   C C2     . U A 1 296 ? 138.110 108.743 88.143  1.00 0.00 ? 317 U A C2     1  
ATOM 9496   O O2     . U A 1 296 ? 138.962 109.483 87.683  1.00 0.00 ? 317 U A O2     1  
ATOM 9497   N N3     . U A 1 296 ? 136.873 109.209 88.518  1.00 0.00 ? 317 U A N3     1  
ATOM 9498   C C4     . U A 1 296 ? 135.833 108.475 89.048  1.00 0.00 ? 317 U A C4     1  
ATOM 9499   O O4     . U A 1 296 ? 134.778 109.042 89.336  1.00 0.00 ? 317 U A O4     1  
ATOM 9500   C C5     . U A 1 296 ? 136.107 107.080 89.209  1.00 0.00 ? 317 U A C5     1  
ATOM 9501   C C6     . U A 1 296 ? 137.302 106.599 88.851  1.00 0.00 ? 317 U A C6     1  
ATOM 9502   H "H5'"  . U A 1 296 ? 140.822 103.173 89.904  1.00 0.00 ? 317 U A "H5'"  1  
ATOM 9503   H "H5''" . U A 1 296 ? 139.340 103.759 89.979  1.00 0.00 ? 317 U A "H5''" 1  
ATOM 9504   H "H4'"  . U A 1 296 ? 141.383 104.713 88.250  1.00 0.00 ? 317 U A "H4'"  1  
ATOM 9505   H "H3'"  . U A 1 296 ? 140.157 106.014 90.452  1.00 0.00 ? 317 U A "H3'"  1  
ATOM 9506   H "H2'"  . U A 1 296 ? 140.468 108.030 89.422  1.00 0.00 ? 317 U A "H2'"  1  
ATOM 9507   H "HO2'" . U A 1 296 ? 141.812 108.310 87.637  1.00 0.00 ? 317 U A "HO2'" 1  
ATOM 9508   H "H1'"  . U A 1 296 ? 139.851 107.143 87.033  1.00 0.00 ? 317 U A "H1'"  1  
ATOM 9509   H H3     . U A 1 296 ? 136.713 110.168 88.397  1.00 0.00 ? 317 U A H3     1  
ATOM 9510   H H5     . U A 1 296 ? 135.424 106.482 89.578  1.00 0.00 ? 317 U A H5     1  
ATOM 9511   H H6     . U A 1 296 ? 137.466 105.641 88.972  1.00 0.00 ? 317 U A H6     1  
ATOM 9512   P P      . C A 1 297 ? 142.276 106.218 91.965  1.00 0.00 ? 318 C A P      1  
ATOM 9513   O OP1    . C A 1 297 ? 143.688 105.965 92.351  1.00 0.00 ? 318 C A OP1    1  
ATOM 9514   O OP2    . C A 1 297 ? 141.182 105.531 92.696  1.00 0.00 ? 318 C A OP2    1  
ATOM 9515   O "O5'"  . C A 1 297 ? 142.018 107.784 92.049  1.00 0.00 ? 318 C A "O5'"  1  
ATOM 9516   C "C5'"  . C A 1 297 ? 143.093 108.678 92.327  1.00 0.00 ? 318 C A "C5'"  1  
ATOM 9517   C "C4'"  . C A 1 297 ? 142.583 109.886 93.065  1.00 0.00 ? 318 C A "C4'"  1  
ATOM 9518   O "O4'"  . C A 1 297 ? 141.337 110.345 92.477  1.00 0.00 ? 318 C A "O4'"  1  
ATOM 9519   C "C3'"  . C A 1 297 ? 142.236 109.631 94.518  1.00 0.00 ? 318 C A "C3'"  1  
ATOM 9520   O "O3'"  . C A 1 297 ? 143.397 109.578 95.351  1.00 0.00 ? 318 C A "O3'"  1  
ATOM 9521   C "C2'"  . C A 1 297 ? 141.286 110.787 94.804  1.00 0.00 ? 318 C A "C2'"  1  
ATOM 9522   O "O2'"  . C A 1 297 ? 141.941 112.026 94.980  1.00 0.00 ? 318 C A "O2'"  1  
ATOM 9523   C "C1'"  . C A 1 297 ? 140.491 110.847 93.496  1.00 0.00 ? 318 C A "C1'"  1  
ATOM 9524   N N1     . C A 1 297 ? 139.275 110.026 93.522  1.00 0.00 ? 318 C A N1     1  
ATOM 9525   C C2     . C A 1 297 ? 138.144 110.531 94.155  1.00 0.00 ? 318 C A C2     1  
ATOM 9526   O O2     . C A 1 297 ? 138.196 111.658 94.655  1.00 0.00 ? 318 C A O2     1  
ATOM 9527   N N3     . C A 1 297 ? 137.022 109.783 94.205  1.00 0.00 ? 318 C A N3     1  
ATOM 9528   C C4     . C A 1 297 ? 137.002 108.573 93.645  1.00 0.00 ? 318 C A C4     1  
ATOM 9529   N N4     . C A 1 297 ? 135.874 107.868 93.726  1.00 0.00 ? 318 C A N4     1  
ATOM 9530   C C5     . C A 1 297 ? 138.138 108.031 92.982  1.00 0.00 ? 318 C A C5     1  
ATOM 9531   C C6     . C A 1 297 ? 139.246 108.785 92.944  1.00 0.00 ? 318 C A C6     1  
ATOM 9532   H "H5'"  . C A 1 297 ? 143.506 108.954 91.483  1.00 0.00 ? 318 C A "H5'"  1  
ATOM 9533   H "H5''" . C A 1 297 ? 143.761 108.213 92.873  1.00 0.00 ? 318 C A "H5''" 1  
ATOM 9534   H "H4'"  . C A 1 297 ? 143.246 110.603 92.993  1.00 0.00 ? 318 C A "H4'"  1  
ATOM 9535   H "H3'"  . C A 1 297 ? 141.745 108.787 94.591  1.00 0.00 ? 318 C A "H3'"  1  
ATOM 9536   H "H2'"  . C A 1 297 ? 140.711 110.594 95.573  1.00 0.00 ? 318 C A "H2'"  1  
ATOM 9537   H "HO2'" . C A 1 297 ? 141.272 112.718 95.160  1.00 0.00 ? 318 C A "HO2'" 1  
ATOM 9538   H "H1'"  . C A 1 297 ? 140.245 111.776 93.312  1.00 0.00 ? 318 C A "H1'"  1  
ATOM 9539   H H41    . C A 1 297 ? 135.094 108.242 94.184  1.00 0.00 ? 318 C A H41    1  
ATOM 9540   H H42    . C A 1 297 ? 135.827 106.975 93.325  1.00 0.00 ? 318 C A H42    1  
ATOM 9541   H H5     . C A 1 297 ? 138.108 107.142 92.568  1.00 0.00 ? 318 C A H5     1  
ATOM 9542   H H6     . C A 1 297 ? 140.041 108.435 92.492  1.00 0.00 ? 318 C A H6     1  
ATOM 9543   P P      . U A 1 298 ? 143.393 108.645 96.674  1.00 0.00 ? 319 U A P      1  
ATOM 9544   O OP1    . U A 1 298 ? 144.714 107.971 96.845  1.00 0.00 ? 319 U A OP1    1  
ATOM 9545   O OP2    . U A 1 298 ? 142.164 107.813 96.683  1.00 0.00 ? 319 U A OP2    1  
ATOM 9546   O "O5'"  . U A 1 298 ? 143.238 109.712 97.843  1.00 0.00 ? 319 U A "O5'"  1  
ATOM 9547   C "C5'"  . U A 1 298 ? 142.708 109.325 99.097  1.00 0.00 ? 319 U A "C5'"  1  
ATOM 9548   C "C4'"  . U A 1 298 ? 141.893 110.444 99.697  1.00 0.00 ? 319 U A "C4'"  1  
ATOM 9549   O "O4'"  . U A 1 298 ? 140.896 110.905 98.742  1.00 0.00 ? 319 U A "O4'"  1  
ATOM 9550   C "C3'"  . U A 1 298 ? 141.115 110.025 100.930 1.00 0.00 ? 319 U A "C3'"  1  
ATOM 9551   O "O3'"  . U A 1 298 ? 141.914 110.204 102.090 1.00 0.00 ? 319 U A "O3'"  1  
ATOM 9552   C "C2'"  . U A 1 298 ? 139.934 110.982 100.907 1.00 0.00 ? 319 U A "C2'"  1  
ATOM 9553   O "O2'"  . U A 1 298 ? 140.267 112.245 101.445 1.00 0.00 ? 319 U A "O2'"  1  
ATOM 9554   C "C1'"  . U A 1 298 ? 139.654 111.083 99.401  1.00 0.00 ? 319 U A "C1'"  1  
ATOM 9555   N N1     . U A 1 298 ? 138.743 110.042 98.902  1.00 0.00 ? 319 U A N1     1  
ATOM 9556   C C2     . U A 1 298 ? 137.464 109.947 99.436  1.00 0.00 ? 319 U A C2     1  
ATOM 9557   O O2     . U A 1 298 ? 137.041 110.714 100.288 1.00 0.00 ? 319 U A O2     1  
ATOM 9558   N N3     . U A 1 298 ? 136.702 108.919 98.926  1.00 0.00 ? 319 U A N3     1  
ATOM 9559   C C4     . U A 1 298 ? 137.083 108.004 97.957  1.00 0.00 ? 319 U A C4     1  
ATOM 9560   O O4     . U A 1 298 ? 136.321 107.093 97.649  1.00 0.00 ? 319 U A O4     1  
ATOM 9561   C C5     . U A 1 298 ? 138.403 108.187 97.450  1.00 0.00 ? 319 U A C5     1  
ATOM 9562   C C6     . U A 1 298 ? 139.165 109.170 97.926  1.00 0.00 ? 319 U A C6     1  
ATOM 9563   H "H5'"  . U A 1 298 ? 143.447 109.097 99.698  1.00 0.00 ? 319 U A "H5'"  1  
ATOM 9564   H "H5''" . U A 1 298 ? 142.141 108.536 98.975  1.00 0.00 ? 319 U A "H5''" 1  
ATOM 9565   H "H4'"  . U A 1 298 ? 142.491 111.190 99.912  1.00 0.00 ? 319 U A "H4'"  1  
ATOM 9566   H "H3'"  . U A 1 298 ? 140.843 109.088 100.838 1.00 0.00 ? 319 U A "H3'"  1  
ATOM 9567   H "H2'"  . U A 1 298 ? 139.152 110.599 101.357 1.00 0.00 ? 319 U A "H2'"  1  
ATOM 9568   H "HO2'" . U A 1 298 ? 139.478 112.826 101.410 1.00 0.00 ? 319 U A "HO2'" 1  
ATOM 9569   H "H1'"  . U A 1 298 ? 139.266 111.961 99.204  1.00 0.00 ? 319 U A "H1'"  1  
ATOM 9570   H H3     . U A 1 298 ? 135.797 108.825 99.289  1.00 0.00 ? 319 U A H3     1  
ATOM 9571   H H5     . U A 1 298 ? 138.750 107.591 96.752  1.00 0.00 ? 319 U A H5     1  
ATOM 9572   H H6     . U A 1 298 ? 140.068 109.268 97.558  1.00 0.00 ? 319 U A H6     1  
ATOM 9573   P P      . C A 1 299 ? 142.843 109.004 102.595 1.00 0.00 ? 320 C A P      1  
ATOM 9574   O OP1    . C A 1 299 ? 144.259 109.444 102.505 1.00 0.00 ? 320 C A OP1    1  
ATOM 9575   O OP2    . C A 1 299 ? 142.409 107.771 101.905 1.00 0.00 ? 320 C A OP2    1  
ATOM 9576   O "O5'"  . C A 1 299 ? 142.500 108.888 104.139 1.00 0.00 ? 320 C A "O5'"  1  
ATOM 9577   C "C5'"  . C A 1 299 ? 141.538 107.971 104.617 1.00 0.00 ? 320 C A "C5'"  1  
ATOM 9578   C "C4'"  . C A 1 299 ? 140.231 108.681 104.879 1.00 0.00 ? 320 C A "C4'"  1  
ATOM 9579   O "O4'"  . C A 1 299 ? 139.594 109.031 103.620 1.00 0.00 ? 320 C A "O4'"  1  
ATOM 9580   C "C3'"  . C A 1 299 ? 139.223 107.811 105.598 1.00 0.00 ? 320 C A "C3'"  1  
ATOM 9581   O "O3'"  . C A 1 299 ? 139.443 107.928 106.997 1.00 0.00 ? 320 C A "O3'"  1  
ATOM 9582   C "C2'"  . C A 1 299 ? 137.896 108.412 105.156 1.00 0.00 ? 320 C A "C2'"  1  
ATOM 9583   O "O2'"  . C A 1 299 ? 137.562 109.567 105.892 1.00 0.00 ? 320 C A "O2'"  1  
ATOM 9584   C "C1'"  . C A 1 299 ? 138.199 108.789 103.704 1.00 0.00 ? 320 C A "C1'"  1  
ATOM 9585   N N1     . C A 1 299 ? 137.865 107.758 102.705 1.00 0.00 ? 320 C A N1     1  
ATOM 9586   C C2     . C A 1 299 ? 136.557 107.252 102.638 1.00 0.00 ? 320 C A C2     1  
ATOM 9587   O O2     . C A 1 299 ? 135.697 107.679 103.424 1.00 0.00 ? 320 C A O2     1  
ATOM 9588   N N3     . C A 1 299 ? 136.265 106.307 101.713 1.00 0.00 ? 320 C A N3     1  
ATOM 9589   C C4     . C A 1 299 ? 137.214 105.870 100.881 1.00 0.00 ? 320 C A C4     1  
ATOM 9590   N N4     . C A 1 299 ? 136.886 104.934 99.990  1.00 0.00 ? 320 C A N4     1  
ATOM 9591   C C5     . C A 1 299 ? 138.544 106.373 100.927 1.00 0.00 ? 320 C A C5     1  
ATOM 9592   C C6     . C A 1 299 ? 138.823 107.304 101.844 1.00 0.00 ? 320 C A C6     1  
ATOM 9593   H "H5'"  . C A 1 299 ? 141.868 107.566 105.446 1.00 0.00 ? 320 C A "H5'"  1  
ATOM 9594   H "H5''" . C A 1 299 ? 141.406 107.269 103.948 1.00 0.00 ? 320 C A "H5''" 1  
ATOM 9595   H "H4'"  . C A 1 299 ? 140.414 109.503 105.381 1.00 0.00 ? 320 C A "H4'"  1  
ATOM 9596   H "H3'"  . C A 1 299 ? 139.322 106.884 105.296 1.00 0.00 ? 320 C A "H3'"  1  
ATOM 9597   H "H2'"  . C A 1 299 ? 137.173 107.750 105.192 1.00 0.00 ? 320 C A "H2'"  1  
ATOM 9598   H "HO2'" . C A 1 299 ? 136.704 109.914 105.571 1.00 0.00 ? 320 C A "HO2'" 1  
ATOM 9599   H "H1'"  . C A 1 299 ? 137.707 109.604 103.473 1.00 0.00 ? 320 C A "H1'"  1  
ATOM 9600   H H41    . C A 1 299 ? 135.970 104.586 99.960  1.00 0.00 ? 320 C A H41    1  
ATOM 9601   H H42    . C A 1 299 ? 137.560 104.594 99.367  1.00 0.00 ? 320 C A H42    1  
ATOM 9602   H H5     . C A 1 299 ? 139.231 106.050 100.307 1.00 0.00 ? 320 C A H5     1  
ATOM 9603   H H6     . C A 1 299 ? 139.733 107.663 101.893 1.00 0.00 ? 320 C A H6     1  
ATOM 9604   P P      . C A 1 300 ? 139.376 106.619 107.910 1.00 0.00 ? 321 C A P      1  
ATOM 9605   O OP1    . C A 1 300 ? 139.500 107.040 109.322 1.00 0.00 ? 321 C A OP1    1  
ATOM 9606   O OP2    . C A 1 300 ? 140.340 105.629 107.346 1.00 0.00 ? 321 C A OP2    1  
ATOM 9607   O "O5'"  . C A 1 300 ? 137.894 106.094 107.660 1.00 0.00 ? 321 C A "O5'"  1  
ATOM 9608   C "C5'"  . C A 1 300 ? 136.777 106.853 108.095 1.00 0.00 ? 321 C A "C5'"  1  
ATOM 9609   C "C4'"  . C A 1 300 ? 135.509 106.060 107.934 1.00 0.00 ? 321 C A "C4'"  1  
ATOM 9610   O "O4'"  . C A 1 300 ? 135.015 106.108 106.566 1.00 0.00 ? 321 C A "O4'"  1  
ATOM 9611   C "C3'"  . C A 1 300 ? 135.642 104.582 108.187 1.00 0.00 ? 321 C A "C3'"  1  
ATOM 9612   O "O3'"  . C A 1 300 ? 135.751 104.302 109.572 1.00 0.00 ? 321 C A "O3'"  1  
ATOM 9613   C "C2'"  . C A 1 300 ? 134.353 104.068 107.560 1.00 0.00 ? 321 C A "C2'"  1  
ATOM 9614   O "O2'"  . C A 1 300 ? 133.238 104.332 108.390 1.00 0.00 ? 321 C A "O2'"  1  
ATOM 9615   C "C1'"  . C A 1 300 ? 134.269 104.929 106.293 1.00 0.00 ? 321 C A "C1'"  1  
ATOM 9616   N N1     . C A 1 300 ? 134.847 104.255 105.116 1.00 0.00 ? 321 C A N1     1  
ATOM 9617   C C2     . C A 1 300 ? 134.097 103.270 104.460 1.00 0.00 ? 321 C A C2     1  
ATOM 9618   O O2     . C A 1 300 ? 132.958 102.999 104.879 1.00 0.00 ? 321 C A O2     1  
ATOM 9619   N N3     . C A 1 300 ? 134.627 102.639 103.387 1.00 0.00 ? 321 C A N3     1  
ATOM 9620   C C4     . C A 1 300 ? 135.852 102.959 102.966 1.00 0.00 ? 321 C A C4     1  
ATOM 9621   N N4     . C A 1 300 ? 136.335 102.304 101.910 1.00 0.00 ? 321 C A N4     1  
ATOM 9622   C C5     . C A 1 300 ? 136.634 103.960 103.612 1.00 0.00 ? 321 C A C5     1  
ATOM 9623   C C6     . C A 1 300 ? 136.099 104.576 104.670 1.00 0.00 ? 321 C A C6     1  
ATOM 9624   H "H5'"  . C A 1 300 ? 136.722 107.675 107.563 1.00 0.00 ? 321 C A "H5'"  1  
ATOM 9625   H "H5''" . C A 1 300 ? 136.900 107.090 109.038 1.00 0.00 ? 321 C A "H5''" 1  
ATOM 9626   H "H4'"  . C A 1 300 ? 134.822 106.443 108.518 1.00 0.00 ? 321 C A "H4'"  1  
ATOM 9627   H "H3'"  . C A 1 300 ? 136.430 104.242 107.715 1.00 0.00 ? 321 C A "H3'"  1  
ATOM 9628   H "H2'"  . C A 1 300 ? 134.418 103.118 107.334 1.00 0.00 ? 321 C A "H2'"  1  
ATOM 9629   H "HO2'" . C A 1 300 ? 132.428 103.990 107.956 1.00 0.00 ? 321 C A "HO2'" 1  
ATOM 9630   H "H1'"  . C A 1 300 ? 133.331 105.147 106.116 1.00 0.00 ? 321 C A "H1'"  1  
ATOM 9631   H H41    . C A 1 300 ? 135.792 101.615 101.472 1.00 0.00 ? 321 C A H41    1  
ATOM 9632   H H42    . C A 1 300 ? 137.230 102.512 101.573 1.00 0.00 ? 321 C A H42    1  
ATOM 9633   H H5     . C A 1 300 ? 137.530 104.189 103.289 1.00 0.00 ? 321 C A H5     1  
ATOM 9634   H H6     . C A 1 300 ? 136.619 105.267 105.129 1.00 0.00 ? 321 C A H6     1  
ATOM 9635   P P      . U A 1 301 ? 136.524 102.984 110.073 1.00 0.00 ? 322 U A P      1  
ATOM 9636   O OP1    . U A 1 301 ? 136.094 102.699 111.466 1.00 0.00 ? 322 U A OP1    1  
ATOM 9637   O OP2    . U A 1 301 ? 137.967 103.156 109.770 1.00 0.00 ? 322 U A OP2    1  
ATOM 9638   O "O5'"  . U A 1 301 ? 135.956 101.828 109.136 1.00 0.00 ? 322 U A "O5'"  1  
ATOM 9639   C "C5'"  . U A 1 301 ? 134.631 101.345 109.292 1.00 0.00 ? 322 U A "C5'"  1  
ATOM 9640   C "C4'"  . U A 1 301 ? 134.225 100.449 108.149 1.00 0.00 ? 322 U A "C4'"  1  
ATOM 9641   O "O4'"  . U A 1 301 ? 134.702 100.981 106.887 1.00 0.00 ? 322 U A "O4'"  1  
ATOM 9642   C "C3'"  . U A 1 301 ? 134.786 99.035  108.173 1.00 0.00 ? 322 U A "C3'"  1  
ATOM 9643   O "O3'"  . U A 1 301 ? 134.159 98.207  109.135 1.00 0.00 ? 322 U A "O3'"  1  
ATOM 9644   C "C2'"  . U A 1 301 ? 134.579 98.572  106.736 1.00 0.00 ? 322 U A "C2'"  1  
ATOM 9645   O "O2'"  . U A 1 301 ? 133.265 98.071  106.541 1.00 0.00 ? 322 U A "O2'"  1  
ATOM 9646   C "C1'"  . U A 1 301 ? 134.732 99.889  105.966 1.00 0.00 ? 322 U A "C1'"  1  
ATOM 9647   N N1     . U A 1 301 ? 135.947 99.905  105.115 1.00 0.00 ? 322 U A N1     1  
ATOM 9648   C C2     . U A 1 301 ? 135.930 99.120  103.978 1.00 0.00 ? 322 U A C2     1  
ATOM 9649   O O2     . U A 1 301 ? 134.977 98.430  103.657 1.00 0.00 ? 322 U A O2     1  
ATOM 9650   N N3     . U A 1 301 ? 137.076 99.166  103.220 1.00 0.00 ? 322 U A N3     1  
ATOM 9651   C C4     . U A 1 301 ? 138.213 99.902  103.476 1.00 0.00 ? 322 U A C4     1  
ATOM 9652   O O4     . U A 1 301 ? 139.163 99.837  102.697 1.00 0.00 ? 322 U A O4     1  
ATOM 9653   C C5     . U A 1 301 ? 138.157 100.692 104.669 1.00 0.00 ? 322 U A C5     1  
ATOM 9654   C C6     . U A 1 301 ? 137.055 100.665 105.424 1.00 0.00 ? 322 U A C6     1  
ATOM 9655   H "H5'"  . U A 1 301 ? 134.017 102.109 109.333 1.00 0.00 ? 322 U A "H5'"  1  
ATOM 9656   H "H5''" . U A 1 301 ? 134.570 100.841 110.129 1.00 0.00 ? 322 U A "H5''" 1  
ATOM 9657   H "H4'"  . U A 1 301 ? 133.247 100.402 108.115 1.00 0.00 ? 322 U A "H4'"  1  
ATOM 9658   H "H3'"  . U A 1 301 ? 135.747 99.073  108.361 1.00 0.00 ? 322 U A "H3'"  1  
ATOM 9659   H "H2'"  . U A 1 301 ? 135.259 97.919  106.469 1.00 0.00 ? 322 U A "H2'"  1  
ATOM 9660   H "HO2'" . U A 1 301 ? 132.882 97.833  107.411 1.00 0.00 ? 322 U A "HO2'" 1  
ATOM 9661   H "H1'"  . U A 1 301 ? 133.941 100.028 105.404 1.00 0.00 ? 322 U A "H1'"  1  
ATOM 9662   H H3     . U A 1 301 ? 137.085 98.615  102.409 1.00 0.00 ? 322 U A H3     1  
ATOM 9663   H H5     . U A 1 301 ? 138.922 101.247 104.929 1.00 0.00 ? 322 U A H5     1  
ATOM 9664   H H6     . U A 1 301 ? 137.043 101.213 106.236 1.00 0.00 ? 322 U A H6     1  
ATOM 9665   P P      . U A 1 302 ? 135.052 97.411  110.200 1.00 0.00 ? 323 U A P      1  
ATOM 9666   O OP1    . U A 1 302 ? 134.330 97.515  111.493 1.00 0.00 ? 323 U A OP1    1  
ATOM 9667   O OP2    . U A 1 302 ? 136.421 97.970  110.077 1.00 0.00 ? 323 U A OP2    1  
ATOM 9668   O "O5'"  . U A 1 302 ? 135.107 95.872  109.788 1.00 0.00 ? 323 U A "O5'"  1  
ATOM 9669   C "C5'"  . U A 1 302 ? 134.409 95.398  108.647 1.00 0.00 ? 323 U A "C5'"  1  
ATOM 9670   C "C4'"  . U A 1 302 ? 135.342 94.765  107.645 1.00 0.00 ? 323 U A "C4'"  1  
ATOM 9671   O "O4'"  . U A 1 302 ? 135.788 95.756  106.693 1.00 0.00 ? 323 U A "O4'"  1  
ATOM 9672   C "C3'"  . U A 1 302 ? 136.638 94.194  108.202 1.00 0.00 ? 323 U A "C3'"  1  
ATOM 9673   O "O3'"  . U A 1 302 ? 136.474 92.913  108.783 1.00 0.00 ? 323 U A "O3'"  1  
ATOM 9674   C "C2'"  . U A 1 302 ? 137.548 94.202  106.984 1.00 0.00 ? 323 U A "C2'"  1  
ATOM 9675   O "O2'"  . U A 1 302 ? 137.270 93.103  106.129 1.00 0.00 ? 323 U A "O2'"  1  
ATOM 9676   C "C1'"  . U A 1 302 ? 137.116 95.487  106.301 1.00 0.00 ? 323 U A "C1'"  1  
ATOM 9677   N N1     . U A 1 302 ? 137.963 96.642  106.686 1.00 0.00 ? 323 U A N1     1  
ATOM 9678   C C2     . U A 1 302 ? 139.090 96.880  105.923 1.00 0.00 ? 323 U A C2     1  
ATOM 9679   O O2     . U A 1 302 ? 139.406 96.192  104.967 1.00 0.00 ? 323 U A O2     1  
ATOM 9680   N N3     . U A 1 302 ? 139.843 97.959  106.317 1.00 0.00 ? 323 U A N3     1  
ATOM 9681   C C4     . U A 1 302 ? 139.591 98.807  107.373 1.00 0.00 ? 323 U A C4     1  
ATOM 9682   O O4     . U A 1 302 ? 140.368 99.736  107.601 1.00 0.00 ? 323 U A O4     1  
ATOM 9683   C C5     . U A 1 302 ? 138.408 98.501  108.119 1.00 0.00 ? 323 U A C5     1  
ATOM 9684   C C6     . U A 1 302 ? 137.657 97.457  107.755 1.00 0.00 ? 323 U A C6     1  
ATOM 9685   H "H5'"  . U A 1 302 ? 133.944 96.148  108.222 1.00 0.00 ? 323 U A "H5'"  1  
ATOM 9686   H "H5''" . U A 1 302 ? 133.747 94.732  108.932 1.00 0.00 ? 323 U A "H5''" 1  
ATOM 9687   H "H4'"  . U A 1 302 ? 134.865 94.056  107.167 1.00 0.00 ? 323 U A "H4'"  1  
ATOM 9688   H "H3'"  . U A 1 302 ? 137.001 94.808  108.875 1.00 0.00 ? 323 U A "H3'"  1  
ATOM 9689   H "H2'"  . U A 1 302 ? 138.492 94.229  107.242 1.00 0.00 ? 323 U A "H2'"  1  
ATOM 9690   H "HO2'" . U A 1 302 ? 137.987 93.026  105.464 1.00 0.00 ? 323 U A "HO2'" 1  
ATOM 9691   H "H1'"  . U A 1 302 ? 137.156 95.365  105.329 1.00 0.00 ? 323 U A "H1'"  1  
ATOM 9692   H H3     . U A 1 302 ? 140.647 98.145  105.789 1.00 0.00 ? 323 U A H3     1  
ATOM 9693   H H5     . U A 1 302 ? 138.153 99.053  108.886 1.00 0.00 ? 323 U A H5     1  
ATOM 9694   H H6     . U A 1 302 ? 136.852 97.267  108.282 1.00 0.00 ? 323 U A H6     1  
ATOM 9695   P P      . A A 1 303 ? 137.688 92.222  109.578 1.00 0.00 ? 324 A A P      1  
ATOM 9696   O OP1    . A A 1 303 ? 137.119 91.207  110.498 1.00 0.00 ? 324 A A OP1    1  
ATOM 9697   O OP2    . A A 1 303 ? 138.556 93.299  110.117 1.00 0.00 ? 324 A A OP2    1  
ATOM 9698   O "O5'"  . A A 1 303 ? 138.505 91.454  108.441 1.00 0.00 ? 324 A A "O5'"  1  
ATOM 9699   C "C5'"  . A A 1 303 ? 139.896 91.156  108.591 1.00 0.00 ? 324 A A "C5'"  1  
ATOM 9700   C "C4'"  . A A 1 303 ? 140.364 90.253  107.469 1.00 0.00 ? 324 A A "C4'"  1  
ATOM 9701   O "O4'"  . A A 1 303 ? 139.593 89.024  107.486 1.00 0.00 ? 324 A A "O4'"  1  
ATOM 9702   C "C3'"  . A A 1 303 ? 140.165 90.789  106.060 1.00 0.00 ? 324 A A "C3'"  1  
ATOM 9703   O "O3'"  . A A 1 303 ? 141.235 91.640  105.673 1.00 0.00 ? 324 A A "O3'"  1  
ATOM 9704   C "C2'"  . A A 1 303 ? 140.143 89.514  105.229 1.00 0.00 ? 324 A A "C2'"  1  
ATOM 9705   O "O2'"  . A A 1 303 ? 141.436 89.008  104.970 1.00 0.00 ? 324 A A "O2'"  1  
ATOM 9706   C "C1'"  . A A 1 303 ? 139.396 88.560  106.161 1.00 0.00 ? 324 A A "C1'"  1  
ATOM 9707   N N9     . A A 1 303 ? 137.961 88.492  105.910 1.00 0.00 ? 324 A A N9     1  
ATOM 9708   C C8     . A A 1 303 ? 137.006 89.423  106.226 1.00 0.00 ? 324 A A C8     1  
ATOM 9709   N N7     . A A 1 303 ? 135.789 89.068  105.895 1.00 0.00 ? 324 A A N7     1  
ATOM 9710   C C5     . A A 1 303 ? 135.956 87.817  105.321 1.00 0.00 ? 324 A A C5     1  
ATOM 9711   C C6     . A A 1 303 ? 135.045 86.905  104.774 1.00 0.00 ? 324 A A C6     1  
ATOM 9712   N N6     . A A 1 303 ? 133.728 87.117  104.726 1.00 0.00 ? 324 A A N6     1  
ATOM 9713   N N1     . A A 1 303 ? 135.533 85.751  104.274 1.00 0.00 ? 324 A A N1     1  
ATOM 9714   C C2     . A A 1 303 ? 136.856 85.541  104.327 1.00 0.00 ? 324 A A C2     1  
ATOM 9715   N N3     . A A 1 303 ? 137.812 86.322  104.821 1.00 0.00 ? 324 A A N3     1  
ATOM 9716   C C4     . A A 1 303 ? 137.289 87.458  105.310 1.00 0.00 ? 324 A A C4     1  
ATOM 9717   H "H5'"  . A A 1 303 ? 140.035 90.711  109.452 1.00 0.00 ? 324 A A "H5'"  1  
ATOM 9718   H "H5''" . A A 1 303 ? 140.406 91.991  108.576 1.00 0.00 ? 324 A A "H5''" 1  
ATOM 9719   H "H4'"  . A A 1 303 ? 141.310 90.040  107.608 1.00 0.00 ? 324 A A "H4'"  1  
ATOM 9720   H "H3'"  . A A 1 303 ? 139.316 91.279  106.020 1.00 0.00 ? 324 A A "H3'"  1  
ATOM 9721   H "H2'"  . A A 1 303 ? 139.643 89.636  104.395 1.00 0.00 ? 324 A A "H2'"  1  
ATOM 9722   H "HO2'" . A A 1 303 ? 142.089 89.726  105.095 1.00 0.00 ? 324 A A "HO2'" 1  
ATOM 9723   H "H1'"  . A A 1 303 ? 139.772 87.660  106.075 1.00 0.00 ? 324 A A "H1'"  1  
ATOM 9724   H H8     . A A 1 303 ? 137.213 90.277  106.661 1.00 0.00 ? 324 A A H8     1  
ATOM 9725   H H61    . A A 1 303 ? 133.136 86.441  104.334 1.00 0.00 ? 324 A A H61    1  
ATOM 9726   H H62    . A A 1 303 ? 133.351 87.948  105.084 1.00 0.00 ? 324 A A H62    1  
ATOM 9727   H H2     . A A 1 303 ? 137.163 84.691  103.947 1.00 0.00 ? 324 A A H2     1  
ATOM 9728   P P      . A A 1 304 ? 140.975 92.801  104.593 1.00 0.00 ? 325 A A P      1  
ATOM 9729   O OP1    . A A 1 304 ? 141.714 93.998  105.068 1.00 0.00 ? 325 A A OP1    1  
ATOM 9730   O OP2    . A A 1 304 ? 139.518 92.899  104.328 1.00 0.00 ? 325 A A OP2    1  
ATOM 9731   O "O5'"  . A A 1 304 ? 141.680 92.274  103.264 1.00 0.00 ? 325 A A "O5'"  1  
ATOM 9732   C "C5'"  . A A 1 304 ? 141.225 92.706  101.987 1.00 0.00 ? 325 A A "C5'"  1  
ATOM 9733   C "C4'"  . A A 1 304 ? 141.268 91.560  101.009 1.00 0.00 ? 325 A A "C4'"  1  
ATOM 9734   O "O4'"  . A A 1 304 ? 140.901 90.333  101.700 1.00 0.00 ? 325 A A "O4'"  1  
ATOM 9735   C "C3'"  . A A 1 304 ? 140.295 91.690  99.843  1.00 0.00 ? 325 A A "C3'"  1  
ATOM 9736   O "O3'"  . A A 1 304 ? 140.874 92.373  98.735  1.00 0.00 ? 325 A A "O3'"  1  
ATOM 9737   C "C2'"  . A A 1 304 ? 139.965 90.235  99.533  1.00 0.00 ? 325 A A "C2'"  1  
ATOM 9738   O "O2'"  . A A 1 304 ? 140.950 89.604  98.734  1.00 0.00 ? 325 A A "O2'"  1  
ATOM 9739   C "C1'"  . A A 1 304 ? 139.924 89.635  100.947 1.00 0.00 ? 325 A A "C1'"  1  
ATOM 9740   N N9     . A A 1 304 ? 138.638 89.840  101.626 1.00 0.00 ? 325 A A N9     1  
ATOM 9741   C C8     . A A 1 304 ? 138.341 90.859  102.508 1.00 0.00 ? 325 A A C8     1  
ATOM 9742   N N7     . A A 1 304 ? 137.115 90.815  102.976 1.00 0.00 ? 325 A A N7     1  
ATOM 9743   C C5     . A A 1 304 ? 136.566 89.698  102.366 1.00 0.00 ? 325 A A C5     1  
ATOM 9744   C C6     . A A 1 304 ? 135.296 89.115  102.449 1.00 0.00 ? 325 A A C6     1  
ATOM 9745   N N6     . A A 1 304 ? 134.314 89.598  103.213 1.00 0.00 ? 325 A A N6     1  
ATOM 9746   N N1     . A A 1 304 ? 135.065 88.005  101.714 1.00 0.00 ? 325 A A N1     1  
ATOM 9747   C C2     . A A 1 304 ? 136.053 87.523  100.950 1.00 0.00 ? 325 A A C2     1  
ATOM 9748   N N3     . A A 1 304 ? 137.294 87.980  100.787 1.00 0.00 ? 325 A A N3     1  
ATOM 9749   C C4     . A A 1 304 ? 137.491 89.084  101.530 1.00 0.00 ? 325 A A C4     1  
ATOM 9750   H "H5'"  . A A 1 304 ? 141.799 93.434  101.671 1.00 0.00 ? 325 A A "H5'"  1  
ATOM 9751   H "H5''" . A A 1 304 ? 140.306 93.038  102.070 1.00 0.00 ? 325 A A "H5''" 1  
ATOM 9752   H "H4'"  . A A 1 304 ? 142.179 91.476  100.659 1.00 0.00 ? 325 A A "H4'"  1  
ATOM 9753   H "H3'"  . A A 1 304 ? 139.495 92.171  100.146 1.00 0.00 ? 325 A A "H3'"  1  
ATOM 9754   H "H2'"  . A A 1 304 ? 139.077 90.147  99.126  1.00 0.00 ? 325 A A "H2'"  1  
ATOM 9755   H "HO2'" . A A 1 304 ? 140.680 88.676  98.573  1.00 0.00 ? 325 A A "HO2'" 1  
ATOM 9756   H "H1'"  . A A 1 304 ? 140.106 88.674  100.899 1.00 0.00 ? 325 A A "H1'"  1  
ATOM 9757   H H8     . A A 1 304 ? 138.987 91.551  102.761 1.00 0.00 ? 325 A A H8     1  
ATOM 9758   H H61    . A A 1 304 ? 133.443 89.146  103.236 1.00 0.00 ? 325 A A H61    1  
ATOM 9759   H H62    . A A 1 304 ? 134.462 90.400  103.754 1.00 0.00 ? 325 A A H62    1  
ATOM 9760   H H2     . A A 1 304 ? 135.832 86.717  100.437 1.00 0.00 ? 325 A A H2     1  
ATOM 9761   P P      . U A 1 305 ? 140.317 92.103  97.256  1.00 0.00 ? 326 U A P      1  
ATOM 9762   O OP1    . U A 1 305 ? 139.944 90.670  97.135  1.00 0.00 ? 326 U A OP1    1  
ATOM 9763   O OP2    . U A 1 305 ? 141.396 92.655  96.399  1.00 0.00 ? 326 U A OP2    1  
ATOM 9764   O "O5'"  . U A 1 305 ? 139.006 92.977  97.026  1.00 0.00 ? 326 U A "O5'"  1  
ATOM 9765   C "C5'"  . U A 1 305 ? 139.065 94.209  96.324  1.00 0.00 ? 326 U A "C5'"  1  
ATOM 9766   C "C4'"  . U A 1 305 ? 138.799 94.025  94.851  1.00 0.00 ? 326 U A "C4'"  1  
ATOM 9767   O "O4'"  . U A 1 305 ? 139.703 93.008  94.341  1.00 0.00 ? 326 U A "O4'"  1  
ATOM 9768   C "C3'"  . U A 1 305 ? 137.392 93.584  94.474  1.00 0.00 ? 326 U A "C3'"  1  
ATOM 9769   O "O3'"  . U A 1 305 ? 136.913 94.208  93.296  1.00 0.00 ? 326 U A "O3'"  1  
ATOM 9770   C "C2'"  . U A 1 305 ? 137.543 92.092  94.204  1.00 0.00 ? 326 U A "C2'"  1  
ATOM 9771   O "O2'"  . U A 1 305 ? 136.632 91.655  93.206  1.00 0.00 ? 326 U A "O2'"  1  
ATOM 9772   C "C1'"  . U A 1 305 ? 138.959 92.025  93.645  1.00 0.00 ? 326 U A "C1'"  1  
ATOM 9773   N N1     . U A 1 305 ? 139.593 90.706  93.878  1.00 0.00 ? 326 U A N1     1  
ATOM 9774   C C2     . U A 1 305 ? 140.361 90.185  92.852  1.00 0.00 ? 326 U A C2     1  
ATOM 9775   O O2     . U A 1 305 ? 140.532 90.760  91.791  1.00 0.00 ? 326 U A O2     1  
ATOM 9776   N N3     . U A 1 305 ? 140.930 88.963  93.111  1.00 0.00 ? 326 U A N3     1  
ATOM 9777   C C4     . U A 1 305 ? 140.810 88.218  94.266  1.00 0.00 ? 326 U A C4     1  
ATOM 9778   O O4     . U A 1 305 ? 141.384 87.130  94.346  1.00 0.00 ? 326 U A O4     1  
ATOM 9779   C C5     . U A 1 305 ? 140.002 88.818  95.284  1.00 0.00 ? 326 U A C5     1  
ATOM 9780   C C6     . U A 1 305 ? 139.438 90.009  95.058  1.00 0.00 ? 326 U A C6     1  
ATOM 9781   H "H5'"  . U A 1 305 ? 139.956 94.601  96.440  1.00 0.00 ? 326 U A "H5'"  1  
ATOM 9782   H "H5''" . U A 1 305 ? 138.396 94.821  96.694  1.00 0.00 ? 326 U A "H5''" 1  
ATOM 9783   H "H4'"  . U A 1 305 ? 139.001 94.863  94.386  1.00 0.00 ? 326 U A "H4'"  1  
ATOM 9784   H "H3'"  . U A 1 305 ? 136.766 93.757  95.207  1.00 0.00 ? 326 U A "H3'"  1  
ATOM 9785   H "H2'"  . U A 1 305 ? 137.458 91.568  95.027  1.00 0.00 ? 326 U A "H2'"  1  
ATOM 9786   H "HO2'" . U A 1 305 ? 136.757 90.693  93.059  1.00 0.00 ? 326 U A "HO2'" 1  
ATOM 9787   H "H1'"  . U A 1 305 ? 138.935 92.209  92.683  1.00 0.00 ? 326 U A "H1'"  1  
ATOM 9788   H H3     . U A 1 305 ? 141.478 88.576  92.399  1.00 0.00 ? 326 U A H3     1  
ATOM 9789   H H5     . U A 1 305 ? 139.864 88.358  96.139  1.00 0.00 ? 326 U A H5     1  
ATOM 9790   H H6     . U A 1 305 ? 138.889 90.397  95.769  1.00 0.00 ? 326 U A H6     1  
ATOM 9791   P P      . G A 1 306 ? 135.849 95.401  93.409  1.00 0.00 ? 327 G A P      1  
ATOM 9792   O OP1    . G A 1 306 ? 135.239 95.529  92.061  1.00 0.00 ? 327 G A OP1    1  
ATOM 9793   O OP2    . G A 1 306 ? 136.587 96.549  93.994  1.00 0.00 ? 327 G A OP2    1  
ATOM 9794   O "O5'"  . G A 1 306 ? 134.704 94.979  94.429  1.00 0.00 ? 327 G A "O5'"  1  
ATOM 9795   C "C5'"  . G A 1 306 ? 133.931 93.813  94.205  1.00 0.00 ? 327 G A "C5'"  1  
ATOM 9796   C "C4'"  . G A 1 306 ? 133.112 93.492  95.426  1.00 0.00 ? 327 G A "C4'"  1  
ATOM 9797   O "O4'"  . G A 1 306 ? 133.981 93.089  96.515  1.00 0.00 ? 327 G A "O4'"  1  
ATOM 9798   C "C3'"  . G A 1 306 ? 132.340 94.676  95.966  1.00 0.00 ? 327 G A "C3'"  1  
ATOM 9799   O "O3'"  . G A 1 306 ? 131.104 94.779  95.281  1.00 0.00 ? 327 G A "O3'"  1  
ATOM 9800   C "C2'"  . G A 1 306 ? 132.166 94.310  97.431  1.00 0.00 ? 327 G A "C2'"  1  
ATOM 9801   O "O2'"  . G A 1 306 ? 131.119 93.388  97.650  1.00 0.00 ? 327 G A "O2'"  1  
ATOM 9802   C "C1'"  . G A 1 306 ? 133.510 93.648  97.731  1.00 0.00 ? 327 G A "C1'"  1  
ATOM 9803   N N9     . G A 1 306 ? 134.524 94.586  98.200  1.00 0.00 ? 327 G A N9     1  
ATOM 9804   C C8     . G A 1 306 ? 135.623 95.000  97.490  1.00 0.00 ? 327 G A C8     1  
ATOM 9805   N N7     . G A 1 306 ? 136.378 95.830  98.150  1.00 0.00 ? 327 G A N7     1  
ATOM 9806   C C5     . G A 1 306 ? 135.738 95.982  99.372  1.00 0.00 ? 327 G A C5     1  
ATOM 9807   C C6     . G A 1 306 ? 136.097 96.763  100.493 1.00 0.00 ? 327 G A C6     1  
ATOM 9808   O O6     . G A 1 306 ? 137.083 97.483  100.637 1.00 0.00 ? 327 G A O6     1  
ATOM 9809   N N1     . G A 1 306 ? 135.176 96.637  101.521 1.00 0.00 ? 327 G A N1     1  
ATOM 9810   C C2     . G A 1 306 ? 134.052 95.857  101.480 1.00 0.00 ? 327 G A C2     1  
ATOM 9811   N N2     . G A 1 306 ? 133.291 95.880  102.587 1.00 0.00 ? 327 G A N2     1  
ATOM 9812   N N3     . G A 1 306 ? 133.702 95.111  100.435 1.00 0.00 ? 327 G A N3     1  
ATOM 9813   C C4     . G A 1 306 ? 134.588 95.226  99.421  1.00 0.00 ? 327 G A C4     1  
ATOM 9814   H "H5'"  . G A 1 306 ? 134.529 93.066  94.001  1.00 0.00 ? 327 G A "H5'"  1  
ATOM 9815   H "H5''" . G A 1 306 ? 133.337 93.965  93.439  1.00 0.00 ? 327 G A "H5''" 1  
ATOM 9816   H "H4'"  . G A 1 306 ? 132.506 92.751  95.217  1.00 0.00 ? 327 G A "H4'"  1  
ATOM 9817   H "H3'"  . G A 1 306 ? 132.874 95.488  95.851  1.00 0.00 ? 327 G A "H3'"  1  
ATOM 9818   H "H2'"  . G A 1 306 ? 132.046 95.108  97.990  1.00 0.00 ? 327 G A "H2'"  1  
ATOM 9819   H "HO2'" . G A 1 306 ? 130.512 93.405  96.881  1.00 0.00 ? 327 G A "HO2'" 1  
ATOM 9820   H "H1'"  . G A 1 306 ? 133.386 92.951  98.410  1.00 0.00 ? 327 G A "H1'"  1  
ATOM 9821   H H8     . G A 1 306 ? 135.823 94.697  96.580  1.00 0.00 ? 327 G A H8     1  
ATOM 9822   H H1     . G A 1 306 ? 135.343 97.149  102.340 1.00 0.00 ? 327 G A H1     1  
ATOM 9823   H H21    . G A 1 306 ? 133.552 96.431  103.354 1.00 0.00 ? 327 G A H21    1  
ATOM 9824   H H22    . G A 1 306 ? 132.468 95.346  102.629 1.00 0.00 ? 327 G A H22    1  
ATOM 9825   P P      . G A 1 307 ? 130.420 96.214  95.104  1.00 0.00 ? 328 G A P      1  
ATOM 9826   O OP1    . G A 1 307 ? 129.909 96.301  93.713  1.00 0.00 ? 328 G A OP1    1  
ATOM 9827   O OP2    . G A 1 307 ? 131.379 97.232  95.596  1.00 0.00 ? 328 G A OP2    1  
ATOM 9828   O "O5'"  . G A 1 307 ? 129.187 96.159  96.106  1.00 0.00 ? 328 G A "O5'"  1  
ATOM 9829   C "C5'"  . G A 1 307 ? 128.681 97.348  96.680  1.00 0.00 ? 328 G A "C5'"  1  
ATOM 9830   C "C4'"  . G A 1 307 ? 128.376 97.139  98.140  1.00 0.00 ? 328 G A "C4'"  1  
ATOM 9831   O "O4'"  . G A 1 307 ? 129.483 96.469  98.800  1.00 0.00 ? 328 G A "O4'"  1  
ATOM 9832   C "C3'"  . G A 1 307 ? 128.216 98.447  98.880  1.00 0.00 ? 328 G A "C3'"  1  
ATOM 9833   O "O3'"  . G A 1 307 ? 126.892 98.929  98.726  1.00 0.00 ? 328 G A "O3'"  1  
ATOM 9834   C "C2'"  . G A 1 307 ? 128.598 98.072  100.305 1.00 0.00 ? 328 G A "C2'"  1  
ATOM 9835   O "O2'"  . G A 1 307 ? 127.559 97.416  101.002 1.00 0.00 ? 328 G A "O2'"  1  
ATOM 9836   C "C1'"  . G A 1 307 ? 129.746 97.095  100.048 1.00 0.00 ? 328 G A "C1'"  1  
ATOM 9837   N N9     . G A 1 307 ? 131.068 97.717  99.953  1.00 0.00 ? 328 G A N9     1  
ATOM 9838   C C8     . G A 1 307 ? 132.034 97.425  99.020  1.00 0.00 ? 328 G A C8     1  
ATOM 9839   N N7     . G A 1 307 ? 133.125 98.123  99.173  1.00 0.00 ? 328 G A N7     1  
ATOM 9840   C C5     . G A 1 307 ? 132.869 98.930  100.272 1.00 0.00 ? 328 G A C5     1  
ATOM 9841   C C6     . G A 1 307 ? 133.685 99.894  100.904 1.00 0.00 ? 328 G A C6     1  
ATOM 9842   O O6     . G A 1 307 ? 134.835 100.240 100.610 1.00 0.00 ? 328 G A O6     1  
ATOM 9843   N N1     . G A 1 307 ? 133.039 100.481 101.986 1.00 0.00 ? 328 G A N1     1  
ATOM 9844   C C2     . G A 1 307 ? 131.764 100.182 102.406 1.00 0.00 ? 328 G A C2     1  
ATOM 9845   N N2     . G A 1 307 ? 131.322 100.871 103.475 1.00 0.00 ? 328 G A N2     1  
ATOM 9846   N N3     . G A 1 307 ? 130.986 99.280  101.824 1.00 0.00 ? 328 G A N3     1  
ATOM 9847   C C4     . G A 1 307 ? 131.600 98.693  100.769 1.00 0.00 ? 328 G A C4     1  
ATOM 9848   H "H5'"  . G A 1 307 ? 127.864 97.610  96.207  1.00 0.00 ? 328 G A "H5'"  1  
ATOM 9849   H "H5''" . G A 1 307 ? 129.348 98.059  96.582  1.00 0.00 ? 328 G A "H5''" 1  
ATOM 9850   H "H4'"  . G A 1 307 ? 127.577 96.576  98.219  1.00 0.00 ? 328 G A "H4'"  1  
ATOM 9851   H "H3'"  . G A 1 307 ? 128.863 99.095  98.533  1.00 0.00 ? 328 G A "H3'"  1  
ATOM 9852   H "H2'"  . G A 1 307 ? 128.914 98.852  100.810 1.00 0.00 ? 328 G A "H2'"  1  
ATOM 9853   H "HO2'" . G A 1 307 ? 127.867 97.203  101.907 1.00 0.00 ? 328 G A "HO2'" 1  
ATOM 9854   H "H1'"  . G A 1 307 ? 129.775 96.428  100.765 1.00 0.00 ? 328 G A "H1'"  1  
ATOM 9855   H H8     . G A 1 307 ? 131.916 96.758  98.312  1.00 0.00 ? 328 G A H8     1  
ATOM 9856   H H1     . G A 1 307 ? 133.534 101.162 102.486 1.00 0.00 ? 328 G A H1     1  
ATOM 9857   H H21    . G A 1 307 ? 131.897 101.536 103.906 1.00 0.00 ? 328 G A H21    1  
ATOM 9858   H H22    . G A 1 307 ? 130.419 100.706 103.825 1.00 0.00 ? 328 G A H22    1  
ATOM 9859   P P      . G A 1 308 ? 126.656 100.410 98.153  1.00 0.00 ? 329 G A P      1  
ATOM 9860   O OP1    . G A 1 308 ? 125.197 100.572 97.956  1.00 0.00 ? 329 G A OP1    1  
ATOM 9861   O OP2    . G A 1 308 ? 127.576 100.627 97.005  1.00 0.00 ? 329 G A OP2    1  
ATOM 9862   O "O5'"  . G A 1 308 ? 127.092 101.341 99.371  1.00 0.00 ? 329 G A "O5'"  1  
ATOM 9863   C "C5'"  . G A 1 308 ? 126.454 101.208 100.638 1.00 0.00 ? 329 G A "C5'"  1  
ATOM 9864   C "C4'"  . G A 1 308 ? 126.926 102.281 101.583 1.00 0.00 ? 329 G A "C4'"  1  
ATOM 9865   O "O4'"  . G A 1 308 ? 128.293 102.020 101.978 1.00 0.00 ? 329 G A "O4'"  1  
ATOM 9866   C "C3'"  . G A 1 308 ? 126.963 103.684 101.007 1.00 0.00 ? 329 G A "C3'"  1  
ATOM 9867   O "O3'"  . G A 1 308 ? 125.690 104.305 101.075 1.00 0.00 ? 329 G A "O3'"  1  
ATOM 9868   C "C2'"  . G A 1 308 ? 127.952 104.373 101.929 1.00 0.00 ? 329 G A "C2'"  1  
ATOM 9869   O "O2'"  . G A 1 308 ? 127.345 104.767 103.145 1.00 0.00 ? 329 G A "O2'"  1  
ATOM 9870   C "C1'"  . G A 1 308 ? 128.963 103.253 102.180 1.00 0.00 ? 329 G A "C1'"  1  
ATOM 9871   N N9     . G A 1 308 ? 130.120 103.295 101.291 1.00 0.00 ? 329 G A N9     1  
ATOM 9872   C C8     . G A 1 308 ? 130.295 102.588 100.125 1.00 0.00 ? 329 G A C8     1  
ATOM 9873   N N7     . G A 1 308 ? 131.454 102.806 99.562  1.00 0.00 ? 329 G A N7     1  
ATOM 9874   C C5     . G A 1 308 ? 132.080 103.716 100.405 1.00 0.00 ? 329 G A C5     1  
ATOM 9875   C C6     . G A 1 308 ? 133.365 104.307 100.325 1.00 0.00 ? 329 G A C6     1  
ATOM 9876   O O6     . G A 1 308 ? 134.242 104.129 99.474  1.00 0.00 ? 329 G A O6     1  
ATOM 9877   N N1     . G A 1 308 ? 133.594 105.178 101.382 1.00 0.00 ? 329 G A N1     1  
ATOM 9878   C C2     . G A 1 308 ? 132.706 105.447 102.390 1.00 0.00 ? 329 G A C2     1  
ATOM 9879   N N2     . G A 1 308 ? 133.114 106.325 103.316 1.00 0.00 ? 329 G A N2     1  
ATOM 9880   N N3     . G A 1 308 ? 131.511 104.895 102.485 1.00 0.00 ? 329 G A N3     1  
ATOM 9881   C C4     . G A 1 308 ? 131.265 104.043 101.466 1.00 0.00 ? 329 G A C4     1  
ATOM 9882   H "H5'"  . G A 1 308 ? 126.664 100.326 101.011 1.00 0.00 ? 329 G A "H5'"  1  
ATOM 9883   H "H5''" . G A 1 308 ? 125.483 101.280 100.517 1.00 0.00 ? 329 G A "H5''" 1  
ATOM 9884   H "H4'"  . G A 1 308 ? 126.356 102.273 102.381 1.00 0.00 ? 329 G A "H4'"  1  
ATOM 9885   H "H3'"  . G A 1 308 ? 127.263 103.641 100.076 1.00 0.00 ? 329 G A "H3'"  1  
ATOM 9886   H "H2'"  . G A 1 308 ? 128.389 105.130 101.487 1.00 0.00 ? 329 G A "H2'"  1  
ATOM 9887   H "HO2'" . G A 1 308 ? 126.374 104.805 103.019 1.00 0.00 ? 329 G A "HO2'" 1  
ATOM 9888   H "H1'"  . G A 1 308 ? 129.280 103.301 103.107 1.00 0.00 ? 329 G A "H1'"  1  
ATOM 9889   H H8     . G A 1 308 ? 129.622 101.979 99.754  1.00 0.00 ? 329 G A H8     1  
ATOM 9890   H H1     . G A 1 308 ? 134.460 105.637 101.406 1.00 0.00 ? 329 G A H1     1  
ATOM 9891   H H21    . G A 1 308 ? 133.999 106.736 103.249 1.00 0.00 ? 329 G A H21    1  
ATOM 9892   H H22    . G A 1 308 ? 132.523 106.558 104.063 1.00 0.00 ? 329 G A H22    1  
ATOM 9893   P P      . A A 1 309 ? 125.340 105.499 100.064 1.00 0.00 ? 330 A A P      1  
ATOM 9894   O OP1    . A A 1 309 ? 123.864 105.513 99.902  1.00 0.00 ? 330 A A OP1    1  
ATOM 9895   O OP2    . A A 1 309 ? 126.209 105.339 98.869  1.00 0.00 ? 330 A A OP2    1  
ATOM 9896   O "O5'"  . A A 1 309 ? 125.788 106.818 100.845 1.00 0.00 ? 330 A A "O5'"  1  
ATOM 9897   C "C5'"  . A A 1 309 ? 126.204 107.997 100.143 1.00 0.00 ? 330 A A "C5'"  1  
ATOM 9898   C "C4'"  . A A 1 309 ? 126.960 108.924 101.075 1.00 0.00 ? 330 A A "C4'"  1  
ATOM 9899   O "O4'"  . A A 1 309 ? 127.980 108.155 101.770 1.00 0.00 ? 330 A A "O4'"  1  
ATOM 9900   C "C3'"  . A A 1 309 ? 127.708 110.079 100.417 1.00 0.00 ? 330 A A "C3'"  1  
ATOM 9901   O "O3'"  . A A 1 309 ? 126.884 111.241 100.303 1.00 0.00 ? 330 A A "O3'"  1  
ATOM 9902   C "C2'"  . A A 1 309 ? 128.835 110.327 101.410 1.00 0.00 ? 330 A A "C2'"  1  
ATOM 9903   O "O2'"  . A A 1 309 ? 128.386 111.050 102.539 1.00 0.00 ? 330 A A "O2'"  1  
ATOM 9904   C "C1'"  . A A 1 309 ? 129.185 108.898 101.829 1.00 0.00 ? 330 A A "C1'"  1  
ATOM 9905   N N9     . A A 1 309 ? 130.148 108.240 100.944 1.00 0.00 ? 330 A A N9     1  
ATOM 9906   C C8     . A A 1 309 ? 129.911 107.135 100.168 1.00 0.00 ? 330 A A C8     1  
ATOM 9907   N N7     . A A 1 309 ? 130.940 106.759 99.455  1.00 0.00 ? 330 A A N7     1  
ATOM 9908   C C5     . A A 1 309 ? 131.924 107.675 99.783  1.00 0.00 ? 330 A A C5     1  
ATOM 9909   C C6     . A A 1 309 ? 133.244 107.820 99.354  1.00 0.00 ? 330 A A C6     1  
ATOM 9910   N N6     . A A 1 309 ? 133.804 107.013 98.458  1.00 0.00 ? 330 A A N6     1  
ATOM 9911   N N1     . A A 1 309 ? 133.973 108.831 99.875  1.00 0.00 ? 330 A A N1     1  
ATOM 9912   C C2     . A A 1 309 ? 133.389 109.642 100.764 1.00 0.00 ? 330 A A C2     1  
ATOM 9913   N N3     . A A 1 309 ? 132.145 109.611 101.244 1.00 0.00 ? 330 A A N3     1  
ATOM 9914   C C4     . A A 1 309 ? 131.457 108.591 100.706 1.00 0.00 ? 330 A A C4     1  
ATOM 9915   H "H5'"  . A A 1 309 ? 125.411 108.457 99.792  1.00 0.00 ? 330 A A "H5'"  1  
ATOM 9916   H "H5''" . A A 1 309 ? 126.780 107.738 99.394  1.00 0.00 ? 330 A A "H5''" 1  
ATOM 9917   H "H4'"  . A A 1 309 ? 126.332 109.299 101.729 1.00 0.00 ? 330 A A "H4'"  1  
ATOM 9918   H "H3'"  . A A 1 309 ? 128.015 109.800 99.529  1.00 0.00 ? 330 A A "H3'"  1  
ATOM 9919   H "H2'"  . A A 1 309 ? 129.600 110.765 100.982 1.00 0.00 ? 330 A A "H2'"  1  
ATOM 9920   H "HO2'" . A A 1 309 ? 129.141 111.187 103.148 1.00 0.00 ? 330 A A "HO2'" 1  
ATOM 9921   H "H1'"  . A A 1 309 ? 129.552 108.906 102.738 1.00 0.00 ? 330 A A "H1'"  1  
ATOM 9922   H H8     . A A 1 309 ? 129.047 106.671 100.148 1.00 0.00 ? 330 A A H8     1  
ATOM 9923   H H61    . A A 1 309 ? 134.734 107.156 98.187  1.00 0.00 ? 330 A A H61    1  
ATOM 9924   H H62    . A A 1 309 ? 133.288 106.275 98.073  1.00 0.00 ? 330 A A H62    1  
ATOM 9925   H H2     . A A 1 309 ? 133.956 110.360 101.113 1.00 0.00 ? 330 A A H2     1  
ATOM 9926   P P      . G A 1 310 ? 126.725 111.980 98.879  1.00 0.00 ? 331 G A P      1  
ATOM 9927   O OP1    . G A 1 310 ? 125.615 112.958 99.020  1.00 0.00 ? 331 G A OP1    1  
ATOM 9928   O OP2    . G A 1 310 ? 126.662 110.942 97.819  1.00 0.00 ? 331 G A OP2    1  
ATOM 9929   O "O5'"  . G A 1 310 ? 128.067 112.815 98.678  1.00 0.00 ? 331 G A "O5'"  1  
ATOM 9930   C "C5'"  . G A 1 310 ? 128.156 114.176 99.098  1.00 0.00 ? 331 G A "C5'"  1  
ATOM 9931   C "C4'"  . G A 1 310 ? 129.572 114.679 98.938  1.00 0.00 ? 331 G A "C4'"  1  
ATOM 9932   O "O4'"  . G A 1 310 ? 130.452 113.557 99.223  1.00 0.00 ? 331 G A "O4'"  1  
ATOM 9933   C "C3'"  . G A 1 310 ? 130.011 115.149 97.552  1.00 0.00 ? 331 G A "C3'"  1  
ATOM 9934   O "O3'"  . G A 1 310 ? 129.720 116.536 97.347  1.00 0.00 ? 331 G A "O3'"  1  
ATOM 9935   C "C2'"  . G A 1 310 ? 131.519 114.939 97.614  1.00 0.00 ? 331 G A "C2'"  1  
ATOM 9936   O "O2'"  . G A 1 310 ? 132.194 115.981 98.291  1.00 0.00 ? 331 G A "O2'"  1  
ATOM 9937   C "C1'"  . G A 1 310 ? 131.614 113.649 98.423  1.00 0.00 ? 331 G A "C1'"  1  
ATOM 9938   N N9     . G A 1 310 ? 131.699 112.467 97.575  1.00 0.00 ? 331 G A N9     1  
ATOM 9939   C C8     . G A 1 310 ? 130.687 111.627 97.170  1.00 0.00 ? 331 G A C8     1  
ATOM 9940   N N7     . G A 1 310 ? 131.105 110.658 96.401  1.00 0.00 ? 331 G A N7     1  
ATOM 9941   C C5     . G A 1 310 ? 132.473 110.873 96.293  1.00 0.00 ? 331 G A C5     1  
ATOM 9942   C C6     . G A 1 310 ? 133.471 110.150 95.592  1.00 0.00 ? 331 G A C6     1  
ATOM 9943   O O6     . G A 1 310 ? 133.344 109.139 94.894  1.00 0.00 ? 331 G A O6     1  
ATOM 9944   N N1     . G A 1 310 ? 134.731 110.723 95.760  1.00 0.00 ? 331 G A N1     1  
ATOM 9945   C C2     . G A 1 310 ? 134.994 111.845 96.507  1.00 0.00 ? 331 G A C2     1  
ATOM 9946   N N2     . G A 1 310 ? 136.271 112.251 96.558  1.00 0.00 ? 331 G A N2     1  
ATOM 9947   N N3     . G A 1 310 ? 134.075 112.525 97.156  1.00 0.00 ? 331 G A N3     1  
ATOM 9948   C C4     . G A 1 310 ? 132.848 111.988 97.010  1.00 0.00 ? 331 G A C4     1  
ATOM 9949   H "H5'"  . G A 1 310 ? 127.885 114.241 100.038 1.00 0.00 ? 331 G A "H5'"  1  
ATOM 9950   H "H5''" . G A 1 310 ? 127.547 114.720 98.553  1.00 0.00 ? 331 G A "H5''" 1  
ATOM 9951   H "H4'"  . G A 1 310 ? 129.726 115.403 99.580  1.00 0.00 ? 331 G A "H4'"  1  
ATOM 9952   H "H3'"  . G A 1 310 ? 129.559 114.611 96.872  1.00 0.00 ? 331 G A "H3'"  1  
ATOM 9953   H "H2'"  . G A 1 310 ? 131.900 114.801 96.721  1.00 0.00 ? 331 G A "H2'"  1  
ATOM 9954   H "HO2'" . G A 1 310 ? 131.619 116.774 98.309  1.00 0.00 ? 331 G A "HO2'" 1  
ATOM 9955   H "H1'"  . G A 1 310 ? 132.400 113.686 99.007  1.00 0.00 ? 331 G A "H1'"  1  
ATOM 9956   H H8     . G A 1 310 ? 129.749 111.741 97.431  1.00 0.00 ? 331 G A H8     1  
ATOM 9957   H H1     . G A 1 310 ? 135.485 110.289 95.311  1.00 0.00 ? 331 G A H1     1  
ATOM 9958   H H21    . G A 1 310 ? 136.966 111.755 96.079  1.00 0.00 ? 331 G A H21    1  
ATOM 9959   H H22    . G A 1 310 ? 136.512 113.047 97.078  1.00 0.00 ? 331 G A H22    1  
ATOM 9960   P P      . C A 1 311 ? 128.205 117.004 97.102  1.00 0.00 ? 332 C A P      1  
ATOM 9961   O OP1    . C A 1 311 ? 127.697 117.437 98.429  1.00 0.00 ? 332 C A OP1    1  
ATOM 9962   O OP2    . C A 1 311 ? 127.544 115.880 96.395  1.00 0.00 ? 332 C A OP2    1  
ATOM 9963   O "O5'"  . C A 1 311 ? 128.200 118.269 96.135  1.00 0.00 ? 332 C A "O5'"  1  
ATOM 9964   C "C5'"  . C A 1 311 ? 126.998 118.970 95.858  1.00 0.00 ? 332 C A "C5'"  1  
ATOM 9965   C "C4'"  . C A 1 311 ? 126.729 120.044 96.885  1.00 0.00 ? 332 C A "C4'"  1  
ATOM 9966   O "O4'"  . C A 1 311 ? 127.937 120.813 97.124  1.00 0.00 ? 332 C A "O4'"  1  
ATOM 9967   C "C3'"  . C A 1 311 ? 125.695 121.091 96.505  1.00 0.00 ? 332 C A "C3'"  1  
ATOM 9968   O "O3'"  . C A 1 311 ? 124.361 120.650 96.704  1.00 0.00 ? 332 C A "O3'"  1  
ATOM 9969   C "C2'"  . C A 1 311 ? 126.082 122.275 97.381  1.00 0.00 ? 332 C A "C2'"  1  
ATOM 9970   O "O2'"  . C A 1 311 ? 125.630 122.100 98.714  1.00 0.00 ? 332 C A "O2'"  1  
ATOM 9971   C "C1'"  . C A 1 311 ? 127.609 122.183 97.357  1.00 0.00 ? 332 C A "C1'"  1  
ATOM 9972   N N1     . C A 1 311 ? 128.210 123.042 96.305  1.00 0.00 ? 332 C A N1     1  
ATOM 9973   C C2     . C A 1 311 ? 128.294 124.420 96.541  1.00 0.00 ? 332 C A C2     1  
ATOM 9974   O O2     . C A 1 311 ? 127.866 124.878 97.612  1.00 0.00 ? 332 C A O2     1  
ATOM 9975   N N3     . C A 1 311 ? 128.837 125.226 95.600  1.00 0.00 ? 332 C A N3     1  
ATOM 9976   C C4     . C A 1 311 ? 129.288 124.707 94.458  1.00 0.00 ? 332 C A C4     1  
ATOM 9977   N N4     . C A 1 311 ? 129.816 125.539 93.558  1.00 0.00 ? 332 C A N4     1  
ATOM 9978   C C5     . C A 1 311 ? 129.216 123.311 94.188  1.00 0.00 ? 332 C A C5     1  
ATOM 9979   C C6     . C A 1 311 ? 128.677 122.524 95.127  1.00 0.00 ? 332 C A C6     1  
ATOM 9980   H "H5'"  . C A 1 311 ? 126.251 118.335 95.857  1.00 0.00 ? 332 C A "H5'"  1  
ATOM 9981   H "H5''" . C A 1 311 ? 127.066 119.385 94.973  1.00 0.00 ? 332 C A "H5''" 1  
ATOM 9982   H "H4'"  . C A 1 311 ? 126.457 119.616 97.723  1.00 0.00 ? 332 C A "H4'"  1  
ATOM 9983   H "H3'"  . C A 1 311 ? 125.816 121.336 95.563  1.00 0.00 ? 332 C A "H3'"  1  
ATOM 9984   H "H2'"  . C A 1 311 ? 125.768 123.121 97.000  1.00 0.00 ? 332 C A "H2'"  1  
ATOM 9985   H "HO2'" . C A 1 311 ? 124.910 121.436 98.723  1.00 0.00 ? 332 C A "HO2'" 1  
ATOM 9986   H "H1'"  . C A 1 311 ? 127.965 122.445 98.233  1.00 0.00 ? 332 C A "H1'"  1  
ATOM 9987   H H41    . C A 1 311 ? 129.863 126.500 93.746  1.00 0.00 ? 332 C A H41    1  
ATOM 9988   H H42    . C A 1 311 ? 130.156 125.190 92.708  1.00 0.00 ? 332 C A H42    1  
ATOM 9989   H H5     . C A 1 311 ? 129.550 122.940 93.345  1.00 0.00 ? 332 C A H5     1  
ATOM 9990   H H6     . C A 1 311 ? 128.619 121.561 94.959  1.00 0.00 ? 332 C A H6     1  
ATOM 9991   P P      . U A 1 312 ? 123.175 121.223 95.782  1.00 0.00 ? 333 U A P      1  
ATOM 9992   O OP1    . U A 1 312 ? 121.902 120.609 96.238  1.00 0.00 ? 333 U A OP1    1  
ATOM 9993   O OP2    . U A 1 312 ? 123.591 121.085 94.364  1.00 0.00 ? 333 U A OP2    1  
ATOM 9994   O "O5'"  . U A 1 312 ? 123.128 122.776 96.135  1.00 0.00 ? 333 U A "O5'"  1  
ATOM 9995   C "C5'"  . U A 1 312 ? 122.643 123.224 97.391  1.00 0.00 ? 333 U A "C5'"  1  
ATOM 9996   C "C4'"  . U A 1 312 ? 122.789 124.717 97.543  1.00 0.00 ? 333 U A "C4'"  1  
ATOM 9997   O "O4'"  . U A 1 312 ? 124.185 125.093 97.428  1.00 0.00 ? 333 U A "O4'"  1  
ATOM 9998   C "C3'"  . U A 1 312 ? 122.090 125.570 96.494  1.00 0.00 ? 333 U A "C3'"  1  
ATOM 9999   O "O3'"  . U A 1 312 ? 120.704 125.727 96.742  1.00 0.00 ? 333 U A "O3'"  1  
ATOM 10000  C "C2'"  . U A 1 312 ? 122.873 126.873 96.550  1.00 0.00 ? 333 U A "C2'"  1  
ATOM 10001  O "O2'"  . U A 1 312 ? 122.489 127.659 97.669  1.00 0.00 ? 333 U A "O2'"  1  
ATOM 10002  C "C1'"  . U A 1 312 ? 124.300 126.363 96.768  1.00 0.00 ? 333 U A "C1'"  1  
ATOM 10003  N N1     . U A 1 312 ? 125.050 126.232 95.497  1.00 0.00 ? 333 U A N1     1  
ATOM 10004  C C2     . U A 1 312 ? 125.538 127.394 94.930  1.00 0.00 ? 333 U A C2     1  
ATOM 10005  O O2     . U A 1 312 ? 125.374 128.495 95.423  1.00 0.00 ? 333 U A O2     1  
ATOM 10006  N N3     . U A 1 312 ? 126.226 127.223 93.754  1.00 0.00 ? 333 U A N3     1  
ATOM 10007  C C4     . U A 1 312 ? 126.475 126.035 93.100  1.00 0.00 ? 333 U A C4     1  
ATOM 10008  O O4     . U A 1 312 ? 127.114 126.046 92.047  1.00 0.00 ? 333 U A O4     1  
ATOM 10009  C C5     . U A 1 312 ? 125.943 124.876 93.746  1.00 0.00 ? 333 U A C5     1  
ATOM 10010  C C6     . U A 1 312 ? 125.268 125.012 94.891  1.00 0.00 ? 333 U A C6     1  
ATOM 10011  H "H5'"  . U A 1 312 ? 123.147 122.780 98.105  1.00 0.00 ? 333 U A "H5'"  1  
ATOM 10012  H "H5''" . U A 1 312 ? 121.697 122.986 97.472  1.00 0.00 ? 333 U A "H5''" 1  
ATOM 10013  H "H4'"  . U A 1 312 ? 122.463 124.977 98.430  1.00 0.00 ? 333 U A "H4'"  1  
ATOM 10014  H "H3'"  . U A 1 312 ? 122.214 125.159 95.613  1.00 0.00 ? 333 U A "H3'"  1  
ATOM 10015  H "H2'"  . U A 1 312 ? 122.798 127.376 95.710  1.00 0.00 ? 333 U A "H2'"  1  
ATOM 10016  H "HO2'" . U A 1 312 ? 122.450 128.600 97.400  1.00 0.00 ? 333 U A "HO2'" 1  
ATOM 10017  H "H1'"  . U A 1 312 ? 124.778 126.977 97.363  1.00 0.00 ? 333 U A "H1'"  1  
ATOM 10018  H H3     . U A 1 312 ? 126.580 128.035 93.334  1.00 0.00 ? 333 U A H3     1  
ATOM 10019  H H5     . U A 1 312 ? 126.074 123.987 93.351  1.00 0.00 ? 333 U A H5     1  
ATOM 10020  H H6     . U A 1 312 ? 124.914 124.202 95.314  1.00 0.00 ? 333 U A H6     1  
ATOM 10021  P P      . A A 1 313 ? 119.700 126.068 95.535  1.00 0.00 ? 334 A A P      1  
ATOM 10022  O OP1    . A A 1 313 ? 118.310 125.924 96.037  1.00 0.00 ? 334 A A OP1    1  
ATOM 10023  O OP2    . A A 1 313 ? 120.133 125.294 94.343  1.00 0.00 ? 334 A A OP2    1  
ATOM 10024  O "O5'"  . A A 1 313 ? 119.960 127.612 95.240  1.00 0.00 ? 334 A A "O5'"  1  
ATOM 10025  C "C5'"  . A A 1 313 ? 119.577 128.608 96.175  1.00 0.00 ? 334 A A "C5'"  1  
ATOM 10026  C "C4'"  . A A 1 313 ? 120.023 129.982 95.739  1.00 0.00 ? 334 A A "C4'"  1  
ATOM 10027  O "O4'"  . A A 1 313 ? 121.469 130.011 95.618  1.00 0.00 ? 334 A A "O4'"  1  
ATOM 10028  C "C3'"  . A A 1 313 ? 119.525 130.444 94.379  1.00 0.00 ? 334 A A "C3'"  1  
ATOM 10029  O "O3'"  . A A 1 313 ? 118.194 130.927 94.410  1.00 0.00 ? 334 A A "O3'"  1  
ATOM 10030  C "C2'"  . A A 1 313 ? 120.550 131.500 93.991  1.00 0.00 ? 334 A A "C2'"  1  
ATOM 10031  O "O2'"  . A A 1 313 ? 120.310 132.725 94.670  1.00 0.00 ? 334 A A "O2'"  1  
ATOM 10032  C "C1'"  . A A 1 313 ? 121.843 130.883 94.526  1.00 0.00 ? 334 A A "C1'"  1  
ATOM 10033  N N9     . A A 1 313 ? 122.582 130.149 93.482  1.00 0.00 ? 334 A A N9     1  
ATOM 10034  C C8     . A A 1 313 ? 122.654 128.789 93.294  1.00 0.00 ? 334 A A C8     1  
ATOM 10035  N N7     . A A 1 313 ? 123.394 128.436 92.274  1.00 0.00 ? 334 A A N7     1  
ATOM 10036  C C5     . A A 1 313 ? 123.842 129.641 91.753  1.00 0.00 ? 334 A A C5     1  
ATOM 10037  C C6     . A A 1 313 ? 124.672 129.952 90.660  1.00 0.00 ? 334 A A C6     1  
ATOM 10038  N N6     . A A 1 313 ? 125.218 129.032 89.861  1.00 0.00 ? 334 A A N6     1  
ATOM 10039  N N1     . A A 1 313 ? 124.922 131.255 90.412  1.00 0.00 ? 334 A A N1     1  
ATOM 10040  C C2     . A A 1 313 ? 124.374 132.178 91.212  1.00 0.00 ? 334 A A C2     1  
ATOM 10041  N N3     . A A 1 313 ? 123.581 132.010 92.267  1.00 0.00 ? 334 A A N3     1  
ATOM 10042  C C4     . A A 1 313 ? 123.350 130.704 92.488  1.00 0.00 ? 334 A A C4     1  
ATOM 10043  H "H5'"  . A A 1 313 ? 119.979 128.404 97.046  1.00 0.00 ? 334 A A "H5'"  1  
ATOM 10044  H "H5''" . A A 1 313 ? 118.602 128.604 96.267  1.00 0.00 ? 334 A A "H5''" 1  
ATOM 10045  H "H4'"  . A A 1 313 ? 119.746 130.635 96.416  1.00 0.00 ? 334 A A "H4'"  1  
ATOM 10046  H "H3'"  . A A 1 313 ? 119.581 129.696 93.746  1.00 0.00 ? 334 A A "H3'"  1  
ATOM 10047  H "H2'"  . A A 1 313 ? 120.589 131.626 93.020  1.00 0.00 ? 334 A A "H2'"  1  
ATOM 10048  H "HO2'" . A A 1 313 ? 120.933 133.402 94.338  1.00 0.00 ? 334 A A "HO2'" 1  
ATOM 10049  H "H1'"  . A A 1 313 ? 122.414 131.589 94.897  1.00 0.00 ? 334 A A "H1'"  1  
ATOM 10050  H H8     . A A 1 313 ? 122.192 128.145 93.870  1.00 0.00 ? 334 A A H8     1  
ATOM 10051  H H61    . A A 1 313 ? 125.788 129.310 89.114  1.00 0.00 ? 334 A A H61    1  
ATOM 10052  H H62    . A A 1 313 ? 125.050 128.081 90.022  1.00 0.00 ? 334 A A H62    1  
ATOM 10053  H H2     . A A 1 313 ? 124.587 133.109 90.990  1.00 0.00 ? 334 A A H2     1  
ATOM 10054  P P      . G A 1 314 ? 117.291 130.895 93.080  1.00 0.00 ? 335 G A P      1  
ATOM 10055  O OP1    . G A 1 314 ? 115.924 131.348 93.440  1.00 0.00 ? 335 G A OP1    1  
ATOM 10056  O OP2    . G A 1 314 ? 117.479 129.572 92.429  1.00 0.00 ? 335 G A OP2    1  
ATOM 10057  O "O5'"  . G A 1 314 ? 117.946 132.003 92.141  1.00 0.00 ? 335 G A "O5'"  1  
ATOM 10058  C "C5'"  . G A 1 314 ? 117.887 133.379 92.489  1.00 0.00 ? 335 G A "C5'"  1  
ATOM 10059  C "C4'"  . G A 1 314 ? 118.729 134.221 91.562  1.00 0.00 ? 335 G A "C4'"  1  
ATOM 10060  O "O4'"  . G A 1 314 ? 120.111 133.779 91.615  1.00 0.00 ? 335 G A "O4'"  1  
ATOM 10061  C "C3'"  . G A 1 314 ? 118.374 134.147 90.084  1.00 0.00 ? 335 G A "C3'"  1  
ATOM 10062  O "O3'"  . G A 1 314 ? 117.249 134.939 89.745  1.00 0.00 ? 335 G A "O3'"  1  
ATOM 10063  C "C2'"  . G A 1 314 ? 119.662 134.592 89.409  1.00 0.00 ? 335 G A "C2'"  1  
ATOM 10064  O "O2'"  . G A 1 314 ? 119.812 136.004 89.465  1.00 0.00 ? 335 G A "O2'"  1  
ATOM 10065  C "C1'"  . G A 1 314 ? 120.717 133.947 90.310  1.00 0.00 ? 335 G A "C1'"  1  
ATOM 10066  N N9     . G A 1 314 ? 121.202 132.664 89.768  1.00 0.00 ? 335 G A N9     1  
ATOM 10067  C C8     . G A 1 314 ? 120.873 131.402 90.196  1.00 0.00 ? 335 G A C8     1  
ATOM 10068  N N7     . G A 1 314 ? 121.465 130.457 89.517  1.00 0.00 ? 335 G A N7     1  
ATOM 10069  C C5     . G A 1 314 ? 122.234 131.137 88.582  1.00 0.00 ? 335 G A C5     1  
ATOM 10070  C C6     . G A 1 314 ? 123.094 130.646 87.568  1.00 0.00 ? 335 G A C6     1  
ATOM 10071  O O6     . G A 1 314 ? 123.360 129.471 87.284  1.00 0.00 ? 335 G A O6     1  
ATOM 10072  N N1     . G A 1 314 ? 123.679 131.682 86.844  1.00 0.00 ? 335 G A N1     1  
ATOM 10073  C C2     . G A 1 314 ? 123.461 133.018 87.067  1.00 0.00 ? 335 G A C2     1  
ATOM 10074  N N2     . G A 1 314 ? 124.115 133.871 86.264  1.00 0.00 ? 335 G A N2     1  
ATOM 10075  N N3     . G A 1 314 ? 122.660 133.490 88.009  1.00 0.00 ? 335 G A N3     1  
ATOM 10076  C C4     . G A 1 314 ? 122.084 132.500 88.722  1.00 0.00 ? 335 G A C4     1  
ATOM 10077  H "H5'"  . G A 1 314 ? 118.211 133.492 93.405  1.00 0.00 ? 335 G A "H5'"  1  
ATOM 10078  H "H5''" . G A 1 314 ? 116.956 133.681 92.439  1.00 0.00 ? 335 G A "H5''" 1  
ATOM 10079  H "H4'"  . G A 1 314 ? 118.683 135.155 91.853  1.00 0.00 ? 335 G A "H4'"  1  
ATOM 10080  H "H3'"  . G A 1 314 ? 118.192 133.212 89.843  1.00 0.00 ? 335 G A "H3'"  1  
ATOM 10081  H "H2'"  . G A 1 314 ? 119.723 134.255 88.490  1.00 0.00 ? 335 G A "H2'"  1  
ATOM 10082  H "HO2'" . G A 1 314 ? 120.615 136.259 88.968  1.00 0.00 ? 335 G A "HO2'" 1  
ATOM 10083  H "H1'"  . G A 1 314 ? 121.473 134.563 90.420  1.00 0.00 ? 335 G A "H1'"  1  
ATOM 10084  H H8     . G A 1 314 ? 120.255 131.225 90.937  1.00 0.00 ? 335 G A H8     1  
ATOM 10085  H H1     . G A 1 314 ? 124.291 131.435 86.121  1.00 0.00 ? 335 G A H1     1  
ATOM 10086  H H21    . G A 1 314 ? 124.710 133.531 85.563  1.00 0.00 ? 335 G A H21    1  
ATOM 10087  H H22    . G A 1 314 ? 123.997 134.838 86.376  1.00 0.00 ? 335 G A H22    1  
ATOM 10088  P P      . C A 1 315 ? 116.334 134.544 88.484  1.00 0.00 ? 336 C A P      1  
ATOM 10089  O OP1    . C A 1 315 ? 115.180 135.478 88.444  1.00 0.00 ? 336 C A OP1    1  
ATOM 10090  O OP2    . C A 1 315 ? 116.089 133.080 88.534  1.00 0.00 ? 336 C A OP2    1  
ATOM 10091  O "O5'"  . C A 1 315 ? 117.258 134.846 87.224  1.00 0.00 ? 336 C A "O5'"  1  
ATOM 10092  C "C5'"  . C A 1 315 ? 117.607 136.179 86.877  1.00 0.00 ? 336 C A "C5'"  1  
ATOM 10093  C "C4'"  . C A 1 315 ? 118.585 136.219 85.730  1.00 0.00 ? 336 C A "C4'"  1  
ATOM 10094  O "O4'"  . C A 1 315 ? 119.809 135.532 86.098  1.00 0.00 ? 336 C A "O4'"  1  
ATOM 10095  C "C3'"  . C A 1 315 ? 118.144 135.526 84.449  1.00 0.00 ? 336 C A "C3'"  1  
ATOM 10096  O "O3'"  . C A 1 315 ? 117.250 136.308 83.676  1.00 0.00 ? 336 C A "O3'"  1  
ATOM 10097  C "C2'"  . C A 1 315 ? 119.468 135.244 83.752  1.00 0.00 ? 336 C A "C2'"  1  
ATOM 10098  O "O2'"  . C A 1 315 ? 119.983 136.411 83.129  1.00 0.00 ? 336 C A "O2'"  1  
ATOM 10099  C "C1'"  . C A 1 315 ? 120.363 134.876 84.937  1.00 0.00 ? 336 C A "C1'"  1  
ATOM 10100  N N1     . C A 1 315 ? 120.456 133.410 85.140  1.00 0.00 ? 336 C A N1     1  
ATOM 10101  C C2     . C A 1 315 ? 121.314 132.676 84.311  1.00 0.00 ? 336 C A C2     1  
ATOM 10102  O O2     . C A 1 315 ? 121.966 133.269 83.437  1.00 0.00 ? 336 C A O2     1  
ATOM 10103  N N3     . C A 1 315 ? 121.417 131.338 84.475  1.00 0.00 ? 336 C A N3     1  
ATOM 10104  C C4     . C A 1 315 ? 120.705 130.724 85.421  1.00 0.00 ? 336 C A C4     1  
ATOM 10105  N N4     . C A 1 315 ? 120.840 129.401 85.548  1.00 0.00 ? 336 C A N4     1  
ATOM 10106  C C5     . C A 1 315 ? 119.825 131.441 86.279  1.00 0.00 ? 336 C A C5     1  
ATOM 10107  C C6     . C A 1 315 ? 119.732 132.764 86.107  1.00 0.00 ? 336 C A C6     1  
ATOM 10108  H "H5'"  . C A 1 315 ? 118.009 136.616 87.658  1.00 0.00 ? 336 C A "H5'"  1  
ATOM 10109  H "H5''" . C A 1 315 ? 116.795 136.664 86.624  1.00 0.00 ? 336 C A "H5''" 1  
ATOM 10110  H "H4'"  . C A 1 315 ? 118.796 137.155 85.527  1.00 0.00 ? 336 C A "H4'"  1  
ATOM 10111  H "H3'"  . C A 1 315 ? 117.713 134.676 84.677  1.00 0.00 ? 336 C A "H3'"  1  
ATOM 10112  H "H2'"  . C A 1 315 ? 119.389 134.499 83.119  1.00 0.00 ? 336 C A "H2'"  1  
ATOM 10113  H "HO2'" . C A 1 315 ? 119.254 137.053 83.000  1.00 0.00 ? 336 C A "HO2'" 1  
ATOM 10114  H "H1'"  . C A 1 315 ? 121.262 135.240 84.791  1.00 0.00 ? 336 C A "H1'"  1  
ATOM 10115  H H41    . C A 1 315 ? 121.446 128.911 84.954  1.00 0.00 ? 336 C A H41    1  
ATOM 10116  H H42    . C A 1 315 ? 120.330 128.922 86.233  1.00 0.00 ? 336 C A H42    1  
ATOM 10117  H H5     . C A 1 315 ? 119.306 130.981 86.973  1.00 0.00 ? 336 C A H5     1  
ATOM 10118  H H6     . C A 1 315 ? 119.132 133.276 86.689  1.00 0.00 ? 336 C A H6     1  
ATOM 10119  P P      . G A 1 316 ? 116.222 135.597 82.664  1.00 0.00 ? 337 G A P      1  
ATOM 10120  O OP1    . G A 1 316 ? 115.333 136.645 82.098  1.00 0.00 ? 337 G A OP1    1  
ATOM 10121  O OP2    . G A 1 316 ? 115.626 134.428 83.362  1.00 0.00 ? 337 G A OP2    1  
ATOM 10122  O "O5'"  . G A 1 316 ? 117.149 135.050 81.491  1.00 0.00 ? 337 G A "O5'"  1  
ATOM 10123  C "C5'"  . G A 1 316 ? 117.818 135.944 80.614  1.00 0.00 ? 337 G A "C5'"  1  
ATOM 10124  C "C4'"  . G A 1 316 ? 118.742 135.211 79.673  1.00 0.00 ? 337 G A "C4'"  1  
ATOM 10125  O "O4'"  . G A 1 316 ? 119.759 134.505 80.433  1.00 0.00 ? 337 G A "O4'"  1  
ATOM 10126  C "C3'"  . G A 1 316 ? 118.102 134.128 78.817  1.00 0.00 ? 337 G A "C3'"  1  
ATOM 10127  O "O3'"  . G A 1 316 ? 117.414 134.646 77.692  1.00 0.00 ? 337 G A "O3'"  1  
ATOM 10128  C "C2'"  . G A 1 316 ? 119.288 133.246 78.456  1.00 0.00 ? 337 G A "C2'"  1  
ATOM 10129  O "O2'"  . G A 1 316 ? 120.064 133.826 77.417  1.00 0.00 ? 337 G A "O2'"  1  
ATOM 10130  C "C1'"  . G A 1 316 ? 120.097 133.274 79.753  1.00 0.00 ? 337 G A "C1'"  1  
ATOM 10131  N N9     . G A 1 316 ? 119.826 132.097 80.602  1.00 0.00 ? 337 G A N9     1  
ATOM 10132  C C8     . G A 1 316 ? 119.069 132.055 81.748  1.00 0.00 ? 337 G A C8     1  
ATOM 10133  N N7     . G A 1 316 ? 119.013 130.864 82.281  1.00 0.00 ? 337 G A N7     1  
ATOM 10134  C C5     . G A 1 316 ? 119.778 130.073 81.439  1.00 0.00 ? 337 G A C5     1  
ATOM 10135  C C6     . G A 1 316 ? 120.086 128.690 81.503  1.00 0.00 ? 337 G A C6     1  
ATOM 10136  O O6     . G A 1 316 ? 119.731 127.860 82.348  1.00 0.00 ? 337 G A O6     1  
ATOM 10137  N N1     . G A 1 316 ? 120.896 128.294 80.444  1.00 0.00 ? 337 G A N1     1  
ATOM 10138  C C2     . G A 1 316 ? 121.355 129.123 79.449  1.00 0.00 ? 337 G A C2     1  
ATOM 10139  N N2     . G A 1 316 ? 122.128 128.556 78.509  1.00 0.00 ? 337 G A N2     1  
ATOM 10140  N N3     . G A 1 316 ? 121.075 130.414 79.377  1.00 0.00 ? 337 G A N3     1  
ATOM 10141  C C4     . G A 1 316 ? 120.288 130.818 80.395  1.00 0.00 ? 337 G A C4     1  
ATOM 10142  H "H5'"  . G A 1 316 ? 118.341 136.581 81.143  1.00 0.00 ? 337 G A "H5'"  1  
ATOM 10143  H "H5''" . G A 1 316 ? 117.153 136.436 80.089  1.00 0.00 ? 337 G A "H5''" 1  
ATOM 10144  H "H4'"  . G A 1 316 ? 119.180 135.862 79.086  1.00 0.00 ? 337 G A "H4'"  1  
ATOM 10145  H "H3'"  . G A 1 316 ? 117.475 133.612 79.369  1.00 0.00 ? 337 G A "H3'"  1  
ATOM 10146  H "H2'"  . G A 1 316 ? 119.004 132.335 78.230  1.00 0.00 ? 337 G A "H2'"  1  
ATOM 10147  H "HO2'" . G A 1 316 ? 119.519 134.486 76.942  1.00 0.00 ? 337 G A "HO2'" 1  
ATOM 10148  H "H1'"  . G A 1 316 ? 121.052 133.310 79.540  1.00 0.00 ? 337 G A "H1'"  1  
ATOM 10149  H H8     . G A 1 316 ? 118.616 132.837 82.125  1.00 0.00 ? 337 G A H8     1  
ATOM 10150  H H1     . G A 1 316 ? 121.162 127.351 80.407  1.00 0.00 ? 337 G A H1     1  
ATOM 10151  H H21    . G A 1 316 ? 122.338 127.601 78.556  1.00 0.00 ? 337 G A H21    1  
ATOM 10152  H H22    . G A 1 316 ? 122.483 129.099 77.774  1.00 0.00 ? 337 G A H22    1  
ATOM 10153  P P      . G A 1 317 ? 116.194 133.823 77.043  1.00 0.00 ? 338 G A P      1  
ATOM 10154  O OP1    . G A 1 317 ? 115.598 134.658 75.968  1.00 0.00 ? 338 G A OP1    1  
ATOM 10155  O OP2    . G A 1 317 ? 115.336 133.324 78.146  1.00 0.00 ? 338 G A OP2    1  
ATOM 10156  O "O5'"  . G A 1 317 ? 116.897 132.569 76.358  1.00 0.00 ? 338 G A "O5'"  1  
ATOM 10157  C "C5'"  . G A 1 317 ? 117.749 132.733 75.235  1.00 0.00 ? 338 G A "C5'"  1  
ATOM 10158  C "C4'"  . G A 1 317 ? 118.408 131.434 74.844  1.00 0.00 ? 338 G A "C4'"  1  
ATOM 10159  O "O4'"  . G A 1 317 ? 119.216 130.942 75.946  1.00 0.00 ? 338 G A "O4'"  1  
ATOM 10160  C "C3'"  . G A 1 317 ? 117.471 130.278 74.528  1.00 0.00 ? 338 G A "C3'"  1  
ATOM 10161  O "O3'"  . G A 1 317 ? 116.918 130.354 73.225  1.00 0.00 ? 338 G A "O3'"  1  
ATOM 10162  C "C2'"  . G A 1 317 ? 118.359 129.061 74.745  1.00 0.00 ? 338 G A "C2'"  1  
ATOM 10163  O "O2'"  . G A 1 317 ? 119.234 128.857 73.644  1.00 0.00 ? 338 G A "O2'"  1  
ATOM 10164  C "C1'"  . G A 1 317 ? 119.182 129.497 75.958  1.00 0.00 ? 338 G A "C1'"  1  
ATOM 10165  N N9     . G A 1 317 ? 118.624 128.980 77.223  1.00 0.00 ? 338 G A N9     1  
ATOM 10166  C C8     . G A 1 317 ? 117.924 129.686 78.172  1.00 0.00 ? 338 G A C8     1  
ATOM 10167  N N7     . G A 1 317 ? 117.557 128.955 79.188  1.00 0.00 ? 338 G A N7     1  
ATOM 10168  C C5     . G A 1 317 ? 118.043 127.690 78.892  1.00 0.00 ? 338 G A C5     1  
ATOM 10169  C C6     . G A 1 317 ? 117.954 126.476 79.625  1.00 0.00 ? 338 G A C6     1  
ATOM 10170  O O6     . G A 1 317 ? 117.410 126.273 80.716  1.00 0.00 ? 338 G A O6     1  
ATOM 10171  N N1     . G A 1 317 ? 118.586 125.430 78.961  1.00 0.00 ? 338 G A N1     1  
ATOM 10172  C C2     . G A 1 317 ? 119.223 125.534 77.748  1.00 0.00 ? 338 G A C2     1  
ATOM 10173  N N2     . G A 1 317 ? 119.774 124.411 77.265  1.00 0.00 ? 338 G A N2     1  
ATOM 10174  N N3     . G A 1 317 ? 119.312 126.659 77.056  1.00 0.00 ? 338 G A N3     1  
ATOM 10175  C C4     . G A 1 317 ? 118.704 127.688 77.684  1.00 0.00 ? 338 G A C4     1  
ATOM 10176  H "H5'"  . G A 1 317 ? 118.441 133.391 75.451  1.00 0.00 ? 338 G A "H5'"  1  
ATOM 10177  H "H5''" . G A 1 317 ? 117.220 133.063 74.479  1.00 0.00 ? 338 G A "H5''" 1  
ATOM 10178  H "H4'"  . G A 1 317 ? 118.989 131.593 74.071  1.00 0.00 ? 338 G A "H4'"  1  
ATOM 10179  H "H3'"  . G A 1 317 ? 116.745 130.264 75.185  1.00 0.00 ? 338 G A "H3'"  1  
ATOM 10180  H "H2'"  . G A 1 317 ? 117.830 128.260 74.940  1.00 0.00 ? 338 G A "H2'"  1  
ATOM 10181  H "HO2'" . G A 1 317 ? 118.876 129.327 72.862  1.00 0.00 ? 338 G A "HO2'" 1  
ATOM 10182  H "H1'"  . G A 1 317 ? 120.105 129.181 75.857  1.00 0.00 ? 338 G A "H1'"  1  
ATOM 10183  H H8     . G A 1 317 ? 117.720 130.642 78.095  1.00 0.00 ? 338 G A H8     1  
ATOM 10184  H H1     . G A 1 317 ? 118.576 124.550 79.394  1.00 0.00 ? 338 G A H1     1  
ATOM 10185  H H21    . G A 1 317 ? 119.713 123.575 77.773  1.00 0.00 ? 338 G A H21    1  
ATOM 10186  H H22    . G A 1 317 ? 120.241 124.427 76.403  1.00 0.00 ? 338 G A H22    1  
ATOM 10187  P P      . A A 1 318 ? 115.420 129.839 72.952  1.00 0.00 ? 339 A A P      1  
ATOM 10188  O OP1    . A A 1 318 ? 115.143 129.977 71.501  1.00 0.00 ? 339 A A OP1    1  
ATOM 10189  O OP2    . A A 1 318 ? 114.522 130.494 73.937  1.00 0.00 ? 339 A A OP2    1  
ATOM 10190  O "O5'"  . A A 1 318 ? 115.478 128.285 73.298  1.00 0.00 ? 339 A A "O5'"  1  
ATOM 10191  C "C5'"  . A A 1 318 ? 115.869 127.334 72.317  1.00 0.00 ? 339 A A "C5'"  1  
ATOM 10192  C "C4'"  . A A 1 318 ? 116.064 125.966 72.919  1.00 0.00 ? 339 A A "C4'"  1  
ATOM 10193  O "O4'"  . A A 1 318 ? 116.814 126.036 74.167  1.00 0.00 ? 339 A A "O4'"  1  
ATOM 10194  C "C3'"  . A A 1 318 ? 114.796 125.212 73.288  1.00 0.00 ? 339 A A "C3'"  1  
ATOM 10195  O "O3'"  . A A 1 318 ? 114.196 124.559 72.182  1.00 0.00 ? 339 A A "O3'"  1  
ATOM 10196  C "C2'"  . A A 1 318 ? 115.312 124.212 74.315  1.00 0.00 ? 339 A A "C2'"  1  
ATOM 10197  O "O2'"  . A A 1 318 ? 115.996 123.136 73.688  1.00 0.00 ? 339 A A "O2'"  1  
ATOM 10198  C "C1'"  . A A 1 318 ? 116.315 125.075 75.071  1.00 0.00 ? 339 A A "C1'"  1  
ATOM 10199  N N9     . A A 1 318 ? 115.702 125.758 76.225  1.00 0.00 ? 339 A A N9     1  
ATOM 10200  C C8     . A A 1 318 ? 115.221 127.043 76.288  1.00 0.00 ? 339 A A C8     1  
ATOM 10201  N N7     . A A 1 318 ? 114.732 127.368 77.459  1.00 0.00 ? 339 A A N7     1  
ATOM 10202  C C5     . A A 1 318 ? 114.901 126.219 78.221  1.00 0.00 ? 339 A A C5     1  
ATOM 10203  C C6     . A A 1 318 ? 114.586 125.914 79.557  1.00 0.00 ? 339 A A C6     1  
ATOM 10204  N N6     . A A 1 318 ? 114.009 126.776 80.397  1.00 0.00 ? 339 A A N6     1  
ATOM 10205  N N1     . A A 1 318 ? 114.887 124.676 80.006  1.00 0.00 ? 339 A A N1     1  
ATOM 10206  C C2     . A A 1 318 ? 115.465 123.811 79.163  1.00 0.00 ? 339 A A C2     1  
ATOM 10207  N N3     . A A 1 318 ? 115.810 123.981 77.889  1.00 0.00 ? 339 A A N3     1  
ATOM 10208  C C4     . A A 1 318 ? 115.497 125.221 77.473  1.00 0.00 ? 339 A A C4     1  
ATOM 10209  H "H5'"  . A A 1 318 ? 116.710 127.626 71.907  1.00 0.00 ? 339 A A "H5'"  1  
ATOM 10210  H "H5''" . A A 1 318 ? 115.177 127.284 71.626  1.00 0.00 ? 339 A A "H5''" 1  
ATOM 10211  H "H4'"  . A A 1 318 ? 116.571 125.411 72.289  1.00 0.00 ? 339 A A "H4'"  1  
ATOM 10212  H "H3'"  . A A 1 318 ? 114.169 125.829 73.722  1.00 0.00 ? 339 A A "H3'"  1  
ATOM 10213  H "H2'"  . A A 1 318 ? 114.592 123.894 74.900  1.00 0.00 ? 339 A A "H2'"  1  
ATOM 10214  H "HO2'" . A A 1 318 ? 116.267 122.490 74.373  1.00 0.00 ? 339 A A "HO2'" 1  
ATOM 10215  H "H1'"  . A A 1 318 ? 117.059 124.515 75.380  1.00 0.00 ? 339 A A "H1'"  1  
ATOM 10216  H H8     . A A 1 318 ? 115.242 127.660 75.526  1.00 0.00 ? 339 A A H8     1  
ATOM 10217  H H61    . A A 1 318 ? 113.813 126.505 81.318  1.00 0.00 ? 339 A A H61    1  
ATOM 10218  H H62    . A A 1 318 ? 113.782 127.679 80.093  1.00 0.00 ? 339 A A H62    1  
ATOM 10219  H H2     . A A 1 318 ? 115.663 122.927 79.538  1.00 0.00 ? 339 A A H2     1  
ATOM 10220  P P      . U A 1 319 ? 112.601 124.378 72.119  1.00 0.00 ? 340 U A P      1  
ATOM 10221  O OP1    . U A 1 319 ? 112.262 123.733 70.824  1.00 0.00 ? 340 U A OP1    1  
ATOM 10222  O OP2    . U A 1 319 ? 111.977 125.676 72.477  1.00 0.00 ? 340 U A OP2    1  
ATOM 10223  O "O5'"  . U A 1 319 ? 112.285 123.340 73.285  1.00 0.00 ? 340 U A "O5'"  1  
ATOM 10224  C "C5'"  . U A 1 319 ? 112.569 121.958 73.128  1.00 0.00 ? 340 U A "C5'"  1  
ATOM 10225  C "C4'"  . U A 1 319 ? 112.513 121.225 74.446  1.00 0.00 ? 340 U A "C4'"  1  
ATOM 10226  O "O4'"  . U A 1 319 ? 113.266 121.956 75.445  1.00 0.00 ? 340 U A "O4'"  1  
ATOM 10227  C "C3'"  . U A 1 319 ? 111.135 121.081 75.074  1.00 0.00 ? 340 U A "C3'"  1  
ATOM 10228  O "O3'"  . U A 1 319 ? 110.378 120.024 74.512  1.00 0.00 ? 340 U A "O3'"  1  
ATOM 10229  C "C2'"  . U A 1 319 ? 111.470 120.891 76.546  1.00 0.00 ? 340 U A "C2'"  1  
ATOM 10230  O "O2'"  . U A 1 319 ? 111.912 119.567 76.807  1.00 0.00 ? 340 U A "O2'"  1  
ATOM 10231  C "C1'"  . U A 1 319 ? 112.650 121.858 76.701  1.00 0.00 ? 340 U A "C1'"  1  
ATOM 10232  N N1     . U A 1 319 ? 112.215 123.215 77.114  1.00 0.00 ? 340 U A N1     1  
ATOM 10233  C C2     . U A 1 319 ? 112.025 123.432 78.466  1.00 0.00 ? 340 U A C2     1  
ATOM 10234  O O2     . U A 1 319 ? 112.199 122.570 79.310  1.00 0.00 ? 340 U A O2     1  
ATOM 10235  N N3     . U A 1 319 ? 111.624 124.702 78.801  1.00 0.00 ? 340 U A N3     1  
ATOM 10236  C C4     . U A 1 319 ? 111.396 125.756 77.943  1.00 0.00 ? 340 U A C4     1  
ATOM 10237  O O4     . U A 1 319 ? 111.036 126.842 78.400  1.00 0.00 ? 340 U A O4     1  
ATOM 10238  C C5     . U A 1 319 ? 111.612 125.458 76.560  1.00 0.00 ? 340 U A C5     1  
ATOM 10239  C C6     . U A 1 319 ? 112.004 124.230 76.205  1.00 0.00 ? 340 U A C6     1  
ATOM 10240  H "H5'"  . U A 1 319 ? 113.466 121.858 72.746  1.00 0.00 ? 340 U A "H5'"  1  
ATOM 10241  H "H5''" . U A 1 319 ? 111.914 121.564 72.516  1.00 0.00 ? 340 U A "H5''" 1  
ATOM 10242  H "H4'"  . U A 1 319 ? 112.914 120.339 74.332  1.00 0.00 ? 340 U A "H4'"  1  
ATOM 10243  H "H3'"  . U A 1 319 ? 110.640 121.919 74.963  1.00 0.00 ? 340 U A "H3'"  1  
ATOM 10244  H "H2'"  . U A 1 319 ? 110.717 121.141 77.121  1.00 0.00 ? 340 U A "H2'"  1  
ATOM 10245  H "HO2'" . U A 1 319 ? 111.670 119.325 77.726  1.00 0.00 ? 340 U A "HO2'" 1  
ATOM 10246  H "H1'"  . U A 1 319 ? 113.274 121.501 77.368  1.00 0.00 ? 340 U A "H1'"  1  
ATOM 10247  H H3     . U A 1 319 ? 111.484 124.877 79.755  1.00 0.00 ? 340 U A H3     1  
ATOM 10248  H H5     . U A 1 319 ? 111.474 126.149 75.879  1.00 0.00 ? 340 U A H5     1  
ATOM 10249  H H6     . U A 1 319 ? 112.145 124.051 75.253  1.00 0.00 ? 340 U A H6     1  
ATOM 10250  P P      . G A 1 320 ? 108.781 119.991 74.686  1.00 0.00 ? 341 G A P      1  
ATOM 10251  O OP1    . G A 1 320 ? 108.181 119.669 73.366  1.00 0.00 ? 341 G A OP1    1  
ATOM 10252  O OP2    . G A 1 320 ? 108.370 121.228 75.397  1.00 0.00 ? 341 G A OP2    1  
ATOM 10253  O "O5'"  . G A 1 320 ? 108.523 118.755 75.658  1.00 0.00 ? 341 G A "O5'"  1  
ATOM 10254  C "C5'"  . G A 1 320 ? 108.912 117.441 75.286  1.00 0.00 ? 341 G A "C5'"  1  
ATOM 10255  C "C4'"  . G A 1 320 ? 108.375 116.411 76.248  1.00 0.00 ? 341 G A "C4'"  1  
ATOM 10256  O "O4'"  . G A 1 320 ? 108.654 116.903 77.585  1.00 0.00 ? 341 G A "O4'"  1  
ATOM 10257  C "C3'"  . G A 1 320 ? 106.879 116.148 76.178  1.00 0.00 ? 341 G A "C3'"  1  
ATOM 10258  O "O3'"  . G A 1 320 ? 106.557 114.768 76.208  1.00 0.00 ? 341 G A "O3'"  1  
ATOM 10259  C "C2'"  . G A 1 320 ? 106.328 116.810 77.424  1.00 0.00 ? 341 G A "C2'"  1  
ATOM 10260  O "O2'"  . G A 1 320 ? 105.258 116.057 77.977  1.00 0.00 ? 341 G A "O2'"  1  
ATOM 10261  C "C1'"  . G A 1 320 ? 107.484 116.758 78.393  1.00 0.00 ? 341 G A "C1'"  1  
ATOM 10262  N N9     . G A 1 320 ? 107.414 117.833 79.400  1.00 0.00 ? 341 G A N9     1  
ATOM 10263  C C8     . G A 1 320 ? 107.451 119.188 79.174  1.00 0.00 ? 341 G A C8     1  
ATOM 10264  N N7     . G A 1 320 ? 107.370 119.894 80.269  1.00 0.00 ? 341 G A N7     1  
ATOM 10265  C C5     . G A 1 320 ? 107.273 118.949 81.280  1.00 0.00 ? 341 G A C5     1  
ATOM 10266  C C6     . G A 1 320 ? 107.157 119.113 82.685  1.00 0.00 ? 341 G A C6     1  
ATOM 10267  O O6     . G A 1 320 ? 107.117 120.163 83.337  1.00 0.00 ? 341 G A O6     1  
ATOM 10268  N N1     . G A 1 320 ? 107.087 117.888 83.341  1.00 0.00 ? 341 G A N1     1  
ATOM 10269  C C2     . G A 1 320 ? 107.121 116.661 82.724  1.00 0.00 ? 341 G A C2     1  
ATOM 10270  N N2     . G A 1 320 ? 107.040 115.589 83.527  1.00 0.00 ? 341 G A N2     1  
ATOM 10271  N N3     . G A 1 320 ? 107.229 116.494 81.416  1.00 0.00 ? 341 G A N3     1  
ATOM 10272  C C4     . G A 1 320 ? 107.299 117.671 80.761  1.00 0.00 ? 341 G A C4     1  
ATOM 10273  H "H5'"  . G A 1 320 ? 109.890 117.389 75.273  1.00 0.00 ? 341 G A "H5'"  1  
ATOM 10274  H "H5''" . G A 1 320 ? 108.570 117.249 74.388  1.00 0.00 ? 341 G A "H5''" 1  
ATOM 10275  H "H4'"  . G A 1 320 ? 108.839 115.561 76.094  1.00 0.00 ? 341 G A "H4'"  1  
ATOM 10276  H "H3'"  . G A 1 320 ? 106.508 116.606 75.396  1.00 0.00 ? 341 G A "H3'"  1  
ATOM 10277  H "H2'"  . G A 1 320 ? 106.067 117.739 77.252  1.00 0.00 ? 341 G A "H2'"  1  
ATOM 10278  H "HO2'" . G A 1 320 ? 105.123 116.332 78.908  1.00 0.00 ? 341 G A "HO2'" 1  
ATOM 10279  H "H1'"  . G A 1 320 ? 107.493 115.888 78.844  1.00 0.00 ? 341 G A "H1'"  1  
ATOM 10280  H H8     . G A 1 320 ? 107.531 119.585 78.282  1.00 0.00 ? 341 G A H8     1  
ATOM 10281  H H1     . G A 1 320 ? 107.005 117.904 84.317  1.00 0.00 ? 341 G A H1     1  
ATOM 10282  H H21    . G A 1 320 ? 106.961 115.704 84.496  1.00 0.00 ? 341 G A H21    1  
ATOM 10283  H H22    . G A 1 320 ? 107.060 114.687 83.143  1.00 0.00 ? 341 G A H22    1  
ATOM 10284  P P      . A A 1 321 ? 105.030 114.307 76.046  1.00 0.00 ? 342 A A P      1  
ATOM 10285  O OP1    . A A 1 321 ? 104.978 113.089 75.198  1.00 0.00 ? 342 A A OP1    1  
ATOM 10286  O OP2    . A A 1 321 ? 104.362 115.550 75.586  1.00 0.00 ? 342 A A OP2    1  
ATOM 10287  O "O5'"  . A A 1 321 ? 104.443 113.934 77.480  1.00 0.00 ? 342 A A "O5'"  1  
ATOM 10288  C "C5'"  . A A 1 321 ? 103.088 114.206 77.806  1.00 0.00 ? 342 A A "C5'"  1  
ATOM 10289  C "C4'"  . A A 1 321 ? 102.895 114.349 79.295  1.00 0.00 ? 342 A A "C4'"  1  
ATOM 10290  O "O4'"  . A A 1 321 ? 103.802 115.372 79.796  1.00 0.00 ? 342 A A "O4'"  1  
ATOM 10291  C "C3'"  . A A 1 321 ? 101.520 114.818 79.747  1.00 0.00 ? 342 A A "C3'"  1  
ATOM 10292  O "O3'"  . A A 1 321 ? 100.570 113.768 79.813  1.00 0.00 ? 342 A A "O3'"  1  
ATOM 10293  C "C2'"  . A A 1 321 ? 101.812 115.458 81.096  1.00 0.00 ? 342 A A "C2'"  1  
ATOM 10294  O "O2'"  . A A 1 321 ? 101.932 114.477 82.116  1.00 0.00 ? 342 A A "O2'"  1  
ATOM 10295  C "C1'"  . A A 1 321 ? 103.181 116.079 80.837  1.00 0.00 ? 342 A A "C1'"  1  
ATOM 10296  N N9     . A A 1 321 ? 103.086 117.512 80.497  1.00 0.00 ? 342 A A N9     1  
ATOM 10297  C C8     . A A 1 321 ? 103.207 118.095 79.259  1.00 0.00 ? 342 A A C8     1  
ATOM 10298  N N7     . A A 1 321 ? 103.073 119.398 79.274  1.00 0.00 ? 342 A A N7     1  
ATOM 10299  C C5     . A A 1 321 ? 102.849 119.695 80.612  1.00 0.00 ? 342 A A C5     1  
ATOM 10300  C C6     . A A 1 321 ? 102.629 120.907 81.289  1.00 0.00 ? 342 A A C6     1  
ATOM 10301  N N6     . A A 1 321 ? 102.596 122.097 80.685  1.00 0.00 ? 342 A A N6     1  
ATOM 10302  N N1     . A A 1 321 ? 102.440 120.855 82.625  1.00 0.00 ? 342 A A N1     1  
ATOM 10303  C C2     . A A 1 321 ? 102.472 119.662 83.232  1.00 0.00 ? 342 A A C2     1  
ATOM 10304  N N3     . A A 1 321 ? 102.670 118.455 82.704  1.00 0.00 ? 342 A A N3     1  
ATOM 10305  C C4     . A A 1 321 ? 102.854 118.542 81.375  1.00 0.00 ? 342 A A C4     1  
ATOM 10306  H "H5'"  . A A 1 321 ? 102.527 113.472 77.480  1.00 0.00 ? 342 A A "H5'"  1  
ATOM 10307  H "H5''" . A A 1 321 ? 102.813 115.037 77.367  1.00 0.00 ? 342 A A "H5''" 1  
ATOM 10308  H "H4'"  . A A 1 321 ? 103.100 113.498 79.736  1.00 0.00 ? 342 A A "H4'"  1  
ATOM 10309  H "H3'"  . A A 1 321 ? 101.196 115.506 79.128  1.00 0.00 ? 342 A A "H3'"  1  
ATOM 10310  H "H2'"  . A A 1 321 ? 101.144 116.139 81.323  1.00 0.00 ? 342 A A "H2'"  1  
ATOM 10311  H "HO2'" . A A 1 321 ? 101.474 113.660 81.828  1.00 0.00 ? 342 A A "HO2'" 1  
ATOM 10312  H "H1'"  . A A 1 321 ? 103.744 115.969 81.632  1.00 0.00 ? 342 A A "H1'"  1  
ATOM 10313  H H8     . A A 1 321 ? 103.377 117.584 78.440  1.00 0.00 ? 342 A A H8     1  
ATOM 10314  H H61    . A A 1 321 ? 102.439 122.909 81.211  1.00 0.00 ? 342 A A H61    1  
ATOM 10315  H H62    . A A 1 321 ? 102.731 122.160 79.717  1.00 0.00 ? 342 A A H62    1  
ATOM 10316  H H2     . A A 1 321 ? 102.329 119.678 84.202  1.00 0.00 ? 342 A A H2     1  
ATOM 10317  P P      . A A 1 322 ? 99.211  113.854 78.958  1.00 0.00 ? 343 A A P      1  
ATOM 10318  O OP1    . A A 1 322 ? 98.461  112.589 79.159  1.00 0.00 ? 343 A A OP1    1  
ATOM 10319  O OP2    . A A 1 322 ? 99.560  114.291 77.583  1.00 0.00 ? 343 A A OP2    1  
ATOM 10320  O "O5'"  . A A 1 322 ? 98.392  115.030 79.656  1.00 0.00 ? 343 A A "O5'"  1  
ATOM 10321  C "C5'"  . A A 1 322 ? 97.832  114.861 80.948  1.00 0.00 ? 343 A A "C5'"  1  
ATOM 10322  C "C4'"  . A A 1 322 ? 97.555  116.187 81.611  1.00 0.00 ? 343 A A "C4'"  1  
ATOM 10323  O "O4'"  . A A 1 322 ? 98.755  117.005 81.594  1.00 0.00 ? 343 A A "O4'"  1  
ATOM 10324  C "C3'"  . A A 1 322 ? 96.502  117.060 80.945  1.00 0.00 ? 343 A A "C3'"  1  
ATOM 10325  O "O3'"  . A A 1 322 ? 95.178  116.683 81.281  1.00 0.00 ? 343 A A "O3'"  1  
ATOM 10326  C "C2'"  . A A 1 322 ? 96.879  118.456 81.420  1.00 0.00 ? 343 A A "C2'"  1  
ATOM 10327  O "O2'"  . A A 1 322 ? 96.440  118.683 82.753  1.00 0.00 ? 343 A A "O2'"  1  
ATOM 10328  C "C1'"  . A A 1 322 ? 98.405  118.382 81.406  1.00 0.00 ? 343 A A "C1'"  1  
ATOM 10329  N N9     . A A 1 322 ? 98.975  118.898 80.148  1.00 0.00 ? 343 A A N9     1  
ATOM 10330  C C8     . A A 1 322 ? 99.511  118.181 79.106  1.00 0.00 ? 343 A A C8     1  
ATOM 10331  N N7     . A A 1 322 ? 99.939  118.926 78.117  1.00 0.00 ? 343 A A N7     1  
ATOM 10332  C C5     . A A 1 322 ? 99.670  120.222 78.533  1.00 0.00 ? 343 A A C5     1  
ATOM 10333  C C6     . A A 1 322 ? 99.888  121.475 77.934  1.00 0.00 ? 343 A A C6     1  
ATOM 10334  N N6     . A A 1 322 ? 100.449 121.633 76.733  1.00 0.00 ? 343 A A N6     1  
ATOM 10335  N N1     . A A 1 322 ? 99.501  122.573 78.616  1.00 0.00 ? 343 A A N1     1  
ATOM 10336  C C2     . A A 1 322 ? 98.937  122.416 79.821  1.00 0.00 ? 343 A A C2     1  
ATOM 10337  N N3     . A A 1 322 ? 98.682  121.293 80.489  1.00 0.00 ? 343 A A N3     1  
ATOM 10338  C C4     . A A 1 322 ? 99.076  120.219 79.782  1.00 0.00 ? 343 A A C4     1  
ATOM 10339  H "H5'"  . A A 1 322 ? 98.457  114.351 81.505  1.00 0.00 ? 343 A A "H5'"  1  
ATOM 10340  H "H5''" . A A 1 322 ? 96.993  114.362 80.873  1.00 0.00 ? 343 A A "H5''" 1  
ATOM 10341  H "H4'"  . A A 1 322 ? 97.292  116.028 82.542  1.00 0.00 ? 343 A A "H4'"  1  
ATOM 10342  H "H3'"  . A A 1 322 ? 96.614  117.012 79.973  1.00 0.00 ? 343 A A "H3'"  1  
ATOM 10343  H "H2'"  . A A 1 322 ? 96.547  119.147 80.807  1.00 0.00 ? 343 A A "H2'"  1  
ATOM 10344  H "HO2'" . A A 1 322 ? 95.731  118.044 82.969  1.00 0.00 ? 343 A A "HO2'" 1  
ATOM 10345  H "H1'"  . A A 1 322 ? 98.764  118.894 82.161  1.00 0.00 ? 343 A A "H1'"  1  
ATOM 10346  H H8     . A A 1 322 ? 99.566  117.201 79.103  1.00 0.00 ? 343 A A H8     1  
ATOM 10347  H H61    . A A 1 322 ? 100.574 122.532 76.366  1.00 0.00 ? 343 A A H61    1  
ATOM 10348  H H62    . A A 1 322 ? 100.737 120.849 76.219  1.00 0.00 ? 343 A A H62    1  
ATOM 10349  H H2     . A A 1 322 ? 98.675  123.244 80.274  1.00 0.00 ? 343 A A H2     1  
ATOM 10350  P P      . G A 1 323 ? 93.968  116.999 80.271  1.00 0.00 ? 344 G A P      1  
ATOM 10351  O OP1    . G A 1 323 ? 92.727  116.412 80.840  1.00 0.00 ? 344 G A OP1    1  
ATOM 10352  O OP2    . G A 1 323 ? 94.399  116.616 78.902  1.00 0.00 ? 344 G A OP2    1  
ATOM 10353  O "O5'"  . G A 1 323 ? 93.829  118.586 80.320  1.00 0.00 ? 344 G A "O5'"  1  
ATOM 10354  C "C5'"  . G A 1 323 ? 93.265  119.234 81.449  1.00 0.00 ? 344 G A "C5'"  1  
ATOM 10355  C "C4'"  . G A 1 323 ? 93.268  120.734 81.287  1.00 0.00 ? 344 G A "C4'"  1  
ATOM 10356  O "O4'"  . G A 1 323 ? 94.628  121.205 81.091  1.00 0.00 ? 344 G A "O4'"  1  
ATOM 10357  C "C3'"  . G A 1 323 ? 92.512  121.276 80.083  1.00 0.00 ? 344 G A "C3'"  1  
ATOM 10358  O "O3'"  . G A 1 323 ? 91.111  121.339 80.291  1.00 0.00 ? 344 G A "O3'"  1  
ATOM 10359  C "C2'"  . G A 1 323 ? 93.160  122.637 79.869  1.00 0.00 ? 344 G A "C2'"  1  
ATOM 10360  O "O2'"  . G A 1 323 ? 92.673  123.591 80.801  1.00 0.00 ? 344 G A "O2'"  1  
ATOM 10361  C "C1'"  . G A 1 323 ? 94.623  122.331 80.190  1.00 0.00 ? 344 G A "C1'"  1  
ATOM 10362  N N9     . G A 1 323 ? 95.411  122.051 78.974  1.00 0.00 ? 344 G A N9     1  
ATOM 10363  C C8     . G A 1 323 ? 95.877  120.830 78.548  1.00 0.00 ? 344 G A C8     1  
ATOM 10364  N N7     . G A 1 323 ? 96.547  120.898 77.431  1.00 0.00 ? 344 G A N7     1  
ATOM 10365  C C5     . G A 1 323 ? 96.524  122.244 77.098  1.00 0.00 ? 344 G A C5     1  
ATOM 10366  C C6     . G A 1 323 ? 97.085  122.927 75.987  1.00 0.00 ? 344 G A C6     1  
ATOM 10367  O O6     . G A 1 323 ? 97.737  122.460 75.046  1.00 0.00 ? 344 G A O6     1  
ATOM 10368  N N1     . G A 1 323 ? 96.824  124.292 76.038  1.00 0.00 ? 344 G A N1     1  
ATOM 10369  C C2     . G A 1 323 ? 96.113  124.921 77.031  1.00 0.00 ? 344 G A C2     1  
ATOM 10370  N N2     . G A 1 323 ? 95.965  126.249 76.908  1.00 0.00 ? 344 G A N2     1  
ATOM 10371  N N3     . G A 1 323 ? 95.584  124.297 78.070  1.00 0.00 ? 344 G A N3     1  
ATOM 10372  C C4     . G A 1 323 ? 95.825  122.970 78.040  1.00 0.00 ? 344 G A C4     1  
ATOM 10373  H "H5'"  . G A 1 323 ? 93.785  118.997 82.246  1.00 0.00 ? 344 G A "H5'"  1  
ATOM 10374  H "H5''" . G A 1 323 ? 92.341  118.926 81.569  1.00 0.00 ? 344 G A "H5''" 1  
ATOM 10375  H "H4'"  . G A 1 323 ? 92.905  121.141 82.100  1.00 0.00 ? 344 G A "H4'"  1  
ATOM 10376  H "H3'"  . G A 1 323 ? 92.697  120.707 79.305  1.00 0.00 ? 344 G A "H3'"  1  
ATOM 10377  H "H2'"  . G A 1 323 ? 93.052  122.945 78.945  1.00 0.00 ? 344 G A "H2'"  1  
ATOM 10378  H "HO2'" . G A 1 323 ? 91.818  123.276 81.162  1.00 0.00 ? 344 G A "HO2'" 1  
ATOM 10379  H "H1'"  . G A 1 323 ? 95.019  123.092 80.667  1.00 0.00 ? 344 G A "H1'"  1  
ATOM 10380  H H8     . G A 1 323 ? 95.722  119.992 79.034  1.00 0.00 ? 344 G A H8     1  
ATOM 10381  H H1     . G A 1 323 ? 97.176  124.846 75.310  1.00 0.00 ? 344 G A H1     1  
ATOM 10382  H H21    . G A 1 323 ? 96.353  126.718 76.140  1.00 0.00 ? 344 G A H21    1  
ATOM 10383  H H22    . G A 1 323 ? 95.467  126.752 77.586  1.00 0.00 ? 344 G A H22    1  
ATOM 10384  P P      . U A 1 324 ? 90.100  121.031 79.080  1.00 0.00 ? 345 U A P      1  
ATOM 10385  O OP1    . U A 1 324 ? 88.744  120.830 79.652  1.00 0.00 ? 345 U A OP1    1  
ATOM 10386  O OP2    . U A 1 324 ? 90.705  119.970 78.236  1.00 0.00 ? 345 U A OP2    1  
ATOM 10387  O "O5'"  . U A 1 324 ? 90.084  122.383 78.239  1.00 0.00 ? 345 U A "O5'"  1  
ATOM 10388  C "C5'"  . U A 1 324 ? 89.617  123.594 78.813  1.00 0.00 ? 345 U A "C5'"  1  
ATOM 10389  C "C4'"  . U A 1 324 ? 89.520  124.696 77.786  1.00 0.00 ? 345 U A "C4'"  1  
ATOM 10390  O "O4'"  . U A 1 324 ? 90.835  125.281 77.579  1.00 0.00 ? 345 U A "O4'"  1  
ATOM 10391  C "C3'"  . U A 1 324 ? 89.108  124.272 76.385  1.00 0.00 ? 345 U A "C3'"  1  
ATOM 10392  O "O3'"  . U A 1 324 ? 87.705  124.151 76.233  1.00 0.00 ? 345 U A "O3'"  1  
ATOM 10393  C "C2'"  . U A 1 324 ? 89.681  125.404 75.544  1.00 0.00 ? 345 U A "C2'"  1  
ATOM 10394  O "O2'"  . U A 1 324 ? 88.901  126.584 75.670  1.00 0.00 ? 345 U A "O2'"  1  
ATOM 10395  C "C1'"  . U A 1 324 ? 91.031  125.620 76.225  1.00 0.00 ? 345 U A "C1'"  1  
ATOM 10396  N N1     . U A 1 324 ? 92.082  124.722 75.688  1.00 0.00 ? 345 U A N1     1  
ATOM 10397  C C2     . U A 1 324 ? 92.941  125.252 74.743  1.00 0.00 ? 345 U A C2     1  
ATOM 10398  O O2     . U A 1 324 ? 92.868  126.402 74.346  1.00 0.00 ? 345 U A O2     1  
ATOM 10399  N N3     . U A 1 324 ? 93.898  124.385 74.274  1.00 0.00 ? 345 U A N3     1  
ATOM 10400  C C4     . U A 1 324 ? 94.081  123.069 74.644  1.00 0.00 ? 345 U A C4     1  
ATOM 10401  O O4     . U A 1 324 ? 94.990  122.418 74.128  1.00 0.00 ? 345 U A O4     1  
ATOM 10402  C C5     . U A 1 324 ? 93.156  122.590 75.625  1.00 0.00 ? 345 U A C5     1  
ATOM 10403  C C6     . U A 1 324 ? 92.215  123.413 76.099  1.00 0.00 ? 345 U A C6     1  
ATOM 10404  H "H5'"  . U A 1 324 ? 90.236  123.872 79.520  1.00 0.00 ? 345 U A "H5'"  1  
ATOM 10405  H "H5''" . U A 1 324 ? 88.732  123.443 79.203  1.00 0.00 ? 345 U A "H5''" 1  
ATOM 10406  H "H4'"  . U A 1 324 ? 88.911  125.387 78.121  1.00 0.00 ? 345 U A "H4'"  1  
ATOM 10407  H "H3'"  . U A 1 324 ? 89.560  123.434 76.155  1.00 0.00 ? 345 U A "H3'"  1  
ATOM 10408  H "H2'"  . U A 1 324 ? 89.786  125.138 74.607  1.00 0.00 ? 345 U A "H2'"  1  
ATOM 10409  H "HO2'" . U A 1 324 ? 88.862  127.036 74.801  1.00 0.00 ? 345 U A "HO2'" 1  
ATOM 10410  H "H1'"  . U A 1 324 ? 91.308  126.553 76.105  1.00 0.00 ? 345 U A "H1'"  1  
ATOM 10411  H H3     . U A 1 324 ? 94.517  124.740 73.603  1.00 0.00 ? 345 U A H3     1  
ATOM 10412  H H5     . U A 1 324 ? 93.213  121.666 75.947  1.00 0.00 ? 345 U A H5     1  
ATOM 10413  H H6     . U A 1 324 ? 91.594  123.060 76.769  1.00 0.00 ? 345 U A H6     1  
ATOM 10414  P P      . G A 1 325 ? 86.727  125.014 77.164  1.00 0.00 ? 346 G A P      1  
ATOM 10415  O OP1    . G A 1 325 ? 87.130  126.442 77.102  1.00 0.00 ? 346 G A OP1    1  
ATOM 10416  O OP2    . G A 1 325 ? 86.789  124.289 78.458  1.00 0.00 ? 346 G A OP2    1  
ATOM 10417  O "O5'"  . G A 1 325 ? 85.240  124.898 76.604  1.00 0.00 ? 346 G A "O5'"  1  
ATOM 10418  C "C5'"  . G A 1 325 ? 84.122  125.066 77.463  1.00 0.00 ? 346 G A "C5'"  1  
ATOM 10419  C "C4'"  . G A 1 325 ? 83.451  123.749 77.763  1.00 0.00 ? 346 G A "C4'"  1  
ATOM 10420  O "O4'"  . G A 1 325 ? 82.026  123.848 77.513  1.00 0.00 ? 346 G A "O4'"  1  
ATOM 10421  C "C3'"  . G A 1 325 ? 83.901  122.563 76.922  1.00 0.00 ? 346 G A "C3'"  1  
ATOM 10422  O "O3'"  . G A 1 325 ? 85.084  121.956 77.412  1.00 0.00 ? 346 G A "O3'"  1  
ATOM 10423  C "C2'"  . G A 1 325 ? 82.689  121.628 76.957  1.00 0.00 ? 346 G A "C2'"  1  
ATOM 10424  O "O2'"  . G A 1 325 ? 82.643  120.888 78.168  1.00 0.00 ? 346 G A "O2'"  1  
ATOM 10425  C "C1'"  . G A 1 325 ? 81.514  122.615 76.942  1.00 0.00 ? 346 G A "C1'"  1  
ATOM 10426  N N9     . G A 1 325 ? 81.039  122.892 75.573  1.00 0.00 ? 346 G A N9     1  
ATOM 10427  C C8     . G A 1 325 ? 81.117  124.082 74.891  1.00 0.00 ? 346 G A C8     1  
ATOM 10428  N N7     . G A 1 325 ? 80.607  124.020 73.690  1.00 0.00 ? 346 G A N7     1  
ATOM 10429  C C5     . G A 1 325 ? 80.166  122.710 73.572  1.00 0.00 ? 346 G A C5     1  
ATOM 10430  C C6     . G A 1 325 ? 79.527  122.049 72.491  1.00 0.00 ? 346 G A C6     1  
ATOM 10431  O O6     . G A 1 325 ? 79.212  122.506 71.386  1.00 0.00 ? 346 G A O6     1  
ATOM 10432  N N1     . G A 1 325 ? 79.251  120.719 72.794  1.00 0.00 ? 346 G A N1     1  
ATOM 10433  C C2     . G A 1 325 ? 79.552  120.103 73.984  1.00 0.00 ? 346 G A C2     1  
ATOM 10434  N N2     . G A 1 325 ? 79.208  118.811 74.090  1.00 0.00 ? 346 G A N2     1  
ATOM 10435  N N3     . G A 1 325 ? 80.148  120.708 74.999  1.00 0.00 ? 346 G A N3     1  
ATOM 10436  C C4     . G A 1 325 ? 80.424  122.000 74.725  1.00 0.00 ? 346 G A C4     1  
ATOM 10437  H "H5'"  . G A 1 325 ? 83.476  125.664 77.034  1.00 0.00 ? 346 G A "H5'"  1  
ATOM 10438  H "H5''" . G A 1 325 ? 84.423  125.471 78.303  1.00 0.00 ? 346 G A "H5''" 1  
ATOM 10439  H "H4'"  . G A 1 325 ? 83.590  123.539 78.710  1.00 0.00 ? 346 G A "H4'"  1  
ATOM 10440  H "H3'"  . G A 1 325 ? 84.052  122.867 76.004  1.00 0.00 ? 346 G A "H3'"  1  
ATOM 10441  H "H2'"  . G A 1 325 ? 82.665  121.041 76.172  1.00 0.00 ? 346 G A "H2'"  1  
ATOM 10442  H "HO2'" . G A 1 325 ? 81.857  120.302 78.155  1.00 0.00 ? 346 G A "HO2'" 1  
ATOM 10443  H "H1'"  . G A 1 325 ? 80.776  122.253 77.476  1.00 0.00 ? 346 G A "H1'"  1  
ATOM 10444  H H8     . G A 1 325 ? 81.514  124.895 75.266  1.00 0.00 ? 346 G A H8     1  
ATOM 10445  H H1     . G A 1 325 ? 78.808  120.183 72.104  1.00 0.00 ? 346 G A H1     1  
ATOM 10446  H H21    . G A 1 325 ? 78.766  118.356 73.343  1.00 0.00 ? 346 G A H21    1  
ATOM 10447  H H22    . G A 1 325 ? 79.398  118.319 74.917  1.00 0.00 ? 346 G A H22    1  
ATOM 10448  P P      . A A 1 326 ? 85.905  120.928 76.488  1.00 0.00 ? 347 A A P      1  
ATOM 10449  O OP1    . A A 1 326 ? 87.114  120.501 77.237  1.00 0.00 ? 347 A A OP1    1  
ATOM 10450  O OP2    . A A 1 326 ? 86.052  121.535 75.142  1.00 0.00 ? 347 A A OP2    1  
ATOM 10451  O "O5'"  . A A 1 326 ? 84.936  119.670 76.358  1.00 0.00 ? 347 A A "O5'"  1  
ATOM 10452  C "C5'"  . A A 1 326 ? 84.824  118.724 77.409  1.00 0.00 ? 347 A A "C5'"  1  
ATOM 10453  C "C4'"  . A A 1 326 ? 84.326  117.391 76.907  1.00 0.00 ? 347 A A "C4'"  1  
ATOM 10454  O "O4'"  . A A 1 326 ? 82.973  117.531 76.403  1.00 0.00 ? 347 A A "O4'"  1  
ATOM 10455  C "C3'"  . A A 1 326 ? 85.095  116.789 75.740  1.00 0.00 ? 347 A A "C3'"  1  
ATOM 10456  O "O3'"  . A A 1 326 ? 86.275  116.115 76.143  1.00 0.00 ? 347 A A "O3'"  1  
ATOM 10457  C "C2'"  . A A 1 326 ? 84.061  115.877 75.096  1.00 0.00 ? 347 A A "C2'"  1  
ATOM 10458  O "O2'"  . A A 1 326 ? 83.913  114.668 75.826  1.00 0.00 ? 347 A A "O2'"  1  
ATOM 10459  C "C1'"  . A A 1 326 ? 82.785  116.708 75.250  1.00 0.00 ? 347 A A "C1'"  1  
ATOM 10460  N N9     . A A 1 326 ? 82.516  117.538 74.061  1.00 0.00 ? 347 A A N9     1  
ATOM 10461  C C8     . A A 1 326 ? 82.700  118.891 73.916  1.00 0.00 ? 347 A A C8     1  
ATOM 10462  N N7     . A A 1 326 ? 82.368  119.347 72.734  1.00 0.00 ? 347 A A N7     1  
ATOM 10463  C C5     . A A 1 326 ? 81.937  118.218 72.050  1.00 0.00 ? 347 A A C5     1  
ATOM 10464  C C6     . A A 1 326 ? 81.451  118.029 70.744  1.00 0.00 ? 347 A A C6     1  
ATOM 10465  N N6     . A A 1 326 ? 81.315  119.017 69.857  1.00 0.00 ? 347 A A N6     1  
ATOM 10466  N N1     . A A 1 326 ? 81.108  116.776 70.378  1.00 0.00 ? 347 A A N1     1  
ATOM 10467  C C2     . A A 1 326 ? 81.245  115.787 71.269  1.00 0.00 ? 347 A A C2     1  
ATOM 10468  N N3     . A A 1 326 ? 81.690  115.839 72.522  1.00 0.00 ? 347 A A N3     1  
ATOM 10469  C C4     . A A 1 326 ? 82.023  117.098 72.855  1.00 0.00 ? 347 A A C4     1  
ATOM 10470  H "H5'"  . A A 1 326 ? 84.197  119.065 78.082  1.00 0.00 ? 347 A A "H5'"  1  
ATOM 10471  H "H5''" . A A 1 326 ? 85.702  118.600 77.825  1.00 0.00 ? 347 A A "H5''" 1  
ATOM 10472  H "H4'"  . A A 1 326 ? 84.326  116.752 77.650  1.00 0.00 ? 347 A A "H4'"  1  
ATOM 10473  H "H3'"  . A A 1 326 ? 85.332  117.501 75.109  1.00 0.00 ? 347 A A "H3'"  1  
ATOM 10474  H "H2'"  . A A 1 326 ? 84.266  115.709 74.152  1.00 0.00 ? 347 A A "H2'"  1  
ATOM 10475  H "HO2'" . A A 1 326 ? 83.291  114.082 75.350  1.00 0.00 ? 347 A A "HO2'" 1  
ATOM 10476  H "H1'"  . A A 1 326 ? 82.025  116.110 75.409  1.00 0.00 ? 347 A A "H1'"  1  
ATOM 10477  H H8     . A A 1 326 ? 83.048  119.464 74.633  1.00 0.00 ? 347 A A H8     1  
ATOM 10478  H H61    . A A 1 326 ? 80.968  118.824 68.959  1.00 0.00 ? 347 A A H61    1  
ATOM 10479  H H62    . A A 1 326 ? 81.556  119.934 70.100  1.00 0.00 ? 347 A A H62    1  
ATOM 10480  H H2     . A A 1 326 ? 80.983  114.896 70.951  1.00 0.00 ? 347 A A H2     1  
ATOM 10481  P P      . U A 1 327 ? 87.537  116.034 75.150  1.00 0.00 ? 348 U A P      1  
ATOM 10482  O OP1    . U A 1 327 ? 88.693  115.504 75.919  1.00 0.00 ? 348 U A OP1    1  
ATOM 10483  O OP2    . U A 1 327 ? 87.655  117.336 74.450  1.00 0.00 ? 348 U A OP2    1  
ATOM 10484  O "O5'"  . U A 1 327 ? 87.114  114.932 74.079  1.00 0.00 ? 348 U A "O5'"  1  
ATOM 10485  C "C5'"  . U A 1 327 ? 86.976  113.570 74.450  1.00 0.00 ? 348 U A "C5'"  1  
ATOM 10486  C "C4'"  . U A 1 327 ? 86.484  112.726 73.298  1.00 0.00 ? 348 U A "C4'"  1  
ATOM 10487  O "O4'"  . U A 1 327 ? 85.163  113.169 72.890  1.00 0.00 ? 348 U A "O4'"  1  
ATOM 10488  C "C3'"  . U A 1 327 ? 87.308  112.791 72.021  1.00 0.00 ? 348 U A "C3'"  1  
ATOM 10489  O "O3'"  . U A 1 327 ? 88.444  111.943 72.051  1.00 0.00 ? 348 U A "O3'"  1  
ATOM 10490  C "C2'"  . U A 1 327 ? 86.293  112.413 70.952  1.00 0.00 ? 348 U A "C2'"  1  
ATOM 10491  O "O2'"  . U A 1 327 ? 86.069  111.011 70.926  1.00 0.00 ? 348 U A "O2'"  1  
ATOM 10492  C "C1'"  . U A 1 327 ? 85.033  113.108 71.470  1.00 0.00 ? 348 U A "C1'"  1  
ATOM 10493  N N1     . U A 1 327 ? 84.874  114.474 70.913  1.00 0.00 ? 348 U A N1     1  
ATOM 10494  C C2     . U A 1 327 ? 84.394  114.575 69.619  1.00 0.00 ? 348 U A C2     1  
ATOM 10495  O O2     . U A 1 327 ? 84.104  113.607 68.938  1.00 0.00 ? 348 U A O2     1  
ATOM 10496  N N3     . U A 1 327 ? 84.264  115.858 69.146  1.00 0.00 ? 348 U A N3     1  
ATOM 10497  C C4     . U A 1 327 ? 84.558  117.026 69.818  1.00 0.00 ? 348 U A C4     1  
ATOM 10498  O O4     . U A 1 327 ? 84.386  118.108 69.253  1.00 0.00 ? 348 U A O4     1  
ATOM 10499  C C5     . U A 1 327 ? 85.047  116.844 71.150  1.00 0.00 ? 348 U A C5     1  
ATOM 10500  C C6     . U A 1 327 ? 85.184  115.606 71.637  1.00 0.00 ? 348 U A C6     1  
ATOM 10501  H "H5'"  . U A 1 327 ? 86.335  113.502 75.189  1.00 0.00 ? 348 U A "H5'"  1  
ATOM 10502  H "H5''" . U A 1 327 ? 87.845  113.228 74.746  1.00 0.00 ? 348 U A "H5''" 1  
ATOM 10503  H "H4'"  . U A 1 327 ? 86.431  111.793 73.594  1.00 0.00 ? 348 U A "H4'"  1  
ATOM 10504  H "H3'"  . U A 1 327 ? 87.600  113.716 71.873  1.00 0.00 ? 348 U A "H3'"  1  
ATOM 10505  H "H2'"  . U A 1 327 ? 86.554  112.755 70.071  1.00 0.00 ? 348 U A "H2'"  1  
ATOM 10506  H "HO2'" . U A 1 327 ? 86.823  110.560 71.359  1.00 0.00 ? 348 U A "HO2'" 1  
ATOM 10507  H "H1'"  . U A 1 327 ? 84.245  112.572 71.235  1.00 0.00 ? 348 U A "H1'"  1  
ATOM 10508  H H3     . U A 1 327 ? 83.925  115.953 68.232  1.00 0.00 ? 348 U A H3     1  
ATOM 10509  H H5     . U A 1 327 ? 85.281  117.620 71.700  1.00 0.00 ? 348 U A H5     1  
ATOM 10510  H H6     . U A 1 327 ? 85.522  115.507 72.549  1.00 0.00 ? 348 U A H6     1  
ATOM 10511  P P      . G A 1 328 ? 89.777  112.348 71.248  1.00 0.00 ? 349 G A P      1  
ATOM 10512  O OP1    . G A 1 328 ? 90.859  111.416 71.653  1.00 0.00 ? 349 G A OP1    1  
ATOM 10513  O OP2    . G A 1 328 ? 89.976  113.812 71.396  1.00 0.00 ? 349 G A OP2    1  
ATOM 10514  O "O5'"  . G A 1 328 ? 89.415  112.051 69.725  1.00 0.00 ? 349 G A "O5'"  1  
ATOM 10515  C "C5'"  . G A 1 328 ? 89.226  110.721 69.266  1.00 0.00 ? 349 G A "C5'"  1  
ATOM 10516  C "C4'"  . G A 1 328 ? 88.732  110.691 67.842  1.00 0.00 ? 349 G A "C4'"  1  
ATOM 10517  O "O4'"  . G A 1 328 ? 87.455  111.371 67.750  1.00 0.00 ? 349 G A "O4'"  1  
ATOM 10518  C "C3'"  . G A 1 328 ? 89.604  111.402 66.819  1.00 0.00 ? 349 G A "C3'"  1  
ATOM 10519  O "O3'"  . G A 1 328 ? 90.703  110.618 66.386  1.00 0.00 ? 349 G A "O3'"  1  
ATOM 10520  C "C2'"  . G A 1 328 ? 88.616  111.732 65.710  1.00 0.00 ? 349 G A "C2'"  1  
ATOM 10521  O "O2'"  . G A 1 328 ? 88.336  110.590 64.912  1.00 0.00 ? 349 G A "O2'"  1  
ATOM 10522  C "C1'"  . G A 1 328 ? 87.365  112.091 66.515  1.00 0.00 ? 349 G A "C1'"  1  
ATOM 10523  N N9     . G A 1 328 ? 87.263  113.543 66.760  1.00 0.00 ? 349 G A N9     1  
ATOM 10524  C C8     . G A 1 328 ? 87.490  114.205 67.942  1.00 0.00 ? 349 G A C8     1  
ATOM 10525  N N7     . G A 1 328 ? 87.318  115.495 67.851  1.00 0.00 ? 349 G A N7     1  
ATOM 10526  C C5     . G A 1 328 ? 86.955  115.700 66.528  1.00 0.00 ? 349 G A C5     1  
ATOM 10527  C C6     . G A 1 328 ? 86.640  116.898 65.835  1.00 0.00 ? 349 G A C6     1  
ATOM 10528  O O6     . G A 1 328 ? 86.618  118.055 66.269  1.00 0.00 ? 349 G A O6     1  
ATOM 10529  N N1     . G A 1 328 ? 86.324  116.652 64.502  1.00 0.00 ? 349 G A N1     1  
ATOM 10530  C C2     . G A 1 328 ? 86.314  115.411 63.911  1.00 0.00 ? 349 G A C2     1  
ATOM 10531  N N2     . G A 1 328 ? 85.984  115.374 62.611  1.00 0.00 ? 349 G A N2     1  
ATOM 10532  N N3     . G A 1 328 ? 86.605  114.288 64.545  1.00 0.00 ? 349 G A N3     1  
ATOM 10533  C C4     . G A 1 328 ? 86.915  114.505 65.841  1.00 0.00 ? 349 G A C4     1  
ATOM 10534  H "H5'"  . G A 1 328 ? 88.571  110.274 69.841  1.00 0.00 ? 349 G A "H5'"  1  
ATOM 10535  H "H5''" . G A 1 328 ? 90.079  110.240 69.320  1.00 0.00 ? 349 G A "H5''" 1  
ATOM 10536  H "H4'"  . G A 1 328 ? 88.618  109.757 67.565  1.00 0.00 ? 349 G A "H4'"  1  
ATOM 10537  H "H3'"  . G A 1 328 ? 89.940  112.238 67.206  1.00 0.00 ? 349 G A "H3'"  1  
ATOM 10538  H "H2'"  . G A 1 328 ? 88.921  112.488 65.167  1.00 0.00 ? 349 G A "H2'"  1  
ATOM 10539  H "HO2'" . G A 1 328 ? 87.760  110.855 64.167  1.00 0.00 ? 349 G A "HO2'" 1  
ATOM 10540  H "H1'"  . G A 1 328 ? 86.568  111.785 66.034  1.00 0.00 ? 349 G A "H1'"  1  
ATOM 10541  H H8     . G A 1 328 ? 87.756  113.753 68.771  1.00 0.00 ? 349 G A H8     1  
ATOM 10542  H H1     . G A 1 328 ? 86.092  117.422 63.945  1.00 0.00 ? 349 G A H1     1  
ATOM 10543  H H21    . G A 1 328 ? 85.766  116.202 62.134  1.00 0.00 ? 349 G A H21    1  
ATOM 10544  H H22    . G A 1 328 ? 85.959  114.518 62.136  1.00 0.00 ? 349 G A H22    1  
ATOM 10545  P P      . C A 1 329 ? 92.072  111.326 65.930  1.00 0.00 ? 350 C A P      1  
ATOM 10546  O OP1    . C A 1 329 ? 93.115  110.276 65.807  1.00 0.00 ? 350 C A OP1    1  
ATOM 10547  O OP2    . C A 1 329 ? 92.304  112.492 66.819  1.00 0.00 ? 350 C A OP2    1  
ATOM 10548  O "O5'"  . C A 1 329 ? 91.753  111.877 64.468  1.00 0.00 ? 350 C A "O5'"  1  
ATOM 10549  C "C5'"  . C A 1 329 ? 91.541  110.985 63.384  1.00 0.00 ? 350 C A "C5'"  1  
ATOM 10550  C "C4'"  . C A 1 329 ? 91.111  111.719 62.137  1.00 0.00 ? 350 C A "C4'"  1  
ATOM 10551  O "O4'"  . C A 1 329 ? 89.855  112.406 62.375  1.00 0.00 ? 350 C A "O4'"  1  
ATOM 10552  C "C3'"  . C A 1 329 ? 92.046  112.816 61.649  1.00 0.00 ? 350 C A "C3'"  1  
ATOM 10553  O "O3'"  . C A 1 329 ? 93.128  112.319 60.880  1.00 0.00 ? 350 C A "O3'"  1  
ATOM 10554  C "C2'"  . C A 1 329 ? 91.108  113.727 60.866  1.00 0.00 ? 350 C A "C2'"  1  
ATOM 10555  O "O2'"  . C A 1 329 ? 90.817  113.188 59.585  1.00 0.00 ? 350 C A "O2'"  1  
ATOM 10556  C "C1'"  . C A 1 329 ? 89.845  113.675 61.726  1.00 0.00 ? 350 C A "C1'"  1  
ATOM 10557  N N1     . C A 1 329 ? 89.802  114.766 62.732  1.00 0.00 ? 350 C A N1     1  
ATOM 10558  C C2     . C A 1 329 ? 89.421  116.045 62.308  1.00 0.00 ? 350 C A C2     1  
ATOM 10559  O O2     . C A 1 329 ? 89.133  116.228 61.115  1.00 0.00 ? 350 C A O2     1  
ATOM 10560  N N3     . C A 1 329 ? 89.373  117.058 63.205  1.00 0.00 ? 350 C A N3     1  
ATOM 10561  C C4     . C A 1 329 ? 89.688  116.835 64.480  1.00 0.00 ? 350 C A C4     1  
ATOM 10562  N N4     . C A 1 329 ? 89.627  117.865 65.329  1.00 0.00 ? 350 C A N4     1  
ATOM 10563  C C5     . C A 1 329 ? 90.080  115.547 64.942  1.00 0.00 ? 350 C A C5     1  
ATOM 10564  C C6     . C A 1 329 ? 90.122  114.553 64.046  1.00 0.00 ? 350 C A C6     1  
ATOM 10565  H "H5'"  . C A 1 329 ? 90.846  110.342 63.632  1.00 0.00 ? 350 C A "H5'"  1  
ATOM 10566  H "H5''" . C A 1 329 ? 92.374  110.503 63.200  1.00 0.00 ? 350 C A "H5''" 1  
ATOM 10567  H "H4'"  . C A 1 329 ? 90.985  111.067 61.417  1.00 0.00 ? 350 C A "H4'"  1  
ATOM 10568  H "H3'"  . C A 1 329 ? 92.399  113.305 62.421  1.00 0.00 ? 350 C A "H3'"  1  
ATOM 10569  H "H2'"  . C A 1 329 ? 91.462  114.639 60.805  1.00 0.00 ? 350 C A "H2'"  1  
ATOM 10570  H "HO2'" . C A 1 329 ? 91.506  112.534 59.350  1.00 0.00 ? 350 C A "HO2'" 1  
ATOM 10571  H "H1'"  . C A 1 329 ? 89.056  113.735 61.150  1.00 0.00 ? 350 C A "H1'"  1  
ATOM 10572  H H41    . C A 1 329 ? 89.358  118.750 65.007  1.00 0.00 ? 350 C A H41    1  
ATOM 10573  H H42    . C A 1 329 ? 89.852  117.733 66.273  1.00 0.00 ? 350 C A H42    1  
ATOM 10574  H H5     . C A 1 329 ? 90.310  115.392 65.882  1.00 0.00 ? 350 C A H5     1  
ATOM 10575  H H6     . C A 1 329 ? 90.389  113.659 64.346  1.00 0.00 ? 350 C A H6     1  
ATOM 10576  P P      . A A 1 330 ? 94.545  113.079 60.893  1.00 0.00 ? 351 A A P      1  
ATOM 10577  O OP1    . A A 1 330 ? 95.540  112.208 60.220  1.00 0.00 ? 351 A A OP1    1  
ATOM 10578  O OP2    . A A 1 330 ? 94.799  113.550 62.277  1.00 0.00 ? 351 A A OP2    1  
ATOM 10579  O "O5'"  . A A 1 330 ? 94.304  114.357 59.974  1.00 0.00 ? 351 A A "O5'"  1  
ATOM 10580  C "C5'"  . A A 1 330 ? 94.092  114.221 58.577  1.00 0.00 ? 351 A A "C5'"  1  
ATOM 10581  C "C4'"  . A A 1 330 ? 93.704  115.534 57.945  1.00 0.00 ? 351 A A "C4'"  1  
ATOM 10582  O "O4'"  . A A 1 330 ? 92.467  116.017 58.534  1.00 0.00 ? 351 A A "O4'"  1  
ATOM 10583  C "C3'"  . A A 1 330 ? 94.681  116.683 58.140  1.00 0.00 ? 351 A A "C3'"  1  
ATOM 10584  O "O3'"  . A A 1 330 ? 95.764  116.652 57.227  1.00 0.00 ? 351 A A "O3'"  1  
ATOM 10585  C "C2'"  . A A 1 330 ? 93.789  117.908 57.987  1.00 0.00 ? 351 A A "C2'"  1  
ATOM 10586  O "O2'"  . A A 1 330 ? 93.504  118.169 56.621  1.00 0.00 ? 351 A A "O2'"  1  
ATOM 10587  C "C1'"  . A A 1 330 ? 92.509  117.441 58.682  1.00 0.00 ? 351 A A "C1'"  1  
ATOM 10588  N N9     . A A 1 330 ? 92.480  117.820 60.109  1.00 0.00 ? 351 A A N9     1  
ATOM 10589  C C8     . A A 1 330 ? 92.691  117.014 61.199  1.00 0.00 ? 351 A A C8     1  
ATOM 10590  N N7     . A A 1 330 ? 92.599  117.644 62.346  1.00 0.00 ? 351 A A N7     1  
ATOM 10591  C C5     . A A 1 330 ? 92.306  118.951 61.984  1.00 0.00 ? 351 A A C5     1  
ATOM 10592  C C6     . A A 1 330 ? 92.084  120.116 62.742  1.00 0.00 ? 351 A A C6     1  
ATOM 10593  N N6     . A A 1 330 ? 92.127  120.150 64.076  1.00 0.00 ? 351 A A N6     1  
ATOM 10594  N N1     . A A 1 330 ? 91.818  121.259 62.074  1.00 0.00 ? 351 A A N1     1  
ATOM 10595  C C2     . A A 1 330 ? 91.775  121.224 60.736  1.00 0.00 ? 351 A A C2     1  
ATOM 10596  N N3     . A A 1 330 ? 91.966  120.194 59.914  1.00 0.00 ? 351 A A N3     1  
ATOM 10597  C C4     . A A 1 330 ? 92.231  119.073 60.610  1.00 0.00 ? 351 A A C4     1  
ATOM 10598  H "H5'"  . A A 1 330 ? 93.376  113.569 58.426  1.00 0.00 ? 351 A A "H5'"  1  
ATOM 10599  H "H5''" . A A 1 330 ? 94.913  113.894 58.157  1.00 0.00 ? 351 A A "H5''" 1  
ATOM 10600  H "H4'"  . A A 1 330 ? 93.565  115.395 56.985  1.00 0.00 ? 351 A A "H4'"  1  
ATOM 10601  H "H3'"  . A A 1 330 ? 95.031  116.655 59.055  1.00 0.00 ? 351 A A "H3'"  1  
ATOM 10602  H "H2'"  . A A 1 330 ? 94.174  118.691 58.434  1.00 0.00 ? 351 A A "H2'"  1  
ATOM 10603  H "HO2'" . A A 1 330 ? 94.175  117.724 56.064  1.00 0.00 ? 351 A A "HO2'" 1  
ATOM 10604  H "H1'"  . A A 1 330 ? 91.732  117.826 58.225  1.00 0.00 ? 351 A A "H1'"  1  
ATOM 10605  H H8     . A A 1 330 ? 92.893  116.058 61.128  1.00 0.00 ? 351 A A H8     1  
ATOM 10606  H H61    . A A 1 330 ? 91.964  120.993 64.549  1.00 0.00 ? 351 A A H61    1  
ATOM 10607  H H62    . A A 1 330 ? 92.319  119.335 64.581  1.00 0.00 ? 351 A A H62    1  
ATOM 10608  H H2     . A A 1 330 ? 91.578  122.080 60.299  1.00 0.00 ? 351 A A H2     1  
ATOM 10609  P P      . A A 1 331 ? 97.229  117.120 57.696  1.00 0.00 ? 352 A A P      1  
ATOM 10610  O OP1    . A A 1 331 ? 98.136  117.036 56.524  1.00 0.00 ? 352 A A OP1    1  
ATOM 10611  O OP2    . A A 1 331 ? 97.569  116.387 58.941  1.00 0.00 ? 352 A A OP2    1  
ATOM 10612  O "O5'"  . A A 1 331 ? 97.041  118.658 58.066  1.00 0.00 ? 352 A A "O5'"  1  
ATOM 10613  C "C5'"  . A A 1 331 ? 96.630  119.599 57.086  1.00 0.00 ? 352 A A "C5'"  1  
ATOM 10614  C "C4'"  . A A 1 331 ? 96.509  120.986 57.665  1.00 0.00 ? 352 A A "C4'"  1  
ATOM 10615  O "O4'"  . A A 1 331 ? 95.363  121.069 58.549  1.00 0.00 ? 352 A A "O4'"  1  
ATOM 10616  C "C3'"  . A A 1 331 ? 97.661  121.445 58.546  1.00 0.00 ? 352 A A "C3'"  1  
ATOM 10617  O "O3'"  . A A 1 331 ? 98.788  121.878 57.805  1.00 0.00 ? 352 A A "O3'"  1  
ATOM 10618  C "C2'"  . A A 1 331 ? 97.007  122.611 59.278  1.00 0.00 ? 352 A A "C2'"  1  
ATOM 10619  O "O2'"  . A A 1 331 ? 96.922  123.758 58.445  1.00 0.00 ? 352 A A "O2'"  1  
ATOM 10620  C "C1'"  . A A 1 331 ? 95.604  122.066 59.517  1.00 0.00 ? 352 A A "C1'"  1  
ATOM 10621  N N9     . A A 1 331 ? 95.457  121.479 60.863  1.00 0.00 ? 352 A A N9     1  
ATOM 10622  C C8     . A A 1 331 ? 95.553  120.157 61.222  1.00 0.00 ? 352 A A C8     1  
ATOM 10623  N N7     . A A 1 331 ? 95.374  119.943 62.502  1.00 0.00 ? 352 A A N7     1  
ATOM 10624  C C5     . A A 1 331 ? 95.143  121.209 63.022  1.00 0.00 ? 352 A A C5     1  
ATOM 10625  C C6     . A A 1 331 ? 94.880  121.664 64.327  1.00 0.00 ? 352 A A C6     1  
ATOM 10626  N N6     . A A 1 331 ? 94.805  120.860 65.390  1.00 0.00 ? 352 A A N6     1  
ATOM 10627  N N1     . A A 1 331 ? 94.698  122.990 64.505  1.00 0.00 ? 352 A A N1     1  
ATOM 10628  C C2     . A A 1 331 ? 94.774  123.797 63.439  1.00 0.00 ? 352 A A C2     1  
ATOM 10629  N N3     . A A 1 331 ? 95.014  123.489 62.166  1.00 0.00 ? 352 A A N3     1  
ATOM 10630  C C4     . A A 1 331 ? 95.192  122.164 62.024  1.00 0.00 ? 352 A A C4     1  
ATOM 10631  H "H5'"  . A A 1 331 ? 95.761  119.326 56.725  1.00 0.00 ? 352 A A "H5'"  1  
ATOM 10632  H "H5''" . A A 1 331 ? 97.287  119.612 56.359  1.00 0.00 ? 352 A A "H5''" 1  
ATOM 10633  H "H4'"  . A A 1 331 ? 96.385  121.626 56.933  1.00 0.00 ? 352 A A "H4'"  1  
ATOM 10634  H "H3'"  . A A 1 331 ? 97.882  120.732 59.183  1.00 0.00 ? 352 A A "H3'"  1  
ATOM 10635  H "H2'"  . A A 1 331 ? 97.465  122.807 60.122  1.00 0.00 ? 352 A A "H2'"  1  
ATOM 10636  H "HO2'" . A A 1 331 ? 96.512  124.489 58.952  1.00 0.00 ? 352 A A "HO2'" 1  
ATOM 10637  H "H1'"  . A A 1 331 ? 94.950  122.788 59.403  1.00 0.00 ? 352 A A "H1'"  1  
ATOM 10638  H H8     . A A 1 331 ? 95.740  119.440 60.580  1.00 0.00 ? 352 A A H8     1  
ATOM 10639  H H61    . A A 1 331 ? 94.619  121.236 66.276  1.00 0.00 ? 352 A A H61    1  
ATOM 10640  H H62    . A A 1 331 ? 94.934  119.895 65.285  1.00 0.00 ? 352 A A H62    1  
ATOM 10641  H H2     . A A 1 331 ? 94.634  124.750 63.622  1.00 0.00 ? 352 A A H2     1  
ATOM 10642  P P      . C A 1 332 ? 100.245 121.891 58.483  1.00 0.00 ? 353 C A P      1  
ATOM 10643  O OP1    . C A 1 332 ? 101.233 122.267 57.440  1.00 0.00 ? 353 C A OP1    1  
ATOM 10644  O OP2    . C A 1 332 ? 100.416 120.621 59.232  1.00 0.00 ? 353 C A OP2    1  
ATOM 10645  O "O5'"  . C A 1 332 ? 100.168 123.081 59.539  1.00 0.00 ? 353 C A "O5'"  1  
ATOM 10646  C "C5'"  . C A 1 332 ? 100.564 122.886 60.888  1.00 0.00 ? 353 C A "C5'"  1  
ATOM 10647  C "C4'"  . C A 1 332 ? 99.827  123.812 61.825  1.00 0.00 ? 353 C A "C4'"  1  
ATOM 10648  O "O4'"  . C A 1 332 ? 98.581  123.198 62.224  1.00 0.00 ? 353 C A "O4'"  1  
ATOM 10649  C "C3'"  . C A 1 332 ? 100.524 124.129 63.139  1.00 0.00 ? 353 C A "C3'"  1  
ATOM 10650  O "O3'"  . C A 1 332 ? 101.484 125.164 63.020  1.00 0.00 ? 353 C A "O3'"  1  
ATOM 10651  C "C2'"  . C A 1 332 ? 99.364  124.496 64.058  1.00 0.00 ? 353 C A "C2'"  1  
ATOM 10652  O "O2'"  . C A 1 332 ? 98.952  125.839 63.856  1.00 0.00 ? 353 C A "O2'"  1  
ATOM 10653  C "C1'"  . C A 1 332 ? 98.262  123.561 63.562  1.00 0.00 ? 353 C A "C1'"  1  
ATOM 10654  N N1     . C A 1 332 ? 98.162  122.326 64.377  1.00 0.00 ? 353 C A N1     1  
ATOM 10655  C C2     . C A 1 332 ? 97.669  122.429 65.684  1.00 0.00 ? 353 C A C2     1  
ATOM 10656  O O2     . C A 1 332 ? 97.335  123.542 66.119  1.00 0.00 ? 353 C A O2     1  
ATOM 10657  N N3     . C A 1 332 ? 97.567  121.318 66.448  1.00 0.00 ? 353 C A N3     1  
ATOM 10658  C C4     . C A 1 332 ? 97.933  120.134 65.957  1.00 0.00 ? 353 C A C4     1  
ATOM 10659  N N4     . C A 1 332 ? 97.815  119.064 66.748  1.00 0.00 ? 353 C A N4     1  
ATOM 10660  C C5     . C A 1 332 ? 98.438  119.995 64.634  1.00 0.00 ? 353 C A C5     1  
ATOM 10661  C C6     . C A 1 332 ? 98.533  121.101 63.886  1.00 0.00 ? 353 C A C6     1  
ATOM 10662  H "H5'"  . C A 1 332 ? 101.527 123.053 60.965  1.00 0.00 ? 353 C A "H5'"  1  
ATOM 10663  H "H5''" . C A 1 332 ? 100.379 121.959 61.144  1.00 0.00 ? 353 C A "H5''" 1  
ATOM 10664  H "H4'"  . C A 1 332 ? 99.636  124.650 61.355  1.00 0.00 ? 353 C A "H4'"  1  
ATOM 10665  H "H3'"  . C A 1 332 ? 100.956 123.318 63.480  1.00 0.00 ? 353 C A "H3'"  1  
ATOM 10666  H "H2'"  . C A 1 332 ? 99.582  124.321 64.997  1.00 0.00 ? 353 C A "H2'"  1  
ATOM 10667  H "HO2'" . C A 1 332 ? 98.685  126.225 64.715  1.00 0.00 ? 353 C A "HO2'" 1  
ATOM 10668  H "H1'"  . C A 1 332 ? 97.405  124.036 63.581  1.00 0.00 ? 353 C A "H1'"  1  
ATOM 10669  H H41    . C A 1 332 ? 97.467  119.164 67.659  1.00 0.00 ? 353 C A H41    1  
ATOM 10670  H H42    . C A 1 332 ? 98.075  118.180 66.416  1.00 0.00 ? 353 C A H42    1  
ATOM 10671  H H5     . C A 1 332 ? 98.704  119.120 64.281  1.00 0.00 ? 353 C A H5     1  
ATOM 10672  H H6     . C A 1 332 ? 98.878  121.026 62.973  1.00 0.00 ? 353 C A H6     1  
ATOM 10673  P P      . A A 1 333 ? 102.011 125.913 64.334  1.00 0.00 ? 354 A A P      1  
ATOM 10674  O OP1    . A A 1 333 ? 103.009 126.938 63.940  1.00 0.00 ? 354 A A OP1    1  
ATOM 10675  O OP2    . A A 1 333 ? 102.423 124.785 65.207  1.00 0.00 ? 354 A A OP2    1  
ATOM 10676  O "O5'"  . A A 1 333 ? 100.789 126.657 65.034  1.00 0.00 ? 354 A A "O5'"  1  
ATOM 10677  C "C5'"  . A A 1 333 ? 100.652 126.662 66.448  1.00 0.00 ? 354 A A "C5'"  1  
ATOM 10678  C "C4'"  . A A 1 333 ? 99.825  127.831 66.920  1.00 0.00 ? 354 A A "C4'"  1  
ATOM 10679  O "O4'"  . A A 1 333 ? 98.470  127.332 66.782  1.00 0.00 ? 354 A A "O4'"  1  
ATOM 10680  C "C3'"  . A A 1 333 ? 100.003 128.230 68.377  1.00 0.00 ? 354 A A "C3'"  1  
ATOM 10681  O "O3'"  . A A 1 333 ? 100.925 129.292 68.552  1.00 0.00 ? 354 A A "O3'"  1  
ATOM 10682  C "C2'"  . A A 1 333 ? 98.602  128.570 68.839  1.00 0.00 ? 354 A A "C2'"  1  
ATOM 10683  O "O2'"  . A A 1 333 ? 98.256  129.904 68.496  1.00 0.00 ? 354 A A "O2'"  1  
ATOM 10684  C "C1'"  . A A 1 333 ? 97.759  127.609 67.999  1.00 0.00 ? 354 A A "C1'"  1  
ATOM 10685  N N9     . A A 1 333 ? 97.518  126.330 68.693  1.00 0.00 ? 354 A A N9     1  
ATOM 10686  C C8     . A A 1 333 ? 97.997  125.086 68.361  1.00 0.00 ? 354 A A C8     1  
ATOM 10687  N N7     . A A 1 333 ? 97.607  124.135 69.174  1.00 0.00 ? 354 A A N7     1  
ATOM 10688  C C5     . A A 1 333 ? 96.817  124.797 70.105  1.00 0.00 ? 354 A A C5     1  
ATOM 10689  C C6     . A A 1 333 ? 96.105  124.348 71.231  1.00 0.00 ? 354 A A C6     1  
ATOM 10690  N N6     . A A 1 333 ? 96.073  123.074 71.629  1.00 0.00 ? 354 A A N6     1  
ATOM 10691  N N1     . A A 1 333 ? 95.418  125.265 71.946  1.00 0.00 ? 354 A A N1     1  
ATOM 10692  C C2     . A A 1 333 ? 95.449  126.544 71.549  1.00 0.00 ? 354 A A C2     1  
ATOM 10693  N N3     . A A 1 333 ? 96.081  127.086 70.509  1.00 0.00 ? 354 A A N3     1  
ATOM 10694  C C4     . A A 1 333 ? 96.754  126.148 69.820  1.00 0.00 ? 354 A A C4     1  
ATOM 10695  H "H5'"  . A A 1 333 ? 101.542 126.716 66.855  1.00 0.00 ? 354 A A "H5'"  1  
ATOM 10696  H "H5''" . A A 1 333 ? 100.221 125.830 66.731  1.00 0.00 ? 354 A A "H5''" 1  
ATOM 10697  H "H4'"  . A A 1 333 ? 99.905  128.632 66.360  1.00 0.00 ? 354 A A "H4'"  1  
ATOM 10698  H "H3'"  . A A 1 333 ? 100.323 127.444 68.867  1.00 0.00 ? 354 A A "H3'"  1  
ATOM 10699  H "H2'"  . A A 1 333 ? 98.489  128.400 69.797  1.00 0.00 ? 354 A A "H2'"  1  
ATOM 10700  H "HO2'" . A A 1 333 ? 97.346  130.088 68.809  1.00 0.00 ? 354 A A "HO2'" 1  
ATOM 10701  H "H1'"  . A A 1 333 ? 96.900  128.031 67.784  1.00 0.00 ? 354 A A "H1'"  1  
ATOM 10702  H H8     . A A 1 333 ? 98.578  124.924 67.588  1.00 0.00 ? 354 A A H8     1  
ATOM 10703  H H61    . A A 1 333 ? 95.558  122.822 72.424  1.00 0.00 ? 354 A A H61    1  
ATOM 10704  H H62    . A A 1 333 ? 96.564  122.391 71.126  1.00 0.00 ? 354 A A H62    1  
ATOM 10705  H H2     . A A 1 333 ? 94.935  127.169 72.101  1.00 0.00 ? 354 A A H2     1  
ATOM 10706  P P      . C A 1 334 ? 102.067 129.194 69.678  1.00 0.00 ? 355 C A P      1  
ATOM 10707  O OP1    . C A 1 334 ? 103.163 130.123 69.303  1.00 0.00 ? 355 C A OP1    1  
ATOM 10708  O OP2    . C A 1 334 ? 102.368 127.758 69.904  1.00 0.00 ? 355 C A OP2    1  
ATOM 10709  O "O5'"  . C A 1 334 ? 101.366 129.764 70.989  1.00 0.00 ? 355 C A "O5'"  1  
ATOM 10710  C "C5'"  . C A 1 334 ? 100.636 130.980 70.956  1.00 0.00 ? 355 C A "C5'"  1  
ATOM 10711  C "C4'"  . C A 1 334 ? 99.626  131.055 72.075  1.00 0.00 ? 355 C A "C4'"  1  
ATOM 10712  O "O4'"  . C A 1 334 ? 98.533  130.136 71.816  1.00 0.00 ? 355 C A "O4'"  1  
ATOM 10713  C "C3'"  . C A 1 334 ? 100.125 130.656 73.456  1.00 0.00 ? 355 C A "C3'"  1  
ATOM 10714  O "O3'"  . C A 1 334 ? 100.814 131.702 74.122  1.00 0.00 ? 355 C A "O3'"  1  
ATOM 10715  C "C2'"  . C A 1 334 ? 98.847  130.221 74.159  1.00 0.00 ? 355 C A "C2'"  1  
ATOM 10716  O "O2'"  . C A 1 334 ? 98.087  131.344 74.585  1.00 0.00 ? 355 C A "O2'"  1  
ATOM 10717  C "C1'"  . C A 1 334 ? 98.099  129.518 73.025  1.00 0.00 ? 355 C A "C1'"  1  
ATOM 10718  N N1     . C A 1 334 ? 98.371  128.059 72.993  1.00 0.00 ? 355 C A N1     1  
ATOM 10719  C C2     . C A 1 334 ? 97.721  127.240 73.925  1.00 0.00 ? 355 C A C2     1  
ATOM 10720  O O2     . C A 1 334 ? 96.946  127.754 74.746  1.00 0.00 ? 355 C A O2     1  
ATOM 10721  N N3     . C A 1 334 ? 97.952  125.908 73.916  1.00 0.00 ? 355 C A N3     1  
ATOM 10722  C C4     . C A 1 334 ? 98.789  125.381 73.023  1.00 0.00 ? 355 C A C4     1  
ATOM 10723  N N4     . C A 1 334 ? 98.987  124.059 73.052  1.00 0.00 ? 355 C A N4     1  
ATOM 10724  C C5     . C A 1 334 ? 99.465  126.186 72.063  1.00 0.00 ? 355 C A C5     1  
ATOM 10725  C C6     . C A 1 334 ? 99.230  127.502 72.081  1.00 0.00 ? 355 C A C6     1  
ATOM 10726  H "H5'"  . C A 1 334 ? 100.167 131.048 70.098  1.00 0.00 ? 355 C A "H5'"  1  
ATOM 10727  H "H5''" . C A 1 334 ? 101.261 131.731 71.039  1.00 0.00 ? 355 C A "H5''" 1  
ATOM 10728  H "H4'"  . C A 1 334 ? 99.273  131.968 72.119  1.00 0.00 ? 355 C A "H4'"  1  
ATOM 10729  H "H3'"  . C A 1 334 ? 100.722 129.882 73.370  1.00 0.00 ? 355 C A "H3'"  1  
ATOM 10730  H "H2'"  . C A 1 334 ? 99.033  129.608 74.899  1.00 0.00 ? 355 C A "H2'"  1  
ATOM 10731  H "HO2'" . C A 1 334 ? 97.316  131.029 75.100  1.00 0.00 ? 355 C A "HO2'" 1  
ATOM 10732  H "H1'"  . C A 1 334 ? 97.136  129.666 73.128  1.00 0.00 ? 355 C A "H1'"  1  
ATOM 10733  H H41    . C A 1 334 ? 98.519  123.508 73.716  1.00 0.00 ? 355 C A H41    1  
ATOM 10734  H H42    . C A 1 334 ? 99.596  123.641 72.410  1.00 0.00 ? 355 C A H42    1  
ATOM 10735  H H5     . C A 1 334 ? 100.080 125.787 71.411  1.00 0.00 ? 355 C A H5     1  
ATOM 10736  H H6     . C A 1 334 ? 99.685  128.071 71.428  1.00 0.00 ? 355 C A H6     1  
ATOM 10737  P P      . U A 1 335 ? 101.972 131.361 75.182  1.00 0.00 ? 356 U A P      1  
ATOM 10738  O OP1    . U A 1 335 ? 102.601 132.640 75.603  1.00 0.00 ? 356 U A OP1    1  
ATOM 10739  O OP2    . U A 1 335 ? 102.814 130.282 74.610  1.00 0.00 ? 356 U A OP2    1  
ATOM 10740  O "O5'"  . U A 1 335 ? 101.185 130.764 76.431  1.00 0.00 ? 356 U A "O5'"  1  
ATOM 10741  C "C5'"  . U A 1 335 ? 100.311 131.577 77.199  1.00 0.00 ? 356 U A "C5'"  1  
ATOM 10742  C "C4'"  . U A 1 335 ? 99.610  130.781 78.273  1.00 0.00 ? 356 U A "C4'"  1  
ATOM 10743  O "O4'"  . U A 1 335 ? 98.766  129.768 77.666  1.00 0.00 ? 356 U A "O4'"  1  
ATOM 10744  C "C3'"  . U A 1 335 ? 100.505 129.998 79.220  1.00 0.00 ? 356 U A "C3'"  1  
ATOM 10745  O "O3'"  . U A 1 335 ? 101.050 130.797 80.258  1.00 0.00 ? 356 U A "O3'"  1  
ATOM 10746  C "C2'"  . U A 1 335 ? 99.579  128.897 79.719  1.00 0.00 ? 356 U A "C2'"  1  
ATOM 10747  O "O2'"  . U A 1 335 ? 98.693  129.383 80.717  1.00 0.00 ? 356 U A "O2'"  1  
ATOM 10748  C "C1'"  . U A 1 335 ? 98.778  128.576 78.456  1.00 0.00 ? 356 U A "C1'"  1  
ATOM 10749  N N1     . U A 1 335 ? 99.366  127.451 77.689  1.00 0.00 ? 356 U A N1     1  
ATOM 10750  C C2     . U A 1 335 ? 99.150  126.175 78.175  1.00 0.00 ? 356 U A C2     1  
ATOM 10751  O O2     . U A 1 335 ? 98.508  125.948 79.186  1.00 0.00 ? 356 U A O2     1  
ATOM 10752  N N3     . U A 1 335 ? 99.709  125.165 77.433  1.00 0.00 ? 356 U A N3     1  
ATOM 10753  C C4     . U A 1 335 ? 100.451 125.296 76.277  1.00 0.00 ? 356 U A C4     1  
ATOM 10754  O O4     . U A 1 335 ? 100.890 124.287 75.724  1.00 0.00 ? 356 U A O4     1  
ATOM 10755  C C5     . U A 1 335 ? 100.635 126.645 75.834  1.00 0.00 ? 356 U A C5     1  
ATOM 10756  C C6     . U A 1 335 ? 100.099 127.647 76.538  1.00 0.00 ? 356 U A C6     1  
ATOM 10757  H "H5'"  . U A 1 335 ? 99.639  131.974 76.607  1.00 0.00 ? 356 U A "H5'"  1  
ATOM 10758  H "H5''" . U A 1 335 ? 100.829 132.293 77.623  1.00 0.00 ? 356 U A "H5''" 1  
ATOM 10759  H "H4'"  . U A 1 335 ? 99.048  131.390 78.798  1.00 0.00 ? 356 U A "H4'"  1  
ATOM 10760  H "H3'"  . U A 1 335 ? 101.237 129.593 78.710  1.00 0.00 ? 356 U A "H3'"  1  
ATOM 10761  H "H2'"  . U A 1 335 ? 100.083 128.117 80.032  1.00 0.00 ? 356 U A "H2'"  1  
ATOM 10762  H "HO2'" . U A 1 335 ? 98.171  128.634 81.072  1.00 0.00 ? 356 U A "HO2'" 1  
ATOM 10763  H "H1'"  . U A 1 335 ? 97.857  128.354 78.702  1.00 0.00 ? 356 U A "H1'"  1  
ATOM 10764  H H3     . U A 1 335 ? 99.568  124.253 77.760  1.00 0.00 ? 356 U A H3     1  
ATOM 10765  H H5     . U A 1 335 ? 101.150 126.831 75.020  1.00 0.00 ? 356 U A H5     1  
ATOM 10766  H H6     . U A 1 335 ? 100.239 128.560 76.214  1.00 0.00 ? 356 U A H6     1  
ATOM 10767  P P      . G A 1 336 ? 102.630 130.781 80.547  1.00 0.00 ? 357 G A P      1  
ATOM 10768  O OP1    . G A 1 336 ? 102.879 131.550 81.793  1.00 0.00 ? 357 G A OP1    1  
ATOM 10769  O OP2    . G A 1 336 ? 103.330 131.164 79.295  1.00 0.00 ? 357 G A OP2    1  
ATOM 10770  O "O5'"  . G A 1 336 ? 102.953 129.248 80.842  1.00 0.00 ? 357 G A "O5'"  1  
ATOM 10771  C "C5'"  . G A 1 336 ? 102.291 128.553 81.888  1.00 0.00 ? 357 G A "C5'"  1  
ATOM 10772  C "C4'"  . G A 1 336 ? 102.465 127.060 81.758  1.00 0.00 ? 357 G A "C4'"  1  
ATOM 10773  O "O4'"  . G A 1 336 ? 101.925 126.576 80.505  1.00 0.00 ? 357 G A "O4'"  1  
ATOM 10774  C "C3'"  . G A 1 336 ? 103.900 126.556 81.721  1.00 0.00 ? 357 G A "C3'"  1  
ATOM 10775  O "O3'"  . G A 1 336 ? 104.493 126.480 83.007  1.00 0.00 ? 357 G A "O3'"  1  
ATOM 10776  C "C2'"  . G A 1 336 ? 103.670 125.145 81.221  1.00 0.00 ? 357 G A "C2'"  1  
ATOM 10777  O "O2'"  . G A 1 336 ? 103.164 124.308 82.251  1.00 0.00 ? 357 G A "O2'"  1  
ATOM 10778  C "C1'"  . G A 1 336 ? 102.572 125.379 80.179  1.00 0.00 ? 357 G A "C1'"  1  
ATOM 10779  N N9     . G A 1 336 ? 103.116 125.481 78.812  1.00 0.00 ? 357 G A N9     1  
ATOM 10780  C C8     . G A 1 336 ? 103.206 126.610 78.034  1.00 0.00 ? 357 G A C8     1  
ATOM 10781  N N7     . G A 1 336 ? 103.735 126.386 76.862  1.00 0.00 ? 357 G A N7     1  
ATOM 10782  C C5     . G A 1 336 ? 104.011 125.026 76.864  1.00 0.00 ? 357 G A C5     1  
ATOM 10783  C C6     . G A 1 336 ? 104.592 124.204 75.864  1.00 0.00 ? 357 G A C6     1  
ATOM 10784  O O6     . G A 1 336 ? 104.991 124.525 74.739  1.00 0.00 ? 357 G A O6     1  
ATOM 10785  N N1     . G A 1 336 ? 104.689 122.880 76.281  1.00 0.00 ? 357 G A N1     1  
ATOM 10786  C C2     . G A 1 336 ? 104.281 122.407 77.505  1.00 0.00 ? 357 G A C2     1  
ATOM 10787  N N2     . G A 1 336 ? 104.457 121.095 77.725  1.00 0.00 ? 357 G A N2     1  
ATOM 10788  N N3     . G A 1 336 ? 103.738 123.163 78.445  1.00 0.00 ? 357 G A N3     1  
ATOM 10789  C C4     . G A 1 336 ? 103.635 124.452 78.060  1.00 0.00 ? 357 G A C4     1  
ATOM 10790  H "H5'"  . G A 1 336 ? 101.335 128.767 81.860  1.00 0.00 ? 357 G A "H5'"  1  
ATOM 10791  H "H5''" . G A 1 336 ? 102.658 128.844 82.749  1.00 0.00 ? 357 G A "H5''" 1  
ATOM 10792  H "H4'"  . G A 1 336 ? 101.983 126.619 82.489  1.00 0.00 ? 357 G A "H4'"  1  
ATOM 10793  H "H3'"  . G A 1 336 ? 104.405 127.072 81.059  1.00 0.00 ? 357 G A "H3'"  1  
ATOM 10794  H "H2'"  . G A 1 336 ? 104.480 124.771 80.815  1.00 0.00 ? 357 G A "H2'"  1  
ATOM 10795  H "HO2'" . G A 1 336 ? 103.494 124.632 83.115  1.00 0.00 ? 357 G A "HO2'" 1  
ATOM 10796  H "H1'"  . G A 1 336 ? 101.923 124.645 80.218  1.00 0.00 ? 357 G A "H1'"  1  
ATOM 10797  H H8     . G A 1 336 ? 102.904 127.494 78.329  1.00 0.00 ? 357 G A H8     1  
ATOM 10798  H H1     . G A 1 336 ? 105.079 122.237 75.653  1.00 0.00 ? 357 G A H1     1  
ATOM 10799  H H21    . G A 1 336 ? 104.858 120.529 77.033  1.00 0.00 ? 357 G A H21    1  
ATOM 10800  H H22    . G A 1 336 ? 104.184 120.701 78.580  1.00 0.00 ? 357 G A H22    1  
ATOM 10801  P P      . G A 1 337 ? 105.968 127.070 83.252  1.00 0.00 ? 358 G A P      1  
ATOM 10802  O OP1    . G A 1 337 ? 106.194 127.149 84.718  1.00 0.00 ? 358 G A OP1    1  
ATOM 10803  O OP2    . G A 1 337 ? 106.120 128.289 82.418  1.00 0.00 ? 358 G A OP2    1  
ATOM 10804  O "O5'"  . G A 1 337 ? 106.934 125.947 82.665  1.00 0.00 ? 358 G A "O5'"  1  
ATOM 10805  C "C5'"  . G A 1 337 ? 106.943 124.636 83.208  1.00 0.00 ? 358 G A "C5'"  1  
ATOM 10806  C "C4'"  . G A 1 337 ? 107.561 123.644 82.253  1.00 0.00 ? 358 G A "C4'"  1  
ATOM 10807  O "O4'"  . G A 1 337 ? 106.708 123.494 81.092  1.00 0.00 ? 358 G A "O4'"  1  
ATOM 10808  C "C3'"  . G A 1 337 ? 108.913 124.030 81.672  1.00 0.00 ? 358 G A "C3'"  1  
ATOM 10809  O "O3'"  . G A 1 337 ? 109.998 123.676 82.513  1.00 0.00 ? 358 G A "O3'"  1  
ATOM 10810  C "C2'"  . G A 1 337 ? 108.929 123.298 80.341  1.00 0.00 ? 358 G A "C2'"  1  
ATOM 10811  O "O2'"  . G A 1 337 ? 109.220 121.919 80.515  1.00 0.00 ? 358 G A "O2'"  1  
ATOM 10812  C "C1'"  . G A 1 337 ? 107.473 123.446 79.896  1.00 0.00 ? 358 G A "C1'"  1  
ATOM 10813  N N9     . G A 1 337 ? 107.242 124.705 79.163  1.00 0.00 ? 358 G A N9     1  
ATOM 10814  C C8     . G A 1 337 ? 106.731 125.877 79.665  1.00 0.00 ? 358 G A C8     1  
ATOM 10815  N N7     . G A 1 337 ? 106.641 126.823 78.769  1.00 0.00 ? 358 G A N7     1  
ATOM 10816  C C5     . G A 1 337 ? 107.123 126.241 77.606  1.00 0.00 ? 358 G A C5     1  
ATOM 10817  C C6     . G A 1 337 ? 107.272 126.780 76.301  1.00 0.00 ? 358 G A C6     1  
ATOM 10818  O O6     . G A 1 337 ? 106.996 127.917 75.902  1.00 0.00 ? 358 G A O6     1  
ATOM 10819  N N1     . G A 1 337 ? 107.799 125.844 75.417  1.00 0.00 ? 358 G A N1     1  
ATOM 10820  C C2     . G A 1 337 ? 108.142 124.555 75.745  1.00 0.00 ? 358 G A C2     1  
ATOM 10821  N N2     . G A 1 337 ? 108.638 123.799 74.754  1.00 0.00 ? 358 G A N2     1  
ATOM 10822  N N3     . G A 1 337 ? 108.009 124.041 76.957  1.00 0.00 ? 358 G A N3     1  
ATOM 10823  C C4     . G A 1 337 ? 107.498 124.933 77.831  1.00 0.00 ? 358 G A C4     1  
ATOM 10824  H "H5'"  . G A 1 337 ? 106.022 124.363 83.401  1.00 0.00 ? 358 G A "H5'"  1  
ATOM 10825  H "H5''" . G A 1 337 ? 107.457 124.639 84.043  1.00 0.00 ? 358 G A "H5''" 1  
ATOM 10826  H "H4'"  . G A 1 337 ? 107.642 122.777 82.704  1.00 0.00 ? 358 G A "H4'"  1  
ATOM 10827  H "H3'"  . G A 1 337 ? 108.927 124.995 81.505  1.00 0.00 ? 358 G A "H3'"  1  
ATOM 10828  H "H2'"  . G A 1 337 ? 109.543 123.721 79.705  1.00 0.00 ? 358 G A "H2'"  1  
ATOM 10829  H "HO2'" . G A 1 337 ? 109.750 121.805 81.332  1.00 0.00 ? 358 G A "HO2'" 1  
ATOM 10830  H "H1'"  . G A 1 337 ? 107.227 122.687 79.326  1.00 0.00 ? 358 G A "H1'"  1  
ATOM 10831  H H8     . G A 1 337 ? 106.460 125.993 80.599  1.00 0.00 ? 358 G A H8     1  
ATOM 10832  H H1     . G A 1 337 ? 107.937 126.128 74.489  1.00 0.00 ? 358 G A H1     1  
ATOM 10833  H H21    . G A 1 337 ? 108.739 124.173 73.854  1.00 0.00 ? 358 G A H21    1  
ATOM 10834  H H22    . G A 1 337 ? 108.900 122.871 74.929  1.00 0.00 ? 358 G A H22    1  
ATOM 10835  P P      . A A 1 338 ? 111.155 124.746 82.830  1.00 0.00 ? 359 A A P      1  
ATOM 10836  O OP1    . A A 1 338 ? 110.574 125.814 83.681  1.00 0.00 ? 359 A A OP1    1  
ATOM 10837  O OP2    . A A 1 338 ? 111.814 125.104 81.549  1.00 0.00 ? 359 A A OP2    1  
ATOM 10838  O "O5'"  . A A 1 338 ? 112.203 123.929 83.711  1.00 0.00 ? 359 A A "O5'"  1  
ATOM 10839  C "C5'"  . A A 1 338 ? 112.547 122.591 83.380  1.00 0.00 ? 359 A A "C5'"  1  
ATOM 10840  C "C4'"  . A A 1 338 ? 111.651 121.600 84.078  1.00 0.00 ? 359 A A "C4'"  1  
ATOM 10841  O "O4'"  . A A 1 338 ? 110.810 120.935 83.101  1.00 0.00 ? 359 A A "O4'"  1  
ATOM 10842  C "C3'"  . A A 1 338 ? 112.353 120.464 84.807  1.00 0.00 ? 359 A A "C3'"  1  
ATOM 10843  O "O3'"  . A A 1 338 ? 112.798 120.828 86.103  1.00 0.00 ? 359 A A "O3'"  1  
ATOM 10844  C "C2'"  . A A 1 338 ? 111.279 119.393 84.849  1.00 0.00 ? 359 A A "C2'"  1  
ATOM 10845  O "O2'"  . A A 1 338 ? 110.335 119.650 85.878  1.00 0.00 ? 359 A A "O2'"  1  
ATOM 10846  C "C1'"  . A A 1 338 ? 110.603 119.591 83.493  1.00 0.00 ? 359 A A "C1'"  1  
ATOM 10847  N N9     . A A 1 338 ? 111.173 118.713 82.454  1.00 0.00 ? 359 A A N9     1  
ATOM 10848  C C8     . A A 1 338 ? 111.763 119.079 81.270  1.00 0.00 ? 359 A A C8     1  
ATOM 10849  N N7     . A A 1 338 ? 112.176 118.066 80.549  1.00 0.00 ? 359 A A N7     1  
ATOM 10850  C C5     . A A 1 338 ? 111.835 116.956 81.310  1.00 0.00 ? 359 A A C5     1  
ATOM 10851  C C6     . A A 1 338 ? 112.002 115.576 81.099  1.00 0.00 ? 359 A A C6     1  
ATOM 10852  N N6     . A A 1 338 ? 112.581 115.057 80.013  1.00 0.00 ? 359 A A N6     1  
ATOM 10853  N N1     . A A 1 338 ? 111.550 114.735 82.054  1.00 0.00 ? 359 A A N1     1  
ATOM 10854  C C2     . A A 1 338 ? 110.970 115.254 83.143  1.00 0.00 ? 359 A A C2     1  
ATOM 10855  N N3     . A A 1 338 ? 110.756 116.531 83.455  1.00 0.00 ? 359 A A N3     1  
ATOM 10856  C C4     . A A 1 338 ? 111.217 117.340 82.485  1.00 0.00 ? 359 A A C4     1  
ATOM 10857  H "H5'"  . A A 1 338 ? 113.476 122.425 83.645  1.00 0.00 ? 359 A A "H5'"  1  
ATOM 10858  H "H5''" . A A 1 338 ? 112.465 122.470 82.411  1.00 0.00 ? 359 A A "H5''" 1  
ATOM 10859  H "H4'"  . A A 1 338 ? 111.082 122.080 84.716  1.00 0.00 ? 359 A A "H4'"  1  
ATOM 10860  H "H3'"  . A A 1 338 ? 113.103 120.147 84.261  1.00 0.00 ? 359 A A "H3'"  1  
ATOM 10861  H "H2'"  . A A 1 338 ? 111.668 118.497 84.928  1.00 0.00 ? 359 A A "H2'"  1  
ATOM 10862  H "HO2'" . A A 1 338 ? 110.744 120.240 86.545  1.00 0.00 ? 359 A A "HO2'" 1  
ATOM 10863  H "H1'"  . A A 1 338 ? 109.642 119.415 83.579  1.00 0.00 ? 359 A A "H1'"  1  
ATOM 10864  H H8     . A A 1 338 ? 111.867 120.013 80.989  1.00 0.00 ? 359 A A H8     1  
ATOM 10865  H H61    . A A 1 338 ? 112.669 114.085 79.922  1.00 0.00 ? 359 A A H61    1  
ATOM 10866  H H62    . A A 1 338 ? 112.916 115.648 79.307  1.00 0.00 ? 359 A A H62    1  
ATOM 10867  H H2     . A A 1 338 ? 110.659 114.602 83.806  1.00 0.00 ? 359 A A H2     1  
ATOM 10868  P P      . G A 1 339 ? 114.051 120.066 86.754  1.00 0.00 ? 360 G A P      1  
ATOM 10869  O OP1    . G A 1 339 ? 113.557 119.057 87.725  1.00 0.00 ? 360 G A OP1    1  
ATOM 10870  O OP2    . G A 1 339 ? 114.899 121.188 87.229  1.00 0.00 ? 360 G A OP2    1  
ATOM 10871  O "O5'"  . G A 1 339 ? 114.847 119.298 85.607  1.00 0.00 ? 360 G A "O5'"  1  
ATOM 10872  C "C5'"  . G A 1 339 ? 115.863 118.359 85.928  1.00 0.00 ? 360 G A "C5'"  1  
ATOM 10873  C "C4'"  . G A 1 339 ? 115.992 117.297 84.865  1.00 0.00 ? 360 G A "C4'"  1  
ATOM 10874  O "O4'"  . G A 1 339 ? 114.958 117.434 83.862  1.00 0.00 ? 360 G A "O4'"  1  
ATOM 10875  C "C3'"  . G A 1 339 ? 117.270 117.329 84.041  1.00 0.00 ? 360 G A "C3'"  1  
ATOM 10876  O "O3'"  . G A 1 339 ? 118.385 116.786 84.728  1.00 0.00 ? 360 G A "O3'"  1  
ATOM 10877  C "C2'"  . G A 1 339 ? 116.855 116.529 82.812  1.00 0.00 ? 360 G A "C2'"  1  
ATOM 10878  O "O2'"  . G A 1 339 ? 116.810 115.138 83.093  1.00 0.00 ? 360 G A "O2'"  1  
ATOM 10879  C "C1'"  . G A 1 339 ? 115.436 117.044 82.599  1.00 0.00 ? 360 G A "C1'"  1  
ATOM 10880  N N9     . G A 1 339 ? 115.399 118.226 81.718  1.00 0.00 ? 360 G A N9     1  
ATOM 10881  C C8     . G A 1 339 ? 115.072 119.514 82.066  1.00 0.00 ? 360 G A C8     1  
ATOM 10882  N N7     . G A 1 339 ? 115.129 120.348 81.064  1.00 0.00 ? 360 G A N7     1  
ATOM 10883  C C5     . G A 1 339 ? 115.518 119.563 79.987  1.00 0.00 ? 360 G A C5     1  
ATOM 10884  C C6     . G A 1 339 ? 115.749 119.913 78.631  1.00 0.00 ? 360 G A C6     1  
ATOM 10885  O O6     . G A 1 339 ? 115.650 121.022 78.094  1.00 0.00 ? 360 G A O6     1  
ATOM 10886  N N1     . G A 1 339 ? 116.129 118.808 77.875  1.00 0.00 ? 360 G A N1     1  
ATOM 10887  C C2     . G A 1 339 ? 116.271 117.531 78.361  1.00 0.00 ? 360 G A C2     1  
ATOM 10888  N N2     . G A 1 339 ? 116.647 116.595 77.476  1.00 0.00 ? 360 G A N2     1  
ATOM 10889  N N3     . G A 1 339 ? 116.060 117.193 79.622  1.00 0.00 ? 360 G A N3     1  
ATOM 10890  C C4     . G A 1 339 ? 115.689 118.251 80.373  1.00 0.00 ? 360 G A C4     1  
ATOM 10891  H "H5'"  . G A 1 339 ? 115.645 117.932 86.782  1.00 0.00 ? 360 G A "H5'"  1  
ATOM 10892  H "H5''" . G A 1 339 ? 116.718 118.831 86.015  1.00 0.00 ? 360 G A "H5''" 1  
ATOM 10893  H "H4'"  . G A 1 339 ? 115.913 116.420 85.296  1.00 0.00 ? 360 G A "H4'"  1  
ATOM 10894  H "H3'"  . G A 1 339 ? 117.477 118.247 83.769  1.00 0.00 ? 360 G A "H3'"  1  
ATOM 10895  H "H2'"  . G A 1 339 ? 117.431 116.725 82.043  1.00 0.00 ? 360 G A "H2'"  1  
ATOM 10896  H "HO2'" . G A 1 339 ? 116.574 114.654 82.274  1.00 0.00 ? 360 G A "HO2'" 1  
ATOM 10897  H "H1'"  . G A 1 339 ? 114.884 116.331 82.213  1.00 0.00 ? 360 G A "H1'"  1  
ATOM 10898  H H8     . G A 1 339 ? 114.821 119.780 82.975  1.00 0.00 ? 360 G A H8     1  
ATOM 10899  H H1     . G A 1 339 ? 116.310 118.954 76.923  1.00 0.00 ? 360 G A H1     1  
ATOM 10900  H H21    . G A 1 339 ? 116.806 116.838 76.540  1.00 0.00 ? 360 G A H21    1  
ATOM 10901  H H22    . G A 1 339 ? 116.765 115.666 77.766  1.00 0.00 ? 360 G A H22    1  
ATOM 10902  P P      . C A 1 340 ? 119.786 117.572 84.743  1.00 0.00 ? 361 C A P      1  
ATOM 10903  O OP1    . C A 1 340 ? 120.846 116.614 85.148  1.00 0.00 ? 361 C A OP1    1  
ATOM 10904  O OP2    . C A 1 340 ? 119.601 118.829 85.512  1.00 0.00 ? 361 C A OP2    1  
ATOM 10905  O "O5'"  . C A 1 340 ? 120.029 117.959 83.215  1.00 0.00 ? 361 C A "O5'"  1  
ATOM 10906  C "C5'"  . C A 1 340 ? 120.481 116.991 82.282  1.00 0.00 ? 361 C A "C5'"  1  
ATOM 10907  C "C4'"  . C A 1 340 ? 120.802 117.614 80.945  1.00 0.00 ? 361 C A "C4'"  1  
ATOM 10908  O "O4'"  . C A 1 340 ? 119.608 118.211 80.378  1.00 0.00 ? 361 C A "O4'"  1  
ATOM 10909  C "C3'"  . C A 1 340 ? 121.811 118.753 80.962  1.00 0.00 ? 361 C A "C3'"  1  
ATOM 10910  O "O3'"  . C A 1 340 ? 123.156 118.300 80.981  1.00 0.00 ? 361 C A "O3'"  1  
ATOM 10911  C "C2'"  . C A 1 340 ? 121.450 119.535 79.709  1.00 0.00 ? 361 C A "C2'"  1  
ATOM 10912  O "O2'"  . C A 1 340 ? 121.950 118.902 78.540  1.00 0.00 ? 361 C A "O2'"  1  
ATOM 10913  C "C1'"  . C A 1 340 ? 119.924 119.431 79.714  1.00 0.00 ? 361 C A "C1'"  1  
ATOM 10914  N N1     . C A 1 340 ? 119.282 120.578 80.403  1.00 0.00 ? 361 C A N1     1  
ATOM 10915  C C2     . C A 1 340 ? 119.178 121.793 79.715  1.00 0.00 ? 361 C A C2     1  
ATOM 10916  O O2     . C A 1 340 ? 119.623 121.877 78.560  1.00 0.00 ? 361 C A O2     1  
ATOM 10917  N N3     . C A 1 340 ? 118.598 122.855 80.322  1.00 0.00 ? 361 C A N3     1  
ATOM 10918  C C4     . C A 1 340 ? 118.130 122.740 81.564  1.00 0.00 ? 361 C A C4     1  
ATOM 10919  N N4     . C A 1 340 ? 117.565 123.815 82.122  1.00 0.00 ? 361 C A N4     1  
ATOM 10920  C C5     . C A 1 340 ? 118.220 121.519 82.290  1.00 0.00 ? 361 C A C5     1  
ATOM 10921  C C6     . C A 1 340 ? 118.795 120.476 81.680  1.00 0.00 ? 361 C A C6     1  
ATOM 10922  H "H5'"  . C A 1 340 ? 119.783 116.315 82.160  1.00 0.00 ? 361 C A "H5'"  1  
ATOM 10923  H "H5''" . C A 1 340 ? 121.287 116.560 82.634  1.00 0.00 ? 361 C A "H5''" 1  
ATOM 10924  H "H4'"  . C A 1 340 ? 121.125 116.913 80.341  1.00 0.00 ? 361 C A "H4'"  1  
ATOM 10925  H "H3'"  . C A 1 340 ? 121.650 119.314 81.749  1.00 0.00 ? 361 C A "H3'"  1  
ATOM 10926  H "H2'"  . C A 1 340 ? 121.745 120.468 79.769  1.00 0.00 ? 361 C A "H2'"  1  
ATOM 10927  H "HO2'" . C A 1 340 ? 122.674 118.292 78.792  1.00 0.00 ? 361 C A "HO2'" 1  
ATOM 10928  H "H1'"  . C A 1 340 ? 119.597 119.385 78.790  1.00 0.00 ? 361 C A "H1'"  1  
ATOM 10929  H H41    . C A 1 340 ? 117.505 124.654 81.620  1.00 0.00 ? 361 C A H41    1  
ATOM 10930  H H42    . C A 1 340 ? 117.210 123.763 83.034  1.00 0.00 ? 361 C A H42    1  
ATOM 10931  H H5     . C A 1 340 ? 117.871 121.445 83.203  1.00 0.00 ? 361 C A H5     1  
ATOM 10932  H H6     . C A 1 340 ? 118.867 119.627 82.163  1.00 0.00 ? 361 C A H6     1  
ATOM 10933  P P      . C A 1 341 ? 124.294 119.181 81.697  1.00 0.00 ? 362 C A P      1  
ATOM 10934  O OP1    . C A 1 341 ? 125.527 118.360 81.778  1.00 0.00 ? 362 C A OP1    1  
ATOM 10935  O OP2    . C A 1 341 ? 123.716 119.761 82.936  1.00 0.00 ? 362 C A OP2    1  
ATOM 10936  O "O5'"  . C A 1 341 ? 124.562 120.373 80.674  1.00 0.00 ? 362 C A "O5'"  1  
ATOM 10937  C "C5'"  . C A 1 341 ? 125.174 120.130 79.416  1.00 0.00 ? 362 C A "C5'"  1  
ATOM 10938  C "C4'"  . C A 1 341 ? 125.216 121.377 78.567  1.00 0.00 ? 362 C A "C4'"  1  
ATOM 10939  O "O4'"  . C A 1 341 ? 123.867 121.830 78.288  1.00 0.00 ? 362 C A "O4'"  1  
ATOM 10940  C "C3'"  . C A 1 341 ? 125.895 122.587 79.189  1.00 0.00 ? 362 C A "C3'"  1  
ATOM 10941  O "O3'"  . C A 1 341 ? 127.308 122.553 79.073  1.00 0.00 ? 362 C A "O3'"  1  
ATOM 10942  C "C2'"  . C A 1 341 ? 125.252 123.748 78.442  1.00 0.00 ? 362 C A "C2'"  1  
ATOM 10943  O "O2'"  . C A 1 341 ? 125.812 123.903 77.147  1.00 0.00 ? 362 C A "O2'"  1  
ATOM 10944  C "C1'"  . C A 1 341 ? 123.809 123.259 78.305  1.00 0.00 ? 362 C A "C1'"  1  
ATOM 10945  N N1     . C A 1 341 ? 122.947 123.724 79.421  1.00 0.00 ? 362 C A N1     1  
ATOM 10946  C C2     . C A 1 341 ? 122.480 125.044 79.394  1.00 0.00 ? 362 C A C2     1  
ATOM 10947  O O2     . C A 1 341 ? 122.798 125.780 78.448  1.00 0.00 ? 362 C A O2     1  
ATOM 10948  N N3     . C A 1 341 ? 121.692 125.491 80.398  1.00 0.00 ? 362 C A N3     1  
ATOM 10949  C C4     . C A 1 341 ? 121.365 124.681 81.404  1.00 0.00 ? 362 C A C4     1  
ATOM 10950  N N4     . C A 1 341 ? 120.586 125.166 82.373  1.00 0.00 ? 362 C A N4     1  
ATOM 10951  C C5     . C A 1 341 ? 121.824 123.335 81.461  1.00 0.00 ? 362 C A C5     1  
ATOM 10952  C C6     . C A 1 341 ? 122.602 122.902 80.462  1.00 0.00 ? 362 C A C6     1  
ATOM 10953  H "H5'"  . C A 1 341 ? 124.668 119.437 78.941  1.00 0.00 ? 362 C A "H5'"  1  
ATOM 10954  H "H5''" . C A 1 341 ? 126.089 119.811 79.563  1.00 0.00 ? 362 C A "H5''" 1  
ATOM 10955  H "H4'"  . C A 1 341 ? 125.662 121.164 77.719  1.00 0.00 ? 362 C A "H4'"  1  
ATOM 10956  H "H3'"  . C A 1 341 ? 125.653 122.640 80.138  1.00 0.00 ? 362 C A "H3'"  1  
ATOM 10957  H "H2'"  . C A 1 341 ? 125.299 124.580 78.960  1.00 0.00 ? 362 C A "H2'"  1  
ATOM 10958  H "HO2'" . C A 1 341 ? 126.685 123.459 77.123  1.00 0.00 ? 362 C A "HO2'" 1  
ATOM 10959  H "H1'"  . C A 1 341 ? 123.437 123.573 77.455  1.00 0.00 ? 362 C A "H1'"  1  
ATOM 10960  H H41    . C A 1 341 ? 120.272 126.095 82.331  1.00 0.00 ? 362 C A H41    1  
ATOM 10961  H H42    . C A 1 341 ? 120.327 124.596 83.127  1.00 0.00 ? 362 C A H42    1  
ATOM 10962  H H5     . C A 1 341 ? 121.579 122.746 82.204  1.00 0.00 ? 362 C A H5     1  
ATOM 10963  H H6     . C A 1 341 ? 122.928 121.978 80.481  1.00 0.00 ? 362 C A H6     1  
ATOM 10964  P P      . G A 1 342 ? 128.228 123.240 80.196  1.00 0.00 ? 363 G A P      1  
ATOM 10965  O OP1    . G A 1 342 ? 129.635 122.836 79.951  1.00 0.00 ? 363 G A OP1    1  
ATOM 10966  O OP2    . G A 1 342 ? 127.609 122.979 81.521  1.00 0.00 ? 363 G A OP2    1  
ATOM 10967  O "O5'"  . G A 1 342 ? 128.104 124.800 79.894  1.00 0.00 ? 363 G A "O5'"  1  
ATOM 10968  C "C5'"  . G A 1 342 ? 128.659 125.361 78.713  1.00 0.00 ? 363 G A "C5'"  1  
ATOM 10969  C "C4'"  . G A 1 342 ? 128.296 126.818 78.568  1.00 0.00 ? 363 G A "C4'"  1  
ATOM 10970  O "O4'"  . G A 1 342 ? 126.854 126.957 78.472  1.00 0.00 ? 363 G A "O4'"  1  
ATOM 10971  C "C3'"  . G A 1 342 ? 128.678 127.721 79.729  1.00 0.00 ? 363 G A "C3'"  1  
ATOM 10972  O "O3'"  . G A 1 342 ? 130.038 128.125 79.692  1.00 0.00 ? 363 G A "O3'"  1  
ATOM 10973  C "C2'"  . G A 1 342 ? 127.693 128.874 79.594  1.00 0.00 ? 363 G A "C2'"  1  
ATOM 10974  O "O2'"  . G A 1 342 ? 128.086 129.766 78.561  1.00 0.00 ? 363 G A "O2'"  1  
ATOM 10975  C "C1'"  . G A 1 342 ? 126.424 128.138 79.159  1.00 0.00 ? 363 G A "C1'"  1  
ATOM 10976  N N9     . G A 1 342 ? 125.564 127.793 80.305  1.00 0.00 ? 363 G A N9     1  
ATOM 10977  C C8     . G A 1 342 ? 125.381 126.549 80.863  1.00 0.00 ? 363 G A C8     1  
ATOM 10978  N N7     . G A 1 342 ? 124.553 126.557 81.873  1.00 0.00 ? 363 G A N7     1  
ATOM 10979  C C5     . G A 1 342 ? 124.166 127.883 81.991  1.00 0.00 ? 363 G A C5     1  
ATOM 10980  C C6     . G A 1 342 ? 123.280 128.506 82.910  1.00 0.00 ? 363 G A C6     1  
ATOM 10981  O O6     . G A 1 342 ? 122.640 127.989 83.833  1.00 0.00 ? 363 G A O6     1  
ATOM 10982  N N1     . G A 1 342 ? 123.173 129.872 82.674  1.00 0.00 ? 363 G A N1     1  
ATOM 10983  C C2     . G A 1 342 ? 123.836 130.555 81.683  1.00 0.00 ? 363 G A C2     1  
ATOM 10984  N N2     . G A 1 342 ? 123.605 131.874 81.612  1.00 0.00 ? 363 G A N2     1  
ATOM 10985  N N3     . G A 1 342