PDB Full entry for 1KX3
HEADER    STRUCTURAL PROTEIN/DNA                  31-JAN-02   1KX3              
TITLE     X-RAY STRUCTURE OF THE NUCLEOSOME CORE PARTICLE, NCP146, AT           
TITLE    2 2.0 A RESOLUTION                                                     
COMPND    MOL_ID: 1;                                                            
COMPND   2 MOLECULE: DNA                                                        
COMPND   3 (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAA          
COMPND   4 AAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATAC          
COMPND   5 ACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3');                                
COMPND   6 CHAIN: I, J;                                                         
COMPND   7 ENGINEERED: YES;                                                     
COMPND   8 OTHER_DETAILS: PALINDROMIC 146 BASE PAIR DNA DUPLEX;                 
COMPND   9 MOL_ID: 2;                                                           
COMPND  10 MOLECULE: HISTONE H3;                                                
COMPND  11 CHAIN: A, E;                                                         
COMPND  12 ENGINEERED: YES;                                                     
COMPND  13 MOL_ID: 3;                                                           
COMPND  14 MOLECULE: HISTONE H4;                                                
COMPND  15 CHAIN: B, F;                                                         
COMPND  16 ENGINEERED: YES;                                                     
COMPND  17 MOL_ID: 4;                                                           
COMPND  18 MOLECULE: HISTONE H2A.1;                                             
COMPND  19 CHAIN: C, G;                                                         
COMPND  20 ENGINEERED: YES;                                                     
COMPND  21 MOL_ID: 5;                                                           
COMPND  22 MOLECULE: HISTONE H2B.2;                                             
COMPND  23 CHAIN: D, H;                                                         
COMPND  24 ENGINEERED: YES                                                      
SOURCE    MOL_ID: 1;                                                            
SOURCE   2 ORGANISM_SCIENTIFIC: HOMO SAPIENS;                                   
SOURCE   3 ORGANISM_COMMON: HUMAN;                                              
SOURCE   4 ORGANISM_TAXID: 9606;                                                
SOURCE   5 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE   6 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE   7 OTHER_DETAILS: DNA SEQUENCE SYNTHESIZED, CLONED,                     
SOURCE   8 MULTIMERIZED, AND EXCISED FROM PLASMID;                              
SOURCE   9 MOL_ID: 2;                                                           
SOURCE  10 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  11 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  12 ORGANISM_TAXID: 8355;                                                
SOURCE  13 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  14 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE  15 MOL_ID: 3;                                                           
SOURCE  16 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  17 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  18 ORGANISM_TAXID: 8355;                                                
SOURCE  19 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  20 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE  21 MOL_ID: 4;                                                           
SOURCE  22 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  23 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  24 ORGANISM_TAXID: 8355;                                                
SOURCE  25 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  26 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE  27 MOL_ID: 5;                                                           
SOURCE  28 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  29 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  30 ORGANISM_TAXID: 8355;                                                
SOURCE  31 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  32 EXPRESSION_SYSTEM_TAXID: 562                                         
KEYWDS    NUCLEOSOME, CHROMATIN, HISTONE, PROTEIN-DNA INTERACTION,              
KEYWDS   2 NUCLEOPROTEIN, SUPERCOILED DNA, NUCLEOSOME CORE, PROTEIN-            
KEYWDS   3 DNA COMPLEX, STRUCTURAL PROTEIN/DNA COMPLEX                          
EXPDTA    X-RAY DIFFRACTION                                                     
AUTHOR    C.A.DAVEY,D.F.SARGENT,K.LUGER,A.W.MAEDER,T.J.RICHMOND                 
REVDAT   2   24-FEB-09 1KX3    1       VERSN                                    
REVDAT   1   25-DEC-02 1KX3    0                                                
JRNL        AUTH   C.A.DAVEY,D.F.SARGENT,K.LUGER,A.W.MAEDER,                    
JRNL        AUTH 2 T.J.RICHMOND                                                 
JRNL        TITL   SOLVENT MEDIATED INTERACTIONS IN THE STRUCTURE OF            
JRNL        TITL 2 THE NUCLEOSOME CORE PARTICLE AT 1.9 A RESOLUTION             
JRNL        REF    J.MOL.BIOL.                   V. 319  1097 2002              
JRNL        REFN                   ISSN 0022-2836                               
JRNL        PMID   12079350                                                     
JRNL        DOI    10.1016/S0022-2836(02)00386-8                                
REMARK   1                                                                      
REMARK   1 REFERENCE 1                                                          
REMARK   1  AUTH   K.LUGER,A.W.MAEDER,R.K.RICHMOND,D.F.SARGENT,                 
REMARK   1  AUTH 2 T.J.RICHMOND                                                 
REMARK   1  TITL   CRYSTAL STRUCTURE OF THE NUCLEOSOME CORE PARTICLE            
REMARK   1  TITL 2 AT 2.8 A RESOLUTION                                          
REMARK   1  REF    NATURE                        V. 389   251 1997              
REMARK   1  REFN                   ISSN 0028-0836                               
REMARK   1  DOI    10.1038/38444                                                
REMARK   2                                                                      
REMARK   2 RESOLUTION.    2.00 ANGSTROMS.                                       
REMARK   3                                                                      
REMARK   3 REFINEMENT.                                                          
REMARK   3   PROGRAM     : CNS 0.5                                              
REMARK   3   AUTHORS     : BRUNGER,ADAMS,CLORE,DELANO,GROS,GROSSE-              
REMARK   3               : KUNSTLEVE,JIANG,KUSZEWSKI,NILGES, PANNU,             
REMARK   3               : READ,RICE,SIMONSON,WARREN                            
REMARK   3                                                                      
REMARK   3  REFINEMENT TARGET : ENGH & HUBER                                    
REMARK   3                                                                      
REMARK   3  DATA USED IN REFINEMENT.                                            
REMARK   3   RESOLUTION RANGE HIGH (ANGSTROMS) : 2.00                           
REMARK   3   RESOLUTION RANGE LOW  (ANGSTROMS) : 6.00                           
REMARK   3   DATA CUTOFF            (SIGMA(F)) : 0.000                          
REMARK   3   DATA CUTOFF HIGH         (ABS(F)) : 952374.430                     
REMARK   3   DATA CUTOFF LOW          (ABS(F)) : 0.0000                         
REMARK   3   COMPLETENESS (WORKING+TEST)   (%) : 99.9                           
REMARK   3   NUMBER OF REFLECTIONS             : 136427                         
REMARK   3                                                                      
REMARK   3  FIT TO DATA USED IN REFINEMENT.                                     
REMARK   3   CROSS-VALIDATION METHOD          : THROUGHOUT                      
REMARK   3   FREE R VALUE TEST SET SELECTION  : RANDOM                          
REMARK   3   R VALUE            (WORKING SET) : 0.240                           
REMARK   3   FREE R VALUE                     : 0.275                           
REMARK   3   FREE R VALUE TEST SET SIZE   (%) : 2.000                           
REMARK   3   FREE R VALUE TEST SET COUNT      : 2716                            
REMARK   3   ESTIMATED ERROR OF FREE R VALUE  : 0.005                           
REMARK   3                                                                      
REMARK   3  FIT IN THE HIGHEST RESOLUTION BIN.                                  
REMARK   3   TOTAL NUMBER OF BINS USED           : 6                            
REMARK   3   BIN RESOLUTION RANGE HIGH       (A) : 2.00                         
REMARK   3   BIN RESOLUTION RANGE LOW        (A) : 2.12                         
REMARK   3   BIN COMPLETENESS (WORKING+TEST) (%) : 99.90                        
REMARK   3   REFLECTIONS IN BIN    (WORKING SET) : 22125                        
REMARK   3   BIN R VALUE           (WORKING SET) : 0.3090                       
REMARK   3   BIN FREE R VALUE                    : 0.3280                       
REMARK   3   BIN FREE R VALUE TEST SET SIZE  (%) : 2.00                         
REMARK   3   BIN FREE R VALUE TEST SET COUNT     : 446                          
REMARK   3   ESTIMATED ERROR OF BIN FREE R VALUE : 0.016                        
REMARK   3                                                                      
REMARK   3  NUMBER OF NON-HYDROGEN ATOMS USED IN REFINEMENT.                    
REMARK   3   PROTEIN ATOMS            : 6087                                    
REMARK   3   NUCLEIC ACID ATOMS       : 5980                                    
REMARK   3   HETEROGEN ATOMS          : 13                                      
REMARK   3   SOLVENT ATOMS            : 943                                     
REMARK   3                                                                      
REMARK   3  B VALUES.                                                           
REMARK   3   FROM WILSON PLOT           (A**2) : 35.70                          
REMARK   3   MEAN B VALUE      (OVERALL, A**2) : 58.20                          
REMARK   3   OVERALL ANISOTROPIC B VALUE.                                       
REMARK   3    B11 (A**2) : 2.12000                                              
REMARK   3    B22 (A**2) : 5.33000                                              
REMARK   3    B33 (A**2) : -7.45000                                             
REMARK   3    B12 (A**2) : 0.00000                                              
REMARK   3    B13 (A**2) : 0.00000                                              
REMARK   3    B23 (A**2) : 0.00000                                              
REMARK   3                                                                      
REMARK   3  ESTIMATED COORDINATE ERROR.                                         
REMARK   3   ESD FROM LUZZATI PLOT        (A) : 0.28                            
REMARK   3   ESD FROM SIGMAA              (A) : 0.23                            
REMARK   3   LOW RESOLUTION CUTOFF        (A) : 6.00                            
REMARK   3                                                                      
REMARK   3  CROSS-VALIDATED ESTIMATED COORDINATE ERROR.                         
REMARK   3   ESD FROM C-V LUZZATI PLOT    (A) : 0.31                            
REMARK   3   ESD FROM C-V SIGMAA          (A) : 0.25                            
REMARK   3                                                                      
REMARK   3  RMS DEVIATIONS FROM IDEAL VALUES.                                   
REMARK   3   BOND LENGTHS                 (A) : 0.010                           
REMARK   3   BOND ANGLES            (DEGREES) : 1.20                            
REMARK   3   DIHEDRAL ANGLES        (DEGREES) : 18.90                           
REMARK   3   IMPROPER ANGLES        (DEGREES) : 1.10                            
REMARK   3                                                                      
REMARK   3  ISOTROPIC THERMAL MODEL : RESTRAINED                                
REMARK   3                                                                      
REMARK   3  ISOTROPIC THERMAL FACTOR RESTRAINTS.    RMS    SIGMA                
REMARK   3   MAIN-CHAIN BOND              (A**2) : 3.870 ; 1.500                
REMARK   3   MAIN-CHAIN ANGLE             (A**2) : 4.190 ; 2.000                
REMARK   3   SIDE-CHAIN BOND              (A**2) : 2.770 ; 2.000                
REMARK   3   SIDE-CHAIN ANGLE             (A**2) : 4.000 ; 2.500                
REMARK   3                                                                      
REMARK   3  BULK SOLVENT MODELING.                                              
REMARK   3   METHOD USED : NULL                                                 
REMARK   3   KSOL        : NULL                                                 
REMARK   3   BSOL        : NULL                                                 
REMARK   3                                                                      
REMARK   3  NCS MODEL : NULL                                                    
REMARK   3                                                                      
REMARK   3  NCS RESTRAINTS.                         RMS   SIGMA/WEIGHT          
REMARK   3   GROUP  1  POSITIONAL            (A) : NULL  ; NULL                 
REMARK   3   GROUP  1  B-FACTOR           (A**2) : NULL  ; NULL                 
REMARK   3                                                                      
REMARK   3  PARAMETER FILE  1  : PROTEIN_REP.PARAM                              
REMARK   3  PARAMETER FILE  2  : DNA-RNA_REP.PARAM                              
REMARK   3  PARAMETER FILE  3  : WATER_REP.PARAM                                
REMARK   3  PARAMETER FILE  4  : ION.PARAM                                      
REMARK   3  PARAMETER FILE  5  : NULL                                           
REMARK   3  TOPOLOGY FILE  1   : PROTEIN.TOP                                    
REMARK   3  TOPOLOGY FILE  2   : DNA-RNA.TOP                                    
REMARK   3  TOPOLOGY FILE  3   : WATER.TOP                                      
REMARK   3  TOPOLOGY FILE  4   : ION.TOP                                        
REMARK   3  TOPOLOGY FILE  5   : NULL                                           
REMARK   3                                                                      
REMARK   3  OTHER REFINEMENT REMARKS: NULL                                      
REMARK   4                                                                      
REMARK   4 1KX3 COMPLIES WITH FORMAT V. 3.15, 01-DEC-08                         
REMARK 100                                                                      
REMARK 100 THIS ENTRY HAS BEEN PROCESSED BY RCSB ON 06-FEB-02.                  
REMARK 100 THE RCSB ID CODE IS RCSB015429.                                      
REMARK 200                                                                      
REMARK 200 EXPERIMENTAL DETAILS                                                 
REMARK 200  EXPERIMENT TYPE                : X-RAY DIFFRACTION                  
REMARK 200  DATE OF DATA COLLECTION        : 02-JUN-96                          
REMARK 200  TEMPERATURE           (KELVIN) : 103                                
REMARK 200  PH                             : 6.0                                
REMARK 200  NUMBER OF CRYSTALS USED        : 27                                 
REMARK 200                                                                      
REMARK 200  SYNCHROTRON              (Y/N) : Y                                  
REMARK 200  RADIATION SOURCE               : ESRF                               
REMARK 200  BEAMLINE                       : ID09                               
REMARK 200  X-RAY GENERATOR MODEL          : NULL                               
REMARK 200  MONOCHROMATIC OR LAUE    (M/L) : M                                  
REMARK 200  WAVELENGTH OR RANGE        (A) : 0.85                               
REMARK 200  MONOCHROMATOR                  : SI 111 CHANNEL                     
REMARK 200  OPTICS                         : NULL                               
REMARK 200                                                                      
REMARK 200  DETECTOR TYPE                  : IMAGE PLATE                        
REMARK 200  DETECTOR MANUFACTURER          : MARRESEARCH                        
REMARK 200  INTENSITY-INTEGRATION SOFTWARE : DENZO                              
REMARK 200  DATA SCALING SOFTWARE          : SCALEPACK                          
REMARK 200                                                                      
REMARK 200  NUMBER OF UNIQUE REFLECTIONS   : 145317                             
REMARK 200  RESOLUTION RANGE HIGH      (A) : 1.970                              
REMARK 200  RESOLUTION RANGE LOW       (A) : 99.000                             
REMARK 200  REJECTION CRITERIA  (SIGMA(I)) : 1.000                              
REMARK 200                                                                      
REMARK 200 OVERALL.                                                             
REMARK 200  COMPLETENESS FOR RANGE     (%) : 98.3                               
REMARK 200  DATA REDUNDANCY                : 7.400                              
REMARK 200  R MERGE                    (I) : 0.06800                            
REMARK 200  R SYM                      (I) : NULL                               
REMARK 200  <I/SIGMA(I)> FOR THE DATA SET  : NULL                               
REMARK 200                                                                      
REMARK 200 IN THE HIGHEST RESOLUTION SHELL.                                     
REMARK 200  HIGHEST RESOLUTION SHELL, RANGE HIGH (A) : 1.97                     
REMARK 200  HIGHEST RESOLUTION SHELL, RANGE LOW  (A) : 2.04                     
REMARK 200  COMPLETENESS FOR SHELL     (%) : 84.5                               
REMARK 200  DATA REDUNDANCY IN SHELL       : NULL                               
REMARK 200  R MERGE FOR SHELL          (I) : 0.49500                            
REMARK 200  R SYM FOR SHELL            (I) : NULL                               
REMARK 200  <I/SIGMA(I)> FOR SHELL         : NULL                               
REMARK 200                                                                      
REMARK 200 DIFFRACTION PROTOCOL: SINGLE WAVELENGTH                              
REMARK 200 METHOD USED TO DETERMINE THE STRUCTURE: FOURIER SYNTHESIS            
REMARK 200 SOFTWARE USED: CNS                                                   
REMARK 200 STARTING MODEL: PDB ENTRY 1AOI                                       
REMARK 200                                                                      
REMARK 200 REMARK: NULL                                                         
REMARK 280                                                                      
REMARK 280 CRYSTAL                                                              
REMARK 280 SOLVENT CONTENT, VS   (%): 52.60                                     
REMARK 280 MATTHEWS COEFFICIENT, VM (ANGSTROMS**3/DA): 2.59                     
REMARK 280                                                                      
REMARK 280 CRYSTALLIZATION CONDITIONS: MANGANESE CHLORIDE, POTASSIUM            
REMARK 280  CHLORIDE, POTASSIUM CACODYLATE, PH 6.0, VAPOR DIFFUSION,            
REMARK 280  SITTING DROP, TEMPERATURE 293K                                      
REMARK 290                                                                      
REMARK 290 CRYSTALLOGRAPHIC SYMMETRY                                            
REMARK 290 SYMMETRY OPERATORS FOR SPACE GROUP: P 21 21 21                       
REMARK 290                                                                      
REMARK 290      SYMOP   SYMMETRY                                                
REMARK 290     NNNMMM   OPERATOR                                                
REMARK 290       1555   X,Y,Z                                                   
REMARK 290       2555   -X+1/2,-Y,Z+1/2                                         
REMARK 290       3555   -X,Y+1/2,-Z+1/2                                         
REMARK 290       4555   X+1/2,-Y+1/2,-Z                                         
REMARK 290                                                                      
REMARK 290     WHERE NNN -> OPERATOR NUMBER                                     
REMARK 290           MMM -> TRANSLATION VECTOR                                  
REMARK 290                                                                      
REMARK 290 CRYSTALLOGRAPHIC SYMMETRY TRANSFORMATIONS                            
REMARK 290 THE FOLLOWING TRANSFORMATIONS OPERATE ON THE ATOM/HETATM             
REMARK 290 RECORDS IN THIS ENTRY TO PRODUCE CRYSTALLOGRAPHICALLY                
REMARK 290 RELATED MOLECULES.                                                   
REMARK 290   SMTRY1   1  1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY2   1  0.000000  1.000000  0.000000        0.00000            
REMARK 290   SMTRY3   1  0.000000  0.000000  1.000000        0.00000            
REMARK 290   SMTRY1   2 -1.000000  0.000000  0.000000       52.70000            
REMARK 290   SMTRY2   2  0.000000 -1.000000  0.000000        0.00000            
REMARK 290   SMTRY3   2  0.000000  0.000000  1.000000       54.80000            
REMARK 290   SMTRY1   3 -1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY2   3  0.000000  1.000000  0.000000       90.77000            
REMARK 290   SMTRY3   3  0.000000  0.000000 -1.000000       54.80000            
REMARK 290   SMTRY1   4  1.000000  0.000000  0.000000       52.70000            
REMARK 290   SMTRY2   4  0.000000 -1.000000  0.000000       90.77000            
REMARK 290   SMTRY3   4  0.000000  0.000000 -1.000000        0.00000            
REMARK 290                                                                      
REMARK 290 REMARK: NULL                                                         
REMARK 300                                                                      
REMARK 300 BIOMOLECULE: 1                                                       
REMARK 300 SEE REMARK 350 FOR THE AUTHOR PROVIDED AND/OR PROGRAM                
REMARK 300 GENERATED ASSEMBLY INFORMATION FOR THE STRUCTURE IN                  
REMARK 300 THIS ENTRY. THE REMARK MAY ALSO PROVIDE INFORMATION ON               
REMARK 300 BURIED SURFACE AREA.                                                 
REMARK 350                                                                      
REMARK 350 COORDINATES FOR A COMPLETE MULTIMER REPRESENTING THE KNOWN           
REMARK 350 BIOLOGICALLY SIGNIFICANT OLIGOMERIZATION STATE OF THE                
REMARK 350 MOLECULE CAN BE GENERATED BY APPLYING BIOMT TRANSFORMATIONS          
REMARK 350 GIVEN BELOW.  BOTH NON-CRYSTALLOGRAPHIC AND                          
REMARK 350 CRYSTALLOGRAPHIC OPERATIONS ARE GIVEN.                               
REMARK 350                                                                      
REMARK 350 BIOMOLECULE: 1                                                       
REMARK 350 AUTHOR DETERMINED BIOLOGICAL UNIT: DECAMERIC                         
REMARK 350 APPLY THE FOLLOWING TO CHAINS: I, J, A, B, C, D, E, F, G, H          
REMARK 350   BIOMT1   1  1.000000  0.000000  0.000000        0.00000            
REMARK 350   BIOMT2   1  0.000000  1.000000  0.000000        0.00000            
REMARK 350   BIOMT3   1  0.000000  0.000000  1.000000        0.00000            
REMARK 465                                                                      
REMARK 465 MISSING RESIDUES                                                     
REMARK 465 THE FOLLOWING RESIDUES WERE NOT LOCATED IN THE                       
REMARK 465 EXPERIMENT. (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN               
REMARK 465 IDENTIFIER; SSSEQ=SEQUENCE NUMBER; I=INSERTION CODE.)                
REMARK 465                                                                      
REMARK 465   M RES C SSSEQI                                                     
REMARK 465     ALA A     1                                                      
REMARK 465     ARG A     2                                                      
REMARK 465     THR A     3                                                      
REMARK 465     LYS A     4                                                      
REMARK 465     GLN A     5                                                      
REMARK 465     THR A     6                                                      
REMARK 465     ALA A     7                                                      
REMARK 465     ARG A     8                                                      
REMARK 465     LYS A     9                                                      
REMARK 465     SER A    10                                                      
REMARK 465     THR A    11                                                      
REMARK 465     GLY A    12                                                      
REMARK 465     GLY A    13                                                      
REMARK 465     LYS A    14                                                      
REMARK 465     ALA A    15                                                      
REMARK 465     PRO A    16                                                      
REMARK 465     ARG A    17                                                      
REMARK 465     LYS A    18                                                      
REMARK 465     GLN A    19                                                      
REMARK 465     LEU A    20                                                      
REMARK 465     ALA A    21                                                      
REMARK 465     THR A    22                                                      
REMARK 465     LYS A    23                                                      
REMARK 465     ALA A    24                                                      
REMARK 465     ALA A    25                                                      
REMARK 465     ARG A    26                                                      
REMARK 465     LYS A    27                                                      
REMARK 465     SER A    28                                                      
REMARK 465     ALA A    29                                                      
REMARK 465     PRO A    30                                                      
REMARK 465     ALA A    31                                                      
REMARK 465     THR A    32                                                      
REMARK 465     GLY A    33                                                      
REMARK 465     GLY A    34                                                      
REMARK 465     VAL A    35                                                      
REMARK 465     LYS A    36                                                      
REMARK 465     LYS A    37                                                      
REMARK 465     SER B     1                                                      
REMARK 465     GLY B     2                                                      
REMARK 465     ARG B     3                                                      
REMARK 465     GLY B     4                                                      
REMARK 465     LYS B     5                                                      
REMARK 465     GLY B     6                                                      
REMARK 465     GLY B     7                                                      
REMARK 465     LYS B     8                                                      
REMARK 465     GLY B     9                                                      
REMARK 465     LEU B    10                                                      
REMARK 465     GLY B    11                                                      
REMARK 465     LYS B    12                                                      
REMARK 465     GLY B    13                                                      
REMARK 465     GLY B    14                                                      
REMARK 465     ALA B    15                                                      
REMARK 465     LYS B    16                                                      
REMARK 465     ARG B    17                                                      
REMARK 465     HIS B    18                                                      
REMARK 465     ARG B    19                                                      
REMARK 465     LYS B    20                                                      
REMARK 465     SER C     1                                                      
REMARK 465     GLY C     2                                                      
REMARK 465     ARG C     3                                                      
REMARK 465     GLY C     4                                                      
REMARK 465     LYS C     5                                                      
REMARK 465     GLN C     6                                                      
REMARK 465     GLY C     7                                                      
REMARK 465     GLY C     8                                                      
REMARK 465     LYS C     9                                                      
REMARK 465     THR C    10                                                      
REMARK 465     ARG C    11                                                      
REMARK 465     ALA C    12                                                      
REMARK 465     LYS C    13                                                      
REMARK 465     GLU C   121                                                      
REMARK 465     SER C   122                                                      
REMARK 465     SER C   123                                                      
REMARK 465     LYS C   124                                                      
REMARK 465     SER C   125                                                      
REMARK 465     LYS C   126                                                      
REMARK 465     SER C   127                                                      
REMARK 465     LYS C   128                                                      
REMARK 465     PRO D    -2                                                      
REMARK 465     GLU D    -1                                                      
REMARK 465     PRO D     0                                                      
REMARK 465     ALA D     1                                                      
REMARK 465     LYS D     2                                                      
REMARK 465     SER D     3                                                      
REMARK 465     ALA D     4                                                      
REMARK 465     PRO D     5                                                      
REMARK 465     ALA D     6                                                      
REMARK 465     PRO D     7                                                      
REMARK 465     LYS D     8                                                      
REMARK 465     LYS D     9                                                      
REMARK 465     GLY D    10                                                      
REMARK 465     SER D    11                                                      
REMARK 465     LYS D    12                                                      
REMARK 465     LYS D    13                                                      
REMARK 465     ALA D    14                                                      
REMARK 465     VAL D    15                                                      
REMARK 465     THR D    16                                                      
REMARK 465     LYS D    17                                                      
REMARK 465     THR D    18                                                      
REMARK 465     GLN D    19                                                      
REMARK 465     LYS D    20                                                      
REMARK 465     LYS D    21                                                      
REMARK 465     ASP D    22                                                      
REMARK 465     GLY D    23                                                      
REMARK 465     LYS D    24                                                      
REMARK 465     LYS D    25                                                      
REMARK 465     ARG D    26                                                      
REMARK 465     ARG D    27                                                      
REMARK 465     LYS D    28                                                      
REMARK 465     ALA E     1                                                      
REMARK 465     ARG E     2                                                      
REMARK 465     THR E     3                                                      
REMARK 465     LYS E     4                                                      
REMARK 465     GLN E     5                                                      
REMARK 465     THR E     6                                                      
REMARK 465     ALA E     7                                                      
REMARK 465     ARG E     8                                                      
REMARK 465     LYS E     9                                                      
REMARK 465     SER E    10                                                      
REMARK 465     THR E    11                                                      
REMARK 465     GLY E    12                                                      
REMARK 465     GLY E    13                                                      
REMARK 465     LYS E    14                                                      
REMARK 465     ALA E    15                                                      
REMARK 465     PRO E    16                                                      
REMARK 465     ARG E    17                                                      
REMARK 465     LYS E    18                                                      
REMARK 465     GLN E    19                                                      
REMARK 465     LEU E    20                                                      
REMARK 465     ALA E    21                                                      
REMARK 465     THR E    22                                                      
REMARK 465     LYS E    23                                                      
REMARK 465     ALA E    24                                                      
REMARK 465     ALA E    25                                                      
REMARK 465     ARG E    26                                                      
REMARK 465     LYS E    27                                                      
REMARK 465     SER E    28                                                      
REMARK 465     ALA E    29                                                      
REMARK 465     PRO E    30                                                      
REMARK 465     ALA E    31                                                      
REMARK 465     THR E    32                                                      
REMARK 465     GLY E    33                                                      
REMARK 465     GLY E    34                                                      
REMARK 465     VAL E    35                                                      
REMARK 465     LYS E    36                                                      
REMARK 465     LYS E    37                                                      
REMARK 465     SER F     1                                                      
REMARK 465     GLY F     2                                                      
REMARK 465     ARG F     3                                                      
REMARK 465     GLY F     4                                                      
REMARK 465     LYS F     5                                                      
REMARK 465     GLY F     6                                                      
REMARK 465     GLY F     7                                                      
REMARK 465     LYS F     8                                                      
REMARK 465     GLY F     9                                                      
REMARK 465     LEU F    10                                                      
REMARK 465     GLY F    11                                                      
REMARK 465     LYS F    12                                                      
REMARK 465     GLY F    13                                                      
REMARK 465     GLY F    14                                                      
REMARK 465     ALA F    15                                                      
REMARK 465     SER G     1                                                      
REMARK 465     GLY G     2                                                      
REMARK 465     ARG G     3                                                      
REMARK 465     GLY G     4                                                      
REMARK 465     LYS G     5                                                      
REMARK 465     GLN G     6                                                      
REMARK 465     GLY G     7                                                      
REMARK 465     GLY G     8                                                      
REMARK 465     LYS G     9                                                      
REMARK 465     THR G    10                                                      
REMARK 465     ARG G    11                                                      
REMARK 465     ALA G    12                                                      
REMARK 465     LYS G    13                                                      
REMARK 465     THR G   120                                                      
REMARK 465     GLU G   121                                                      
REMARK 465     SER G   122                                                      
REMARK 465     SER G   123                                                      
REMARK 465     LYS G   124                                                      
REMARK 465     SER G   125                                                      
REMARK 465     LYS G   126                                                      
REMARK 465     SER G   127                                                      
REMARK 465     LYS G   128                                                      
REMARK 465     PRO H    -2                                                      
REMARK 465     GLU H    -1                                                      
REMARK 465     PRO H     0                                                      
REMARK 465     ALA H     1                                                      
REMARK 465     LYS H     2                                                      
REMARK 465     SER H     3                                                      
REMARK 465     ALA H     4                                                      
REMARK 465     PRO H     5                                                      
REMARK 465     ALA H     6                                                      
REMARK 465     PRO H     7                                                      
REMARK 465     LYS H     8                                                      
REMARK 465     LYS H     9                                                      
REMARK 465     GLY H    10                                                      
REMARK 465     SER H    11                                                      
REMARK 465     LYS H    12                                                      
REMARK 465     LYS H    13                                                      
REMARK 465     ALA H    14                                                      
REMARK 465     VAL H    15                                                      
REMARK 465     THR H    16                                                      
REMARK 465     LYS H    17                                                      
REMARK 465     THR H    18                                                      
REMARK 465     GLN H    19                                                      
REMARK 465     LYS H    20                                                      
REMARK 465     LYS H    21                                                      
REMARK 465     ASP H    22                                                      
REMARK 465     GLY H    23                                                      
REMARK 465     LYS H    24                                                      
REMARK 465     LYS H    25                                                      
REMARK 465     ARG H    26                                                      
REMARK 465     ARG H    27                                                      
REMARK 465     LYS H    28                                                      
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: CLOSE CONTACTS IN SAME ASYMMETRIC UNIT                     
REMARK 500                                                                      
REMARK 500 THE FOLLOWING ATOMS ARE IN CLOSE CONTACT.                            
REMARK 500                                                                      
REMARK 500  ATM1  RES C  SSEQI   ATM2  RES C  SSEQI           DISTANCE          
REMARK 500   NE   ARG E    63     O    HOH E  1051              2.04            
REMARK 500   OE1  GLU H    73     O    HOH H   160              2.08            
REMARK 500   O    GLY B   101     O    HOH B   111              2.15            
REMARK 500   O    GLY F   102     O    HOH F   152              2.19            
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: COVALENT BOND ANGLES                                       
REMARK 500                                                                      
REMARK 500 THE STEREOCHEMICAL PARAMETERS OF THE FOLLOWING RESIDUES              
REMARK 500 HAVE VALUES WHICH DEVIATE FROM EXPECTED VALUES BY MORE               
REMARK 500 THAN 6*RMSD (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN               
REMARK 500 IDENTIFIER; SSEQ=SEQUENCE NUMBER; I=INSERTION CODE).                 
REMARK 500                                                                      
REMARK 500 STANDARD TABLE:                                                      
REMARK 500 FORMAT: (10X,I3,1X,A3,1X,A1,I4,A1,3(1X,A4,2X),12X,F5.1)              
REMARK 500                                                                      
REMARK 500 EXPECTED VALUES PROTEIN: ENGH AND HUBER, 1999                        
REMARK 500 EXPECTED VALUES NUCLEIC ACID: CLOWNEY ET AL 1996                     
REMARK 500                                                                      
REMARK 500  M RES CSSEQI ATM1   ATM2   ATM3                                     
REMARK 500    ARG C  81   NE  -  CZ  -  NH1 ANGL. DEV. =   4.7 DEGREES          
REMARK 500    ARG C  81   NE  -  CZ  -  NH2 ANGL. DEV. =  -4.4 DEGREES          
REMARK 500    ARG E 128   NE  -  CZ  -  NH2 ANGL. DEV. =  -3.4 DEGREES          
REMARK 500    ARG G  88   NE  -  CZ  -  NH1 ANGL. DEV. =   3.4 DEGREES          
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: TORSION ANGLES                                             
REMARK 500                                                                      
REMARK 500 TORSION ANGLES OUTSIDE THE EXPECTED RAMACHANDRAN REGIONS:            
REMARK 500 (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN IDENTIFIER;               
REMARK 500 SSEQ=SEQUENCE NUMBER; I=INSERTION CODE).                             
REMARK 500                                                                      
REMARK 500 STANDARD TABLE:                                                      
REMARK 500 FORMAT:(10X,I3,1X,A3,1X,A1,I4,A1,4X,F7.2,3X,F7.2)                    
REMARK 500                                                                      
REMARK 500 EXPECTED VALUES: GJ KLEYWEGT AND TA JONES (1996). PHI/PSI-           
REMARK 500 CHOLOGY: RAMACHANDRAN REVISITED. STRUCTURE 4, 1395 - 1400            
REMARK 500                                                                      
REMARK 500  M RES CSSEQI        PSI       PHI                                   
REMARK 500    LEU B  22     -168.75    -58.60                                   
REMARK 500    ARG B  23      116.80    177.12                                   
REMARK 500    ASN C 110      105.81   -167.18                                   
REMARK 500    LYS C 118     -146.09     52.24                                   
REMARK 500    ALA D 121       52.04    -96.11                                   
REMARK 500    ARG E 134      -19.92   -144.25                                   
REMARK 500    HIS F  18      177.21     54.31                                   
REMARK 500    ARG F  19       94.58    171.26                                   
REMARK 500    LYS F  20      139.98    -30.50                                   
REMARK 500    THR F  96      130.95    -39.87                                   
REMARK 500    ASN G 110      115.29   -164.67                                   
REMARK 500    ARG H  30      137.93    -31.32                                   
REMARK 500    ALA H 121      116.84   -177.44                                   
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: PLANAR GROUPS                                              
REMARK 500                                                                      
REMARK 500 PLANAR GROUPS IN THE FOLLOWING RESIDUES HAVE A TOTAL                 
REMARK 500 RMS DISTANCE OF ALL ATOMS FROM THE BEST-FIT PLANE                    
REMARK 500 BY MORE THAN AN EXPECTED VALUE OF 6*RMSD, WITH AN                    
REMARK 500 RMSD 0.02 ANGSTROMS, OR AT LEAST ONE ATOM HAS                        
REMARK 500 AN RMSD GREATER THAN THIS VALUE                                      
REMARK 500 (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN IDENTIFIER;               
REMARK 500 SSEQ=SEQUENCE NUMBER; I=INSERTION CODE).                             
REMARK 500                                                                      
REMARK 500  M RES CSSEQI        RMS     TYPE                                    
REMARK 500     DT J -12         0.08    SIDE_CHAIN                              
REMARK 500     DG J  -6         0.06    SIDE_CHAIN                              
REMARK 500    TYR D  39         0.08    SIDE_CHAIN                              
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 525                                                                      
REMARK 525 SOLVENT                                                              
REMARK 525                                                                      
REMARK 525 THE SOLVENT MOLECULES HAVE CHAIN IDENTIFIERS THAT                    
REMARK 525 INDICATE THE POLYMER CHAIN WITH WHICH THEY ARE MOST                  
REMARK 525 CLOSELY ASSOCIATED. THE REMARK LISTS ALL THE SOLVENT                 
REMARK 525 MOLECULES WHICH ARE MORE THAN 5A AWAY FROM THE                       
REMARK 525 NEAREST POLYMER CHAIN (M = MODEL NUMBER;                             
REMARK 525 RES=RESIDUE NAME; C=CHAIN IDENTIFIER; SSEQ=SEQUENCE                  
REMARK 525 NUMBER; I=INSERTION CODE):                                           
REMARK 525                                                                      
REMARK 525  M RES CSSEQI                                                        
REMARK 525    HOH H 157        DISTANCE =  5.32 ANGSTROMS                       
REMARK 525    HOH G 170        DISTANCE =  5.56 ANGSTROMS                       
REMARK 525    HOH I1015        DISTANCE =  5.09 ANGSTROMS                       
REMARK 525    HOH J1015        DISTANCE =  5.06 ANGSTROMS                       
REMARK 525    HOH I1024        DISTANCE =  5.15 ANGSTROMS                       
REMARK 525    HOH F 173        DISTANCE =  6.91 ANGSTROMS                       
REMARK 525    HOH E1036        DISTANCE =  5.65 ANGSTROMS                       
REMARK 525    HOH I1049        DISTANCE =  5.08 ANGSTROMS                       
REMARK 525    HOH C 227        DISTANCE =  6.00 ANGSTROMS                       
REMARK 525    HOH I1062        DISTANCE =  6.02 ANGSTROMS                       
REMARK 525    HOH J1061        DISTANCE =  6.90 ANGSTROMS                       
REMARK 525    HOH J1069        DISTANCE =  6.26 ANGSTROMS                       
REMARK 525    HOH J1070        DISTANCE =  5.27 ANGSTROMS                       
REMARK 525    HOH J1074        DISTANCE =  5.48 ANGSTROMS                       
REMARK 525    HOH I1077        DISTANCE =  7.09 ANGSTROMS                       
REMARK 525    HOH I1089        DISTANCE =  5.21 ANGSTROMS                       
REMARK 525    HOH J1087        DISTANCE =  6.90 ANGSTROMS                       
REMARK 525    HOH I1091        DISTANCE =  5.51 ANGSTROMS                       
REMARK 620                                                                      
REMARK 620 METAL COORDINATION                                                   
REMARK 620  (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN IDENTIFIER;              
REMARK 620  SSEQ=SEQUENCE NUMBER; I=INSERTION CODE):                            
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN E 946  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH E1020   O                                                      
REMARK 620 2 HOH E 999   O    92.8                                              
REMARK 620 3 ASP E  77   OD1  93.0  88.8                                        
REMARK 620 4 HOH F 155   O    87.4  89.3 178.1                                  
REMARK 620 5 HOH E1032   O   172.8  87.7  94.2  85.4                            
REMARK 620 6 VAL D  45   O    88.3 177.5  93.3  88.5  90.9                      
REMARK 620 N                    1     2     3     4     5                       
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN I 944  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1  DG I -34   N7                                                     
REMARK 620 2  DG I -33   O6   87.0                                              
REMARK 620 3 HOH I1031   O   103.1  85.6                                        
REMARK 620 N                    1     2                                         
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN I 950  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH J 983   O                                                      
REMARK 620 2 HOH J1060   O   161.2                                              
REMARK 620 3 HOH J1024   O    85.4  76.7                                        
REMARK 620 N                    1     2                                         
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN I 952  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH I 990   O                                                      
REMARK 620 2  DG I  61   N7  111.5                                              
REMARK 620 3 HOH I1060   O    86.9 160.3                                        
REMARK 620 4 HOH I 962   O   171.1  75.7  86.7                                  
REMARK 620 N                    1     2     3                                   
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN I 955  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1  DG I  27   N7                                                     
REMARK 620 2 HOH I1061   O    83.8                                              
REMARK 620 3 HOH I1079   O    83.5  84.2                                        
REMARK 620 N                    1     2                                         
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN I 956  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH I 958   O                                                      
REMARK 620 2  DG I  65   N7   94.0                                              
REMARK 620 N                    1                                               
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN J 945  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH J1032   O                                                      
REMARK 620 2  DG J  60   N7  102.0                                              
REMARK 620 N                    1                                               
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN J 947  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH J1021   O                                                      
REMARK 620 2  DG J  26   N7   74.4                                              
REMARK 620 N                    1                                               
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN J 949  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH J1023   O                                                      
REMARK 620 2  DG J  47   N7   83.9                                              
REMARK 620 N                    1                                               
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN J 953  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1  DG J -35   N7                                                     
REMARK 620 2 HOH J1059   O    87.9                                              
REMARK 620 3 HOH J1027   O   104.8 110.1                                        
REMARK 620 4  DG J -34   O6   84.4 172.3  72.9                                  
REMARK 620 N                    1     2     3                                   
REMARK 800                                                                      
REMARK 800 SITE                                                                 
REMARK 800 SITE_IDENTIFIER: AC1                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 944                  
REMARK 800 SITE_IDENTIFIER: AC2                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN J 945                  
REMARK 800 SITE_IDENTIFIER: AC3                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN E 946                  
REMARK 800 SITE_IDENTIFIER: AC4                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN J 947                  
REMARK 800 SITE_IDENTIFIER: AC5                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN J 948                  
REMARK 800 SITE_IDENTIFIER: AC6                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN J 949                  
REMARK 800 SITE_IDENTIFIER: AC7                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 950                  
REMARK 800 SITE_IDENTIFIER: AC8                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 951                  
REMARK 800 SITE_IDENTIFIER: AC9                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 952                  
REMARK 800 SITE_IDENTIFIER: BC1                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN J 953                  
REMARK 800 SITE_IDENTIFIER: BC2                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN J 954                  
REMARK 800 SITE_IDENTIFIER: BC3                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 955                  
REMARK 800 SITE_IDENTIFIER: BC4                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 956                  
REMARK 900                                                                      
REMARK 900 RELATED ENTRIES                                                      
REMARK 900 RELATED ID: 1AOI   RELATED DB: PDB                                   
REMARK 900 NCP146 AT 2.8 A                                                      
REMARK 900 RELATED ID: 1KX4   RELATED DB: PDB                                   
REMARK 900 NCP146B AT 2.6 A                                                     
REMARK 900 RELATED ID: 1KX5   RELATED DB: PDB                                   
REMARK 900 NCP147 AT 1.9 A                                                      
DBREF  1KX3 A    1   135  UNP    P84233   H31_XENLA        1    135             
DBREF  1KX3 E    1   135  UNP    P84233   H31_XENLA        1    135             
DBREF  1KX3 B    1   102  UNP    P62799   H4_XENLA         1    102             
DBREF  1KX3 F    1   102  UNP    P62799   H4_XENLA         1    102             
DBREF  1KX3 C    1   128  UNP    P06897   H2A1_XENLA       1    129             
DBREF  1KX3 G    1   128  UNP    P06897   H2A1_XENLA       1    129             
DBREF  1KX3 D   -2   122  UNP    P02281   H2B1_XENLA       1    125             
DBREF  1KX3 H   -2   122  UNP    P02281   H2B1_XENLA       1    125             
DBREF  1KX3 I  -72    73  PDB    1KX3     1KX3           -72     73             
DBREF  1KX3 J  -73    72  PDB    1KX3     1KX3           -73     72             
SEQADV 1KX3 ALA A  102  UNP  P84233    GLY   102 CONFLICT                       
SEQADV 1KX3 ALA E  102  UNP  P84233    GLY   102 CONFLICT                       
SEQADV 1KX3 ARG C   99  UNP  P06897    GLY    99 VARIANT                        
SEQADV 1KX3 SER C  123  UNP  P06897    ALA   123 CONFLICT                       
SEQADV 1KX3     C       UNP  P06897    ALA   126 DELETION                       
SEQADV 1KX3 ARG G   99  UNP  P06897    GLY    99 VARIANT                        
SEQADV 1KX3 SER G  123  UNP  P06897    ALA   123 CONFLICT                       
SEQADV 1KX3     G       UNP  P06897    ALA   126 DELETION                       
SEQADV 1KX3 THR D   29  UNP  P02281    SER    32 VARIANT                        
SEQADV 1KX3 THR H   29  UNP  P02281    SER    32 VARIANT                        
SEQRES   1 I  146   DA  DT  DC  DA  DA  DT  DA  DT  DC  DC  DA  DC  DC          
SEQRES   2 I  146   DT  DG  DC  DA  DG  DA  DT  DT  DC  DT  DA  DC  DC          
SEQRES   3 I  146   DA  DA  DA  DA  DG  DT  DG  DT  DA  DT  DT  DT  DG          
SEQRES   4 I  146   DG  DA  DA  DA  DC  DT  DG  DC  DT  DC  DC  DA  DT          
SEQRES   5 I  146   DC  DA  DA  DA  DA  DG  DG  DC  DA  DT  DG  DT  DT          
SEQRES   6 I  146   DC  DA  DG  DC  DT  DG  DA  DA  DT  DT  DC  DA  DG          
SEQRES   7 I  146   DC  DT  DG  DA  DA  DC  DA  DT  DG  DC  DC  DT  DT          
SEQRES   8 I  146   DT  DT  DG  DA  DT  DG  DG  DA  DG  DC  DA  DG  DT          
SEQRES   9 I  146   DT  DT  DC  DC  DA  DA  DA  DT  DA  DC  DA  DC  DT          
SEQRES  10 I  146   DT  DT  DT  DG  DG  DT  DA  DG  DA  DA  DT  DC  DT          
SEQRES  11 I  146   DG  DC  DA  DG  DG  DT  DG  DG  DA  DT  DA  DT  DT          
SEQRES  12 I  146   DG  DA  DT                                                  
SEQRES   1 J  146   DA  DT  DC  DA  DA  DT  DA  DT  DC  DC  DA  DC  DC          
SEQRES   2 J  146   DT  DG  DC  DA  DG  DA  DT  DT  DC  DT  DA  DC  DC          
SEQRES   3 J  146   DA  DA  DA  DA  DG  DT  DG  DT  DA  DT  DT  DT  DG          
SEQRES   4 J  146   DG  DA  DA  DA  DC  DT  DG  DC  DT  DC  DC  DA  DT          
SEQRES   5 J  146   DC  DA  DA  DA  DA  DG  DG  DC  DA  DT  DG  DT  DT          
SEQRES   6 J  146   DC  DA  DG  DC  DT  DG  DA  DA  DT  DT  DC  DA  DG          
SEQRES   7 J  146   DC  DT  DG  DA  DA  DC  DA  DT  DG  DC  DC  DT  DT          
SEQRES   8 J  146   DT  DT  DG  DA  DT  DG  DG  DA  DG  DC  DA  DG  DT          
SEQRES   9 J  146   DT  DT  DC  DC  DA  DA  DA  DT  DA  DC  DA  DC  DT          
SEQRES  10 J  146   DT  DT  DT  DG  DG  DT  DA  DG  DA  DA  DT  DC  DT          
SEQRES  11 J  146   DG  DC  DA  DG  DG  DT  DG  DG  DA  DT  DA  DT  DT          
SEQRES  12 J  146   DG  DA  DT                                                  
SEQRES   1 A  135  ALA ARG THR LYS GLN THR ALA ARG LYS SER THR GLY GLY          
SEQRES   2 A  135  LYS ALA PRO ARG LYS GLN LEU ALA THR LYS ALA ALA ARG          
SEQRES   3 A  135  LYS SER ALA PRO ALA THR GLY GLY VAL LYS LYS PRO HIS          
SEQRES   4 A  135  ARG TYR ARG PRO GLY THR VAL ALA LEU ARG GLU ILE ARG          
SEQRES   5 A  135  ARG TYR GLN LYS SER THR GLU LEU LEU ILE ARG LYS LEU          
SEQRES   6 A  135  PRO PHE GLN ARG LEU VAL ARG GLU ILE ALA GLN ASP PHE          
SEQRES   7 A  135  LYS THR ASP LEU ARG PHE GLN SER SER ALA VAL MET ALA          
SEQRES   8 A  135  LEU GLN GLU ALA SER GLU ALA TYR LEU VAL ALA LEU PHE          
SEQRES   9 A  135  GLU ASP THR ASN LEU CYS ALA ILE HIS ALA LYS ARG VAL          
SEQRES  10 A  135  THR ILE MET PRO LYS ASP ILE GLN LEU ALA ARG ARG ILE          
SEQRES  11 A  135  ARG GLY GLU ARG ALA                                          
SEQRES   1 B  102  SER GLY ARG GLY LYS GLY GLY LYS GLY LEU GLY LYS GLY          
SEQRES   2 B  102  GLY ALA LYS ARG HIS ARG LYS VAL LEU ARG ASP ASN ILE          
SEQRES   3 B  102  GLN GLY ILE THR LYS PRO ALA ILE ARG ARG LEU ALA ARG          
SEQRES   4 B  102  ARG GLY GLY VAL LYS ARG ILE SER GLY LEU ILE TYR GLU          
SEQRES   5 B  102  GLU THR ARG GLY VAL LEU LYS VAL PHE LEU GLU ASN VAL          
SEQRES   6 B  102  ILE ARG ASP ALA VAL THR TYR THR GLU HIS ALA LYS ARG          
SEQRES   7 B  102  LYS THR VAL THR ALA MET ASP VAL VAL TYR ALA LEU LYS          
SEQRES   8 B  102  ARG GLN GLY ARG THR LEU TYR GLY PHE GLY GLY                  
SEQRES   1 C  128  SER GLY ARG GLY LYS GLN GLY GLY LYS THR ARG ALA LYS          
SEQRES   2 C  128  ALA LYS THR ARG SER SER ARG ALA GLY LEU GLN PHE PRO          
SEQRES   3 C  128  VAL GLY ARG VAL HIS ARG LEU LEU ARG LYS GLY ASN TYR          
SEQRES   4 C  128  ALA GLU ARG VAL GLY ALA GLY ALA PRO VAL TYR LEU ALA          
SEQRES   5 C  128  ALA VAL LEU GLU TYR LEU THR ALA GLU ILE LEU GLU LEU          
SEQRES   6 C  128  ALA GLY ASN ALA ALA ARG ASP ASN LYS LYS THR ARG ILE          
SEQRES   7 C  128  ILE PRO ARG HIS LEU GLN LEU ALA VAL ARG ASN ASP GLU          
SEQRES   8 C  128  GLU LEU ASN LYS LEU LEU GLY ARG VAL THR ILE ALA GLN          
SEQRES   9 C  128  GLY GLY VAL LEU PRO ASN ILE GLN SER VAL LEU LEU PRO          
SEQRES  10 C  128  LYS LYS THR GLU SER SER LYS SER LYS SER LYS                  
SEQRES   1 D  125  PRO GLU PRO ALA LYS SER ALA PRO ALA PRO LYS LYS GLY          
SEQRES   2 D  125  SER LYS LYS ALA VAL THR LYS THR GLN LYS LYS ASP GLY          
SEQRES   3 D  125  LYS LYS ARG ARG LYS THR ARG LYS GLU SER TYR ALA ILE          
SEQRES   4 D  125  TYR VAL TYR LYS VAL LEU LYS GLN VAL HIS PRO ASP THR          
SEQRES   5 D  125  GLY ILE SER SER LYS ALA MET SER ILE MET ASN SER PHE          
SEQRES   6 D  125  VAL ASN ASP VAL PHE GLU ARG ILE ALA GLY GLU ALA SER          
SEQRES   7 D  125  ARG LEU ALA HIS TYR ASN LYS ARG SER THR ILE THR SER          
SEQRES   8 D  125  ARG GLU ILE GLN THR ALA VAL ARG LEU LEU LEU PRO GLY          
SEQRES   9 D  125  GLU LEU ALA LYS HIS ALA VAL SER GLU GLY THR LYS ALA          
SEQRES  10 D  125  VAL THR LYS TYR THR SER ALA LYS                              
SEQRES   1 E  135  ALA ARG THR LYS GLN THR ALA ARG LYS SER THR GLY GLY          
SEQRES   2 E  135  LYS ALA PRO ARG LYS GLN LEU ALA THR LYS ALA ALA ARG          
SEQRES   3 E  135  LYS SER ALA PRO ALA THR GLY GLY VAL LYS LYS PRO HIS          
SEQRES   4 E  135  ARG TYR ARG PRO GLY THR VAL ALA LEU ARG GLU ILE ARG          
SEQRES   5 E  135  ARG TYR GLN LYS SER THR GLU LEU LEU ILE ARG LYS LEU          
SEQRES   6 E  135  PRO PHE GLN ARG LEU VAL ARG GLU ILE ALA GLN ASP PHE          
SEQRES   7 E  135  LYS THR ASP LEU ARG PHE GLN SER SER ALA VAL MET ALA          
SEQRES   8 E  135  LEU GLN GLU ALA SER GLU ALA TYR LEU VAL ALA LEU PHE          
SEQRES   9 E  135  GLU ASP THR ASN LEU CYS ALA ILE HIS ALA LYS ARG VAL          
SEQRES  10 E  135  THR ILE MET PRO LYS ASP ILE GLN LEU ALA ARG ARG ILE          
SEQRES  11 E  135  ARG GLY GLU ARG ALA                                          
SEQRES   1 F  102  SER GLY ARG GLY LYS GLY GLY LYS GLY LEU GLY LYS GLY          
SEQRES   2 F  102  GLY ALA LYS ARG HIS ARG LYS VAL LEU ARG ASP ASN ILE          
SEQRES   3 F  102  GLN GLY ILE THR LYS PRO ALA ILE ARG ARG LEU ALA ARG          
SEQRES   4 F  102  ARG GLY GLY VAL LYS ARG ILE SER GLY LEU ILE TYR GLU          
SEQRES   5 F  102  GLU THR ARG GLY VAL LEU LYS VAL PHE LEU GLU ASN VAL          
SEQRES   6 F  102  ILE ARG ASP ALA VAL THR TYR THR GLU HIS ALA LYS ARG          
SEQRES   7 F  102  LYS THR VAL THR ALA MET ASP VAL VAL TYR ALA LEU LYS          
SEQRES   8 F  102  ARG GLN GLY ARG THR LEU TYR GLY PHE GLY GLY                  
SEQRES   1 G  128  SER GLY ARG GLY LYS GLN GLY GLY LYS THR ARG ALA LYS          
SEQRES   2 G  128  ALA LYS THR ARG SER SER ARG ALA GLY LEU GLN PHE PRO          
SEQRES   3 G  128  VAL GLY ARG VAL HIS ARG LEU LEU ARG LYS GLY ASN TYR          
SEQRES   4 G  128  ALA GLU ARG VAL GLY ALA GLY ALA PRO VAL TYR LEU ALA          
SEQRES   5 G  128  ALA VAL LEU GLU TYR LEU THR ALA GLU ILE LEU GLU LEU          
SEQRES   6 G  128  ALA GLY ASN ALA ALA ARG ASP ASN LYS LYS THR ARG ILE          
SEQRES   7 G  128  ILE PRO ARG HIS LEU GLN LEU ALA VAL ARG ASN ASP GLU          
SEQRES   8 G  128  GLU LEU ASN LYS LEU LEU GLY ARG VAL THR ILE ALA GLN          
SEQRES   9 G  128  GLY GLY VAL LEU PRO ASN ILE GLN SER VAL LEU LEU PRO          
SEQRES  10 G  128  LYS LYS THR GLU SER SER LYS SER LYS SER LYS                  
SEQRES   1 H  125  PRO GLU PRO ALA LYS SER ALA PRO ALA PRO LYS LYS GLY          
SEQRES   2 H  125  SER LYS LYS ALA VAL THR LYS THR GLN LYS LYS ASP GLY          
SEQRES   3 H  125  LYS LYS ARG ARG LYS THR ARG LYS GLU SER TYR ALA ILE          
SEQRES   4 H  125  TYR VAL TYR LYS VAL LEU LYS GLN VAL HIS PRO ASP THR          
SEQRES   5 H  125  GLY ILE SER SER LYS ALA MET SER ILE MET ASN SER PHE          
SEQRES   6 H  125  VAL ASN ASP VAL PHE GLU ARG ILE ALA GLY GLU ALA SER          
SEQRES   7 H  125  ARG LEU ALA HIS TYR ASN LYS ARG SER THR ILE THR SER          
SEQRES   8 H  125  ARG GLU ILE GLN THR ALA VAL ARG LEU LEU LEU PRO GLY          
SEQRES   9 H  125  GLU LEU ALA LYS HIS ALA VAL SER GLU GLY THR LYS ALA          
SEQRES  10 H  125  VAL THR LYS TYR THR SER ALA LYS                              
HET     MN  I 944       1                                                       
HET     MN  J 945       1                                                       
HET     MN  E 946       1                                                       
HET     MN  J 947       1                                                       
HET     MN  J 948       1                                                       
HET     MN  J 949       1                                                       
HET     MN  I 950       1                                                       
HET     MN  I 951       1                                                       
HET     MN  I 952       1                                                       
HET     MN  J 953       1                                                       
HET     MN  J 954       1                                                       
HET     MN  I 955       1                                                       
HET     MN  I 956       1                                                       
HETNAM      MN MANGANESE (II) ION                                               
FORMUL  11   MN    13(MN 2+)                                                    
FORMUL  24  HOH   *943(H2 O)                                                    
HELIX    1   1 GLY A   44  SER A   57  1                                  14    
HELIX    2   2 ARG A   63  ASP A   77  1                                  15    
HELIX    3   3 GLN A   85  ALA A  114  1                                  30    
HELIX    4   4 MET A  120  ARG A  131  1                                  12    
HELIX    5   5 ASP B   24  ILE B   29  5                                   6    
HELIX    6   6 THR B   30  GLY B   41  1                                  12    
HELIX    7   7 LEU B   49  ALA B   76  1                                  28    
HELIX    8   8 THR B   82  GLN B   93  1                                  12    
HELIX    9   9 THR C   16  GLY C   22  1                                   7    
HELIX   10  10 PRO C   26  GLY C   37  1                                  12    
HELIX   11  11 ALA C   45  ASN C   73  1                                  29    
HELIX   12  12 ILE C   79  ASN C   89  1                                  11    
HELIX   13  13 ASP C   90  LEU C   97  1                                   8    
HELIX   14  14 GLN C  112  LEU C  116  5                                   5    
HELIX   15  15 TYR D   34  HIS D   46  1                                  13    
HELIX   16  16 SER D   52  ASN D   81  1                                  30    
HELIX   17  17 THR D   87  LEU D   99  1                                  13    
HELIX   18  18 PRO D  100  ALA D  121  1                                  22    
HELIX   19  19 GLY E   44  SER E   57  1                                  14    
HELIX   20  20 ARG E   63  LYS E   79  1                                  17    
HELIX   21  21 GLN E   85  ALA E  114  1                                  30    
HELIX   22  22 MET E  120  ARG E  131  1                                  12    
HELIX   23  23 ASP F   24  ILE F   29  5                                   6    
HELIX   24  24 THR F   30  GLY F   41  1                                  12    
HELIX   25  25 LEU F   49  ALA F   76  1                                  28    
HELIX   26  26 THR F   82  GLN F   93  1                                  12    
HELIX   27  27 THR G   16  GLY G   22  1                                   7    
HELIX   28  28 PRO G   26  GLY G   37  1                                  12    
HELIX   29  29 ALA G   45  ASN G   73  1                                  29    
HELIX   30  30 ILE G   79  ASN G   89  1                                  11    
HELIX   31  31 ASP G   90  LEU G   97  1                                   8    
HELIX   32  32 GLN G  112  LEU G  116  5                                   5    
HELIX   33  33 TYR H   34  HIS H   46  1                                  13    
HELIX   34  34 SER H   52  ASN H   81  1                                  30    
HELIX   35  35 THR H   87  LEU H   99  1                                  13    
HELIX   36  36 PRO H  100  SER H  120  1                                  21    
SHEET    1   A 2 ARG A  83  PHE A  84  0                                        
SHEET    2   A 2 THR B  80  VAL B  81  1  O  VAL B  81   N  ARG A  83           
SHEET    1   B 2 THR A 118  ILE A 119  0                                        
SHEET    2   B 2 ARG B  45  ILE B  46  1  O  ARG B  45   N  ILE A 119           
SHEET    1   C 2 THR B  96  TYR B  98  0                                        
SHEET    2   C 2 VAL G 100  ILE G 102  1  O  THR G 101   N  TYR B  98           
SHEET    1   D 2 ARG C  42  VAL C  43  0                                        
SHEET    2   D 2 THR D  85  ILE D  86  1  O  ILE D  86   N  ARG C  42           
SHEET    1   E 2 ARG C  77  ILE C  78  0                                        
SHEET    2   E 2 GLY D  50  ILE D  51  1  O  GLY D  50   N  ILE C  78           
SHEET    1   F 2 VAL C 100  ILE C 102  0                                        
SHEET    2   F 2 THR F  96  TYR F  98  1  O  TYR F  98   N  THR C 101           
SHEET    1   G 2 ARG E  83  PHE E  84  0                                        
SHEET    2   G 2 THR F  80  VAL F  81  1  O  VAL F  81   N  ARG E  83           
SHEET    1   H 2 THR E 118  ILE E 119  0                                        
SHEET    2   H 2 ARG F  45  ILE F  46  1  O  ARG F  45   N  ILE E 119           
SHEET    1   I 2 ARG G  42  VAL G  43  0                                        
SHEET    2   I 2 THR H  85  ILE H  86  1  O  ILE H  86   N  ARG G  42           
SHEET    1   J 2 ARG G  77  ILE G  78  0                                        
SHEET    2   J 2 GLY H  50  ILE H  51  1  O  GLY H  50   N  ILE G  78           
LINK        MN    MN E 946                 O   HOH E1020     1555   1555  1.83  
LINK        MN    MN E 946                 O   HOH E 999     1555   1555  1.92  
LINK        MN    MN E 946                 OD1 ASP E  77     1555   1555  1.99  
LINK        MN    MN E 946                 O   HOH F 155     1555   1555  1.90  
LINK        MN    MN E 946                 O   HOH E1032     1555   1555  1.84  
LINK        MN    MN I 944                 N7   DG I -34     1555   1555  2.44  
LINK        MN    MN I 944                 O6   DG I -33     1555   1555  2.36  
LINK        MN    MN I 944                 O   HOH I1031     1555   1555  2.45  
LINK        MN    MN I 950                 O   HOH J 983     1555   1555  2.26  
LINK        MN    MN I 950                 O   HOH J1060     1555   1555  2.27  
LINK        MN    MN I 950                 O   HOH J1024     1555   1555  2.05  
LINK        MN    MN I 951                 N7   DG I  48     1555   1555  2.46  
LINK        MN    MN I 952                 O   HOH I 990     1555   1555  2.35  
LINK        MN    MN I 952                 N7   DG I  61     1555   1555  2.37  
LINK        MN    MN I 952                 O   HOH I1060     1555   1555  2.31  
LINK        MN    MN I 952                 O   HOH I 962     1555   1555  2.49  
LINK        MN    MN I 955                 N7   DG I  27     1555   1555  2.31  
LINK        MN    MN I 955                 O   HOH I1061     1555   1555  2.29  
LINK        MN    MN I 955                 O   HOH I1079     1555   1555  2.41  
LINK        MN    MN I 956                 O   HOH I 958     1555   1555  2.42  
LINK        MN    MN I 956                 N7   DG I  65     1555   1555  2.46  
LINK        MN    MN J 945                 O   HOH J1032     1555   1555  2.37  
LINK        MN    MN J 945                 N7   DG J  60     1555   1555  2.47  
LINK        MN    MN J 947                 O   HOH J1021     1555   1555  2.32  
LINK        MN    MN J 947                 N7   DG J  26     1555   1555  2.49  
LINK        MN    MN J 948                 N7   DG J  -3     1555   1555  2.24  
LINK        MN    MN J 949                 O   HOH J1023     1555   1555  2.27  
LINK        MN    MN J 949                 N7   DG J  47     1555   1555  2.36  
LINK        MN    MN J 953                 N7   DG J -35     1555   1555  2.61  
LINK        MN    MN J 953                 O   HOH J1059     1555   1555  2.41  
LINK        MN    MN J 953                 O   HOH J1027     1555   1555  2.61  
LINK        MN    MN J 953                 O6   DG J -34     1555   1555  2.37  
LINK        MN    MN J 954                 N7   DG J   7     1555   1555  2.52  
LINK        MN    MN E 946                 O   VAL D  45     1555   2564  1.97  
SITE     1 AC1  3  DG I -34   DG I -33  HOH I1031                               
SITE     1 AC2  2  DG J  60  HOH J1032                                          
SITE     1 AC3  6 VAL D  45  ASP E  77  HOH E 999  HOH E1020                    
SITE     2 AC3  6 HOH E1032  HOH F 155                                          
SITE     1 AC4  3  DT I  67   DG J  26  HOH J1021                               
SITE     1 AC5  1  DG J  -3                                                     
SITE     1 AC6  2  DG J  47  HOH J1023                                          
SITE     1 AC7  3 HOH J 983  HOH J1024  HOH J1060                               
SITE     1 AC8  1  DG I  48                                                     
SITE     1 AC9  4  DG I  61  HOH I 962  HOH I 990  HOH I1060                    
SITE     1 BC1  4  DG J -34   DG J -35  HOH J1027  HOH J1059                    
SITE     1 BC2  1  DG J   7                                                     
SITE     1 BC3  3  DG I  27  HOH I1061  HOH I1079                               
SITE     1 BC4  2  DG I  65  HOH I 958                                          
CRYST1  105.400  181.540  109.600  90.00  90.00  90.00 P 21 21 21    8          
ORIGX1      1.000000  0.000000  0.000000        0.00000                         
ORIGX2      0.000000  1.000000  0.000000        0.00000                         
ORIGX3      0.000000  0.000000  1.000000        0.00000                         
SCALE1      0.009488  0.000000  0.000000        0.00000                         
SCALE2      0.000000  0.005508  0.000000        0.00000                         
SCALE3      0.000000  0.000000  0.009124        0.00000                         
ATOM      1  O5'  DA I -72      25.213 138.856  26.663  1.00128.00           O  
ATOM      2  C5'  DA I -72      24.472 139.909  27.289  1.00127.00           C  
ATOM      3  C4'  DA I -72      23.057 139.992  26.765  1.00125.89           C  
ATOM      4  O4'  DA I -72      23.096 140.097  25.322  1.00125.70           O  
ATOM      5  C3'  DA I -72      22.191 138.771  27.069  1.00125.33           C  
ATOM      6  O3'  DA I -72      20.835 139.180  27.262  1.00124.40           O  
ATOM      7  C2'  DA I -72      22.304 137.948  25.802  1.00125.49           C  
ATOM      8  C1'  DA I -72      22.376 139.022  24.737  1.00125.18           C  
ATOM      9  N9   DA I -72      23.090 138.603  23.533  1.00124.26           N  
ATOM     10  C8   DA I -72      24.309 137.975  23.456  1.00124.14           C  
ATOM     11  N7   DA I -72      24.686 137.703  22.232  1.00124.18           N  
ATOM     12  C5   DA I -72      23.648 138.188  21.448  1.00123.59           C  
ATOM     13  C6   DA I -72      23.441 138.205  20.059  1.00122.72           C  
ATOM     14  N6   DA I -72      24.302 137.693  19.177  1.00122.36           N  
ATOM     15  N1   DA I -72      22.304 138.770  19.600  1.00122.42           N  
ATOM     16  C2   DA I -72      21.440 139.278  20.486  1.00122.97           C  
ATOM     17  N3   DA I -72      21.519 139.319  21.814  1.00123.28           N  
ATOM     18  C4   DA I -72      22.662 138.751  22.236  1.00123.75           C  
ATOM     19  P    DT I -71      19.691 138.075  27.496  1.00124.04           P  
ATOM     20  OP1  DT I -71      19.081 138.318  28.829  1.00124.24           O  
ATOM     21  OP2  DT I -71      20.262 136.740  27.186  1.00123.99           O  
ATOM     22  O5'  DT I -71      18.610 138.428  26.381  1.00121.95           O  
ATOM     23  C5'  DT I -71      18.204 139.778  26.172  1.00119.70           C  
ATOM     24  C4'  DT I -71      17.274 139.874  24.986  1.00118.35           C  
ATOM     25  O4'  DT I -71      17.987 139.562  23.765  1.00118.31           O  
ATOM     26  C3'  DT I -71      16.078 138.928  25.025  1.00117.22           C  
ATOM     27  O3'  DT I -71      14.936 139.598  24.491  1.00115.76           O  
ATOM     28  C2'  DT I -71      16.502 137.785  24.120  1.00117.19           C  
ATOM     29  C1'  DT I -71      17.340 138.501  23.076  1.00116.84           C  
ATOM     30  N1   DT I -71      18.386 137.672  22.444  1.00116.02           N  
ATOM     31  C2   DT I -71      18.348 137.501  21.076  1.00114.81           C  
ATOM     32  O2   DT I -71      17.478 137.978  20.366  1.00114.80           O  
ATOM     33  N3   DT I -71      19.374 136.744  20.568  1.00113.53           N  
ATOM     34  C4   DT I -71      20.405 136.152  21.272  1.00113.41           C  
ATOM     35  O4   DT I -71      21.263 135.511  20.677  1.00112.43           O  
ATOM     36  C5   DT I -71      20.373 136.357  22.701  1.00113.99           C  
ATOM     37  C7   DT I -71      21.442 135.739  23.544  1.00113.51           C  
ATOM     38  C6   DT I -71      19.379 137.097  23.209  1.00114.94           C  
ATOM     39  P    DC I -70      13.573 138.786  24.269  1.00115.46           P  
ATOM     40  OP1  DC I -70      12.452 139.757  24.208  1.00115.06           O  
ATOM     41  OP2  DC I -70      13.546 137.687  25.268  1.00116.02           O  
ATOM     42  O5'  DC I -70      13.752 138.145  22.824  1.00112.97           O  
ATOM     43  C5'  DC I -70      13.559 138.935  21.655  1.00109.08           C  
ATOM     44  C4'  DC I -70      13.301 138.044  20.464  1.00106.32           C  
ATOM     45  O4'  DC I -70      14.524 137.370  20.078  1.00105.74           O  
ATOM     46  C3'  DC I -70      12.276 136.940  20.727  1.00103.98           C  
ATOM     47  O3'  DC I -70      11.488 136.721  19.559  1.00100.44           O  
ATOM     48  C2'  DC I -70      13.139 135.723  20.995  1.00104.07           C  
ATOM     49  C1'  DC I -70      14.306 135.968  20.057  1.00103.79           C  
ATOM     50  N1   DC I -70      15.563 135.301  20.432  1.00101.99           N  
ATOM     51  C2   DC I -70      16.446 134.927  19.419  1.00100.24           C  
ATOM     52  O2   DC I -70      16.146 135.182  18.243  1.00 99.17           O  
ATOM     53  N3   DC I -70      17.598 134.301  19.742  1.00 99.11           N  
ATOM     54  C4   DC I -70      17.882 134.047  21.020  1.00 99.26           C  
ATOM     55  N4   DC I -70      19.028 133.423  21.293  1.00 99.24           N  
ATOM     56  C5   DC I -70      17.003 134.421  22.076  1.00 99.87           C  
ATOM     57  C6   DC I -70      15.866 135.042  21.740  1.00101.29           C  
ATOM     58  P    DA I -69      10.210 135.758  19.636  1.00 99.24           P  
ATOM     59  OP1  DA I -69       8.991 136.601  19.747  1.00100.25           O  
ATOM     60  OP2  DA I -69      10.493 134.728  20.672  1.00 99.18           O  
ATOM     61  O5'  DA I -69      10.192 135.048  18.213  1.00 94.63           O  
ATOM     62  C5'  DA I -69      10.597 135.758  17.049  1.00 88.11           C  
ATOM     63  C4'  DA I -69      11.261 134.817  16.073  1.00 83.02           C  
ATOM     64  O4'  DA I -69      12.491 134.302  16.639  1.00 80.44           O  
ATOM     65  C3'  DA I -69      10.427 133.591  15.710  1.00 81.18           C  
ATOM     66  O3'  DA I -69      10.711 133.246  14.359  1.00 79.67           O  
ATOM     67  C2'  DA I -69      10.977 132.520  16.634  1.00 79.32           C  
ATOM     68  C1'  DA I -69      12.448 132.883  16.662  1.00 77.87           C  
ATOM     69  N9   DA I -69      13.190 132.429  17.839  1.00 74.15           N  
ATOM     70  C8   DA I -69      12.859 132.560  19.162  1.00 74.00           C  
ATOM     71  N7   DA I -69      13.761 132.077  19.984  1.00 73.39           N  
ATOM     72  C5   DA I -69      14.749 131.588  19.142  1.00 71.37           C  
ATOM     73  C6   DA I -69      15.982 130.960  19.391  1.00 70.01           C  
ATOM     74  N6   DA I -69      16.452 130.703  20.614  1.00 67.87           N  
ATOM     75  N1   DA I -69      16.727 130.600  18.326  1.00 69.29           N  
ATOM     76  C2   DA I -69      16.258 130.854  17.101  1.00 69.41           C  
ATOM     77  N3   DA I -69      15.121 131.437  16.738  1.00 68.55           N  
ATOM     78  C4   DA I -69      14.404 131.788  17.818  1.00 71.93           C  
ATOM     79  P    DA I -68       9.563 132.628  13.430  1.00 79.76           P  
ATOM     80  OP1  DA I -68       9.206 133.646  12.411  1.00 80.35           O  
ATOM     81  OP2  DA I -68       8.509 132.028  14.284  1.00 80.13           O  
ATOM     82  O5'  DA I -68      10.308 131.444  12.679  1.00 79.32           O  
ATOM     83  C5'  DA I -68      11.465 131.706  11.896  1.00 76.49           C  
ATOM     84  C4'  DA I -68      12.314 130.463  11.802  1.00 74.35           C  
ATOM     85  O4'  DA I -68      12.982 130.228  13.067  1.00 72.05           O  
ATOM     86  C3'  DA I -68      11.509 129.200  11.498  1.00 73.10           C  
ATOM     87  O3'  DA I -68      12.195 128.408  10.526  1.00 73.12           O  
ATOM     88  C2'  DA I -68      11.415 128.504  12.845  1.00 70.50           C  
ATOM     89  C1'  DA I -68      12.723 128.905  13.504  1.00 71.42           C  
ATOM     90  N9   DA I -68      12.718 128.905  14.968  1.00 69.31           N  
ATOM     91  C8   DA I -68      11.777 129.437  15.813  1.00 70.73           C  
ATOM     92  N7   DA I -68      12.062 129.287  17.085  1.00 69.50           N  
ATOM     93  C5   DA I -68      13.270 128.606  17.078  1.00 67.94           C  
ATOM     94  C6   DA I -68      14.099 128.143  18.110  1.00 67.44           C  
ATOM     95  N6   DA I -68      13.836 128.314  19.405  1.00 66.93           N  
ATOM     96  N1   DA I -68      15.229 127.488  17.762  1.00 68.54           N  
ATOM     97  C2   DA I -68      15.497 127.319  16.464  1.00 67.16           C  
ATOM     98  N3   DA I -68      14.800 127.711  15.402  1.00 69.13           N  
ATOM     99  C4   DA I -68      13.684 128.359  15.781  1.00 69.29           C  
ATOM    100  P    DT I -67      11.495 127.091   9.931  1.00 74.60           P  
ATOM    101  OP1  DT I -67      11.541 127.121   8.447  1.00 74.97           O  
ATOM    102  OP2  DT I -67      10.195 126.911  10.626  1.00 74.60           O  
ATOM    103  O5'  DT I -67      12.455 125.944  10.452  1.00 74.17           O  
ATOM    104  C5'  DT I -67      12.892 125.978  11.795  1.00 70.96           C  
ATOM    105  C4'  DT I -67      13.816 124.829  12.084  1.00 67.73           C  
ATOM    106  O4'  DT I -67      14.158 124.936  13.482  1.00 69.31           O  
ATOM    107  C3'  DT I -67      13.184 123.451  11.909  1.00 67.07           C  
ATOM    108  O3'  DT I -67      14.212 122.526  11.542  1.00 67.87           O  
ATOM    109  C2'  DT I -67      12.613 123.163  13.284  1.00 66.36           C  
ATOM    110  C1'  DT I -67      13.590 123.866  14.216  1.00 67.77           C  
ATOM    111  N1   DT I -67      12.983 124.435  15.432  1.00 66.65           N  
ATOM    112  C2   DT I -67      13.746 124.461  16.568  1.00 64.92           C  
ATOM    113  O2   DT I -67      14.891 124.061  16.602  1.00 64.54           O  
ATOM    114  N3   DT I -67      13.117 124.978  17.669  1.00 66.00           N  
ATOM    115  C4   DT I -67      11.829 125.470  17.740  1.00 67.08           C  
ATOM    116  O4   DT I -67      11.403 125.912  18.802  1.00 68.08           O  
ATOM    117  C5   DT I -67      11.082 125.417  16.508  1.00 67.18           C  
ATOM    118  C7   DT I -67       9.671 125.915  16.490  1.00 68.21           C  
ATOM    119  C6   DT I -67      11.691 124.915  15.426  1.00 67.62           C  
ATOM    120  P    DA I -66      13.878 120.965  11.364  1.00 68.15           P  
ATOM    121  OP1  DA I -66      14.061 120.615   9.935  1.00 65.99           O  
ATOM    122  OP2  DA I -66      12.593 120.661  12.037  1.00 70.51           O  
ATOM    123  O5'  DA I -66      15.034 120.271  12.198  1.00 67.01           O  
ATOM    124  C5'  DA I -66      16.314 120.884  12.286  1.00 67.22           C  
ATOM    125  C4'  DA I -66      16.989 120.491  13.577  1.00 67.08           C  
ATOM    126  O4'  DA I -66      16.307 121.098  14.698  1.00 68.13           O  
ATOM    127  C3'  DA I -66      16.989 118.991  13.846  1.00 65.80           C  
ATOM    128  O3'  DA I -66      18.226 118.631  14.447  1.00 67.91           O  
ATOM    129  C2'  DA I -66      15.843 118.805  14.821  1.00 66.33           C  
ATOM    130  C1'  DA I -66      15.874 120.098  15.611  1.00 67.88           C  
ATOM    131  N9   DA I -66      14.564 120.505  16.113  1.00 66.37           N  
ATOM    132  C8   DA I -66      13.435 120.727  15.369  1.00 66.45           C  
ATOM    133  N7   DA I -66      12.403 121.110  16.077  1.00 66.99           N  
ATOM    134  C5   DA I -66      12.883 121.139  17.378  1.00 63.89           C  
ATOM    135  C6   DA I -66      12.276 121.480  18.595  1.00 64.12           C  
ATOM    136  N6   DA I -66      11.015 121.905  18.689  1.00 61.91           N  
ATOM    137  N1   DA I -66      13.019 121.383  19.719  1.00 62.58           N  
ATOM    138  C2   DA I -66      14.295 120.989  19.607  1.00 64.50           C  
ATOM    139  N3   DA I -66      14.986 120.659  18.511  1.00 63.47           N  
ATOM    140  C4   DA I -66      14.210 120.757  17.418  1.00 63.50           C  
ATOM    141  P    DT I -65      18.471 117.124  14.916  1.00 68.04           P  
ATOM    142  OP1  DT I -65      19.940 116.911  14.929  1.00 70.02           O  
ATOM    143  OP2  DT I -65      17.599 116.218  14.125  1.00 65.69           O  
ATOM    144  O5'  DT I -65      17.968 117.141  16.421  1.00 70.35           O  
ATOM    145  C5'  DT I -65      18.682 117.885  17.397  1.00 73.58           C  
ATOM    146  C4'  DT I -65      18.423 117.310  18.765  1.00 76.60           C  
ATOM    147  O4'  DT I -65      17.175 117.825  19.286  1.00 76.77           O  
ATOM    148  C3'  DT I -65      18.291 115.789  18.744  1.00 78.61           C  
ATOM    149  O3'  DT I -65      19.014 115.228  19.838  1.00 81.61           O  
ATOM    150  C2'  DT I -65      16.789 115.557  18.817  1.00 77.03           C  
ATOM    151  C1'  DT I -65      16.290 116.760  19.602  1.00 75.79           C  
ATOM    152  N1   DT I -65      14.917 117.201  19.268  1.00 72.14           N  
ATOM    153  C2   DT I -65      14.155 117.754  20.272  1.00 72.32           C  
ATOM    154  O2   DT I -65      14.562 117.892  21.418  1.00 72.68           O  
ATOM    155  N3   DT I -65      12.895 118.147  19.885  1.00 69.82           N  
ATOM    156  C4   DT I -65      12.341 118.047  18.619  1.00 71.70           C  
ATOM    157  O4   DT I -65      11.196 118.459  18.407  1.00 71.42           O  
ATOM    158  C5   DT I -65      13.193 117.450  17.622  1.00 70.27           C  
ATOM    159  C7   DT I -65      12.670 117.289  16.230  1.00 71.27           C  
ATOM    160  C6   DT I -65      14.421 117.064  17.991  1.00 70.49           C  
ATOM    161  P    DC I -64      18.502 113.877  20.528  1.00 82.70           P  
ATOM    162  OP1  DC I -64      19.665 113.296  21.242  1.00 83.81           O  
ATOM    163  OP2  DC I -64      17.747 113.049  19.554  1.00 82.66           O  
ATOM    164  O5'  DC I -64      17.498 114.432  21.621  1.00 84.78           O  
ATOM    165  C5'  DC I -64      17.948 115.382  22.579  1.00 86.61           C  
ATOM    166  C4'  DC I -64      17.234 115.153  23.884  1.00 87.38           C  
ATOM    167  O4'  DC I -64      15.855 115.546  23.705  1.00 87.02           O  
ATOM    168  C3'  DC I -64      17.211 113.676  24.261  1.00 88.65           C  
ATOM    169  O3'  DC I -64      17.313 113.499  25.675  1.00 92.20           O  
ATOM    170  C2'  DC I -64      15.885 113.187  23.705  1.00 85.96           C  
ATOM    171  C1'  DC I -64      14.996 114.420  23.755  1.00 83.76           C  
ATOM    172  N1   DC I -64      14.065 114.531  22.621  1.00 80.35           N  
ATOM    173  C2   DC I -64      12.814 115.101  22.835  1.00 77.81           C  
ATOM    174  O2   DC I -64      12.538 115.520  23.964  1.00 79.37           O  
ATOM    175  N3   DC I -64      11.940 115.189  21.807  1.00 75.98           N  
ATOM    176  C4   DC I -64      12.288 114.745  20.597  1.00 75.72           C  
ATOM    177  N4   DC I -64      11.398 114.858  19.607  1.00 75.33           N  
ATOM    178  C5   DC I -64      13.564 114.167  20.347  1.00 75.71           C  
ATOM    179  C6   DC I -64      14.414 114.080  21.378  1.00 78.94           C  
ATOM    180  P    DC I -63      17.162 112.028  26.298  1.00 93.33           P  
ATOM    181  OP1  DC I -63      17.595 112.093  27.715  1.00 94.53           O  
ATOM    182  OP2  DC I -63      17.795 111.044  25.381  1.00 93.34           O  
ATOM    183  O5'  DC I -63      15.592 111.799  26.266  1.00 92.83           O  
ATOM    184  C5'  DC I -63      14.737 112.569  27.097  1.00 93.89           C  
ATOM    185  C4'  DC I -63      13.409 111.870  27.234  1.00 95.75           C  
ATOM    186  O4'  DC I -63      12.498 112.286  26.188  1.00 95.29           O  
ATOM    187  C3'  DC I -63      13.542 110.350  27.117  1.00 96.23           C  
ATOM    188  O3'  DC I -63      12.702 109.709  28.072  1.00 97.45           O  
ATOM    189  C2'  DC I -63      13.037 110.069  25.713  1.00 96.59           C  
ATOM    190  C1'  DC I -63      11.969 111.136  25.561  1.00 95.79           C  
ATOM    191  N1   DC I -63      11.608 111.480  24.177  1.00 95.97           N  
ATOM    192  C2   DC I -63      10.359 112.061  23.936  1.00 96.75           C  
ATOM    193  O2   DC I -63       9.618 112.314  24.899  1.00 99.21           O  
ATOM    194  N3   DC I -63       9.989 112.333  22.666  1.00 97.10           N  
ATOM    195  C4   DC I -63      10.818 112.057  21.658  1.00 96.52           C  
ATOM    196  N4   DC I -63      10.403 112.330  20.419  1.00 96.94           N  
ATOM    197  C5   DC I -63      12.107 111.489  21.875  1.00 95.87           C  
ATOM    198  C6   DC I -63      12.459 111.222  23.139  1.00 95.51           C  
ATOM    199  P    DA I -62      13.357 108.826  29.243  1.00 97.52           P  
ATOM    200  OP1  DA I -62      14.407 109.647  29.902  1.00 95.76           O  
ATOM    201  OP2  DA I -62      13.707 107.488  28.697  1.00 97.24           O  
ATOM    202  O5'  DA I -62      12.142 108.654  30.254  1.00 93.46           O  
ATOM    203  C5'  DA I -62      11.423 109.790  30.717  1.00 88.17           C  
ATOM    204  C4'  DA I -62       9.950 109.627  30.428  1.00 86.71           C  
ATOM    205  O4'  DA I -62       9.633 110.008  29.067  1.00 85.62           O  
ATOM    206  C3'  DA I -62       9.420 108.204  30.607  1.00 85.56           C  
ATOM    207  O3'  DA I -62       8.160 108.238  31.275  1.00 83.65           O  
ATOM    208  C2'  DA I -62       9.224 107.722  29.182  1.00 86.05           C  
ATOM    209  C1'  DA I -62       8.821 109.003  28.484  1.00 85.63           C  
ATOM    210  N9   DA I -62       9.051 109.004  27.040  1.00 85.36           N  
ATOM    211  C8   DA I -62      10.183 108.625  26.365  1.00 85.92           C  
ATOM    212  N7   DA I -62      10.081 108.727  25.060  1.00 84.84           N  
ATOM    213  C5   DA I -62       8.793 109.206  24.864  1.00 83.67           C  
ATOM    214  C6   DA I -62       8.068 109.524  23.703  1.00 83.26           C  
ATOM    215  N6   DA I -62       8.556 109.403  22.467  1.00 82.78           N  
ATOM    216  N1   DA I -62       6.807 109.978  23.856  1.00 82.71           N  
ATOM    217  C2   DA I -62       6.317 110.100  25.093  1.00 82.46           C  
ATOM    218  N3   DA I -62       6.896 109.833  26.259  1.00 83.68           N  
ATOM    219  C4   DA I -62       8.149 109.384  26.074  1.00 84.33           C  
ATOM    220  P    DC I -61       7.390 106.870  31.590  1.00 79.50           P  
ATOM    221  OP1  DC I -61       6.889 106.986  32.978  1.00 83.40           O  
ATOM    222  OP2  DC I -61       8.247 105.723  31.215  1.00 81.40           O  
ATOM    223  O5'  DC I -61       6.150 106.919  30.597  1.00 81.62           O  
ATOM    224  C5'  DC I -61       5.287 108.050  30.578  1.00 83.48           C  
ATOM    225  C4'  DC I -61       4.182 107.849  29.568  1.00 86.21           C  
ATOM    226  O4'  DC I -61       4.687 108.010  28.220  1.00 86.71           O  
ATOM    227  C3'  DC I -61       3.521 106.472  29.615  1.00 87.22           C  
ATOM    228  O3'  DC I -61       2.111 106.613  29.433  1.00 89.20           O  
ATOM    229  C2'  DC I -61       4.137 105.745  28.432  1.00 86.73           C  
ATOM    230  C1'  DC I -61       4.323 106.880  27.441  1.00 87.09           C  
ATOM    231  N1   DC I -61       5.371 106.665  26.426  1.00 84.97           N  
ATOM    232  C2   DC I -61       5.053 106.880  25.084  1.00 83.10           C  
ATOM    233  O2   DC I -61       3.908 107.242  24.793  1.00 84.56           O  
ATOM    234  N3   DC I -61       5.998 106.690  24.141  1.00 81.46           N  
ATOM    235  C4   DC I -61       7.222 106.303  24.493  1.00 82.39           C  
ATOM    236  N4   DC I -61       8.124 106.132  23.525  1.00 80.62           N  
ATOM    237  C5   DC I -61       7.577 106.074  25.856  1.00 83.34           C  
ATOM    238  C6   DC I -61       6.629 106.265  26.781  1.00 84.91           C  
ATOM    239  P    DC I -60       1.147 105.356  29.684  1.00 89.57           P  
ATOM    240  OP1  DC I -60      -0.090 105.884  30.303  1.00 92.12           O  
ATOM    241  OP2  DC I -60       1.917 104.293  30.376  1.00 90.40           O  
ATOM    242  O5'  DC I -60       0.807 104.857  28.212  1.00 91.19           O  
ATOM    243  C5'  DC I -60       0.102 105.700  27.309  1.00 95.23           C  
ATOM    244  C4'  DC I -60      -0.120 104.993  25.993  1.00 98.97           C  
ATOM    245  O4'  DC I -60       1.103 104.967  25.215  1.00 99.21           O  
ATOM    246  C3'  DC I -60      -0.580 103.539  26.115  1.00101.73           C  
ATOM    247  O3'  DC I -60      -1.591 103.268  25.140  1.00107.37           O  
ATOM    248  C2'  DC I -60       0.672 102.748  25.783  1.00100.32           C  
ATOM    249  C1'  DC I -60       1.334 103.646  24.754  1.00 98.48           C  
ATOM    250  N1   DC I -60       2.787 103.460  24.588  1.00 95.67           N  
ATOM    251  C2   DC I -60       3.327 103.510  23.298  1.00 95.24           C  
ATOM    252  O2   DC I -60       2.569 103.712  22.337  1.00 96.25           O  
ATOM    253  N3   DC I -60       4.657 103.338  23.129  1.00 93.59           N  
ATOM    254  C4   DC I -60       5.440 103.132  24.187  1.00 92.84           C  
ATOM    255  N4   DC I -60       6.748 102.983  23.976  1.00 90.50           N  
ATOM    256  C5   DC I -60       4.918 103.074  25.512  1.00 93.72           C  
ATOM    257  C6   DC I -60       3.599 103.243  25.664  1.00 94.88           C  
ATOM    258  P    DT I -59      -2.489 101.943  25.268  1.00110.15           P  
ATOM    259  OP1  DT I -59      -3.865 102.376  25.616  1.00111.56           O  
ATOM    260  OP2  DT I -59      -1.782 100.977  26.147  1.00110.40           O  
ATOM    261  O5'  DT I -59      -2.511 101.368  23.781  1.00112.33           O  
ATOM    262  C5'  DT I -59      -2.909 102.198  22.689  1.00115.07           C  
ATOM    263  C4'  DT I -59      -2.530 101.563  21.370  1.00117.25           C  
ATOM    264  O4'  DT I -59      -1.090 101.559  21.211  1.00117.76           O  
ATOM    265  C3'  DT I -59      -2.981 100.113  21.183  1.00118.85           C  
ATOM    266  O3'  DT I -59      -3.415  99.909  19.835  1.00120.71           O  
ATOM    267  C2'  DT I -59      -1.716  99.316  21.438  1.00118.28           C  
ATOM    268  C1'  DT I -59      -0.644 100.246  20.903  1.00117.33           C  
ATOM    269  N1   DT I -59       0.690 100.058  21.510  1.00116.39           N  
ATOM    270  C2   DT I -59       1.769  99.889  20.669  1.00115.78           C  
ATOM    271  O2   DT I -59       1.674  99.876  19.452  1.00115.51           O  
ATOM    272  N3   DT I -59       2.973  99.731  21.310  1.00114.62           N  
ATOM    273  C4   DT I -59       3.198  99.720  22.673  1.00114.43           C  
ATOM    274  O4   DT I -59       4.338  99.575  23.102  1.00114.66           O  
ATOM    275  C5   DT I -59       2.023  99.889  23.494  1.00114.51           C  
ATOM    276  C7   DT I -59       2.170  99.871  24.982  1.00114.20           C  
ATOM    277  C6   DT I -59       0.844 100.053  22.880  1.00114.87           C  
ATOM    278  P    DG I -58      -4.025  98.487  19.400  1.00122.93           P  
ATOM    279  OP1  DG I -58      -5.323  98.749  18.724  1.00122.88           O  
ATOM    280  OP2  DG I -58      -3.978  97.570  20.568  1.00122.46           O  
ATOM    281  O5'  DG I -58      -2.998  97.955  18.306  1.00121.05           O  
ATOM    282  C5'  DG I -58      -2.736  98.710  17.126  1.00120.51           C  
ATOM    283  C4'  DG I -58      -1.751  97.977  16.247  1.00120.01           C  
ATOM    284  O4'  DG I -58      -0.465  97.918  16.910  1.00120.81           O  
ATOM    285  C3'  DG I -58      -2.133  96.530  15.943  1.00119.10           C  
ATOM    286  O3'  DG I -58      -1.750  96.201  14.605  1.00116.91           O  
ATOM    287  C2'  DG I -58      -1.331  95.735  16.955  1.00119.87           C  
ATOM    288  C1'  DG I -58      -0.069  96.566  17.100  1.00120.41           C  
ATOM    289  N9   DG I -58       0.555  96.466  18.415  1.00120.50           N  
ATOM    290  C8   DG I -58      -0.083  96.349  19.627  1.00120.74           C  
ATOM    291  N7   DG I -58       0.741  96.278  20.636  1.00120.92           N  
ATOM    292  C5   DG I -58       2.000  96.353  20.057  1.00120.38           C  
ATOM    293  C6   DG I -58       3.287  96.327  20.653  1.00119.83           C  
ATOM    294  O6   DG I -58       3.580  96.233  21.850  1.00120.20           O  
ATOM    295  N1   DG I -58       4.293  96.426  19.698  1.00119.29           N  
ATOM    296  C2   DG I -58       4.089  96.539  18.345  1.00119.81           C  
ATOM    297  N2   DG I -58       5.191  96.623  17.586  1.00119.45           N  
ATOM    298  N3   DG I -58       2.895  96.567  17.777  1.00120.01           N  
ATOM    299  C4   DG I -58       1.903  96.469  18.687  1.00120.49           C  
ATOM    300  P    DC I -57      -1.654  94.660  14.157  1.00115.77           P  
ATOM    301  OP1  DC I -57      -1.870  94.618  12.687  1.00115.42           O  
ATOM    302  OP2  DC I -57      -2.501  93.826  15.051  1.00115.16           O  
ATOM    303  O5'  DC I -57      -0.133  94.294  14.443  1.00114.23           O  
ATOM    304  C5'  DC I -57       0.917  95.012  13.801  1.00111.34           C  
ATOM    305  C4'  DC I -57       2.204  94.227  13.882  1.00108.76           C  
ATOM    306  O4'  DC I -57       2.697  94.231  15.243  1.00108.07           O  
ATOM    307  C3'  DC I -57       2.052  92.758  13.494  1.00107.59           C  
ATOM    308  O3'  DC I -57       3.227  92.324  12.823  1.00105.42           O  
ATOM    309  C2'  DC I -57       1.943  92.054  14.832  1.00107.66           C  
ATOM    310  C1'  DC I -57       2.858  92.898  15.698  1.00107.25           C  
ATOM    311  N1   DC I -57       2.549  92.870  17.134  1.00106.56           N  
ATOM    312  C2   DC I -57       3.595  92.685  18.036  1.00106.16           C  
ATOM    313  O2   DC I -57       4.745  92.555  17.596  1.00106.19           O  
ATOM    314  N3   DC I -57       3.328  92.655  19.361  1.00105.93           N  
ATOM    315  C4   DC I -57       2.074  92.803  19.791  1.00105.40           C  
ATOM    316  N4   DC I -57       1.857  92.766  21.107  1.00104.49           N  
ATOM    317  C5   DC I -57       0.987  92.994  18.892  1.00105.52           C  
ATOM    318  C6   DC I -57       1.267  93.021  17.583  1.00106.08           C  
ATOM    319  P    DA I -56       3.140  91.119  11.774  1.00104.76           P  
ATOM    320  OP1  DA I -56       2.362  91.608  10.611  1.00106.16           O  
ATOM    321  OP2  DA I -56       2.708  89.889  12.486  1.00104.77           O  
ATOM    322  O5'  DA I -56       4.650  90.945  11.319  1.00103.42           O  
ATOM    323  C5'  DA I -56       5.518  92.072  11.293  1.00 99.19           C  
ATOM    324  C4'  DA I -56       6.753  91.791  12.114  1.00 95.87           C  
ATOM    325  O4'  DA I -56       6.397  91.647  13.512  1.00 94.74           O  
ATOM    326  C3'  DA I -56       7.466  90.502  11.723  1.00 93.23           C  
ATOM    327  O3'  DA I -56       8.873  90.708  11.762  1.00 89.69           O  
ATOM    328  C2'  DA I -56       7.019  89.508  12.781  1.00 92.89           C  
ATOM    329  C1'  DA I -56       6.811  90.382  14.004  1.00 93.47           C  
ATOM    330  N9   DA I -56       5.769  89.896  14.908  1.00 94.04           N  
ATOM    331  C8   DA I -56       4.575  89.310  14.566  1.00 94.32           C  
ATOM    332  N7   DA I -56       3.836  88.976  15.595  1.00 94.70           N  
ATOM    333  C5   DA I -56       4.591  89.366  16.689  1.00 95.06           C  
ATOM    334  C6   DA I -56       4.361  89.286  18.076  1.00 95.76           C  
ATOM    335  N6   DA I -56       3.254  88.767  18.616  1.00 95.60           N  
ATOM    336  N1   DA I -56       5.319  89.763  18.899  1.00 95.19           N  
ATOM    337  C2   DA I -56       6.428  90.283  18.356  1.00 95.96           C  
ATOM    338  N3   DA I -56       6.759  90.415  17.071  1.00 95.38           N  
ATOM    339  C4   DA I -56       5.787  89.932  16.281  1.00 94.52           C  
ATOM    340  P    DG I -55       9.858  89.547  11.264  1.00 88.80           P  
ATOM    341  OP1  DG I -55      10.807  90.164  10.301  1.00 88.06           O  
ATOM    342  OP2  DG I -55       9.052  88.369  10.852  1.00 88.61           O  
ATOM    343  O5'  DG I -55      10.643  89.176  12.595  1.00 81.63           O  
ATOM    344  C5'  DG I -55      11.006  90.202  13.502  1.00 73.40           C  
ATOM    345  C4'  DG I -55      11.160  89.642  14.894  1.00 68.47           C  
ATOM    346  O4'  DG I -55       9.874  89.283  15.453  1.00 68.68           O  
ATOM    347  C3'  DG I -55      12.036  88.397  15.006  1.00 65.29           C  
ATOM    348  O3'  DG I -55      12.858  88.554  16.157  1.00 59.81           O  
ATOM    349  C2'  DG I -55      11.032  87.278  15.228  1.00 65.89           C  
ATOM    350  C1'  DG I -55       9.964  87.993  16.029  1.00 68.62           C  
ATOM    351  N9   DG I -55       8.637  87.387  15.992  1.00 71.95           N  
ATOM    352  C8   DG I -55       7.964  86.929  14.887  1.00 73.39           C  
ATOM    353  N7   DG I -55       6.789  86.440  15.171  1.00 73.18           N  
ATOM    354  C5   DG I -55       6.678  86.585  16.545  1.00 74.12           C  
ATOM    355  C6   DG I -55       5.621  86.240  17.419  1.00 75.79           C  
ATOM    356  O6   DG I -55       4.533  85.726  17.143  1.00 79.41           O  
ATOM    357  N1   DG I -55       5.924  86.555  18.739  1.00 75.98           N  
ATOM    358  C2   DG I -55       7.094  87.132  19.162  1.00 75.01           C  
ATOM    359  N2   DG I -55       7.206  87.349  20.482  1.00 75.16           N  
ATOM    360  N3   DG I -55       8.084  87.468  18.354  1.00 74.22           N  
ATOM    361  C4   DG I -55       7.811  87.165  17.068  1.00 73.05           C  
ATOM    362  P    DA I -54      13.974  87.463  16.504  1.00 58.07           P  
ATOM    363  OP1  DA I -54      15.218  88.245  16.687  1.00 54.84           O  
ATOM    364  OP2  DA I -54      13.947  86.346  15.532  1.00 54.47           O  
ATOM    365  O5'  DA I -54      13.485  86.902  17.912  1.00 58.22           O  
ATOM    366  C5'  DA I -54      13.152  87.803  18.969  1.00 65.23           C  
ATOM    367  C4'  DA I -54      12.570  87.057  20.149  1.00 69.79           C  
ATOM    368  O4'  DA I -54      11.202  86.664  19.888  1.00 69.84           O  
ATOM    369  C3'  DA I -54      13.309  85.782  20.555  1.00 72.85           C  
ATOM    370  O3'  DA I -54      13.367  85.698  21.982  1.00 77.90           O  
ATOM    371  C2'  DA I -54      12.423  84.678  20.002  1.00 70.95           C  
ATOM    372  C1'  DA I -54      11.043  85.283  20.168  1.00 72.86           C  
ATOM    373  N9   DA I -54       9.999  84.765  19.281  1.00 76.04           N  
ATOM    374  C8   DA I -54      10.031  84.620  17.916  1.00 76.88           C  
ATOM    375  N7   DA I -54       8.915  84.161  17.407  1.00 77.58           N  
ATOM    376  C5   DA I -54       8.094  83.982  18.511  1.00 79.15           C  
ATOM    377  C6   DA I -54       6.765  83.525  18.645  1.00 81.05           C  
ATOM    378  N6   DA I -54       5.998  83.159  17.614  1.00 80.85           N  
ATOM    379  N1   DA I -54       6.244  83.464  19.889  1.00 80.04           N  
ATOM    380  C2   DA I -54       7.009  83.842  20.922  1.00 80.94           C  
ATOM    381  N3   DA I -54       8.264  84.292  20.923  1.00 80.22           N  
ATOM    382  C4   DA I -54       8.753  84.339  19.672  1.00 77.94           C  
ATOM    383  P    DT I -53      14.556  84.879  22.685  1.00 82.08           P  
ATOM    384  OP1  DT I -53      15.527  85.828  23.293  1.00 80.00           O  
ATOM    385  OP2  DT I -53      15.035  83.864  21.715  1.00 81.76           O  
ATOM    386  O5'  DT I -53      13.814  84.111  23.864  1.00 86.03           O  
ATOM    387  C5'  DT I -53      12.944  84.810  24.741  1.00 91.46           C  
ATOM    388  C4'  DT I -53      11.795  83.921  25.154  1.00 96.79           C  
ATOM    389  O4'  DT I -53      10.986  83.588  23.996  1.00 97.63           O  
ATOM    390  C3'  DT I -53      12.193  82.586  25.788  1.00100.33           C  
ATOM    391  O3'  DT I -53      11.316  82.316  26.892  1.00105.47           O  
ATOM    392  C2'  DT I -53      11.987  81.590  24.660  1.00 99.52           C  
ATOM    393  C1'  DT I -53      10.783  82.184  23.960  1.00 98.52           C  
ATOM    394  N1   DT I -53      10.595  81.775  22.554  1.00 98.82           N  
ATOM    395  C2   DT I -53       9.314  81.475  22.147  1.00 97.90           C  
ATOM    396  O2   DT I -53       8.354  81.508  22.897  1.00 98.29           O  
ATOM    397  N3   DT I -53       9.198  81.127  20.824  1.00 97.52           N  
ATOM    398  C4   DT I -53      10.216  81.040  19.891  1.00 98.12           C  
ATOM    399  O4   DT I -53       9.959  80.723  18.731  1.00 98.22           O  
ATOM    400  C5   DT I -53      11.539  81.348  20.392  1.00 97.74           C  
ATOM    401  C7   DT I -53      12.704  81.259  19.459  1.00 97.54           C  
ATOM    402  C6   DT I -53      11.660  81.699  21.680  1.00 98.53           C  
ATOM    403  P    DT I -52      10.995  80.799  27.316  1.00108.78           P  
ATOM    404  OP1  DT I -52      10.559  80.807  28.735  1.00109.22           O  
ATOM    405  OP2  DT I -52      12.147  79.954  26.908  1.00109.39           O  
ATOM    406  O5'  DT I -52       9.730  80.424  26.423  1.00110.66           O  
ATOM    407  C5'  DT I -52       8.513  81.161  26.557  1.00114.96           C  
ATOM    408  C4'  DT I -52       7.332  80.221  26.608  1.00117.40           C  
ATOM    409  O4'  DT I -52       6.998  79.768  25.275  1.00117.52           O  
ATOM    410  C3'  DT I -52       7.571  78.962  27.438  1.00119.07           C  
ATOM    411  O3'  DT I -52       6.389  78.605  28.158  1.00121.33           O  
ATOM    412  C2'  DT I -52       7.909  77.914  26.393  1.00118.72           C  
ATOM    413  C1'  DT I -52       7.074  78.352  25.200  1.00117.84           C  
ATOM    414  N1   DT I -52       7.658  78.009  23.889  1.00117.61           N  
ATOM    415  C2   DT I -52       6.802  77.645  22.874  1.00117.04           C  
ATOM    416  O2   DT I -52       5.593  77.575  23.017  1.00116.61           O  
ATOM    417  N3   DT I -52       7.417  77.365  21.679  1.00116.67           N  
ATOM    418  C4   DT I -52       8.773  77.407  21.407  1.00116.55           C  
ATOM    419  O4   DT I -52       9.180  77.137  20.280  1.00116.23           O  
ATOM    420  C5   DT I -52       9.614  77.783  22.521  1.00116.48           C  
ATOM    421  C7   DT I -52      11.096  77.844  22.324  1.00116.47           C  
ATOM    422  C6   DT I -52       9.022  78.061  23.690  1.00116.72           C  
ATOM    423  P    DC I -51       6.336  77.211  28.952  1.00123.58           P  
ATOM    424  OP1  DC I -51       5.137  77.211  29.830  1.00123.69           O  
ATOM    425  OP2  DC I -51       7.678  76.977  29.542  1.00123.26           O  
ATOM    426  O5'  DC I -51       6.112  76.142  27.794  1.00124.53           O  
ATOM    427  C5'  DC I -51       6.443  74.773  27.986  1.00126.00           C  
ATOM    428  C4'  DC I -51       5.477  73.897  27.224  1.00126.44           C  
ATOM    429  O4'  DC I -51       5.512  74.244  25.818  1.00126.56           O  
ATOM    430  C3'  DC I -51       5.787  72.403  27.297  1.00127.22           C  
ATOM    431  O3'  DC I -51       4.567  71.667  27.397  1.00129.01           O  
ATOM    432  C2'  DC I -51       6.484  72.121  25.980  1.00126.63           C  
ATOM    433  C1'  DC I -51       5.794  73.090  25.041  1.00126.22           C  
ATOM    434  N1   DC I -51       6.611  73.499  23.888  1.00125.38           N  
ATOM    435  C2   DC I -51       6.008  73.568  22.627  1.00125.04           C  
ATOM    436  O2   DC I -51       4.801  73.302  22.524  1.00124.77           O  
ATOM    437  N3   DC I -51       6.753  73.922  21.556  1.00124.57           N  
ATOM    438  C4   DC I -51       8.049  74.203  21.708  1.00124.28           C  
ATOM    439  N4   DC I -51       8.747  74.538  20.621  1.00123.86           N  
ATOM    440  C5   DC I -51       8.687  74.150  22.982  1.00124.09           C  
ATOM    441  C6   DC I -51       7.938  73.799  24.035  1.00124.58           C  
ATOM    442  P    DT I -50       4.569  70.088  27.122  1.00129.51           P  
ATOM    443  OP1  DT I -50       3.400  69.491  27.815  1.00129.81           O  
ATOM    444  OP2  DT I -50       5.933  69.581  27.411  1.00129.52           O  
ATOM    445  O5'  DT I -50       4.324  69.988  25.554  1.00131.56           O  
ATOM    446  C5'  DT I -50       3.002  69.900  25.029  1.00134.53           C  
ATOM    447  C4'  DT I -50       2.908  68.726  24.086  1.00136.57           C  
ATOM    448  O4'  DT I -50       3.623  69.035  22.864  1.00136.98           O  
ATOM    449  C3'  DT I -50       3.557  67.464  24.652  1.00137.88           C  
ATOM    450  O3'  DT I -50       2.812  66.300  24.297  1.00139.24           O  
ATOM    451  C2'  DT I -50       4.930  67.451  24.007  1.00137.83           C  
ATOM    452  C1'  DT I -50       4.678  68.107  22.660  1.00137.33           C  
ATOM    453  N1   DT I -50       5.839  68.850  22.130  1.00137.24           N  
ATOM    454  C2   DT I -50       5.832  69.212  20.802  1.00137.31           C  
ATOM    455  O2   DT I -50       4.904  68.969  20.050  1.00137.32           O  
ATOM    456  N3   DT I -50       6.958  69.877  20.386  1.00137.58           N  
ATOM    457  C4   DT I -50       8.061  70.213  21.149  1.00137.74           C  
ATOM    458  O4   DT I -50       9.006  70.805  20.633  1.00137.78           O  
ATOM    459  C5   DT I -50       7.994  69.817  22.537  1.00137.48           C  
ATOM    460  C7   DT I -50       9.135  70.151  23.445  1.00137.16           C  
ATOM    461  C6   DT I -50       6.903  69.162  22.950  1.00137.21           C  
ATOM    462  P    DA I -49       3.496  64.854  24.426  1.00140.68           P  
ATOM    463  OP1  DA I -49       2.425  63.839  24.600  1.00141.38           O  
ATOM    464  OP2  DA I -49       4.587  64.951  25.432  1.00140.31           O  
ATOM    465  O5'  DA I -49       4.159  64.642  22.996  1.00140.45           O  
ATOM    466  C5'  DA I -49       3.374  64.757  21.813  1.00140.85           C  
ATOM    467  C4'  DA I -49       4.145  64.223  20.630  1.00141.09           C  
ATOM    468  O4'  DA I -49       5.239  65.121  20.329  1.00141.47           O  
ATOM    469  C3'  DA I -49       4.776  62.855  20.882  1.00141.25           C  
ATOM    470  O3'  DA I -49       4.726  62.064  19.695  1.00140.70           O  
ATOM    471  C2'  DA I -49       6.208  63.192  21.251  1.00141.65           C  
ATOM    472  C1'  DA I -49       6.479  64.436  20.424  1.00142.02           C  
ATOM    473  N9   DA I -49       7.449  65.348  21.029  1.00142.80           N  
ATOM    474  C8   DA I -49       7.617  65.638  22.361  1.00143.04           C  
ATOM    475  N7   DA I -49       8.583  66.492  22.598  1.00143.02           N  
ATOM    476  C5   DA I -49       9.083  66.787  21.338  1.00143.20           C  
ATOM    477  C6   DA I -49      10.122  67.628  20.907  1.00143.47           C  
ATOM    478  N6   DA I -49      10.877  68.356  21.734  1.00143.52           N  
ATOM    479  N1   DA I -49      10.365  67.697  19.580  1.00143.48           N  
ATOM    480  C2   DA I -49       9.609  66.965  18.751  1.00143.60           C  
ATOM    481  N3   DA I -49       8.607  66.136  19.036  1.00143.56           N  
ATOM    482  C4   DA I -49       8.392  66.092  20.362  1.00143.14           C  
ATOM    483  P    DC I -48       5.449  60.631  19.664  1.00140.22           P  
ATOM    484  OP1  DC I -48       4.525  59.688  18.984  1.00140.25           O  
ATOM    485  OP2  DC I -48       5.949  60.315  21.026  1.00140.01           O  
ATOM    486  O5'  DC I -48       6.699  60.880  18.711  1.00139.35           O  
ATOM    487  C5'  DC I -48       6.507  61.389  17.393  1.00138.25           C  
ATOM    488  C4'  DC I -48       7.811  61.391  16.632  1.00137.12           C  
ATOM    489  O4'  DC I -48       8.655  62.485  17.067  1.00137.00           O  
ATOM    490  C3'  DC I -48       8.644  60.118  16.788  1.00136.10           C  
ATOM    491  O3'  DC I -48       9.213  59.761  15.525  1.00134.34           O  
ATOM    492  C2'  DC I -48       9.727  60.531  17.771  1.00136.19           C  
ATOM    493  C1'  DC I -48       9.941  61.988  17.399  1.00136.62           C  
ATOM    494  N1   DC I -48      10.499  62.841  18.464  1.00136.65           N  
ATOM    495  C2   DC I -48      11.552  63.710  18.148  1.00136.23           C  
ATOM    496  O2   DC I -48      11.984  63.734  16.986  1.00136.06           O  
ATOM    497  N3   DC I -48      12.070  64.501  19.115  1.00135.95           N  
ATOM    498  C4   DC I -48      11.581  64.446  20.355  1.00136.56           C  
ATOM    499  N4   DC I -48      12.123  65.246  21.277  1.00136.34           N  
ATOM    500  C5   DC I -48      10.512  63.568  20.706  1.00136.47           C  
ATOM    501  C6   DC I -48      10.006  62.791  19.739  1.00136.70           C  
ATOM    502  P    DC I -47      10.008  58.375  15.371  1.00133.10           P  
ATOM    503  OP1  DC I -47       9.443  57.625  14.221  1.00133.47           O  
ATOM    504  OP2  DC I -47      10.057  57.737  16.712  1.00132.87           O  
ATOM    505  O5'  DC I -47      11.482  58.844  14.997  1.00131.34           O  
ATOM    506  C5'  DC I -47      12.077  59.940  15.682  1.00128.33           C  
ATOM    507  C4'  DC I -47      13.558  59.998  15.400  1.00125.62           C  
ATOM    508  O4'  DC I -47      14.127  61.026  16.242  1.00125.22           O  
ATOM    509  C3'  DC I -47      14.296  58.713  15.759  1.00124.13           C  
ATOM    510  O3'  DC I -47      15.423  58.551  14.899  1.00121.90           O  
ATOM    511  C2'  DC I -47      14.733  58.952  17.191  1.00124.51           C  
ATOM    512  C1'  DC I -47      14.980  60.453  17.224  1.00124.67           C  
ATOM    513  N1   DC I -47      14.664  61.091  18.513  1.00124.19           N  
ATOM    514  C2   DC I -47      15.054  62.413  18.715  1.00123.15           C  
ATOM    515  O2   DC I -47      15.652  63.002  17.806  1.00122.93           O  
ATOM    516  N3   DC I -47      14.770  63.015  19.892  1.00122.44           N  
ATOM    517  C4   DC I -47      14.120  62.344  20.844  1.00122.35           C  
ATOM    518  N4   DC I -47      13.858  62.977  21.989  1.00121.36           N  
ATOM    519  C5   DC I -47      13.709  60.992  20.665  1.00123.38           C  
ATOM    520  C6   DC I -47      14.000  60.409  19.495  1.00123.90           C  
ATOM    521  P    DA I -46      15.476  57.306  13.887  1.00120.63           P  
ATOM    522  OP1  DA I -46      14.186  57.290  13.154  1.00120.95           O  
ATOM    523  OP2  DA I -46      15.911  56.099  14.638  1.00120.51           O  
ATOM    524  O5'  DA I -46      16.622  57.705  12.858  1.00119.17           O  
ATOM    525  C5'  DA I -46      16.509  58.883  12.062  1.00115.31           C  
ATOM    526  C4'  DA I -46      17.693  59.790  12.303  1.00112.07           C  
ATOM    527  O4'  DA I -46      17.676  60.241  13.678  1.00111.83           O  
ATOM    528  C3'  DA I -46      19.055  59.132  12.098  1.00110.30           C  
ATOM    529  O3'  DA I -46      19.963  60.095  11.568  1.00107.92           O  
ATOM    530  C2'  DA I -46      19.468  58.737  13.504  1.00110.83           C  
ATOM    531  C1'  DA I -46      18.872  59.853  14.340  1.00111.78           C  
ATOM    532  N9   DA I -46      18.518  59.464  15.706  1.00112.98           N  
ATOM    533  C8   DA I -46      18.221  58.211  16.178  1.00113.10           C  
ATOM    534  N7   DA I -46      17.917  58.184  17.453  1.00113.59           N  
ATOM    535  C5   DA I -46      18.026  59.509  17.850  1.00113.54           C  
ATOM    536  C6   DA I -46      17.825  60.147  19.087  1.00113.98           C  
ATOM    537  N6   DA I -46      17.443  59.511  20.197  1.00114.30           N  
ATOM    538  N1   DA I -46      18.028  61.480  19.145  1.00114.19           N  
ATOM    539  C2   DA I -46      18.401  62.120  18.031  1.00114.29           C  
ATOM    540  N3   DA I -46      18.612  61.635  16.811  1.00114.26           N  
ATOM    541  C4   DA I -46      18.405  60.308  16.786  1.00113.89           C  
ATOM    542  P    DA I -45      21.438  59.645  11.127  1.00106.61           P  
ATOM    543  OP1  DA I -45      21.565  59.889   9.667  1.00106.28           O  
ATOM    544  OP2  DA I -45      21.723  58.293  11.676  1.00106.12           O  
ATOM    545  O5'  DA I -45      22.362  60.699  11.872  1.00104.98           O  
ATOM    546  C5'  DA I -45      21.912  62.035  12.073  1.00101.47           C  
ATOM    547  C4'  DA I -45      22.509  62.594  13.341  1.00 98.25           C  
ATOM    548  O4'  DA I -45      21.911  61.957  14.500  1.00 96.80           O  
ATOM    549  C3'  DA I -45      24.012  62.346  13.449  1.00 96.17           C  
ATOM    550  O3'  DA I -45      24.653  63.485  14.021  1.00 93.27           O  
ATOM    551  C2'  DA I -45      24.099  61.148  14.378  1.00 96.71           C  
ATOM    552  C1'  DA I -45      22.935  61.408  15.315  1.00 97.55           C  
ATOM    553  N9   DA I -45      22.401  60.225  15.994  1.00 98.84           N  
ATOM    554  C8   DA I -45      22.295  58.942  15.518  1.00 99.19           C  
ATOM    555  N7   DA I -45      21.778  58.099  16.381  1.00 99.01           N  
ATOM    556  C5   DA I -45      21.526  58.880  17.500  1.00 99.20           C  
ATOM    557  C6   DA I -45      20.980  58.581  18.762  1.00 99.54           C  
ATOM    558  N6   DA I -45      20.570  57.366  19.126  1.00 99.46           N  
ATOM    559  N1   DA I -45      20.868  59.589  19.652  1.00 99.75           N  
ATOM    560  C2   DA I -45      21.278  60.809  19.291  1.00 99.69           C  
ATOM    561  N3   DA I -45      21.806  61.214  18.139  1.00 99.44           N  
ATOM    562  C4   DA I -45      21.904  60.191  17.276  1.00 98.91           C  
ATOM    563  P    DA I -44      26.240  63.657  13.873  1.00 90.58           P  
ATOM    564  OP1  DA I -44      26.536  65.069  13.507  1.00 91.62           O  
ATOM    565  OP2  DA I -44      26.718  62.554  13.005  1.00 93.41           O  
ATOM    566  O5'  DA I -44      26.776  63.394  15.342  1.00 88.11           O  
ATOM    567  C5'  DA I -44      25.967  62.704  16.272  1.00 85.99           C  
ATOM    568  C4'  DA I -44      25.772  63.532  17.518  1.00 83.83           C  
ATOM    569  O4'  DA I -44      24.851  62.818  18.364  1.00 82.88           O  
ATOM    570  C3'  DA I -44      27.043  63.684  18.339  1.00 82.84           C  
ATOM    571  O3'  DA I -44      27.014  64.889  19.103  1.00 81.09           O  
ATOM    572  C2'  DA I -44      27.029  62.457  19.228  1.00 83.38           C  
ATOM    573  C1'  DA I -44      25.552  62.106  19.371  1.00 83.94           C  
ATOM    574  N9   DA I -44      25.287  60.686  19.147  1.00 85.30           N  
ATOM    575  C8   DA I -44      25.673  59.937  18.063  1.00 85.23           C  
ATOM    576  N7   DA I -44      25.283  58.690  18.117  1.00 84.96           N  
ATOM    577  C5   DA I -44      24.597  58.609  19.319  1.00 85.92           C  
ATOM    578  C6   DA I -44      23.942  57.550  19.959  1.00 86.18           C  
ATOM    579  N6   DA I -44      23.862  56.319  19.452  1.00 87.95           N  
ATOM    580  N1   DA I -44      23.362  57.800  21.153  1.00 87.05           N  
ATOM    581  C2   DA I -44      23.441  59.036  21.657  1.00 86.10           C  
ATOM    582  N3   DA I -44      24.028  60.115  21.149  1.00 86.16           N  
ATOM    583  C4   DA I -44      24.595  59.831  19.965  1.00 85.24           C  
ATOM    584  P    DA I -43      28.341  65.372  19.864  1.00 79.15           P  
ATOM    585  OP1  DA I -43      28.137  66.787  20.271  1.00 80.08           O  
ATOM    586  OP2  DA I -43      29.505  64.998  19.016  1.00 79.88           O  
ATOM    587  O5'  DA I -43      28.369  64.483  21.172  1.00 72.17           O  
ATOM    588  C5'  DA I -43      27.332  64.616  22.117  1.00 70.81           C  
ATOM    589  C4'  DA I -43      27.472  63.580  23.200  1.00 67.78           C  
ATOM    590  O4'  DA I -43      26.952  62.300  22.769  1.00 68.74           O  
ATOM    591  C3'  DA I -43      28.893  63.333  23.704  1.00 66.18           C  
ATOM    592  O3'  DA I -43      28.859  63.436  25.122  1.00 62.96           O  
ATOM    593  C2'  DA I -43      29.196  61.912  23.246  1.00 68.59           C  
ATOM    594  C1'  DA I -43      27.817  61.273  23.202  1.00 68.20           C  
ATOM    595  N9   DA I -43      27.671  60.149  22.276  1.00 69.99           N  
ATOM    596  C8   DA I -43      28.062  60.077  20.965  1.00 70.34           C  
ATOM    597  N7   DA I -43      27.799  58.926  20.394  1.00 69.98           N  
ATOM    598  C5   DA I -43      27.195  58.187  21.400  1.00 69.82           C  
ATOM    599  C6   DA I -43      26.678  56.878  21.433  1.00 68.32           C  
ATOM    600  N6   DA I -43      26.709  56.045  20.398  1.00 65.90           N  
ATOM    601  N1   DA I -43      26.125  56.451  22.585  1.00 69.14           N  
ATOM    602  C2   DA I -43      26.104  57.287  23.633  1.00 70.94           C  
ATOM    603  N3   DA I -43      26.565  58.532  23.730  1.00 70.30           N  
ATOM    604  C4   DA I -43      27.103  58.929  22.564  1.00 70.50           C  
ATOM    605  P    DG I -42      30.153  63.100  25.991  1.00 58.67           P  
ATOM    606  OP1  DG I -42      30.208  64.114  27.071  1.00 61.55           O  
ATOM    607  OP2  DG I -42      31.321  62.903  25.105  1.00 61.42           O  
ATOM    608  O5'  DG I -42      29.754  61.713  26.645  1.00 63.19           O  
ATOM    609  C5'  DG I -42      28.437  61.517  27.159  1.00 67.61           C  
ATOM    610  C4'  DG I -42      28.272  60.097  27.645  1.00 70.84           C  
ATOM    611  O4'  DG I -42      28.111  59.194  26.527  1.00 70.67           O  
ATOM    612  C3'  DG I -42      29.470  59.582  28.437  1.00 73.13           C  
ATOM    613  O3'  DG I -42      29.021  58.793  29.530  1.00 77.12           O  
ATOM    614  C2'  DG I -42      30.210  58.717  27.434  1.00 72.66           C  
ATOM    615  C1'  DG I -42      29.068  58.155  26.616  1.00 73.33           C  
ATOM    616  N9   DG I -42      29.423  57.761  25.260  1.00 76.57           N  
ATOM    617  C8   DG I -42      30.053  58.522  24.306  1.00 77.95           C  
ATOM    618  N7   DG I -42      30.216  57.891  23.175  1.00 78.78           N  
ATOM    619  C5   DG I -42      29.667  56.637  23.400  1.00 78.82           C  
ATOM    620  C6   DG I -42      29.551  55.518  22.541  1.00 77.82           C  
ATOM    621  O6   DG I -42      29.929  55.403  21.371  1.00 77.59           O  
ATOM    622  N1   DG I -42      28.918  54.455  23.172  1.00 78.96           N  
ATOM    623  C2   DG I -42      28.455  54.465  24.465  1.00 79.48           C  
ATOM    624  N2   DG I -42      27.858  53.344  24.894  1.00 79.55           N  
ATOM    625  N3   DG I -42      28.565  55.498  25.278  1.00 78.50           N  
ATOM    626  C4   DG I -42      29.174  56.543  24.683  1.00 78.09           C  
ATOM    627  P    DT I -41      30.072  58.296  30.627  1.00 80.97           P  
ATOM    628  OP1  DT I -41      29.555  58.732  31.948  1.00 80.78           O  
ATOM    629  OP2  DT I -41      31.439  58.683  30.207  1.00 81.06           O  
ATOM    630  O5'  DT I -41      29.985  56.712  30.523  1.00 86.96           O  
ATOM    631  C5'  DT I -41      28.764  56.024  30.766  1.00 92.38           C  
ATOM    632  C4'  DT I -41      28.993  54.534  30.677  1.00 97.26           C  
ATOM    633  O4'  DT I -41      29.109  54.135  29.289  1.00 98.25           O  
ATOM    634  C3'  DT I -41      30.283  54.081  31.360  1.00 99.82           C  
ATOM    635  O3'  DT I -41      30.077  52.866  32.077  1.00104.07           O  
ATOM    636  C2'  DT I -41      31.246  53.866  30.206  1.00 98.62           C  
ATOM    637  C1'  DT I -41      30.323  53.429  29.085  1.00 98.16           C  
ATOM    638  N1   DT I -41      30.818  53.751  27.731  1.00 98.42           N  
ATOM    639  C2   DT I -41      30.529  52.877  26.706  1.00 98.31           C  
ATOM    640  O2   DT I -41      29.866  51.863  26.858  1.00 98.35           O  
ATOM    641  N3   DT I -41      31.046  53.239  25.486  1.00 98.02           N  
ATOM    642  C4   DT I -41      31.796  54.362  25.194  1.00 97.83           C  
ATOM    643  O4   DT I -41      32.193  54.552  24.049  1.00 97.70           O  
ATOM    644  C5   DT I -41      32.049  55.240  26.310  1.00 98.29           C  
ATOM    645  C7   DT I -41      32.844  56.488  26.085  1.00 98.05           C  
ATOM    646  C6   DT I -41      31.555  54.895  27.506  1.00 98.83           C  
ATOM    647  P    DG I -40      31.342  52.058  32.643  1.00107.47           P  
ATOM    648  OP1  DG I -40      30.901  51.294  33.835  1.00108.47           O  
ATOM    649  OP2  DG I -40      32.488  52.997  32.758  1.00106.46           O  
ATOM    650  O5'  DG I -40      31.658  51.037  31.464  1.00109.88           O  
ATOM    651  C5'  DG I -40      30.614  50.250  30.894  1.00113.46           C  
ATOM    652  C4'  DG I -40      31.198  49.176  30.008  1.00116.09           C  
ATOM    653  O4'  DG I -40      31.644  49.747  28.753  1.00116.53           O  
ATOM    654  C3'  DG I -40      32.413  48.474  30.613  1.00117.68           C  
ATOM    655  O3'  DG I -40      32.373  47.075  30.327  1.00119.91           O  
ATOM    656  C2'  DG I -40      33.586  49.127  29.905  1.00117.17           C  
ATOM    657  C1'  DG I -40      33.005  49.411  28.533  1.00116.76           C  
ATOM    658  N9   DG I -40      33.633  50.518  27.821  1.00116.45           N  
ATOM    659  C8   DG I -40      34.065  51.711  28.348  1.00116.44           C  
ATOM    660  N7   DG I -40      34.593  52.503  27.456  1.00116.69           N  
ATOM    661  C5   DG I -40      34.503  51.792  26.268  1.00116.67           C  
ATOM    662  C6   DG I -40      34.911  52.139  24.955  1.00116.93           C  
ATOM    663  O6   DG I -40      35.451  53.180  24.566  1.00117.06           O  
ATOM    664  N1   DG I -40      34.632  51.122  24.048  1.00117.67           N  
ATOM    665  C2   DG I -40      34.035  49.925  24.361  1.00117.44           C  
ATOM    666  N2   DG I -40      33.847  49.071  23.343  1.00117.42           N  
ATOM    667  N3   DG I -40      33.650  49.590  25.580  1.00117.07           N  
ATOM    668  C4   DG I -40      33.912  50.564  26.477  1.00116.81           C  
ATOM    669  P    DT I -39      33.500  46.113  30.940  1.00121.54           P  
ATOM    670  OP1  DT I -39      32.865  44.823  31.312  1.00122.11           O  
ATOM    671  OP2  DT I -39      34.242  46.890  31.966  1.00121.48           O  
ATOM    672  O5'  DT I -39      34.483  45.864  29.714  1.00122.21           O  
ATOM    673  C5'  DT I -39      35.821  45.428  29.928  1.00122.92           C  
ATOM    674  C4'  DT I -39      36.324  44.692  28.709  1.00123.59           C  
ATOM    675  O4'  DT I -39      36.164  45.536  27.544  1.00123.12           O  
ATOM    676  C3'  DT I -39      37.805  44.323  28.765  1.00124.24           C  
ATOM    677  O3'  DT I -39      38.020  43.048  28.154  1.00124.52           O  
ATOM    678  C2'  DT I -39      38.470  45.425  27.960  1.00124.14           C  
ATOM    679  C1'  DT I -39      37.420  45.736  26.910  1.00123.76           C  
ATOM    680  N1   DT I -39      37.464  47.124  26.416  1.00123.48           N  
ATOM    681  C2   DT I -39      37.585  47.329  25.061  1.00123.54           C  
ATOM    682  O2   DT I -39      37.659  46.418  24.253  1.00123.84           O  
ATOM    683  N3   DT I -39      37.619  48.648  24.685  1.00123.29           N  
ATOM    684  C4   DT I -39      37.550  49.754  25.509  1.00123.16           C  
ATOM    685  O4   DT I -39      37.597  50.880  25.026  1.00123.21           O  
ATOM    686  C5   DT I -39      37.426  49.465  26.919  1.00123.42           C  
ATOM    687  C7   DT I -39      37.349  50.600  27.890  1.00123.72           C  
ATOM    688  C6   DT I -39      37.388  48.181  27.296  1.00123.41           C  
ATOM    689  P    DA I -38      39.507  42.607  27.745  1.00125.09           P  
ATOM    690  OP1  DA I -38      39.509  41.137  27.535  1.00125.50           O  
ATOM    691  OP2  DA I -38      40.456  43.211  28.718  1.00125.28           O  
ATOM    692  O5'  DA I -38      39.723  43.308  26.333  1.00124.59           O  
ATOM    693  C5'  DA I -38      38.999  42.873  25.185  1.00123.52           C  
ATOM    694  C4'  DA I -38      39.793  43.165  23.935  1.00123.23           C  
ATOM    695  O4'  DA I -38      39.790  44.591  23.685  1.00123.64           O  
ATOM    696  C3'  DA I -38      41.262  42.756  24.032  1.00122.39           C  
ATOM    697  O3'  DA I -38      41.723  42.244  22.777  1.00120.59           O  
ATOM    698  C2'  DA I -38      41.965  44.054  24.388  1.00122.96           C  
ATOM    699  C1'  DA I -38      41.120  45.091  23.670  1.00123.66           C  
ATOM    700  N9   DA I -38      41.110  46.403  24.316  1.00123.96           N  
ATOM    701  C8   DA I -38      40.809  46.688  25.624  1.00124.21           C  
ATOM    702  N7   DA I -38      40.876  47.964  25.916  1.00124.01           N  
ATOM    703  C5   DA I -38      41.249  48.560  24.719  1.00124.04           C  
ATOM    704  C6   DA I -38      41.489  49.898  24.365  1.00124.24           C  
ATOM    705  N6   DA I -38      41.378  50.920  25.217  1.00124.64           N  
ATOM    706  N1   DA I -38      41.850  50.155  23.089  1.00124.06           N  
ATOM    707  C2   DA I -38      41.955  49.129  22.236  1.00124.22           C  
ATOM    708  N3   DA I -38      41.752  47.830  22.448  1.00124.47           N  
ATOM    709  C4   DA I -38      41.398  47.610  23.726  1.00124.09           C  
ATOM    710  P    DT I -37      43.298  42.053  22.525  1.00119.45           P  
ATOM    711  OP1  DT I -37      43.482  41.027  21.468  1.00119.03           O  
ATOM    712  OP2  DT I -37      43.959  41.878  23.844  1.00119.30           O  
ATOM    713  O5'  DT I -37      43.742  43.460  21.930  1.00117.23           O  
ATOM    714  C5'  DT I -37      43.182  43.929  20.708  1.00114.08           C  
ATOM    715  C4'  DT I -37      44.114  44.918  20.051  1.00112.04           C  
ATOM    716  O4'  DT I -37      43.984  46.220  20.671  1.00111.46           O  
ATOM    717  C3'  DT I -37      45.594  44.548  20.132  1.00109.91           C  
ATOM    718  O3'  DT I -37      46.217  44.790  18.868  1.00106.90           O  
ATOM    719  C2'  DT I -37      46.129  45.465  21.219  1.00110.38           C  
ATOM    720  C1'  DT I -37      45.260  46.699  21.062  1.00110.46           C  
ATOM    721  N1   DT I -37      45.086  47.497  22.292  1.00109.56           N  
ATOM    722  C2   DT I -37      45.241  48.866  22.209  1.00109.00           C  
ATOM    723  O2   DT I -37      45.524  49.446  21.172  1.00108.24           O  
ATOM    724  N3   DT I -37      45.050  49.537  23.391  1.00108.44           N  
ATOM    725  C4   DT I -37      44.727  48.991  24.620  1.00108.86           C  
ATOM    726  O4   DT I -37      44.576  49.724  25.597  1.00107.02           O  
ATOM    727  C5   DT I -37      44.588  47.550  24.637  1.00109.20           C  
ATOM    728  C7   DT I -37      44.247  46.870  25.925  1.00108.80           C  
ATOM    729  C6   DT I -37      44.773  46.886  23.487  1.00109.16           C  
ATOM    730  P    DT I -36      47.783  45.135  18.795  1.00105.81           P  
ATOM    731  OP1  DT I -36      48.271  44.695  17.464  1.00104.75           O  
ATOM    732  OP2  DT I -36      48.465  44.652  20.025  1.00104.73           O  
ATOM    733  O5'  DT I -36      47.781  46.724  18.800  1.00103.56           O  
ATOM    734  C5'  DT I -36      46.865  47.435  17.976  1.00 99.44           C  
ATOM    735  C4'  DT I -36      47.289  48.877  17.848  1.00 96.22           C  
ATOM    736  O4'  DT I -36      47.092  49.549  19.113  1.00 95.89           O  
ATOM    737  C3'  DT I -36      48.760  49.074  17.484  1.00 93.28           C  
ATOM    738  O3'  DT I -36      48.888  50.161  16.568  1.00 88.41           O  
ATOM    739  C2'  DT I -36      49.416  49.395  18.816  1.00 93.15           C  
ATOM    740  C1'  DT I -36      48.310  50.124  19.556  1.00 94.75           C  
ATOM    741  N1   DT I -36      48.344  50.009  21.023  1.00 94.48           N  
ATOM    742  C2   DT I -36      48.186  51.160  21.751  1.00 94.95           C  
ATOM    743  O2   DT I -36      48.060  52.259  21.236  1.00 96.24           O  
ATOM    744  N3   DT I -36      48.182  50.981  23.111  1.00 94.31           N  
ATOM    745  C4   DT I -36      48.323  49.793  23.797  1.00 93.52           C  
ATOM    746  O4   DT I -36      48.286  49.786  25.022  1.00 91.86           O  
ATOM    747  C5   DT I -36      48.505  48.624  22.969  1.00 94.30           C  
ATOM    748  C7   DT I -36      48.675  47.290  23.625  1.00 95.07           C  
ATOM    749  C6   DT I -36      48.510  48.789  21.640  1.00 94.56           C  
ATOM    750  P    DT I -35      50.335  50.560  16.011  1.00 85.10           P  
ATOM    751  OP1  DT I -35      50.145  51.116  14.649  1.00 84.25           O  
ATOM    752  OP2  DT I -35      51.242  49.405  16.212  1.00 87.03           O  
ATOM    753  O5'  DT I -35      50.791  51.732  16.989  1.00 84.60           O  
ATOM    754  C5'  DT I -35      50.000  52.914  17.121  1.00 79.50           C  
ATOM    755  C4'  DT I -35      50.688  53.919  18.013  1.00 74.79           C  
ATOM    756  O4'  DT I -35      50.570  53.540  19.406  1.00 73.59           O  
ATOM    757  C3'  DT I -35      52.183  54.108  17.746  1.00 72.78           C  
ATOM    758  O3'  DT I -35      52.514  55.491  17.852  1.00 67.65           O  
ATOM    759  C2'  DT I -35      52.833  53.372  18.903  1.00 73.94           C  
ATOM    760  C1'  DT I -35      51.841  53.655  20.012  1.00 75.26           C  
ATOM    761  N1   DT I -35      51.895  52.738  21.163  1.00 77.94           N  
ATOM    762  C2   DT I -35      51.903  53.304  22.416  1.00 79.25           C  
ATOM    763  O2   DT I -35      51.844  54.510  22.601  1.00 79.14           O  
ATOM    764  N3   DT I -35      51.983  52.404  23.450  1.00 79.80           N  
ATOM    765  C4   DT I -35      52.052  51.028  23.355  1.00 79.40           C  
ATOM    766  O4   DT I -35      52.126  50.349  24.374  1.00 79.09           O  
ATOM    767  C5   DT I -35      52.029  50.501  22.009  1.00 79.59           C  
ATOM    768  C7   DT I -35      52.099  49.020  21.808  1.00 81.17           C  
ATOM    769  C6   DT I -35      51.948  51.371  20.993  1.00 78.49           C  
ATOM    770  P    DG I -34      52.634  56.384  16.528  1.00 63.34           P  
ATOM    771  OP1  DG I -34      51.459  56.096  15.678  1.00 64.84           O  
ATOM    772  OP2  DG I -34      53.996  56.237  15.968  1.00 63.55           O  
ATOM    773  O5'  DG I -34      52.485  57.868  17.086  1.00 63.81           O  
ATOM    774  C5'  DG I -34      51.236  58.327  17.590  1.00 58.14           C  
ATOM    775  C4'  DG I -34      51.456  59.219  18.789  1.00 56.51           C  
ATOM    776  O4'  DG I -34      51.874  58.446  19.934  1.00 56.45           O  
ATOM    777  C3'  DG I -34      52.521  60.292  18.605  1.00 54.44           C  
ATOM    778  O3'  DG I -34      52.130  61.434  19.366  1.00 48.81           O  
ATOM    779  C2'  DG I -34      53.764  59.643  19.188  1.00 54.91           C  
ATOM    780  C1'  DG I -34      53.193  58.802  20.320  1.00 58.69           C  
ATOM    781  N9   DG I -34      53.905  57.556  20.589  1.00 63.58           N  
ATOM    782  C8   DG I -34      54.530  56.736  19.679  1.00 62.24           C  
ATOM    783  N7   DG I -34      55.018  55.654  20.220  1.00 64.52           N  
ATOM    784  C5   DG I -34      54.713  55.772  21.567  1.00 64.36           C  
ATOM    785  C6   DG I -34      54.978  54.899  22.644  1.00 65.71           C  
ATOM    786  O6   DG I -34      55.557  53.810  22.628  1.00 67.72           O  
ATOM    787  N1   DG I -34      54.489  55.404  23.841  1.00 64.27           N  
ATOM    788  C2   DG I -34      53.827  56.594  23.984  1.00 63.87           C  
ATOM    789  N2   DG I -34      53.418  56.898  25.223  1.00 62.89           N  
ATOM    790  N3   DG I -34      53.579  57.422  22.988  1.00 62.05           N  
ATOM    791  C4   DG I -34      54.043  56.949  21.816  1.00 63.78           C  
ATOM    792  P    DG I -33      52.937  62.806  19.215  1.00 46.59           P  
ATOM    793  OP1  DG I -33      51.937  63.906  19.338  1.00 49.06           O  
ATOM    794  OP2  DG I -33      53.813  62.747  18.009  1.00 45.45           O  
ATOM    795  O5'  DG I -33      53.900  62.808  20.483  1.00 47.48           O  
ATOM    796  C5'  DG I -33      53.376  62.705  21.798  1.00 48.98           C  
ATOM    797  C4'  DG I -33      54.487  62.436  22.785  1.00 53.56           C  
ATOM    798  O4'  DG I -33      54.963  61.077  22.646  1.00 54.49           O  
ATOM    799  C3'  DG I -33      55.724  63.328  22.647  1.00 56.15           C  
ATOM    800  O3'  DG I -33      56.231  63.596  23.946  1.00 57.99           O  
ATOM    801  C2'  DG I -33      56.718  62.429  21.936  1.00 56.61           C  
ATOM    802  C1'  DG I -33      56.377  61.103  22.584  1.00 56.09           C  
ATOM    803  N9   DG I -33      56.835  59.879  21.929  1.00 56.66           N  
ATOM    804  C8   DG I -33      57.178  59.687  20.610  1.00 56.35           C  
ATOM    805  N7   DG I -33      57.559  58.464  20.353  1.00 56.20           N  
ATOM    806  C5   DG I -33      57.465  57.812  21.577  1.00 58.38           C  
ATOM    807  C6   DG I -33      57.754  56.464  21.934  1.00 58.78           C  
ATOM    808  O6   DG I -33      58.166  55.544  21.215  1.00 57.89           O  
ATOM    809  N1   DG I -33      57.511  56.232  23.285  1.00 57.52           N  
ATOM    810  C2   DG I -33      57.048  57.169  24.179  1.00 61.41           C  
ATOM    811  N2   DG I -33      56.852  56.752  25.439  1.00 61.85           N  
ATOM    812  N3   DG I -33      56.786  58.425  23.860  1.00 58.62           N  
ATOM    813  C4   DG I -33      57.014  58.673  22.554  1.00 57.00           C  
ATOM    814  P    DA I -32      56.257  65.099  24.499  1.00 61.90           P  
ATOM    815  OP1  DA I -32      54.899  65.663  24.314  1.00 62.25           O  
ATOM    816  OP2  DA I -32      57.432  65.798  23.923  1.00 62.14           O  
ATOM    817  O5'  DA I -32      56.492  64.899  26.060  1.00 61.73           O  
ATOM    818  C5'  DA I -32      55.467  64.342  26.878  1.00 65.81           C  
ATOM    819  C4'  DA I -32      56.073  63.505  27.978  1.00 69.52           C  
ATOM    820  O4'  DA I -32      56.624  62.288  27.426  1.00 68.85           O  
ATOM    821  C3'  DA I -32      57.220  64.182  28.719  1.00 70.27           C  
ATOM    822  O3'  DA I -32      57.177  63.820  30.096  1.00 74.30           O  
ATOM    823  C2'  DA I -32      58.457  63.619  28.043  1.00 69.29           C  
ATOM    824  C1'  DA I -32      58.019  62.211  27.678  1.00 68.91           C  
ATOM    825  N9   DA I -32      58.643  61.666  26.474  1.00 69.42           N  
ATOM    826  C8   DA I -32      58.809  62.287  25.258  1.00 69.28           C  
ATOM    827  N7   DA I -32      59.340  61.516  24.340  1.00 68.35           N  
ATOM    828  C5   DA I -32      59.550  60.311  24.998  1.00 70.21           C  
ATOM    829  C6   DA I -32      60.066  59.077  24.568  1.00 70.32           C  
ATOM    830  N6   DA I -32      60.457  58.836  23.317  1.00 72.27           N  
ATOM    831  N1   DA I -32      60.154  58.082  25.476  1.00 67.83           N  
ATOM    832  C2   DA I -32      59.734  58.316  26.725  1.00 68.01           C  
ATOM    833  N3   DA I -32      59.213  59.426  27.245  1.00 69.51           N  
ATOM    834  C4   DA I -32      59.147  60.398  26.319  1.00 69.60           C  
ATOM    835  P    DA I -31      58.391  64.226  31.056  1.00 80.29           P  
ATOM    836  OP1  DA I -31      57.926  64.087  32.459  1.00 81.36           O  
ATOM    837  OP2  DA I -31      58.951  65.526  30.590  1.00 79.55           O  
ATOM    838  O5'  DA I -31      59.469  63.095  30.771  1.00 79.02           O  
ATOM    839  C5'  DA I -31      59.282  61.784  31.277  1.00 79.92           C  
ATOM    840  C4'  DA I -31      60.614  61.087  31.398  1.00 81.28           C  
ATOM    841  O4'  DA I -31      61.062  60.628  30.101  1.00 78.99           O  
ATOM    842  C3'  DA I -31      61.727  61.977  31.947  1.00 82.80           C  
ATOM    843  O3'  DA I -31      62.518  61.238  32.871  1.00 84.73           O  
ATOM    844  C2'  DA I -31      62.534  62.340  30.712  1.00 81.66           C  
ATOM    845  C1'  DA I -31      62.373  61.104  29.845  1.00 80.82           C  
ATOM    846  N9   DA I -31      62.488  61.327  28.402  1.00 79.86           N  
ATOM    847  C8   DA I -31      62.194  62.461  27.683  1.00 78.68           C  
ATOM    848  N7   DA I -31      62.370  62.326  26.390  1.00 77.73           N  
ATOM    849  C5   DA I -31      62.814  61.018  26.249  1.00 77.07           C  
ATOM    850  C6   DA I -31      63.167  60.251  25.120  1.00 75.71           C  
ATOM    851  N6   DA I -31      63.120  60.706  23.868  1.00 72.51           N  
ATOM    852  N1   DA I -31      63.574  58.981  25.327  1.00 76.66           N  
ATOM    853  C2   DA I -31      63.617  58.519  26.584  1.00 77.82           C  
ATOM    854  N3   DA I -31      63.305  59.137  27.721  1.00 77.78           N  
ATOM    855  C4   DA I -31      62.905  60.397  27.481  1.00 78.13           C  
ATOM    856  P    DA I -30      63.629  61.991  33.745  1.00 87.28           P  
ATOM    857  OP1  DA I -30      63.366  61.705  35.179  1.00 87.93           O  
ATOM    858  OP2  DA I -30      63.723  63.398  33.279  1.00 88.22           O  
ATOM    859  O5'  DA I -30      64.967  61.254  33.315  1.00 86.61           O  
ATOM    860  C5'  DA I -30      65.018  59.837  33.263  1.00 85.99           C  
ATOM    861  C4'  DA I -30      66.197  59.392  32.434  1.00 85.94           C  
ATOM    862  O4'  DA I -30      65.899  59.494  31.020  1.00 85.15           O  
ATOM    863  C3'  DA I -30      67.461  60.217  32.670  1.00 85.77           C  
ATOM    864  O3'  DA I -30      68.586  59.357  32.811  1.00 86.27           O  
ATOM    865  C2'  DA I -30      67.592  61.044  31.403  1.00 84.53           C  
ATOM    866  C1'  DA I -30      66.985  60.123  30.366  1.00 84.96           C  
ATOM    867  N9   DA I -30      66.474  60.795  29.171  1.00 85.49           N  
ATOM    868  C8   DA I -30      65.653  61.892  29.103  1.00 85.55           C  
ATOM    869  N7   DA I -30      65.387  62.278  27.880  1.00 84.68           N  
ATOM    870  C5   DA I -30      66.074  61.372  27.086  1.00 84.64           C  
ATOM    871  C6   DA I -30      66.196  61.240  25.694  1.00 83.94           C  
ATOM    872  N6   DA I -30      65.607  62.059  24.822  1.00 83.76           N  
ATOM    873  N1   DA I -30      66.953  60.226  25.221  1.00 84.13           N  
ATOM    874  C2   DA I -30      67.541  59.405  26.099  1.00 84.92           C  
ATOM    875  N3   DA I -30      67.502  59.426  27.431  1.00 85.72           N  
ATOM    876  C4   DA I -30      66.742  60.447  27.867  1.00 85.31           C  
ATOM    877  P    DC I -29      69.992  59.967  33.274  1.00 87.13           P  
ATOM    878  OP1  DC I -29      70.475  59.170  34.432  1.00 89.54           O  
ATOM    879  OP2  DC I -29      69.860  61.439  33.403  1.00 87.75           O  
ATOM    880  O5'  DC I -29      70.921  59.657  32.025  1.00 86.98           O  
ATOM    881  C5'  DC I -29      70.816  58.410  31.351  1.00 87.86           C  
ATOM    882  C4'  DC I -29      71.631  58.442  30.082  1.00 89.58           C  
ATOM    883  O4'  DC I -29      70.887  59.082  29.014  1.00 90.13           O  
ATOM    884  C3'  DC I -29      72.943  59.214  30.217  1.00 89.05           C  
ATOM    885  O3'  DC I -29      73.995  58.505  29.566  1.00 90.56           O  
ATOM    886  C2'  DC I -29      72.657  60.524  29.504  1.00 89.54           C  
ATOM    887  C1'  DC I -29      71.689  60.086  28.419  1.00 89.54           C  
ATOM    888  N1   DC I -29      70.801  61.143  27.901  1.00 90.06           N  
ATOM    889  C2   DC I -29      70.384  61.073  26.568  1.00 89.66           C  
ATOM    890  O2   DC I -29      70.739  60.107  25.880  1.00 90.40           O  
ATOM    891  N3   DC I -29      69.604  62.054  26.065  1.00 90.09           N  
ATOM    892  C4   DC I -29      69.229  63.072  26.841  1.00 90.45           C  
ATOM    893  N4   DC I -29      68.469  64.028  26.296  1.00 89.86           N  
ATOM    894  C5   DC I -29      69.621  63.159  28.211  1.00 90.23           C  
ATOM    895  C6   DC I -29      70.399  62.181  28.695  1.00 89.78           C  
ATOM    896  P    DT I -28      75.387  59.244  29.278  1.00 91.16           P  
ATOM    897  OP1  DT I -28      76.444  58.212  29.112  1.00 91.46           O  
ATOM    898  OP2  DT I -28      75.544  60.307  30.300  1.00 91.05           O  
ATOM    899  O5'  DT I -28      75.144  59.931  27.867  1.00 90.63           O  
ATOM    900  C5'  DT I -28      74.888  59.132  26.720  1.00 92.56           C  
ATOM    901  C4'  DT I -28      75.259  59.895  25.474  1.00 93.57           C  
ATOM    902  O4'  DT I -28      74.239  60.873  25.161  1.00 93.83           O  
ATOM    903  C3'  DT I -28      76.563  60.677  25.617  1.00 94.44           C  
ATOM    904  O3'  DT I -28      77.262  60.648  24.378  1.00 94.85           O  
ATOM    905  C2'  DT I -28      76.087  62.089  25.908  1.00 93.93           C  
ATOM    906  C1'  DT I -28      74.835  62.155  25.057  1.00 94.00           C  
ATOM    907  N1   DT I -28      73.835  63.154  25.463  1.00 93.71           N  
ATOM    908  C2   DT I -28      73.030  63.672  24.478  1.00 93.47           C  
ATOM    909  O2   DT I -28      73.123  63.346  23.306  1.00 93.05           O  
ATOM    910  N3   DT I -28      72.109  64.588  24.916  1.00 93.29           N  
ATOM    911  C4   DT I -28      71.918  65.028  26.210  1.00 94.00           C  
ATOM    912  O4   DT I -28      71.042  65.857  26.453  1.00 94.04           O  
ATOM    913  C5   DT I -28      72.803  64.448  27.194  1.00 93.72           C  
ATOM    914  C7   DT I -28      72.675  64.871  28.624  1.00 92.05           C  
ATOM    915  C6   DT I -28      73.705  63.551  26.777  1.00 93.61           C  
ATOM    916  P    DG I -27      78.854  60.812  24.359  1.00 93.59           P  
ATOM    917  OP1  DG I -27      79.429  59.520  24.808  1.00 94.46           O  
ATOM    918  OP2  DG I -27      79.216  62.064  25.068  1.00 93.84           O  
ATOM    919  O5'  DG I -27      79.160  61.010  22.813  1.00 93.60           O  
ATOM    920  C5'  DG I -27      78.378  60.337  21.832  1.00 92.96           C  
ATOM    921  C4'  DG I -27      78.011  61.289  20.718  1.00 93.51           C  
ATOM    922  O4'  DG I -27      76.952  62.188  21.129  1.00 94.15           O  
ATOM    923  C3'  DG I -27      79.163  62.177  20.256  1.00 93.48           C  
ATOM    924  O3'  DG I -27      79.114  62.311  18.841  1.00 93.45           O  
ATOM    925  C2'  DG I -27      78.876  63.507  20.928  1.00 93.49           C  
ATOM    926  C1'  DG I -27      77.358  63.535  20.936  1.00 93.74           C  
ATOM    927  N9   DG I -27      76.764  64.338  22.001  1.00 93.17           N  
ATOM    928  C8   DG I -27      76.955  64.191  23.353  1.00 93.64           C  
ATOM    929  N7   DG I -27      76.270  65.045  24.064  1.00 93.64           N  
ATOM    930  C5   DG I -27      75.588  65.805  23.125  1.00 93.10           C  
ATOM    931  C6   DG I -27      74.679  66.883  23.298  1.00 91.92           C  
ATOM    932  O6   DG I -27      74.274  67.388  24.350  1.00 90.47           O  
ATOM    933  N1   DG I -27      74.229  67.374  22.077  1.00 92.30           N  
ATOM    934  C2   DG I -27      74.598  66.888  20.845  1.00 93.29           C  
ATOM    935  N2   DG I -27      74.061  67.502  19.779  1.00 91.80           N  
ATOM    936  N3   DG I -27      75.435  65.876  20.671  1.00 93.63           N  
ATOM    937  C4   DG I -27      75.889  65.387  21.845  1.00 93.30           C  
ATOM    938  P    DC I -26      80.304  63.061  18.079  1.00 94.99           P  
ATOM    939  OP1  DC I -26      80.763  62.207  16.953  1.00 94.84           O  
ATOM    940  OP2  DC I -26      81.280  63.531  19.098  1.00 94.66           O  
ATOM    941  O5'  DC I -26      79.580  64.331  17.464  1.00 93.71           O  
ATOM    942  C5'  DC I -26      78.334  64.188  16.794  1.00 91.60           C  
ATOM    943  C4'  DC I -26      77.768  65.548  16.480  1.00 88.97           C  
ATOM    944  O4'  DC I -26      77.372  66.200  17.710  1.00 88.63           O  
ATOM    945  C3'  DC I -26      78.786  66.470  15.819  1.00 86.91           C  
ATOM    946  O3'  DC I -26      78.127  67.267  14.842  1.00 86.53           O  
ATOM    947  C2'  DC I -26      79.310  67.306  16.974  1.00 86.16           C  
ATOM    948  C1'  DC I -26      78.103  67.401  17.895  1.00 86.29           C  
ATOM    949  N1   DC I -26      78.413  67.519  19.333  1.00 84.20           N  
ATOM    950  C2   DC I -26      77.688  68.437  20.106  1.00 84.23           C  
ATOM    951  O2   DC I -26      76.810  69.118  19.563  1.00 85.45           O  
ATOM    952  N3   DC I -26      77.961  68.554  21.422  1.00 84.31           N  
ATOM    953  C4   DC I -26      78.911  67.798  21.977  1.00 85.01           C  
ATOM    954  N4   DC I -26      79.148  67.951  23.281  1.00 83.02           N  
ATOM    955  C5   DC I -26      79.660  66.852  21.217  1.00 84.03           C  
ATOM    956  C6   DC I -26      79.383  66.750  19.910  1.00 83.76           C  
ATOM    957  P    DT I -25      78.951  67.826  13.584  1.00 85.55           P  
ATOM    958  OP1  DT I -25      78.509  67.102  12.362  1.00 85.56           O  
ATOM    959  OP2  DT I -25      80.387  67.846  13.961  1.00 84.31           O  
ATOM    960  O5'  DT I -25      78.467  69.336  13.508  1.00 84.65           O  
ATOM    961  C5'  DT I -25      78.376  70.087  14.704  1.00 79.77           C  
ATOM    962  C4'  DT I -25      77.006  70.702  14.839  1.00 76.56           C  
ATOM    963  O4'  DT I -25      76.676  70.738  16.239  1.00 76.43           O  
ATOM    964  C3'  DT I -25      76.943  72.146  14.365  1.00 74.26           C  
ATOM    965  O3'  DT I -25      75.621  72.460  13.915  1.00 71.76           O  
ATOM    966  C2'  DT I -25      77.338  72.923  15.609  1.00 75.12           C  
ATOM    967  C1'  DT I -25      76.831  72.050  16.754  1.00 76.35           C  
ATOM    968  N1   DT I -25      77.728  71.937  17.919  1.00 77.54           N  
ATOM    969  C2   DT I -25      77.273  72.362  19.148  1.00 78.19           C  
ATOM    970  O2   DT I -25      76.193  72.906  19.310  1.00 77.88           O  
ATOM    971  N3   DT I -25      78.136  72.123  20.189  1.00 77.73           N  
ATOM    972  C4   DT I -25      79.378  71.521  20.123  1.00 78.63           C  
ATOM    973  O4   DT I -25      80.021  71.328  21.152  1.00 80.42           O  
ATOM    974  C5   DT I -25      79.811  71.146  18.799  1.00 78.16           C  
ATOM    975  C7   DT I -25      81.158  70.517  18.628  1.00 76.82           C  
ATOM    976  C6   DT I -25      78.979  71.376  17.776  1.00 78.06           C  
ATOM    977  P    DC I -24      75.389  73.732  12.961  1.00 67.31           P  
ATOM    978  OP1  DC I -24      74.050  73.630  12.336  1.00 67.13           O  
ATOM    979  OP2  DC I -24      76.594  73.859  12.099  1.00 68.57           O  
ATOM    980  O5'  DC I -24      75.395  74.947  13.986  1.00 63.76           O  
ATOM    981  C5'  DC I -24      74.437  75.018  15.035  1.00 60.94           C  
ATOM    982  C4'  DC I -24      74.860  76.063  16.038  1.00 58.01           C  
ATOM    983  O4'  DC I -24      75.970  75.568  16.827  1.00 59.73           O  
ATOM    984  C3'  DC I -24      75.341  77.365  15.400  1.00 55.05           C  
ATOM    985  O3'  DC I -24      74.998  78.457  16.248  1.00 51.63           O  
ATOM    986  C2'  DC I -24      76.851  77.209  15.436  1.00 59.11           C  
ATOM    987  C1'  DC I -24      77.020  76.512  16.774  1.00 61.88           C  
ATOM    988  N1   DC I -24      78.294  75.804  17.003  1.00 65.77           N  
ATOM    989  C2   DC I -24      78.622  75.431  18.313  1.00 65.86           C  
ATOM    990  O2   DC I -24      77.827  75.686  19.227  1.00 62.01           O  
ATOM    991  N3   DC I -24      79.798  74.807  18.550  1.00 69.72           N  
ATOM    992  C4   DC I -24      80.633  74.554  17.543  1.00 70.17           C  
ATOM    993  N4   DC I -24      81.785  73.950  17.831  1.00 72.60           N  
ATOM    994  C5   DC I -24      80.322  74.912  16.195  1.00 69.40           C  
ATOM    995  C6   DC I -24      79.151  75.526  15.972  1.00 67.08           C  
ATOM    996  P    DC I -23      73.576  79.194  16.086  1.00 47.95           P  
ATOM    997  OP1  DC I -23      72.529  78.142  16.100  1.00 41.80           O  
ATOM    998  OP2  DC I -23      73.645  80.136  14.939  1.00 47.62           O  
ATOM    999  O5'  DC I -23      73.493  80.027  17.439  1.00 44.71           O  
ATOM   1000  C5'  DC I -23      73.059  79.400  18.642  1.00 45.56           C  
ATOM   1001  C4'  DC I -23      73.839  79.911  19.832  1.00 46.53           C  
ATOM   1002  O4'  DC I -23      75.129  79.253  19.964  1.00 51.50           O  
ATOM   1003  C3'  DC I -23      74.112  81.416  19.885  1.00 47.58           C  
ATOM   1004  O3'  DC I -23      73.767  81.887  21.180  1.00 43.04           O  
ATOM   1005  C2'  DC I -23      75.616  81.519  19.671  1.00 51.31           C  
ATOM   1006  C1'  DC I -23      76.126  80.215  20.271  1.00 53.17           C  
ATOM   1007  N1   DC I -23      77.410  79.725  19.722  1.00 56.97           N  
ATOM   1008  C2   DC I -23      78.390  79.223  20.607  1.00 56.99           C  
ATOM   1009  O2   DC I -23      78.161  79.215  21.822  1.00 55.59           O  
ATOM   1010  N3   DC I -23      79.552  78.758  20.106  1.00 57.18           N  
ATOM   1011  C4   DC I -23      79.765  78.773  18.788  1.00 59.25           C  
ATOM   1012  N4   DC I -23      80.920  78.286  18.340  1.00 60.24           N  
ATOM   1013  C5   DC I -23      78.801  79.284  17.871  1.00 58.24           C  
ATOM   1014  C6   DC I -23      77.649  79.746  18.377  1.00 56.95           C  
ATOM   1015  P    DA I -22      73.729  83.454  21.476  1.00 42.14           P  
ATOM   1016  OP1  DA I -22      72.409  83.815  22.003  1.00 41.70           O  
ATOM   1017  OP2  DA I -22      74.268  84.137  20.283  1.00 39.38           O  
ATOM   1018  O5'  DA I -22      74.777  83.634  22.664  1.00 46.84           O  
ATOM   1019  C5'  DA I -22      74.744  82.774  23.798  1.00 52.50           C  
ATOM   1020  C4'  DA I -22      75.937  83.042  24.681  1.00 59.71           C  
ATOM   1021  O4'  DA I -22      77.149  82.538  24.068  1.00 59.26           O  
ATOM   1022  C3'  DA I -22      76.175  84.526  24.927  1.00 62.11           C  
ATOM   1023  O3'  DA I -22      76.612  84.709  26.265  1.00 67.33           O  
ATOM   1024  C2'  DA I -22      77.255  84.886  23.925  1.00 61.97           C  
ATOM   1025  C1'  DA I -22      78.057  83.601  23.812  1.00 63.62           C  
ATOM   1026  N9   DA I -22      78.628  83.368  22.488  1.00 67.64           N  
ATOM   1027  C8   DA I -22      78.082  83.691  21.274  1.00 71.37           C  
ATOM   1028  N7   DA I -22      78.792  83.285  20.250  1.00 71.94           N  
ATOM   1029  C5   DA I -22      79.887  82.670  20.829  1.00 71.14           C  
ATOM   1030  C6   DA I -22      81.000  82.026  20.279  1.00 73.09           C  
ATOM   1031  N6   DA I -22      81.195  81.886  18.967  1.00 73.09           N  
ATOM   1032  N1   DA I -22      81.917  81.521  21.131  1.00 73.76           N  
ATOM   1033  C2   DA I -22      81.716  81.667  22.447  1.00 73.37           C  
ATOM   1034  N3   DA I -22      80.707  82.252  23.086  1.00 71.70           N  
ATOM   1035  C4   DA I -22      79.812  82.733  22.208  1.00 71.08           C  
ATOM   1036  P    DT I -21      77.116  86.147  26.739  1.00 74.54           P  
ATOM   1037  OP1  DT I -21      76.926  86.225  28.209  1.00 74.54           O  
ATOM   1038  OP2  DT I -21      76.498  87.170  25.863  1.00 72.59           O  
ATOM   1039  O5'  DT I -21      78.677  86.085  26.439  1.00 76.24           O  
ATOM   1040  C5'  DT I -21      79.498  85.132  27.107  1.00 81.25           C  
ATOM   1041  C4'  DT I -21      80.956  85.417  26.841  1.00 84.15           C  
ATOM   1042  O4'  DT I -21      81.325  84.984  25.510  1.00 85.17           O  
ATOM   1043  C3'  DT I -21      81.343  86.892  26.934  1.00 86.50           C  
ATOM   1044  O3'  DT I -21      82.591  87.014  27.611  1.00 92.42           O  
ATOM   1045  C2'  DT I -21      81.497  87.307  25.483  1.00 85.70           C  
ATOM   1046  C1'  DT I -21      82.008  86.030  24.845  1.00 85.43           C  
ATOM   1047  N1   DT I -21      81.747  85.899  23.396  1.00 86.25           N  
ATOM   1048  C2   DT I -21      82.532  85.029  22.671  1.00 87.69           C  
ATOM   1049  O2   DT I -21      83.417  84.352  23.172  1.00 87.94           O  
ATOM   1050  N3   DT I -21      82.241  84.978  21.328  1.00 87.95           N  
ATOM   1051  C4   DT I -21      81.263  85.694  20.655  1.00 88.09           C  
ATOM   1052  O4   DT I -21      81.115  85.544  19.443  1.00 87.03           O  
ATOM   1053  C5   DT I -21      80.477  86.582  21.478  1.00 87.77           C  
ATOM   1054  C7   DT I -21      79.400  87.399  20.839  1.00 87.22           C  
ATOM   1055  C6   DT I -21      80.752  86.637  22.789  1.00 87.92           C  
ATOM   1056  P    DC I -20      83.086  88.452  28.121  1.00 95.84           P  
ATOM   1057  OP1  DC I -20      83.009  88.442  29.604  1.00 95.20           O  
ATOM   1058  OP2  DC I -20      82.378  89.511  27.358  1.00 97.50           O  
ATOM   1059  O5'  DC I -20      84.613  88.461  27.684  1.00 98.92           O  
ATOM   1060  C5'  DC I -20      85.406  87.285  27.823  1.00105.71           C  
ATOM   1061  C4'  DC I -20      86.569  87.321  26.859  1.00110.72           C  
ATOM   1062  O4'  DC I -20      86.142  86.972  25.519  1.00111.75           O  
ATOM   1063  C3'  DC I -20      87.241  88.689  26.752  1.00113.49           C  
ATOM   1064  O3'  DC I -20      88.659  88.540  26.721  1.00116.49           O  
ATOM   1065  C2'  DC I -20      86.738  89.228  25.424  1.00113.56           C  
ATOM   1066  C1'  DC I -20      86.598  87.958  24.607  1.00113.25           C  
ATOM   1067  N1   DC I -20      85.637  88.036  23.493  1.00114.08           N  
ATOM   1068  C2   DC I -20      85.944  87.381  22.297  1.00114.71           C  
ATOM   1069  O2   DC I -20      87.003  86.745  22.218  1.00115.39           O  
ATOM   1070  N3   DC I -20      85.079  87.456  21.260  1.00115.15           N  
ATOM   1071  C4   DC I -20      83.946  88.148  21.386  1.00115.51           C  
ATOM   1072  N4   DC I -20      83.124  88.198  20.335  1.00115.79           N  
ATOM   1073  C5   DC I -20      83.605  88.820  22.596  1.00115.48           C  
ATOM   1074  C6   DC I -20      84.470  88.737  23.615  1.00114.71           C  
ATOM   1075  P    DA I -19      89.590  89.840  26.823  1.00118.70           P  
ATOM   1076  OP1  DA I -19      90.658  89.566  27.816  1.00119.07           O  
ATOM   1077  OP2  DA I -19      88.696  91.012  27.009  1.00117.92           O  
ATOM   1078  O5'  DA I -19      90.254  89.932  25.379  1.00119.85           O  
ATOM   1079  C5'  DA I -19      91.118  88.900  24.912  1.00122.41           C  
ATOM   1080  C4'  DA I -19      91.712  89.284  23.578  1.00124.67           C  
ATOM   1081  O4'  DA I -19      90.688  89.237  22.556  1.00125.50           O  
ATOM   1082  C3'  DA I -19      92.284  90.701  23.535  1.00125.86           C  
ATOM   1083  O3'  DA I -19      93.456  90.728  22.720  1.00127.18           O  
ATOM   1084  C2'  DA I -19      91.175  91.504  22.885  1.00126.03           C  
ATOM   1085  C1'  DA I -19      90.598  90.498  21.909  1.00126.63           C  
ATOM   1086  N9   DA I -19      89.196  90.724  21.562  1.00127.67           N  
ATOM   1087  C8   DA I -19      88.184  91.191  22.366  1.00128.29           C  
ATOM   1088  N7   DA I -19      87.025  91.275  21.761  1.00128.61           N  
ATOM   1089  C5   DA I -19      87.292  90.835  20.471  1.00128.67           C  
ATOM   1090  C6   DA I -19      86.477  90.684  19.337  1.00128.85           C  
ATOM   1091  N6   DA I -19      85.173  90.961  19.324  1.00129.41           N  
ATOM   1092  N1   DA I -19      87.056  90.229  18.204  1.00128.69           N  
ATOM   1093  C2   DA I -19      88.363  89.945  18.222  1.00128.43           C  
ATOM   1094  N3   DA I -19      89.232  90.041  19.225  1.00128.35           N  
ATOM   1095  C4   DA I -19      88.626  90.498  20.334  1.00128.19           C  
ATOM   1096  P    DA I -18      94.309  92.080  22.599  1.00127.61           P  
ATOM   1097  OP1  DA I -18      95.735  91.748  22.845  1.00128.73           O  
ATOM   1098  OP2  DA I -18      93.642  93.115  23.429  1.00128.02           O  
ATOM   1099  O5'  DA I -18      94.142  92.486  21.071  1.00128.46           O  
ATOM   1100  C5'  DA I -18      94.323  91.519  20.041  1.00129.66           C  
ATOM   1101  C4'  DA I -18      93.704  92.009  18.755  1.00131.20           C  
ATOM   1102  O4'  DA I -18      92.265  92.076  18.902  1.00132.34           O  
ATOM   1103  C3'  DA I -18      94.149  93.411  18.343  1.00131.59           C  
ATOM   1104  O3'  DA I -18      94.218  93.488  16.920  1.00131.16           O  
ATOM   1105  C2'  DA I -18      93.018  94.289  18.845  1.00132.27           C  
ATOM   1106  C1'  DA I -18      91.820  93.390  18.607  1.00132.79           C  
ATOM   1107  N9   DA I -18      90.659  93.673  19.447  1.00133.23           N  
ATOM   1108  C8   DA I -18      90.626  93.972  20.787  1.00133.37           C  
ATOM   1109  N7   DA I -18      89.418  94.180  21.252  1.00133.62           N  
ATOM   1110  C5   DA I -18      88.600  94.007  20.144  1.00133.68           C  
ATOM   1111  C6   DA I -18      87.209  94.092  19.972  1.00133.47           C  
ATOM   1112  N6   DA I -18      86.356  94.379  20.958  1.00133.70           N  
ATOM   1113  N1   DA I -18      86.715  93.865  18.735  1.00133.18           N  
ATOM   1114  C2   DA I -18      87.568  93.570  17.748  1.00133.01           C  
ATOM   1115  N3   DA I -18      88.892  93.459  17.785  1.00133.55           N  
ATOM   1116  C4   DA I -18      89.351  93.693  19.026  1.00133.55           C  
ATOM   1117  P    DA I -17      95.575  93.970  16.214  1.00131.27           P  
ATOM   1118  OP1  DA I -17      96.586  92.892  16.365  1.00131.45           O  
ATOM   1119  OP2  DA I -17      95.878  95.337  16.712  1.00131.19           O  
ATOM   1120  O5'  DA I -17      95.179  94.071  14.677  1.00130.54           O  
ATOM   1121  C5'  DA I -17      94.711  92.926  13.969  1.00129.01           C  
ATOM   1122  C4'  DA I -17      93.527  93.296  13.107  1.00128.02           C  
ATOM   1123  O4'  DA I -17      92.368  93.552  13.940  1.00128.27           O  
ATOM   1124  C3'  DA I -17      93.732  94.559  12.273  1.00127.06           C  
ATOM   1125  O3'  DA I -17      93.135  94.400  10.986  1.00125.01           O  
ATOM   1126  C2'  DA I -17      93.008  95.629  13.069  1.00127.17           C  
ATOM   1127  C1'  DA I -17      91.858  94.851  13.678  1.00127.66           C  
ATOM   1128  N9   DA I -17      91.364  95.405  14.938  1.00128.27           N  
ATOM   1129  C8   DA I -17      92.093  95.742  16.051  1.00128.62           C  
ATOM   1130  N7   DA I -17      91.368  96.222  17.033  1.00128.56           N  
ATOM   1131  C5   DA I -17      90.074  96.200  16.533  1.00128.55           C  
ATOM   1132  C6   DA I -17      88.839  96.583  17.086  1.00128.57           C  
ATOM   1133  N6   DA I -17      88.699  97.078  18.318  1.00129.09           N  
ATOM   1134  N1   DA I -17      87.737  96.437  16.321  1.00128.46           N  
ATOM   1135  C2   DA I -17      87.876  95.939  15.087  1.00128.74           C  
ATOM   1136  N3   DA I -17      88.979  95.541  14.457  1.00128.93           N  
ATOM   1137  C4   DA I -17      90.057  95.700  15.244  1.00128.62           C  
ATOM   1138  P    DA I -16      92.917  95.684  10.051  1.00123.27           P  
ATOM   1139  OP1  DA I -16      92.891  95.232   8.637  1.00123.85           O  
ATOM   1140  OP2  DA I -16      93.899  96.714  10.474  1.00123.18           O  
ATOM   1141  O5'  DA I -16      91.459  96.186  10.450  1.00122.00           O  
ATOM   1142  C5'  DA I -16      90.323  95.344  10.252  1.00118.47           C  
ATOM   1143  C4'  DA I -16      89.061  96.171  10.173  1.00115.90           C  
ATOM   1144  O4'  DA I -16      88.646  96.606  11.490  1.00115.10           O  
ATOM   1145  C3'  DA I -16      89.181  97.437   9.325  1.00114.44           C  
ATOM   1146  O3'  DA I -16      87.980  97.634   8.585  1.00112.31           O  
ATOM   1147  C2'  DA I -16      89.324  98.536  10.362  1.00114.05           C  
ATOM   1148  C1'  DA I -16      88.454  98.012  11.487  1.00113.97           C  
ATOM   1149  N9   DA I -16      88.797  98.515  12.816  1.00113.44           N  
ATOM   1150  C8   DA I -16      90.022  98.510  13.433  1.00113.48           C  
ATOM   1151  N7   DA I -16      90.009  99.021  14.640  1.00113.56           N  
ATOM   1152  C5   DA I -16      88.686  99.393  14.830  1.00113.54           C  
ATOM   1153  C6   DA I -16      88.017  99.992  15.912  1.00113.74           C  
ATOM   1154  N6   DA I -16      88.615 100.335  17.055  1.00113.16           N  
ATOM   1155  N1   DA I -16      86.694 100.231  15.778  1.00113.77           N  
ATOM   1156  C2   DA I -16      86.094  99.885  14.633  1.00113.42           C  
ATOM   1157  N3   DA I -16      86.613  99.315  13.548  1.00114.05           N  
ATOM   1158  C4   DA I -16      87.929  99.091  13.713  1.00113.73           C  
ATOM   1159  P    DG I -15      88.030  98.398   7.176  1.00110.97           P  
ATOM   1160  OP1  DG I -15      88.143  97.392   6.091  1.00111.86           O  
ATOM   1161  OP2  DG I -15      89.035  99.486   7.283  1.00111.34           O  
ATOM   1162  O5'  DG I -15      86.590  99.055   7.078  1.00108.72           O  
ATOM   1163  C5'  DG I -15      85.450  98.350   7.550  1.00105.50           C  
ATOM   1164  C4'  DG I -15      84.502  99.302   8.237  1.00102.63           C  
ATOM   1165  O4'  DG I -15      85.045  99.733   9.510  1.00102.26           O  
ATOM   1166  C3'  DG I -15      84.220 100.573   7.441  1.00 99.70           C  
ATOM   1167  O3'  DG I -15      82.835 100.884   7.530  1.00 95.15           O  
ATOM   1168  C2'  DG I -15      85.069 101.627   8.131  1.00 99.87           C  
ATOM   1169  C1'  DG I -15      85.086 101.150   9.571  1.00101.13           C  
ATOM   1170  N9   DG I -15      86.284 101.524  10.316  1.00102.24           N  
ATOM   1171  C8   DG I -15      87.591 101.317   9.941  1.00102.78           C  
ATOM   1172  N7   DG I -15      88.452 101.737  10.829  1.00101.81           N  
ATOM   1173  C5   DG I -15      87.668 102.256  11.850  1.00101.77           C  
ATOM   1174  C6   DG I -15      88.040 102.843  13.085  1.00101.47           C  
ATOM   1175  O6   DG I -15      89.172 103.019  13.544  1.00101.22           O  
ATOM   1176  N1   DG I -15      86.926 103.241  13.818  1.00102.33           N  
ATOM   1177  C2   DG I -15      85.621 103.090  13.419  1.00102.00           C  
ATOM   1178  N2   DG I -15      84.685 103.549  14.265  1.00101.58           N  
ATOM   1179  N3   DG I -15      85.259 102.532  12.274  1.00102.13           N  
ATOM   1180  C4   DG I -15      86.327 102.141  11.545  1.00102.17           C  
ATOM   1181  P    DG I -14      82.256 102.154   6.753  1.00 90.41           P  
ATOM   1182  OP1  DG I -14      80.932 101.776   6.197  1.00 92.31           O  
ATOM   1183  OP2  DG I -14      83.295 102.715   5.857  1.00 92.10           O  
ATOM   1184  O5'  DG I -14      82.011 103.189   7.924  1.00 86.89           O  
ATOM   1185  C5'  DG I -14      80.748 103.797   8.080  1.00 80.82           C  
ATOM   1186  C4'  DG I -14      80.246 103.597   9.488  1.00 76.09           C  
ATOM   1187  O4'  DG I -14      81.308 103.864  10.430  1.00 77.89           O  
ATOM   1188  C3'  DG I -14      79.154 104.600   9.813  1.00 72.51           C  
ATOM   1189  O3'  DG I -14      78.237 104.083  10.763  1.00 63.67           O  
ATOM   1190  C2'  DG I -14      79.919 105.755  10.415  1.00 74.25           C  
ATOM   1191  C1'  DG I -14      81.017 105.041  11.172  1.00 79.10           C  
ATOM   1192  N9   DG I -14      82.242 105.823  11.264  1.00 83.24           N  
ATOM   1193  C8   DG I -14      83.012 106.280  10.224  1.00 84.72           C  
ATOM   1194  N7   DG I -14      84.064 106.938  10.619  1.00 87.81           N  
ATOM   1195  C5   DG I -14      83.981 106.914  12.004  1.00 89.05           C  
ATOM   1196  C6   DG I -14      84.847 107.458  12.987  1.00 91.83           C  
ATOM   1197  O6   DG I -14      85.900 108.090  12.824  1.00 94.09           O  
ATOM   1198  N1   DG I -14      84.380 107.205  14.274  1.00 93.01           N  
ATOM   1199  C2   DG I -14      83.228 106.518  14.576  1.00 91.02           C  
ATOM   1200  N2   DG I -14      82.941 106.380  15.880  1.00 90.00           N  
ATOM   1201  N3   DG I -14      82.418 106.006  13.667  1.00 88.83           N  
ATOM   1202  C4   DG I -14      82.854 106.238  12.414  1.00 86.07           C  
ATOM   1203  P    DC I -13      76.847 104.833  10.965  1.00 53.34           P  
ATOM   1204  OP1  DC I -13      75.846 103.768  11.234  1.00 57.57           O  
ATOM   1205  OP2  DC I -13      76.678 105.737   9.811  1.00 53.38           O  
ATOM   1206  O5'  DC I -13      77.059 105.711  12.267  1.00 53.63           O  
ATOM   1207  C5'  DC I -13      77.398 105.091  13.496  1.00 57.08           C  
ATOM   1208  C4'  DC I -13      77.756 106.135  14.525  1.00 56.21           C  
ATOM   1209  O4'  DC I -13      79.048 106.725  14.237  1.00 56.02           O  
ATOM   1210  C3'  DC I -13      76.765 107.291  14.614  1.00 56.24           C  
ATOM   1211  O3'  DC I -13      76.552 107.583  15.984  1.00 56.01           O  
ATOM   1212  C2'  DC I -13      77.476 108.436  13.913  1.00 54.97           C  
ATOM   1213  C1'  DC I -13      78.940 108.139  14.209  1.00 55.79           C  
ATOM   1214  N1   DC I -13      79.904 108.640  13.215  1.00 54.40           N  
ATOM   1215  C2   DC I -13      81.078 109.269  13.666  1.00 57.64           C  
ATOM   1216  O2   DC I -13      81.257 109.405  14.887  1.00 54.62           O  
ATOM   1217  N3   DC I -13      81.982 109.706  12.761  1.00 55.95           N  
ATOM   1218  C4   DC I -13      81.754 109.536  11.458  1.00 59.43           C  
ATOM   1219  N4   DC I -13      82.680 109.967  10.598  1.00 61.19           N  
ATOM   1220  C5   DC I -13      80.564 108.913  10.973  1.00 54.86           C  
ATOM   1221  C6   DC I -13      79.676 108.488  11.878  1.00 50.58           C  
ATOM   1222  P    DA I -12      75.422 108.620  16.407  1.00 58.54           P  
ATOM   1223  OP1  DA I -12      74.519 107.948  17.374  1.00 58.59           O  
ATOM   1224  OP2  DA I -12      74.871 109.242  15.186  1.00 61.82           O  
ATOM   1225  O5'  DA I -12      76.235 109.722  17.205  1.00 56.98           O  
ATOM   1226  C5'  DA I -12      77.106 109.338  18.261  1.00 56.13           C  
ATOM   1227  C4'  DA I -12      77.927 110.522  18.696  1.00 58.06           C  
ATOM   1228  O4'  DA I -12      78.797 110.913  17.610  1.00 58.11           O  
ATOM   1229  C3'  DA I -12      77.070 111.739  19.012  1.00 60.25           C  
ATOM   1230  O3'  DA I -12      77.599 112.410  20.144  1.00 66.92           O  
ATOM   1231  C2'  DA I -12      77.158 112.585  17.756  1.00 58.82           C  
ATOM   1232  C1'  DA I -12      78.520 112.236  17.189  1.00 57.42           C  
ATOM   1233  N9   DA I -12      78.590 112.242  15.730  1.00 61.52           N  
ATOM   1234  C8   DA I -12      77.570 112.064  14.828  1.00 60.12           C  
ATOM   1235  N7   DA I -12      77.959 112.082  13.578  1.00 61.44           N  
ATOM   1236  C5   DA I -12      79.328 112.295  13.657  1.00 62.90           C  
ATOM   1237  C6   DA I -12      80.330 112.411  12.676  1.00 65.65           C  
ATOM   1238  N6   DA I -12      80.100 112.319  11.363  1.00 63.47           N  
ATOM   1239  N1   DA I -12      81.599 112.625  13.096  1.00 67.09           N  
ATOM   1240  C2   DA I -12      81.833 112.714  14.411  1.00 65.03           C  
ATOM   1241  N3   DA I -12      80.982 112.622  15.426  1.00 66.49           N  
ATOM   1242  C4   DA I -12      79.729 112.407  14.977  1.00 64.88           C  
ATOM   1243  P    DT I -11      76.776 113.608  20.801  1.00 72.78           P  
ATOM   1244  OP1  DT I -11      77.070 113.595  22.254  1.00 73.02           O  
ATOM   1245  OP2  DT I -11      75.373 113.532  20.338  1.00 72.63           O  
ATOM   1246  O5'  DT I -11      77.444 114.883  20.126  1.00 74.74           O  
ATOM   1247  C5'  DT I -11      78.849 115.096  20.224  1.00 75.94           C  
ATOM   1248  C4'  DT I -11      79.240 116.354  19.488  1.00 77.37           C  
ATOM   1249  O4'  DT I -11      79.477 116.089  18.083  1.00 76.80           O  
ATOM   1250  C3'  DT I -11      78.194 117.468  19.549  1.00 79.64           C  
ATOM   1251  O3'  DT I -11      78.815 118.711  19.840  1.00 83.89           O  
ATOM   1252  C2'  DT I -11      77.634 117.509  18.139  1.00 78.93           C  
ATOM   1253  C1'  DT I -11      78.838 117.093  17.319  1.00 76.90           C  
ATOM   1254  N1   DT I -11      78.542 116.540  15.983  1.00 77.79           N  
ATOM   1255  C2   DT I -11      79.513 116.676  15.020  1.00 78.53           C  
ATOM   1256  O2   DT I -11      80.583 117.219  15.228  1.00 80.44           O  
ATOM   1257  N3   DT I -11      79.184 116.154  13.798  1.00 77.67           N  
ATOM   1258  C4   DT I -11      78.007 115.529  13.448  1.00 75.60           C  
ATOM   1259  O4   DT I -11      77.858 115.110  12.307  1.00 75.10           O  
ATOM   1260  C5   DT I -11      77.027 115.425  14.502  1.00 76.16           C  
ATOM   1261  C7   DT I -11      75.712 114.776  14.205  1.00 75.26           C  
ATOM   1262  C6   DT I -11      77.342 115.923  15.706  1.00 75.91           C  
ATOM   1263  P    DG I -10      77.943 119.901  20.461  1.00 88.25           P  
ATOM   1264  OP1  DG I -10      78.290 120.032  21.898  1.00 88.10           O  
ATOM   1265  OP2  DG I -10      76.527 119.690  20.061  1.00 88.95           O  
ATOM   1266  O5'  DG I -10      78.489 121.172  19.684  1.00 86.91           O  
ATOM   1267  C5'  DG I -10      79.875 121.295  19.418  1.00 88.49           C  
ATOM   1268  C4'  DG I -10      80.093 122.159  18.201  1.00 88.16           C  
ATOM   1269  O4'  DG I -10      79.734 121.438  16.999  1.00 88.87           O  
ATOM   1270  C3'  DG I -10      79.271 123.444  18.191  1.00 88.80           C  
ATOM   1271  O3'  DG I -10      80.094 124.507  17.712  1.00 88.70           O  
ATOM   1272  C2'  DG I -10      78.131 123.129  17.235  1.00 88.38           C  
ATOM   1273  C1'  DG I -10      78.790 122.185  16.246  1.00 88.80           C  
ATOM   1274  N9   DG I -10      77.897 121.232  15.590  1.00 88.01           N  
ATOM   1275  C8   DG I -10      76.834 120.561  16.145  1.00 87.31           C  
ATOM   1276  N7   DG I -10      76.258 119.734  15.313  1.00 85.90           N  
ATOM   1277  C5   DG I -10      76.977 119.876  14.136  1.00 86.96           C  
ATOM   1278  C6   DG I -10      76.825 119.230  12.883  1.00 87.23           C  
ATOM   1279  O6   DG I -10      76.011 118.364  12.557  1.00 88.80           O  
ATOM   1280  N1   DG I -10      77.760 119.682  11.958  1.00 87.57           N  
ATOM   1281  C2   DG I -10      78.724 120.627  12.207  1.00 87.87           C  
ATOM   1282  N2   DG I -10      79.531 120.932  11.180  1.00 88.37           N  
ATOM   1283  N3   DG I -10      78.884 121.229  13.373  1.00 86.37           N  
ATOM   1284  C4   DG I -10      77.982 120.808  14.285  1.00 87.35           C  
ATOM   1285  P    DT I  -9      79.456 125.950  17.436  1.00 87.87           P  
ATOM   1286  OP1  DT I  -9      80.414 126.971  17.926  1.00 89.76           O  
ATOM   1287  OP2  DT I  -9      78.057 125.958  17.933  1.00 88.24           O  
ATOM   1288  O5'  DT I  -9      79.448 126.005  15.849  1.00 86.50           O  
ATOM   1289  C5'  DT I  -9      80.616 125.642  15.122  1.00 84.35           C  
ATOM   1290  C4'  DT I  -9      80.478 126.066  13.682  1.00 84.38           C  
ATOM   1291  O4'  DT I  -9      79.735 125.078  12.929  1.00 82.96           O  
ATOM   1292  C3'  DT I  -9      79.725 127.382  13.524  1.00 83.74           C  
ATOM   1293  O3'  DT I  -9      80.346 128.185  12.523  1.00 82.16           O  
ATOM   1294  C2'  DT I  -9      78.332 126.943  13.102  1.00 84.02           C  
ATOM   1295  C1'  DT I  -9      78.619 125.686  12.300  1.00 83.46           C  
ATOM   1296  N1   DT I  -9      77.527 124.689  12.268  1.00 83.77           N  
ATOM   1297  C2   DT I  -9      77.285 124.035  11.079  1.00 83.46           C  
ATOM   1298  O2   DT I  -9      77.893 124.278  10.047  1.00 82.22           O  
ATOM   1299  N3   DT I  -9      76.297 123.082  11.142  1.00 83.57           N  
ATOM   1300  C4   DT I  -9      75.536 122.737  12.244  1.00 83.64           C  
ATOM   1301  O4   DT I  -9      74.699 121.843  12.155  1.00 83.67           O  
ATOM   1302  C5   DT I  -9      75.818 123.490  13.446  1.00 83.38           C  
ATOM   1303  C7   DT I  -9      75.021 123.210  14.681  1.00 80.67           C  
ATOM   1304  C6   DT I  -9      76.788 124.414  13.399  1.00 83.31           C  
ATOM   1305  P    DT I  -8      79.708 129.602  12.148  1.00 82.86           P  
ATOM   1306  OP1  DT I  -8      80.811 130.541  11.812  1.00 84.28           O  
ATOM   1307  OP2  DT I  -8      78.742 129.952  13.223  1.00 81.26           O  
ATOM   1308  O5'  DT I  -8      78.891 129.286  10.821  1.00 79.25           O  
ATOM   1309  C5'  DT I  -8      79.549 128.721   9.696  1.00 74.52           C  
ATOM   1310  C4'  DT I  -8      78.592 128.613   8.535  1.00 70.68           C  
ATOM   1311  O4'  DT I  -8      77.688 127.496   8.715  1.00 67.44           O  
ATOM   1312  C3'  DT I  -8      77.713 129.847   8.349  1.00 69.39           C  
ATOM   1313  O3'  DT I  -8      77.607 130.145   6.961  1.00 69.14           O  
ATOM   1314  C2'  DT I  -8      76.369 129.409   8.903  1.00 67.87           C  
ATOM   1315  C1'  DT I  -8      76.354 127.936   8.535  1.00 64.66           C  
ATOM   1316  N1   DT I  -8      75.474 127.069   9.349  1.00 61.19           N  
ATOM   1317  C2   DT I  -8      74.992 125.916   8.762  1.00 58.62           C  
ATOM   1318  O2   DT I  -8      75.241 125.599   7.613  1.00 55.80           O  
ATOM   1319  N3   DT I  -8      74.207 125.143   9.578  1.00 55.98           N  
ATOM   1320  C4   DT I  -8      73.863 125.398  10.889  1.00 56.36           C  
ATOM   1321  O4   DT I  -8      73.156 124.603  11.498  1.00 53.72           O  
ATOM   1322  C5   DT I  -8      74.396 126.628  11.440  1.00 56.74           C  
ATOM   1323  C7   DT I  -8      74.082 126.984  12.859  1.00 54.88           C  
ATOM   1324  C6   DT I  -8      75.157 127.394  10.650  1.00 57.38           C  
ATOM   1325  P    DC I  -7      76.948 131.526   6.502  1.00 70.43           P  
ATOM   1326  OP1  DC I  -7      77.899 132.210   5.592  1.00 69.16           O  
ATOM   1327  OP2  DC I  -7      76.452 132.217   7.718  1.00 70.94           O  
ATOM   1328  O5'  DC I  -7      75.679 131.068   5.661  1.00 68.85           O  
ATOM   1329  C5'  DC I  -7      75.814 130.138   4.590  1.00 65.86           C  
ATOM   1330  C4'  DC I  -7      74.463 129.570   4.228  1.00 64.24           C  
ATOM   1331  O4'  DC I  -7      73.982 128.730   5.306  1.00 62.48           O  
ATOM   1332  C3'  DC I  -7      73.380 130.628   4.006  1.00 62.88           C  
ATOM   1333  O3'  DC I  -7      72.520 130.189   2.964  1.00 65.48           O  
ATOM   1334  C2'  DC I  -7      72.603 130.603   5.309  1.00 60.96           C  
ATOM   1335  C1'  DC I  -7      72.662 129.127   5.626  1.00 61.54           C  
ATOM   1336  N1   DC I  -7      72.376 128.732   7.012  1.00 61.23           N  
ATOM   1337  C2   DC I  -7      71.801 127.470   7.236  1.00 60.01           C  
ATOM   1338  O2   DC I  -7      71.574 126.736   6.266  1.00 60.56           O  
ATOM   1339  N3   DC I  -7      71.510 127.090   8.494  1.00 58.86           N  
ATOM   1340  C4   DC I  -7      71.767 127.912   9.511  1.00 60.13           C  
ATOM   1341  N4   DC I  -7      71.458 127.495  10.737  1.00 60.29           N  
ATOM   1342  C5   DC I  -7      72.353 129.199   9.314  1.00 59.70           C  
ATOM   1343  C6   DC I  -7      72.642 129.563   8.060  1.00 57.87           C  
ATOM   1344  P    DA I  -6      72.801 130.646   1.461  1.00 62.70           P  
ATOM   1345  OP1  DA I  -6      74.259 130.550   1.230  1.00 64.31           O  
ATOM   1346  OP2  DA I  -6      72.101 131.931   1.252  1.00 68.63           O  
ATOM   1347  O5'  DA I  -6      72.091 129.523   0.589  1.00 63.45           O  
ATOM   1348  C5'  DA I  -6      72.659 128.223   0.482  1.00 59.42           C  
ATOM   1349  C4'  DA I  -6      71.567 127.180   0.451  1.00 56.69           C  
ATOM   1350  O4'  DA I  -6      70.967 127.064   1.760  1.00 57.04           O  
ATOM   1351  C3'  DA I  -6      70.426 127.492  -0.508  1.00 53.67           C  
ATOM   1352  O3'  DA I  -6      70.005 126.284  -1.128  1.00 52.10           O  
ATOM   1353  C2'  DA I  -6      69.352 128.079   0.394  1.00 52.21           C  
ATOM   1354  C1'  DA I  -6      69.579 127.365   1.711  1.00 53.18           C  
ATOM   1355  N9   DA I  -6      69.268 128.143   2.911  1.00 54.21           N  
ATOM   1356  C8   DA I  -6      69.491 129.480   3.116  1.00 54.63           C  
ATOM   1357  N7   DA I  -6      69.183 129.889   4.322  1.00 54.15           N  
ATOM   1358  C5   DA I  -6      68.712 128.750   4.951  1.00 52.79           C  
ATOM   1359  C6   DA I  -6      68.244 128.522   6.251  1.00 54.51           C  
ATOM   1360  N6   DA I  -6      68.190 129.468   7.188  1.00 54.11           N  
ATOM   1361  N1   DA I  -6      67.833 127.267   6.565  1.00 54.08           N  
ATOM   1362  C2   DA I  -6      67.898 126.322   5.619  1.00 50.73           C  
ATOM   1363  N3   DA I  -6      68.328 126.418   4.360  1.00 53.16           N  
ATOM   1364  C4   DA I  -6      68.731 127.671   4.087  1.00 53.50           C  
ATOM   1365  P    DG I  -5      68.961 126.335  -2.334  1.00 52.37           P  
ATOM   1366  OP1  DG I  -5      69.266 125.251  -3.288  1.00 49.25           O  
ATOM   1367  OP2  DG I  -5      68.848 127.725  -2.823  1.00 54.01           O  
ATOM   1368  O5'  DG I  -5      67.582 126.012  -1.613  1.00 54.57           O  
ATOM   1369  C5'  DG I  -5      67.437 124.844  -0.820  1.00 51.67           C  
ATOM   1370  C4'  DG I  -5      66.153 124.920  -0.036  1.00 51.98           C  
ATOM   1371  O4'  DG I  -5      66.280 125.849   1.064  1.00 48.92           O  
ATOM   1372  C3'  DG I  -5      64.949 125.403  -0.851  1.00 52.93           C  
ATOM   1373  O3'  DG I  -5      63.795 124.742  -0.356  1.00 54.25           O  
ATOM   1374  C2'  DG I  -5      64.820 126.853  -0.426  1.00 51.34           C  
ATOM   1375  C1'  DG I  -5      65.149 126.696   1.036  1.00 51.63           C  
ATOM   1376  N9   DG I  -5      65.454 127.906   1.787  1.00 55.36           N  
ATOM   1377  C8   DG I  -5      65.979 129.088   1.328  1.00 54.43           C  
ATOM   1378  N7   DG I  -5      66.121 129.981   2.271  1.00 57.63           N  
ATOM   1379  C5   DG I  -5      65.663 129.343   3.418  1.00 58.69           C  
ATOM   1380  C6   DG I  -5      65.566 129.803   4.758  1.00 60.58           C  
ATOM   1381  O6   DG I  -5      65.879 130.904   5.221  1.00 65.24           O  
ATOM   1382  N1   DG I  -5      65.041 128.827   5.596  1.00 60.46           N  
ATOM   1383  C2   DG I  -5      64.663 127.571   5.199  1.00 58.89           C  
ATOM   1384  N2   DG I  -5      64.187 126.762   6.154  1.00 60.41           N  
ATOM   1385  N3   DG I  -5      64.747 127.135   3.959  1.00 56.40           N  
ATOM   1386  C4   DG I  -5      65.252 128.064   3.130  1.00 55.67           C  
ATOM   1387  P    DC I  -4      63.091 123.599  -1.219  1.00 52.18           P  
ATOM   1388  OP1  DC I  -4      64.130 122.634  -1.646  1.00 50.41           O  
ATOM   1389  OP2  DC I  -4      62.246 124.274  -2.233  1.00 53.68           O  
ATOM   1390  O5'  DC I  -4      62.188 122.897  -0.113  1.00 53.15           O  
ATOM   1391  C5'  DC I  -4      62.809 122.296   1.015  1.00 48.14           C  
ATOM   1392  C4'  DC I  -4      62.048 122.627   2.275  1.00 47.50           C  
ATOM   1393  O4'  DC I  -4      62.381 123.944   2.777  1.00 44.00           O  
ATOM   1394  C3'  DC I  -4      60.529 122.575   2.124  1.00 45.58           C  
ATOM   1395  O3'  DC I  -4      59.979 121.711   3.113  1.00 41.34           O  
ATOM   1396  C2'  DC I  -4      60.080 124.017   2.323  1.00 45.35           C  
ATOM   1397  C1'  DC I  -4      61.201 124.650   3.143  1.00 46.60           C  
ATOM   1398  N1   DC I  -4      61.416 126.095   2.846  1.00 46.96           N  
ATOM   1399  C2   DC I  -4      61.443 127.018   3.901  1.00 46.21           C  
ATOM   1400  O2   DC I  -4      61.306 126.616   5.059  1.00 47.26           O  
ATOM   1401  N3   DC I  -4      61.627 128.331   3.628  1.00 48.60           N  
ATOM   1402  C4   DC I  -4      61.789 128.731   2.365  1.00 48.96           C  
ATOM   1403  N4   DC I  -4      61.990 130.039   2.140  1.00 52.10           N  
ATOM   1404  C5   DC I  -4      61.761 127.813   1.272  1.00 45.53           C  
ATOM   1405  C6   DC I  -4      61.579 126.523   1.556  1.00 43.09           C  
ATOM   1406  P    DT I  -3      58.415 121.329   3.060  1.00 36.81           P  
ATOM   1407  OP1  DT I  -3      58.313 119.864   3.363  1.00 40.27           O  
ATOM   1408  OP2  DT I  -3      57.836 121.856   1.818  1.00 31.93           O  
ATOM   1409  O5'  DT I  -3      57.862 122.120   4.309  1.00 32.85           O  
ATOM   1410  C5'  DT I  -3      58.418 121.873   5.586  1.00 36.37           C  
ATOM   1411  C4'  DT I  -3      57.852 122.844   6.589  1.00 42.87           C  
ATOM   1412  O4'  DT I  -3      58.234 124.192   6.219  1.00 46.96           O  
ATOM   1413  C3'  DT I  -3      56.329 122.843   6.689  1.00 42.42           C  
ATOM   1414  O3'  DT I  -3      56.006 122.993   8.059  1.00 44.97           O  
ATOM   1415  C2'  DT I  -3      55.912 124.056   5.872  1.00 44.66           C  
ATOM   1416  C1'  DT I  -3      57.079 125.009   6.090  1.00 45.97           C  
ATOM   1417  N1   DT I  -3      57.341 125.986   5.012  1.00 45.86           N  
ATOM   1418  C2   DT I  -3      57.703 127.267   5.389  1.00 46.36           C  
ATOM   1419  O2   DT I  -3      57.805 127.610   6.552  1.00 46.20           O  
ATOM   1420  N3   DT I  -3      57.943 128.131   4.347  1.00 44.25           N  
ATOM   1421  C4   DT I  -3      57.867 127.850   2.999  1.00 45.43           C  
ATOM   1422  O4   DT I  -3      58.116 128.726   2.176  1.00 46.13           O  
ATOM   1423  C5   DT I  -3      57.488 126.484   2.671  1.00 46.22           C  
ATOM   1424  C7   DT I  -3      57.404 126.083   1.230  1.00 39.15           C  
ATOM   1425  C6   DT I  -3      57.238 125.636   3.684  1.00 41.85           C  
ATOM   1426  P    DG I  -2      54.524 122.692   8.576  1.00 47.94           P  
ATOM   1427  OP1  DG I  -2      54.719 122.079   9.916  1.00 49.64           O  
ATOM   1428  OP2  DG I  -2      53.711 122.005   7.544  1.00 49.94           O  
ATOM   1429  O5'  DG I  -2      53.896 124.136   8.768  1.00 46.79           O  
ATOM   1430  C5'  DG I  -2      54.497 125.060   9.653  1.00 51.33           C  
ATOM   1431  C4'  DG I  -2      53.916 126.433   9.421  1.00 54.28           C  
ATOM   1432  O4'  DG I  -2      54.405 126.976   8.174  1.00 49.85           O  
ATOM   1433  C3'  DG I  -2      52.389 126.442   9.307  1.00 55.98           C  
ATOM   1434  O3'  DG I  -2      51.925 127.662   9.849  1.00 60.85           O  
ATOM   1435  C2'  DG I  -2      52.162 126.495   7.810  1.00 54.34           C  
ATOM   1436  C1'  DG I  -2      53.298 127.409   7.420  1.00 51.83           C  
ATOM   1437  N9   DG I  -2      53.669 127.416   6.014  1.00 51.03           N  
ATOM   1438  C8   DG I  -2      53.473 126.434   5.081  1.00 50.85           C  
ATOM   1439  N7   DG I  -2      53.860 126.781   3.887  1.00 51.48           N  
ATOM   1440  C5   DG I  -2      54.347 128.069   4.050  1.00 53.11           C  
ATOM   1441  C6   DG I  -2      54.884 128.969   3.109  1.00 51.94           C  
ATOM   1442  O6   DG I  -2      55.033 128.809   1.895  1.00 54.61           O  
ATOM   1443  N1   DG I  -2      55.270 130.165   3.705  1.00 53.97           N  
ATOM   1444  C2   DG I  -2      55.153 130.454   5.037  1.00 54.83           C  
ATOM   1445  N2   DG I  -2      55.603 131.653   5.430  1.00 59.13           N  
ATOM   1446  N3   DG I  -2      54.637 129.626   5.925  1.00 54.40           N  
ATOM   1447  C4   DG I  -2      54.258 128.460   5.362  1.00 53.33           C  
ATOM   1448  P    DA I  -1      50.606 127.693  10.751  1.00 62.05           P  
ATOM   1449  OP1  DA I  -1      50.841 126.904  11.985  1.00 59.15           O  
ATOM   1450  OP2  DA I  -1      49.432 127.403   9.890  1.00 59.20           O  
ATOM   1451  O5'  DA I  -1      50.565 129.222  11.163  1.00 61.70           O  
ATOM   1452  C5'  DA I  -1      51.780 129.926  11.397  1.00 61.14           C  
ATOM   1453  C4'  DA I  -1      51.729 131.276  10.723  1.00 64.27           C  
ATOM   1454  O4'  DA I  -1      52.175 131.215   9.346  1.00 61.67           O  
ATOM   1455  C3'  DA I  -1      50.334 131.894  10.693  1.00 65.24           C  
ATOM   1456  O3'  DA I  -1      50.443 133.279  11.006  1.00 72.11           O  
ATOM   1457  C2'  DA I  -1      49.885 131.689   9.256  1.00 61.28           C  
ATOM   1458  C1'  DA I  -1      51.196 131.790   8.494  1.00 60.08           C  
ATOM   1459  N9   DA I  -1      51.241 131.074   7.216  1.00 57.07           N  
ATOM   1460  C8   DA I  -1      51.001 129.745   6.989  1.00 53.49           C  
ATOM   1461  N7   DA I  -1      51.152 129.386   5.737  1.00 52.84           N  
ATOM   1462  C5   DA I  -1      51.508 130.559   5.092  1.00 52.19           C  
ATOM   1463  C6   DA I  -1      51.817 130.850   3.749  1.00 51.73           C  
ATOM   1464  N6   DA I  -1      51.817 129.944   2.767  1.00 46.24           N  
ATOM   1465  N1   DA I  -1      52.132 132.126   3.442  1.00 51.82           N  
ATOM   1466  C2   DA I  -1      52.134 133.035   4.419  1.00 53.11           C  
ATOM   1467  N3   DA I  -1      51.867 132.886   5.714  1.00 55.30           N  
ATOM   1468  C4   DA I  -1      51.559 131.610   5.990  1.00 54.81           C  
ATOM   1469  P    DA I   0      49.136 134.103  11.423  1.00 75.59           P  
ATOM   1470  OP1  DA I   0      49.537 134.992  12.542  1.00 77.46           O  
ATOM   1471  OP2  DA I   0      47.993 133.165  11.598  1.00 76.76           O  
ATOM   1472  O5'  DA I   0      48.868 134.984  10.131  1.00 71.34           O  
ATOM   1473  C5'  DA I   0      49.864 135.878   9.675  1.00 71.14           C  
ATOM   1474  C4'  DA I   0      49.397 136.580   8.428  1.00 71.01           C  
ATOM   1475  O4'  DA I   0      49.612 135.745   7.268  1.00 69.80           O  
ATOM   1476  C3'  DA I   0      47.915 136.948   8.434  1.00 71.46           C  
ATOM   1477  O3'  DA I   0      47.759 138.293   7.987  1.00 72.93           O  
ATOM   1478  C2'  DA I   0      47.296 135.958   7.460  1.00 70.80           C  
ATOM   1479  C1'  DA I   0      48.432 135.691   6.490  1.00 71.32           C  
ATOM   1480  N9   DA I   0      48.390 134.379   5.845  1.00 72.46           N  
ATOM   1481  C8   DA I   0      48.011 133.183   6.402  1.00 71.99           C  
ATOM   1482  N7   DA I   0      48.082 132.171   5.576  1.00 72.30           N  
ATOM   1483  C5   DA I   0      48.538 132.735   4.396  1.00 71.07           C  
ATOM   1484  C6   DA I   0      48.822 132.185   3.142  1.00 72.17           C  
ATOM   1485  N6   DA I   0      48.697 130.885   2.862  1.00 71.06           N  
ATOM   1486  N1   DA I   0      49.251 133.021   2.171  1.00 74.07           N  
ATOM   1487  C2   DA I   0      49.390 134.323   2.463  1.00 73.87           C  
ATOM   1488  N3   DA I   0      49.162 134.956   3.609  1.00 72.69           N  
ATOM   1489  C4   DA I   0      48.731 134.095   4.545  1.00 71.58           C  
ATOM   1490  P    DT I   1      46.290 138.892   7.761  1.00 73.35           P  
ATOM   1491  OP1  DT I   1      46.336 140.338   8.106  1.00 76.01           O  
ATOM   1492  OP2  DT I   1      45.304 138.002   8.433  1.00 72.17           O  
ATOM   1493  O5'  DT I   1      46.105 138.756   6.191  1.00 68.31           O  
ATOM   1494  C5'  DT I   1      47.153 139.147   5.318  1.00 63.87           C  
ATOM   1495  C4'  DT I   1      46.691 139.042   3.889  1.00 63.25           C  
ATOM   1496  O4'  DT I   1      46.855 137.687   3.397  1.00 64.15           O  
ATOM   1497  C3'  DT I   1      45.214 139.390   3.722  1.00 64.36           C  
ATOM   1498  O3'  DT I   1      45.036 140.298   2.645  1.00 65.53           O  
ATOM   1499  C2'  DT I   1      44.554 138.054   3.420  1.00 64.81           C  
ATOM   1500  C1'  DT I   1      45.671 137.275   2.740  1.00 63.38           C  
ATOM   1501  N1   DT I   1      45.567 135.795   2.849  1.00 58.50           N  
ATOM   1502  C2   DT I   1      45.807 135.038   1.722  1.00 57.88           C  
ATOM   1503  O2   DT I   1      46.109 135.519   0.639  1.00 55.99           O  
ATOM   1504  N3   DT I   1      45.676 133.682   1.906  1.00 57.80           N  
ATOM   1505  C4   DT I   1      45.337 133.025   3.071  1.00 57.38           C  
ATOM   1506  O4   DT I   1      45.262 131.799   3.082  1.00 61.35           O  
ATOM   1507  C5   DT I   1      45.097 133.878   4.210  1.00 56.93           C  
ATOM   1508  C7   DT I   1      44.710 133.253   5.514  1.00 52.95           C  
ATOM   1509  C6   DT I   1      45.231 135.202   4.045  1.00 57.62           C  
ATOM   1510  P    DT I   2      43.574 140.878   2.339  1.00 72.04           P  
ATOM   1511  OP1  DT I   2      43.729 142.312   1.984  1.00 73.44           O  
ATOM   1512  OP2  DT I   2      42.672 140.492   3.461  1.00 70.44           O  
ATOM   1513  O5'  DT I   2      43.162 140.081   1.029  1.00 66.51           O  
ATOM   1514  C5'  DT I   2      44.071 140.023  -0.058  1.00 66.38           C  
ATOM   1515  C4'  DT I   2      43.524 139.155  -1.163  1.00 66.41           C  
ATOM   1516  O4'  DT I   2      43.681 137.751  -0.838  1.00 64.81           O  
ATOM   1517  C3'  DT I   2      42.044 139.372  -1.475  1.00 65.55           C  
ATOM   1518  O3'  DT I   2      41.878 139.510  -2.886  1.00 67.50           O  
ATOM   1519  C2'  DT I   2      41.378 138.103  -0.960  1.00 63.12           C  
ATOM   1520  C1'  DT I   2      42.480 137.065  -1.131  1.00 62.24           C  
ATOM   1521  N1   DT I   2      42.411 135.882  -0.244  1.00 57.37           N  
ATOM   1522  C2   DT I   2      42.689 134.647  -0.788  1.00 56.25           C  
ATOM   1523  O2   DT I   2      42.977 134.484  -1.962  1.00 55.99           O  
ATOM   1524  N3   DT I   2      42.616 133.602   0.100  1.00 52.16           N  
ATOM   1525  C4   DT I   2      42.302 133.668   1.439  1.00 52.02           C  
ATOM   1526  O4   DT I   2      42.270 132.643   2.112  1.00 51.05           O  
ATOM   1527  C5   DT I   2      42.024 134.992   1.942  1.00 52.30           C  
ATOM   1528  C7   DT I   2      41.684 135.160   3.388  1.00 48.43           C  
ATOM   1529  C6   DT I   2      42.087 136.017   1.086  1.00 54.41           C  
ATOM   1530  P    DC I   3      40.526 140.147  -3.466  1.00 69.36           P  
ATOM   1531  OP1  DC I   3      40.878 141.119  -4.528  1.00 69.94           O  
ATOM   1532  OP2  DC I   3      39.714 140.584  -2.305  1.00 66.59           O  
ATOM   1533  O5'  DC I   3      39.809 138.907  -4.158  1.00 66.48           O  
ATOM   1534  C5'  DC I   3      40.469 138.169  -5.184  1.00 62.98           C  
ATOM   1535  C4'  DC I   3      39.710 136.898  -5.486  1.00 61.95           C  
ATOM   1536  O4'  DC I   3      39.933 135.898  -4.459  1.00 56.96           O  
ATOM   1537  C3'  DC I   3      38.194 137.079  -5.578  1.00 60.20           C  
ATOM   1538  O3'  DC I   3      37.698 136.257  -6.624  1.00 63.94           O  
ATOM   1539  C2'  DC I   3      37.703 136.527  -4.253  1.00 59.50           C  
ATOM   1540  C1'  DC I   3      38.679 135.385  -4.055  1.00 55.08           C  
ATOM   1541  N1   DC I   3      38.804 134.855  -2.688  1.00 53.71           N  
ATOM   1542  C2   DC I   3      39.172 133.507  -2.528  1.00 52.13           C  
ATOM   1543  O2   DC I   3      39.413 132.829  -3.535  1.00 48.67           O  
ATOM   1544  N3   DC I   3      39.251 132.984  -1.282  1.00 51.14           N  
ATOM   1545  C4   DC I   3      38.981 133.750  -0.223  1.00 48.28           C  
ATOM   1546  N4   DC I   3      39.036 133.181   0.984  1.00 42.24           N  
ATOM   1547  C5   DC I   3      38.634 135.132  -0.356  1.00 48.81           C  
ATOM   1548  C6   DC I   3      38.558 135.636  -1.595  1.00 49.32           C  
ATOM   1549  P    DA I   4      36.987 136.930  -7.888  1.00 66.53           P  
ATOM   1550  OP1  DA I   4      37.878 138.024  -8.342  1.00 70.57           O  
ATOM   1551  OP2  DA I   4      35.569 137.223  -7.531  1.00 68.19           O  
ATOM   1552  O5'  DA I   4      37.001 135.779  -8.987  1.00 65.15           O  
ATOM   1553  C5'  DA I   4      38.218 135.129  -9.343  1.00 63.39           C  
ATOM   1554  C4'  DA I   4      38.024 133.630  -9.344  1.00 63.44           C  
ATOM   1555  O4'  DA I   4      37.902 133.129  -7.990  1.00 63.82           O  
ATOM   1556  C3'  DA I   4      36.766 133.168 -10.072  1.00 62.32           C  
ATOM   1557  O3'  DA I   4      37.041 131.942 -10.745  1.00 60.50           O  
ATOM   1558  C2'  DA I   4      35.758 132.978  -8.950  1.00 62.37           C  
ATOM   1559  C1'  DA I   4      36.634 132.514  -7.798  1.00 62.62           C  
ATOM   1560  N9   DA I   4      36.176 132.895  -6.465  1.00 61.63           N  
ATOM   1561  C8   DA I   4      35.615 134.080  -6.066  1.00 64.03           C  
ATOM   1562  N7   DA I   4      35.418 134.162  -4.770  1.00 61.62           N  
ATOM   1563  C5   DA I   4      35.854 132.939  -4.291  1.00 58.54           C  
ATOM   1564  C6   DA I   4      35.934 132.412  -3.000  1.00 57.05           C  
ATOM   1565  N6   DA I   4      35.585 133.088  -1.901  1.00 53.15           N  
ATOM   1566  N1   DA I   4      36.405 131.154  -2.866  1.00 57.77           N  
ATOM   1567  C2   DA I   4      36.779 130.489  -3.965  1.00 58.98           C  
ATOM   1568  N3   DA I   4      36.767 130.884  -5.233  1.00 58.37           N  
ATOM   1569  C4   DA I   4      36.290 132.135  -5.328  1.00 61.18           C  
ATOM   1570  P    DG I   5      35.948 131.324 -11.731  1.00 63.19           P  
ATOM   1571  OP1  DG I   5      36.677 130.594 -12.797  1.00 62.24           O  
ATOM   1572  OP2  DG I   5      34.982 132.390 -12.094  1.00 64.59           O  
ATOM   1573  O5'  DG I   5      35.170 130.271 -10.822  1.00 63.12           O  
ATOM   1574  C5'  DG I   5      35.847 129.165 -10.236  1.00 58.25           C  
ATOM   1575  C4'  DG I   5      34.923 128.429  -9.292  1.00 56.75           C  
ATOM   1576  O4'  DG I   5      34.686 129.223  -8.103  1.00 53.61           O  
ATOM   1577  C3'  DG I   5      33.537 128.098  -9.855  1.00 56.44           C  
ATOM   1578  O3'  DG I   5      33.125 126.830  -9.347  1.00 53.78           O  
ATOM   1579  C2'  DG I   5      32.657 129.157  -9.214  1.00 55.89           C  
ATOM   1580  C1'  DG I   5      33.300 129.231  -7.846  1.00 54.66           C  
ATOM   1581  N9   DG I   5      32.991 130.395  -7.025  1.00 56.81           N  
ATOM   1582  C8   DG I   5      32.679 131.660  -7.456  1.00 56.16           C  
ATOM   1583  N7   DG I   5      32.449 132.490  -6.476  1.00 57.72           N  
ATOM   1584  C5   DG I   5      32.615 131.729  -5.328  1.00 57.82           C  
ATOM   1585  C6   DG I   5      32.485 132.089  -3.955  1.00 58.86           C  
ATOM   1586  O6   DG I   5      32.195 133.182  -3.471  1.00 58.47           O  
ATOM   1587  N1   DG I   5      32.733 131.009  -3.116  1.00 58.69           N  
ATOM   1588  C2   DG I   5      33.070 129.745  -3.536  1.00 59.43           C  
ATOM   1589  N2   DG I   5      33.278 128.839  -2.562  1.00 55.55           N  
ATOM   1590  N3   DG I   5      33.194 129.396  -4.813  1.00 56.28           N  
ATOM   1591  C4   DG I   5      32.952 130.432  -5.647  1.00 57.77           C  
ATOM   1592  P    DC I   6      33.091 125.546 -10.307  1.00 54.11           P  
ATOM   1593  OP1  DC I   6      34.304 125.590 -11.159  1.00 54.25           O  
ATOM   1594  OP2  DC I   6      31.759 125.367 -10.926  1.00 51.63           O  
ATOM   1595  O5'  DC I   6      33.287 124.349  -9.278  1.00 50.98           O  
ATOM   1596  C5'  DC I   6      34.509 124.212  -8.569  1.00 45.57           C  
ATOM   1597  C4'  DC I   6      34.234 123.876  -7.125  1.00 45.82           C  
ATOM   1598  O4'  DC I   6      33.683 124.999  -6.394  1.00 42.34           O  
ATOM   1599  C3'  DC I   6      33.262 122.724  -6.911  1.00 42.27           C  
ATOM   1600  O3'  DC I   6      33.737 122.100  -5.746  1.00 47.68           O  
ATOM   1601  C2'  DC I   6      31.953 123.436  -6.621  1.00 46.00           C  
ATOM   1602  C1'  DC I   6      32.421 124.657  -5.846  1.00 42.61           C  
ATOM   1603  N1   DC I   6      31.564 125.854  -5.941  1.00 47.33           N  
ATOM   1604  C2   DC I   6      31.246 126.556  -4.762  1.00 45.99           C  
ATOM   1605  O2   DC I   6      31.639 126.114  -3.673  1.00 47.17           O  
ATOM   1606  N3   DC I   6      30.525 127.700  -4.847  1.00 47.52           N  
ATOM   1607  C4   DC I   6      30.133 128.154  -6.039  1.00 48.06           C  
ATOM   1608  N4   DC I   6      29.489 129.321  -6.076  1.00 48.80           N  
ATOM   1609  C5   DC I   6      30.405 127.441  -7.248  1.00 48.51           C  
ATOM   1610  C6   DC I   6      31.112 126.304  -7.152  1.00 47.06           C  
ATOM   1611  P    DT I   7      33.476 120.553  -5.483  1.00 45.40           P  
ATOM   1612  OP1  DT I   7      34.772 120.143  -4.895  1.00 44.88           O  
ATOM   1613  OP2  DT I   7      32.921 119.830  -6.629  1.00 40.68           O  
ATOM   1614  O5'  DT I   7      32.374 120.584  -4.341  1.00 41.01           O  
ATOM   1615  C5'  DT I   7      32.671 121.204  -3.110  1.00 38.23           C  
ATOM   1616  C4'  DT I   7      31.395 121.543  -2.387  1.00 37.55           C  
ATOM   1617  O4'  DT I   7      30.746 122.669  -3.030  1.00 34.75           O  
ATOM   1618  C3'  DT I   7      30.354 120.421  -2.310  1.00 34.59           C  
ATOM   1619  O3'  DT I   7      29.892 120.387  -0.970  1.00 32.66           O  
ATOM   1620  C2'  DT I   7      29.238 120.906  -3.219  1.00 37.70           C  
ATOM   1621  C1'  DT I   7      29.361 122.423  -3.094  1.00 39.53           C  
ATOM   1622  N1   DT I   7      28.811 123.224  -4.215  1.00 42.38           N  
ATOM   1623  C2   DT I   7      28.242 124.463  -3.925  1.00 44.66           C  
ATOM   1624  O2   DT I   7      28.200 124.958  -2.805  1.00 35.02           O  
ATOM   1625  N3   DT I   7      27.726 125.114  -5.012  1.00 46.98           N  
ATOM   1626  C4   DT I   7      27.730 124.690  -6.319  1.00 49.19           C  
ATOM   1627  O4   DT I   7      27.210 125.388  -7.188  1.00 55.50           O  
ATOM   1628  C5   DT I   7      28.365 123.415  -6.559  1.00 47.98           C  
ATOM   1629  C7   DT I   7      28.451 122.911  -7.967  1.00 44.78           C  
ATOM   1630  C6   DT I   7      28.857 122.749  -5.508  1.00 41.56           C  
ATOM   1631  P    DG I   8      28.973 119.191  -0.441  1.00 27.91           P  
ATOM   1632  OP1  DG I   8      29.869 118.325   0.384  1.00 30.92           O  
ATOM   1633  OP2  DG I   8      28.133 118.580  -1.472  1.00 29.71           O  
ATOM   1634  O5'  DG I   8      28.039 119.997   0.557  1.00 29.58           O  
ATOM   1635  C5'  DG I   8      28.631 120.900   1.491  1.00 27.74           C  
ATOM   1636  C4'  DG I   8      27.581 121.810   2.085  1.00 30.02           C  
ATOM   1637  O4'  DG I   8      27.107 122.778   1.120  1.00 27.68           O  
ATOM   1638  C3'  DG I   8      26.340 121.094   2.591  1.00 32.69           C  
ATOM   1639  O3'  DG I   8      25.899 121.798   3.753  1.00 29.52           O  
ATOM   1640  C2'  DG I   8      25.381 121.194   1.416  1.00 26.96           C  
ATOM   1641  C1'  DG I   8      25.766 122.521   0.779  1.00 32.10           C  
ATOM   1642  N9   DG I   8      25.672 122.599  -0.680  1.00 36.84           N  
ATOM   1643  C8   DG I   8      26.044 121.660  -1.610  1.00 37.16           C  
ATOM   1644  N7   DG I   8      25.851 122.057  -2.844  1.00 36.60           N  
ATOM   1645  C5   DG I   8      25.316 123.330  -2.716  1.00 40.38           C  
ATOM   1646  C6   DG I   8      24.915 124.278  -3.714  1.00 40.95           C  
ATOM   1647  O6   DG I   8      24.950 124.160  -4.941  1.00 36.49           O  
ATOM   1648  N1   DG I   8      24.439 125.453  -3.141  1.00 37.63           N  
ATOM   1649  C2   DG I   8      24.341 125.680  -1.793  1.00 39.31           C  
ATOM   1650  N2   DG I   8      23.838 126.856  -1.426  1.00 35.60           N  
ATOM   1651  N3   DG I   8      24.709 124.809  -0.860  1.00 35.52           N  
ATOM   1652  C4   DG I   8      25.188 123.674  -1.388  1.00 37.54           C  
ATOM   1653  P    DA I   9      24.683 121.243   4.605  1.00 29.72           P  
ATOM   1654  OP1  DA I   9      25.053 121.551   6.017  1.00 30.61           O  
ATOM   1655  OP2  DA I   9      24.368 119.860   4.195  1.00 29.20           O  
ATOM   1656  O5'  DA I   9      23.454 122.159   4.166  1.00 30.30           O  
ATOM   1657  C5'  DA I   9      23.518 123.567   4.338  1.00 24.97           C  
ATOM   1658  C4'  DA I   9      22.250 124.207   3.834  1.00 29.94           C  
ATOM   1659  O4'  DA I   9      22.261 124.248   2.395  1.00 32.37           O  
ATOM   1660  C3'  DA I   9      20.964 123.494   4.234  1.00 30.21           C  
ATOM   1661  O3'  DA I   9      20.072 124.475   4.749  1.00 34.17           O  
ATOM   1662  C2'  DA I   9      20.470 122.859   2.940  1.00 28.61           C  
ATOM   1663  C1'  DA I   9      21.047 123.766   1.867  1.00 32.93           C  
ATOM   1664  N9   DA I   9      21.363 123.159   0.568  1.00 36.72           N  
ATOM   1665  C8   DA I   9      21.906 121.921   0.316  1.00 34.78           C  
ATOM   1666  N7   DA I   9      22.092 121.676  -0.956  1.00 35.30           N  
ATOM   1667  C5   DA I   9      21.642 122.828  -1.589  1.00 37.29           C  
ATOM   1668  C6   DA I   9      21.575 123.202  -2.947  1.00 37.84           C  
ATOM   1669  N6   DA I   9      21.989 122.420  -3.950  1.00 31.38           N  
ATOM   1670  N1   DA I   9      21.059 124.425  -3.240  1.00 36.33           N  
ATOM   1671  C2   DA I   9      20.645 125.195  -2.239  1.00 38.34           C  
ATOM   1672  N3   DA I   9      20.663 124.954  -0.927  1.00 40.28           N  
ATOM   1673  C4   DA I   9      21.182 123.745  -0.665  1.00 36.72           C  
ATOM   1674  P    DA I  10      18.647 124.048   5.321  1.00 34.62           P  
ATOM   1675  OP1  DA I  10      18.307 125.048   6.367  1.00 38.09           O  
ATOM   1676  OP2  DA I  10      18.628 122.602   5.668  1.00 36.10           O  
ATOM   1677  O5'  DA I  10      17.698 124.302   4.087  1.00 35.80           O  
ATOM   1678  C5'  DA I  10      17.611 125.619   3.558  1.00 39.28           C  
ATOM   1679  C4'  DA I  10      16.685 125.646   2.372  1.00 42.05           C  
ATOM   1680  O4'  DA I  10      17.342 125.027   1.240  1.00 42.18           O  
ATOM   1681  C3'  DA I  10      15.351 124.917   2.569  1.00 42.36           C  
ATOM   1682  O3'  DA I  10      14.298 125.793   2.167  1.00 51.03           O  
ATOM   1683  C2'  DA I  10      15.459 123.697   1.668  1.00 40.40           C  
ATOM   1684  C1'  DA I  10      16.426 124.164   0.590  1.00 45.37           C  
ATOM   1685  N9   DA I  10      17.202 123.113  -0.065  1.00 42.18           N  
ATOM   1686  C8   DA I  10      17.773 121.998   0.493  1.00 43.88           C  
ATOM   1687  N7   DA I  10      18.425 121.255  -0.363  1.00 41.78           N  
ATOM   1688  C5   DA I  10      18.266 121.920  -1.566  1.00 42.82           C  
ATOM   1689  C6   DA I  10      18.719 121.641  -2.860  1.00 45.49           C  
ATOM   1690  N6   DA I  10      19.459 120.568  -3.172  1.00 42.74           N  
ATOM   1691  N1   DA I  10      18.384 122.508  -3.841  1.00 46.86           N  
ATOM   1692  C2   DA I  10      17.646 123.577  -3.528  1.00 44.05           C  
ATOM   1693  N3   DA I  10      17.162 123.946  -2.345  1.00 44.20           N  
ATOM   1694  C4   DA I  10      17.511 123.063  -1.397  1.00 43.24           C  
ATOM   1695  P    DC I  11      12.757 125.361   2.342  1.00 51.74           P  
ATOM   1696  OP1  DC I  11      12.019 126.611   2.661  1.00 58.16           O  
ATOM   1697  OP2  DC I  11      12.569 124.175   3.187  1.00 50.08           O  
ATOM   1698  O5'  DC I  11      12.365 124.964   0.858  1.00 51.26           O  
ATOM   1699  C5'  DC I  11      12.704 125.846  -0.200  1.00 55.65           C  
ATOM   1700  C4'  DC I  11      12.335 125.233  -1.526  1.00 57.34           C  
ATOM   1701  O4'  DC I  11      13.376 124.364  -2.034  1.00 58.21           O  
ATOM   1702  C3'  DC I  11      11.057 124.405  -1.476  1.00 57.98           C  
ATOM   1703  O3'  DC I  11      10.220 124.800  -2.547  1.00 61.46           O  
ATOM   1704  C2'  DC I  11      11.537 122.981  -1.689  1.00 57.54           C  
ATOM   1705  C1'  DC I  11      12.785 123.179  -2.531  1.00 55.35           C  
ATOM   1706  N1   DC I  11      13.776 122.086  -2.438  1.00 50.90           N  
ATOM   1707  C2   DC I  11      14.447 121.694  -3.599  1.00 53.84           C  
ATOM   1708  O2   DC I  11      14.227 122.310  -4.651  1.00 52.34           O  
ATOM   1709  N3   DC I  11      15.316 120.651  -3.549  1.00 52.74           N  
ATOM   1710  C4   DC I  11      15.522 120.010  -2.394  1.00 50.64           C  
ATOM   1711  N4   DC I  11      16.359 118.968  -2.400  1.00 47.59           N  
ATOM   1712  C5   DC I  11      14.872 120.410  -1.185  1.00 49.51           C  
ATOM   1713  C6   DC I  11      14.020 121.447  -1.253  1.00 48.85           C  
ATOM   1714  P    DA I  12       8.663 124.455  -2.499  1.00 56.72           P  
ATOM   1715  OP1  DA I  12       7.930 125.750  -2.400  1.00 62.30           O  
ATOM   1716  OP2  DA I  12       8.401 123.386  -1.514  1.00 56.28           O  
ATOM   1717  O5'  DA I  12       8.437 123.861  -3.948  1.00 55.68           O  
ATOM   1718  C5'  DA I  12       8.923 124.553  -5.081  1.00 51.58           C  
ATOM   1719  C4'  DA I  12       8.862 123.644  -6.279  1.00 55.78           C  
ATOM   1720  O4'  DA I  12       9.933 122.670  -6.198  1.00 55.26           O  
ATOM   1721  C3'  DA I  12       7.558 122.853  -6.342  1.00 55.93           C  
ATOM   1722  O3'  DA I  12       7.052 122.854  -7.675  1.00 58.32           O  
ATOM   1723  C2'  DA I  12       7.946 121.459  -5.874  1.00 53.72           C  
ATOM   1724  C1'  DA I  12       9.417 121.350  -6.250  1.00 55.72           C  
ATOM   1725  N9   DA I  12      10.218 120.530  -5.334  1.00 56.08           N  
ATOM   1726  C8   DA I  12      10.149 120.517  -3.963  1.00 55.29           C  
ATOM   1727  N7   DA I  12      10.995 119.692  -3.396  1.00 55.02           N  
ATOM   1728  C5   DA I  12      11.662 119.113  -4.464  1.00 55.62           C  
ATOM   1729  C6   DA I  12      12.678 118.140  -4.526  1.00 55.40           C  
ATOM   1730  N6   DA I  12      13.199 117.553  -3.447  1.00 47.65           N  
ATOM   1731  N1   DA I  12      13.139 117.783  -5.753  1.00 54.50           N  
ATOM   1732  C2   DA I  12      12.599 118.372  -6.834  1.00 55.92           C  
ATOM   1733  N3   DA I  12      11.632 119.292  -6.901  1.00 54.63           N  
ATOM   1734  C4   DA I  12      11.200 119.623  -5.668  1.00 55.64           C  
ATOM   1735  P    DT I  13       5.734 122.019  -8.022  1.00 57.96           P  
ATOM   1736  OP1  DT I  13       5.038 122.709  -9.133  1.00 63.98           O  
ATOM   1737  OP2  DT I  13       5.003 121.696  -6.780  1.00 55.70           O  
ATOM   1738  O5'  DT I  13       6.345 120.674  -8.593  1.00 58.80           O  
ATOM   1739  C5'  DT I  13       7.403 120.729  -9.531  1.00 52.00           C  
ATOM   1740  C4'  DT I  13       7.819 119.334  -9.910  1.00 53.39           C  
ATOM   1741  O4'  DT I  13       8.672 118.762  -8.883  1.00 52.20           O  
ATOM   1742  C3'  DT I  13       6.646 118.370 -10.097  1.00 51.02           C  
ATOM   1743  O3'  DT I  13       6.800 117.697 -11.354  1.00 52.95           O  
ATOM   1744  C2'  DT I  13       6.763 117.424  -8.907  1.00 51.01           C  
ATOM   1745  C1'  DT I  13       8.258 117.434  -8.623  1.00 51.89           C  
ATOM   1746  N1   DT I  13       8.709 117.064  -7.250  1.00 52.18           N  
ATOM   1747  C2   DT I  13       9.840 116.259  -7.138  1.00 51.26           C  
ATOM   1748  O2   DT I  13      10.474 115.860  -8.091  1.00 46.60           O  
ATOM   1749  N3   DT I  13      10.204 115.948  -5.856  1.00 51.79           N  
ATOM   1750  C4   DT I  13       9.587 116.352  -4.691  1.00 53.05           C  
ATOM   1751  O4   DT I  13      10.045 115.995  -3.605  1.00 51.56           O  
ATOM   1752  C5   DT I  13       8.415 117.195  -4.869  1.00 51.25           C  
ATOM   1753  C7   DT I  13       7.681 117.673  -3.656  1.00 45.55           C  
ATOM   1754  C6   DT I  13       8.040 117.503  -6.124  1.00 50.83           C  
ATOM   1755  P    DG I  14       5.596 116.815 -11.952  1.00 51.30           P  
ATOM   1756  OP1  DG I  14       5.596 116.995 -13.417  1.00 50.03           O  
ATOM   1757  OP2  DG I  14       4.373 117.064 -11.166  1.00 52.29           O  
ATOM   1758  O5'  DG I  14       6.032 115.317 -11.636  1.00 49.12           O  
ATOM   1759  C5'  DG I  14       7.196 114.754 -12.234  1.00 48.20           C  
ATOM   1760  C4'  DG I  14       7.481 113.398 -11.633  1.00 46.51           C  
ATOM   1761  O4'  DG I  14       7.924 113.571 -10.268  1.00 46.11           O  
ATOM   1762  C3'  DG I  14       6.268 112.465 -11.568  1.00 47.84           C  
ATOM   1763  O3'  DG I  14       6.667 111.121 -11.838  1.00 49.59           O  
ATOM   1764  C2'  DG I  14       5.849 112.549 -10.113  1.00 49.57           C  
ATOM   1765  C1'  DG I  14       7.204 112.673  -9.455  1.00 49.21           C  
ATOM   1766  N9   DG I  14       7.210 113.178  -8.091  1.00 53.87           N  
ATOM   1767  C8   DG I  14       6.418 114.162  -7.550  1.00 54.93           C  
ATOM   1768  N7   DG I  14       6.637 114.352  -6.276  1.00 55.98           N  
ATOM   1769  C5   DG I  14       7.642 113.446  -5.962  1.00 55.79           C  
ATOM   1770  C6   DG I  14       8.280 113.175  -4.728  1.00 56.19           C  
ATOM   1771  O6   DG I  14       8.058 113.679  -3.623  1.00 54.94           O  
ATOM   1772  N1   DG I  14       9.262 112.189  -4.861  1.00 55.90           N  
ATOM   1773  C2   DG I  14       9.573 111.535  -6.031  1.00 56.86           C  
ATOM   1774  N2   DG I  14      10.567 110.625  -5.965  1.00 50.09           N  
ATOM   1775  N3   DG I  14       8.958 111.761  -7.185  1.00 53.53           N  
ATOM   1776  C4   DG I  14       8.017 112.725  -7.076  1.00 55.84           C  
ATOM   1777  P    DC I  15       6.996 110.684 -13.344  1.00 46.80           P  
ATOM   1778  OP1  DC I  15       7.521 111.874 -14.061  1.00 39.84           O  
ATOM   1779  OP2  DC I  15       5.857 109.925 -13.899  1.00 49.68           O  
ATOM   1780  O5'  DC I  15       8.213 109.682 -13.176  1.00 50.66           O  
ATOM   1781  C5'  DC I  15       9.539 110.171 -13.247  1.00 47.12           C  
ATOM   1782  C4'  DC I  15      10.427 109.372 -12.330  1.00 51.52           C  
ATOM   1783  O4'  DC I  15       9.987 109.527 -10.964  1.00 50.15           O  
ATOM   1784  C3'  DC I  15      10.424 107.875 -12.596  1.00 50.15           C  
ATOM   1785  O3'  DC I  15      11.745 107.437 -12.313  1.00 52.40           O  
ATOM   1786  C2'  DC I  15       9.432 107.346 -11.572  1.00 52.32           C  
ATOM   1787  C1'  DC I  15       9.711 108.267 -10.401  1.00 52.11           C  
ATOM   1788  N1   DC I  15       8.672 108.463  -9.382  1.00 54.25           N  
ATOM   1789  C2   DC I  15       9.059 108.428  -8.038  1.00 58.86           C  
ATOM   1790  O2   DC I  15      10.237 108.149  -7.762  1.00 62.17           O  
ATOM   1791  N3   DC I  15       8.151 108.700  -7.076  1.00 58.03           N  
ATOM   1792  C4   DC I  15       6.894 108.989  -7.412  1.00 61.14           C  
ATOM   1793  N4   DC I  15       6.044 109.298  -6.428  1.00 61.86           N  
ATOM   1794  C5   DC I  15       6.456 108.986  -8.772  1.00 57.78           C  
ATOM   1795  C6   DC I  15       7.372 108.714  -9.717  1.00 57.71           C  
ATOM   1796  P    DC I  16      12.306 106.106 -12.978  1.00 52.25           P  
ATOM   1797  OP1  DC I  16      13.670 106.445 -13.480  1.00 50.24           O  
ATOM   1798  OP2  DC I  16      11.304 105.501 -13.887  1.00 48.75           O  
ATOM   1799  O5'  DC I  16      12.470 105.119 -11.754  1.00 49.84           O  
ATOM   1800  C5'  DC I  16      13.290 105.470 -10.657  1.00 45.24           C  
ATOM   1801  C4'  DC I  16      12.922 104.614  -9.475  1.00 42.30           C  
ATOM   1802  O4'  DC I  16      11.607 104.974  -9.000  1.00 40.10           O  
ATOM   1803  C3'  DC I  16      12.857 103.115  -9.785  1.00 42.70           C  
ATOM   1804  O3'  DC I  16      13.310 102.430  -8.637  1.00 45.62           O  
ATOM   1805  C2'  DC I  16      11.365 102.849  -9.873  1.00 45.36           C  
ATOM   1806  C1'  DC I  16      10.879 103.778  -8.785  1.00 42.72           C  
ATOM   1807  N1   DC I  16       9.440 104.095  -8.767  1.00 46.01           N  
ATOM   1808  C2   DC I  16       8.823 104.372  -7.530  1.00 48.30           C  
ATOM   1809  O2   DC I  16       9.497 104.319  -6.483  1.00 40.79           O  
ATOM   1810  N3   DC I  16       7.506 104.686  -7.510  1.00 49.23           N  
ATOM   1811  C4   DC I  16       6.806 104.725  -8.650  1.00 50.66           C  
ATOM   1812  N4   DC I  16       5.512 105.063  -8.577  1.00 50.60           N  
ATOM   1813  C5   DC I  16       7.402 104.428  -9.913  1.00 46.48           C  
ATOM   1814  C6   DC I  16       8.708 104.124  -9.925  1.00 49.49           C  
ATOM   1815  P    DT I  17      14.509 101.381  -8.738  1.00 43.27           P  
ATOM   1816  OP1  DT I  17      15.681 102.079  -9.269  1.00 39.77           O  
ATOM   1817  OP2  DT I  17      13.945 100.199  -9.428  1.00 41.55           O  
ATOM   1818  O5'  DT I  17      14.756 101.087  -7.202  1.00 36.92           O  
ATOM   1819  C5'  DT I  17      14.961 102.180  -6.336  1.00 33.85           C  
ATOM   1820  C4'  DT I  17      14.073 102.065  -5.127  1.00 33.93           C  
ATOM   1821  O4'  DT I  17      12.683 102.269  -5.474  1.00 33.95           O  
ATOM   1822  C3'  DT I  17      14.162 100.710  -4.430  1.00 35.86           C  
ATOM   1823  O3'  DT I  17      14.507 100.916  -3.074  1.00 27.44           O  
ATOM   1824  C2'  DT I  17      12.770 100.104  -4.579  1.00 34.00           C  
ATOM   1825  C1'  DT I  17      11.874 101.317  -4.801  1.00 36.71           C  
ATOM   1826  N1   DT I  17      10.671 101.086  -5.646  1.00 43.28           N  
ATOM   1827  C2   DT I  17       9.434 101.466  -5.148  1.00 48.65           C  
ATOM   1828  O2   DT I  17       9.274 101.918  -4.023  1.00 46.98           O  
ATOM   1829  N3   DT I  17       8.386 101.294  -6.025  1.00 49.73           N  
ATOM   1830  C4   DT I  17       8.448 100.789  -7.314  1.00 50.51           C  
ATOM   1831  O4   DT I  17       7.444 100.738  -7.998  1.00 47.38           O  
ATOM   1832  C5   DT I  17       9.760 100.368  -7.751  1.00 49.00           C  
ATOM   1833  C7   DT I  17       9.906  99.770  -9.119  1.00 44.84           C  
ATOM   1834  C6   DT I  17      10.793 100.537  -6.905  1.00 46.33           C  
ATOM   1835  P    DT I  18      14.759  99.665  -2.139  1.00 32.17           P  
ATOM   1836  OP1  DT I  18      15.758 100.085  -1.135  1.00 32.41           O  
ATOM   1837  OP2  DT I  18      15.008  98.482  -2.971  1.00 31.30           O  
ATOM   1838  O5'  DT I  18      13.377  99.453  -1.390  1.00 35.18           O  
ATOM   1839  C5'  DT I  18      12.768 100.548  -0.703  1.00 37.01           C  
ATOM   1840  C4'  DT I  18      11.350 100.208  -0.304  1.00 38.71           C  
ATOM   1841  O4'  DT I  18      10.483 100.156  -1.465  1.00 38.38           O  
ATOM   1842  C3'  DT I  18      11.182  98.871   0.415  1.00 43.67           C  
ATOM   1843  O3'  DT I  18      10.508  99.086   1.651  1.00 47.11           O  
ATOM   1844  C2'  DT I  18      10.342  98.026  -0.539  1.00 43.62           C  
ATOM   1845  C1'  DT I  18       9.583  99.067  -1.336  1.00 40.85           C  
ATOM   1846  N1   DT I  18       9.133  98.685  -2.703  1.00 43.36           N  
ATOM   1847  C2   DT I  18       7.812  98.963  -3.043  1.00 46.84           C  
ATOM   1848  O2   DT I  18       7.004  99.438  -2.262  1.00 44.50           O  
ATOM   1849  N3   DT I  18       7.474  98.663  -4.342  1.00 42.69           N  
ATOM   1850  C4   DT I  18       8.291  98.122  -5.312  1.00 44.76           C  
ATOM   1851  O4   DT I  18       7.860  97.947  -6.442  1.00 42.62           O  
ATOM   1852  C5   DT I  18       9.647  97.816  -4.886  1.00 42.87           C  
ATOM   1853  C7   DT I  18      10.586  97.204  -5.879  1.00 34.23           C  
ATOM   1854  C6   DT I  18       9.994  98.103  -3.617  1.00 41.80           C  
ATOM   1855  P    DT I  19      10.392  97.893   2.708  1.00 49.49           P  
ATOM   1856  OP1  DT I  19      10.481  98.523   4.046  1.00 52.36           O  
ATOM   1857  OP2  DT I  19      11.284  96.766   2.367  1.00 49.61           O  
ATOM   1858  O5'  DT I  19       8.902  97.399   2.483  1.00 52.94           O  
ATOM   1859  C5'  DT I  19       7.848  98.349   2.480  1.00 55.03           C  
ATOM   1860  C4'  DT I  19       6.545  97.681   2.121  1.00 56.30           C  
ATOM   1861  O4'  DT I  19       6.405  97.531   0.690  1.00 55.49           O  
ATOM   1862  C3'  DT I  19       6.374  96.292   2.722  1.00 58.41           C  
ATOM   1863  O3'  DT I  19       5.108  96.229   3.354  1.00 62.43           O  
ATOM   1864  C2'  DT I  19       6.444  95.360   1.521  1.00 55.66           C  
ATOM   1865  C1'  DT I  19       5.924  96.236   0.402  1.00 53.90           C  
ATOM   1866  N1   DT I  19       6.363  95.890  -0.961  1.00 53.02           N  
ATOM   1867  C2   DT I  19       5.433  96.004  -1.963  1.00 53.39           C  
ATOM   1868  O2   DT I  19       4.276  96.321  -1.757  1.00 56.85           O  
ATOM   1869  N3   DT I  19       5.907  95.728  -3.222  1.00 51.76           N  
ATOM   1870  C4   DT I  19       7.188  95.348  -3.567  1.00 50.15           C  
ATOM   1871  O4   DT I  19       7.477  95.166  -4.747  1.00 48.41           O  
ATOM   1872  C5   DT I  19       8.105  95.208  -2.461  1.00 48.44           C  
ATOM   1873  C7   DT I  19       9.505  94.762  -2.738  1.00 47.19           C  
ATOM   1874  C6   DT I  19       7.654  95.485  -1.229  1.00 51.15           C  
ATOM   1875  P    DT I  20       4.763  95.001   4.316  1.00 65.21           P  
ATOM   1876  OP1  DT I  20       4.099  95.571   5.514  1.00 65.04           O  
ATOM   1877  OP2  DT I  20       5.956  94.132   4.484  1.00 65.25           O  
ATOM   1878  O5'  DT I  20       3.696  94.212   3.447  1.00 68.59           O  
ATOM   1879  C5'  DT I  20       2.611  94.913   2.854  1.00 73.48           C  
ATOM   1880  C4'  DT I  20       1.822  93.986   1.964  1.00 76.56           C  
ATOM   1881  O4'  DT I  20       2.398  93.927   0.637  1.00 75.57           O  
ATOM   1882  C3'  DT I  20       1.775  92.552   2.483  1.00 79.43           C  
ATOM   1883  O3'  DT I  20       0.448  92.049   2.367  1.00 85.64           O  
ATOM   1884  C2'  DT I  20       2.734  91.811   1.564  1.00 78.05           C  
ATOM   1885  C1'  DT I  20       2.579  92.573   0.261  1.00 75.14           C  
ATOM   1886  N1   DT I  20       3.728  92.503  -0.665  1.00 73.89           N  
ATOM   1887  C2   DT I  20       3.464  92.573  -2.015  1.00 74.26           C  
ATOM   1888  O2   DT I  20       2.342  92.729  -2.467  1.00 76.40           O  
ATOM   1889  N3   DT I  20       4.567  92.464  -2.822  1.00 73.00           N  
ATOM   1890  C4   DT I  20       5.880  92.315  -2.426  1.00 72.28           C  
ATOM   1891  O4   DT I  20       6.767  92.221  -3.272  1.00 70.79           O  
ATOM   1892  C5   DT I  20       6.091  92.280  -0.996  1.00 73.08           C  
ATOM   1893  C7   DT I  20       7.486  92.148  -0.472  1.00 72.25           C  
ATOM   1894  C6   DT I  20       5.017  92.369  -0.197  1.00 73.57           C  
ATOM   1895  P    DG I  21       0.082  90.618   2.992  1.00 90.93           P  
ATOM   1896  OP1  DG I  21      -1.137  90.771   3.829  1.00 90.09           O  
ATOM   1897  OP2  DG I  21       1.317  90.045   3.591  1.00 89.95           O  
ATOM   1898  O5'  DG I  21      -0.281  89.765   1.700  1.00 90.35           O  
ATOM   1899  C5'  DG I  21       0.381  90.023   0.467  1.00 92.23           C  
ATOM   1900  C4'  DG I  21      -0.168  89.129  -0.614  1.00 93.07           C  
ATOM   1901  O4'  DG I  21       0.564  89.375  -1.840  1.00 92.32           O  
ATOM   1902  C3'  DG I  21       0.009  87.647  -0.299  1.00 94.18           C  
ATOM   1903  O3'  DG I  21      -1.145  86.913  -0.704  1.00 97.30           O  
ATOM   1904  C2'  DG I  21       1.242  87.252  -1.089  1.00 92.47           C  
ATOM   1905  C1'  DG I  21       1.223  88.197  -2.279  1.00 90.77           C  
ATOM   1906  N9   DG I  21       2.567  88.565  -2.716  1.00 87.73           N  
ATOM   1907  C8   DG I  21       3.645  88.843  -1.909  1.00 86.58           C  
ATOM   1908  N7   DG I  21       4.736  89.092  -2.579  1.00 84.34           N  
ATOM   1909  C5   DG I  21       4.356  88.986  -3.908  1.00 84.26           C  
ATOM   1910  C6   DG I  21       5.117  89.138  -5.090  1.00 83.42           C  
ATOM   1911  O6   DG I  21       6.320  89.396  -5.203  1.00 82.84           O  
ATOM   1912  N1   DG I  21       4.339  88.949  -6.226  1.00 83.11           N  
ATOM   1913  C2   DG I  21       3.000  88.648  -6.224  1.00 84.11           C  
ATOM   1914  N2   DG I  21       2.424  88.509  -7.429  1.00 84.03           N  
ATOM   1915  N3   DG I  21       2.279  88.495  -5.125  1.00 84.08           N  
ATOM   1916  C4   DG I  21       3.016  88.676  -4.011  1.00 85.13           C  
ATOM   1917  P    DA I  22      -1.113  85.309  -0.685  1.00 99.52           P  
ATOM   1918  OP1  DA I  22      -2.455  84.818  -0.270  1.00 98.93           O  
ATOM   1919  OP2  DA I  22       0.092  84.870   0.068  1.00 99.86           O  
ATOM   1920  O5'  DA I  22      -0.883  84.962  -2.217  1.00 97.04           O  
ATOM   1921  C5'  DA I  22      -1.596  85.668  -3.227  1.00 96.60           C  
ATOM   1922  C4'  DA I  22      -1.251  85.100  -4.579  1.00 96.67           C  
ATOM   1923  O4'  DA I  22       0.012  85.640  -5.039  1.00 96.86           O  
ATOM   1924  C3'  DA I  22      -1.075  83.586  -4.522  1.00 96.67           C  
ATOM   1925  O3'  DA I  22      -1.644  82.961  -5.664  1.00 96.98           O  
ATOM   1926  C2'  DA I  22       0.431  83.400  -4.493  1.00 95.82           C  
ATOM   1927  C1'  DA I  22       0.928  84.587  -5.297  1.00 94.81           C  
ATOM   1928  N9   DA I  22       2.261  85.042  -4.903  1.00 93.60           N  
ATOM   1929  C8   DA I  22       2.717  85.314  -3.636  1.00 92.44           C  
ATOM   1930  N7   DA I  22       3.973  85.683  -3.594  1.00 90.35           N  
ATOM   1931  C5   DA I  22       4.371  85.657  -4.922  1.00 91.11           C  
ATOM   1932  C6   DA I  22       5.595  85.941  -5.545  1.00 90.82           C  
ATOM   1933  N6   DA I  22       6.691  86.318  -4.882  1.00 89.50           N  
ATOM   1934  N1   DA I  22       5.659  85.822  -6.889  1.00 91.30           N  
ATOM   1935  C2   DA I  22       4.559  85.439  -7.551  1.00 92.12           C  
ATOM   1936  N3   DA I  22       3.352  85.140  -7.078  1.00 92.25           N  
ATOM   1937  C4   DA I  22       3.325  85.270  -5.740  1.00 92.01           C  
ATOM   1938  P    DT I  23      -1.601  81.366  -5.782  1.00 98.08           P  
ATOM   1939  OP1  DT I  23      -2.894  80.887  -6.337  1.00 98.83           O  
ATOM   1940  OP2  DT I  23      -1.117  80.836  -4.481  1.00 97.56           O  
ATOM   1941  O5'  DT I  23      -0.453  81.120  -6.852  1.00 95.79           O  
ATOM   1942  C5'  DT I  23      -0.479  81.781  -8.111  1.00 92.79           C  
ATOM   1943  C4'  DT I  23       0.665  81.287  -8.960  1.00 92.08           C  
ATOM   1944  O4'  DT I  23       1.905  81.937  -8.576  1.00 89.60           O  
ATOM   1945  C3'  DT I  23       0.898  79.786  -8.788  1.00 91.90           C  
ATOM   1946  O3'  DT I  23       1.211  79.186 -10.036  1.00 93.01           O  
ATOM   1947  C2'  DT I  23       2.104  79.718  -7.872  1.00 90.25           C  
ATOM   1948  C1'  DT I  23       2.883  80.947  -8.300  1.00 88.06           C  
ATOM   1949  N1   DT I  23       3.807  81.470  -7.271  1.00 85.42           N  
ATOM   1950  C2   DT I  23       5.067  81.843  -7.672  1.00 83.27           C  
ATOM   1951  O2   DT I  23       5.430  81.806  -8.835  1.00 84.69           O  
ATOM   1952  N3   DT I  23       5.889  82.264  -6.659  1.00 80.97           N  
ATOM   1953  C4   DT I  23       5.580  82.353  -5.316  1.00 80.97           C  
ATOM   1954  O4   DT I  23       6.433  82.726  -4.514  1.00 77.51           O  
ATOM   1955  C5   DT I  23       4.228  81.974  -4.970  1.00 81.09           C  
ATOM   1956  C7   DT I  23       3.793  82.059  -3.542  1.00 80.22           C  
ATOM   1957  C6   DT I  23       3.421  81.559  -5.952  1.00 82.76           C  
ATOM   1958  P    DG I  24       1.099  77.598 -10.197  1.00 92.78           P  
ATOM   1959  OP1  DG I  24      -0.270  77.288 -10.676  1.00 95.53           O  
ATOM   1960  OP2  DG I  24       1.605  76.966  -8.954  1.00 91.74           O  
ATOM   1961  O5'  DG I  24       2.121  77.296 -11.373  1.00 91.17           O  
ATOM   1962  C5'  DG I  24       2.298  78.237 -12.422  1.00 88.41           C  
ATOM   1963  C4'  DG I  24       3.751  78.291 -12.822  1.00 86.14           C  
ATOM   1964  O4'  DG I  24       4.542  78.867 -11.751  1.00 85.91           O  
ATOM   1965  C3'  DG I  24       4.350  76.917 -13.100  1.00 84.12           C  
ATOM   1966  O3'  DG I  24       5.225  76.998 -14.222  1.00 83.39           O  
ATOM   1967  C2'  DG I  24       5.105  76.592 -11.822  1.00 84.47           C  
ATOM   1968  C1'  DG I  24       5.564  77.963 -11.355  1.00 83.15           C  
ATOM   1969  N9   DG I  24       5.736  78.096  -9.910  1.00 80.78           N  
ATOM   1970  C8   DG I  24       4.868  77.680  -8.930  1.00 79.97           C  
ATOM   1971  N7   DG I  24       5.277  77.972  -7.725  1.00 77.97           N  
ATOM   1972  C5   DG I  24       6.492  78.613  -7.920  1.00 77.48           C  
ATOM   1973  C6   DG I  24       7.402  79.170  -6.978  1.00 75.59           C  
ATOM   1974  O6   DG I  24       7.304  79.224  -5.748  1.00 72.18           O  
ATOM   1975  N1   DG I  24       8.518  79.711  -7.605  1.00 73.14           N  
ATOM   1976  C2   DG I  24       8.732  79.728  -8.960  1.00 76.02           C  
ATOM   1977  N2   DG I  24       9.878  80.296  -9.371  1.00 71.59           N  
ATOM   1978  N3   DG I  24       7.887  79.223  -9.850  1.00 76.91           N  
ATOM   1979  C4   DG I  24       6.797  78.686  -9.262  1.00 78.47           C  
ATOM   1980  P    DG I  25       5.813  75.655 -14.860  1.00 82.30           P  
ATOM   1981  OP1  DG I  25       6.043  75.880 -16.308  1.00 81.05           O  
ATOM   1982  OP2  DG I  25       4.962  74.530 -14.407  1.00 82.15           O  
ATOM   1983  O5'  DG I  25       7.215  75.486 -14.135  1.00 81.67           O  
ATOM   1984  C5'  DG I  25       8.226  76.467 -14.283  1.00 77.70           C  
ATOM   1985  C4'  DG I  25       9.400  76.124 -13.401  1.00 75.32           C  
ATOM   1986  O4'  DG I  25       9.104  76.436 -12.018  1.00 74.67           O  
ATOM   1987  C3'  DG I  25       9.781  74.643 -13.430  1.00 74.21           C  
ATOM   1988  O3'  DG I  25      11.195  74.534 -13.410  1.00 75.99           O  
ATOM   1989  C2'  DG I  25       9.242  74.124 -12.110  1.00 74.28           C  
ATOM   1990  C1'  DG I  25       9.485  75.329 -11.230  1.00 74.13           C  
ATOM   1991  N9   DG I  25       8.754  75.376  -9.970  1.00 73.31           N  
ATOM   1992  C8   DG I  25       7.517  74.847  -9.693  1.00 73.46           C  
ATOM   1993  N7   DG I  25       7.155  75.018  -8.449  1.00 74.05           N  
ATOM   1994  C5   DG I  25       8.214  75.708  -7.874  1.00 73.36           C  
ATOM   1995  C6   DG I  25       8.401  76.166  -6.541  1.00 73.58           C  
ATOM   1996  O6   DG I  25       7.651  76.035  -5.566  1.00 72.89           O  
ATOM   1997  N1   DG I  25       9.615  76.833  -6.395  1.00 72.50           N  
ATOM   1998  C2   DG I  25      10.535  77.024  -7.396  1.00 72.96           C  
ATOM   1999  N2   DG I  25      11.649  77.693  -7.055  1.00 71.89           N  
ATOM   2000  N3   DG I  25      10.378  76.593  -8.637  1.00 72.24           N  
ATOM   2001  C4   DG I  25       9.202  75.949  -8.803  1.00 74.40           C  
ATOM   2002  P    DA I  26      11.997  74.331 -14.781  1.00 77.97           P  
ATOM   2003  OP1  DA I  26      11.374  75.186 -15.826  1.00 79.02           O  
ATOM   2004  OP2  DA I  26      12.135  72.870 -15.009  1.00 79.42           O  
ATOM   2005  O5'  DA I  26      13.433  74.925 -14.444  1.00 75.62           O  
ATOM   2006  C5'  DA I  26      13.654  76.330 -14.444  1.00 70.83           C  
ATOM   2007  C4'  DA I  26      14.594  76.704 -13.326  1.00 69.51           C  
ATOM   2008  O4'  DA I  26      13.934  76.488 -12.057  1.00 67.93           O  
ATOM   2009  C3'  DA I  26      15.878  75.876 -13.282  1.00 67.42           C  
ATOM   2010  O3'  DA I  26      16.961  76.703 -12.849  1.00 65.14           O  
ATOM   2011  C2'  DA I  26      15.557  74.796 -12.263  1.00 67.99           C  
ATOM   2012  C1'  DA I  26      14.631  75.515 -11.291  1.00 68.02           C  
ATOM   2013  N9   DA I  26      13.628  74.654 -10.664  1.00 67.48           N  
ATOM   2014  C8   DA I  26      12.815  73.743 -11.287  1.00 68.44           C  
ATOM   2015  N7   DA I  26      11.971  73.148 -10.481  1.00 67.40           N  
ATOM   2016  C5   DA I  26      12.258  73.693  -9.240  1.00 67.62           C  
ATOM   2017  C6   DA I  26      11.708  73.480  -7.968  1.00 68.48           C  
ATOM   2018  N6   DA I  26      10.697  72.644  -7.734  1.00 69.67           N  
ATOM   2019  N1   DA I  26      12.233  74.169  -6.929  1.00 67.09           N  
ATOM   2020  C2   DA I  26      13.233  75.021  -7.173  1.00 66.33           C  
ATOM   2021  N3   DA I  26      13.826  75.318  -8.328  1.00 66.64           N  
ATOM   2022  C4   DA I  26      13.287  74.611  -9.334  1.00 67.37           C  
ATOM   2023  P    DG I  27      18.467  76.168 -12.951  1.00 62.69           P  
ATOM   2024  OP1  DG I  27      19.294  77.262 -13.509  1.00 66.52           O  
ATOM   2025  OP2  DG I  27      18.419  74.855 -13.638  1.00 65.89           O  
ATOM   2026  O5'  DG I  27      18.857  75.932 -11.431  1.00 59.96           O  
ATOM   2027  C5'  DG I  27      17.823  75.704 -10.496  1.00 56.33           C  
ATOM   2028  C4'  DG I  27      18.354  75.198  -9.180  1.00 52.66           C  
ATOM   2029  O4'  DG I  27      17.248  74.468  -8.612  1.00 51.81           O  
ATOM   2030  C3'  DG I  27      19.501  74.190  -9.217  1.00 50.73           C  
ATOM   2031  O3'  DG I  27      20.000  74.128  -7.876  1.00 48.26           O  
ATOM   2032  C2'  DG I  27      18.768  72.889  -9.461  1.00 48.03           C  
ATOM   2033  C1'  DG I  27      17.582  73.093  -8.538  1.00 50.93           C  
ATOM   2034  N9   DG I  27      16.384  72.330  -8.854  1.00 53.41           N  
ATOM   2035  C8   DG I  27      16.002  71.818 -10.070  1.00 53.60           C  
ATOM   2036  N7   DG I  27      14.887  71.150 -10.010  1.00 55.71           N  
ATOM   2037  C5   DG I  27      14.512  71.227  -8.678  1.00 57.02           C  
ATOM   2038  C6   DG I  27      13.396  70.681  -8.007  1.00 56.37           C  
ATOM   2039  O6   DG I  27      12.488  69.983  -8.469  1.00 60.10           O  
ATOM   2040  N1   DG I  27      13.395  71.021  -6.657  1.00 57.92           N  
ATOM   2041  C2   DG I  27      14.349  71.790  -6.035  1.00 58.54           C  
ATOM   2042  N2   DG I  27      14.171  72.027  -4.729  1.00 57.57           N  
ATOM   2043  N3   DG I  27      15.401  72.293  -6.651  1.00 56.07           N  
ATOM   2044  C4   DG I  27      15.419  71.972  -7.959  1.00 54.80           C  
ATOM   2045  P    DC I  28      21.553  74.316  -7.568  1.00 41.84           P  
ATOM   2046  OP1  DC I  28      21.922  75.685  -7.954  1.00 46.95           O  
ATOM   2047  OP2  DC I  28      22.331  73.190  -8.085  1.00 43.50           O  
ATOM   2048  O5'  DC I  28      21.560  74.237  -5.986  1.00 47.33           O  
ATOM   2049  C5'  DC I  28      20.768  75.140  -5.231  1.00 52.79           C  
ATOM   2050  C4'  DC I  28      20.090  74.418  -4.092  1.00 57.86           C  
ATOM   2051  O4'  DC I  28      19.045  73.546  -4.589  1.00 58.72           O  
ATOM   2052  C3'  DC I  28      21.008  73.539  -3.241  1.00 61.06           C  
ATOM   2053  O3'  DC I  28      20.658  73.708  -1.864  1.00 65.69           O  
ATOM   2054  C2'  DC I  28      20.683  72.133  -3.716  1.00 60.83           C  
ATOM   2055  C1'  DC I  28      19.208  72.248  -4.043  1.00 59.09           C  
ATOM   2056  N1   DC I  28      18.692  71.282  -5.026  1.00 61.45           N  
ATOM   2057  C2   DC I  28      17.522  70.558  -4.716  1.00 60.71           C  
ATOM   2058  O2   DC I  28      16.981  70.724  -3.617  1.00 59.12           O  
ATOM   2059  N3   DC I  28      17.015  69.703  -5.627  1.00 60.72           N  
ATOM   2060  C4   DC I  28      17.615  69.552  -6.809  1.00 60.04           C  
ATOM   2061  N4   DC I  28      17.049  68.726  -7.687  1.00 63.26           N  
ATOM   2062  C5   DC I  28      18.816  70.248  -7.144  1.00 59.93           C  
ATOM   2063  C6   DC I  28      19.318  71.096  -6.229  1.00 61.61           C  
ATOM   2064  P    DA I  29      21.624  73.137  -0.721  1.00 69.60           P  
ATOM   2065  OP1  DA I  29      21.490  73.996   0.479  1.00 68.06           O  
ATOM   2066  OP2  DA I  29      22.963  72.901  -1.317  1.00 70.97           O  
ATOM   2067  O5'  DA I  29      20.980  71.727  -0.371  1.00 70.08           O  
ATOM   2068  C5'  DA I  29      19.698  71.666   0.240  1.00 70.49           C  
ATOM   2069  C4'  DA I  29      19.220  70.237   0.310  1.00 70.73           C  
ATOM   2070  O4'  DA I  29      18.925  69.733  -1.016  1.00 68.53           O  
ATOM   2071  C3'  DA I  29      20.217  69.251   0.921  1.00 70.60           C  
ATOM   2072  O3'  DA I  29      19.481  68.349   1.742  1.00 74.05           O  
ATOM   2073  C2'  DA I  29      20.763  68.514  -0.291  1.00 67.86           C  
ATOM   2074  C1'  DA I  29      19.522  68.459  -1.154  1.00 67.33           C  
ATOM   2075  N9   DA I  29      19.699  68.189  -2.579  1.00 66.28           N  
ATOM   2076  C8   DA I  29      20.672  68.627  -3.447  1.00 67.39           C  
ATOM   2077  N7   DA I  29      20.503  68.211  -4.682  1.00 64.70           N  
ATOM   2078  C5   DA I  29      19.347  67.444  -4.618  1.00 63.81           C  
ATOM   2079  C6   DA I  29      18.627  66.731  -5.592  1.00 62.28           C  
ATOM   2080  N6   DA I  29      18.970  66.678  -6.879  1.00 59.88           N  
ATOM   2081  N1   DA I  29      17.521  66.069  -5.192  1.00 61.52           N  
ATOM   2082  C2   DA I  29      17.163  66.129  -3.907  1.00 61.47           C  
ATOM   2083  N3   DA I  29      17.748  66.772  -2.902  1.00 64.84           N  
ATOM   2084  C4   DA I  29      18.849  67.416  -3.329  1.00 65.04           C  
ATOM   2085  P    DG I  30      20.255  67.347   2.724  1.00 74.30           P  
ATOM   2086  OP1  DG I  30      20.194  67.928   4.082  1.00 76.26           O  
ATOM   2087  OP2  DG I  30      21.565  66.994   2.131  1.00 73.42           O  
ATOM   2088  O5'  DG I  30      19.332  66.055   2.712  1.00 75.53           O  
ATOM   2089  C5'  DG I  30      17.955  66.137   3.059  1.00 74.64           C  
ATOM   2090  C4'  DG I  30      17.253  64.862   2.659  1.00 75.68           C  
ATOM   2091  O4'  DG I  30      17.273  64.751   1.215  1.00 75.38           O  
ATOM   2092  C3'  DG I  30      17.920  63.593   3.184  1.00 76.75           C  
ATOM   2093  O3'  DG I  30      16.916  62.632   3.514  1.00 80.45           O  
ATOM   2094  C2'  DG I  30      18.764  63.124   2.011  1.00 75.32           C  
ATOM   2095  C1'  DG I  30      17.941  63.564   0.814  1.00 74.60           C  
ATOM   2096  N9   DG I  30      18.722  63.877  -0.380  1.00 74.25           N  
ATOM   2097  C8   DG I  30      19.716  64.818  -0.493  1.00 73.87           C  
ATOM   2098  N7   DG I  30      20.223  64.886  -1.694  1.00 72.69           N  
ATOM   2099  C5   DG I  30      19.525  63.932  -2.419  1.00 72.59           C  
ATOM   2100  C6   DG I  30      19.630  63.557  -3.783  1.00 72.73           C  
ATOM   2101  O6   DG I  30      20.379  64.012  -4.654  1.00 73.89           O  
ATOM   2102  N1   DG I  30      18.737  62.544  -4.105  1.00 74.16           N  
ATOM   2103  C2   DG I  30      17.848  61.966  -3.232  1.00 75.34           C  
ATOM   2104  N2   DG I  30      17.068  61.000  -3.740  1.00 74.47           N  
ATOM   2105  N3   DG I  30      17.735  62.311  -1.956  1.00 74.29           N  
ATOM   2106  C4   DG I  30      18.598  63.294  -1.622  1.00 73.67           C  
ATOM   2107  P    DT I  31      17.339  61.218   4.147  1.00 82.65           P  
ATOM   2108  OP1  DT I  31      16.222  60.758   5.008  1.00 84.64           O  
ATOM   2109  OP2  DT I  31      18.699  61.340   4.717  1.00 83.77           O  
ATOM   2110  O5'  DT I  31      17.414  60.263   2.879  1.00 85.40           O  
ATOM   2111  C5'  DT I  31      16.229  59.922   2.172  1.00 87.58           C  
ATOM   2112  C4'  DT I  31      16.484  58.741   1.269  1.00 89.58           C  
ATOM   2113  O4'  DT I  31      17.121  59.159   0.036  1.00 88.22           O  
ATOM   2114  C3'  DT I  31      17.385  57.667   1.879  1.00 90.98           C  
ATOM   2115  O3'  DT I  31      16.845  56.377   1.591  1.00 94.21           O  
ATOM   2116  C2'  DT I  31      18.710  57.874   1.166  1.00 89.58           C  
ATOM   2117  C1'  DT I  31      18.260  58.355  -0.204  1.00 88.64           C  
ATOM   2118  N1   DT I  31      19.238  59.170  -0.947  1.00 88.02           N  
ATOM   2119  C2   DT I  31      19.352  58.956  -2.301  1.00 88.19           C  
ATOM   2120  O2   DT I  31      18.702  58.117  -2.900  1.00 88.36           O  
ATOM   2121  N3   DT I  31      20.262  59.765  -2.934  1.00 88.24           N  
ATOM   2122  C4   DT I  31      21.053  60.740  -2.363  1.00 87.38           C  
ATOM   2123  O4   DT I  31      21.812  61.400  -3.066  1.00 87.58           O  
ATOM   2124  C5   DT I  31      20.897  60.902  -0.936  1.00 87.75           C  
ATOM   2125  C7   DT I  31      21.727  61.926  -0.227  1.00 86.51           C  
ATOM   2126  C6   DT I  31      20.007  60.120  -0.307  1.00 88.60           C  
ATOM   2127  P    DT I  32      17.529  55.067   2.215  1.00 96.40           P  
ATOM   2128  OP1  DT I  32      16.445  54.270   2.837  1.00 97.48           O  
ATOM   2129  OP2  DT I  32      18.707  55.465   3.027  1.00 97.29           O  
ATOM   2130  O5'  DT I  32      18.031  54.294   0.921  1.00 95.44           O  
ATOM   2131  C5'  DT I  32      17.156  54.130  -0.187  1.00 96.64           C  
ATOM   2132  C4'  DT I  32      17.892  53.521  -1.354  1.00 97.74           C  
ATOM   2133  O4'  DT I  32      18.679  54.516  -2.052  1.00 97.28           O  
ATOM   2134  C3'  DT I  32      18.851  52.390  -0.988  1.00 98.21           C  
ATOM   2135  O3'  DT I  32      18.706  51.340  -1.943  1.00 99.69           O  
ATOM   2136  C2'  DT I  32      20.220  53.041  -1.096  1.00 97.36           C  
ATOM   2137  C1'  DT I  32      20.004  54.039  -2.220  1.00 96.61           C  
ATOM   2138  N1   DT I  32      20.910  55.207  -2.222  1.00 94.99           N  
ATOM   2139  C2   DT I  32      21.460  55.592  -3.426  1.00 94.57           C  
ATOM   2140  O2   DT I  32      21.264  54.992  -4.471  1.00 94.19           O  
ATOM   2141  N3   DT I  32      22.256  56.708  -3.361  1.00 93.35           N  
ATOM   2142  C4   DT I  32      22.559  57.453  -2.239  1.00 92.49           C  
ATOM   2143  O4   DT I  32      23.279  58.441  -2.340  1.00 91.90           O  
ATOM   2144  C5   DT I  32      21.970  56.980  -1.007  1.00 92.16           C  
ATOM   2145  C7   DT I  32      22.261  57.712   0.264  1.00 90.44           C  
ATOM   2146  C6   DT I  32      21.185  55.896  -1.060  1.00 93.46           C  
ATOM   2147  P    DT I  33      19.587  50.008  -1.810  1.00101.15           P  
ATOM   2148  OP1  DT I  33      18.649  48.859  -1.846  1.00101.57           O  
ATOM   2149  OP2  DT I  33      20.533  50.151  -0.674  1.00100.35           O  
ATOM   2150  O5'  DT I  33      20.412  50.014  -3.169  1.00101.76           O  
ATOM   2151  C5'  DT I  33      19.783  50.420  -4.383  1.00102.36           C  
ATOM   2152  C4'  DT I  33      20.814  50.612  -5.467  1.00102.90           C  
ATOM   2153  O4'  DT I  33      21.558  51.838  -5.253  1.00103.40           O  
ATOM   2154  C3'  DT I  33      21.848  49.490  -5.531  1.00102.99           C  
ATOM   2155  O3'  DT I  33      22.118  49.145  -6.887  1.00102.76           O  
ATOM   2156  C2'  DT I  33      23.080  50.102  -4.888  1.00103.41           C  
ATOM   2157  C1'  DT I  33      22.949  51.562  -5.278  1.00102.85           C  
ATOM   2158  N1   DT I  33      23.617  52.502  -4.358  1.00102.19           N  
ATOM   2159  C2   DT I  33      24.387  53.506  -4.903  1.00101.57           C  
ATOM   2160  O2   DT I  33      24.546  53.647  -6.105  1.00100.69           O  
ATOM   2161  N3   DT I  33      24.968  54.344  -3.984  1.00101.08           N  
ATOM   2162  C4   DT I  33      24.862  54.276  -2.608  1.00101.11           C  
ATOM   2163  O4   DT I  33      25.434  55.107  -1.908  1.00100.94           O  
ATOM   2164  C5   DT I  33      24.050  53.192  -2.105  1.00101.21           C  
ATOM   2165  C7   DT I  33      23.892  53.031  -0.627  1.00100.85           C  
ATOM   2166  C6   DT I  33      23.472  52.372  -2.994  1.00101.54           C  
ATOM   2167  P    DC I  34      23.106  47.925  -7.203  1.00102.32           P  
ATOM   2168  OP1  DC I  34      22.789  47.449  -8.574  1.00102.34           O  
ATOM   2169  OP2  DC I  34      23.049  46.978  -6.060  1.00101.02           O  
ATOM   2170  O5'  DC I  34      24.545  48.603  -7.218  1.00100.47           O  
ATOM   2171  C5'  DC I  34      24.937  49.450  -8.294  1.00 98.94           C  
ATOM   2172  C4'  DC I  34      26.422  49.718  -8.227  1.00 98.30           C  
ATOM   2173  O4'  DC I  34      26.720  50.671  -7.175  1.00 97.14           O  
ATOM   2174  C3'  DC I  34      27.264  48.477  -7.928  1.00 97.10           C  
ATOM   2175  O3'  DC I  34      28.467  48.511  -8.690  1.00 96.17           O  
ATOM   2176  C2'  DC I  34      27.599  48.634  -6.457  1.00 97.02           C  
ATOM   2177  C1'  DC I  34      27.745  50.140  -6.353  1.00 95.65           C  
ATOM   2178  N1   DC I  34      27.601  50.706  -5.002  1.00 93.00           N  
ATOM   2179  C2   DC I  34      27.889  52.059  -4.811  1.00 91.17           C  
ATOM   2180  O2   DC I  34      28.213  52.742  -5.791  1.00 88.45           O  
ATOM   2181  N3   DC I  34      27.805  52.585  -3.569  1.00 88.94           N  
ATOM   2182  C4   DC I  34      27.442  51.814  -2.542  1.00 90.37           C  
ATOM   2183  N4   DC I  34      27.388  52.368  -1.330  1.00 89.24           N  
ATOM   2184  C5   DC I  34      27.122  50.437  -2.712  1.00 91.77           C  
ATOM   2185  C6   DC I  34      27.212  49.929  -3.947  1.00 92.63           C  
ATOM   2186  P    DC I  35      29.156  47.137  -9.147  1.00 95.55           P  
ATOM   2187  OP1  DC I  35      28.168  46.394  -9.967  1.00 98.42           O  
ATOM   2188  OP2  DC I  35      29.747  46.494  -7.948  1.00 96.08           O  
ATOM   2189  O5'  DC I  35      30.336  47.623 -10.094  1.00 94.31           O  
ATOM   2190  C5'  DC I  35      30.103  48.643 -11.056  1.00 91.20           C  
ATOM   2191  C4'  DC I  35      31.010  49.824 -10.802  1.00 89.18           C  
ATOM   2192  O4'  DC I  35      30.742  50.411  -9.504  1.00 87.65           O  
ATOM   2193  C3'  DC I  35      32.500  49.494 -10.813  1.00 87.35           C  
ATOM   2194  O3'  DC I  35      33.190  50.557 -11.453  1.00 86.30           O  
ATOM   2195  C2'  DC I  35      32.866  49.464  -9.341  1.00 86.58           C  
ATOM   2196  C1'  DC I  35      31.963  50.549  -8.795  1.00 86.95           C  
ATOM   2197  N1   DC I  35      31.674  50.465  -7.355  1.00 86.87           N  
ATOM   2198  C2   DC I  35      32.082  51.518  -6.528  1.00 85.56           C  
ATOM   2199  O2   DC I  35      32.682  52.477  -7.032  1.00 85.12           O  
ATOM   2200  N3   DC I  35      31.814  51.462  -5.205  1.00 84.85           N  
ATOM   2201  C4   DC I  35      31.170  50.408  -4.701  1.00 84.53           C  
ATOM   2202  N4   DC I  35      30.922  50.396  -3.389  1.00 84.15           N  
ATOM   2203  C5   DC I  35      30.749  49.321  -5.517  1.00 84.75           C  
ATOM   2204  C6   DC I  35      31.018  49.390  -6.827  1.00 85.84           C  
ATOM   2205  P    DA I  36      34.212  50.237 -12.641  1.00 86.95           P  
ATOM   2206  OP1  DA I  36      33.440  50.211 -13.908  1.00 86.92           O  
ATOM   2207  OP2  DA I  36      35.017  49.057 -12.243  1.00 88.20           O  
ATOM   2208  O5'  DA I  36      35.146  51.526 -12.660  1.00 85.69           O  
ATOM   2209  C5'  DA I  36      34.572  52.833 -12.690  1.00 81.34           C  
ATOM   2210  C4'  DA I  36      35.346  53.772 -11.794  1.00 78.40           C  
ATOM   2211  O4'  DA I  36      35.178  53.384 -10.410  1.00 75.54           O  
ATOM   2212  C3'  DA I  36      36.853  53.811 -12.045  1.00 77.71           C  
ATOM   2213  O3'  DA I  36      37.322  55.158 -11.919  1.00 77.83           O  
ATOM   2214  C2'  DA I  36      37.418  52.915 -10.956  1.00 75.51           C  
ATOM   2215  C1'  DA I  36      36.435  53.104  -9.811  1.00 76.10           C  
ATOM   2216  N9   DA I  36      36.260  51.925  -8.962  1.00 76.25           N  
ATOM   2217  C8   DA I  36      36.418  50.608  -9.317  1.00 76.84           C  
ATOM   2218  N7   DA I  36      36.151  49.764  -8.350  1.00 77.18           N  
ATOM   2219  C5   DA I  36      35.802  50.578  -7.282  1.00 76.50           C  
ATOM   2220  C6   DA I  36      35.406  50.293  -5.962  1.00 76.29           C  
ATOM   2221  N6   DA I  36      35.283  49.056  -5.474  1.00 76.30           N  
ATOM   2222  N1   DA I  36      35.138  51.335  -5.148  1.00 76.07           N  
ATOM   2223  C2   DA I  36      35.259  52.573  -5.635  1.00 75.80           C  
ATOM   2224  N3   DA I  36      35.616  52.969  -6.854  1.00 76.91           N  
ATOM   2225  C4   DA I  36      35.878  51.912  -7.640  1.00 76.73           C  
ATOM   2226  P    DA I  37      38.889  55.478 -12.068  1.00 76.45           P  
ATOM   2227  OP1  DA I  37      38.990  56.773 -12.785  1.00 78.23           O  
ATOM   2228  OP2  DA I  37      39.579  54.285 -12.615  1.00 78.10           O  
ATOM   2229  O5'  DA I  37      39.357  55.681 -10.560  1.00 75.56           O  
ATOM   2230  C5'  DA I  37      38.646  56.570  -9.703  1.00 72.33           C  
ATOM   2231  C4'  DA I  37      39.143  56.452  -8.283  1.00 71.05           C  
ATOM   2232  O4'  DA I  37      38.667  55.232  -7.667  1.00 71.37           O  
ATOM   2233  C3'  DA I  37      40.662  56.441  -8.118  1.00 71.38           C  
ATOM   2234  O3'  DA I  37      40.999  57.185  -6.945  1.00 70.37           O  
ATOM   2235  C2'  DA I  37      40.964  54.973  -7.878  1.00 71.14           C  
ATOM   2236  C1'  DA I  37      39.760  54.576  -7.053  1.00 71.17           C  
ATOM   2237  N9   DA I  37      39.469  53.144  -6.997  1.00 71.47           N  
ATOM   2238  C8   DA I  37      39.573  52.214  -7.999  1.00 72.33           C  
ATOM   2239  N7   DA I  37      39.249  50.999  -7.627  1.00 73.27           N  
ATOM   2240  C5   DA I  37      38.907  51.139  -6.289  1.00 73.23           C  
ATOM   2241  C6   DA I  37      38.468  50.214  -5.317  1.00 72.94           C  
ATOM   2242  N6   DA I  37      38.280  48.913  -5.559  1.00 73.28           N  
ATOM   2243  N1   DA I  37      38.217  50.682  -4.075  1.00 72.85           N  
ATOM   2244  C2   DA I  37      38.384  51.989  -3.839  1.00 72.98           C  
ATOM   2245  N3   DA I  37      38.785  52.953  -4.667  1.00 72.57           N  
ATOM   2246  C4   DA I  37      39.035  52.456  -5.890  1.00 71.72           C  
ATOM   2247  P    DA I  38      42.538  57.486  -6.602  1.00 68.27           P  
ATOM   2248  OP1  DA I  38      42.879  58.825  -7.140  1.00 63.43           O  
ATOM   2249  OP2  DA I  38      43.353  56.306  -6.990  1.00 66.91           O  
ATOM   2250  O5'  DA I  38      42.548  57.546  -5.014  1.00 65.40           O  
ATOM   2251  C5'  DA I  38      41.406  57.987  -4.289  1.00 62.48           C  
ATOM   2252  C4'  DA I  38      41.403  57.355  -2.918  1.00 61.06           C  
ATOM   2253  O4'  DA I  38      40.885  56.002  -2.996  1.00 62.53           O  
ATOM   2254  C3'  DA I  38      42.807  57.242  -2.326  1.00 59.64           C  
ATOM   2255  O3'  DA I  38      42.810  57.496  -0.925  1.00 53.56           O  
ATOM   2256  C2'  DA I  38      43.181  55.797  -2.585  1.00 62.48           C  
ATOM   2257  C1'  DA I  38      41.844  55.089  -2.483  1.00 65.71           C  
ATOM   2258  N9   DA I  38      41.777  53.867  -3.284  1.00 67.16           N  
ATOM   2259  C8   DA I  38      41.956  53.743  -4.637  1.00 68.28           C  
ATOM   2260  N7   DA I  38      41.857  52.513  -5.073  1.00 69.79           N  
ATOM   2261  C5   DA I  38      41.591  51.775  -3.929  1.00 69.06           C  
ATOM   2262  C6   DA I  38      41.375  50.399  -3.720  1.00 70.00           C  
ATOM   2263  N6   DA I  38      41.403  49.495  -4.695  1.00 68.96           N  
ATOM   2264  N1   DA I  38      41.129  49.985  -2.459  1.00 68.70           N  
ATOM   2265  C2   DA I  38      41.104  50.900  -1.482  1.00 70.72           C  
ATOM   2266  N3   DA I  38      41.295  52.223  -1.554  1.00 69.56           N  
ATOM   2267  C4   DA I  38      41.534  52.597  -2.821  1.00 67.81           C  
ATOM   2268  P    DT I  39      44.205  57.542  -0.140  1.00 52.69           P  
ATOM   2269  OP1  DT I  39      44.338  58.847   0.551  1.00 55.72           O  
ATOM   2270  OP2  DT I  39      45.257  57.115  -1.088  1.00 54.99           O  
ATOM   2271  O5'  DT I  39      44.034  56.411   0.962  1.00 54.68           O  
ATOM   2272  C5'  DT I  39      42.856  56.362   1.755  1.00 63.08           C  
ATOM   2273  C4'  DT I  39      42.810  55.083   2.556  1.00 66.54           C  
ATOM   2274  O4'  DT I  39      42.638  53.950   1.671  1.00 67.42           O  
ATOM   2275  C3'  DT I  39      44.063  54.795   3.379  1.00 70.57           C  
ATOM   2276  O3'  DT I  39      43.674  54.270   4.648  1.00 78.32           O  
ATOM   2277  C2'  DT I  39      44.799  53.754   2.550  1.00 70.48           C  
ATOM   2278  C1'  DT I  39      43.656  52.989   1.911  1.00 68.50           C  
ATOM   2279  N1   DT I  39      43.969  52.330   0.625  1.00 68.42           N  
ATOM   2280  C2   DT I  39      43.738  50.972   0.513  1.00 67.80           C  
ATOM   2281  O2   DT I  39      43.343  50.284   1.438  1.00 66.68           O  
ATOM   2282  N3   DT I  39      43.995  50.449  -0.729  1.00 66.58           N  
ATOM   2283  C4   DT I  39      44.462  51.127  -1.839  1.00 67.46           C  
ATOM   2284  O4   DT I  39      44.618  50.532  -2.898  1.00 66.62           O  
ATOM   2285  C5   DT I  39      44.722  52.533  -1.638  1.00 66.14           C  
ATOM   2286  C7   DT I  39      45.273  53.334  -2.774  1.00 66.89           C  
ATOM   2287  C6   DT I  39      44.460  53.058  -0.435  1.00 67.79           C  
ATOM   2288  P    DA I  40      44.773  53.603   5.608  1.00 82.74           P  
ATOM   2289  OP1  DA I  40      44.153  53.427   6.946  1.00 82.56           O  
ATOM   2290  OP2  DA I  40      46.034  54.373   5.479  1.00 80.91           O  
ATOM   2291  O5'  DA I  40      44.981  52.160   4.971  1.00 86.18           O  
ATOM   2292  C5'  DA I  40      44.046  51.112   5.224  1.00 89.86           C  
ATOM   2293  C4'  DA I  40      44.757  49.781   5.242  1.00 92.37           C  
ATOM   2294  O4'  DA I  40      45.044  49.354   3.889  1.00 93.01           O  
ATOM   2295  C3'  DA I  40      46.101  49.826   5.967  1.00 94.32           C  
ATOM   2296  O3'  DA I  40      46.316  48.620   6.703  1.00 98.39           O  
ATOM   2297  C2'  DA I  40      47.104  49.950   4.834  1.00 93.07           C  
ATOM   2298  C1'  DA I  40      46.440  49.139   3.737  1.00 92.61           C  
ATOM   2299  N9   DA I  40      46.804  49.532   2.378  1.00 91.87           N  
ATOM   2300  C8   DA I  40      47.000  50.796   1.882  1.00 92.12           C  
ATOM   2301  N7   DA I  40      47.285  50.823   0.603  1.00 92.21           N  
ATOM   2302  C5   DA I  40      47.284  49.486   0.234  1.00 91.96           C  
ATOM   2303  C6   DA I  40      47.508  48.843  -0.996  1.00 92.41           C  
ATOM   2304  N6   DA I  40      47.775  49.488  -2.133  1.00 92.19           N  
ATOM   2305  N1   DA I  40      47.445  47.495  -1.018  1.00 92.43           N  
ATOM   2306  C2   DA I  40      47.171  46.848   0.119  1.00 92.18           C  
ATOM   2307  N3   DA I  40      46.932  47.339   1.330  1.00 92.50           N  
ATOM   2308  C4   DA I  40      47.003  48.680   1.320  1.00 91.84           C  
ATOM   2309  P    DC I  41      47.509  48.551   7.773  1.00101.38           P  
ATOM   2310  OP1  DC I  41      47.699  47.130   8.155  1.00101.34           O  
ATOM   2311  OP2  DC I  41      47.239  49.564   8.826  1.00101.86           O  
ATOM   2312  O5'  DC I  41      48.773  49.035   6.934  1.00103.52           O  
ATOM   2313  C5'  DC I  41      50.009  48.338   7.007  1.00107.00           C  
ATOM   2314  C4'  DC I  41      49.881  46.984   6.349  1.00109.21           C  
ATOM   2315  O4'  DC I  41      49.440  47.122   4.974  1.00109.83           O  
ATOM   2316  C3'  DC I  41      51.182  46.188   6.297  1.00110.72           C  
ATOM   2317  O3'  DC I  41      50.922  44.818   6.595  1.00113.95           O  
ATOM   2318  C2'  DC I  41      51.643  46.345   4.860  1.00109.62           C  
ATOM   2319  C1'  DC I  41      50.330  46.433   4.108  1.00108.56           C  
ATOM   2320  N1   DC I  41      50.412  47.187   2.846  1.00107.36           N  
ATOM   2321  C2   DC I  41      50.411  46.483   1.635  1.00106.97           C  
ATOM   2322  O2   DC I  41      50.342  45.245   1.659  1.00107.42           O  
ATOM   2323  N3   DC I  41      50.489  47.169   0.472  1.00106.03           N  
ATOM   2324  C4   DC I  41      50.570  48.501   0.488  1.00105.52           C  
ATOM   2325  N4   DC I  41      50.653  49.136  -0.682  1.00104.96           N  
ATOM   2326  C5   DC I  41      50.571  49.242   1.706  1.00105.42           C  
ATOM   2327  C6   DC I  41      50.491  48.552   2.850  1.00106.44           C  
ATOM   2328  P    DA I  42      52.133  43.868   7.035  1.00116.00           P  
ATOM   2329  OP1  DA I  42      51.569  42.618   7.608  1.00115.95           O  
ATOM   2330  OP2  DA I  42      53.067  44.692   7.845  1.00115.36           O  
ATOM   2331  O5'  DA I  42      52.837  43.526   5.650  1.00116.99           O  
ATOM   2332  C5'  DA I  42      52.279  42.552   4.775  1.00118.71           C  
ATOM   2333  C4'  DA I  42      53.239  42.256   3.649  1.00120.04           C  
ATOM   2334  O4'  DA I  42      53.139  43.274   2.622  1.00120.09           O  
ATOM   2335  C3'  DA I  42      54.706  42.223   4.082  1.00121.03           C  
ATOM   2336  O3'  DA I  42      55.387  41.136   3.451  1.00122.47           O  
ATOM   2337  C2'  DA I  42      55.250  43.552   3.588  1.00121.14           C  
ATOM   2338  C1'  DA I  42      54.432  43.783   2.330  1.00120.49           C  
ATOM   2339  N9   DA I  42      54.294  45.187   1.940  1.00119.64           N  
ATOM   2340  C8   DA I  42      54.189  46.287   2.755  1.00119.29           C  
ATOM   2341  N7   DA I  42      54.086  47.420   2.104  1.00119.16           N  
ATOM   2342  C5   DA I  42      54.121  47.041   0.770  1.00118.93           C  
ATOM   2343  C6   DA I  42      54.058  47.780  -0.425  1.00118.73           C  
ATOM   2344  N6   DA I  42      53.935  49.108  -0.468  1.00118.66           N  
ATOM   2345  N1   DA I  42      54.124  47.099  -1.589  1.00118.16           N  
ATOM   2346  C2   DA I  42      54.246  45.768  -1.544  1.00118.25           C  
ATOM   2347  N3   DA I  42      54.317  44.962  -0.487  1.00118.57           N  
ATOM   2348  C4   DA I  42      54.249  45.670   0.653  1.00118.89           C  
ATOM   2349  P    DC I  43      56.977  40.987   3.621  1.00122.61           P  
ATOM   2350  OP1  DC I  43      57.292  39.545   3.773  1.00122.97           O  
ATOM   2351  OP2  DC I  43      57.427  41.952   4.658  1.00122.63           O  
ATOM   2352  O5'  DC I  43      57.533  41.475   2.213  1.00121.61           O  
ATOM   2353  C5'  DC I  43      57.024  40.911   1.008  1.00120.43           C  
ATOM   2354  C4'  DC I  43      57.714  41.521  -0.188  1.00119.32           C  
ATOM   2355  O4'  DC I  43      57.255  42.882  -0.391  1.00119.19           O  
ATOM   2356  C3'  DC I  43      59.236  41.596  -0.059  1.00117.57           C  
ATOM   2357  O3'  DC I  43      59.847  41.263  -1.304  1.00114.39           O  
ATOM   2358  C2'  DC I  43      59.486  43.053   0.282  1.00117.96           C  
ATOM   2359  C1'  DC I  43      58.372  43.753  -0.472  1.00118.62           C  
ATOM   2360  N1   DC I  43      57.981  45.054   0.093  1.00118.54           N  
ATOM   2361  C2   DC I  43      57.821  46.145  -0.771  1.00118.54           C  
ATOM   2362  O2   DC I  43      58.000  45.980  -1.988  1.00118.33           O  
ATOM   2363  N3   DC I  43      57.477  47.350  -0.259  1.00118.35           N  
ATOM   2364  C4   DC I  43      57.293  47.487   1.056  1.00118.24           C  
ATOM   2365  N4   DC I  43      56.957  48.693   1.517  1.00117.67           N  
ATOM   2366  C5   DC I  43      57.445  46.393   1.957  1.00118.28           C  
ATOM   2367  C6   DC I  43      57.784  45.206   1.438  1.00118.49           C  
ATOM   2368  P    DT I  44      61.445  41.308  -1.445  1.00111.97           P  
ATOM   2369  OP1  DT I  44      61.902  40.001  -1.976  1.00112.91           O  
ATOM   2370  OP2  DT I  44      62.025  41.831  -0.181  1.00111.31           O  
ATOM   2371  O5'  DT I  44      61.665  42.395  -2.581  1.00110.43           O  
ATOM   2372  C5'  DT I  44      61.017  42.258  -3.839  1.00108.82           C  
ATOM   2373  C4'  DT I  44      61.574  43.265  -4.814  1.00107.68           C  
ATOM   2374  O4'  DT I  44      61.095  44.585  -4.465  1.00107.61           O  
ATOM   2375  C3'  DT I  44      63.097  43.340  -4.791  1.00106.74           C  
ATOM   2376  O3'  DT I  44      63.599  43.491  -6.121  1.00105.55           O  
ATOM   2377  C2'  DT I  44      63.384  44.542  -3.907  1.00106.83           C  
ATOM   2378  C1'  DT I  44      62.174  45.442  -4.119  1.00106.50           C  
ATOM   2379  N1   DT I  44      61.771  46.206  -2.917  1.00105.48           N  
ATOM   2380  C2   DT I  44      61.383  47.523  -3.068  1.00105.11           C  
ATOM   2381  O2   DT I  44      61.367  48.099  -4.143  1.00104.06           O  
ATOM   2382  N3   DT I  44      61.013  48.146  -1.903  1.00104.55           N  
ATOM   2383  C4   DT I  44      60.999  47.603  -0.633  1.00105.00           C  
ATOM   2384  O4   DT I  44      60.638  48.286   0.321  1.00104.80           O  
ATOM   2385  C5   DT I  44      61.427  46.226  -0.546  1.00104.33           C  
ATOM   2386  C7   DT I  44      61.456  45.561   0.793  1.00103.78           C  
ATOM   2387  C6   DT I  44      61.783  45.604  -1.676  1.00104.39           C  
ATOM   2388  P    DT I  45      65.066  44.097  -6.355  1.00104.81           P  
ATOM   2389  OP1  DT I  45      65.568  43.567  -7.648  1.00104.84           O  
ATOM   2390  OP2  DT I  45      65.876  43.922  -5.123  1.00104.13           O  
ATOM   2391  O5'  DT I  45      64.755  45.641  -6.549  1.00102.40           O  
ATOM   2392  C5'  DT I  45      63.615  46.042  -7.301  1.00 98.39           C  
ATOM   2393  C4'  DT I  45      63.629  47.535  -7.507  1.00 94.69           C  
ATOM   2394  O4'  DT I  45      63.266  48.203  -6.277  1.00 94.23           O  
ATOM   2395  C3'  DT I  45      64.995  48.084  -7.904  1.00 92.43           C  
ATOM   2396  O3'  DT I  45      64.824  49.111  -8.877  1.00 90.38           O  
ATOM   2397  C2'  DT I  45      65.550  48.622  -6.596  1.00 92.19           C  
ATOM   2398  C1'  DT I  45      64.296  49.095  -5.883  1.00 92.54           C  
ATOM   2399  N1   DT I  45      64.362  49.077  -4.411  1.00 90.89           N  
ATOM   2400  C2   DT I  45      64.088  50.244  -3.735  1.00 90.87           C  
ATOM   2401  O2   DT I  45      63.834  51.295  -4.297  1.00 90.94           O  
ATOM   2402  N3   DT I  45      64.128  50.137  -2.369  1.00 89.92           N  
ATOM   2403  C4   DT I  45      64.414  49.010  -1.627  1.00 89.86           C  
ATOM   2404  O4   DT I  45      64.397  49.066  -0.400  1.00 88.53           O  
ATOM   2405  C5   DT I  45      64.714  47.825  -2.401  1.00 90.48           C  
ATOM   2406  C7   DT I  45      65.054  46.556  -1.685  1.00 89.71           C  
ATOM   2407  C6   DT I  45      64.673  47.918  -3.737  1.00 90.80           C  
ATOM   2408  P    DT I  46      66.086  49.976  -9.350  1.00 90.96           P  
ATOM   2409  OP1  DT I  46      65.952  50.234 -10.805  1.00 90.11           O  
ATOM   2410  OP2  DT I  46      67.318  49.329  -8.828  1.00 90.88           O  
ATOM   2411  O5'  DT I  46      65.885  51.347  -8.569  1.00 91.17           O  
ATOM   2412  C5'  DT I  46      64.794  52.206  -8.884  1.00 91.32           C  
ATOM   2413  C4'  DT I  46      65.156  53.636  -8.563  1.00 90.83           C  
ATOM   2414  O4'  DT I  46      65.049  53.816  -7.132  1.00 91.88           O  
ATOM   2415  C3'  DT I  46      66.592  53.992  -8.939  1.00 91.10           C  
ATOM   2416  O3'  DT I  46      66.713  55.123  -9.815  1.00 90.49           O  
ATOM   2417  C2'  DT I  46      67.346  54.091  -7.624  1.00 91.65           C  
ATOM   2418  C1'  DT I  46      66.271  54.268  -6.565  1.00 91.93           C  
ATOM   2419  N1   DT I  46      66.520  53.469  -5.346  1.00 92.46           N  
ATOM   2420  C2   DT I  46      66.188  54.003  -4.121  1.00 93.49           C  
ATOM   2421  O2   DT I  46      65.699  55.112  -3.987  1.00 95.77           O  
ATOM   2422  N3   DT I  46      66.453  53.186  -3.050  1.00 93.44           N  
ATOM   2423  C4   DT I  46      67.006  51.918  -3.080  1.00 93.85           C  
ATOM   2424  O4   DT I  46      67.184  51.299  -2.034  1.00 93.43           O  
ATOM   2425  C5   DT I  46      67.333  51.424  -4.395  1.00 93.81           C  
ATOM   2426  C7   DT I  46      67.939  50.062  -4.527  1.00 94.46           C  
ATOM   2427  C6   DT I  46      67.076  52.212  -5.447  1.00 93.46           C  
ATOM   2428  P    DT I  47      65.938  56.493  -9.512  1.00 86.69           P  
ATOM   2429  OP1  DT I  47      64.513  56.289  -9.873  1.00 87.66           O  
ATOM   2430  OP2  DT I  47      66.724  57.546 -10.201  1.00 87.77           O  
ATOM   2431  O5'  DT I  47      66.036  56.728  -7.941  1.00 84.30           O  
ATOM   2432  C5'  DT I  47      64.908  57.242  -7.233  1.00 80.56           C  
ATOM   2433  C4'  DT I  47      65.333  58.226  -6.167  1.00 76.13           C  
ATOM   2434  O4'  DT I  47      65.898  57.529  -5.036  1.00 75.64           O  
ATOM   2435  C3'  DT I  47      66.349  59.294  -6.574  1.00 75.22           C  
ATOM   2436  O3'  DT I  47      65.968  60.541  -5.994  1.00 72.44           O  
ATOM   2437  C2'  DT I  47      67.639  58.810  -5.938  1.00 76.88           C  
ATOM   2438  C1'  DT I  47      67.147  58.100  -4.686  1.00 77.42           C  
ATOM   2439  N1   DT I  47      68.012  57.002  -4.216  1.00 78.56           N  
ATOM   2440  C2   DT I  47      68.137  56.806  -2.859  1.00 79.10           C  
ATOM   2441  O2   DT I  47      67.596  57.517  -2.028  1.00 76.99           O  
ATOM   2442  N3   DT I  47      68.923  55.735  -2.509  1.00 81.68           N  
ATOM   2443  C4   DT I  47      69.581  54.863  -3.361  1.00 81.95           C  
ATOM   2444  O4   DT I  47      70.231  53.927  -2.899  1.00 81.46           O  
ATOM   2445  C5   DT I  47      69.424  55.146  -4.769  1.00 81.39           C  
ATOM   2446  C7   DT I  47      70.118  54.274  -5.767  1.00 81.28           C  
ATOM   2447  C6   DT I  47      68.660  56.187  -5.121  1.00 79.97           C  
ATOM   2448  P    DG I  48      66.597  61.912  -6.542  1.00 72.04           P  
ATOM   2449  OP1  DG I  48      65.802  62.420  -7.688  1.00 72.06           O  
ATOM   2450  OP2  DG I  48      68.059  61.728  -6.691  1.00 72.01           O  
ATOM   2451  O5'  DG I  48      66.361  62.899  -5.322  1.00 66.07           O  
ATOM   2452  C5'  DG I  48      65.271  62.694  -4.436  1.00 58.87           C  
ATOM   2453  C4'  DG I  48      65.704  62.974  -3.020  1.00 54.74           C  
ATOM   2454  O4'  DG I  48      66.579  61.922  -2.555  1.00 54.83           O  
ATOM   2455  C3'  DG I  48      66.488  64.270  -2.861  1.00 51.33           C  
ATOM   2456  O3'  DG I  48      66.183  64.813  -1.588  1.00 46.72           O  
ATOM   2457  C2'  DG I  48      67.933  63.810  -2.912  1.00 53.93           C  
ATOM   2458  C1'  DG I  48      67.868  62.440  -2.253  1.00 54.84           C  
ATOM   2459  N9   DG I  48      68.844  61.486  -2.769  1.00 61.48           N  
ATOM   2460  C8   DG I  48      69.247  61.351  -4.075  1.00 59.28           C  
ATOM   2461  N7   DG I  48      70.096  60.380  -4.250  1.00 61.76           N  
ATOM   2462  C5   DG I  48      70.276  59.844  -2.984  1.00 62.63           C  
ATOM   2463  C6   DG I  48      71.074  58.760  -2.558  1.00 64.13           C  
ATOM   2464  O6   DG I  48      71.799  58.032  -3.240  1.00 66.11           O  
ATOM   2465  N1   DG I  48      70.968  58.553  -1.186  1.00 63.02           N  
ATOM   2466  C2   DG I  48      70.189  59.293  -0.335  1.00 63.16           C  
ATOM   2467  N2   DG I  48      70.229  58.942   0.956  1.00 63.24           N  
ATOM   2468  N3   DG I  48      69.428  60.304  -0.722  1.00 62.07           N  
ATOM   2469  C4   DG I  48      69.520  60.523  -2.053  1.00 62.64           C  
ATOM   2470  P    DG I  49      66.751  66.247  -1.168  1.00 47.26           P  
ATOM   2471  OP1  DG I  49      65.586  66.994  -0.628  1.00 45.84           O  
ATOM   2472  OP2  DG I  49      67.558  66.831  -2.247  1.00 43.07           O  
ATOM   2473  O5'  DG I  49      67.696  65.898   0.056  1.00 46.98           O  
ATOM   2474  C5'  DG I  49      67.183  65.128   1.136  1.00 55.28           C  
ATOM   2475  C4'  DG I  49      68.300  64.716   2.060  1.00 59.01           C  
ATOM   2476  O4'  DG I  49      69.090  63.667   1.457  1.00 60.78           O  
ATOM   2477  C3'  DG I  49      69.271  65.845   2.394  1.00 62.29           C  
ATOM   2478  O3'  DG I  49      69.527  65.843   3.790  1.00 64.72           O  
ATOM   2479  C2'  DG I  49      70.522  65.500   1.603  1.00 62.01           C  
ATOM   2480  C1'  DG I  49      70.464  63.988   1.585  1.00 63.21           C  
ATOM   2481  N9   DG I  49      71.183  63.332   0.498  1.00 63.44           N  
ATOM   2482  C8   DG I  49      71.199  63.683  -0.827  1.00 64.17           C  
ATOM   2483  N7   DG I  49      71.924  62.880  -1.560  1.00 66.46           N  
ATOM   2484  C5   DG I  49      72.422  61.948  -0.661  1.00 64.97           C  
ATOM   2485  C6   DG I  49      73.272  60.830  -0.870  1.00 67.58           C  
ATOM   2486  O6   DG I  49      73.780  60.429  -1.930  1.00 66.11           O  
ATOM   2487  N1   DG I  49      73.520  60.149   0.319  1.00 66.57           N  
ATOM   2488  C2   DG I  49      73.027  60.501   1.549  1.00 66.72           C  
ATOM   2489  N2   DG I  49      73.386  59.719   2.575  1.00 64.57           N  
ATOM   2490  N3   DG I  49      72.240  61.544   1.757  1.00 67.01           N  
ATOM   2491  C4   DG I  49      71.978  62.216   0.614  1.00 65.32           C  
ATOM   2492  P    DT I  50      70.507  66.939   4.410  1.00 69.64           P  
ATOM   2493  OP1  DT I  50      69.938  67.429   5.686  1.00 70.66           O  
ATOM   2494  OP2  DT I  50      70.856  67.906   3.339  1.00 69.26           O  
ATOM   2495  O5'  DT I  50      71.784  66.061   4.752  1.00 75.27           O  
ATOM   2496  C5'  DT I  50      71.628  64.830   5.449  1.00 80.35           C  
ATOM   2497  C4'  DT I  50      72.977  64.223   5.731  1.00 84.59           C  
ATOM   2498  O4'  DT I  50      73.475  63.540   4.557  1.00 85.30           O  
ATOM   2499  C3'  DT I  50      74.029  65.263   6.106  1.00 87.25           C  
ATOM   2500  O3'  DT I  50      74.781  64.808   7.226  1.00 91.85           O  
ATOM   2501  C2'  DT I  50      74.883  65.385   4.855  1.00 85.46           C  
ATOM   2502  C1'  DT I  50      74.778  64.000   4.244  1.00 85.20           C  
ATOM   2503  N1   DT I  50      74.931  63.944   2.778  1.00 86.09           N  
ATOM   2504  C2   DT I  50      75.567  62.848   2.237  1.00 86.61           C  
ATOM   2505  O2   DT I  50      76.021  61.940   2.916  1.00 86.63           O  
ATOM   2506  N3   DT I  50      75.654  62.855   0.865  1.00 84.74           N  
ATOM   2507  C4   DT I  50      75.184  63.827   0.004  1.00 84.90           C  
ATOM   2508  O4   DT I  50      75.325  63.694  -1.208  1.00 84.09           O  
ATOM   2509  C5   DT I  50      74.541  64.951   0.639  1.00 84.52           C  
ATOM   2510  C7   DT I  50      74.013  66.058  -0.216  1.00 85.08           C  
ATOM   2511  C6   DT I  50      74.447  64.955   1.975  1.00 85.48           C  
ATOM   2512  P    DA I  51      76.017  65.677   7.749  1.00 95.39           P  
ATOM   2513  OP1  DA I  51      76.115  65.511   9.222  1.00 95.49           O  
ATOM   2514  OP2  DA I  51      75.912  67.039   7.166  1.00 95.40           O  
ATOM   2515  O5'  DA I  51      77.247  64.945   7.063  1.00 98.45           O  
ATOM   2516  C5'  DA I  51      77.508  63.571   7.327  1.00102.60           C  
ATOM   2517  C4'  DA I  51      78.954  63.272   7.029  1.00105.96           C  
ATOM   2518  O4'  DA I  51      79.117  63.050   5.607  1.00105.71           O  
ATOM   2519  C3'  DA I  51      79.846  64.458   7.388  1.00108.56           C  
ATOM   2520  O3'  DA I  51      81.053  64.038   8.016  1.00112.68           O  
ATOM   2521  C2'  DA I  51      80.107  65.132   6.054  1.00107.55           C  
ATOM   2522  C1'  DA I  51      80.030  63.987   5.060  1.00106.19           C  
ATOM   2523  N9   DA I  51      79.524  64.393   3.749  1.00104.67           N  
ATOM   2524  C8   DA I  51      78.745  65.486   3.462  1.00104.54           C  
ATOM   2525  N7   DA I  51      78.453  65.609   2.191  1.00104.04           N  
ATOM   2526  C5   DA I  51      79.079  64.522   1.599  1.00104.42           C  
ATOM   2527  C6   DA I  51      79.151  64.084   0.267  1.00104.25           C  
ATOM   2528  N6   DA I  51      78.563  64.716  -0.751  1.00104.30           N  
ATOM   2529  N1   DA I  51      79.858  62.962   0.013  1.00103.64           N  
ATOM   2530  C2   DA I  51      80.445  62.331   1.035  1.00103.11           C  
ATOM   2531  N3   DA I  51      80.449  62.643   2.328  1.00103.80           N  
ATOM   2532  C4   DA I  51      79.740  63.763   2.548  1.00104.25           C  
ATOM   2533  P    DG I  52      82.261  65.078   8.174  1.00116.17           P  
ATOM   2534  OP1  DG I  52      83.017  64.697   9.395  1.00116.57           O  
ATOM   2535  OP2  DG I  52      81.736  66.461   8.039  1.00115.65           O  
ATOM   2536  O5'  DG I  52      83.153  64.747   6.901  1.00118.38           O  
ATOM   2537  C5'  DG I  52      83.449  63.392   6.578  1.00122.11           C  
ATOM   2538  C4'  DG I  52      84.474  63.328   5.474  1.00124.80           C  
ATOM   2539  O4'  DG I  52      83.843  63.570   4.192  1.00125.33           O  
ATOM   2540  C3'  DG I  52      85.594  64.359   5.607  1.00126.24           C  
ATOM   2541  O3'  DG I  52      86.854  63.760   5.306  1.00128.21           O  
ATOM   2542  C2'  DG I  52      85.230  65.411   4.575  1.00126.57           C  
ATOM   2543  C1'  DG I  52      84.540  64.591   3.501  1.00126.17           C  
ATOM   2544  N9   DG I  52      83.571  65.339   2.704  1.00126.43           N  
ATOM   2545  C8   DG I  52      82.824  66.419   3.108  1.00126.67           C  
ATOM   2546  N7   DG I  52      82.060  66.895   2.164  1.00127.03           N  
ATOM   2547  C5   DG I  52      82.313  66.078   1.071  1.00126.82           C  
ATOM   2548  C6   DG I  52      81.778  66.109  -0.244  1.00127.15           C  
ATOM   2549  O6   DG I  52      80.948  66.892  -0.721  1.00127.71           O  
ATOM   2550  N1   DG I  52      82.306  65.094  -1.033  1.00126.78           N  
ATOM   2551  C2   DG I  52      83.229  64.168  -0.616  1.00126.35           C  
ATOM   2552  N2   DG I  52      83.614  63.266  -1.529  1.00126.09           N  
ATOM   2553  N3   DG I  52      83.737  64.129   0.605  1.00126.25           N  
ATOM   2554  C4   DG I  52      83.239  65.107   1.390  1.00126.48           C  
ATOM   2555  P    DA I  53      88.107  64.689   4.937  1.00129.27           P  
ATOM   2556  OP1  DA I  53      89.337  63.941   5.301  1.00129.84           O  
ATOM   2557  OP2  DA I  53      87.876  66.045   5.501  1.00129.23           O  
ATOM   2558  O5'  DA I  53      88.036  64.770   3.350  1.00129.57           O  
ATOM   2559  C5'  DA I  53      88.256  63.602   2.565  1.00131.07           C  
ATOM   2560  C4'  DA I  53      88.881  63.975   1.243  1.00132.06           C  
ATOM   2561  O4'  DA I  53      87.865  64.427   0.318  1.00132.34           O  
ATOM   2562  C3'  DA I  53      89.905  65.104   1.344  1.00132.71           C  
ATOM   2563  O3'  DA I  53      91.024  64.825   0.501  1.00133.26           O  
ATOM   2564  C2'  DA I  53      89.131  66.323   0.871  1.00132.64           C  
ATOM   2565  C1'  DA I  53      88.173  65.731  -0.149  1.00132.73           C  
ATOM   2566  N9   DA I  53      86.913  66.459  -0.294  1.00133.24           N  
ATOM   2567  C8   DA I  53      86.189  67.106   0.679  1.00133.36           C  
ATOM   2568  N7   DA I  53      85.088  67.664   0.237  1.00133.21           N  
ATOM   2569  C5   DA I  53      85.086  67.367  -1.119  1.00133.28           C  
ATOM   2570  C6   DA I  53      84.186  67.676  -2.153  1.00133.09           C  
ATOM   2571  N6   DA I  53      83.067  68.380  -1.974  1.00133.27           N  
ATOM   2572  N1   DA I  53      84.479  67.231  -3.394  1.00133.21           N  
ATOM   2573  C2   DA I  53      85.601  66.523  -3.573  1.00133.16           C  
ATOM   2574  N3   DA I  53      86.525  66.169  -2.683  1.00133.27           N  
ATOM   2575  C4   DA I  53      86.205  66.627  -1.460  1.00133.36           C  
ATOM   2576  P    DA I  54      92.055  65.997   0.129  1.00132.98           P  
ATOM   2577  OP1  DA I  54      93.338  65.373  -0.283  1.00133.33           O  
ATOM   2578  OP2  DA I  54      92.042  66.994   1.229  1.00132.80           O  
ATOM   2579  O5'  DA I  54      91.385  66.653  -1.154  1.00132.92           O  
ATOM   2580  C5'  DA I  54      91.010  65.839  -2.261  1.00132.75           C  
ATOM   2581  C4'  DA I  54      90.741  66.702  -3.469  1.00132.55           C  
ATOM   2582  O4'  DA I  54      89.428  67.306  -3.375  1.00132.83           O  
ATOM   2583  C3'  DA I  54      91.735  67.852  -3.625  1.00132.46           C  
ATOM   2584  O3'  DA I  54      92.080  68.000  -4.997  1.00131.79           O  
ATOM   2585  C2'  DA I  54      90.959  69.058  -3.130  1.00132.58           C  
ATOM   2586  C1'  DA I  54      89.533  68.714  -3.519  1.00132.72           C  
ATOM   2587  N9   DA I  54      88.520  69.333  -2.663  1.00132.47           N  
ATOM   2588  C8   DA I  54      88.552  69.475  -1.297  1.00132.13           C  
ATOM   2589  N7   DA I  54      87.504  70.088  -0.804  1.00131.94           N  
ATOM   2590  C5   DA I  54      86.724  70.365  -1.918  1.00131.86           C  
ATOM   2591  C6   DA I  54      85.479  71.002  -2.066  1.00131.43           C  
ATOM   2592  N6   DA I  54      84.775  71.496  -1.046  1.00131.03           N  
ATOM   2593  N1   DA I  54      84.977  71.116  -3.314  1.00131.20           N  
ATOM   2594  C2   DA I  54      85.683  70.620  -4.336  1.00131.53           C  
ATOM   2595  N3   DA I  54      86.863  70.000  -4.325  1.00131.84           N  
ATOM   2596  C4   DA I  54      87.336  69.903  -3.070  1.00132.12           C  
ATOM   2597  P    DT I  55      93.096  69.157  -5.449  1.00131.07           P  
ATOM   2598  OP1  DT I  55      94.355  68.502  -5.888  1.00130.80           O  
ATOM   2599  OP2  DT I  55      93.144  70.210  -4.403  1.00131.41           O  
ATOM   2600  O5'  DT I  55      92.367  69.739  -6.736  1.00129.80           O  
ATOM   2601  C5'  DT I  55      91.626  68.860  -7.579  1.00127.08           C  
ATOM   2602  C4'  DT I  55      90.529  69.604  -8.301  1.00124.56           C  
ATOM   2603  O4'  DT I  55      89.516  70.067  -7.374  1.00124.28           O  
ATOM   2604  C3'  DT I  55      90.981  70.831  -9.089  1.00122.78           C  
ATOM   2605  O3'  DT I  55      90.331  70.823 -10.359  1.00119.59           O  
ATOM   2606  C2'  DT I  55      90.496  71.996  -8.242  1.00122.99           C  
ATOM   2607  C1'  DT I  55      89.226  71.429  -7.642  1.00123.96           C  
ATOM   2608  N1   DT I  55      88.774  72.062  -6.386  1.00124.45           N  
ATOM   2609  C2   DT I  55      87.555  72.708  -6.390  1.00124.63           C  
ATOM   2610  O2   DT I  55      86.849  72.797  -7.382  1.00124.32           O  
ATOM   2611  N3   DT I  55      87.191  73.251  -5.183  1.00124.35           N  
ATOM   2612  C4   DT I  55      87.907  73.219  -4.002  1.00124.22           C  
ATOM   2613  O4   DT I  55      87.444  73.742  -2.992  1.00123.72           O  
ATOM   2614  C5   DT I  55      89.181  72.540  -4.074  1.00124.30           C  
ATOM   2615  C7   DT I  55      90.033  72.470  -2.846  1.00124.57           C  
ATOM   2616  C6   DT I  55      89.546  72.001  -5.246  1.00124.48           C  
ATOM   2617  P    DC I  56      90.606  72.007 -11.401  1.00117.27           P  
ATOM   2618  OP1  DC I  56      90.660  71.401 -12.758  1.00117.16           O  
ATOM   2619  OP2  DC I  56      91.751  72.817 -10.909  1.00118.25           O  
ATOM   2620  O5'  DC I  56      89.283  72.884 -11.297  1.00114.33           O  
ATOM   2621  C5'  DC I  56      88.004  72.268 -11.405  1.00108.04           C  
ATOM   2622  C4'  DC I  56      86.910  73.302 -11.282  1.00103.55           C  
ATOM   2623  O4'  DC I  56      86.798  73.758  -9.912  1.00103.26           O  
ATOM   2624  C3'  DC I  56      87.108  74.557 -12.132  1.00 99.14           C  
ATOM   2625  O3'  DC I  56      85.850  74.943 -12.684  1.00 93.35           O  
ATOM   2626  C2'  DC I  56      87.582  75.591 -11.126  1.00 99.73           C  
ATOM   2627  C1'  DC I  56      86.811  75.175  -9.888  1.00102.28           C  
ATOM   2628  N1   DC I  56      87.380  75.603  -8.600  1.00102.62           N  
ATOM   2629  C2   DC I  56      86.583  76.359  -7.734  1.00102.58           C  
ATOM   2630  O2   DC I  56      85.436  76.662  -8.085  1.00101.97           O  
ATOM   2631  N3   DC I  56      87.083  76.743  -6.540  1.00103.15           N  
ATOM   2632  C4   DC I  56      88.329  76.408  -6.202  1.00103.68           C  
ATOM   2633  N4   DC I  56      88.781  76.809  -5.012  1.00104.10           N  
ATOM   2634  C5   DC I  56      89.166  75.646  -7.068  1.00103.45           C  
ATOM   2635  C6   DC I  56      88.655  75.268  -8.247  1.00102.87           C  
ATOM   2636  P    DT I  57      85.798  76.000 -13.888  1.00 88.49           P  
ATOM   2637  OP1  DT I  57      84.836  75.507 -14.907  1.00 87.00           O  
ATOM   2638  OP2  DT I  57      87.194  76.310 -14.283  1.00 88.25           O  
ATOM   2639  O5'  DT I  57      85.184  77.298 -13.207  1.00 85.65           O  
ATOM   2640  C5'  DT I  57      83.827  77.319 -12.783  1.00 78.01           C  
ATOM   2641  C4'  DT I  57      83.499  78.659 -12.170  1.00 73.14           C  
ATOM   2642  O4'  DT I  57      84.147  78.786 -10.882  1.00 71.26           O  
ATOM   2643  C3'  DT I  57      83.961  79.860 -12.998  1.00 70.29           C  
ATOM   2644  O3'  DT I  57      82.982  80.893 -12.915  1.00 66.37           O  
ATOM   2645  C2'  DT I  57      85.210  80.315 -12.268  1.00 70.85           C  
ATOM   2646  C1'  DT I  57      84.815  80.029 -10.837  1.00 73.21           C  
ATOM   2647  N1   DT I  57      85.913  79.934  -9.863  1.00 76.89           N  
ATOM   2648  C2   DT I  57      85.773  80.648  -8.695  1.00 79.12           C  
ATOM   2649  O2   DT I  57      84.793  81.331  -8.446  1.00 78.24           O  
ATOM   2650  N3   DT I  57      86.830  80.540  -7.826  1.00 81.56           N  
ATOM   2651  C4   DT I  57      87.988  79.811  -8.006  1.00 81.60           C  
ATOM   2652  O4   DT I  57      88.859  79.826  -7.138  1.00 82.45           O  
ATOM   2653  C5   DT I  57      88.066  79.078  -9.252  1.00 80.71           C  
ATOM   2654  C7   DT I  57      89.283  78.254  -9.532  1.00 81.51           C  
ATOM   2655  C6   DT I  57      87.036  79.173 -10.106  1.00 79.12           C  
ATOM   2656  P    DG I  58      82.249  81.409 -14.243  1.00 62.15           P  
ATOM   2657  OP1  DG I  58      81.574  80.262 -14.888  1.00 62.58           O  
ATOM   2658  OP2  DG I  58      83.213  82.225 -15.018  1.00 62.70           O  
ATOM   2659  O5'  DG I  58      81.132  82.393 -13.677  1.00 62.82           O  
ATOM   2660  C5'  DG I  58      80.153  81.930 -12.750  1.00 56.51           C  
ATOM   2661  C4'  DG I  58      79.927  82.960 -11.667  1.00 54.92           C  
ATOM   2662  O4'  DG I  58      81.071  83.024 -10.782  1.00 53.53           O  
ATOM   2663  C3'  DG I  58      79.699  84.382 -12.166  1.00 51.79           C  
ATOM   2664  O3'  DG I  58      78.728  85.017 -11.331  1.00 46.85           O  
ATOM   2665  C2'  DG I  58      81.070  85.030 -12.023  1.00 50.08           C  
ATOM   2666  C1'  DG I  58      81.674  84.319 -10.817  1.00 54.34           C  
ATOM   2667  N9   DG I  58      83.117  84.102 -10.905  1.00 58.58           N  
ATOM   2668  C8   DG I  58      83.826  83.762 -12.034  1.00 57.92           C  
ATOM   2669  N7   DG I  58      85.085  83.522 -11.795  1.00 57.97           N  
ATOM   2670  C5   DG I  58      85.228  83.739 -10.432  1.00 60.04           C  
ATOM   2671  C6   DG I  58      86.365  83.600  -9.596  1.00 60.21           C  
ATOM   2672  O6   DG I  58      87.499  83.225  -9.898  1.00 62.22           O  
ATOM   2673  N1   DG I  58      86.072  83.924  -8.277  1.00 60.79           N  
ATOM   2674  C2   DG I  58      84.837  84.306  -7.813  1.00 60.24           C  
ATOM   2675  N2   DG I  58      84.755  84.561  -6.500  1.00 58.97           N  
ATOM   2676  N3   DG I  58      83.764  84.424  -8.580  1.00 56.84           N  
ATOM   2677  C4   DG I  58      84.029  84.128  -9.870  1.00 58.90           C  
ATOM   2678  P    DC I  59      78.256  86.520 -11.645  1.00 51.37           P  
ATOM   2679  OP1  DC I  59      76.846  86.668 -11.180  1.00 50.87           O  
ATOM   2680  OP2  DC I  59      78.592  86.826 -13.058  1.00 54.15           O  
ATOM   2681  O5'  DC I  59      79.184  87.398 -10.702  1.00 48.75           O  
ATOM   2682  C5'  DC I  59      79.229  87.139  -9.302  1.00 51.32           C  
ATOM   2683  C4'  DC I  59      80.246  88.033  -8.634  1.00 54.90           C  
ATOM   2684  O4'  DC I  59      81.590  87.558  -8.874  1.00 52.95           O  
ATOM   2685  C3'  DC I  59      80.226  89.483  -9.114  1.00 53.16           C  
ATOM   2686  O3'  DC I  59      80.559  90.321  -8.014  1.00 56.82           O  
ATOM   2687  C2'  DC I  59      81.368  89.521 -10.110  1.00 53.57           C  
ATOM   2688  C1'  DC I  59      82.360  88.633  -9.392  1.00 54.55           C  
ATOM   2689  N1   DC I  59      83.452  88.068 -10.195  1.00 56.35           N  
ATOM   2690  C2   DC I  59      84.586  87.630  -9.525  1.00 59.00           C  
ATOM   2691  O2   DC I  59      84.633  87.766  -8.287  1.00 58.10           O  
ATOM   2692  N3   DC I  59      85.604  87.078 -10.229  1.00 58.59           N  
ATOM   2693  C4   DC I  59      85.515  86.976 -11.557  1.00 59.26           C  
ATOM   2694  N4   DC I  59      86.539  86.420 -12.211  1.00 60.03           N  
ATOM   2695  C5   DC I  59      84.370  87.437 -12.271  1.00 56.68           C  
ATOM   2696  C6   DC I  59      83.368  87.967 -11.555  1.00 54.08           C  
ATOM   2697  P    DA I  60      79.438  91.266  -7.371  1.00 56.66           P  
ATOM   2698  OP1  DA I  60      78.241  90.405  -7.226  1.00 57.97           O  
ATOM   2699  OP2  DA I  60      79.346  92.525  -8.136  1.00 54.86           O  
ATOM   2700  O5'  DA I  60      80.032  91.580  -5.933  1.00 57.46           O  
ATOM   2701  C5'  DA I  60      80.384  90.522  -5.049  1.00 61.32           C  
ATOM   2702  C4'  DA I  60      81.715  90.819  -4.402  1.00 66.53           C  
ATOM   2703  O4'  DA I  60      82.789  90.576  -5.341  1.00 66.91           O  
ATOM   2704  C3'  DA I  60      81.857  92.274  -3.966  1.00 69.86           C  
ATOM   2705  O3'  DA I  60      82.628  92.342  -2.768  1.00 74.74           O  
ATOM   2706  C2'  DA I  60      82.588  92.919  -5.131  1.00 68.12           C  
ATOM   2707  C1'  DA I  60      83.471  91.788  -5.643  1.00 67.15           C  
ATOM   2708  N9   DA I  60      83.697  91.796  -7.086  1.00 64.63           N  
ATOM   2709  C8   DA I  60      82.870  92.262  -8.074  1.00 64.87           C  
ATOM   2710  N7   DA I  60      83.329  92.061  -9.285  1.00 62.82           N  
ATOM   2711  C5   DA I  60      84.545  91.431  -9.077  1.00 62.00           C  
ATOM   2712  C6   DA I  60      85.515  90.934  -9.961  1.00 61.81           C  
ATOM   2713  N6   DA I  60      85.405  90.985 -11.289  1.00 60.87           N  
ATOM   2714  N1   DA I  60      86.614  90.367  -9.426  1.00 61.51           N  
ATOM   2715  C2   DA I  60      86.719  90.302  -8.099  1.00 61.69           C  
ATOM   2716  N3   DA I  60      85.875  90.721  -7.165  1.00 61.92           N  
ATOM   2717  C4   DA I  60      84.794  91.282  -7.727  1.00 63.24           C  
ATOM   2718  P    DG I  61      82.359  93.521  -1.718  1.00 77.78           P  
ATOM   2719  OP1  DG I  61      81.970  92.928  -0.416  1.00 80.66           O  
ATOM   2720  OP2  DG I  61      81.481  94.534  -2.359  1.00 77.32           O  
ATOM   2721  O5'  DG I  61      83.787  94.182  -1.554  1.00 78.45           O  
ATOM   2722  C5'  DG I  61      84.188  95.221  -2.425  1.00 79.76           C  
ATOM   2723  C4'  DG I  61      85.639  95.050  -2.791  1.00 78.86           C  
ATOM   2724  O4'  DG I  61      85.754  94.483  -4.120  1.00 77.00           O  
ATOM   2725  C3'  DG I  61      86.374  96.381  -2.834  1.00 80.13           C  
ATOM   2726  O3'  DG I  61      87.671  96.217  -2.283  1.00 83.70           O  
ATOM   2727  C2'  DG I  61      86.424  96.723  -4.309  1.00 77.83           C  
ATOM   2728  C1'  DG I  61      86.498  95.355  -4.957  1.00 74.11           C  
ATOM   2729  N9   DG I  61      85.921  95.299  -6.296  1.00 69.63           N  
ATOM   2730  C8   DG I  61      84.713  95.808  -6.713  1.00 67.97           C  
ATOM   2731  N7   DG I  61      84.481  95.602  -7.980  1.00 65.23           N  
ATOM   2732  C5   DG I  61      85.600  94.915  -8.426  1.00 63.39           C  
ATOM   2733  C6   DG I  61      85.923  94.416  -9.714  1.00 60.07           C  
ATOM   2734  O6   DG I  61      85.266  94.487 -10.756  1.00 55.97           O  
ATOM   2735  N1   DG I  61      87.158  93.782  -9.717  1.00 61.20           N  
ATOM   2736  C2   DG I  61      87.982  93.646  -8.623  1.00 62.61           C  
ATOM   2737  N2   DG I  61      89.140  92.996  -8.817  1.00 62.08           N  
ATOM   2738  N3   DG I  61      87.694  94.108  -7.425  1.00 62.58           N  
ATOM   2739  C4   DG I  61      86.498  94.723  -7.397  1.00 66.46           C  
ATOM   2740  P    DG I  62      88.439  97.492  -1.709  1.00 87.32           P  
ATOM   2741  OP1  DG I  62      89.117  97.083  -0.453  1.00 88.48           O  
ATOM   2742  OP2  DG I  62      87.494  98.638  -1.698  1.00 86.82           O  
ATOM   2743  O5'  DG I  62      89.537  97.758  -2.825  1.00 87.35           O  
ATOM   2744  C5'  DG I  62      90.505  96.765  -3.141  1.00 86.85           C  
ATOM   2745  C4'  DG I  62      91.328  97.225  -4.317  1.00 87.05           C  
ATOM   2746  O4'  DG I  62      90.720  96.812  -5.567  1.00 87.26           O  
ATOM   2747  C3'  DG I  62      91.437  98.747  -4.374  1.00 87.54           C  
ATOM   2748  O3'  DG I  62      92.768  99.144  -4.670  1.00 89.75           O  
ATOM   2749  C2'  DG I  62      90.497  99.133  -5.502  1.00 86.36           C  
ATOM   2750  C1'  DG I  62      90.596  97.934  -6.425  1.00 84.42           C  
ATOM   2751  N9   DG I  62      89.421  97.737  -7.271  1.00 80.99           N  
ATOM   2752  C8   DG I  62      88.108  97.892  -6.905  1.00 79.30           C  
ATOM   2753  N7   DG I  62      87.273  97.683  -7.886  1.00 78.03           N  
ATOM   2754  C5   DG I  62      88.082  97.363  -8.966  1.00 76.98           C  
ATOM   2755  C6   DG I  62      87.742  97.048 -10.303  1.00 75.43           C  
ATOM   2756  O6   DG I  62      86.625  97.004 -10.823  1.00 72.56           O  
ATOM   2757  N1   DG I  62      88.869  96.774 -11.067  1.00 75.76           N  
ATOM   2758  C2   DG I  62      90.160  96.812 -10.611  1.00 76.48           C  
ATOM   2759  N2   DG I  62      91.106  96.508 -11.510  1.00 75.83           N  
ATOM   2760  N3   DG I  62      90.496  97.120  -9.367  1.00 76.58           N  
ATOM   2761  C4   DG I  62      89.413  97.381  -8.603  1.00 79.10           C  
ATOM   2762  P    DT I  63      93.079 100.684  -4.980  1.00 91.57           P  
ATOM   2763  OP1  DT I  63      94.318 101.066  -4.252  1.00 92.05           O  
ATOM   2764  OP2  DT I  63      91.832 101.465  -4.774  1.00 91.66           O  
ATOM   2765  O5'  DT I  63      93.376 100.662  -6.539  1.00 90.97           O  
ATOM   2766  C5'  DT I  63      94.231  99.670  -7.092  1.00 91.11           C  
ATOM   2767  C4'  DT I  63      94.517  99.997  -8.534  1.00 92.00           C  
ATOM   2768  O4'  DT I  63      93.395  99.602  -9.361  1.00 90.31           O  
ATOM   2769  C3'  DT I  63      94.708 101.495  -8.749  1.00 92.61           C  
ATOM   2770  O3'  DT I  63      95.790 101.750  -9.638  1.00 94.98           O  
ATOM   2771  C2'  DT I  63      93.390 101.945  -9.349  1.00 91.70           C  
ATOM   2772  C1'  DT I  63      92.916 100.712 -10.097  1.00 90.33           C  
ATOM   2773  N1   DT I  63      91.447 100.603 -10.173  1.00 88.72           N  
ATOM   2774  C2   DT I  63      90.875 100.283 -11.384  1.00 88.41           C  
ATOM   2775  O2   DT I  63      91.527 100.056 -12.390  1.00 88.14           O  
ATOM   2776  N3   DT I  63      89.502 100.235 -11.372  1.00 87.38           N  
ATOM   2777  C4   DT I  63      88.668 100.466 -10.292  1.00 88.26           C  
ATOM   2778  O4   DT I  63      87.448 100.402 -10.434  1.00 89.13           O  
ATOM   2779  C5   DT I  63      89.339 100.779  -9.051  1.00 87.98           C  
ATOM   2780  C7   DT I  63      88.520 101.034  -7.826  1.00 87.22           C  
ATOM   2781  C6   DT I  63      90.676 100.830  -9.055  1.00 87.86           C  
ATOM   2782  P    DG I  64      96.044 103.244 -10.153  1.00 96.95           P  
ATOM   2783  OP1  DG I  64      97.493 103.405 -10.452  1.00 97.57           O  
ATOM   2784  OP2  DG I  64      95.380 104.175  -9.201  1.00 97.49           O  
ATOM   2785  O5'  DG I  64      95.232 103.270 -11.517  1.00 94.92           O  
ATOM   2786  C5'  DG I  64      95.588 102.394 -12.577  1.00 92.32           C  
ATOM   2787  C4'  DG I  64      95.201 103.017 -13.893  1.00 89.89           C  
ATOM   2788  O4'  DG I  64      93.783 102.829 -14.112  1.00 87.33           O  
ATOM   2789  C3'  DG I  64      95.447 104.523 -13.905  1.00 89.69           C  
ATOM   2790  O3'  DG I  64      95.986 104.935 -15.159  1.00 90.75           O  
ATOM   2791  C2'  DG I  64      94.073 105.116 -13.634  1.00 86.90           C  
ATOM   2792  C1'  DG I  64      93.116 104.076 -14.199  1.00 84.88           C  
ATOM   2793  N9   DG I  64      91.862 103.949 -13.461  1.00 81.11           N  
ATOM   2794  C8   DG I  64      91.678 104.102 -12.106  1.00 80.32           C  
ATOM   2795  N7   DG I  64      90.443 103.913 -11.731  1.00 77.51           N  
ATOM   2796  C5   DG I  64      89.768 103.621 -12.907  1.00 77.03           C  
ATOM   2797  C6   DG I  64      88.406 103.322 -13.128  1.00 74.39           C  
ATOM   2798  O6   DG I  64      87.494 103.255 -12.303  1.00 73.81           O  
ATOM   2799  N1   DG I  64      88.146 103.083 -14.472  1.00 72.96           N  
ATOM   2800  C2   DG I  64      89.080 103.124 -15.476  1.00 73.14           C  
ATOM   2801  N2   DG I  64      88.637 102.845 -16.708  1.00 72.13           N  
ATOM   2802  N3   DG I  64      90.356 103.410 -15.285  1.00 75.08           N  
ATOM   2803  C4   DG I  64      90.629 103.643 -13.985  1.00 78.11           C  
ATOM   2804  P    DG I  65      96.296 106.489 -15.418  1.00 92.74           P  
ATOM   2805  OP1  DG I  65      97.545 106.584 -16.217  1.00 93.06           O  
ATOM   2806  OP2  DG I  65      96.190 107.220 -14.126  1.00 92.23           O  
ATOM   2807  O5'  DG I  65      95.081 106.924 -16.343  1.00 89.89           O  
ATOM   2808  C5'  DG I  65      94.676 106.081 -17.411  1.00 86.60           C  
ATOM   2809  C4'  DG I  65      93.370 106.563 -17.989  1.00 84.36           C  
ATOM   2810  O4'  DG I  65      92.266 106.228 -17.110  1.00 82.61           O  
ATOM   2811  C3'  DG I  65      93.309 108.073 -18.208  1.00 83.27           C  
ATOM   2812  O3'  DG I  65      92.794 108.334 -19.511  1.00 84.38           O  
ATOM   2813  C2'  DG I  65      92.373 108.557 -17.112  1.00 81.61           C  
ATOM   2814  C1'  DG I  65      91.451 107.371 -16.911  1.00 79.26           C  
ATOM   2815  N9   DG I  65      90.863 107.284 -15.577  1.00 74.62           N  
ATOM   2816  C8   DG I  65      91.477 107.565 -14.381  1.00 72.84           C  
ATOM   2817  N7   DG I  65      90.691 107.407 -13.351  1.00 69.83           N  
ATOM   2818  C5   DG I  65      89.485 106.997 -13.897  1.00 70.19           C  
ATOM   2819  C6   DG I  65      88.251 106.679 -13.268  1.00 69.61           C  
ATOM   2820  O6   DG I  65      87.969 106.707 -12.064  1.00 68.87           O  
ATOM   2821  N1   DG I  65      87.287 106.301 -14.197  1.00 67.03           N  
ATOM   2822  C2   DG I  65      87.481 106.240 -15.553  1.00 68.78           C  
ATOM   2823  N2   DG I  65      86.433 105.840 -16.280  1.00 66.84           N  
ATOM   2824  N3   DG I  65      88.622 106.545 -16.153  1.00 70.64           N  
ATOM   2825  C4   DG I  65      89.575 106.910 -15.270  1.00 71.78           C  
ATOM   2826  P    DA I  66      92.158 109.764 -19.850  1.00 86.40           P  
ATOM   2827  OP1  DA I  66      92.629 110.168 -21.200  1.00 88.34           O  
ATOM   2828  OP2  DA I  66      92.343 110.691 -18.704  1.00 88.40           O  
ATOM   2829  O5'  DA I  66      90.613 109.422 -19.938  1.00 83.32           O  
ATOM   2830  C5'  DA I  66      90.176 108.260 -20.627  1.00 77.82           C  
ATOM   2831  C4'  DA I  66      88.685 108.330 -20.819  1.00 75.27           C  
ATOM   2832  O4'  DA I  66      88.037 108.170 -19.536  1.00 72.98           O  
ATOM   2833  C3'  DA I  66      88.248 109.692 -21.344  1.00 74.63           C  
ATOM   2834  O3'  DA I  66      87.143 109.534 -22.229  1.00 76.05           O  
ATOM   2835  C2'  DA I  66      87.880 110.458 -20.084  1.00 71.90           C  
ATOM   2836  C1'  DA I  66      87.356 109.364 -19.163  1.00 70.51           C  
ATOM   2837  N9   DA I  66      87.605 109.576 -17.735  1.00 65.39           N  
ATOM   2838  C8   DA I  66      88.792 109.917 -17.134  1.00 65.04           C  
ATOM   2839  N7   DA I  66      88.727 109.974 -15.826  1.00 62.29           N  
ATOM   2840  C5   DA I  66      87.404 109.664 -15.546  1.00 61.19           C  
ATOM   2841  C6   DA I  66      86.698 109.554 -14.337  1.00 57.23           C  
ATOM   2842  N6   DA I  66      87.252 109.751 -13.139  1.00 52.42           N  
ATOM   2843  N1   DA I  66      85.391 109.234 -14.404  1.00 54.21           N  
ATOM   2844  C2   DA I  66      84.838 109.040 -15.606  1.00 56.99           C  
ATOM   2845  N3   DA I  66      85.395 109.114 -16.812  1.00 60.91           N  
ATOM   2846  C4   DA I  66      86.697 109.431 -16.712  1.00 62.50           C  
ATOM   2847  P    DT I  67      86.509 110.822 -22.931  1.00 79.45           P  
ATOM   2848  OP1  DT I  67      85.973 110.416 -24.257  1.00 80.06           O  
ATOM   2849  OP2  DT I  67      87.504 111.923 -22.835  1.00 76.97           O  
ATOM   2850  O5'  DT I  67      85.288 111.171 -21.976  1.00 76.65           O  
ATOM   2851  C5'  DT I  67      84.367 110.156 -21.613  1.00 72.37           C  
ATOM   2852  C4'  DT I  67      83.286 110.722 -20.727  1.00 70.42           C  
ATOM   2853  O4'  DT I  67      83.721 110.786 -19.349  1.00 68.67           O  
ATOM   2854  C3'  DT I  67      82.794 112.123 -21.096  1.00 69.01           C  
ATOM   2855  O3'  DT I  67      81.376 112.090 -21.072  1.00 71.11           O  
ATOM   2856  C2'  DT I  67      83.356 113.002 -19.989  1.00 65.62           C  
ATOM   2857  C1'  DT I  67      83.370 112.047 -18.813  1.00 66.30           C  
ATOM   2858  N1   DT I  67      84.302 112.346 -17.707  1.00 64.51           N  
ATOM   2859  C2   DT I  67      83.801 112.223 -16.429  1.00 62.07           C  
ATOM   2860  O2   DT I  67      82.656 111.876 -16.197  1.00 63.01           O  
ATOM   2861  N3   DT I  67      84.692 112.512 -15.432  1.00 59.27           N  
ATOM   2862  C4   DT I  67      86.006 112.903 -15.578  1.00 57.87           C  
ATOM   2863  O4   DT I  67      86.683 113.151 -14.583  1.00 53.80           O  
ATOM   2864  C5   DT I  67      86.474 112.996 -16.942  1.00 58.45           C  
ATOM   2865  C7   DT I  67      87.896 113.390 -17.188  1.00 59.28           C  
ATOM   2866  C6   DT I  67      85.608 112.720 -17.930  1.00 60.20           C  
ATOM   2867  P    DA I  68      80.529 113.423 -21.330  1.00 74.63           P  
ATOM   2868  OP1  DA I  68      79.769 113.250 -22.595  1.00 74.66           O  
ATOM   2869  OP2  DA I  68      81.383 114.620 -21.143  1.00 74.32           O  
ATOM   2870  O5'  DA I  68      79.487 113.350 -20.136  1.00 73.16           O  
ATOM   2871  C5'  DA I  68      79.135 112.087 -19.586  1.00 68.79           C  
ATOM   2872  C4'  DA I  68      78.489 112.274 -18.235  1.00 67.25           C  
ATOM   2873  O4'  DA I  68      79.481 112.547 -17.220  1.00 64.36           O  
ATOM   2874  C3'  DA I  68      77.497 113.428 -18.187  1.00 64.72           C  
ATOM   2875  O3'  DA I  68      76.367 113.026 -17.424  1.00 66.52           O  
ATOM   2876  C2'  DA I  68      78.277 114.539 -17.511  1.00 62.90           C  
ATOM   2877  C1'  DA I  68      79.224 113.786 -16.589  1.00 60.19           C  
ATOM   2878  N9   DA I  68      80.518 114.439 -16.385  1.00 57.53           N  
ATOM   2879  C8   DA I  68      81.422 114.787 -17.353  1.00 57.95           C  
ATOM   2880  N7   DA I  68      82.534 115.298 -16.881  1.00 59.46           N  
ATOM   2881  C5   DA I  68      82.344 115.298 -15.509  1.00 56.50           C  
ATOM   2882  C6   DA I  68      83.166 115.701 -14.444  1.00 55.24           C  
ATOM   2883  N6   DA I  68      84.408 116.160 -14.604  1.00 56.96           N  
ATOM   2884  N1   DA I  68      82.670 115.599 -13.193  1.00 52.90           N  
ATOM   2885  C2   DA I  68      81.437 115.102 -13.037  1.00 53.67           C  
ATOM   2886  N3   DA I  68      80.575 114.670 -13.959  1.00 53.20           N  
ATOM   2887  C4   DA I  68      81.096 114.796 -15.189  1.00 55.02           C  
ATOM   2888  P    DT I  69      75.159 114.047 -17.200  1.00 66.48           P  
ATOM   2889  OP1  DT I  69      73.933 113.227 -17.039  1.00 66.45           O  
ATOM   2890  OP2  DT I  69      75.204 115.116 -18.223  1.00 66.14           O  
ATOM   2891  O5'  DT I  69      75.517 114.642 -15.779  1.00 63.41           O  
ATOM   2892  C5'  DT I  69      75.740 113.749 -14.709  1.00 59.17           C  
ATOM   2893  C4'  DT I  69      75.845 114.511 -13.417  1.00 58.19           C  
ATOM   2894  O4'  DT I  69      77.167 115.077 -13.296  1.00 57.41           O  
ATOM   2895  C3'  DT I  69      74.851 115.662 -13.277  1.00 56.48           C  
ATOM   2896  O3'  DT I  69      74.279 115.576 -11.976  1.00 54.75           O  
ATOM   2897  C2'  DT I  69      75.717 116.906 -13.445  1.00 56.80           C  
ATOM   2898  C1'  DT I  69      77.085 116.442 -12.950  1.00 56.38           C  
ATOM   2899  N1   DT I  69      78.261 117.110 -13.549  1.00 53.84           N  
ATOM   2900  C2   DT I  69      79.252 117.547 -12.705  1.00 54.85           C  
ATOM   2901  O2   DT I  69      79.188 117.443 -11.493  1.00 55.72           O  
ATOM   2902  N3   DT I  69      80.329 118.118 -13.335  1.00 56.19           N  
ATOM   2903  C4   DT I  69      80.501 118.299 -14.690  1.00 55.21           C  
ATOM   2904  O4   DT I  69      81.526 118.815 -15.110  1.00 56.71           O  
ATOM   2905  C5   DT I  69      79.413 117.836 -15.515  1.00 54.43           C  
ATOM   2906  C7   DT I  69      79.508 118.006 -16.999  1.00 52.63           C  
ATOM   2907  C6   DT I  69      78.362 117.271 -14.912  1.00 52.62           C  
ATOM   2908  P    DT I  70      73.084 116.550 -11.554  1.00 52.13           P  
ATOM   2909  OP1  DT I  70      72.230 115.771 -10.617  1.00 57.27           O  
ATOM   2910  OP2  DT I  70      72.484 117.142 -12.767  1.00 52.69           O  
ATOM   2911  O5'  DT I  70      73.847 117.658 -10.715  1.00 50.57           O  
ATOM   2912  C5'  DT I  70      74.788 117.249  -9.735  1.00 50.89           C  
ATOM   2913  C4'  DT I  70      75.592 118.424  -9.237  1.00 51.31           C  
ATOM   2914  O4'  DT I  70      76.665 118.782 -10.145  1.00 50.06           O  
ATOM   2915  C3'  DT I  70      74.787 119.696  -8.991  1.00 50.54           C  
ATOM   2916  O3'  DT I  70      75.062 120.152  -7.676  1.00 50.67           O  
ATOM   2917  C2'  DT I  70      75.325 120.679 -10.023  1.00 50.92           C  
ATOM   2918  C1'  DT I  70      76.753 120.197 -10.204  1.00 50.67           C  
ATOM   2919  N1   DT I  70      77.403 120.567 -11.482  1.00 48.07           N  
ATOM   2920  C2   DT I  70      78.700 121.044 -11.445  1.00 47.62           C  
ATOM   2921  O2   DT I  70      79.325 121.226 -10.411  1.00 46.72           O  
ATOM   2922  N3   DT I  70      79.238 121.319 -12.672  1.00 46.75           N  
ATOM   2923  C4   DT I  70      78.625 121.194 -13.897  1.00 48.86           C  
ATOM   2924  O4   DT I  70      79.237 121.474 -14.913  1.00 54.89           O  
ATOM   2925  C5   DT I  70      77.264 120.721 -13.862  1.00 50.46           C  
ATOM   2926  C7   DT I  70      76.515 120.575 -15.148  1.00 51.40           C  
ATOM   2927  C6   DT I  70      76.731 120.430 -12.672  1.00 48.10           C  
ATOM   2928  P    DG I  71      74.103 121.238  -7.000  1.00 50.59           P  
ATOM   2929  OP1  DG I  71      73.943 120.888  -5.564  1.00 46.28           O  
ATOM   2930  OP2  DG I  71      72.911 121.404  -7.858  1.00 46.33           O  
ATOM   2931  O5'  DG I  71      74.996 122.549  -7.063  1.00 53.03           O  
ATOM   2932  C5'  DG I  71      76.213 122.597  -6.319  1.00 58.22           C  
ATOM   2933  C4'  DG I  71      77.018 123.817  -6.696  1.00 59.78           C  
ATOM   2934  O4'  DG I  71      77.573 123.660  -8.025  1.00 59.01           O  
ATOM   2935  C3'  DG I  71      76.212 125.115  -6.712  1.00 61.52           C  
ATOM   2936  O3'  DG I  71      76.962 126.145  -6.072  1.00 67.78           O  
ATOM   2937  C2'  DG I  71      76.049 125.412  -8.193  1.00 60.62           C  
ATOM   2938  C1'  DG I  71      77.338 124.848  -8.756  1.00 59.71           C  
ATOM   2939  N9   DG I  71      77.333 124.536 -10.184  1.00 58.03           N  
ATOM   2940  C8   DG I  71      76.281 124.087 -10.947  1.00 57.86           C  
ATOM   2941  N7   DG I  71      76.576 123.983 -12.215  1.00 58.20           N  
ATOM   2942  C5   DG I  71      77.908 124.374 -12.292  1.00 58.17           C  
ATOM   2943  C6   DG I  71      78.778 124.498 -13.418  1.00 57.60           C  
ATOM   2944  O6   DG I  71      78.534 124.290 -14.618  1.00 57.65           O  
ATOM   2945  N1   DG I  71      80.045 124.924 -13.038  1.00 55.97           N  
ATOM   2946  C2   DG I  71      80.429 125.204 -11.751  1.00 58.45           C  
ATOM   2947  N2   DG I  71      81.695 125.589 -11.579  1.00 59.81           N  
ATOM   2948  N3   DG I  71      79.629 125.111 -10.703  1.00 60.80           N  
ATOM   2949  C4   DG I  71      78.394 124.693 -11.043  1.00 58.69           C  
ATOM   2950  P    DA I  72      76.260 127.552  -5.717  1.00 73.34           P  
ATOM   2951  OP1  DA I  72      75.765 127.519  -4.316  1.00 71.82           O  
ATOM   2952  OP2  DA I  72      75.318 127.876  -6.824  1.00 69.37           O  
ATOM   2953  O5'  DA I  72      77.483 128.569  -5.762  1.00 70.08           O  
ATOM   2954  C5'  DA I  72      78.739 128.200  -5.204  1.00 71.10           C  
ATOM   2955  C4'  DA I  72      79.861 128.825  -5.997  1.00 72.95           C  
ATOM   2956  O4'  DA I  72      79.956 128.175  -7.291  1.00 69.75           O  
ATOM   2957  C3'  DA I  72      79.640 130.314  -6.272  1.00 74.19           C  
ATOM   2958  O3'  DA I  72      80.812 131.091  -6.018  1.00 79.92           O  
ATOM   2959  C2'  DA I  72      79.272 130.366  -7.741  1.00 71.58           C  
ATOM   2960  C1'  DA I  72      79.963 129.145  -8.321  1.00 68.12           C  
ATOM   2961  N9   DA I  72      79.237 128.603  -9.470  1.00 64.69           N  
ATOM   2962  C8   DA I  72      77.955 128.113  -9.495  1.00 64.03           C  
ATOM   2963  N7   DA I  72      77.535 127.787 -10.696  1.00 61.64           N  
ATOM   2964  C5   DA I  72      78.621 128.063 -11.513  1.00 59.65           C  
ATOM   2965  C6   DA I  72      78.809 127.957 -12.901  1.00 59.68           C  
ATOM   2966  N6   DA I  72      77.857 127.568 -13.751  1.00 59.80           N  
ATOM   2967  N1   DA I  72      80.021 128.288 -13.397  1.00 60.50           N  
ATOM   2968  C2   DA I  72      80.963 128.719 -12.549  1.00 59.47           C  
ATOM   2969  N3   DA I  72      80.899 128.886 -11.231  1.00 60.81           N  
ATOM   2970  C4   DA I  72      79.687 128.536 -10.768  1.00 61.74           C  
ATOM   2971  P    DT I  73      80.700 132.698  -5.986  1.00 83.55           P  
ATOM   2972  OP1  DT I  73      81.594 133.208  -4.910  1.00 79.74           O  
ATOM   2973  OP2  DT I  73      79.251 133.039  -5.960  1.00 79.74           O  
ATOM   2974  O5'  DT I  73      81.281 133.127  -7.409  1.00 82.92           O  
ATOM   2975  C5'  DT I  73      82.531 132.611  -7.861  1.00 83.04           C  
ATOM   2976  C4'  DT I  73      82.739 132.914  -9.327  1.00 84.14           C  
ATOM   2977  O4'  DT I  73      81.880 132.091 -10.155  1.00 82.85           O  
ATOM   2978  C3'  DT I  73      82.478 134.361  -9.755  1.00 85.17           C  
ATOM   2979  O3'  DT I  73      83.411 134.731 -10.788  1.00 85.39           O  
ATOM   2980  C2'  DT I  73      81.121 134.272 -10.429  1.00 83.71           C  
ATOM   2981  C1'  DT I  73      81.226 132.916 -11.100  1.00 81.34           C  
ATOM   2982  N1   DT I  73      79.941 132.290 -11.455  1.00 79.40           N  
ATOM   2983  C2   DT I  73      79.748 131.931 -12.765  1.00 78.42           C  
ATOM   2984  O2   DT I  73      80.594 132.087 -13.628  1.00 79.13           O  
ATOM   2985  N3   DT I  73      78.523 131.381 -13.032  1.00 77.74           N  
ATOM   2986  C4   DT I  73      77.496 131.157 -12.138  1.00 79.00           C  
ATOM   2987  O4   DT I  73      76.441 130.663 -12.526  1.00 81.28           O  
ATOM   2988  C5   DT I  73      77.770 131.544 -10.780  1.00 79.11           C  
ATOM   2989  C7   DT I  73      76.716 131.328  -9.741  1.00 78.86           C  
ATOM   2990  C6   DT I  73      78.964 132.084 -10.508  1.00 80.34           C  
TER    2991       DT I  73                                                      
ATOM   2992  O5'  DA J -73      76.248 129.637 -22.640  1.00 92.34           O  
ATOM   2993  C5'  DA J -73      77.004 130.285 -23.669  1.00 90.09           C  
ATOM   2994  C4'  DA J -73      78.267 130.884 -23.098  1.00 89.69           C  
ATOM   2995  O4'  DA J -73      77.938 131.510 -21.832  1.00 88.78           O  
ATOM   2996  C3'  DA J -73      79.355 129.857 -22.789  1.00 90.09           C  
ATOM   2997  O3'  DA J -73      80.653 130.409 -23.022  1.00 92.70           O  
ATOM   2998  C2'  DA J -73      79.168 129.582 -21.311  1.00 88.82           C  
ATOM   2999  C1'  DA J -73      78.686 130.919 -20.779  1.00 86.27           C  
ATOM   3000  N9   DA J -73      77.806 130.771 -19.622  1.00 81.98           N  
ATOM   3001  C8   DA J -73      76.517 130.301 -19.597  1.00 80.99           C  
ATOM   3002  N7   DA J -73      76.007 130.222 -18.391  1.00 80.27           N  
ATOM   3003  C5   DA J -73      77.025 130.684 -17.568  1.00 78.31           C  
ATOM   3004  C6   DA J -73      77.120 130.840 -16.172  1.00 76.83           C  
ATOM   3005  N6   DA J -73      76.143 130.517 -15.319  1.00 74.90           N  
ATOM   3006  N1   DA J -73      78.270 131.339 -15.673  1.00 75.56           N  
ATOM   3007  C2   DA J -73      79.254 131.649 -16.524  1.00 77.41           C  
ATOM   3008  N3   DA J -73      79.290 131.540 -17.850  1.00 78.12           N  
ATOM   3009  C4   DA J -73      78.131 131.044 -18.315  1.00 79.60           C  
ATOM   3010  P    DT J -72      81.961 129.549 -22.654  1.00 94.36           P  
ATOM   3011  OP1  DT J -72      83.062 129.987 -23.546  1.00 96.31           O  
ATOM   3012  OP2  DT J -72      81.571 128.112 -22.620  1.00 93.29           O  
ATOM   3013  O5'  DT J -72      82.322 130.011 -21.174  1.00 93.29           O  
ATOM   3014  C5'  DT J -72      83.052 131.216 -20.947  1.00 92.83           C  
ATOM   3015  C4'  DT J -72      83.998 131.037 -19.784  1.00 92.11           C  
ATOM   3016  O4'  DT J -72      83.227 130.940 -18.563  1.00 91.04           O  
ATOM   3017  C3'  DT J -72      84.828 129.759 -19.867  1.00 92.72           C  
ATOM   3018  O3'  DT J -72      86.151 129.961 -19.368  1.00 95.72           O  
ATOM   3019  C2'  DT J -72      84.067 128.785 -18.990  1.00 91.81           C  
ATOM   3020  C1'  DT J -72      83.443 129.686 -17.935  1.00 89.72           C  
ATOM   3021  N1   DT J -72      82.140 129.195 -17.447  1.00 86.57           N  
ATOM   3022  C2   DT J -72      81.847 129.328 -16.110  1.00 85.93           C  
ATOM   3023  O2   DT J -72      82.606 129.847 -15.309  1.00 86.86           O  
ATOM   3024  N3   DT J -72      80.623 128.829 -15.741  1.00 84.64           N  
ATOM   3025  C4   DT J -72      79.687 128.228 -16.557  1.00 83.60           C  
ATOM   3026  O4   DT J -72      78.631 127.832 -16.086  1.00 82.62           O  
ATOM   3027  C5   DT J -72      80.058 128.122 -17.945  1.00 83.89           C  
ATOM   3028  C7   DT J -72      79.109 127.470 -18.900  1.00 85.04           C  
ATOM   3029  C6   DT J -72      81.247 128.610 -18.318  1.00 84.39           C  
ATOM   3030  P    DC J -71      87.263 128.822 -19.601  1.00 99.10           P  
ATOM   3031  OP1  DC J -71      88.571 129.304 -19.079  1.00 98.03           O  
ATOM   3032  OP2  DC J -71      87.148 128.392 -21.024  1.00 97.88           O  
ATOM   3033  O5'  DC J -71      86.753 127.622 -18.685  1.00 97.04           O  
ATOM   3034  C5'  DC J -71      87.653 126.657 -18.148  1.00 94.03           C  
ATOM   3035  C4'  DC J -71      88.015 127.026 -16.728  1.00 91.94           C  
ATOM   3036  O4'  DC J -71      86.834 127.535 -16.062  1.00 90.05           O  
ATOM   3037  C3'  DC J -71      88.530 125.871 -15.872  1.00 90.43           C  
ATOM   3038  O3'  DC J -71      89.665 126.264 -15.084  1.00 91.05           O  
ATOM   3039  C2'  DC J -71      87.322 125.451 -15.056  1.00 89.18           C  
ATOM   3040  C1'  DC J -71      86.440 126.693 -14.986  1.00 86.71           C  
ATOM   3041  N1   DC J -71      85.009 126.382 -15.171  1.00 83.61           N  
ATOM   3042  C2   DC J -71      84.154 126.356 -14.053  1.00 81.61           C  
ATOM   3043  O2   DC J -71      84.615 126.620 -12.931  1.00 81.05           O  
ATOM   3044  N3   DC J -71      82.848 126.043 -14.228  1.00 77.48           N  
ATOM   3045  C4   DC J -71      82.388 125.764 -15.449  1.00 76.52           C  
ATOM   3046  N4   DC J -71      81.102 125.447 -15.573  1.00 74.48           N  
ATOM   3047  C5   DC J -71      83.229 125.796 -16.599  1.00 78.19           C  
ATOM   3048  C6   DC J -71      84.519 126.108 -16.417  1.00 80.36           C  
ATOM   3049  P    DA J -70      89.469 127.174 -13.771  1.00 91.97           P  
ATOM   3050  OP1  DA J -70      88.662 128.366 -14.149  1.00 91.01           O  
ATOM   3051  OP2  DA J -70      90.807 127.362 -13.151  1.00 91.27           O  
ATOM   3052  O5'  DA J -70      88.611 126.287 -12.768  1.00 88.44           O  
ATOM   3053  C5'  DA J -70      88.136 126.861 -11.557  1.00 84.53           C  
ATOM   3054  C4'  DA J -70      87.587 125.794 -10.641  1.00 80.90           C  
ATOM   3055  O4'  DA J -70      86.380 125.224 -11.194  1.00 78.53           O  
ATOM   3056  C3'  DA J -70      88.513 124.616 -10.351  1.00 79.91           C  
ATOM   3057  O3'  DA J -70      88.357 124.281  -8.977  1.00 80.58           O  
ATOM   3058  C2'  DA J -70      87.954 123.508 -11.227  1.00 76.61           C  
ATOM   3059  C1'  DA J -70      86.471 123.811 -11.178  1.00 74.80           C  
ATOM   3060  N9   DA J -70      85.671 123.309 -12.293  1.00 69.72           N  
ATOM   3061  C8   DA J -70      86.033 123.144 -13.605  1.00 68.42           C  
ATOM   3062  N7   DA J -70      85.057 122.739 -14.378  1.00 66.05           N  
ATOM   3063  C5   DA J -70      83.980 122.609 -13.510  1.00 64.55           C  
ATOM   3064  C6   DA J -70      82.646 122.232 -13.712  1.00 61.28           C  
ATOM   3065  N6   DA J -70      82.135 121.939 -14.911  1.00 57.49           N  
ATOM   3066  N1   DA J -70      81.836 122.185 -12.629  1.00 60.35           N  
ATOM   3067  C2   DA J -70      82.336 122.528 -11.438  1.00 60.35           C  
ATOM   3068  N3   DA J -70      83.567 122.921 -11.125  1.00 64.52           N  
ATOM   3069  C4   DA J -70      84.350 122.939 -12.220  1.00 66.87           C  
ATOM   3070  P    DA J -69      89.278 123.154  -8.318  1.00 80.47           P  
ATOM   3071  OP1  DA J -69      90.265 123.805  -7.424  1.00 82.44           O  
ATOM   3072  OP2  DA J -69      89.740 122.248  -9.398  1.00 82.28           O  
ATOM   3073  O5'  DA J -69      88.251 122.369  -7.396  1.00 80.46           O  
ATOM   3074  C5'  DA J -69      87.277 123.083  -6.637  1.00 76.68           C  
ATOM   3075  C4'  DA J -69      86.146 122.161  -6.259  1.00 73.87           C  
ATOM   3076  O4'  DA J -69      85.387 121.809  -7.441  1.00 72.51           O  
ATOM   3077  C3'  DA J -69      86.642 120.843  -5.674  1.00 73.36           C  
ATOM   3078  O3'  DA J -69      85.775 120.428  -4.618  1.00 73.93           O  
ATOM   3079  C2'  DA J -69      86.598 119.897  -6.861  1.00 70.91           C  
ATOM   3080  C1'  DA J -69      85.386 120.401  -7.615  1.00 70.36           C  
ATOM   3081  N9   DA J -69      85.379 120.129  -9.052  1.00 68.75           N  
ATOM   3082  C8   DA J -69      86.399 120.292  -9.953  1.00 68.81           C  
ATOM   3083  N7   DA J -69      86.061 120.015 -11.192  1.00 68.51           N  
ATOM   3084  C5   DA J -69      84.732 119.636 -11.097  1.00 65.07           C  
ATOM   3085  C6   DA J -69      83.791 119.252 -12.060  1.00 65.94           C  
ATOM   3086  N6   DA J -69      84.048 119.205 -13.368  1.00 63.41           N  
ATOM   3087  N1   DA J -69      82.551 118.926 -11.631  1.00 66.17           N  
ATOM   3088  C2   DA J -69      82.285 119.002 -10.323  1.00 64.05           C  
ATOM   3089  N3   DA J -69      83.080 119.366  -9.323  1.00 65.21           N  
ATOM   3090  C4   DA J -69      84.304 119.678  -9.783  1.00 67.44           C  
ATOM   3091  P    DT J -68      86.230 119.247  -3.641  1.00 72.30           P  
ATOM   3092  OP1  DT J -68      85.954 119.620  -2.234  1.00 73.11           O  
ATOM   3093  OP2  DT J -68      87.603 118.859  -4.048  1.00 74.99           O  
ATOM   3094  O5'  DT J -68      85.263 118.061  -4.057  1.00 72.77           O  
ATOM   3095  C5'  DT J -68      84.997 117.829  -5.427  1.00 67.16           C  
ATOM   3096  C4'  DT J -68      83.747 117.005  -5.596  1.00 61.60           C  
ATOM   3097  O4'  DT J -68      83.393 117.058  -6.995  1.00 60.76           O  
ATOM   3098  C3'  DT J -68      83.910 115.526  -5.249  1.00 60.30           C  
ATOM   3099  O3'  DT J -68      82.674 115.043  -4.719  1.00 61.62           O  
ATOM   3100  C2'  DT J -68      84.247 114.897  -6.588  1.00 59.07           C  
ATOM   3101  C1'  DT J -68      83.491 115.774  -7.579  1.00 60.72           C  
ATOM   3102  N1   DT J -68      84.140 115.929  -8.895  1.00 58.74           N  
ATOM   3103  C2   DT J -68      83.334 115.897 -10.009  1.00 58.80           C  
ATOM   3104  O2   DT J -68      82.122 115.756  -9.952  1.00 57.82           O  
ATOM   3105  N3   DT J -68      83.998 116.034 -11.200  1.00 55.61           N  
ATOM   3106  C4   DT J -68      85.357 116.188 -11.388  1.00 57.61           C  
ATOM   3107  O4   DT J -68      85.811 116.284 -12.528  1.00 55.77           O  
ATOM   3108  C5   DT J -68      86.147 116.214 -10.178  1.00 59.00           C  
ATOM   3109  C7   DT J -68      87.632 116.370 -10.286  1.00 60.55           C  
ATOM   3110  C6   DT J -68      85.506 116.091  -9.004  1.00 59.10           C  
ATOM   3111  P    DA J -67      82.524 113.510  -4.238  1.00 58.05           P  
ATOM   3112  OP1  DA J -67      81.860 113.603  -2.913  1.00 59.75           O  
ATOM   3113  OP2  DA J -67      83.773 112.723  -4.382  1.00 54.56           O  
ATOM   3114  O5'  DA J -67      81.465 112.952  -5.270  1.00 53.71           O  
ATOM   3115  C5'  DA J -67      80.323 113.733  -5.577  1.00 54.36           C  
ATOM   3116  C4'  DA J -67      79.648 113.195  -6.810  1.00 55.20           C  
ATOM   3117  O4'  DA J -67      80.468 113.415  -7.984  1.00 54.88           O  
ATOM   3118  C3'  DA J -67      79.401 111.696  -6.749  1.00 54.29           C  
ATOM   3119  O3'  DA J -67      78.149 111.466  -7.366  1.00 54.55           O  
ATOM   3120  C2'  DA J -67      80.551 111.122  -7.564  1.00 52.62           C  
ATOM   3121  C1'  DA J -67      80.728 112.184  -8.633  1.00 53.87           C  
ATOM   3122  N9   DA J -67      82.070 112.271  -9.208  1.00 54.54           N  
ATOM   3123  C8   DA J -67      83.244 112.474  -8.531  1.00 53.16           C  
ATOM   3124  N7   DA J -67      84.289 112.579  -9.309  1.00 55.16           N  
ATOM   3125  C5   DA J -67      83.774 112.415 -10.586  1.00 52.70           C  
ATOM   3126  C6   DA J -67      84.376 112.436 -11.855  1.00 52.58           C  
ATOM   3127  N6   DA J -67      85.680 112.643 -12.048  1.00 50.59           N  
ATOM   3128  N1   DA J -67      83.586 112.239 -12.928  1.00 50.16           N  
ATOM   3129  C2   DA J -67      82.277 112.029 -12.726  1.00 51.50           C  
ATOM   3130  N3   DA J -67      81.596 111.994 -11.584  1.00 51.99           N  
ATOM   3131  C4   DA J -67      82.411 112.203 -10.539  1.00 52.47           C  
ATOM   3132  P    DT J -66      77.507 110.009  -7.344  1.00 54.91           P  
ATOM   3133  OP1  DT J -66      76.046 110.268  -7.345  1.00 57.73           O  
ATOM   3134  OP2  DT J -66      78.121 109.193  -6.264  1.00 50.76           O  
ATOM   3135  O5'  DT J -66      77.896 109.429  -8.769  1.00 52.57           O  
ATOM   3136  C5'  DT J -66      77.526 110.148  -9.934  1.00 54.77           C  
ATOM   3137  C4'  DT J -66      78.004 109.434 -11.172  1.00 57.10           C  
ATOM   3138  O4'  DT J -66      79.396 109.719 -11.440  1.00 58.10           O  
ATOM   3139  C3'  DT J -66      77.867 107.913 -11.144  1.00 58.75           C  
ATOM   3140  O3'  DT J -66      77.275 107.513 -12.372  1.00 62.58           O  
ATOM   3141  C2'  DT J -66      79.307 107.429 -11.047  1.00 57.91           C  
ATOM   3142  C1'  DT J -66      80.045 108.518 -11.803  1.00 58.50           C  
ATOM   3143  N1   DT J -66      81.491 108.677 -11.530  1.00 56.06           N  
ATOM   3144  C2   DT J -66      82.320 108.826 -12.623  1.00 56.85           C  
ATOM   3145  O2   DT J -66      81.908 108.853 -13.769  1.00 60.46           O  
ATOM   3146  N3   DT J -66      83.648 108.961 -12.324  1.00 53.72           N  
ATOM   3147  C4   DT J -66      84.220 108.989 -11.070  1.00 53.70           C  
ATOM   3148  O4   DT J -66      85.427 109.146 -10.956  1.00 49.91           O  
ATOM   3149  C5   DT J -66      83.297 108.833  -9.965  1.00 53.90           C  
ATOM   3150  C7   DT J -66      83.834 108.852  -8.568  1.00 51.86           C  
ATOM   3151  C6   DT J -66      81.994 108.681 -10.248  1.00 53.64           C  
ATOM   3152  P    DC J -65      76.585 106.075 -12.502  1.00 65.23           P  
ATOM   3153  OP1  DC J -65      75.172 106.281 -12.904  1.00 67.69           O  
ATOM   3154  OP2  DC J -65      76.912 105.279 -11.292  1.00 64.09           O  
ATOM   3155  O5'  DC J -65      77.370 105.448 -13.727  1.00 66.68           O  
ATOM   3156  C5'  DC J -65      78.723 105.805 -13.917  1.00 67.69           C  
ATOM   3157  C4'  DC J -65      79.105 105.680 -15.368  1.00 67.72           C  
ATOM   3158  O4'  DC J -65      80.424 106.249 -15.505  1.00 67.77           O  
ATOM   3159  C3'  DC J -65      79.222 104.228 -15.809  1.00 66.95           C  
ATOM   3160  O3'  DC J -65      78.883 104.081 -17.185  1.00 66.67           O  
ATOM   3161  C2'  DC J -65      80.671 103.888 -15.534  1.00 67.42           C  
ATOM   3162  C1'  DC J -65      81.404 105.228 -15.578  1.00 66.05           C  
ATOM   3163  N1   DC J -65      82.309 105.413 -14.434  1.00 61.90           N  
ATOM   3164  C2   DC J -65      83.640 105.735 -14.673  1.00 62.47           C  
ATOM   3165  O2   DC J -65      84.020 105.851 -15.844  1.00 64.60           O  
ATOM   3166  N3   DC J -65      84.479 105.905 -13.623  1.00 60.73           N  
ATOM   3167  C4   DC J -65      84.025 105.749 -12.378  1.00 59.49           C  
ATOM   3168  N4   DC J -65      84.884 105.902 -11.372  1.00 58.74           N  
ATOM   3169  C5   DC J -65      82.667 105.421 -12.109  1.00 59.30           C  
ATOM   3170  C6   DC J -65      81.852 105.269 -13.155  1.00 59.64           C  
ATOM   3171  P    DC J -64      78.537 102.624 -17.759  1.00 65.92           P  
ATOM   3172  OP1  DC J -64      77.620 102.790 -18.914  1.00 63.40           O  
ATOM   3173  OP2  DC J -64      78.147 101.746 -16.625  1.00 63.64           O  
ATOM   3174  O5'  DC J -64      79.944 102.108 -18.282  1.00 62.34           O  
ATOM   3175  C5'  DC J -64      80.677 102.861 -19.236  1.00 61.89           C  
ATOM   3176  C4'  DC J -64      82.086 102.331 -19.337  1.00 61.35           C  
ATOM   3177  O4'  DC J -64      82.885 102.767 -18.214  1.00 60.83           O  
ATOM   3178  C3'  DC J -64      82.188 100.805 -19.354  1.00 62.58           C  
ATOM   3179  O3'  DC J -64      83.238 100.445 -20.236  1.00 66.76           O  
ATOM   3180  C2'  DC J -64      82.631 100.469 -17.943  1.00 59.65           C  
ATOM   3181  C1'  DC J -64      83.549 101.639 -17.675  1.00 58.06           C  
ATOM   3182  N1   DC J -64      83.870 101.922 -16.274  1.00 57.20           N  
ATOM   3183  C2   DC J -64      85.149 102.373 -15.982  1.00 55.52           C  
ATOM   3184  O2   DC J -64      85.950 102.518 -16.915  1.00 56.79           O  
ATOM   3185  N3   DC J -64      85.484 102.640 -14.702  1.00 55.59           N  
ATOM   3186  C4   DC J -64      84.588 102.468 -13.733  1.00 53.47           C  
ATOM   3187  N4   DC J -64      84.964 102.732 -12.488  1.00 53.28           N  
ATOM   3188  C5   DC J -64      83.265 102.013 -14.001  1.00 54.59           C  
ATOM   3189  C6   DC J -64      82.952 101.754 -15.277  1.00 55.62           C  
ATOM   3190  P    DA J -63      83.098  99.143 -21.150  1.00 64.54           P  
ATOM   3191  OP1  DA J -63      82.583  99.586 -22.471  1.00 64.31           O  
ATOM   3192  OP2  DA J -63      82.384  98.085 -20.386  1.00 60.84           O  
ATOM   3193  O5'  DA J -63      84.610  98.700 -21.314  1.00 64.39           O  
ATOM   3194  C5'  DA J -63      85.617  99.655 -21.615  1.00 61.32           C  
ATOM   3195  C4'  DA J -63      86.953  99.129 -21.154  1.00 60.32           C  
ATOM   3196  O4'  DA J -63      87.201  99.526 -19.781  1.00 59.76           O  
ATOM   3197  C3'  DA J -63      87.026  97.602 -21.192  1.00 59.63           C  
ATOM   3198  O3'  DA J -63      88.242  97.178 -21.808  1.00 60.90           O  
ATOM   3199  C2'  DA J -63      86.932  97.195 -19.729  1.00 58.16           C  
ATOM   3200  C1'  DA J -63      87.497  98.395 -18.984  1.00 58.21           C  
ATOM   3201  N9   DA J -63      86.918  98.622 -17.656  1.00 58.71           N  
ATOM   3202  C8   DA J -63      85.614  98.448 -17.258  1.00 56.83           C  
ATOM   3203  N7   DA J -63      85.408  98.715 -15.989  1.00 55.69           N  
ATOM   3204  C5   DA J -63      86.656  99.098 -15.520  1.00 58.32           C  
ATOM   3205  C6   DA J -63      87.111  99.500 -14.248  1.00 58.24           C  
ATOM   3206  N6   DA J -63      86.324  99.608 -13.178  1.00 58.40           N  
ATOM   3207  N1   DA J -63      88.423  99.795 -14.114  1.00 57.47           N  
ATOM   3208  C2   DA J -63      89.208  99.705 -15.189  1.00 56.98           C  
ATOM   3209  N3   DA J -63      88.897  99.352 -16.436  1.00 56.40           N  
ATOM   3210  C4   DA J -63      87.594  99.051 -16.535  1.00 56.79           C  
ATOM   3211  P    DC J -62      88.597  95.612 -21.899  1.00 59.92           P  
ATOM   3212  OP1  DC J -62      89.501  95.443 -23.068  1.00 62.50           O  
ATOM   3213  OP2  DC J -62      87.390  94.777 -21.787  1.00 58.19           O  
ATOM   3214  O5'  DC J -62      89.461  95.414 -20.585  1.00 59.03           O  
ATOM   3215  C5'  DC J -62      90.407  96.406 -20.235  1.00 60.34           C  
ATOM   3216  C4'  DC J -62      91.065  96.071 -18.923  1.00 62.06           C  
ATOM   3217  O4'  DC J -62      90.244  96.491 -17.808  1.00 62.98           O  
ATOM   3218  C3'  DC J -62      91.374  94.591 -18.708  1.00 62.52           C  
ATOM   3219  O3'  DC J -62      92.713  94.468 -18.246  1.00 65.36           O  
ATOM   3220  C2'  DC J -62      90.406  94.183 -17.608  1.00 63.67           C  
ATOM   3221  C1'  DC J -62      90.264  95.476 -16.825  1.00 62.55           C  
ATOM   3222  N1   DC J -62      89.044  95.608 -16.012  1.00 61.42           N  
ATOM   3223  C2   DC J -62      89.163  96.085 -14.698  1.00 60.46           C  
ATOM   3224  O2   DC J -62      90.288  96.375 -14.268  1.00 59.33           O  
ATOM   3225  N3   DC J -62      88.051  96.219 -13.937  1.00 59.35           N  
ATOM   3226  C4   DC J -62      86.857  95.902 -14.446  1.00 60.59           C  
ATOM   3227  N4   DC J -62      85.785  96.063 -13.670  1.00 59.14           N  
ATOM   3228  C5   DC J -62      86.708  95.409 -15.781  1.00 59.74           C  
ATOM   3229  C6   DC J -62      87.817  95.279 -16.520  1.00 59.18           C  
ATOM   3230  P    DC J -61      93.401  93.028 -18.187  1.00 63.06           P  
ATOM   3231  OP1  DC J -61      94.762  93.164 -18.757  1.00 66.67           O  
ATOM   3232  OP2  DC J -61      92.456  92.043 -18.760  1.00 64.63           O  
ATOM   3233  O5'  DC J -61      93.534  92.765 -16.627  1.00 63.64           O  
ATOM   3234  C5'  DC J -61      94.183  93.718 -15.793  1.00 64.57           C  
ATOM   3235  C4'  DC J -61      94.095  93.283 -14.351  1.00 67.48           C  
ATOM   3236  O4'  DC J -61      92.801  93.624 -13.790  1.00 68.49           O  
ATOM   3237  C3'  DC J -61      94.260  91.776 -14.171  1.00 67.88           C  
ATOM   3238  O3'  DC J -61      95.129  91.502 -13.076  1.00 69.98           O  
ATOM   3239  C2'  DC J -61      92.847  91.293 -13.881  1.00 68.78           C  
ATOM   3240  C1'  DC J -61      92.246  92.484 -13.155  1.00 68.38           C  
ATOM   3241  N1   DC J -61      90.777  92.587 -13.228  1.00 67.53           N  
ATOM   3242  C2   DC J -61      90.050  92.833 -12.047  1.00 68.61           C  
ATOM   3243  O2   DC J -61      90.666  92.987 -10.978  1.00 66.77           O  
ATOM   3244  N3   DC J -61      88.700  92.902 -12.106  1.00 65.87           N  
ATOM   3245  C4   DC J -61      88.074  92.743 -13.273  1.00 65.37           C  
ATOM   3246  N4   DC J -61      86.742  92.802 -13.282  1.00 61.75           N  
ATOM   3247  C5   DC J -61      88.786  92.510 -14.486  1.00 66.12           C  
ATOM   3248  C6   DC J -61      90.122  92.440 -14.418  1.00 68.04           C  
ATOM   3249  P    DT J -60      95.837  90.067 -12.974  1.00 72.80           P  
ATOM   3250  OP1  DT J -60      97.291  90.271 -12.738  1.00 73.69           O  
ATOM   3251  OP2  DT J -60      95.388  89.248 -14.130  1.00 71.24           O  
ATOM   3252  O5'  DT J -60      95.192  89.435 -11.667  1.00 74.13           O  
ATOM   3253  C5'  DT J -60      95.233  90.127 -10.426  1.00 76.34           C  
ATOM   3254  C4'  DT J -60      94.334  89.434  -9.433  1.00 80.77           C  
ATOM   3255  O4'  DT J -60      92.948  89.771  -9.685  1.00 80.03           O  
ATOM   3256  C3'  DT J -60      94.421  87.909  -9.505  1.00 82.65           C  
ATOM   3257  O3'  DT J -60      94.353  87.366  -8.191  1.00 87.68           O  
ATOM   3258  C2'  DT J -60      93.171  87.526 -10.277  1.00 81.66           C  
ATOM   3259  C1'  DT J -60      92.196  88.574  -9.778  1.00 80.18           C  
ATOM   3260  N1   DT J -60      91.015  88.828 -10.629  1.00 78.05           N  
ATOM   3261  C2   DT J -60      89.948  89.483 -10.053  1.00 76.16           C  
ATOM   3262  O2   DT J -60      89.952  89.870  -8.895  1.00 74.40           O  
ATOM   3263  N3   DT J -60      88.870  89.664 -10.883  1.00 73.28           N  
ATOM   3264  C4   DT J -60      88.752  89.259 -12.197  1.00 73.46           C  
ATOM   3265  O4   DT J -60      87.715  89.478 -12.812  1.00 71.05           O  
ATOM   3266  C5   DT J -60      89.912  88.583 -12.742  1.00 74.47           C  
ATOM   3267  C7   DT J -60      89.875  88.106 -14.160  1.00 72.07           C  
ATOM   3268  C6   DT J -60      90.974  88.410 -11.943  1.00 75.58           C  
ATOM   3269  P    DG J -59      95.621  86.593  -7.587  1.00 91.87           P  
ATOM   3270  OP1  DG J -59      96.821  87.434  -7.845  1.00 91.29           O  
ATOM   3271  OP2  DG J -59      95.585  85.187  -8.075  1.00 90.94           O  
ATOM   3272  O5'  DG J -59      95.331  86.592  -6.023  1.00 90.90           O  
ATOM   3273  C5'  DG J -59      95.153  87.817  -5.317  1.00 91.26           C  
ATOM   3274  C4'  DG J -59      93.922  87.736  -4.445  1.00 91.87           C  
ATOM   3275  O4'  DG J -59      92.729  87.773  -5.263  1.00 91.28           O  
ATOM   3276  C3'  DG J -59      93.833  86.449  -3.633  1.00 91.82           C  
ATOM   3277  O3'  DG J -59      93.265  86.721  -2.355  1.00 91.16           O  
ATOM   3278  C2'  DG J -59      92.917  85.569  -4.464  1.00 91.72           C  
ATOM   3279  C1'  DG J -59      91.978  86.577  -5.106  1.00 90.50           C  
ATOM   3280  N9   DG J -59      91.485  86.195  -6.426  1.00 90.76           N  
ATOM   3281  C8   DG J -59      92.164  85.506  -7.402  1.00 90.11           C  
ATOM   3282  N7   DG J -59      91.469  85.348  -8.496  1.00 89.69           N  
ATOM   3283  C5   DG J -59      90.254  85.963  -8.221  1.00 89.49           C  
ATOM   3284  C6   DG J -59      89.098  86.124  -9.032  1.00 89.17           C  
ATOM   3285  O6   DG J -59      88.912  85.757 -10.200  1.00 85.74           O  
ATOM   3286  N1   DG J -59      88.090  86.801  -8.351  1.00 90.49           N  
ATOM   3287  C2   DG J -59      88.181  87.269  -7.062  1.00 90.36           C  
ATOM   3288  N2   DG J -59      87.095  87.891  -6.575  1.00 90.00           N  
ATOM   3289  N3   DG J -59      89.255  87.137  -6.305  1.00 90.65           N  
ATOM   3290  C4   DG J -59      90.245  86.478  -6.942  1.00 90.31           C  
ATOM   3291  P    DC J -58      93.252  85.575  -1.239  1.00 92.11           P  
ATOM   3292  OP1  DC J -58      93.623  86.207   0.052  1.00 91.57           O  
ATOM   3293  OP2  DC J -58      94.022  84.405  -1.739  1.00 91.32           O  
ATOM   3294  O5'  DC J -58      91.722  85.160  -1.166  1.00 91.62           O  
ATOM   3295  C5'  DC J -58      90.728  86.129  -0.870  1.00 92.67           C  
ATOM   3296  C4'  DC J -58      89.357  85.525  -1.036  1.00 93.23           C  
ATOM   3297  O4'  DC J -58      89.042  85.367  -2.441  1.00 92.98           O  
ATOM   3298  C3'  DC J -58      89.220  84.137  -0.412  1.00 94.37           C  
ATOM   3299  O3'  DC J -58      87.938  84.026   0.192  1.00 95.94           O  
ATOM   3300  C2'  DC J -58      89.294  83.204  -1.607  1.00 94.32           C  
ATOM   3301  C1'  DC J -58      88.599  84.040  -2.663  1.00 94.17           C  
ATOM   3302  N1   DC J -58      88.895  83.682  -4.058  1.00 95.02           N  
ATOM   3303  C2   DC J -58      87.889  83.853  -5.014  1.00 94.70           C  
ATOM   3304  O2   DC J -58      86.799  84.325  -4.657  1.00 94.52           O  
ATOM   3305  N3   DC J -58      88.129  83.505  -6.297  1.00 94.64           N  
ATOM   3306  C4   DC J -58      89.320  83.012  -6.642  1.00 95.55           C  
ATOM   3307  N4   DC J -58      89.512  82.679  -7.920  1.00 94.86           N  
ATOM   3308  C5   DC J -58      90.368  82.837  -5.690  1.00 95.21           C  
ATOM   3309  C6   DC J -58      90.115  83.183  -4.421  1.00 94.97           C  
ATOM   3310  P    DA J -57      87.825  83.633   1.737  1.00 96.74           P  
ATOM   3311  OP1  DA J -57      88.641  84.601   2.512  1.00 96.39           O  
ATOM   3312  OP2  DA J -57      88.104  82.178   1.849  1.00 97.58           O  
ATOM   3313  O5'  DA J -57      86.292  83.897   2.064  1.00 96.53           O  
ATOM   3314  C5'  DA J -57      85.691  85.154   1.764  1.00 94.86           C  
ATOM   3315  C4'  DA J -57      84.417  84.943   0.981  1.00 94.02           C  
ATOM   3316  O4'  DA J -57      84.743  84.402  -0.321  1.00 94.29           O  
ATOM   3317  C3'  DA J -57      83.451  83.948   1.618  1.00 92.61           C  
ATOM   3318  O3'  DA J -57      82.104  84.357   1.373  1.00 92.24           O  
ATOM   3319  C2'  DA J -57      83.765  82.646   0.905  1.00 92.30           C  
ATOM   3320  C1'  DA J -57      84.168  83.113  -0.484  1.00 92.95           C  
ATOM   3321  N9   DA J -57      85.168  82.260  -1.128  1.00 92.63           N  
ATOM   3322  C8   DA J -57      86.200  81.577  -0.532  1.00 92.26           C  
ATOM   3323  N7   DA J -57      86.934  80.889  -1.373  1.00 91.59           N  
ATOM   3324  C5   DA J -57      86.347  81.135  -2.605  1.00 92.04           C  
ATOM   3325  C6   DA J -57      86.656  80.696  -3.904  1.00 92.61           C  
ATOM   3326  N6   DA J -57      87.679  79.883  -4.189  1.00 92.98           N  
ATOM   3327  N1   DA J -57      85.869  81.125  -4.915  1.00 92.09           N  
ATOM   3328  C2   DA J -57      84.850  81.943  -4.630  1.00 92.10           C  
ATOM   3329  N3   DA J -57      84.461  82.428  -3.452  1.00 92.28           N  
ATOM   3330  C4   DA J -57      85.259  81.979  -2.469  1.00 92.27           C  
ATOM   3331  P    DG J -56      80.889  83.454   1.905  1.00 90.61           P  
ATOM   3332  OP1  DG J -56      79.768  84.365   2.247  1.00 90.98           O  
ATOM   3333  OP2  DG J -56      81.426  82.524   2.934  1.00 91.25           O  
ATOM   3334  O5'  DG J -56      80.471  82.617   0.623  1.00 84.93           O  
ATOM   3335  C5'  DG J -56      80.182  83.290  -0.589  1.00 81.44           C  
ATOM   3336  C4'  DG J -56      80.013  82.301  -1.716  1.00 79.94           C  
ATOM   3337  O4'  DG J -56      81.267  81.660  -2.048  1.00 79.13           O  
ATOM   3338  C3'  DG J -56      79.018  81.168  -1.473  1.00 78.75           C  
ATOM   3339  O3'  DG J -56      78.352  80.934  -2.707  1.00 77.23           O  
ATOM   3340  C2'  DG J -56      79.919  79.980  -1.188  1.00 78.13           C  
ATOM   3341  C1'  DG J -56      81.032  80.270  -2.169  1.00 79.18           C  
ATOM   3342  N9   DG J -56      82.294  79.568  -1.963  1.00 79.89           N  
ATOM   3343  C8   DG J -56      82.918  79.282  -0.774  1.00 78.60           C  
ATOM   3344  N7   DG J -56      84.043  78.641  -0.932  1.00 79.00           N  
ATOM   3345  C5   DG J -56      84.169  78.499  -2.306  1.00 78.88           C  
ATOM   3346  C6   DG J -56      85.193  77.896  -3.081  1.00 78.66           C  
ATOM   3347  O6   DG J -56      86.233  77.356  -2.693  1.00 79.24           O  
ATOM   3348  N1   DG J -56      84.917  77.972  -4.443  1.00 78.27           N  
ATOM   3349  C2   DG J -56      83.805  78.563  -4.990  1.00 77.28           C  
ATOM   3350  N2   DG J -56      83.714  78.544  -6.325  1.00 73.76           N  
ATOM   3351  N3   DG J -56      82.850  79.133  -4.279  1.00 77.85           N  
ATOM   3352  C4   DG J -56      83.096  79.064  -2.955  1.00 78.55           C  
ATOM   3353  P    DA J -55      76.964  80.148  -2.734  1.00 75.32           P  
ATOM   3354  OP1  DA J -55      75.909  81.175  -2.882  1.00 74.32           O  
ATOM   3355  OP2  DA J -55      76.915  79.197  -1.599  1.00 75.61           O  
ATOM   3356  O5'  DA J -55      77.050  79.346  -4.104  1.00 77.77           O  
ATOM   3357  C5'  DA J -55      77.291  80.044  -5.322  1.00 83.79           C  
ATOM   3358  C4'  DA J -55      77.909  79.128  -6.351  1.00 87.45           C  
ATOM   3359  O4'  DA J -55      79.237  78.726  -5.939  1.00 87.96           O  
ATOM   3360  C3'  DA J -55      77.140  77.836  -6.612  1.00 90.37           C  
ATOM   3361  O3'  DA J -55      77.174  77.548  -8.007  1.00 94.95           O  
ATOM   3362  C2'  DA J -55      77.923  76.796  -5.832  1.00 90.03           C  
ATOM   3363  C1'  DA J -55      79.341  77.311  -5.963  1.00 89.15           C  
ATOM   3364  N9   DA J -55      80.244  76.910  -4.885  1.00 89.43           N  
ATOM   3365  C8   DA J -55      80.169  77.241  -3.556  1.00 90.61           C  
ATOM   3366  N7   DA J -55      81.144  76.746  -2.832  1.00 90.42           N  
ATOM   3367  C5   DA J -55      81.910  76.037  -3.745  1.00 89.92           C  
ATOM   3368  C6   DA J -55      83.091  75.290  -3.607  1.00 90.85           C  
ATOM   3369  N6   DA J -55      83.733  75.128  -2.446  1.00 90.97           N  
ATOM   3370  N1   DA J -55      83.600  74.710  -4.715  1.00 90.29           N  
ATOM   3371  C2   DA J -55      82.959  74.880  -5.878  1.00 90.36           C  
ATOM   3372  N3   DA J -55      81.844  75.560  -6.134  1.00 89.79           N  
ATOM   3373  C4   DA J -55      81.365  76.123  -5.012  1.00 90.00           C  
ATOM   3374  P    DT J -54      76.486  76.212  -8.558  1.00 99.11           P  
ATOM   3375  OP1  DT J -54      75.884  76.532  -9.878  1.00100.22           O  
ATOM   3376  OP2  DT J -54      75.636  75.643  -7.484  1.00 99.60           O  
ATOM   3377  O5'  DT J -54      77.732  75.253  -8.798  1.00101.81           O  
ATOM   3378  C5'  DT J -54      78.844  75.704  -9.565  1.00106.15           C  
ATOM   3379  C4'  DT J -54      79.743  74.543  -9.909  1.00110.20           C  
ATOM   3380  O4'  DT J -54      80.597  74.213  -8.786  1.00110.76           O  
ATOM   3381  C3'  DT J -54      78.983  73.266 -10.261  1.00112.71           C  
ATOM   3382  O3'  DT J -54      79.596  72.616 -11.376  1.00115.32           O  
ATOM   3383  C2'  DT J -54      79.101  72.427  -9.001  1.00112.35           C  
ATOM   3384  C1'  DT J -54      80.456  72.840  -8.462  1.00111.36           C  
ATOM   3385  N1   DT J -54      80.605  72.700  -7.002  1.00111.07           N  
ATOM   3386  C2   DT J -54      81.711  72.032  -6.530  1.00111.86           C  
ATOM   3387  O2   DT J -54      82.567  71.556  -7.262  1.00112.63           O  
ATOM   3388  N3   DT J -54      81.783  71.944  -5.160  1.00111.83           N  
ATOM   3389  C4   DT J -54      80.882  72.447  -4.241  1.00111.16           C  
ATOM   3390  O4   DT J -54      81.083  72.295  -3.040  1.00111.45           O  
ATOM   3391  C5   DT J -54      79.746  73.132  -4.807  1.00110.79           C  
ATOM   3392  C7   DT J -54      78.716  73.708  -3.887  1.00110.18           C  
ATOM   3393  C6   DT J -54      79.664  73.223  -6.141  1.00110.79           C  
ATOM   3394  P    DT J -53      79.148  71.129 -11.771  1.00116.86           P  
ATOM   3395  OP1  DT J -53      79.222  70.991 -13.248  1.00117.28           O  
ATOM   3396  OP2  DT J -53      77.872  70.831 -11.070  1.00117.16           O  
ATOM   3397  O5'  DT J -53      80.294  70.243 -11.119  1.00118.89           O  
ATOM   3398  C5'  DT J -53      81.655  70.435 -11.497  1.00121.56           C  
ATOM   3399  C4'  DT J -53      82.440  69.175 -11.236  1.00122.63           C  
ATOM   3400  O4'  DT J -53      82.767  69.090  -9.829  1.00121.60           O  
ATOM   3401  C3'  DT J -53      81.643  67.918 -11.571  1.00124.24           C  
ATOM   3402  O3'  DT J -53      82.472  66.933 -12.184  1.00127.53           O  
ATOM   3403  C2'  DT J -53      81.126  67.457 -10.220  1.00123.19           C  
ATOM   3404  C1'  DT J -53      82.211  67.915  -9.262  1.00121.68           C  
ATOM   3405  N1   DT J -53      81.720  68.257  -7.912  1.00121.01           N  
ATOM   3406  C2   DT J -53      82.577  68.090  -6.847  1.00120.01           C  
ATOM   3407  O2   DT J -53      83.718  67.677  -6.970  1.00119.08           O  
ATOM   3408  N3   DT J -53      82.046  68.427  -5.625  1.00119.60           N  
ATOM   3409  C4   DT J -53      80.772  68.903  -5.370  1.00119.32           C  
ATOM   3410  O4   DT J -53      80.433  69.163  -4.219  1.00118.46           O  
ATOM   3411  C5   DT J -53      79.928  69.054  -6.531  1.00119.57           C  
ATOM   3412  C7   DT J -53      78.533  69.562  -6.351  1.00119.77           C  
ATOM   3413  C6   DT J -53      80.437  68.730  -7.728  1.00120.20           C  
ATOM   3414  P    DC J -52      81.963  65.416 -12.267  1.00130.10           P  
ATOM   3415  OP1  DC J -52      82.744  64.736 -13.332  1.00130.31           O  
ATOM   3416  OP2  DC J -52      80.477  65.412 -12.327  1.00129.23           O  
ATOM   3417  O5'  DC J -52      82.414  64.823 -10.863  1.00131.87           O  
ATOM   3418  C5'  DC J -52      83.783  64.871 -10.476  1.00134.76           C  
ATOM   3419  C4'  DC J -52      84.053  63.844  -9.405  1.00136.75           C  
ATOM   3420  O4'  DC J -52      83.748  64.376  -8.092  1.00137.15           O  
ATOM   3421  C3'  DC J -52      83.229  62.565  -9.557  1.00137.74           C  
ATOM   3422  O3'  DC J -52      84.054  61.427  -9.314  1.00139.28           O  
ATOM   3423  C2'  DC J -52      82.169  62.702  -8.477  1.00137.57           C  
ATOM   3424  C1'  DC J -52      82.921  63.458  -7.398  1.00137.08           C  
ATOM   3425  N1   DC J -52      82.078  64.215  -6.458  1.00136.72           N  
ATOM   3426  C2   DC J -52      82.565  64.462  -5.169  1.00136.54           C  
ATOM   3427  O2   DC J -52      83.700  64.060  -4.869  1.00136.18           O  
ATOM   3428  N3   DC J -52      81.789  65.133  -4.286  1.00136.30           N  
ATOM   3429  C4   DC J -52      80.575  65.554  -4.649  1.00136.16           C  
ATOM   3430  N4   DC J -52      79.841  66.203  -3.743  1.00135.65           N  
ATOM   3431  C5   DC J -52      80.059  65.328  -5.959  1.00136.12           C  
ATOM   3432  C6   DC J -52      80.838  64.661  -6.824  1.00136.50           C  
ATOM   3433  P    DT J -51      83.395  59.966  -9.238  1.00140.51           P  
ATOM   3434  OP1  DT J -51      84.203  59.055 -10.087  1.00140.91           O  
ATOM   3435  OP2  DT J -51      81.932  60.081  -9.471  1.00139.76           O  
ATOM   3436  O5'  DT J -51      83.623  59.563  -7.719  1.00140.91           O  
ATOM   3437  C5'  DT J -51      84.932  59.569  -7.160  1.00141.90           C  
ATOM   3438  C4'  DT J -51      84.916  58.896  -5.810  1.00142.59           C  
ATOM   3439  O4'  DT J -51      84.251  59.758  -4.855  1.00142.57           O  
ATOM   3440  C3'  DT J -51      84.141  57.580  -5.809  1.00142.92           C  
ATOM   3441  O3'  DT J -51      84.788  56.610  -4.986  1.00143.30           O  
ATOM   3442  C2'  DT J -51      82.787  57.964  -5.242  1.00142.69           C  
ATOM   3443  C1'  DT J -51      83.127  59.100  -4.293  1.00142.22           C  
ATOM   3444  N1   DT J -51      82.050  60.096  -4.141  1.00141.58           N  
ATOM   3445  C2   DT J -51      81.963  60.784  -2.953  1.00141.63           C  
ATOM   3446  O2   DT J -51      82.743  60.620  -2.029  1.00142.03           O  
ATOM   3447  N3   DT J -51      80.924  61.678  -2.885  1.00141.63           N  
ATOM   3448  C4   DT J -51      79.988  61.947  -3.864  1.00141.45           C  
ATOM   3449  O4   DT J -51      79.104  62.772  -3.655  1.00141.71           O  
ATOM   3450  C5   DT J -51      80.145  61.197  -5.087  1.00141.33           C  
ATOM   3451  C7   DT J -51      79.182  61.427  -6.208  1.00141.21           C  
ATOM   3452  C6   DT J -51      81.154  60.322  -5.164  1.00141.42           C  
ATOM   3453  P    DA J -50      84.030  55.240  -4.636  1.00143.54           P  
ATOM   3454  OP1  DA J -50      85.051  54.197  -4.366  1.00143.71           O  
ATOM   3455  OP2  DA J -50      83.002  55.010  -5.685  1.00143.72           O  
ATOM   3456  O5'  DA J -50      83.281  55.583  -3.275  1.00142.52           O  
ATOM   3457  C5'  DA J -50      84.020  56.020  -2.138  1.00141.29           C  
ATOM   3458  C4'  DA J -50      83.140  56.017  -0.911  1.00140.21           C  
ATOM   3459  O4'  DA J -50      82.216  57.130  -0.964  1.00140.38           O  
ATOM   3460  C3'  DA J -50      82.288  54.758  -0.765  1.00139.45           C  
ATOM   3461  O3'  DA J -50      82.249  54.346   0.601  1.00137.87           O  
ATOM   3462  C2'  DA J -50      80.916  55.200  -1.243  1.00139.89           C  
ATOM   3463  C1'  DA J -50      80.881  56.665  -0.847  1.00140.45           C  
ATOM   3464  N9   DA J -50      80.040  57.499  -1.707  1.00140.83           N  
ATOM   3465  C8   DA J -50      79.892  57.422  -3.070  1.00141.25           C  
ATOM   3466  N7   DA J -50      79.064  58.311  -3.564  1.00141.32           N  
ATOM   3467  C5   DA J -50      78.636  59.022  -2.452  1.00140.98           C  
ATOM   3468  C6   DA J -50      77.748  60.103  -2.304  1.00140.96           C  
ATOM   3469  N6   DA J -50      77.106  60.679  -3.323  1.00140.67           N  
ATOM   3470  N1   DA J -50      77.541  60.578  -1.057  1.00140.85           N  
ATOM   3471  C2   DA J -50      78.186  60.000  -0.036  1.00140.95           C  
ATOM   3472  N3   DA J -50      79.043  58.981  -0.047  1.00140.84           N  
ATOM   3473  C4   DA J -50      79.228  58.532  -1.301  1.00140.87           C  
ATOM   3474  P    DC J -49      81.388  53.058   1.018  1.00136.35           P  
ATOM   3475  OP1  DC J -49      82.167  52.260   1.996  1.00136.33           O  
ATOM   3476  OP2  DC J -49      80.889  52.414  -0.225  1.00136.51           O  
ATOM   3477  O5'  DC J -49      80.144  53.695   1.772  1.00134.95           O  
ATOM   3478  C5'  DC J -49      80.340  54.513   2.918  1.00132.52           C  
ATOM   3479  C4'  DC J -49      79.014  54.808   3.572  1.00130.94           C  
ATOM   3480  O4'  DC J -49      78.306  55.827   2.824  1.00130.59           O  
ATOM   3481  C3'  DC J -49      78.087  53.594   3.632  1.00129.70           C  
ATOM   3482  O3'  DC J -49      77.457  53.515   4.908  1.00127.68           O  
ATOM   3483  C2'  DC J -49      77.074  53.857   2.530  1.00129.69           C  
ATOM   3484  C1'  DC J -49      77.000  55.375   2.505  1.00129.88           C  
ATOM   3485  N1   DC J -49      76.624  55.958   1.203  1.00129.27           N  
ATOM   3486  C2   DC J -49      75.751  57.053   1.183  1.00128.28           C  
ATOM   3487  O2   DC J -49      75.333  57.506   2.259  1.00127.38           O  
ATOM   3488  N3   DC J -49      75.389  57.590  -0.005  1.00127.70           N  
ATOM   3489  C4   DC J -49      75.866  57.077  -1.142  1.00128.31           C  
ATOM   3490  N4   DC J -49      75.479  57.635  -2.292  1.00127.52           N  
ATOM   3491  C5   DC J -49      76.761  55.967  -1.151  1.00128.83           C  
ATOM   3492  C6   DC J -49      77.111  55.444   0.033  1.00129.44           C  
ATOM   3493  P    DC J -48      76.439  52.317   5.213  1.00125.74           P  
ATOM   3494  OP1  DC J -48      76.506  52.037   6.668  1.00126.42           O  
ATOM   3495  OP2  DC J -48      76.677  51.221   4.242  1.00126.27           O  
ATOM   3496  O5'  DC J -48      75.025  52.969   4.893  1.00125.62           O  
ATOM   3497  C5'  DC J -48      74.527  54.032   5.697  1.00123.97           C  
ATOM   3498  C4'  DC J -48      73.051  54.222   5.447  1.00123.04           C  
ATOM   3499  O4'  DC J -48      72.848  54.901   4.185  1.00124.23           O  
ATOM   3500  C3'  DC J -48      72.261  52.917   5.365  1.00121.53           C  
ATOM   3501  O3'  DC J -48      71.003  53.080   6.020  1.00119.05           O  
ATOM   3502  C2'  DC J -48      72.066  52.720   3.872  1.00122.25           C  
ATOM   3503  C1'  DC J -48      71.953  54.154   3.383  1.00123.34           C  
ATOM   3504  N1   DC J -48      72.302  54.391   1.971  1.00123.65           N  
ATOM   3505  C2   DC J -48      72.174  55.688   1.459  1.00123.95           C  
ATOM   3506  O2   DC J -48      71.788  56.595   2.214  1.00124.17           O  
ATOM   3507  N3   DC J -48      72.469  55.921   0.161  1.00123.39           N  
ATOM   3508  C4   DC J -48      72.881  54.921  -0.618  1.00123.65           C  
ATOM   3509  N4   DC J -48      73.152  55.196  -1.895  1.00123.47           N  
ATOM   3510  C5   DC J -48      73.030  53.592  -0.123  1.00123.90           C  
ATOM   3511  C6   DC J -48      72.735  53.374   1.166  1.00123.68           C  
ATOM   3512  P    DA J -47      70.675  52.221   7.336  1.00117.40           P  
ATOM   3513  OP1  DA J -47      71.841  52.315   8.252  1.00117.41           O  
ATOM   3514  OP2  DA J -47      70.191  50.888   6.895  1.00117.07           O  
ATOM   3515  O5'  DA J -47      69.459  53.003   8.000  1.00115.20           O  
ATOM   3516  C5'  DA J -47      69.670  54.254   8.650  1.00111.85           C  
ATOM   3517  C4'  DA J -47      68.683  55.280   8.144  1.00109.56           C  
ATOM   3518  O4'  DA J -47      68.925  55.513   6.735  1.00108.12           O  
ATOM   3519  C3'  DA J -47      67.217  54.865   8.260  1.00108.46           C  
ATOM   3520  O3'  DA J -47      66.412  55.991   8.624  1.00106.35           O  
ATOM   3521  C2'  DA J -47      66.881  54.355   6.871  1.00108.06           C  
ATOM   3522  C1'  DA J -47      67.779  55.180   5.965  1.00108.21           C  
ATOM   3523  N9   DA J -47      68.236  54.443   4.788  1.00108.68           N  
ATOM   3524  C8   DA J -47      68.505  53.099   4.706  1.00108.97           C  
ATOM   3525  N7   DA J -47      68.904  52.710   3.521  1.00109.13           N  
ATOM   3526  C5   DA J -47      68.896  53.874   2.768  1.00109.14           C  
ATOM   3527  C6   DA J -47      69.221  54.132   1.426  1.00109.20           C  
ATOM   3528  N6   DA J -47      69.641  53.196   0.572  1.00108.60           N  
ATOM   3529  N1   DA J -47      69.102  55.403   0.985  1.00108.95           N  
ATOM   3530  C2   DA J -47      68.690  56.342   1.845  1.00109.77           C  
ATOM   3531  N3   DA J -47      68.359  56.224   3.130  1.00109.90           N  
ATOM   3532  C4   DA J -47      68.485  54.950   3.536  1.00109.21           C  
ATOM   3533  P    DA J -46      64.811  55.898   8.525  1.00104.45           P  
ATOM   3534  OP1  DA J -46      64.218  56.602   9.688  1.00104.96           O  
ATOM   3535  OP2  DA J -46      64.434  54.488   8.250  1.00104.36           O  
ATOM   3536  O5'  DA J -46      64.492  56.756   7.228  1.00102.69           O  
ATOM   3537  C5'  DA J -46      65.173  57.984   6.994  1.00 99.96           C  
ATOM   3538  C4'  DA J -46      64.806  58.523   5.634  1.00 98.31           C  
ATOM   3539  O4'  DA J -46      65.370  57.674   4.604  1.00 97.03           O  
ATOM   3540  C3'  DA J -46      63.300  58.534   5.394  1.00 97.54           C  
ATOM   3541  O3'  DA J -46      62.926  59.698   4.648  1.00 96.95           O  
ATOM   3542  C2'  DA J -46      63.063  57.245   4.627  1.00 96.28           C  
ATOM   3543  C1'  DA J -46      64.339  57.099   3.817  1.00 96.30           C  
ATOM   3544  N9   DA J -46      64.714  55.713   3.533  1.00 96.28           N  
ATOM   3545  C8   DA J -46      64.650  54.636   4.383  1.00 96.94           C  
ATOM   3546  N7   DA J -46      65.056  53.512   3.844  1.00 96.01           N  
ATOM   3547  C5   DA J -46      65.410  53.872   2.553  1.00 95.70           C  
ATOM   3548  C6   DA J -46      65.915  53.131   1.471  1.00 96.21           C  
ATOM   3549  N6   DA J -46      66.155  51.819   1.519  1.00 95.36           N  
ATOM   3550  N1   DA J -46      66.165  53.793   0.321  1.00 96.34           N  
ATOM   3551  C2   DA J -46      65.919  55.107   0.273  1.00 95.69           C  
ATOM   3552  N3   DA J -46      65.445  55.910   1.219  1.00 95.11           N  
ATOM   3553  C4   DA J -46      65.207  55.224   2.348  1.00 95.33           C  
ATOM   3554  P    DA J -45      61.512  60.399   4.935  1.00 97.61           P  
ATOM   3555  OP1  DA J -45      61.643  61.869   4.762  1.00 99.03           O  
ATOM   3556  OP2  DA J -45      61.017  59.852   6.223  1.00 99.22           O  
ATOM   3557  O5'  DA J -45      60.589  59.838   3.773  1.00 93.45           O  
ATOM   3558  C5'  DA J -45      60.990  58.684   3.069  1.00 90.43           C  
ATOM   3559  C4'  DA J -45      61.237  59.014   1.620  1.00 87.70           C  
ATOM   3560  O4'  DA J -45      62.105  58.010   1.056  1.00 85.96           O  
ATOM   3561  C3'  DA J -45      59.966  58.974   0.790  1.00 86.67           C  
ATOM   3562  O3'  DA J -45      60.068  59.882  -0.299  1.00 86.07           O  
ATOM   3563  C2'  DA J -45      59.905  57.531   0.330  1.00 86.16           C  
ATOM   3564  C1'  DA J -45      61.368  57.110   0.247  1.00 85.75           C  
ATOM   3565  N9   DA J -45      61.623  55.770   0.771  1.00 86.08           N  
ATOM   3566  C8   DA J -45      61.356  55.307   2.036  1.00 85.57           C  
ATOM   3567  N7   DA J -45      61.724  54.066   2.233  1.00 84.53           N  
ATOM   3568  C5   DA J -45      62.264  53.682   1.015  1.00 85.16           C  
ATOM   3569  C6   DA J -45      62.835  52.482   0.576  1.00 84.51           C  
ATOM   3570  N6   DA J -45      62.970  51.404   1.349  1.00 85.30           N  
ATOM   3571  N1   DA J -45      63.272  52.425  -0.700  1.00 83.26           N  
ATOM   3572  C2   DA J -45      63.142  53.510  -1.470  1.00 84.17           C  
ATOM   3573  N3   DA J -45      62.626  54.698  -1.171  1.00 83.36           N  
ATOM   3574  C4   DA J -45      62.201  54.719   0.102  1.00 84.64           C  
ATOM   3575  P    DA J -44      58.738  60.357  -1.057  1.00 85.40           P  
ATOM   3576  OP1  DA J -44      58.957  61.754  -1.503  1.00 86.22           O  
ATOM   3577  OP2  DA J -44      57.579  60.027  -0.185  1.00 84.71           O  
ATOM   3578  O5'  DA J -44      58.696  59.408  -2.332  1.00 83.22           O  
ATOM   3579  C5'  DA J -44      59.833  59.294  -3.180  1.00 79.16           C  
ATOM   3580  C4'  DA J -44      59.723  58.056  -4.038  1.00 76.24           C  
ATOM   3581  O4'  DA J -44      60.066  56.869  -3.281  1.00 75.02           O  
ATOM   3582  C3'  DA J -44      58.330  57.807  -4.619  1.00 74.77           C  
ATOM   3583  O3'  DA J -44      58.438  57.437  -5.986  1.00 71.95           O  
ATOM   3584  C2'  DA J -44      57.812  56.629  -3.812  1.00 75.04           C  
ATOM   3585  C1'  DA J -44      59.091  55.868  -3.528  1.00 76.03           C  
ATOM   3586  N9   DA J -44      59.041  54.983  -2.365  1.00 75.33           N  
ATOM   3587  C8   DA J -44      58.454  55.216  -1.150  1.00 76.76           C  
ATOM   3588  N7   DA J -44      58.581  54.227  -0.301  1.00 77.47           N  
ATOM   3589  C5   DA J -44      59.298  53.272  -1.007  1.00 77.44           C  
ATOM   3590  C6   DA J -44      59.757  51.981  -0.666  1.00 75.55           C  
ATOM   3591  N6   DA J -44      59.563  51.412   0.525  1.00 72.27           N  
ATOM   3592  N1   DA J -44      60.434  51.290  -1.606  1.00 76.16           N  
ATOM   3593  C2   DA J -44      60.638  51.860  -2.800  1.00 76.37           C  
ATOM   3594  N3   DA J -44      60.263  53.060  -3.237  1.00 78.31           N  
ATOM   3595  C4   DA J -44      59.588  53.724  -2.282  1.00 77.20           C  
ATOM   3596  P    DG J -43      57.127  57.399  -6.902  1.00 72.58           P  
ATOM   3597  OP1  DG J -43      57.294  58.379  -8.002  1.00 70.67           O  
ATOM   3598  OP2  DG J -43      55.938  57.482  -6.021  1.00 72.21           O  
ATOM   3599  O5'  DG J -43      57.178  55.940  -7.531  1.00 77.52           O  
ATOM   3600  C5'  DG J -43      58.348  55.482  -8.201  1.00 82.58           C  
ATOM   3601  C4'  DG J -43      58.296  53.984  -8.378  1.00 86.83           C  
ATOM   3602  O4'  DG J -43      58.499  53.325  -7.103  1.00 87.96           O  
ATOM   3603  C3'  DG J -43      56.960  53.470  -8.916  1.00 89.37           C  
ATOM   3604  O3'  DG J -43      57.184  52.433  -9.870  1.00 92.06           O  
ATOM   3605  C2'  DG J -43      56.271  52.915  -7.684  1.00 89.18           C  
ATOM   3606  C1'  DG J -43      57.444  52.408  -6.868  1.00 90.38           C  
ATOM   3607  N9   DG J -43      57.194  52.358  -5.431  1.00 92.55           N  
ATOM   3608  C8   DG J -43      56.627  53.334  -4.649  1.00 94.11           C  
ATOM   3609  N7   DG J -43      56.500  52.981  -3.400  1.00 93.65           N  
ATOM   3610  C5   DG J -43      57.023  51.697  -3.352  1.00 94.62           C  
ATOM   3611  C6   DG J -43      57.148  50.798  -2.266  1.00 95.58           C  
ATOM   3612  O6   DG J -43      56.807  50.959  -1.090  1.00 96.28           O  
ATOM   3613  N1   DG J -43      57.737  49.602  -2.658  1.00 96.43           N  
ATOM   3614  C2   DG J -43      58.148  49.304  -3.931  1.00 97.22           C  
ATOM   3615  N2   DG J -43      58.693  48.090  -4.109  1.00 98.92           N  
ATOM   3616  N3   DG J -43      58.035  50.132  -4.954  1.00 96.92           N  
ATOM   3617  C4   DG J -43      57.466  51.302  -4.595  1.00 94.89           C  
ATOM   3618  P    DT J -42      55.958  51.883 -10.748  1.00 93.41           P  
ATOM   3619  OP1  DT J -42      56.415  51.876 -12.160  1.00 93.35           O  
ATOM   3620  OP2  DT J -42      54.713  52.608 -10.382  1.00 94.40           O  
ATOM   3621  O5'  DT J -42      55.806  50.382 -10.245  1.00 97.83           O  
ATOM   3622  C5'  DT J -42      56.923  49.500 -10.260  1.00101.01           C  
ATOM   3623  C4'  DT J -42      56.554  48.174  -9.642  1.00102.96           C  
ATOM   3624  O4'  DT J -42      56.461  48.298  -8.202  1.00103.94           O  
ATOM   3625  C3'  DT J -42      55.212  47.615 -10.111  1.00104.60           C  
ATOM   3626  O3'  DT J -42      55.332  46.213 -10.356  1.00106.07           O  
ATOM   3627  C2'  DT J -42      54.287  47.880  -8.935  1.00104.21           C  
ATOM   3628  C1'  DT J -42      55.235  47.743  -7.762  1.00104.63           C  
ATOM   3629  N1   DT J -42      54.831  48.444  -6.530  1.00106.18           N  
ATOM   3630  C2   DT J -42      54.956  47.759  -5.343  1.00107.58           C  
ATOM   3631  O2   DT J -42      55.374  46.616  -5.279  1.00109.13           O  
ATOM   3632  N3   DT J -42      54.570  48.462  -4.229  1.00107.42           N  
ATOM   3633  C4   DT J -42      54.079  49.751  -4.186  1.00107.88           C  
ATOM   3634  O4   DT J -42      53.773  50.252  -3.107  1.00108.48           O  
ATOM   3635  C5   DT J -42      53.971  50.413  -5.470  1.00107.66           C  
ATOM   3636  C7   DT J -42      53.448  51.815  -5.522  1.00107.78           C  
ATOM   3637  C6   DT J -42      54.347  49.735  -6.564  1.00107.07           C  
ATOM   3638  P    DG J -41      54.069  45.394 -10.907  1.00106.77           P  
ATOM   3639  OP1  DG J -41      54.545  44.392 -11.890  1.00108.56           O  
ATOM   3640  OP2  DG J -41      53.036  46.380 -11.309  1.00108.39           O  
ATOM   3641  O5'  DG J -41      53.557  44.624  -9.614  1.00108.08           O  
ATOM   3642  C5'  DG J -41      54.416  43.721  -8.926  1.00110.31           C  
ATOM   3643  C4'  DG J -41      53.635  42.967  -7.878  1.00112.58           C  
ATOM   3644  O4'  DG J -41      53.416  43.808  -6.718  1.00113.23           O  
ATOM   3645  C3'  DG J -41      52.253  42.529  -8.357  1.00113.30           C  
ATOM   3646  O3'  DG J -41      51.956  41.220  -7.874  1.00114.09           O  
ATOM   3647  C2'  DG J -41      51.325  43.565  -7.748  1.00113.45           C  
ATOM   3648  C1'  DG J -41      52.027  43.910  -6.446  1.00113.49           C  
ATOM   3649  N9   DG J -41      51.763  45.263  -5.964  1.00113.47           N  
ATOM   3650  C8   DG J -41      51.832  46.428  -6.688  1.00113.46           C  
ATOM   3651  N7   DG J -41      51.539  47.487  -5.984  1.00113.60           N  
ATOM   3652  C5   DG J -41      51.261  46.992  -4.718  1.00113.37           C  
ATOM   3653  C6   DG J -41      50.882  47.670  -3.528  1.00113.91           C  
ATOM   3654  O6   DG J -41      50.710  48.885  -3.351  1.00113.61           O  
ATOM   3655  N1   DG J -41      50.700  46.783  -2.472  1.00113.57           N  
ATOM   3656  C2   DG J -41      50.861  45.421  -2.548  1.00113.82           C  
ATOM   3657  N2   DG J -41      50.640  44.735  -1.418  1.00114.13           N  
ATOM   3658  N3   DG J -41      51.212  44.778  -3.649  1.00113.66           N  
ATOM   3659  C4   DG J -41      51.395  45.621  -4.688  1.00113.54           C  
ATOM   3660  P    DT J -40      50.458  40.659  -7.983  1.00114.64           P  
ATOM   3661  OP1  DT J -40      50.535  39.184  -8.129  1.00115.32           O  
ATOM   3662  OP2  DT J -40      49.726  41.460  -8.998  1.00115.33           O  
ATOM   3663  O5'  DT J -40      49.852  40.984  -6.549  1.00114.07           O  
ATOM   3664  C5'  DT J -40      50.391  40.370  -5.383  1.00113.49           C  
ATOM   3665  C4'  DT J -40      49.357  40.356  -4.284  1.00113.32           C  
ATOM   3666  O4'  DT J -40      49.232  41.678  -3.705  1.00113.13           O  
ATOM   3667  C3'  DT J -40      47.961  39.969  -4.770  1.00113.25           C  
ATOM   3668  O3'  DT J -40      47.316  39.134  -3.808  1.00113.53           O  
ATOM   3669  C2'  DT J -40      47.251  41.304  -4.891  1.00113.12           C  
ATOM   3670  C1'  DT J -40      47.880  42.101  -3.765  1.00112.99           C  
ATOM   3671  N1   DT J -40      47.863  43.563  -3.965  1.00113.14           N  
ATOM   3672  C2   DT J -40      47.576  44.356  -2.878  1.00113.11           C  
ATOM   3673  O2   DT J -40      47.354  43.907  -1.766  1.00113.29           O  
ATOM   3674  N3   DT J -40      47.558  45.704  -3.141  1.00112.58           N  
ATOM   3675  C4   DT J -40      47.793  46.321  -4.352  1.00112.66           C  
ATOM   3676  O4   DT J -40      47.740  47.545  -4.436  1.00112.50           O  
ATOM   3677  C5   DT J -40      48.091  45.430  -5.450  1.00112.77           C  
ATOM   3678  C7   DT J -40      48.355  46.010  -6.803  1.00112.60           C  
ATOM   3679  C6   DT J -40      48.115  44.113  -5.204  1.00113.00           C  
ATOM   3680  P    DA J -39      45.733  38.895  -3.903  1.00113.32           P  
ATOM   3681  OP1  DA J -39      45.421  37.543  -3.374  1.00113.77           O  
ATOM   3682  OP2  DA J -39      45.304  39.266  -5.277  1.00113.99           O  
ATOM   3683  O5'  DA J -39      45.146  39.961  -2.882  1.00112.41           O  
ATOM   3684  C5'  DA J -39      45.444  39.858  -1.494  1.00111.58           C  
ATOM   3685  C4'  DA J -39      44.321  40.452  -0.681  1.00110.50           C  
ATOM   3686  O4'  DA J -39      44.370  41.896  -0.772  1.00109.93           O  
ATOM   3687  C3'  DA J -39      42.930  40.034  -1.153  1.00109.87           C  
ATOM   3688  O3'  DA J -39      42.103  39.729  -0.024  1.00109.71           O  
ATOM   3689  C2'  DA J -39      42.448  41.231  -1.955  1.00108.85           C  
ATOM   3690  C1'  DA J -39      43.161  42.407  -1.309  1.00108.25           C  
ATOM   3691  N9   DA J -39      43.508  43.470  -2.255  1.00106.33           N  
ATOM   3692  C8   DA J -39      43.598  43.378  -3.622  1.00105.49           C  
ATOM   3693  N7   DA J -39      43.923  44.503  -4.209  1.00103.77           N  
ATOM   3694  C5   DA J -39      44.059  45.398  -3.159  1.00103.60           C  
ATOM   3695  C6   DA J -39      44.388  46.762  -3.120  1.00102.45           C  
ATOM   3696  N6   DA J -39      44.651  47.489  -4.206  1.00101.05           N  
ATOM   3697  N1   DA J -39      44.438  47.361  -1.910  1.00101.97           N  
ATOM   3698  C2   DA J -39      44.171  46.629  -0.823  1.00102.38           C  
ATOM   3699  N3   DA J -39      43.850  45.341  -0.731  1.00103.36           N  
ATOM   3700  C4   DA J -39      43.809  44.776  -1.949  1.00104.32           C  
ATOM   3701  P    DT J -38      40.533  40.057  -0.061  1.00109.58           P  
ATOM   3702  OP1  DT J -38      39.854  39.154   0.903  1.00109.32           O  
ATOM   3703  OP2  DT J -38      40.080  40.092  -1.476  1.00109.42           O  
ATOM   3704  O5'  DT J -38      40.496  41.529   0.538  1.00107.96           O  
ATOM   3705  C5'  DT J -38      41.319  41.858   1.657  1.00105.05           C  
ATOM   3706  C4'  DT J -38      40.842  43.138   2.297  1.00102.92           C  
ATOM   3707  O4'  DT J -38      41.248  44.271   1.493  1.00101.09           O  
ATOM   3708  C3'  DT J -38      39.323  43.223   2.428  1.00101.29           C  
ATOM   3709  O3'  DT J -38      38.969  43.792   3.689  1.00 99.44           O  
ATOM   3710  C2'  DT J -38      38.918  44.114   1.268  1.00100.37           C  
ATOM   3711  C1'  DT J -38      40.117  45.034   1.113  1.00 99.61           C  
ATOM   3712  N1   DT J -38      40.340  45.514  -0.265  1.00 98.07           N  
ATOM   3713  C2   DT J -38      40.763  46.813  -0.443  1.00 97.14           C  
ATOM   3714  O2   DT J -38      40.979  47.581   0.481  1.00 97.19           O  
ATOM   3715  N3   DT J -38      40.927  47.183  -1.754  1.00 96.39           N  
ATOM   3716  C4   DT J -38      40.718  46.406  -2.876  1.00 96.77           C  
ATOM   3717  O4   DT J -38      40.902  46.879  -3.992  1.00 95.32           O  
ATOM   3718  C5   DT J -38      40.283  45.055  -2.615  1.00 97.70           C  
ATOM   3719  C7   DT J -38      40.033  44.140  -3.772  1.00 98.14           C  
ATOM   3720  C6   DT J -38      40.120  44.680  -1.340  1.00 97.97           C  
ATOM   3721  P    DT J -37      37.466  44.293   3.940  1.00 99.07           P  
ATOM   3722  OP1  DT J -37      37.153  44.131   5.384  1.00 97.47           O  
ATOM   3723  OP2  DT J -37      36.598  43.645   2.920  1.00 96.93           O  
ATOM   3724  O5'  DT J -37      37.564  45.852   3.628  1.00 95.82           O  
ATOM   3725  C5'  DT J -37      38.616  46.631   4.196  1.00 91.49           C  
ATOM   3726  C4'  DT J -37      38.421  48.096   3.879  1.00 89.01           C  
ATOM   3727  O4'  DT J -37      38.685  48.345   2.478  1.00 87.93           O  
ATOM   3728  C3'  DT J -37      37.018  48.635   4.153  1.00 87.54           C  
ATOM   3729  O3'  DT J -37      37.104  49.921   4.766  1.00 84.48           O  
ATOM   3730  C2'  DT J -37      36.393  48.725   2.770  1.00 86.73           C  
ATOM   3731  C1'  DT J -37      37.589  49.024   1.888  1.00 86.68           C  
ATOM   3732  N1   DT J -37      37.472  48.557   0.495  1.00 86.92           N  
ATOM   3733  C2   DT J -37      37.651  49.477  -0.513  1.00 87.67           C  
ATOM   3734  O2   DT J -37      37.884  50.655  -0.308  1.00 88.75           O  
ATOM   3735  N3   DT J -37      37.549  48.966  -1.780  1.00 87.75           N  
ATOM   3736  C4   DT J -37      37.294  47.658  -2.134  1.00 87.56           C  
ATOM   3737  O4   DT J -37      37.247  47.346  -3.319  1.00 87.74           O  
ATOM   3738  C5   DT J -37      37.106  46.747  -1.028  1.00 87.23           C  
ATOM   3739  C7   DT J -37      36.820  45.307  -1.316  1.00 86.79           C  
ATOM   3740  C6   DT J -37      37.201  47.237   0.215  1.00 86.83           C  
ATOM   3741  P    DT J -36      35.762  50.685   5.202  1.00 83.76           P  
ATOM   3742  OP1  DT J -36      36.058  51.476   6.425  1.00 82.62           O  
ATOM   3743  OP2  DT J -36      34.653  49.698   5.214  1.00 84.11           O  
ATOM   3744  O5'  DT J -36      35.515  51.701   3.998  1.00 82.22           O  
ATOM   3745  C5'  DT J -36      36.517  52.653   3.644  1.00 76.96           C  
ATOM   3746  C4'  DT J -36      36.033  53.539   2.520  1.00 74.33           C  
ATOM   3747  O4'  DT J -36      36.086  52.843   1.250  1.00 73.48           O  
ATOM   3748  C3'  DT J -36      34.599  54.054   2.670  1.00 72.48           C  
ATOM   3749  O3'  DT J -36      34.545  55.418   2.258  1.00 68.60           O  
ATOM   3750  C2'  DT J -36      33.825  53.207   1.675  1.00 72.88           C  
ATOM   3751  C1'  DT J -36      34.855  53.027   0.576  1.00 73.46           C  
ATOM   3752  N1   DT J -36      34.644  51.876  -0.317  1.00 75.82           N  
ATOM   3753  C2   DT J -36      34.851  52.069  -1.661  1.00 77.94           C  
ATOM   3754  O2   DT J -36      35.208  53.134  -2.130  1.00 79.42           O  
ATOM   3755  N3   DT J -36      34.629  50.962  -2.443  1.00 79.26           N  
ATOM   3756  C4   DT J -36      34.235  49.709  -2.021  1.00 80.32           C  
ATOM   3757  O4   DT J -36      34.077  48.808  -2.841  1.00 79.95           O  
ATOM   3758  C5   DT J -36      34.041  49.574  -0.593  1.00 79.55           C  
ATOM   3759  C7   DT J -36      33.620  48.250  -0.042  1.00 81.42           C  
ATOM   3760  C6   DT J -36      34.250  50.651   0.177  1.00 77.79           C  
ATOM   3761  P    DG J -35      34.012  56.547   3.270  1.00 66.33           P  
ATOM   3762  OP1  DG J -35      34.828  56.532   4.509  1.00 65.12           O  
ATOM   3763  OP2  DG J -35      32.538  56.427   3.363  1.00 66.74           O  
ATOM   3764  O5'  DG J -35      34.323  57.889   2.477  1.00 63.81           O  
ATOM   3765  C5'  DG J -35      35.629  58.145   1.985  1.00 59.34           C  
ATOM   3766  C4'  DG J -35      35.566  58.582   0.542  1.00 57.80           C  
ATOM   3767  O4'  DG J -35      35.121  57.490  -0.289  1.00 57.25           O  
ATOM   3768  C3'  DG J -35      34.614  59.738   0.255  1.00 55.30           C  
ATOM   3769  O3'  DG J -35      35.189  60.560  -0.762  1.00 50.17           O  
ATOM   3770  C2'  DG J -35      33.359  59.043  -0.242  1.00 57.34           C  
ATOM   3771  C1'  DG J -35      33.912  57.818  -0.956  1.00 58.23           C  
ATOM   3772  N9   DG J -35      33.063  56.631  -0.896  1.00 61.52           N  
ATOM   3773  C8   DG J -35      32.421  56.131   0.214  1.00 61.52           C  
ATOM   3774  N7   DG J -35      31.806  55.001  -0.015  1.00 63.52           N  
ATOM   3775  C5   DG J -35      32.044  54.745  -1.359  1.00 62.61           C  
ATOM   3776  C6   DG J -35      31.653  53.647  -2.167  1.00 61.40           C  
ATOM   3777  O6   DG J -35      31.036  52.636  -1.835  1.00 63.30           O  
ATOM   3778  N1   DG J -35      32.076  53.801  -3.481  1.00 60.07           N  
ATOM   3779  C2   DG J -35      32.802  54.866  -3.956  1.00 60.47           C  
ATOM   3780  N2   DG J -35      33.094  54.844  -5.265  1.00 58.45           N  
ATOM   3781  N3   DG J -35      33.203  55.881  -3.205  1.00 59.39           N  
ATOM   3782  C4   DG J -35      32.790  55.758  -1.928  1.00 60.70           C  
ATOM   3783  P    DG J -34      34.664  62.057  -0.965  1.00 47.91           P  
ATOM   3784  OP1  DG J -34      35.832  62.847  -1.432  1.00 47.12           O  
ATOM   3785  OP2  DG J -34      33.956  62.444   0.277  1.00 44.17           O  
ATOM   3786  O5'  DG J -34      33.613  61.929  -2.152  1.00 47.17           O  
ATOM   3787  C5'  DG J -34      34.044  61.505  -3.443  1.00 53.95           C  
ATOM   3788  C4'  DG J -34      32.868  61.062  -4.282  1.00 57.64           C  
ATOM   3789  O4'  DG J -34      32.307  59.827  -3.774  1.00 57.82           O  
ATOM   3790  C3'  DG J -34      31.702  62.048  -4.366  1.00 60.29           C  
ATOM   3791  O3'  DG J -34      31.152  61.990  -5.682  1.00 65.93           O  
ATOM   3792  C2'  DG J -34      30.688  61.448  -3.412  1.00 59.80           C  
ATOM   3793  C1'  DG J -34      30.906  59.978  -3.703  1.00 58.28           C  
ATOM   3794  N9   DG J -34      30.382  59.021  -2.734  1.00 59.14           N  
ATOM   3795  C8   DG J -34      30.155  59.207  -1.391  1.00 58.18           C  
ATOM   3796  N7   DG J -34      29.641  58.156  -0.808  1.00 57.86           N  
ATOM   3797  C5   DG J -34      29.532  57.218  -1.827  1.00 58.78           C  
ATOM   3798  C6   DG J -34      29.031  55.881  -1.811  1.00 59.61           C  
ATOM   3799  O6   DG J -34      28.569  55.237  -0.861  1.00 56.66           O  
ATOM   3800  N1   DG J -34      29.106  55.297  -3.071  1.00 57.26           N  
ATOM   3801  C2   DG J -34      29.595  55.909  -4.199  1.00 59.72           C  
ATOM   3802  N2   DG J -34      29.596  55.182  -5.320  1.00 57.00           N  
ATOM   3803  N3   DG J -34      30.054  57.146  -4.228  1.00 58.40           N  
ATOM   3804  C4   DG J -34      29.993  57.736  -3.018  1.00 58.35           C  
ATOM   3805  P    DA J -33      31.440  63.174  -6.721  1.00 69.72           P  
ATOM   3806  OP1  DA J -33      32.911  63.342  -6.812  1.00 71.83           O  
ATOM   3807  OP2  DA J -33      30.593  64.330  -6.351  1.00 71.26           O  
ATOM   3808  O5'  DA J -33      30.915  62.593  -8.106  1.00 70.89           O  
ATOM   3809  C5'  DA J -33      31.729  61.718  -8.882  1.00 75.05           C  
ATOM   3810  C4'  DA J -33      30.871  60.685  -9.575  1.00 78.63           C  
ATOM   3811  O4'  DA J -33      30.293  59.796  -8.591  1.00 79.02           O  
ATOM   3812  C3'  DA J -33      29.696  61.255 -10.365  1.00 80.42           C  
ATOM   3813  O3'  DA J -33      29.489  60.475 -11.543  1.00 86.53           O  
ATOM   3814  C2'  DA J -33      28.525  61.096  -9.414  1.00 78.86           C  
ATOM   3815  C1'  DA J -33      28.877  59.812  -8.690  1.00 77.66           C  
ATOM   3816  N9   DA J -33      28.340  59.706  -7.334  1.00 75.77           N  
ATOM   3817  C8   DA J -33      28.274  60.676  -6.367  1.00 74.65           C  
ATOM   3818  N7   DA J -33      27.761  60.259  -5.235  1.00 73.75           N  
ATOM   3819  C5   DA J -33      27.463  58.925  -5.476  1.00 74.88           C  
ATOM   3820  C6   DA J -33      26.905  57.916  -4.669  1.00 74.33           C  
ATOM   3821  N6   DA J -33      26.534  58.100  -3.401  1.00 75.12           N  
ATOM   3822  N1   DA J -33      26.741  56.694  -5.216  1.00 73.41           N  
ATOM   3823  C2   DA J -33      27.119  56.507  -6.483  1.00 74.94           C  
ATOM   3824  N3   DA J -33      27.657  57.370  -7.339  1.00 75.06           N  
ATOM   3825  C4   DA J -33      27.805  58.575  -6.767  1.00 75.11           C  
ATOM   3826  P    DA J -32      28.443  60.974 -12.655  1.00 89.81           P  
ATOM   3827  OP1  DA J -32      29.020  60.669 -13.990  1.00 89.81           O  
ATOM   3828  OP2  DA J -32      28.043  62.364 -12.329  1.00 89.89           O  
ATOM   3829  O5'  DA J -32      27.183  60.031 -12.432  1.00 88.91           O  
ATOM   3830  C5'  DA J -32      27.073  58.805 -13.139  1.00 91.67           C  
ATOM   3831  C4'  DA J -32      25.621  58.417 -13.274  1.00 93.28           C  
ATOM   3832  O4'  DA J -32      25.149  57.964 -11.983  1.00 92.66           O  
ATOM   3833  C3'  DA J -32      24.713  59.574 -13.686  1.00 94.58           C  
ATOM   3834  O3'  DA J -32      23.861  59.248 -14.797  1.00 96.27           O  
ATOM   3835  C2'  DA J -32      23.999  59.984 -12.410  1.00 92.78           C  
ATOM   3836  C1'  DA J -32      24.066  58.752 -11.520  1.00 92.08           C  
ATOM   3837  N9   DA J -32      24.314  59.060 -10.111  1.00 91.56           N  
ATOM   3838  C8   DA J -32      24.954  60.160  -9.593  1.00 91.43           C  
ATOM   3839  N7   DA J -32      25.010  60.173  -8.284  1.00 90.79           N  
ATOM   3840  C5   DA J -32      24.368  59.002  -7.913  1.00 90.58           C  
ATOM   3841  C6   DA J -32      24.087  58.437  -6.658  1.00 90.55           C  
ATOM   3842  N6   DA J -32      24.417  59.010  -5.498  1.00 90.45           N  
ATOM   3843  N1   DA J -32      23.436  57.253  -6.634  1.00 89.00           N  
ATOM   3844  C2   DA J -32      23.087  56.692  -7.798  1.00 89.78           C  
ATOM   3845  N3   DA J -32      23.284  57.130  -9.040  1.00 90.50           N  
ATOM   3846  C4   DA J -32      23.939  58.303  -9.028  1.00 91.16           C  
ATOM   3847  P    DA J -31      23.024  57.877 -14.814  1.00 97.78           P  
ATOM   3848  OP1  DA J -31      23.973  56.760 -15.057  1.00 97.65           O  
ATOM   3849  OP2  DA J -31      21.893  58.091 -15.751  1.00 98.62           O  
ATOM   3850  O5'  DA J -31      22.426  57.727 -13.347  1.00 97.20           O  
ATOM   3851  C5'  DA J -31      22.116  56.434 -12.828  1.00 94.78           C  
ATOM   3852  C4'  DA J -31      20.766  56.448 -12.151  1.00 92.68           C  
ATOM   3853  O4'  DA J -31      20.867  57.014 -10.822  1.00 91.54           O  
ATOM   3854  C3'  DA J -31      19.691  57.255 -12.880  1.00 92.06           C  
ATOM   3855  O3'  DA J -31      18.453  56.540 -12.850  1.00 93.18           O  
ATOM   3856  C2'  DA J -31      19.595  58.528 -12.058  1.00 90.90           C  
ATOM   3857  C1'  DA J -31      19.869  58.007 -10.661  1.00 89.51           C  
ATOM   3858  N9   DA J -31      20.367  59.001  -9.709  1.00 88.06           N  
ATOM   3859  C8   DA J -31      20.812  60.274  -9.959  1.00 86.27           C  
ATOM   3860  N7   DA J -31      21.177  60.926  -8.883  1.00 85.45           N  
ATOM   3861  C5   DA J -31      20.960  60.021  -7.854  1.00 85.33           C  
ATOM   3862  C6   DA J -31      21.146  60.105  -6.464  1.00 85.30           C  
ATOM   3863  N6   DA J -31      21.603  61.191  -5.840  1.00 86.09           N  
ATOM   3864  N1   DA J -31      20.839  59.021  -5.722  1.00 85.72           N  
ATOM   3865  C2   DA J -31      20.374  57.935  -6.343  1.00 86.57           C  
ATOM   3866  N3   DA J -31      20.151  57.735  -7.639  1.00 87.31           N  
ATOM   3867  C4   DA J -31      20.468  58.830  -8.349  1.00 86.80           C  
ATOM   3868  P    DC J -30      17.102  57.249 -13.356  1.00 92.43           P  
ATOM   3869  OP1  DC J -30      16.309  56.214 -14.062  1.00 93.37           O  
ATOM   3870  OP2  DC J -30      17.430  58.520 -14.050  1.00 91.99           O  
ATOM   3871  O5'  DC J -30      16.352  57.598 -11.997  1.00 93.67           O  
ATOM   3872  C5'  DC J -30      16.060  56.571 -11.052  1.00 93.24           C  
ATOM   3873  C4'  DC J -30      15.223  57.118  -9.921  1.00 93.24           C  
ATOM   3874  O4'  DC J -30      16.034  57.932  -9.039  1.00 93.32           O  
ATOM   3875  C3'  DC J -30      14.049  57.998 -10.353  1.00 93.28           C  
ATOM   3876  O3'  DC J -30      12.903  57.697  -9.553  1.00 94.10           O  
ATOM   3877  C2'  DC J -30      14.544  59.406 -10.071  1.00 92.98           C  
ATOM   3878  C1'  DC J -30      15.406  59.189  -8.841  1.00 91.99           C  
ATOM   3879  N1   DC J -30      16.458  60.199  -8.625  1.00 90.50           N  
ATOM   3880  C2   DC J -30      16.906  60.431  -7.319  1.00 89.31           C  
ATOM   3881  O2   DC J -30      16.404  59.782  -6.389  1.00 88.47           O  
ATOM   3882  N3   DC J -30      17.867  61.358  -7.103  1.00 88.92           N  
ATOM   3883  C4   DC J -30      18.375  62.043  -8.129  1.00 88.79           C  
ATOM   3884  N4   DC J -30      19.314  62.953  -7.870  1.00 87.67           N  
ATOM   3885  C5   DC J -30      17.939  61.826  -9.469  1.00 88.76           C  
ATOM   3886  C6   DC J -30      16.990  60.902  -9.670  1.00 89.47           C  
ATOM   3887  P    DT J -29      11.637  58.682  -9.574  1.00 94.81           P  
ATOM   3888  OP1  DT J -29      10.436  57.920  -9.144  1.00 94.07           O  
ATOM   3889  OP2  DT J -29      11.634  59.385 -10.884  1.00 95.66           O  
ATOM   3890  O5'  DT J -29      11.988  59.739  -8.436  1.00 94.94           O  
ATOM   3891  C5'  DT J -29      12.200  59.304  -7.095  1.00 92.44           C  
ATOM   3892  C4'  DT J -29      12.134  60.474  -6.142  1.00 90.09           C  
ATOM   3893  O4'  DT J -29      13.330  61.282  -6.236  1.00 88.49           O  
ATOM   3894  C3'  DT J -29      10.960  61.430  -6.359  1.00 89.25           C  
ATOM   3895  O3'  DT J -29      10.492  61.874  -5.087  1.00 90.80           O  
ATOM   3896  C2'  DT J -29      11.605  62.602  -7.076  1.00 87.47           C  
ATOM   3897  C1'  DT J -29      12.955  62.639  -6.389  1.00 86.77           C  
ATOM   3898  N1   DT J -29      14.032  63.332  -7.112  1.00 84.27           N  
ATOM   3899  C2   DT J -29      14.944  64.027  -6.359  1.00 81.90           C  
ATOM   3900  O2   DT J -29      14.891  64.086  -5.143  1.00 80.21           O  
ATOM   3901  N3   DT J -29      15.927  64.651  -7.084  1.00 81.58           N  
ATOM   3902  C4   DT J -29      16.085  64.645  -8.456  1.00 82.52           C  
ATOM   3903  O4   DT J -29      17.023  65.253  -8.969  1.00 81.10           O  
ATOM   3904  C5   DT J -29      15.089  63.892  -9.184  1.00 82.84           C  
ATOM   3905  C7   DT J -29      15.179  63.824 -10.675  1.00 83.95           C  
ATOM   3906  C6   DT J -29      14.125  63.283  -8.485  1.00 83.30           C  
ATOM   3907  P    DG J -28       8.923  62.068  -4.834  1.00 90.39           P  
ATOM   3908  OP1  DG J -28       8.322  60.718  -4.694  1.00 90.98           O  
ATOM   3909  OP2  DG J -28       8.401  63.006  -5.861  1.00 90.65           O  
ATOM   3910  O5'  DG J -28       8.875  62.801  -3.423  1.00 89.48           O  
ATOM   3911  C5'  DG J -28       9.590  62.272  -2.312  1.00 86.99           C  
ATOM   3912  C4'  DG J -28      10.259  63.384  -1.537  1.00 87.08           C  
ATOM   3913  O4'  DG J -28      11.292  64.002  -2.344  1.00 87.01           O  
ATOM   3914  C3'  DG J -28       9.339  64.516  -1.087  1.00 86.14           C  
ATOM   3915  O3'  DG J -28       9.704  64.910   0.240  1.00 85.84           O  
ATOM   3916  C2'  DG J -28       9.616  65.619  -2.095  1.00 85.61           C  
ATOM   3917  C1'  DG J -28      11.086  65.405  -2.412  1.00 86.40           C  
ATOM   3918  N9   DG J -28      11.533  65.853  -3.730  1.00 85.11           N  
ATOM   3919  C8   DG J -28      11.041  65.463  -4.952  1.00 85.56           C  
ATOM   3920  N7   DG J -28      11.694  65.983  -5.958  1.00 84.91           N  
ATOM   3921  C5   DG J -28      12.669  66.773  -5.365  1.00 84.80           C  
ATOM   3922  C6   DG J -28      13.697  67.567  -5.950  1.00 84.80           C  
ATOM   3923  O6   DG J -28      13.976  67.718  -7.146  1.00 83.50           O  
ATOM   3924  N1   DG J -28      14.452  68.216  -4.980  1.00 84.19           N  
ATOM   3925  C2   DG J -28      14.259  68.111  -3.627  1.00 83.80           C  
ATOM   3926  N2   DG J -28      15.090  68.827  -2.859  1.00 83.15           N  
ATOM   3927  N3   DG J -28      13.319  67.363  -3.069  1.00 84.38           N  
ATOM   3928  C4   DG J -28      12.567  66.726  -3.990  1.00 84.56           C  
ATOM   3929  P    DC J -27       8.720  65.849   1.098  1.00 87.04           P  
ATOM   3930  OP1  DC J -27       8.969  65.601   2.541  1.00 84.35           O  
ATOM   3931  OP2  DC J -27       7.346  65.713   0.555  1.00 86.11           O  
ATOM   3932  O5'  DC J -27       9.238  67.313   0.756  1.00 86.61           O  
ATOM   3933  C5'  DC J -27      10.541  67.723   1.158  1.00 83.78           C  
ATOM   3934  C4'  DC J -27      10.848  69.097   0.613  1.00 80.70           C  
ATOM   3935  O4'  DC J -27      11.243  69.045  -0.778  1.00 80.43           O  
ATOM   3936  C3'  DC J -27       9.691  70.096   0.682  1.00 78.40           C  
ATOM   3937  O3'  DC J -27      10.238  71.373   0.974  1.00 77.12           O  
ATOM   3938  C2'  DC J -27       9.196  70.134  -0.751  1.00 78.00           C  
ATOM   3939  C1'  DC J -27      10.531  70.064  -1.454  1.00 79.12           C  
ATOM   3940  N1   DC J -27      10.536  69.781  -2.895  1.00 78.55           N  
ATOM   3941  C2   DC J -27      11.475  70.448  -3.687  1.00 78.17           C  
ATOM   3942  O2   DC J -27      12.292  71.205  -3.135  1.00 78.19           O  
ATOM   3943  N3   DC J -27      11.475  70.251  -5.022  1.00 77.29           N  
ATOM   3944  C4   DC J -27      10.589  69.418  -5.572  1.00 77.79           C  
ATOM   3945  N4   DC J -27      10.613  69.269  -6.899  1.00 74.94           N  
ATOM   3946  C5   DC J -27       9.636  68.705  -4.785  1.00 76.66           C  
ATOM   3947  C6   DC J -27       9.646  68.913  -3.461  1.00 77.35           C  
ATOM   3948  P    DT J -26       9.668  72.224   2.200  1.00 76.56           P  
ATOM   3949  OP1  DT J -26       9.775  71.355   3.399  1.00 75.81           O  
ATOM   3950  OP2  DT J -26       8.356  72.807   1.817  1.00 76.51           O  
ATOM   3951  O5'  DT J -26      10.741  73.389   2.345  1.00 75.42           O  
ATOM   3952  C5'  DT J -26      12.087  73.072   2.679  1.00 70.80           C  
ATOM   3953  C4'  DT J -26      13.047  73.807   1.776  1.00 68.14           C  
ATOM   3954  O4'  DT J -26      12.802  73.441   0.398  1.00 67.65           O  
ATOM   3955  C3'  DT J -26      12.961  75.331   1.831  1.00 65.44           C  
ATOM   3956  O3'  DT J -26      14.285  75.867   1.838  1.00 63.95           O  
ATOM   3957  C2'  DT J -26      12.220  75.696   0.556  1.00 65.28           C  
ATOM   3958  C1'  DT J -26      12.675  74.605  -0.395  1.00 67.92           C  
ATOM   3959  N1   DT J -26      11.755  74.294  -1.508  1.00 69.05           N  
ATOM   3960  C2   DT J -26      12.227  74.418  -2.802  1.00 71.80           C  
ATOM   3961  O2   DT J -26      13.362  74.780  -3.076  1.00 70.93           O  
ATOM   3962  N3   DT J -26      11.313  74.094  -3.776  1.00 72.56           N  
ATOM   3963  C4   DT J -26      10.012  73.673  -3.594  1.00 70.85           C  
ATOM   3964  O4   DT J -26       9.314  73.417  -4.568  1.00 70.46           O  
ATOM   3965  C5   DT J -26       9.584  73.573  -2.221  1.00 71.52           C  
ATOM   3966  C7   DT J -26       8.183  73.130  -1.930  1.00 72.16           C  
ATOM   3967  C6   DT J -26      10.465  73.884  -1.258  1.00 70.03           C  
ATOM   3968  P    DC J -25      14.524  77.384   2.294  1.00 59.61           P  
ATOM   3969  OP1  DC J -25      15.872  77.487   2.889  1.00 61.55           O  
ATOM   3970  OP2  DC J -25      13.339  77.825   3.068  1.00 62.73           O  
ATOM   3971  O5'  DC J -25      14.487  78.183   0.923  1.00 55.04           O  
ATOM   3972  C5'  DC J -25      15.497  78.004  -0.058  1.00 49.66           C  
ATOM   3973  C4'  DC J -25      15.131  78.778  -1.297  1.00 47.88           C  
ATOM   3974  O4'  DC J -25      14.028  78.113  -1.962  1.00 47.08           O  
ATOM   3975  C3'  DC J -25      14.653  80.208  -0.998  1.00 47.55           C  
ATOM   3976  O3'  DC J -25      15.096  81.089  -2.027  1.00 42.64           O  
ATOM   3977  C2'  DC J -25      13.145  80.089  -1.095  1.00 49.08           C  
ATOM   3978  C1'  DC J -25      13.028  79.079  -2.228  1.00 50.50           C  
ATOM   3979  N1   DC J -25      11.737  78.389  -2.371  1.00 49.99           N  
ATOM   3980  C2   DC J -25      11.409  77.838  -3.618  1.00 50.68           C  
ATOM   3981  O2   DC J -25      12.212  77.947  -4.554  1.00 43.15           O  
ATOM   3982  N3   DC J -25      10.226  77.204  -3.770  1.00 51.25           N  
ATOM   3983  C4   DC J -25       9.383  77.114  -2.745  1.00 53.39           C  
ATOM   3984  N4   DC J -25       8.224  76.487  -2.949  1.00 60.06           N  
ATOM   3985  C5   DC J -25       9.687  77.662  -1.465  1.00 53.28           C  
ATOM   3986  C6   DC J -25      10.868  78.284  -1.322  1.00 53.09           C  
ATOM   3987  P    DC J -24      16.603  81.642  -2.001  1.00 41.21           P  
ATOM   3988  OP1  DC J -24      17.510  80.539  -1.618  1.00 34.34           O  
ATOM   3989  OP2  DC J -24      16.630  82.915  -1.230  1.00 40.23           O  
ATOM   3990  O5'  DC J -24      16.885  81.974  -3.523  1.00 41.49           O  
ATOM   3991  C5'  DC J -24      17.196  80.932  -4.435  1.00 38.27           C  
ATOM   3992  C4'  DC J -24      16.535  81.211  -5.761  1.00 41.63           C  
ATOM   3993  O4'  DC J -24      15.176  80.704  -5.764  1.00 42.05           O  
ATOM   3994  C3'  DC J -24      16.450  82.697  -6.104  1.00 37.23           C  
ATOM   3995  O3'  DC J -24      16.979  82.910  -7.403  1.00 31.61           O  
ATOM   3996  C2'  DC J -24      14.959  83.013  -6.021  1.00 42.27           C  
ATOM   3997  C1'  DC J -24      14.302  81.672  -6.310  1.00 42.86           C  
ATOM   3998  N1   DC J -24      12.977  81.461  -5.691  1.00 44.57           N  
ATOM   3999  C2   DC J -24      11.928  80.957  -6.483  1.00 42.09           C  
ATOM   4000  O2   DC J -24      12.132  80.744  -7.680  1.00 41.37           O  
ATOM   4001  N3   DC J -24      10.726  80.721  -5.915  1.00 41.26           N  
ATOM   4002  C4   DC J -24      10.538  80.966  -4.615  1.00 45.50           C  
ATOM   4003  N4   DC J -24       9.345  80.676  -4.084  1.00 45.30           N  
ATOM   4004  C5   DC J -24      11.576  81.510  -3.790  1.00 46.98           C  
ATOM   4005  C6   DC J -24      12.769  81.735  -4.365  1.00 45.11           C  
ATOM   4006  P    DA J -23      17.133  84.396  -7.961  1.00 34.45           P  
ATOM   4007  OP1  DA J -23      18.445  84.531  -8.642  1.00 34.71           O  
ATOM   4008  OP2  DA J -23      16.742  85.362  -6.910  1.00 37.21           O  
ATOM   4009  O5'  DA J -23      16.014  84.449  -9.098  1.00 42.20           O  
ATOM   4010  C5'  DA J -23      15.997  83.460 -10.132  1.00 43.64           C  
ATOM   4011  C4'  DA J -23      14.781  83.635 -11.012  1.00 48.36           C  
ATOM   4012  O4'  DA J -23      13.589  83.348 -10.250  1.00 50.29           O  
ATOM   4013  C3'  DA J -23      14.592  85.041 -11.568  1.00 52.04           C  
ATOM   4014  O3'  DA J -23      14.171  84.967 -12.925  1.00 58.19           O  
ATOM   4015  C2'  DA J -23      13.514  85.648 -10.683  1.00 48.97           C  
ATOM   4016  C1'  DA J -23      12.695  84.448 -10.284  1.00 48.03           C  
ATOM   4017  N9   DA J -23      12.069  84.528  -8.968  1.00 53.84           N  
ATOM   4018  C8   DA J -23      12.595  85.044  -7.813  1.00 55.11           C  
ATOM   4019  N7   DA J -23      11.813  84.909  -6.771  1.00 55.54           N  
ATOM   4020  C5   DA J -23      10.689  84.276  -7.277  1.00 53.46           C  
ATOM   4021  C6   DA J -23       9.501  83.852  -6.675  1.00 54.19           C  
ATOM   4022  N6   DA J -23       9.241  83.994  -5.374  1.00 52.95           N  
ATOM   4023  N1   DA J -23       8.577  83.263  -7.460  1.00 56.18           N  
ATOM   4024  C2   DA J -23       8.845  83.114  -8.761  1.00 57.27           C  
ATOM   4025  N3   DA J -23       9.928  83.470  -9.444  1.00 56.39           N  
ATOM   4026  C4   DA J -23      10.824  84.051  -8.631  1.00 54.67           C  
ATOM   4027  P    DT J -22      14.003  86.313 -13.772  1.00 59.19           P  
ATOM   4028  OP1  DT J -22      14.326  85.983 -15.176  1.00 64.29           O  
ATOM   4029  OP2  DT J -22      14.721  87.406 -13.086  1.00 63.92           O  
ATOM   4030  O5'  DT J -22      12.447  86.571 -13.649  1.00 61.53           O  
ATOM   4031  C5'  DT J -22      11.562  85.467 -13.692  1.00 63.98           C  
ATOM   4032  C4'  DT J -22      10.146  85.930 -13.478  1.00 65.12           C  
ATOM   4033  O4'  DT J -22       9.723  85.741 -12.108  1.00 63.88           O  
ATOM   4034  C3'  DT J -22       9.923  87.405 -13.806  1.00 66.99           C  
ATOM   4035  O3'  DT J -22       8.739  87.513 -14.578  1.00 75.29           O  
ATOM   4036  C2'  DT J -22       9.702  88.035 -12.443  1.00 65.29           C  
ATOM   4037  C1'  DT J -22       9.028  86.900 -11.703  1.00 61.77           C  
ATOM   4038  N1   DT J -22       9.046  86.963 -10.231  1.00 60.41           N  
ATOM   4039  C2   DT J -22       7.965  86.418  -9.573  1.00 59.40           C  
ATOM   4040  O2   DT J -22       7.063  85.839 -10.150  1.00 57.72           O  
ATOM   4041  N3   DT J -22       7.985  86.568  -8.210  1.00 56.76           N  
ATOM   4042  C4   DT J -22       8.964  87.179  -7.455  1.00 56.40           C  
ATOM   4043  O4   DT J -22       8.827  87.275  -6.242  1.00 54.41           O  
ATOM   4044  C5   DT J -22      10.096  87.680  -8.198  1.00 55.71           C  
ATOM   4045  C7   DT J -22      11.230  88.302  -7.448  1.00 55.10           C  
ATOM   4046  C6   DT J -22      10.081  87.557  -9.536  1.00 59.20           C  
ATOM   4047  P    DC J -21       8.476  88.822 -15.462  1.00 78.06           P  
ATOM   4048  OP1  DC J -21       8.601  88.431 -16.888  1.00 78.12           O  
ATOM   4049  OP2  DC J -21       9.281  89.953 -14.935  1.00 79.68           O  
ATOM   4050  O5'  DC J -21       6.948  89.090 -15.148  1.00 76.63           O  
ATOM   4051  C5'  DC J -21       6.025  88.012 -15.185  1.00 77.19           C  
ATOM   4052  C4'  DC J -21       4.737  88.422 -14.522  1.00 78.03           C  
ATOM   4053  O4'  DC J -21       4.832  88.214 -13.093  1.00 77.33           O  
ATOM   4054  C3'  DC J -21       4.417  89.900 -14.732  1.00 79.41           C  
ATOM   4055  O3'  DC J -21       3.048  90.075 -15.090  1.00 82.46           O  
ATOM   4056  C2'  DC J -21       4.744  90.537 -13.391  1.00 77.74           C  
ATOM   4057  C1'  DC J -21       4.497  89.405 -12.404  1.00 76.41           C  
ATOM   4058  N1   DC J -21       5.311  89.459 -11.174  1.00 74.09           N  
ATOM   4059  C2   DC J -21       4.819  88.848 -10.022  1.00 73.99           C  
ATOM   4060  O2   DC J -21       3.731  88.260 -10.076  1.00 76.66           O  
ATOM   4061  N3   DC J -21       5.540  88.910  -8.879  1.00 72.30           N  
ATOM   4062  C4   DC J -21       6.710  89.546  -8.865  1.00 70.87           C  
ATOM   4063  N4   DC J -21       7.383  89.591  -7.714  1.00 69.43           N  
ATOM   4064  C5   DC J -21       7.243  90.166 -10.029  1.00 70.58           C  
ATOM   4065  C6   DC J -21       6.519  90.099 -11.152  1.00 72.41           C  
ATOM   4066  P    DA J -20       2.433  91.551 -15.158  1.00 83.54           P  
ATOM   4067  OP1  DA J -20       1.298  91.535 -16.119  1.00 86.32           O  
ATOM   4068  OP2  DA J -20       3.553  92.503 -15.362  1.00 82.30           O  
ATOM   4069  O5'  DA J -20       1.855  91.743 -13.690  1.00 80.23           O  
ATOM   4070  C5'  DA J -20       1.059  90.723 -13.098  1.00 78.15           C  
ATOM   4071  C4'  DA J -20       0.267  91.295 -11.950  1.00 78.08           C  
ATOM   4072  O4'  DA J -20       0.982  91.148 -10.698  1.00 76.73           O  
ATOM   4073  C3'  DA J -20      -0.008  92.786 -12.123  1.00 78.61           C  
ATOM   4074  O3'  DA J -20      -1.365  93.083 -11.807  1.00 81.03           O  
ATOM   4075  C2'  DA J -20       0.951  93.447 -11.146  1.00 75.60           C  
ATOM   4076  C1'  DA J -20       1.086  92.405 -10.048  1.00 74.57           C  
ATOM   4077  N9   DA J -20       2.363  92.435  -9.328  1.00 72.36           N  
ATOM   4078  C8   DA J -20       3.616  92.638  -9.847  1.00 70.94           C  
ATOM   4079  N7   DA J -20       4.570  92.613  -8.952  1.00 69.41           N  
ATOM   4080  C5   DA J -20       3.902  92.376  -7.759  1.00 69.59           C  
ATOM   4081  C6   DA J -20       4.353  92.242  -6.431  1.00 69.31           C  
ATOM   4082  N6   DA J -20       5.633  92.339  -6.070  1.00 67.68           N  
ATOM   4083  N1   DA J -20       3.428  92.004  -5.475  1.00 70.70           N  
ATOM   4084  C2   DA J -20       2.142  91.917  -5.838  1.00 72.12           C  
ATOM   4085  N3   DA J -20       1.597  92.033  -7.050  1.00 72.37           N  
ATOM   4086  C4   DA J -20       2.543  92.263  -7.976  1.00 70.82           C  
ATOM   4087  P    DA J -19      -1.994  94.481 -12.274  1.00 81.53           P  
ATOM   4088  OP1  DA J -19      -3.373  94.220 -12.761  1.00 83.09           O  
ATOM   4089  OP2  DA J -19      -1.010  95.143 -13.168  1.00 81.38           O  
ATOM   4090  O5'  DA J -19      -2.075  95.296 -10.912  1.00 80.40           O  
ATOM   4091  C5'  DA J -19      -2.682  94.712  -9.765  1.00 79.17           C  
ATOM   4092  C4'  DA J -19      -2.449  95.580  -8.554  1.00 79.53           C  
ATOM   4093  O4'  DA J -19      -1.130  95.353  -7.997  1.00 78.16           O  
ATOM   4094  C3'  DA J -19      -2.537  97.072  -8.856  1.00 80.77           C  
ATOM   4095  O3'  DA J -19      -3.264  97.734  -7.827  1.00 84.99           O  
ATOM   4096  C2'  DA J -19      -1.087  97.520  -8.855  1.00 78.97           C  
ATOM   4097  C1'  DA J -19      -0.471  96.594  -7.821  1.00 76.27           C  
ATOM   4098  N9   DA J -19       0.971  96.375  -7.972  1.00 73.69           N  
ATOM   4099  C8   DA J -19       1.696  96.318  -9.136  1.00 70.05           C  
ATOM   4100  N7   DA J -19       2.977  96.125  -8.952  1.00 68.80           N  
ATOM   4101  C5   DA J -19       3.109  96.044  -7.572  1.00 67.95           C  
ATOM   4102  C6   DA J -19       4.225  95.842  -6.738  1.00 65.38           C  
ATOM   4103  N6   DA J -19       5.467  95.688  -7.189  1.00 62.67           N  
ATOM   4104  N1   DA J -19       4.017  95.808  -5.406  1.00 66.13           N  
ATOM   4105  C2   DA J -19       2.770  95.974  -4.952  1.00 67.55           C  
ATOM   4106  N3   DA J -19       1.643  96.173  -5.634  1.00 69.64           N  
ATOM   4107  C4   DA J -19       1.883  96.195  -6.956  1.00 70.12           C  
ATOM   4108  P    DA J -18      -3.762  99.241  -8.053  1.00 87.80           P  
ATOM   4109  OP1  DA J -18      -5.233  99.219  -8.246  1.00 89.90           O  
ATOM   4110  OP2  DA J -18      -2.893  99.879  -9.078  1.00 87.26           O  
ATOM   4111  O5'  DA J -18      -3.442  99.930  -6.658  1.00 84.92           O  
ATOM   4112  C5'  DA J -18      -3.343  99.151  -5.473  1.00 79.53           C  
ATOM   4113  C4'  DA J -18      -2.329  99.769  -4.543  1.00 77.78           C  
ATOM   4114  O4'  DA J -18      -0.982  99.337  -4.858  1.00 75.52           O  
ATOM   4115  C3'  DA J -18      -2.312 101.295  -4.602  1.00 76.64           C  
ATOM   4116  O3'  DA J -18      -2.244 101.818  -3.279  1.00 79.81           O  
ATOM   4117  C2'  DA J -18      -1.036 101.606  -5.370  1.00 74.12           C  
ATOM   4118  C1'  DA J -18      -0.135 100.474  -4.919  1.00 71.94           C  
ATOM   4119  N9   DA J -18       1.001 100.153  -5.788  1.00 66.58           N  
ATOM   4120  C8   DA J -18       1.037 100.052  -7.155  1.00 66.27           C  
ATOM   4121  N7   DA J -18       2.210  99.704  -7.631  1.00 62.28           N  
ATOM   4122  C5   DA J -18       3.003  99.576  -6.499  1.00 61.08           C  
ATOM   4123  C6   DA J -18       4.353  99.212  -6.322  1.00 58.54           C  
ATOM   4124  N6   DA J -18       5.169  98.891  -7.320  1.00 50.47           N  
ATOM   4125  N1   DA J -18       4.835  99.185  -5.061  1.00 57.71           N  
ATOM   4126  C2   DA J -18       4.010  99.493  -4.053  1.00 60.68           C  
ATOM   4127  N3   DA J -18       2.725  99.841  -4.092  1.00 60.02           N  
ATOM   4128  C4   DA J -18       2.276  99.862  -5.359  1.00 62.86           C  
ATOM   4129  P    DA J -17      -2.731 103.318  -2.998  1.00 78.49           P  
ATOM   4130  OP1  DA J -17      -3.698 103.281  -1.875  1.00 78.20           O  
ATOM   4131  OP2  DA J -17      -3.124 103.921  -4.298  1.00 79.04           O  
ATOM   4132  O5'  DA J -17      -1.401 104.044  -2.519  1.00 77.79           O  
ATOM   4133  C5'  DA J -17      -0.677 103.557  -1.396  1.00 74.77           C  
ATOM   4134  C4'  DA J -17       0.668 104.238  -1.316  1.00 72.05           C  
ATOM   4135  O4'  DA J -17       1.597 103.650  -2.256  1.00 69.99           O  
ATOM   4136  C3'  DA J -17       0.629 105.734  -1.637  1.00 70.09           C  
ATOM   4137  O3'  DA J -17       1.504 106.416  -0.754  1.00 69.18           O  
ATOM   4138  C2'  DA J -17       1.213 105.803  -3.034  1.00 68.42           C  
ATOM   4139  C1'  DA J -17       2.244 104.700  -2.946  1.00 68.95           C  
ATOM   4140  N9   DA J -17       2.732 104.180  -4.216  1.00 66.49           N  
ATOM   4141  C8   DA J -17       2.182 104.296  -5.465  1.00 67.30           C  
ATOM   4142  N7   DA J -17       2.893 103.733  -6.408  1.00 69.07           N  
ATOM   4143  C5   DA J -17       3.985 103.208  -5.732  1.00 65.90           C  
ATOM   4144  C6   DA J -17       5.109 102.494  -6.166  1.00 64.18           C  
ATOM   4145  N6   DA J -17       5.338 102.184  -7.439  1.00 62.70           N  
ATOM   4146  N1   DA J -17       6.007 102.108  -5.234  1.00 63.37           N  
ATOM   4147  C2   DA J -17       5.780 102.432  -3.955  1.00 66.01           C  
ATOM   4148  N3   DA J -17       4.763 103.106  -3.425  1.00 64.43           N  
ATOM   4149  C4   DA J -17       3.891 103.468  -4.380  1.00 65.75           C  
ATOM   4150  P    DG J -16       0.913 107.129   0.549  1.00 70.58           P  
ATOM   4151  OP1  DG J -16      -0.011 106.191   1.234  1.00 67.92           O  
ATOM   4152  OP2  DG J -16       0.438 108.473   0.125  1.00 69.17           O  
ATOM   4153  O5'  DG J -16       2.188 107.303   1.474  1.00 67.04           O  
ATOM   4154  C5'  DG J -16       2.931 106.171   1.900  1.00 62.65           C  
ATOM   4155  C4'  DG J -16       4.381 106.351   1.529  1.00 60.91           C  
ATOM   4156  O4'  DG J -16       4.602 106.069   0.125  1.00 57.20           O  
ATOM   4157  C3'  DG J -16       4.878 107.778   1.752  1.00 59.75           C  
ATOM   4158  O3'  DG J -16       6.234 107.707   2.145  1.00 60.78           O  
ATOM   4159  C2'  DG J -16       4.826 108.377   0.360  1.00 60.11           C  
ATOM   4160  C1'  DG J -16       5.253 107.181  -0.465  1.00 58.12           C  
ATOM   4161  N9   DG J -16       4.902 107.219  -1.877  1.00 58.76           N  
ATOM   4162  C8   DG J -16       3.833 107.850  -2.460  1.00 60.15           C  
ATOM   4163  N7   DG J -16       3.802 107.711  -3.757  1.00 62.41           N  
ATOM   4164  C5   DG J -16       4.921 106.941  -4.045  1.00 61.99           C  
ATOM   4165  C6   DG J -16       5.424 106.474  -5.288  1.00 61.68           C  
ATOM   4166  O6   DG J -16       4.968 106.662  -6.428  1.00 58.52           O  
ATOM   4167  N1   DG J -16       6.586 105.720  -5.116  1.00 61.58           N  
ATOM   4168  C2   DG J -16       7.187 105.458  -3.906  1.00 61.28           C  
ATOM   4169  N2   DG J -16       8.301 104.717  -3.935  1.00 58.74           N  
ATOM   4170  N3   DG J -16       6.728 105.895  -2.747  1.00 60.74           N  
ATOM   4171  C4   DG J -16       5.603 106.624  -2.890  1.00 61.07           C  
ATOM   4172  P    DG J -15       6.698 108.337   3.531  1.00 59.13           P  
ATOM   4173  OP1  DG J -15       5.902 107.740   4.620  1.00 60.90           O  
ATOM   4174  OP2  DG J -15       6.751 109.811   3.370  1.00 57.40           O  
ATOM   4175  O5'  DG J -15       8.169 107.755   3.650  1.00 55.76           O  
ATOM   4176  C5'  DG J -15       8.367 106.350   3.559  1.00 55.47           C  
ATOM   4177  C4'  DG J -15       9.548 106.041   2.675  1.00 50.71           C  
ATOM   4178  O4'  DG J -15       9.252 106.315   1.283  1.00 50.43           O  
ATOM   4179  C3'  DG J -15      10.770 106.866   3.030  1.00 50.24           C  
ATOM   4180  O3'  DG J -15      11.882 105.994   3.106  1.00 49.21           O  
ATOM   4181  C2'  DG J -15      10.854 107.922   1.934  1.00 49.22           C  
ATOM   4182  C1'  DG J -15      10.135 107.288   0.746  1.00 50.99           C  
ATOM   4183  N9   DG J -15       9.326 108.214  -0.046  1.00 53.82           N  
ATOM   4184  C8   DG J -15       8.475 109.178   0.442  1.00 56.35           C  
ATOM   4185  N7   DG J -15       7.857 109.842  -0.497  1.00 56.96           N  
ATOM   4186  C5   DG J -15       8.328 109.292  -1.682  1.00 56.49           C  
ATOM   4187  C6   DG J -15       8.000 109.598  -3.036  1.00 57.37           C  
ATOM   4188  O6   DG J -15       7.189 110.417  -3.467  1.00 55.82           O  
ATOM   4189  N1   DG J -15       8.721 108.814  -3.925  1.00 55.33           N  
ATOM   4190  C2   DG J -15       9.621 107.848  -3.573  1.00 53.36           C  
ATOM   4191  N2   DG J -15      10.218 107.220  -4.596  1.00 47.96           N  
ATOM   4192  N3   DG J -15       9.918 107.529  -2.316  1.00 52.67           N  
ATOM   4193  C4   DG J -15       9.243 108.291  -1.428  1.00 54.70           C  
ATOM   4194  P    DC J -14      13.352 106.593   3.060  1.00 46.92           P  
ATOM   4195  OP1  DC J -14      14.324 105.530   3.425  1.00 45.36           O  
ATOM   4196  OP2  DC J -14      13.433 107.933   3.695  1.00 43.77           O  
ATOM   4197  O5'  DC J -14      13.473 106.838   1.520  1.00 47.19           O  
ATOM   4198  C5'  DC J -14      14.334 107.771   1.053  1.00 40.03           C  
ATOM   4199  C4'  DC J -14      14.432 107.622  -0.432  1.00 41.29           C  
ATOM   4200  O4'  DC J -14      13.239 108.137  -1.087  1.00 40.08           O  
ATOM   4201  C3'  DC J -14      15.563 108.527  -0.843  1.00 37.63           C  
ATOM   4202  O3'  DC J -14      16.197 107.926  -1.937  1.00 35.15           O  
ATOM   4203  C2'  DC J -14      14.870 109.836  -1.152  1.00 39.39           C  
ATOM   4204  C1'  DC J -14      13.546 109.365  -1.723  1.00 39.13           C  
ATOM   4205  N1   DC J -14      12.435 110.309  -1.509  1.00 41.58           N  
ATOM   4206  C2   DC J -14      11.722 110.716  -2.629  1.00 43.75           C  
ATOM   4207  O2   DC J -14      12.026 110.218  -3.720  1.00 34.95           O  
ATOM   4208  N3   DC J -14      10.725 111.630  -2.494  1.00 44.12           N  
ATOM   4209  C4   DC J -14      10.419 112.114  -1.277  1.00 45.22           C  
ATOM   4210  N4   DC J -14       9.415 113.005  -1.184  1.00 41.68           N  
ATOM   4211  C5   DC J -14      11.124 111.699  -0.105  1.00 40.90           C  
ATOM   4212  C6   DC J -14      12.119 110.800  -0.267  1.00 42.94           C  
ATOM   4213  P    DA J -13      17.730 108.190  -2.161  1.00 30.33           P  
ATOM   4214  OP1  DA J -13      18.329 106.847  -1.989  1.00 29.12           O  
ATOM   4215  OP2  DA J -13      18.151 109.329  -1.302  1.00 28.45           O  
ATOM   4216  O5'  DA J -13      17.768 108.590  -3.698  1.00 30.78           O  
ATOM   4217  C5'  DA J -13      17.200 107.683  -4.648  1.00 32.36           C  
ATOM   4218  C4'  DA J -13      16.933 108.382  -5.959  1.00 30.31           C  
ATOM   4219  O4'  DA J -13      15.794 109.261  -5.843  1.00 31.85           O  
ATOM   4220  C3'  DA J -13      18.085 109.237  -6.447  1.00 32.32           C  
ATOM   4221  O3'  DA J -13      18.245 108.988  -7.834  1.00 32.58           O  
ATOM   4222  C2'  DA J -13      17.665 110.661  -6.120  1.00 31.69           C  
ATOM   4223  C1'  DA J -13      16.151 110.598  -6.138  1.00 32.19           C  
ATOM   4224  N9   DA J -13      15.484 111.442  -5.148  1.00 37.92           N  
ATOM   4225  C8   DA J -13      15.711 111.489  -3.794  1.00 41.74           C  
ATOM   4226  N7   DA J -13      14.908 112.298  -3.147  1.00 40.30           N  
ATOM   4227  C5   DA J -13      14.108 112.837  -4.143  1.00 45.30           C  
ATOM   4228  C6   DA J -13      13.042 113.751  -4.108  1.00 46.03           C  
ATOM   4229  N6   DA J -13      12.587 114.323  -2.985  1.00 43.41           N  
ATOM   4230  N1   DA J -13      12.449 114.064  -5.281  1.00 47.47           N  
ATOM   4231  C2   DA J -13      12.910 113.499  -6.409  1.00 45.04           C  
ATOM   4232  N3   DA J -13      13.901 112.631  -6.571  1.00 43.56           N  
ATOM   4233  C4   DA J -13      14.464 112.330  -5.386  1.00 44.11           C  
ATOM   4234  P    DT J -12      19.389 109.719  -8.651  1.00 32.76           P  
ATOM   4235  OP1  DT J -12      19.595 108.769  -9.793  1.00 34.83           O  
ATOM   4236  OP2  DT J -12      20.555 110.170  -7.841  1.00 36.08           O  
ATOM   4237  O5'  DT J -12      18.628 111.001  -9.177  1.00 33.53           O  
ATOM   4238  C5'  DT J -12      17.419 110.812  -9.877  1.00 33.42           C  
ATOM   4239  C4'  DT J -12      16.864 112.134 -10.332  1.00 34.88           C  
ATOM   4240  O4'  DT J -12      16.225 112.840  -9.248  1.00 35.72           O  
ATOM   4241  C3'  DT J -12      17.882 113.086 -10.941  1.00 35.93           C  
ATOM   4242  O3'  DT J -12      17.372 113.441 -12.220  1.00 40.36           O  
ATOM   4243  C2'  DT J -12      17.921 114.268  -9.977  1.00 30.92           C  
ATOM   4244  C1'  DT J -12      16.559 114.212  -9.307  1.00 33.47           C  
ATOM   4245  N1   DT J -12      16.440 114.733  -7.924  1.00 39.91           N  
ATOM   4246  C2   DT J -12      15.395 115.584  -7.661  1.00 43.37           C  
ATOM   4247  O2   DT J -12      14.658 116.019  -8.532  1.00 43.41           O  
ATOM   4248  N3   DT J -12      15.238 115.911  -6.335  1.00 43.70           N  
ATOM   4249  C4   DT J -12      16.017 115.493  -5.273  1.00 43.23           C  
ATOM   4250  O4   DT J -12      15.691 115.791  -4.112  1.00 40.24           O  
ATOM   4251  C5   DT J -12      17.164 114.683  -5.641  1.00 39.77           C  
ATOM   4252  C7   DT J -12      18.144 114.281  -4.577  1.00 41.24           C  
ATOM   4253  C6   DT J -12      17.306 114.339  -6.926  1.00 39.70           C  
ATOM   4254  P    DG J -11      18.344 114.043 -13.324  1.00 40.86           P  
ATOM   4255  OP1  DG J -11      17.708 113.596 -14.592  1.00 47.65           O  
ATOM   4256  OP2  DG J -11      19.752 113.731 -13.049  1.00 39.72           O  
ATOM   4257  O5'  DG J -11      18.114 115.612 -13.176  1.00 42.26           O  
ATOM   4258  C5'  DG J -11      16.797 116.133 -13.310  1.00 43.03           C  
ATOM   4259  C4'  DG J -11      16.729 117.559 -12.818  1.00 44.67           C  
ATOM   4260  O4'  DG J -11      16.616 117.622 -11.377  1.00 41.83           O  
ATOM   4261  C3'  DG J -11      17.893 118.472 -13.202  1.00 46.38           C  
ATOM   4262  O3'  DG J -11      17.363 119.673 -13.756  1.00 48.77           O  
ATOM   4263  C2'  DG J -11      18.556 118.782 -11.869  1.00 46.94           C  
ATOM   4264  C1'  DG J -11      17.384 118.711 -10.914  1.00 45.22           C  
ATOM   4265  N9   DG J -11      17.734 118.442  -9.527  1.00 44.61           N  
ATOM   4266  C8   DG J -11      18.697 117.574  -9.082  1.00 42.62           C  
ATOM   4267  N7   DG J -11      18.747 117.487  -7.785  1.00 41.77           N  
ATOM   4268  C5   DG J -11      17.770 118.365  -7.340  1.00 42.80           C  
ATOM   4269  C6   DG J -11      17.356 118.685  -6.022  1.00 45.82           C  
ATOM   4270  O6   DG J -11      17.754 118.214  -4.960  1.00 39.42           O  
ATOM   4271  N1   DG J -11      16.348 119.647  -6.017  1.00 48.52           N  
ATOM   4272  C2   DG J -11      15.789 120.206  -7.136  1.00 46.64           C  
ATOM   4273  N2   DG J -11      14.824 121.103  -6.909  1.00 47.82           N  
ATOM   4274  N3   DG J -11      16.152 119.900  -8.379  1.00 41.65           N  
ATOM   4275  C4   DG J -11      17.145 118.980  -8.403  1.00 45.19           C  
ATOM   4276  P    DT J -10      18.348 120.813 -14.295  1.00 52.58           P  
ATOM   4277  OP1  DT J -10      17.843 121.181 -15.643  1.00 52.97           O  
ATOM   4278  OP2  DT J -10      19.763 120.422 -14.121  1.00 47.34           O  
ATOM   4279  O5'  DT J -10      18.040 122.018 -13.302  1.00 53.25           O  
ATOM   4280  C5'  DT J -10      16.696 122.267 -12.898  1.00 56.63           C  
ATOM   4281  C4'  DT J -10      16.637 123.379 -11.879  1.00 58.42           C  
ATOM   4282  O4'  DT J -10      16.789 122.885 -10.524  1.00 60.34           O  
ATOM   4283  C3'  DT J -10      17.669 124.487 -12.062  1.00 58.19           C  
ATOM   4284  O3'  DT J -10      17.019 125.748 -12.007  1.00 62.39           O  
ATOM   4285  C2'  DT J -10      18.592 124.322 -10.867  1.00 57.94           C  
ATOM   4286  C1'  DT J -10      17.683 123.719  -9.808  1.00 57.44           C  
ATOM   4287  N1   DT J -10      18.384 122.873  -8.818  1.00 57.65           N  
ATOM   4288  C2   DT J -10      18.053 122.986  -7.479  1.00 58.83           C  
ATOM   4289  O2   DT J -10      17.209 123.755  -7.056  1.00 59.95           O  
ATOM   4290  N3   DT J -10      18.757 122.154  -6.643  1.00 56.01           N  
ATOM   4291  C4   DT J -10      19.738 121.252  -6.995  1.00 54.77           C  
ATOM   4292  O4   DT J -10      20.281 120.576  -6.126  1.00 50.13           O  
ATOM   4293  C5   DT J -10      20.038 121.191  -8.418  1.00 53.51           C  
ATOM   4294  C7   DT J -10      21.093 120.249  -8.904  1.00 52.34           C  
ATOM   4295  C6   DT J -10      19.352 121.989  -9.240  1.00 53.19           C  
ATOM   4296  P    DT J  -9      17.850 127.075 -12.317  1.00 65.40           P  
ATOM   4297  OP1  DT J  -9      17.118 127.826 -13.362  1.00 63.47           O  
ATOM   4298  OP2  DT J  -9      19.271 126.705 -12.530  1.00 65.37           O  
ATOM   4299  O5'  DT J  -9      17.789 127.862 -10.936  1.00 62.33           O  
ATOM   4300  C5'  DT J  -9      16.580 127.924 -10.194  1.00 58.23           C  
ATOM   4301  C4'  DT J  -9      16.842 128.528  -8.838  1.00 56.52           C  
ATOM   4302  O4'  DT J  -9      17.427 127.552  -7.939  1.00 52.66           O  
ATOM   4303  C3'  DT J  -9      17.810 129.706  -8.880  1.00 54.64           C  
ATOM   4304  O3'  DT J  -9      17.325 130.734  -8.024  1.00 55.27           O  
ATOM   4305  C2'  DT J  -9      19.115 129.121  -8.362  1.00 50.22           C  
ATOM   4306  C1'  DT J  -9      18.642 128.052  -7.394  1.00 49.01           C  
ATOM   4307  N1   DT J  -9      19.559 126.898  -7.209  1.00 46.16           N  
ATOM   4308  C2   DT J  -9      19.775 126.440  -5.921  1.00 45.96           C  
ATOM   4309  O2   DT J  -9      19.295 126.972  -4.934  1.00 39.52           O  
ATOM   4310  N3   DT J  -9      20.578 125.321  -5.834  1.00 41.66           N  
ATOM   4311  C4   DT J  -9      21.173 124.638  -6.874  1.00 44.71           C  
ATOM   4312  O4   DT J  -9      21.816 123.617  -6.648  1.00 41.94           O  
ATOM   4313  C5   DT J  -9      20.952 125.204  -8.191  1.00 45.69           C  
ATOM   4314  C7   DT J  -9      21.621 124.570  -9.370  1.00 41.12           C  
ATOM   4315  C6   DT J  -9      20.161 126.286  -8.291  1.00 44.16           C  
ATOM   4316  P    DC J  -8      17.943 132.207  -8.122  1.00 56.30           P  
ATOM   4317  OP1  DC J  -8      16.811 133.144  -7.936  1.00 60.43           O  
ATOM   4318  OP2  DC J  -8      18.820 132.330  -9.311  1.00 51.93           O  
ATOM   4319  O5'  DC J  -8      18.862 132.284  -6.833  1.00 55.89           O  
ATOM   4320  C5'  DC J  -8      18.347 131.871  -5.581  1.00 53.87           C  
ATOM   4321  C4'  DC J  -8      19.466 131.724  -4.583  1.00 55.04           C  
ATOM   4322  O4'  DC J  -8      20.136 130.446  -4.713  1.00 53.44           O  
ATOM   4323  C3'  DC J  -8      20.548 132.795  -4.701  1.00 52.89           C  
ATOM   4324  O3'  DC J  -8      20.729 133.410  -3.438  1.00 52.95           O  
ATOM   4325  C2'  DC J  -8      21.796 132.022  -5.111  1.00 54.31           C  
ATOM   4326  C1'  DC J  -8      21.527 130.640  -4.548  1.00 51.26           C  
ATOM   4327  N1   DC J  -8      22.221 129.516  -5.204  1.00 50.04           N  
ATOM   4328  C2   DC J  -8      22.695 128.455  -4.401  1.00 48.59           C  
ATOM   4329  O2   DC J  -8      22.538 128.517  -3.173  1.00 41.69           O  
ATOM   4330  N3   DC J  -8      23.306 127.395  -4.991  1.00 43.41           N  
ATOM   4331  C4   DC J  -8      23.457 127.366  -6.317  1.00 48.44           C  
ATOM   4332  N4   DC J  -8      24.052 126.300  -6.853  1.00 44.53           N  
ATOM   4333  C5   DC J  -8      22.999 128.437  -7.155  1.00 47.66           C  
ATOM   4334  C6   DC J  -8      22.395 129.482  -6.560  1.00 47.89           C  
ATOM   4335  P    DA J  -7      21.522 134.790  -3.344  1.00 50.03           P  
ATOM   4336  OP1  DA J  -7      20.644 135.742  -2.645  1.00 51.15           O  
ATOM   4337  OP2  DA J  -7      22.059 135.116  -4.692  1.00 48.39           O  
ATOM   4338  O5'  DA J  -7      22.752 134.435  -2.392  1.00 48.98           O  
ATOM   4339  C5'  DA J  -7      22.539 133.672  -1.210  1.00 46.87           C  
ATOM   4340  C4'  DA J  -7      23.827 133.017  -0.769  1.00 48.57           C  
ATOM   4341  O4'  DA J  -7      24.188 131.943  -1.665  1.00 46.02           O  
ATOM   4342  C3'  DA J  -7      25.035 133.950  -0.733  1.00 47.41           C  
ATOM   4343  O3'  DA J  -7      25.865 133.563   0.351  1.00 51.20           O  
ATOM   4344  C2'  DA J  -7      25.764 133.612  -2.013  1.00 48.59           C  
ATOM   4345  C1'  DA J  -7      25.530 132.122  -2.056  1.00 46.55           C  
ATOM   4346  N9   DA J  -7      25.710 131.486  -3.351  1.00 49.42           N  
ATOM   4347  C8   DA J  -7      25.604 132.011  -4.612  1.00 49.71           C  
ATOM   4348  N7   DA J  -7      25.868 131.146  -5.568  1.00 52.78           N  
ATOM   4349  C5   DA J  -7      26.162 129.974  -4.884  1.00 50.45           C  
ATOM   4350  C6   DA J  -7      26.519 128.694  -5.320  1.00 51.77           C  
ATOM   4351  N6   DA J  -7      26.651 128.363  -6.607  1.00 48.74           N  
ATOM   4352  N1   DA J  -7      26.738 127.748  -4.377  1.00 52.02           N  
ATOM   4353  C2   DA J  -7      26.594 128.083  -3.084  1.00 52.83           C  
ATOM   4354  N3   DA J  -7      26.259 129.256  -2.550  1.00 46.94           N  
ATOM   4355  C4   DA J  -7      26.059 130.167  -3.517  1.00 51.27           C  
ATOM   4356  P    DG J  -6      25.848 134.418   1.702  1.00 47.88           P  
ATOM   4357  OP1  DG J  -6      24.440 134.698   2.067  1.00 45.43           O  
ATOM   4358  OP2  DG J  -6      26.807 135.524   1.514  1.00 49.02           O  
ATOM   4359  O5'  DG J  -6      26.432 133.403   2.782  1.00 46.48           O  
ATOM   4360  C5'  DG J  -6      25.675 132.271   3.192  1.00 42.97           C  
ATOM   4361  C4'  DG J  -6      26.597 131.104   3.468  1.00 43.03           C  
ATOM   4362  O4'  DG J  -6      27.119 130.575   2.225  1.00 40.68           O  
ATOM   4363  C3'  DG J  -6      27.809 131.455   4.324  1.00 38.35           C  
ATOM   4364  O3'  DG J  -6      28.061 130.390   5.230  1.00 40.55           O  
ATOM   4365  C2'  DG J  -6      28.928 131.640   3.311  1.00 40.38           C  
ATOM   4366  C1'  DG J  -6      28.539 130.687   2.189  1.00 40.59           C  
ATOM   4367  N9   DG J  -6      28.895 131.114   0.841  1.00 42.83           N  
ATOM   4368  C8   DG J  -6      28.796 132.384   0.313  1.00 44.19           C  
ATOM   4369  N7   DG J  -6      29.078 132.430  -0.965  1.00 43.99           N  
ATOM   4370  C5   DG J  -6      29.399 131.120  -1.298  1.00 42.70           C  
ATOM   4371  C6   DG J  -6      29.755 130.552  -2.542  1.00 47.51           C  
ATOM   4372  O6   DG J  -6      29.817 131.096  -3.653  1.00 44.88           O  
ATOM   4373  N1   DG J  -6      30.038 129.192  -2.423  1.00 46.50           N  
ATOM   4374  C2   DG J  -6      29.966 128.472  -1.258  1.00 45.72           C  
ATOM   4375  N2   DG J  -6      30.289 127.184  -1.347  1.00 42.41           N  
ATOM   4376  N3   DG J  -6      29.607 128.982  -0.094  1.00 45.18           N  
ATOM   4377  C4   DG J  -6      29.337 130.303  -0.186  1.00 46.21           C  
ATOM   4378  P    DC J  -5      29.245 130.517   6.315  1.00 41.29           P  
ATOM   4379  OP1  DC J  -5      28.887 129.628   7.434  1.00 37.99           O  
ATOM   4380  OP2  DC J  -5      29.565 131.939   6.580  1.00 42.62           O  
ATOM   4381  O5'  DC J  -5      30.491 129.898   5.552  1.00 40.63           O  
ATOM   4382  C5'  DC J  -5      30.403 128.600   4.987  1.00 42.18           C  
ATOM   4383  C4'  DC J  -5      31.659 128.292   4.212  1.00 42.80           C  
ATOM   4384  O4'  DC J  -5      31.663 129.021   2.966  1.00 42.92           O  
ATOM   4385  C3'  DC J  -5      32.956 128.669   4.924  1.00 42.89           C  
ATOM   4386  O3'  DC J  -5      33.923 127.679   4.599  1.00 42.43           O  
ATOM   4387  C2'  DC J  -5      33.339 129.971   4.242  1.00 43.18           C  
ATOM   4388  C1'  DC J  -5      32.910 129.653   2.823  1.00 45.40           C  
ATOM   4389  N1   DC J  -5      32.746 130.762   1.876  1.00 48.10           N  
ATOM   4390  C2   DC J  -5      32.935 130.503   0.512  1.00 49.92           C  
ATOM   4391  O2   DC J  -5      33.285 129.360   0.146  1.00 42.77           O  
ATOM   4392  N3   DC J  -5      32.745 131.498  -0.374  1.00 48.74           N  
ATOM   4393  C4   DC J  -5      32.405 132.711   0.048  1.00 50.01           C  
ATOM   4394  N4   DC J  -5      32.227 133.661  -0.880  1.00 53.15           N  
ATOM   4395  C5   DC J  -5      32.232 133.010   1.428  1.00 49.22           C  
ATOM   4396  C6   DC J  -5      32.405 132.016   2.299  1.00 50.39           C  
ATOM   4397  P    DT J  -4      34.384 126.605   5.696  1.00 44.32           P  
ATOM   4398  OP1  DT J  -4      33.181 125.927   6.246  1.00 43.64           O  
ATOM   4399  OP2  DT J  -4      35.361 127.218   6.617  1.00 41.91           O  
ATOM   4400  O5'  DT J  -4      35.161 125.545   4.801  1.00 40.27           O  
ATOM   4401  C5'  DT J  -4      34.452 124.809   3.821  1.00 36.34           C  
ATOM   4402  C4'  DT J  -4      35.236 124.785   2.535  1.00 39.58           C  
ATOM   4403  O4'  DT J  -4      35.115 126.009   1.749  1.00 39.69           O  
ATOM   4404  C3'  DT J  -4      36.724 124.555   2.766  1.00 35.35           C  
ATOM   4405  O3'  DT J  -4      37.085 123.458   1.975  1.00 34.07           O  
ATOM   4406  C2'  DT J  -4      37.382 125.833   2.269  1.00 41.22           C  
ATOM   4407  C1'  DT J  -4      36.393 126.378   1.240  1.00 42.20           C  
ATOM   4408  N1   DT J  -4      36.422 127.870   1.085  1.00 40.29           N  
ATOM   4409  C2   DT J  -4      36.325 128.442  -0.182  1.00 41.03           C  
ATOM   4410  O2   DT J  -4      36.245 127.803  -1.208  1.00 39.44           O  
ATOM   4411  N3   DT J  -4      36.319 129.822  -0.194  1.00 43.18           N  
ATOM   4412  C4   DT J  -4      36.397 130.666   0.900  1.00 44.05           C  
ATOM   4413  O4   DT J  -4      36.337 131.880   0.738  1.00 47.67           O  
ATOM   4414  C5   DT J  -4      36.534 130.008   2.181  1.00 42.51           C  
ATOM   4415  C7   DT J  -4      36.674 130.845   3.412  1.00 41.87           C  
ATOM   4416  C6   DT J  -4      36.535 128.662   2.208  1.00 41.95           C  
ATOM   4417  P    DG J  -3      38.520 122.785   2.134  1.00 31.94           P  
ATOM   4418  OP1  DG J  -3      38.208 121.322   2.239  1.00 34.64           O  
ATOM   4419  OP2  DG J  -3      39.331 123.423   3.165  1.00 32.17           O  
ATOM   4420  O5'  DG J  -3      39.140 123.082   0.707  1.00 29.82           O  
ATOM   4421  C5'  DG J  -3      38.391 122.738  -0.441  1.00 29.41           C  
ATOM   4422  C4'  DG J  -3      39.062 123.269  -1.681  1.00 37.44           C  
ATOM   4423  O4'  DG J  -3      39.044 124.708  -1.664  1.00 39.47           O  
ATOM   4424  C3'  DG J  -3      40.521 122.875  -1.859  1.00 38.03           C  
ATOM   4425  O3'  DG J  -3      40.713 122.712  -3.258  1.00 42.44           O  
ATOM   4426  C2'  DG J  -3      41.277 124.066  -1.297  1.00 38.74           C  
ATOM   4427  C1'  DG J  -3      40.361 125.230  -1.639  1.00 40.26           C  
ATOM   4428  N9   DG J  -3      40.352 126.340  -0.692  1.00 41.15           N  
ATOM   4429  C8   DG J  -3      40.475 126.291   0.672  1.00 39.34           C  
ATOM   4430  N7   DG J  -3      40.347 127.455   1.239  1.00 41.05           N  
ATOM   4431  C5   DG J  -3      40.139 128.328   0.177  1.00 45.10           C  
ATOM   4432  C6   DG J  -3      39.908 129.722   0.168  1.00 44.16           C  
ATOM   4433  O6   DG J  -3      39.796 130.475   1.127  1.00 44.45           O  
ATOM   4434  N1   DG J  -3      39.782 130.215  -1.127  1.00 43.53           N  
ATOM   4435  C2   DG J  -3      39.846 129.450  -2.268  1.00 46.68           C  
ATOM   4436  N2   DG J  -3      39.714 130.094  -3.445  1.00 44.64           N  
ATOM   4437  N3   DG J  -3      40.027 128.145  -2.267  1.00 43.20           N  
ATOM   4438  C4   DG J  -3      40.167 127.656  -1.019  1.00 44.60           C  
ATOM   4439  P    DA J  -2      42.132 122.258  -3.831  1.00 45.50           P  
ATOM   4440  OP1  DA J  -2      41.874 121.352  -4.970  1.00 40.85           O  
ATOM   4441  OP2  DA J  -2      43.010 121.842  -2.711  1.00 47.21           O  
ATOM   4442  O5'  DA J  -2      42.719 123.620  -4.400  1.00 48.20           O  
ATOM   4443  C5'  DA J  -2      41.971 124.384  -5.333  1.00 50.17           C  
ATOM   4444  C4'  DA J  -2      42.734 125.638  -5.677  1.00 56.90           C  
ATOM   4445  O4'  DA J  -2      42.567 126.638  -4.641  1.00 57.67           O  
ATOM   4446  C3'  DA J  -2      44.237 125.392  -5.790  1.00 58.80           C  
ATOM   4447  O3'  DA J  -2      44.753 126.125  -6.899  1.00 64.08           O  
ATOM   4448  C2'  DA J  -2      44.780 125.929  -4.477  1.00 55.54           C  
ATOM   4449  C1'  DA J  -2      43.839 127.082  -4.221  1.00 55.25           C  
ATOM   4450  N9   DA J  -2      43.734 127.531  -2.836  1.00 52.48           N  
ATOM   4451  C8   DA J  -2      43.912 126.820  -1.679  1.00 53.67           C  
ATOM   4452  N7   DA J  -2      43.785 127.542  -0.590  1.00 51.39           N  
ATOM   4453  C5   DA J  -2      43.487 128.811  -1.065  1.00 51.35           C  
ATOM   4454  C6   DA J  -2      43.235 130.030  -0.413  1.00 49.92           C  
ATOM   4455  N6   DA J  -2      43.225 130.170   0.914  1.00 49.14           N  
ATOM   4456  N1   DA J  -2      42.989 131.114  -1.181  1.00 52.54           N  
ATOM   4457  C2   DA J  -2      42.984 130.969  -2.518  1.00 54.25           C  
ATOM   4458  N3   DA J  -2      43.195 129.874  -3.245  1.00 51.50           N  
ATOM   4459  C4   DA J  -2      43.447 128.818  -2.446  1.00 52.68           C  
ATOM   4460  P    DA J  -1      46.292 125.951  -7.332  1.00 65.21           P  
ATOM   4461  OP1  DA J  -1      46.262 125.328  -8.678  1.00 65.43           O  
ATOM   4462  OP2  DA J  -1      47.095 125.331  -6.247  1.00 61.99           O  
ATOM   4463  O5'  DA J  -1      46.772 127.461  -7.435  1.00 61.79           O  
ATOM   4464  C5'  DA J  -1      45.843 128.471  -7.794  1.00 60.36           C  
ATOM   4465  C4'  DA J  -1      46.319 129.816  -7.310  1.00 60.12           C  
ATOM   4466  O4'  DA J  -1      45.921 130.059  -5.939  1.00 59.10           O  
ATOM   4467  C3'  DA J  -1      47.834 129.995  -7.369  1.00 61.25           C  
ATOM   4468  O3'  DA J  -1      48.141 131.185  -8.082  1.00 67.24           O  
ATOM   4469  C2'  DA J  -1      48.255 130.092  -5.909  1.00 59.07           C  
ATOM   4470  C1'  DA J  -1      47.006 130.614  -5.219  1.00 58.41           C  
ATOM   4471  N9   DA J  -1      46.876 130.203  -3.821  1.00 58.82           N  
ATOM   4472  C8   DA J  -1      46.991 128.935  -3.314  1.00 58.69           C  
ATOM   4473  N7   DA J  -1      46.852 128.868  -2.013  1.00 57.44           N  
ATOM   4474  C5   DA J  -1      46.617 130.177  -1.635  1.00 57.19           C  
ATOM   4475  C6   DA J  -1      46.387 130.770  -0.385  1.00 56.74           C  
ATOM   4476  N6   DA J  -1      46.352 130.092   0.764  1.00 52.72           N  
ATOM   4477  N1   DA J  -1      46.196 132.110  -0.353  1.00 59.85           N  
ATOM   4478  C2   DA J  -1      46.236 132.790  -1.505  1.00 58.57           C  
ATOM   4479  N3   DA J  -1      46.444 132.343  -2.738  1.00 59.15           N  
ATOM   4480  C4   DA J  -1      46.629 131.014  -2.738  1.00 58.92           C  
ATOM   4481  P    DT J   0      49.658 131.517  -8.456  1.00 69.05           P  
ATOM   4482  OP1  DT J   0      49.636 132.129  -9.806  1.00 72.63           O  
ATOM   4483  OP2  DT J   0      50.528 130.344  -8.188  1.00 69.51           O  
ATOM   4484  O5'  DT J   0      50.021 132.625  -7.386  1.00 68.49           O  
ATOM   4485  C5'  DT J   0      49.089 133.644  -7.077  1.00 65.23           C  
ATOM   4486  C4'  DT J   0      49.648 134.525  -5.992  1.00 66.17           C  
ATOM   4487  O4'  DT J   0      49.292 134.018  -4.685  1.00 64.36           O  
ATOM   4488  C3'  DT J   0      51.170 134.634  -6.023  1.00 65.34           C  
ATOM   4489  O3'  DT J   0      51.543 136.003  -5.899  1.00 69.18           O  
ATOM   4490  C2'  DT J   0      51.613 133.815  -4.820  1.00 64.03           C  
ATOM   4491  C1'  DT J   0      50.442 133.972  -3.864  1.00 64.39           C  
ATOM   4492  N1   DT J   0      50.246 132.891  -2.864  1.00 60.11           N  
ATOM   4493  C2   DT J   0      49.979 133.268  -1.573  1.00 59.69           C  
ATOM   4494  O2   DT J   0      49.937 134.429  -1.217  1.00 60.87           O  
ATOM   4495  N3   DT J   0      49.764 132.233  -0.703  1.00 60.15           N  
ATOM   4496  C4   DT J   0      49.793 130.886  -0.984  1.00 60.14           C  
ATOM   4497  O4   DT J   0      49.541 130.071  -0.101  1.00 60.51           O  
ATOM   4498  C5   DT J   0      50.116 130.551  -2.349  1.00 60.21           C  
ATOM   4499  C7   DT J   0      50.212 129.107  -2.734  1.00 57.49           C  
ATOM   4500  C6   DT J   0      50.318 131.560  -3.215  1.00 61.03           C  
ATOM   4501  P    DT J   1      53.081 136.432  -6.053  1.00 73.07           P  
ATOM   4502  OP1  DT J   1      53.111 137.645  -6.904  1.00 73.18           O  
ATOM   4503  OP2  DT J   1      53.889 135.241  -6.436  1.00 70.95           O  
ATOM   4504  O5'  DT J   1      53.448 136.833  -4.563  1.00 69.44           O  
ATOM   4505  C5'  DT J   1      52.515 137.563  -3.782  1.00 69.06           C  
ATOM   4506  C4'  DT J   1      53.022 137.704  -2.371  1.00 70.58           C  
ATOM   4507  O4'  DT J   1      52.626 136.585  -1.547  1.00 68.57           O  
ATOM   4508  C3'  DT J   1      54.542 137.788  -2.282  1.00 72.14           C  
ATOM   4509  O3'  DT J   1      54.897 138.835  -1.390  1.00 76.51           O  
ATOM   4510  C2'  DT J   1      54.942 136.436  -1.716  1.00 68.87           C  
ATOM   4511  C1'  DT J   1      53.750 136.093  -0.846  1.00 65.70           C  
ATOM   4512  N1   DT J   1      53.532 134.653  -0.606  1.00 62.23           N  
ATOM   4513  C2   DT J   1      53.171 134.262   0.663  1.00 61.63           C  
ATOM   4514  O2   DT J   1      53.047 135.044   1.593  1.00 60.99           O  
ATOM   4515  N3   DT J   1      52.956 132.914   0.806  1.00 59.94           N  
ATOM   4516  C4   DT J   1      53.062 131.943  -0.170  1.00 59.02           C  
ATOM   4517  O4   DT J   1      52.812 130.775   0.102  1.00 58.58           O  
ATOM   4518  C5   DT J   1      53.463 132.420  -1.471  1.00 58.16           C  
ATOM   4519  C7   DT J   1      53.624 131.437  -2.585  1.00 56.85           C  
ATOM   4520  C6   DT J   1      53.675 133.734  -1.622  1.00 59.55           C  
ATOM   4521  P    DC J   2      56.413 139.340  -1.326  1.00 79.17           P  
ATOM   4522  OP1  DC J   2      56.376 140.828  -1.359  1.00 81.61           O  
ATOM   4523  OP2  DC J   2      57.202 138.595  -2.345  1.00 76.44           O  
ATOM   4524  O5'  DC J   2      56.858 138.876   0.128  1.00 77.81           O  
ATOM   4525  C5'  DC J   2      55.997 139.099   1.243  1.00 78.15           C  
ATOM   4526  C4'  DC J   2      56.477 138.311   2.437  1.00 78.47           C  
ATOM   4527  O4'  DC J   2      55.997 136.940   2.423  1.00 76.54           O  
ATOM   4528  C3'  DC J   2      57.999 138.231   2.506  1.00 78.91           C  
ATOM   4529  O3'  DC J   2      58.425 138.440   3.833  1.00 80.70           O  
ATOM   4530  C2'  DC J   2      58.302 136.798   2.112  1.00 78.65           C  
ATOM   4531  C1'  DC J   2      57.093 136.070   2.669  1.00 75.59           C  
ATOM   4532  N1   DC J   2      56.823 134.774   2.023  1.00 73.02           N  
ATOM   4533  C2   DC J   2      56.305 133.721   2.800  1.00 71.29           C  
ATOM   4534  O2   DC J   2      56.058 133.921   3.999  1.00 69.66           O  
ATOM   4535  N3   DC J   2      56.090 132.520   2.222  1.00 68.93           N  
ATOM   4536  C4   DC J   2      56.364 132.344   0.927  1.00 69.52           C  
ATOM   4537  N4   DC J   2      56.150 131.137   0.400  1.00 67.01           N  
ATOM   4538  C5   DC J   2      56.875 133.398   0.112  1.00 69.37           C  
ATOM   4539  C6   DC J   2      57.085 134.585   0.695  1.00 70.97           C  
ATOM   4540  P    DA J   3      59.771 139.248   4.099  1.00 81.16           P  
ATOM   4541  OP1  DA J   3      59.442 140.689   3.979  1.00 83.86           O  
ATOM   4542  OP2  DA J   3      60.838 138.658   3.249  1.00 81.11           O  
ATOM   4543  O5'  DA J   3      60.072 138.914   5.618  1.00 80.91           O  
ATOM   4544  C5'  DA J   3      59.003 138.797   6.545  1.00 81.07           C  
ATOM   4545  C4'  DA J   3      59.221 137.588   7.419  1.00 81.37           C  
ATOM   4546  O4'  DA J   3      58.918 136.372   6.689  1.00 81.24           O  
ATOM   4547  C3'  DA J   3      60.667 137.454   7.886  1.00 82.01           C  
ATOM   4548  O3'  DA J   3      60.680 136.998   9.228  1.00 84.62           O  
ATOM   4549  C2'  DA J   3      61.234 136.385   6.969  1.00 80.92           C  
ATOM   4550  C1'  DA J   3      60.025 135.490   6.756  1.00 79.11           C  
ATOM   4551  N9   DA J   3      60.050 134.700   5.524  1.00 77.03           N  
ATOM   4552  C8   DA J   3      60.592 135.044   4.312  1.00 77.31           C  
ATOM   4553  N7   DA J   3      60.461 134.122   3.391  1.00 75.61           N  
ATOM   4554  C5   DA J   3      59.780 133.101   4.037  1.00 75.32           C  
ATOM   4555  C6   DA J   3      59.327 131.843   3.601  1.00 73.68           C  
ATOM   4556  N6   DA J   3      59.478 131.397   2.352  1.00 72.06           N  
ATOM   4557  N1   DA J   3      58.699 131.054   4.500  1.00 74.39           N  
ATOM   4558  C2   DA J   3      58.527 131.516   5.748  1.00 74.44           C  
ATOM   4559  N3   DA J   3      58.893 132.686   6.272  1.00 75.08           N  
ATOM   4560  C4   DA J   3      59.525 133.440   5.354  1.00 76.13           C  
ATOM   4561  P    DG J   4      61.942 137.307  10.159  1.00 85.50           P  
ATOM   4562  OP1  DG J   4      61.693 138.592  10.855  1.00 85.50           O  
ATOM   4563  OP2  DG J   4      63.173 137.138   9.341  1.00 85.25           O  
ATOM   4564  O5'  DG J   4      61.853 136.142  11.234  1.00 84.16           O  
ATOM   4565  C5'  DG J   4      60.590 135.794  11.792  1.00 80.01           C  
ATOM   4566  C4'  DG J   4      60.480 134.298  11.958  1.00 77.40           C  
ATOM   4567  O4'  DG J   4      60.478 133.641  10.670  1.00 75.34           O  
ATOM   4568  C3'  DG J   4      61.613 133.665  12.755  1.00 75.95           C  
ATOM   4569  O3'  DG J   4      61.058 132.688  13.628  1.00 75.89           O  
ATOM   4570  C2'  DG J   4      62.502 133.040  11.691  1.00 73.15           C  
ATOM   4571  C1'  DG J   4      61.509 132.668  10.606  1.00 73.10           C  
ATOM   4572  N9   DG J   4      62.037 132.685   9.245  1.00 72.52           N  
ATOM   4573  C8   DG J   4      62.773 133.681   8.653  1.00 71.58           C  
ATOM   4574  N7   DG J   4      63.060 133.435   7.403  1.00 69.92           N  
ATOM   4575  C5   DG J   4      62.487 132.196   7.157  1.00 69.31           C  
ATOM   4576  C6   DG J   4      62.459 131.415   5.972  1.00 69.39           C  
ATOM   4577  O6   DG J   4      62.923 131.686   4.858  1.00 66.08           O  
ATOM   4578  N1   DG J   4      61.793 130.211   6.171  1.00 68.67           N  
ATOM   4579  C2   DG J   4      61.212 129.816   7.348  1.00 70.59           C  
ATOM   4580  N2   DG J   4      60.621 128.612   7.340  1.00 72.17           N  
ATOM   4581  N3   DG J   4      61.211 130.544   8.452  1.00 70.08           N  
ATOM   4582  C4   DG J   4      61.866 131.711   8.287  1.00 71.48           C  
ATOM   4583  P    DC J   5      61.971 132.038  14.763  1.00 79.86           P  
ATOM   4584  OP1  DC J   5      61.127 131.728  15.942  1.00 78.42           O  
ATOM   4585  OP2  DC J   5      63.166 132.899  14.925  1.00 79.73           O  
ATOM   4586  O5'  DC J   5      62.451 130.682  14.081  1.00 81.17           O  
ATOM   4587  C5'  DC J   5      61.506 129.719  13.622  1.00 80.39           C  
ATOM   4588  C4'  DC J   5      62.225 128.582  12.934  1.00 80.98           C  
ATOM   4589  O4'  DC J   5      62.619 128.956  11.591  1.00 81.10           O  
ATOM   4590  C3'  DC J   5      63.510 128.152  13.643  1.00 81.45           C  
ATOM   4591  O3'  DC J   5      63.671 126.744  13.505  1.00 78.89           O  
ATOM   4592  C2'  DC J   5      64.587 128.845  12.830  1.00 82.21           C  
ATOM   4593  C1'  DC J   5      64.005 128.698  11.438  1.00 83.07           C  
ATOM   4594  N1   DC J   5      64.540 129.610  10.416  1.00 83.99           N  
ATOM   4595  C2   DC J   5      64.439 129.237   9.069  1.00 85.17           C  
ATOM   4596  O2   DC J   5      63.894 128.154   8.783  1.00 84.25           O  
ATOM   4597  N3   DC J   5      64.936 130.060   8.117  1.00 85.89           N  
ATOM   4598  C4   DC J   5      65.513 131.211   8.468  1.00 85.86           C  
ATOM   4599  N4   DC J   5      65.992 131.995   7.498  1.00 86.78           N  
ATOM   4600  C5   DC J   5      65.626 131.614   9.831  1.00 85.62           C  
ATOM   4601  C6   DC J   5      65.130 130.792  10.762  1.00 84.09           C  
ATOM   4602  P    DT J   6      63.751 125.817  14.808  1.00 77.25           P  
ATOM   4603  OP1  DT J   6      62.817 126.334  15.837  1.00 78.34           O  
ATOM   4604  OP2  DT J   6      65.185 125.627  15.142  1.00 76.92           O  
ATOM   4605  O5'  DT J   6      63.174 124.434  14.275  1.00 76.76           O  
ATOM   4606  C5'  DT J   6      62.094 124.411  13.341  1.00 69.02           C  
ATOM   4607  C4'  DT J   6      62.530 123.737  12.061  1.00 66.18           C  
ATOM   4608  O4'  DT J   6      63.318 124.615  11.218  1.00 63.96           O  
ATOM   4609  C3'  DT J   6      63.389 122.494  12.264  1.00 64.13           C  
ATOM   4610  O3'  DT J   6      63.166 121.673  11.131  1.00 60.75           O  
ATOM   4611  C2'  DT J   6      64.795 123.060  12.139  1.00 64.86           C  
ATOM   4612  C1'  DT J   6      64.586 124.017  10.980  1.00 65.44           C  
ATOM   4613  N1   DT J   6      65.578 125.098  10.815  1.00 65.94           N  
ATOM   4614  C2   DT J   6      65.997 125.386   9.541  1.00 65.27           C  
ATOM   4615  O2   DT J   6      65.650 124.745   8.569  1.00 65.29           O  
ATOM   4616  N3   DT J   6      66.849 126.454   9.444  1.00 67.64           N  
ATOM   4617  C4   DT J   6      67.329 127.231  10.473  1.00 68.02           C  
ATOM   4618  O4   DT J   6      68.058 128.184  10.226  1.00 71.13           O  
ATOM   4619  C5   DT J   6      66.899 126.837  11.792  1.00 68.29           C  
ATOM   4620  C7   DT J   6      67.425 127.578  12.980  1.00 68.29           C  
ATOM   4621  C6   DT J   6      66.048 125.808  11.895  1.00 67.93           C  
ATOM   4622  P    DG J   7      62.657 120.161  11.296  1.00 57.75           P  
ATOM   4623  OP1  DG J   7      61.171 120.132  11.315  1.00 56.49           O  
ATOM   4624  OP2  DG J   7      63.429 119.482  12.363  1.00 51.33           O  
ATOM   4625  O5'  DG J   7      63.165 119.556   9.932  1.00 52.80           O  
ATOM   4626  C5'  DG J   7      64.428 118.973   9.897  1.00 49.82           C  
ATOM   4627  C4'  DG J   7      65.147 119.349   8.631  1.00 49.62           C  
ATOM   4628  O4'  DG J   7      65.729 120.677   8.715  1.00 50.72           O  
ATOM   4629  C3'  DG J   7      66.320 118.402   8.481  1.00 44.46           C  
ATOM   4630  O3'  DG J   7      66.509 118.134   7.124  1.00 40.11           O  
ATOM   4631  C2'  DG J   7      67.485 119.160   9.074  1.00 45.75           C  
ATOM   4632  C1'  DG J   7      67.146 120.577   8.677  1.00 48.17           C  
ATOM   4633  N9   DG J   7      67.701 121.581   9.573  1.00 49.22           N  
ATOM   4634  C8   DG J   7      67.579 121.654  10.940  1.00 50.09           C  
ATOM   4635  N7   DG J   7      68.188 122.690  11.452  1.00 52.35           N  
ATOM   4636  C5   DG J   7      68.741 123.334  10.352  1.00 52.34           C  
ATOM   4637  C6   DG J   7      69.505 124.523  10.274  1.00 53.63           C  
ATOM   4638  O6   DG J   7      69.835 125.276  11.186  1.00 60.33           O  
ATOM   4639  N1   DG J   7      69.879 124.809   8.966  1.00 50.58           N  
ATOM   4640  C2   DG J   7      69.544 124.052   7.866  1.00 53.60           C  
ATOM   4641  N2   DG J   7      69.995 124.484   6.671  1.00 51.38           N  
ATOM   4642  N3   DG J   7      68.817 122.948   7.929  1.00 47.24           N  
ATOM   4643  C4   DG J   7      68.457 122.653   9.191  1.00 48.10           C  
ATOM   4644  P    DA J   8      67.329 116.854   6.720  1.00 40.82           P  
ATOM   4645  OP1  DA J   8      66.423 115.917   5.987  1.00 39.29           O  
ATOM   4646  OP2  DA J   8      68.000 116.405   7.961  1.00 32.85           O  
ATOM   4647  O5'  DA J   8      68.384 117.447   5.696  1.00 36.80           O  
ATOM   4648  C5'  DA J   8      67.941 118.195   4.572  1.00 36.24           C  
ATOM   4649  C4'  DA J   8      69.132 118.750   3.832  1.00 39.73           C  
ATOM   4650  O4'  DA J   8      69.715 119.831   4.585  1.00 44.02           O  
ATOM   4651  C3'  DA J   8      70.252 117.740   3.629  1.00 38.85           C  
ATOM   4652  O3'  DA J   8      70.869 118.042   2.401  1.00 39.46           O  
ATOM   4653  C2'  DA J   8      71.179 118.002   4.801  1.00 40.84           C  
ATOM   4654  C1'  DA J   8      71.010 119.493   5.045  1.00 42.71           C  
ATOM   4655  N9   DA J   8      71.072 119.889   6.451  1.00 46.66           N  
ATOM   4656  C8   DA J   8      70.477 119.275   7.519  1.00 47.58           C  
ATOM   4657  N7   DA J   8      70.688 119.881   8.664  1.00 48.47           N  
ATOM   4658  C5   DA J   8      71.478 120.966   8.326  1.00 47.73           C  
ATOM   4659  C6   DA J   8      72.035 122.001   9.092  1.00 49.34           C  
ATOM   4660  N6   DA J   8      71.849 122.128  10.402  1.00 48.65           N  
ATOM   4661  N1   DA J   8      72.791 122.918   8.455  1.00 50.59           N  
ATOM   4662  C2   DA J   8      72.953 122.806   7.124  1.00 51.62           C  
ATOM   4663  N3   DA J   8      72.465 121.887   6.292  1.00 51.07           N  
ATOM   4664  C4   DA J   8      71.730 120.982   6.966  1.00 49.04           C  
ATOM   4665  P    DA J   9      71.941 117.044   1.784  1.00 38.65           P  
ATOM   4666  OP1  DA J   9      71.686 116.998   0.329  1.00 36.52           O  
ATOM   4667  OP2  DA J   9      71.971 115.807   2.586  1.00 39.68           O  
ATOM   4668  O5'  DA J   9      73.308 117.808   2.021  1.00 42.46           O  
ATOM   4669  C5'  DA J   9      73.488 119.102   1.464  1.00 41.15           C  
ATOM   4670  C4'  DA J   9      74.785 119.691   1.947  1.00 44.03           C  
ATOM   4671  O4'  DA J   9      74.668 120.090   3.330  1.00 40.90           O  
ATOM   4672  C3'  DA J   9      75.957 118.716   1.867  1.00 43.84           C  
ATOM   4673  O3'  DA J   9      77.027 119.383   1.226  1.00 54.10           O  
ATOM   4674  C2'  DA J   9      76.267 118.390   3.319  1.00 42.56           C  
ATOM   4675  C1'  DA J   9      75.783 119.621   4.059  1.00 43.92           C  
ATOM   4676  N9   DA J   9      75.342 119.394   5.433  1.00 47.69           N  
ATOM   4677  C8   DA J   9      74.607 118.335   5.919  1.00 51.08           C  
ATOM   4678  N7   DA J   9      74.343 118.416   7.198  1.00 48.80           N  
ATOM   4679  C5   DA J   9      74.948 119.604   7.587  1.00 48.86           C  
ATOM   4680  C6   DA J   9      75.039 120.249   8.825  1.00 48.76           C  
ATOM   4681  N6   DA J   9      74.502 119.768   9.951  1.00 45.86           N  
ATOM   4682  N1   DA J   9      75.716 121.420   8.876  1.00 50.13           N  
ATOM   4683  C2   DA J   9      76.273 121.887   7.756  1.00 50.45           C  
ATOM   4684  N3   DA J   9      76.268 121.365   6.532  1.00 51.11           N  
ATOM   4685  C4   DA J   9      75.574 120.212   6.513  1.00 50.00           C  
ATOM   4686  P    DC J  10      78.369 118.596   0.876  1.00 55.96           P  
ATOM   4687  OP1  DC J  10      78.942 119.313  -0.287  1.00 57.70           O  
ATOM   4688  OP2  DC J  10      78.083 117.145   0.769  1.00 56.24           O  
ATOM   4689  O5'  DC J  10      79.255 118.893   2.163  1.00 55.90           O  
ATOM   4690  C5'  DC J  10      79.437 120.238   2.596  1.00 58.82           C  
ATOM   4691  C4'  DC J  10      80.294 120.287   3.837  1.00 62.91           C  
ATOM   4692  O4'  DC J  10      79.508 120.199   5.050  1.00 63.76           O  
ATOM   4693  C3'  DC J  10      81.353 119.190   3.929  1.00 67.91           C  
ATOM   4694  O3'  DC J  10      82.596 119.747   4.340  1.00 77.29           O  
ATOM   4695  C2'  DC J  10      80.837 118.301   5.043  1.00 66.02           C  
ATOM   4696  C1'  DC J  10      80.169 119.316   5.941  1.00 63.16           C  
ATOM   4697  N1   DC J  10      79.180 118.760   6.879  1.00 63.14           N  
ATOM   4698  C2   DC J  10      79.066 119.330   8.154  1.00 61.85           C  
ATOM   4699  O2   DC J  10      79.755 120.313   8.432  1.00 66.22           O  
ATOM   4700  N3   DC J  10      78.205 118.798   9.046  1.00 61.11           N  
ATOM   4701  C4   DC J  10      77.463 117.745   8.705  1.00 58.21           C  
ATOM   4702  N4   DC J  10      76.636 117.246   9.623  1.00 55.72           N  
ATOM   4703  C5   DC J  10      77.537 117.157   7.406  1.00 59.15           C  
ATOM   4704  C6   DC J  10      78.398 117.693   6.530  1.00 58.74           C  
ATOM   4705  P    DA J  11      83.961 119.047   3.885  1.00 81.35           P  
ATOM   4706  OP1  DA J  11      84.219 119.456   2.482  1.00 81.48           O  
ATOM   4707  OP2  DA J  11      83.882 117.602   4.226  1.00 81.69           O  
ATOM   4708  O5'  DA J  11      85.040 119.725   4.832  1.00 87.06           O  
ATOM   4709  C5'  DA J  11      84.860 121.059   5.294  1.00 96.93           C  
ATOM   4710  C4'  DA J  11      85.037 121.110   6.793  1.00103.66           C  
ATOM   4711  O4'  DA J  11      83.915 120.455   7.435  1.00106.26           O  
ATOM   4712  C3'  DA J  11      86.289 120.379   7.278  1.00107.56           C  
ATOM   4713  O3'  DA J  11      86.912 121.101   8.341  1.00111.98           O  
ATOM   4714  C2'  DA J  11      85.755 119.049   7.775  1.00107.67           C  
ATOM   4715  C1'  DA J  11      84.383 119.429   8.297  1.00107.91           C  
ATOM   4716  N9   DA J  11      83.414 118.334   8.267  1.00109.47           N  
ATOM   4717  C8   DA J  11      83.108 117.504   7.218  1.00109.80           C  
ATOM   4718  N7   DA J  11      82.209 116.594   7.507  1.00109.71           N  
ATOM   4719  C5   DA J  11      81.897 116.845   8.835  1.00110.17           C  
ATOM   4720  C6   DA J  11      81.009 116.223   9.731  1.00110.72           C  
ATOM   4721  N6   DA J  11      80.238 115.183   9.410  1.00110.60           N  
ATOM   4722  N1   DA J  11      80.940 116.715  10.987  1.00111.77           N  
ATOM   4723  C2   DA J  11      81.711 117.764  11.308  1.00112.34           C  
ATOM   4724  N3   DA J  11      82.580 118.435  10.553  1.00110.94           N  
ATOM   4725  C4   DA J  11      82.627 117.918   9.314  1.00110.22           C  
ATOM   4726  P    DT J  12      88.294 120.565   8.953  1.00114.08           P  
ATOM   4727  OP1  DT J  12      89.107 121.752   9.319  1.00114.50           O  
ATOM   4728  OP2  DT J  12      88.848 119.558   8.015  1.00113.97           O  
ATOM   4729  O5'  DT J  12      87.845 119.826  10.291  1.00117.01           O  
ATOM   4730  C5'  DT J  12      87.442 120.577  11.434  1.00122.45           C  
ATOM   4731  C4'  DT J  12      87.446 119.702  12.665  1.00126.41           C  
ATOM   4732  O4'  DT J  12      86.269 118.857  12.691  1.00127.31           O  
ATOM   4733  C3'  DT J  12      88.649 118.763  12.769  1.00128.85           C  
ATOM   4734  O3'  DT J  12      89.113 118.698  14.118  1.00131.55           O  
ATOM   4735  C2'  DT J  12      88.077 117.420  12.357  1.00128.80           C  
ATOM   4736  C1'  DT J  12      86.664 117.511  12.898  1.00128.59           C  
ATOM   4737  N1   DT J  12      85.686 116.634  12.229  1.00129.54           N  
ATOM   4738  C2   DT J  12      84.706 116.053  13.001  1.00129.94           C  
ATOM   4739  O2   DT J  12      84.604 116.242  14.202  1.00129.93           O  
ATOM   4740  N3   DT J  12      83.843 115.236  12.313  1.00130.27           N  
ATOM   4741  C4   DT J  12      83.864 114.950  10.963  1.00130.73           C  
ATOM   4742  O4   DT J  12      83.027 114.190  10.487  1.00130.97           O  
ATOM   4743  C5   DT J  12      84.915 115.598  10.212  1.00130.91           C  
ATOM   4744  C7   DT J  12      85.017 115.348   8.741  1.00131.35           C  
ATOM   4745  C6   DT J  12      85.760 116.399  10.874  1.00130.61           C  
ATOM   4746  P    DG J  13      90.414 117.825  14.469  1.00133.28           P  
ATOM   4747  OP1  DG J  13      91.308 118.675  15.296  1.00134.11           O  
ATOM   4748  OP2  DG J  13      90.931 117.216  13.215  1.00132.78           O  
ATOM   4749  O5'  DG J  13      89.840 116.661  15.390  1.00134.26           O  
ATOM   4750  C5'  DG J  13      89.134 116.966  16.590  1.00136.43           C  
ATOM   4751  C4'  DG J  13      88.563 115.704  17.193  1.00137.84           C  
ATOM   4752  O4'  DG J  13      87.494 115.203  16.351  1.00138.84           O  
ATOM   4753  C3'  DG J  13      89.571 114.561  17.326  1.00137.98           C  
ATOM   4754  O3'  DG J  13      89.338 113.847  18.542  1.00136.06           O  
ATOM   4755  C2'  DG J  13      89.260 113.681  16.130  1.00139.07           C  
ATOM   4756  C1'  DG J  13      87.760 113.857  15.986  1.00140.07           C  
ATOM   4757  N9   DG J  13      87.265 113.647  14.628  1.00141.61           N  
ATOM   4758  C8   DG J  13      87.659 114.305  13.488  1.00142.08           C  
ATOM   4759  N7   DG J  13      87.048 113.883  12.414  1.00142.16           N  
ATOM   4760  C5   DG J  13      86.195 112.889  12.873  1.00142.60           C  
ATOM   4761  C6   DG J  13      85.281 112.065  12.167  1.00142.85           C  
ATOM   4762  O6   DG J  13      85.036 112.047  10.954  1.00142.38           O  
ATOM   4763  N1   DG J  13      84.616 111.190  13.022  1.00143.32           N  
ATOM   4764  C2   DG J  13      84.806 111.116  14.380  1.00143.23           C  
ATOM   4765  N2   DG J  13      84.067 110.205  15.033  1.00143.08           N  
ATOM   4766  N3   DG J  13      85.656 111.877  15.050  1.00142.95           N  
ATOM   4767  C4   DG J  13      86.313 112.734  14.239  1.00142.51           C  
ATOM   4768  P    DC J  14      90.351 112.682  18.992  1.00134.26           P  
ATOM   4769  OP1  DC J  14      91.209 113.227  20.073  1.00135.02           O  
ATOM   4770  OP2  DC J  14      90.979 112.085  17.786  1.00134.46           O  
ATOM   4771  O5'  DC J  14      89.376 111.604  19.638  1.00133.39           O  
ATOM   4772  C5'  DC J  14      88.058 111.981  20.026  1.00129.93           C  
ATOM   4773  C4'  DC J  14      87.152 110.775  20.080  1.00127.27           C  
ATOM   4774  O4'  DC J  14      87.024 110.178  18.765  1.00127.93           O  
ATOM   4775  C3'  DC J  14      87.608 109.652  21.011  1.00124.65           C  
ATOM   4776  O3'  DC J  14      86.459 109.111  21.655  1.00120.13           O  
ATOM   4777  C2'  DC J  14      88.172 108.616  20.057  1.00126.10           C  
ATOM   4778  C1'  DC J  14      87.237 108.780  18.876  1.00128.12           C  
ATOM   4779  N1   DC J  14      87.746 108.281  17.588  1.00129.57           N  
ATOM   4780  C2   DC J  14      86.884 107.534  16.775  1.00130.19           C  
ATOM   4781  O2   DC J  14      85.718 107.344  17.153  1.00130.13           O  
ATOM   4782  N3   DC J  14      87.340 107.044  15.601  1.00130.28           N  
ATOM   4783  C4   DC J  14      88.596 107.283  15.223  1.00131.10           C  
ATOM   4784  N4   DC J  14      89.005 106.777  14.058  1.00131.99           N  
ATOM   4785  C5   DC J  14      89.492 108.053  16.024  1.00130.94           C  
ATOM   4786  C6   DC J  14      89.029 108.528  17.188  1.00130.06           C  
ATOM   4787  P    DC J  15      86.597 108.434  23.100  1.00117.11           P  
ATOM   4788  OP1  DC J  15      86.595 109.518  24.113  1.00117.52           O  
ATOM   4789  OP2  DC J  15      87.720 107.463  23.062  1.00117.23           O  
ATOM   4790  O5'  DC J  15      85.239 107.620  23.239  1.00114.24           O  
ATOM   4791  C5'  DC J  15      84.047 108.090  22.613  1.00108.31           C  
ATOM   4792  C4'  DC J  15      83.374 106.966  21.862  1.00103.95           C  
ATOM   4793  O4'  DC J  15      84.094 106.656  20.642  1.00102.78           O  
ATOM   4794  C3'  DC J  15      83.284 105.654  22.644  1.00101.59           C  
ATOM   4795  O3'  DC J  15      82.023 105.035  22.417  1.00 96.03           O  
ATOM   4796  C2'  DC J  15      84.366 104.797  22.016  1.00102.14           C  
ATOM   4797  C1'  DC J  15      84.294 105.254  20.575  1.00103.14           C  
ATOM   4798  N1   DC J  15      85.499 104.991  19.778  1.00104.15           N  
ATOM   4799  C2   DC J  15      85.362 104.817  18.400  1.00105.08           C  
ATOM   4800  O2   DC J  15      84.235 104.908  17.896  1.00105.25           O  
ATOM   4801  N3   DC J  15      86.459 104.557  17.653  1.00106.25           N  
ATOM   4802  C4   DC J  15      87.657 104.471  18.235  1.00106.75           C  
ATOM   4803  N4   DC J  15      88.713 104.210  17.460  1.00106.44           N  
ATOM   4804  C5   DC J  15      87.827 104.649  19.638  1.00106.54           C  
ATOM   4805  C6   DC J  15      86.732 104.907  20.365  1.00105.55           C  
ATOM   4806  P    DT J  16      81.542 103.845  23.375  1.00 92.50           P  
ATOM   4807  OP1  DT J  16      80.858 104.436  24.553  1.00 93.38           O  
ATOM   4808  OP2  DT J  16      82.692 102.928  23.573  1.00 92.72           O  
ATOM   4809  O5'  DT J  16      80.460 103.093  22.492  1.00 90.37           O  
ATOM   4810  C5'  DT J  16      79.725 103.805  21.507  1.00 83.07           C  
ATOM   4811  C4'  DT J  16      79.644 102.996  20.236  1.00 76.16           C  
ATOM   4812  O4'  DT J  16      80.954 102.879  19.629  1.00 74.68           O  
ATOM   4813  C3'  DT J  16      79.138 101.570  20.429  1.00 72.74           C  
ATOM   4814  O3'  DT J  16      78.271 101.240  19.349  1.00 68.28           O  
ATOM   4815  C2'  DT J  16      80.402 100.734  20.359  1.00 72.67           C  
ATOM   4816  C1'  DT J  16      81.242 101.516  19.373  1.00 73.69           C  
ATOM   4817  N1   DT J  16      82.693 101.321  19.524  1.00 74.92           N  
ATOM   4818  C2   DT J  16      83.456 101.177  18.384  1.00 76.33           C  
ATOM   4819  O2   DT J  16      82.989 101.205  17.255  1.00 77.95           O  
ATOM   4820  N3   DT J  16      84.797 100.998  18.615  1.00 76.39           N  
ATOM   4821  C4   DT J  16      85.434 100.949  19.840  1.00 76.48           C  
ATOM   4822  O4   DT J  16      86.649 100.783  19.891  1.00 78.11           O  
ATOM   4823  C5   DT J  16      84.573 101.105  20.990  1.00 74.41           C  
ATOM   4824  C7   DT J  16      85.174 101.062  22.357  1.00 73.45           C  
ATOM   4825  C6   DT J  16      83.264 101.282  20.777  1.00 74.43           C  
ATOM   4826  P    DT J  17      77.617  99.782  19.268  1.00 62.22           P  
ATOM   4827  OP1  DT J  17      76.189 100.027  18.972  1.00 66.86           O  
ATOM   4828  OP2  DT J  17      77.988  98.985  20.461  1.00 63.57           O  
ATOM   4829  O5'  DT J  17      78.316  99.157  17.984  1.00 58.57           O  
ATOM   4830  C5'  DT J  17      78.369  99.908  16.781  1.00 54.65           C  
ATOM   4831  C4'  DT J  17      79.139  99.170  15.711  1.00 53.41           C  
ATOM   4832  O4'  DT J  17      80.557  99.157  16.009  1.00 56.23           O  
ATOM   4833  C3'  DT J  17      78.735  97.723  15.433  1.00 50.29           C  
ATOM   4834  O3'  DT J  17      78.644  97.559  14.017  1.00 41.26           O  
ATOM   4835  C2'  DT J  17      79.879  96.912  16.025  1.00 53.95           C  
ATOM   4836  C1'  DT J  17      81.077  97.843  15.871  1.00 57.83           C  
ATOM   4837  N1   DT J  17      82.147  97.683  16.885  1.00 63.61           N  
ATOM   4838  C2   DT J  17      83.455  97.562  16.457  1.00 66.47           C  
ATOM   4839  O2   DT J  17      83.782  97.543  15.279  1.00 67.37           O  
ATOM   4840  N3   DT J  17      84.376  97.463  17.468  1.00 69.38           N  
ATOM   4841  C4   DT J  17      84.131  97.472  18.828  1.00 68.26           C  
ATOM   4842  O4   DT J  17      85.062  97.396  19.616  1.00 69.25           O  
ATOM   4843  C5   DT J  17      82.747  97.580  19.205  1.00 67.26           C  
ATOM   4844  C7   DT J  17      82.392  97.585  20.657  1.00 67.10           C  
ATOM   4845  C6   DT J  17      81.834  97.676  18.229  1.00 65.87           C  
ATOM   4846  P    DT J  18      78.361  96.113  13.385  1.00 46.72           P  
ATOM   4847  OP1  DT J  18      77.634  96.340  12.111  1.00 46.61           O  
ATOM   4848  OP2  DT J  18      77.793  95.186  14.402  1.00 42.35           O  
ATOM   4849  O5'  DT J  18      79.814  95.623  12.964  1.00 53.86           O  
ATOM   4850  C5'  DT J  18      80.572  96.359  12.009  1.00 55.19           C  
ATOM   4851  C4'  DT J  18      81.829  95.604  11.646  1.00 63.06           C  
ATOM   4852  O4'  DT J  18      82.750  95.614  12.764  1.00 62.75           O  
ATOM   4853  C3'  DT J  18      81.609  94.135  11.288  1.00 64.89           C  
ATOM   4854  O3'  DT J  18      82.449  93.788  10.188  1.00 70.02           O  
ATOM   4855  C2'  DT J  18      82.023  93.398  12.551  1.00 66.29           C  
ATOM   4856  C1'  DT J  18      83.124  94.287  13.098  1.00 65.01           C  
ATOM   4857  N1   DT J  18      83.341  94.228  14.562  1.00 65.75           N  
ATOM   4858  C2   DT J  18      84.645  94.266  15.019  1.00 67.72           C  
ATOM   4859  O2   DT J  18      85.613  94.300  14.275  1.00 66.97           O  
ATOM   4860  N3   DT J  18      84.775  94.255  16.384  1.00 66.10           N  
ATOM   4861  C4   DT J  18      83.762  94.199  17.317  1.00 67.03           C  
ATOM   4862  O4   DT J  18      84.032  94.217  18.515  1.00 65.02           O  
ATOM   4863  C5   DT J  18      82.427  94.128  16.773  1.00 65.31           C  
ATOM   4864  C7   DT J  18      81.269  94.032  17.714  1.00 65.07           C  
ATOM   4865  C6   DT J  18      82.284  94.150  15.439  1.00 65.29           C  
ATOM   4866  P    DT J  19      82.379  92.312   9.559  1.00 75.56           P  
ATOM   4867  OP1  DT J  19      82.457  92.450   8.086  1.00 75.28           O  
ATOM   4868  OP2  DT J  19      81.250  91.571  10.169  1.00 77.91           O  
ATOM   4869  O5'  DT J  19      83.730  91.648  10.068  1.00 81.84           O  
ATOM   4870  C5'  DT J  19      84.980  92.283   9.813  1.00 87.84           C  
ATOM   4871  C4'  DT J  19      86.095  91.531  10.495  1.00 92.09           C  
ATOM   4872  O4'  DT J  19      86.086  91.802  11.918  1.00 92.30           O  
ATOM   4873  C3'  DT J  19      85.994  90.014  10.344  1.00 95.83           C  
ATOM   4874  O3'  DT J  19      87.283  89.459  10.093  1.00103.19           O  
ATOM   4875  C2'  DT J  19      85.476  89.560  11.696  1.00 94.79           C  
ATOM   4876  C1'  DT J  19      86.094  90.579  12.631  1.00 93.10           C  
ATOM   4877  N1   DT J  19      85.373  90.783  13.903  1.00 94.26           N  
ATOM   4878  C2   DT J  19      86.116  91.099  15.018  1.00 95.54           C  
ATOM   4879  O2   DT J  19      87.327  91.251  14.991  1.00 97.86           O  
ATOM   4880  N3   DT J  19      85.387  91.235  16.174  1.00 94.29           N  
ATOM   4881  C4   DT J  19      84.024  91.098  16.320  1.00 93.96           C  
ATOM   4882  O4   DT J  19      83.514  91.236  17.424  1.00 94.21           O  
ATOM   4883  C5   DT J  19      83.302  90.790  15.109  1.00 94.04           C  
ATOM   4884  C7   DT J  19      81.815  90.644  15.172  1.00 93.66           C  
ATOM   4885  C6   DT J  19      84.003  90.648  13.975  1.00 94.19           C  
ATOM   4886  P    DG J  20      87.408  88.069   9.301  1.00108.62           P  
ATOM   4887  OP1  DG J  20      88.233  88.331   8.091  1.00107.70           O  
ATOM   4888  OP2  DG J  20      86.052  87.480   9.152  1.00107.55           O  
ATOM   4889  O5'  DG J  20      88.245  87.161  10.306  1.00110.32           O  
ATOM   4890  C5'  DG J  20      89.481  87.628  10.842  1.00114.37           C  
ATOM   4891  C4'  DG J  20      89.783  86.937  12.151  1.00117.45           C  
ATOM   4892  O4'  DG J  20      88.924  87.441  13.205  1.00118.00           O  
ATOM   4893  C3'  DG J  20      89.588  85.419  12.132  1.00119.51           C  
ATOM   4894  O3'  DG J  20      90.640  84.785  12.864  1.00121.95           O  
ATOM   4895  C2'  DG J  20      88.269  85.231  12.859  1.00118.89           C  
ATOM   4896  C1'  DG J  20      88.335  86.344  13.884  1.00119.07           C  
ATOM   4897  N9   DG J  20      87.041  86.766  14.415  1.00119.67           N  
ATOM   4898  C8   DG J  20      85.900  87.056  13.707  1.00119.63           C  
ATOM   4899  N7   DG J  20      84.893  87.386  14.470  1.00119.35           N  
ATOM   4900  C5   DG J  20      85.403  87.314  15.760  1.00119.73           C  
ATOM   4901  C6   DG J  20      84.778  87.559  17.013  1.00120.13           C  
ATOM   4902  O6   DG J  20      83.610  87.900  17.241  1.00120.32           O  
ATOM   4903  N1   DG J  20      85.663  87.366  18.070  1.00120.21           N  
ATOM   4904  C2   DG J  20      86.976  86.985  17.942  1.00119.98           C  
ATOM   4905  N2   DG J  20      87.666  86.846  19.082  1.00119.77           N  
ATOM   4906  N3   DG J  20      87.569  86.756  16.783  1.00119.71           N  
ATOM   4907  C4   DG J  20      86.729  86.937  15.741  1.00119.64           C  
ATOM   4908  P    DA J  21      90.669  83.184  12.993  1.00123.47           P  
ATOM   4909  OP1  DA J  21      91.978  82.721  12.473  1.00124.10           O  
ATOM   4910  OP2  DA J  21      89.415  82.627  12.424  1.00123.82           O  
ATOM   4911  O5'  DA J  21      90.642  82.943  14.565  1.00123.89           O  
ATOM   4912  C5'  DA J  21      91.656  83.489  15.403  1.00125.35           C  
ATOM   4913  C4'  DA J  21      91.448  83.029  16.825  1.00126.75           C  
ATOM   4914  O4'  DA J  21      90.250  83.650  17.352  1.00127.59           O  
ATOM   4915  C3'  DA J  21      91.236  81.520  16.953  1.00126.85           C  
ATOM   4916  O3'  DA J  21      91.860  81.018  18.136  1.00126.08           O  
ATOM   4917  C2'  DA J  21      89.728  81.383  17.044  1.00127.50           C  
ATOM   4918  C1'  DA J  21      89.323  82.656  17.764  1.00128.05           C  
ATOM   4919  N9   DA J  21      87.979  83.122  17.423  1.00128.62           N  
ATOM   4920  C8   DA J  21      87.467  83.385  16.176  1.00128.86           C  
ATOM   4921  N7   DA J  21      86.213  83.769  16.188  1.00129.01           N  
ATOM   4922  C5   DA J  21      85.877  83.763  17.535  1.00128.90           C  
ATOM   4923  C6   DA J  21      84.684  84.070  18.215  1.00128.82           C  
ATOM   4924  N6   DA J  21      83.562  84.457  17.604  1.00128.53           N  
ATOM   4925  N1   DA J  21      84.684  83.964  19.561  1.00128.82           N  
ATOM   4926  C2   DA J  21      85.810  83.575  20.173  1.00128.95           C  
ATOM   4927  N3   DA J  21      86.990  83.257  19.646  1.00128.64           N  
ATOM   4928  C4   DA J  21      86.957  83.373  18.307  1.00128.77           C  
ATOM   4929  P    DT J  22      91.792  79.447  18.461  1.00125.14           P  
ATOM   4930  OP1  DT J  22      93.127  79.043  18.968  1.00125.60           O  
ATOM   4931  OP2  DT J  22      91.211  78.750  17.284  1.00125.17           O  
ATOM   4932  O5'  DT J  22      90.756  79.359  19.667  1.00123.53           O  
ATOM   4933  C5'  DT J  22      90.998  80.066  20.880  1.00121.62           C  
ATOM   4934  C4'  DT J  22      89.900  79.794  21.882  1.00120.57           C  
ATOM   4935  O4'  DT J  22      88.673  80.451  21.481  1.00120.52           O  
ATOM   4936  C3'  DT J  22      89.545  78.319  22.089  1.00119.89           C  
ATOM   4937  O3'  DT J  22      89.316  78.069  23.477  1.00117.81           O  
ATOM   4938  C2'  DT J  22      88.237  78.168  21.334  1.00120.02           C  
ATOM   4939  C1'  DT J  22      87.605  79.523  21.569  1.00120.32           C  
ATOM   4940  N1   DT J  22      86.571  79.914  20.593  1.00120.16           N  
ATOM   4941  C2   DT J  22      85.348  80.311  21.081  1.00119.52           C  
ATOM   4942  O2   DT J  22      85.088  80.355  22.273  1.00118.58           O  
ATOM   4943  N3   DT J  22      84.434  80.657  20.118  1.00119.61           N  
ATOM   4944  C4   DT J  22      84.617  80.643  18.748  1.00120.03           C  
ATOM   4945  O4   DT J  22      83.703  80.980  18.005  1.00120.38           O  
ATOM   4946  C5   DT J  22      85.922  80.214  18.305  1.00120.28           C  
ATOM   4947  C7   DT J  22      86.208  80.162  16.837  1.00119.91           C  
ATOM   4948  C6   DT J  22      86.824  79.877  19.237  1.00120.59           C  
ATOM   4949  P    DG J  23      89.398  76.569  24.040  1.00115.20           P  
ATOM   4950  OP1  DG J  23      90.805  76.122  23.890  1.00116.57           O  
ATOM   4951  OP2  DG J  23      88.309  75.771  23.425  1.00114.95           O  
ATOM   4952  O5'  DG J  23      89.091  76.740  25.593  1.00113.41           O  
ATOM   4953  C5'  DG J  23      88.239  75.826  26.279  1.00110.71           C  
ATOM   4954  C4'  DG J  23      87.053  76.562  26.858  1.00108.23           C  
ATOM   4955  O4'  DG J  23      86.347  77.235  25.790  1.00107.81           O  
ATOM   4956  C3'  DG J  23      86.019  75.671  27.541  1.00106.20           C  
ATOM   4957  O3'  DG J  23      85.441  76.367  28.645  1.00103.41           O  
ATOM   4958  C2'  DG J  23      84.983  75.441  26.457  1.00106.50           C  
ATOM   4959  C1'  DG J  23      85.013  76.753  25.693  1.00106.14           C  
ATOM   4960  N9   DG J  23      84.695  76.627  24.275  1.00105.31           N  
ATOM   4961  C8   DG J  23      85.398  75.923  23.328  1.00105.26           C  
ATOM   4962  N7   DG J  23      84.885  76.016  22.132  1.00104.57           N  
ATOM   4963  C5   DG J  23      83.770  76.826  22.301  1.00105.03           C  
ATOM   4964  C6   DG J  23      82.816  77.282  21.358  1.00103.97           C  
ATOM   4965  O6   DG J  23      82.765  77.056  20.145  1.00103.32           O  
ATOM   4966  N1   DG J  23      81.846  78.078  21.958  1.00103.81           N  
ATOM   4967  C2   DG J  23      81.798  78.395  23.292  1.00103.98           C  
ATOM   4968  N2   DG J  23      80.777  79.169  23.679  1.00102.85           N  
ATOM   4969  N3   DG J  23      82.685  77.981  24.181  1.00105.33           N  
ATOM   4970  C4   DG J  23      83.636  77.205  23.621  1.00105.62           C  
ATOM   4971  P    DG J  24      84.576  75.558  29.724  1.00102.06           P  
ATOM   4972  OP1  DG J  24      84.884  76.060  31.089  1.00101.25           O  
ATOM   4973  OP2  DG J  24      84.726  74.113  29.416  1.00102.85           O  
ATOM   4974  O5'  DG J  24      83.074  75.941  29.382  1.00100.48           O  
ATOM   4975  C5'  DG J  24      82.033  75.010  29.625  1.00 97.08           C  
ATOM   4976  C4'  DG J  24      80.796  75.400  28.855  1.00 93.95           C  
ATOM   4977  O4'  DG J  24      81.127  75.632  27.465  1.00 92.48           O  
ATOM   4978  C3'  DG J  24      79.724  74.314  28.859  1.00 91.99           C  
ATOM   4979  O3'  DG J  24      78.443  74.928  28.922  1.00 89.78           O  
ATOM   4980  C2'  DG J  24      79.914  73.640  27.514  1.00 91.89           C  
ATOM   4981  C1'  DG J  24      80.300  74.821  26.652  1.00 92.14           C  
ATOM   4982  N9   DG J  24      81.029  74.494  25.432  1.00 92.57           N  
ATOM   4983  C8   DG J  24      82.231  73.838  25.316  1.00 92.22           C  
ATOM   4984  N7   DG J  24      82.609  73.678  24.075  1.00 92.26           N  
ATOM   4985  C5   DG J  24      81.595  74.264  23.329  1.00 91.62           C  
ATOM   4986  C6   DG J  24      81.440  74.393  21.926  1.00 90.88           C  
ATOM   4987  O6   DG J  24      82.189  73.993  21.027  1.00 88.32           O  
ATOM   4988  N1   DG J  24      80.268  75.070  21.603  1.00 91.10           N  
ATOM   4989  C2   DG J  24      79.360  75.558  22.509  1.00 91.76           C  
ATOM   4990  N2   DG J  24      78.294  76.201  22.000  1.00 92.35           N  
ATOM   4991  N3   DG J  24      79.487  75.433  23.817  1.00 91.36           N  
ATOM   4992  C4   DG J  24      80.619  74.782  24.153  1.00 92.27           C  
ATOM   4993  P    DA J  25      77.650  74.961  30.311  1.00 88.50           P  
ATOM   4994  OP1  DA J  25      78.402  75.828  31.249  1.00 89.11           O  
ATOM   4995  OP2  DA J  25      77.325  73.563  30.693  1.00 89.02           O  
ATOM   4996  O5'  DA J  25      76.302  75.714  29.945  1.00 85.82           O  
ATOM   4997  C5'  DA J  25      76.335  77.062  29.504  1.00 80.87           C  
ATOM   4998  C4'  DA J  25      75.430  77.231  28.310  1.00 78.75           C  
ATOM   4999  O4'  DA J  25      76.008  76.594  27.146  1.00 77.64           O  
ATOM   5000  C3'  DA J  25      74.060  76.595  28.505  1.00 75.80           C  
ATOM   5001  O3'  DA J  25      73.056  77.441  27.965  1.00 73.22           O  
ATOM   5002  C2'  DA J  25      74.155  75.285  27.745  1.00 75.55           C  
ATOM   5003  C1'  DA J  25      75.120  75.617  26.624  1.00 76.77           C  
ATOM   5004  N9   DA J  25      75.935  74.493  26.167  1.00 76.53           N  
ATOM   5005  C8   DA J  25      76.615  73.583  26.936  1.00 77.03           C  
ATOM   5006  N7   DA J  25      77.312  72.717  26.238  1.00 77.31           N  
ATOM   5007  C5   DA J  25      77.063  73.074  24.921  1.00 77.58           C  
ATOM   5008  C6   DA J  25      77.516  72.552  23.698  1.00 76.37           C  
ATOM   5009  N6   DA J  25      78.361  71.527  23.601  1.00 77.15           N  
ATOM   5010  N1   DA J  25      77.068  73.131  22.563  1.00 75.49           N  
ATOM   5011  C2   DA J  25      76.231  74.168  22.663  1.00 74.17           C  
ATOM   5012  N3   DA J  25      75.743  74.755  23.752  1.00 74.58           N  
ATOM   5013  C4   DA J  25      76.203  74.155  24.862  1.00 76.26           C  
ATOM   5014  P    DG J  26      71.536  76.962  27.992  1.00 72.35           P  
ATOM   5015  OP1  DG J  26      70.624  78.137  28.003  1.00 74.85           O  
ATOM   5016  OP2  DG J  26      71.413  75.924  29.044  1.00 74.28           O  
ATOM   5017  O5'  DG J  26      71.384  76.233  26.598  1.00 69.28           O  
ATOM   5018  C5'  DG J  26      70.459  75.193  26.452  1.00 64.75           C  
ATOM   5019  C4'  DG J  26      70.574  74.598  25.074  1.00 61.41           C  
ATOM   5020  O4'  DG J  26      71.883  73.996  24.873  1.00 60.55           O  
ATOM   5021  C3'  DG J  26      69.562  73.477  24.890  1.00 57.24           C  
ATOM   5022  O3'  DG J  26      69.138  73.487  23.540  1.00 56.07           O  
ATOM   5023  C2'  DG J  26      70.389  72.240  25.155  1.00 58.59           C  
ATOM   5024  C1'  DG J  26      71.692  72.642  24.500  1.00 60.04           C  
ATOM   5025  N9   DG J  26      72.854  71.862  24.912  1.00 62.12           N  
ATOM   5026  C8   DG J  26      73.198  71.480  26.188  1.00 61.18           C  
ATOM   5027  N7   DG J  26      74.279  70.749  26.230  1.00 61.15           N  
ATOM   5028  C5   DG J  26      74.677  70.648  24.903  1.00 63.43           C  
ATOM   5029  C6   DG J  26      75.782  69.969  24.319  1.00 63.13           C  
ATOM   5030  O6   DG J  26      76.658  69.300  24.875  1.00 67.88           O  
ATOM   5031  N1   DG J  26      75.808  70.127  22.939  1.00 62.03           N  
ATOM   5032  C2   DG J  26      74.892  70.839  22.209  1.00 60.83           C  
ATOM   5033  N2   DG J  26      75.091  70.861  20.883  1.00 57.65           N  
ATOM   5034  N3   DG J  26      73.859  71.476  22.737  1.00 56.52           N  
ATOM   5035  C4   DG J  26      73.813  71.338  24.078  1.00 61.28           C  
ATOM   5036  P    DC J  27      67.739  74.157  23.148  1.00 48.89           P  
ATOM   5037  OP1  DC J  27      67.846  75.598  23.473  1.00 50.76           O  
ATOM   5038  OP2  DC J  27      66.624  73.366  23.701  1.00 52.39           O  
ATOM   5039  O5'  DC J  27      67.761  74.000  21.573  1.00 52.70           O  
ATOM   5040  C5'  DC J  27      68.766  74.656  20.822  1.00 52.92           C  
ATOM   5041  C4'  DC J  27      69.370  73.704  19.821  1.00 57.08           C  
ATOM   5042  O4'  DC J  27      70.276  72.766  20.454  1.00 57.21           O  
ATOM   5043  C3'  DC J  27      68.345  72.869  19.061  1.00 57.75           C  
ATOM   5044  O3'  DC J  27      68.698  72.876  17.686  1.00 55.53           O  
ATOM   5045  C2'  DC J  27      68.476  71.481  19.675  1.00 57.77           C  
ATOM   5046  C1'  DC J  27      69.942  71.434  20.085  1.00 56.48           C  
ATOM   5047  N1   DC J  27      70.266  70.570  21.236  1.00 57.10           N  
ATOM   5048  C2   DC J  27      71.411  69.750  21.174  1.00 58.60           C  
ATOM   5049  O2   DC J  27      72.053  69.682  20.114  1.00 56.47           O  
ATOM   5050  N3   DC J  27      71.781  69.052  22.273  1.00 58.47           N  
ATOM   5051  C4   DC J  27      71.055  69.135  23.388  1.00 57.63           C  
ATOM   5052  N4   DC J  27      71.496  68.497  24.468  1.00 58.30           N  
ATOM   5053  C5   DC J  27      69.851  69.895  23.452  1.00 56.54           C  
ATOM   5054  C6   DC J  27      69.498  70.592  22.365  1.00 57.02           C  
ATOM   5055  P    DA J  28      67.876  71.978  16.664  1.00 59.73           P  
ATOM   5056  OP1  DA J  28      68.075  72.499  15.294  1.00 60.25           O  
ATOM   5057  OP2  DA J  28      66.503  71.822  17.202  1.00 61.93           O  
ATOM   5058  O5'  DA J  28      68.608  70.579  16.770  1.00 64.35           O  
ATOM   5059  C5'  DA J  28      67.959  69.401  16.362  1.00 70.25           C  
ATOM   5060  C4'  DA J  28      68.922  68.246  16.445  1.00 73.40           C  
ATOM   5061  O4'  DA J  28      69.490  68.178  17.774  1.00 72.69           O  
ATOM   5062  C3'  DA J  28      68.254  66.902  16.204  1.00 74.88           C  
ATOM   5063  O3'  DA J  28      69.174  66.056  15.542  1.00 79.50           O  
ATOM   5064  C2'  DA J  28      67.984  66.397  17.605  1.00 73.76           C  
ATOM   5065  C1'  DA J  28      69.190  66.920  18.353  1.00 73.96           C  
ATOM   5066  N9   DA J  28      68.960  67.116  19.782  1.00 74.41           N  
ATOM   5067  C8   DA J  28      68.038  67.925  20.399  1.00 74.01           C  
ATOM   5068  N7   DA J  28      68.055  67.843  21.707  1.00 74.18           N  
ATOM   5069  C5   DA J  28      69.062  66.923  21.969  1.00 75.57           C  
ATOM   5070  C6   DA J  28      69.575  66.394  23.166  1.00 75.16           C  
ATOM   5071  N6   DA J  28      69.109  66.711  24.379  1.00 72.64           N  
ATOM   5072  N1   DA J  28      70.596  65.512  23.075  1.00 75.38           N  
ATOM   5073  C2   DA J  28      71.056  65.185  21.862  1.00 75.26           C  
ATOM   5074  N3   DA J  28      70.649  65.602  20.668  1.00 76.45           N  
ATOM   5075  C4   DA J  28      69.638  66.481  20.793  1.00 75.81           C  
ATOM   5076  P    DG J  29      68.670  65.142  14.340  1.00 83.02           P  
ATOM   5077  OP1  DG J  29      69.374  65.628  13.125  1.00 84.60           O  
ATOM   5078  OP2  DG J  29      67.188  65.088  14.363  1.00 82.40           O  
ATOM   5079  O5'  DG J  29      69.235  63.710  14.730  1.00 84.37           O  
ATOM   5080  C5'  DG J  29      70.637  63.456  14.723  1.00 85.50           C  
ATOM   5081  C4'  DG J  29      70.932  62.200  15.503  1.00 85.26           C  
ATOM   5082  O4'  DG J  29      70.831  62.471  16.921  1.00 85.37           O  
ATOM   5083  C3'  DG J  29      69.949  61.068  15.216  1.00 86.22           C  
ATOM   5084  O3'  DG J  29      70.647  59.822  15.152  1.00 88.39           O  
ATOM   5085  C2'  DG J  29      68.988  61.125  16.393  1.00 84.57           C  
ATOM   5086  C1'  DG J  29      69.884  61.598  17.521  1.00 85.66           C  
ATOM   5087  N9   DG J  29      69.203  62.339  18.578  1.00 86.06           N  
ATOM   5088  C8   DG J  29      68.295  63.356  18.421  1.00 86.58           C  
ATOM   5089  N7   DG J  29      67.875  63.849  19.555  1.00 86.19           N  
ATOM   5090  C5   DG J  29      68.543  63.109  20.520  1.00 86.36           C  
ATOM   5091  C6   DG J  29      68.495  63.192  21.934  1.00 86.57           C  
ATOM   5092  O6   DG J  29      67.843  63.967  22.639  1.00 87.05           O  
ATOM   5093  N1   DG J  29      69.323  62.247  22.528  1.00 87.08           N  
ATOM   5094  C2   DG J  29      70.099  61.341  21.851  1.00 86.70           C  
ATOM   5095  N2   DG J  29      70.822  60.505  22.606  1.00 87.24           N  
ATOM   5096  N3   DG J  29      70.161  61.259  20.533  1.00 85.52           N  
ATOM   5097  C4   DG J  29      69.361  62.167  19.935  1.00 86.32           C  
ATOM   5098  P    DT J  30      69.830  58.446  15.249  1.00 89.11           P  
ATOM   5099  OP1  DT J  30      70.652  57.405  14.591  1.00 90.25           O  
ATOM   5100  OP2  DT J  30      68.428  58.665  14.805  1.00 89.78           O  
ATOM   5101  O5'  DT J  30      69.824  58.153  16.809  1.00 91.74           O  
ATOM   5102  C5'  DT J  30      71.044  57.925  17.497  1.00 96.05           C  
ATOM   5103  C4'  DT J  30      70.806  57.005  18.667  1.00 99.94           C  
ATOM   5104  O4'  DT J  30      70.209  57.748  19.754  1.00100.44           O  
ATOM   5105  C3'  DT J  30      69.848  55.859  18.349  1.00101.97           C  
ATOM   5106  O3'  DT J  30      70.314  54.652  18.951  1.00106.30           O  
ATOM   5107  C2'  DT J  30      68.532  56.320  18.953  1.00101.21           C  
ATOM   5108  C1'  DT J  30      68.981  57.156  20.139  1.00100.92           C  
ATOM   5109  N1   DT J  30      68.059  58.246  20.515  1.00101.33           N  
ATOM   5110  C2   DT J  30      68.009  58.622  21.839  1.00102.45           C  
ATOM   5111  O2   DT J  30      68.684  58.093  22.708  1.00103.42           O  
ATOM   5112  N3   DT J  30      67.136  59.646  22.111  1.00101.98           N  
ATOM   5113  C4   DT J  30      66.326  60.313  21.213  1.00101.51           C  
ATOM   5114  O4   DT J  30      65.595  61.217  21.605  1.00101.16           O  
ATOM   5115  C5   DT J  30      66.424  59.863  19.844  1.00101.37           C  
ATOM   5116  C7   DT J  30      65.577  60.521  18.802  1.00101.61           C  
ATOM   5117  C6   DT J  30      67.276  58.868  19.567  1.00101.54           C  
ATOM   5118  P    DT J  31      69.370  53.355  18.972  1.00109.03           P  
ATOM   5119  OP1  DT J  31      70.235  52.156  18.852  1.00110.81           O  
ATOM   5120  OP2  DT J  31      68.260  53.561  18.004  1.00109.58           O  
ATOM   5121  O5'  DT J  31      68.776  53.381  20.446  1.00109.56           O  
ATOM   5122  C5'  DT J  31      69.652  53.411  21.567  1.00111.45           C  
ATOM   5123  C4'  DT J  31      68.884  53.117  22.831  1.00112.93           C  
ATOM   5124  O4'  DT J  31      68.096  54.271  23.210  1.00113.15           O  
ATOM   5125  C3'  DT J  31      67.904  51.954  22.696  1.00113.60           C  
ATOM   5126  O3'  DT J  31      67.919  51.172  23.890  1.00113.65           O  
ATOM   5127  C2'  DT J  31      66.568  52.645  22.492  1.00113.55           C  
ATOM   5128  C1'  DT J  31      66.726  53.916  23.305  1.00113.81           C  
ATOM   5129  N1   DT J  31      65.931  55.058  22.816  1.00114.45           N  
ATOM   5130  C2   DT J  31      65.354  55.891  23.748  1.00114.65           C  
ATOM   5131  O2   DT J  31      65.453  55.714  24.952  1.00114.90           O  
ATOM   5132  N3   DT J  31      64.649  56.943  23.216  1.00114.23           N  
ATOM   5133  C4   DT J  31      64.464  57.231  21.877  1.00114.25           C  
ATOM   5134  O4   DT J  31      63.815  58.218  21.548  1.00114.38           O  
ATOM   5135  C5   DT J  31      65.081  56.307  20.957  1.00114.36           C  
ATOM   5136  C7   DT J  31      64.912  56.527  19.487  1.00114.35           C  
ATOM   5137  C6   DT J  31      65.779  55.283  21.465  1.00114.48           C  
ATOM   5138  P    DT J  32      66.839  50.003  24.092  1.00113.40           P  
ATOM   5139  OP1  DT J  32      67.535  48.832  24.680  1.00114.14           O  
ATOM   5140  OP2  DT J  32      66.055  49.842  22.840  1.00113.52           O  
ATOM   5141  O5'  DT J  32      65.882  50.618  25.198  1.00113.23           O  
ATOM   5142  C5'  DT J  32      66.432  51.280  26.329  1.00112.34           C  
ATOM   5143  C4'  DT J  32      65.324  51.728  27.248  1.00111.52           C  
ATOM   5144  O4'  DT J  32      64.694  52.921  26.719  1.00110.84           O  
ATOM   5145  C3'  DT J  32      64.221  50.682  27.392  1.00110.60           C  
ATOM   5146  O3'  DT J  32      63.813  50.573  28.754  1.00109.30           O  
ATOM   5147  C2'  DT J  32      63.102  51.219  26.515  1.00111.05           C  
ATOM   5148  C1'  DT J  32      63.295  52.722  26.622  1.00111.29           C  
ATOM   5149  N1   DT J  32      62.801  53.506  25.469  1.00111.54           N  
ATOM   5150  C2   DT J  32      62.160  54.696  25.730  1.00111.41           C  
ATOM   5151  O2   DT J  32      61.972  55.117  26.860  1.00111.70           O  
ATOM   5152  N3   DT J  32      61.742  55.378  24.615  1.00111.35           N  
ATOM   5153  C4   DT J  32      61.891  54.995  23.296  1.00111.62           C  
ATOM   5154  O4   DT J  32      61.467  55.715  22.397  1.00111.70           O  
ATOM   5155  C5   DT J  32      62.560  53.733  23.095  1.00111.51           C  
ATOM   5156  C7   DT J  32      62.756  53.232  21.699  1.00111.62           C  
ATOM   5157  C6   DT J  32      62.979  53.061  24.177  1.00111.83           C  
ATOM   5158  P    DC J  33      62.594  49.608  29.136  1.00107.59           P  
ATOM   5159  OP1  DC J  33      62.800  49.150  30.533  1.00108.84           O  
ATOM   5160  OP2  DC J  33      62.416  48.611  28.052  1.00108.39           O  
ATOM   5161  O5'  DC J  33      61.345  50.588  29.110  1.00106.82           O  
ATOM   5162  C5'  DC J  33      61.271  51.690  30.006  1.00104.36           C  
ATOM   5163  C4'  DC J  33      59.861  52.224  30.041  1.00103.17           C  
ATOM   5164  O4'  DC J  33      59.583  52.959  28.825  1.00102.77           O  
ATOM   5165  C3'  DC J  33      58.800  51.127  30.129  1.00101.96           C  
ATOM   5166  O3'  DC J  33      57.743  51.555  30.976  1.00100.49           O  
ATOM   5167  C2'  DC J  33      58.300  51.002  28.701  1.00102.27           C  
ATOM   5168  C1'  DC J  33      58.426  52.430  28.196  1.00102.40           C  
ATOM   5169  N1   DC J  33      58.605  52.561  26.741  1.00102.18           N  
ATOM   5170  C2   DC J  33      58.478  53.827  26.162  1.00102.07           C  
ATOM   5171  O2   DC J  33      58.223  54.797  26.894  1.00100.94           O  
ATOM   5172  N3   DC J  33      58.636  53.962  24.826  1.00101.54           N  
ATOM   5173  C4   DC J  33      58.909  52.893  24.075  1.00102.08           C  
ATOM   5174  N4   DC J  33      59.053  53.071  22.760  1.00101.09           N  
ATOM   5175  C5   DC J  33      59.045  51.591  24.639  1.00102.50           C  
ATOM   5176  C6   DC J  33      58.887  51.472  25.963  1.00102.21           C  
ATOM   5177  P    DC J  34      56.693  50.488  31.542  1.00 99.31           P  
ATOM   5178  OP1  DC J  34      57.263  49.903  32.777  1.00100.59           O  
ATOM   5179  OP2  DC J  34      56.265  49.594  30.433  1.00100.39           O  
ATOM   5180  O5'  DC J  34      55.472  51.412  31.957  1.00 98.31           O  
ATOM   5181  C5'  DC J  34      55.704  52.747  32.393  1.00 95.08           C  
ATOM   5182  C4'  DC J  34      54.697  53.680  31.767  1.00 93.00           C  
ATOM   5183  O4'  DC J  34      54.964  53.842  30.352  1.00 91.69           O  
ATOM   5184  C3'  DC J  34      53.255  53.187  31.870  1.00 91.70           C  
ATOM   5185  O3'  DC J  34      52.401  54.298  32.108  1.00 90.19           O  
ATOM   5186  C2'  DC J  34      52.978  52.632  30.486  1.00 91.45           C  
ATOM   5187  C1'  DC J  34      53.766  53.602  29.632  1.00 92.39           C  
ATOM   5188  N1   DC J  34      54.119  53.119  28.289  1.00 92.49           N  
ATOM   5189  C2   DC J  34      54.076  54.022  27.222  1.00 91.69           C  
ATOM   5190  O2   DC J  34      53.758  55.199  27.447  1.00 88.50           O  
ATOM   5191  N3   DC J  34      54.384  53.589  25.979  1.00 91.33           N  
ATOM   5192  C4   DC J  34      54.725  52.316  25.782  1.00 92.22           C  
ATOM   5193  N4   DC J  34      55.022  51.932  24.538  1.00 92.35           N  
ATOM   5194  C5   DC J  34      54.780  51.376  26.851  1.00 92.54           C  
ATOM   5195  C6   DC J  34      54.474  51.816  28.078  1.00 92.28           C  
ATOM   5196  P    DA J  35      51.340  54.241  33.304  1.00 90.11           P  
ATOM   5197  OP1  DA J  35      52.110  54.050  34.557  1.00 90.79           O  
ATOM   5198  OP2  DA J  35      50.270  53.275  32.942  1.00 88.84           O  
ATOM   5199  O5'  DA J  35      50.733  55.710  33.305  1.00 86.79           O  
ATOM   5200  C5'  DA J  35      51.590  56.842  33.180  1.00 82.23           C  
ATOM   5201  C4'  DA J  35      51.181  57.681  31.991  1.00 78.19           C  
ATOM   5202  O4'  DA J  35      51.437  56.957  30.764  1.00 76.23           O  
ATOM   5203  C3'  DA J  35      49.702  58.048  31.961  1.00 75.98           C  
ATOM   5204  O3'  DA J  35      49.543  59.381  31.488  1.00 75.30           O  
ATOM   5205  C2'  DA J  35      49.103  57.047  30.991  1.00 75.16           C  
ATOM   5206  C1'  DA J  35      50.240  56.779  30.024  1.00 74.60           C  
ATOM   5207  N9   DA J  35      50.246  55.412  29.508  1.00 75.58           N  
ATOM   5208  C8   DA J  35      49.998  54.267  30.220  1.00 76.71           C  
ATOM   5209  N7   DA J  35      50.094  53.170  29.511  1.00 77.70           N  
ATOM   5210  C5   DA J  35      50.421  53.623  28.241  1.00 78.11           C  
ATOM   5211  C6   DA J  35      50.662  52.950  27.031  1.00 78.70           C  
ATOM   5212  N6   DA J  35      50.614  51.623  26.902  1.00 79.25           N  
ATOM   5213  N1   DA J  35      50.955  53.696  25.944  1.00 77.80           N  
ATOM   5214  C2   DA J  35      51.000  55.024  26.078  1.00 77.37           C  
ATOM   5215  N3   DA J  35      50.797  55.772  27.160  1.00 77.31           N  
ATOM   5216  C4   DA J  35      50.508  55.003  28.222  1.00 76.99           C  
ATOM   5217  P    DA J  36      48.074  60.008  31.367  1.00 74.68           P  
ATOM   5218  OP1  DA J  36      48.202  61.479  31.520  1.00 74.94           O  
ATOM   5219  OP2  DA J  36      47.169  59.250  32.268  1.00 76.05           O  
ATOM   5220  O5'  DA J  36      47.662  59.684  29.866  1.00 73.24           O  
ATOM   5221  C5'  DA J  36      48.409  60.229  28.786  1.00 69.46           C  
ATOM   5222  C4'  DA J  36      47.845  59.759  27.467  1.00 67.88           C  
ATOM   5223  O4'  DA J  36      48.148  58.361  27.236  1.00 66.65           O  
ATOM   5224  C3'  DA J  36      46.329  59.893  27.305  1.00 65.95           C  
ATOM   5225  O3'  DA J  36      46.076  60.232  25.946  1.00 63.74           O  
ATOM   5226  C2'  DA J  36      45.843  58.475  27.531  1.00 67.65           C  
ATOM   5227  C1'  DA J  36      46.953  57.710  26.841  1.00 69.05           C  
ATOM   5228  N9   DA J  36      47.060  56.289  27.172  1.00 73.25           N  
ATOM   5229  C8   DA J  36      46.785  55.658  28.359  1.00 74.74           C  
ATOM   5230  N7   DA J  36      46.946  54.357  28.315  1.00 75.41           N  
ATOM   5231  C5   DA J  36      47.365  54.118  27.014  1.00 75.05           C  
ATOM   5232  C6   DA J  36      47.709  52.936  26.334  1.00 76.10           C  
ATOM   5233  N6   DA J  36      47.698  51.727  26.897  1.00 75.08           N  
ATOM   5234  N1   DA J  36      48.081  53.044  25.038  1.00 76.29           N  
ATOM   5235  C2   DA J  36      48.114  54.261  24.482  1.00 74.64           C  
ATOM   5236  N3   DA J  36      47.820  55.442  25.021  1.00 72.23           N  
ATOM   5237  C4   DA J  36      47.448  55.298  26.302  1.00 72.55           C  
ATOM   5238  P    DA J  37      44.674  60.877  25.519  1.00 63.34           P  
ATOM   5239  OP1  DA J  37      44.717  62.332  25.786  1.00 61.69           O  
ATOM   5240  OP2  DA J  37      43.565  60.058  26.060  1.00 60.40           O  
ATOM   5241  O5'  DA J  37      44.696  60.701  23.948  1.00 62.52           O  
ATOM   5242  C5'  DA J  37      45.929  60.747  23.241  1.00 61.87           C  
ATOM   5243  C4'  DA J  37      45.868  59.796  22.075  1.00 59.84           C  
ATOM   5244  O4'  DA J  37      46.122  58.440  22.517  1.00 60.87           O  
ATOM   5245  C3'  DA J  37      44.471  59.795  21.472  1.00 58.86           C  
ATOM   5246  O3'  DA J  37      44.503  59.799  20.063  1.00 55.72           O  
ATOM   5247  C2'  DA J  37      43.846  58.516  21.984  1.00 61.23           C  
ATOM   5248  C1'  DA J  37      45.035  57.598  22.172  1.00 63.03           C  
ATOM   5249  N9   DA J  37      44.833  56.658  23.273  1.00 65.13           N  
ATOM   5250  C8   DA J  37      44.393  56.950  24.541  1.00 64.93           C  
ATOM   5251  N7   DA J  37      44.289  55.902  25.318  1.00 68.07           N  
ATOM   5252  C5   DA J  37      44.693  54.848  24.511  1.00 68.36           C  
ATOM   5253  C6   DA J  37      44.812  53.467  24.749  1.00 70.20           C  
ATOM   5254  N6   DA J  37      44.522  52.894  25.917  1.00 69.87           N  
ATOM   5255  N1   DA J  37      45.245  52.688  23.731  1.00 69.66           N  
ATOM   5256  C2   DA J  37      45.535  53.269  22.561  1.00 68.77           C  
ATOM   5257  N3   DA J  37      45.464  54.556  22.216  1.00 68.61           N  
ATOM   5258  C4   DA J  37      45.033  55.300  23.248  1.00 66.67           C  
ATOM   5259  P    DT J  38      43.128  59.719  19.265  1.00 56.91           P  
ATOM   5260  OP1  DT J  38      43.215  60.575  18.061  1.00 58.19           O  
ATOM   5261  OP2  DT J  38      42.024  59.912  20.224  1.00 56.29           O  
ATOM   5262  O5'  DT J  38      43.098  58.202  18.835  1.00 63.12           O  
ATOM   5263  C5'  DT J  38      42.271  57.768  17.790  1.00 74.65           C  
ATOM   5264  C4'  DT J  38      42.901  56.573  17.127  1.00 81.83           C  
ATOM   5265  O4'  DT J  38      43.409  55.682  18.146  1.00 82.69           O  
ATOM   5266  C3'  DT J  38      41.897  55.770  16.323  1.00 85.63           C  
ATOM   5267  O3'  DT J  38      42.539  55.199  15.192  1.00 91.45           O  
ATOM   5268  C2'  DT J  38      41.411  54.732  17.319  1.00 85.62           C  
ATOM   5269  C1'  DT J  38      42.619  54.505  18.219  1.00 85.22           C  
ATOM   5270  N1   DT J  38      42.292  54.281  19.645  1.00 86.06           N  
ATOM   5271  C2   DT J  38      42.276  52.989  20.123  1.00 86.35           C  
ATOM   5272  O2   DT J  38      42.466  52.016  19.413  1.00 88.01           O  
ATOM   5273  N3   DT J  38      42.018  52.878  21.469  1.00 85.37           N  
ATOM   5274  C4   DT J  38      41.766  53.905  22.358  1.00 85.89           C  
ATOM   5275  O4   DT J  38      41.571  53.654  23.546  1.00 84.93           O  
ATOM   5276  C5   DT J  38      41.762  55.232  21.780  1.00 86.02           C  
ATOM   5277  C7   DT J  38      41.463  56.406  22.658  1.00 85.66           C  
ATOM   5278  C6   DT J  38      42.027  55.351  20.473  1.00 85.85           C  
ATOM   5279  P    DA J  39      41.652  54.541  14.042  1.00 97.12           P  
ATOM   5280  OP1  DA J  39      42.574  54.136  12.948  1.00 97.28           O  
ATOM   5281  OP2  DA J  39      40.521  55.458  13.751  1.00 95.86           O  
ATOM   5282  O5'  DA J  39      41.095  53.231  14.752  1.00 98.81           O  
ATOM   5283  C5'  DA J  39      41.974  52.151  15.054  1.00103.57           C  
ATOM   5284  C4'  DA J  39      41.186  50.965  15.555  1.00106.55           C  
ATOM   5285  O4'  DA J  39      40.987  51.045  16.987  1.00107.41           O  
ATOM   5286  C3'  DA J  39      39.795  50.847  14.932  1.00108.30           C  
ATOM   5287  O3'  DA J  39      39.520  49.495  14.570  1.00109.73           O  
ATOM   5288  C2'  DA J  39      38.868  51.311  16.042  1.00108.04           C  
ATOM   5289  C1'  DA J  39      39.614  50.864  17.285  1.00108.05           C  
ATOM   5290  N9   DA J  39      39.310  51.631  18.493  1.00108.63           N  
ATOM   5291  C8   DA J  39      39.210  52.992  18.625  1.00109.46           C  
ATOM   5292  N7   DA J  39      38.933  53.388  19.844  1.00109.52           N  
ATOM   5293  C5   DA J  39      38.836  52.206  20.563  1.00109.24           C  
ATOM   5294  C6   DA J  39      38.558  51.943  21.914  1.00109.43           C  
ATOM   5295  N6   DA J  39      38.310  52.894  22.817  1.00109.30           N  
ATOM   5296  N1   DA J  39      38.539  50.652  22.310  1.00109.18           N  
ATOM   5297  C2   DA J  39      38.780  49.701  21.401  1.00109.37           C  
ATOM   5298  N3   DA J  39      39.051  49.823  20.104  1.00109.33           N  
ATOM   5299  C4   DA J  39      39.065  51.116  19.744  1.00109.07           C  
ATOM   5300  P    DC J  40      38.137  49.139  13.843  1.00110.98           P  
ATOM   5301  OP1  DC J  40      38.375  47.936  13.007  1.00110.15           O  
ATOM   5302  OP2  DC J  40      37.589  50.372  13.219  1.00110.33           O  
ATOM   5303  O5'  DC J  40      37.196  48.733  15.058  1.00112.07           O  
ATOM   5304  C5'  DC J  40      37.505  47.596  15.856  1.00115.48           C  
ATOM   5305  C4'  DC J  40      36.355  47.285  16.783  1.00117.97           C  
ATOM   5306  O4'  DC J  40      36.377  48.168  17.931  1.00118.51           O  
ATOM   5307  C3'  DC J  40      34.977  47.450  16.142  1.00119.30           C  
ATOM   5308  O3'  DC J  40      34.108  46.411  16.588  1.00121.14           O  
ATOM   5309  C2'  DC J  40      34.498  48.780  16.692  1.00119.18           C  
ATOM   5310  C1'  DC J  40      35.096  48.754  18.085  1.00119.40           C  
ATOM   5311  N1   DC J  40      35.265  50.068  18.725  1.00119.94           N  
ATOM   5312  C2   DC J  40      35.349  50.126  20.117  1.00120.44           C  
ATOM   5313  O2   DC J  40      35.305  49.070  20.764  1.00120.32           O  
ATOM   5314  N3   DC J  40      35.477  51.328  20.722  1.00121.12           N  
ATOM   5315  C4   DC J  40      35.526  52.442  19.989  1.00120.76           C  
ATOM   5316  N4   DC J  40      35.644  53.606  20.629  1.00120.94           N  
ATOM   5317  C5   DC J  40      35.454  52.410  18.566  1.00120.58           C  
ATOM   5318  C6   DC J  40      35.327  51.213  17.981  1.00120.18           C  
ATOM   5319  P    DA J  41      32.676  46.218  15.892  1.00122.65           P  
ATOM   5320  OP1  DA J  41      32.729  44.981  15.075  1.00123.52           O  
ATOM   5321  OP2  DA J  41      32.280  47.500  15.256  1.00122.46           O  
ATOM   5322  O5'  DA J  41      31.711  45.962  17.129  1.00122.79           O  
ATOM   5323  C5'  DA J  41      32.026  44.971  18.103  1.00123.55           C  
ATOM   5324  C4'  DA J  41      31.087  45.089  19.278  1.00124.02           C  
ATOM   5325  O4'  DA J  41      31.430  46.260  20.058  1.00123.87           O  
ATOM   5326  C3'  DA J  41      29.634  45.274  18.850  1.00124.30           C  
ATOM   5327  O3'  DA J  41      28.761  44.572  19.741  1.00124.55           O  
ATOM   5328  C2'  DA J  41      29.440  46.778  18.928  1.00123.99           C  
ATOM   5329  C1'  DA J  41      30.335  47.163  20.094  1.00124.21           C  
ATOM   5330  N9   DA J  41      30.872  48.524  20.027  1.00124.14           N  
ATOM   5331  C8   DA J  41      31.339  49.193  18.922  1.00123.87           C  
ATOM   5332  N7   DA J  41      31.764  50.407  19.179  1.00123.55           N  
ATOM   5333  C5   DA J  41      31.563  50.549  20.544  1.00123.65           C  
ATOM   5334  C6   DA J  41      31.811  51.611  21.433  1.00123.96           C  
ATOM   5335  N6   DA J  41      32.335  52.782  21.062  1.00123.28           N  
ATOM   5336  N1   DA J  41      31.498  51.427  22.734  1.00123.68           N  
ATOM   5337  C2   DA J  41      30.971  50.255  23.105  1.00123.92           C  
ATOM   5338  N3   DA J  41      30.690  49.184  22.365  1.00123.98           N  
ATOM   5339  C4   DA J  41      31.014  49.397  21.079  1.00123.77           C  
ATOM   5340  P    DC J  42      27.312  44.102  19.229  1.00125.26           P  
ATOM   5341  OP1  DC J  42      27.047  42.740  19.758  1.00126.05           O  
ATOM   5342  OP2  DC J  42      27.245  44.348  17.765  1.00125.09           O  
ATOM   5343  O5'  DC J  42      26.327  45.121  19.950  1.00124.46           O  
ATOM   5344  C5'  DC J  42      26.823  46.363  20.430  1.00123.43           C  
ATOM   5345  C4'  DC J  42      26.582  46.485  21.914  1.00122.20           C  
ATOM   5346  O4'  DC J  42      27.389  47.567  22.428  1.00122.31           O  
ATOM   5347  C3'  DC J  42      25.142  46.830  22.265  1.00121.92           C  
ATOM   5348  O3'  DC J  42      24.767  46.222  23.500  1.00120.99           O  
ATOM   5349  C2'  DC J  42      25.158  48.344  22.364  1.00122.13           C  
ATOM   5350  C1'  DC J  42      26.578  48.670  22.806  1.00122.10           C  
ATOM   5351  N1   DC J  42      27.129  49.856  22.137  1.00122.22           N  
ATOM   5352  C2   DC J  42      27.499  50.960  22.904  1.00122.09           C  
ATOM   5353  O2   DC J  42      27.342  50.916  24.131  1.00122.20           O  
ATOM   5354  N3   DC J  42      28.019  52.047  22.287  1.00122.19           N  
ATOM   5355  C4   DC J  42      28.168  52.054  20.960  1.00122.53           C  
ATOM   5356  N4   DC J  42      28.685  53.145  20.391  1.00122.35           N  
ATOM   5357  C5   DC J  42      27.794  50.941  20.155  1.00122.75           C  
ATOM   5358  C6   DC J  42      27.283  49.875  20.779  1.00122.61           C  
ATOM   5359  P    DT J  43      23.319  46.524  24.118  1.00120.26           P  
ATOM   5360  OP1  DT J  43      23.081  45.540  25.205  1.00120.78           O  
ATOM   5361  OP2  DT J  43      22.345  46.641  23.001  1.00120.23           O  
ATOM   5362  O5'  DT J  43      23.496  47.962  24.774  1.00118.44           O  
ATOM   5363  C5'  DT J  43      24.299  48.134  25.934  1.00116.23           C  
ATOM   5364  C4'  DT J  43      23.974  49.453  26.592  1.00114.73           C  
ATOM   5365  O4'  DT J  43      24.603  50.543  25.874  1.00114.24           O  
ATOM   5366  C3'  DT J  43      22.480  49.766  26.622  1.00113.58           C  
ATOM   5367  O3'  DT J  43      22.130  50.345  27.876  1.00112.03           O  
ATOM   5368  C2'  DT J  43      22.303  50.762  25.490  1.00113.38           C  
ATOM   5369  C1'  DT J  43      23.627  51.502  25.500  1.00113.79           C  
ATOM   5370  N1   DT J  43      24.017  52.064  24.191  1.00113.60           N  
ATOM   5371  C2   DT J  43      24.506  53.354  24.153  1.00113.41           C  
ATOM   5372  O2   DT J  43      24.654  54.044  25.150  1.00113.53           O  
ATOM   5373  N3   DT J  43      24.819  53.809  22.895  1.00112.82           N  
ATOM   5374  C4   DT J  43      24.697  53.119  21.703  1.00113.08           C  
ATOM   5375  O4   DT J  43      25.007  53.661  20.647  1.00112.66           O  
ATOM   5376  C5   DT J  43      24.193  51.771  21.819  1.00112.94           C  
ATOM   5377  C7   DT J  43      24.038  50.947  20.580  1.00112.53           C  
ATOM   5378  C6   DT J  43      23.883  51.317  23.040  1.00112.95           C  
ATOM   5379  P    DT J  44      20.687  51.017  28.067  1.00110.72           P  
ATOM   5380  OP1  DT J  44      20.237  50.680  29.441  1.00112.26           O  
ATOM   5381  OP2  DT J  44      19.822  50.686  26.906  1.00110.35           O  
ATOM   5382  O5'  DT J  44      21.022  52.570  28.020  1.00108.35           O  
ATOM   5383  C5'  DT J  44      22.167  53.070  28.700  1.00102.95           C  
ATOM   5384  C4'  DT J  44      22.239  54.572  28.571  1.00 98.73           C  
ATOM   5385  O4'  DT J  44      22.670  54.945  27.242  1.00 97.00           O  
ATOM   5386  C3'  DT J  44      20.915  55.295  28.816  1.00 95.95           C  
ATOM   5387  O3'  DT J  44      21.160  56.442  29.625  1.00 93.46           O  
ATOM   5388  C2'  DT J  44      20.452  55.674  27.419  1.00 94.79           C  
ATOM   5389  C1'  DT J  44      21.762  55.882  26.684  1.00 95.27           C  
ATOM   5390  N1   DT J  44      21.715  55.653  25.226  1.00 93.64           N  
ATOM   5391  C2   DT J  44      22.228  56.632  24.407  1.00 93.53           C  
ATOM   5392  O2   DT J  44      22.686  57.681  24.831  1.00 93.59           O  
ATOM   5393  N3   DT J  44      22.185  56.339  23.066  1.00 92.69           N  
ATOM   5394  C4   DT J  44      21.683  55.195  22.475  1.00 91.73           C  
ATOM   5395  O4   DT J  44      21.722  55.067  21.254  1.00 88.94           O  
ATOM   5396  C5   DT J  44      21.140  54.221  23.391  1.00 92.10           C  
ATOM   5397  C7   DT J  44      20.553  52.961  22.839  1.00 92.75           C  
ATOM   5398  C6   DT J  44      21.185  54.492  24.703  1.00 93.19           C  
ATOM   5399  P    DT J  45      19.984  57.496  29.900  1.00 91.83           P  
ATOM   5400  OP1  DT J  45      20.054  57.856  31.338  1.00 92.15           O  
ATOM   5401  OP2  DT J  45      18.706  57.016  29.320  1.00 91.52           O  
ATOM   5402  O5'  DT J  45      20.479  58.754  29.070  1.00 91.53           O  
ATOM   5403  C5'  DT J  45      21.853  59.110  29.100  1.00 87.50           C  
ATOM   5404  C4'  DT J  45      22.092  60.335  28.258  1.00 84.01           C  
ATOM   5405  O4'  DT J  45      21.960  59.990  26.861  1.00 81.79           O  
ATOM   5406  C3'  DT J  45      21.116  61.480  28.522  1.00 82.49           C  
ATOM   5407  O3'  DT J  45      21.853  62.701  28.605  1.00 80.50           O  
ATOM   5408  C2'  DT J  45      20.175  61.432  27.328  1.00 80.93           C  
ATOM   5409  C1'  DT J  45      21.052  60.864  26.223  1.00 81.39           C  
ATOM   5410  N1   DT J  45      20.355  60.087  25.178  1.00 83.14           N  
ATOM   5411  C2   DT J  45      20.719  60.303  23.869  1.00 84.66           C  
ATOM   5412  O2   DT J  45      21.569  61.111  23.543  1.00 87.08           O  
ATOM   5413  N3   DT J  45      20.051  59.535  22.952  1.00 85.50           N  
ATOM   5414  C4   DT J  45      19.075  58.589  23.208  1.00 87.33           C  
ATOM   5415  O4   DT J  45      18.563  57.966  22.278  1.00 89.03           O  
ATOM   5416  C5   DT J  45      18.739  58.416  24.601  1.00 85.73           C  
ATOM   5417  C7   DT J  45      17.699  57.408  24.973  1.00 87.47           C  
ATOM   5418  C6   DT J  45      19.382  59.168  25.505  1.00 85.21           C  
ATOM   5419  P    DT J  46      21.082  64.097  28.737  1.00 77.47           P  
ATOM   5420  OP1  DT J  46      21.952  64.991  29.541  1.00 77.57           O  
ATOM   5421  OP2  DT J  46      19.674  63.871  29.149  1.00 80.26           O  
ATOM   5422  O5'  DT J  46      21.079  64.615  27.238  1.00 80.01           O  
ATOM   5423  C5'  DT J  46      22.280  64.587  26.470  1.00 79.42           C  
ATOM   5424  C4'  DT J  46      22.054  65.266  25.144  1.00 78.69           C  
ATOM   5425  O4'  DT J  46      21.427  64.353  24.209  1.00 78.75           O  
ATOM   5426  C3'  DT J  46      21.129  66.477  25.258  1.00 78.63           C  
ATOM   5427  O3'  DT J  46      21.629  67.537  24.461  1.00 77.23           O  
ATOM   5428  C2'  DT J  46      19.814  65.971  24.694  1.00 80.30           C  
ATOM   5429  C1'  DT J  46      20.265  64.949  23.666  1.00 79.89           C  
ATOM   5430  N1   DT J  46      19.278  63.883  23.409  1.00 80.25           N  
ATOM   5431  C2   DT J  46      19.030  63.521  22.103  1.00 80.68           C  
ATOM   5432  O2   DT J  46      19.610  64.011  21.150  1.00 78.52           O  
ATOM   5433  N3   DT J  46      18.075  62.548  21.953  1.00 83.12           N  
ATOM   5434  C4   DT J  46      17.369  61.904  22.952  1.00 82.34           C  
ATOM   5435  O4   DT J  46      16.543  61.042  22.658  1.00 83.65           O  
ATOM   5436  C5   DT J  46      17.689  62.322  24.297  1.00 80.88           C  
ATOM   5437  C7   DT J  46      16.981  61.678  25.447  1.00 80.33           C  
ATOM   5438  C6   DT J  46      18.615  63.277  24.455  1.00 80.28           C  
ATOM   5439  P    DG J  47      21.136  69.043  24.719  1.00 78.22           P  
ATOM   5440  OP1  DG J  47      21.951  69.623  25.813  1.00 78.36           O  
ATOM   5441  OP2  DG J  47      19.652  69.096  24.804  1.00 76.10           O  
ATOM   5442  O5'  DG J  47      21.584  69.731  23.363  1.00 72.36           O  
ATOM   5443  C5'  DG J  47      22.722  69.232  22.683  1.00 62.47           C  
ATOM   5444  C4'  DG J  47      22.452  69.157  21.205  1.00 57.93           C  
ATOM   5445  O4'  DG J  47      21.485  68.124  20.916  1.00 58.87           O  
ATOM   5446  C3'  DG J  47      21.895  70.447  20.618  1.00 54.34           C  
ATOM   5447  O3'  DG J  47      22.555  70.668  19.383  1.00 52.52           O  
ATOM   5448  C2'  DG J  47      20.406  70.175  20.481  1.00 56.39           C  
ATOM   5449  C1'  DG J  47      20.319  68.665  20.311  1.00 58.31           C  
ATOM   5450  N9   DG J  47      19.175  68.075  20.999  1.00 62.37           N  
ATOM   5451  C8   DG J  47      18.724  68.401  22.252  1.00 62.66           C  
ATOM   5452  N7   DG J  47      17.713  67.676  22.638  1.00 63.58           N  
ATOM   5453  C5   DG J  47      17.469  66.827  21.570  1.00 62.48           C  
ATOM   5454  C6   DG J  47      16.494  65.807  21.414  1.00 62.64           C  
ATOM   5455  O6   DG J  47      15.623  65.448  22.215  1.00 61.09           O  
ATOM   5456  N1   DG J  47      16.600  65.185  20.176  1.00 62.26           N  
ATOM   5457  C2   DG J  47      17.526  65.503  19.210  1.00 65.21           C  
ATOM   5458  N2   DG J  47      17.474  64.790  18.074  1.00 61.70           N  
ATOM   5459  N3   DG J  47      18.441  66.452  19.347  1.00 63.51           N  
ATOM   5460  C4   DG J  47      18.355  67.067  20.543  1.00 62.57           C  
ATOM   5461  P    DG J  48      22.074  71.832  18.410  1.00 48.28           P  
ATOM   5462  OP1  DG J  48      23.254  72.270  17.623  1.00 46.60           O  
ATOM   5463  OP2  DG J  48      21.263  72.833  19.135  1.00 45.53           O  
ATOM   5464  O5'  DG J  48      21.144  71.010  17.441  1.00 53.32           O  
ATOM   5465  C5'  DG J  48      20.156  71.645  16.704  1.00 56.94           C  
ATOM   5466  C4'  DG J  48      19.524  70.651  15.773  1.00 60.52           C  
ATOM   5467  O4'  DG J  48      18.912  69.580  16.531  1.00 60.36           O  
ATOM   5468  C3'  DG J  48      18.413  71.314  14.990  1.00 62.15           C  
ATOM   5469  O3'  DG J  48      18.476  70.902  13.651  1.00 65.47           O  
ATOM   5470  C2'  DG J  48      17.144  70.873  15.685  1.00 64.08           C  
ATOM   5471  C1'  DG J  48      17.520  69.527  16.265  1.00 63.88           C  
ATOM   5472  N9   DG J  48      16.831  69.253  17.519  1.00 66.52           N  
ATOM   5473  C8   DG J  48      17.038  69.857  18.735  1.00 69.06           C  
ATOM   5474  N7   DG J  48      16.237  69.415  19.668  1.00 70.89           N  
ATOM   5475  C5   DG J  48      15.463  68.458  19.027  1.00 71.31           C  
ATOM   5476  C6   DG J  48      14.414  67.643  19.521  1.00 73.17           C  
ATOM   5477  O6   DG J  48      13.937  67.607  20.664  1.00 75.07           O  
ATOM   5478  N1   DG J  48      13.905  66.811  18.529  1.00 72.83           N  
ATOM   5479  C2   DG J  48      14.340  66.774  17.228  1.00 71.74           C  
ATOM   5480  N2   DG J  48      13.716  65.907  16.416  1.00 71.71           N  
ATOM   5481  N3   DG J  48      15.312  67.531  16.755  1.00 70.29           N  
ATOM   5482  C4   DG J  48      15.824  68.343  17.702  1.00 69.68           C  
ATOM   5483  P    DT J  49      17.906  71.870  12.538  1.00 71.21           P  
ATOM   5484  OP1  DT J  49      18.851  71.907  11.398  1.00 70.94           O  
ATOM   5485  OP2  DT J  49      17.561  73.116  13.257  1.00 72.00           O  
ATOM   5486  O5'  DT J  49      16.555  71.148  12.120  1.00 77.71           O  
ATOM   5487  C5'  DT J  49      16.238  69.848  12.623  1.00 84.41           C  
ATOM   5488  C4'  DT J  49      14.742  69.700  12.763  1.00 90.20           C  
ATOM   5489  O4'  DT J  49      14.356  69.552  14.153  1.00 89.87           O  
ATOM   5490  C3'  DT J  49      13.960  70.899  12.227  1.00 93.67           C  
ATOM   5491  O3'  DT J  49      12.838  70.455  11.474  1.00100.77           O  
ATOM   5492  C2'  DT J  49      13.488  71.606  13.483  1.00 92.76           C  
ATOM   5493  C1'  DT J  49      13.283  70.438  14.423  1.00 91.68           C  
ATOM   5494  N1   DT J  49      13.297  70.772  15.863  1.00 93.43           N  
ATOM   5495  C2   DT J  49      12.786  69.846  16.750  1.00 93.43           C  
ATOM   5496  O2   DT J  49      12.357  68.756  16.405  1.00 93.56           O  
ATOM   5497  N3   DT J  49      12.801  70.244  18.065  1.00 92.21           N  
ATOM   5498  C4   DT J  49      13.272  71.440  18.571  1.00 92.90           C  
ATOM   5499  O4   DT J  49      13.213  71.662  19.779  1.00 90.89           O  
ATOM   5500  C5   DT J  49      13.809  72.354  17.588  1.00 93.43           C  
ATOM   5501  C7   DT J  49      14.357  73.669  18.044  1.00 96.25           C  
ATOM   5502  C6   DT J  49      13.793  71.980  16.301  1.00 93.76           C  
ATOM   5503  P    DA J  50      12.414  71.248  10.149  1.00106.73           P  
ATOM   5504  OP1  DA J  50      13.362  70.911   9.056  1.00106.87           O  
ATOM   5505  OP2  DA J  50      12.207  72.667  10.533  1.00107.00           O  
ATOM   5506  O5'  DA J  50      11.003  70.623   9.785  1.00109.33           O  
ATOM   5507  C5'  DA J  50      10.804  69.216   9.788  1.00113.99           C  
ATOM   5508  C4'  DA J  50       9.444  68.910  10.362  1.00117.20           C  
ATOM   5509  O4'  DA J  50       9.523  68.881  11.809  1.00117.89           O  
ATOM   5510  C3'  DA J  50       8.440  70.005  10.007  1.00119.44           C  
ATOM   5511  O3'  DA J  50       7.177  69.470   9.625  1.00122.37           O  
ATOM   5512  C2'  DA J  50       8.326  70.821  11.282  1.00119.32           C  
ATOM   5513  C1'  DA J  50       8.592  69.793  12.366  1.00118.89           C  
ATOM   5514  N9   DA J  50       9.184  70.363  13.577  1.00118.79           N  
ATOM   5515  C8   DA J  50      10.216  71.262  13.652  1.00119.21           C  
ATOM   5516  N7   DA J  50      10.525  71.613  14.877  1.00119.45           N  
ATOM   5517  C5   DA J  50       9.637  70.894  15.663  1.00119.44           C  
ATOM   5518  C6   DA J  50       9.446  70.826  17.056  1.00119.48           C  
ATOM   5519  N6   DA J  50      10.168  71.520  17.939  1.00119.09           N  
ATOM   5520  N1   DA J  50       8.473  70.010  17.517  1.00119.50           N  
ATOM   5521  C2   DA J  50       7.750  69.315  16.632  1.00119.17           C  
ATOM   5522  N3   DA J  50       7.835  69.294  15.303  1.00119.43           N  
ATOM   5523  C4   DA J  50       8.809  70.114  14.876  1.00119.08           C  
ATOM   5524  P    DG J  51       6.011  70.472   9.171  1.00123.95           P  
ATOM   5525  OP1  DG J  51       5.084  69.718   8.291  1.00124.82           O  
ATOM   5526  OP2  DG J  51       6.634  71.728   8.678  1.00123.61           O  
ATOM   5527  O5'  DG J  51       5.261  70.788  10.537  1.00125.96           O  
ATOM   5528  C5'  DG J  51       4.575  69.754  11.234  1.00129.37           C  
ATOM   5529  C4'  DG J  51       3.598  70.350  12.218  1.00131.85           C  
ATOM   5530  O4'  DG J  51       4.289  70.761  13.424  1.00132.31           O  
ATOM   5531  C3'  DG J  51       2.860  71.584  11.698  1.00133.11           C  
ATOM   5532  O3'  DG J  51       1.474  71.503  12.034  1.00135.16           O  
ATOM   5533  C2'  DG J  51       3.535  72.732  12.429  1.00133.39           C  
ATOM   5534  C1'  DG J  51       3.927  72.092  13.746  1.00133.31           C  
ATOM   5535  N9   DG J  51       5.064  72.726  14.404  1.00134.03           N  
ATOM   5536  C8   DG J  51       6.131  73.346  13.800  1.00134.78           C  
ATOM   5537  N7   DG J  51       6.986  73.844  14.653  1.00134.71           N  
ATOM   5538  C5   DG J  51       6.454  73.530  15.895  1.00134.29           C  
ATOM   5539  C6   DG J  51       6.936  73.815  17.199  1.00134.01           C  
ATOM   5540  O6   DG J  51       7.961  74.424  17.527  1.00133.87           O  
ATOM   5541  N1   DG J  51       6.087  73.310  18.178  1.00134.43           N  
ATOM   5542  C2   DG J  51       4.925  72.621  17.937  1.00134.23           C  
ATOM   5543  N2   DG J  51       4.248  72.210  19.019  1.00134.67           N  
ATOM   5544  N3   DG J  51       4.461  72.352  16.727  1.00134.11           N  
ATOM   5545  C4   DG J  51       5.270  72.834  15.760  1.00134.25           C  
ATOM   5546  P    DA J  52       0.540  72.805  11.912  1.00137.06           P  
ATOM   5547  OP1  DA J  52      -0.761  72.383  11.335  1.00137.08           O  
ATOM   5548  OP2  DA J  52       1.308  73.901  11.265  1.00136.38           O  
ATOM   5549  O5'  DA J  52       0.299  73.196  13.434  1.00138.06           O  
ATOM   5550  C5'  DA J  52      -0.014  72.186  14.390  1.00139.72           C  
ATOM   5551  C4'  DA J  52      -0.331  72.811  15.726  1.00140.81           C  
ATOM   5552  O4'  DA J  52       0.884  73.311  16.335  1.00141.34           O  
ATOM   5553  C3'  DA J  52      -1.288  73.997  15.641  1.00141.44           C  
ATOM   5554  O3'  DA J  52      -2.218  73.949  16.724  1.00141.86           O  
ATOM   5555  C2'  DA J  52      -0.368  75.201  15.746  1.00141.91           C  
ATOM   5556  C1'  DA J  52       0.743  74.689  16.643  1.00142.32           C  
ATOM   5557  N9   DA J  52       2.037  75.334  16.421  1.00143.32           N  
ATOM   5558  C8   DA J  52       2.557  75.799  15.236  1.00143.47           C  
ATOM   5559  N7   DA J  52       3.750  76.331  15.354  1.00143.67           N  
ATOM   5560  C5   DA J  52       4.036  76.209  16.707  1.00143.99           C  
ATOM   5561  C6   DA J  52       5.154  76.582  17.473  1.00144.22           C  
ATOM   5562  N6   DA J  52       6.237  77.172  16.963  1.00144.22           N  
ATOM   5563  N1   DA J  52       5.122  76.321  18.799  1.00144.30           N  
ATOM   5564  C2   DA J  52       4.036  75.725  19.308  1.00144.57           C  
ATOM   5565  N3   DA J  52       2.925  75.326  18.691  1.00144.15           N  
ATOM   5566  C4   DA J  52       2.989  75.599  17.376  1.00143.91           C  
ATOM   5567  P    DA J  53      -3.036  75.267  17.131  1.00142.07           P  
ATOM   5568  OP1  DA J  53      -4.315  74.839  17.752  1.00142.32           O  
ATOM   5569  OP2  DA J  53      -3.059  76.179  15.959  1.00142.30           O  
ATOM   5570  O5'  DA J  53      -2.124  75.917  18.262  1.00141.91           O  
ATOM   5571  C5'  DA J  53      -1.861  75.208  19.470  1.00142.41           C  
ATOM   5572  C4'  DA J  53      -1.473  76.169  20.568  1.00142.64           C  
ATOM   5573  O4'  DA J  53      -0.088  76.568  20.426  1.00143.47           O  
ATOM   5574  C3'  DA J  53      -2.294  77.459  20.585  1.00142.41           C  
ATOM   5575  O3'  DA J  53      -2.614  77.825  21.927  1.00140.67           O  
ATOM   5576  C2'  DA J  53      -1.355  78.481  19.971  1.00143.16           C  
ATOM   5577  C1'  DA J  53       0.004  77.984  20.429  1.00143.96           C  
ATOM   5578  N9   DA J  53       1.106  78.368  19.547  1.00144.87           N  
ATOM   5579  C8   DA J  53       1.144  78.310  18.175  1.00145.18           C  
ATOM   5580  N7   DA J  53       2.269  78.740  17.658  1.00145.32           N  
ATOM   5581  C5   DA J  53       3.026  79.104  18.764  1.00145.08           C  
ATOM   5582  C6   DA J  53       4.319  79.639  18.889  1.00145.19           C  
ATOM   5583  N6   DA J  53       5.109  79.915  17.849  1.00145.14           N  
ATOM   5584  N1   DA J  53       4.778  79.887  20.135  1.00145.30           N  
ATOM   5585  C2   DA J  53       3.983  79.612  21.176  1.00145.18           C  
ATOM   5586  N3   DA J  53       2.750  79.111  21.186  1.00145.11           N  
ATOM   5587  C4   DA J  53       2.324  78.876  19.934  1.00144.98           C  
ATOM   5588  P    DT J  54      -3.501  79.133  22.204  1.00139.20           P  
ATOM   5589  OP1  DT J  54      -4.619  78.722  23.090  1.00139.43           O  
ATOM   5590  OP2  DT J  54      -3.796  79.799  20.909  1.00138.77           O  
ATOM   5591  O5'  DT J  54      -2.519  80.061  23.046  1.00137.68           O  
ATOM   5592  C5'  DT J  54      -1.865  79.548  24.204  1.00134.45           C  
ATOM   5593  C4'  DT J  54      -0.807  80.512  24.687  1.00131.87           C  
ATOM   5594  O4'  DT J  54       0.282  80.581  23.733  1.00132.05           O  
ATOM   5595  C3'  DT J  54      -1.280  81.952  24.899  1.00129.56           C  
ATOM   5596  O3'  DT J  54      -0.691  82.466  26.096  1.00125.28           O  
ATOM   5597  C2'  DT J  54      -0.731  82.678  23.685  1.00130.47           C  
ATOM   5598  C1'  DT J  54       0.569  81.940  23.451  1.00131.81           C  
ATOM   5599  N1   DT J  54       1.083  82.033  22.072  1.00132.75           N  
ATOM   5600  C2   DT J  54       2.395  82.412  21.901  1.00133.44           C  
ATOM   5601  O2   DT J  54       3.147  82.649  22.832  1.00133.86           O  
ATOM   5602  N3   DT J  54       2.797  82.506  20.592  1.00133.49           N  
ATOM   5603  C4   DT J  54       2.036  82.263  19.466  1.00133.37           C  
ATOM   5604  O4   DT J  54       2.533  82.397  18.351  1.00133.70           O  
ATOM   5605  C5   DT J  54       0.673  81.859  19.719  1.00132.97           C  
ATOM   5606  C7   DT J  54      -0.224  81.567  18.558  1.00132.94           C  
ATOM   5607  C6   DT J  54       0.270  81.762  20.993  1.00132.78           C  
ATOM   5608  P    DC J  55      -0.758  84.040  26.413  1.00122.04           P  
ATOM   5609  OP1  DC J  55      -1.332  84.191  27.775  1.00122.37           O  
ATOM   5610  OP2  DC J  55      -1.386  84.752  25.271  1.00122.37           O  
ATOM   5611  O5'  DC J  55       0.780  84.449  26.473  1.00119.13           O  
ATOM   5612  C5'  DC J  55       1.756  83.513  26.931  1.00112.58           C  
ATOM   5613  C4'  DC J  55       3.152  84.045  26.704  1.00107.04           C  
ATOM   5614  O4'  DC J  55       3.446  84.094  25.288  1.00105.94           O  
ATOM   5615  C3'  DC J  55       3.404  85.453  27.240  1.00102.68           C  
ATOM   5616  O3'  DC J  55       4.715  85.511  27.809  1.00 95.89           O  
ATOM   5617  C2'  DC J  55       3.316  86.320  25.996  1.00103.24           C  
ATOM   5618  C1'  DC J  55       3.883  85.395  24.934  1.00104.89           C  
ATOM   5619  N1   DC J  55       3.429  85.659  23.563  1.00105.51           N  
ATOM   5620  C2   DC J  55       4.378  85.988  22.588  1.00106.27           C  
ATOM   5621  O2   DC J  55       5.571  86.080  22.917  1.00106.52           O  
ATOM   5622  N3   DC J  55       3.974  86.195  21.315  1.00106.45           N  
ATOM   5623  C4   DC J  55       2.682  86.087  21.001  1.00106.64           C  
ATOM   5624  N4   DC J  55       2.331  86.278  19.728  1.00106.82           N  
ATOM   5625  C5   DC J  55       1.693  85.773  21.977  1.00106.91           C  
ATOM   5626  C6   DC J  55       2.106  85.571  23.234  1.00106.16           C  
ATOM   5627  P    DT J  56       5.088  86.689  28.833  1.00 91.30           P  
ATOM   5628  OP1  DT J  56       6.081  86.153  29.801  1.00 89.93           O  
ATOM   5629  OP2  DT J  56       3.836  87.315  29.332  1.00 91.90           O  
ATOM   5630  O5'  DT J  56       5.835  87.751  27.918  1.00 85.46           O  
ATOM   5631  C5'  DT J  56       7.105  87.452  27.356  1.00 75.75           C  
ATOM   5632  C4'  DT J  56       7.536  88.567  26.438  1.00 69.33           C  
ATOM   5633  O4'  DT J  56       6.786  88.536  25.201  1.00 68.69           O  
ATOM   5634  C3'  DT J  56       7.338  89.970  27.010  1.00 64.75           C  
ATOM   5635  O3'  DT J  56       8.419  90.775  26.574  1.00 60.40           O  
ATOM   5636  C2'  DT J  56       6.093  90.453  26.293  1.00 66.56           C  
ATOM   5637  C1'  DT J  56       6.331  89.845  24.933  1.00 69.56           C  
ATOM   5638  N1   DT J  56       5.178  89.766  24.024  1.00 76.31           N  
ATOM   5639  C2   DT J  56       5.412  90.042  22.697  1.00 78.99           C  
ATOM   5640  O2   DT J  56       6.517  90.324  22.260  1.00 78.49           O  
ATOM   5641  N3   DT J  56       4.303  89.976  21.893  1.00 80.81           N  
ATOM   5642  C4   DT J  56       3.015  89.660  22.271  1.00 82.32           C  
ATOM   5643  O4   DT J  56       2.121  89.638  21.428  1.00 84.70           O  
ATOM   5644  C5   DT J  56       2.839  89.372  23.678  1.00 81.87           C  
ATOM   5645  C7   DT J  56       1.476  89.011  24.178  1.00 82.05           C  
ATOM   5646  C6   DT J  56       3.916  89.439  24.476  1.00 80.06           C  
ATOM   5647  P    DG J  57       9.281  91.602  27.629  1.00 56.71           P  
ATOM   5648  OP1  DG J  57       9.962  90.639  28.525  1.00 56.01           O  
ATOM   5649  OP2  DG J  57       8.444  92.681  28.203  1.00 57.33           O  
ATOM   5650  O5'  DG J  57      10.394  92.301  26.722  1.00 55.77           O  
ATOM   5651  C5'  DG J  57      11.254  91.526  25.892  1.00 47.88           C  
ATOM   5652  C4'  DG J  57      11.582  92.285  24.628  1.00 44.21           C  
ATOM   5653  O4'  DG J  57      10.432  92.348  23.757  1.00 47.11           O  
ATOM   5654  C3'  DG J  57      12.031  93.725  24.830  1.00 42.19           C  
ATOM   5655  O3'  DG J  57      13.028  94.005  23.853  1.00 37.04           O  
ATOM   5656  C2'  DG J  57      10.764  94.527  24.582  1.00 42.11           C  
ATOM   5657  C1'  DG J  57      10.030  93.692  23.545  1.00 47.09           C  
ATOM   5658  N9   DG J  57       8.573  93.720  23.652  1.00 54.24           N  
ATOM   5659  C8   DG J  57       7.826  93.764  24.805  1.00 55.01           C  
ATOM   5660  N7   DG J  57       6.540  93.724  24.582  1.00 57.32           N  
ATOM   5661  C5   DG J  57       6.430  93.660  23.200  1.00 57.75           C  
ATOM   5662  C6   DG J  57       5.281  93.579  22.372  1.00 61.07           C  
ATOM   5663  O6   DG J  57       4.089  93.538  22.709  1.00 64.65           O  
ATOM   5664  N1   DG J  57       5.623  93.537  21.023  1.00 59.18           N  
ATOM   5665  C2   DG J  57       6.902  93.564  20.533  1.00 59.73           C  
ATOM   5666  N2   DG J  57       7.027  93.531  19.196  1.00 55.46           N  
ATOM   5667  N3   DG J  57       7.983  93.623  21.298  1.00 57.19           N  
ATOM   5668  C4   DG J  57       7.674  93.670  22.609  1.00 55.52           C  
ATOM   5669  P    DC J  58      13.832  95.376  23.901  1.00 39.73           P  
ATOM   5670  OP1  DC J  58      15.218  95.034  23.467  1.00 40.66           O  
ATOM   5671  OP2  DC J  58      13.633  96.028  25.217  1.00 40.61           O  
ATOM   5672  O5'  DC J  58      13.127  96.211  22.745  1.00 39.75           O  
ATOM   5673  C5'  DC J  58      12.943  95.615  21.460  1.00 40.80           C  
ATOM   5674  C4'  DC J  58      11.984  96.428  20.620  1.00 45.62           C  
ATOM   5675  O4'  DC J  58      10.613  96.211  21.030  1.00 42.66           O  
ATOM   5676  C3'  DC J  58      12.201  97.944  20.640  1.00 46.82           C  
ATOM   5677  O3'  DC J  58      11.969  98.455  19.330  1.00 51.31           O  
ATOM   5678  C2'  DC J  58      11.091  98.437  21.548  1.00 47.42           C  
ATOM   5679  C1'  DC J  58       9.979  97.473  21.181  1.00 46.70           C  
ATOM   5680  N1   DC J  58       8.893  97.329  22.165  1.00 48.76           N  
ATOM   5681  C2   DC J  58       7.596  97.079  21.696  1.00 51.64           C  
ATOM   5682  O2   DC J  58       7.405  96.990  20.477  1.00 51.80           O  
ATOM   5683  N3   DC J  58       6.589  96.944  22.582  1.00 53.05           N  
ATOM   5684  C4   DC J  58       6.830  97.048  23.887  1.00 53.09           C  
ATOM   5685  N4   DC J  58       5.802  96.905  24.722  1.00 57.16           N  
ATOM   5686  C5   DC J  58       8.137  97.304  24.395  1.00 52.60           C  
ATOM   5687  C6   DC J  58       9.131  97.437  23.504  1.00 51.03           C  
ATOM   5688  P    DA J  59      13.183  99.074  18.495  1.00 49.70           P  
ATOM   5689  OP1  DA J  59      14.209  98.007  18.490  1.00 55.73           O  
ATOM   5690  OP2  DA J  59      13.525 100.423  18.999  1.00 47.97           O  
ATOM   5691  O5'  DA J  59      12.592  99.217  17.027  1.00 55.76           O  
ATOM   5692  C5'  DA J  59      12.220  98.065  16.285  1.00 59.17           C  
ATOM   5693  C4'  DA J  59      10.969  98.346  15.490  1.00 62.96           C  
ATOM   5694  O4'  DA J  59       9.835  98.435  16.377  1.00 63.68           O  
ATOM   5695  C3'  DA J  59      10.986  99.655  14.710  1.00 63.48           C  
ATOM   5696  O3'  DA J  59      10.252  99.470  13.500  1.00 69.71           O  
ATOM   5697  C2'  DA J  59      10.288 100.628  15.645  1.00 62.46           C  
ATOM   5698  C1'  DA J  59       9.281  99.745  16.366  1.00 61.00           C  
ATOM   5699  N9   DA J  59       9.023 100.102  17.762  1.00 60.66           N  
ATOM   5700  C8   DA J  59       9.918 100.535  18.706  1.00 57.41           C  
ATOM   5701  N7   DA J  59       9.399 100.681  19.897  1.00 56.77           N  
ATOM   5702  C5   DA J  59       8.068 100.340  19.723  1.00 60.09           C  
ATOM   5703  C6   DA J  59       6.984 100.272  20.611  1.00 60.29           C  
ATOM   5704  N6   DA J  59       7.073 100.538  21.912  1.00 60.15           N  
ATOM   5705  N1   DA J  59       5.788  99.907  20.110  1.00 62.09           N  
ATOM   5706  C2   DA J  59       5.698  99.626  18.811  1.00 60.11           C  
ATOM   5707  N3   DA J  59       6.640  99.646  17.880  1.00 62.77           N  
ATOM   5708  C4   DA J  59       7.818 100.011  18.407  1.00 59.51           C  
ATOM   5709  P    DG J  60      10.146 100.667  12.438  1.00 72.68           P  
ATOM   5710  OP1  DG J  60       9.757 100.041  11.150  1.00 75.47           O  
ATOM   5711  OP2  DG J  60      11.362 101.519  12.505  1.00 69.97           O  
ATOM   5712  O5'  DG J  60       8.914 101.513  12.973  1.00 73.61           O  
ATOM   5713  C5'  DG J  60       7.606 100.952  12.999  1.00 76.59           C  
ATOM   5714  C4'  DG J  60       6.602 102.027  13.336  1.00 77.44           C  
ATOM   5715  O4'  DG J  60       6.504 102.207  14.771  1.00 76.17           O  
ATOM   5716  C3'  DG J  60       6.997 103.385  12.758  1.00 79.04           C  
ATOM   5717  O3'  DG J  60       5.846 104.043  12.228  1.00 83.83           O  
ATOM   5718  C2'  DG J  60       7.559 104.129  13.958  1.00 77.07           C  
ATOM   5719  C1'  DG J  60       6.730 103.569  15.099  1.00 74.90           C  
ATOM   5720  N9   DG J  60       7.369 103.628  16.416  1.00 71.43           N  
ATOM   5721  C8   DG J  60       8.696 103.863  16.689  1.00 69.05           C  
ATOM   5722  N7   DG J  60       8.960 103.886  17.967  1.00 66.03           N  
ATOM   5723  C5   DG J  60       7.738 103.643  18.575  1.00 67.61           C  
ATOM   5724  C6   DG J  60       7.396 103.546  19.954  1.00 67.93           C  
ATOM   5725  O6   DG J  60       8.129 103.662  20.939  1.00 63.67           O  
ATOM   5726  N1   DG J  60       6.043 103.285  20.127  1.00 69.98           N  
ATOM   5727  C2   DG J  60       5.131 103.138  19.110  1.00 71.53           C  
ATOM   5728  N2   DG J  60       3.866 102.886  19.482  1.00 72.13           N  
ATOM   5729  N3   DG J  60       5.434 103.229  17.825  1.00 70.29           N  
ATOM   5730  C4   DG J  60       6.745 103.478  17.632  1.00 69.33           C  
ATOM   5731  P    DG J  61       6.002 105.471  11.511  1.00 82.43           P  
ATOM   5732  OP1  DG J  61       5.640 105.290  10.088  1.00 85.59           O  
ATOM   5733  OP2  DG J  61       7.304 106.085  11.862  1.00 84.11           O  
ATOM   5734  O5'  DG J  61       4.856 106.306  12.213  1.00 86.38           O  
ATOM   5735  C5'  DG J  61       3.612 105.689  12.517  1.00 91.51           C  
ATOM   5736  C4'  DG J  61       2.880 106.508  13.548  1.00 95.95           C  
ATOM   5737  O4'  DG J  61       3.371 106.201  14.879  1.00 95.73           O  
ATOM   5738  C3'  DG J  61       3.092 108.007  13.342  1.00 99.26           C  
ATOM   5739  O3'  DG J  61       1.862 108.716  13.477  1.00104.47           O  
ATOM   5740  C2'  DG J  61       4.077 108.380  14.435  1.00 98.11           C  
ATOM   5741  C1'  DG J  61       3.723 107.403  15.540  1.00 96.19           C  
ATOM   5742  N9   DG J  61       4.833 107.126  16.448  1.00 94.37           N  
ATOM   5743  C8   DG J  61       6.156 106.980  16.114  1.00 93.93           C  
ATOM   5744  N7   DG J  61       6.930 106.805  17.150  1.00 93.47           N  
ATOM   5745  C5   DG J  61       6.065 106.822  18.233  1.00 92.70           C  
ATOM   5746  C6   DG J  61       6.329 106.696  19.620  1.00 92.04           C  
ATOM   5747  O6   DG J  61       7.418 106.556  20.186  1.00 90.29           O  
ATOM   5748  N1   DG J  61       5.160 106.753  20.371  1.00 92.14           N  
ATOM   5749  C2   DG J  61       3.900 106.919  19.857  1.00 92.93           C  
ATOM   5750  N2   DG J  61       2.900 106.929  20.746  1.00 93.70           N  
ATOM   5751  N3   DG J  61       3.640 107.059  18.566  1.00 93.96           N  
ATOM   5752  C4   DG J  61       4.763 106.999  17.817  1.00 93.79           C  
ATOM   5753  P    DT J  62       1.876 110.238  13.979  1.00108.13           P  
ATOM   5754  OP1  DT J  62       0.587 110.858  13.584  1.00108.51           O  
ATOM   5755  OP2  DT J  62       3.157 110.869  13.561  1.00106.84           O  
ATOM   5756  O5'  DT J  62       1.886 110.070  15.558  1.00108.42           O  
ATOM   5757  C5'  DT J  62       0.753 109.531  16.225  1.00110.55           C  
ATOM   5758  C4'  DT J  62       0.389 110.413  17.391  1.00112.61           C  
ATOM   5759  O4'  DT J  62       1.309 110.157  18.478  1.00111.95           O  
ATOM   5760  C3'  DT J  62       0.520 111.895  17.053  1.00114.10           C  
ATOM   5761  O3'  DT J  62      -0.524 112.653  17.661  1.00117.88           O  
ATOM   5762  C2'  DT J  62       1.880 112.269  17.612  1.00112.79           C  
ATOM   5763  C1'  DT J  62       2.046 111.324  18.793  1.00111.10           C  
ATOM   5764  N1   DT J  62       3.442 110.915  19.031  1.00109.16           N  
ATOM   5765  C2   DT J  62       3.842 110.688  20.324  1.00108.26           C  
ATOM   5766  O2   DT J  62       3.091 110.790  21.278  1.00108.86           O  
ATOM   5767  N3   DT J  62       5.161 110.334  20.461  1.00108.05           N  
ATOM   5768  C4   DT J  62       6.096 110.187  19.454  1.00107.42           C  
ATOM   5769  O4   DT J  62       7.251 109.875  19.730  1.00106.64           O  
ATOM   5770  C5   DT J  62       5.604 110.429  18.119  1.00107.76           C  
ATOM   5771  C7   DT J  62       6.539 110.287  16.961  1.00107.44           C  
ATOM   5772  C6   DT J  62       4.318 110.774  17.977  1.00108.59           C  
ATOM   5773  P    DG J  63      -0.509 114.254  17.550  1.00120.24           P  
ATOM   5774  OP1  DG J  63      -1.922 114.692  17.402  1.00119.81           O  
ATOM   5775  OP2  DG J  63       0.496 114.663  16.535  1.00119.88           O  
ATOM   5776  O5'  DG J  63       0.020 114.699  18.984  1.00120.24           O  
ATOM   5777  C5'  DG J  63      -0.577 114.172  20.167  1.00121.56           C  
ATOM   5778  C4'  DG J  63       0.114 114.725  21.389  1.00123.14           C  
ATOM   5779  O4'  DG J  63       1.407 114.091  21.556  1.00123.39           O  
ATOM   5780  C3'  DG J  63       0.377 116.228  21.313  1.00124.02           C  
ATOM   5781  O3'  DG J  63       0.122 116.846  22.573  1.00125.95           O  
ATOM   5782  C2'  DG J  63       1.849 116.316  20.956  1.00123.92           C  
ATOM   5783  C1'  DG J  63       2.434 115.071  21.606  1.00123.16           C  
ATOM   5784  N9   DG J  63       3.595 114.538  20.897  1.00121.92           N  
ATOM   5785  C8   DG J  63       3.709 114.350  19.541  1.00121.43           C  
ATOM   5786  N7   DG J  63       4.871 113.874  19.184  1.00121.10           N  
ATOM   5787  C5   DG J  63       5.568 113.735  20.377  1.00120.49           C  
ATOM   5788  C6   DG J  63       6.885 113.268  20.619  1.00120.10           C  
ATOM   5789  O6   DG J  63       7.725 112.872  19.802  1.00120.22           O  
ATOM   5790  N1   DG J  63       7.195 113.291  21.974  1.00119.18           N  
ATOM   5791  C2   DG J  63       6.349 113.710  22.969  1.00118.87           C  
ATOM   5792  N2   DG J  63       6.841 113.654  24.216  1.00118.60           N  
ATOM   5793  N3   DG J  63       5.116 114.150  22.758  1.00119.33           N  
ATOM   5794  C4   DG J  63       4.794 114.136  21.447  1.00120.52           C  
ATOM   5795  P    DG J  64      -0.014 118.445  22.660  1.00126.83           P  
ATOM   5796  OP1  DG J  64      -1.274 118.768  23.376  1.00126.72           O  
ATOM   5797  OP2  DG J  64       0.220 118.996  21.300  1.00126.39           O  
ATOM   5798  O5'  DG J  64       1.211 118.854  23.588  1.00126.59           O  
ATOM   5799  C5'  DG J  64       1.441 118.166  24.813  1.00126.97           C  
ATOM   5800  C4'  DG J  64       2.876 118.337  25.250  1.00127.19           C  
ATOM   5801  O4'  DG J  64       3.761 117.596  24.373  1.00127.71           O  
ATOM   5802  C3'  DG J  64       3.372 119.783  25.232  1.00126.80           C  
ATOM   5803  O3'  DG J  64       4.189 120.027  26.375  1.00126.42           O  
ATOM   5804  C2'  DG J  64       4.224 119.848  23.979  1.00126.88           C  
ATOM   5805  C1'  DG J  64       4.810 118.451  23.947  1.00127.04           C  
ATOM   5806  N9   DG J  64       5.266 118.004  22.634  1.00125.86           N  
ATOM   5807  C8   DG J  64       4.625 118.160  21.429  1.00125.61           C  
ATOM   5808  N7   DG J  64       5.301 117.677  20.422  1.00125.15           N  
ATOM   5809  C5   DG J  64       6.456 117.165  20.999  1.00125.33           C  
ATOM   5810  C6   DG J  64       7.572 116.517  20.406  1.00125.15           C  
ATOM   5811  O6   DG J  64       7.769 116.257  19.213  1.00125.02           O  
ATOM   5812  N1   DG J  64       8.520 116.158  21.361  1.00124.34           N  
ATOM   5813  C2   DG J  64       8.410 116.390  22.710  1.00123.88           C  
ATOM   5814  N2   DG J  64       9.429 115.963  23.469  1.00123.87           N  
ATOM   5815  N3   DG J  64       7.378 116.994  23.273  1.00124.13           N  
ATOM   5816  C4   DG J  64       6.445 117.352  22.365  1.00124.98           C  
ATOM   5817  P    DA J  65       4.145 121.463  27.087  1.00126.24           P  
ATOM   5818  OP1  DA J  65       3.000 121.491  28.037  1.00126.53           O  
ATOM   5819  OP2  DA J  65       4.238 122.487  26.016  1.00126.32           O  
ATOM   5820  O5'  DA J  65       5.492 121.493  27.930  1.00124.38           O  
ATOM   5821  C5'  DA J  65       5.818 120.429  28.817  1.00121.50           C  
ATOM   5822  C4'  DA J  65       7.311 120.212  28.826  1.00119.53           C  
ATOM   5823  O4'  DA J  65       7.719 119.605  27.573  1.00118.62           O  
ATOM   5824  C3'  DA J  65       8.104 121.513  28.949  1.00118.19           C  
ATOM   5825  O3'  DA J  65       9.227 121.338  29.815  1.00116.83           O  
ATOM   5826  C2'  DA J  65       8.550 121.790  27.525  1.00118.04           C  
ATOM   5827  C1'  DA J  65       8.736 120.391  26.972  1.00117.67           C  
ATOM   5828  N9   DA J  65       8.596 120.297  25.517  1.00115.98           N  
ATOM   5829  C8   DA J  65       7.559 120.731  24.726  1.00115.36           C  
ATOM   5830  N7   DA J  65       7.750 120.525  23.443  1.00113.89           N  
ATOM   5831  C5   DA J  65       8.992 119.908  23.386  1.00113.68           C  
ATOM   5832  C6   DA J  65       9.767 119.435  22.311  1.00113.02           C  
ATOM   5833  N6   DA J  65       9.393 119.517  21.032  1.00112.37           N  
ATOM   5834  N1   DA J  65      10.958 118.868  22.598  1.00112.55           N  
ATOM   5835  C2   DA J  65      11.336 118.787  23.880  1.00113.23           C  
ATOM   5836  N3   DA J  65      10.701 119.197  24.975  1.00113.34           N  
ATOM   5837  C4   DA J  65       9.521 119.755  24.656  1.00114.46           C  
ATOM   5838  P    DT J  66      10.426 122.407  29.792  1.00115.40           P  
ATOM   5839  OP1  DT J  66      11.056 122.419  31.137  1.00115.66           O  
ATOM   5840  OP2  DT J  66       9.917 123.676  29.208  1.00115.07           O  
ATOM   5841  O5'  DT J  66      11.465 121.751  28.781  1.00112.98           O  
ATOM   5842  C5'  DT J  66      11.981 120.443  29.026  1.00108.28           C  
ATOM   5843  C4'  DT J  66      13.296 120.256  28.309  1.00105.05           C  
ATOM   5844  O4'  DT J  66      13.061 120.175  26.883  1.00102.80           O  
ATOM   5845  C3'  DT J  66      14.296 121.394  28.511  1.00103.55           C  
ATOM   5846  O3'  DT J  66      15.621 120.873  28.648  1.00102.20           O  
ATOM   5847  C2'  DT J  66      14.156 122.215  27.240  1.00101.73           C  
ATOM   5848  C1'  DT J  66      13.829 121.155  26.205  1.00 99.69           C  
ATOM   5849  N1   DT J  66      13.038 121.626  25.056  1.00 95.83           N  
ATOM   5850  C2   DT J  66      13.526 121.379  23.792  1.00 93.28           C  
ATOM   5851  O2   DT J  66      14.579 120.800  23.586  1.00 91.64           O  
ATOM   5852  N3   DT J  66      12.730 121.832  22.772  1.00 91.49           N  
ATOM   5853  C4   DT J  66      11.523 122.488  22.886  1.00 92.14           C  
ATOM   5854  O4   DT J  66      10.917 122.828  21.876  1.00 91.35           O  
ATOM   5855  C5   DT J  66      11.072 122.719  24.240  1.00 93.44           C  
ATOM   5856  C7   DT J  66       9.769 123.422  24.458  1.00 94.47           C  
ATOM   5857  C6   DT J  66      11.844 122.286  25.245  1.00 94.17           C  
ATOM   5858  P    DA J  67      16.866 121.883  28.725  1.00101.83           P  
ATOM   5859  OP1  DA J  67      18.015 121.204  29.380  1.00101.27           O  
ATOM   5860  OP2  DA J  67      16.363 123.169  29.275  1.00101.38           O  
ATOM   5861  O5'  DA J  67      17.219 122.118  27.195  1.00 98.06           O  
ATOM   5862  C5'  DA J  67      18.494 122.597  26.800  1.00 91.42           C  
ATOM   5863  C4'  DA J  67      18.984 121.813  25.607  1.00 86.72           C  
ATOM   5864  O4'  DA J  67      17.905 121.661  24.656  1.00 82.41           O  
ATOM   5865  C3'  DA J  67      20.119 122.493  24.853  1.00 84.14           C  
ATOM   5866  O3'  DA J  67      21.057 121.526  24.376  1.00 80.32           O  
ATOM   5867  C2'  DA J  67      19.407 123.230  23.733  1.00 82.47           C  
ATOM   5868  C1'  DA J  67      18.170 122.384  23.464  1.00 79.91           C  
ATOM   5869  N9   DA J  67      16.964 123.154  23.152  1.00 76.11           N  
ATOM   5870  C8   DA J  67      16.100 123.727  24.051  1.00 75.98           C  
ATOM   5871  N7   DA J  67      15.071 124.319  23.495  1.00 74.86           N  
ATOM   5872  C5   DA J  67      15.275 124.134  22.137  1.00 74.34           C  
ATOM   5873  C6   DA J  67      14.532 124.520  21.011  1.00 74.32           C  
ATOM   5874  N6   DA J  67      13.379 125.190  21.076  1.00 73.48           N  
ATOM   5875  N1   DA J  67      15.017 124.184  19.796  1.00 74.32           N  
ATOM   5876  C2   DA J  67      16.166 123.503  19.732  1.00 74.50           C  
ATOM   5877  N3   DA J  67      16.951 123.078  20.717  1.00 74.74           N  
ATOM   5878  C4   DA J  67      16.444 123.429  21.909  1.00 74.99           C  
ATOM   5879  P    DT J  68      22.452 122.023  23.768  1.00 82.24           P  
ATOM   5880  OP1  DT J  68      23.376 120.866  23.628  1.00 80.99           O  
ATOM   5881  OP2  DT J  68      22.886 123.222  24.535  1.00 81.30           O  
ATOM   5882  O5'  DT J  68      22.026 122.493  22.309  1.00 77.46           O  
ATOM   5883  C5'  DT J  68      21.394 121.576  21.428  1.00 70.81           C  
ATOM   5884  C4'  DT J  68      21.326 122.150  20.035  1.00 65.26           C  
ATOM   5885  O4'  DT J  68      20.106 122.899  19.833  1.00 64.79           O  
ATOM   5886  C3'  DT J  68      22.480 123.075  19.653  1.00 62.77           C  
ATOM   5887  O3'  DT J  68      22.885 122.726  18.326  1.00 56.53           O  
ATOM   5888  C2'  DT J  68      21.848 124.460  19.728  1.00 62.36           C  
ATOM   5889  C1'  DT J  68      20.406 124.187  19.320  1.00 62.51           C  
ATOM   5890  N1   DT J  68      19.382 125.115  19.848  1.00 62.35           N  
ATOM   5891  C2   DT J  68      18.479 125.664  18.967  1.00 60.73           C  
ATOM   5892  O2   DT J  68      18.551 125.527  17.761  1.00 60.28           O  
ATOM   5893  N3   DT J  68      17.484 126.405  19.557  1.00 63.74           N  
ATOM   5894  C4   DT J  68      17.327 126.673  20.899  1.00 62.90           C  
ATOM   5895  O4   DT J  68      16.355 127.313  21.280  1.00 63.72           O  
ATOM   5896  C5   DT J  68      18.355 126.134  21.758  1.00 61.49           C  
ATOM   5897  C7   DT J  68      18.307 126.433  23.222  1.00 60.73           C  
ATOM   5898  C6   DT J  68      19.314 125.387  21.199  1.00 61.60           C  
ATOM   5899  P    DT J  69      24.264 123.278  17.722  1.00 56.85           P  
ATOM   5900  OP1  DT J  69      24.991 122.107  17.151  1.00 59.68           O  
ATOM   5901  OP2  DT J  69      24.947 124.165  18.691  1.00 55.50           O  
ATOM   5902  O5'  DT J  69      23.746 124.167  16.512  1.00 54.58           O  
ATOM   5903  C5'  DT J  69      22.436 124.666  16.571  1.00 53.43           C  
ATOM   5904  C4'  DT J  69      22.016 125.290  15.268  1.00 48.31           C  
ATOM   5905  O4'  DT J  69      20.837 126.039  15.632  1.00 48.90           O  
ATOM   5906  C3'  DT J  69      22.977 126.317  14.679  1.00 44.70           C  
ATOM   5907  O3'  DT J  69      22.725 126.418  13.270  1.00 36.16           O  
ATOM   5908  C2'  DT J  69      22.599 127.586  15.421  1.00 45.36           C  
ATOM   5909  C1'  DT J  69      21.102 127.425  15.649  1.00 45.74           C  
ATOM   5910  N1   DT J  69      20.614 127.943  16.944  1.00 46.65           N  
ATOM   5911  C2   DT J  69      19.418 128.611  16.958  1.00 46.63           C  
ATOM   5912  O2   DT J  69      18.746 128.798  15.962  1.00 44.71           O  
ATOM   5913  N3   DT J  69      19.033 129.060  18.192  1.00 50.13           N  
ATOM   5914  C4   DT J  69      19.710 128.913  19.382  1.00 48.91           C  
ATOM   5915  O4   DT J  69      19.248 129.378  20.406  1.00 56.84           O  
ATOM   5916  C5   DT J  69      20.943 128.202  19.306  1.00 50.12           C  
ATOM   5917  C7   DT J  69      21.721 127.986  20.568  1.00 46.85           C  
ATOM   5918  C6   DT J  69      21.340 127.755  18.103  1.00 47.02           C  
ATOM   5919  P    DG J  70      23.741 127.223  12.318  1.00 38.28           P  
ATOM   5920  OP1  DG J  70      23.704 126.576  10.976  1.00 35.31           O  
ATOM   5921  OP2  DG J  70      25.034 127.428  12.991  1.00 35.73           O  
ATOM   5922  O5'  DG J  70      23.067 128.655  12.165  1.00 40.65           O  
ATOM   5923  C5'  DG J  70      21.808 128.785  11.510  1.00 43.44           C  
ATOM   5924  C4'  DG J  70      21.283 130.192  11.665  1.00 50.80           C  
ATOM   5925  O4'  DG J  70      20.881 130.428  13.035  1.00 50.57           O  
ATOM   5926  C3'  DG J  70      22.308 131.280  11.332  1.00 51.01           C  
ATOM   5927  O3'  DG J  70      21.625 132.325  10.665  1.00 56.80           O  
ATOM   5928  C2'  DG J  70      22.767 131.756  12.698  1.00 49.26           C  
ATOM   5929  C1'  DG J  70      21.482 131.631  13.481  1.00 50.37           C  
ATOM   5930  N9   DG J  70      21.631 131.564  14.927  1.00 50.33           N  
ATOM   5931  C8   DG J  70      22.706 131.090  15.634  1.00 52.30           C  
ATOM   5932  N7   DG J  70      22.557 131.201  16.927  1.00 53.93           N  
ATOM   5933  C5   DG J  70      21.306 131.777  17.080  1.00 54.25           C  
ATOM   5934  C6   DG J  70      20.613 132.150  18.254  1.00 57.19           C  
ATOM   5935  O6   DG J  70      20.993 132.056  19.424  1.00 60.55           O  
ATOM   5936  N1   DG J  70      19.363 132.697  17.964  1.00 55.66           N  
ATOM   5937  C2   DG J  70      18.862 132.885  16.695  1.00 57.42           C  
ATOM   5938  N2   DG J  70      17.649 133.456  16.610  1.00 56.44           N  
ATOM   5939  N3   DG J  70      19.508 132.544  15.586  1.00 53.73           N  
ATOM   5940  C4   DG J  70      20.715 131.997  15.855  1.00 52.95           C  
ATOM   5941  P    DA J  71      22.450 133.457   9.888  1.00 60.12           P  
ATOM   5942  OP1  DA J  71      22.494 133.092   8.451  1.00 61.69           O  
ATOM   5943  OP2  DA J  71      23.715 133.718  10.613  1.00 57.99           O  
ATOM   5944  O5'  DA J  71      21.474 134.706  10.041  1.00 62.05           O  
ATOM   5945  C5'  DA J  71      20.083 134.562   9.740  1.00 62.16           C  
ATOM   5946  C4'  DA J  71      19.291 135.697  10.347  1.00 64.72           C  
ATOM   5947  O4'  DA J  71      19.151 135.522  11.782  1.00 61.53           O  
ATOM   5948  C3'  DA J  71      19.932 137.067  10.139  1.00 63.07           C  
ATOM   5949  O3'  DA J  71      18.930 138.029   9.838  1.00 69.84           O  
ATOM   5950  C2'  DA J  71      20.567 137.373  11.481  1.00 62.74           C  
ATOM   5951  C1'  DA J  71      19.670 136.651  12.472  1.00 59.26           C  
ATOM   5952  N9   DA J  71      20.408 136.157  13.633  1.00 59.58           N  
ATOM   5953  C8   DA J  71      21.605 135.491  13.617  1.00 57.31           C  
ATOM   5954  N7   DA J  71      22.052 135.180  14.808  1.00 57.92           N  
ATOM   5955  C5   DA J  71      21.083 135.671  15.666  1.00 58.02           C  
ATOM   5956  C6   DA J  71      20.975 135.664  17.062  1.00 58.84           C  
ATOM   5957  N6   DA J  71      21.896 135.137  17.870  1.00 60.73           N  
ATOM   5958  N1   DA J  71      19.880 136.227  17.610  1.00 57.67           N  
ATOM   5959  C2   DA J  71      18.970 136.771  16.799  1.00 58.91           C  
ATOM   5960  N3   DA J  71      18.963 136.850  15.472  1.00 60.48           N  
ATOM   5961  C4   DA J  71      20.062 136.272  14.958  1.00 58.95           C  
ATOM   5962  P    DT J  72      19.349 139.555   9.571  1.00 69.04           P  
ATOM   5963  OP1  DT J  72      18.282 140.114   8.703  1.00 70.67           O  
ATOM   5964  OP2  DT J  72      20.764 139.575   9.112  1.00 67.34           O  
ATOM   5965  O5'  DT J  72      19.259 140.223  11.017  1.00 66.27           O  
ATOM   5966  C5'  DT J  72      18.058 140.139  11.774  1.00 61.18           C  
ATOM   5967  C4'  DT J  72      18.235 140.776  13.134  1.00 63.65           C  
ATOM   5968  O4'  DT J  72      18.959 139.918  14.052  1.00 62.46           O  
ATOM   5969  C3'  DT J  72      18.951 142.130  13.163  1.00 63.19           C  
ATOM   5970  O3'  DT J  72      18.310 142.972  14.125  1.00 64.38           O  
ATOM   5971  C2'  DT J  72      20.297 141.790  13.773  1.00 61.85           C  
ATOM   5972  C1'  DT J  72      19.892 140.712  14.757  1.00 60.52           C  
ATOM   5973  N1   DT J  72      20.988 139.851  15.226  1.00 59.42           N  
ATOM   5974  C2   DT J  72      21.086 139.584  16.580  1.00 62.31           C  
ATOM   5975  O2   DT J  72      20.288 139.986  17.409  1.00 64.48           O  
ATOM   5976  N3   DT J  72      22.167 138.820  16.932  1.00 60.85           N  
ATOM   5977  C4   DT J  72      23.132 138.307  16.098  1.00 57.53           C  
ATOM   5978  O4   DT J  72      24.047 137.652  16.570  1.00 57.97           O  
ATOM   5979  C5   DT J  72      22.961 138.606  14.695  1.00 57.15           C  
ATOM   5980  C7   DT J  72      23.963 138.091  13.712  1.00 58.14           C  
ATOM   5981  C6   DT J  72      21.906 139.346  14.334  1.00 61.00           C  
TER    5982       DT J  72                                                      
ATOM   5983  N   PRO A  38      86.324 125.677  -0.938  1.00 79.51           N  
ATOM   5984  CA  PRO A  38      85.289 124.895  -0.226  1.00 78.15           C  
ATOM   5985  C   PRO A  38      84.072 124.666  -1.116  1.00 76.36           C  
ATOM   5986  O   PRO A  38      83.244 125.557  -1.292  1.00 76.96           O  
ATOM   5987  CB  PRO A  38      84.912 125.691   1.015  1.00 79.21           C  
ATOM   5988  CG  PRO A  38      85.211 127.117   0.556  1.00 79.80           C  
ATOM   5989  CD  PRO A  38      86.500 126.986  -0.281  1.00 80.36           C  
ATOM   5990  N   HIS A  39      83.978 123.472  -1.690  1.00 73.97           N  
ATOM   5991  CA  HIS A  39      82.854 123.136  -2.553  1.00 71.30           C  
ATOM   5992  C   HIS A  39      81.664 122.773  -1.681  1.00 68.79           C  
ATOM   5993  O   HIS A  39      81.832 122.261  -0.573  1.00 68.52           O  
ATOM   5994  CB  HIS A  39      83.210 121.956  -3.459  1.00 72.31           C  
ATOM   5995  CG  HIS A  39      82.053 121.443  -4.257  1.00 75.22           C  
ATOM   5996  ND1 HIS A  39      81.023 120.722  -3.692  1.00 73.36           N  
ATOM   5997  CD2 HIS A  39      81.747 121.572  -5.570  1.00 75.50           C  
ATOM   5998  CE1 HIS A  39      80.132 120.431  -4.623  1.00 74.54           C  
ATOM   5999  NE2 HIS A  39      80.547 120.934  -5.771  1.00 74.70           N  
ATOM   6000  N   ARG A  40      80.459 123.041  -2.165  1.00 65.71           N  
ATOM   6001  CA  ARG A  40      79.292 122.711  -1.363  1.00 63.09           C  
ATOM   6002  C   ARG A  40      78.061 122.372  -2.188  1.00 58.76           C  
ATOM   6003  O   ARG A  40      77.597 123.176  -2.991  1.00 57.33           O  
ATOM   6004  CB  ARG A  40      78.986 123.862  -0.410  1.00 64.17           C  
ATOM   6005  CG  ARG A  40      78.206 123.450   0.815  1.00 66.19           C  
ATOM   6006  CD  ARG A  40      77.875 124.643   1.695  1.00 63.81           C  
ATOM   6007  NE  ARG A  40      77.001 124.257   2.797  1.00 61.14           N  
ATOM   6008  CZ  ARG A  40      77.397 123.545   3.842  1.00 61.05           C  
ATOM   6009  NH1 ARG A  40      78.660 123.144   3.927  1.00 60.52           N  
ATOM   6010  NH2 ARG A  40      76.532 123.237   4.802  1.00 58.72           N  
ATOM   6011  N   TYR A  41      77.547 121.161  -1.993  1.00 55.24           N  
ATOM   6012  CA  TYR A  41      76.345 120.716  -2.699  1.00 49.50           C  
ATOM   6013  C   TYR A  41      75.135 121.359  -2.038  1.00 44.24           C  
ATOM   6014  O   TYR A  41      75.095 121.511  -0.825  1.00 43.62           O  
ATOM   6015  CB  TYR A  41      76.232 119.187  -2.644  1.00 45.15           C  
ATOM   6016  CG  TYR A  41      77.194 118.492  -3.577  1.00 44.06           C  
ATOM   6017  CD1 TYR A  41      78.209 117.678  -3.089  1.00 43.51           C  
ATOM   6018  CD2 TYR A  41      77.111 118.690  -4.951  1.00 42.58           C  
ATOM   6019  CE1 TYR A  41      79.123 117.083  -3.949  1.00 44.42           C  
ATOM   6020  CE2 TYR A  41      78.015 118.104  -5.813  1.00 45.87           C  
ATOM   6021  CZ  TYR A  41      79.022 117.304  -5.307  1.00 44.72           C  
ATOM   6022  OH  TYR A  41      79.941 116.756  -6.171  1.00 50.85           O  
ATOM   6023  N   ARG A  42      74.153 121.759  -2.827  1.00 43.38           N  
ATOM   6024  CA  ARG A  42      72.977 122.378  -2.232  1.00 45.68           C  
ATOM   6025  C   ARG A  42      72.129 121.391  -1.415  1.00 45.10           C  
ATOM   6026  O   ARG A  42      72.189 120.180  -1.614  1.00 43.35           O  
ATOM   6027  CB  ARG A  42      72.129 123.043  -3.309  1.00 47.72           C  
ATOM   6028  CG  ARG A  42      72.865 124.184  -3.990  1.00 55.89           C  
ATOM   6029  CD  ARG A  42      71.912 125.260  -4.423  1.00 61.62           C  
ATOM   6030  NE  ARG A  42      70.893 124.716  -5.310  1.00 68.00           N  
ATOM   6031  CZ  ARG A  42      69.897 125.428  -5.819  1.00 70.57           C  
ATOM   6032  NH1 ARG A  42      69.792 126.717  -5.523  1.00 71.58           N  
ATOM   6033  NH2 ARG A  42      69.005 124.849  -6.614  1.00 72.26           N  
ATOM   6034  N   PRO A  43      71.333 121.906  -0.475  1.00 44.48           N  
ATOM   6035  CA  PRO A  43      70.505 121.013   0.334  1.00 42.73           C  
ATOM   6036  C   PRO A  43      69.641 120.200  -0.594  1.00 41.62           C  
ATOM   6037  O   PRO A  43      68.995 120.760  -1.475  1.00 39.16           O  
ATOM   6038  CB  PRO A  43      69.688 121.978   1.181  1.00 43.63           C  
ATOM   6039  CG  PRO A  43      70.624 123.191   1.299  1.00 42.53           C  
ATOM   6040  CD  PRO A  43      71.095 123.314  -0.116  1.00 42.51           C  
ATOM   6041  N   GLY A  44      69.660 118.878  -0.416  1.00 43.55           N  
ATOM   6042  CA  GLY A  44      68.850 118.004  -1.248  1.00 41.00           C  
ATOM   6043  C   GLY A  44      69.617 117.225  -2.304  1.00 41.93           C  
ATOM   6044  O   GLY A  44      69.277 116.072  -2.597  1.00 40.03           O  
ATOM   6045  N   THR A  45      70.656 117.837  -2.870  1.00 39.80           N  
ATOM   6046  CA  THR A  45      71.437 117.179  -3.904  1.00 38.64           C  
ATOM   6047  C   THR A  45      72.036 115.872  -3.394  1.00 37.87           C  
ATOM   6048  O   THR A  45      72.007 114.864  -4.081  1.00 40.67           O  
ATOM   6049  CB  THR A  45      72.570 118.118  -4.441  1.00 39.42           C  
ATOM   6050  OG1 THR A  45      71.974 119.229  -5.123  1.00 38.30           O  
ATOM   6051  CG2 THR A  45      73.476 117.393  -5.428  1.00 38.21           C  
ATOM   6052  N   VAL A  46      72.577 115.885  -2.191  1.00 35.55           N  
ATOM   6053  CA  VAL A  46      73.184 114.687  -1.644  1.00 38.36           C  
ATOM   6054  C   VAL A  46      72.109 113.700  -1.165  1.00 37.61           C  
ATOM   6055  O   VAL A  46      72.305 112.495  -1.208  1.00 36.91           O  
ATOM   6056  CB  VAL A  46      74.137 115.036  -0.480  1.00 37.98           C  
ATOM   6057  CG1 VAL A  46      74.767 113.759   0.080  1.00 40.59           C  
ATOM   6058  CG2 VAL A  46      75.243 115.990  -0.985  1.00 41.97           C  
ATOM   6059  N   ALA A  47      70.986 114.230  -0.697  1.00 36.19           N  
ATOM   6060  CA  ALA A  47      69.890 113.390  -0.240  1.00 37.95           C  
ATOM   6061  C   ALA A  47      69.470 112.525  -1.427  1.00 38.86           C  
ATOM   6062  O   ALA A  47      69.360 111.299  -1.315  1.00 37.16           O  
ATOM   6063  CB  ALA A  47      68.726 114.267   0.214  1.00 34.46           C  
ATOM   6064  N   LEU A  48      69.268 113.179  -2.572  1.00 39.91           N  
ATOM   6065  CA  LEU A  48      68.851 112.494  -3.789  1.00 40.38           C  
ATOM   6066  C   LEU A  48      69.904 111.451  -4.173  1.00 40.77           C  
ATOM   6067  O   LEU A  48      69.588 110.333  -4.587  1.00 36.89           O  
ATOM   6068  CB  LEU A  48      68.651 113.521  -4.899  1.00 40.34           C  
ATOM   6069  CG  LEU A  48      67.244 113.757  -5.471  1.00 46.64           C  
ATOM   6070  CD1 LEU A  48      66.171 113.574  -4.414  1.00 45.82           C  
ATOM   6071  CD2 LEU A  48      67.180 115.160  -6.070  1.00 43.91           C  
ATOM   6072  N   ARG A  49      71.165 111.832  -4.035  1.00 40.57           N  
ATOM   6073  CA  ARG A  49      72.256 110.934  -4.335  1.00 38.86           C  
ATOM   6074  C   ARG A  49      72.153 109.677  -3.446  1.00 35.13           C  
ATOM   6075  O   ARG A  49      72.311 108.571  -3.936  1.00 35.46           O  
ATOM   6076  CB  ARG A  49      73.585 111.682  -4.124  1.00 42.73           C  
ATOM   6077  CG  ARG A  49      74.825 110.833  -4.172  1.00 44.58           C  
ATOM   6078  CD  ARG A  49      75.949 111.535  -4.926  1.00 47.95           C  
ATOM   6079  NE  ARG A  49      76.451 112.760  -4.315  1.00 45.45           N  
ATOM   6080  CZ  ARG A  49      76.278 113.970  -4.832  1.00 51.75           C  
ATOM   6081  NH1 ARG A  49      75.605 114.127  -5.972  1.00 55.42           N  
ATOM   6082  NH2 ARG A  49      76.790 115.023  -4.226  1.00 48.80           N  
ATOM   6083  N   GLU A  50      71.875 109.850  -2.156  1.00 34.67           N  
ATOM   6084  CA  GLU A  50      71.746 108.718  -1.233  1.00 34.33           C  
ATOM   6085  C   GLU A  50      70.538 107.826  -1.576  1.00 33.91           C  
ATOM   6086  O   GLU A  50      70.615 106.607  -1.499  1.00 34.84           O  
ATOM   6087  CB  GLU A  50      71.626 109.222   0.206  1.00 35.63           C  
ATOM   6088  CG  GLU A  50      72.930 109.703   0.801  1.00 40.44           C  
ATOM   6089  CD  GLU A  50      72.735 110.477   2.085  1.00 45.77           C  
ATOM   6090  OE1 GLU A  50      71.745 110.227   2.806  1.00 46.64           O  
ATOM   6091  OE2 GLU A  50      73.584 111.336   2.388  1.00 49.92           O  
ATOM   6092  N   ILE A  51      69.418 108.434  -1.944  1.00 34.21           N  
ATOM   6093  CA  ILE A  51      68.238 107.648  -2.311  1.00 32.91           C  
ATOM   6094  C   ILE A  51      68.641 106.728  -3.458  1.00 34.49           C  
ATOM   6095  O   ILE A  51      68.393 105.519  -3.421  1.00 31.19           O  
ATOM   6096  CB  ILE A  51      67.067 108.563  -2.775  1.00 32.81           C  
ATOM   6097  CG1 ILE A  51      66.536 109.367  -1.580  1.00 30.29           C  
ATOM   6098  CG2 ILE A  51      65.959 107.719  -3.438  1.00 27.63           C  
ATOM   6099  CD1 ILE A  51      65.469 110.397  -1.953  1.00 30.34           C  
ATOM   6100  N   ARG A  52      69.281 107.290  -4.483  1.00 35.35           N  
ATOM   6101  CA  ARG A  52      69.675 106.472  -5.623  1.00 36.06           C  
ATOM   6102  C   ARG A  52      70.607 105.347  -5.215  1.00 36.69           C  
ATOM   6103  O   ARG A  52      70.467 104.198  -5.661  1.00 38.42           O  
ATOM   6104  CB  ARG A  52      70.317 107.350  -6.707  1.00 39.78           C  
ATOM   6105  CG  ARG A  52      69.286 108.214  -7.415  1.00 43.83           C  
ATOM   6106  CD  ARG A  52      69.874 109.065  -8.543  1.00 50.46           C  
ATOM   6107  NE  ARG A  52      68.806 109.778  -9.247  1.00 52.05           N  
ATOM   6108  CZ  ARG A  52      68.492 111.053  -9.050  1.00 54.33           C  
ATOM   6109  NH1 ARG A  52      69.168 111.782  -8.176  1.00 56.07           N  
ATOM   6110  NH2 ARG A  52      67.481 111.592  -9.712  1.00 54.76           N  
ATOM   6111  N   ARG A  53      71.547 105.671  -4.343  1.00 36.88           N  
ATOM   6112  CA  ARG A  53      72.493 104.688  -3.871  1.00 38.98           C  
ATOM   6113  C   ARG A  53      71.843 103.580  -3.040  1.00 35.57           C  
ATOM   6114  O   ARG A  53      72.121 102.404  -3.247  1.00 32.48           O  
ATOM   6115  CB  ARG A  53      73.583 105.355  -3.025  1.00 40.34           C  
ATOM   6116  CG  ARG A  53      74.470 104.347  -2.292  1.00 44.09           C  
ATOM   6117  CD  ARG A  53      75.430 105.042  -1.344  1.00 51.98           C  
ATOM   6118  NE  ARG A  53      76.166 104.077  -0.528  1.00 58.78           N  
ATOM   6119  CZ  ARG A  53      76.941 104.408   0.500  1.00 62.85           C  
ATOM   6120  NH1 ARG A  53      77.082 105.684   0.842  1.00 65.31           N  
ATOM   6121  NH2 ARG A  53      77.575 103.468   1.186  1.00 64.70           N  
ATOM   6122  N   TYR A  54      70.989 103.945  -2.088  1.00 34.14           N  
ATOM   6123  CA  TYR A  54      70.406 102.903  -1.261  1.00 33.66           C  
ATOM   6124  C   TYR A  54      69.318 102.108  -1.952  1.00 32.54           C  
ATOM   6125  O   TYR A  54      69.078 100.954  -1.595  1.00 34.08           O  
ATOM   6126  CB  TYR A  54      69.949 103.471   0.087  1.00 33.46           C  
ATOM   6127  CG  TYR A  54      71.116 103.860   0.958  1.00 33.57           C  
ATOM   6128  CD1 TYR A  54      71.312 105.187   1.348  1.00 34.39           C  
ATOM   6129  CD2 TYR A  54      72.068 102.913   1.337  1.00 36.17           C  
ATOM   6130  CE1 TYR A  54      72.427 105.570   2.091  1.00 34.30           C  
ATOM   6131  CE2 TYR A  54      73.206 103.284   2.077  1.00 38.75           C  
ATOM   6132  CZ  TYR A  54      73.373 104.612   2.444  1.00 40.14           C  
ATOM   6133  OH  TYR A  54      74.487 104.987   3.138  1.00 40.01           O  
ATOM   6134  N   GLN A  55      68.678 102.683  -2.962  1.00 32.34           N  
ATOM   6135  CA  GLN A  55      67.666 101.922  -3.677  1.00 30.65           C  
ATOM   6136  C   GLN A  55      68.321 100.926  -4.657  1.00 33.15           C  
ATOM   6137  O   GLN A  55      67.674 100.010  -5.142  1.00 30.86           O  
ATOM   6138  CB  GLN A  55      66.695 102.854  -4.406  1.00 27.96           C  
ATOM   6139  CG  GLN A  55      65.821 103.691  -3.461  1.00 26.73           C  
ATOM   6140  CD  GLN A  55      64.702 104.426  -4.184  1.00 32.27           C  
ATOM   6141  OE1 GLN A  55      64.798 104.709  -5.391  1.00 29.65           O  
ATOM   6142  NE2 GLN A  55      63.623 104.738  -3.450  1.00 29.35           N  
ATOM   6143  N   LYS A  56      69.613 101.101  -4.930  1.00 34.56           N  
ATOM   6144  CA  LYS A  56      70.331 100.192  -5.818  1.00 37.73           C  
ATOM   6145  C   LYS A  56      70.857  98.994  -5.032  1.00 35.87           C  
ATOM   6146  O   LYS A  56      70.985  97.916  -5.573  1.00 38.20           O  
ATOM   6147  CB  LYS A  56      71.552 100.875  -6.471  1.00 41.57           C  
ATOM   6148  CG  LYS A  56      71.244 101.745  -7.673  1.00 52.52           C  
ATOM   6149  CD  LYS A  56      72.513 102.439  -8.187  1.00 55.70           C  
ATOM   6150  CE  LYS A  56      72.197 103.449  -9.281  1.00 59.87           C  
ATOM   6151  NZ  LYS A  56      73.371 104.328  -9.595  1.00 63.75           N  
ATOM   6152  N   SER A  57      71.154  99.182  -3.754  1.00 35.36           N  
ATOM   6153  CA  SER A  57      71.722  98.102  -2.968  1.00 33.00           C  
ATOM   6154  C   SER A  57      70.741  97.355  -2.073  1.00 34.17           C  
ATOM   6155  O   SER A  57      69.581  97.748  -1.929  1.00 35.46           O  
ATOM   6156  CB  SER A  57      72.866  98.650  -2.143  1.00 32.78           C  
ATOM   6157  OG  SER A  57      72.387  99.676  -1.306  1.00 37.21           O  
ATOM   6158  N   THR A  58      71.224  96.277  -1.474  1.00 32.90           N  
ATOM   6159  CA  THR A  58      70.414  95.431  -0.610  1.00 34.43           C  
ATOM   6160  C   THR A  58      70.972  95.179   0.795  1.00 35.60           C  
ATOM   6161  O   THR A  58      70.320  94.503   1.606  1.00 33.42           O  
ATOM   6162  CB  THR A  58      70.211  94.072  -1.272  1.00 33.68           C  
ATOM   6163  OG1 THR A  58      71.473  93.399  -1.343  1.00 37.67           O  
ATOM   6164  CG2 THR A  58      69.669  94.245  -2.708  1.00 30.27           C  
ATOM   6165  N   GLU A  59      72.159  95.702   1.108  1.00 34.09           N  
ATOM   6166  CA  GLU A  59      72.717  95.426   2.443  1.00 38.05           C  
ATOM   6167  C   GLU A  59      71.882  96.043   3.538  1.00 35.59           C  
ATOM   6168  O   GLU A  59      71.218  97.057   3.310  1.00 35.21           O  
ATOM   6169  CB  GLU A  59      74.158  95.941   2.612  1.00 39.14           C  
ATOM   6170  CG  GLU A  59      74.689  96.840   1.516  1.00 52.80           C  
ATOM   6171  CD  GLU A  59      73.943  98.157   1.374  1.00 54.19           C  
ATOM   6172  OE1 GLU A  59      74.155  99.079   2.185  1.00 57.21           O  
ATOM   6173  OE2 GLU A  59      73.144  98.269   0.432  1.00 54.12           O  
ATOM   6174  N   LEU A  60      71.934  95.444   4.727  1.00 31.80           N  
ATOM   6175  CA  LEU A  60      71.202  95.962   5.857  1.00 32.13           C  
ATOM   6176  C   LEU A  60      71.777  97.329   6.218  1.00 33.66           C  
ATOM   6177  O   LEU A  60      72.965  97.580   6.024  1.00 34.65           O  
ATOM   6178  CB  LEU A  60      71.273  94.972   7.016  1.00 35.61           C  
ATOM   6179  CG  LEU A  60      70.635  93.625   6.619  1.00 36.25           C  
ATOM   6180  CD1 LEU A  60      70.737  92.620   7.740  1.00 38.22           C  
ATOM   6181  CD2 LEU A  60      69.183  93.853   6.239  1.00 38.98           C  
ATOM   6182  N   LEU A  61      70.934  98.206   6.750  1.00 32.72           N  
ATOM   6183  CA  LEU A  61      71.328  99.568   7.040  1.00 32.86           C  
ATOM   6184  C   LEU A  61      71.440  99.910   8.502  1.00 33.04           C  
ATOM   6185  O   LEU A  61      71.921 101.006   8.838  1.00 34.49           O  
ATOM   6186  CB  LEU A  61      70.357 100.528   6.334  1.00 35.78           C  
ATOM   6187  CG  LEU A  61      70.244 100.247   4.829  1.00 34.10           C  
ATOM   6188  CD1 LEU A  61      69.085 101.054   4.237  1.00 34.28           C  
ATOM   6189  CD2 LEU A  61      71.570 100.608   4.145  1.00 33.42           C  
ATOM   6190  N   ILE A  62      70.957  99.019   9.369  1.00 29.74           N  
ATOM   6191  CA  ILE A  62      71.106  99.218  10.807  1.00 32.34           C  
ATOM   6192  C   ILE A  62      72.351  98.385  11.138  1.00 33.15           C  
ATOM   6193  O   ILE A  62      72.552  97.337  10.531  1.00 34.03           O  
ATOM   6194  CB  ILE A  62      69.917  98.646  11.631  1.00 30.19           C  
ATOM   6195  CG1 ILE A  62      68.605  99.344  11.241  1.00 33.14           C  
ATOM   6196  CG2 ILE A  62      70.156  98.893  13.135  1.00 27.73           C  
ATOM   6197  CD1 ILE A  62      67.360  98.817  12.024  1.00 24.29           C  
ATOM   6198  N   ARG A  63      73.195  98.825  12.065  1.00 36.55           N  
ATOM   6199  CA  ARG A  63      74.383  98.014  12.377  1.00 37.82           C  
ATOM   6200  C   ARG A  63      73.961  96.787  13.169  1.00 38.14           C  
ATOM   6201  O   ARG A  63      73.114  96.870  14.045  1.00 36.74           O  
ATOM   6202  CB  ARG A  63      75.422  98.810  13.160  1.00 40.12           C  
ATOM   6203  CG  ARG A  63      76.188  99.784  12.290  1.00 45.72           C  
ATOM   6204  CD  ARG A  63      75.767 101.167  12.571  1.00 49.96           C  
ATOM   6205  NE  ARG A  63      76.140 101.527  13.926  1.00 56.85           N  
ATOM   6206  CZ  ARG A  63      75.693 102.608  14.551  1.00 59.19           C  
ATOM   6207  NH1 ARG A  63      74.846 103.424  13.920  1.00 54.19           N  
ATOM   6208  NH2 ARG A  63      76.102 102.868  15.793  1.00 53.56           N  
ATOM   6209  N   LYS A  64      74.584  95.656  12.872  1.00 39.08           N  
ATOM   6210  CA  LYS A  64      74.213  94.395  13.489  1.00 41.62           C  
ATOM   6211  C   LYS A  64      74.201  94.257  15.000  1.00 40.58           C  
ATOM   6212  O   LYS A  64      73.183  93.884  15.582  1.00 39.76           O  
ATOM   6213  CB  LYS A  64      75.053  93.282  12.873  1.00 45.75           C  
ATOM   6214  CG  LYS A  64      74.789  93.151  11.377  1.00 59.54           C  
ATOM   6215  CD  LYS A  64      75.429  91.899  10.792  1.00 63.49           C  
ATOM   6216  CE  LYS A  64      74.998  91.681   9.350  1.00 66.82           C  
ATOM   6217  NZ  LYS A  64      75.340  90.293   8.893  1.00 68.98           N  
ATOM   6218  N   LEU A  65      75.319  94.554  15.651  1.00 41.92           N  
ATOM   6219  CA  LEU A  65      75.378  94.404  17.104  1.00 37.93           C  
ATOM   6220  C   LEU A  65      74.305  95.179  17.844  1.00 36.84           C  
ATOM   6221  O   LEU A  65      73.617  94.633  18.700  1.00 39.91           O  
ATOM   6222  CB  LEU A  65      76.758  94.811  17.630  1.00 41.34           C  
ATOM   6223  CG  LEU A  65      76.900  94.855  19.153  1.00 41.41           C  
ATOM   6224  CD1 LEU A  65      76.561  93.508  19.743  1.00 37.80           C  
ATOM   6225  CD2 LEU A  65      78.330  95.242  19.511  1.00 42.68           C  
ATOM   6226  N   PRO A  66      74.157  96.472  17.540  1.00 35.12           N  
ATOM   6227  CA  PRO A  66      73.142  97.275  18.223  1.00 35.27           C  
ATOM   6228  C   PRO A  66      71.746  96.682  17.983  1.00 34.69           C  
ATOM   6229  O   PRO A  66      70.890  96.695  18.867  1.00 35.59           O  
ATOM   6230  CB  PRO A  66      73.296  98.652  17.582  1.00 34.67           C  
ATOM   6231  CG  PRO A  66      74.708  98.645  17.073  1.00 39.04           C  
ATOM   6232  CD  PRO A  66      74.870  97.266  16.532  1.00 34.02           C  
ATOM   6233  N   PHE A  67      71.516  96.151  16.790  1.00 35.36           N  
ATOM   6234  CA  PHE A  67      70.201  95.566  16.514  1.00 34.86           C  
ATOM   6235  C   PHE A  67      70.048  94.317  17.385  1.00 34.59           C  
ATOM   6236  O   PHE A  67      69.013  94.092  18.018  1.00 32.31           O  
ATOM   6237  CB  PHE A  67      70.061  95.191  15.036  1.00 33.09           C  
ATOM   6238  CG  PHE A  67      68.695  94.654  14.681  1.00 35.00           C  
ATOM   6239  CD1 PHE A  67      67.630  95.530  14.422  1.00 33.88           C  
ATOM   6240  CD2 PHE A  67      68.460  93.290  14.647  1.00 31.45           C  
ATOM   6241  CE1 PHE A  67      66.358  95.039  14.139  1.00 30.91           C  
ATOM   6242  CE2 PHE A  67      67.174  92.788  14.361  1.00 33.55           C  
ATOM   6243  CZ  PHE A  67      66.131  93.667  14.111  1.00 30.68           C  
ATOM   6244  N   GLN A  68      71.101  93.513  17.429  1.00 35.42           N  
ATOM   6245  CA  GLN A  68      71.081  92.294  18.224  1.00 36.68           C  
ATOM   6246  C   GLN A  68      70.821  92.596  19.698  1.00 34.97           C  
ATOM   6247  O   GLN A  68      70.026  91.904  20.362  1.00 35.03           O  
ATOM   6248  CB  GLN A  68      72.398  91.538  18.069  1.00 41.19           C  
ATOM   6249  CG  GLN A  68      72.312  90.112  18.580  1.00 51.00           C  
ATOM   6250  CD  GLN A  68      73.431  89.247  18.071  1.00 56.79           C  
ATOM   6251  OE1 GLN A  68      74.589  89.425  18.451  1.00 62.29           O  
ATOM   6252  NE2 GLN A  68      73.100  88.308  17.192  1.00 60.47           N  
ATOM   6253  N   ARG A  69      71.466  93.632  20.216  1.00 33.66           N  
ATOM   6254  CA  ARG A  69      71.264  93.984  21.620  1.00 34.33           C  
ATOM   6255  C   ARG A  69      69.804  94.328  21.843  1.00 33.97           C  
ATOM   6256  O   ARG A  69      69.201  93.906  22.831  1.00 32.80           O  
ATOM   6257  CB  ARG A  69      72.094  95.207  22.031  1.00 35.60           C  
ATOM   6258  CG  ARG A  69      73.582  94.948  22.304  1.00 42.59           C  
ATOM   6259  CD  ARG A  69      74.120  96.053  23.226  1.00 42.45           C  
ATOM   6260  NE  ARG A  69      73.929  97.376  22.644  1.00 42.53           N  
ATOM   6261  CZ  ARG A  69      74.759  97.932  21.769  1.00 43.77           C  
ATOM   6262  NH1 ARG A  69      75.849  97.283  21.381  1.00 45.38           N  
ATOM   6263  NH2 ARG A  69      74.490  99.136  21.271  1.00 42.47           N  
ATOM   6264  N   LEU A  70      69.250  95.121  20.926  1.00 32.05           N  
ATOM   6265  CA  LEU A  70      67.861  95.537  21.032  1.00 32.39           C  
ATOM   6266  C   LEU A  70      66.954  94.324  21.045  1.00 30.48           C  
ATOM   6267  O   LEU A  70      66.059  94.228  21.876  1.00 34.38           O  
ATOM   6268  CB  LEU A  70      67.493  96.459  19.865  1.00 33.91           C  
ATOM   6269  CG  LEU A  70      66.050  96.978  19.845  1.00 32.69           C  
ATOM   6270  CD1 LEU A  70      65.788  97.798  21.105  1.00 30.59           C  
ATOM   6271  CD2 LEU A  70      65.842  97.845  18.605  1.00 28.17           C  
ATOM   6272  N   VAL A  71      67.193  93.399  20.126  1.00 31.45           N  
ATOM   6273  CA  VAL A  71      66.404  92.175  20.033  1.00 32.76           C  
ATOM   6274  C   VAL A  71      66.454  91.379  21.346  1.00 35.38           C  
ATOM   6275  O   VAL A  71      65.410  91.019  21.902  1.00 33.05           O  
ATOM   6276  CB  VAL A  71      66.924  91.313  18.847  1.00 33.61           C  
ATOM   6277  CG1 VAL A  71      66.441  89.880  18.948  1.00 30.55           C  
ATOM   6278  CG2 VAL A  71      66.459  91.940  17.522  1.00 33.46           C  
ATOM   6279  N   ARG A  72      67.666  91.135  21.857  1.00 34.10           N  
ATOM   6280  CA  ARG A  72      67.826  90.380  23.111  1.00 32.61           C  
ATOM   6281  C   ARG A  72      67.114  91.048  24.278  1.00 29.73           C  
ATOM   6282  O   ARG A  72      66.437  90.380  25.073  1.00 30.40           O  
ATOM   6283  CB  ARG A  72      69.318  90.198  23.452  1.00 33.17           C  
ATOM   6284  CG  ARG A  72      70.011  89.240  22.521  1.00 34.41           C  
ATOM   6285  CD  ARG A  72      71.525  89.310  22.667  1.00 40.56           C  
ATOM   6286  NE  ARG A  72      72.172  88.541  21.611  1.00 42.46           N  
ATOM   6287  CZ  ARG A  72      72.148  87.217  21.535  1.00 42.55           C  
ATOM   6288  NH1 ARG A  72      71.518  86.511  22.462  1.00 41.11           N  
ATOM   6289  NH2 ARG A  72      72.729  86.604  20.512  1.00 46.89           N  
ATOM   6290  N   GLU A  73      67.256  92.367  24.377  1.00 29.06           N  
ATOM   6291  CA  GLU A  73      66.614  93.100  25.448  1.00 31.60           C  
ATOM   6292  C   GLU A  73      65.105  92.930  25.373  1.00 33.61           C  
ATOM   6293  O   GLU A  73      64.446  92.671  26.378  1.00 34.10           O  
ATOM   6294  CB  GLU A  73      66.984  94.574  25.357  1.00 35.93           C  
ATOM   6295  CG  GLU A  73      66.143  95.493  26.205  1.00 42.04           C  
ATOM   6296  CD  GLU A  73      66.584  96.930  26.054  1.00 46.90           C  
ATOM   6297  OE1 GLU A  73      67.703  97.250  26.478  1.00 50.80           O  
ATOM   6298  OE2 GLU A  73      65.821  97.743  25.506  1.00 54.79           O  
ATOM   6299  N   ILE A  74      64.530  93.058  24.184  1.00 32.65           N  
ATOM   6300  CA  ILE A  74      63.074  92.892  24.102  1.00 29.97           C  
ATOM   6301  C   ILE A  74      62.646  91.478  24.483  1.00 29.96           C  
ATOM   6302  O   ILE A  74      61.659  91.286  25.202  1.00 30.45           O  
ATOM   6303  CB  ILE A  74      62.558  93.218  22.685  1.00 29.15           C  
ATOM   6304  CG1 ILE A  74      62.574  94.734  22.472  1.00 30.54           C  
ATOM   6305  CG2 ILE A  74      61.151  92.663  22.508  1.00 28.17           C  
ATOM   6306  CD1 ILE A  74      62.523  95.152  20.989  1.00 30.01           C  
ATOM   6307  N   ALA A  75      63.386  90.487  23.999  1.00 30.41           N  
ATOM   6308  CA  ALA A  75      63.065  89.088  24.270  1.00 31.59           C  
ATOM   6309  C   ALA A  75      63.177  88.742  25.755  1.00 37.09           C  
ATOM   6310  O   ALA A  75      62.388  87.937  26.272  1.00 36.49           O  
ATOM   6311  CB  ALA A  75      63.983  88.176  23.456  1.00 34.21           C  
ATOM   6312  N   GLN A  76      64.140  89.356  26.440  1.00 39.37           N  
ATOM   6313  CA  GLN A  76      64.352  89.088  27.865  1.00 42.16           C  
ATOM   6314  C   GLN A  76      63.102  89.429  28.669  1.00 43.43           C  
ATOM   6315  O   GLN A  76      62.892  88.875  29.740  1.00 44.00           O  
ATOM   6316  CB  GLN A  76      65.559  89.886  28.397  1.00 45.13           C  
ATOM   6317  CG  GLN A  76      65.890  89.656  29.890  1.00 49.04           C  
ATOM   6318  CD  GLN A  76      66.839  88.476  30.148  1.00 52.86           C  
ATOM   6319  OE1 GLN A  76      67.117  87.669  29.260  1.00 53.05           O  
ATOM   6320  NE2 GLN A  76      67.326  88.374  31.378  1.00 54.59           N  
ATOM   6321  N   ASP A  77      62.265  90.334  28.156  1.00 44.01           N  
ATOM   6322  CA  ASP A  77      61.033  90.693  28.859  1.00 42.31           C  
ATOM   6323  C   ASP A  77      59.991  89.599  28.707  1.00 43.25           C  
ATOM   6324  O   ASP A  77      59.056  89.529  29.493  1.00 44.78           O  
ATOM   6325  CB  ASP A  77      60.444  92.000  28.320  1.00 48.80           C  
ATOM   6326  CG  ASP A  77      61.259  93.228  28.711  1.00 53.58           C  
ATOM   6327  OD1 ASP A  77      61.172  94.244  27.986  1.00 57.16           O  
ATOM   6328  OD2 ASP A  77      61.971  93.194  29.740  1.00 56.29           O  
ATOM   6329  N   PHE A  78      60.143  88.732  27.709  1.00 40.42           N  
ATOM   6330  CA  PHE A  78      59.159  87.672  27.503  1.00 39.72           C  
ATOM   6331  C   PHE A  78      59.647  86.370  28.100  1.00 40.96           C  
ATOM   6332  O   PHE A  78      58.861  85.552  28.554  1.00 41.02           O  
ATOM   6333  CB  PHE A  78      58.873  87.482  26.005  1.00 37.54           C  
ATOM   6334  CG  PHE A  78      58.365  88.725  25.324  1.00 38.85           C  
ATOM   6335  CD1 PHE A  78      58.917  89.148  24.124  1.00 34.16           C  
ATOM   6336  CD2 PHE A  78      57.355  89.491  25.904  1.00 39.11           C  
ATOM   6337  CE1 PHE A  78      58.490  90.309  23.515  1.00 34.57           C  
ATOM   6338  CE2 PHE A  78      56.914  90.671  25.291  1.00 40.02           C  
ATOM   6339  CZ  PHE A  78      57.488  91.079  24.097  1.00 36.12           C  
ATOM   6340  N   LYS A  79      60.955  86.160  28.066  1.00 41.56           N  
ATOM   6341  CA  LYS A  79      61.522  84.957  28.655  1.00 41.68           C  
ATOM   6342  C   LYS A  79      62.993  85.226  28.896  1.00 41.99           C  
ATOM   6343  O   LYS A  79      63.713  85.628  27.990  1.00 38.50           O  
ATOM   6344  CB  LYS A  79      61.343  83.738  27.747  1.00 41.68           C  
ATOM   6345  CG  LYS A  79      61.722  82.455  28.452  1.00 43.57           C  
ATOM   6346  CD  LYS A  79      61.552  81.230  27.584  1.00 54.03           C  
ATOM   6347  CE  LYS A  79      61.798  79.967  28.400  1.00 58.08           C  
ATOM   6348  NZ  LYS A  79      61.364  78.758  27.674  1.00 65.72           N  
ATOM   6349  N   THR A  80      63.427  85.025  30.136  1.00 43.13           N  
ATOM   6350  CA  THR A  80      64.818  85.269  30.522  1.00 40.96           C  
ATOM   6351  C   THR A  80      65.730  84.138  30.073  1.00 42.40           C  
ATOM   6352  O   THR A  80      65.272  83.040  29.777  1.00 43.04           O  
ATOM   6353  CB  THR A  80      64.944  85.395  32.051  1.00 42.09           C  
ATOM   6354  OG1 THR A  80      64.525  84.166  32.667  1.00 41.85           O  
ATOM   6355  CG2 THR A  80      64.061  86.525  32.571  1.00 41.82           C  
ATOM   6356  N   ASP A  81      67.022  84.440  29.997  1.00 44.53           N  
ATOM   6357  CA  ASP A  81      68.062  83.468  29.659  1.00 44.70           C  
ATOM   6358  C   ASP A  81      67.936  82.745  28.333  1.00 44.44           C  
ATOM   6359  O   ASP A  81      68.256  81.554  28.228  1.00 42.56           O  
ATOM   6360  CB  ASP A  81      68.188  82.446  30.798  1.00 44.29           C  
ATOM   6361  CG  ASP A  81      69.449  81.597  30.691  1.00 45.55           C  
ATOM   6362  OD1 ASP A  81      70.534  82.136  30.403  1.00 48.02           O  
ATOM   6363  OD2 ASP A  81      69.357  80.378  30.908  1.00 50.63           O  
ATOM   6364  N   LEU A  82      67.502  83.479  27.311  1.00 42.63           N  
ATOM   6365  CA  LEU A  82      67.340  82.920  25.981  1.00 39.20           C  
ATOM   6366  C   LEU A  82      68.604  83.055  25.152  1.00 37.56           C  
ATOM   6367  O   LEU A  82      69.395  83.965  25.353  1.00 39.01           O  
ATOM   6368  CB  LEU A  82      66.224  83.659  25.222  1.00 41.09           C  
ATOM   6369  CG  LEU A  82      64.756  83.333  25.481  1.00 41.13           C  
ATOM   6370  CD1 LEU A  82      63.876  84.291  24.661  1.00 44.83           C  
ATOM   6371  CD2 LEU A  82      64.488  81.897  25.090  1.00 40.75           C  
ATOM   6372  N   ARG A  83      68.783  82.142  24.215  1.00 35.96           N  
ATOM   6373  CA  ARG A  83      69.882  82.247  23.272  1.00 37.00           C  
ATOM   6374  C   ARG A  83      69.184  82.474  21.902  1.00 38.21           C  
ATOM   6375  O   ARG A  83      67.960  82.271  21.769  1.00 32.85           O  
ATOM   6376  CB  ARG A  83      70.707  80.952  23.258  1.00 40.28           C  
ATOM   6377  CG  ARG A  83      71.378  80.649  24.622  1.00 45.08           C  
ATOM   6378  CD  ARG A  83      72.217  79.381  24.593  1.00 50.67           C  
ATOM   6379  NE  ARG A  83      73.443  79.577  23.820  1.00 59.32           N  
ATOM   6380  CZ  ARG A  83      74.447  78.704  23.755  1.00 61.26           C  
ATOM   6381  NH1 ARG A  83      74.382  77.559  24.416  1.00 62.97           N  
ATOM   6382  NH2 ARG A  83      75.524  78.982  23.035  1.00 61.19           N  
ATOM   6383  N   PHE A  84      69.947  82.895  20.899  1.00 37.34           N  
ATOM   6384  CA  PHE A  84      69.398  83.120  19.566  1.00 37.40           C  
ATOM   6385  C   PHE A  84      70.266  82.472  18.515  1.00 38.38           C  
ATOM   6386  O   PHE A  84      71.491  82.597  18.572  1.00 41.03           O  
ATOM   6387  CB  PHE A  84      69.328  84.624  19.228  1.00 34.94           C  
ATOM   6388  CG  PHE A  84      68.131  85.326  19.799  1.00 34.57           C  
ATOM   6389  CD1 PHE A  84      68.083  85.676  21.142  1.00 35.97           C  
ATOM   6390  CD2 PHE A  84      67.026  85.605  18.997  1.00 35.99           C  
ATOM   6391  CE1 PHE A  84      66.955  86.285  21.683  1.00 32.25           C  
ATOM   6392  CE2 PHE A  84      65.879  86.223  19.539  1.00 33.44           C  
ATOM   6393  CZ  PHE A  84      65.850  86.555  20.870  1.00 32.43           C  
ATOM   6394  N   GLN A  85      69.668  81.765  17.566  1.00 34.99           N  
ATOM   6395  CA  GLN A  85      70.497  81.242  16.511  1.00 35.52           C  
ATOM   6396  C   GLN A  85      70.846  82.531  15.791  1.00 37.55           C  
ATOM   6397  O   GLN A  85      70.104  83.532  15.875  1.00 37.43           O  
ATOM   6398  CB  GLN A  85      69.730  80.337  15.560  1.00 38.37           C  
ATOM   6399  CG  GLN A  85      69.244  79.051  16.156  1.00 39.33           C  
ATOM   6400  CD  GLN A  85      68.713  78.118  15.096  1.00 42.25           C  
ATOM   6401  OE1 GLN A  85      68.041  78.553  14.153  1.00 39.77           O  
ATOM   6402  NE2 GLN A  85      68.995  76.827  15.242  1.00 39.05           N  
ATOM   6403  N   SER A  86      71.969  82.519  15.089  1.00 35.08           N  
ATOM   6404  CA  SER A  86      72.422  83.680  14.355  1.00 33.45           C  
ATOM   6405  C   SER A  86      71.436  84.038  13.245  1.00 31.05           C  
ATOM   6406  O   SER A  86      71.190  85.208  12.972  1.00 31.46           O  
ATOM   6407  CB  SER A  86      73.783  83.375  13.731  1.00 35.55           C  
ATOM   6408  OG  SER A  86      74.276  84.513  13.073  1.00 46.67           O  
ATOM   6409  N   SER A  87      70.890  83.026  12.593  1.00 29.40           N  
ATOM   6410  CA  SER A  87      69.957  83.247  11.504  1.00 32.24           C  
ATOM   6411  C   SER A  87      68.633  83.841  12.001  1.00 30.56           C  
ATOM   6412  O   SER A  87      67.922  84.489  11.238  1.00 30.58           O  
ATOM   6413  CB  SER A  87      69.711  81.938  10.776  1.00 29.76           C  
ATOM   6414  OG  SER A  87      69.335  80.964  11.739  1.00 40.62           O  
ATOM   6415  N   ALA A  88      68.328  83.633  13.282  1.00 32.10           N  
ATOM   6416  CA  ALA A  88      67.114  84.161  13.900  1.00 30.23           C  
ATOM   6417  C   ALA A  88      67.227  85.679  13.990  1.00 29.83           C  
ATOM   6418  O   ALA A  88      66.292  86.402  13.673  1.00 26.20           O  
ATOM   6419  CB  ALA A  88      66.925  83.577  15.302  1.00 26.77           C  
ATOM   6420  N   VAL A  89      68.368  86.172  14.438  1.00 29.36           N  
ATOM   6421  CA  VAL A  89      68.541  87.615  14.531  1.00 29.57           C  
ATOM   6422  C   VAL A  89      68.547  88.244  13.135  1.00 31.73           C  
ATOM   6423  O   VAL A  89      67.963  89.304  12.919  1.00 34.07           O  
ATOM   6424  CB  VAL A  89      69.850  88.001  15.270  1.00 32.25           C  
ATOM   6425  CG1 VAL A  89      69.988  89.522  15.295  1.00 30.90           C  
ATOM   6426  CG2 VAL A  89      69.808  87.484  16.716  1.00 31.60           C  
ATOM   6427  N   MET A  90      69.203  87.590  12.186  1.00 32.36           N  
ATOM   6428  CA  MET A  90      69.264  88.114  10.833  1.00 32.70           C  
ATOM   6429  C   MET A  90      67.877  88.169  10.188  1.00 29.10           C  
ATOM   6430  O   MET A  90      67.559  89.125   9.523  1.00 29.51           O  
ATOM   6431  CB  MET A  90      70.224  87.275   9.983  1.00 33.72           C  
ATOM   6432  CG  MET A  90      71.665  87.415  10.440  1.00 47.45           C  
ATOM   6433  SD  MET A  90      72.167  89.173  10.534  1.00 59.72           S  
ATOM   6434  CE  MET A  90      72.445  89.480   8.798  1.00 55.11           C  
ATOM   6435  N   ALA A  91      67.061  87.138  10.382  1.00 32.33           N  
ATOM   6436  CA  ALA A  91      65.705  87.132   9.838  1.00 29.61           C  
ATOM   6437  C   ALA A  91      64.916  88.316  10.445  1.00 29.69           C  
ATOM   6438  O   ALA A  91      64.169  89.006   9.747  1.00 29.96           O  
ATOM   6439  CB  ALA A  91      65.011  85.806  10.176  1.00 28.87           C  
ATOM   6440  N   LEU A  92      65.079  88.539  11.747  1.00 28.26           N  
ATOM   6441  CA  LEU A  92      64.390  89.637  12.415  1.00 29.76           C  
ATOM   6442  C   LEU A  92      64.850  90.964  11.815  1.00 29.96           C  
ATOM   6443  O   LEU A  92      64.035  91.878  11.615  1.00 29.82           O  
ATOM   6444  CB  LEU A  92      64.660  89.621  13.940  1.00 25.49           C  
ATOM   6445  CG  LEU A  92      63.830  88.637  14.782  1.00 31.94           C  
ATOM   6446  CD1 LEU A  92      64.436  88.450  16.164  1.00 31.17           C  
ATOM   6447  CD2 LEU A  92      62.390  89.162  14.923  1.00 28.02           C  
ATOM   6448  N   GLN A  93      66.151  91.086  11.532  1.00 25.90           N  
ATOM   6449  CA  GLN A  93      66.640  92.328  10.948  1.00 29.09           C  
ATOM   6450  C   GLN A  93      66.181  92.520   9.496  1.00 27.07           C  
ATOM   6451  O   GLN A  93      65.824  93.638   9.108  1.00 28.32           O  
ATOM   6452  CB  GLN A  93      68.183  92.444  11.014  1.00 27.42           C  
ATOM   6453  CG  GLN A  93      68.640  93.915  11.002  1.00 27.26           C  
ATOM   6454  CD  GLN A  93      70.150  94.093  11.141  1.00 36.11           C  
ATOM   6455  OE1 GLN A  93      70.826  93.246  11.739  1.00 30.09           O  
ATOM   6456  NE2 GLN A  93      70.684  95.209  10.603  1.00 28.31           N  
ATOM   6457  N   GLU A  94      66.216  91.462   8.691  1.00 25.99           N  
ATOM   6458  CA  GLU A  94      65.742  91.575   7.308  1.00 28.34           C  
ATOM   6459  C   GLU A  94      64.265  91.989   7.351  1.00 28.45           C  
ATOM   6460  O   GLU A  94      63.859  92.888   6.629  1.00 26.92           O  
ATOM   6461  CB  GLU A  94      65.863  90.243   6.558  1.00 26.39           C  
ATOM   6462  CG  GLU A  94      67.313  89.867   6.163  1.00 33.57           C  
ATOM   6463  CD  GLU A  94      67.838  90.626   4.960  1.00 36.69           C  
ATOM   6464  OE1 GLU A  94      69.074  90.622   4.763  1.00 34.75           O  
ATOM   6465  OE2 GLU A  94      67.026  91.200   4.185  1.00 35.25           O  
ATOM   6466  N   ALA A  95      63.476  91.352   8.222  1.00 26.13           N  
ATOM   6467  CA  ALA A  95      62.047  91.695   8.304  1.00 28.32           C  
ATOM   6468  C   ALA A  95      61.793  93.108   8.840  1.00 27.58           C  
ATOM   6469  O   ALA A  95      60.928  93.837   8.313  1.00 25.42           O  
ATOM   6470  CB  ALA A  95      61.309  90.675   9.148  1.00 24.35           C  
ATOM   6471  N   SER A  96      62.561  93.501   9.858  1.00 24.05           N  
ATOM   6472  CA  SER A  96      62.403  94.807  10.478  1.00 25.96           C  
ATOM   6473  C   SER A  96      62.791  95.892   9.506  1.00 25.90           C  
ATOM   6474  O   SER A  96      62.095  96.896   9.380  1.00 22.63           O  
ATOM   6475  CB  SER A  96      63.263  94.928  11.759  1.00 24.39           C  
ATOM   6476  OG  SER A  96      62.830  93.979  12.718  1.00 27.17           O  
ATOM   6477  N   GLU A  97      63.894  95.691   8.783  1.00 24.36           N  
ATOM   6478  CA  GLU A  97      64.293  96.720   7.839  1.00 25.25           C  
ATOM   6479  C   GLU A  97      63.331  96.841   6.660  1.00 26.19           C  
ATOM   6480  O   GLU A  97      63.018  97.945   6.225  1.00 25.50           O  
ATOM   6481  CB  GLU A  97      65.741  96.495   7.350  1.00 26.70           C  
ATOM   6482  CG  GLU A  97      66.706  96.808   8.484  1.00 29.14           C  
ATOM   6483  CD  GLU A  97      68.134  97.086   8.043  1.00 33.03           C  
ATOM   6484  OE1 GLU A  97      68.374  97.519   6.888  1.00 26.38           O  
ATOM   6485  OE2 GLU A  97      69.015  96.897   8.903  1.00 31.51           O  
ATOM   6486  N   ALA A  98      62.850  95.715   6.150  1.00 23.39           N  
ATOM   6487  CA  ALA A  98      61.937  95.783   5.014  1.00 25.00           C  
ATOM   6488  C   ALA A  98      60.638  96.494   5.475  1.00 23.63           C  
ATOM   6489  O   ALA A  98      60.044  97.285   4.731  1.00 21.20           O  
ATOM   6490  CB  ALA A  98      61.659  94.368   4.499  1.00 22.36           C  
ATOM   6491  N   TYR A  99      60.245  96.244   6.724  1.00 23.32           N  
ATOM   6492  CA  TYR A  99      59.042  96.858   7.292  1.00 23.52           C  
ATOM   6493  C   TYR A  99      59.227  98.383   7.358  1.00 26.45           C  
ATOM   6494  O   TYR A  99      58.376  99.153   6.896  1.00 24.97           O  
ATOM   6495  CB  TYR A  99      58.792  96.324   8.713  1.00 23.98           C  
ATOM   6496  CG  TYR A  99      57.790  97.138   9.523  1.00 23.63           C  
ATOM   6497  CD1 TYR A  99      56.419  97.045   9.285  1.00 24.23           C  
ATOM   6498  CD2 TYR A  99      58.226  98.030  10.490  1.00 25.98           C  
ATOM   6499  CE1 TYR A  99      55.522  97.824   9.985  1.00 24.92           C  
ATOM   6500  CE2 TYR A  99      57.339  98.811  11.197  1.00 28.41           C  
ATOM   6501  CZ  TYR A  99      55.987  98.698  10.937  1.00 27.24           C  
ATOM   6502  OH  TYR A  99      55.133  99.460  11.676  1.00 26.42           O  
ATOM   6503  N   LEU A 100      60.354  98.825   7.901  1.00 23.58           N  
ATOM   6504  CA  LEU A 100      60.570 100.263   8.046  1.00 23.10           C  
ATOM   6505  C   LEU A 100      60.723 100.971   6.729  1.00 21.68           C  
ATOM   6506  O   LEU A 100      60.255 102.101   6.576  1.00 25.16           O  
ATOM   6507  CB  LEU A 100      61.796 100.564   8.925  1.00 25.51           C  
ATOM   6508  CG  LEU A 100      61.645 100.227  10.414  1.00 29.02           C  
ATOM   6509  CD1 LEU A 100      62.966 100.552  11.154  1.00 29.64           C  
ATOM   6510  CD2 LEU A 100      60.503 101.034  11.027  1.00 23.70           C  
ATOM   6511  N   VAL A 101      61.394 100.329   5.780  1.00 22.24           N  
ATOM   6512  CA  VAL A 101      61.610 100.935   4.457  1.00 24.91           C  
ATOM   6513  C   VAL A 101      60.244 101.125   3.753  1.00 24.58           C  
ATOM   6514  O   VAL A 101      59.943 102.187   3.202  1.00 25.95           O  
ATOM   6515  CB  VAL A 101      62.504 100.030   3.594  1.00 25.66           C  
ATOM   6516  CG1 VAL A 101      62.423 100.474   2.131  1.00 26.11           C  
ATOM   6517  CG2 VAL A 101      63.968 100.085   4.119  1.00 26.96           C  
ATOM   6518  N   ALA A 102      59.416 100.095   3.768  1.00 24.39           N  
ATOM   6519  CA  ALA A 102      58.091 100.216   3.140  1.00 22.62           C  
ATOM   6520  C   ALA A 102      57.235 101.227   3.910  1.00 23.86           C  
ATOM   6521  O   ALA A 102      56.418 101.929   3.303  1.00 23.78           O  
ATOM   6522  CB  ALA A 102      57.386  98.842   3.075  1.00 22.41           C  
ATOM   6523  N   LEU A 103      57.405 101.297   5.235  1.00 20.86           N  
ATOM   6524  CA  LEU A 103      56.644 102.279   6.019  1.00 20.96           C  
ATOM   6525  C   LEU A 103      57.100 103.698   5.642  1.00 23.93           C  
ATOM   6526  O   LEU A 103      56.298 104.645   5.584  1.00 23.09           O  
ATOM   6527  CB  LEU A 103      56.833 102.058   7.528  1.00 20.69           C  
ATOM   6528  CG  LEU A 103      56.224 103.139   8.444  1.00 24.62           C  
ATOM   6529  CD1 LEU A 103      54.653 103.168   8.281  1.00 24.13           C  
ATOM   6530  CD2 LEU A 103      56.601 102.824   9.903  1.00 20.13           C  
ATOM   6531  N   PHE A 104      58.397 103.853   5.394  1.00 22.27           N  
ATOM   6532  CA  PHE A 104      58.909 105.157   4.984  1.00 22.07           C  
ATOM   6533  C   PHE A 104      58.361 105.561   3.615  1.00 21.24           C  
ATOM   6534  O   PHE A 104      58.162 106.747   3.343  1.00 26.45           O  
ATOM   6535  CB  PHE A 104      60.436 105.145   4.974  1.00 21.90           C  
ATOM   6536  CG  PHE A 104      61.040 105.481   6.317  1.00 22.45           C  
ATOM   6537  CD1 PHE A 104      62.041 104.676   6.879  1.00 24.90           C  
ATOM   6538  CD2 PHE A 104      60.585 106.570   7.028  1.00 22.59           C  
ATOM   6539  CE1 PHE A 104      62.559 104.966   8.142  1.00 25.18           C  
ATOM   6540  CE2 PHE A 104      61.087 106.874   8.293  1.00 24.49           C  
ATOM   6541  CZ  PHE A 104      62.074 106.071   8.853  1.00 27.21           C  
ATOM   6542  N   GLU A 105      58.131 104.592   2.745  1.00 21.85           N  
ATOM   6543  CA  GLU A 105      57.558 104.878   1.436  1.00 24.01           C  
ATOM   6544  C   GLU A 105      56.145 105.454   1.672  1.00 23.50           C  
ATOM   6545  O   GLU A 105      55.799 106.497   1.133  1.00 25.50           O  
ATOM   6546  CB  GLU A 105      57.462 103.598   0.583  1.00 23.69           C  
ATOM   6547  CG  GLU A 105      58.818 102.928   0.257  1.00 31.65           C  
ATOM   6548  CD  GLU A 105      58.660 101.554  -0.435  1.00 37.21           C  
ATOM   6549  OE1 GLU A 105      57.508 101.107  -0.593  1.00 34.77           O  
ATOM   6550  OE2 GLU A 105      59.681 100.926  -0.807  1.00 34.51           O  
ATOM   6551  N   ASP A 106      55.332 104.782   2.487  1.00 24.08           N  
ATOM   6552  CA  ASP A 106      53.957 105.280   2.762  1.00 23.69           C  
ATOM   6553  C   ASP A 106      53.974 106.637   3.477  1.00 22.79           C  
ATOM   6554  O   ASP A 106      53.136 107.519   3.237  1.00 24.26           O  
ATOM   6555  CB  ASP A 106      53.206 104.288   3.641  1.00 21.10           C  
ATOM   6556  CG  ASP A 106      52.999 102.963   2.956  1.00 24.05           C  
ATOM   6557  OD1 ASP A 106      53.304 102.853   1.739  1.00 28.43           O  
ATOM   6558  OD2 ASP A 106      52.520 102.030   3.630  1.00 27.75           O  
ATOM   6559  N   THR A 107      54.923 106.780   4.390  1.00 22.82           N  
ATOM   6560  CA  THR A 107      55.088 108.017   5.143  1.00 25.13           C  
ATOM   6561  C   THR A 107      55.361 109.140   4.124  1.00 24.73           C  
ATOM   6562  O   THR A 107      54.741 110.214   4.145  1.00 26.19           O  
ATOM   6563  CB  THR A 107      56.263 107.826   6.146  1.00 27.96           C  
ATOM   6564  OG1 THR A 107      55.870 106.847   7.129  1.00 23.22           O  
ATOM   6565  CG2 THR A 107      56.666 109.128   6.808  1.00 23.91           C  
ATOM   6566  N   ASN A 108      56.251 108.860   3.194  1.00 24.50           N  
ATOM   6567  CA  ASN A 108      56.608 109.830   2.165  1.00 24.07           C  
ATOM   6568  C   ASN A 108      55.376 110.239   1.300  1.00 24.75           C  
ATOM   6569  O   ASN A 108      55.155 111.431   0.994  1.00 22.44           O  
ATOM   6570  CB  ASN A 108      57.724 109.244   1.289  1.00 24.55           C  
ATOM   6571  CG  ASN A 108      58.570 110.326   0.676  1.00 28.87           C  
ATOM   6572  OD1 ASN A 108      58.821 111.346   1.324  1.00 27.68           O  
ATOM   6573  ND2 ASN A 108      59.016 110.125  -0.553  1.00 29.10           N  
ATOM   6574  N   LEU A 109      54.561 109.270   0.922  1.00 18.78           N  
ATOM   6575  CA  LEU A 109      53.363 109.599   0.166  1.00 21.19           C  
ATOM   6576  C   LEU A 109      52.441 110.497   1.011  1.00 23.77           C  
ATOM   6577  O   LEU A 109      51.795 111.379   0.466  1.00 24.32           O  
ATOM   6578  CB  LEU A 109      52.603 108.333  -0.234  1.00 22.71           C  
ATOM   6579  CG  LEU A 109      53.360 107.449  -1.235  1.00 29.73           C  
ATOM   6580  CD1 LEU A 109      52.538 106.202  -1.577  1.00 25.80           C  
ATOM   6581  CD2 LEU A 109      53.623 108.277  -2.498  1.00 24.92           C  
ATOM   6582  N   CYS A 110      52.389 110.280   2.332  1.00 22.93           N  
ATOM   6583  CA  CYS A 110      51.540 111.108   3.194  1.00 24.00           C  
ATOM   6584  C   CYS A 110      52.053 112.558   3.308  1.00 25.62           C  
ATOM   6585  O   CYS A 110      51.279 113.515   3.286  1.00 24.05           O  
ATOM   6586  CB  CYS A 110      51.430 110.487   4.589  1.00 24.74           C  
ATOM   6587  SG  CYS A 110      50.515 108.909   4.560  1.00 22.98           S  
ATOM   6588  N   ALA A 111      53.358 112.711   3.417  1.00 25.95           N  
ATOM   6589  CA  ALA A 111      53.951 114.055   3.497  1.00 27.71           C  
ATOM   6590  C   ALA A 111      53.687 114.760   2.163  1.00 24.81           C  
ATOM   6591  O   ALA A 111      53.276 115.913   2.137  1.00 28.64           O  
ATOM   6592  CB  ALA A 111      55.433 113.947   3.745  1.00 27.31           C  
ATOM   6593  N   ILE A 112      53.895 114.056   1.056  1.00 26.52           N  
ATOM   6594  CA  ILE A 112      53.651 114.636  -0.261  1.00 27.03           C  
ATOM   6595  C   ILE A 112      52.176 114.982  -0.449  1.00 29.33           C  
ATOM   6596  O   ILE A 112      51.831 115.977  -1.085  1.00 27.65           O  
ATOM   6597  CB  ILE A 112      54.115 113.682  -1.399  1.00 28.32           C  
ATOM   6598  CG1 ILE A 112      55.644 113.567  -1.375  1.00 25.59           C  
ATOM   6599  CG2 ILE A 112      53.664 114.229  -2.777  1.00 31.49           C  
ATOM   6600  CD1 ILE A 112      56.204 112.510  -2.351  1.00 26.02           C  
ATOM   6601  N   HIS A 113      51.296 114.178   0.141  1.00 28.57           N  
ATOM   6602  CA  HIS A 113      49.881 114.432   0.026  1.00 25.77           C  
ATOM   6603  C   HIS A 113      49.572 115.802   0.658  1.00 27.16           C  
ATOM   6604  O   HIS A 113      48.686 116.531   0.199  1.00 25.99           O  
ATOM   6605  CB  HIS A 113      49.101 113.341   0.758  1.00 25.76           C  
ATOM   6606  CG  HIS A 113      47.615 113.455   0.604  1.00 22.92           C  
ATOM   6607  ND1 HIS A 113      46.975 113.176  -0.581  1.00 24.23           N  
ATOM   6608  CD2 HIS A 113      46.641 113.758   1.498  1.00 23.37           C  
ATOM   6609  CE1 HIS A 113      45.666 113.297  -0.416  1.00 22.39           C  
ATOM   6610  NE2 HIS A 113      45.437 113.652   0.836  1.00 22.84           N  
ATOM   6611  N   ALA A 114      50.299 116.146   1.715  1.00 27.25           N  
ATOM   6612  CA  ALA A 114      50.075 117.412   2.401  1.00 28.36           C  
ATOM   6613  C   ALA A 114      50.936 118.514   1.771  1.00 29.08           C  
ATOM   6614  O   ALA A 114      51.159 119.546   2.366  1.00 30.81           O  
ATOM   6615  CB  ALA A 114      50.384 117.268   3.897  1.00 27.31           C  
ATOM   6616  N   LYS A 115      51.401 118.285   0.553  1.00 29.71           N  
ATOM   6617  CA  LYS A 115      52.220 119.262  -0.147  1.00 34.64           C  
ATOM   6618  C   LYS A 115      53.551 119.566   0.516  1.00 35.32           C  
ATOM   6619  O   LYS A 115      54.045 120.689   0.420  1.00 35.96           O  
ATOM   6620  CB  LYS A 115      51.441 120.572  -0.349  1.00 38.38           C  
ATOM   6621  CG  LYS A 115      50.184 120.400  -1.205  1.00 44.63           C  
ATOM   6622  CD  LYS A 115      49.283 121.622  -1.087  1.00 51.46           C  
ATOM   6623  CE  LYS A 115      48.140 121.578  -2.088  1.00 54.88           C  
ATOM   6624  NZ  LYS A 115      47.327 122.830  -1.998  1.00 58.75           N  
ATOM   6625  N   ARG A 116      54.133 118.581   1.190  1.00 32.00           N  
ATOM   6626  CA  ARG A 116      55.444 118.774   1.812  1.00 31.32           C  
ATOM   6627  C   ARG A 116      56.405 117.793   1.151  1.00 31.40           C  
ATOM   6628  O   ARG A 116      56.002 116.957   0.332  1.00 31.29           O  
ATOM   6629  CB  ARG A 116      55.398 118.494   3.324  1.00 29.95           C  
ATOM   6630  CG  ARG A 116      54.692 119.563   4.155  1.00 31.80           C  
ATOM   6631  CD  ARG A 116      54.693 119.266   5.640  1.00 30.27           C  
ATOM   6632  NE  ARG A 116      53.598 118.380   6.061  1.00 28.57           N  
ATOM   6633  CZ  ARG A 116      53.711 117.062   6.229  1.00 31.68           C  
ATOM   6634  NH1 ARG A 116      54.874 116.454   6.006  1.00 26.21           N  
ATOM   6635  NH2 ARG A 116      52.667 116.351   6.671  1.00 31.19           N  
ATOM   6636  N   VAL A 117      57.684 117.909   1.479  1.00 32.07           N  
ATOM   6637  CA  VAL A 117      58.657 116.974   0.955  1.00 30.47           C  
ATOM   6638  C   VAL A 117      59.444 116.492   2.177  1.00 29.56           C  
ATOM   6639  O   VAL A 117      60.388 115.730   2.079  1.00 30.67           O  
ATOM   6640  CB  VAL A 117      59.579 117.643  -0.113  1.00 34.71           C  
ATOM   6641  CG1 VAL A 117      58.746 118.068  -1.314  1.00 29.70           C  
ATOM   6642  CG2 VAL A 117      60.291 118.863   0.467  1.00 31.21           C  
ATOM   6643  N   THR A 118      59.002 116.934   3.342  1.00 29.71           N  
ATOM   6644  CA  THR A 118      59.636 116.571   4.600  1.00 30.69           C  
ATOM   6645  C   THR A 118      58.702 115.663   5.390  1.00 31.94           C  
ATOM   6646  O   THR A 118      57.577 116.064   5.742  1.00 31.21           O  
ATOM   6647  CB  THR A 118      59.902 117.815   5.489  1.00 29.75           C  
ATOM   6648  OG1 THR A 118      60.582 118.814   4.735  1.00 32.82           O  
ATOM   6649  CG2 THR A 118      60.735 117.455   6.680  1.00 28.72           C  
ATOM   6650  N   ILE A 119      59.152 114.444   5.671  1.00 29.36           N  
ATOM   6651  CA  ILE A 119      58.316 113.565   6.470  1.00 29.65           C  
ATOM   6652  C   ILE A 119      58.323 113.999   7.927  1.00 30.12           C  
ATOM   6653  O   ILE A 119      59.347 114.420   8.473  1.00 30.00           O  
ATOM   6654  CB  ILE A 119      58.759 112.085   6.386  1.00 27.87           C  
ATOM   6655  CG1 ILE A 119      60.214 111.910   6.793  1.00 23.90           C  
ATOM   6656  CG2 ILE A 119      58.532 111.591   4.987  1.00 24.73           C  
ATOM   6657  CD1 ILE A 119      60.589 110.442   7.040  1.00 27.85           C  
ATOM   6658  N   MET A 120      57.157 113.890   8.552  1.00 27.47           N  
ATOM   6659  CA  MET A 120      57.007 114.253   9.931  1.00 26.91           C  
ATOM   6660  C   MET A 120      56.326 113.128  10.701  1.00 27.59           C  
ATOM   6661  O   MET A 120      55.719 112.214  10.124  1.00 25.63           O  
ATOM   6662  CB  MET A 120      56.187 115.532  10.040  1.00 27.26           C  
ATOM   6663  CG  MET A 120      56.788 116.681   9.237  1.00 32.82           C  
ATOM   6664  SD  MET A 120      55.738 118.123   9.245  1.00 37.46           S  
ATOM   6665  CE  MET A 120      56.830 119.359   8.404  1.00 40.94           C  
ATOM   6666  N   PRO A 121      56.409 113.185  12.019  1.00 26.77           N  
ATOM   6667  CA  PRO A 121      55.769 112.121  12.779  1.00 28.56           C  
ATOM   6668  C   PRO A 121      54.300 111.911  12.374  1.00 31.29           C  
ATOM   6669  O   PRO A 121      53.821 110.766  12.322  1.00 30.76           O  
ATOM   6670  CB  PRO A 121      55.912 112.605  14.215  1.00 28.88           C  
ATOM   6671  CG  PRO A 121      57.288 113.264  14.190  1.00 27.83           C  
ATOM   6672  CD  PRO A 121      57.162 114.095  12.905  1.00 30.77           C  
ATOM   6673  N   LYS A 122      53.587 112.991  12.079  1.00 27.54           N  
ATOM   6674  CA  LYS A 122      52.166 112.817  11.741  1.00 28.30           C  
ATOM   6675  C   LYS A 122      51.985 112.047  10.447  1.00 26.37           C  
ATOM   6676  O   LYS A 122      50.922 111.479  10.201  1.00 27.57           O  
ATOM   6677  CB  LYS A 122      51.455 114.161  11.672  1.00 26.87           C  
ATOM   6678  CG  LYS A 122      52.059 115.150  10.702  1.00 32.09           C  
ATOM   6679  CD  LYS A 122      51.333 116.484  10.799  1.00 37.72           C  
ATOM   6680  CE  LYS A 122      51.984 117.516   9.929  1.00 45.59           C  
ATOM   6681  NZ  LYS A 122      51.239 118.799   9.990  1.00 52.04           N  
ATOM   6682  N   ASP A 123      53.018 112.029   9.606  1.00 25.47           N  
ATOM   6683  CA  ASP A 123      52.929 111.259   8.371  1.00 24.33           C  
ATOM   6684  C   ASP A 123      53.057 109.773   8.681  1.00 24.14           C  
ATOM   6685  O   ASP A 123      52.364 108.965   8.096  1.00 19.51           O  
ATOM   6686  CB  ASP A 123      54.017 111.659   7.402  1.00 20.99           C  
ATOM   6687  CG  ASP A 123      53.917 113.105   7.004  1.00 27.84           C  
ATOM   6688  OD1 ASP A 123      52.778 113.560   6.711  1.00 24.32           O  
ATOM   6689  OD2 ASP A 123      54.980 113.770   6.968  1.00 24.46           O  
ATOM   6690  N   ILE A 124      53.959 109.414   9.598  1.00 21.48           N  
ATOM   6691  CA  ILE A 124      54.133 108.005   9.948  1.00 21.98           C  
ATOM   6692  C   ILE A 124      52.844 107.534  10.645  1.00 22.38           C  
ATOM   6693  O   ILE A 124      52.396 106.419  10.439  1.00 24.17           O  
ATOM   6694  CB  ILE A 124      55.333 107.811  10.954  1.00 23.10           C  
ATOM   6695  CG1 ILE A 124      56.662 108.060  10.249  1.00 27.86           C  
ATOM   6696  CG2 ILE A 124      55.305 106.419  11.571  1.00 23.67           C  
ATOM   6697  CD1 ILE A 124      57.865 107.992  11.213  1.00 30.03           C  
ATOM   6698  N   GLN A 125      52.287 108.392  11.492  1.00 22.48           N  
ATOM   6699  CA  GLN A 125      51.076 108.068  12.244  1.00 26.48           C  
ATOM   6700  C   GLN A 125      49.905 107.864  11.297  1.00 23.17           C  
ATOM   6701  O   GLN A 125      49.170 106.922  11.451  1.00 23.56           O  
ATOM   6702  CB  GLN A 125      50.769 109.168  13.271  1.00 31.02           C  
ATOM   6703  CG  GLN A 125      51.774 109.161  14.469  1.00 34.08           C  
ATOM   6704  CD  GLN A 125      51.908 110.531  15.150  1.00 40.29           C  
ATOM   6705  OE1 GLN A 125      51.058 111.394  14.995  1.00 39.56           O  
ATOM   6706  NE2 GLN A 125      52.991 110.720  15.914  1.00 43.36           N  
ATOM   6707  N   LEU A 126      49.752 108.735  10.314  1.00 21.29           N  
ATOM   6708  CA  LEU A 126      48.675 108.572   9.333  1.00 22.09           C  
ATOM   6709  C   LEU A 126      48.852 107.225   8.614  1.00 22.69           C  
ATOM   6710  O   LEU A 126      47.905 106.431   8.510  1.00 22.68           O  
ATOM   6711  CB  LEU A 126      48.706 109.692   8.286  1.00 24.40           C  
ATOM   6712  CG  LEU A 126      47.606 109.580   7.212  1.00 25.11           C  
ATOM   6713  CD1 LEU A 126      46.231 109.541   7.913  1.00 24.34           C  
ATOM   6714  CD2 LEU A 126      47.683 110.780   6.221  1.00 21.76           C  
ATOM   6715  N   ALA A 127      50.058 106.963   8.114  1.00 23.45           N  
ATOM   6716  CA  ALA A 127      50.300 105.698   7.405  1.00 22.75           C  
ATOM   6717  C   ALA A 127      49.986 104.474   8.269  1.00 25.92           C  
ATOM   6718  O   ALA A 127      49.310 103.536   7.814  1.00 22.25           O  
ATOM   6719  CB  ALA A 127      51.753 105.632   6.914  1.00 22.76           C  
ATOM   6720  N   ARG A 128      50.418 104.495   9.537  1.00 24.80           N  
ATOM   6721  CA  ARG A 128      50.182 103.344  10.389  1.00 23.71           C  
ATOM   6722  C   ARG A 128      48.700 103.177  10.691  1.00 27.34           C  
ATOM   6723  O   ARG A 128      48.197 102.051  10.818  1.00 26.49           O  
ATOM   6724  CB  ARG A 128      50.978 103.432  11.702  1.00 22.86           C  
ATOM   6725  CG  ARG A 128      52.482 103.277  11.464  1.00 23.13           C  
ATOM   6726  CD  ARG A 128      53.262 103.169  12.769  1.00 30.40           C  
ATOM   6727  NE  ARG A 128      53.010 101.894  13.423  1.00 30.87           N  
ATOM   6728  CZ  ARG A 128      52.641 101.759  14.690  1.00 33.84           C  
ATOM   6729  NH1 ARG A 128      52.473 102.817  15.463  1.00 32.50           N  
ATOM   6730  NH2 ARG A 128      52.453 100.549  15.188  1.00 36.45           N  
ATOM   6731  N   ARG A 129      48.007 104.292  10.860  1.00 26.07           N  
ATOM   6732  CA  ARG A 129      46.585 104.209  11.136  1.00 27.30           C  
ATOM   6733  C   ARG A 129      45.824 103.595   9.951  1.00 26.57           C  
ATOM   6734  O   ARG A 129      44.967 102.730  10.128  1.00 26.06           O  
ATOM   6735  CB  ARG A 129      46.045 105.603  11.458  1.00 30.83           C  
ATOM   6736  CG  ARG A 129      44.565 105.757  11.205  1.00 35.90           C  
ATOM   6737  CD  ARG A 129      43.704 104.809  12.040  1.00 38.12           C  
ATOM   6738  NE  ARG A 129      42.285 105.057  11.787  1.00 36.59           N  
ATOM   6739  CZ  ARG A 129      41.640 104.650  10.696  1.00 39.03           C  
ATOM   6740  NH1 ARG A 129      42.297 103.958   9.769  1.00 29.97           N  
ATOM   6741  NH2 ARG A 129      40.350 104.963  10.517  1.00 38.78           N  
ATOM   6742  N   ILE A 130      46.148 104.022   8.742  1.00 23.93           N  
ATOM   6743  CA  ILE A 130      45.462 103.509   7.570  1.00 25.65           C  
ATOM   6744  C   ILE A 130      45.832 102.048   7.312  1.00 28.26           C  
ATOM   6745  O   ILE A 130      44.996 101.265   6.856  1.00 26.68           O  
ATOM   6746  CB  ILE A 130      45.763 104.379   6.347  1.00 27.37           C  
ATOM   6747  CG1 ILE A 130      45.116 105.765   6.545  1.00 28.18           C  
ATOM   6748  CG2 ILE A 130      45.212 103.721   5.087  1.00 25.27           C  
ATOM   6749  CD1 ILE A 130      45.713 106.807   5.646  1.00 33.57           C  
ATOM   6750  N   ARG A 131      47.079 101.689   7.597  1.00 26.29           N  
ATOM   6751  CA  ARG A 131      47.510 100.303   7.459  1.00 27.17           C  
ATOM   6752  C   ARG A 131      46.775  99.460   8.487  1.00 30.56           C  
ATOM   6753  O   ARG A 131      46.761  98.241   8.395  1.00 33.28           O  
ATOM   6754  CB  ARG A 131      48.995 100.163   7.751  1.00 28.82           C  
ATOM   6755  CG  ARG A 131      49.906 100.667   6.685  1.00 29.61           C  
ATOM   6756  CD  ARG A 131      51.305 100.754   7.239  1.00 27.18           C  
ATOM   6757  NE  ARG A 131      52.242 100.755   6.146  1.00 31.82           N  
ATOM   6758  CZ  ARG A 131      53.379 100.069   6.143  1.00 31.37           C  
ATOM   6759  NH1 ARG A 131      53.710  99.338   7.206  1.00 21.72           N  
ATOM   6760  NH2 ARG A 131      54.148 100.082   5.063  1.00 27.44           N  
ATOM   6761  N   GLY A 132      46.190 100.095   9.491  1.00 32.89           N  
ATOM   6762  CA  GLY A 132      45.489  99.326  10.501  1.00 35.59           C  
ATOM   6763  C   GLY A 132      46.432  98.855  11.598  1.00 39.92           C  
ATOM   6764  O   GLY A 132      46.115  97.925  12.341  1.00 39.65           O  
ATOM   6765  N   GLU A 133      47.595  99.484  11.714  1.00 37.36           N  
ATOM   6766  CA  GLU A 133      48.535  99.083  12.755  1.00 41.86           C  
ATOM   6767  C   GLU A 133      48.208  99.887  13.998  1.00 47.70           C  
ATOM   6768  O   GLU A 133      48.587  99.517  15.107  1.00 49.18           O  
ATOM   6769  CB  GLU A 133      49.988  99.340  12.319  1.00 36.90           C  
ATOM   6770  CG  GLU A 133      50.496  98.410  11.192  1.00 32.06           C  
ATOM   6771  CD  GLU A 133      51.885  98.805  10.684  1.00 35.40           C  
ATOM   6772  OE1 GLU A 133      52.638  99.459  11.438  1.00 31.89           O  
ATOM   6773  OE2 GLU A 133      52.232  98.440   9.543  1.00 31.44           O  
ATOM   6774  N   ARG A 134      47.503 100.994  13.777  1.00 53.50           N  
ATOM   6775  CA  ARG A 134      47.055 101.926  14.822  1.00 60.23           C  
ATOM   6776  C   ARG A 134      45.536 101.795  14.913  1.00 61.36           C  
ATOM   6777  O   ARG A 134      44.952 101.924  15.987  1.00 64.05           O  
ATOM   6778  CB  ARG A 134      47.370 103.387  14.444  1.00 58.38           C  
ATOM   6779  CG  ARG A 134      48.730 103.943  14.836  1.00 61.72           C  
ATOM   6780  CD  ARG A 134      48.835 105.415  14.370  1.00 61.00           C  
ATOM   6781  NE  ARG A 134      49.985 106.150  14.906  1.00 65.86           N  
ATOM   6782  CZ  ARG A 134      51.249 105.728  14.870  1.00 62.76           C  
ATOM   6783  NH1 ARG A 134      51.542 104.564  14.334  1.00 65.88           N  
ATOM   6784  NH2 ARG A 134      52.228 106.486  15.341  1.00 64.73           N  
ATOM   6785  N   ALA A 135      44.901 101.563  13.771  1.00 63.36           N  
ATOM   6786  CA  ALA A 135      43.448 101.417  13.729  1.00 68.02           C  
ATOM   6787  C   ALA A 135      42.996 100.067  14.298  1.00 71.15           C  
ATOM   6788  O   ALA A 135      42.368 100.064  15.386  1.00 72.52           O  
ATOM   6789  CB  ALA A 135      42.953 101.572  12.303  1.00 65.20           C  
ATOM   6790  OXT ALA A 135      43.279  99.028  13.652  1.00 73.08           O  
TER    6791      ALA A 135                                                      
ATOM   6792  N   VAL B  21      80.968 106.256  27.818  1.00 93.99           N  
ATOM   6793  CA  VAL B  21      79.601 106.850  27.803  1.00 94.15           C  
ATOM   6794  C   VAL B  21      78.552 105.768  27.562  1.00 93.64           C  
ATOM   6795  O   VAL B  21      78.606 105.057  26.559  1.00 94.46           O  
ATOM   6796  CB  VAL B  21      79.473 107.912  26.692  1.00 94.77           C  
ATOM   6797  CG1 VAL B  21      78.105 108.561  26.753  1.00 95.84           C  
ATOM   6798  CG2 VAL B  21      80.567 108.956  26.839  1.00 95.30           C  
ATOM   6799  N   LEU B  22      77.600 105.645  28.484  1.00 91.88           N  
ATOM   6800  CA  LEU B  22      76.541 104.648  28.362  1.00 90.18           C  
ATOM   6801  C   LEU B  22      75.727 104.819  27.077  1.00 88.11           C  
ATOM   6802  O   LEU B  22      76.114 105.583  26.188  1.00 88.44           O  
ATOM   6803  CB  LEU B  22      75.625 104.707  29.589  1.00 91.82           C  
ATOM   6804  CG  LEU B  22      75.379 106.077  30.227  1.00 93.38           C  
ATOM   6805  CD1 LEU B  22      74.804 107.050  29.203  1.00 94.55           C  
ATOM   6806  CD2 LEU B  22      74.432 105.910  31.407  1.00 93.50           C  
ATOM   6807  N   ARG B  23      74.601 104.115  26.977  1.00 84.18           N  
ATOM   6808  CA  ARG B  23      73.772 104.192  25.776  1.00 80.84           C  
ATOM   6809  C   ARG B  23      72.562 103.257  25.830  1.00 77.02           C  
ATOM   6810  O   ARG B  23      72.710 102.036  25.885  1.00 76.68           O  
ATOM   6811  CB  ARG B  23      74.625 103.837  24.556  1.00 82.63           C  
ATOM   6812  CG  ARG B  23      73.946 103.995  23.208  1.00 85.54           C  
ATOM   6813  CD  ARG B  23      73.762 105.453  22.833  1.00 87.49           C  
ATOM   6814  NE  ARG B  23      73.813 105.631  21.383  1.00 89.85           N  
ATOM   6815  CZ  ARG B  23      73.685 106.802  20.766  1.00 90.61           C  
ATOM   6816  NH1 ARG B  23      73.487 107.912  21.468  1.00 90.46           N  
ATOM   6817  NH2 ARG B  23      73.777 106.864  19.446  1.00 89.48           N  
ATOM   6818  N   ASP B  24      71.366 103.834  25.812  1.00 72.59           N  
ATOM   6819  CA  ASP B  24      70.132 103.051  25.830  1.00 66.72           C  
ATOM   6820  C   ASP B  24      70.127 102.264  24.515  1.00 59.87           C  
ATOM   6821  O   ASP B  24      70.367 102.843  23.462  1.00 57.87           O  
ATOM   6822  CB  ASP B  24      68.938 103.999  25.889  1.00 70.78           C  
ATOM   6823  CG  ASP B  24      67.684 103.328  26.380  1.00 73.44           C  
ATOM   6824  OD1 ASP B  24      67.306 102.280  25.816  1.00 76.10           O  
ATOM   6825  OD2 ASP B  24      67.072 103.860  27.329  1.00 75.76           O  
ATOM   6826  N   ASN B  25      69.860 100.959  24.578  1.00 54.71           N  
ATOM   6827  CA  ASN B  25      69.877 100.091  23.389  1.00 49.15           C  
ATOM   6828  C   ASN B  25      69.087 100.566  22.178  1.00 46.40           C  
ATOM   6829  O   ASN B  25      69.602 100.559  21.066  1.00 46.31           O  
ATOM   6830  CB  ASN B  25      69.427  98.672  23.744  1.00 46.00           C  
ATOM   6831  CG  ASN B  25      70.459  97.917  24.568  1.00 47.90           C  
ATOM   6832  OD1 ASN B  25      71.644  97.884  24.229  1.00 40.84           O  
ATOM   6833  ND2 ASN B  25      70.005  97.295  25.647  1.00 43.90           N  
ATOM   6834  N   ILE B  26      67.839 100.960  22.385  1.00 44.95           N  
ATOM   6835  CA  ILE B  26      67.020 101.446  21.290  1.00 43.83           C  
ATOM   6836  C   ILE B  26      67.697 102.676  20.687  1.00 44.01           C  
ATOM   6837  O   ILE B  26      67.471 102.994  19.526  1.00 42.30           O  
ATOM   6838  CB  ILE B  26      65.591 101.793  21.771  1.00 45.06           C  
ATOM   6839  CG1 ILE B  26      64.699 102.178  20.584  1.00 44.05           C  
ATOM   6840  CG2 ILE B  26      65.633 102.946  22.745  1.00 44.61           C  
ATOM   6841  CD1 ILE B  26      64.434 101.076  19.608  1.00 41.19           C  
ATOM   6842  N   GLN B  27      68.546 103.362  21.460  1.00 43.18           N  
ATOM   6843  CA  GLN B  27      69.249 104.528  20.928  1.00 41.50           C  
ATOM   6844  C   GLN B  27      70.375 104.056  20.026  1.00 43.23           C  
ATOM   6845  O   GLN B  27      70.970 104.852  19.273  1.00 45.36           O  
ATOM   6846  CB  GLN B  27      69.798 105.416  22.047  1.00 43.89           C  
ATOM   6847  CG  GLN B  27      68.709 106.188  22.816  1.00 45.23           C  
ATOM   6848  CD  GLN B  27      67.788 107.004  21.900  1.00 45.01           C  
ATOM   6849  OE1 GLN B  27      68.238 107.639  20.943  1.00 45.33           O  
ATOM   6850  NE2 GLN B  27      66.497 106.994  22.204  1.00 39.47           N  
ATOM   6851  N   GLY B  28      70.665 102.759  20.090  1.00 40.37           N  
ATOM   6852  CA  GLY B  28      71.685 102.195  19.224  1.00 39.66           C  
ATOM   6853  C   GLY B  28      71.197 102.203  17.780  1.00 39.94           C  
ATOM   6854  O   GLY B  28      71.978 101.984  16.843  1.00 38.38           O  
ATOM   6855  N   ILE B  29      69.885 102.398  17.590  1.00 38.72           N  
ATOM   6856  CA  ILE B  29      69.324 102.489  16.240  1.00 35.87           C  
ATOM   6857  C   ILE B  29      69.535 103.972  16.066  1.00 34.67           C  
ATOM   6858  O   ILE B  29      68.751 104.789  16.556  1.00 35.72           O  
ATOM   6859  CB  ILE B  29      67.793 102.160  16.198  1.00 36.06           C  
ATOM   6860  CG1 ILE B  29      67.537 100.789  16.819  1.00 32.59           C  
ATOM   6861  CG2 ILE B  29      67.310 102.122  14.736  1.00 31.94           C  
ATOM   6862  CD1 ILE B  29      68.441  99.717  16.282  1.00 35.41           C  
ATOM   6863  N   THR B  30      70.611 104.321  15.379  1.00 35.84           N  
ATOM   6864  CA  THR B  30      71.001 105.721  15.244  1.00 36.22           C  
ATOM   6865  C   THR B  30      70.335 106.552  14.173  1.00 38.04           C  
ATOM   6866  O   THR B  30      69.727 106.037  13.230  1.00 39.08           O  
ATOM   6867  CB  THR B  30      72.506 105.803  15.009  1.00 37.54           C  
ATOM   6868  OG1 THR B  30      72.800 105.121  13.787  1.00 38.24           O  
ATOM   6869  CG2 THR B  30      73.281 105.133  16.165  1.00 38.38           C  
ATOM   6870  N   LYS B  31      70.486 107.863  14.309  1.00 36.90           N  
ATOM   6871  CA  LYS B  31      69.916 108.787  13.358  1.00 37.71           C  
ATOM   6872  C   LYS B  31      70.375 108.436  11.952  1.00 38.68           C  
ATOM   6873  O   LYS B  31      69.564 108.428  11.012  1.00 39.70           O  
ATOM   6874  CB  LYS B  31      70.306 110.232  13.714  1.00 39.35           C  
ATOM   6875  CG  LYS B  31      70.077 111.234  12.598  1.00 43.88           C  
ATOM   6876  CD  LYS B  31      70.351 112.672  13.070  1.00 50.35           C  
ATOM   6877  CE  LYS B  31      70.086 113.687  11.970  1.00 52.15           C  
ATOM   6878  NZ  LYS B  31      70.399 115.087  12.396  1.00 53.05           N  
ATOM   6879  N   PRO B  32      71.681 108.153  11.770  1.00 36.69           N  
ATOM   6880  CA  PRO B  32      72.159 107.811  10.423  1.00 35.25           C  
ATOM   6881  C   PRO B  32      71.567 106.512   9.875  1.00 32.29           C  
ATOM   6882  O   PRO B  32      71.302 106.400   8.698  1.00 36.51           O  
ATOM   6883  CB  PRO B  32      73.678 107.719  10.604  1.00 38.66           C  
ATOM   6884  CG  PRO B  32      73.943 108.688  11.717  1.00 39.27           C  
ATOM   6885  CD  PRO B  32      72.813 108.423  12.682  1.00 37.64           C  
ATOM   6886  N   ALA B  33      71.386 105.521  10.733  1.00 33.36           N  
ATOM   6887  CA  ALA B  33      70.825 104.256  10.292  1.00 32.09           C  
ATOM   6888  C   ALA B  33      69.374 104.502   9.841  1.00 31.33           C  
ATOM   6889  O   ALA B  33      68.929 103.980   8.820  1.00 31.28           O  
ATOM   6890  CB  ALA B  33      70.853 103.282  11.430  1.00 33.27           C  
ATOM   6891  N   ILE B  34      68.652 105.320  10.606  1.00 29.92           N  
ATOM   6892  CA  ILE B  34      67.254 105.615  10.289  1.00 31.50           C  
ATOM   6893  C   ILE B  34      67.166 106.394   8.984  1.00 34.46           C  
ATOM   6894  O   ILE B  34      66.298 106.134   8.152  1.00 34.35           O  
ATOM   6895  CB  ILE B  34      66.581 106.373  11.456  1.00 28.85           C  
ATOM   6896  CG1 ILE B  34      66.640 105.479  12.701  1.00 29.75           C  
ATOM   6897  CG2 ILE B  34      65.112 106.702  11.126  1.00 30.14           C  
ATOM   6898  CD1 ILE B  34      66.228 106.132  13.991  1.00 29.44           C  
ATOM   6899  N   ARG B  35      68.088 107.325   8.781  1.00 32.07           N  
ATOM   6900  CA  ARG B  35      68.087 108.101   7.562  1.00 32.21           C  
ATOM   6901  C   ARG B  35      68.349 107.199   6.366  1.00 32.61           C  
ATOM   6902  O   ARG B  35      67.730 107.363   5.317  1.00 35.05           O  
ATOM   6903  CB  ARG B  35      69.131 109.235   7.645  1.00 36.66           C  
ATOM   6904  CG  ARG B  35      69.549 109.836   6.312  1.00 41.84           C  
ATOM   6905  CD  ARG B  35      70.498 111.049   6.516  1.00 50.41           C  
ATOM   6906  NE  ARG B  35      69.823 112.100   7.275  1.00 52.54           N  
ATOM   6907  CZ  ARG B  35      69.760 113.382   6.918  1.00 57.23           C  
ATOM   6908  NH1 ARG B  35      70.345 113.818   5.807  1.00 59.53           N  
ATOM   6909  NH2 ARG B  35      69.057 114.228   7.654  1.00 60.37           N  
ATOM   6910  N   ARG B  36      69.253 106.234   6.506  1.00 31.50           N  
ATOM   6911  CA  ARG B  36      69.529 105.348   5.387  1.00 30.84           C  
ATOM   6912  C   ARG B  36      68.254 104.579   5.039  1.00 28.43           C  
ATOM   6913  O   ARG B  36      67.932 104.445   3.868  1.00 28.69           O  
ATOM   6914  CB  ARG B  36      70.661 104.347   5.703  1.00 33.97           C  
ATOM   6915  CG  ARG B  36      72.067 104.960   5.861  1.00 35.93           C  
ATOM   6916  CD  ARG B  36      73.175 103.859   5.902  1.00 32.71           C  
ATOM   6917  NE  ARG B  36      73.259 103.138   7.168  1.00 33.66           N  
ATOM   6918  CZ  ARG B  36      73.879 103.593   8.264  1.00 38.31           C  
ATOM   6919  NH1 ARG B  36      74.476 104.779   8.255  1.00 35.53           N  
ATOM   6920  NH2 ARG B  36      73.921 102.852   9.369  1.00 32.69           N  
ATOM   6921  N   LEU B  37      67.564 104.057   6.056  1.00 26.20           N  
ATOM   6922  CA  LEU B  37      66.312 103.305   5.833  1.00 27.27           C  
ATOM   6923  C   LEU B  37      65.345 104.200   5.066  1.00 26.81           C  
ATOM   6924  O   LEU B  37      64.771 103.802   4.057  1.00 28.29           O  
ATOM   6925  CB  LEU B  37      65.697 102.902   7.158  1.00 25.13           C  
ATOM   6926  CG  LEU B  37      66.475 101.780   7.861  1.00 31.44           C  
ATOM   6927  CD1 LEU B  37      66.068 101.698   9.330  1.00 33.37           C  
ATOM   6928  CD2 LEU B  37      66.242 100.463   7.121  1.00 25.47           C  
ATOM   6929  N   ALA B  38      65.219 105.439   5.535  1.00 27.22           N  
ATOM   6930  CA  ALA B  38      64.350 106.406   4.901  1.00 26.02           C  
ATOM   6931  C   ALA B  38      64.762 106.656   3.444  1.00 27.30           C  
ATOM   6932  O   ALA B  38      63.896 106.748   2.559  1.00 24.74           O  
ATOM   6933  CB  ALA B  38      64.335 107.736   5.728  1.00 25.02           C  
ATOM   6934  N   ARG B  39      66.072 106.736   3.174  1.00 26.47           N  
ATOM   6935  CA  ARG B  39      66.543 106.949   1.799  1.00 25.38           C  
ATOM   6936  C   ARG B  39      66.120 105.796   0.893  1.00 26.22           C  
ATOM   6937  O   ARG B  39      65.639 106.013  -0.202  1.00 26.48           O  
ATOM   6938  CB  ARG B  39      68.072 107.104   1.757  1.00 31.04           C  
ATOM   6939  CG  ARG B  39      68.585 108.348   2.476  1.00 31.49           C  
ATOM   6940  CD  ARG B  39      68.332 109.640   1.675  1.00 33.83           C  
ATOM   6941  NE  ARG B  39      68.999 110.751   2.336  1.00 35.46           N  
ATOM   6942  CZ  ARG B  39      68.391 111.676   3.070  1.00 40.64           C  
ATOM   6943  NH1 ARG B  39      67.066 111.667   3.230  1.00 33.92           N  
ATOM   6944  NH2 ARG B  39      69.125 112.558   3.733  1.00 36.14           N  
ATOM   6945  N   ARG B  40      66.308 104.558   1.347  1.00 26.59           N  
ATOM   6946  CA  ARG B  40      65.909 103.407   0.540  1.00 24.97           C  
ATOM   6947  C   ARG B  40      64.390 103.480   0.322  1.00 25.31           C  
ATOM   6948  O   ARG B  40      63.878 102.984  -0.688  1.00 26.82           O  
ATOM   6949  CB  ARG B  40      66.263 102.104   1.255  1.00 23.22           C  
ATOM   6950  CG  ARG B  40      65.946 100.855   0.450  1.00 26.82           C  
ATOM   6951  CD  ARG B  40      66.665  99.622   1.063  1.00 31.49           C  
ATOM   6952  NE  ARG B  40      68.064  99.548   0.633  1.00 33.59           N  
ATOM   6953  CZ  ARG B  40      69.003  98.780   1.195  1.00 33.91           C  
ATOM   6954  NH1 ARG B  40      68.732  97.991   2.246  1.00 27.84           N  
ATOM   6955  NH2 ARG B  40      70.228  98.783   0.679  1.00 35.50           N  
ATOM   6956  N   GLY B  41      63.699 104.109   1.273  1.00 26.46           N  
ATOM   6957  CA  GLY B  41      62.257 104.298   1.175  1.00 27.73           C  
ATOM   6958  C   GLY B  41      61.881 105.513   0.317  1.00 28.29           C  
ATOM   6959  O   GLY B  41      60.721 105.902   0.261  1.00 28.41           O  
ATOM   6960  N   GLY B  42      62.877 106.131  -0.322  1.00 28.47           N  
ATOM   6961  CA  GLY B  42      62.633 107.273  -1.190  1.00 29.12           C  
ATOM   6962  C   GLY B  42      62.472 108.647  -0.560  1.00 31.18           C  
ATOM   6963  O   GLY B  42      62.069 109.591  -1.248  1.00 31.25           O  
ATOM   6964  N   VAL B  43      62.784 108.755   0.731  1.00 28.89           N  
ATOM   6965  CA  VAL B  43      62.653 109.988   1.494  1.00 28.79           C  
ATOM   6966  C   VAL B  43      63.792 111.002   1.326  1.00 30.94           C  
ATOM   6967  O   VAL B  43      64.963 110.680   1.552  1.00 30.12           O  
ATOM   6968  CB  VAL B  43      62.480 109.636   2.983  1.00 30.48           C  
ATOM   6969  CG1 VAL B  43      62.480 110.889   3.846  1.00 28.09           C  
ATOM   6970  CG2 VAL B  43      61.156 108.871   3.161  1.00 28.92           C  
ATOM   6971  N   LYS B  44      63.428 112.230   0.953  1.00 31.67           N  
ATOM   6972  CA  LYS B  44      64.395 113.315   0.703  1.00 32.05           C  
ATOM   6973  C   LYS B  44      64.720 114.264   1.863  1.00 33.43           C  
ATOM   6974  O   LYS B  44      65.844 114.763   1.980  1.00 33.98           O  
ATOM   6975  CB  LYS B  44      63.920 114.163  -0.484  1.00 33.03           C  
ATOM   6976  CG  LYS B  44      64.868 115.304  -0.873  1.00 38.90           C  
ATOM   6977  CD  LYS B  44      64.363 116.015  -2.127  1.00 36.69           C  
ATOM   6978  CE  LYS B  44      65.334 117.089  -2.629  1.00 38.26           C  
ATOM   6979  NZ  LYS B  44      64.807 117.748  -3.857  1.00 33.92           N  
ATOM   6980  N   ARG B  45      63.752 114.526   2.719  1.00 32.52           N  
ATOM   6981  CA  ARG B  45      63.974 115.460   3.814  1.00 33.07           C  
ATOM   6982  C   ARG B  45      63.268 114.899   5.028  1.00 33.85           C  
ATOM   6983  O   ARG B  45      62.132 114.412   4.923  1.00 29.95           O  
ATOM   6984  CB  ARG B  45      63.408 116.825   3.426  1.00 32.29           C  
ATOM   6985  CG  ARG B  45      63.999 117.979   4.196  1.00 34.25           C  
ATOM   6986  CD  ARG B  45      63.726 119.284   3.445  1.00 34.14           C  
ATOM   6987  NE  ARG B  45      64.247 120.448   4.139  1.00 33.60           N  
ATOM   6988  CZ  ARG B  45      63.639 121.050   5.155  1.00 39.59           C  
ATOM   6989  NH1 ARG B  45      62.463 120.611   5.620  1.00 33.37           N  
ATOM   6990  NH2 ARG B  45      64.218 122.100   5.722  1.00 42.86           N  
ATOM   6991  N   ILE B  46      63.942 114.975   6.173  1.00 31.62           N  
ATOM   6992  CA  ILE B  46      63.451 114.404   7.408  1.00 32.36           C  
ATOM   6993  C   ILE B  46      63.359 115.356   8.611  1.00 34.13           C  
ATOM   6994  O   ILE B  46      64.306 116.084   8.912  1.00 37.99           O  
ATOM   6995  CB  ILE B  46      64.377 113.222   7.737  1.00 33.13           C  
ATOM   6996  CG1 ILE B  46      64.444 112.291   6.521  1.00 32.27           C  
ATOM   6997  CG2 ILE B  46      63.961 112.547   9.006  1.00 29.65           C  
ATOM   6998  CD1 ILE B  46      65.516 111.161   6.666  1.00 36.92           C  
ATOM   6999  N   SER B  47      62.217 115.332   9.294  1.00 31.87           N  
ATOM   7000  CA  SER B  47      61.959 116.152  10.473  1.00 32.70           C  
ATOM   7001  C   SER B  47      62.760 115.557  11.623  1.00 34.14           C  
ATOM   7002  O   SER B  47      62.875 114.329  11.742  1.00 33.38           O  
ATOM   7003  CB  SER B  47      60.464 116.128  10.807  1.00 31.27           C  
ATOM   7004  OG  SER B  47      60.200 116.629  12.109  1.00 36.95           O  
ATOM   7005  N   GLY B  48      63.320 116.424  12.470  1.00 34.36           N  
ATOM   7006  CA  GLY B  48      64.143 115.945  13.563  1.00 32.65           C  
ATOM   7007  C   GLY B  48      63.437 114.964  14.462  1.00 34.95           C  
ATOM   7008  O   GLY B  48      64.071 114.055  15.023  1.00 39.00           O  
ATOM   7009  N   LEU B  49      62.125 115.134  14.594  1.00 33.44           N  
ATOM   7010  CA  LEU B  49      61.296 114.277  15.449  1.00 33.63           C  
ATOM   7011  C   LEU B  49      61.069 112.848  14.910  1.00 32.88           C  
ATOM   7012  O   LEU B  49      60.623 111.956  15.632  1.00 32.07           O  
ATOM   7013  CB  LEU B  49      59.945 114.960  15.688  1.00 33.88           C  
ATOM   7014  CG  LEU B  49      60.011 116.332  16.385  1.00 36.11           C  
ATOM   7015  CD1 LEU B  49      58.634 116.956  16.467  1.00 38.82           C  
ATOM   7016  CD2 LEU B  49      60.598 116.156  17.789  1.00 36.89           C  
ATOM   7017  N   ILE B  50      61.400 112.642  13.646  1.00 33.64           N  
ATOM   7018  CA  ILE B  50      61.241 111.342  12.996  1.00 32.31           C  
ATOM   7019  C   ILE B  50      62.027 110.235  13.692  1.00 33.14           C  
ATOM   7020  O   ILE B  50      61.510 109.137  13.900  1.00 32.30           O  
ATOM   7021  CB  ILE B  50      61.688 111.432  11.500  1.00 30.64           C  
ATOM   7022  CG1 ILE B  50      60.638 112.200  10.697  1.00 30.22           C  
ATOM   7023  CG2 ILE B  50      61.974 110.042  10.930  1.00 26.25           C  
ATOM   7024  CD1 ILE B  50      59.292 111.446  10.561  1.00 32.43           C  
ATOM   7025  N   TYR B  51      63.261 110.528  14.102  1.00 33.11           N  
ATOM   7026  CA  TYR B  51      64.086 109.491  14.710  1.00 31.21           C  
ATOM   7027  C   TYR B  51      63.495 108.835  15.915  1.00 29.16           C  
ATOM   7028  O   TYR B  51      63.464 107.611  15.985  1.00 31.36           O  
ATOM   7029  CB  TYR B  51      65.502 110.022  14.993  1.00 31.56           C  
ATOM   7030  CG  TYR B  51      66.043 110.697  13.766  1.00 29.75           C  
ATOM   7031  CD1 TYR B  51      66.279 109.975  12.603  1.00 27.69           C  
ATOM   7032  CD2 TYR B  51      66.172 112.085  13.718  1.00 30.69           C  
ATOM   7033  CE1 TYR B  51      66.619 110.616  11.425  1.00 30.34           C  
ATOM   7034  CE2 TYR B  51      66.501 112.730  12.549  1.00 26.09           C  
ATOM   7035  CZ  TYR B  51      66.722 112.007  11.409  1.00 30.44           C  
ATOM   7036  OH  TYR B  51      67.005 112.684  10.240  1.00 32.84           O  
ATOM   7037  N   GLU B  52      63.008 109.610  16.866  1.00 31.91           N  
ATOM   7038  CA  GLU B  52      62.427 108.983  18.033  1.00 31.26           C  
ATOM   7039  C   GLU B  52      61.150 108.252  17.650  1.00 30.17           C  
ATOM   7040  O   GLU B  52      60.912 107.152  18.110  1.00 27.58           O  
ATOM   7041  CB  GLU B  52      62.149 110.004  19.137  1.00 36.24           C  
ATOM   7042  CG  GLU B  52      63.388 110.394  19.908  1.00 39.57           C  
ATOM   7043  CD  GLU B  52      63.961 109.234  20.683  1.00 43.81           C  
ATOM   7044  OE1 GLU B  52      63.326 108.812  21.673  1.00 48.19           O  
ATOM   7045  OE2 GLU B  52      65.038 108.738  20.295  1.00 43.91           O  
ATOM   7046  N   GLU B  53      60.351 108.841  16.771  1.00 33.09           N  
ATOM   7047  CA  GLU B  53      59.099 108.203  16.347  1.00 29.49           C  
ATOM   7048  C   GLU B  53      59.385 106.823  15.740  1.00 30.77           C  
ATOM   7049  O   GLU B  53      58.677 105.837  16.012  1.00 29.43           O  
ATOM   7050  CB  GLU B  53      58.397 109.077  15.300  1.00 31.51           C  
ATOM   7051  CG  GLU B  53      56.995 108.621  14.968  1.00 33.08           C  
ATOM   7052  CD  GLU B  53      55.993 109.050  16.028  1.00 41.79           C  
ATOM   7053  OE1 GLU B  53      56.412 109.721  17.004  1.00 43.11           O  
ATOM   7054  OE2 GLU B  53      54.791 108.737  15.881  1.00 44.22           O  
ATOM   7055  N   THR B  54      60.436 106.767  14.924  1.00 29.05           N  
ATOM   7056  CA  THR B  54      60.823 105.543  14.251  1.00 28.91           C  
ATOM   7057  C   THR B  54      61.251 104.487  15.257  1.00 30.73           C  
ATOM   7058  O   THR B  54      60.865 103.323  15.148  1.00 28.46           O  
ATOM   7059  CB  THR B  54      61.949 105.821  13.245  1.00 28.27           C  
ATOM   7060  OG1 THR B  54      61.458 106.727  12.256  1.00 29.60           O  
ATOM   7061  CG2 THR B  54      62.427 104.540  12.567  1.00 25.91           C  
ATOM   7062  N   ARG B  55      62.024 104.903  16.254  1.00 30.71           N  
ATOM   7063  CA  ARG B  55      62.469 103.972  17.279  1.00 30.88           C  
ATOM   7064  C   ARG B  55      61.276 103.359  17.974  1.00 28.95           C  
ATOM   7065  O   ARG B  55      61.246 102.148  18.205  1.00 32.37           O  
ATOM   7066  CB  ARG B  55      63.372 104.679  18.309  1.00 30.97           C  
ATOM   7067  CG  ARG B  55      64.712 105.095  17.718  1.00 28.78           C  
ATOM   7068  CD  ARG B  55      65.721 105.699  18.765  1.00 37.41           C  
ATOM   7069  NE  ARG B  55      66.926 106.137  18.054  1.00 34.08           N  
ATOM   7070  CZ  ARG B  55      67.234 107.406  17.825  1.00 33.87           C  
ATOM   7071  NH1 ARG B  55      66.447 108.372  18.278  1.00 33.99           N  
ATOM   7072  NH2 ARG B  55      68.284 107.710  17.072  1.00 35.49           N  
ATOM   7073  N   GLY B  56      60.293 104.192  18.293  1.00 25.31           N  
ATOM   7074  CA  GLY B  56      59.100 103.700  18.964  1.00 28.65           C  
ATOM   7075  C   GLY B  56      58.377 102.693  18.090  1.00 28.37           C  
ATOM   7076  O   GLY B  56      57.941 101.623  18.545  1.00 28.80           O  
ATOM   7077  N   VAL B  57      58.255 103.022  16.811  1.00 27.31           N  
ATOM   7078  CA  VAL B  57      57.585 102.120  15.878  1.00 25.91           C  
ATOM   7079  C   VAL B  57      58.350 100.812  15.753  1.00 23.97           C  
ATOM   7080  O   VAL B  57      57.757  99.730  15.809  1.00 25.19           O  
ATOM   7081  CB  VAL B  57      57.424 102.815  14.496  1.00 26.79           C  
ATOM   7082  CG1 VAL B  57      57.052 101.806  13.421  1.00 30.51           C  
ATOM   7083  CG2 VAL B  57      56.351 103.886  14.604  1.00 24.15           C  
ATOM   7084  N   LEU B  58      59.675 100.890  15.619  1.00 25.72           N  
ATOM   7085  CA  LEU B  58      60.470  99.669  15.496  1.00 24.75           C  
ATOM   7086  C   LEU B  58      60.374  98.782  16.746  1.00 25.65           C  
ATOM   7087  O   LEU B  58      60.312  97.555  16.655  1.00 26.70           O  
ATOM   7088  CB  LEU B  58      61.943 100.008  15.222  1.00 27.89           C  
ATOM   7089  CG  LEU B  58      62.923  98.829  15.292  1.00 29.23           C  
ATOM   7090  CD1 LEU B  58      62.580  97.719  14.287  1.00 26.72           C  
ATOM   7091  CD2 LEU B  58      64.310  99.351  15.009  1.00 32.94           C  
ATOM   7092  N   LYS B  59      60.331  99.393  17.920  1.00 27.76           N  
ATOM   7093  CA  LYS B  59      60.229  98.609  19.141  1.00 28.62           C  
ATOM   7094  C   LYS B  59      58.916  97.819  19.187  1.00 26.28           C  
ATOM   7095  O   LYS B  59      58.880  96.657  19.599  1.00 25.07           O  
ATOM   7096  CB  LYS B  59      60.328  99.531  20.347  1.00 30.32           C  
ATOM   7097  CG  LYS B  59      60.323  98.838  21.696  1.00 37.38           C  
ATOM   7098  CD  LYS B  59      60.810  99.837  22.787  1.00 43.98           C  
ATOM   7099  CE  LYS B  59      60.443  99.406  24.211  1.00 47.52           C  
ATOM   7100  NZ  LYS B  59      58.984  99.605  24.520  1.00 51.06           N  
ATOM   7101  N   VAL B  60      57.833  98.467  18.789  1.00 27.29           N  
ATOM   7102  CA  VAL B  60      56.524  97.817  18.776  1.00 26.52           C  
ATOM   7103  C   VAL B  60      56.577  96.655  17.781  1.00 25.23           C  
ATOM   7104  O   VAL B  60      56.092  95.557  18.060  1.00 26.68           O  
ATOM   7105  CB  VAL B  60      55.431  98.814  18.345  1.00 29.26           C  
ATOM   7106  CG1 VAL B  60      54.142  98.062  18.027  1.00 32.39           C  
ATOM   7107  CG2 VAL B  60      55.194  99.838  19.466  1.00 31.27           C  
ATOM   7108  N   PHE B  61      57.180  96.889  16.628  1.00 23.95           N  
ATOM   7109  CA  PHE B  61      57.302  95.844  15.627  1.00 26.36           C  
ATOM   7110  C   PHE B  61      58.049  94.642  16.206  1.00 27.88           C  
ATOM   7111  O   PHE B  61      57.620  93.511  16.073  1.00 26.66           O  
ATOM   7112  CB  PHE B  61      58.080  96.352  14.391  1.00 25.76           C  
ATOM   7113  CG  PHE B  61      58.232  95.309  13.302  1.00 27.78           C  
ATOM   7114  CD1 PHE B  61      57.235  95.146  12.336  1.00 23.72           C  
ATOM   7115  CD2 PHE B  61      59.363  94.491  13.248  1.00 26.39           C  
ATOM   7116  CE1 PHE B  61      57.357  94.183  11.320  1.00 27.75           C  
ATOM   7117  CE2 PHE B  61      59.511  93.514  12.237  1.00 29.61           C  
ATOM   7118  CZ  PHE B  61      58.507  93.352  11.263  1.00 25.87           C  
ATOM   7119  N   LEU B  62      59.193  94.886  16.839  1.00 29.37           N  
ATOM   7120  CA  LEU B  62      59.986  93.792  17.399  1.00 25.66           C  
ATOM   7121  C   LEU B  62      59.275  93.117  18.558  1.00 27.71           C  
ATOM   7122  O   LEU B  62      59.302  91.889  18.662  1.00 28.76           O  
ATOM   7123  CB  LEU B  62      61.386  94.304  17.825  1.00 25.99           C  
ATOM   7124  CG  LEU B  62      62.289  94.629  16.622  1.00 27.57           C  
ATOM   7125  CD1 LEU B  62      63.525  95.368  17.091  1.00 27.37           C  
ATOM   7126  CD2 LEU B  62      62.656  93.329  15.866  1.00 25.50           C  
ATOM   7127  N   GLU B  63      58.637  93.896  19.433  1.00 25.07           N  
ATOM   7128  CA  GLU B  63      57.896  93.291  20.533  1.00 27.71           C  
ATOM   7129  C   GLU B  63      56.859  92.323  19.993  1.00 28.35           C  
ATOM   7130  O   GLU B  63      56.780  91.186  20.447  1.00 27.37           O  
ATOM   7131  CB  GLU B  63      57.198  94.354  21.389  1.00 28.47           C  
ATOM   7132  CG  GLU B  63      58.167  95.244  22.124  1.00 34.61           C  
ATOM   7133  CD  GLU B  63      57.503  96.407  22.822  1.00 39.98           C  
ATOM   7134  OE1 GLU B  63      56.492  96.915  22.295  1.00 36.88           O  
ATOM   7135  OE2 GLU B  63      58.010  96.828  23.889  1.00 38.49           O  
ATOM   7136  N   ASN B  64      56.083  92.740  18.987  1.00 27.73           N  
ATOM   7137  CA  ASN B  64      55.059  91.840  18.441  1.00 27.36           C  
ATOM   7138  C   ASN B  64      55.630  90.580  17.808  1.00 27.06           C  
ATOM   7139  O   ASN B  64      55.144  89.493  18.065  1.00 26.93           O  
ATOM   7140  CB  ASN B  64      54.172  92.564  17.424  1.00 28.90           C  
ATOM   7141  CG  ASN B  64      53.371  93.689  18.061  1.00 32.81           C  
ATOM   7142  OD1 ASN B  64      53.093  93.649  19.247  1.00 39.57           O  
ATOM   7143  ND2 ASN B  64      52.988  94.682  17.274  1.00 35.32           N  
ATOM   7144  N   VAL B  65      56.648  90.722  16.971  1.00 24.68           N  
ATOM   7145  CA  VAL B  65      57.232  89.547  16.333  1.00 24.92           C  
ATOM   7146  C   VAL B  65      57.982  88.638  17.355  1.00 25.02           C  
ATOM   7147  O   VAL B  65      57.821  87.414  17.349  1.00 23.36           O  
ATOM   7148  CB  VAL B  65      58.204  89.982  15.193  1.00 29.39           C  
ATOM   7149  CG1 VAL B  65      58.825  88.758  14.519  1.00 24.28           C  
ATOM   7150  CG2 VAL B  65      57.424  90.811  14.130  1.00 32.36           C  
ATOM   7151  N   ILE B  66      58.788  89.237  18.224  1.00 25.44           N  
ATOM   7152  CA  ILE B  66      59.567  88.450  19.215  1.00 26.31           C  
ATOM   7153  C   ILE B  66      58.664  87.734  20.215  1.00 27.77           C  
ATOM   7154  O   ILE B  66      58.885  86.565  20.547  1.00 27.41           O  
ATOM   7155  CB  ILE B  66      60.609  89.350  19.946  1.00 25.53           C  
ATOM   7156  CG1 ILE B  66      61.634  89.816  18.914  1.00 25.58           C  
ATOM   7157  CG2 ILE B  66      61.367  88.544  21.065  1.00 26.62           C  
ATOM   7158  CD1 ILE B  66      62.476  90.984  19.370  1.00 31.56           C  
ATOM   7159  N   ARG B  67      57.610  88.409  20.653  1.00 24.14           N  
ATOM   7160  CA  ARG B  67      56.698  87.764  21.577  1.00 27.31           C  
ATOM   7161  C   ARG B  67      56.259  86.424  20.961  1.00 26.99           C  
ATOM   7162  O   ARG B  67      56.384  85.384  21.602  1.00 27.08           O  
ATOM   7163  CB  ARG B  67      55.469  88.661  21.857  1.00 28.29           C  
ATOM   7164  CG  ARG B  67      54.450  88.010  22.769  1.00 33.55           C  
ATOM   7165  CD  ARG B  67      53.192  88.826  22.881  1.00 39.30           C  
ATOM   7166  NE  ARG B  67      53.427  90.118  23.511  1.00 47.95           N  
ATOM   7167  CZ  ARG B  67      53.403  91.282  22.865  1.00 51.16           C  
ATOM   7168  NH1 ARG B  67      53.148  91.313  21.563  1.00 47.45           N  
ATOM   7169  NH2 ARG B  67      53.629  92.410  23.523  1.00 50.60           N  
ATOM   7170  N   ASP B  68      55.776  86.430  19.713  1.00 22.25           N  
ATOM   7171  CA  ASP B  68      55.312  85.185  19.093  1.00 22.01           C  
ATOM   7172  C   ASP B  68      56.445  84.197  18.878  1.00 23.04           C  
ATOM   7173  O   ASP B  68      56.280  83.007  19.097  1.00 23.78           O  
ATOM   7174  CB  ASP B  68      54.612  85.448  17.752  1.00 21.51           C  
ATOM   7175  CG  ASP B  68      53.231  86.104  17.923  1.00 27.36           C  
ATOM   7176  OD1 ASP B  68      52.833  86.356  19.078  1.00 22.59           O  
ATOM   7177  OD2 ASP B  68      52.547  86.360  16.898  1.00 27.38           O  
ATOM   7178  N   ALA B  69      57.586  84.687  18.430  1.00 21.68           N  
ATOM   7179  CA  ALA B  69      58.713  83.782  18.217  1.00 26.40           C  
ATOM   7180  C   ALA B  69      59.030  83.027  19.529  1.00 24.98           C  
ATOM   7181  O   ALA B  69      59.207  81.812  19.526  1.00 23.14           O  
ATOM   7182  CB  ALA B  69      59.944  84.569  17.774  1.00 22.78           C  
ATOM   7183  N   VAL B  70      59.111  83.772  20.630  1.00 26.90           N  
ATOM   7184  CA  VAL B  70      59.429  83.183  21.933  1.00 26.92           C  
ATOM   7185  C   VAL B  70      58.323  82.231  22.372  1.00 30.07           C  
ATOM   7186  O   VAL B  70      58.595  81.213  23.025  1.00 29.77           O  
ATOM   7187  CB  VAL B  70      59.663  84.278  22.978  1.00 29.15           C  
ATOM   7188  CG1 VAL B  70      59.890  83.645  24.387  1.00 30.71           C  
ATOM   7189  CG2 VAL B  70      60.914  85.095  22.552  1.00 28.51           C  
ATOM   7190  N   THR B  71      57.077  82.537  21.995  1.00 26.54           N  
ATOM   7191  CA  THR B  71      55.990  81.637  22.323  1.00 25.60           C  
ATOM   7192  C   THR B  71      56.240  80.303  21.606  1.00 27.49           C  
ATOM   7193  O   THR B  71      55.976  79.219  22.163  1.00 26.98           O  
ATOM   7194  CB  THR B  71      54.655  82.271  21.918  1.00 27.91           C  
ATOM   7195  OG1 THR B  71      54.435  83.409  22.761  1.00 28.82           O  
ATOM   7196  CG2 THR B  71      53.486  81.296  22.060  1.00 24.25           C  
ATOM   7197  N   TYR B  72      56.767  80.345  20.381  1.00 25.54           N  
ATOM   7198  CA  TYR B  72      57.037  79.088  19.689  1.00 26.41           C  
ATOM   7199  C   TYR B  72      58.264  78.410  20.350  1.00 29.16           C  
ATOM   7200  O   TYR B  72      58.315  77.187  20.477  1.00 29.15           O  
ATOM   7201  CB  TYR B  72      57.333  79.296  18.199  1.00 26.10           C  
ATOM   7202  CG  TYR B  72      56.111  79.583  17.335  1.00 28.15           C  
ATOM   7203  CD1 TYR B  72      55.967  80.817  16.688  1.00 25.52           C  
ATOM   7204  CD2 TYR B  72      55.121  78.604  17.138  1.00 27.97           C  
ATOM   7205  CE1 TYR B  72      54.879  81.064  15.866  1.00 27.40           C  
ATOM   7206  CE2 TYR B  72      54.024  78.847  16.327  1.00 26.17           C  
ATOM   7207  CZ  TYR B  72      53.913  80.079  15.694  1.00 25.41           C  
ATOM   7208  OH  TYR B  72      52.833  80.329  14.894  1.00 28.81           O  
ATOM   7209  N   THR B  73      59.240  79.218  20.765  1.00 31.97           N  
ATOM   7210  CA  THR B  73      60.450  78.695  21.416  1.00 32.84           C  
ATOM   7211  C   THR B  73      60.049  77.900  22.669  1.00 36.22           C  
ATOM   7212  O   THR B  73      60.427  76.728  22.848  1.00 35.58           O  
ATOM   7213  CB  THR B  73      61.380  79.841  21.845  1.00 31.61           C  
ATOM   7214  OG1 THR B  73      61.746  80.622  20.693  1.00 27.54           O  
ATOM   7215  CG2 THR B  73      62.645  79.276  22.502  1.00 30.51           C  
ATOM   7216  N   GLU B  74      59.260  78.534  23.524  1.00 34.77           N  
ATOM   7217  CA  GLU B  74      58.830  77.892  24.755  1.00 36.32           C  
ATOM   7218  C   GLU B  74      57.975  76.664  24.507  1.00 36.89           C  
ATOM   7219  O   GLU B  74      58.126  75.654  25.197  1.00 33.78           O  
ATOM   7220  CB  GLU B  74      58.064  78.871  25.635  1.00 37.44           C  
ATOM   7221  CG  GLU B  74      58.872  80.066  26.062  1.00 49.28           C  
ATOM   7222  CD  GLU B  74      58.367  80.653  27.365  1.00 56.83           C  
ATOM   7223  OE1 GLU B  74      58.503  79.977  28.413  1.00 62.17           O  
ATOM   7224  OE2 GLU B  74      57.832  81.778  27.345  1.00 58.23           O  
ATOM   7225  N   HIS B  75      57.065  76.739  23.537  1.00 33.06           N  
ATOM   7226  CA  HIS B  75      56.247  75.579  23.266  1.00 34.75           C  
ATOM   7227  C   HIS B  75      57.124  74.378  22.881  1.00 35.92           C  
ATOM   7228  O   HIS B  75      56.760  73.236  23.130  1.00 36.87           O  
ATOM   7229  CB  HIS B  75      55.295  75.811  22.106  1.00 31.58           C  
ATOM   7230  CG  HIS B  75      54.372  74.660  21.876  1.00 29.57           C  
ATOM   7231  ND1 HIS B  75      53.204  74.500  22.587  1.00 33.33           N  
ATOM   7232  CD2 HIS B  75      54.492  73.560  21.101  1.00 31.16           C  
ATOM   7233  CE1 HIS B  75      52.646  73.346  22.265  1.00 30.03           C  
ATOM   7234  NE2 HIS B  75      53.406  72.756  21.366  1.00 31.03           N  
ATOM   7235  N   ALA B  76      58.247  74.645  22.229  1.00 34.12           N  
ATOM   7236  CA  ALA B  76      59.132  73.575  21.785  1.00 38.05           C  
ATOM   7237  C   ALA B  76      60.065  73.151  22.910  1.00 39.12           C  
ATOM   7238  O   ALA B  76      60.933  72.311  22.710  1.00 37.97           O  
ATOM   7239  CB  ALA B  76      59.957  74.038  20.568  1.00 35.31           C  
ATOM   7240  N   LYS B  77      59.904  73.767  24.073  1.00 37.58           N  
ATOM   7241  CA  LYS B  77      60.742  73.445  25.221  1.00 42.46           C  
ATOM   7242  C   LYS B  77      62.208  73.761  24.943  1.00 41.34           C  
ATOM   7243  O   LYS B  77      63.094  73.040  25.390  1.00 40.61           O  
ATOM   7244  CB  LYS B  77      60.590  71.957  25.576  1.00 43.11           C  
ATOM   7245  CG  LYS B  77      59.167  71.538  25.925  1.00 48.93           C  
ATOM   7246  CD  LYS B  77      59.034  70.016  25.962  1.00 54.57           C  
ATOM   7247  CE  LYS B  77      57.619  69.575  26.341  1.00 57.67           C  
ATOM   7248  NZ  LYS B  77      57.480  68.078  26.345  1.00 58.08           N  
ATOM   7249  N   ARG B  78      62.465  74.839  24.205  1.00 37.66           N  
ATOM   7250  CA  ARG B  78      63.832  75.217  23.907  1.00 36.52           C  
ATOM   7251  C   ARG B  78      64.227  76.472  24.648  1.00 36.69           C  
ATOM   7252  O   ARG B  78      63.396  77.178  25.207  1.00 35.91           O  
ATOM   7253  CB  ARG B  78      64.041  75.425  22.396  1.00 37.99           C  
ATOM   7254  CG  ARG B  78      64.059  74.135  21.563  1.00 36.98           C  
ATOM   7255  CD  ARG B  78      64.385  74.396  20.077  1.00 35.26           C  
ATOM   7256  NE  ARG B  78      63.205  74.565  19.219  1.00 37.19           N  
ATOM   7257  CZ  ARG B  78      62.669  75.740  18.867  1.00 37.45           C  
ATOM   7258  NH1 ARG B  78      63.193  76.895  19.291  1.00 29.46           N  
ATOM   7259  NH2 ARG B  78      61.605  75.762  18.068  1.00 33.77           N  
ATOM   7260  N   LYS B  79      65.522  76.737  24.666  1.00 35.86           N  
ATOM   7261  CA  LYS B  79      66.037  77.920  25.315  1.00 35.32           C  
ATOM   7262  C   LYS B  79      66.646  78.799  24.237  1.00 33.88           C  
ATOM   7263  O   LYS B  79      67.124  79.887  24.527  1.00 36.40           O  
ATOM   7264  CB  LYS B  79      67.106  77.532  26.335  1.00 42.32           C  
ATOM   7265  CG  LYS B  79      66.619  76.556  27.410  1.00 47.16           C  
ATOM   7266  CD  LYS B  79      67.641  76.415  28.528  1.00 52.05           C  
ATOM   7267  CE  LYS B  79      67.278  75.255  29.454  1.00 58.33           C  
ATOM   7268  NZ  LYS B  79      68.140  75.211  30.689  1.00 63.12           N  
ATOM   7269  N   THR B  80      66.631  78.309  23.002  1.00 28.39           N  
ATOM   7270  CA  THR B  80      67.185  79.030  21.865  1.00 32.85           C  
ATOM   7271  C   THR B  80      66.117  79.383  20.808  1.00 31.58           C  
ATOM   7272  O   THR B  80      65.451  78.497  20.269  1.00 31.15           O  
ATOM   7273  CB  THR B  80      68.264  78.191  21.130  1.00 34.96           C  
ATOM   7274  OG1 THR B  80      69.261  77.762  22.060  1.00 41.96           O  
ATOM   7275  CG2 THR B  80      68.932  79.004  20.015  1.00 33.17           C  
ATOM   7276  N   VAL B  81      65.965  80.675  20.525  1.00 32.46           N  
ATOM   7277  CA  VAL B  81      65.041  81.146  19.488  1.00 29.25           C  
ATOM   7278  C   VAL B  81      65.657  80.812  18.129  1.00 30.10           C  
ATOM   7279  O   VAL B  81      66.757  81.262  17.801  1.00 31.69           O  
ATOM   7280  CB  VAL B  81      64.849  82.672  19.558  1.00 29.94           C  
ATOM   7281  CG1 VAL B  81      63.966  83.145  18.377  1.00 29.00           C  
ATOM   7282  CG2 VAL B  81      64.183  83.038  20.888  1.00 28.65           C  
ATOM   7283  N   THR B  82      64.967  80.017  17.330  1.00 28.00           N  
ATOM   7284  CA  THR B  82      65.511  79.639  16.029  1.00 30.90           C  
ATOM   7285  C   THR B  82      64.935  80.505  14.928  1.00 31.93           C  
ATOM   7286  O   THR B  82      63.921  81.178  15.131  1.00 27.57           O  
ATOM   7287  CB  THR B  82      65.150  78.212  15.678  1.00 30.59           C  
ATOM   7288  OG1 THR B  82      63.721  78.108  15.621  1.00 30.59           O  
ATOM   7289  CG2 THR B  82      65.662  77.231  16.751  1.00 32.68           C  
ATOM   7290  N   ALA B  83      65.586  80.464  13.769  1.00 31.45           N  
ATOM   7291  CA  ALA B  83      65.138  81.218  12.605  1.00 30.06           C  
ATOM   7292  C   ALA B  83      63.704  80.803  12.314  1.00 30.23           C  
ATOM   7293  O   ALA B  83      62.891  81.646  11.956  1.00 32.44           O  
ATOM   7294  CB  ALA B  83      66.028  80.904  11.356  1.00 31.00           C  
ATOM   7295  N   MET B  84      63.407  79.509  12.448  1.00 27.81           N  
ATOM   7296  CA  MET B  84      62.069  79.019  12.172  1.00 28.48           C  
ATOM   7297  C   MET B  84      61.043  79.622  13.125  1.00 30.63           C  
ATOM   7298  O   MET B  84      59.914  79.939  12.698  1.00 28.95           O  
ATOM   7299  CB  MET B  84      62.006  77.490  12.222  1.00 32.11           C  
ATOM   7300  CG  MET B  84      62.593  76.788  10.980  1.00 39.61           C  
ATOM   7301  SD  MET B  84      62.148  77.483   9.337  1.00 43.62           S  
ATOM   7302  CE  MET B  84      60.377  77.042   9.148  1.00 46.08           C  
ATOM   7303  N   ASP B  85      61.410  79.784  14.398  1.00 24.21           N  
ATOM   7304  CA  ASP B  85      60.494  80.419  15.338  1.00 28.33           C  
ATOM   7305  C   ASP B  85      60.208  81.831  14.769  1.00 27.65           C  
ATOM   7306  O   ASP B  85      59.091  82.304  14.801  1.00 27.82           O  
ATOM   7307  CB  ASP B  85      61.106  80.618  16.735  1.00 24.09           C  
ATOM   7308  CG  ASP B  85      61.385  79.302  17.478  1.00 28.02           C  
ATOM   7309  OD1 ASP B  85      60.710  78.299  17.204  1.00 29.31           O  
ATOM   7310  OD2 ASP B  85      62.263  79.302  18.375  1.00 31.66           O  
ATOM   7311  N   VAL B  86      61.233  82.512  14.293  1.00 24.14           N  
ATOM   7312  CA  VAL B  86      61.020  83.858  13.750  1.00 25.81           C  
ATOM   7313  C   VAL B  86      60.169  83.838  12.457  1.00 26.64           C  
ATOM   7314  O   VAL B  86      59.241  84.619  12.306  1.00 27.69           O  
ATOM   7315  CB  VAL B  86      62.368  84.541  13.510  1.00 25.43           C  
ATOM   7316  CG1 VAL B  86      62.183  85.868  12.792  1.00 25.00           C  
ATOM   7317  CG2 VAL B  86      63.031  84.805  14.872  1.00 24.59           C  
ATOM   7318  N   VAL B  87      60.469  82.917  11.548  1.00 28.01           N  
ATOM   7319  CA  VAL B  87      59.727  82.777  10.297  1.00 24.38           C  
ATOM   7320  C   VAL B  87      58.246  82.504  10.538  1.00 25.87           C  
ATOM   7321  O   VAL B  87      57.377  83.047   9.836  1.00 26.62           O  
ATOM   7322  CB  VAL B  87      60.317  81.614   9.478  1.00 23.94           C  
ATOM   7323  CG1 VAL B  87      59.431  81.291   8.229  1.00 24.49           C  
ATOM   7324  CG2 VAL B  87      61.709  82.002   9.065  1.00 23.39           C  
ATOM   7325  N   TYR B  88      57.953  81.663  11.524  1.00 26.24           N  
ATOM   7326  CA  TYR B  88      56.584  81.319  11.829  1.00 27.94           C  
ATOM   7327  C   TYR B  88      55.928  82.530  12.460  1.00 26.57           C  
ATOM   7328  O   TYR B  88      54.773  82.803  12.209  1.00 25.13           O  
ATOM   7329  CB  TYR B  88      56.521  80.144  12.817  1.00 30.79           C  
ATOM   7330  CG  TYR B  88      57.053  78.829  12.274  1.00 31.85           C  
ATOM   7331  CD1 TYR B  88      57.784  77.973  13.086  1.00 32.19           C  
ATOM   7332  CD2 TYR B  88      56.787  78.430  10.967  1.00 32.86           C  
ATOM   7333  CE1 TYR B  88      58.241  76.751  12.618  1.00 34.91           C  
ATOM   7334  CE2 TYR B  88      57.238  77.205  10.481  1.00 36.84           C  
ATOM   7335  CZ  TYR B  88      57.968  76.370  11.320  1.00 38.17           C  
ATOM   7336  OH  TYR B  88      58.433  75.154  10.868  1.00 43.05           O  
ATOM   7337  N   ALA B  89      56.672  83.252  13.290  1.00 24.42           N  
ATOM   7338  CA  ALA B  89      56.115  84.439  13.936  1.00 25.11           C  
ATOM   7339  C   ALA B  89      55.782  85.476  12.876  1.00 25.12           C  
ATOM   7340  O   ALA B  89      54.707  86.060  12.889  1.00 23.48           O  
ATOM   7341  CB  ALA B  89      57.111  85.022  14.918  1.00 22.69           C  
ATOM   7342  N   LEU B  90      56.716  85.717  11.971  1.00 23.22           N  
ATOM   7343  CA  LEU B  90      56.484  86.718  10.911  1.00 24.86           C  
ATOM   7344  C   LEU B  90      55.306  86.318  10.036  1.00 24.76           C  
ATOM   7345  O   LEU B  90      54.447  87.143   9.680  1.00 27.23           O  
ATOM   7346  CB  LEU B  90      57.742  86.878  10.053  1.00 22.75           C  
ATOM   7347  CG  LEU B  90      58.878  87.591  10.801  1.00 23.79           C  
ATOM   7348  CD1 LEU B  90      60.177  87.333  10.078  1.00 23.62           C  
ATOM   7349  CD2 LEU B  90      58.601  89.133  10.922  1.00 22.31           C  
ATOM   7350  N   LYS B  91      55.240  85.036   9.710  1.00 26.07           N  
ATOM   7351  CA  LYS B  91      54.154  84.561   8.879  1.00 25.99           C  
ATOM   7352  C   LYS B  91      52.787  84.773   9.515  1.00 29.73           C  
ATOM   7353  O   LYS B  91      51.859  85.233   8.823  1.00 26.08           O  
ATOM   7354  CB  LYS B  91      54.326  83.082   8.521  1.00 28.11           C  
ATOM   7355  CG  LYS B  91      53.111  82.533   7.807  1.00 32.43           C  
ATOM   7356  CD  LYS B  91      53.447  81.514   6.728  1.00 47.71           C  
ATOM   7357  CE  LYS B  91      54.149  80.277   7.245  1.00 48.38           C  
ATOM   7358  NZ  LYS B  91      54.197  79.251   6.162  1.00 48.07           N  
ATOM   7359  N   ARG B  92      52.636  84.460  10.809  1.00 24.88           N  
ATOM   7360  CA  ARG B  92      51.317  84.641  11.396  1.00 28.46           C  
ATOM   7361  C   ARG B  92      50.987  86.108  11.546  1.00 30.51           C  
ATOM   7362  O   ARG B  92      49.819  86.465  11.663  1.00 30.16           O  
ATOM   7363  CB  ARG B  92      51.138  83.894  12.742  1.00 29.64           C  
ATOM   7364  CG  ARG B  92      52.003  84.352  13.911  1.00 30.43           C  
ATOM   7365  CD  ARG B  92      51.665  83.505  15.159  1.00 29.19           C  
ATOM   7366  NE  ARG B  92      50.214  83.461  15.340  1.00 28.31           N  
ATOM   7367  CZ  ARG B  92      49.483  84.502  15.745  1.00 33.03           C  
ATOM   7368  NH1 ARG B  92      50.058  85.663  16.047  1.00 29.37           N  
ATOM   7369  NH2 ARG B  92      48.160  84.416  15.768  1.00 32.40           N  
ATOM   7370  N   GLN B  93      52.002  86.965  11.527  1.00 27.28           N  
ATOM   7371  CA  GLN B  93      51.748  88.407  11.627  1.00 28.35           C  
ATOM   7372  C   GLN B  93      51.520  89.014  10.222  1.00 26.02           C  
ATOM   7373  O   GLN B  93      51.465  90.214  10.076  1.00 29.46           O  
ATOM   7374  CB  GLN B  93      52.947  89.123  12.277  1.00 33.33           C  
ATOM   7375  CG  GLN B  93      53.248  88.782  13.744  1.00 40.62           C  
ATOM   7376  CD  GLN B  93      52.394  89.566  14.731  1.00 43.32           C  
ATOM   7377  OE1 GLN B  93      52.116  90.745  14.526  1.00 45.23           O  
ATOM   7378  NE2 GLN B  93      51.997  88.919  15.818  1.00 41.23           N  
ATOM   7379  N   GLY B  94      51.437  88.183   9.196  1.00 27.87           N  
ATOM   7380  CA  GLY B  94      51.221  88.651   7.836  1.00 27.19           C  
ATOM   7381  C   GLY B  94      52.461  89.307   7.248  1.00 29.93           C  
ATOM   7382  O   GLY B  94      52.344  90.162   6.379  1.00 28.57           O  
ATOM   7383  N   ARG B  95      53.645  88.914   7.725  1.00 26.68           N  
ATOM   7384  CA  ARG B  95      54.906  89.474   7.262  1.00 25.72           C  
ATOM   7385  C   ARG B  95      55.849  88.353   6.758  1.00 25.47           C  
ATOM   7386  O   ARG B  95      57.045  88.363   7.055  1.00 27.70           O  
ATOM   7387  CB  ARG B  95      55.605  90.227   8.397  1.00 29.44           C  
ATOM   7388  CG  ARG B  95      54.853  91.401   9.101  1.00 31.18           C  
ATOM   7389  CD  ARG B  95      54.759  92.703   8.335  1.00 34.37           C  
ATOM   7390  NE  ARG B  95      55.952  93.008   7.550  1.00 41.14           N  
ATOM   7391  CZ  ARG B  95      55.999  93.942   6.601  1.00 37.52           C  
ATOM   7392  NH1 ARG B  95      54.918  94.666   6.321  1.00 42.02           N  
ATOM   7393  NH2 ARG B  95      57.116  94.142   5.918  1.00 40.14           N  
ATOM   7394  N   THR B  96      55.301  87.414   5.998  1.00 24.94           N  
ATOM   7395  CA  THR B  96      56.035  86.279   5.442  1.00 26.42           C  
ATOM   7396  C   THR B  96      57.414  86.643   4.912  1.00 28.73           C  
ATOM   7397  O   THR B  96      57.589  87.559   4.079  1.00 26.76           O  
ATOM   7398  CB  THR B  96      55.276  85.623   4.291  1.00 28.27           C  
ATOM   7399  OG1 THR B  96      54.048  85.082   4.786  1.00 27.25           O  
ATOM   7400  CG2 THR B  96      56.106  84.478   3.698  1.00 30.60           C  
ATOM   7401  N   LEU B  97      58.405  85.914   5.383  1.00 22.61           N  
ATOM   7402  CA  LEU B  97      59.745  86.211   4.954  1.00 21.20           C  
ATOM   7403  C   LEU B  97      60.349  84.994   4.262  1.00 23.61           C  
ATOM   7404  O   LEU B  97      60.302  83.901   4.815  1.00 24.08           O  
ATOM   7405  CB  LEU B  97      60.580  86.561   6.188  1.00 22.05           C  
ATOM   7406  CG  LEU B  97      62.082  86.757   5.966  1.00 24.10           C  
ATOM   7407  CD1 LEU B  97      62.346  88.031   5.221  1.00 20.44           C  
ATOM   7408  CD2 LEU B  97      62.771  86.809   7.345  1.00 25.79           C  
ATOM   7409  N   TYR B  98      60.931  85.197   3.080  1.00 24.78           N  
ATOM   7410  CA  TYR B  98      61.587  84.111   2.347  1.00 25.17           C  
ATOM   7411  C   TYR B  98      63.117  84.201   2.573  1.00 26.31           C  
ATOM   7412  O   TYR B  98      63.675  85.284   2.720  1.00 24.33           O  
ATOM   7413  CB  TYR B  98      61.348  84.222   0.828  1.00 24.39           C  
ATOM   7414  CG  TYR B  98      59.967  83.887   0.281  1.00 23.15           C  
ATOM   7415  CD1 TYR B  98      58.945  83.420   1.095  1.00 26.50           C  
ATOM   7416  CD2 TYR B  98      59.705  84.025  -1.075  1.00 22.64           C  
ATOM   7417  CE1 TYR B  98      57.680  83.089   0.554  1.00 24.96           C  
ATOM   7418  CE2 TYR B  98      58.467  83.705  -1.611  1.00 27.78           C  
ATOM   7419  CZ  TYR B  98      57.464  83.239  -0.794  1.00 26.27           C  
ATOM   7420  OH  TYR B  98      56.250  82.939  -1.362  1.00 30.20           O  
ATOM   7421  N   GLY B  99      63.777  83.051   2.582  1.00 28.52           N  
ATOM   7422  CA  GLY B  99      65.211  83.015   2.726  1.00 32.21           C  
ATOM   7423  C   GLY B  99      65.768  82.407   3.996  1.00 36.34           C  
ATOM   7424  O   GLY B  99      66.970  82.170   4.068  1.00 35.51           O  
ATOM   7425  N   PHE B 100      64.925  82.130   4.985  1.00 35.21           N  
ATOM   7426  CA  PHE B 100      65.439  81.596   6.236  1.00 34.42           C  
ATOM   7427  C   PHE B 100      64.826  80.264   6.649  1.00 35.90           C  
ATOM   7428  O   PHE B 100      64.842  79.921   7.812  1.00 35.73           O  
ATOM   7429  CB  PHE B 100      65.276  82.630   7.366  1.00 31.18           C  
ATOM   7430  CG  PHE B 100      66.152  83.852   7.210  1.00 31.58           C  
ATOM   7431  CD1 PHE B 100      65.763  84.916   6.403  1.00 30.43           C  
ATOM   7432  CD2 PHE B 100      67.400  83.902   7.817  1.00 31.38           C  
ATOM   7433  CE1 PHE B 100      66.599  85.995   6.196  1.00 31.22           C  
ATOM   7434  CE2 PHE B 100      68.254  84.981   7.621  1.00 33.67           C  
ATOM   7435  CZ  PHE B 100      67.857  86.032   6.807  1.00 35.27           C  
ATOM   7436  N   GLY B 101      64.332  79.495   5.687  1.00 37.10           N  
ATOM   7437  CA  GLY B 101      63.734  78.216   6.024  1.00 41.39           C  
ATOM   7438  C   GLY B 101      62.224  78.323   5.963  1.00 46.25           C  
ATOM   7439  O   GLY B 101      61.686  79.436   5.910  1.00 46.18           O  
ATOM   7440  N   GLY B 102      61.544  77.175   5.964  1.00 48.42           N  
ATOM   7441  CA  GLY B 102      60.095  77.159   5.905  1.00 49.77           C  
ATOM   7442  C   GLY B 102      59.607  77.191   4.471  1.00 52.45           C  
ATOM   7443  O   GLY B 102      58.370  77.158   4.253  1.00 53.99           O  
ATOM   7444  OXT GLY B 102      60.465  77.252   3.564  1.00 52.55           O  
TER    7445      GLY B 102                                                      
ATOM   7446  N   ALA C  14      25.348  58.342  34.345  1.00 68.45           N  
ATOM   7447  CA  ALA C  14      26.432  58.879  33.471  1.00 69.26           C  
ATOM   7448  C   ALA C  14      26.561  60.389  33.629  1.00 68.25           C  
ATOM   7449  O   ALA C  14      25.728  61.038  34.267  1.00 70.22           O  
ATOM   7450  CB  ALA C  14      26.146  58.539  32.006  1.00 66.91           C  
ATOM   7451  N   LYS C  15      27.616  60.941  33.045  1.00 65.04           N  
ATOM   7452  CA  LYS C  15      27.848  62.377  33.091  1.00 62.85           C  
ATOM   7453  C   LYS C  15      28.597  62.851  31.853  1.00 57.95           C  
ATOM   7454  O   LYS C  15      29.499  62.177  31.355  1.00 56.19           O  
ATOM   7455  CB  LYS C  15      28.608  62.762  34.364  1.00 65.20           C  
ATOM   7456  CG  LYS C  15      27.696  62.864  35.573  1.00 70.18           C  
ATOM   7457  CD  LYS C  15      28.435  63.251  36.839  1.00 73.89           C  
ATOM   7458  CE  LYS C  15      27.457  63.355  38.007  1.00 76.14           C  
ATOM   7459  NZ  LYS C  15      28.143  63.450  39.327  1.00 78.45           N  
ATOM   7460  N   THR C  16      28.200  64.017  31.358  1.00 52.97           N  
ATOM   7461  CA  THR C  16      28.816  64.594  30.170  1.00 47.09           C  
ATOM   7462  C   THR C  16      30.232  65.034  30.479  1.00 41.17           C  
ATOM   7463  O   THR C  16      30.584  65.336  31.624  1.00 37.09           O  
ATOM   7464  CB  THR C  16      28.054  65.838  29.687  1.00 49.43           C  
ATOM   7465  OG1 THR C  16      28.085  66.836  30.718  1.00 46.75           O  
ATOM   7466  CG2 THR C  16      26.615  65.495  29.330  1.00 47.95           C  
ATOM   7467  N   ARG C  17      31.061  65.079  29.450  1.00 39.14           N  
ATOM   7468  CA  ARG C  17      32.423  65.533  29.673  1.00 36.56           C  
ATOM   7469  C   ARG C  17      32.352  67.029  30.055  1.00 32.36           C  
ATOM   7470  O   ARG C  17      33.215  67.553  30.741  1.00 32.25           O  
ATOM   7471  CB  ARG C  17      33.254  65.307  28.408  1.00 41.41           C  
ATOM   7472  CG  ARG C  17      33.490  63.843  28.102  1.00 43.11           C  
ATOM   7473  CD  ARG C  17      34.678  63.674  27.159  1.00 43.82           C  
ATOM   7474  NE  ARG C  17      34.212  63.552  25.792  1.00 45.66           N  
ATOM   7475  CZ  ARG C  17      34.983  63.698  24.724  1.00 44.58           C  
ATOM   7476  NH1 ARG C  17      36.261  63.982  24.866  1.00 40.63           N  
ATOM   7477  NH2 ARG C  17      34.468  63.544  23.522  1.00 46.14           N  
ATOM   7478  N   SER C  18      31.305  67.703  29.615  1.00 30.63           N  
ATOM   7479  CA  SER C  18      31.150  69.114  29.959  1.00 33.52           C  
ATOM   7480  C   SER C  18      30.926  69.234  31.483  1.00 34.21           C  
ATOM   7481  O   SER C  18      31.546  70.081  32.135  1.00 33.03           O  
ATOM   7482  CB  SER C  18      29.973  69.729  29.194  1.00 30.82           C  
ATOM   7483  OG  SER C  18      30.298  69.949  27.823  1.00 34.11           O  
ATOM   7484  N   SER C  19      30.066  68.384  32.055  1.00 33.63           N  
ATOM   7485  CA  SER C  19      29.845  68.460  33.502  1.00 37.29           C  
ATOM   7486  C   SER C  19      31.117  68.117  34.276  1.00 34.91           C  
ATOM   7487  O   SER C  19      31.481  68.826  35.203  1.00 36.00           O  
ATOM   7488  CB  SER C  19      28.658  67.580  33.941  1.00 38.99           C  
ATOM   7489  OG  SER C  19      28.764  66.269  33.445  1.00 48.03           O  
ATOM   7490  N   ARG C  20      31.829  67.067  33.878  1.00 35.93           N  
ATOM   7491  CA  ARG C  20      33.085  66.725  34.553  1.00 36.04           C  
ATOM   7492  C   ARG C  20      34.082  67.873  34.499  1.00 35.55           C  
ATOM   7493  O   ARG C  20      34.923  68.027  35.390  1.00 35.56           O  
ATOM   7494  CB  ARG C  20      33.756  65.518  33.906  1.00 40.37           C  
ATOM   7495  CG  ARG C  20      33.118  64.184  34.164  1.00 48.97           C  
ATOM   7496  CD  ARG C  20      33.868  63.133  33.354  1.00 55.67           C  
ATOM   7497  NE  ARG C  20      33.101  61.903  33.183  1.00 63.17           N  
ATOM   7498  CZ  ARG C  20      33.022  60.935  34.093  1.00 66.58           C  
ATOM   7499  NH1 ARG C  20      33.661  61.044  35.256  1.00 67.64           N  
ATOM   7500  NH2 ARG C  20      32.315  59.847  33.832  1.00 67.91           N  
ATOM   7501  N   ALA C  21      34.035  68.674  33.440  1.00 34.93           N  
ATOM   7502  CA  ALA C  21      34.982  69.797  33.343  1.00 33.05           C  
ATOM   7503  C   ALA C  21      34.403  71.092  33.925  1.00 31.77           C  
ATOM   7504  O   ALA C  21      35.103  72.097  33.997  1.00 33.06           O  
ATOM   7505  CB  ALA C  21      35.379  70.031  31.866  1.00 32.11           C  
ATOM   7506  N   GLY C  22      33.124  71.069  34.307  1.00 32.06           N  
ATOM   7507  CA  GLY C  22      32.485  72.267  34.859  1.00 32.32           C  
ATOM   7508  C   GLY C  22      32.137  73.333  33.816  1.00 30.04           C  
ATOM   7509  O   GLY C  22      32.054  74.536  34.125  1.00 29.80           O  
ATOM   7510  N   LEU C  23      31.900  72.887  32.584  1.00 31.45           N  
ATOM   7511  CA  LEU C  23      31.601  73.784  31.474  1.00 31.42           C  
ATOM   7512  C   LEU C  23      30.172  73.751  30.993  1.00 32.52           C  
ATOM   7513  O   LEU C  23      29.454  72.773  31.188  1.00 33.31           O  
ATOM   7514  CB  LEU C  23      32.510  73.446  30.281  1.00 29.29           C  
ATOM   7515  CG  LEU C  23      34.005  73.618  30.553  1.00 27.35           C  
ATOM   7516  CD1 LEU C  23      34.869  73.163  29.344  1.00 25.56           C  
ATOM   7517  CD2 LEU C  23      34.251  75.117  30.846  1.00 26.73           C  
ATOM   7518  N   GLN C  24      29.789  74.841  30.334  1.00 31.69           N  
ATOM   7519  CA  GLN C  24      28.480  75.006  29.738  1.00 30.73           C  
ATOM   7520  C   GLN C  24      28.637  74.585  28.276  1.00 31.40           C  
ATOM   7521  O   GLN C  24      27.736  73.976  27.722  1.00 31.98           O  
ATOM   7522  CB  GLN C  24      28.055  76.477  29.792  1.00 33.63           C  
ATOM   7523  CG  GLN C  24      27.828  77.022  31.208  1.00 36.57           C  
ATOM   7524  CD  GLN C  24      26.878  76.142  31.979  1.00 33.96           C  
ATOM   7525  OE1 GLN C  24      25.745  75.961  31.593  1.00 32.74           O  
ATOM   7526  NE2 GLN C  24      27.349  75.589  33.072  1.00 40.83           N  
ATOM   7527  N   PHE C  25      29.765  74.957  27.648  1.00 28.02           N  
ATOM   7528  CA  PHE C  25      30.010  74.580  26.247  1.00 25.92           C  
ATOM   7529  C   PHE C  25      30.237  73.058  26.153  1.00 29.54           C  
ATOM   7530  O   PHE C  25      30.806  72.448  27.061  1.00 30.04           O  
ATOM   7531  CB  PHE C  25      31.186  75.406  25.669  1.00 22.62           C  
ATOM   7532  CG  PHE C  25      30.754  76.732  25.051  1.00 27.81           C  
ATOM   7533  CD1 PHE C  25      29.843  77.572  25.708  1.00 27.31           C  
ATOM   7534  CD2 PHE C  25      31.214  77.113  23.785  1.00 30.24           C  
ATOM   7535  CE1 PHE C  25      29.382  78.766  25.118  1.00 28.69           C  
ATOM   7536  CE2 PHE C  25      30.773  78.305  23.171  1.00 31.24           C  
ATOM   7537  CZ  PHE C  25      29.847  79.141  23.833  1.00 28.62           C  
ATOM   7538  N   PRO C  26      29.820  72.432  25.029  1.00 31.86           N  
ATOM   7539  CA  PRO C  26      29.915  70.987  24.756  1.00 30.40           C  
ATOM   7540  C   PRO C  26      31.275  70.416  24.418  1.00 33.49           C  
ATOM   7541  O   PRO C  26      31.739  70.554  23.278  1.00 31.95           O  
ATOM   7542  CB  PRO C  26      28.939  70.800  23.613  1.00 30.71           C  
ATOM   7543  CG  PRO C  26      29.230  72.014  22.780  1.00 34.21           C  
ATOM   7544  CD  PRO C  26      29.373  73.151  23.823  1.00 29.49           C  
ATOM   7545  N   VAL C  27      31.892  69.737  25.384  1.00 29.66           N  
ATOM   7546  CA  VAL C  27      33.205  69.164  25.152  1.00 32.51           C  
ATOM   7547  C   VAL C  27      33.132  68.086  24.072  1.00 34.94           C  
ATOM   7548  O   VAL C  27      34.012  68.015  23.202  1.00 29.47           O  
ATOM   7549  CB  VAL C  27      33.755  68.572  26.411  1.00 32.05           C  
ATOM   7550  CG1 VAL C  27      35.040  67.806  26.104  1.00 32.45           C  
ATOM   7551  CG2 VAL C  27      34.011  69.703  27.428  1.00 30.30           C  
ATOM   7552  N   GLY C  28      32.072  67.271  24.126  1.00 31.61           N  
ATOM   7553  CA  GLY C  28      31.902  66.211  23.154  1.00 32.35           C  
ATOM   7554  C   GLY C  28      31.861  66.752  21.739  1.00 33.65           C  
ATOM   7555  O   GLY C  28      32.535  66.252  20.841  1.00 32.43           O  
ATOM   7556  N   ARG C  29      31.047  67.772  21.533  1.00 32.58           N  
ATOM   7557  CA  ARG C  29      30.923  68.402  20.226  1.00 33.10           C  
ATOM   7558  C   ARG C  29      32.272  68.959  19.759  1.00 33.88           C  
ATOM   7559  O   ARG C  29      32.707  68.709  18.623  1.00 33.98           O  
ATOM   7560  CB  ARG C  29      29.939  69.548  20.315  1.00 33.89           C  
ATOM   7561  CG  ARG C  29      29.627  70.215  19.004  1.00 37.69           C  
ATOM   7562  CD  ARG C  29      28.179  70.064  18.773  1.00 39.27           C  
ATOM   7563  NE  ARG C  29      27.527  71.334  18.637  1.00 46.35           N  
ATOM   7564  CZ  ARG C  29      26.216  71.513  18.671  1.00 42.14           C  
ATOM   7565  NH1 ARG C  29      25.375  70.492  18.854  1.00 45.95           N  
ATOM   7566  NH2 ARG C  29      25.749  72.727  18.481  1.00 48.80           N  
ATOM   7567  N   VAL C  30      32.921  69.728  20.630  1.00 29.49           N  
ATOM   7568  CA  VAL C  30      34.198  70.313  20.280  1.00 31.34           C  
ATOM   7569  C   VAL C  30      35.260  69.259  19.916  1.00 34.46           C  
ATOM   7570  O   VAL C  30      36.044  69.487  18.992  1.00 34.48           O  
ATOM   7571  CB  VAL C  30      34.702  71.249  21.391  1.00 28.52           C  
ATOM   7572  CG1 VAL C  30      36.164  71.658  21.118  1.00 25.07           C  
ATOM   7573  CG2 VAL C  30      33.809  72.479  21.421  1.00 23.84           C  
ATOM   7574  N   HIS C  31      35.272  68.123  20.621  1.00 32.79           N  
ATOM   7575  CA  HIS C  31      36.212  67.022  20.338  1.00 35.98           C  
ATOM   7576  C   HIS C  31      35.926  66.524  18.910  1.00 35.57           C  
ATOM   7577  O   HIS C  31      36.831  66.321  18.099  1.00 36.36           O  
ATOM   7578  CB  HIS C  31      35.979  65.855  21.313  1.00 40.02           C  
ATOM   7579  CG  HIS C  31      37.159  64.946  21.481  1.00 42.36           C  
ATOM   7580  ND1 HIS C  31      38.166  64.840  20.544  1.00 46.96           N  
ATOM   7581  CD2 HIS C  31      37.510  64.124  22.498  1.00 43.63           C  
ATOM   7582  CE1 HIS C  31      39.092  64.003  20.983  1.00 43.98           C  
ATOM   7583  NE2 HIS C  31      38.717  63.555  22.167  1.00 46.95           N  
ATOM   7584  N   ARG C  32      34.651  66.341  18.616  1.00 35.28           N  
ATOM   7585  CA  ARG C  32      34.222  65.855  17.312  1.00 37.35           C  
ATOM   7586  C   ARG C  32      34.618  66.823  16.204  1.00 37.52           C  
ATOM   7587  O   ARG C  32      35.174  66.425  15.187  1.00 39.28           O  
ATOM   7588  CB  ARG C  32      32.714  65.683  17.311  1.00 39.74           C  
ATOM   7589  CG  ARG C  32      32.166  64.950  16.130  1.00 42.46           C  
ATOM   7590  CD  ARG C  32      30.661  65.079  16.142  1.00 51.62           C  
ATOM   7591  NE  ARG C  32      30.278  66.117  15.205  1.00 53.26           N  
ATOM   7592  CZ  ARG C  32      29.415  67.087  15.461  1.00 52.56           C  
ATOM   7593  NH1 ARG C  32      28.819  67.169  16.643  1.00 50.26           N  
ATOM   7594  NH2 ARG C  32      29.174  67.989  14.524  1.00 56.60           N  
ATOM   7595  N   LEU C  33      34.300  68.095  16.393  1.00 34.17           N  
ATOM   7596  CA  LEU C  33      34.644  69.093  15.409  1.00 33.87           C  
ATOM   7597  C   LEU C  33      36.146  69.124  15.204  1.00 32.29           C  
ATOM   7598  O   LEU C  33      36.588  69.290  14.072  1.00 33.64           O  
ATOM   7599  CB  LEU C  33      34.119  70.463  15.834  1.00 33.33           C  
ATOM   7600  CG  LEU C  33      32.587  70.533  15.738  1.00 33.82           C  
ATOM   7601  CD1 LEU C  33      32.086  71.813  16.390  1.00 37.12           C  
ATOM   7602  CD2 LEU C  33      32.158  70.465  14.270  1.00 36.35           C  
ATOM   7603  N   LEU C  34      36.935  68.947  16.268  1.00 28.33           N  
ATOM   7604  CA  LEU C  34      38.391  68.960  16.099  1.00 28.27           C  
ATOM   7605  C   LEU C  34      38.845  67.781  15.219  1.00 35.65           C  
ATOM   7606  O   LEU C  34      39.717  67.937  14.359  1.00 36.17           O  
ATOM   7607  CB  LEU C  34      39.114  68.902  17.440  1.00 27.92           C  
ATOM   7608  CG  LEU C  34      39.174  70.160  18.328  1.00 31.20           C  
ATOM   7609  CD1 LEU C  34      39.834  69.847  19.700  1.00 27.63           C  
ATOM   7610  CD2 LEU C  34      39.954  71.235  17.593  1.00 27.41           C  
ATOM   7611  N   ARG C  35      38.254  66.606  15.430  1.00 37.93           N  
ATOM   7612  CA  ARG C  35      38.605  65.432  14.632  1.00 42.01           C  
ATOM   7613  C   ARG C  35      38.184  65.607  13.181  1.00 43.70           C  
ATOM   7614  O   ARG C  35      38.956  65.336  12.269  1.00 49.01           O  
ATOM   7615  CB  ARG C  35      37.935  64.172  15.176  1.00 44.37           C  
ATOM   7616  CG  ARG C  35      38.408  63.688  16.539  1.00 44.61           C  
ATOM   7617  CD  ARG C  35      37.724  62.361  16.838  1.00 53.98           C  
ATOM   7618  NE  ARG C  35      37.868  61.920  18.222  1.00 56.73           N  
ATOM   7619  CZ  ARG C  35      39.026  61.638  18.808  1.00 58.44           C  
ATOM   7620  NH1 ARG C  35      40.160  61.760  18.133  1.00 60.76           N  
ATOM   7621  NH2 ARG C  35      39.043  61.204  20.064  1.00 58.45           N  
ATOM   7622  N   LYS C  36      36.968  66.069  12.949  1.00 44.19           N  
ATOM   7623  CA  LYS C  36      36.511  66.231  11.582  1.00 46.85           C  
ATOM   7624  C   LYS C  36      37.218  67.332  10.809  1.00 46.43           C  
ATOM   7625  O   LYS C  36      37.257  67.300   9.576  1.00 46.13           O  
ATOM   7626  CB  LYS C  36      35.009  66.485  11.565  1.00 52.47           C  
ATOM   7627  CG  LYS C  36      34.591  67.792  12.195  1.00 58.49           C  
ATOM   7628  CD  LYS C  36      33.089  67.790  12.494  1.00 63.28           C  
ATOM   7629  CE  LYS C  36      32.246  67.771  11.231  1.00 61.97           C  
ATOM   7630  NZ  LYS C  36      30.798  67.701  11.576  1.00 65.48           N  
ATOM   7631  N   GLY C  37      37.791  68.298  11.525  1.00 44.34           N  
ATOM   7632  CA  GLY C  37      38.465  69.404  10.869  1.00 40.26           C  
ATOM   7633  C   GLY C  37      39.827  69.096  10.266  1.00 41.62           C  
ATOM   7634  O   GLY C  37      40.419  69.951   9.617  1.00 41.24           O  
ATOM   7635  N   ASN C  38      40.349  67.900  10.492  1.00 39.06           N  
ATOM   7636  CA  ASN C  38      41.653  67.550   9.935  1.00 43.11           C  
ATOM   7637  C   ASN C  38      42.763  68.465  10.404  1.00 40.78           C  
ATOM   7638  O   ASN C  38      43.583  68.926   9.607  1.00 43.12           O  
ATOM   7639  CB  ASN C  38      41.630  67.581   8.408  1.00 48.25           C  
ATOM   7640  CG  ASN C  38      40.934  66.381   7.817  1.00 52.37           C  
ATOM   7641  OD1 ASN C  38      39.749  66.430   7.506  1.00 53.93           O  
ATOM   7642  ND2 ASN C  38      41.675  65.279   7.670  1.00 56.00           N  
ATOM   7643  N   TYR C  39      42.800  68.723  11.700  1.00 36.48           N  
ATOM   7644  CA  TYR C  39      43.836  69.576  12.261  1.00 32.88           C  
ATOM   7645  C   TYR C  39      45.077  68.766  12.602  1.00 31.51           C  
ATOM   7646  O   TYR C  39      46.188  69.278  12.552  1.00 33.29           O  
ATOM   7647  CB  TYR C  39      43.277  70.288  13.498  1.00 26.45           C  
ATOM   7648  CG  TYR C  39      42.083  71.165  13.134  1.00 30.02           C  
ATOM   7649  CD1 TYR C  39      40.775  70.785  13.445  1.00 28.11           C  
ATOM   7650  CD2 TYR C  39      42.273  72.372  12.477  1.00 30.12           C  
ATOM   7651  CE1 TYR C  39      39.690  71.609  13.107  1.00 30.77           C  
ATOM   7652  CE2 TYR C  39      41.207  73.190  12.137  1.00 31.61           C  
ATOM   7653  CZ  TYR C  39      39.922  72.805  12.457  1.00 33.49           C  
ATOM   7654  OH  TYR C  39      38.883  73.643  12.129  1.00 37.51           O  
ATOM   7655  N   ALA C  40      44.895  67.494  12.936  1.00 30.86           N  
ATOM   7656  CA  ALA C  40      46.033  66.631  13.289  1.00 32.92           C  
ATOM   7657  C   ALA C  40      45.587  65.186  13.222  1.00 33.88           C  
ATOM   7658  O   ALA C  40      44.391  64.895  13.177  1.00 33.37           O  
ATOM   7659  CB  ALA C  40      46.539  66.940  14.709  1.00 32.03           C  
ATOM   7660  N   GLU C  41      46.539  64.269  13.211  1.00 36.86           N  
ATOM   7661  CA  GLU C  41      46.151  62.868  13.152  1.00 39.61           C  
ATOM   7662  C   GLU C  41      45.430  62.491  14.433  1.00 38.04           C  
ATOM   7663  O   GLU C  41      44.468  61.753  14.396  1.00 40.98           O  
ATOM   7664  CB  GLU C  41      47.379  61.960  12.963  1.00 43.52           C  
ATOM   7665  CG  GLU C  41      48.001  62.058  11.574  1.00 55.17           C  
ATOM   7666  CD  GLU C  41      46.983  61.831  10.453  1.00 61.78           C  
ATOM   7667  OE1 GLU C  41      46.365  60.738  10.424  1.00 63.09           O  
ATOM   7668  OE2 GLU C  41      46.799  62.745   9.609  1.00 62.03           O  
ATOM   7669  N   ARG C  42      45.889  63.028  15.559  1.00 36.93           N  
ATOM   7670  CA  ARG C  42      45.307  62.706  16.859  1.00 37.54           C  
ATOM   7671  C   ARG C  42      44.929  63.959  17.648  1.00 36.91           C  
ATOM   7672  O   ARG C  42      45.589  64.991  17.538  1.00 33.86           O  
ATOM   7673  CB  ARG C  42      46.307  61.921  17.720  1.00 39.31           C  
ATOM   7674  CG  ARG C  42      46.810  60.589  17.159  1.00 44.69           C  
ATOM   7675  CD  ARG C  42      47.675  59.867  18.205  1.00 46.06           C  
ATOM   7676  NE  ARG C  42      47.746  58.434  17.937  1.00 56.34           N  
ATOM   7677  CZ  ARG C  42      48.087  57.501  18.824  1.00 55.21           C  
ATOM   7678  NH1 ARG C  42      48.401  57.829  20.072  1.00 56.41           N  
ATOM   7679  NH2 ARG C  42      48.102  56.229  18.456  1.00 56.82           N  
ATOM   7680  N   VAL C  43      43.893  63.836  18.471  1.00 36.08           N  
ATOM   7681  CA  VAL C  43      43.439  64.922  19.330  1.00 36.25           C  
ATOM   7682  C   VAL C  43      43.302  64.370  20.736  1.00 35.21           C  
ATOM   7683  O   VAL C  43      42.475  63.518  20.970  1.00 36.17           O  
ATOM   7684  CB  VAL C  43      42.064  65.466  18.901  1.00 36.82           C  
ATOM   7685  CG1 VAL C  43      41.591  66.543  19.904  1.00 31.64           C  
ATOM   7686  CG2 VAL C  43      42.157  66.041  17.489  1.00 39.18           C  
ATOM   7687  N   GLY C  44      44.108  64.865  21.664  1.00 35.00           N  
ATOM   7688  CA  GLY C  44      44.041  64.396  23.035  1.00 36.02           C  
ATOM   7689  C   GLY C  44      42.763  64.772  23.759  1.00 35.32           C  
ATOM   7690  O   GLY C  44      42.095  65.739  23.401  1.00 34.56           O  
ATOM   7691  N   ALA C  45      42.440  64.018  24.811  1.00 36.28           N  
ATOM   7692  CA  ALA C  45      41.214  64.245  25.586  1.00 34.80           C  
ATOM   7693  C   ALA C  45      41.082  65.637  26.208  1.00 29.93           C  
ATOM   7694  O   ALA C  45      39.990  66.161  26.289  1.00 33.70           O  
ATOM   7695  CB  ALA C  45      41.089  63.174  26.679  1.00 37.05           C  
ATOM   7696  N   GLY C  46      42.183  66.214  26.664  1.00 27.66           N  
ATOM   7697  CA  GLY C  46      42.135  67.532  27.270  1.00 30.67           C  
ATOM   7698  C   GLY C  46      42.000  68.707  26.292  1.00 31.26           C  
ATOM   7699  O   GLY C  46      41.600  69.807  26.689  1.00 30.75           O  
ATOM   7700  N   ALA C  47      42.305  68.474  25.018  1.00 28.36           N  
ATOM   7701  CA  ALA C  47      42.227  69.515  24.007  1.00 26.35           C  
ATOM   7702  C   ALA C  47      40.836  70.111  23.881  1.00 25.52           C  
ATOM   7703  O   ALA C  47      40.667  71.323  23.976  1.00 28.30           O  
ATOM   7704  CB  ALA C  47      42.676  68.969  22.646  1.00 26.10           C  
ATOM   7705  N   PRO C  48      39.826  69.274  23.665  1.00 24.34           N  
ATOM   7706  CA  PRO C  48      38.476  69.817  23.535  1.00 24.79           C  
ATOM   7707  C   PRO C  48      37.983  70.469  24.828  1.00 27.46           C  
ATOM   7708  O   PRO C  48      37.205  71.401  24.782  1.00 27.32           O  
ATOM   7709  CB  PRO C  48      37.645  68.604  23.096  1.00 27.14           C  
ATOM   7710  CG  PRO C  48      38.397  67.419  23.690  1.00 28.08           C  
ATOM   7711  CD  PRO C  48      39.853  67.801  23.525  1.00 27.90           C  
ATOM   7712  N   VAL C  49      38.456  69.987  25.976  1.00 28.09           N  
ATOM   7713  CA  VAL C  49      38.043  70.565  27.239  1.00 25.52           C  
ATOM   7714  C   VAL C  49      38.601  71.972  27.317  1.00 26.09           C  
ATOM   7715  O   VAL C  49      37.875  72.927  27.593  1.00 26.47           O  
ATOM   7716  CB  VAL C  49      38.554  69.746  28.455  1.00 29.14           C  
ATOM   7717  CG1 VAL C  49      38.286  70.545  29.792  1.00 27.52           C  
ATOM   7718  CG2 VAL C  49      37.835  68.366  28.500  1.00 24.24           C  
ATOM   7719  N   TYR C  50      39.900  72.101  27.066  1.00 24.09           N  
ATOM   7720  CA  TYR C  50      40.549  73.393  27.116  1.00 26.81           C  
ATOM   7721  C   TYR C  50      39.908  74.356  26.089  1.00 28.75           C  
ATOM   7722  O   TYR C  50      39.589  75.508  26.408  1.00 27.66           O  
ATOM   7723  CB  TYR C  50      42.039  73.219  26.832  1.00 21.16           C  
ATOM   7724  CG  TYR C  50      42.890  74.363  27.306  1.00 26.43           C  
ATOM   7725  CD1 TYR C  50      43.892  74.152  28.257  1.00 26.58           C  
ATOM   7726  CD2 TYR C  50      42.744  75.645  26.772  1.00 28.08           C  
ATOM   7727  CE1 TYR C  50      44.729  75.177  28.659  1.00 30.14           C  
ATOM   7728  CE2 TYR C  50      43.573  76.681  27.165  1.00 25.17           C  
ATOM   7729  CZ  TYR C  50      44.568  76.447  28.106  1.00 31.45           C  
ATOM   7730  OH  TYR C  50      45.434  77.448  28.479  1.00 28.95           O  
ATOM   7731  N   LEU C  51      39.696  73.866  24.869  1.00 26.96           N  
ATOM   7732  CA  LEU C  51      39.123  74.703  23.833  1.00 26.13           C  
ATOM   7733  C   LEU C  51      37.690  75.139  24.153  1.00 27.50           C  
ATOM   7734  O   LEU C  51      37.362  76.328  24.011  1.00 26.31           O  
ATOM   7735  CB  LEU C  51      39.194  73.985  22.460  1.00 25.58           C  
ATOM   7736  CG  LEU C  51      38.690  74.772  21.230  1.00 24.86           C  
ATOM   7737  CD1 LEU C  51      39.395  76.166  21.133  1.00 23.59           C  
ATOM   7738  CD2 LEU C  51      38.986  73.956  19.964  1.00 22.95           C  
ATOM   7739  N   ALA C  52      36.836  74.199  24.579  1.00 26.56           N  
ATOM   7740  CA  ALA C  52      35.450  74.552  24.932  1.00 26.76           C  
ATOM   7741  C   ALA C  52      35.456  75.615  26.032  1.00 25.14           C  
ATOM   7742  O   ALA C  52      34.669  76.547  26.006  1.00 24.80           O  
ATOM   7743  CB  ALA C  52      34.702  73.321  25.428  1.00 25.47           C  
ATOM   7744  N   ALA C  53      36.368  75.473  26.991  1.00 26.97           N  
ATOM   7745  CA  ALA C  53      36.477  76.415  28.096  1.00 25.72           C  
ATOM   7746  C   ALA C  53      36.805  77.820  27.588  1.00 26.96           C  
ATOM   7747  O   ALA C  53      36.206  78.820  28.019  1.00 25.16           O  
ATOM   7748  CB  ALA C  53      37.555  75.943  29.085  1.00 20.72           C  
ATOM   7749  N   VAL C  54      37.760  77.905  26.675  1.00 24.65           N  
ATOM   7750  CA  VAL C  54      38.159  79.199  26.114  1.00 23.96           C  
ATOM   7751  C   VAL C  54      37.027  79.844  25.318  1.00 24.46           C  
ATOM   7752  O   VAL C  54      36.777  81.045  25.427  1.00 26.02           O  
ATOM   7753  CB  VAL C  54      39.425  79.044  25.216  1.00 25.62           C  
ATOM   7754  CG1 VAL C  54      39.636  80.304  24.314  1.00 26.36           C  
ATOM   7755  CG2 VAL C  54      40.651  78.828  26.114  1.00 21.71           C  
ATOM   7756  N   LEU C  55      36.345  79.047  24.513  1.00 24.51           N  
ATOM   7757  CA  LEU C  55      35.248  79.553  23.701  1.00 24.09           C  
ATOM   7758  C   LEU C  55      34.149  80.074  24.618  1.00 28.07           C  
ATOM   7759  O   LEU C  55      33.562  81.122  24.358  1.00 25.61           O  
ATOM   7760  CB  LEU C  55      34.700  78.435  22.818  1.00 25.03           C  
ATOM   7761  CG  LEU C  55      35.666  77.948  21.710  1.00 21.91           C  
ATOM   7762  CD1 LEU C  55      35.080  76.708  21.108  1.00 24.63           C  
ATOM   7763  CD2 LEU C  55      35.899  79.013  20.641  1.00 23.81           C  
ATOM   7764  N   GLU C  56      33.876  79.317  25.674  1.00 25.24           N  
ATOM   7765  CA  GLU C  56      32.868  79.690  26.659  1.00 26.16           C  
ATOM   7766  C   GLU C  56      33.276  80.984  27.330  1.00 22.17           C  
ATOM   7767  O   GLU C  56      32.463  81.855  27.518  1.00 24.94           O  
ATOM   7768  CB  GLU C  56      32.711  78.595  27.719  1.00 28.85           C  
ATOM   7769  CG  GLU C  56      31.544  78.876  28.704  1.00 27.78           C  
ATOM   7770  CD  GLU C  56      31.385  77.766  29.723  1.00 32.26           C  
ATOM   7771  OE1 GLU C  56      31.273  76.595  29.298  1.00 30.71           O  
ATOM   7772  OE2 GLU C  56      31.388  78.069  30.939  1.00 27.17           O  
ATOM   7773  N   TYR C  57      34.544  81.121  27.665  1.00 23.71           N  
ATOM   7774  CA  TYR C  57      35.018  82.328  28.342  1.00 24.64           C  
ATOM   7775  C   TYR C  57      34.907  83.531  27.428  1.00 27.01           C  
ATOM   7776  O   TYR C  57      34.491  84.630  27.865  1.00 24.62           O  
ATOM   7777  CB  TYR C  57      36.481  82.166  28.761  1.00 26.90           C  
ATOM   7778  CG  TYR C  57      37.181  83.466  29.005  1.00 28.79           C  
ATOM   7779  CD1 TYR C  57      36.893  84.249  30.144  1.00 33.79           C  
ATOM   7780  CD2 TYR C  57      38.077  83.966  28.072  1.00 31.43           C  
ATOM   7781  CE1 TYR C  57      37.496  85.531  30.310  1.00 34.31           C  
ATOM   7782  CE2 TYR C  57      38.677  85.217  28.226  1.00 30.10           C  
ATOM   7783  CZ  TYR C  57      38.381  85.994  29.333  1.00 34.37           C  
ATOM   7784  OH  TYR C  57      38.964  87.244  29.428  1.00 36.13           O  
ATOM   7785  N   LEU C  58      35.307  83.357  26.162  1.00 21.84           N  
ATOM   7786  CA  LEU C  58      35.205  84.501  25.258  1.00 21.04           C  
ATOM   7787  C   LEU C  58      33.745  84.817  25.024  1.00 17.31           C  
ATOM   7788  O   LEU C  58      33.389  85.990  24.880  1.00 23.44           O  
ATOM   7789  CB  LEU C  58      35.899  84.227  23.915  1.00 20.65           C  
ATOM   7790  CG  LEU C  58      37.408  84.074  24.012  1.00 21.69           C  
ATOM   7791  CD1 LEU C  58      38.002  83.564  22.665  1.00 22.29           C  
ATOM   7792  CD2 LEU C  58      38.014  85.459  24.422  1.00 22.62           C  
ATOM   7793  N   THR C  59      32.863  83.823  24.997  1.00 20.52           N  
ATOM   7794  CA  THR C  59      31.500  84.223  24.729  1.00 23.08           C  
ATOM   7795  C   THR C  59      30.895  84.940  25.964  1.00 25.28           C  
ATOM   7796  O   THR C  59      30.096  85.880  25.812  1.00 25.35           O  
ATOM   7797  CB  THR C  59      30.551  83.072  24.219  1.00 32.00           C  
ATOM   7798  OG1 THR C  59      29.843  82.494  25.315  1.00 44.97           O  
ATOM   7799  CG2 THR C  59      31.277  82.038  23.403  1.00 19.36           C  
ATOM   7800  N   ALA C  60      31.307  84.527  27.170  1.00 23.93           N  
ATOM   7801  CA  ALA C  60      30.831  85.176  28.416  1.00 21.91           C  
ATOM   7802  C   ALA C  60      31.256  86.633  28.378  1.00 20.97           C  
ATOM   7803  O   ALA C  60      30.481  87.530  28.681  1.00 21.53           O  
ATOM   7804  CB  ALA C  60      31.470  84.465  29.669  1.00 20.71           C  
ATOM   7805  N   GLU C  61      32.501  86.879  27.966  1.00 21.33           N  
ATOM   7806  CA  GLU C  61      33.025  88.231  27.922  1.00 22.53           C  
ATOM   7807  C   GLU C  61      32.270  89.136  26.944  1.00 23.14           C  
ATOM   7808  O   GLU C  61      31.936  90.312  27.275  1.00 20.84           O  
ATOM   7809  CB  GLU C  61      34.487  88.176  27.526  1.00 24.66           C  
ATOM   7810  CG  GLU C  61      35.114  89.507  27.371  1.00 31.84           C  
ATOM   7811  CD  GLU C  61      35.495  90.108  28.700  1.00 42.90           C  
ATOM   7812  OE1 GLU C  61      35.224  89.449  29.731  1.00 46.89           O  
ATOM   7813  OE2 GLU C  61      36.050  91.228  28.709  1.00 41.05           O  
ATOM   7814  N   ILE C  62      32.031  88.631  25.729  1.00 20.92           N  
ATOM   7815  CA  ILE C  62      31.320  89.456  24.757  1.00 19.84           C  
ATOM   7816  C   ILE C  62      29.880  89.687  25.157  1.00 18.97           C  
ATOM   7817  O   ILE C  62      29.362  90.803  24.990  1.00 20.29           O  
ATOM   7818  CB  ILE C  62      31.418  88.883  23.291  1.00 23.60           C  
ATOM   7819  CG1 ILE C  62      30.694  89.841  22.338  1.00 27.06           C  
ATOM   7820  CG2 ILE C  62      30.688  87.546  23.135  1.00 23.30           C  
ATOM   7821  CD1 ILE C  62      31.106  89.634  20.822  1.00 32.71           C  
ATOM   7822  N   LEU C  63      29.219  88.669  25.702  1.00 16.96           N  
ATOM   7823  CA  LEU C  63      27.814  88.856  26.150  1.00 20.89           C  
ATOM   7824  C   LEU C  63      27.736  89.785  27.376  1.00 21.12           C  
ATOM   7825  O   LEU C  63      26.782  90.555  27.527  1.00 23.34           O  
ATOM   7826  CB  LEU C  63      27.168  87.513  26.504  1.00 19.22           C  
ATOM   7827  CG  LEU C  63      26.962  86.568  25.309  1.00 21.07           C  
ATOM   7828  CD1 LEU C  63      26.465  85.205  25.789  1.00 20.05           C  
ATOM   7829  CD2 LEU C  63      25.963  87.230  24.359  1.00 21.99           C  
ATOM   7830  N   GLU C  64      28.744  89.738  28.247  1.00 22.44           N  
ATOM   7831  CA  GLU C  64      28.730  90.634  29.402  1.00 22.16           C  
ATOM   7832  C   GLU C  64      28.702  92.061  28.864  1.00 23.94           C  
ATOM   7833  O   GLU C  64      27.835  92.868  29.205  1.00 22.19           O  
ATOM   7834  CB  GLU C  64      29.991  90.434  30.263  1.00 20.36           C  
ATOM   7835  CG  GLU C  64      30.110  91.460  31.385  1.00 26.82           C  
ATOM   7836  CD  GLU C  64      29.024  91.295  32.491  1.00 29.19           C  
ATOM   7837  OE1 GLU C  64      28.989  92.108  33.394  1.00 38.46           O  
ATOM   7838  OE2 GLU C  64      28.224  90.352  32.470  1.00 36.58           O  
ATOM   7839  N   LEU C  65      29.661  92.393  28.011  1.00 21.19           N  
ATOM   7840  CA  LEU C  65      29.704  93.748  27.444  1.00 23.02           C  
ATOM   7841  C   LEU C  65      28.531  94.125  26.549  1.00 16.77           C  
ATOM   7842  O   LEU C  65      28.095  95.275  26.562  1.00 20.37           O  
ATOM   7843  CB  LEU C  65      31.001  93.955  26.654  1.00 21.60           C  
ATOM   7844  CG  LEU C  65      32.250  93.736  27.516  1.00 25.33           C  
ATOM   7845  CD1 LEU C  65      33.529  93.707  26.633  1.00 19.76           C  
ATOM   7846  CD2 LEU C  65      32.309  94.837  28.557  1.00 27.80           C  
ATOM   7847  N   ALA C  66      28.041  93.197  25.746  1.00 19.99           N  
ATOM   7848  CA  ALA C  66      26.915  93.527  24.860  1.00 24.25           C  
ATOM   7849  C   ALA C  66      25.639  93.736  25.685  1.00 23.46           C  
ATOM   7850  O   ALA C  66      24.870  94.630  25.398  1.00 24.40           O  
ATOM   7851  CB  ALA C  66      26.692  92.424  23.833  1.00 21.90           C  
ATOM   7852  N   GLY C  67      25.406  92.912  26.705  1.00 26.49           N  
ATOM   7853  CA  GLY C  67      24.230  93.145  27.542  1.00 23.05           C  
ATOM   7854  C   GLY C  67      24.349  94.516  28.213  1.00 23.05           C  
ATOM   7855  O   GLY C  67      23.341  95.185  28.428  1.00 25.49           O  
ATOM   7856  N   ASN C  68      25.561  94.958  28.563  1.00 23.04           N  
ATOM   7857  CA  ASN C  68      25.697  96.281  29.184  1.00 23.27           C  
ATOM   7858  C   ASN C  68      25.350  97.355  28.139  1.00 28.98           C  
ATOM   7859  O   ASN C  68      24.681  98.353  28.456  1.00 28.82           O  
ATOM   7860  CB  ASN C  68      27.125  96.536  29.705  1.00 24.15           C  
ATOM   7861  CG  ASN C  68      27.506  95.651  30.911  1.00 27.84           C  
ATOM   7862  OD1 ASN C  68      26.678  94.973  31.496  1.00 28.73           O  
ATOM   7863  ND2 ASN C  68      28.773  95.654  31.253  1.00 27.18           N  
ATOM   7864  N   ALA C  69      25.803  97.161  26.889  1.00 26.89           N  
ATOM   7865  CA  ALA C  69      25.492  98.145  25.832  1.00 28.22           C  
ATOM   7866  C   ALA C  69      23.977  98.167  25.655  1.00 27.74           C  
ATOM   7867  O   ALA C  69      23.379  99.227  25.489  1.00 29.76           O  
ATOM   7868  CB  ALA C  69      26.183  97.767  24.483  1.00 27.75           C  
ATOM   7869  N   ALA C  70      23.345  97.003  25.718  1.00 25.40           N  
ATOM   7870  CA  ALA C  70      21.897  96.964  25.555  1.00 28.32           C  
ATOM   7871  C   ALA C  70      21.230  97.728  26.698  1.00 31.69           C  
ATOM   7872  O   ALA C  70      20.311  98.520  26.478  1.00 31.09           O  
ATOM   7873  CB  ALA C  70      21.396  95.510  25.511  1.00 26.77           C  
ATOM   7874  N   ARG C  71      21.700  97.502  27.925  1.00 33.24           N  
ATOM   7875  CA  ARG C  71      21.135  98.202  29.068  1.00 33.28           C  
ATOM   7876  C   ARG C  71      21.324  99.696  28.888  1.00 31.71           C  
ATOM   7877  O   ARG C  71      20.400 100.465  29.147  1.00 33.06           O  
ATOM   7878  CB  ARG C  71      21.797  97.766  30.380  1.00 38.54           C  
ATOM   7879  CG  ARG C  71      21.416  98.661  31.563  1.00 42.97           C  
ATOM   7880  CD  ARG C  71      22.009  98.188  32.899  1.00 48.03           C  
ATOM   7881  NE  ARG C  71      21.337  96.990  33.398  1.00 56.72           N  
ATOM   7882  CZ  ARG C  71      21.426  96.532  34.648  1.00 61.36           C  
ATOM   7883  NH1 ARG C  71      22.160  97.167  35.552  1.00 59.53           N  
ATOM   7884  NH2 ARG C  71      20.781  95.426  34.993  1.00 61.50           N  
ATOM   7885  N   ASP C  72      22.519 100.102  28.456  1.00 35.37           N  
ATOM   7886  CA  ASP C  72      22.831 101.518  28.228  1.00 35.99           C  
ATOM   7887  C   ASP C  72      21.830 102.140  27.243  1.00 39.00           C  
ATOM   7888  O   ASP C  72      21.530 103.318  27.317  1.00 38.50           O  
ATOM   7889  CB  ASP C  72      24.226 101.693  27.604  1.00 38.73           C  
ATOM   7890  CG  ASP C  72      25.376 101.376  28.563  1.00 38.91           C  
ATOM   7891  OD1 ASP C  72      25.179 101.361  29.794  1.00 35.80           O  
ATOM   7892  OD2 ASP C  72      26.502 101.160  28.059  1.00 41.41           O  
ATOM   7893  N   ASN C  73      21.349 101.336  26.304  1.00 39.30           N  
ATOM   7894  CA  ASN C  73      20.431 101.793  25.279  1.00 42.51           C  
ATOM   7895  C   ASN C  73      18.990 101.477  25.657  1.00 43.45           C  
ATOM   7896  O   ASN C  73      18.093 101.501  24.807  1.00 43.26           O  
ATOM   7897  CB  ASN C  73      20.810 101.142  23.939  1.00 45.62           C  
ATOM   7898  CG  ASN C  73      22.125 101.678  23.378  1.00 51.80           C  
ATOM   7899  OD1 ASN C  73      22.150 102.735  22.742  1.00 56.49           O  
ATOM   7900  ND2 ASN C  73      23.228 100.965  23.627  1.00 49.43           N  
ATOM   7901  N   LYS C  74      18.781 101.164  26.934  1.00 41.81           N  
ATOM   7902  CA  LYS C  74      17.453 100.873  27.451  1.00 42.14           C  
ATOM   7903  C   LYS C  74      16.736  99.728  26.759  1.00 42.17           C  
ATOM   7904  O   LYS C  74      15.505  99.723  26.659  1.00 43.88           O  
ATOM   7905  CB  LYS C  74      16.600 102.139  27.379  1.00 48.68           C  
ATOM   7906  CG  LYS C  74      17.243 103.309  28.134  1.00 53.06           C  
ATOM   7907  CD  LYS C  74      16.501 104.616  27.942  1.00 59.61           C  
ATOM   7908  CE  LYS C  74      17.266 105.761  28.593  1.00 62.45           C  
ATOM   7909  NZ  LYS C  74      16.999 107.061  27.915  1.00 63.91           N  
ATOM   7910  N   LYS C  75      17.501  98.744  26.300  1.00 37.65           N  
ATOM   7911  CA  LYS C  75      16.934  97.590  25.628  1.00 33.09           C  
ATOM   7912  C   LYS C  75      17.201  96.360  26.465  1.00 33.40           C  
ATOM   7913  O   LYS C  75      18.206  96.285  27.154  1.00 33.26           O  
ATOM   7914  CB  LYS C  75      17.578  97.412  24.246  1.00 36.28           C  
ATOM   7915  CG  LYS C  75      17.473  98.650  23.365  1.00 37.75           C  
ATOM   7916  CD  LYS C  75      16.086  98.787  22.767  1.00 46.72           C  
ATOM   7917  CE  LYS C  75      15.995 100.013  21.841  1.00 50.57           C  
ATOM   7918  NZ  LYS C  75      15.946 101.283  22.627  1.00 54.51           N  
ATOM   7919  N   THR C  76      16.318  95.381  26.354  1.00 29.77           N  
ATOM   7920  CA  THR C  76      16.429  94.137  27.097  1.00 34.43           C  
ATOM   7921  C   THR C  76      16.937  93.017  26.214  1.00 33.08           C  
ATOM   7922  O   THR C  76      17.374  91.947  26.702  1.00 33.02           O  
ATOM   7923  CB  THR C  76      15.050  93.781  27.678  1.00 35.72           C  
ATOM   7924  OG1 THR C  76      14.879  94.528  28.892  1.00 45.10           O  
ATOM   7925  CG2 THR C  76      14.914  92.319  27.939  1.00 43.01           C  
ATOM   7926  N   ARG C  77      16.896  93.261  24.908  1.00 28.49           N  
ATOM   7927  CA  ARG C  77      17.340  92.250  23.961  1.00 29.16           C  
ATOM   7928  C   ARG C  77      18.599  92.719  23.218  1.00 26.23           C  
ATOM   7929  O   ARG C  77      18.632  93.807  22.617  1.00 22.07           O  
ATOM   7930  CB  ARG C  77      16.215  91.961  22.950  1.00 33.93           C  
ATOM   7931  CG  ARG C  77      16.535  90.886  21.926  1.00 38.73           C  
ATOM   7932  CD  ARG C  77      15.410  90.740  20.905  1.00 38.34           C  
ATOM   7933  NE  ARG C  77      14.192  90.266  21.541  1.00 37.57           N  
ATOM   7934  CZ  ARG C  77      12.972  90.762  21.318  1.00 41.46           C  
ATOM   7935  NH1 ARG C  77      12.789  91.763  20.470  1.00 39.26           N  
ATOM   7936  NH2 ARG C  77      11.926  90.236  21.939  1.00 39.56           N  
ATOM   7937  N   ILE C  78      19.620  91.880  23.262  1.00 24.88           N  
ATOM   7938  CA  ILE C  78      20.877  92.159  22.575  1.00 24.17           C  
ATOM   7939  C   ILE C  78      20.667  92.037  21.049  1.00 22.00           C  
ATOM   7940  O   ILE C  78      20.097  91.029  20.554  1.00 20.63           O  
ATOM   7941  CB  ILE C  78      21.944  91.175  23.009  1.00 22.66           C  
ATOM   7942  CG1 ILE C  78      22.435  91.550  24.435  1.00 23.51           C  
ATOM   7943  CG2 ILE C  78      23.128  91.246  22.017  1.00 24.34           C  
ATOM   7944  CD1 ILE C  78      23.289  90.458  25.059  1.00 19.44           C  
ATOM   7945  N   ILE C  79      21.059  93.081  20.319  1.00 22.50           N  
ATOM   7946  CA  ILE C  79      20.954  93.057  18.850  1.00 22.83           C  
ATOM   7947  C   ILE C  79      22.377  93.235  18.291  1.00 25.02           C  
ATOM   7948  O   ILE C  79      23.312  93.529  19.058  1.00 21.25           O  
ATOM   7949  CB  ILE C  79      19.990  94.170  18.298  1.00 22.19           C  
ATOM   7950  CG1 ILE C  79      20.470  95.567  18.688  1.00 21.18           C  
ATOM   7951  CG2 ILE C  79      18.572  93.909  18.841  1.00 24.69           C  
ATOM   7952  CD1 ILE C  79      19.716  96.813  17.935  1.00 21.10           C  
ATOM   7953  N   PRO C  80      22.561  93.085  16.957  1.00 21.46           N  
ATOM   7954  CA  PRO C  80      23.938  93.248  16.444  1.00 17.12           C  
ATOM   7955  C   PRO C  80      24.600  94.538  16.811  1.00 14.76           C  
ATOM   7956  O   PRO C  80      25.792  94.560  17.077  1.00 17.73           O  
ATOM   7957  CB  PRO C  80      23.793  93.047  14.912  1.00 18.27           C  
ATOM   7958  CG  PRO C  80      22.636  92.002  14.828  1.00 18.13           C  
ATOM   7959  CD  PRO C  80      21.649  92.516  15.937  1.00 21.02           C  
ATOM   7960  N   ARG C  81      23.873  95.654  16.791  1.00 16.68           N  
ATOM   7961  CA  ARG C  81      24.491  96.914  17.174  1.00 17.60           C  
ATOM   7962  C   ARG C  81      25.155  96.803  18.563  1.00 20.24           C  
ATOM   7963  O   ARG C  81      26.210  97.403  18.804  1.00 20.57           O  
ATOM   7964  CB  ARG C  81      23.453  98.088  17.212  1.00 21.85           C  
ATOM   7965  CG  ARG C  81      23.846  99.190  18.214  1.00 28.24           C  
ATOM   7966  CD  ARG C  81      24.180 100.664  17.768  1.00 36.22           C  
ATOM   7967  NE  ARG C  81      25.283 100.735  16.864  1.00 33.52           N  
ATOM   7968  CZ  ARG C  81      26.023 101.793  16.526  1.00 31.85           C  
ATOM   7969  NH1 ARG C  81      25.868 103.027  17.018  1.00 26.21           N  
ATOM   7970  NH2 ARG C  81      26.934 101.586  15.583  1.00 27.41           N  
ATOM   7971  N   HIS C  82      24.547  96.059  19.490  1.00 22.94           N  
ATOM   7972  CA  HIS C  82      25.109  95.963  20.874  1.00 22.54           C  
ATOM   7973  C   HIS C  82      26.366  95.139  20.881  1.00 24.65           C  
ATOM   7974  O   HIS C  82      27.284  95.405  21.668  1.00 23.29           O  
ATOM   7975  CB  HIS C  82      24.075  95.335  21.840  1.00 19.06           C  
ATOM   7976  CG  HIS C  82      22.817  96.130  21.928  1.00 18.72           C  
ATOM   7977  ND1 HIS C  82      21.574  95.549  22.042  1.00 21.58           N  
ATOM   7978  CD2 HIS C  82      22.608  97.464  21.863  1.00 23.21           C  
ATOM   7979  CE1 HIS C  82      20.650  96.493  22.027  1.00 21.53           C  
ATOM   7980  NE2 HIS C  82      21.249  97.665  21.917  1.00 22.30           N  
ATOM   7981  N   LEU C  83      26.389  94.105  20.042  1.00 20.11           N  
ATOM   7982  CA  LEU C  83      27.592  93.304  19.916  1.00 19.83           C  
ATOM   7983  C   LEU C  83      28.695  94.204  19.347  1.00 21.49           C  
ATOM   7984  O   LEU C  83      29.842  94.182  19.821  1.00 21.94           O  
ATOM   7985  CB  LEU C  83      27.327  92.120  19.000  1.00 18.60           C  
ATOM   7986  CG  LEU C  83      26.358  91.079  19.567  1.00 24.86           C  
ATOM   7987  CD1 LEU C  83      26.070  89.997  18.536  1.00 20.02           C  
ATOM   7988  CD2 LEU C  83      26.954  90.524  20.855  1.00 20.52           C  
ATOM   7989  N   GLN C  84      28.359  95.043  18.365  1.00 19.66           N  
ATOM   7990  CA  GLN C  84      29.373  95.933  17.770  1.00 19.07           C  
ATOM   7991  C   GLN C  84      29.865  96.990  18.760  1.00 19.75           C  
ATOM   7992  O   GLN C  84      31.066  97.229  18.877  1.00 20.74           O  
ATOM   7993  CB  GLN C  84      28.809  96.639  16.507  1.00 22.63           C  
ATOM   7994  CG  GLN C  84      29.716  97.772  15.995  1.00 21.32           C  
ATOM   7995  CD  GLN C  84      30.837  97.265  15.079  1.00 22.96           C  
ATOM   7996  OE1 GLN C  84      31.306  96.143  15.242  1.00 18.94           O  
ATOM   7997  NE2 GLN C  84      31.284  98.110  14.128  1.00 17.42           N  
ATOM   7998  N   LEU C  85      28.951  97.665  19.457  1.00 18.78           N  
ATOM   7999  CA  LEU C  85      29.396  98.642  20.442  1.00 19.58           C  
ATOM   8000  C   LEU C  85      30.317  97.980  21.465  1.00 19.13           C  
ATOM   8001  O   LEU C  85      31.305  98.561  21.852  1.00 23.31           O  
ATOM   8002  CB  LEU C  85      28.201  99.275  21.205  1.00 24.12           C  
ATOM   8003  CG  LEU C  85      27.230 100.100  20.342  1.00 26.06           C  
ATOM   8004  CD1 LEU C  85      26.042 100.583  21.178  1.00 29.15           C  
ATOM   8005  CD2 LEU C  85      27.966 101.262  19.748  1.00 27.43           C  
ATOM   8006  N   ALA C  86      29.996  96.758  21.877  1.00 19.45           N  
ATOM   8007  CA  ALA C  86      30.780  96.036  22.903  1.00 23.73           C  
ATOM   8008  C   ALA C  86      32.195  95.730  22.419  1.00 23.28           C  
ATOM   8009  O   ALA C  86      33.206  95.947  23.097  1.00 20.84           O  
ATOM   8010  CB  ALA C  86      30.059  94.715  23.279  1.00 20.87           C  
ATOM   8011  N   VAL C  87      32.255  95.194  21.219  1.00 21.38           N  
ATOM   8012  CA  VAL C  87      33.518  94.866  20.606  1.00 17.10           C  
ATOM   8013  C   VAL C  87      34.339  96.096  20.289  1.00 17.86           C  
ATOM   8014  O   VAL C  87      35.533  96.166  20.659  1.00 20.61           O  
ATOM   8015  CB  VAL C  87      33.245  94.042  19.309  1.00 17.57           C  
ATOM   8016  CG1 VAL C  87      34.490  93.944  18.451  1.00 19.02           C  
ATOM   8017  CG2 VAL C  87      32.788  92.650  19.714  1.00 20.95           C  
ATOM   8018  N   ARG C  88      33.734  97.089  19.626  1.00 17.11           N  
ATOM   8019  CA  ARG C  88      34.522  98.250  19.232  1.00 19.66           C  
ATOM   8020  C   ARG C  88      34.919  99.155  20.386  1.00 21.66           C  
ATOM   8021  O   ARG C  88      35.924  99.841  20.307  1.00 18.66           O  
ATOM   8022  CB  ARG C  88      33.834  99.059  18.133  1.00 18.23           C  
ATOM   8023  CG  ARG C  88      33.509  98.204  16.847  1.00 17.53           C  
ATOM   8024  CD  ARG C  88      34.740  97.383  16.362  1.00 20.06           C  
ATOM   8025  NE  ARG C  88      34.364  96.287  15.454  1.00 19.49           N  
ATOM   8026  CZ  ARG C  88      35.183  95.318  15.043  1.00 19.69           C  
ATOM   8027  NH1 ARG C  88      36.452  95.280  15.433  1.00 17.71           N  
ATOM   8028  NH2 ARG C  88      34.711  94.344  14.290  1.00 19.59           N  
ATOM   8029  N   ASN C  89      34.134  99.168  21.454  1.00 20.95           N  
ATOM   8030  CA  ASN C  89      34.528  99.981  22.603  1.00 24.98           C  
ATOM   8031  C   ASN C  89      35.520  99.252  23.523  1.00 27.51           C  
ATOM   8032  O   ASN C  89      36.006  99.829  24.487  1.00 27.32           O  
ATOM   8033  CB  ASN C  89      33.307 100.389  23.406  1.00 23.84           C  
ATOM   8034  CG  ASN C  89      32.602 101.559  22.788  1.00 23.41           C  
ATOM   8035  OD1 ASN C  89      33.232 102.541  22.471  1.00 25.14           O  
ATOM   8036  ND2 ASN C  89      31.306 101.461  22.614  1.00 26.00           N  
ATOM   8037  N   ASP C  90      35.819  97.986  23.229  1.00 26.30           N  
ATOM   8038  CA  ASP C  90      36.755  97.218  24.074  1.00 24.30           C  
ATOM   8039  C   ASP C  90      38.041  96.991  23.298  1.00 25.15           C  
ATOM   8040  O   ASP C  90      38.044  96.309  22.270  1.00 24.15           O  
ATOM   8041  CB  ASP C  90      36.168  95.860  24.436  1.00 21.78           C  
ATOM   8042  CG  ASP C  90      37.100  95.055  25.351  1.00 30.04           C  
ATOM   8043  OD1 ASP C  90      37.180  95.366  26.546  1.00 28.13           O  
ATOM   8044  OD2 ASP C  90      37.782  94.141  24.880  1.00 26.64           O  
ATOM   8045  N   GLU C  91      39.137  97.538  23.790  1.00 24.89           N  
ATOM   8046  CA  GLU C  91      40.399  97.421  23.096  1.00 27.05           C  
ATOM   8047  C   GLU C  91      40.797  96.022  22.635  1.00 27.77           C  
ATOM   8048  O   GLU C  91      41.180  95.835  21.479  1.00 27.23           O  
ATOM   8049  CB  GLU C  91      41.508  98.009  23.957  1.00 34.26           C  
ATOM   8050  CG  GLU C  91      42.188  99.171  23.302  1.00 46.67           C  
ATOM   8051  CD  GLU C  91      43.163  99.874  24.226  1.00 55.05           C  
ATOM   8052  OE1 GLU C  91      44.131  99.218  24.684  1.00 54.38           O  
ATOM   8053  OE2 GLU C  91      42.952 101.082  24.486  1.00 59.30           O  
ATOM   8054  N   GLU C  92      40.721  95.036  23.523  1.00 26.02           N  
ATOM   8055  CA  GLU C  92      41.130  93.679  23.147  1.00 26.82           C  
ATOM   8056  C   GLU C  92      40.172  92.961  22.202  1.00 23.84           C  
ATOM   8057  O   GLU C  92      40.603  92.313  21.268  1.00 22.93           O  
ATOM   8058  CB  GLU C  92      41.409  92.833  24.408  1.00 27.45           C  
ATOM   8059  CG  GLU C  92      42.391  93.543  25.349  1.00 36.07           C  
ATOM   8060  CD  GLU C  92      43.179  92.603  26.258  1.00 41.08           C  
ATOM   8061  OE1 GLU C  92      42.601  91.597  26.717  1.00 43.16           O  
ATOM   8062  OE2 GLU C  92      44.379  92.894  26.515  1.00 43.10           O  
ATOM   8063  N   LEU C  93      38.876  93.056  22.443  1.00 22.53           N  
ATOM   8064  CA  LEU C  93      37.941  92.408  21.537  1.00 23.42           C  
ATOM   8065  C   LEU C  93      38.025  93.093  20.147  1.00 20.57           C  
ATOM   8066  O   LEU C  93      37.970  92.444  19.117  1.00 20.92           O  
ATOM   8067  CB  LEU C  93      36.525  92.495  22.099  1.00 22.65           C  
ATOM   8068  CG  LEU C  93      36.231  91.533  23.262  1.00 22.49           C  
ATOM   8069  CD1 LEU C  93      34.802  91.774  23.729  1.00 24.89           C  
ATOM   8070  CD2 LEU C  93      36.395  90.074  22.787  1.00 20.75           C  
ATOM   8071  N   ASN C  94      38.179  94.409  20.132  1.00 21.66           N  
ATOM   8072  CA  ASN C  94      38.328  95.120  18.874  1.00 21.63           C  
ATOM   8073  C   ASN C  94      39.523  94.578  18.067  1.00 25.81           C  
ATOM   8074  O   ASN C  94      39.433  94.374  16.839  1.00 23.06           O  
ATOM   8075  CB  ASN C  94      38.535  96.592  19.122  1.00 21.76           C  
ATOM   8076  CG  ASN C  94      38.649  97.376  17.819  1.00 27.92           C  
ATOM   8077  OD1 ASN C  94      37.756  97.329  16.961  1.00 23.54           O  
ATOM   8078  ND2 ASN C  94      39.722  98.098  17.678  1.00 23.98           N  
ATOM   8079  N   LYS C  95      40.635  94.328  18.751  1.00 23.63           N  
ATOM   8080  CA  LYS C  95      41.802  93.785  18.087  1.00 27.38           C  
ATOM   8081  C   LYS C  95      41.548  92.341  17.606  1.00 26.91           C  
ATOM   8082  O   LYS C  95      41.804  91.994  16.442  1.00 26.27           O  
ATOM   8083  CB  LYS C  95      43.002  93.859  19.038  1.00 34.31           C  
ATOM   8084  CG  LYS C  95      44.332  93.448  18.428  1.00 42.14           C  
ATOM   8085  CD  LYS C  95      45.476  93.998  19.314  1.00 54.21           C  
ATOM   8086  CE  LYS C  95      46.849  93.817  18.675  1.00 59.55           C  
ATOM   8087  NZ  LYS C  95      47.875  94.722  19.297  1.00 64.03           N  
ATOM   8088  N   LEU C  96      41.013  91.501  18.482  1.00 22.62           N  
ATOM   8089  CA  LEU C  96      40.730  90.116  18.099  1.00 20.18           C  
ATOM   8090  C   LEU C  96      39.799  90.066  16.886  1.00 20.54           C  
ATOM   8091  O   LEU C  96      39.905  89.166  16.062  1.00 22.22           O  
ATOM   8092  CB  LEU C  96      40.065  89.353  19.259  1.00 19.20           C  
ATOM   8093  CG  LEU C  96      39.622  87.926  18.928  1.00 23.04           C  
ATOM   8094  CD1 LEU C  96      40.880  87.030  18.778  1.00 22.44           C  
ATOM   8095  CD2 LEU C  96      38.710  87.380  20.055  1.00 22.32           C  
ATOM   8096  N   LEU C  97      38.884  91.032  16.788  1.00 20.38           N  
ATOM   8097  CA  LEU C  97      37.931  91.069  15.677  1.00 20.82           C  
ATOM   8098  C   LEU C  97      38.268  92.229  14.747  1.00 20.76           C  
ATOM   8099  O   LEU C  97      37.372  92.805  14.107  1.00 20.21           O  
ATOM   8100  CB  LEU C  97      36.491  91.214  16.221  1.00 19.73           C  
ATOM   8101  CG  LEU C  97      36.105  90.075  17.226  1.00 28.03           C  
ATOM   8102  CD1 LEU C  97      34.607  90.165  17.581  1.00 27.43           C  
ATOM   8103  CD2 LEU C  97      36.382  88.713  16.634  1.00 25.76           C  
ATOM   8104  N   GLY C  98      39.566  92.547  14.648  1.00 19.46           N  
ATOM   8105  CA  GLY C  98      39.996  93.676  13.844  1.00 20.58           C  
ATOM   8106  C   GLY C  98      39.689  93.561  12.353  1.00 23.59           C  
ATOM   8107  O   GLY C  98      39.584  94.556  11.672  1.00 21.83           O  
ATOM   8108  N   ARG C  99      39.506  92.347  11.863  1.00 18.48           N  
ATOM   8109  CA  ARG C  99      39.242  92.138  10.449  1.00 22.22           C  
ATOM   8110  C   ARG C  99      37.927  91.415  10.292  1.00 23.20           C  
ATOM   8111  O   ARG C  99      37.728  90.620   9.391  1.00 25.01           O  
ATOM   8112  CB  ARG C  99      40.401  91.348   9.843  1.00 27.39           C  
ATOM   8113  CG  ARG C  99      41.653  92.224   9.756  1.00 33.87           C  
ATOM   8114  CD  ARG C  99      42.876  91.466   9.251  1.00 51.84           C  
ATOM   8115  NE  ARG C  99      43.766  92.320   8.457  1.00 58.57           N  
ATOM   8116  CZ  ARG C  99      44.975  91.953   8.042  1.00 62.28           C  
ATOM   8117  NH1 ARG C  99      45.450  90.748   8.343  1.00 64.71           N  
ATOM   8118  NH2 ARG C  99      45.712  92.790   7.329  1.00 64.99           N  
ATOM   8119  N   VAL C 100      37.013  91.692  11.200  1.00 19.86           N  
ATOM   8120  CA  VAL C 100      35.723  91.028  11.150  1.00 18.18           C  
ATOM   8121  C   VAL C 100      34.671  92.095  11.031  1.00 19.11           C  
ATOM   8122  O   VAL C 100      34.775  93.142  11.686  1.00 19.55           O  
ATOM   8123  CB  VAL C 100      35.444  90.260  12.462  1.00 20.38           C  
ATOM   8124  CG1 VAL C 100      33.965  90.010  12.601  1.00 20.31           C  
ATOM   8125  CG2 VAL C 100      36.206  88.943  12.459  1.00 17.81           C  
ATOM   8126  N   THR C 101      33.645  91.817  10.237  1.00 17.80           N  
ATOM   8127  CA  THR C 101      32.562  92.767  10.081  1.00 15.58           C  
ATOM   8128  C   THR C 101      31.334  92.145  10.737  1.00 20.54           C  
ATOM   8129  O   THR C 101      30.956  91.041  10.390  1.00 19.49           O  
ATOM   8130  CB  THR C 101      32.222  93.002   8.574  1.00 19.15           C  
ATOM   8131  OG1 THR C 101      33.332  93.628   7.922  1.00 17.68           O  
ATOM   8132  CG2 THR C 101      30.998  93.900   8.439  1.00 13.76           C  
ATOM   8133  N   ILE C 102      30.757  92.840  11.707  1.00 19.93           N  
ATOM   8134  CA  ILE C 102      29.529  92.388  12.350  1.00 19.38           C  
ATOM   8135  C   ILE C 102      28.381  93.009  11.537  1.00 15.68           C  
ATOM   8136  O   ILE C 102      28.214  94.217  11.491  1.00 17.26           O  
ATOM   8137  CB  ILE C 102      29.461  92.869  13.825  1.00 20.82           C  
ATOM   8138  CG1 ILE C 102      30.533  92.117  14.654  1.00 18.39           C  
ATOM   8139  CG2 ILE C 102      28.053  92.628  14.377  1.00 20.73           C  
ATOM   8140  CD1 ILE C 102      30.701  92.649  16.111  1.00 22.21           C  
ATOM   8141  N   ALA C 103      27.645  92.174  10.822  1.00 21.29           N  
ATOM   8142  CA  ALA C 103      26.497  92.649  10.023  1.00 19.36           C  
ATOM   8143  C   ALA C 103      25.533  93.427  10.920  1.00 24.83           C  
ATOM   8144  O   ALA C 103      25.293  93.017  12.061  1.00 23.35           O  
ATOM   8145  CB  ALA C 103      25.744  91.430   9.422  1.00 18.84           C  
ATOM   8146  N   GLN C 104      24.972  94.506  10.375  1.00 20.09           N  
ATOM   8147  CA  GLN C 104      24.020  95.387  11.046  1.00 21.07           C  
ATOM   8148  C   GLN C 104      24.588  95.935  12.322  1.00 19.84           C  
ATOM   8149  O   GLN C 104      23.866  96.172  13.300  1.00 19.85           O  
ATOM   8150  CB  GLN C 104      22.697  94.642  11.312  1.00 24.31           C  
ATOM   8151  CG  GLN C 104      21.796  94.629  10.055  1.00 32.90           C  
ATOM   8152  CD  GLN C 104      21.467  96.074   9.605  1.00 35.24           C  
ATOM   8153  OE1 GLN C 104      20.718  96.798  10.301  1.00 33.48           O  
ATOM   8154  NE2 GLN C 104      22.061  96.512   8.465  1.00 24.72           N  
ATOM   8155  N   GLY C 105      25.891  96.175  12.303  1.00 20.95           N  
ATOM   8156  CA  GLY C 105      26.542  96.696  13.480  1.00 19.38           C  
ATOM   8157  C   GLY C 105      26.708  98.193  13.472  1.00 22.04           C  
ATOM   8158  O   GLY C 105      26.815  98.814  14.539  1.00 20.00           O  
ATOM   8159  N   GLY C 106      26.735  98.797  12.276  1.00 16.76           N  
ATOM   8160  CA  GLY C 106      26.947 100.233  12.228  1.00 12.72           C  
ATOM   8161  C   GLY C 106      28.358 100.506  12.734  1.00 18.35           C  
ATOM   8162  O   GLY C 106      29.180  99.571  12.788  1.00 18.37           O  
ATOM   8163  N   VAL C 107      28.656 101.751  13.091  1.00 15.94           N  
ATOM   8164  CA  VAL C 107      29.987 102.124  13.554  1.00 21.43           C  
ATOM   8165  C   VAL C 107      29.820 102.919  14.838  1.00 22.34           C  
ATOM   8166  O   VAL C 107      28.688 103.261  15.225  1.00 19.80           O  
ATOM   8167  CB  VAL C 107      30.726 103.046  12.549  1.00 23.64           C  
ATOM   8168  CG1 VAL C 107      30.807 102.365  11.140  1.00 24.17           C  
ATOM   8169  CG2 VAL C 107      29.986 104.403  12.438  1.00 21.10           C  
ATOM   8170  N   LEU C 108      30.946 103.202  15.493  1.00 22.98           N  
ATOM   8171  CA  LEU C 108      30.946 104.004  16.724  1.00 24.98           C  
ATOM   8172  C   LEU C 108      30.825 105.487  16.388  1.00 25.12           C  
ATOM   8173  O   LEU C 108      31.453 105.964  15.440  1.00 23.88           O  
ATOM   8174  CB  LEU C 108      32.269 103.859  17.491  1.00 23.76           C  
ATOM   8175  CG  LEU C 108      32.709 102.504  18.024  1.00 25.16           C  
ATOM   8176  CD1 LEU C 108      33.979 102.721  18.882  1.00 28.94           C  
ATOM   8177  CD2 LEU C 108      31.585 101.869  18.845  1.00 24.70           C  
ATOM   8178  N   PRO C 109      30.035 106.243  17.171  1.00 25.24           N  
ATOM   8179  CA  PRO C 109      29.906 107.680  16.898  1.00 24.75           C  
ATOM   8180  C   PRO C 109      31.293 108.263  17.065  1.00 30.23           C  
ATOM   8181  O   PRO C 109      31.951 108.007  18.064  1.00 30.33           O  
ATOM   8182  CB  PRO C 109      28.924 108.143  17.976  1.00 29.95           C  
ATOM   8183  CG  PRO C 109      27.953 106.969  17.993  1.00 29.12           C  
ATOM   8184  CD  PRO C 109      28.909 105.766  18.003  1.00 25.77           C  
ATOM   8185  N   ASN C 110      31.765 109.010  16.079  1.00 28.86           N  
ATOM   8186  CA  ASN C 110      33.114 109.565  16.151  1.00 32.24           C  
ATOM   8187  C   ASN C 110      33.253 110.617  15.057  1.00 33.77           C  
ATOM   8188  O   ASN C 110      33.312 110.275  13.876  1.00 32.30           O  
ATOM   8189  CB  ASN C 110      34.143 108.446  15.933  1.00 36.29           C  
ATOM   8190  CG  ASN C 110      35.588 108.907  16.136  1.00 43.49           C  
ATOM   8191  OD1 ASN C 110      35.862 109.794  16.936  1.00 47.99           O  
ATOM   8192  ND2 ASN C 110      36.517 108.277  15.431  1.00 42.68           N  
ATOM   8193  N   ILE C 111      33.243 111.892  15.451  1.00 31.73           N  
ATOM   8194  CA  ILE C 111      33.388 112.999  14.507  1.00 29.62           C  
ATOM   8195  C   ILE C 111      34.744 113.647  14.751  1.00 33.12           C  
ATOM   8196  O   ILE C 111      35.041 114.086  15.863  1.00 32.66           O  
ATOM   8197  CB  ILE C 111      32.290 114.057  14.709  1.00 29.99           C  
ATOM   8198  CG1 ILE C 111      30.910 113.438  14.475  1.00 28.08           C  
ATOM   8199  CG2 ILE C 111      32.486 115.191  13.759  1.00 33.07           C  
ATOM   8200  CD1 ILE C 111      29.740 114.406  14.685  1.00 31.19           C  
ATOM   8201  N   GLN C 112      35.595 113.679  13.738  1.00 27.47           N  
ATOM   8202  CA  GLN C 112      36.907 114.295  13.915  1.00 27.24           C  
ATOM   8203  C   GLN C 112      36.752 115.747  14.386  1.00 31.55           C  
ATOM   8204  O   GLN C 112      35.939 116.514  13.853  1.00 30.75           O  
ATOM   8205  CB  GLN C 112      37.669 114.228  12.593  1.00 30.60           C  
ATOM   8206  CG  GLN C 112      37.875 112.772  12.103  1.00 30.35           C  
ATOM   8207  CD  GLN C 112      38.773 111.976  13.043  1.00 34.70           C  
ATOM   8208  OE1 GLN C 112      39.859 112.419  13.377  1.00 28.22           O  
ATOM   8209  NE2 GLN C 112      38.312 110.793  13.471  1.00 34.39           N  
ATOM   8210  N   SER C 113      37.530 116.121  15.397  1.00 31.79           N  
ATOM   8211  CA  SER C 113      37.490 117.472  15.959  1.00 33.50           C  
ATOM   8212  C   SER C 113      37.460 118.649  15.004  1.00 31.74           C  
ATOM   8213  O   SER C 113      36.601 119.516  15.132  1.00 32.78           O  
ATOM   8214  CB  SER C 113      38.679 117.677  16.909  1.00 35.57           C  
ATOM   8215  OG  SER C 113      38.596 116.742  17.956  1.00 44.27           O  
ATOM   8216  N   VAL C 114      38.386 118.696  14.053  1.00 29.77           N  
ATOM   8217  CA  VAL C 114      38.460 119.841  13.144  1.00 30.87           C  
ATOM   8218  C   VAL C 114      37.207 120.125  12.377  1.00 32.34           C  
ATOM   8219  O   VAL C 114      37.069 121.209  11.809  1.00 30.56           O  
ATOM   8220  CB  VAL C 114      39.567 119.684  12.096  1.00 36.11           C  
ATOM   8221  CG1 VAL C 114      40.905 119.560  12.788  1.00 38.85           C  
ATOM   8222  CG2 VAL C 114      39.289 118.451  11.225  1.00 34.88           C  
ATOM   8223  N   LEU C 115      36.317 119.132  12.322  1.00 31.27           N  
ATOM   8224  CA  LEU C 115      35.060 119.264  11.593  1.00 32.01           C  
ATOM   8225  C   LEU C 115      33.958 119.945  12.408  1.00 33.35           C  
ATOM   8226  O   LEU C 115      32.909 120.290  11.856  1.00 31.91           O  
ATOM   8227  CB  LEU C 115      34.572 117.878  11.137  1.00 27.64           C  
ATOM   8228  CG  LEU C 115      35.529 117.124  10.188  1.00 29.47           C  
ATOM   8229  CD1 LEU C 115      34.875 115.790   9.789  1.00 26.36           C  
ATOM   8230  CD2 LEU C 115      35.806 117.981   8.914  1.00 25.07           C  
ATOM   8231  N   LEU C 116      34.173 120.113  13.714  1.00 33.89           N  
ATOM   8232  CA  LEU C 116      33.148 120.763  14.532  1.00 38.21           C  
ATOM   8233  C   LEU C 116      33.175 122.267  14.284  1.00 38.74           C  
ATOM   8234  O   LEU C 116      34.208 122.829  13.929  1.00 39.21           O  
ATOM   8235  CB  LEU C 116      33.362 120.477  16.019  1.00 37.70           C  
ATOM   8236  CG  LEU C 116      33.313 119.003  16.439  1.00 41.03           C  
ATOM   8237  CD1 LEU C 116      33.728 118.884  17.899  1.00 41.45           C  
ATOM   8238  CD2 LEU C 116      31.937 118.423  16.220  1.00 36.71           C  
ATOM   8239  N   PRO C 117      32.036 122.940  14.467  1.00 44.19           N  
ATOM   8240  CA  PRO C 117      32.008 124.387  14.235  1.00 50.71           C  
ATOM   8241  C   PRO C 117      32.705 125.214  15.316  1.00 56.92           C  
ATOM   8242  O   PRO C 117      33.364 124.675  16.200  1.00 55.51           O  
ATOM   8243  CB  PRO C 117      30.513 124.683  14.151  1.00 47.20           C  
ATOM   8244  CG  PRO C 117      29.935 123.733  15.129  1.00 45.71           C  
ATOM   8245  CD  PRO C 117      30.727 122.448  14.936  1.00 44.51           C  
ATOM   8246  N   LYS C 118      32.545 126.532  15.218  1.00 66.99           N  
ATOM   8247  CA  LYS C 118      33.094 127.497  16.175  1.00 73.27           C  
ATOM   8248  C   LYS C 118      34.583 127.365  16.459  1.00 77.40           C  
ATOM   8249  O   LYS C 118      35.377 127.016  15.584  1.00 78.15           O  
ATOM   8250  CB  LYS C 118      32.337 127.407  17.504  1.00 74.40           C  
ATOM   8251  CG  LYS C 118      30.825 127.491  17.383  1.00 79.30           C  
ATOM   8252  CD  LYS C 118      30.169 127.376  18.753  1.00 83.05           C  
ATOM   8253  CE  LYS C 118      28.647 127.407  18.657  1.00 86.60           C  
ATOM   8254  NZ  LYS C 118      27.991 127.376  20.005  1.00 87.44           N  
ATOM   8255  N   LYS C 119      34.945 127.664  17.704  1.00 81.28           N  
ATOM   8256  CA  LYS C 119      36.327 127.611  18.163  1.00 85.26           C  
ATOM   8257  C   LYS C 119      36.381 127.515  19.685  1.00 87.93           C  
ATOM   8258  O   LYS C 119      35.386 127.772  20.367  1.00 88.64           O  
ATOM   8259  CB  LYS C 119      37.090 128.858  17.698  1.00 85.79           C  
ATOM   8260  CG  LYS C 119      36.317 130.171  17.833  1.00 85.35           C  
ATOM   8261  CD  LYS C 119      35.321 130.349  16.691  1.00 85.87           C  
ATOM   8262  CE  LYS C 119      34.461 131.585  16.866  1.00 85.04           C  
ATOM   8263  NZ  LYS C 119      33.486 131.734  15.749  1.00 85.12           N  
ATOM   8264  N   THR C 120      37.550 127.151  20.208  1.00 90.19           N  
ATOM   8265  CA  THR C 120      37.751 127.007  21.648  1.00 91.99           C  
ATOM   8266  C   THR C 120      36.995 125.793  22.174  1.00 92.22           C  
ATOM   8267  O   THR C 120      35.764 125.738  21.969  1.00 92.49           O  
ATOM   8268  CB  THR C 120      37.270 128.260  22.420  1.00 93.00           C  
ATOM   8269  OG1 THR C 120      38.043 129.397  22.017  1.00 94.43           O  
ATOM   8270  CG2 THR C 120      37.426 128.057  23.921  1.00 93.86           C  
TER    8271      THR C 120                                                      
ATOM   8272  N   THR D  29      18.536  67.436   6.976  1.00 72.63           N  
ATOM   8273  CA  THR D  29      19.785  67.183   7.748  1.00 72.40           C  
ATOM   8274  C   THR D  29      19.893  68.192   8.885  1.00 71.22           C  
ATOM   8275  O   THR D  29      19.731  69.397   8.677  1.00 70.60           O  
ATOM   8276  CB  THR D  29      21.036  67.314   6.855  1.00 75.35           C  
ATOM   8277  OG1 THR D  29      22.196  66.898   7.588  1.00 79.51           O  
ATOM   8278  CG2 THR D  29      21.230  68.759   6.420  1.00 77.19           C  
ATOM   8279  N   ARG D  30      20.164  67.694  10.085  1.00 69.14           N  
ATOM   8280  CA  ARG D  30      20.287  68.548  11.256  1.00 66.37           C  
ATOM   8281  C   ARG D  30      21.487  69.481  11.120  1.00 64.19           C  
ATOM   8282  O   ARG D  30      22.582  69.047  10.765  1.00 64.79           O  
ATOM   8283  CB  ARG D  30      20.462  67.692  12.515  1.00 67.25           C  
ATOM   8284  CG  ARG D  30      21.785  66.936  12.553  1.00 67.32           C  
ATOM   8285  CD  ARG D  30      21.989  66.155  13.843  1.00 67.06           C  
ATOM   8286  NE  ARG D  30      21.946  66.998  15.033  1.00 64.97           N  
ATOM   8287  CZ  ARG D  30      22.270  66.582  16.252  1.00 65.69           C  
ATOM   8288  NH1 ARG D  30      22.670  65.335  16.449  1.00 68.65           N  
ATOM   8289  NH2 ARG D  30      22.184  67.405  17.283  1.00 69.71           N  
ATOM   8290  N   LYS D  31      21.280  70.765  11.392  1.00 61.53           N  
ATOM   8291  CA  LYS D  31      22.374  71.720  11.335  1.00 57.20           C  
ATOM   8292  C   LYS D  31      22.646  72.230  12.746  1.00 53.43           C  
ATOM   8293  O   LYS D  31      21.791  72.834  13.378  1.00 53.80           O  
ATOM   8294  CB  LYS D  31      22.052  72.875  10.380  1.00 59.69           C  
ATOM   8295  CG  LYS D  31      20.864  73.739  10.745  1.00 63.66           C  
ATOM   8296  CD  LYS D  31      20.588  74.744   9.633  1.00 66.14           C  
ATOM   8297  CE  LYS D  31      19.282  75.494   9.848  1.00 67.84           C  
ATOM   8298  NZ  LYS D  31      19.068  76.528   8.791  1.00 68.69           N  
ATOM   8299  N   GLU D  32      23.851  71.971  13.233  1.00 48.94           N  
ATOM   8300  CA  GLU D  32      24.241  72.371  14.573  1.00 45.85           C  
ATOM   8301  C   GLU D  32      24.615  73.845  14.706  1.00 42.56           C  
ATOM   8302  O   GLU D  32      24.994  74.499  13.749  1.00 41.36           O  
ATOM   8303  CB  GLU D  32      25.472  71.603  15.032  1.00 47.70           C  
ATOM   8304  CG  GLU D  32      25.520  70.117  14.838  1.00 49.19           C  
ATOM   8305  CD  GLU D  32      26.914  69.615  15.160  1.00 53.09           C  
ATOM   8306  OE1 GLU D  32      27.881  70.137  14.540  1.00 53.13           O  
ATOM   8307  OE2 GLU D  32      27.049  68.731  16.030  1.00 47.80           O  
ATOM   8308  N   SER D  33      24.545  74.340  15.932  1.00 39.55           N  
ATOM   8309  CA  SER D  33      24.955  75.702  16.222  1.00 39.43           C  
ATOM   8310  C   SER D  33      25.231  75.756  17.715  1.00 36.12           C  
ATOM   8311  O   SER D  33      24.785  74.899  18.470  1.00 32.53           O  
ATOM   8312  CB  SER D  33      23.882  76.711  15.828  1.00 38.82           C  
ATOM   8313  OG  SER D  33      23.214  77.243  16.951  1.00 42.06           O  
ATOM   8314  N   TYR D  34      26.000  76.743  18.128  1.00 32.16           N  
ATOM   8315  CA  TYR D  34      26.324  76.898  19.531  1.00 29.39           C  
ATOM   8316  C   TYR D  34      25.215  77.670  20.271  1.00 28.14           C  
ATOM   8317  O   TYR D  34      25.331  77.952  21.468  1.00 27.61           O  
ATOM   8318  CB  TYR D  34      27.643  77.634  19.672  1.00 27.00           C  
ATOM   8319  CG  TYR D  34      28.828  76.812  19.271  1.00 29.57           C  
ATOM   8320  CD1 TYR D  34      29.397  76.946  18.006  1.00 30.12           C  
ATOM   8321  CD2 TYR D  34      29.412  75.910  20.165  1.00 31.69           C  
ATOM   8322  CE1 TYR D  34      30.534  76.213  17.644  1.00 28.21           C  
ATOM   8323  CE2 TYR D  34      30.554  75.163  19.803  1.00 32.09           C  
ATOM   8324  CZ  TYR D  34      31.103  75.335  18.539  1.00 30.55           C  
ATOM   8325  OH  TYR D  34      32.237  74.643  18.171  1.00 27.80           O  
ATOM   8326  N   ALA D  35      24.143  77.994  19.558  1.00 25.41           N  
ATOM   8327  CA  ALA D  35      23.057  78.771  20.124  1.00 29.78           C  
ATOM   8328  C   ALA D  35      22.632  78.451  21.580  1.00 30.78           C  
ATOM   8329  O   ALA D  35      22.625  79.357  22.422  1.00 31.72           O  
ATOM   8330  CB  ALA D  35      21.840  78.720  19.193  1.00 28.12           C  
ATOM   8331  N   ILE D  36      22.297  77.198  21.887  1.00 30.68           N  
ATOM   8332  CA  ILE D  36      21.843  76.873  23.253  1.00 31.87           C  
ATOM   8333  C   ILE D  36      22.918  77.101  24.308  1.00 29.86           C  
ATOM   8334  O   ILE D  36      22.606  77.424  25.454  1.00 31.50           O  
ATOM   8335  CB  ILE D  36      21.297  75.401  23.385  1.00 36.03           C  
ATOM   8336  CG1 ILE D  36      22.403  74.386  23.142  1.00 40.62           C  
ATOM   8337  CG2 ILE D  36      20.181  75.157  22.403  1.00 33.93           C  
ATOM   8338  CD1 ILE D  36      21.942  72.916  23.411  1.00 43.36           C  
ATOM   8339  N   TYR D  37      24.182  76.958  23.928  1.00 26.60           N  
ATOM   8340  CA  TYR D  37      25.263  77.170  24.876  1.00 27.75           C  
ATOM   8341  C   TYR D  37      25.514  78.657  25.032  1.00 30.85           C  
ATOM   8342  O   TYR D  37      25.872  79.131  26.130  1.00 29.49           O  
ATOM   8343  CB  TYR D  37      26.527  76.461  24.411  1.00 27.02           C  
ATOM   8344  CG  TYR D  37      26.269  75.022  24.010  1.00 30.70           C  
ATOM   8345  CD1 TYR D  37      26.278  74.649  22.661  1.00 34.99           C  
ATOM   8346  CD2 TYR D  37      25.951  74.054  24.958  1.00 30.08           C  
ATOM   8347  CE1 TYR D  37      25.972  73.360  22.263  1.00 34.13           C  
ATOM   8348  CE2 TYR D  37      25.638  72.736  24.566  1.00 34.44           C  
ATOM   8349  CZ  TYR D  37      25.649  72.410  23.215  1.00 39.66           C  
ATOM   8350  OH  TYR D  37      25.307  71.151  22.789  1.00 42.81           O  
ATOM   8351  N   VAL D  38      25.338  79.408  23.942  1.00 25.69           N  
ATOM   8352  CA  VAL D  38      25.516  80.857  24.029  1.00 24.42           C  
ATOM   8353  C   VAL D  38      24.417  81.365  24.963  1.00 26.35           C  
ATOM   8354  O   VAL D  38      24.656  82.206  25.810  1.00 25.46           O  
ATOM   8355  CB  VAL D  38      25.371  81.530  22.621  1.00 23.93           C  
ATOM   8356  CG1 VAL D  38      25.181  83.020  22.771  1.00 23.24           C  
ATOM   8357  CG2 VAL D  38      26.627  81.219  21.783  1.00 23.91           C  
ATOM   8358  N   TYR D  39      23.212  80.832  24.796  1.00 28.54           N  
ATOM   8359  CA  TYR D  39      22.067  81.243  25.605  1.00 29.56           C  
ATOM   8360  C   TYR D  39      22.301  80.940  27.101  1.00 28.76           C  
ATOM   8361  O   TYR D  39      22.008  81.769  27.953  1.00 31.19           O  
ATOM   8362  CB  TYR D  39      20.792  80.547  25.127  1.00 33.05           C  
ATOM   8363  CG  TYR D  39      19.571  81.372  25.435  1.00 40.04           C  
ATOM   8364  CD1 TYR D  39      19.326  82.535  24.725  1.00 43.19           C  
ATOM   8365  CD2 TYR D  39      18.779  81.101  26.558  1.00 45.74           C  
ATOM   8366  CE1 TYR D  39      18.356  83.435  25.118  1.00 50.44           C  
ATOM   8367  CE2 TYR D  39      17.781  82.007  26.974  1.00 48.86           C  
ATOM   8368  CZ  TYR D  39      17.591  83.177  26.243  1.00 52.25           C  
ATOM   8369  OH  TYR D  39      16.686  84.132  26.637  1.00 57.47           O  
ATOM   8370  N   LYS D  40      22.858  79.774  27.402  1.00 28.76           N  
ATOM   8371  CA  LYS D  40      23.133  79.406  28.791  1.00 31.02           C  
ATOM   8372  C   LYS D  40      24.098  80.396  29.407  1.00 33.15           C  
ATOM   8373  O   LYS D  40      23.922  80.871  30.547  1.00 29.73           O  
ATOM   8374  CB  LYS D  40      23.716  77.999  28.855  1.00 31.42           C  
ATOM   8375  CG  LYS D  40      22.680  76.923  28.628  1.00 32.93           C  
ATOM   8376  CD  LYS D  40      23.297  75.514  28.752  1.00 39.43           C  
ATOM   8377  CE  LYS D  40      22.223  74.458  28.491  1.00 44.56           C  
ATOM   8378  NZ  LYS D  40      22.717  73.050  28.602  1.00 51.44           N  
ATOM   8379  N   VAL D  41      25.123  80.745  28.646  1.00 30.13           N  
ATOM   8380  CA  VAL D  41      26.086  81.697  29.161  1.00 25.00           C  
ATOM   8381  C   VAL D  41      25.435  83.059  29.266  1.00 26.84           C  
ATOM   8382  O   VAL D  41      25.633  83.779  30.252  1.00 26.16           O  
ATOM   8383  CB  VAL D  41      27.339  81.731  28.263  1.00 27.74           C  
ATOM   8384  CG1 VAL D  41      28.303  82.786  28.750  1.00 22.47           C  
ATOM   8385  CG2 VAL D  41      28.001  80.331  28.290  1.00 23.74           C  
ATOM   8386  N   LEU D  42      24.636  83.440  28.274  1.00 23.80           N  
ATOM   8387  CA  LEU D  42      23.976  84.752  28.377  1.00 23.68           C  
ATOM   8388  C   LEU D  42      23.212  84.847  29.734  1.00 26.07           C  
ATOM   8389  O   LEU D  42      23.302  85.846  30.458  1.00 24.13           O  
ATOM   8390  CB  LEU D  42      22.960  84.945  27.250  1.00 20.31           C  
ATOM   8391  CG  LEU D  42      22.095  86.202  27.352  1.00 25.43           C  
ATOM   8392  CD1 LEU D  42      22.955  87.437  27.538  1.00 21.67           C  
ATOM   8393  CD2 LEU D  42      21.235  86.328  26.116  1.00 23.18           C  
ATOM   8394  N   LYS D  43      22.482  83.793  30.048  1.00 28.24           N  
ATOM   8395  CA  LYS D  43      21.680  83.739  31.271  1.00 33.98           C  
ATOM   8396  C   LYS D  43      22.530  83.817  32.515  1.00 32.98           C  
ATOM   8397  O   LYS D  43      22.088  84.365  33.526  1.00 33.72           O  
ATOM   8398  CB  LYS D  43      20.787  82.488  31.285  1.00 37.48           C  
ATOM   8399  CG  LYS D  43      19.622  82.572  30.258  1.00 37.58           C  
ATOM   8400  CD  LYS D  43      19.159  84.032  30.165  1.00 44.06           C  
ATOM   8401  CE  LYS D  43      17.866  84.224  29.402  1.00 46.84           C  
ATOM   8402  NZ  LYS D  43      17.405  85.653  29.521  1.00 43.55           N  
ATOM   8403  N   GLN D  44      23.769  83.354  32.449  1.00 29.53           N  
ATOM   8404  CA  GLN D  44      24.619  83.462  33.637  1.00 28.23           C  
ATOM   8405  C   GLN D  44      25.099  84.897  33.886  1.00 28.09           C  
ATOM   8406  O   GLN D  44      25.149  85.379  35.032  1.00 25.56           O  
ATOM   8407  CB  GLN D  44      25.840  82.555  33.513  1.00 25.91           C  
ATOM   8408  CG  GLN D  44      25.562  81.055  33.518  1.00 31.16           C  
ATOM   8409  CD  GLN D  44      26.854  80.236  33.395  1.00 31.73           C  
ATOM   8410  OE1 GLN D  44      27.723  80.558  32.572  1.00 38.07           O  
ATOM   8411  NE2 GLN D  44      26.985  79.182  34.202  1.00 27.72           N  
ATOM   8412  N   VAL D  45      25.422  85.619  32.814  1.00 23.14           N  
ATOM   8413  CA  VAL D  45      25.940  86.954  33.002  1.00 21.01           C  
ATOM   8414  C   VAL D  45      24.937  88.085  33.164  1.00 21.13           C  
ATOM   8415  O   VAL D  45      25.169  89.047  33.980  1.00 26.29           O  
ATOM   8416  CB  VAL D  45      26.907  87.341  31.871  1.00 25.10           C  
ATOM   8417  CG1 VAL D  45      28.084  86.299  31.823  1.00 25.01           C  
ATOM   8418  CG2 VAL D  45      26.159  87.314  30.482  1.00 22.43           C  
ATOM   8419  N   HIS D  46      23.835  87.920  32.447  1.00 22.13           N  
ATOM   8420  CA  HIS D  46      22.712  88.865  32.338  1.00 24.70           C  
ATOM   8421  C   HIS D  46      21.395  88.091  32.317  1.00 25.82           C  
ATOM   8422  O   HIS D  46      20.736  87.955  31.267  1.00 26.82           O  
ATOM   8423  CB  HIS D  46      22.849  89.660  31.039  1.00 22.93           C  
ATOM   8424  CG  HIS D  46      23.997  90.619  31.053  1.00 26.31           C  
ATOM   8425  ND1 HIS D  46      24.166  91.553  32.062  1.00 23.41           N  
ATOM   8426  CD2 HIS D  46      24.930  90.905  30.109  1.00 25.87           C  
ATOM   8427  CE1 HIS D  46      25.138  92.384  31.730  1.00 27.01           C  
ATOM   8428  NE2 HIS D  46      25.616  92.016  30.546  1.00 29.16           N  
ATOM   8429  N   PRO D  47      20.959  87.622  33.499  1.00 27.73           N  
ATOM   8430  CA  PRO D  47      19.731  86.840  33.703  1.00 27.54           C  
ATOM   8431  C   PRO D  47      18.459  87.279  33.018  1.00 24.29           C  
ATOM   8432  O   PRO D  47      17.685  86.449  32.576  1.00 26.29           O  
ATOM   8433  CB  PRO D  47      19.567  86.818  35.236  1.00 27.32           C  
ATOM   8434  CG  PRO D  47      20.974  86.891  35.719  1.00 29.14           C  
ATOM   8435  CD  PRO D  47      21.618  87.944  34.793  1.00 21.62           C  
ATOM   8436  N   ASP D  48      18.236  88.573  32.926  1.00 26.19           N  
ATOM   8437  CA  ASP D  48      17.008  89.076  32.327  1.00 28.39           C  
ATOM   8438  C   ASP D  48      17.206  89.707  30.945  1.00 29.11           C  
ATOM   8439  O   ASP D  48      16.380  90.501  30.503  1.00 26.88           O  
ATOM   8440  CB  ASP D  48      16.385  90.127  33.245  1.00 31.25           C  
ATOM   8441  CG  ASP D  48      16.180  89.606  34.663  1.00 38.02           C  
ATOM   8442  OD1 ASP D  48      15.701  88.473  34.800  1.00 37.02           O  
ATOM   8443  OD2 ASP D  48      16.507  90.329  35.626  1.00 42.01           O  
ATOM   8444  N   THR D  49      18.296  89.361  30.278  1.00 28.92           N  
ATOM   8445  CA  THR D  49      18.596  89.933  28.961  1.00 25.64           C  
ATOM   8446  C   THR D  49      18.424  88.834  27.903  1.00 25.00           C  
ATOM   8447  O   THR D  49      18.858  87.698  28.095  1.00 26.29           O  
ATOM   8448  CB  THR D  49      20.059  90.440  28.941  1.00 28.76           C  
ATOM   8449  OG1 THR D  49      20.218  91.476  29.920  1.00 28.08           O  
ATOM   8450  CG2 THR D  49      20.478  90.970  27.515  1.00 23.38           C  
ATOM   8451  N   GLY D  50      17.743  89.149  26.814  1.00 25.90           N  
ATOM   8452  CA  GLY D  50      17.611  88.167  25.747  1.00 25.88           C  
ATOM   8453  C   GLY D  50      18.570  88.498  24.566  1.00 25.98           C  
ATOM   8454  O   GLY D  50      19.425  89.389  24.673  1.00 23.66           O  
ATOM   8455  N   ILE D  51      18.425  87.810  23.444  1.00 27.35           N  
ATOM   8456  CA  ILE D  51      19.278  88.072  22.268  1.00 29.10           C  
ATOM   8457  C   ILE D  51      18.433  87.783  20.993  1.00 29.81           C  
ATOM   8458  O   ILE D  51      17.671  86.827  20.960  1.00 26.78           O  
ATOM   8459  CB  ILE D  51      20.575  87.224  22.367  1.00 28.71           C  
ATOM   8460  CG1 ILE D  51      21.481  87.434  21.146  1.00 28.40           C  
ATOM   8461  CG2 ILE D  51      20.218  85.718  22.575  1.00 26.75           C  
ATOM   8462  CD1 ILE D  51      22.865  86.738  21.320  1.00 23.07           C  
ATOM   8463  N   SER D  52      18.514  88.666  19.997  1.00 26.77           N  
ATOM   8464  CA  SER D  52      17.738  88.521  18.772  1.00 27.29           C  
ATOM   8465  C   SER D  52      18.368  87.403  17.972  1.00 30.37           C  
ATOM   8466  O   SER D  52      19.494  86.991  18.278  1.00 26.85           O  
ATOM   8467  CB  SER D  52      17.740  89.830  17.983  1.00 26.64           C  
ATOM   8468  OG  SER D  52      18.957  90.028  17.277  1.00 29.04           O  
ATOM   8469  N   SER D  53      17.652  86.888  16.972  1.00 28.48           N  
ATOM   8470  CA  SER D  53      18.203  85.799  16.194  1.00 29.81           C  
ATOM   8471  C   SER D  53      19.420  86.281  15.387  1.00 28.81           C  
ATOM   8472  O   SER D  53      20.397  85.543  15.244  1.00 27.69           O  
ATOM   8473  CB  SER D  53      17.132  85.189  15.260  1.00 31.35           C  
ATOM   8474  OG  SER D  53      16.654  86.168  14.356  1.00 35.25           O  
ATOM   8475  N   LYS D  54      19.389  87.513  14.886  1.00 26.88           N  
ATOM   8476  CA  LYS D  54      20.534  87.984  14.093  1.00 26.88           C  
ATOM   8477  C   LYS D  54      21.780  88.107  14.969  1.00 25.46           C  
ATOM   8478  O   LYS D  54      22.892  87.791  14.519  1.00 25.81           O  
ATOM   8479  CB  LYS D  54      20.202  89.315  13.436  1.00 31.54           C  
ATOM   8480  CG  LYS D  54      19.072  89.202  12.425  1.00 38.51           C  
ATOM   8481  CD  LYS D  54      18.716  90.551  11.848  1.00 45.20           C  
ATOM   8482  CE  LYS D  54      17.706  90.422  10.712  1.00 46.87           C  
ATOM   8483  NZ  LYS D  54      17.250  91.769  10.267  1.00 57.57           N  
ATOM   8484  N   ALA D  55      21.608  88.547  16.232  1.00 25.75           N  
ATOM   8485  CA  ALA D  55      22.763  88.646  17.147  1.00 20.41           C  
ATOM   8486  C   ALA D  55      23.240  87.265  17.489  1.00 20.23           C  
ATOM   8487  O   ALA D  55      24.440  87.054  17.629  1.00 23.04           O  
ATOM   8488  CB  ALA D  55      22.406  89.395  18.476  1.00 20.12           C  
ATOM   8489  N   MET D  56      22.321  86.307  17.638  1.00 20.63           N  
ATOM   8490  CA  MET D  56      22.732  84.935  17.951  1.00 20.51           C  
ATOM   8491  C   MET D  56      23.493  84.388  16.736  1.00 23.11           C  
ATOM   8492  O   MET D  56      24.452  83.633  16.884  1.00 24.65           O  
ATOM   8493  CB  MET D  56      21.515  84.029  18.252  1.00 21.71           C  
ATOM   8494  CG  MET D  56      21.895  82.595  18.582  1.00 23.61           C  
ATOM   8495  SD  MET D  56      23.017  82.468  19.993  1.00 29.00           S  
ATOM   8496  CE  MET D  56      21.734  82.270  21.412  1.00 28.84           C  
ATOM   8497  N   SER D  57      23.081  84.781  15.542  1.00 19.14           N  
ATOM   8498  CA  SER D  57      23.804  84.302  14.361  1.00 26.01           C  
ATOM   8499  C   SER D  57      25.224  84.878  14.385  1.00 22.02           C  
ATOM   8500  O   SER D  57      26.204  84.188  14.069  1.00 26.39           O  
ATOM   8501  CB  SER D  57      23.086  84.713  13.065  1.00 26.57           C  
ATOM   8502  OG  SER D  57      23.761  84.069  11.985  1.00 34.08           O  
ATOM   8503  N   ILE D  58      25.343  86.137  14.782  1.00 20.27           N  
ATOM   8504  CA  ILE D  58      26.658  86.732  14.891  1.00 21.28           C  
ATOM   8505  C   ILE D  58      27.481  85.984  15.974  1.00 22.61           C  
ATOM   8506  O   ILE D  58      28.673  85.684  15.761  1.00 20.92           O  
ATOM   8507  CB  ILE D  58      26.531  88.202  15.215  1.00 22.49           C  
ATOM   8508  CG1 ILE D  58      26.015  88.945  13.964  1.00 28.92           C  
ATOM   8509  CG2 ILE D  58      27.904  88.787  15.637  1.00 17.14           C  
ATOM   8510  CD1 ILE D  58      25.346  90.213  14.306  1.00 30.29           C  
ATOM   8511  N   MET D  59      26.851  85.652  17.114  1.00 18.74           N  
ATOM   8512  CA  MET D  59      27.579  84.932  18.155  1.00 21.16           C  
ATOM   8513  C   MET D  59      27.998  83.539  17.644  1.00 21.85           C  
ATOM   8514  O   MET D  59      29.060  83.063  17.993  1.00 19.55           O  
ATOM   8515  CB  MET D  59      26.726  84.777  19.444  1.00 21.63           C  
ATOM   8516  CG  MET D  59      26.486  86.099  20.189  1.00 18.52           C  
ATOM   8517  SD  MET D  59      28.017  86.824  20.702  1.00 25.36           S  
ATOM   8518  CE  MET D  59      28.727  85.488  21.665  1.00 24.42           C  
ATOM   8519  N   ASN D  60      27.143  82.872  16.864  1.00 21.31           N  
ATOM   8520  CA  ASN D  60      27.513  81.567  16.352  1.00 22.67           C  
ATOM   8521  C   ASN D  60      28.716  81.704  15.390  1.00 22.16           C  
ATOM   8522  O   ASN D  60      29.599  80.846  15.389  1.00 24.27           O  
ATOM   8523  CB  ASN D  60      26.315  80.900  15.648  1.00 26.60           C  
ATOM   8524  CG  ASN D  60      26.570  79.418  15.372  1.00 35.43           C  
ATOM   8525  OD1 ASN D  60      26.886  78.662  16.292  1.00 34.44           O  
ATOM   8526  ND2 ASN D  60      26.464  79.007  14.101  1.00 30.67           N  
ATOM   8527  N   SER D  61      28.743  82.770  14.572  1.00 24.71           N  
ATOM   8528  CA  SER D  61      29.881  83.027  13.635  1.00 25.61           C  
ATOM   8529  C   SER D  61      31.151  83.265  14.456  1.00 24.77           C  
ATOM   8530  O   SER D  61      32.234  82.811  14.102  1.00 24.41           O  
ATOM   8531  CB  SER D  61      29.644  84.303  12.819  1.00 23.25           C  
ATOM   8532  OG  SER D  61      28.718  84.092  11.771  1.00 23.16           O  
ATOM   8533  N   PHE D  62      30.998  84.006  15.561  1.00 23.74           N  
ATOM   8534  CA  PHE D  62      32.139  84.337  16.411  1.00 22.78           C  
ATOM   8535  C   PHE D  62      32.715  83.061  16.982  1.00 21.87           C  
ATOM   8536  O   PHE D  62      33.892  82.787  16.826  1.00 23.31           O  
ATOM   8537  CB  PHE D  62      31.690  85.288  17.542  1.00 26.02           C  
ATOM   8538  CG  PHE D  62      32.728  85.497  18.612  1.00 26.23           C  
ATOM   8539  CD1 PHE D  62      33.900  86.189  18.337  1.00 25.04           C  
ATOM   8540  CD2 PHE D  62      32.509  85.002  19.910  1.00 29.29           C  
ATOM   8541  CE1 PHE D  62      34.867  86.393  19.339  1.00 31.34           C  
ATOM   8542  CE2 PHE D  62      33.462  85.200  20.923  1.00 31.52           C  
ATOM   8543  CZ  PHE D  62      34.653  85.900  20.631  1.00 27.66           C  
ATOM   8544  N   VAL D  63      31.881  82.243  17.615  1.00 21.76           N  
ATOM   8545  CA  VAL D  63      32.426  81.024  18.182  1.00 20.80           C  
ATOM   8546  C   VAL D  63      33.118  80.146  17.115  1.00 22.62           C  
ATOM   8547  O   VAL D  63      34.214  79.686  17.336  1.00 21.86           O  
ATOM   8548  CB  VAL D  63      31.349  80.221  18.926  1.00 20.57           C  
ATOM   8549  CG1 VAL D  63      31.974  78.936  19.458  1.00 20.14           C  
ATOM   8550  CG2 VAL D  63      30.808  81.064  20.124  1.00 18.87           C  
ATOM   8551  N   ASN D  64      32.485  79.929  15.965  1.00 23.01           N  
ATOM   8552  CA  ASN D  64      33.097  79.135  14.896  1.00 22.74           C  
ATOM   8553  C   ASN D  64      34.392  79.741  14.404  1.00 19.01           C  
ATOM   8554  O   ASN D  64      35.352  79.030  14.104  1.00 22.29           O  
ATOM   8555  CB  ASN D  64      32.150  79.019  13.697  1.00 25.29           C  
ATOM   8556  CG  ASN D  64      31.013  78.051  13.960  1.00 31.28           C  
ATOM   8557  OD1 ASN D  64      31.237  76.973  14.503  1.00 32.91           O  
ATOM   8558  ND2 ASN D  64      29.790  78.418  13.563  1.00 35.41           N  
ATOM   8559  N   ASP D  65      34.403  81.064  14.301  1.00 21.91           N  
ATOM   8560  CA  ASP D  65      35.575  81.787  13.834  1.00 24.25           C  
ATOM   8561  C   ASP D  65      36.771  81.545  14.784  1.00 26.03           C  
ATOM   8562  O   ASP D  65      37.860  81.117  14.345  1.00 23.29           O  
ATOM   8563  CB  ASP D  65      35.229  83.277  13.741  1.00 24.78           C  
ATOM   8564  CG  ASP D  65      36.369  84.103  13.153  1.00 26.79           C  
ATOM   8565  OD1 ASP D  65      37.153  83.516  12.392  1.00 33.94           O  
ATOM   8566  OD2 ASP D  65      36.478  85.326  13.418  1.00 24.63           O  
ATOM   8567  N   VAL D  66      36.557  81.780  16.089  1.00 22.25           N  
ATOM   8568  CA  VAL D  66      37.625  81.594  17.069  1.00 20.53           C  
ATOM   8569  C   VAL D  66      37.993  80.114  17.156  1.00 20.81           C  
ATOM   8570  O   VAL D  66      39.154  79.770  17.287  1.00 22.68           O  
ATOM   8571  CB  VAL D  66      37.185  82.142  18.467  1.00 24.40           C  
ATOM   8572  CG1 VAL D  66      38.256  81.866  19.485  1.00 25.56           C  
ATOM   8573  CG2 VAL D  66      36.884  83.683  18.353  1.00 23.01           C  
ATOM   8574  N   PHE D  67      37.009  79.221  17.090  1.00 19.96           N  
ATOM   8575  CA  PHE D  67      37.342  77.796  17.117  1.00 21.97           C  
ATOM   8576  C   PHE D  67      38.345  77.516  15.964  1.00 23.56           C  
ATOM   8577  O   PHE D  67      39.435  76.951  16.170  1.00 23.68           O  
ATOM   8578  CB  PHE D  67      36.060  76.977  16.891  1.00 23.17           C  
ATOM   8579  CG  PHE D  67      36.299  75.496  16.690  1.00 27.93           C  
ATOM   8580  CD1 PHE D  67      36.204  74.610  17.749  1.00 32.39           C  
ATOM   8581  CD2 PHE D  67      36.648  75.000  15.434  1.00 32.96           C  
ATOM   8582  CE1 PHE D  67      36.457  73.246  17.575  1.00 32.74           C  
ATOM   8583  CE2 PHE D  67      36.903  73.647  15.240  1.00 35.88           C  
ATOM   8584  CZ  PHE D  67      36.809  72.760  16.322  1.00 33.09           C  
ATOM   8585  N   GLU D  68      37.981  77.906  14.747  1.00 24.21           N  
ATOM   8586  CA  GLU D  68      38.861  77.652  13.584  1.00 26.46           C  
ATOM   8587  C   GLU D  68      40.220  78.311  13.751  1.00 25.16           C  
ATOM   8588  O   GLU D  68      41.242  77.727  13.430  1.00 26.48           O  
ATOM   8589  CB  GLU D  68      38.250  78.211  12.288  1.00 29.46           C  
ATOM   8590  CG  GLU D  68      36.858  77.746  11.909  1.00 42.85           C  
ATOM   8591  CD  GLU D  68      36.253  78.669  10.842  1.00 49.38           C  
ATOM   8592  OE1 GLU D  68      36.903  78.871   9.798  1.00 55.15           O  
ATOM   8593  OE2 GLU D  68      35.152  79.210  11.051  1.00 54.50           O  
ATOM   8594  N   ARG D  69      40.233  79.547  14.237  1.00 24.70           N  
ATOM   8595  CA  ARG D  69      41.504  80.230  14.391  1.00 23.62           C  
ATOM   8596  C   ARG D  69      42.390  79.516  15.392  1.00 26.73           C  
ATOM   8597  O   ARG D  69      43.566  79.231  15.112  1.00 23.28           O  
ATOM   8598  CB  ARG D  69      41.296  81.674  14.824  1.00 25.42           C  
ATOM   8599  CG  ARG D  69      40.735  82.570  13.758  1.00 28.28           C  
ATOM   8600  CD  ARG D  69      40.998  84.026  14.207  1.00 33.34           C  
ATOM   8601  NE  ARG D  69      39.833  84.854  14.101  1.00 29.49           N  
ATOM   8602  CZ  ARG D  69      39.804  86.132  14.459  1.00 27.95           C  
ATOM   8603  NH1 ARG D  69      40.888  86.710  14.961  1.00 24.23           N  
ATOM   8604  NH2 ARG D  69      38.711  86.854  14.230  1.00 30.46           N  
ATOM   8605  N   ILE D  70      41.823  79.194  16.553  1.00 22.77           N  
ATOM   8606  CA  ILE D  70      42.622  78.502  17.549  1.00 21.89           C  
ATOM   8607  C   ILE D  70      43.035  77.107  17.034  1.00 25.17           C  
ATOM   8608  O   ILE D  70      44.182  76.714  17.195  1.00 26.96           O  
ATOM   8609  CB  ILE D  70      41.838  78.336  18.886  1.00 23.13           C  
ATOM   8610  CG1 ILE D  70      41.639  79.708  19.565  1.00 21.87           C  
ATOM   8611  CG2 ILE D  70      42.597  77.355  19.787  1.00 25.06           C  
ATOM   8612  CD1 ILE D  70      40.620  79.675  20.760  1.00 26.68           C  
ATOM   8613  N   ALA D  71      42.099  76.381  16.415  1.00 25.88           N  
ATOM   8614  CA  ALA D  71      42.390  75.020  15.927  1.00 26.10           C  
ATOM   8615  C   ALA D  71      43.463  75.047  14.851  1.00 24.44           C  
ATOM   8616  O   ALA D  71      44.344  74.222  14.858  1.00 24.92           O  
ATOM   8617  CB  ALA D  71      41.127  74.335  15.408  1.00 22.05           C  
ATOM   8618  N   GLY D  72      43.395  76.020  13.958  1.00 25.37           N  
ATOM   8619  CA  GLY D  72      44.396  76.145  12.907  1.00 26.66           C  
ATOM   8620  C   GLY D  72      45.774  76.483  13.469  1.00 29.31           C  
ATOM   8621  O   GLY D  72      46.779  75.931  13.017  1.00 28.41           O  
ATOM   8622  N   GLU D  73      45.836  77.414  14.426  1.00 28.36           N  
ATOM   8623  CA  GLU D  73      47.102  77.759  15.065  1.00 29.58           C  
ATOM   8624  C   GLU D  73      47.637  76.489  15.756  1.00 26.02           C  
ATOM   8625  O   GLU D  73      48.832  76.230  15.718  1.00 28.77           O  
ATOM   8626  CB  GLU D  73      46.911  78.840  16.144  1.00 30.16           C  
ATOM   8627  CG  GLU D  73      46.518  80.208  15.659  1.00 36.47           C  
ATOM   8628  CD  GLU D  73      47.672  81.003  15.083  1.00 37.35           C  
ATOM   8629  OE1 GLU D  73      48.847  80.587  15.213  1.00 37.68           O  
ATOM   8630  OE2 GLU D  73      47.396  82.059  14.490  1.00 38.18           O  
ATOM   8631  N   ALA D  74      46.752  75.710  16.389  1.00 25.20           N  
ATOM   8632  CA  ALA D  74      47.167  74.466  17.099  1.00 25.71           C  
ATOM   8633  C   ALA D  74      47.729  73.450  16.111  1.00 25.33           C  
ATOM   8634  O   ALA D  74      48.740  72.790  16.383  1.00 26.31           O  
ATOM   8635  CB  ALA D  74      45.955  73.832  17.852  1.00 26.12           C  
ATOM   8636  N   SER D  75      47.046  73.307  14.976  1.00 26.00           N  
ATOM   8637  CA  SER D  75      47.475  72.388  13.909  1.00 28.20           C  
ATOM   8638  C   SER D  75      48.886  72.686  13.393  1.00 30.26           C  
ATOM   8639  O   SER D  75      49.727  71.782  13.273  1.00 28.06           O  
ATOM   8640  CB  SER D  75      46.517  72.487  12.733  1.00 28.50           C  
ATOM   8641  OG  SER D  75      46.921  71.604  11.711  1.00 32.98           O  
ATOM   8642  N   ARG D  76      49.122  73.960  13.079  1.00 29.67           N  
ATOM   8643  CA  ARG D  76      50.409  74.418  12.559  1.00 31.71           C  
ATOM   8644  C   ARG D  76      51.442  74.173  13.628  1.00 33.42           C  
ATOM   8645  O   ARG D  76      52.518  73.618  13.362  1.00 33.52           O  
ATOM   8646  CB  ARG D  76      50.367  75.924  12.224  1.00 32.82           C  
ATOM   8647  CG  ARG D  76      49.610  76.292  10.936  1.00 33.38           C  
ATOM   8648  CD  ARG D  76      49.356  77.848  10.804  1.00 38.04           C  
ATOM   8649  NE  ARG D  76      47.982  78.001  10.348  1.00 46.26           N  
ATOM   8650  CZ  ARG D  76      47.039  78.716  10.940  1.00 43.68           C  
ATOM   8651  NH1 ARG D  76      47.288  79.410  12.036  1.00 48.26           N  
ATOM   8652  NH2 ARG D  76      45.810  78.665  10.459  1.00 51.89           N  
ATOM   8653  N   LEU D  77      51.108  74.581  14.849  1.00 30.75           N  
ATOM   8654  CA  LEU D  77      52.016  74.394  15.971  1.00 32.57           C  
ATOM   8655  C   LEU D  77      52.479  72.926  16.073  1.00 32.90           C  
ATOM   8656  O   LEU D  77      53.666  72.643  16.144  1.00 34.48           O  
ATOM   8657  CB  LEU D  77      51.327  74.806  17.271  1.00 31.63           C  
ATOM   8658  CG  LEU D  77      52.277  74.770  18.462  1.00 38.87           C  
ATOM   8659  CD1 LEU D  77      53.338  75.876  18.326  1.00 36.23           C  
ATOM   8660  CD2 LEU D  77      51.478  74.953  19.738  1.00 40.45           C  
ATOM   8661  N   ALA D  78      51.531  72.002  16.082  1.00 31.70           N  
ATOM   8662  CA  ALA D  78      51.853  70.594  16.165  1.00 34.03           C  
ATOM   8663  C   ALA D  78      52.706  70.187  14.957  1.00 34.69           C  
ATOM   8664  O   ALA D  78      53.660  69.432  15.094  1.00 36.28           O  
ATOM   8665  CB  ALA D  78      50.554  69.753  16.196  1.00 29.81           C  
ATOM   8666  N   HIS D  79      52.355  70.664  13.772  1.00 34.09           N  
ATOM   8667  CA  HIS D  79      53.123  70.274  12.594  1.00 36.47           C  
ATOM   8668  C   HIS D  79      54.536  70.793  12.705  1.00 35.37           C  
ATOM   8669  O   HIS D  79      55.476  70.037  12.510  1.00 38.98           O  
ATOM   8670  CB  HIS D  79      52.449  70.754  11.298  1.00 38.51           C  
ATOM   8671  CG  HIS D  79      51.313  69.883  10.856  1.00 45.37           C  
ATOM   8672  ND1 HIS D  79      51.487  68.560  10.502  1.00 54.67           N  
ATOM   8673  CD2 HIS D  79      49.986  70.128  10.740  1.00 49.06           C  
ATOM   8674  CE1 HIS D  79      50.315  68.029  10.192  1.00 52.24           C  
ATOM   8675  NE2 HIS D  79      49.387  68.958  10.330  1.00 50.31           N  
ATOM   8676  N   TYR D  80      54.686  72.069  13.051  1.00 33.74           N  
ATOM   8677  CA  TYR D  80      56.005  72.676  13.217  1.00 36.11           C  
ATOM   8678  C   TYR D  80      56.876  71.838  14.164  1.00 37.83           C  
ATOM   8679  O   TYR D  80      58.095  71.774  14.005  1.00 38.44           O  
ATOM   8680  CB  TYR D  80      55.887  74.101  13.810  1.00 36.02           C  
ATOM   8681  CG  TYR D  80      55.143  75.119  12.959  1.00 40.69           C  
ATOM   8682  CD1 TYR D  80      54.775  76.351  13.496  1.00 40.98           C  
ATOM   8683  CD2 TYR D  80      54.831  74.867  11.618  1.00 40.97           C  
ATOM   8684  CE1 TYR D  80      54.121  77.310  12.728  1.00 43.64           C  
ATOM   8685  CE2 TYR D  80      54.171  75.828  10.834  1.00 45.11           C  
ATOM   8686  CZ  TYR D  80      53.821  77.051  11.405  1.00 46.73           C  
ATOM   8687  OH  TYR D  80      53.189  78.029  10.658  1.00 48.89           O  
ATOM   8688  N   ASN D  81      56.260  71.223  15.169  1.00 37.33           N  
ATOM   8689  CA  ASN D  81      57.006  70.409  16.133  1.00 38.45           C  
ATOM   8690  C   ASN D  81      56.956  68.916  15.846  1.00 37.32           C  
ATOM   8691  O   ASN D  81      57.256  68.086  16.715  1.00 38.36           O  
ATOM   8692  CB  ASN D  81      56.494  70.689  17.538  1.00 35.51           C  
ATOM   8693  CG  ASN D  81      56.932  72.033  18.028  1.00 38.83           C  
ATOM   8694  OD1 ASN D  81      58.108  72.232  18.306  1.00 37.40           O  
ATOM   8695  ND2 ASN D  81      56.000  72.984  18.108  1.00 37.22           N  
ATOM   8696  N   LYS D  82      56.564  68.574  14.627  1.00 37.68           N  
ATOM   8697  CA  LYS D  82      56.496  67.174  14.226  1.00 41.31           C  
ATOM   8698  C   LYS D  82      55.722  66.291  15.198  1.00 41.63           C  
ATOM   8699  O   LYS D  82      56.144  65.189  15.500  1.00 41.30           O  
ATOM   8700  CB  LYS D  82      57.914  66.635  14.037  1.00 42.03           C  
ATOM   8701  CG  LYS D  82      58.594  67.230  12.816  1.00 48.68           C  
ATOM   8702  CD  LYS D  82      60.079  66.954  12.798  1.00 56.10           C  
ATOM   8703  CE  LYS D  82      60.759  67.797  11.734  1.00 57.21           C  
ATOM   8704  NZ  LYS D  82      62.239  67.692  11.835  1.00 65.01           N  
ATOM   8705  N   ARG D  83      54.588  66.789  15.678  1.00 41.52           N  
ATOM   8706  CA  ARG D  83      53.726  66.057  16.595  1.00 41.59           C  
ATOM   8707  C   ARG D  83      52.443  65.735  15.870  1.00 41.63           C  
ATOM   8708  O   ARG D  83      51.870  66.595  15.207  1.00 41.66           O  
ATOM   8709  CB  ARG D  83      53.393  66.907  17.825  1.00 43.64           C  
ATOM   8710  CG  ARG D  83      54.555  67.076  18.785  1.00 51.71           C  
ATOM   8711  CD  ARG D  83      54.873  65.774  19.495  1.00 56.97           C  
ATOM   8712  NE  ARG D  83      56.085  65.884  20.298  1.00 62.82           N  
ATOM   8713  CZ  ARG D  83      57.309  65.909  19.788  1.00 65.84           C  
ATOM   8714  NH1 ARG D  83      57.474  65.824  18.476  1.00 70.99           N  
ATOM   8715  NH2 ARG D  83      58.362  66.033  20.583  1.00 69.25           N  
ATOM   8716  N   SER D  84      51.967  64.509  16.004  1.00 37.27           N  
ATOM   8717  CA  SER D  84      50.733  64.137  15.349  1.00 36.68           C  
ATOM   8718  C   SER D  84      49.526  64.342  16.285  1.00 34.20           C  
ATOM   8719  O   SER D  84      48.389  64.062  15.905  1.00 33.19           O  
ATOM   8720  CB  SER D  84      50.815  62.671  14.927  1.00 40.47           C  
ATOM   8721  OG  SER D  84      51.068  61.866  16.059  1.00 40.97           O  
ATOM   8722  N   THR D  85      49.775  64.830  17.500  1.00 32.46           N  
ATOM   8723  CA  THR D  85      48.684  65.034  18.460  1.00 31.84           C  
ATOM   8724  C   THR D  85      48.437  66.476  18.905  1.00 30.94           C  
ATOM   8725  O   THR D  85      49.358  67.194  19.284  1.00 31.27           O  
ATOM   8726  CB  THR D  85      48.909  64.232  19.774  1.00 34.00           C  
ATOM   8727  OG1 THR D  85      49.382  62.921  19.463  1.00 37.99           O  
ATOM   8728  CG2 THR D  85      47.569  64.076  20.537  1.00 34.48           C  
ATOM   8729  N   ILE D  86      47.189  66.903  18.867  1.00 30.27           N  
ATOM   8730  CA  ILE D  86      46.892  68.233  19.372  1.00 28.22           C  
ATOM   8731  C   ILE D  86      46.386  67.981  20.790  1.00 28.62           C  
ATOM   8732  O   ILE D  86      45.327  67.378  20.973  1.00 29.84           O  
ATOM   8733  CB  ILE D  86      45.792  68.938  18.557  1.00 28.26           C  
ATOM   8734  CG1 ILE D  86      46.405  69.480  17.241  1.00 30.27           C  
ATOM   8735  CG2 ILE D  86      45.207  70.102  19.373  1.00 27.21           C  
ATOM   8736  CD1 ILE D  86      45.381  70.141  16.293  1.00 28.79           C  
ATOM   8737  N   THR D  87      47.158  68.406  21.774  1.00 26.22           N  
ATOM   8738  CA  THR D  87      46.765  68.252  23.175  1.00 28.81           C  
ATOM   8739  C   THR D  87      46.397  69.629  23.727  1.00 30.64           C  
ATOM   8740  O   THR D  87      46.505  70.643  23.032  1.00 30.18           O  
ATOM   8741  CB  THR D  87      47.910  67.719  24.021  1.00 30.56           C  
ATOM   8742  OG1 THR D  87      48.911  68.736  24.132  1.00 28.32           O  
ATOM   8743  CG2 THR D  87      48.527  66.470  23.366  1.00 29.51           C  
ATOM   8744  N   SER D  88      45.978  69.675  24.984  1.00 28.53           N  
ATOM   8745  CA  SER D  88      45.591  70.936  25.568  1.00 28.31           C  
ATOM   8746  C   SER D  88      46.762  71.887  25.569  1.00 29.47           C  
ATOM   8747  O   SER D  88      46.580  73.114  25.592  1.00 30.96           O  
ATOM   8748  CB  SER D  88      45.045  70.726  26.987  1.00 29.46           C  
ATOM   8749  OG  SER D  88      46.051  70.205  27.793  1.00 30.30           O  
ATOM   8750  N   ARG D  89      47.972  71.343  25.527  1.00 28.50           N  
ATOM   8751  CA  ARG D  89      49.155  72.201  25.492  1.00 28.95           C  
ATOM   8752  C   ARG D  89      49.251  72.999  24.160  1.00 30.12           C  
ATOM   8753  O   ARG D  89      49.716  74.140  24.151  1.00 28.46           O  
ATOM   8754  CB  ARG D  89      50.406  71.367  25.685  1.00 33.68           C  
ATOM   8755  CG  ARG D  89      51.635  72.213  25.960  1.00 39.79           C  
ATOM   8756  CD  ARG D  89      52.775  71.380  26.599  1.00 47.90           C  
ATOM   8757  NE  ARG D  89      53.908  72.255  26.894  1.00 44.75           N  
ATOM   8758  CZ  ARG D  89      54.809  72.626  25.994  1.00 44.02           C  
ATOM   8759  NH1 ARG D  89      54.716  72.176  24.756  1.00 39.88           N  
ATOM   8760  NH2 ARG D  89      55.772  73.481  26.320  1.00 44.88           N  
ATOM   8761  N   GLU D  90      48.841  72.399  23.043  1.00 29.27           N  
ATOM   8762  CA  GLU D  90      48.862  73.116  21.769  1.00 30.36           C  
ATOM   8763  C   GLU D  90      47.719  74.137  21.785  1.00 28.53           C  
ATOM   8764  O   GLU D  90      47.860  75.241  21.249  1.00 28.10           O  
ATOM   8765  CB  GLU D  90      48.674  72.169  20.565  1.00 28.96           C  
ATOM   8766  CG  GLU D  90      49.934  71.410  20.146  1.00 33.07           C  
ATOM   8767  CD  GLU D  90      50.421  70.451  21.214  1.00 33.28           C  
ATOM   8768  OE1 GLU D  90      51.646  70.402  21.449  1.00 34.33           O  
ATOM   8769  OE2 GLU D  90      49.579  69.744  21.807  1.00 35.06           O  
ATOM   8770  N   ILE D  91      46.584  73.775  22.388  1.00 28.60           N  
ATOM   8771  CA  ILE D  91      45.475  74.723  22.427  1.00 25.83           C  
ATOM   8772  C   ILE D  91      45.915  75.923  23.261  1.00 28.31           C  
ATOM   8773  O   ILE D  91      45.647  77.077  22.903  1.00 28.88           O  
ATOM   8774  CB  ILE D  91      44.171  74.125  23.074  1.00 27.20           C  
ATOM   8775  CG1 ILE D  91      43.642  72.905  22.274  1.00 29.21           C  
ATOM   8776  CG2 ILE D  91      43.117  75.238  23.185  1.00 19.20           C  
ATOM   8777  CD1 ILE D  91      43.247  73.171  20.775  1.00 28.44           C  
ATOM   8778  N   GLN D  92      46.641  75.667  24.350  1.00 26.73           N  
ATOM   8779  CA  GLN D  92      47.066  76.777  25.208  1.00 26.82           C  
ATOM   8780  C   GLN D  92      48.020  77.704  24.473  1.00 23.18           C  
ATOM   8781  O   GLN D  92      47.882  78.918  24.541  1.00 25.40           O  
ATOM   8782  CB  GLN D  92      47.708  76.246  26.505  1.00 27.97           C  
ATOM   8783  CG  GLN D  92      48.367  77.312  27.370  1.00 29.86           C  
ATOM   8784  CD  GLN D  92      48.741  76.747  28.739  1.00 32.56           C  
ATOM   8785  OE1 GLN D  92      49.876  76.360  28.974  1.00 35.89           O  
ATOM   8786  NE2 GLN D  92      47.776  76.664  29.615  1.00 22.59           N  
ATOM   8787  N   THR D  93      48.988  77.146  23.765  1.00 24.43           N  
ATOM   8788  CA  THR D  93      49.922  77.994  23.028  1.00 25.80           C  
ATOM   8789  C   THR D  93      49.197  78.738  21.895  1.00 24.20           C  
ATOM   8790  O   THR D  93      49.453  79.915  21.663  1.00 24.41           O  
ATOM   8791  CB  THR D  93      51.088  77.173  22.461  1.00 28.18           C  
ATOM   8792  OG1 THR D  93      51.787  76.563  23.556  1.00 28.10           O  
ATOM   8793  CG2 THR D  93      52.045  78.074  21.676  1.00 23.35           C  
ATOM   8794  N   ALA D  94      48.261  78.063  21.229  1.00 24.61           N  
ATOM   8795  CA  ALA D  94      47.512  78.704  20.150  1.00 25.62           C  
ATOM   8796  C   ALA D  94      46.750  79.900  20.733  1.00 27.99           C  
ATOM   8797  O   ALA D  94      46.681  80.993  20.130  1.00 27.68           O  
ATOM   8798  CB  ALA D  94      46.538  77.702  19.521  1.00 23.12           C  
ATOM   8799  N   VAL D  95      46.175  79.693  21.916  1.00 27.20           N  
ATOM   8800  CA  VAL D  95      45.434  80.749  22.577  1.00 26.22           C  
ATOM   8801  C   VAL D  95      46.321  81.945  22.887  1.00 26.03           C  
ATOM   8802  O   VAL D  95      45.912  83.100  22.715  1.00 25.22           O  
ATOM   8803  CB  VAL D  95      44.758  80.239  23.883  1.00 28.41           C  
ATOM   8804  CG1 VAL D  95      44.244  81.412  24.680  1.00 26.57           C  
ATOM   8805  CG2 VAL D  95      43.565  79.282  23.514  1.00 23.85           C  
ATOM   8806  N   ARG D  96      47.545  81.685  23.314  1.00 26.02           N  
ATOM   8807  CA  ARG D  96      48.473  82.759  23.636  1.00 26.77           C  
ATOM   8808  C   ARG D  96      48.882  83.515  22.384  1.00 29.31           C  
ATOM   8809  O   ARG D  96      49.055  84.726  22.426  1.00 29.21           O  
ATOM   8810  CB  ARG D  96      49.726  82.196  24.338  1.00 29.01           C  
ATOM   8811  CG  ARG D  96      49.518  82.061  25.856  1.00 35.74           C  
ATOM   8812  CD  ARG D  96      50.509  81.076  26.461  1.00 45.47           C  
ATOM   8813  NE  ARG D  96      50.380  80.924  27.916  1.00 49.89           N  
ATOM   8814  CZ  ARG D  96      50.990  79.965  28.618  1.00 52.08           C  
ATOM   8815  NH1 ARG D  96      51.763  79.072  28.007  1.00 47.25           N  
ATOM   8816  NH2 ARG D  96      50.837  79.900  29.938  1.00 55.42           N  
ATOM   8817  N   LEU D  97      49.091  82.788  21.292  1.00 24.90           N  
ATOM   8818  CA  LEU D  97      49.438  83.409  20.011  1.00 27.54           C  
ATOM   8819  C   LEU D  97      48.285  84.231  19.444  1.00 29.39           C  
ATOM   8820  O   LEU D  97      48.492  85.320  18.884  1.00 28.49           O  
ATOM   8821  CB  LEU D  97      49.761  82.343  18.986  1.00 26.55           C  
ATOM   8822  CG  LEU D  97      51.037  81.521  19.252  1.00 28.36           C  
ATOM   8823  CD1 LEU D  97      51.027  80.323  18.342  1.00 28.72           C  
ATOM   8824  CD2 LEU D  97      52.269  82.377  19.035  1.00 26.86           C  
ATOM   8825  N   LEU D  98      47.068  83.716  19.596  1.00 28.68           N  
ATOM   8826  CA  LEU D  98      45.909  84.384  19.013  1.00 27.36           C  
ATOM   8827  C   LEU D  98      45.282  85.517  19.793  1.00 29.78           C  
ATOM   8828  O   LEU D  98      44.901  86.509  19.203  1.00 29.54           O  
ATOM   8829  CB  LEU D  98      44.819  83.360  18.709  1.00 29.23           C  
ATOM   8830  CG  LEU D  98      43.500  83.845  18.061  1.00 36.11           C  
ATOM   8831  CD1 LEU D  98      43.768  84.150  16.597  1.00 39.34           C  
ATOM   8832  CD2 LEU D  98      42.393  82.780  18.144  1.00 34.51           C  
ATOM   8833  N   LEU D  99      45.178  85.385  21.111  1.00 27.27           N  
ATOM   8834  CA  LEU D  99      44.480  86.388  21.890  1.00 28.84           C  
ATOM   8835  C   LEU D  99      45.274  87.544  22.452  1.00 30.82           C  
ATOM   8836  O   LEU D  99      46.398  87.373  22.925  1.00 33.92           O  
ATOM   8837  CB  LEU D  99      43.716  85.727  23.053  1.00 25.90           C  
ATOM   8838  CG  LEU D  99      42.714  84.604  22.804  1.00 33.90           C  
ATOM   8839  CD1 LEU D  99      41.850  84.414  24.079  1.00 26.74           C  
ATOM   8840  CD2 LEU D  99      41.807  84.929  21.644  1.00 29.17           C  
ATOM   8841  N   PRO D 100      44.685  88.751  22.427  1.00 31.22           N  
ATOM   8842  CA  PRO D 100      45.386  89.924  22.966  1.00 35.77           C  
ATOM   8843  C   PRO D 100      45.579  89.693  24.465  1.00 33.95           C  
ATOM   8844  O   PRO D 100      44.828  88.947  25.091  1.00 36.68           O  
ATOM   8845  CB  PRO D 100      44.406  91.074  22.721  1.00 33.60           C  
ATOM   8846  CG  PRO D 100      43.469  90.564  21.666  1.00 34.83           C  
ATOM   8847  CD  PRO D 100      43.330  89.108  21.973  1.00 32.26           C  
ATOM   8848  N   GLY D 101      46.569  90.375  25.012  1.00 36.36           N  
ATOM   8849  CA  GLY D 101      46.938  90.310  26.420  1.00 35.04           C  
ATOM   8850  C   GLY D 101      46.053  89.754  27.509  1.00 34.95           C  
ATOM   8851  O   GLY D 101      46.151  88.585  27.885  1.00 36.95           O  
ATOM   8852  N   GLU D 102      45.205  90.603  28.049  1.00 35.45           N  
ATOM   8853  CA  GLU D 102      44.331  90.230  29.137  1.00 35.67           C  
ATOM   8854  C   GLU D 102      43.369  89.095  28.785  1.00 38.59           C  
ATOM   8855  O   GLU D 102      43.051  88.268  29.654  1.00 36.97           O  
ATOM   8856  CB  GLU D 102      43.595  91.482  29.607  1.00 39.40           C  
ATOM   8857  CG  GLU D 102      43.457  91.620  31.124  1.00 51.51           C  
ATOM   8858  CD  GLU D 102      44.720  91.213  31.887  1.00 50.78           C  
ATOM   8859  OE1 GLU D 102      45.797  91.820  31.700  1.00 54.04           O  
ATOM   8860  OE2 GLU D 102      44.631  90.262  32.672  1.00 54.79           O  
ATOM   8861  N   LEU D 103      42.903  89.018  27.528  1.00 31.64           N  
ATOM   8862  CA  LEU D 103      41.996  87.925  27.166  1.00 27.62           C  
ATOM   8863  C   LEU D 103      42.766  86.609  27.174  1.00 25.37           C  
ATOM   8864  O   LEU D 103      42.248  85.569  27.574  1.00 28.67           O  
ATOM   8865  CB  LEU D 103      41.381  88.144  25.756  1.00 27.68           C  
ATOM   8866  CG  LEU D 103      40.291  89.211  25.646  1.00 28.45           C  
ATOM   8867  CD1 LEU D 103      39.904  89.417  24.113  1.00 25.91           C  
ATOM   8868  CD2 LEU D 103      39.059  88.734  26.447  1.00 25.28           C  
ATOM   8869  N   ALA D 104      43.998  86.625  26.696  1.00 26.29           N  
ATOM   8870  CA  ALA D 104      44.751  85.383  26.695  1.00 26.61           C  
ATOM   8871  C   ALA D 104      44.942  84.872  28.137  1.00 30.79           C  
ATOM   8872  O   ALA D 104      44.759  83.673  28.418  1.00 31.16           O  
ATOM   8873  CB  ALA D 104      46.072  85.587  26.023  1.00 27.47           C  
ATOM   8874  N   LYS D 105      45.265  85.785  29.051  1.00 33.55           N  
ATOM   8875  CA  LYS D 105      45.493  85.448  30.466  1.00 34.36           C  
ATOM   8876  C   LYS D 105      44.315  84.747  31.083  1.00 36.18           C  
ATOM   8877  O   LYS D 105      44.458  83.662  31.701  1.00 35.06           O  
ATOM   8878  CB  LYS D 105      45.791  86.708  31.253  1.00 40.50           C  
ATOM   8879  CG  LYS D 105      45.979  86.522  32.772  1.00 50.57           C  
ATOM   8880  CD  LYS D 105      46.309  87.872  33.441  1.00 52.15           C  
ATOM   8881  CE  LYS D 105      47.435  88.589  32.677  1.00 57.75           C  
ATOM   8882  NZ  LYS D 105      47.656  90.008  33.127  1.00 64.78           N  
ATOM   8883  N   HIS D 106      43.140  85.346  30.902  1.00 30.21           N  
ATOM   8884  CA  HIS D 106      41.926  84.791  31.454  1.00 32.35           C  
ATOM   8885  C   HIS D 106      41.490  83.507  30.748  1.00 32.91           C  
ATOM   8886  O   HIS D 106      40.986  82.589  31.399  1.00 30.36           O  
ATOM   8887  CB  HIS D 106      40.806  85.831  31.420  1.00 35.76           C  
ATOM   8888  CG  HIS D 106      40.927  86.884  32.473  1.00 44.17           C  
ATOM   8889  ND1 HIS D 106      40.374  88.141  32.338  1.00 50.90           N  
ATOM   8890  CD2 HIS D 106      41.521  86.863  33.689  1.00 45.53           C  
ATOM   8891  CE1 HIS D 106      40.628  88.848  33.426  1.00 48.20           C  
ATOM   8892  NE2 HIS D 106      41.321  88.094  34.259  1.00 47.78           N  
ATOM   8893  N   ALA D 107      41.661  83.447  29.423  1.00 31.16           N  
ATOM   8894  CA  ALA D 107      41.295  82.235  28.672  1.00 28.41           C  
ATOM   8895  C   ALA D 107      42.184  81.111  29.186  1.00 28.98           C  
ATOM   8896  O   ALA D 107      41.706  80.013  29.439  1.00 29.37           O  
ATOM   8897  CB  ALA D 107      41.521  82.419  27.122  1.00 24.92           C  
ATOM   8898  N   VAL D 108      43.481  81.382  29.296  1.00 29.23           N  
ATOM   8899  CA  VAL D 108      44.429  80.380  29.795  1.00 32.08           C  
ATOM   8900  C   VAL D 108      44.009  79.825  31.172  1.00 34.91           C  
ATOM   8901  O   VAL D 108      43.974  78.602  31.360  1.00 31.04           O  
ATOM   8902  CB  VAL D 108      45.874  80.954  29.844  1.00 32.97           C  
ATOM   8903  CG1 VAL D 108      46.810  80.025  30.639  1.00 36.46           C  
ATOM   8904  CG2 VAL D 108      46.408  81.063  28.428  1.00 31.68           C  
ATOM   8905  N   SER D 109      43.649  80.697  32.112  1.00 34.27           N  
ATOM   8906  CA  SER D 109      43.215  80.237  33.448  1.00 35.72           C  
ATOM   8907  C   SER D 109      41.979  79.366  33.371  1.00 36.39           C  
ATOM   8908  O   SER D 109      41.905  78.307  34.003  1.00 34.86           O  
ATOM   8909  CB  SER D 109      42.907  81.424  34.379  1.00 32.84           C  
ATOM   8910  OG  SER D 109      44.053  82.244  34.469  1.00 46.99           O  
ATOM   8911  N   GLU D 110      40.992  79.820  32.615  1.00 33.16           N  
ATOM   8912  CA  GLU D 110      39.765  79.057  32.462  1.00 33.32           C  
ATOM   8913  C   GLU D 110      40.002  77.682  31.809  1.00 34.16           C  
ATOM   8914  O   GLU D 110      39.413  76.669  32.222  1.00 32.69           O  
ATOM   8915  CB  GLU D 110      38.767  79.853  31.632  1.00 35.51           C  
ATOM   8916  CG  GLU D 110      38.241  81.090  32.311  1.00 42.68           C  
ATOM   8917  CD  GLU D 110      36.828  80.895  32.816  1.00 51.13           C  
ATOM   8918  OE1 GLU D 110      36.663  80.316  33.912  1.00 51.35           O  
ATOM   8919  OE2 GLU D 110      35.880  81.305  32.102  1.00 52.24           O  
ATOM   8920  N   GLY D 111      40.838  77.631  30.780  1.00 30.13           N  
ATOM   8921  CA  GLY D 111      41.081  76.337  30.149  1.00 31.76           C  
ATOM   8922  C   GLY D 111      41.878  75.411  31.063  1.00 29.36           C  
ATOM   8923  O   GLY D 111      41.583  74.222  31.192  1.00 31.11           O  
ATOM   8924  N   THR D 112      42.907  75.952  31.688  1.00 29.33           N  
ATOM   8925  CA  THR D 112      43.723  75.161  32.607  1.00 34.86           C  
ATOM   8926  C   THR D 112      42.811  74.604  33.718  1.00 33.72           C  
ATOM   8927  O   THR D 112      42.825  73.422  34.045  1.00 34.77           O  
ATOM   8928  CB  THR D 112      44.781  76.024  33.262  1.00 32.17           C  
ATOM   8929  OG1 THR D 112      45.571  76.645  32.250  1.00 36.34           O  
ATOM   8930  CG2 THR D 112      45.670  75.191  34.142  1.00 32.55           C  
ATOM   8931  N   LYS D 113      41.999  75.475  34.279  1.00 32.40           N  
ATOM   8932  CA  LYS D 113      41.115  75.058  35.330  1.00 35.96           C  
ATOM   8933  C   LYS D 113      40.170  73.960  34.848  1.00 35.41           C  
ATOM   8934  O   LYS D 113      39.952  72.972  35.557  1.00 33.95           O  
ATOM   8935  CB  LYS D 113      40.335  76.275  35.851  1.00 40.02           C  
ATOM   8936  CG  LYS D 113      39.289  75.982  36.889  1.00 45.42           C  
ATOM   8937  CD  LYS D 113      38.889  77.285  37.575  1.00 56.10           C  
ATOM   8938  CE  LYS D 113      37.761  77.068  38.567  1.00 62.74           C  
ATOM   8939  NZ  LYS D 113      36.498  76.673  37.880  1.00 67.45           N  
ATOM   8940  N   ALA D 114      39.631  74.113  33.641  1.00 30.43           N  
ATOM   8941  CA  ALA D 114      38.684  73.143  33.117  1.00 30.55           C  
ATOM   8942  C   ALA D 114      39.339  71.769  32.932  1.00 32.81           C  
ATOM   8943  O   ALA D 114      38.705  70.735  33.189  1.00 32.18           O  
ATOM   8944  CB  ALA D 114      38.088  73.641  31.786  1.00 27.37           C  
ATOM   8945  N   VAL D 115      40.602  71.761  32.502  1.00 32.30           N  
ATOM   8946  CA  VAL D 115      41.311  70.498  32.293  1.00 32.81           C  
ATOM   8947  C   VAL D 115      41.688  69.864  33.629  1.00 32.42           C  
ATOM   8948  O   VAL D 115      41.489  68.690  33.810  1.00 31.78           O  
ATOM   8949  CB  VAL D 115      42.601  70.662  31.412  1.00 33.60           C  
ATOM   8950  CG1 VAL D 115      43.321  69.317  31.298  1.00 29.16           C  
ATOM   8951  CG2 VAL D 115      42.224  71.158  29.986  1.00 28.36           C  
ATOM   8952  N   THR D 116      42.245  70.637  34.549  1.00 34.32           N  
ATOM   8953  CA  THR D 116      42.579  70.102  35.856  1.00 37.04           C  
ATOM   8954  C   THR D 116      41.327  69.491  36.498  1.00 38.18           C  
ATOM   8955  O   THR D 116      41.391  68.406  37.068  1.00 40.23           O  
ATOM   8956  CB  THR D 116      43.118  71.187  36.763  1.00 36.15           C  
ATOM   8957  OG1 THR D 116      44.259  71.777  36.135  1.00 38.10           O  
ATOM   8958  CG2 THR D 116      43.543  70.601  38.108  1.00 40.09           C  
ATOM   8959  N   LYS D 117      40.186  70.171  36.391  1.00 36.05           N  
ATOM   8960  CA  LYS D 117      38.959  69.648  36.954  1.00 35.96           C  
ATOM   8961  C   LYS D 117      38.526  68.388  36.233  1.00 38.51           C  
ATOM   8962  O   LYS D 117      38.132  67.383  36.855  1.00 39.60           O  
ATOM   8963  CB  LYS D 117      37.826  70.675  36.877  1.00 37.78           C  
ATOM   8964  CG  LYS D 117      36.507  70.077  37.309  1.00 41.93           C  
ATOM   8965  CD  LYS D 117      35.379  71.088  37.414  1.00 49.03           C  
ATOM   8966  CE  LYS D 117      34.136  70.367  37.929  1.00 52.71           C  
ATOM   8967  NZ  LYS D 117      32.931  71.223  37.917  1.00 62.79           N  
ATOM   8968  N   TYR D 118      38.584  68.437  34.910  1.00 35.02           N  
ATOM   8969  CA  TYR D 118      38.180  67.306  34.087  1.00 34.95           C  
ATOM   8970  C   TYR D 118      38.933  66.028  34.440  1.00 40.07           C  
ATOM   8971  O   TYR D 118      38.358  64.933  34.506  1.00 37.74           O  
ATOM   8972  CB  TYR D 118      38.462  67.608  32.628  1.00 36.76           C  
ATOM   8973  CG  TYR D 118      38.088  66.475  31.735  1.00 34.37           C  
ATOM   8974  CD1 TYR D 118      36.752  66.218  31.451  1.00 34.48           C  
ATOM   8975  CD2 TYR D 118      39.067  65.638  31.176  1.00 34.23           C  
ATOM   8976  CE1 TYR D 118      36.393  65.168  30.636  1.00 38.04           C  
ATOM   8977  CE2 TYR D 118      38.714  64.579  30.358  1.00 33.81           C  
ATOM   8978  CZ  TYR D 118      37.375  64.359  30.090  1.00 36.40           C  
ATOM   8979  OH  TYR D 118      36.985  63.384  29.220  1.00 45.40           O  
ATOM   8980  N   THR D 119      40.238  66.190  34.623  1.00 39.58           N  
ATOM   8981  CA  THR D 119      41.122  65.096  34.925  1.00 47.46           C  
ATOM   8982  C   THR D 119      40.992  64.611  36.364  1.00 50.46           C  
ATOM   8983  O   THR D 119      41.453  63.524  36.694  1.00 50.39           O  
ATOM   8984  CB  THR D 119      42.574  65.511  34.646  1.00 48.38           C  
ATOM   8985  OG1 THR D 119      42.701  65.865  33.263  1.00 53.10           O  
ATOM   8986  CG2 THR D 119      43.515  64.367  34.926  1.00 53.15           C  
ATOM   8987  N   SER D 120      40.359  65.417  37.212  1.00 51.92           N  
ATOM   8988  CA  SER D 120      40.182  65.044  38.604  1.00 54.61           C  
ATOM   8989  C   SER D 120      38.891  64.259  38.741  1.00 57.38           C  
ATOM   8990  O   SER D 120      38.677  63.573  39.733  1.00 58.39           O  
ATOM   8991  CB  SER D 120      40.102  66.289  39.488  1.00 52.96           C  
ATOM   8992  OG  SER D 120      38.787  66.827  39.453  1.00 49.36           O  
ATOM   8993  N   ALA D 121      38.036  64.351  37.730  1.00 60.91           N  
ATOM   8994  CA  ALA D 121      36.749  63.689  37.775  1.00 64.10           C  
ATOM   8995  C   ALA D 121      36.619  62.322  37.111  1.00 69.63           C  
ATOM   8996  O   ALA D 121      35.707  62.114  36.303  1.00 70.29           O  
ATOM   8997  CB  ALA D 121      35.700  64.620  37.225  1.00 65.21           C  
ATOM   8998  N   LYS D 122      37.507  61.388  37.450  1.00 72.63           N  
ATOM   8999  CA  LYS D 122      37.423  60.032  36.895  1.00 76.70           C  
ATOM   9000  C   LYS D 122      38.588  59.130  37.288  1.00 78.69           C  
ATOM   9001  O   LYS D 122      38.352  58.210  38.102  1.00 79.38           O  
ATOM   9002  CB  LYS D 122      37.313  60.073  35.370  1.00 77.06           C  
ATOM   9003  CG  LYS D 122      36.735  58.803  34.774  1.00 78.37           C  
ATOM   9004  CD  LYS D 122      36.280  59.025  33.342  1.00 80.54           C  
ATOM   9005  CE  LYS D 122      35.353  57.911  32.877  1.00 81.00           C  
ATOM   9006  NZ  LYS D 122      34.779  58.195  31.528  1.00 81.09           N  
ATOM   9007  OXT LYS D 122      39.714  59.352  36.785  1.00 80.44           O  
TER    9008      LYS D 122                                                      
ATOM   9009  N   PRO E  38      13.209 133.506   5.192  1.00 57.69           N  
ATOM   9010  CA  PRO E  38      13.274 132.032   5.259  1.00 57.20           C  
ATOM   9011  C   PRO E  38      14.541 131.550   5.970  1.00 55.98           C  
ATOM   9012  O   PRO E  38      15.655 131.944   5.627  1.00 56.83           O  
ATOM   9013  CB  PRO E  38      13.212 131.526   3.823  1.00 57.74           C  
ATOM   9014  CG  PRO E  38      13.744 132.718   3.055  1.00 57.57           C  
ATOM   9015  CD  PRO E  38      13.177 133.937   3.784  1.00 58.13           C  
ATOM   9016  N   HIS E  39      14.348 130.697   6.968  1.00 54.89           N  
ATOM   9017  CA  HIS E  39      15.441 130.148   7.764  1.00 52.32           C  
ATOM   9018  C   HIS E  39      16.389 129.250   6.965  1.00 48.64           C  
ATOM   9019  O   HIS E  39      15.968 128.525   6.063  1.00 47.38           O  
ATOM   9020  CB  HIS E  39      14.855 129.372   8.947  1.00 55.83           C  
ATOM   9021  CG  HIS E  39      15.881 128.709   9.809  1.00 60.85           C  
ATOM   9022  ND1 HIS E  39      16.597 127.603   9.400  1.00 60.99           N  
ATOM   9023  CD2 HIS E  39      16.306 128.990  11.064  1.00 61.23           C  
ATOM   9024  CE1 HIS E  39      17.418 127.232  10.366  1.00 61.56           C  
ATOM   9025  NE2 HIS E  39      17.261 128.057  11.387  1.00 61.76           N  
ATOM   9026  N   ARG E  40      17.673 129.319   7.301  1.00 44.53           N  
ATOM   9027  CA  ARG E  40      18.691 128.507   6.642  1.00 42.19           C  
ATOM   9028  C   ARG E  40      19.819 128.102   7.592  1.00 40.27           C  
ATOM   9029  O   ARG E  40      20.428 128.956   8.233  1.00 36.80           O  
ATOM   9030  CB  ARG E  40      19.327 129.254   5.461  1.00 40.96           C  
ATOM   9031  CG  ARG E  40      18.547 129.250   4.149  1.00 44.45           C  
ATOM   9032  CD  ARG E  40      19.468 129.643   2.976  1.00 47.68           C  
ATOM   9033  NE  ARG E  40      19.300 128.753   1.822  1.00 54.97           N  
ATOM   9034  CZ  ARG E  40      20.194 127.854   1.431  1.00 55.09           C  
ATOM   9035  NH1 ARG E  40      21.328 127.712   2.089  1.00 63.33           N  
ATOM   9036  NH2 ARG E  40      19.962 127.095   0.383  1.00 54.19           N  
ATOM   9037  N   TYR E  41      20.102 126.806   7.692  1.00 36.03           N  
ATOM   9038  CA  TYR E  41      21.229 126.400   8.526  1.00 32.91           C  
ATOM   9039  C   TYR E  41      22.416 126.736   7.667  1.00 29.50           C  
ATOM   9040  O   TYR E  41      22.305 126.756   6.454  1.00 31.32           O  
ATOM   9041  CB  TYR E  41      21.189 124.894   8.852  1.00 30.68           C  
ATOM   9042  CG  TYR E  41      20.120 124.561   9.869  1.00 31.10           C  
ATOM   9043  CD1 TYR E  41      18.906 124.028   9.480  1.00 32.18           C  
ATOM   9044  CD2 TYR E  41      20.300 124.862  11.219  1.00 32.34           C  
ATOM   9045  CE1 TYR E  41      17.890 123.795  10.414  1.00 33.11           C  
ATOM   9046  CE2 TYR E  41      19.284 124.650  12.151  1.00 32.69           C  
ATOM   9047  CZ  TYR E  41      18.089 124.114  11.739  1.00 30.43           C  
ATOM   9048  OH  TYR E  41      17.071 123.898  12.648  1.00 39.46           O  
ATOM   9049  N   ARG E  42      23.547 127.031   8.284  1.00 30.02           N  
ATOM   9050  CA  ARG E  42      24.746 127.368   7.538  1.00 29.30           C  
ATOM   9051  C   ARG E  42      25.353 126.099   6.900  1.00 34.55           C  
ATOM   9052  O   ARG E  42      25.164 124.986   7.392  1.00 31.70           O  
ATOM   9053  CB  ARG E  42      25.753 128.008   8.487  1.00 35.28           C  
ATOM   9054  CG  ARG E  42      25.174 129.208   9.252  1.00 39.03           C  
ATOM   9055  CD  ARG E  42      26.168 129.740  10.259  1.00 46.45           C  
ATOM   9056  NE  ARG E  42      27.388 130.235   9.623  1.00 53.67           N  
ATOM   9057  CZ  ARG E  42      28.470 130.610  10.296  1.00 59.92           C  
ATOM   9058  NH1 ARG E  42      28.486 130.540  11.624  1.00 61.16           N  
ATOM   9059  NH2 ARG E  42      29.531 131.073   9.648  1.00 62.73           N  
ATOM   9060  N   PRO E  43      26.088 126.255   5.793  1.00 33.84           N  
ATOM   9061  CA  PRO E  43      26.653 125.039   5.205  1.00 32.86           C  
ATOM   9062  C   PRO E  43      27.570 124.318   6.189  1.00 31.74           C  
ATOM   9063  O   PRO E  43      28.473 124.927   6.775  1.00 32.90           O  
ATOM   9064  CB  PRO E  43      27.394 125.545   3.965  1.00 33.13           C  
ATOM   9065  CG  PRO E  43      27.556 127.002   4.170  1.00 36.45           C  
ATOM   9066  CD  PRO E  43      26.367 127.444   4.974  1.00 34.92           C  
ATOM   9067  N   GLY E  44      27.312 123.028   6.380  1.00 29.31           N  
ATOM   9068  CA  GLY E  44      28.122 122.232   7.287  1.00 27.31           C  
ATOM   9069  C   GLY E  44      27.317 121.775   8.485  1.00 29.05           C  
ATOM   9070  O   GLY E  44      27.550 120.696   9.042  1.00 31.47           O  
ATOM   9071  N   THR E  45      26.348 122.594   8.873  1.00 27.48           N  
ATOM   9072  CA  THR E  45      25.489 122.301  10.006  1.00 27.40           C  
ATOM   9073  C   THR E  45      24.659 121.061   9.777  1.00 26.33           C  
ATOM   9074  O   THR E  45      24.612 120.180  10.624  1.00 26.43           O  
ATOM   9075  CB  THR E  45      24.550 123.495  10.306  1.00 28.36           C  
ATOM   9076  OG1 THR E  45      25.337 124.585  10.794  1.00 29.49           O  
ATOM   9077  CG2 THR E  45      23.522 123.129  11.374  1.00 27.44           C  
ATOM   9078  N   VAL E  46      23.991 120.984   8.634  1.00 27.17           N  
ATOM   9079  CA  VAL E  46      23.182 119.824   8.343  1.00 25.81           C  
ATOM   9080  C   VAL E  46      24.102 118.612   8.083  1.00 26.57           C  
ATOM   9081  O   VAL E  46      23.784 117.495   8.479  1.00 26.99           O  
ATOM   9082  CB  VAL E  46      22.298 120.070   7.130  1.00 27.72           C  
ATOM   9083  CG1 VAL E  46      21.416 118.811   6.859  1.00 27.98           C  
ATOM   9084  CG2 VAL E  46      21.395 121.310   7.397  1.00 30.66           C  
ATOM   9085  N   ALA E  47      25.237 118.845   7.425  1.00 25.48           N  
ATOM   9086  CA  ALA E  47      26.192 117.763   7.179  1.00 25.81           C  
ATOM   9087  C   ALA E  47      26.564 117.113   8.527  1.00 27.85           C  
ATOM   9088  O   ALA E  47      26.590 115.891   8.645  1.00 23.16           O  
ATOM   9089  CB  ALA E  47      27.451 118.296   6.513  1.00 24.40           C  
ATOM   9090  N   LEU E  48      26.875 117.932   9.530  1.00 28.66           N  
ATOM   9091  CA  LEU E  48      27.239 117.392  10.851  1.00 26.55           C  
ATOM   9092  C   LEU E  48      26.043 116.666  11.426  1.00 26.86           C  
ATOM   9093  O   LEU E  48      26.192 115.604  12.015  1.00 27.90           O  
ATOM   9094  CB  LEU E  48      27.719 118.505  11.785  1.00 22.98           C  
ATOM   9095  CG  LEU E  48      29.130 118.978  11.456  1.00 27.16           C  
ATOM   9096  CD1 LEU E  48      29.389 120.347  12.090  1.00 26.68           C  
ATOM   9097  CD2 LEU E  48      30.146 117.914  11.933  1.00 26.18           C  
ATOM   9098  N   ARG E  49      24.850 117.219  11.262  1.00 25.35           N  
ATOM   9099  CA  ARG E  49      23.671 116.530  11.758  1.00 25.47           C  
ATOM   9100  C   ARG E  49      23.527 115.145  11.100  1.00 26.03           C  
ATOM   9101  O   ARG E  49      23.130 114.162  11.735  1.00 22.15           O  
ATOM   9102  CB  ARG E  49      22.404 117.323  11.438  1.00 31.56           C  
ATOM   9103  CG  ARG E  49      21.252 116.871  12.298  1.00 38.74           C  
ATOM   9104  CD  ARG E  49      19.962 116.609  11.549  1.00 45.72           C  
ATOM   9105  NE  ARG E  49      19.464 117.771  10.825  1.00 48.24           N  
ATOM   9106  CZ  ARG E  49      19.566 119.026  11.241  1.00 44.39           C  
ATOM   9107  NH1 ARG E  49      20.161 119.295  12.391  1.00 46.99           N  
ATOM   9108  NH2 ARG E  49      19.067 120.012  10.495  1.00 39.79           N  
ATOM   9109  N   GLU E  50      23.810 115.074   9.804  1.00 19.46           N  
ATOM   9110  CA  GLU E  50      23.701 113.812   9.099  1.00 20.38           C  
ATOM   9111  C   GLU E  50      24.738 112.815   9.618  1.00 20.62           C  
ATOM   9112  O   GLU E  50      24.464 111.629   9.769  1.00 23.11           O  
ATOM   9113  CB  GLU E  50      23.871 114.061   7.577  1.00 19.44           C  
ATOM   9114  CG  GLU E  50      22.688 114.822   6.978  1.00 23.54           C  
ATOM   9115  CD  GLU E  50      22.838 115.042   5.480  1.00 31.04           C  
ATOM   9116  OE1 GLU E  50      21.916 115.623   4.891  1.00 30.26           O  
ATOM   9117  OE2 GLU E  50      23.876 114.639   4.894  1.00 28.46           O  
ATOM   9118  N   ILE E  51      25.937 113.290   9.892  1.00 21.36           N  
ATOM   9119  CA  ILE E  51      26.954 112.388  10.410  1.00 22.63           C  
ATOM   9120  C   ILE E  51      26.444 111.745  11.716  1.00 25.24           C  
ATOM   9121  O   ILE E  51      26.463 110.516  11.865  1.00 24.88           O  
ATOM   9122  CB  ILE E  51      28.246 113.149  10.691  1.00 22.08           C  
ATOM   9123  CG1 ILE E  51      28.894 113.577   9.359  1.00 21.79           C  
ATOM   9124  CG2 ILE E  51      29.214 112.262  11.464  1.00 21.13           C  
ATOM   9125  CD1 ILE E  51      30.092 114.501   9.556  1.00 20.17           C  
ATOM   9126  N   ARG E  52      25.928 112.564  12.639  1.00 23.53           N  
ATOM   9127  CA  ARG E  52      25.455 112.022  13.919  1.00 26.03           C  
ATOM   9128  C   ARG E  52      24.294 111.038  13.741  1.00 26.70           C  
ATOM   9129  O   ARG E  52      24.189 109.997  14.419  1.00 24.64           O  
ATOM   9130  CB  ARG E  52      25.042 113.172  14.858  1.00 26.87           C  
ATOM   9131  CG  ARG E  52      26.194 114.123  15.218  1.00 33.32           C  
ATOM   9132  CD  ARG E  52      25.743 115.212  16.210  1.00 38.52           C  
ATOM   9133  NE  ARG E  52      26.379 116.497  15.940  1.00 44.09           N  
ATOM   9134  CZ  ARG E  52      27.580 116.843  16.376  1.00 48.10           C  
ATOM   9135  NH1 ARG E  52      28.280 115.992  17.111  1.00 55.67           N  
ATOM   9136  NH2 ARG E  52      28.084 118.036  16.085  1.00 43.27           N  
ATOM   9137  N   ARG E  53      23.414 111.360  12.809  1.00 23.22           N  
ATOM   9138  CA  ARG E  53      22.295 110.498  12.576  1.00 22.43           C  
ATOM   9139  C   ARG E  53      22.743 109.118  12.065  1.00 23.70           C  
ATOM   9140  O   ARG E  53      22.337 108.069  12.601  1.00 21.94           O  
ATOM   9141  CB  ARG E  53      21.377 111.131  11.522  1.00 23.70           C  
ATOM   9142  CG  ARG E  53      20.403 110.121  10.962  1.00 23.95           C  
ATOM   9143  CD  ARG E  53      19.512 110.698   9.848  1.00 34.52           C  
ATOM   9144  NE  ARG E  53      18.634 109.649   9.314  1.00 43.04           N  
ATOM   9145  CZ  ARG E  53      17.704 109.835   8.378  1.00 44.46           C  
ATOM   9146  NH1 ARG E  53      17.514 111.032   7.850  1.00 44.70           N  
ATOM   9147  NH2 ARG E  53      16.949 108.821   7.989  1.00 45.39           N  
ATOM   9148  N   TYR E  54      23.574 109.111  11.015  1.00 22.48           N  
ATOM   9149  CA  TYR E  54      23.977 107.831  10.436  1.00 23.21           C  
ATOM   9150  C   TYR E  54      24.953 107.062  11.294  1.00 22.35           C  
ATOM   9151  O   TYR E  54      24.986 105.838  11.227  1.00 22.50           O  
ATOM   9152  CB  TYR E  54      24.512 108.032   8.984  1.00 23.21           C  
ATOM   9153  CG  TYR E  54      23.387 108.480   8.060  1.00 24.41           C  
ATOM   9154  CD1 TYR E  54      23.412 109.730   7.441  1.00 22.55           C  
ATOM   9155  CD2 TYR E  54      22.279 107.668   7.860  1.00 23.16           C  
ATOM   9156  CE1 TYR E  54      22.344 110.153   6.635  1.00 24.56           C  
ATOM   9157  CE2 TYR E  54      21.213 108.077   7.071  1.00 27.42           C  
ATOM   9158  CZ  TYR E  54      21.256 109.310   6.470  1.00 22.99           C  
ATOM   9159  OH  TYR E  54      20.182 109.700   5.728  1.00 26.24           O  
ATOM   9160  N   GLN E  55      25.740 107.746  12.118  1.00 22.23           N  
ATOM   9161  CA  GLN E  55      26.665 106.982  12.959  1.00 22.08           C  
ATOM   9162  C   GLN E  55      25.912 106.364  14.133  1.00 25.55           C  
ATOM   9163  O   GLN E  55      26.443 105.560  14.866  1.00 26.75           O  
ATOM   9164  CB  GLN E  55      27.787 107.865  13.482  1.00 22.58           C  
ATOM   9165  CG  GLN E  55      28.719 108.317  12.386  1.00 23.09           C  
ATOM   9166  CD  GLN E  55      29.977 108.916  12.933  1.00 24.97           C  
ATOM   9167  OE1 GLN E  55      29.984 109.513  14.020  1.00 24.03           O  
ATOM   9168  NE2 GLN E  55      31.056 108.782  12.186  1.00 28.38           N  
ATOM   9169  N   LYS E  56      24.655 106.737  14.280  1.00 28.95           N  
ATOM   9170  CA  LYS E  56      23.822 106.229  15.367  1.00 27.91           C  
ATOM   9171  C   LYS E  56      23.041 105.034  14.891  1.00 28.38           C  
ATOM   9172  O   LYS E  56      22.654 104.193  15.688  1.00 27.33           O  
ATOM   9173  CB  LYS E  56      22.855 107.332  15.785  1.00 36.00           C  
ATOM   9174  CG  LYS E  56      22.130 107.139  17.097  1.00 46.58           C  
ATOM   9175  CD  LYS E  56      21.485 108.475  17.551  1.00 48.96           C  
ATOM   9176  CE  LYS E  56      20.628 108.261  18.794  1.00 60.66           C  
ATOM   9177  NZ  LYS E  56      20.189 109.543  19.451  1.00 63.48           N  
ATOM   9178  N   SER E  57      22.843 104.911  13.577  1.00 24.17           N  
ATOM   9179  CA  SER E  57      22.018 103.817  13.084  1.00 23.74           C  
ATOM   9180  C   SER E  57      22.797 102.739  12.374  1.00 23.24           C  
ATOM   9181  O   SER E  57      24.012 102.855  12.176  1.00 23.34           O  
ATOM   9182  CB  SER E  57      20.935 104.391  12.146  1.00 25.54           C  
ATOM   9183  OG  SER E  57      21.555 105.048  11.036  1.00 27.42           O  
ATOM   9184  N   THR E  58      22.112 101.674  11.995  1.00 23.17           N  
ATOM   9185  CA  THR E  58      22.801 100.597  11.331  1.00 25.84           C  
ATOM   9186  C   THR E  58      22.171 100.153  10.008  1.00 23.21           C  
ATOM   9187  O   THR E  58      22.664  99.243   9.398  1.00 22.95           O  
ATOM   9188  CB  THR E  58      22.860  99.353  12.235  1.00 25.34           C  
ATOM   9189  OG1 THR E  58      21.536  98.862  12.424  1.00 25.96           O  
ATOM   9190  CG2 THR E  58      23.441  99.716  13.623  1.00 30.11           C  
ATOM   9191  N   GLU E  59      21.044 100.722   9.607  1.00 24.23           N  
ATOM   9192  CA  GLU E  59      20.452 100.256   8.363  1.00 24.94           C  
ATOM   9193  C   GLU E  59      21.343 100.515   7.149  1.00 22.39           C  
ATOM   9194  O   GLU E  59      22.117 101.463   7.104  1.00 20.31           O  
ATOM   9195  CB  GLU E  59      19.094 100.900   8.135  1.00 28.75           C  
ATOM   9196  CG  GLU E  59      18.937 102.226   8.795  1.00 44.60           C  
ATOM   9197  CD  GLU E  59      19.393 103.342   7.935  1.00 43.18           C  
ATOM   9198  OE1 GLU E  59      19.335 103.135   6.714  1.00 51.51           O  
ATOM   9199  OE2 GLU E  59      19.779 104.410   8.460  1.00 38.20           O  
ATOM   9200  N   LEU E  60      21.234  99.647   6.167  1.00 20.90           N  
ATOM   9201  CA  LEU E  60      22.015  99.823   4.945  1.00 23.43           C  
ATOM   9202  C   LEU E  60      21.598 101.153   4.288  1.00 23.65           C  
ATOM   9203  O   LEU E  60      20.432 101.598   4.399  1.00 23.66           O  
ATOM   9204  CB  LEU E  60      21.782  98.604   4.061  1.00 21.97           C  
ATOM   9205  CG  LEU E  60      22.342  97.380   4.825  1.00 25.03           C  
ATOM   9206  CD1 LEU E  60      22.153  96.114   3.991  1.00 25.98           C  
ATOM   9207  CD2 LEU E  60      23.838  97.576   5.052  1.00 22.93           C  
ATOM   9208  N   LEU E  61      22.553 101.790   3.620  1.00 22.12           N  
ATOM   9209  CA  LEU E  61      22.368 103.108   3.025  1.00 19.33           C  
ATOM   9210  C   LEU E  61      22.207 103.145   1.496  1.00 21.70           C  
ATOM   9211  O   LEU E  61      21.789 104.164   0.952  1.00 20.82           O  
ATOM   9212  CB  LEU E  61      23.539 103.977   3.469  1.00 19.48           C  
ATOM   9213  CG  LEU E  61      23.678 104.016   5.021  1.00 20.46           C  
ATOM   9214  CD1 LEU E  61      25.014 104.730   5.400  1.00 21.86           C  
ATOM   9215  CD2 LEU E  61      22.473 104.768   5.637  1.00 22.80           C  
ATOM   9216  N   ILE E  62      22.553 102.047   0.817  1.00 21.21           N  
ATOM   9217  CA  ILE E  62      22.377 101.964  -0.640  1.00 23.05           C  
ATOM   9218  C   ILE E  62      20.996 101.298  -0.819  1.00 21.71           C  
ATOM   9219  O   ILE E  62      20.657 100.394  -0.077  1.00 17.96           O  
ATOM   9220  CB  ILE E  62      23.444 101.045  -1.304  1.00 21.37           C  
ATOM   9221  CG1 ILE E  62      24.857 101.660  -1.125  1.00 17.17           C  
ATOM   9222  CG2 ILE E  62      23.163 100.930  -2.867  1.00 19.97           C  
ATOM   9223  CD1 ILE E  62      25.981 100.707  -1.500  1.00 18.46           C  
ATOM   9224  N   ARG E  63      20.214 101.738  -1.798  1.00 24.09           N  
ATOM   9225  CA  ARG E  63      18.903 101.139  -2.063  1.00 25.76           C  
ATOM   9226  C   ARG E  63      19.119  99.679  -2.405  1.00 24.99           C  
ATOM   9227  O   ARG E  63      20.032  99.335  -3.166  1.00 23.37           O  
ATOM   9228  CB  ARG E  63      18.231 101.845  -3.242  1.00 27.41           C  
ATOM   9229  CG  ARG E  63      17.969 103.326  -3.009  1.00 34.30           C  
ATOM   9230  CD  ARG E  63      16.747 103.484  -2.156  1.00 41.20           C  
ATOM   9231  NE  ARG E  63      17.069 103.239  -0.763  1.00 51.41           N  
ATOM   9232  CZ  ARG E  63      16.250 102.685   0.117  1.00 55.83           C  
ATOM   9233  NH1 ARG E  63      15.043 102.298  -0.266  1.00 60.26           N  
ATOM   9234  NH2 ARG E  63      16.633 102.553   1.387  1.00 57.49           N  
ATOM   9235  N   LYS E  64      18.247  98.829  -1.889  1.00 22.79           N  
ATOM   9236  CA  LYS E  64      18.383  97.395  -2.078  1.00 26.71           C  
ATOM   9237  C   LYS E  64      18.251  96.820  -3.488  1.00 28.24           C  
ATOM   9238  O   LYS E  64      19.075  96.035  -3.921  1.00 25.31           O  
ATOM   9239  CB  LYS E  64      17.404  96.678  -1.140  1.00 32.48           C  
ATOM   9240  CG  LYS E  64      17.737  96.880   0.358  1.00 47.00           C  
ATOM   9241  CD  LYS E  64      16.831  95.988   1.237  1.00 52.12           C  
ATOM   9242  CE  LYS E  64      16.835  96.401   2.697  1.00 55.52           C  
ATOM   9243  NZ  LYS E  64      18.138  96.198   3.360  1.00 58.02           N  
ATOM   9244  N   LEU E  65      17.185  97.143  -4.197  1.00 27.29           N  
ATOM   9245  CA  LEU E  65      17.050  96.583  -5.547  1.00 25.45           C  
ATOM   9246  C   LEU E  65      18.191  97.070  -6.451  1.00 23.11           C  
ATOM   9247  O   LEU E  65      18.780  96.288  -7.164  1.00 25.35           O  
ATOM   9248  CB  LEU E  65      15.683  96.961  -6.142  1.00 28.89           C  
ATOM   9249  CG  LEU E  65      15.372  96.545  -7.597  1.00 28.66           C  
ATOM   9250  CD1 LEU E  65      15.510  95.049  -7.732  1.00 31.26           C  
ATOM   9251  CD2 LEU E  65      13.936  96.982  -7.952  1.00 28.94           C  
ATOM   9252  N   PRO E  66      18.498  98.378  -6.449  1.00 23.36           N  
ATOM   9253  CA  PRO E  66      19.587  98.823  -7.315  1.00 23.54           C  
ATOM   9254  C   PRO E  66      20.882  98.081  -6.997  1.00 26.95           C  
ATOM   9255  O   PRO E  66      21.625  97.730  -7.901  1.00 21.69           O  
ATOM   9256  CB  PRO E  66      19.688 100.310  -7.028  1.00 23.23           C  
ATOM   9257  CG  PRO E  66      18.252 100.690  -6.735  1.00 24.37           C  
ATOM   9258  CD  PRO E  66      17.803  99.526  -5.846  1.00 25.36           C  
ATOM   9259  N   PHE E  67      21.165  97.846  -5.713  1.00 25.54           N  
ATOM   9260  CA  PHE E  67      22.373  97.117  -5.390  1.00 25.61           C  
ATOM   9261  C   PHE E  67      22.250  95.665  -5.903  1.00 23.75           C  
ATOM   9262  O   PHE E  67      23.196  95.104  -6.436  1.00 20.02           O  
ATOM   9263  CB  PHE E  67      22.628  97.091  -3.887  1.00 22.85           C  
ATOM   9264  CG  PHE E  67      23.944  96.422  -3.520  1.00 22.25           C  
ATOM   9265  CD1 PHE E  67      25.136  97.139  -3.530  1.00 22.64           C  
ATOM   9266  CD2 PHE E  67      23.967  95.092  -3.129  1.00 22.98           C  
ATOM   9267  CE1 PHE E  67      26.365  96.516  -3.127  1.00 19.78           C  
ATOM   9268  CE2 PHE E  67      25.161  94.467  -2.736  1.00 18.14           C  
ATOM   9269  CZ  PHE E  67      26.367  95.192  -2.734  1.00 16.55           C  
ATOM   9270  N   GLN E  68      21.089  95.047  -5.741  1.00 19.85           N  
ATOM   9271  CA  GLN E  68      20.920  93.694  -6.242  1.00 23.80           C  
ATOM   9272  C   GLN E  68      21.167  93.595  -7.786  1.00 24.39           C  
ATOM   9273  O   GLN E  68      21.731  92.601  -8.282  1.00 21.76           O  
ATOM   9274  CB  GLN E  68      19.509  93.190  -5.921  1.00 28.33           C  
ATOM   9275  CG  GLN E  68      19.322  91.796  -6.418  1.00 40.68           C  
ATOM   9276  CD  GLN E  68      18.094  91.154  -5.861  1.00 49.09           C  
ATOM   9277  OE1 GLN E  68      16.975  91.495  -6.244  1.00 52.69           O  
ATOM   9278  NE2 GLN E  68      18.288  90.221  -4.930  1.00 52.90           N  
ATOM   9279  N   ARG E  69      20.746  94.611  -8.533  1.00 23.60           N  
ATOM   9280  CA  ARG E  69      20.944  94.611  -9.993  1.00 25.78           C  
ATOM   9281  C   ARG E  69      22.432  94.746 -10.313  1.00 25.42           C  
ATOM   9282  O   ARG E  69      22.945  94.133 -11.256  1.00 24.52           O  
ATOM   9283  CB  ARG E  69      20.228  95.787 -10.665  1.00 24.66           C  
ATOM   9284  CG  ARG E  69      18.699  95.724 -10.763  1.00 27.83           C  
ATOM   9285  CD  ARG E  69      18.262  96.991 -11.600  1.00 33.53           C  
ATOM   9286  NE  ARG E  69      17.028  97.576 -11.093  1.00 44.99           N  
ATOM   9287  CZ  ARG E  69      16.917  98.825 -10.658  1.00 40.64           C  
ATOM   9288  NH1 ARG E  69      17.947  99.651 -10.647  1.00 35.09           N  
ATOM   9289  NH2 ARG E  69      15.756  99.254 -10.251  1.00 47.43           N  
ATOM   9290  N   LEU E  70      23.119  95.592  -9.560  1.00 21.56           N  
ATOM   9291  CA  LEU E  70      24.549  95.736  -9.805  1.00 22.14           C  
ATOM   9292  C   LEU E  70      25.239  94.384  -9.564  1.00 21.81           C  
ATOM   9293  O   LEU E  70      26.081  93.959 -10.359  1.00 21.44           O  
ATOM   9294  CB  LEU E  70      25.141  96.819  -8.898  1.00 23.31           C  
ATOM   9295  CG  LEU E  70      26.649  96.968  -9.008  1.00 24.17           C  
ATOM   9296  CD1 LEU E  70      27.001  97.311 -10.492  1.00 20.95           C  
ATOM   9297  CD2 LEU E  70      27.131  98.066  -8.050  1.00 24.23           C  
ATOM   9298  N   VAL E  71      24.880  93.704  -8.470  1.00 21.17           N  
ATOM   9299  CA  VAL E  71      25.459  92.407  -8.165  1.00 21.44           C  
ATOM   9300  C   VAL E  71      25.179  91.431  -9.328  1.00 24.07           C  
ATOM   9301  O   VAL E  71      26.077  90.769  -9.788  1.00 21.23           O  
ATOM   9302  CB  VAL E  71      24.879  91.810  -6.860  1.00 23.20           C  
ATOM   9303  CG1 VAL E  71      25.185  90.322  -6.764  1.00 18.65           C  
ATOM   9304  CG2 VAL E  71      25.507  92.548  -5.653  1.00 21.25           C  
ATOM   9305  N   ARG E  72      23.926  91.353  -9.771  1.00 24.48           N  
ATOM   9306  CA  ARG E  72      23.563  90.474 -10.873  1.00 26.21           C  
ATOM   9307  C   ARG E  72      24.267  90.816 -12.200  1.00 23.01           C  
ATOM   9308  O   ARG E  72      24.672  89.923 -12.946  1.00 29.24           O  
ATOM   9309  CB  ARG E  72      22.044  90.473 -11.055  1.00 25.55           C  
ATOM   9310  CG  ARG E  72      21.334  89.638  -9.983  1.00 30.82           C  
ATOM   9311  CD  ARG E  72      19.815  89.685 -10.137  1.00 34.46           C  
ATOM   9312  NE  ARG E  72      19.136  89.235  -8.930  1.00 37.82           N  
ATOM   9313  CZ  ARG E  72      18.975  87.962  -8.577  1.00 40.49           C  
ATOM   9314  NH1 ARG E  72      19.440  86.972  -9.342  1.00 30.28           N  
ATOM   9315  NH2 ARG E  72      18.349  87.685  -7.438  1.00 42.97           N  
ATOM   9316  N   GLU E  73      24.415  92.095 -12.486  1.00 24.15           N  
ATOM   9317  CA  GLU E  73      25.085  92.520 -13.702  1.00 24.23           C  
ATOM   9318  C   GLU E  73      26.528  92.055 -13.672  1.00 25.98           C  
ATOM   9319  O   GLU E  73      27.055  91.451 -14.619  1.00 26.23           O  
ATOM   9320  CB  GLU E  73      25.073  94.024 -13.808  1.00 24.43           C  
ATOM   9321  CG  GLU E  73      25.817  94.570 -15.028  1.00 20.82           C  
ATOM   9322  CD  GLU E  73      25.726  96.064 -15.093  1.00 24.61           C  
ATOM   9323  OE1 GLU E  73      24.588  96.575 -15.006  1.00 23.58           O  
ATOM   9324  OE2 GLU E  73      26.754  96.739 -15.258  1.00 23.16           O  
ATOM   9325  N   ILE E  74      27.196  92.371 -12.585  1.00 25.19           N  
ATOM   9326  CA  ILE E  74      28.588  91.970 -12.460  1.00 21.89           C  
ATOM   9327  C   ILE E  74      28.741  90.477 -12.510  1.00 21.08           C  
ATOM   9328  O   ILE E  74      29.604  89.976 -13.234  1.00 23.30           O  
ATOM   9329  CB  ILE E  74      29.207  92.507 -11.134  1.00 23.83           C  
ATOM   9330  CG1 ILE E  74      29.360  94.022 -11.239  1.00 24.16           C  
ATOM   9331  CG2 ILE E  74      30.572  91.806 -10.857  1.00 19.66           C  
ATOM   9332  CD1 ILE E  74      29.590  94.768  -9.879  1.00 26.00           C  
ATOM   9333  N   ALA E  75      27.939  89.752 -11.731  1.00 21.38           N  
ATOM   9334  CA  ALA E  75      28.040  88.293 -11.708  1.00 21.50           C  
ATOM   9335  C   ALA E  75      27.790  87.698 -13.093  1.00 26.03           C  
ATOM   9336  O   ALA E  75      28.466  86.760 -13.500  1.00 24.28           O  
ATOM   9337  CB  ALA E  75      27.039  87.705 -10.756  1.00 20.04           C  
ATOM   9338  N   GLN E  76      26.803  88.244 -13.784  1.00 23.83           N  
ATOM   9339  CA  GLN E  76      26.438  87.773 -15.115  1.00 27.95           C  
ATOM   9340  C   GLN E  76      27.601  87.890 -16.095  1.00 27.19           C  
ATOM   9341  O   GLN E  76      27.793  86.995 -16.929  1.00 27.18           O  
ATOM   9342  CB  GLN E  76      25.227  88.560 -15.602  1.00 29.37           C  
ATOM   9343  CG  GLN E  76      24.786  88.312 -17.053  1.00 33.22           C  
ATOM   9344  CD  GLN E  76      23.520  89.093 -17.318  1.00 30.18           C  
ATOM   9345  OE1 GLN E  76      23.540  90.299 -17.330  1.00 28.76           O  
ATOM   9346  NE2 GLN E  76      22.408  88.398 -17.474  1.00 33.00           N  
ATOM   9347  N   ASP E  77      28.378  88.967 -16.002  1.00 26.14           N  
ATOM   9348  CA  ASP E  77      29.538  89.102 -16.884  1.00 27.95           C  
ATOM   9349  C   ASP E  77      30.623  88.065 -16.548  1.00 32.51           C  
ATOM   9350  O   ASP E  77      31.511  87.788 -17.369  1.00 30.90           O  
ATOM   9351  CB  ASP E  77      30.143  90.507 -16.812  1.00 26.85           C  
ATOM   9352  CG  ASP E  77      29.235  91.585 -17.442  1.00 29.25           C  
ATOM   9353  OD1 ASP E  77      28.457  91.275 -18.381  1.00 25.46           O  
ATOM   9354  OD2 ASP E  77      29.355  92.737 -16.979  1.00 28.80           O  
ATOM   9355  N   PHE E  78      30.587  87.519 -15.334  1.00 28.76           N  
ATOM   9356  CA  PHE E  78      31.555  86.501 -14.952  1.00 33.67           C  
ATOM   9357  C   PHE E  78      31.060  85.147 -15.412  1.00 32.62           C  
ATOM   9358  O   PHE E  78      31.830  84.351 -15.945  1.00 31.17           O  
ATOM   9359  CB  PHE E  78      31.729  86.414 -13.431  1.00 38.06           C  
ATOM   9360  CG  PHE E  78      32.682  87.412 -12.874  1.00 42.81           C  
ATOM   9361  CD1 PHE E  78      32.359  88.127 -11.728  1.00 38.64           C  
ATOM   9362  CD2 PHE E  78      33.915  87.629 -13.476  1.00 41.86           C  
ATOM   9363  CE1 PHE E  78      33.252  89.047 -11.182  1.00 38.70           C  
ATOM   9364  CE2 PHE E  78      34.811  88.557 -12.926  1.00 47.26           C  
ATOM   9365  CZ  PHE E  78      34.460  89.266 -11.764  1.00 38.29           C  
ATOM   9366  N   LYS E  79      29.771  84.899 -15.213  1.00 29.75           N  
ATOM   9367  CA  LYS E  79      29.189  83.605 -15.546  1.00 33.26           C  
ATOM   9368  C   LYS E  79      27.701  83.769 -15.796  1.00 33.83           C  
ATOM   9369  O   LYS E  79      26.986  84.328 -14.963  1.00 32.86           O  
ATOM   9370  CB  LYS E  79      29.403  82.651 -14.364  1.00 36.72           C  
ATOM   9371  CG  LYS E  79      29.482  81.196 -14.735  1.00 45.75           C  
ATOM   9372  CD  LYS E  79      28.167  80.669 -15.190  1.00 51.11           C  
ATOM   9373  CE  LYS E  79      28.305  79.232 -15.682  1.00 50.21           C  
ATOM   9374  NZ  LYS E  79      27.073  78.912 -16.434  1.00 53.49           N  
ATOM   9375  N   THR E  80      27.212  83.257 -16.921  1.00 32.95           N  
ATOM   9376  CA  THR E  80      25.794  83.416 -17.247  1.00 32.12           C  
ATOM   9377  C   THR E  80      24.920  82.429 -16.508  1.00 31.49           C  
ATOM   9378  O   THR E  80      25.397  81.420 -16.016  1.00 38.41           O  
ATOM   9379  CB  THR E  80      25.520  83.199 -18.774  1.00 37.97           C  
ATOM   9380  OG1 THR E  80      25.908  81.870 -19.134  1.00 35.26           O  
ATOM   9381  CG2 THR E  80      26.316  84.185 -19.621  1.00 39.07           C  
ATOM   9382  N   ASP E  81      23.636  82.742 -16.423  1.00 32.57           N  
ATOM   9383  CA  ASP E  81      22.649  81.874 -15.817  1.00 37.16           C  
ATOM   9384  C   ASP E  81      22.806  81.535 -14.340  1.00 38.74           C  
ATOM   9385  O   ASP E  81      22.436  80.439 -13.893  1.00 38.83           O  
ATOM   9386  CB  ASP E  81      22.565  80.588 -16.648  1.00 44.59           C  
ATOM   9387  CG  ASP E  81      22.487  80.880 -18.135  1.00 51.73           C  
ATOM   9388  OD1 ASP E  81      23.443  80.523 -18.871  1.00 55.57           O  
ATOM   9389  OD2 ASP E  81      21.477  81.493 -18.557  1.00 53.40           O  
ATOM   9390  N   LEU E  82      23.326  82.471 -13.560  1.00 35.16           N  
ATOM   9391  CA  LEU E  82      23.470  82.198 -12.138  1.00 34.79           C  
ATOM   9392  C   LEU E  82      22.222  82.630 -11.407  1.00 31.04           C  
ATOM   9393  O   LEU E  82      21.536  83.555 -11.824  1.00 33.04           O  
ATOM   9394  CB  LEU E  82      24.634  82.981 -11.554  1.00 29.91           C  
ATOM   9395  CG  LEU E  82      26.066  82.590 -11.910  1.00 29.11           C  
ATOM   9396  CD1 LEU E  82      26.968  83.735 -11.452  1.00 30.14           C  
ATOM   9397  CD2 LEU E  82      26.459  81.283 -11.240  1.00 26.87           C  
ATOM   9398  N   ARG E  83      21.932  81.957 -10.310  1.00 30.55           N  
ATOM   9399  CA  ARG E  83      20.823  82.361  -9.453  1.00 31.66           C  
ATOM   9400  C   ARG E  83      21.524  82.808  -8.128  1.00 29.97           C  
ATOM   9401  O   ARG E  83      22.696  82.492  -7.930  1.00 26.96           O  
ATOM   9402  CB  ARG E  83      19.895  81.177  -9.185  1.00 33.11           C  
ATOM   9403  CG  ARG E  83      18.992  80.827 -10.373  1.00 41.18           C  
ATOM   9404  CD  ARG E  83      17.988  79.757  -9.960  1.00 45.44           C  
ATOM   9405  NE  ARG E  83      16.866  79.735 -10.885  1.00 58.45           N  
ATOM   9406  CZ  ARG E  83      15.598  79.573 -10.522  1.00 58.63           C  
ATOM   9407  NH1 ARG E  83      15.278  79.416  -9.245  1.00 59.51           N  
ATOM   9408  NH2 ARG E  83      14.651  79.572 -11.446  1.00 65.03           N  
ATOM   9409  N   PHE E  84      20.811  83.521  -7.256  1.00 26.87           N  
ATOM   9410  CA  PHE E  84      21.362  84.017  -5.982  1.00 30.29           C  
ATOM   9411  C   PHE E  84      20.389  83.806  -4.842  1.00 28.29           C  
ATOM   9412  O   PHE E  84      19.195  84.093  -4.985  1.00 30.67           O  
ATOM   9413  CB  PHE E  84      21.624  85.557  -5.999  1.00 26.09           C  
ATOM   9414  CG  PHE E  84      22.935  85.964  -6.620  1.00 24.22           C  
ATOM   9415  CD1 PHE E  84      23.072  86.062  -8.017  1.00 26.78           C  
ATOM   9416  CD2 PHE E  84      24.039  86.237  -5.820  1.00 24.10           C  
ATOM   9417  CE1 PHE E  84      24.278  86.419  -8.601  1.00 25.01           C  
ATOM   9418  CE2 PHE E  84      25.281  86.601  -6.388  1.00 24.54           C  
ATOM   9419  CZ  PHE E  84      25.399  86.690  -7.786  1.00 27.17           C  
ATOM   9420  N   GLN E  85      20.889  83.306  -3.718  1.00 27.11           N  
ATOM   9421  CA  GLN E  85      20.042  83.178  -2.525  1.00 28.71           C  
ATOM   9422  C   GLN E  85      19.892  84.619  -2.101  1.00 27.46           C  
ATOM   9423  O   GLN E  85      20.844  85.380  -2.243  1.00 24.81           O  
ATOM   9424  CB  GLN E  85      20.778  82.422  -1.407  1.00 27.88           C  
ATOM   9425  CG  GLN E  85      20.976  80.942  -1.680  1.00 30.68           C  
ATOM   9426  CD  GLN E  85      21.482  80.204  -0.456  1.00 33.71           C  
ATOM   9427  OE1 GLN E  85      22.206  80.779   0.375  1.00 31.00           O  
ATOM   9428  NE2 GLN E  85      21.128  78.912  -0.344  1.00 33.51           N  
ATOM   9429  N   SER E  86      18.740  85.009  -1.577  1.00 27.25           N  
ATOM   9430  CA  SER E  86      18.563  86.401  -1.169  1.00 27.56           C  
ATOM   9431  C   SER E  86      19.593  86.795  -0.088  1.00 25.85           C  
ATOM   9432  O   SER E  86      20.089  87.904  -0.102  1.00 25.87           O  
ATOM   9433  CB  SER E  86      17.149  86.642  -0.633  1.00 27.56           C  
ATOM   9434  OG  SER E  86      17.004  85.924   0.578  1.00 38.16           O  
ATOM   9435  N   SER E  87      19.894  85.912   0.850  1.00 24.80           N  
ATOM   9436  CA  SER E  87      20.898  86.248   1.865  1.00 26.64           C  
ATOM   9437  C   SER E  87      22.303  86.421   1.259  1.00 23.93           C  
ATOM   9438  O   SER E  87      23.141  87.064   1.875  1.00 23.47           O  
ATOM   9439  CB  SER E  87      20.970  85.177   2.963  1.00 24.11           C  
ATOM   9440  OG  SER E  87      21.333  83.946   2.387  1.00 35.09           O  
ATOM   9441  N   ALA E  88      22.568  85.846   0.079  1.00 22.95           N  
ATOM   9442  CA  ALA E  88      23.884  86.026  -0.548  1.00 22.40           C  
ATOM   9443  C   ALA E  88      23.993  87.470  -1.013  1.00 23.47           C  
ATOM   9444  O   ALA E  88      25.054  88.097  -0.906  1.00 19.96           O  
ATOM   9445  CB  ALA E  88      24.084  85.070  -1.757  1.00 23.25           C  
ATOM   9446  N   VAL E  89      22.900  88.022  -1.520  1.00 19.39           N  
ATOM   9447  CA  VAL E  89      22.949  89.415  -1.960  1.00 21.32           C  
ATOM   9448  C   VAL E  89      23.040  90.351  -0.752  1.00 20.73           C  
ATOM   9449  O   VAL E  89      23.683  91.381  -0.841  1.00 21.90           O  
ATOM   9450  CB  VAL E  89      21.705  89.821  -2.797  1.00 20.74           C  
ATOM   9451  CG1 VAL E  89      21.780  91.285  -3.195  1.00 19.25           C  
ATOM   9452  CG2 VAL E  89      21.605  88.953  -4.027  1.00 26.29           C  
ATOM   9453  N   MET E  90      22.340  90.031   0.342  1.00 20.76           N  
ATOM   9454  CA  MET E  90      22.393  90.871   1.547  1.00 22.29           C  
ATOM   9455  C   MET E  90      23.796  90.809   2.165  1.00 20.97           C  
ATOM   9456  O   MET E  90      24.306  91.802   2.668  1.00 21.86           O  
ATOM   9457  CB  MET E  90      21.363  90.393   2.573  1.00 23.17           C  
ATOM   9458  CG  MET E  90      19.909  90.585   2.115  1.00 32.25           C  
ATOM   9459  SD  MET E  90      19.598  92.190   1.258  1.00 44.17           S  
ATOM   9460  CE  MET E  90      20.079  93.371   2.565  1.00 37.09           C  
ATOM   9461  N   ALA E  91      24.411  89.627   2.129  1.00 21.13           N  
ATOM   9462  CA  ALA E  91      25.769  89.476   2.650  1.00 21.33           C  
ATOM   9463  C   ALA E  91      26.721  90.378   1.851  1.00 22.10           C  
ATOM   9464  O   ALA E  91      27.570  91.062   2.417  1.00 20.91           O  
ATOM   9465  CB  ALA E  91      26.214  88.014   2.563  1.00 18.99           C  
ATOM   9466  N   LEU E  92      26.584  90.381   0.531  1.00 19.20           N  
ATOM   9467  CA  LEU E  92      27.436  91.226  -0.302  1.00 19.34           C  
ATOM   9468  C   LEU E  92      27.158  92.676   0.031  1.00 19.25           C  
ATOM   9469  O   LEU E  92      28.086  93.499   0.099  1.00 17.15           O  
ATOM   9470  CB  LEU E  92      27.165  90.983  -1.810  1.00 19.25           C  
ATOM   9471  CG  LEU E  92      27.721  89.662  -2.374  1.00 20.70           C  
ATOM   9472  CD1 LEU E  92      27.096  89.325  -3.739  1.00 21.68           C  
ATOM   9473  CD2 LEU E  92      29.239  89.841  -2.551  1.00 18.18           C  
ATOM   9474  N   GLN E  93      25.899  93.016   0.301  1.00 15.58           N  
ATOM   9475  CA  GLN E  93      25.624  94.414   0.600  1.00 17.68           C  
ATOM   9476  C   GLN E  93      26.185  94.855   1.953  1.00 17.18           C  
ATOM   9477  O   GLN E  93      26.724  95.948   2.061  1.00 19.20           O  
ATOM   9478  CB  GLN E  93      24.112  94.743   0.582  1.00 19.72           C  
ATOM   9479  CG  GLN E  93      23.956  96.246   0.442  1.00 18.44           C  
ATOM   9480  CD  GLN E  93      22.538  96.715   0.207  1.00 25.51           C  
ATOM   9481  OE1 GLN E  93      21.650  95.931  -0.200  1.00 21.68           O  
ATOM   9482  NE2 GLN E  93      22.308  98.019   0.451  1.00 20.65           N  
ATOM   9483  N   GLU E  94      26.027  94.021   2.979  1.00 20.83           N  
ATOM   9484  CA  GLU E  94      26.573  94.345   4.309  1.00 19.80           C  
ATOM   9485  C   GLU E  94      28.077  94.500   4.192  1.00 19.28           C  
ATOM   9486  O   GLU E  94      28.651  95.490   4.680  1.00 17.87           O  
ATOM   9487  CB  GLU E  94      26.252  93.234   5.304  1.00 18.65           C  
ATOM   9488  CG  GLU E  94      24.784  93.210   5.686  1.00 18.31           C  
ATOM   9489  CD  GLU E  94      24.453  94.224   6.745  1.00 27.03           C  
ATOM   9490  OE1 GLU E  94      25.398  94.800   7.357  1.00 24.46           O  
ATOM   9491  OE2 GLU E  94      23.234  94.437   6.978  1.00 28.18           O  
ATOM   9492  N   ALA E  95      28.719  93.561   3.503  1.00 17.36           N  
ATOM   9493  CA  ALA E  95      30.177  93.688   3.330  1.00 18.03           C  
ATOM   9494  C   ALA E  95      30.603  94.890   2.501  1.00 19.20           C  
ATOM   9495  O   ALA E  95      31.600  95.537   2.828  1.00 17.77           O  
ATOM   9496  CB  ALA E  95      30.742  92.429   2.722  1.00 16.81           C  
ATOM   9497  N   SER E  96      29.866  95.205   1.419  1.00 19.93           N  
ATOM   9498  CA  SER E  96      30.240  96.342   0.569  1.00 18.13           C  
ATOM   9499  C   SER E  96      30.066  97.650   1.312  1.00 16.34           C  
ATOM   9500  O   SER E  96      30.908  98.544   1.220  1.00 17.02           O  
ATOM   9501  CB  SER E  96      29.415  96.373  -0.755  1.00 19.35           C  
ATOM   9502  OG  SER E  96      29.588  95.165  -1.515  1.00 22.53           O  
ATOM   9503  N   GLU E  97      28.966  97.798   2.053  1.00 16.73           N  
ATOM   9504  CA  GLU E  97      28.801  99.037   2.796  1.00 15.95           C  
ATOM   9505  C   GLU E  97      29.835  99.175   3.930  1.00 16.05           C  
ATOM   9506  O   GLU E  97      30.338 100.268   4.150  1.00 17.00           O  
ATOM   9507  CB  GLU E  97      27.352  99.164   3.337  1.00 17.06           C  
ATOM   9508  CG  GLU E  97      26.341  99.313   2.148  1.00 17.18           C  
ATOM   9509  CD  GLU E  97      25.024  99.965   2.548  1.00 24.93           C  
ATOM   9510  OE1 GLU E  97      24.961 100.644   3.617  1.00 19.62           O  
ATOM   9511  OE2 GLU E  97      24.070  99.820   1.764  1.00 24.13           O  
ATOM   9512  N   ALA E  98      30.162  98.092   4.632  1.00 16.33           N  
ATOM   9513  CA  ALA E  98      31.140  98.223   5.713  1.00 17.42           C  
ATOM   9514  C   ALA E  98      32.447  98.627   5.105  1.00 19.60           C  
ATOM   9515  O   ALA E  98      33.169  99.441   5.666  1.00 19.84           O  
ATOM   9516  CB  ALA E  98      31.320  96.885   6.474  1.00 16.77           C  
ATOM   9517  N   TYR E  99      32.761  98.047   3.943  1.00 19.16           N  
ATOM   9518  CA  TYR E  99      34.006  98.359   3.275  1.00 16.74           C  
ATOM   9519  C   TYR E  99      34.023  99.835   2.906  1.00 16.61           C  
ATOM   9520  O   TYR E  99      34.980 100.547   3.221  1.00 18.04           O  
ATOM   9521  CB  TYR E  99      34.172  97.475   2.013  1.00 19.82           C  
ATOM   9522  CG  TYR E  99      35.261  97.952   1.069  1.00 19.99           C  
ATOM   9523  CD1 TYR E  99      36.611  97.698   1.334  1.00 21.20           C  
ATOM   9524  CD2 TYR E  99      34.931  98.715  -0.081  1.00 24.56           C  
ATOM   9525  CE1 TYR E  99      37.645  98.225   0.475  1.00 21.23           C  
ATOM   9526  CE2 TYR E  99      35.920  99.216  -0.932  1.00 19.83           C  
ATOM   9527  CZ  TYR E  99      37.273  98.980  -0.646  1.00 25.75           C  
ATOM   9528  OH  TYR E  99      38.227  99.501  -1.494  1.00 23.69           O  
ATOM   9529  N   LEU E 100      32.949 100.336   2.299  1.00 16.08           N  
ATOM   9530  CA  LEU E 100      32.950 101.748   1.889  1.00 17.19           C  
ATOM   9531  C   LEU E 100      32.971 102.749   3.061  1.00 15.72           C  
ATOM   9532  O   LEU E 100      33.635 103.799   2.999  1.00 18.67           O  
ATOM   9533  CB  LEU E 100      31.735 102.027   0.978  1.00 18.28           C  
ATOM   9534  CG  LEU E 100      31.795 101.365  -0.441  1.00 22.64           C  
ATOM   9535  CD1 LEU E 100      30.551 101.798  -1.285  1.00 17.85           C  
ATOM   9536  CD2 LEU E 100      33.100 101.852  -1.192  1.00 17.44           C  
ATOM   9537  N   VAL E 101      32.216 102.456   4.104  1.00 17.75           N  
ATOM   9538  CA  VAL E 101      32.205 103.359   5.266  1.00 17.67           C  
ATOM   9539  C   VAL E 101      33.609 103.473   5.848  1.00 14.79           C  
ATOM   9540  O   VAL E 101      34.106 104.585   6.135  1.00 16.66           O  
ATOM   9541  CB  VAL E 101      31.210 102.836   6.338  1.00 15.29           C  
ATOM   9542  CG1 VAL E 101      31.402 103.568   7.677  1.00 15.18           C  
ATOM   9543  CG2 VAL E 101      29.799 103.082   5.826  1.00 18.40           C  
ATOM   9544  N   ALA E 102      34.261 102.321   6.029  1.00 18.40           N  
ATOM   9545  CA  ALA E 102      35.639 102.292   6.579  1.00 19.60           C  
ATOM   9546  C   ALA E 102      36.620 102.974   5.616  1.00 20.28           C  
ATOM   9547  O   ALA E 102      37.576 103.633   6.055  1.00 20.29           O  
ATOM   9548  CB  ALA E 102      36.078 100.813   6.879  1.00 16.61           C  
ATOM   9549  N   LEU E 103      36.406 102.839   4.300  1.00 19.03           N  
ATOM   9550  CA  LEU E 103      37.299 103.530   3.361  1.00 15.42           C  
ATOM   9551  C   LEU E 103      37.050 105.064   3.474  1.00 15.09           C  
ATOM   9552  O   LEU E 103      37.964 105.857   3.423  1.00 17.00           O  
ATOM   9553  CB  LEU E 103      37.032 103.055   1.911  1.00 16.03           C  
ATOM   9554  CG  LEU E 103      37.775 103.815   0.838  1.00 18.40           C  
ATOM   9555  CD1 LEU E 103      39.255 103.536   1.009  1.00 19.62           C  
ATOM   9556  CD2 LEU E 103      37.286 103.324  -0.583  1.00 17.41           C  
ATOM   9557  N   PHE E 104      35.803 105.495   3.641  1.00 17.40           N  
ATOM   9558  CA  PHE E 104      35.557 106.952   3.765  1.00 17.36           C  
ATOM   9559  C   PHE E 104      36.181 107.487   5.046  1.00 18.85           C  
ATOM   9560  O   PHE E 104      36.608 108.656   5.094  1.00 22.59           O  
ATOM   9561  CB  PHE E 104      34.048 107.280   3.765  1.00 15.91           C  
ATOM   9562  CG  PHE E 104      33.443 107.307   2.385  1.00 17.91           C  
ATOM   9563  CD1 PHE E 104      32.326 106.521   2.065  1.00 17.26           C  
ATOM   9564  CD2 PHE E 104      34.007 108.096   1.400  1.00 18.58           C  
ATOM   9565  CE1 PHE E 104      31.806 106.530   0.766  1.00 17.41           C  
ATOM   9566  CE2 PHE E 104      33.485 108.112   0.076  1.00 18.10           C  
ATOM   9567  CZ  PHE E 104      32.390 107.326  -0.225  1.00 18.14           C  
ATOM   9568  N   GLU E 105      36.253 106.660   6.087  1.00 17.24           N  
ATOM   9569  CA  GLU E 105      36.892 107.131   7.334  1.00 18.05           C  
ATOM   9570  C   GLU E 105      38.361 107.406   7.010  1.00 19.00           C  
ATOM   9571  O   GLU E 105      38.891 108.463   7.350  1.00 19.36           O  
ATOM   9572  CB  GLU E 105      36.822 106.070   8.450  1.00 18.46           C  
ATOM   9573  CG  GLU E 105      35.408 105.816   9.023  1.00 27.88           C  
ATOM   9574  CD  GLU E 105      35.308 104.489   9.818  1.00 32.39           C  
ATOM   9575  OE1 GLU E 105      36.337 103.787   9.965  1.00 30.45           O  
ATOM   9576  OE2 GLU E 105      34.202 104.153  10.276  1.00 32.44           O  
ATOM   9577  N   ASP E 106      39.020 106.468   6.330  1.00 18.67           N  
ATOM   9578  CA  ASP E 106      40.450 106.636   5.995  1.00 18.55           C  
ATOM   9579  C   ASP E 106      40.648 107.840   5.040  1.00 18.56           C  
ATOM   9580  O   ASP E 106      41.577 108.620   5.178  1.00 20.01           O  
ATOM   9581  CB  ASP E 106      40.981 105.348   5.346  1.00 18.28           C  
ATOM   9582  CG  ASP E 106      41.058 104.183   6.323  1.00 23.10           C  
ATOM   9583  OD1 ASP E 106      40.897 104.409   7.533  1.00 24.53           O  
ATOM   9584  OD2 ASP E 106      41.291 103.047   5.889  1.00 24.63           O  
ATOM   9585  N   THR E 107      39.737 107.962   4.069  1.00 20.26           N  
ATOM   9586  CA  THR E 107      39.762 109.040   3.090  1.00 16.56           C  
ATOM   9587  C   THR E 107      39.674 110.367   3.831  1.00 17.45           C  
ATOM   9588  O   THR E 107      40.372 111.332   3.529  1.00 19.73           O  
ATOM   9589  CB  THR E 107      38.524 108.859   2.137  1.00 20.15           C  
ATOM   9590  OG1 THR E 107      38.668 107.613   1.444  1.00 18.12           O  
ATOM   9591  CG2 THR E 107      38.414 109.980   1.130  1.00 21.66           C  
ATOM   9592  N   ASN E 108      38.764 110.431   4.794  1.00 18.50           N  
ATOM   9593  CA  ASN E 108      38.575 111.639   5.579  1.00 18.45           C  
ATOM   9594  C   ASN E 108      39.878 112.011   6.294  1.00 24.42           C  
ATOM   9595  O   ASN E 108      40.276 113.197   6.356  1.00 21.11           O  
ATOM   9596  CB  ASN E 108      37.477 111.385   6.638  1.00 20.58           C  
ATOM   9597  CG  ASN E 108      36.804 112.669   7.097  1.00 23.01           C  
ATOM   9598  OD1 ASN E 108      36.733 113.656   6.341  1.00 26.09           O  
ATOM   9599  ND2 ASN E 108      36.275 112.651   8.306  1.00 24.76           N  
ATOM   9600  N   LEU E 109      40.530 111.000   6.868  1.00 20.90           N  
ATOM   9601  CA  LEU E 109      41.770 111.275   7.566  1.00 20.46           C  
ATOM   9602  C   LEU E 109      42.789 111.840   6.568  1.00 22.50           C  
ATOM   9603  O   LEU E 109      43.581 112.706   6.928  1.00 20.32           O  
ATOM   9604  CB  LEU E 109      42.288 109.988   8.221  1.00 20.29           C  
ATOM   9605  CG  LEU E 109      41.485 109.503   9.426  1.00 23.88           C  
ATOM   9606  CD1 LEU E 109      42.164 108.212   9.964  1.00 26.96           C  
ATOM   9607  CD2 LEU E 109      41.449 110.599  10.512  1.00 24.98           C  
ATOM   9608  N   CYS E 110      42.777 111.346   5.325  1.00 19.80           N  
ATOM   9609  CA  CYS E 110      43.706 111.847   4.312  1.00 22.52           C  
ATOM   9610  C   CYS E 110      43.424 113.304   3.923  1.00 22.57           C  
ATOM   9611  O   CYS E 110      44.340 114.065   3.712  1.00 21.92           O  
ATOM   9612  CB  CYS E 110      43.698 110.957   3.072  1.00 16.17           C  
ATOM   9613  SG  CYS E 110      44.412 109.319   3.453  1.00 21.92           S  
ATOM   9614  N   ALA E 111      42.163 113.674   3.829  1.00 23.67           N  
ATOM   9615  CA  ALA E 111      41.813 115.056   3.503  1.00 23.11           C  
ATOM   9616  C   ALA E 111      42.257 115.962   4.654  1.00 22.70           C  
ATOM   9617  O   ALA E 111      42.873 116.996   4.438  1.00 25.99           O  
ATOM   9618  CB  ALA E 111      40.312 115.163   3.308  1.00 25.01           C  
ATOM   9619  N   ILE E 112      41.933 115.572   5.880  1.00 22.19           N  
ATOM   9620  CA  ILE E 112      42.289 116.351   7.065  1.00 24.24           C  
ATOM   9621  C   ILE E 112      43.796 116.486   7.176  1.00 26.54           C  
ATOM   9622  O   ILE E 112      44.308 117.513   7.584  1.00 27.91           O  
ATOM   9623  CB  ILE E 112      41.726 115.693   8.334  1.00 25.04           C  
ATOM   9624  CG1 ILE E 112      40.203 115.896   8.368  1.00 21.98           C  
ATOM   9625  CG2 ILE E 112      42.348 116.318   9.594  1.00 24.41           C  
ATOM   9626  CD1 ILE E 112      39.515 114.939   9.404  1.00 24.79           C  
ATOM   9627  N   HIS E 113      44.502 115.445   6.772  1.00 23.16           N  
ATOM   9628  CA  HIS E 113      45.952 115.456   6.799  1.00 25.97           C  
ATOM   9629  C   HIS E 113      46.437 116.585   5.882  1.00 28.83           C  
ATOM   9630  O   HIS E 113      47.446 117.225   6.154  1.00 31.62           O  
ATOM   9631  CB  HIS E 113      46.495 114.114   6.295  1.00 23.24           C  
ATOM   9632  CG  HIS E 113      47.977 113.973   6.447  1.00 22.97           C  
ATOM   9633  ND1 HIS E 113      48.590 113.891   7.678  1.00 21.63           N  
ATOM   9634  CD2 HIS E 113      48.975 113.959   5.528  1.00 23.51           C  
ATOM   9635  CE1 HIS E 113      49.903 113.841   7.516  1.00 22.25           C  
ATOM   9636  NE2 HIS E 113      50.162 113.882   6.219  1.00 23.20           N  
ATOM   9637  N   ALA E 114      45.712 116.821   4.789  1.00 26.97           N  
ATOM   9638  CA  ALA E 114      46.105 117.858   3.854  1.00 28.91           C  
ATOM   9639  C   ALA E 114      45.489 119.216   4.222  1.00 29.12           C  
ATOM   9640  O   ALA E 114      45.459 120.124   3.398  1.00 29.44           O  
ATOM   9641  CB  ALA E 114      45.691 117.459   2.436  1.00 27.75           C  
ATOM   9642  N   LYS E 115      44.992 119.346   5.447  1.00 30.64           N  
ATOM   9643  CA  LYS E 115      44.385 120.592   5.896  1.00 32.74           C  
ATOM   9644  C   LYS E 115      43.084 120.938   5.183  1.00 32.05           C  
ATOM   9645  O   LYS E 115      42.676 122.107   5.093  1.00 33.27           O  
ATOM   9646  CB  LYS E 115      45.402 121.728   5.781  1.00 32.98           C  
ATOM   9647  CG  LYS E 115      46.604 121.486   6.687  1.00 43.23           C  
ATOM   9648  CD  LYS E 115      47.680 122.538   6.485  1.00 50.88           C  
ATOM   9649  CE  LYS E 115      48.807 122.407   7.494  1.00 54.47           C  
ATOM   9650  NZ  LYS E 115      49.817 123.496   7.260  1.00 60.55           N  
ATOM   9651  N   ARG E 116      42.397 119.909   4.712  1.00 29.41           N  
ATOM   9652  CA  ARG E 116      41.117 120.100   4.051  1.00 27.59           C  
ATOM   9653  C   ARG E 116      40.043 119.415   4.893  1.00 28.98           C  
ATOM   9654  O   ARG E 116      40.352 118.646   5.807  1.00 30.09           O  
ATOM   9655  CB  ARG E 116      41.141 119.484   2.638  1.00 25.20           C  
ATOM   9656  CG  ARG E 116      41.954 120.304   1.600  1.00 27.80           C  
ATOM   9657  CD  ARG E 116      41.929 119.661   0.189  1.00 28.17           C  
ATOM   9658  NE  ARG E 116      42.843 118.524   0.019  1.00 26.34           N  
ATOM   9659  CZ  ARG E 116      42.500 117.234   0.069  1.00 29.05           C  
ATOM   9660  NH1 ARG E 116      41.236 116.856   0.303  1.00 22.28           N  
ATOM   9661  NH2 ARG E 116      43.412 116.314  -0.208  1.00 24.17           N  
ATOM   9662  N   VAL E 117      38.787 119.697   4.589  1.00 25.21           N  
ATOM   9663  CA  VAL E 117      37.675 119.064   5.267  1.00 25.76           C  
ATOM   9664  C   VAL E 117      36.835 118.428   4.154  1.00 23.86           C  
ATOM   9665  O   VAL E 117      35.838 117.765   4.407  1.00 28.42           O  
ATOM   9666  CB  VAL E 117      36.833 120.100   6.072  1.00 26.64           C  
ATOM   9667  CG1 VAL E 117      37.719 120.779   7.123  1.00 27.72           C  
ATOM   9668  CG2 VAL E 117      36.242 121.155   5.129  1.00 26.60           C  
ATOM   9669  N   THR E 118      37.253 118.635   2.914  1.00 23.46           N  
ATOM   9670  CA  THR E 118      36.545 118.087   1.753  1.00 26.15           C  
ATOM   9671  C   THR E 118      37.283 116.858   1.198  1.00 24.22           C  
ATOM   9672  O   THR E 118      38.454 116.960   0.825  1.00 25.34           O  
ATOM   9673  CB  THR E 118      36.462 119.149   0.621  1.00 27.80           C  
ATOM   9674  OG1 THR E 118      35.949 120.382   1.158  1.00 27.68           O  
ATOM   9675  CG2 THR E 118      35.566 118.662  -0.521  1.00 24.03           C  
ATOM   9676  N   ILE E 119      36.630 115.703   1.146  1.00 22.89           N  
ATOM   9677  CA  ILE E 119      37.333 114.558   0.602  1.00 21.60           C  
ATOM   9678  C   ILE E 119      37.368 114.657  -0.931  1.00 24.34           C  
ATOM   9679  O   ILE E 119      36.419 115.123  -1.577  1.00 22.14           O  
ATOM   9680  CB  ILE E 119      36.705 113.218   1.024  1.00 21.90           C  
ATOM   9681  CG1 ILE E 119      35.245 113.133   0.583  1.00 22.58           C  
ATOM   9682  CG2 ILE E 119      36.839 113.052   2.574  1.00 19.26           C  
ATOM   9683  CD1 ILE E 119      34.630 111.728   0.768  1.00 22.59           C  
ATOM   9684  N   MET E 120      38.469 114.203  -1.507  1.00 22.15           N  
ATOM   9685  CA  MET E 120      38.645 114.272  -2.946  1.00 24.29           C  
ATOM   9686  C   MET E 120      39.179 112.952  -3.473  1.00 25.46           C  
ATOM   9687  O   MET E 120      39.682 112.130  -2.695  1.00 23.68           O  
ATOM   9688  CB  MET E 120      39.633 115.389  -3.273  1.00 27.77           C  
ATOM   9689  CG  MET E 120      39.264 116.752  -2.710  1.00 25.55           C  
ATOM   9690  SD  MET E 120      40.564 117.954  -3.090  1.00 34.13           S  
ATOM   9691  CE  MET E 120      41.989 117.056  -2.748  1.00 41.63           C  
ATOM   9692  N   PRO E 121      39.063 112.715  -4.799  1.00 25.76           N  
ATOM   9693  CA  PRO E 121      39.578 111.445  -5.336  1.00 25.83           C  
ATOM   9694  C   PRO E 121      41.009 111.127  -4.878  1.00 23.36           C  
ATOM   9695  O   PRO E 121      41.315 109.974  -4.580  1.00 26.76           O  
ATOM   9696  CB  PRO E 121      39.462 111.629  -6.865  1.00 26.41           C  
ATOM   9697  CG  PRO E 121      38.114 112.384  -6.963  1.00 23.85           C  
ATOM   9698  CD  PRO E 121      38.257 113.434  -5.812  1.00 24.97           C  
ATOM   9699  N   LYS E 122      41.881 112.115  -4.789  1.00 23.02           N  
ATOM   9700  CA  LYS E 122      43.252 111.805  -4.362  1.00 25.90           C  
ATOM   9701  C   LYS E 122      43.314 111.251  -2.921  1.00 23.44           C  
ATOM   9702  O   LYS E 122      44.258 110.552  -2.579  1.00 23.25           O  
ATOM   9703  CB  LYS E 122      44.153 113.044  -4.462  1.00 27.49           C  
ATOM   9704  CG  LYS E 122      43.684 114.207  -3.597  1.00 32.70           C  
ATOM   9705  CD  LYS E 122      44.164 115.550  -4.133  1.00 40.34           C  
ATOM   9706  CE  LYS E 122      45.517 115.904  -3.638  1.00 46.68           C  
ATOM   9707  NZ  LYS E 122      46.061 117.104  -4.342  1.00 49.94           N  
ATOM   9708  N   ASP E 123      42.339 111.578  -2.075  1.00 21.54           N  
ATOM   9709  CA  ASP E 123      42.340 111.051  -0.701  1.00 18.56           C  
ATOM   9710  C   ASP E 123      41.959 109.565  -0.709  1.00 22.09           C  
ATOM   9711  O   ASP E 123      42.506 108.773   0.020  1.00 20.49           O  
ATOM   9712  CB  ASP E 123      41.325 111.819   0.168  1.00 20.13           C  
ATOM   9713  CG  ASP E 123      41.657 113.293   0.264  1.00 19.78           C  
ATOM   9714  OD1 ASP E 123      42.842 113.625   0.510  1.00 21.74           O  
ATOM   9715  OD2 ASP E 123      40.755 114.118   0.096  1.00 23.70           O  
ATOM   9716  N   ILE E 124      40.967 109.204  -1.517  1.00 20.88           N  
ATOM   9717  CA  ILE E 124      40.551 107.812  -1.609  1.00 21.88           C  
ATOM   9718  C   ILE E 124      41.727 106.994  -2.160  1.00 23.50           C  
ATOM   9719  O   ILE E 124      42.020 105.894  -1.683  1.00 25.09           O  
ATOM   9720  CB  ILE E 124      39.358 107.653  -2.599  1.00 23.00           C  
ATOM   9721  CG1 ILE E 124      38.106 108.338  -2.031  1.00 24.62           C  
ATOM   9722  CG2 ILE E 124      39.130 106.167  -2.923  1.00 22.66           C  
ATOM   9723  CD1 ILE E 124      36.831 108.054  -2.865  1.00 19.50           C  
ATOM   9724  N   GLN E 125      42.388 107.543  -3.173  1.00 24.36           N  
ATOM   9725  CA  GLN E 125      43.537 106.878  -3.829  1.00 24.48           C  
ATOM   9726  C   GLN E 125      44.705 106.707  -2.852  1.00 21.69           C  
ATOM   9727  O   GLN E 125      45.328 105.668  -2.808  1.00 23.50           O  
ATOM   9728  CB  GLN E 125      43.967 107.683  -5.087  1.00 22.31           C  
ATOM   9729  CG  GLN E 125      42.932 107.653  -6.261  1.00 28.10           C  
ATOM   9730  CD  GLN E 125      43.050 108.840  -7.262  1.00 33.14           C  
ATOM   9731  OE1 GLN E 125      44.043 109.560  -7.298  1.00 38.69           O  
ATOM   9732  NE2 GLN E 125      42.028 109.024  -8.074  1.00 32.20           N  
ATOM   9733  N   LEU E 126      45.015 107.720  -2.066  1.00 19.01           N  
ATOM   9734  CA  LEU E 126      46.090 107.563  -1.103  1.00 19.44           C  
ATOM   9735  C   LEU E 126      45.683 106.490  -0.078  1.00 21.49           C  
ATOM   9736  O   LEU E 126      46.486 105.617   0.263  1.00 21.75           O  
ATOM   9737  CB  LEU E 126      46.372 108.877  -0.371  1.00 22.44           C  
ATOM   9738  CG  LEU E 126      47.392 108.821   0.779  1.00 26.38           C  
ATOM   9739  CD1 LEU E 126      48.739 108.482   0.189  1.00 26.38           C  
ATOM   9740  CD2 LEU E 126      47.443 110.168   1.535  1.00 24.65           C  
ATOM   9741  N   ALA E 127      44.442 106.553   0.407  1.00 19.83           N  
ATOM   9742  CA  ALA E 127      43.968 105.572   1.385  1.00 20.54           C  
ATOM   9743  C   ALA E 127      44.081 104.147   0.814  1.00 23.98           C  
ATOM   9744  O   ALA E 127      44.588 103.253   1.496  1.00 23.72           O  
ATOM   9745  CB  ALA E 127      42.488 105.878   1.797  1.00 20.07           C  
ATOM   9746  N   ARG E 128      43.647 103.936  -0.434  1.00 21.03           N  
ATOM   9747  CA  ARG E 128      43.725 102.595  -1.004  1.00 22.42           C  
ATOM   9748  C   ARG E 128      45.179 102.192  -1.251  1.00 25.01           C  
ATOM   9749  O   ARG E 128      45.556 101.017  -1.098  1.00 22.89           O  
ATOM   9750  CB  ARG E 128      42.915 102.519  -2.291  1.00 25.16           C  
ATOM   9751  CG  ARG E 128      41.425 102.703  -2.024  1.00 26.13           C  
ATOM   9752  CD  ARG E 128      40.620 101.739  -2.884  1.00 36.57           C  
ATOM   9753  NE  ARG E 128      40.970 101.965  -4.244  1.00 47.06           N  
ATOM   9754  CZ  ARG E 128      41.056 101.043  -5.183  1.00 43.59           C  
ATOM   9755  NH1 ARG E 128      40.807  99.761  -4.939  1.00 42.24           N  
ATOM   9756  NH2 ARG E 128      41.419 101.443  -6.373  1.00 44.06           N  
ATOM   9757  N   ARG E 129      45.998 103.146  -1.653  1.00 21.11           N  
ATOM   9758  CA  ARG E 129      47.397 102.806  -1.849  1.00 27.21           C  
ATOM   9759  C   ARG E 129      48.072 102.376  -0.516  1.00 26.95           C  
ATOM   9760  O   ARG E 129      48.806 101.376  -0.484  1.00 26.86           O  
ATOM   9761  CB  ARG E 129      48.155 103.977  -2.479  1.00 32.28           C  
ATOM   9762  CG  ARG E 129      49.624 103.660  -2.745  1.00 41.48           C  
ATOM   9763  CD  ARG E 129      50.150 104.425  -3.962  1.00 52.17           C  
ATOM   9764  NE  ARG E 129      51.559 104.121  -4.216  1.00 58.19           N  
ATOM   9765  CZ  ARG E 129      52.380 104.900  -4.918  1.00 59.07           C  
ATOM   9766  NH1 ARG E 129      51.934 106.039  -5.449  1.00 57.97           N  
ATOM   9767  NH2 ARG E 129      53.654 104.558  -5.064  1.00 58.12           N  
ATOM   9768  N   ILE E 130      47.830 103.099   0.582  1.00 26.40           N  
ATOM   9769  CA  ILE E 130      48.470 102.720   1.844  1.00 28.82           C  
ATOM   9770  C   ILE E 130      47.942 101.375   2.337  1.00 30.86           C  
ATOM   9771  O   ILE E 130      48.711 100.560   2.865  1.00 28.35           O  
ATOM   9772  CB  ILE E 130      48.293 103.810   2.891  1.00 28.40           C  
ATOM   9773  CG1 ILE E 130      49.067 105.046   2.426  1.00 30.03           C  
ATOM   9774  CG2 ILE E 130      48.853 103.374   4.243  1.00 24.86           C  
ATOM   9775  CD1 ILE E 130      48.900 106.230   3.339  1.00 34.92           C  
ATOM   9776  N   ARG E 131      46.647 101.127   2.113  1.00 27.19           N  
ATOM   9777  CA  ARG E 131      46.023  99.857   2.492  1.00 30.50           C  
ATOM   9778  C   ARG E 131      46.530  98.678   1.681  1.00 31.11           C  
ATOM   9779  O   ARG E 131      46.235  97.542   2.012  1.00 32.04           O  
ATOM   9780  CB  ARG E 131      44.522  99.900   2.251  1.00 30.77           C  
ATOM   9781  CG  ARG E 131      43.761 100.874   3.103  1.00 28.49           C  
ATOM   9782  CD  ARG E 131      42.350 100.871   2.584  1.00 27.15           C  
ATOM   9783  NE  ARG E 131      41.431 101.306   3.614  1.00 25.70           N  
ATOM   9784  CZ  ARG E 131      40.195 100.836   3.734  1.00 25.97           C  
ATOM   9785  NH1 ARG E 131      39.740  99.932   2.867  1.00 22.78           N  
ATOM   9786  NH2 ARG E 131      39.446 101.226   4.752  1.00 22.06           N  
ATOM   9787  N   GLY E 132      47.243  98.932   0.589  1.00 30.23           N  
ATOM   9788  CA  GLY E 132      47.695  97.813  -0.205  1.00 32.27           C  
ATOM   9789  C   GLY E 132      46.622  97.355  -1.181  1.00 35.68           C  
ATOM   9790  O   GLY E 132      46.698  96.253  -1.691  1.00 35.29           O  
ATOM   9791  N   GLU E 133      45.617  98.189  -1.449  1.00 35.33           N  
ATOM   9792  CA  GLU E 133      44.569  97.820  -2.406  1.00 38.17           C  
ATOM   9793  C   GLU E 133      45.032  98.170  -3.817  1.00 44.26           C  
ATOM   9794  O   GLU E 133      44.474  97.691  -4.811  1.00 47.98           O  
ATOM   9795  CB  GLU E 133      43.246  98.537  -2.082  1.00 30.66           C  
ATOM   9796  CG  GLU E 133      42.510  97.877  -0.899  1.00 32.73           C  
ATOM   9797  CD  GLU E 133      41.251  98.595  -0.465  1.00 28.13           C  
ATOM   9798  OE1 GLU E 133      40.528  99.159  -1.327  1.00 27.49           O  
ATOM   9799  OE2 GLU E 133      40.974  98.558   0.765  1.00 30.58           O  
ATOM   9800  N   ARG E 134      46.052  99.012  -3.896  1.00 47.63           N  
ATOM   9801  CA  ARG E 134      46.607  99.420  -5.178  1.00 54.56           C  
ATOM   9802  C   ARG E 134      48.128  99.588  -5.053  1.00 55.59           C  
ATOM   9803  O   ARG E 134      48.839  99.542  -6.051  1.00 59.05           O  
ATOM   9804  CB  ARG E 134      45.950 100.734  -5.658  1.00 55.25           C  
ATOM   9805  CG  ARG E 134      46.349 101.980  -4.877  1.00 56.59           C  
ATOM   9806  CD  ARG E 134      45.818 103.264  -5.530  1.00 58.60           C  
ATOM   9807  NE  ARG E 134      44.402 103.478  -5.260  1.00 60.79           N  
ATOM   9808  CZ  ARG E 134      43.531 103.982  -6.132  1.00 58.84           C  
ATOM   9809  NH1 ARG E 134      43.930 104.328  -7.350  1.00 59.32           N  
ATOM   9810  NH2 ARG E 134      42.260 104.137  -5.784  1.00 49.09           N  
ATOM   9811  N   ALA E 135      48.590  99.752  -3.812  1.00 56.39           N  
ATOM   9812  CA  ALA E 135      50.000  99.946  -3.419  1.00 58.71           C  
ATOM   9813  C   ALA E 135      51.138  99.969  -4.458  1.00 61.43           C  
ATOM   9814  O   ALA E 135      52.305  99.832  -4.009  1.00 60.72           O  
ATOM   9815  CB  ALA E 135      50.351  98.946  -2.334  1.00 56.71           C  
ATOM   9816  OXT ALA E 135      50.893 100.151  -5.675  1.00 61.56           O  
TER    9817      ALA E 135                                                      
ATOM   9818  N   LYS F  16      12.059  78.965 -21.230  1.00103.78           N  
ATOM   9819  CA  LYS F  16      12.194  80.327 -20.638  1.00103.39           C  
ATOM   9820  C   LYS F  16      12.353  81.372 -21.733  1.00102.39           C  
ATOM   9821  O   LYS F  16      13.296  81.315 -22.523  1.00102.93           O  
ATOM   9822  CB  LYS F  16      13.401  80.374 -19.696  1.00104.63           C  
ATOM   9823  CG  LYS F  16      14.722  79.998 -20.347  1.00104.86           C  
ATOM   9824  CD  LYS F  16      15.850  80.010 -19.331  1.00106.12           C  
ATOM   9825  CE  LYS F  16      17.165  79.568 -19.955  1.00106.73           C  
ATOM   9826  NZ  LYS F  16      18.272  79.537 -18.958  1.00107.04           N  
ATOM   9827  N   ARG F  17      11.429  82.326 -21.779  1.00100.86           N  
ATOM   9828  CA  ARG F  17      11.478  83.373 -22.793  1.00 98.88           C  
ATOM   9829  C   ARG F  17      12.048  84.694 -22.299  1.00 95.82           C  
ATOM   9830  O   ARG F  17      11.598  85.242 -21.293  1.00 96.26           O  
ATOM   9831  CB  ARG F  17      10.086  83.653 -23.363  1.00100.67           C  
ATOM   9832  CG  ARG F  17       9.459  82.546 -24.187  1.00103.43           C  
ATOM   9833  CD  ARG F  17       8.398  83.152 -25.098  1.00105.89           C  
ATOM   9834  NE  ARG F  17       7.424  82.181 -25.587  1.00107.81           N  
ATOM   9835  CZ  ARG F  17       6.468  82.470 -26.465  1.00108.47           C  
ATOM   9836  NH1 ARG F  17       6.364  83.700 -26.952  1.00108.59           N  
ATOM   9837  NH2 ARG F  17       5.607  81.536 -26.847  1.00109.18           N  
ATOM   9838  N   HIS F  18      13.037  85.200 -23.025  1.00 92.16           N  
ATOM   9839  CA  HIS F  18      13.648  86.486 -22.719  1.00 88.59           C  
ATOM   9840  C   HIS F  18      14.166  86.617 -21.289  1.00 84.54           C  
ATOM   9841  O   HIS F  18      14.013  85.711 -20.475  1.00 85.34           O  
ATOM   9842  CB  HIS F  18      12.627  87.592 -23.000  1.00 89.72           C  
ATOM   9843  CG  HIS F  18      11.737  87.300 -24.169  1.00 90.64           C  
ATOM   9844  ND1 HIS F  18      12.168  87.383 -25.475  1.00 91.06           N  
ATOM   9845  CD2 HIS F  18      10.450  86.879 -24.224  1.00 91.70           C  
ATOM   9846  CE1 HIS F  18      11.186  87.026 -26.284  1.00 91.22           C  
ATOM   9847  NE2 HIS F  18      10.133  86.715 -25.551  1.00 91.53           N  
ATOM   9848  N   ARG F  19      14.778  87.765 -21.014  1.00 79.82           N  
ATOM   9849  CA  ARG F  19      15.343  88.110 -19.711  1.00 74.53           C  
ATOM   9850  C   ARG F  19      16.129  89.406 -19.912  1.00 68.81           C  
ATOM   9851  O   ARG F  19      17.290  89.391 -20.316  1.00 67.77           O  
ATOM   9852  CB  ARG F  19      16.264  86.997 -19.200  1.00 77.77           C  
ATOM   9853  CG  ARG F  19      16.607  87.126 -17.714  1.00 80.81           C  
ATOM   9854  CD  ARG F  19      17.903  87.893 -17.497  1.00 84.59           C  
ATOM   9855  NE  ARG F  19      18.016  88.404 -16.134  1.00 86.78           N  
ATOM   9856  CZ  ARG F  19      19.164  88.714 -15.546  1.00 86.16           C  
ATOM   9857  NH1 ARG F  19      20.303  88.559 -16.199  1.00 87.44           N  
ATOM   9858  NH2 ARG F  19      19.173  89.182 -14.306  1.00 86.68           N  
ATOM   9859  N   LYS F  20      15.465  90.521 -19.637  1.00 62.38           N  
ATOM   9860  CA  LYS F  20      16.020  91.858 -19.803  1.00 57.42           C  
ATOM   9861  C   LYS F  20      17.537  92.006 -19.614  1.00 51.84           C  
ATOM   9862  O   LYS F  20      18.148  91.403 -18.731  1.00 51.47           O  
ATOM   9863  CB  LYS F  20      15.275  92.829 -18.888  1.00 60.49           C  
ATOM   9864  CG  LYS F  20      15.734  94.258 -19.003  1.00 64.90           C  
ATOM   9865  CD  LYS F  20      15.485  94.851 -20.372  1.00 65.26           C  
ATOM   9866  CE  LYS F  20      16.067  96.252 -20.407  1.00 68.01           C  
ATOM   9867  NZ  LYS F  20      15.519  97.117 -21.489  1.00 73.05           N  
ATOM   9868  N   VAL F  21      18.127  92.822 -20.472  1.00 42.51           N  
ATOM   9869  CA  VAL F  21      19.554  93.066 -20.462  1.00 38.88           C  
ATOM   9870  C   VAL F  21      19.935  93.995 -19.318  1.00 35.05           C  
ATOM   9871  O   VAL F  21      19.316  95.045 -19.129  1.00 29.56           O  
ATOM   9872  CB  VAL F  21      19.990  93.671 -21.815  1.00 36.37           C  
ATOM   9873  CG1 VAL F  21      21.425  94.038 -21.786  1.00 37.51           C  
ATOM   9874  CG2 VAL F  21      19.755  92.653 -22.908  1.00 40.74           C  
ATOM   9875  N   LEU F  22      20.933  93.591 -18.539  1.00 32.56           N  
ATOM   9876  CA  LEU F  22      21.392  94.420 -17.414  1.00 31.11           C  
ATOM   9877  C   LEU F  22      22.548  95.288 -17.866  1.00 30.98           C  
ATOM   9878  O   LEU F  22      23.549  94.773 -18.349  1.00 32.21           O  
ATOM   9879  CB  LEU F  22      21.821  93.521 -16.252  1.00 31.42           C  
ATOM   9880  CG  LEU F  22      20.719  92.621 -15.675  1.00 33.45           C  
ATOM   9881  CD1 LEU F  22      21.274  91.605 -14.642  1.00 32.94           C  
ATOM   9882  CD2 LEU F  22      19.680  93.508 -15.045  1.00 34.10           C  
ATOM   9883  N   ARG F  23      22.411  96.602 -17.730  1.00 29.12           N  
ATOM   9884  CA  ARG F  23      23.469  97.529 -18.102  1.00 30.93           C  
ATOM   9885  C   ARG F  23      23.450  98.806 -17.247  1.00 27.10           C  
ATOM   9886  O   ARG F  23      22.408  99.238 -16.807  1.00 28.25           O  
ATOM   9887  CB  ARG F  23      23.330  97.913 -19.605  1.00 34.48           C  
ATOM   9888  CG  ARG F  23      21.882  98.060 -20.035  1.00 39.61           C  
ATOM   9889  CD  ARG F  23      21.642  98.064 -21.595  1.00 40.77           C  
ATOM   9890  NE  ARG F  23      22.261  99.223 -22.169  1.00 36.82           N  
ATOM   9891  CZ  ARG F  23      21.625 100.318 -22.580  1.00 30.69           C  
ATOM   9892  NH1 ARG F  23      20.309 100.431 -22.519  1.00 33.82           N  
ATOM   9893  NH2 ARG F  23      22.342 101.331 -23.000  1.00 27.56           N  
ATOM   9894  N   ASP F  24      24.626  99.368 -16.996  1.00 26.18           N  
ATOM   9895  CA  ASP F  24      24.778 100.631 -16.284  1.00 27.69           C  
ATOM   9896  C   ASP F  24      24.215 100.695 -14.863  1.00 23.51           C  
ATOM   9897  O   ASP F  24      24.009 101.791 -14.321  1.00 22.93           O  
ATOM   9898  CB  ASP F  24      24.149 101.752 -17.138  1.00 30.25           C  
ATOM   9899  CG  ASP F  24      24.794 103.095 -16.913  1.00 32.87           C  
ATOM   9900  OD1 ASP F  24      26.005 103.166 -16.551  1.00 35.68           O  
ATOM   9901  OD2 ASP F  24      24.103 104.102 -17.144  1.00 35.14           O  
ATOM   9902  N   ASN F  25      24.021  99.539 -14.253  1.00 20.44           N  
ATOM   9903  CA  ASN F  25      23.497  99.520 -12.894  1.00 25.25           C  
ATOM   9904  C   ASN F  25      24.425 100.098 -11.849  1.00 22.63           C  
ATOM   9905  O   ASN F  25      24.024 100.282 -10.704  1.00 28.71           O  
ATOM   9906  CB  ASN F  25      23.050  98.119 -12.520  1.00 23.64           C  
ATOM   9907  CG  ASN F  25      21.840  97.717 -13.312  1.00 30.87           C  
ATOM   9908  OD1 ASN F  25      20.756  98.257 -13.081  1.00 26.72           O  
ATOM   9909  ND2 ASN F  25      22.017  96.820 -14.288  1.00 25.32           N  
ATOM   9910  N   ILE F  26      25.643 100.426 -12.224  1.00 23.17           N  
ATOM   9911  CA  ILE F  26      26.541 101.044 -11.251  1.00 25.80           C  
ATOM   9912  C   ILE F  26      25.918 102.420 -10.894  1.00 30.06           C  
ATOM   9913  O   ILE F  26      26.155 102.971  -9.799  1.00 26.36           O  
ATOM   9914  CB  ILE F  26      27.985 101.221 -11.839  1.00 26.66           C  
ATOM   9915  CG1 ILE F  26      28.935 101.726 -10.749  1.00 28.31           C  
ATOM   9916  CG2 ILE F  26      27.975 102.204 -13.023  1.00 24.70           C  
ATOM   9917  CD1 ILE F  26      29.058 100.775  -9.582  1.00 24.08           C  
ATOM   9918  N   GLN F  27      25.095 102.961 -11.800  1.00 24.43           N  
ATOM   9919  CA  GLN F  27      24.467 104.265 -11.552  1.00 30.30           C  
ATOM   9920  C   GLN F  27      23.348 104.174 -10.528  1.00 30.97           C  
ATOM   9921  O   GLN F  27      22.811 105.195 -10.089  1.00 36.82           O  
ATOM   9922  CB  GLN F  27      23.965 104.901 -12.853  1.00 32.75           C  
ATOM   9923  CG  GLN F  27      25.112 105.359 -13.745  1.00 32.60           C  
ATOM   9924  CD  GLN F  27      25.971 106.410 -13.062  1.00 35.95           C  
ATOM   9925  OE1 GLN F  27      25.443 107.329 -12.443  1.00 44.51           O  
ATOM   9926  NE2 GLN F  27      27.291 106.293 -13.180  1.00 36.93           N  
ATOM   9927  N   GLY F  28      23.009 102.957 -10.141  1.00 30.13           N  
ATOM   9928  CA  GLY F  28      22.004 102.761  -9.103  1.00 32.13           C  
ATOM   9929  C   GLY F  28      22.638 103.113  -7.751  1.00 32.38           C  
ATOM   9930  O   GLY F  28      21.957 103.253  -6.741  1.00 36.91           O  
ATOM   9931  N   ILE F  29      23.962 103.205  -7.715  1.00 30.00           N  
ATOM   9932  CA  ILE F  29      24.667 103.613  -6.496  1.00 30.33           C  
ATOM   9933  C   ILE F  29      24.667 105.146  -6.660  1.00 24.23           C  
ATOM   9934  O   ILE F  29      25.591 105.736  -7.211  1.00 26.34           O  
ATOM   9935  CB  ILE F  29      26.128 103.095  -6.460  1.00 27.98           C  
ATOM   9936  CG1 ILE F  29      26.162 101.598  -6.800  1.00 31.22           C  
ATOM   9937  CG2 ILE F  29      26.725 103.337  -5.088  1.00 27.12           C  
ATOM   9938  CD1 ILE F  29      25.305 100.698  -5.911  1.00 29.14           C  
ATOM   9939  N   THR F  30      23.610 105.772  -6.183  1.00 23.58           N  
ATOM   9940  CA  THR F  30      23.407 107.217  -6.345  1.00 23.34           C  
ATOM   9941  C   THR F  30      24.219 108.150  -5.484  1.00 26.40           C  
ATOM   9942  O   THR F  30      24.754 107.767  -4.448  1.00 24.05           O  
ATOM   9943  CB  THR F  30      21.962 107.566  -6.072  1.00 24.48           C  
ATOM   9944  OG1 THR F  30      21.701 107.340  -4.679  1.00 27.16           O  
ATOM   9945  CG2 THR F  30      21.023 106.656  -6.873  1.00 23.52           C  
ATOM   9946  N   LYS F  31      24.269 109.406  -5.916  1.00 21.82           N  
ATOM   9947  CA  LYS F  31      24.956 110.439  -5.182  1.00 25.18           C  
ATOM   9948  C   LYS F  31      24.485 110.494  -3.699  1.00 24.27           C  
ATOM   9949  O   LYS F  31      25.305 110.544  -2.775  1.00 23.40           O  
ATOM   9950  CB  LYS F  31      24.733 111.784  -5.888  1.00 26.36           C  
ATOM   9951  CG  LYS F  31      25.221 113.007  -5.105  1.00 33.47           C  
ATOM   9952  CD  LYS F  31      25.145 114.304  -5.949  1.00 33.50           C  
ATOM   9953  CE  LYS F  31      25.271 115.511  -5.034  1.00 40.56           C  
ATOM   9954  NZ  LYS F  31      25.404 116.841  -5.721  1.00 45.28           N  
ATOM   9955  N   PRO F  32      23.172 110.478  -3.454  1.00 24.36           N  
ATOM   9956  CA  PRO F  32      22.751 110.531  -2.037  1.00 25.89           C  
ATOM   9957  C   PRO F  32      23.166 109.278  -1.257  1.00 24.61           C  
ATOM   9958  O   PRO F  32      23.487 109.370  -0.058  1.00 25.09           O  
ATOM   9959  CB  PRO F  32      21.215 110.668  -2.103  1.00 28.87           C  
ATOM   9960  CG  PRO F  32      20.947 111.112  -3.578  1.00 29.79           C  
ATOM   9961  CD  PRO F  32      22.008 110.409  -4.363  1.00 29.10           C  
ATOM   9962  N   ALA F  33      23.150 108.107  -1.890  1.00 24.03           N  
ATOM   9963  CA  ALA F  33      23.563 106.917  -1.152  1.00 22.06           C  
ATOM   9964  C   ALA F  33      25.046 107.012  -0.801  1.00 24.36           C  
ATOM   9965  O   ALA F  33      25.470 106.640   0.297  1.00 22.61           O  
ATOM   9966  CB  ALA F  33      23.299 105.645  -1.954  1.00 20.98           C  
ATOM   9967  N   ILE F  34      25.840 107.517  -1.731  1.00 19.42           N  
ATOM   9968  CA  ILE F  34      27.252 107.633  -1.460  1.00 22.33           C  
ATOM   9969  C   ILE F  34      27.470 108.689  -0.371  1.00 24.06           C  
ATOM   9970  O   ILE F  34      28.316 108.513   0.497  1.00 21.53           O  
ATOM   9971  CB  ILE F  34      28.027 107.979  -2.757  1.00 19.57           C  
ATOM   9972  CG1 ILE F  34      27.942 106.773  -3.732  1.00 22.85           C  
ATOM   9973  CG2 ILE F  34      29.456 108.356  -2.429  1.00 21.13           C  
ATOM   9974  CD1 ILE F  34      28.470 107.121  -5.179  1.00 21.80           C  
ATOM   9975  N   ARG F  35      26.699 109.774  -0.411  1.00 23.20           N  
ATOM   9976  CA  ARG F  35      26.818 110.824   0.588  1.00 21.66           C  
ATOM   9977  C   ARG F  35      26.512 110.216   1.970  1.00 21.39           C  
ATOM   9978  O   ARG F  35      27.220 110.481   2.923  1.00 23.74           O  
ATOM   9979  CB  ARG F  35      25.823 111.971   0.331  1.00 25.39           C  
ATOM   9980  CG  ARG F  35      25.928 113.095   1.393  1.00 33.31           C  
ATOM   9981  CD  ARG F  35      24.841 114.172   1.226  1.00 39.42           C  
ATOM   9982  NE  ARG F  35      24.715 114.542  -0.173  1.00 47.74           N  
ATOM   9983  CZ  ARG F  35      25.683 115.093  -0.894  1.00 57.15           C  
ATOM   9984  NH1 ARG F  35      26.868 115.364  -0.354  1.00 55.43           N  
ATOM   9985  NH2 ARG F  35      25.473 115.347  -2.178  1.00 62.35           N  
ATOM   9986  N   ARG F  36      25.473 109.392   2.054  1.00 18.03           N  
ATOM   9987  CA  ARG F  36      25.091 108.767   3.313  1.00 20.82           C  
ATOM   9988  C   ARG F  36      26.205 107.872   3.832  1.00 21.99           C  
ATOM   9989  O   ARG F  36      26.534 107.903   5.020  1.00 23.35           O  
ATOM   9990  CB  ARG F  36      23.812 107.919   3.144  1.00 21.95           C  
ATOM   9991  CG  ARG F  36      22.504 108.736   2.977  1.00 21.38           C  
ATOM   9992  CD  ARG F  36      21.316 107.809   3.062  1.00 24.97           C  
ATOM   9993  NE  ARG F  36      21.136 106.902   1.915  1.00 25.08           N  
ATOM   9994  CZ  ARG F  36      20.434 107.214   0.803  1.00 30.79           C  
ATOM   9995  NH1 ARG F  36      19.868 108.424   0.691  1.00 21.01           N  
ATOM   9996  NH2 ARG F  36      20.247 106.295  -0.165  1.00 24.54           N  
ATOM   9997  N   LEU F  37      26.753 107.042   2.960  1.00 18.65           N  
ATOM   9998  CA  LEU F  37      27.851 106.172   3.363  1.00 19.28           C  
ATOM   9999  C   LEU F  37      29.024 107.041   3.880  1.00 20.85           C  
ATOM  10000  O   LEU F  37      29.679 106.688   4.873  1.00 17.97           O  
ATOM  10001  CB  LEU F  37      28.326 105.333   2.164  1.00 19.54           C  
ATOM  10002  CG  LEU F  37      27.327 104.276   1.749  1.00 16.60           C  
ATOM  10003  CD1 LEU F  37      27.591 103.830   0.291  1.00 17.82           C  
ATOM  10004  CD2 LEU F  37      27.499 103.058   2.733  1.00 19.21           C  
ATOM  10005  N   ALA F  38      29.326 108.152   3.206  1.00 16.31           N  
ATOM  10006  CA  ALA F  38      30.432 108.989   3.673  1.00 18.26           C  
ATOM  10007  C   ALA F  38      30.067 109.624   5.037  1.00 20.49           C  
ATOM  10008  O   ALA F  38      30.950 109.825   5.887  1.00 19.35           O  
ATOM  10009  CB  ALA F  38      30.786 110.087   2.660  1.00 20.08           C  
ATOM  10010  N   ARG F  39      28.788 109.944   5.246  1.00 17.87           N  
ATOM  10011  CA  ARG F  39      28.405 110.532   6.533  1.00 20.58           C  
ATOM  10012  C   ARG F  39      28.632 109.491   7.629  1.00 21.23           C  
ATOM  10013  O   ARG F  39      29.157 109.819   8.685  1.00 23.67           O  
ATOM  10014  CB  ARG F  39      26.930 110.962   6.514  1.00 19.78           C  
ATOM  10015  CG  ARG F  39      26.641 112.112   5.536  1.00 15.84           C  
ATOM  10016  CD  ARG F  39      27.091 113.453   6.076  1.00 20.10           C  
ATOM  10017  NE  ARG F  39      26.559 114.529   5.238  1.00 21.98           N  
ATOM  10018  CZ  ARG F  39      27.274 115.158   4.326  1.00 25.84           C  
ATOM  10019  NH1 ARG F  39      28.548 114.821   4.160  1.00 20.82           N  
ATOM  10020  NH2 ARG F  39      26.701 116.073   3.547  1.00 25.10           N  
ATOM  10021  N   ARG F  40      28.226 108.240   7.410  1.00 20.28           N  
ATOM  10022  CA  ARG F  40      28.479 107.223   8.439  1.00 20.27           C  
ATOM  10023  C   ARG F  40      29.994 107.120   8.701  1.00 21.42           C  
ATOM  10024  O   ARG F  40      30.432 106.812   9.834  1.00 20.84           O  
ATOM  10025  CB  ARG F  40      27.923 105.871   8.015  1.00 21.59           C  
ATOM  10026  CG  ARG F  40      28.067 104.750   9.064  1.00 17.78           C  
ATOM  10027  CD  ARG F  40      27.072 103.616   8.799  1.00 21.87           C  
ATOM  10028  NE  ARG F  40      25.695 103.969   9.197  1.00 21.48           N  
ATOM  10029  CZ  ARG F  40      24.600 103.324   8.795  1.00 22.73           C  
ATOM  10030  NH1 ARG F  40      24.687 102.300   7.964  1.00 17.94           N  
ATOM  10031  NH2 ARG F  40      23.403 103.662   9.276  1.00 21.26           N  
ATOM  10032  N   GLY F  41      30.781 107.394   7.660  1.00 18.10           N  
ATOM  10033  CA  GLY F  41      32.244 107.349   7.772  1.00 18.19           C  
ATOM  10034  C   GLY F  41      32.827 108.632   8.331  1.00 17.97           C  
ATOM  10035  O   GLY F  41      34.047 108.836   8.320  1.00 19.13           O  
ATOM  10036  N   GLY F  42      31.941 109.510   8.785  1.00 20.42           N  
ATOM  10037  CA  GLY F  42      32.339 110.770   9.412  1.00 19.71           C  
ATOM  10038  C   GLY F  42      32.696 111.915   8.502  1.00 23.92           C  
ATOM  10039  O   GLY F  42      33.296 112.887   8.966  1.00 21.94           O  
ATOM  10040  N   VAL F  43      32.315 111.830   7.219  1.00 20.01           N  
ATOM  10041  CA  VAL F  43      32.687 112.870   6.251  1.00 20.56           C  
ATOM  10042  C   VAL F  43      31.733 114.023   6.209  1.00 17.28           C  
ATOM  10043  O   VAL F  43      30.560 113.834   6.072  1.00 19.74           O  
ATOM  10044  CB  VAL F  43      32.818 112.286   4.806  1.00 23.42           C  
ATOM  10045  CG1 VAL F  43      33.053 113.433   3.795  1.00 18.30           C  
ATOM  10046  CG2 VAL F  43      33.996 111.279   4.759  1.00 16.28           C  
ATOM  10047  N   LYS F  44      32.272 115.227   6.264  1.00 20.55           N  
ATOM  10048  CA  LYS F  44      31.457 116.433   6.273  1.00 22.36           C  
ATOM  10049  C   LYS F  44      31.299 117.175   4.934  1.00 25.83           C  
ATOM  10050  O   LYS F  44      30.268 117.821   4.699  1.00 26.05           O  
ATOM  10051  CB  LYS F  44      32.028 117.405   7.312  1.00 22.94           C  
ATOM  10052  CG  LYS F  44      31.185 118.671   7.523  1.00 25.22           C  
ATOM  10053  CD  LYS F  44      31.937 119.669   8.401  1.00 29.00           C  
ATOM  10054  CE  LYS F  44      31.067 120.869   8.807  1.00 30.45           C  
ATOM  10055  NZ  LYS F  44      31.947 121.884   9.458  1.00 31.08           N  
ATOM  10056  N   ARG F  45      32.292 117.087   4.055  1.00 23.92           N  
ATOM  10057  CA  ARG F  45      32.222 117.807   2.777  1.00 25.36           C  
ATOM  10058  C   ARG F  45      32.803 116.893   1.731  1.00 27.44           C  
ATOM  10059  O   ARG F  45      33.789 116.192   1.999  1.00 23.62           O  
ATOM  10060  CB  ARG F  45      33.004 119.108   2.883  1.00 29.49           C  
ATOM  10061  CG  ARG F  45      32.619 120.151   1.865  1.00 31.53           C  
ATOM  10062  CD  ARG F  45      33.080 121.536   2.323  1.00 31.40           C  
ATOM  10063  NE  ARG F  45      32.641 122.583   1.410  1.00 32.11           N  
ATOM  10064  CZ  ARG F  45      33.233 122.881   0.258  1.00 36.99           C  
ATOM  10065  NH1 ARG F  45      34.314 122.214  -0.152  1.00 26.53           N  
ATOM  10066  NH2 ARG F  45      32.733 123.864  -0.491  1.00 37.87           N  
ATOM  10067  N   ILE F  46      32.204 116.921   0.544  1.00 23.33           N  
ATOM  10068  CA  ILE F  46      32.528 115.994  -0.537  1.00 25.82           C  
ATOM  10069  C   ILE F  46      32.674 116.660  -1.925  1.00 28.81           C  
ATOM  10070  O   ILE F  46      31.751 117.358  -2.401  1.00 25.83           O  
ATOM  10071  CB  ILE F  46      31.369 114.951  -0.615  1.00 23.81           C  
ATOM  10072  CG1 ILE F  46      31.184 114.283   0.759  1.00 24.41           C  
ATOM  10073  CG2 ILE F  46      31.593 113.972  -1.743  1.00 21.83           C  
ATOM  10074  CD1 ILE F  46      29.996 113.324   0.838  1.00 23.35           C  
ATOM  10075  N   SER F  47      33.832 116.448  -2.552  1.00 26.80           N  
ATOM  10076  CA  SER F  47      34.094 116.983  -3.892  1.00 27.17           C  
ATOM  10077  C   SER F  47      33.173 116.290  -4.913  1.00 28.51           C  
ATOM  10078  O   SER F  47      32.865 115.091  -4.785  1.00 25.02           O  
ATOM  10079  CB  SER F  47      35.556 116.706  -4.280  1.00 28.53           C  
ATOM  10080  OG  SER F  47      35.662 116.516  -5.686  1.00 38.64           O  
ATOM  10081  N   GLY F  48      32.740 117.031  -5.932  1.00 27.39           N  
ATOM  10082  CA  GLY F  48      31.875 116.443  -6.943  1.00 24.05           C  
ATOM  10083  C   GLY F  48      32.428 115.215  -7.665  1.00 23.91           C  
ATOM  10084  O   GLY F  48      31.666 114.394  -8.174  1.00 26.41           O  
ATOM  10085  N   LEU F  49      33.743 115.073  -7.706  1.00 23.99           N  
ATOM  10086  CA  LEU F  49      34.354 113.924  -8.375  1.00 26.64           C  
ATOM  10087  C   LEU F  49      34.320 112.618  -7.550  1.00 28.12           C  
ATOM  10088  O   LEU F  49      34.594 111.516  -8.061  1.00 23.30           O  
ATOM  10089  CB  LEU F  49      35.795 114.259  -8.738  1.00 28.52           C  
ATOM  10090  CG  LEU F  49      35.890 115.420  -9.750  1.00 36.13           C  
ATOM  10091  CD1 LEU F  49      37.345 115.778  -9.961  1.00 38.76           C  
ATOM  10092  CD2 LEU F  49      35.240 115.012 -11.073  1.00 37.74           C  
ATOM  10093  N   ILE F  50      33.946 112.734  -6.279  1.00 25.04           N  
ATOM  10094  CA  ILE F  50      33.945 111.567  -5.412  1.00 21.14           C  
ATOM  10095  C   ILE F  50      32.946 110.507  -5.832  1.00 21.54           C  
ATOM  10096  O   ILE F  50      33.213 109.309  -5.725  1.00 23.21           O  
ATOM  10097  CB  ILE F  50      33.658 112.013  -3.931  1.00 20.63           C  
ATOM  10098  CG1 ILE F  50      34.916 112.677  -3.332  1.00 21.14           C  
ATOM  10099  CG2 ILE F  50      33.196 110.831  -3.091  1.00 21.34           C  
ATOM  10100  CD1 ILE F  50      36.015 111.702  -2.896  1.00 20.55           C  
ATOM  10101  N   TYR F  51      31.780 110.920  -6.331  1.00 21.68           N  
ATOM  10102  CA  TYR F  51      30.779 109.911  -6.656  1.00 20.08           C  
ATOM  10103  C   TYR F  51      31.227 108.893  -7.681  1.00 24.09           C  
ATOM  10104  O   TYR F  51      31.057 107.689  -7.468  1.00 21.59           O  
ATOM  10105  CB  TYR F  51      29.464 110.583  -7.073  1.00 19.04           C  
ATOM  10106  CG  TYR F  51      29.085 111.591  -6.019  1.00 22.66           C  
ATOM  10107  CD1 TYR F  51      29.205 112.952  -6.251  1.00 23.41           C  
ATOM  10108  CD2 TYR F  51      28.746 111.172  -4.742  1.00 23.21           C  
ATOM  10109  CE1 TYR F  51      29.009 113.884  -5.229  1.00 23.60           C  
ATOM  10110  CE2 TYR F  51      28.535 112.091  -3.718  1.00 28.12           C  
ATOM  10111  CZ  TYR F  51      28.670 113.433  -3.970  1.00 26.49           C  
ATOM  10112  OH  TYR F  51      28.455 114.325  -2.942  1.00 26.75           O  
ATOM  10113  N   GLU F  52      31.799 109.360  -8.787  1.00 24.37           N  
ATOM  10114  CA  GLU F  52      32.252 108.421  -9.808  1.00 24.74           C  
ATOM  10115  C   GLU F  52      33.430 107.598  -9.295  1.00 20.80           C  
ATOM  10116  O   GLU F  52      33.547 106.430  -9.613  1.00 23.74           O  
ATOM  10117  CB  GLU F  52      32.667 109.146 -11.100  1.00 25.89           C  
ATOM  10118  CG  GLU F  52      31.505 109.385 -12.039  1.00 39.73           C  
ATOM  10119  CD  GLU F  52      30.757 108.105 -12.393  1.00 39.52           C  
ATOM  10120  OE1 GLU F  52      31.408 107.124 -12.831  1.00 50.31           O  
ATOM  10121  OE2 GLU F  52      29.520 108.078 -12.238  1.00 40.85           O  
ATOM  10122  N   GLU F  53      34.310 108.222  -8.533  1.00 20.36           N  
ATOM  10123  CA  GLU F  53      35.449 107.512  -7.976  1.00 22.31           C  
ATOM  10124  C   GLU F  53      34.956 106.378  -7.065  1.00 21.09           C  
ATOM  10125  O   GLU F  53      35.475 105.255  -7.094  1.00 20.15           O  
ATOM  10126  CB  GLU F  53      36.300 108.479  -7.157  1.00 23.29           C  
ATOM  10127  CG  GLU F  53      37.608 107.899  -6.752  1.00 24.94           C  
ATOM  10128  CD  GLU F  53      38.578 107.934  -7.902  1.00 34.59           C  
ATOM  10129  OE1 GLU F  53      38.210 108.479  -8.961  1.00 32.61           O  
ATOM  10130  OE2 GLU F  53      39.698 107.437  -7.742  1.00 34.12           O  
ATOM  10131  N   THR F  54      33.932 106.653  -6.272  1.00 17.06           N  
ATOM  10132  CA  THR F  54      33.424 105.640  -5.355  1.00 18.06           C  
ATOM  10133  C   THR F  54      32.761 104.495  -6.101  1.00 21.66           C  
ATOM  10134  O   THR F  54      32.884 103.335  -5.721  1.00 19.15           O  
ATOM  10135  CB  THR F  54      32.406 106.261  -4.350  1.00 18.48           C  
ATOM  10136  OG1 THR F  54      33.041 107.300  -3.591  1.00 19.78           O  
ATOM  10137  CG2 THR F  54      31.848 105.171  -3.407  1.00 16.83           C  
ATOM  10138  N   ARG F  55      32.031 104.812  -7.176  1.00 25.47           N  
ATOM  10139  CA  ARG F  55      31.409 103.755  -7.950  1.00 20.30           C  
ATOM  10140  C   ARG F  55      32.497 102.825  -8.488  1.00 20.48           C  
ATOM  10141  O   ARG F  55      32.341 101.600  -8.452  1.00 23.73           O  
ATOM  10142  CB  ARG F  55      30.614 104.369  -9.122  1.00 23.47           C  
ATOM  10143  CG  ARG F  55      29.306 105.014  -8.664  1.00 22.88           C  
ATOM  10144  CD  ARG F  55      28.570 105.775  -9.802  1.00 30.34           C  
ATOM  10145  NE  ARG F  55      27.481 106.514  -9.193  1.00 27.65           N  
ATOM  10146  CZ  ARG F  55      27.335 107.828  -9.255  1.00 27.12           C  
ATOM  10147  NH1 ARG F  55      28.189 108.564  -9.935  1.00 22.75           N  
ATOM  10148  NH2 ARG F  55      26.385 108.404  -8.541  1.00 27.89           N  
ATOM  10149  N   GLY F  56      33.576 103.413  -9.003  1.00 22.03           N  
ATOM  10150  CA  GLY F  56      34.666 102.627  -9.567  1.00 23.77           C  
ATOM  10151  C   GLY F  56      35.282 101.726  -8.500  1.00 26.23           C  
ATOM  10152  O   GLY F  56      35.600 100.568  -8.754  1.00 22.34           O  
ATOM  10153  N   VAL F  57      35.463 102.265  -7.296  1.00 24.22           N  
ATOM  10154  CA  VAL F  57      36.016 101.462  -6.201  1.00 21.69           C  
ATOM  10155  C   VAL F  57      35.039 100.373  -5.780  1.00 19.41           C  
ATOM  10156  O   VAL F  57      35.448  99.252  -5.481  1.00 20.79           O  
ATOM  10157  CB  VAL F  57      36.355 102.369  -4.983  1.00 25.56           C  
ATOM  10158  CG1 VAL F  57      36.643 101.505  -3.738  1.00 26.25           C  
ATOM  10159  CG2 VAL F  57      37.566 103.245  -5.338  1.00 22.49           C  
ATOM  10160  N   LEU F  58      33.739 100.667  -5.770  1.00 21.12           N  
ATOM  10161  CA  LEU F  58      32.794  99.646  -5.362  1.00 20.29           C  
ATOM  10162  C   LEU F  58      32.733  98.541  -6.406  1.00 22.21           C  
ATOM  10163  O   LEU F  58      32.556  97.374  -6.083  1.00 21.52           O  
ATOM  10164  CB  LEU F  58      31.383 100.247  -5.140  1.00 19.85           C  
ATOM  10165  CG  LEU F  58      30.254  99.241  -4.941  1.00 20.64           C  
ATOM  10166  CD1 LEU F  58      30.513  98.352  -3.679  1.00 21.78           C  
ATOM  10167  CD2 LEU F  58      28.904  99.976  -4.789  1.00 27.88           C  
ATOM  10168  N   LYS F  59      32.861  98.906  -7.674  1.00 22.72           N  
ATOM  10169  CA  LYS F  59      32.808  97.895  -8.716  1.00 22.47           C  
ATOM  10170  C   LYS F  59      33.956  96.909  -8.593  1.00 17.58           C  
ATOM  10171  O   LYS F  59      33.761  95.729  -8.785  1.00 21.60           O  
ATOM  10172  CB  LYS F  59      32.813  98.562 -10.110  1.00 26.15           C  
ATOM  10173  CG  LYS F  59      32.828  97.600 -11.271  1.00 29.49           C  
ATOM  10174  CD  LYS F  59      32.732  98.370 -12.606  1.00 35.78           C  
ATOM  10175  CE  LYS F  59      33.091  97.470 -13.832  1.00 39.81           C  
ATOM  10176  NZ  LYS F  59      34.542  97.026 -13.869  1.00 35.96           N  
ATOM  10177  N   VAL F  60      35.148  97.395  -8.286  1.00 21.91           N  
ATOM  10178  CA  VAL F  60      36.309  96.525  -8.122  1.00 22.06           C  
ATOM  10179  C   VAL F  60      36.089  95.624  -6.932  1.00 22.59           C  
ATOM  10180  O   VAL F  60      36.297  94.417  -6.998  1.00 22.11           O  
ATOM  10181  CB  VAL F  60      37.596  97.351  -7.918  1.00 25.59           C  
ATOM  10182  CG1 VAL F  60      38.762  96.436  -7.468  1.00 25.29           C  
ATOM  10183  CG2 VAL F  60      37.977  98.057  -9.259  1.00 28.38           C  
ATOM  10184  N   PHE F  61      35.625  96.205  -5.830  1.00 24.00           N  
ATOM  10185  CA  PHE F  61      35.386  95.413  -4.643  1.00 19.69           C  
ATOM  10186  C   PHE F  61      34.399  94.286  -4.966  1.00 21.06           C  
ATOM  10187  O   PHE F  61      34.617  93.109  -4.645  1.00 19.85           O  
ATOM  10188  CB  PHE F  61      34.810  96.312  -3.534  1.00 20.70           C  
ATOM  10189  CG  PHE F  61      34.487  95.559  -2.276  1.00 21.85           C  
ATOM  10190  CD1 PHE F  61      35.472  95.352  -1.303  1.00 22.49           C  
ATOM  10191  CD2 PHE F  61      33.217  95.032  -2.091  1.00 19.36           C  
ATOM  10192  CE1 PHE F  61      35.183  94.629  -0.151  1.00 22.62           C  
ATOM  10193  CE2 PHE F  61      32.893  94.288  -0.929  1.00 23.69           C  
ATOM  10194  CZ  PHE F  61      33.894  94.090   0.054  1.00 23.36           C  
ATOM  10195  N   LEU F  62      33.276  94.641  -5.569  1.00 20.07           N  
ATOM  10196  CA  LEU F  62      32.286  93.638  -5.913  1.00 20.68           C  
ATOM  10197  C   LEU F  62      32.771  92.607  -6.927  1.00 18.87           C  
ATOM  10198  O   LEU F  62      32.519  91.430  -6.752  1.00 21.03           O  
ATOM  10199  CB  LEU F  62      31.009  94.313  -6.429  1.00 22.67           C  
ATOM  10200  CG  LEU F  62      30.092  94.878  -5.341  1.00 26.19           C  
ATOM  10201  CD1 LEU F  62      28.977  95.655  -6.065  1.00 24.37           C  
ATOM  10202  CD2 LEU F  62      29.507  93.757  -4.451  1.00 17.09           C  
ATOM  10203  N   GLU F  63      33.475  93.037  -7.976  1.00 22.12           N  
ATOM  10204  CA  GLU F  63      33.996  92.066  -8.964  1.00 22.93           C  
ATOM  10205  C   GLU F  63      34.870  91.042  -8.258  1.00 22.23           C  
ATOM  10206  O   GLU F  63      34.744  89.849  -8.489  1.00 21.15           O  
ATOM  10207  CB  GLU F  63      34.860  92.769 -10.038  1.00 25.95           C  
ATOM  10208  CG  GLU F  63      34.020  93.701 -10.902  1.00 29.92           C  
ATOM  10209  CD  GLU F  63      34.833  94.541 -11.875  1.00 29.57           C  
ATOM  10210  OE1 GLU F  63      35.984  94.878 -11.563  1.00 30.92           O  
ATOM  10211  OE2 GLU F  63      34.278  94.901 -12.938  1.00 36.01           O  
ATOM  10212  N   ASN F  64      35.754  91.516  -7.379  1.00 22.24           N  
ATOM  10213  CA  ASN F  64      36.665  90.600  -6.681  1.00 21.55           C  
ATOM  10214  C   ASN F  64      35.936  89.622  -5.784  1.00 20.93           C  
ATOM  10215  O   ASN F  64      36.184  88.416  -5.824  1.00 20.00           O  
ATOM  10216  CB  ASN F  64      37.711  91.390  -5.867  1.00 21.20           C  
ATOM  10217  CG  ASN F  64      38.688  92.150  -6.763  1.00 28.98           C  
ATOM  10218  OD1 ASN F  64      38.819  91.822  -7.938  1.00 36.11           O  
ATOM  10219  ND2 ASN F  64      39.369  93.156  -6.220  1.00 30.14           N  
ATOM  10220  N   VAL F  65      35.027  90.118  -4.956  1.00 21.68           N  
ATOM  10221  CA  VAL F  65      34.328  89.174  -4.069  1.00 20.67           C  
ATOM  10222  C   VAL F  65      33.410  88.235  -4.878  1.00 18.88           C  
ATOM  10223  O   VAL F  65      33.347  87.025  -4.607  1.00 18.32           O  
ATOM  10224  CB  VAL F  65      33.470  89.932  -3.000  1.00 19.15           C  
ATOM  10225  CG1 VAL F  65      32.762  88.922  -2.103  1.00 21.50           C  
ATOM  10226  CG2 VAL F  65      34.396  90.867  -2.142  1.00 25.18           C  
ATOM  10227  N   ILE F  66      32.679  88.794  -5.845  1.00 20.76           N  
ATOM  10228  CA  ILE F  66      31.764  87.971  -6.647  1.00 19.78           C  
ATOM  10229  C   ILE F  66      32.531  86.928  -7.464  1.00 23.33           C  
ATOM  10230  O   ILE F  66      32.097  85.781  -7.567  1.00 22.15           O  
ATOM  10231  CB  ILE F  66      30.876  88.851  -7.595  1.00 24.40           C  
ATOM  10232  CG1 ILE F  66      29.816  89.595  -6.764  1.00 21.56           C  
ATOM  10233  CG2 ILE F  66      30.144  87.948  -8.630  1.00 22.22           C  
ATOM  10234  CD1 ILE F  66      29.225  90.857  -7.449  1.00 20.62           C  
ATOM  10235  N   ARG F  67      33.681  87.311  -8.032  1.00 21.67           N  
ATOM  10236  CA  ARG F  67      34.469  86.320  -8.778  1.00 22.15           C  
ATOM  10237  C   ARG F  67      34.757  85.074  -7.920  1.00 23.61           C  
ATOM  10238  O   ARG F  67      34.537  83.923  -8.345  1.00 21.15           O  
ATOM  10239  CB  ARG F  67      35.798  86.952  -9.240  1.00 21.46           C  
ATOM  10240  CG  ARG F  67      36.707  86.002 -10.054  1.00 31.67           C  
ATOM  10241  CD  ARG F  67      38.066  86.665 -10.371  1.00 35.94           C  
ATOM  10242  NE  ARG F  67      37.874  87.980 -10.986  1.00 50.44           N  
ATOM  10243  CZ  ARG F  67      38.295  89.134 -10.465  1.00 50.40           C  
ATOM  10244  NH1 ARG F  67      38.946  89.156  -9.302  1.00 49.86           N  
ATOM  10245  NH2 ARG F  67      38.072  90.270 -11.117  1.00 51.42           N  
ATOM  10246  N   ASP F  68      35.274  85.288  -6.710  1.00 24.21           N  
ATOM  10247  CA  ASP F  68      35.594  84.167  -5.820  1.00 22.72           C  
ATOM  10248  C   ASP F  68      34.335  83.442  -5.380  1.00 20.21           C  
ATOM  10249  O   ASP F  68      34.286  82.213  -5.317  1.00 23.51           O  
ATOM  10250  CB  ASP F  68      36.321  84.670  -4.569  1.00 20.69           C  
ATOM  10251  CG  ASP F  68      37.763  85.044  -4.843  1.00 28.53           C  
ATOM  10252  OD1 ASP F  68      38.215  84.940  -6.014  1.00 24.88           O  
ATOM  10253  OD2 ASP F  68      38.448  85.444  -3.889  1.00 22.76           O  
ATOM  10254  N   ALA F  69      33.300  84.196  -5.059  1.00 20.99           N  
ATOM  10255  CA  ALA F  69      32.078  83.529  -4.596  1.00 22.53           C  
ATOM  10256  C   ALA F  69      31.570  82.576  -5.698  1.00 23.33           C  
ATOM  10257  O   ALA F  69      31.268  81.413  -5.440  1.00 23.52           O  
ATOM  10258  CB  ALA F  69      31.039  84.548  -4.261  1.00 20.52           C  
ATOM  10259  N   VAL F  70      31.512  83.077  -6.931  1.00 25.19           N  
ATOM  10260  CA  VAL F  70      31.045  82.253  -8.051  1.00 24.95           C  
ATOM  10261  C   VAL F  70      32.005  81.096  -8.305  1.00 25.33           C  
ATOM  10262  O   VAL F  70      31.590  80.020  -8.754  1.00 30.27           O  
ATOM  10263  CB  VAL F  70      30.883  83.119  -9.329  1.00 27.88           C  
ATOM  10264  CG1 VAL F  70      30.646  82.232 -10.566  1.00 25.80           C  
ATOM  10265  CG2 VAL F  70      29.735  84.073  -9.116  1.00 23.43           C  
ATOM  10266  N   THR F  71      33.279  81.290  -8.006  1.00 24.38           N  
ATOM  10267  CA  THR F  71      34.226  80.195  -8.191  1.00 25.80           C  
ATOM  10268  C   THR F  71      33.862  79.067  -7.234  1.00 29.58           C  
ATOM  10269  O   THR F  71      33.904  77.882  -7.634  1.00 26.38           O  
ATOM  10270  CB  THR F  71      35.649  80.658  -7.984  1.00 24.68           C  
ATOM  10271  OG1 THR F  71      35.932  81.613  -8.996  1.00 22.46           O  
ATOM  10272  CG2 THR F  71      36.640  79.505  -8.142  1.00 24.79           C  
ATOM  10273  N   TYR F  72      33.473  79.416  -5.993  1.00 25.15           N  
ATOM  10274  CA  TYR F  72      33.053  78.402  -5.039  1.00 23.25           C  
ATOM  10275  C   TYR F  72      31.741  77.758  -5.561  1.00 27.36           C  
ATOM  10276  O   TYR F  72      31.573  76.545  -5.469  1.00 25.26           O  
ATOM  10277  CB  TYR F  72      32.801  78.990  -3.632  1.00 21.96           C  
ATOM  10278  CG  TYR F  72      34.065  79.283  -2.829  1.00 25.45           C  
ATOM  10279  CD1 TYR F  72      34.432  80.596  -2.505  1.00 24.08           C  
ATOM  10280  CD2 TYR F  72      34.898  78.249  -2.416  1.00 23.84           C  
ATOM  10281  CE1 TYR F  72      35.604  80.861  -1.797  1.00 24.82           C  
ATOM  10282  CE2 TYR F  72      36.038  78.494  -1.712  1.00 27.33           C  
ATOM  10283  CZ  TYR F  72      36.396  79.799  -1.404  1.00 27.13           C  
ATOM  10284  OH  TYR F  72      37.550  80.012  -0.698  1.00 30.10           O  
ATOM  10285  N   THR F  73      30.823  78.579  -6.085  1.00 23.80           N  
ATOM  10286  CA  THR F  73      29.540  78.076  -6.628  1.00 28.27           C  
ATOM  10287  C   THR F  73      29.781  77.019  -7.741  1.00 30.90           C  
ATOM  10288  O   THR F  73      29.213  75.923  -7.727  1.00 28.71           O  
ATOM  10289  CB  THR F  73      28.690  79.243  -7.237  1.00 29.07           C  
ATOM  10290  OG1 THR F  73      28.486  80.258  -6.242  1.00 29.43           O  
ATOM  10291  CG2 THR F  73      27.300  78.745  -7.703  1.00 23.34           C  
ATOM  10292  N   GLU F  74      30.645  77.344  -8.691  1.00 30.49           N  
ATOM  10293  CA  GLU F  74      30.947  76.419  -9.785  1.00 31.98           C  
ATOM  10294  C   GLU F  74      31.629  75.147  -9.290  1.00 34.22           C  
ATOM  10295  O   GLU F  74      31.313  74.046  -9.744  1.00 31.87           O  
ATOM  10296  CB  GLU F  74      31.842  77.108 -10.810  1.00 34.22           C  
ATOM  10297  CG  GLU F  74      31.153  78.241 -11.564  1.00 47.02           C  
ATOM  10298  CD  GLU F  74      32.110  79.023 -12.464  1.00 52.53           C  
ATOM  10299  OE1 GLU F  74      33.304  78.666 -12.543  1.00 59.38           O  
ATOM  10300  OE2 GLU F  74      31.668  80.002 -13.095  1.00 57.92           O  
ATOM  10301  N   HIS F  75      32.567  75.292  -8.355  1.00 30.76           N  
ATOM  10302  CA  HIS F  75      33.263  74.143  -7.844  1.00 30.10           C  
ATOM  10303  C   HIS F  75      32.286  73.141  -7.229  1.00 34.34           C  
ATOM  10304  O   HIS F  75      32.482  71.926  -7.316  1.00 31.25           O  
ATOM  10305  CB  HIS F  75      34.259  74.539  -6.772  1.00 31.26           C  
ATOM  10306  CG  HIS F  75      35.078  73.387  -6.302  1.00 32.73           C  
ATOM  10307  ND1 HIS F  75      36.144  72.897  -7.023  1.00 32.25           N  
ATOM  10308  CD2 HIS F  75      34.903  72.542  -5.265  1.00 32.78           C  
ATOM  10309  CE1 HIS F  75      36.582  71.793  -6.451  1.00 35.45           C  
ATOM  10310  NE2 HIS F  75      35.845  71.556  -5.383  1.00 32.28           N  
ATOM  10311  N   ALA F  76      31.254  73.657  -6.568  1.00 32.73           N  
ATOM  10312  CA  ALA F  76      30.284  72.786  -5.942  1.00 36.25           C  
ATOM  10313  C   ALA F  76      29.281  72.313  -6.984  1.00 35.71           C  
ATOM  10314  O   ALA F  76      28.332  71.608  -6.654  1.00 37.65           O  
ATOM  10315  CB  ALA F  76      29.576  73.522  -4.840  1.00 32.27           C  
ATOM  10316  N   LYS F  77      29.483  72.736  -8.228  1.00 36.15           N  
ATOM  10317  CA  LYS F  77      28.587  72.380  -9.330  1.00 36.89           C  
ATOM  10318  C   LYS F  77      27.156  72.857  -9.106  1.00 37.37           C  
ATOM  10319  O   LYS F  77      26.199  72.162  -9.446  1.00 36.06           O  
ATOM  10320  CB  LYS F  77      28.583  70.863  -9.559  1.00 38.19           C  
ATOM  10321  CG  LYS F  77      29.800  70.354 -10.290  1.00 42.61           C  
ATOM  10322  CD  LYS F  77      29.841  68.836 -10.267  1.00 48.98           C  
ATOM  10323  CE  LYS F  77      31.184  68.305 -10.735  1.00 53.62           C  
ATOM  10324  NZ  LYS F  77      31.413  66.935 -10.160  1.00 57.91           N  
ATOM  10325  N   ARG F  78      27.005  74.043  -8.529  1.00 33.95           N  
ATOM  10326  CA  ARG F  78      25.677  74.589  -8.293  1.00 30.45           C  
ATOM  10327  C   ARG F  78      25.487  75.707  -9.287  1.00 29.45           C  
ATOM  10328  O   ARG F  78      26.435  76.136  -9.915  1.00 28.26           O  
ATOM  10329  CB  ARG F  78      25.560  75.138  -6.858  1.00 28.99           C  
ATOM  10330  CG  ARG F  78      25.306  74.063  -5.802  1.00 29.79           C  
ATOM  10331  CD  ARG F  78      25.169  74.629  -4.358  1.00 32.47           C  
ATOM  10332  NE  ARG F  78      26.437  74.850  -3.647  1.00 31.23           N  
ATOM  10333  CZ  ARG F  78      27.067  76.030  -3.576  1.00 28.08           C  
ATOM  10334  NH1 ARG F  78      26.565  77.106  -4.185  1.00 23.22           N  
ATOM  10335  NH2 ARG F  78      28.191  76.147  -2.855  1.00 27.71           N  
ATOM  10336  N   LYS F  79      24.260  76.180  -9.438  1.00 28.62           N  
ATOM  10337  CA  LYS F  79      23.992  77.287 -10.329  1.00 33.31           C  
ATOM  10338  C   LYS F  79      23.543  78.472  -9.466  1.00 31.27           C  
ATOM  10339  O   LYS F  79      23.333  79.564  -9.956  1.00 33.50           O  
ATOM  10340  CB  LYS F  79      22.879  76.908 -11.312  1.00 39.33           C  
ATOM  10341  CG  LYS F  79      23.307  75.899 -12.376  1.00 47.15           C  
ATOM  10342  CD  LYS F  79      22.075  75.326 -13.052  1.00 57.31           C  
ATOM  10343  CE  LYS F  79      22.396  74.646 -14.374  1.00 61.00           C  
ATOM  10344  NZ  LYS F  79      21.144  74.517 -15.193  1.00 63.23           N  
ATOM  10345  N   THR F  80      23.374  78.221  -8.179  1.00 28.71           N  
ATOM  10346  CA  THR F  80      22.926  79.236  -7.228  1.00 30.54           C  
ATOM  10347  C   THR F  80      24.068  79.705  -6.302  1.00 28.41           C  
ATOM  10348  O   THR F  80      24.708  78.903  -5.650  1.00 27.52           O  
ATOM  10349  CB  THR F  80      21.773  78.649  -6.378  1.00 33.18           C  
ATOM  10350  OG1 THR F  80      20.769  78.139  -7.267  1.00 37.09           O  
ATOM  10351  CG2 THR F  80      21.145  79.724  -5.467  1.00 35.18           C  
ATOM  10352  N   VAL F  81      24.344  80.998  -6.284  1.00 29.58           N  
ATOM  10353  CA  VAL F  81      25.398  81.529  -5.418  1.00 25.82           C  
ATOM  10354  C   VAL F  81      24.766  81.575  -4.021  1.00 27.38           C  
ATOM  10355  O   VAL F  81      23.707  82.197  -3.843  1.00 25.50           O  
ATOM  10356  CB  VAL F  81      25.789  82.936  -5.839  1.00 24.45           C  
ATOM  10357  CG1 VAL F  81      26.967  83.438  -4.929  1.00 24.41           C  
ATOM  10358  CG2 VAL F  81      26.256  82.939  -7.339  1.00 26.18           C  
ATOM  10359  N   THR F  82      25.379  80.898  -3.059  1.00 23.30           N  
ATOM  10360  CA  THR F  82      24.825  80.861  -1.703  1.00 26.12           C  
ATOM  10361  C   THR F  82      25.424  81.935  -0.792  1.00 25.92           C  
ATOM  10362  O   THR F  82      26.441  82.541  -1.130  1.00 21.75           O  
ATOM  10363  CB  THR F  82      25.063  79.467  -1.018  1.00 26.98           C  
ATOM  10364  OG1 THR F  82      26.462  79.150  -1.022  1.00 27.76           O  
ATOM  10365  CG2 THR F  82      24.308  78.358  -1.735  1.00 27.64           C  
ATOM  10366  N   ALA F  83      24.781  82.181   0.354  1.00 24.45           N  
ATOM  10367  CA  ALA F  83      25.323  83.136   1.312  1.00 23.11           C  
ATOM  10368  C   ALA F  83      26.703  82.589   1.723  1.00 21.12           C  
ATOM  10369  O   ALA F  83      27.655  83.349   1.879  1.00 23.48           O  
ATOM  10370  CB  ALA F  83      24.397  83.263   2.536  1.00 20.75           C  
ATOM  10371  N   MET F  84      26.821  81.272   1.865  1.00 21.86           N  
ATOM  10372  CA  MET F  84      28.105  80.676   2.248  1.00 22.12           C  
ATOM  10373  C   MET F  84      29.172  80.890   1.155  1.00 23.50           C  
ATOM  10374  O   MET F  84      30.348  81.099   1.471  1.00 22.99           O  
ATOM  10375  CB  MET F  84      27.971  79.173   2.556  1.00 21.05           C  
ATOM  10376  CG  MET F  84      27.299  78.870   3.931  1.00 36.83           C  
ATOM  10377  SD  MET F  84      27.903  79.947   5.309  1.00 41.42           S  
ATOM  10378  CE  MET F  84      29.671  79.557   5.354  1.00 36.34           C  
ATOM  10379  N   ASP F  85      28.801  80.820  -0.126  1.00 22.69           N  
ATOM  10380  CA  ASP F  85      29.826  81.098  -1.164  1.00 21.86           C  
ATOM  10381  C   ASP F  85      30.362  82.528  -0.935  1.00 19.63           C  
ATOM  10382  O   ASP F  85      31.538  82.798  -1.097  1.00 21.01           O  
ATOM  10383  CB  ASP F  85      29.238  81.032  -2.598  1.00 23.63           C  
ATOM  10384  CG  ASP F  85      28.773  79.636  -2.990  1.00 26.36           C  
ATOM  10385  OD1 ASP F  85      29.358  78.668  -2.466  1.00 24.03           O  
ATOM  10386  OD2 ASP F  85      27.848  79.511  -3.849  1.00 27.71           O  
ATOM  10387  N   VAL F  86      29.488  83.458  -0.577  1.00 16.91           N  
ATOM  10388  CA  VAL F  86      29.931  84.865  -0.354  1.00 17.00           C  
ATOM  10389  C   VAL F  86      30.790  84.991   0.937  1.00 17.83           C  
ATOM  10390  O   VAL F  86      31.822  85.657   0.948  1.00 20.64           O  
ATOM  10391  CB  VAL F  86      28.724  85.793  -0.278  1.00 18.37           C  
ATOM  10392  CG1 VAL F  86      29.149  87.209   0.234  1.00 17.83           C  
ATOM  10393  CG2 VAL F  86      28.072  85.905  -1.707  1.00 20.06           C  
ATOM  10394  N   VAL F  87      30.331  84.359   2.013  1.00 21.26           N  
ATOM  10395  CA  VAL F  87      31.050  84.355   3.293  1.00 19.58           C  
ATOM  10396  C   VAL F  87      32.446  83.800   3.094  1.00 18.76           C  
ATOM  10397  O   VAL F  87      33.423  84.392   3.546  1.00 18.87           O  
ATOM  10398  CB  VAL F  87      30.245  83.507   4.360  1.00 20.69           C  
ATOM  10399  CG1 VAL F  87      31.095  83.280   5.656  1.00 22.83           C  
ATOM  10400  CG2 VAL F  87      28.988  84.274   4.713  1.00 19.99           C  
ATOM  10401  N   TYR F  88      32.568  82.678   2.386  1.00 21.96           N  
ATOM  10402  CA  TYR F  88      33.882  82.099   2.141  1.00 21.87           C  
ATOM  10403  C   TYR F  88      34.712  83.013   1.276  1.00 21.81           C  
ATOM  10404  O   TYR F  88      35.914  83.169   1.509  1.00 22.94           O  
ATOM  10405  CB  TYR F  88      33.763  80.725   1.466  1.00 26.17           C  
ATOM  10406  CG  TYR F  88      33.056  79.697   2.316  1.00 29.38           C  
ATOM  10407  CD1 TYR F  88      32.232  78.742   1.737  1.00 34.89           C  
ATOM  10408  CD2 TYR F  88      33.247  79.658   3.690  1.00 35.18           C  
ATOM  10409  CE1 TYR F  88      31.617  77.766   2.496  1.00 35.49           C  
ATOM  10410  CE2 TYR F  88      32.640  78.688   4.468  1.00 39.56           C  
ATOM  10411  CZ  TYR F  88      31.826  77.739   3.853  1.00 38.82           C  
ATOM  10412  OH  TYR F  88      31.247  76.748   4.594  1.00 42.43           O  
ATOM  10413  N   ALA F  89      34.092  83.629   0.279  1.00 21.08           N  
ATOM  10414  CA  ALA F  89      34.840  84.551  -0.597  1.00 19.96           C  
ATOM  10415  C   ALA F  89      35.325  85.742   0.246  1.00 22.38           C  
ATOM  10416  O   ALA F  89      36.490  86.171   0.153  1.00 21.15           O  
ATOM  10417  CB  ALA F  89      33.940  85.045  -1.741  1.00 19.33           C  
ATOM  10418  N   LEU F  90      34.440  86.276   1.080  1.00 18.52           N  
ATOM  10419  CA  LEU F  90      34.856  87.404   1.921  1.00 22.75           C  
ATOM  10420  C   LEU F  90      35.990  87.009   2.868  1.00 22.14           C  
ATOM  10421  O   LEU F  90      36.953  87.763   3.050  1.00 22.67           O  
ATOM  10422  CB  LEU F  90      33.667  87.909   2.728  1.00 21.86           C  
ATOM  10423  CG  LEU F  90      32.619  88.676   1.915  1.00 22.49           C  
ATOM  10424  CD1 LEU F  90      31.356  88.817   2.777  1.00 19.03           C  
ATOM  10425  CD2 LEU F  90      33.209  90.083   1.532  1.00 20.43           C  
ATOM  10426  N   LYS F  91      35.874  85.831   3.471  1.00 22.22           N  
ATOM  10427  CA  LYS F  91      36.901  85.368   4.386  1.00 24.29           C  
ATOM  10428  C   LYS F  91      38.250  85.281   3.666  1.00 26.32           C  
ATOM  10429  O   LYS F  91      39.247  85.756   4.202  1.00 26.57           O  
ATOM  10430  CB  LYS F  91      36.550  83.985   5.002  1.00 27.65           C  
ATOM  10431  CG  LYS F  91      37.562  83.614   6.093  1.00 28.50           C  
ATOM  10432  CD  LYS F  91      37.339  82.240   6.675  1.00 42.55           C  
ATOM  10433  CE  LYS F  91      36.004  82.104   7.398  1.00 46.29           C  
ATOM  10434  NZ  LYS F  91      35.801  80.721   7.974  1.00 44.82           N  
ATOM  10435  N   ARG F  92      38.272  84.694   2.461  1.00 24.75           N  
ATOM  10436  CA  ARG F  92      39.499  84.535   1.643  1.00 28.11           C  
ATOM  10437  C   ARG F  92      40.169  85.867   1.413  1.00 26.72           C  
ATOM  10438  O   ARG F  92      41.352  85.951   1.261  1.00 27.78           O  
ATOM  10439  CB  ARG F  92      39.228  84.085   0.194  1.00 31.91           C  
ATOM  10440  CG  ARG F  92      38.835  82.730  -0.123  1.00 40.30           C  
ATOM  10441  CD  ARG F  92      39.171  82.532  -1.631  1.00 31.27           C  
ATOM  10442  NE  ARG F  92      40.619  82.487  -1.790  1.00 26.59           N  
ATOM  10443  CZ  ARG F  92      41.374  83.393  -2.414  1.00 29.97           C  
ATOM  10444  NH1 ARG F  92      40.868  84.477  -3.001  1.00 25.42           N  
ATOM  10445  NH2 ARG F  92      42.683  83.231  -2.404  1.00 35.49           N  
ATOM  10446  N   GLN F  93      39.358  86.885   1.236  1.00 28.32           N  
ATOM  10447  CA  GLN F  93      39.847  88.214   1.021  1.00 28.52           C  
ATOM  10448  C   GLN F  93      40.165  88.980   2.293  1.00 28.45           C  
ATOM  10449  O   GLN F  93      40.460  90.140   2.224  1.00 26.72           O  
ATOM  10450  CB  GLN F  93      38.826  88.979   0.202  1.00 30.74           C  
ATOM  10451  CG  GLN F  93      39.024  88.675  -1.268  1.00 45.46           C  
ATOM  10452  CD  GLN F  93      37.774  88.773  -2.069  1.00 47.26           C  
ATOM  10453  OE1 GLN F  93      37.158  89.839  -2.155  1.00 48.58           O  
ATOM  10454  NE2 GLN F  93      37.379  87.654  -2.678  1.00 47.19           N  
ATOM  10455  N   GLY F  94      40.098  88.345   3.452  1.00 29.56           N  
ATOM  10456  CA  GLY F  94      40.423  89.085   4.668  1.00 27.97           C  
ATOM  10457  C   GLY F  94      39.348  90.089   5.077  1.00 29.08           C  
ATOM  10458  O   GLY F  94      39.656  91.115   5.691  1.00 27.50           O  
ATOM  10459  N   ARG F  95      38.093  89.795   4.723  1.00 25.58           N  
ATOM  10460  CA  ARG F  95      36.936  90.651   5.048  1.00 27.21           C  
ATOM  10461  C   ARG F  95      35.864  89.773   5.746  1.00 25.40           C  
ATOM  10462  O   ARG F  95      34.646  89.905   5.453  1.00 23.83           O  
ATOM  10463  CB  ARG F  95      36.286  91.240   3.782  1.00 28.23           C  
ATOM  10464  CG  ARG F  95      37.159  92.002   2.790  1.00 34.64           C  
ATOM  10465  CD  ARG F  95      37.554  93.352   3.254  1.00 39.23           C  
ATOM  10466  NE  ARG F  95      36.476  94.046   3.958  1.00 46.13           N  
ATOM  10467  CZ  ARG F  95      36.615  95.236   4.529  1.00 41.37           C  
ATOM  10468  NH1 ARG F  95      37.792  95.854   4.462  1.00 40.72           N  
ATOM  10469  NH2 ARG F  95      35.590  95.795   5.171  1.00 36.34           N  
ATOM  10470  N   THR F  96      36.309  88.894   6.647  1.00 21.38           N  
ATOM  10471  CA  THR F  96      35.399  87.996   7.370  1.00 22.14           C  
ATOM  10472  C   THR F  96      34.105  88.702   7.773  1.00 19.37           C  
ATOM  10473  O   THR F  96      34.132  89.803   8.299  1.00 20.90           O  
ATOM  10474  CB  THR F  96      36.058  87.430   8.619  1.00 23.14           C  
ATOM  10475  OG1 THR F  96      37.204  86.665   8.247  1.00 23.52           O  
ATOM  10476  CG2 THR F  96      35.067  86.489   9.360  1.00 23.28           C  
ATOM  10477  N   LEU F  97      32.984  88.069   7.480  1.00 18.24           N  
ATOM  10478  CA  LEU F  97      31.679  88.641   7.755  1.00 20.89           C  
ATOM  10479  C   LEU F  97      30.928  87.701   8.700  1.00 20.05           C  
ATOM  10480  O   LEU F  97      30.897  86.487   8.478  1.00 21.66           O  
ATOM  10481  CB  LEU F  97      30.873  88.785   6.424  1.00 20.69           C  
ATOM  10482  CG  LEU F  97      29.422  89.259   6.618  1.00 23.40           C  
ATOM  10483  CD1 LEU F  97      29.487  90.697   7.150  1.00 21.59           C  
ATOM  10484  CD2 LEU F  97      28.588  89.219   5.327  1.00 24.72           C  
ATOM  10485  N   TYR F  98      30.369  88.251   9.776  1.00 20.22           N  
ATOM  10486  CA  TYR F  98      29.585  87.440  10.702  1.00 19.90           C  
ATOM  10487  C   TYR F  98      28.111  87.749  10.449  1.00 20.41           C  
ATOM  10488  O   TYR F  98      27.759  88.877  10.143  1.00 17.43           O  
ATOM  10489  CB  TYR F  98      29.833  87.863  12.162  1.00 19.34           C  
ATOM  10490  CG  TYR F  98      31.131  87.453  12.793  1.00 20.61           C  
ATOM  10491  CD1 TYR F  98      32.065  86.676  12.121  1.00 20.15           C  
ATOM  10492  CD2 TYR F  98      31.403  87.828  14.116  1.00 20.16           C  
ATOM  10493  CE1 TYR F  98      33.261  86.278  12.762  1.00 25.36           C  
ATOM  10494  CE2 TYR F  98      32.551  87.452  14.749  1.00 24.53           C  
ATOM  10495  CZ  TYR F  98      33.485  86.684  14.086  1.00 26.55           C  
ATOM  10496  OH  TYR F  98      34.641  86.357  14.756  1.00 26.51           O  
ATOM  10497  N   GLY F  99      27.256  86.766  10.671  1.00 22.35           N  
ATOM  10498  CA  GLY F  99      25.836  87.006  10.555  1.00 23.02           C  
ATOM  10499  C   GLY F  99      25.152  86.254   9.448  1.00 24.88           C  
ATOM  10500  O   GLY F  99      23.953  86.275   9.378  1.00 26.11           O  
ATOM  10501  N   PHE F 100      25.894  85.591   8.579  1.00 25.93           N  
ATOM  10502  CA  PHE F 100      25.235  84.898   7.494  1.00 27.22           C  
ATOM  10503  C   PHE F 100      25.564  83.429   7.375  1.00 27.56           C  
ATOM  10504  O   PHE F 100      25.434  82.856   6.286  1.00 33.00           O  
ATOM  10505  CB  PHE F 100      25.529  85.608   6.173  1.00 23.57           C  
ATOM  10506  CG  PHE F 100      24.904  86.974   6.067  1.00 22.49           C  
ATOM  10507  CD1 PHE F 100      25.531  88.082   6.607  1.00 17.27           C  
ATOM  10508  CD2 PHE F 100      23.645  87.133   5.461  1.00 23.06           C  
ATOM  10509  CE1 PHE F 100      24.929  89.334   6.559  1.00 22.27           C  
ATOM  10510  CE2 PHE F 100      23.022  88.383   5.407  1.00 23.46           C  
ATOM  10511  CZ  PHE F 100      23.662  89.487   5.957  1.00 26.06           C  
ATOM  10512  N   GLY F 101      25.970  82.826   8.488  1.00 27.19           N  
ATOM  10513  CA  GLY F 101      26.305  81.412   8.512  1.00 30.01           C  
ATOM  10514  C   GLY F 101      27.808  81.266   8.545  1.00 36.38           C  
ATOM  10515  O   GLY F 101      28.356  80.161   8.669  1.00 39.59           O  
ATOM  10516  N   GLY F 102      28.483  82.405   8.453  1.00 36.23           N  
ATOM  10517  CA  GLY F 102      29.922  82.391   8.460  1.00 45.12           C  
ATOM  10518  C   GLY F 102      30.451  82.987   9.729  1.00 45.29           C  
ATOM  10519  O   GLY F 102      30.228  82.364  10.766  1.00 51.12           O  
ATOM  10520  OXT GLY F 102      31.069  84.065   9.683  1.00 49.86           O  
TER   10521      GLY F 102                                                      
ATOM  10522  N   ALA G  14      60.552  50.224 -13.040  1.00 74.08           N  
ATOM  10523  CA  ALA G  14      59.564  51.213 -12.512  1.00 73.13           C  
ATOM  10524  C   ALA G  14      59.910  52.625 -12.965  1.00 72.08           C  
ATOM  10525  O   ALA G  14      61.070  53.034 -12.925  1.00 71.12           O  
ATOM  10526  CB  ALA G  14      59.530  51.158 -10.990  1.00 72.79           C  
ATOM  10527  N   LYS G  15      58.895  53.364 -13.397  1.00 71.59           N  
ATOM  10528  CA  LYS G  15      59.085  54.738 -13.847  1.00 70.12           C  
ATOM  10529  C   LYS G  15      58.517  55.676 -12.780  1.00 66.90           C  
ATOM  10530  O   LYS G  15      57.409  55.458 -12.283  1.00 67.84           O  
ATOM  10531  CB  LYS G  15      58.356  54.957 -15.176  1.00 73.42           C  
ATOM  10532  CG  LYS G  15      58.826  56.172 -15.960  1.00 77.56           C  
ATOM  10533  CD  LYS G  15      60.243  55.973 -16.491  1.00 81.02           C  
ATOM  10534  CE  LYS G  15      60.760  57.215 -17.219  1.00 83.38           C  
ATOM  10535  NZ  LYS G  15      59.869  57.651 -18.338  1.00 84.45           N  
ATOM  10536  N   THR G  16      59.274  56.708 -12.418  1.00 62.34           N  
ATOM  10537  CA  THR G  16      58.807  57.658 -11.410  1.00 57.17           C  
ATOM  10538  C   THR G  16      57.540  58.351 -11.883  1.00 53.59           C  
ATOM  10539  O   THR G  16      57.343  58.577 -13.080  1.00 52.67           O  
ATOM  10540  CB  THR G  16      59.823  58.762 -11.139  1.00 55.87           C  
ATOM  10541  OG1 THR G  16      59.912  59.601 -12.295  1.00 55.99           O  
ATOM  10542  CG2 THR G  16      61.183  58.181 -10.820  1.00 55.78           C  
ATOM  10543  N   ARG G  17      56.675  58.691 -10.939  1.00 50.31           N  
ATOM  10544  CA  ARG G  17      55.455  59.381 -11.291  1.00 48.11           C  
ATOM  10545  C   ARG G  17      55.802  60.714 -11.975  1.00 45.66           C  
ATOM  10546  O   ARG G  17      55.099  61.165 -12.876  1.00 45.76           O  
ATOM  10547  CB  ARG G  17      54.597  59.587 -10.035  1.00 50.85           C  
ATOM  10548  CG  ARG G  17      53.863  58.324  -9.590  1.00 50.03           C  
ATOM  10549  CD  ARG G  17      52.865  58.601  -8.469  1.00 49.28           C  
ATOM  10550  NE  ARG G  17      53.510  58.639  -7.164  1.00 50.50           N  
ATOM  10551  CZ  ARG G  17      52.890  58.956  -6.031  1.00 51.70           C  
ATOM  10552  NH1 ARG G  17      51.598  59.272  -6.042  1.00 45.35           N  
ATOM  10553  NH2 ARG G  17      53.559  58.935  -4.888  1.00 49.33           N  
ATOM  10554  N   SER G  18      56.901  61.335 -11.566  1.00 43.99           N  
ATOM  10555  CA  SER G  18      57.306  62.586 -12.188  1.00 46.14           C  
ATOM  10556  C   SER G  18      57.560  62.390 -13.686  1.00 47.11           C  
ATOM  10557  O   SER G  18      57.071  63.159 -14.512  1.00 45.85           O  
ATOM  10558  CB  SER G  18      58.575  63.143 -11.521  1.00 47.80           C  
ATOM  10559  OG  SER G  18      58.343  63.521 -10.165  1.00 47.19           O  
ATOM  10560  N   SER G  19      58.330  61.360 -14.037  1.00 48.21           N  
ATOM  10561  CA  SER G  19      58.638  61.102 -15.444  1.00 49.84           C  
ATOM  10562  C   SER G  19      57.377  60.815 -16.250  1.00 47.26           C  
ATOM  10563  O   SER G  19      57.227  61.301 -17.367  1.00 47.93           O  
ATOM  10564  CB  SER G  19      59.657  59.953 -15.576  1.00 52.89           C  
ATOM  10565  OG  SER G  19      59.259  58.794 -14.866  1.00 56.93           O  
ATOM  10566  N   ARG G  20      56.466  60.044 -15.674  1.00 47.32           N  
ATOM  10567  CA  ARG G  20      55.203  59.734 -16.343  1.00 50.35           C  
ATOM  10568  C   ARG G  20      54.409  61.010 -16.623  1.00 50.56           C  
ATOM  10569  O   ARG G  20      53.682  61.102 -17.614  1.00 51.10           O  
ATOM  10570  CB  ARG G  20      54.328  58.832 -15.466  1.00 54.79           C  
ATOM  10571  CG  ARG G  20      54.827  57.417 -15.216  1.00 60.84           C  
ATOM  10572  CD  ARG G  20      53.813  56.692 -14.346  1.00 65.16           C  
ATOM  10573  NE  ARG G  20      54.273  55.388 -13.879  1.00 70.65           N  
ATOM  10574  CZ  ARG G  20      54.363  54.312 -14.652  1.00 71.65           C  
ATOM  10575  NH1 ARG G  20      54.027  54.388 -15.934  1.00 71.43           N  
ATOM  10576  NH2 ARG G  20      54.765  53.156 -14.141  1.00 71.32           N  
ATOM  10577  N   ALA G  21      54.528  61.989 -15.728  1.00 48.93           N  
ATOM  10578  CA  ALA G  21      53.790  63.238 -15.875  1.00 45.66           C  
ATOM  10579  C   ALA G  21      54.565  64.222 -16.704  1.00 45.75           C  
ATOM  10580  O   ALA G  21      54.048  65.282 -17.066  1.00 46.22           O  
ATOM  10581  CB  ALA G  21      53.494  63.835 -14.499  1.00 43.87           C  
ATOM  10582  N   GLY G  22      55.816  63.882 -16.984  1.00 44.32           N  
ATOM  10583  CA  GLY G  22      56.658  64.761 -17.775  1.00 45.30           C  
ATOM  10584  C   GLY G  22      57.093  65.966 -16.968  1.00 44.49           C  
ATOM  10585  O   GLY G  22      57.294  67.054 -17.507  1.00 44.52           O  
ATOM  10586  N   LEU G  23      57.273  65.758 -15.669  1.00 43.07           N  
ATOM  10587  CA  LEU G  23      57.655  66.839 -14.777  1.00 40.15           C  
ATOM  10588  C   LEU G  23      59.023  66.668 -14.160  1.00 40.20           C  
ATOM  10589  O   LEU G  23      59.529  65.551 -14.035  1.00 41.47           O  
ATOM  10590  CB  LEU G  23      56.630  66.941 -13.644  1.00 39.71           C  
ATOM  10591  CG  LEU G  23      55.179  67.171 -14.066  1.00 39.38           C  
ATOM  10592  CD1 LEU G  23      54.260  67.153 -12.843  1.00 41.10           C  
ATOM  10593  CD2 LEU G  23      55.098  68.488 -14.805  1.00 35.72           C  
ATOM  10594  N   GLN G  24      59.611  67.790 -13.766  1.00 39.70           N  
ATOM  10595  CA  GLN G  24      60.890  67.808 -13.078  1.00 39.83           C  
ATOM  10596  C   GLN G  24      60.597  67.743 -11.565  1.00 42.55           C  
ATOM  10597  O   GLN G  24      61.341  67.129 -10.803  1.00 44.40           O  
ATOM  10598  CB  GLN G  24      61.636  69.096 -13.391  1.00 41.61           C  
ATOM  10599  CG  GLN G  24      62.005  69.244 -14.852  1.00 50.99           C  
ATOM  10600  CD  GLN G  24      62.679  67.996 -15.374  1.00 52.55           C  
ATOM  10601  OE1 GLN G  24      63.607  67.477 -14.756  1.00 54.23           O  
ATOM  10602  NE2 GLN G  24      62.211  67.502 -16.510  1.00 53.47           N  
ATOM  10603  N   PHE G  25      59.518  68.393 -11.123  1.00 38.03           N  
ATOM  10604  CA  PHE G  25      59.174  68.365  -9.703  1.00 36.83           C  
ATOM  10605  C   PHE G  25      58.709  66.979  -9.266  1.00 36.95           C  
ATOM  10606  O   PHE G  25      58.051  66.274 -10.020  1.00 37.91           O  
ATOM  10607  CB  PHE G  25      58.128  69.444  -9.398  1.00 34.01           C  
ATOM  10608  CG  PHE G  25      58.735  70.775  -9.059  1.00 33.24           C  
ATOM  10609  CD1 PHE G  25      59.789  71.283  -9.817  1.00 33.21           C  
ATOM  10610  CD2 PHE G  25      58.309  71.492  -7.932  1.00 34.27           C  
ATOM  10611  CE1 PHE G  25      60.421  72.477  -9.458  1.00 31.89           C  
ATOM  10612  CE2 PHE G  25      58.923  72.682  -7.559  1.00 33.70           C  
ATOM  10613  CZ  PHE G  25      59.991  73.179  -8.326  1.00 39.85           C  
ATOM  10614  N   PRO G  26      59.026  66.584  -8.019  1.00 37.84           N  
ATOM  10615  CA  PRO G  26      58.680  65.278  -7.440  1.00 34.47           C  
ATOM  10616  C   PRO G  26      57.230  64.994  -7.050  1.00 38.20           C  
ATOM  10617  O   PRO G  26      56.785  65.329  -5.952  1.00 36.85           O  
ATOM  10618  CB  PRO G  26      59.607  65.195  -6.237  1.00 37.14           C  
ATOM  10619  CG  PRO G  26      59.567  66.648  -5.724  1.00 37.81           C  
ATOM  10620  CD  PRO G  26      59.666  67.461  -7.017  1.00 38.58           C  
ATOM  10621  N   VAL G  27      56.508  64.338  -7.941  1.00 36.61           N  
ATOM  10622  CA  VAL G  27      55.140  63.967  -7.677  1.00 35.66           C  
ATOM  10623  C   VAL G  27      55.072  63.160  -6.387  1.00 39.39           C  
ATOM  10624  O   VAL G  27      54.284  63.474  -5.497  1.00 37.93           O  
ATOM  10625  CB  VAL G  27      54.591  63.126  -8.824  1.00 35.94           C  
ATOM  10626  CG1 VAL G  27      53.320  62.461  -8.419  1.00 33.37           C  
ATOM  10627  CG2 VAL G  27      54.377  63.998 -10.030  1.00 38.09           C  
ATOM  10628  N   GLY G  28      55.905  62.122  -6.274  1.00 38.19           N  
ATOM  10629  CA  GLY G  28      55.882  61.294  -5.081  1.00 36.87           C  
ATOM  10630  C   GLY G  28      55.994  62.081  -3.779  1.00 37.33           C  
ATOM  10631  O   GLY G  28      55.251  61.836  -2.824  1.00 38.02           O  
ATOM  10632  N   ARG G  29      56.936  63.008  -3.732  1.00 34.33           N  
ATOM  10633  CA  ARG G  29      57.122  63.835  -2.549  1.00 38.19           C  
ATOM  10634  C   ARG G  29      55.906  64.743  -2.304  1.00 37.44           C  
ATOM  10635  O   ARG G  29      55.481  64.926  -1.157  1.00 35.37           O  
ATOM  10636  CB  ARG G  29      58.360  64.712  -2.694  1.00 35.39           C  
ATOM  10637  CG  ARG G  29      58.566  65.648  -1.517  1.00 37.52           C  
ATOM  10638  CD  ARG G  29      59.831  66.474  -1.679  1.00 42.66           C  
ATOM  10639  NE  ARG G  29      61.025  65.639  -1.623  1.00 41.07           N  
ATOM  10640  CZ  ARG G  29      62.267  66.095  -1.594  1.00 43.87           C  
ATOM  10641  NH1 ARG G  29      62.505  67.401  -1.622  1.00 41.19           N  
ATOM  10642  NH2 ARG G  29      63.281  65.233  -1.513  1.00 40.08           N  
ATOM  10643  N   VAL G  30      55.340  65.290  -3.380  1.00 36.65           N  
ATOM  10644  CA  VAL G  30      54.195  66.188  -3.247  1.00 35.33           C  
ATOM  10645  C   VAL G  30      52.997  65.409  -2.703  1.00 35.97           C  
ATOM  10646  O   VAL G  30      52.234  65.918  -1.875  1.00 33.74           O  
ATOM  10647  CB  VAL G  30      53.911  66.902  -4.610  1.00 34.02           C  
ATOM  10648  CG1 VAL G  30      52.644  67.732  -4.564  1.00 27.88           C  
ATOM  10649  CG2 VAL G  30      55.067  67.835  -4.928  1.00 29.40           C  
ATOM  10650  N   HIS G  31      52.851  64.156  -3.129  1.00 36.03           N  
ATOM  10651  CA  HIS G  31      51.757  63.316  -2.638  1.00 36.39           C  
ATOM  10652  C   HIS G  31      51.941  63.115  -1.131  1.00 37.46           C  
ATOM  10653  O   HIS G  31      51.011  63.291  -0.336  1.00 36.88           O  
ATOM  10654  CB  HIS G  31      51.781  61.953  -3.329  1.00 41.14           C  
ATOM  10655  CG  HIS G  31      50.468  61.230  -3.299  1.00 44.69           C  
ATOM  10656  ND1 HIS G  31      49.440  61.577  -2.446  1.00 48.49           N  
ATOM  10657  CD2 HIS G  31      50.017  60.176  -4.017  1.00 43.72           C  
ATOM  10658  CE1 HIS G  31      48.414  60.766  -2.644  1.00 47.88           C  
ATOM  10659  NE2 HIS G  31      48.740  59.908  -3.594  1.00 45.66           N  
ATOM  10660  N   ARG G  32      53.162  62.767  -0.753  1.00 36.37           N  
ATOM  10661  CA  ARG G  32      53.516  62.517   0.639  1.00 38.39           C  
ATOM  10662  C   ARG G  32      53.270  63.763   1.484  1.00 39.66           C  
ATOM  10663  O   ARG G  32      52.660  63.689   2.557  1.00 40.82           O  
ATOM  10664  CB  ARG G  32      54.996  62.120   0.711  1.00 40.45           C  
ATOM  10665  CG  ARG G  32      55.491  61.645   2.065  1.00 45.09           C  
ATOM  10666  CD  ARG G  32      57.019  61.700   2.088  1.00 51.66           C  
ATOM  10667  NE  ARG G  32      57.486  62.979   2.616  1.00 55.55           N  
ATOM  10668  CZ  ARG G  32      58.598  63.602   2.245  1.00 55.85           C  
ATOM  10669  NH1 ARG G  32      59.391  63.081   1.317  1.00 57.86           N  
ATOM  10670  NH2 ARG G  32      58.921  64.754   2.820  1.00 60.36           N  
ATOM  10671  N   LEU G  33      53.765  64.904   1.016  1.00 36.31           N  
ATOM  10672  CA  LEU G  33      53.569  66.154   1.749  1.00 37.27           C  
ATOM  10673  C   LEU G  33      52.068  66.469   1.882  1.00 37.91           C  
ATOM  10674  O   LEU G  33      51.632  66.948   2.923  1.00 40.94           O  
ATOM  10675  CB  LEU G  33      54.306  67.305   1.054  1.00 37.50           C  
ATOM  10676  CG  LEU G  33      55.837  67.182   1.008  1.00 37.02           C  
ATOM  10677  CD1 LEU G  33      56.432  68.316   0.196  1.00 35.49           C  
ATOM  10678  CD2 LEU G  33      56.390  67.194   2.412  1.00 37.35           C  
ATOM  10679  N   LEU G  34      51.278  66.197   0.853  1.00 33.77           N  
ATOM  10680  CA  LEU G  34      49.845  66.459   0.951  1.00 36.65           C  
ATOM  10681  C   LEU G  34      49.186  65.579   2.014  1.00 40.33           C  
ATOM  10682  O   LEU G  34      48.383  66.066   2.805  1.00 41.72           O  
ATOM  10683  CB  LEU G  34      49.141  66.243  -0.391  1.00 30.65           C  
ATOM  10684  CG  LEU G  34      49.340  67.360  -1.424  1.00 33.44           C  
ATOM  10685  CD1 LEU G  34      48.812  66.911  -2.787  1.00 28.07           C  
ATOM  10686  CD2 LEU G  34      48.620  68.652  -0.927  1.00 31.24           C  
ATOM  10687  N   ARG G  35      49.533  64.293   2.032  1.00 41.20           N  
ATOM  10688  CA  ARG G  35      48.967  63.343   2.990  1.00 45.74           C  
ATOM  10689  C   ARG G  35      49.263  63.683   4.425  1.00 46.50           C  
ATOM  10690  O   ARG G  35      48.385  63.620   5.276  1.00 51.38           O  
ATOM  10691  CB  ARG G  35      49.508  61.925   2.747  1.00 48.89           C  
ATOM  10692  CG  ARG G  35      48.995  61.251   1.509  1.00 53.09           C  
ATOM  10693  CD  ARG G  35      49.498  59.822   1.434  1.00 60.49           C  
ATOM  10694  NE  ARG G  35      48.946  59.124   0.275  1.00 63.31           N  
ATOM  10695  CZ  ARG G  35      47.646  58.944   0.068  1.00 64.86           C  
ATOM  10696  NH1 ARG G  35      46.758  59.404   0.940  1.00 66.93           N  
ATOM  10697  NH2 ARG G  35      47.233  58.317  -1.021  1.00 68.07           N  
ATOM  10698  N   LYS G  36      50.511  64.026   4.701  1.00 46.32           N  
ATOM  10699  CA  LYS G  36      50.914  64.322   6.059  1.00 47.49           C  
ATOM  10700  C   LYS G  36      50.658  65.749   6.493  1.00 48.14           C  
ATOM  10701  O   LYS G  36      50.882  66.091   7.660  1.00 46.05           O  
ATOM  10702  CB  LYS G  36      52.390  63.994   6.244  1.00 52.06           C  
ATOM  10703  CG  LYS G  36      52.713  62.501   6.153  1.00 55.12           C  
ATOM  10704  CD  LYS G  36      54.198  62.252   6.417  1.00 61.67           C  
ATOM  10705  CE  LYS G  36      54.560  60.781   6.240  1.00 65.44           C  
ATOM  10706  NZ  LYS G  36      56.033  60.557   6.266  1.00 69.17           N  
ATOM  10707  N   GLY G  37      50.193  66.584   5.563  1.00 43.54           N  
ATOM  10708  CA  GLY G  37      49.919  67.954   5.922  1.00 40.75           C  
ATOM  10709  C   GLY G  37      48.541  68.075   6.568  1.00 39.87           C  
ATOM  10710  O   GLY G  37      48.123  69.166   6.937  1.00 40.86           O  
ATOM  10711  N   ASN G  38      47.839  66.962   6.716  1.00 38.13           N  
ATOM  10712  CA  ASN G  38      46.492  66.998   7.296  1.00 41.56           C  
ATOM  10713  C   ASN G  38      45.550  67.921   6.543  1.00 40.10           C  
ATOM  10714  O   ASN G  38      44.801  68.671   7.163  1.00 41.07           O  
ATOM  10715  CB  ASN G  38      46.519  67.453   8.755  1.00 42.44           C  
ATOM  10716  CG  ASN G  38      47.018  66.382   9.681  1.00 45.17           C  
ATOM  10717  OD1 ASN G  38      48.125  66.467  10.210  1.00 44.67           O  
ATOM  10718  ND2 ASN G  38      46.201  65.353   9.881  1.00 47.34           N  
ATOM  10719  N   TYR G  39      45.589  67.877   5.219  1.00 34.41           N  
ATOM  10720  CA  TYR G  39      44.714  68.715   4.417  1.00 31.99           C  
ATOM  10721  C   TYR G  39      43.354  68.069   4.186  1.00 32.52           C  
ATOM  10722  O   TYR G  39      42.343  68.767   4.067  1.00 29.57           O  
ATOM  10723  CB  TYR G  39      45.383  69.025   3.075  1.00 29.17           C  
ATOM  10724  CG  TYR G  39      46.655  69.800   3.258  1.00 32.85           C  
ATOM  10725  CD1 TYR G  39      47.893  69.205   3.043  1.00 32.31           C  
ATOM  10726  CD2 TYR G  39      46.619  71.127   3.679  1.00 33.56           C  
ATOM  10727  CE1 TYR G  39      49.058  69.908   3.241  1.00 37.05           C  
ATOM  10728  CE2 TYR G  39      47.780  71.845   3.875  1.00 34.36           C  
ATOM  10729  CZ  TYR G  39      48.999  71.227   3.651  1.00 37.41           C  
ATOM  10730  OH  TYR G  39      50.156  71.933   3.803  1.00 35.14           O  
ATOM  10731  N   ALA G  40      43.338  66.738   4.121  1.00 28.51           N  
ATOM  10732  CA  ALA G  40      42.104  65.979   3.919  1.00 34.37           C  
ATOM  10733  C   ALA G  40      42.363  64.534   4.350  1.00 34.22           C  
ATOM  10734  O   ALA G  40      43.513  64.135   4.476  1.00 36.80           O  
ATOM  10735  CB  ALA G  40      41.695  66.010   2.440  1.00 30.91           C  
ATOM  10736  N   GLU G  41      41.312  63.759   4.580  1.00 36.11           N  
ATOM  10737  CA  GLU G  41      41.495  62.362   4.973  1.00 41.53           C  
ATOM  10738  C   GLU G  41      42.126  61.587   3.808  1.00 41.37           C  
ATOM  10739  O   GLU G  41      42.961  60.709   4.011  1.00 43.18           O  
ATOM  10740  CB  GLU G  41      40.155  61.709   5.329  1.00 46.11           C  
ATOM  10741  CG  GLU G  41      39.366  62.373   6.461  1.00 59.91           C  
ATOM  10742  CD  GLU G  41      40.068  62.299   7.811  1.00 66.55           C  
ATOM  10743  OE1 GLU G  41      40.713  61.265   8.087  1.00 69.29           O  
ATOM  10744  OE2 GLU G  41      39.961  63.268   8.602  1.00 71.06           O  
ATOM  10745  N   ARG G  42      41.733  61.921   2.588  1.00 39.33           N  
ATOM  10746  CA  ARG G  42      42.264  61.239   1.421  1.00 40.76           C  
ATOM  10747  C   ARG G  42      42.812  62.210   0.388  1.00 39.11           C  
ATOM  10748  O   ARG G  42      42.419  63.364   0.356  1.00 39.76           O  
ATOM  10749  CB  ARG G  42      41.173  60.402   0.762  1.00 44.47           C  
ATOM  10750  CG  ARG G  42      40.560  59.350   1.656  1.00 46.49           C  
ATOM  10751  CD  ARG G  42      39.607  58.508   0.858  1.00 50.93           C  
ATOM  10752  NE  ARG G  42      39.489  57.170   1.442  1.00 58.03           N  
ATOM  10753  CZ  ARG G  42      38.887  56.150   0.846  1.00 53.11           C  
ATOM  10754  NH1 ARG G  42      38.347  56.304  -0.357  1.00 54.11           N  
ATOM  10755  NH2 ARG G  42      38.814  54.986   1.461  1.00 56.99           N  
ATOM  10756  N   VAL G  43      43.710  61.720  -0.459  1.00 38.32           N  
ATOM  10757  CA  VAL G  43      44.314  62.509  -1.523  1.00 40.12           C  
ATOM  10758  C   VAL G  43      44.307  61.685  -2.797  1.00 39.24           C  
ATOM  10759  O   VAL G  43      44.956  60.653  -2.864  1.00 38.89           O  
ATOM  10760  CB  VAL G  43      45.787  62.876  -1.208  1.00 40.64           C  
ATOM  10761  CG1 VAL G  43      46.385  63.677  -2.389  1.00 37.33           C  
ATOM  10762  CG2 VAL G  43      45.859  63.665   0.086  1.00 39.56           C  
ATOM  10763  N   GLY G  44      43.560  62.130  -3.792  1.00 38.89           N  
ATOM  10764  CA  GLY G  44      43.499  61.413  -5.048  1.00 39.02           C  
ATOM  10765  C   GLY G  44      44.832  61.390  -5.781  1.00 40.06           C  
ATOM  10766  O   GLY G  44      45.725  62.200  -5.517  1.00 37.08           O  
ATOM  10767  N   ALA G  45      44.951  60.462  -6.730  1.00 39.58           N  
ATOM  10768  CA  ALA G  45      46.165  60.274  -7.522  1.00 37.52           C  
ATOM  10769  C   ALA G  45      46.597  61.443  -8.387  1.00 35.19           C  
ATOM  10770  O   ALA G  45      47.787  61.715  -8.507  1.00 36.66           O  
ATOM  10771  CB  ALA G  45      46.019  58.995  -8.403  1.00 39.75           C  
ATOM  10772  N   GLY G  46      45.652  62.137  -8.999  1.00 32.91           N  
ATOM  10773  CA  GLY G  46      46.025  63.263  -9.841  1.00 33.17           C  
ATOM  10774  C   GLY G  46      46.416  64.551  -9.103  1.00 35.44           C  
ATOM  10775  O   GLY G  46      47.157  65.379  -9.644  1.00 34.28           O  
ATOM  10776  N   ALA G  47      45.947  64.711  -7.859  1.00 35.99           N  
ATOM  10777  CA  ALA G  47      46.229  65.923  -7.074  1.00 32.73           C  
ATOM  10778  C   ALA G  47      47.699  66.264  -6.980  1.00 31.98           C  
ATOM  10779  O   ALA G  47      48.094  67.389  -7.292  1.00 34.95           O  
ATOM  10780  CB  ALA G  47      45.626  65.799  -5.677  1.00 33.89           C  
ATOM  10781  N   PRO G  48      48.538  65.318  -6.519  1.00 32.97           N  
ATOM  10782  CA  PRO G  48      49.972  65.617  -6.427  1.00 32.64           C  
ATOM  10783  C   PRO G  48      50.601  65.868  -7.791  1.00 32.00           C  
ATOM  10784  O   PRO G  48      51.590  66.575  -7.887  1.00 30.77           O  
ATOM  10785  CB  PRO G  48      50.553  64.369  -5.743  1.00 33.07           C  
ATOM  10786  CG  PRO G  48      49.607  63.307  -6.134  1.00 33.21           C  
ATOM  10787  CD  PRO G  48      48.262  63.974  -5.982  1.00 32.72           C  
ATOM  10788  N   VAL G  49      50.036  65.287  -8.850  1.00 33.75           N  
ATOM  10789  CA  VAL G  49      50.604  65.518 -10.188  1.00 34.02           C  
ATOM  10790  C   VAL G  49      50.281  66.944 -10.617  1.00 32.82           C  
ATOM  10791  O   VAL G  49      51.151  67.686 -11.052  1.00 31.36           O  
ATOM  10792  CB  VAL G  49      50.033  64.546 -11.275  1.00 33.51           C  
ATOM  10793  CG1 VAL G  49      50.637  64.891 -12.648  1.00 32.09           C  
ATOM  10794  CG2 VAL G  49      50.381  63.088 -10.926  1.00 33.95           C  
ATOM  10795  N   TYR G  50      49.005  67.306 -10.516  1.00 33.41           N  
ATOM  10796  CA  TYR G  50      48.558  68.654 -10.880  1.00 32.63           C  
ATOM  10797  C   TYR G  50      49.338  69.709 -10.073  1.00 32.18           C  
ATOM  10798  O   TYR G  50      49.870  70.677 -10.623  1.00 30.44           O  
ATOM  10799  CB  TYR G  50      47.074  68.785 -10.562  1.00 29.84           C  
ATOM  10800  CG  TYR G  50      46.381  69.934 -11.257  1.00 32.70           C  
ATOM  10801  CD1 TYR G  50      45.422  69.695 -12.250  1.00 30.31           C  
ATOM  10802  CD2 TYR G  50      46.668  71.249 -10.913  1.00 31.06           C  
ATOM  10803  CE1 TYR G  50      44.770  70.735 -12.877  1.00 30.44           C  
ATOM  10804  CE2 TYR G  50      46.028  72.306 -11.526  1.00 32.29           C  
ATOM  10805  CZ  TYR G  50      45.073  72.048 -12.510  1.00 33.92           C  
ATOM  10806  OH  TYR G  50      44.408  73.101 -13.083  1.00 27.26           O  
ATOM  10807  N   LEU G  51      49.392  69.513  -8.755  1.00 32.23           N  
ATOM  10808  CA  LEU G  51      50.069  70.459  -7.880  1.00 29.81           C  
ATOM  10809  C   LEU G  51      51.553  70.575  -8.194  1.00 30.03           C  
ATOM  10810  O   LEU G  51      52.096  71.676  -8.233  1.00 28.46           O  
ATOM  10811  CB  LEU G  51      49.866  70.060  -6.422  1.00 29.63           C  
ATOM  10812  CG  LEU G  51      50.548  70.952  -5.381  1.00 27.08           C  
ATOM  10813  CD1 LEU G  51      50.249  72.424  -5.665  1.00 23.22           C  
ATOM  10814  CD2 LEU G  51      50.048  70.542  -3.993  1.00 26.71           C  
ATOM  10815  N   ALA G  52      52.214  69.452  -8.424  1.00 28.04           N  
ATOM  10816  CA  ALA G  52      53.648  69.496  -8.757  1.00 27.34           C  
ATOM  10817  C   ALA G  52      53.854  70.315 -10.027  1.00 26.33           C  
ATOM  10818  O   ALA G  52      54.755  71.137 -10.116  1.00 28.87           O  
ATOM  10819  CB  ALA G  52      54.180  68.061  -8.955  1.00 28.96           C  
ATOM  10820  N   ALA G  53      52.985  70.111 -11.007  1.00 30.68           N  
ATOM  10821  CA  ALA G  53      53.096  70.812 -12.279  1.00 31.21           C  
ATOM  10822  C   ALA G  53      52.923  72.303 -12.079  1.00 31.20           C  
ATOM  10823  O   ALA G  53      53.587  73.107 -12.728  1.00 29.45           O  
ATOM  10824  CB  ALA G  53      52.048  70.288 -13.254  1.00 31.14           C  
ATOM  10825  N   VAL G  54      52.013  72.674 -11.180  1.00 29.64           N  
ATOM  10826  CA  VAL G  54      51.780  74.093 -10.899  1.00 28.62           C  
ATOM  10827  C   VAL G  54      53.003  74.695 -10.224  1.00 28.50           C  
ATOM  10828  O   VAL G  54      53.396  75.819 -10.544  1.00 32.14           O  
ATOM  10829  CB  VAL G  54      50.513  74.281 -10.008  1.00 27.26           C  
ATOM  10830  CG1 VAL G  54      50.443  75.732  -9.392  1.00 24.71           C  
ATOM  10831  CG2 VAL G  54      49.271  74.011 -10.867  1.00 24.45           C  
ATOM  10832  N   LEU G  55      53.608  73.954  -9.297  1.00 28.56           N  
ATOM  10833  CA  LEU G  55      54.770  74.460  -8.591  1.00 29.71           C  
ATOM  10834  C   LEU G  55      55.953  74.604  -9.532  1.00 32.43           C  
ATOM  10835  O   LEU G  55      56.763  75.528  -9.385  1.00 31.55           O  
ATOM  10836  CB  LEU G  55      55.143  73.526  -7.443  1.00 30.02           C  
ATOM  10837  CG  LEU G  55      54.073  73.436  -6.343  1.00 30.77           C  
ATOM  10838  CD1 LEU G  55      54.436  72.342  -5.345  1.00 30.28           C  
ATOM  10839  CD2 LEU G  55      53.936  74.800  -5.675  1.00 27.36           C  
ATOM  10840  N   GLU G  56      56.058  73.668 -10.478  1.00 31.75           N  
ATOM  10841  CA  GLU G  56      57.148  73.686 -11.454  1.00 31.20           C  
ATOM  10842  C   GLU G  56      56.998  74.903 -12.339  1.00 29.59           C  
ATOM  10843  O   GLU G  56      57.947  75.667 -12.541  1.00 33.23           O  
ATOM  10844  CB  GLU G  56      57.123  72.416 -12.318  1.00 31.89           C  
ATOM  10845  CG  GLU G  56      58.367  72.270 -13.178  1.00 33.95           C  
ATOM  10846  CD  GLU G  56      58.526  70.877 -13.785  1.00 37.66           C  
ATOM  10847  OE1 GLU G  56      58.352  69.863 -13.084  1.00 37.59           O  
ATOM  10848  OE2 GLU G  56      58.845  70.804 -14.982  1.00 46.57           O  
ATOM  10849  N   TYR G  57      55.795  75.079 -12.870  1.00 29.94           N  
ATOM  10850  CA  TYR G  57      55.504  76.218 -13.739  1.00 31.37           C  
ATOM  10851  C   TYR G  57      55.799  77.568 -13.066  1.00 31.75           C  
ATOM  10852  O   TYR G  57      56.452  78.432 -13.656  1.00 32.72           O  
ATOM  10853  CB  TYR G  57      54.031  76.175 -14.170  1.00 32.73           C  
ATOM  10854  CG  TYR G  57      53.565  77.478 -14.749  1.00 35.52           C  
ATOM  10855  CD1 TYR G  57      54.061  77.943 -15.981  1.00 34.54           C  
ATOM  10856  CD2 TYR G  57      52.711  78.298 -14.027  1.00 34.64           C  
ATOM  10857  CE1 TYR G  57      53.718  79.194 -16.452  1.00 32.69           C  
ATOM  10858  CE2 TYR G  57      52.360  79.539 -14.486  1.00 33.86           C  
ATOM  10859  CZ  TYR G  57      52.868  79.987 -15.689  1.00 34.98           C  
ATOM  10860  OH  TYR G  57      52.540  81.252 -16.083  1.00 36.24           O  
ATOM  10861  N   LEU G  58      55.336  77.755 -11.828  1.00 29.11           N  
ATOM  10862  CA  LEU G  58      55.576  79.014 -11.151  1.00 27.70           C  
ATOM  10863  C   LEU G  58      57.066  79.216 -10.956  1.00 26.54           C  
ATOM  10864  O   LEU G  58      57.572  80.321 -11.106  1.00 25.59           O  
ATOM  10865  CB  LEU G  58      54.861  79.075  -9.786  1.00 28.18           C  
ATOM  10866  CG  LEU G  58      53.348  79.267  -9.939  1.00 30.24           C  
ATOM  10867  CD1 LEU G  58      52.600  79.080  -8.576  1.00 25.79           C  
ATOM  10868  CD2 LEU G  58      53.118  80.643 -10.572  1.00 25.80           C  
ATOM  10869  N   THR G  59      57.747  78.140 -10.613  1.00 25.92           N  
ATOM  10870  CA  THR G  59      59.201  78.186 -10.417  1.00 30.15           C  
ATOM  10871  C   THR G  59      59.895  78.641 -11.720  1.00 28.81           C  
ATOM  10872  O   THR G  59      60.744  79.534 -11.714  1.00 30.91           O  
ATOM  10873  CB  THR G  59      59.733  76.786  -9.983  1.00 29.39           C  
ATOM  10874  OG1 THR G  59      59.205  76.459  -8.686  1.00 33.03           O  
ATOM  10875  CG2 THR G  59      61.273  76.789  -9.902  1.00 28.37           C  
ATOM  10876  N   ALA G  60      59.517  78.028 -12.828  1.00 31.67           N  
ATOM  10877  CA  ALA G  60      60.075  78.387 -14.145  1.00 33.61           C  
ATOM  10878  C   ALA G  60      59.805  79.850 -14.443  1.00 32.80           C  
ATOM  10879  O   ALA G  60      60.678  80.556 -14.944  1.00 36.00           O  
ATOM  10880  CB  ALA G  60      59.437  77.506 -15.270  1.00 33.50           C  
ATOM  10881  N   GLU G  61      58.592  80.316 -14.147  1.00 31.52           N  
ATOM  10882  CA  GLU G  61      58.251  81.723 -14.407  1.00 33.43           C  
ATOM  10883  C   GLU G  61      59.187  82.696 -13.676  1.00 35.12           C  
ATOM  10884  O   GLU G  61      59.732  83.630 -14.275  1.00 35.58           O  
ATOM  10885  CB  GLU G  61      56.806  81.992 -13.976  1.00 38.43           C  
ATOM  10886  CG  GLU G  61      56.239  83.301 -14.405  1.00 44.32           C  
ATOM  10887  CD  GLU G  61      56.196  83.459 -15.922  1.00 51.05           C  
ATOM  10888  OE1 GLU G  61      56.144  82.434 -16.645  1.00 48.82           O  
ATOM  10889  OE2 GLU G  61      56.201  84.622 -16.375  1.00 52.74           O  
ATOM  10890  N   ILE G  62      59.381  82.491 -12.375  1.00 31.13           N  
ATOM  10891  CA  ILE G  62      60.238  83.387 -11.624  1.00 28.18           C  
ATOM  10892  C   ILE G  62      61.714  83.279 -12.035  1.00 28.02           C  
ATOM  10893  O   ILE G  62      62.423  84.297 -12.132  1.00 28.96           O  
ATOM  10894  CB  ILE G  62      60.153  83.095 -10.120  1.00 29.46           C  
ATOM  10895  CG1 ILE G  62      58.760  83.395  -9.604  1.00 32.24           C  
ATOM  10896  CG2 ILE G  62      61.141  83.968  -9.365  1.00 32.04           C  
ATOM  10897  CD1 ILE G  62      58.655  83.251  -8.096  1.00 35.07           C  
ATOM  10898  N   LEU G  63      62.193  82.051 -12.230  1.00 26.92           N  
ATOM  10899  CA  LEU G  63      63.596  81.844 -12.629  1.00 29.92           C  
ATOM  10900  C   LEU G  63      63.795  82.450 -14.028  1.00 30.41           C  
ATOM  10901  O   LEU G  63      64.832  83.060 -14.310  1.00 33.29           O  
ATOM  10902  CB  LEU G  63      63.942  80.351 -12.642  1.00 28.14           C  
ATOM  10903  CG  LEU G  63      63.997  79.625 -11.305  1.00 25.32           C  
ATOM  10904  CD1 LEU G  63      64.208  78.138 -11.548  1.00 29.22           C  
ATOM  10905  CD2 LEU G  63      65.089  80.189 -10.450  1.00 29.12           C  
ATOM  10906  N   GLU G  64      62.793  82.314 -14.888  1.00 30.58           N  
ATOM  10907  CA  GLU G  64      62.880  82.907 -16.225  1.00 34.89           C  
ATOM  10908  C   GLU G  64      63.112  84.423 -16.112  1.00 37.63           C  
ATOM  10909  O   GLU G  64      64.078  84.964 -16.663  1.00 36.14           O  
ATOM  10910  CB  GLU G  64      61.587  82.656 -16.998  1.00 40.35           C  
ATOM  10911  CG  GLU G  64      61.521  83.413 -18.297  1.00 48.30           C  
ATOM  10912  CD  GLU G  64      62.664  83.049 -19.213  1.00 55.44           C  
ATOM  10913  OE1 GLU G  64      62.659  81.925 -19.763  1.00 55.61           O  
ATOM  10914  OE2 GLU G  64      63.577  83.889 -19.363  1.00 62.38           O  
ATOM  10915  N   LEU G  65      62.235  85.117 -15.383  1.00 36.25           N  
ATOM  10916  CA  LEU G  65      62.384  86.564 -15.216  1.00 34.85           C  
ATOM  10917  C   LEU G  65      63.611  86.910 -14.358  1.00 37.03           C  
ATOM  10918  O   LEU G  65      64.280  87.925 -14.596  1.00 35.88           O  
ATOM  10919  CB  LEU G  65      61.124  87.151 -14.573  1.00 38.15           C  
ATOM  10920  CG  LEU G  65      59.832  86.871 -15.349  1.00 39.14           C  
ATOM  10921  CD1 LEU G  65      58.626  87.311 -14.528  1.00 38.48           C  
ATOM  10922  CD2 LEU G  65      59.857  87.621 -16.675  1.00 35.91           C  
ATOM  10923  N   ALA G  66      63.916  86.083 -13.361  1.00 33.18           N  
ATOM  10924  CA  ALA G  66      65.072  86.378 -12.516  1.00 36.87           C  
ATOM  10925  C   ALA G  66      66.350  86.273 -13.357  1.00 34.37           C  
ATOM  10926  O   ALA G  66      67.217  87.142 -13.306  1.00 34.92           O  
ATOM  10927  CB  ALA G  66      65.141  85.392 -11.323  1.00 33.95           C  
ATOM  10928  N   GLY G  67      66.461  85.190 -14.112  1.00 36.09           N  
ATOM  10929  CA  GLY G  67      67.623  85.006 -14.962  1.00 36.40           C  
ATOM  10930  C   GLY G  67      67.791  86.191 -15.893  1.00 37.70           C  
ATOM  10931  O   GLY G  67      68.927  86.636 -16.098  1.00 37.52           O  
ATOM  10932  N   ASN G  68      66.677  86.703 -16.443  1.00 36.99           N  
ATOM  10933  CA  ASN G  68      66.723  87.866 -17.343  1.00 40.43           C  
ATOM  10934  C   ASN G  68      67.279  89.080 -16.617  1.00 40.28           C  
ATOM  10935  O   ASN G  68      67.987  89.902 -17.213  1.00 38.43           O  
ATOM  10936  CB  ASN G  68      65.323  88.249 -17.877  1.00 39.21           C  
ATOM  10937  CG  ASN G  68      64.788  87.260 -18.883  1.00 43.17           C  
ATOM  10938  OD1 ASN G  68      65.491  86.341 -19.313  1.00 43.78           O  
ATOM  10939  ND2 ASN G  68      63.532  87.444 -19.274  1.00 42.77           N  
ATOM  10940  N   ALA G  69      66.927  89.211 -15.340  1.00 37.87           N  
ATOM  10941  CA  ALA G  69      67.396  90.339 -14.533  1.00 38.31           C  
ATOM  10942  C   ALA G  69      68.877  90.192 -14.258  1.00 39.99           C  
ATOM  10943  O   ALA G  69      69.590  91.183 -14.198  1.00 41.07           O  
ATOM  10944  CB  ALA G  69      66.623  90.430 -13.204  1.00 35.74           C  
ATOM  10945  N   ALA G  70      69.339  88.959 -14.063  1.00 42.06           N  
ATOM  10946  CA  ALA G  70      70.764  88.739 -13.819  1.00 44.43           C  
ATOM  10947  C   ALA G  70      71.475  89.172 -15.109  1.00 45.36           C  
ATOM  10948  O   ALA G  70      72.464  89.894 -15.068  1.00 43.89           O  
ATOM  10949  CB  ALA G  70      71.050  87.262 -13.524  1.00 40.53           C  
ATOM  10950  N   ARG G  71      70.927  88.757 -16.246  1.00 49.26           N  
ATOM  10951  CA  ARG G  71      71.501  89.111 -17.542  1.00 54.73           C  
ATOM  10952  C   ARG G  71      71.599  90.626 -17.718  1.00 55.14           C  
ATOM  10953  O   ARG G  71      72.672  91.143 -18.041  1.00 56.36           O  
ATOM  10954  CB  ARG G  71      70.673  88.518 -18.688  1.00 58.37           C  
ATOM  10955  CG  ARG G  71      71.228  88.857 -20.077  1.00 64.73           C  
ATOM  10956  CD  ARG G  71      70.263  88.466 -21.198  1.00 70.66           C  
ATOM  10957  NE  ARG G  71      70.621  89.097 -22.470  1.00 76.72           N  
ATOM  10958  CZ  ARG G  71      69.774  89.316 -23.473  1.00 78.18           C  
ATOM  10959  NH1 ARG G  71      68.503  88.959 -23.368  1.00 79.95           N  
ATOM  10960  NH2 ARG G  71      70.198  89.894 -24.590  1.00 81.86           N  
ATOM  10961  N   ASP G  72      70.495  91.338 -17.501  1.00 54.87           N  
ATOM  10962  CA  ASP G  72      70.491  92.793 -17.648  1.00 55.43           C  
ATOM  10963  C   ASP G  72      71.529  93.419 -16.740  1.00 56.47           C  
ATOM  10964  O   ASP G  72      72.044  94.498 -17.018  1.00 58.22           O  
ATOM  10965  CB  ASP G  72      69.140  93.397 -17.275  1.00 58.24           C  
ATOM  10966  CG  ASP G  72      67.994  92.772 -18.018  1.00 64.13           C  
ATOM  10967  OD1 ASP G  72      68.208  92.269 -19.149  1.00 65.82           O  
ATOM  10968  OD2 ASP G  72      66.870  92.798 -17.466  1.00 67.42           O  
ATOM  10969  N   ASN G  73      71.819  92.749 -15.636  1.00 57.13           N  
ATOM  10970  CA  ASN G  73      72.784  93.267 -14.682  1.00 58.58           C  
ATOM  10971  C   ASN G  73      74.190  92.755 -14.993  1.00 57.79           C  
ATOM  10972  O   ASN G  73      75.134  93.006 -14.241  1.00 57.14           O  
ATOM  10973  CB  ASN G  73      72.355  92.878 -13.261  1.00 61.98           C  
ATOM  10974  CG  ASN G  73      71.141  93.671 -12.781  1.00 68.45           C  
ATOM  10975  OD1 ASN G  73      71.266  94.577 -11.945  1.00 70.84           O  
ATOM  10976  ND2 ASN G  73      69.961  93.348 -13.320  1.00 66.49           N  
ATOM  10977  N   LYS G  74      74.314  92.038 -16.106  1.00 55.38           N  
ATOM  10978  CA  LYS G  74      75.597  91.491 -16.536  1.00 57.33           C  
ATOM  10979  C   LYS G  74      76.098  90.420 -15.576  1.00 54.55           C  
ATOM  10980  O   LYS G  74      77.291  90.328 -15.299  1.00 53.30           O  
ATOM  10981  CB  LYS G  74      76.640  92.614 -16.649  1.00 60.80           C  
ATOM  10982  CG  LYS G  74      76.148  93.848 -17.411  1.00 67.73           C  
ATOM  10983  CD  LYS G  74      75.561  93.458 -18.767  1.00 72.40           C  
ATOM  10984  CE  LYS G  74      74.848  94.628 -19.440  1.00 74.81           C  
ATOM  10985  NZ  LYS G  74      74.053  94.162 -20.621  1.00 76.82           N  
ATOM  10986  N   LYS G  75      75.175  89.605 -15.077  1.00 52.89           N  
ATOM  10987  CA  LYS G  75      75.521  88.539 -14.152  1.00 49.44           C  
ATOM  10988  C   LYS G  75      74.973  87.220 -14.632  1.00 46.63           C  
ATOM  10989  O   LYS G  75      73.917  87.166 -15.245  1.00 48.83           O  
ATOM  10990  CB  LYS G  75      74.992  88.868 -12.759  1.00 51.14           C  
ATOM  10991  CG  LYS G  75      75.736  90.034 -12.117  1.00 55.01           C  
ATOM  10992  CD  LYS G  75      75.240  90.297 -10.719  1.00 61.28           C  
ATOM  10993  CE  LYS G  75      75.949  91.488 -10.108  1.00 63.68           C  
ATOM  10994  NZ  LYS G  75      75.299  91.872  -8.811  1.00 68.62           N  
ATOM  10995  N   THR G  76      75.709  86.153 -14.370  1.00 45.30           N  
ATOM  10996  CA  THR G  76      75.293  84.819 -14.780  1.00 44.36           C  
ATOM  10997  C   THR G  76      74.695  84.027 -13.612  1.00 43.51           C  
ATOM  10998  O   THR G  76      74.098  82.956 -13.802  1.00 45.07           O  
ATOM  10999  CB  THR G  76      76.485  84.060 -15.340  1.00 47.30           C  
ATOM  11000  OG1 THR G  76      77.448  83.874 -14.299  1.00 48.61           O  
ATOM  11001  CG2 THR G  76      77.122  84.869 -16.467  1.00 48.90           C  
ATOM  11002  N   ARG G  77      74.875  84.536 -12.400  1.00 39.92           N  
ATOM  11003  CA  ARG G  77      74.308  83.869 -11.237  1.00 40.30           C  
ATOM  11004  C   ARG G  77      73.170  84.690 -10.598  1.00 34.37           C  
ATOM  11005  O   ARG G  77      73.344  85.842 -10.223  1.00 32.28           O  
ATOM  11006  CB  ARG G  77      75.375  83.603 -10.177  1.00 38.93           C  
ATOM  11007  CG  ARG G  77      74.825  82.889  -8.947  1.00 42.60           C  
ATOM  11008  CD  ARG G  77      75.894  82.731  -7.877  1.00 44.97           C  
ATOM  11009  NE  ARG G  77      76.996  81.914  -8.366  1.00 45.09           N  
ATOM  11010  CZ  ARG G  77      78.280  82.181  -8.149  1.00 50.52           C  
ATOM  11011  NH1 ARG G  77      78.635  83.256  -7.450  1.00 47.95           N  
ATOM  11012  NH2 ARG G  77      79.210  81.367  -8.634  1.00 48.13           N  
ATOM  11013  N   ILE G  78      72.016  84.059 -10.482  1.00 34.47           N  
ATOM  11014  CA  ILE G  78      70.835  84.676  -9.877  1.00 32.96           C  
ATOM  11015  C   ILE G  78      71.043  84.838  -8.367  1.00 32.09           C  
ATOM  11016  O   ILE G  78      71.396  83.883  -7.691  1.00 32.11           O  
ATOM  11017  CB  ILE G  78      69.612  83.776 -10.130  1.00 33.27           C  
ATOM  11018  CG1 ILE G  78      69.256  83.825 -11.620  1.00 29.64           C  
ATOM  11019  CG2 ILE G  78      68.446  84.187  -9.212  1.00 30.12           C  
ATOM  11020  CD1 ILE G  78      68.098  82.901 -12.042  1.00 29.86           C  
ATOM  11021  N   ILE G  79      70.880  86.051  -7.845  1.00 31.68           N  
ATOM  11022  CA  ILE G  79      71.017  86.274  -6.398  1.00 33.28           C  
ATOM  11023  C   ILE G  79      69.656  86.821  -5.923  1.00 31.19           C  
ATOM  11024  O   ILE G  79      68.792  87.050  -6.748  1.00 32.96           O  
ATOM  11025  CB  ILE G  79      72.146  87.284  -6.055  1.00 31.45           C  
ATOM  11026  CG1 ILE G  79      71.881  88.631  -6.736  1.00 29.19           C  
ATOM  11027  CG2 ILE G  79      73.534  86.685  -6.473  1.00 32.40           C  
ATOM  11028  CD1 ILE G  79      72.813  89.755  -6.251  1.00 31.74           C  
ATOM  11029  N   PRO G  80      69.446  87.016  -4.607  1.00 30.71           N  
ATOM  11030  CA  PRO G  80      68.134  87.531  -4.166  1.00 27.97           C  
ATOM  11031  C   PRO G  80      67.640  88.789  -4.863  1.00 27.75           C  
ATOM  11032  O   PRO G  80      66.464  88.900  -5.179  1.00 31.14           O  
ATOM  11033  CB  PRO G  80      68.322  87.726  -2.656  1.00 31.15           C  
ATOM  11034  CG  PRO G  80      69.260  86.550  -2.312  1.00 30.78           C  
ATOM  11035  CD  PRO G  80      70.278  86.625  -3.454  1.00 28.99           C  
ATOM  11036  N   ARG G  81      68.532  89.747  -5.078  1.00 31.01           N  
ATOM  11037  CA  ARG G  81      68.190  90.981  -5.752  1.00 30.69           C  
ATOM  11038  C   ARG G  81      67.454  90.711  -7.053  1.00 33.61           C  
ATOM  11039  O   ARG G  81      66.425  91.355  -7.338  1.00 34.78           O  
ATOM  11040  CB  ARG G  81      69.462  91.796  -6.035  1.00 33.63           C  
ATOM  11041  CG  ARG G  81      69.263  93.053  -6.888  1.00 34.44           C  
ATOM  11042  CD  ARG G  81      68.262  94.002  -6.252  1.00 30.52           C  
ATOM  11043  NE  ARG G  81      68.226  95.314  -6.895  1.00 29.62           N  
ATOM  11044  CZ  ARG G  81      67.466  96.320  -6.450  1.00 35.04           C  
ATOM  11045  NH1 ARG G  81      66.683  96.128  -5.375  1.00 25.93           N  
ATOM  11046  NH2 ARG G  81      67.514  97.519  -7.036  1.00 27.53           N  
ATOM  11047  N   HIS G  82      67.956  89.758  -7.838  1.00 31.11           N  
ATOM  11048  CA  HIS G  82      67.333  89.453  -9.114  1.00 31.77           C  
ATOM  11049  C   HIS G  82      65.930  88.874  -8.962  1.00 30.36           C  
ATOM  11050  O   HIS G  82      65.055  89.134  -9.799  1.00 28.01           O  
ATOM  11051  CB  HIS G  82      68.204  88.486  -9.919  1.00 32.26           C  
ATOM  11052  CG  HIS G  82      69.617  88.955 -10.089  1.00 35.23           C  
ATOM  11053  ND1 HIS G  82      70.657  88.091 -10.350  1.00 35.59           N  
ATOM  11054  CD2 HIS G  82      70.164  90.195 -10.026  1.00 37.41           C  
ATOM  11055  CE1 HIS G  82      71.785  88.776 -10.439  1.00 35.58           C  
ATOM  11056  NE2 HIS G  82      71.515  90.055 -10.247  1.00 35.23           N  
ATOM  11057  N   LEU G  83      65.726  88.066  -7.924  1.00 27.04           N  
ATOM  11058  CA  LEU G  83      64.403  87.497  -7.695  1.00 28.86           C  
ATOM  11059  C   LEU G  83      63.482  88.650  -7.348  1.00 24.94           C  
ATOM  11060  O   LEU G  83      62.371  88.693  -7.851  1.00 28.15           O  
ATOM  11061  CB  LEU G  83      64.416  86.463  -6.559  1.00 31.48           C  
ATOM  11062  CG  LEU G  83      65.192  85.167  -6.854  1.00 29.69           C  
ATOM  11063  CD1 LEU G  83      65.345  84.380  -5.576  1.00 26.90           C  
ATOM  11064  CD2 LEU G  83      64.468  84.358  -7.904  1.00 26.96           C  
ATOM  11065  N   GLN G  84      63.941  89.580  -6.513  1.00 25.73           N  
ATOM  11066  CA  GLN G  84      63.120  90.755  -6.139  1.00 26.91           C  
ATOM  11067  C   GLN G  84      62.798  91.618  -7.368  1.00 30.86           C  
ATOM  11068  O   GLN G  84      61.643  91.993  -7.587  1.00 28.97           O  
ATOM  11069  CB  GLN G  84      63.835  91.617  -5.076  1.00 24.95           C  
ATOM  11070  CG  GLN G  84      63.163  92.978  -4.756  1.00 26.75           C  
ATOM  11071  CD  GLN G  84      61.885  92.865  -3.884  1.00 28.34           C  
ATOM  11072  OE1 GLN G  84      61.258  91.810  -3.809  1.00 26.60           O  
ATOM  11073  NE2 GLN G  84      61.506  93.967  -3.246  1.00 23.01           N  
ATOM  11074  N   LEU G  85      63.804  91.939  -8.180  1.00 27.00           N  
ATOM  11075  CA  LEU G  85      63.546  92.725  -9.382  1.00 27.63           C  
ATOM  11076  C   LEU G  85      62.561  92.012 -10.295  1.00 26.89           C  
ATOM  11077  O   LEU G  85      61.679  92.653 -10.844  1.00 29.88           O  
ATOM  11078  CB  LEU G  85      64.840  92.992 -10.187  1.00 29.89           C  
ATOM  11079  CG  LEU G  85      65.910  93.895  -9.556  1.00 34.34           C  
ATOM  11080  CD1 LEU G  85      67.199  93.893 -10.425  1.00 32.94           C  
ATOM  11081  CD2 LEU G  85      65.373  95.292  -9.425  1.00 33.20           C  
ATOM  11082  N   ALA G  86      62.692  90.694 -10.453  1.00 26.81           N  
ATOM  11083  CA  ALA G  86      61.788  89.955 -11.331  1.00 22.44           C  
ATOM  11084  C   ALA G  86      60.355  89.971 -10.815  1.00 28.49           C  
ATOM  11085  O   ALA G  86      59.389  90.134 -11.589  1.00 25.59           O  
ATOM  11086  CB  ALA G  86      62.243  88.503 -11.465  1.00 26.77           C  
ATOM  11087  N   VAL G  87      60.218  89.762  -9.505  1.00 25.60           N  
ATOM  11088  CA  VAL G  87      58.897  89.746  -8.874  1.00 25.20           C  
ATOM  11089  C   VAL G  87      58.257  91.141  -8.844  1.00 29.09           C  
ATOM  11090  O   VAL G  87      57.116  91.323  -9.307  1.00 28.37           O  
ATOM  11091  CB  VAL G  87      58.982  89.190  -7.405  1.00 21.50           C  
ATOM  11092  CG1 VAL G  87      57.651  89.491  -6.632  1.00 21.72           C  
ATOM  11093  CG2 VAL G  87      59.274  87.658  -7.437  1.00 18.88           C  
ATOM  11094  N   ARG G  88      58.973  92.139  -8.331  1.00 29.20           N  
ATOM  11095  CA  ARG G  88      58.343  93.456  -8.224  1.00 31.28           C  
ATOM  11096  C   ARG G  88      58.076  94.159  -9.562  1.00 32.00           C  
ATOM  11097  O   ARG G  88      57.214  95.021  -9.647  1.00 28.73           O  
ATOM  11098  CB  ARG G  88      59.131  94.342  -7.251  1.00 28.93           C  
ATOM  11099  CG  ARG G  88      59.769  93.538  -6.101  1.00 29.93           C  
ATOM  11100  CD  ARG G  88      59.059  93.349  -4.730  1.00 41.07           C  
ATOM  11101  NE  ARG G  88      57.730  92.788  -4.776  1.00 37.70           N  
ATOM  11102  CZ  ARG G  88      57.202  91.895  -3.928  1.00 35.97           C  
ATOM  11103  NH1 ARG G  88      57.863  91.369  -2.912  1.00 32.68           N  
ATOM  11104  NH2 ARG G  88      55.932  91.578  -4.084  1.00 26.75           N  
ATOM  11105  N   ASN G  89      58.789  93.771 -10.611  1.00 31.91           N  
ATOM  11106  CA  ASN G  89      58.555  94.374 -11.927  1.00 31.63           C  
ATOM  11107  C   ASN G  89      57.504  93.626 -12.698  1.00 30.77           C  
ATOM  11108  O   ASN G  89      57.171  94.008 -13.786  1.00 31.22           O  
ATOM  11109  CB  ASN G  89      59.824  94.401 -12.770  1.00 29.93           C  
ATOM  11110  CG  ASN G  89      60.723  95.547 -12.401  1.00 33.02           C  
ATOM  11111  OD1 ASN G  89      60.292  96.697 -12.365  1.00 33.96           O  
ATOM  11112  ND2 ASN G  89      61.978  95.245 -12.122  1.00 33.81           N  
ATOM  11113  N   ASP G  90      57.024  92.523 -12.159  1.00 30.83           N  
ATOM  11114  CA  ASP G  90      56.009  91.747 -12.841  1.00 29.31           C  
ATOM  11115  C   ASP G  90      54.704  91.948 -12.075  1.00 32.04           C  
ATOM  11116  O   ASP G  90      54.587  91.574 -10.909  1.00 27.25           O  
ATOM  11117  CB  ASP G  90      56.367  90.267 -12.842  1.00 30.49           C  
ATOM  11118  CG  ASP G  90      55.366  89.447 -13.612  1.00 33.77           C  
ATOM  11119  OD1 ASP G  90      55.422  89.482 -14.861  1.00 36.95           O  
ATOM  11120  OD2 ASP G  90      54.514  88.793 -12.979  1.00 37.17           O  
ATOM  11121  N   GLU G  91      53.716  92.541 -12.732  1.00 32.45           N  
ATOM  11122  CA  GLU G  91      52.447  92.808 -12.069  1.00 32.12           C  
ATOM  11123  C   GLU G  91      51.854  91.607 -11.322  1.00 31.64           C  
ATOM  11124  O   GLU G  91      51.489  91.717 -10.156  1.00 30.65           O  
ATOM  11125  CB  GLU G  91      51.437  93.329 -13.098  1.00 36.96           C  
ATOM  11126  CG  GLU G  91      50.066  93.636 -12.517  1.00 51.51           C  
ATOM  11127  CD  GLU G  91      49.088  94.134 -13.564  1.00 60.57           C  
ATOM  11128  OE1 GLU G  91      48.621  93.316 -14.395  1.00 65.29           O  
ATOM  11129  OE2 GLU G  91      48.796  95.352 -13.558  1.00 66.13           O  
ATOM  11130  N   GLU G  92      51.772  90.454 -11.981  1.00 30.42           N  
ATOM  11131  CA  GLU G  92      51.154  89.289 -11.352  1.00 33.21           C  
ATOM  11132  C   GLU G  92      51.948  88.651 -10.228  1.00 31.48           C  
ATOM  11133  O   GLU G  92      51.392  88.347  -9.178  1.00 31.66           O  
ATOM  11134  CB  GLU G  92      50.787  88.261 -12.406  1.00 33.43           C  
ATOM  11135  CG  GLU G  92      49.804  88.828 -13.420  1.00 37.62           C  
ATOM  11136  CD  GLU G  92      49.054  87.752 -14.183  1.00 41.70           C  
ATOM  11137  OE1 GLU G  92      49.556  86.617 -14.276  1.00 41.65           O  
ATOM  11138  OE2 GLU G  92      47.952  88.044 -14.696  1.00 46.02           O  
ATOM  11139  N   LEU G  93      53.239  88.456 -10.440  1.00 29.81           N  
ATOM  11140  CA  LEU G  93      54.075  87.874  -9.401  1.00 29.89           C  
ATOM  11141  C   LEU G  93      54.098  88.812  -8.187  1.00 25.87           C  
ATOM  11142  O   LEU G  93      54.053  88.354  -7.060  1.00 27.01           O  
ATOM  11143  CB  LEU G  93      55.485  87.643  -9.917  1.00 26.53           C  
ATOM  11144  CG  LEU G  93      55.591  86.438 -10.871  1.00 31.14           C  
ATOM  11145  CD1 LEU G  93      56.978  86.404 -11.487  1.00 34.00           C  
ATOM  11146  CD2 LEU G  93      55.338  85.155 -10.123  1.00 30.33           C  
ATOM  11147  N   ASN G  94      54.128  90.123  -8.433  1.00 25.59           N  
ATOM  11148  CA  ASN G  94      54.150  91.091  -7.363  1.00 25.29           C  
ATOM  11149  C   ASN G  94      52.907  90.962  -6.473  1.00 28.75           C  
ATOM  11150  O   ASN G  94      53.006  91.068  -5.248  1.00 26.91           O  
ATOM  11151  CB  ASN G  94      54.237  92.506  -7.908  1.00 26.38           C  
ATOM  11152  CG  ASN G  94      54.236  93.539  -6.794  1.00 30.46           C  
ATOM  11153  OD1 ASN G  94      55.109  93.509  -5.928  1.00 25.38           O  
ATOM  11154  ND2 ASN G  94      53.242  94.439  -6.795  1.00 27.62           N  
ATOM  11155  N   LYS G  95      51.746  90.745  -7.090  1.00 27.78           N  
ATOM  11156  CA  LYS G  95      50.500  90.576  -6.333  1.00 30.38           C  
ATOM  11157  C   LYS G  95      50.523  89.212  -5.610  1.00 28.68           C  
ATOM  11158  O   LYS G  95      50.189  89.112  -4.436  1.00 27.55           O  
ATOM  11159  CB  LYS G  95      49.298  90.659  -7.288  1.00 35.68           C  
ATOM  11160  CG  LYS G  95      47.921  90.536  -6.608  1.00 40.82           C  
ATOM  11161  CD  LYS G  95      46.844  90.588  -7.683  1.00 52.74           C  
ATOM  11162  CE  LYS G  95      45.466  90.900  -7.141  1.00 55.90           C  
ATOM  11163  NZ  LYS G  95      44.454  90.894  -8.251  1.00 60.41           N  
ATOM  11164  N   LEU G  96      50.918  88.148  -6.307  1.00 28.15           N  
ATOM  11165  CA  LEU G  96      50.984  86.839  -5.639  1.00 27.88           C  
ATOM  11166  C   LEU G  96      51.853  86.937  -4.382  1.00 27.28           C  
ATOM  11167  O   LEU G  96      51.531  86.372  -3.337  1.00 30.54           O  
ATOM  11168  CB  LEU G  96      51.597  85.786  -6.555  1.00 29.49           C  
ATOM  11169  CG  LEU G  96      51.734  84.374  -5.998  1.00 28.37           C  
ATOM  11170  CD1 LEU G  96      50.346  83.823  -5.687  1.00 26.06           C  
ATOM  11171  CD2 LEU G  96      52.432  83.500  -7.041  1.00 29.59           C  
ATOM  11172  N   LEU G  97      52.958  87.656  -4.494  1.00 25.05           N  
ATOM  11173  CA  LEU G  97      53.893  87.812  -3.388  1.00 26.81           C  
ATOM  11174  C   LEU G  97      53.747  89.195  -2.735  1.00 23.74           C  
ATOM  11175  O   LEU G  97      54.698  89.769  -2.219  1.00 22.88           O  
ATOM  11176  CB  LEU G  97      55.327  87.587  -3.925  1.00 23.35           C  
ATOM  11177  CG  LEU G  97      55.521  86.220  -4.632  1.00 25.29           C  
ATOM  11178  CD1 LEU G  97      57.017  86.048  -4.975  1.00 30.04           C  
ATOM  11179  CD2 LEU G  97      55.052  85.071  -3.770  1.00 27.59           C  
ATOM  11180  N   GLY G  98      52.528  89.715  -2.745  1.00 24.22           N  
ATOM  11181  CA  GLY G  98      52.286  91.037  -2.163  1.00 25.32           C  
ATOM  11182  C   GLY G  98      52.555  91.145  -0.666  1.00 26.82           C  
ATOM  11183  O   GLY G  98      52.814  92.230  -0.163  1.00 25.66           O  
ATOM  11184  N   ARG G  99      52.486  90.034   0.060  1.00 27.31           N  
ATOM  11185  CA  ARG G  99      52.754  90.087   1.509  1.00 28.24           C  
ATOM  11186  C   ARG G  99      53.995  89.267   1.879  1.00 28.24           C  
ATOM  11187  O   ARG G  99      54.132  88.766   2.992  1.00 30.56           O  
ATOM  11188  CB  ARG G  99      51.511  89.605   2.266  1.00 31.63           C  
ATOM  11189  CG  ARG G  99      50.336  90.552   1.959  1.00 37.98           C  
ATOM  11190  CD  ARG G  99      48.983  90.044   2.419  1.00 53.94           C  
ATOM  11191  NE  ARG G  99      47.913  90.618   1.595  1.00 64.45           N  
ATOM  11192  CZ  ARG G  99      46.635  90.692   1.962  1.00 68.43           C  
ATOM  11193  NH1 ARG G  99      46.260  90.231   3.152  1.00 69.50           N  
ATOM  11194  NH2 ARG G  99      45.735  91.227   1.138  1.00 69.83           N  
ATOM  11195  N   VAL G 100      54.905  89.143   0.930  1.00 24.70           N  
ATOM  11196  CA  VAL G 100      56.121  88.369   1.149  1.00 23.49           C  
ATOM  11197  C   VAL G 100      57.336  89.264   1.068  1.00 25.43           C  
ATOM  11198  O   VAL G 100      57.375  90.137   0.252  1.00 24.98           O  
ATOM  11199  CB  VAL G 100      56.271  87.267   0.058  1.00 25.59           C  
ATOM  11200  CG1 VAL G 100      57.708  86.720   0.033  1.00 22.91           C  
ATOM  11201  CG2 VAL G 100      55.291  86.136   0.340  1.00 22.17           C  
ATOM  11202  N   THR G 101      58.325  89.020   1.907  1.00 22.73           N  
ATOM  11203  CA  THR G 101      59.561  89.788   1.891  1.00 24.60           C  
ATOM  11204  C   THR G 101      60.670  88.857   1.412  1.00 25.79           C  
ATOM  11205  O   THR G 101      60.873  87.784   1.986  1.00 27.20           O  
ATOM  11206  CB  THR G 101      59.925  90.268   3.304  1.00 24.77           C  
ATOM  11207  OG1 THR G 101      58.924  91.186   3.755  1.00 24.06           O  
ATOM  11208  CG2 THR G 101      61.301  90.956   3.323  1.00 23.00           C  
ATOM  11209  N   ILE G 102      61.346  89.246   0.339  1.00 26.33           N  
ATOM  11210  CA  ILE G 102      62.457  88.466  -0.183  1.00 26.28           C  
ATOM  11211  C   ILE G 102      63.699  89.027   0.521  1.00 25.10           C  
ATOM  11212  O   ILE G 102      64.073  90.182   0.339  1.00 26.04           O  
ATOM  11213  CB  ILE G 102      62.536  88.606  -1.731  1.00 28.37           C  
ATOM  11214  CG1 ILE G 102      61.319  87.913  -2.360  1.00 28.08           C  
ATOM  11215  CG2 ILE G 102      63.831  88.007  -2.273  1.00 30.62           C  
ATOM  11216  CD1 ILE G 102      61.260  87.926  -3.888  1.00 28.62           C  
ATOM  11217  N   ALA G 103      64.318  88.219   1.374  1.00 25.51           N  
ATOM  11218  CA  ALA G 103      65.503  88.678   2.112  1.00 26.73           C  
ATOM  11219  C   ALA G 103      66.552  89.171   1.110  1.00 27.84           C  
ATOM  11220  O   ALA G 103      66.637  88.641   0.013  1.00 29.60           O  
ATOM  11221  CB  ALA G 103      66.081  87.523   2.969  1.00 26.71           C  
ATOM  11222  N   GLN G 104      67.326  90.175   1.498  1.00 27.77           N  
ATOM  11223  CA  GLN G 104      68.371  90.746   0.642  1.00 30.31           C  
ATOM  11224  C   GLN G 104      67.846  91.110  -0.728  1.00 29.95           C  
ATOM  11225  O   GLN G 104      68.541  90.955  -1.722  1.00 29.14           O  
ATOM  11226  CB  GLN G 104      69.557  89.768   0.507  1.00 30.36           C  
ATOM  11227  CG  GLN G 104      70.476  89.824   1.702  1.00 37.99           C  
ATOM  11228  CD  GLN G 104      71.062  91.235   1.907  1.00 47.50           C  
ATOM  11229  OE1 GLN G 104      71.859  91.738   1.071  1.00 44.53           O  
ATOM  11230  NE2 GLN G 104      70.662  91.886   3.007  1.00 39.72           N  
ATOM  11231  N   GLY G 105      66.607  91.588  -0.784  1.00 30.68           N  
ATOM  11232  CA  GLY G 105      66.048  91.961  -2.063  1.00 28.34           C  
ATOM  11233  C   GLY G 105      66.156  93.451  -2.394  1.00 28.74           C  
ATOM  11234  O   GLY G 105      66.211  93.815  -3.558  1.00 29.58           O  
ATOM  11235  N   GLY G 106      66.191  94.307  -1.386  1.00 25.53           N  
ATOM  11236  CA  GLY G 106      66.215  95.731  -1.644  1.00 25.04           C  
ATOM  11237  C   GLY G 106      64.866  96.108  -2.231  1.00 26.98           C  
ATOM  11238  O   GLY G 106      63.918  95.318  -2.142  1.00 27.52           O  
ATOM  11239  N   VAL G 107      64.776  97.296  -2.830  1.00 27.52           N  
ATOM  11240  CA  VAL G 107      63.541  97.795  -3.441  1.00 27.73           C  
ATOM  11241  C   VAL G 107      63.822  98.246  -4.872  1.00 30.96           C  
ATOM  11242  O   VAL G 107      64.984  98.332  -5.298  1.00 27.94           O  
ATOM  11243  CB  VAL G 107      63.001  99.013  -2.677  1.00 29.59           C  
ATOM  11244  CG1 VAL G 107      62.884  98.685  -1.200  1.00 25.35           C  
ATOM  11245  CG2 VAL G 107      63.938 100.221  -2.883  1.00 31.64           C  
ATOM  11246  N   LEU G 108      62.757  98.535  -5.616  1.00 29.92           N  
ATOM  11247  CA  LEU G 108      62.901  99.009  -6.988  1.00 30.52           C  
ATOM  11248  C   LEU G 108      63.336 100.462  -6.983  1.00 30.99           C  
ATOM  11249  O   LEU G 108      62.913 101.235  -6.131  1.00 31.02           O  
ATOM  11250  CB  LEU G 108      61.571  98.931  -7.732  1.00 30.54           C  
ATOM  11251  CG  LEU G 108      60.987  97.539  -7.937  1.00 30.73           C  
ATOM  11252  CD1 LEU G 108      59.793  97.625  -8.859  1.00 34.04           C  
ATOM  11253  CD2 LEU G 108      62.052  96.619  -8.512  1.00 35.17           C  
ATOM  11254  N   PRO G 109      64.217 100.852  -7.912  1.00 34.07           N  
ATOM  11255  CA  PRO G 109      64.626 102.266  -7.926  1.00 37.58           C  
ATOM  11256  C   PRO G 109      63.368 103.090  -8.177  1.00 37.75           C  
ATOM  11257  O   PRO G 109      62.669 102.837  -9.147  1.00 42.16           O  
ATOM  11258  CB  PRO G 109      65.582 102.328  -9.116  1.00 35.31           C  
ATOM  11259  CG  PRO G 109      66.291 101.007  -9.017  1.00 37.14           C  
ATOM  11260  CD  PRO G 109      65.099 100.049  -8.781  1.00 36.91           C  
ATOM  11261  N   ASN G 110      63.054 104.045  -7.313  1.00 38.93           N  
ATOM  11262  CA  ASN G 110      61.850 104.848  -7.527  1.00 41.05           C  
ATOM  11263  C   ASN G 110      61.859 106.115  -6.663  1.00 41.18           C  
ATOM  11264  O   ASN G 110      61.843 106.040  -5.441  1.00 38.94           O  
ATOM  11265  CB  ASN G 110      60.608 103.994  -7.230  1.00 44.14           C  
ATOM  11266  CG  ASN G 110      59.306 104.660  -7.665  1.00 46.66           C  
ATOM  11267  OD1 ASN G 110      59.244 105.301  -8.706  1.00 51.15           O  
ATOM  11268  ND2 ASN G 110      58.258 104.482  -6.877  1.00 45.57           N  
ATOM  11269  N   ILE G 111      61.909 107.275  -7.314  1.00 39.98           N  
ATOM  11270  CA  ILE G 111      61.916 108.560  -6.612  1.00 40.45           C  
ATOM  11271  C   ILE G 111      60.679 109.339  -7.025  1.00 38.97           C  
ATOM  11272  O   ILE G 111      60.419 109.502  -8.216  1.00 35.84           O  
ATOM  11273  CB  ILE G 111      63.160 109.385  -6.987  1.00 40.94           C  
ATOM  11274  CG1 ILE G 111      64.418 108.585  -6.630  1.00 41.96           C  
ATOM  11275  CG2 ILE G 111      63.141 110.714  -6.262  1.00 37.66           C  
ATOM  11276  CD1 ILE G 111      65.699 109.206  -7.096  1.00 44.91           C  
ATOM  11277  N   GLN G 112      59.904 109.798  -6.048  1.00 38.42           N  
ATOM  11278  CA  GLN G 112      58.682 110.546  -6.357  1.00 39.78           C  
ATOM  11279  C   GLN G 112      59.075 111.820  -7.126  1.00 39.81           C  
ATOM  11280  O   GLN G 112      59.922 112.593  -6.679  1.00 36.38           O  
ATOM  11281  CB  GLN G 112      57.934 110.883  -5.059  1.00 39.97           C  
ATOM  11282  CG  GLN G 112      57.438 109.646  -4.315  1.00 37.08           C  
ATOM  11283  CD  GLN G 112      56.528 108.805  -5.181  1.00 39.48           C  
ATOM  11284  OE1 GLN G 112      55.501 109.274  -5.655  1.00 37.37           O  
ATOM  11285  NE2 GLN G 112      56.902 107.557  -5.396  1.00 40.93           N  
ATOM  11286  N   SER G 113      58.446 112.016  -8.281  1.00 38.58           N  
ATOM  11287  CA  SER G 113      58.742 113.144  -9.162  1.00 39.97           C  
ATOM  11288  C   SER G 113      58.877 114.493  -8.488  1.00 39.61           C  
ATOM  11289  O   SER G 113      59.815 115.236  -8.788  1.00 37.90           O  
ATOM  11290  CB  SER G 113      57.694 113.231 -10.273  1.00 41.88           C  
ATOM  11291  OG  SER G 113      56.501 113.794  -9.782  1.00 45.66           O  
ATOM  11292  N   VAL G 114      57.969 114.813  -7.566  1.00 37.38           N  
ATOM  11293  CA  VAL G 114      58.021 116.098  -6.880  1.00 39.22           C  
ATOM  11294  C   VAL G 114      59.310 116.295  -6.108  1.00 41.17           C  
ATOM  11295  O   VAL G 114      59.636 117.413  -5.689  1.00 43.26           O  
ATOM  11296  CB  VAL G 114      56.838 116.260  -5.880  1.00 41.58           C  
ATOM  11297  CG1 VAL G 114      57.037 115.328  -4.682  1.00 40.57           C  
ATOM  11298  CG2 VAL G 114      56.753 117.707  -5.383  1.00 40.60           C  
ATOM  11299  N   LEU G 115      60.055 115.218  -5.891  1.00 42.27           N  
ATOM  11300  CA  LEU G 115      61.294 115.346  -5.127  1.00 40.41           C  
ATOM  11301  C   LEU G 115      62.509 115.695  -5.992  1.00 41.48           C  
ATOM  11302  O   LEU G 115      63.560 116.067  -5.469  1.00 40.67           O  
ATOM  11303  CB  LEU G 115      61.564 114.062  -4.327  1.00 35.64           C  
ATOM  11304  CG  LEU G 115      60.469 113.665  -3.315  1.00 37.99           C  
ATOM  11305  CD1 LEU G 115      60.802 112.287  -2.719  1.00 33.11           C  
ATOM  11306  CD2 LEU G 115      60.325 114.706  -2.215  1.00 31.47           C  
ATOM  11307  N   LEU G 116      62.364 115.570  -7.306  1.00 42.77           N  
ATOM  11308  CA  LEU G 116      63.462 115.867  -8.221  1.00 46.41           C  
ATOM  11309  C   LEU G 116      63.715 117.370  -8.324  1.00 49.08           C  
ATOM  11310  O   LEU G 116      62.807 118.171  -8.190  1.00 46.51           O  
ATOM  11311  CB  LEU G 116      63.168 115.289  -9.612  1.00 41.84           C  
ATOM  11312  CG  LEU G 116      62.968 113.771  -9.684  1.00 45.28           C  
ATOM  11313  CD1 LEU G 116      62.758 113.368 -11.129  1.00 49.54           C  
ATOM  11314  CD2 LEU G 116      64.175 113.035  -9.099  1.00 44.65           C  
ATOM  11315  N   PRO G 117      64.972 117.768  -8.550  1.00 55.62           N  
ATOM  11316  CA  PRO G 117      65.254 119.202  -8.656  1.00 59.88           C  
ATOM  11317  C   PRO G 117      64.551 119.829  -9.851  1.00 62.25           C  
ATOM  11318  O   PRO G 117      64.247 119.145 -10.822  1.00 61.62           O  
ATOM  11319  CB  PRO G 117      66.778 119.246  -8.773  1.00 60.59           C  
ATOM  11320  CG  PRO G 117      67.113 117.952  -9.447  1.00 58.81           C  
ATOM  11321  CD  PRO G 117      66.196 116.970  -8.743  1.00 56.99           C  
ATOM  11322  N   LYS G 118      64.283 121.127  -9.768  1.00 68.24           N  
ATOM  11323  CA  LYS G 118      63.619 121.841 -10.856  1.00 73.92           C  
ATOM  11324  C   LYS G 118      64.648 122.255 -11.901  1.00 77.17           C  
ATOM  11325  O   LYS G 118      65.047 123.416 -11.974  1.00 78.81           O  
ATOM  11326  CB  LYS G 118      62.893 123.074 -10.315  1.00 76.51           C  
ATOM  11327  CG  LYS G 118      61.889 122.755  -9.220  1.00 79.48           C  
ATOM  11328  CD  LYS G 118      61.030 123.959  -8.870  1.00 82.81           C  
ATOM  11329  CE  LYS G 118      59.969 123.591  -7.835  1.00 83.56           C  
ATOM  11330  NZ  LYS G 118      59.020 124.715  -7.573  1.00 84.31           N  
ATOM  11331  N   LYS G 119      65.069 121.280 -12.700  1.00 79.91           N  
ATOM  11332  CA  LYS G 119      66.061 121.466 -13.754  1.00 82.28           C  
ATOM  11333  C   LYS G 119      65.950 122.812 -14.467  1.00 82.87           C  
ATOM  11334  O   LYS G 119      66.993 123.289 -14.960  1.00 82.80           O  
ATOM  11335  CB  LYS G 119      65.923 120.335 -14.777  1.00 85.18           C  
ATOM  11336  CG  LYS G 119      66.095 118.936 -14.182  1.00 87.05           C  
ATOM  11337  CD  LYS G 119      65.383 117.873 -15.018  1.00 88.14           C  
ATOM  11338  CE  LYS G 119      65.894 117.824 -16.450  1.00 88.75           C  
ATOM  11339  NZ  LYS G 119      65.127 116.833 -17.255  1.00 89.61           N  
TER   11340      LYS G 119                                                      
ATOM  11341  N   THR H  29      69.696  64.192  10.732  1.00 74.87           N  
ATOM  11342  CA  THR H  29      68.372  63.769  10.193  1.00 75.03           C  
ATOM  11343  C   THR H  29      68.072  64.523   8.891  1.00 73.69           C  
ATOM  11344  O   THR H  29      68.076  65.753   8.859  1.00 74.09           O  
ATOM  11345  CB  THR H  29      67.248  64.030  11.231  1.00 76.27           C  
ATOM  11346  OG1 THR H  29      66.025  63.435  10.781  1.00 78.05           O  
ATOM  11347  CG2 THR H  29      67.023  65.514  11.417  1.00 77.89           C  
ATOM  11348  N   ARG H  30      67.832  63.772   7.819  1.00 71.78           N  
ATOM  11349  CA  ARG H  30      67.540  64.340   6.504  1.00 70.65           C  
ATOM  11350  C   ARG H  30      66.813  65.676   6.544  1.00 67.88           C  
ATOM  11351  O   ARG H  30      65.889  65.870   7.326  1.00 68.36           O  
ATOM  11352  CB  ARG H  30      66.680  63.378   5.679  1.00 72.51           C  
ATOM  11353  CG  ARG H  30      67.387  62.167   5.122  1.00 74.31           C  
ATOM  11354  CD  ARG H  30      66.376  61.219   4.490  1.00 76.03           C  
ATOM  11355  NE  ARG H  30      65.726  61.774   3.305  1.00 76.70           N  
ATOM  11356  CZ  ARG H  30      66.313  61.889   2.118  1.00 77.87           C  
ATOM  11357  NH1 ARG H  30      67.565  61.489   1.957  1.00 79.13           N  
ATOM  11358  NH2 ARG H  30      65.645  62.386   1.086  1.00 77.82           N  
ATOM  11359  N   LYS H  31      67.237  66.590   5.683  1.00 64.49           N  
ATOM  11360  CA  LYS H  31      66.600  67.890   5.572  1.00 61.50           C  
ATOM  11361  C   LYS H  31      66.250  67.999   4.097  1.00 57.66           C  
ATOM  11362  O   LYS H  31      67.115  68.247   3.264  1.00 57.89           O  
ATOM  11363  CB  LYS H  31      67.559  69.008   5.965  1.00 65.15           C  
ATOM  11364  CG  LYS H  31      66.897  70.145   6.716  1.00 68.53           C  
ATOM  11365  CD  LYS H  31      65.655  70.658   6.000  1.00 72.06           C  
ATOM  11366  CE  LYS H  31      65.005  71.780   6.798  1.00 73.84           C  
ATOM  11367  NZ  LYS H  31      64.717  71.335   8.194  1.00 75.61           N  
ATOM  11368  N   GLU H  32      64.984  67.772   3.776  1.00 53.50           N  
ATOM  11369  CA  GLU H  32      64.531  67.829   2.397  1.00 51.26           C  
ATOM  11370  C   GLU H  32      64.219  69.250   1.948  1.00 49.79           C  
ATOM  11371  O   GLU H  32      63.822  70.093   2.747  1.00 50.35           O  
ATOM  11372  CB  GLU H  32      63.289  66.958   2.218  1.00 51.47           C  
ATOM  11373  CG  GLU H  32      63.558  65.473   2.374  1.00 56.49           C  
ATOM  11374  CD  GLU H  32      62.327  64.622   2.141  1.00 59.90           C  
ATOM  11375  OE1 GLU H  32      62.458  63.380   2.184  1.00 64.09           O  
ATOM  11376  OE2 GLU H  32      61.231  65.184   1.920  1.00 59.70           O  
ATOM  11377  N   SER H  33      64.407  69.504   0.660  1.00 46.77           N  
ATOM  11378  CA  SER H  33      64.129  70.806   0.091  1.00 42.86           C  
ATOM  11379  C   SER H  33      63.871  70.602  -1.389  1.00 40.44           C  
ATOM  11380  O   SER H  33      64.058  69.500  -1.919  1.00 40.58           O  
ATOM  11381  CB  SER H  33      65.314  71.756   0.293  1.00 45.73           C  
ATOM  11382  OG  SER H  33      66.080  71.880  -0.881  1.00 46.39           O  
ATOM  11383  N   TYR H  34      63.419  71.652  -2.054  1.00 34.45           N  
ATOM  11384  CA  TYR H  34      63.131  71.562  -3.477  1.00 33.68           C  
ATOM  11385  C   TYR H  34      64.356  71.976  -4.291  1.00 31.80           C  
ATOM  11386  O   TYR H  34      64.308  72.045  -5.513  1.00 34.45           O  
ATOM  11387  CB  TYR H  34      61.943  72.479  -3.822  1.00 30.78           C  
ATOM  11388  CG  TYR H  34      60.615  71.958  -3.325  1.00 33.19           C  
ATOM  11389  CD1 TYR H  34      60.055  72.439  -2.136  1.00 34.03           C  
ATOM  11390  CD2 TYR H  34      59.909  70.984  -4.049  1.00 32.74           C  
ATOM  11391  CE1 TYR H  34      58.822  71.970  -1.682  1.00 34.60           C  
ATOM  11392  CE2 TYR H  34      58.687  70.509  -3.609  1.00 33.01           C  
ATOM  11393  CZ  TYR H  34      58.145  71.007  -2.421  1.00 35.64           C  
ATOM  11394  OH  TYR H  34      56.924  70.551  -1.976  1.00 36.77           O  
ATOM  11395  N   ALA H  35      65.453  72.252  -3.610  1.00 31.23           N  
ATOM  11396  CA  ALA H  35      66.648  72.729  -4.295  1.00 35.70           C  
ATOM  11397  C   ALA H  35      67.020  71.981  -5.577  1.00 37.47           C  
ATOM  11398  O   ALA H  35      67.151  72.602  -6.629  1.00 40.61           O  
ATOM  11399  CB  ALA H  35      67.826  72.751  -3.327  1.00 36.89           C  
ATOM  11400  N   ILE H  36      67.172  70.660  -5.528  1.00 39.29           N  
ATOM  11401  CA  ILE H  36      67.564  69.956  -6.753  1.00 40.54           C  
ATOM  11402  C   ILE H  36      66.580  70.090  -7.905  1.00 40.39           C  
ATOM  11403  O   ILE H  36      67.000  70.127  -9.059  1.00 40.22           O  
ATOM  11404  CB  ILE H  36      67.843  68.449  -6.513  1.00 43.78           C  
ATOM  11405  CG1 ILE H  36      66.618  67.765  -5.930  1.00 46.10           C  
ATOM  11406  CG2 ILE H  36      69.020  68.287  -5.568  1.00 44.65           C  
ATOM  11407  CD1 ILE H  36      66.884  66.300  -5.581  1.00 52.49           C  
ATOM  11408  N   TYR H  37      65.282  70.182  -7.607  1.00 37.08           N  
ATOM  11409  CA  TYR H  37      64.286  70.316  -8.671  1.00 34.71           C  
ATOM  11410  C   TYR H  37      64.244  71.755  -9.195  1.00 34.84           C  
ATOM  11411  O   TYR H  37      64.020  71.988 -10.384  1.00 37.56           O  
ATOM  11412  CB  TYR H  37      62.915  69.878  -8.169  1.00 34.03           C  
ATOM  11413  CG  TYR H  37      62.988  68.616  -7.344  1.00 40.79           C  
ATOM  11414  CD1 TYR H  37      62.955  68.671  -5.948  1.00 41.08           C  
ATOM  11415  CD2 TYR H  37      63.158  67.372  -7.946  1.00 39.71           C  
ATOM  11416  CE1 TYR H  37      63.088  67.528  -5.178  1.00 40.29           C  
ATOM  11417  CE2 TYR H  37      63.295  66.218  -7.176  1.00 42.04           C  
ATOM  11418  CZ  TYR H  37      63.257  66.304  -5.794  1.00 45.53           C  
ATOM  11419  OH  TYR H  37      63.364  65.163  -5.019  1.00 46.75           O  
ATOM  11420  N   VAL H  38      64.453  72.726  -8.316  1.00 31.40           N  
ATOM  11421  CA  VAL H  38      64.484  74.102  -8.769  1.00 31.06           C  
ATOM  11422  C   VAL H  38      65.661  74.227  -9.755  1.00 36.44           C  
ATOM  11423  O   VAL H  38      65.566  74.894 -10.795  1.00 34.68           O  
ATOM  11424  CB  VAL H  38      64.725  75.059  -7.602  1.00 30.26           C  
ATOM  11425  CG1 VAL H  38      64.940  76.462  -8.123  1.00 26.82           C  
ATOM  11426  CG2 VAL H  38      63.507  75.012  -6.621  1.00 30.11           C  
ATOM  11427  N   TYR H  39      66.775  73.590  -9.412  1.00 36.41           N  
ATOM  11428  CA  TYR H  39      67.951  73.654 -10.264  1.00 41.88           C  
ATOM  11429  C   TYR H  39      67.702  73.029 -11.636  1.00 40.06           C  
ATOM  11430  O   TYR H  39      68.128  73.581 -12.653  1.00 40.13           O  
ATOM  11431  CB  TYR H  39      69.142  72.976  -9.593  1.00 46.54           C  
ATOM  11432  CG  TYR H  39      70.442  73.432 -10.185  1.00 51.77           C  
ATOM  11433  CD1 TYR H  39      70.975  74.672  -9.856  1.00 54.69           C  
ATOM  11434  CD2 TYR H  39      71.111  72.653 -11.124  1.00 53.69           C  
ATOM  11435  CE1 TYR H  39      72.153  75.131 -10.455  1.00 59.94           C  
ATOM  11436  CE2 TYR H  39      72.289  73.100 -11.729  1.00 56.37           C  
ATOM  11437  CZ  TYR H  39      72.801  74.335 -11.391  1.00 58.35           C  
ATOM  11438  OH  TYR H  39      73.962  74.781 -11.987  1.00 64.10           O  
ATOM  11439  N   LYS H  40      67.010  71.893 -11.679  1.00 40.18           N  
ATOM  11440  CA  LYS H  40      66.724  71.265 -12.977  1.00 41.01           C  
ATOM  11441  C   LYS H  40      65.903  72.215 -13.839  1.00 41.13           C  
ATOM  11442  O   LYS H  40      66.124  72.307 -15.053  1.00 40.97           O  
ATOM  11443  CB  LYS H  40      65.951  69.954 -12.813  1.00 44.53           C  
ATOM  11444  CG  LYS H  40      66.739  68.797 -12.210  1.00 47.31           C  
ATOM  11445  CD  LYS H  40      65.782  67.633 -11.947  1.00 52.11           C  
ATOM  11446  CE  LYS H  40      66.447  66.481 -11.214  1.00 55.90           C  
ATOM  11447  NZ  LYS H  40      65.434  65.450 -10.797  1.00 60.52           N  
ATOM  11448  N   VAL H  41      64.945  72.917 -13.219  1.00 38.22           N  
ATOM  11449  CA  VAL H  41      64.107  73.859 -13.955  1.00 32.99           C  
ATOM  11450  C   VAL H  41      64.932  75.045 -14.421  1.00 32.87           C  
ATOM  11451  O   VAL H  41      64.771  75.530 -15.541  1.00 35.22           O  
ATOM  11452  CB  VAL H  41      62.926  74.363 -13.096  1.00 34.06           C  
ATOM  11453  CG1 VAL H  41      62.138  75.428 -13.861  1.00 33.55           C  
ATOM  11454  CG2 VAL H  41      62.026  73.207 -12.750  1.00 29.59           C  
ATOM  11455  N   LEU H  42      65.831  75.516 -13.572  1.00 32.36           N  
ATOM  11456  CA  LEU H  42      66.667  76.636 -13.956  1.00 36.48           C  
ATOM  11457  C   LEU H  42      67.412  76.303 -15.269  1.00 41.75           C  
ATOM  11458  O   LEU H  42      67.449  77.115 -16.198  1.00 40.66           O  
ATOM  11459  CB  LEU H  42      67.666  76.934 -12.849  1.00 31.24           C  
ATOM  11460  CG  LEU H  42      68.769  77.951 -13.124  1.00 33.91           C  
ATOM  11461  CD1 LEU H  42      68.197  79.289 -13.536  1.00 38.61           C  
ATOM  11462  CD2 LEU H  42      69.583  78.125 -11.842  1.00 38.04           C  
ATOM  11463  N   LYS H  43      68.015  75.118 -15.320  1.00 42.88           N  
ATOM  11464  CA  LYS H  43      68.750  74.685 -16.502  1.00 46.79           C  
ATOM  11465  C   LYS H  43      67.882  74.609 -17.752  1.00 50.35           C  
ATOM  11466  O   LYS H  43      68.366  74.869 -18.852  1.00 54.06           O  
ATOM  11467  CB  LYS H  43      69.443  73.353 -16.229  1.00 44.41           C  
ATOM  11468  CG  LYS H  43      70.569  73.521 -15.217  1.00 46.01           C  
ATOM  11469  CD  LYS H  43      71.345  74.794 -15.547  1.00 49.29           C  
ATOM  11470  CE  LYS H  43      72.272  75.238 -14.435  1.00 52.28           C  
ATOM  11471  NZ  LYS H  43      73.087  76.434 -14.822  1.00 46.18           N  
ATOM  11472  N   GLN H  44      66.600  74.292 -17.598  1.00 49.50           N  
ATOM  11473  CA  GLN H  44      65.720  74.232 -18.759  1.00 49.64           C  
ATOM  11474  C   GLN H  44      65.463  75.641 -19.290  1.00 49.20           C  
ATOM  11475  O   GLN H  44      65.448  75.875 -20.500  1.00 48.90           O  
ATOM  11476  CB  GLN H  44      64.369  73.610 -18.404  1.00 51.99           C  
ATOM  11477  CG  GLN H  44      64.334  72.116 -18.211  1.00 57.54           C  
ATOM  11478  CD  GLN H  44      62.897  71.602 -18.093  1.00 63.58           C  
ATOM  11479  OE1 GLN H  44      62.158  71.987 -17.179  1.00 66.56           O  
ATOM  11480  NE2 GLN H  44      62.494  70.742 -19.027  1.00 62.96           N  
ATOM  11481  N   VAL H  45      65.255  76.576 -18.371  1.00 45.24           N  
ATOM  11482  CA  VAL H  45      64.961  77.958 -18.717  1.00 42.64           C  
ATOM  11483  C   VAL H  45      66.177  78.843 -19.038  1.00 40.77           C  
ATOM  11484  O   VAL H  45      66.102  79.701 -19.901  1.00 41.29           O  
ATOM  11485  CB  VAL H  45      64.124  78.621 -17.570  1.00 42.88           C  
ATOM  11486  CG1 VAL H  45      63.878  80.072 -17.868  1.00 44.78           C  
ATOM  11487  CG2 VAL H  45      62.803  77.891 -17.408  1.00 42.57           C  
ATOM  11488  N   HIS H  46      67.280  78.657 -18.329  1.00 41.06           N  
ATOM  11489  CA  HIS H  46      68.495  79.448 -18.557  1.00 41.99           C  
ATOM  11490  C   HIS H  46      69.670  78.500 -18.379  1.00 43.14           C  
ATOM  11491  O   HIS H  46      70.288  78.446 -17.318  1.00 39.96           O  
ATOM  11492  CB  HIS H  46      68.601  80.595 -17.546  1.00 45.34           C  
ATOM  11493  CG  HIS H  46      67.616  81.703 -17.774  1.00 47.91           C  
ATOM  11494  ND1 HIS H  46      67.638  82.500 -18.898  1.00 41.46           N  
ATOM  11495  CD2 HIS H  46      66.586  82.153 -17.016  1.00 46.63           C  
ATOM  11496  CE1 HIS H  46      66.667  83.391 -18.824  1.00 47.33           C  
ATOM  11497  NE2 HIS H  46      66.013  83.203 -17.692  1.00 47.22           N  
ATOM  11498  N   PRO H  47      70.013  77.750 -19.438  1.00 44.46           N  
ATOM  11499  CA  PRO H  47      71.120  76.789 -19.364  1.00 41.72           C  
ATOM  11500  C   PRO H  47      72.431  77.271 -18.798  1.00 40.29           C  
ATOM  11501  O   PRO H  47      73.098  76.525 -18.100  1.00 43.53           O  
ATOM  11502  CB  PRO H  47      71.245  76.297 -20.798  1.00 44.15           C  
ATOM  11503  CG  PRO H  47      69.790  76.372 -21.290  1.00 45.42           C  
ATOM  11504  CD  PRO H  47      69.393  77.746 -20.777  1.00 42.59           C  
ATOM  11505  N   ASP H  48      72.811  78.510 -19.052  1.00 40.50           N  
ATOM  11506  CA  ASP H  48      74.085  78.959 -18.531  1.00 44.87           C  
ATOM  11507  C   ASP H  48      74.002  79.954 -17.383  1.00 46.21           C  
ATOM  11508  O   ASP H  48      74.891  80.796 -17.180  1.00 47.63           O  
ATOM  11509  CB  ASP H  48      74.910  79.495 -19.691  1.00 48.50           C  
ATOM  11510  CG  ASP H  48      74.931  78.519 -20.863  1.00 51.05           C  
ATOM  11511  OD1 ASP H  48      75.393  77.372 -20.674  1.00 55.39           O  
ATOM  11512  OD2 ASP H  48      74.460  78.883 -21.958  1.00 55.06           O  
ATOM  11513  N   THR H  49      72.946  79.814 -16.590  1.00 44.87           N  
ATOM  11514  CA  THR H  49      72.732  80.702 -15.452  1.00 40.57           C  
ATOM  11515  C   THR H  49      72.775  79.890 -14.161  1.00 35.09           C  
ATOM  11516  O   THR H  49      72.186  78.835 -14.076  1.00 36.81           O  
ATOM  11517  CB  THR H  49      71.352  81.415 -15.612  1.00 41.88           C  
ATOM  11518  OG1 THR H  49      71.380  82.201 -16.811  1.00 39.60           O  
ATOM  11519  CG2 THR H  49      71.034  82.318 -14.419  1.00 36.65           C  
ATOM  11520  N   GLY H  50      73.495  80.374 -13.166  1.00 34.99           N  
ATOM  11521  CA  GLY H  50      73.551  79.664 -11.900  1.00 33.04           C  
ATOM  11522  C   GLY H  50      72.655  80.374 -10.882  1.00 36.54           C  
ATOM  11523  O   GLY H  50      71.938  81.307 -11.216  1.00 36.11           O  
ATOM  11524  N   ILE H  51      72.687  79.936  -9.635  1.00 38.42           N  
ATOM  11525  CA  ILE H  51      71.868  80.560  -8.610  1.00 36.70           C  
ATOM  11526  C   ILE H  51      72.613  80.428  -7.304  1.00 35.41           C  
ATOM  11527  O   ILE H  51      73.107  79.357  -6.994  1.00 36.53           O  
ATOM  11528  CB  ILE H  51      70.493  79.862  -8.526  1.00 36.11           C  
ATOM  11529  CG1 ILE H  51      69.607  80.538  -7.460  1.00 33.48           C  
ATOM  11530  CG2 ILE H  51      70.686  78.376  -8.234  1.00 33.57           C  
ATOM  11531  CD1 ILE H  51      68.142  80.171  -7.609  1.00 33.19           C  
ATOM  11532  N   SER H  52      72.708  81.515  -6.549  1.00 33.59           N  
ATOM  11533  CA  SER H  52      73.413  81.486  -5.273  1.00 33.41           C  
ATOM  11534  C   SER H  52      72.601  80.721  -4.207  1.00 36.04           C  
ATOM  11535  O   SER H  52      71.405  80.447  -4.389  1.00 31.62           O  
ATOM  11536  CB  SER H  52      73.697  82.914  -4.781  1.00 31.80           C  
ATOM  11537  OG  SER H  52      72.532  83.529  -4.231  1.00 36.29           O  
ATOM  11538  N   SER H  53      73.270  80.383  -3.104  1.00 35.07           N  
ATOM  11539  CA  SER H  53      72.657  79.659  -2.005  1.00 37.40           C  
ATOM  11540  C   SER H  53      71.470  80.417  -1.439  1.00 35.44           C  
ATOM  11541  O   SER H  53      70.410  79.840  -1.249  1.00 36.87           O  
ATOM  11542  CB  SER H  53      73.661  79.427  -0.880  1.00 33.37           C  
ATOM  11543  OG  SER H  53      74.301  78.187  -1.065  1.00 50.95           O  
ATOM  11544  N   LYS H  54      71.675  81.694  -1.140  1.00 35.83           N  
ATOM  11545  CA  LYS H  54      70.616  82.539  -0.594  1.00 38.04           C  
ATOM  11546  C   LYS H  54      69.429  82.607  -1.544  1.00 37.48           C  
ATOM  11547  O   LYS H  54      68.274  82.525  -1.107  1.00 41.23           O  
ATOM  11548  CB  LYS H  54      71.162  83.938  -0.296  1.00 35.06           C  
ATOM  11549  CG  LYS H  54      71.992  83.931   0.973  1.00 42.87           C  
ATOM  11550  CD  LYS H  54      72.850  85.176   1.164  1.00 46.91           C  
ATOM  11551  CE  LYS H  54      73.761  84.970   2.377  1.00 51.07           C  
ATOM  11552  NZ  LYS H  54      74.852  85.984   2.480  1.00 58.48           N  
ATOM  11553  N   ALA H  55      69.702  82.748  -2.840  1.00 33.50           N  
ATOM  11554  CA  ALA H  55      68.624  82.795  -3.822  1.00 32.37           C  
ATOM  11555  C   ALA H  55      67.874  81.463  -3.840  1.00 33.16           C  
ATOM  11556  O   ALA H  55      66.635  81.420  -3.919  1.00 31.95           O  
ATOM  11557  CB  ALA H  55      69.178  83.096  -5.191  1.00 30.98           C  
ATOM  11558  N   MET H  56      68.612  80.364  -3.761  1.00 29.19           N  
ATOM  11559  CA  MET H  56      67.968  79.062  -3.782  1.00 29.19           C  
ATOM  11560  C   MET H  56      67.075  78.888  -2.548  1.00 29.25           C  
ATOM  11561  O   MET H  56      66.022  78.263  -2.620  1.00 27.38           O  
ATOM  11562  CB  MET H  56      69.006  77.944  -3.791  1.00 29.39           C  
ATOM  11563  CG  MET H  56      68.377  76.567  -3.768  1.00 27.63           C  
ATOM  11564  SD  MET H  56      67.343  76.266  -5.221  1.00 32.43           S  
ATOM  11565  CE  MET H  56      68.680  75.599  -6.448  1.00 30.04           C  
ATOM  11566  N   SER H  57      67.539  79.400  -1.417  1.00 27.64           N  
ATOM  11567  CA  SER H  57      66.781  79.309  -0.181  1.00 32.41           C  
ATOM  11568  C   SER H  57      65.481  80.123  -0.331  1.00 30.44           C  
ATOM  11569  O   SER H  57      64.430  79.763   0.191  1.00 30.63           O  
ATOM  11570  CB  SER H  57      67.632  79.828   0.964  1.00 33.25           C  
ATOM  11571  OG  SER H  57      66.899  79.697   2.155  1.00 44.01           O  
ATOM  11572  N   ILE H  58      65.562  81.216  -1.068  1.00 29.76           N  
ATOM  11573  CA  ILE H  58      64.391  82.011  -1.349  1.00 29.66           C  
ATOM  11574  C   ILE H  58      63.453  81.204  -2.223  1.00 30.12           C  
ATOM  11575  O   ILE H  58      62.250  81.147  -1.971  1.00 28.48           O  
ATOM  11576  CB  ILE H  58      64.786  83.321  -2.021  1.00 30.27           C  
ATOM  11577  CG1 ILE H  58      65.461  84.201  -0.956  1.00 29.50           C  
ATOM  11578  CG2 ILE H  58      63.546  83.961  -2.674  1.00 28.59           C  
ATOM  11579  CD1 ILE H  58      66.096  85.440  -1.443  1.00 34.75           C  
ATOM  11580  N   MET H  59      63.991  80.526  -3.233  1.00 29.59           N  
ATOM  11581  CA  MET H  59      63.129  79.720  -4.090  1.00 29.23           C  
ATOM  11582  C   MET H  59      62.509  78.577  -3.309  1.00 29.21           C  
ATOM  11583  O   MET H  59      61.361  78.206  -3.554  1.00 27.49           O  
ATOM  11584  CB  MET H  59      63.910  79.164  -5.292  1.00 31.55           C  
ATOM  11585  CG  MET H  59      64.378  80.255  -6.254  1.00 24.91           C  
ATOM  11586  SD  MET H  59      62.976  81.156  -7.009  1.00 29.42           S  
ATOM  11587  CE  MET H  59      62.117  79.866  -7.790  1.00 22.82           C  
ATOM  11588  N   ASN H  60      63.258  77.999  -2.373  1.00 27.00           N  
ATOM  11589  CA  ASN H  60      62.696  76.911  -1.581  1.00 29.01           C  
ATOM  11590  C   ASN H  60      61.514  77.441  -0.736  1.00 29.60           C  
ATOM  11591  O   ASN H  60      60.481  76.764  -0.606  1.00 28.92           O  
ATOM  11592  CB  ASN H  60      63.760  76.294  -0.654  1.00 30.94           C  
ATOM  11593  CG  ASN H  60      63.311  74.963  -0.075  1.00 32.84           C  
ATOM  11594  OD1 ASN H  60      62.849  74.101  -0.804  1.00 37.38           O  
ATOM  11595  ND2 ASN H  60      63.451  74.790   1.226  1.00 30.90           N  
ATOM  11596  N   SER H  61      61.689  78.636  -0.165  1.00 28.31           N  
ATOM  11597  CA  SER H  61      60.650  79.290   0.644  1.00 28.73           C  
ATOM  11598  C   SER H  61      59.432  79.528  -0.257  1.00 28.23           C  
ATOM  11599  O   SER H  61      58.306  79.234   0.131  1.00 27.79           O  
ATOM  11600  CB  SER H  61      61.141  80.639   1.177  1.00 28.50           C  
ATOM  11601  OG  SER H  61      62.002  80.488   2.286  1.00 29.49           O  
ATOM  11602  N   PHE H  62      59.673  80.025  -1.474  1.00 26.42           N  
ATOM  11603  CA  PHE H  62      58.597  80.270  -2.439  1.00 24.52           C  
ATOM  11604  C   PHE H  62      57.779  79.023  -2.730  1.00 26.51           C  
ATOM  11605  O   PHE H  62      56.539  79.039  -2.676  1.00 25.40           O  
ATOM  11606  CB  PHE H  62      59.165  80.778  -3.766  1.00 24.37           C  
ATOM  11607  CG  PHE H  62      58.124  80.905  -4.851  1.00 27.32           C  
ATOM  11608  CD1 PHE H  62      57.171  81.939  -4.809  1.00 25.29           C  
ATOM  11609  CD2 PHE H  62      58.123  80.024  -5.940  1.00 28.30           C  
ATOM  11610  CE1 PHE H  62      56.256  82.093  -5.830  1.00 28.93           C  
ATOM  11611  CE2 PHE H  62      57.203  80.171  -6.970  1.00 33.71           C  
ATOM  11612  CZ  PHE H  62      56.267  81.205  -6.924  1.00 27.99           C  
ATOM  11613  N   VAL H  63      58.460  77.926  -3.061  1.00 24.95           N  
ATOM  11614  CA  VAL H  63      57.755  76.686  -3.376  1.00 24.72           C  
ATOM  11615  C   VAL H  63      56.951  76.179  -2.173  1.00 23.92           C  
ATOM  11616  O   VAL H  63      55.796  75.761  -2.319  1.00 27.16           O  
ATOM  11617  CB  VAL H  63      58.746  75.566  -3.834  1.00 26.81           C  
ATOM  11618  CG1 VAL H  63      57.972  74.277  -4.052  1.00 26.70           C  
ATOM  11619  CG2 VAL H  63      59.458  75.995  -5.176  1.00 24.12           C  
ATOM  11620  N   ASN H  64      57.552  76.215  -0.992  1.00 23.07           N  
ATOM  11621  CA  ASN H  64      56.846  75.754   0.200  1.00 26.07           C  
ATOM  11622  C   ASN H  64      55.652  76.643   0.501  1.00 24.94           C  
ATOM  11623  O   ASN H  64      54.613  76.170   0.932  1.00 26.76           O  
ATOM  11624  CB  ASN H  64      57.772  75.740   1.416  1.00 29.37           C  
ATOM  11625  CG  ASN H  64      58.664  74.534   1.422  1.00 34.22           C  
ATOM  11626  OD1 ASN H  64      58.217  73.457   1.094  1.00 38.88           O  
ATOM  11627  ND2 ASN H  64      59.932  74.705   1.792  1.00 39.06           N  
ATOM  11628  N   ASP H  65      55.814  77.931   0.248  1.00 24.91           N  
ATOM  11629  CA  ASP H  65      54.768  78.892   0.532  1.00 25.19           C  
ATOM  11630  C   ASP H  65      53.590  78.629  -0.410  1.00 22.71           C  
ATOM  11631  O   ASP H  65      52.446  78.459   0.049  1.00 23.71           O  
ATOM  11632  CB  ASP H  65      55.339  80.325   0.364  1.00 22.18           C  
ATOM  11633  CG  ASP H  65      54.317  81.404   0.701  1.00 27.28           C  
ATOM  11634  OD1 ASP H  65      53.530  81.165   1.620  1.00 34.00           O  
ATOM  11635  OD2 ASP H  65      54.301  82.483   0.066  1.00 26.46           O  
ATOM  11636  N   VAL H  66      53.852  78.578  -1.715  1.00 21.21           N  
ATOM  11637  CA  VAL H  66      52.767  78.322  -2.675  1.00 23.45           C  
ATOM  11638  C   VAL H  66      52.144  76.957  -2.447  1.00 24.32           C  
ATOM  11639  O   VAL H  66      50.936  76.793  -2.529  1.00 25.12           O  
ATOM  11640  CB  VAL H  66      53.271  78.450  -4.117  1.00 27.12           C  
ATOM  11641  CG1 VAL H  66      52.185  78.071  -5.082  1.00 26.94           C  
ATOM  11642  CG2 VAL H  66      53.689  79.895  -4.366  1.00 29.50           C  
ATOM  11643  N   PHE H  67      52.967  75.957  -2.142  1.00 26.83           N  
ATOM  11644  CA  PHE H  67      52.414  74.640  -1.839  1.00 25.57           C  
ATOM  11645  C   PHE H  67      51.392  74.775  -0.683  1.00 24.58           C  
ATOM  11646  O   PHE H  67      50.264  74.294  -0.791  1.00 25.77           O  
ATOM  11647  CB  PHE H  67      53.533  73.675  -1.406  1.00 24.34           C  
ATOM  11648  CG  PHE H  67      53.030  72.342  -0.896  1.00 30.23           C  
ATOM  11649  CD1 PHE H  67      52.960  71.231  -1.739  1.00 31.21           C  
ATOM  11650  CD2 PHE H  67      52.625  72.197   0.435  1.00 32.21           C  
ATOM  11651  CE1 PHE H  67      52.489  69.983  -1.267  1.00 32.55           C  
ATOM  11652  CE2 PHE H  67      52.157  70.967   0.920  1.00 36.31           C  
ATOM  11653  CZ  PHE H  67      52.090  69.853   0.054  1.00 35.17           C  
ATOM  11654  N   GLU H  68      51.787  75.415   0.416  1.00 27.08           N  
ATOM  11655  CA  GLU H  68      50.872  75.556   1.565  1.00 27.24           C  
ATOM  11656  C   GLU H  68      49.609  76.356   1.221  1.00 26.20           C  
ATOM  11657  O   GLU H  68      48.516  75.985   1.625  1.00 25.32           O  
ATOM  11658  CB  GLU H  68      51.570  76.229   2.763  1.00 28.02           C  
ATOM  11659  CG  GLU H  68      52.764  75.445   3.299  1.00 41.32           C  
ATOM  11660  CD  GLU H  68      53.582  76.208   4.357  1.00 45.10           C  
ATOM  11661  OE1 GLU H  68      53.756  77.448   4.250  1.00 47.67           O  
ATOM  11662  OE2 GLU H  68      54.068  75.549   5.291  1.00 49.36           O  
ATOM  11663  N   ARG H  69      49.745  77.443   0.472  1.00 21.99           N  
ATOM  11664  CA  ARG H  69      48.554  78.217   0.149  1.00 24.91           C  
ATOM  11665  C   ARG H  69      47.593  77.421  -0.703  1.00 25.70           C  
ATOM  11666  O   ARG H  69      46.400  77.394  -0.460  1.00 22.88           O  
ATOM  11667  CB  ARG H  69      48.922  79.462  -0.617  1.00 26.55           C  
ATOM  11668  CG  ARG H  69      49.717  80.454   0.139  1.00 26.92           C  
ATOM  11669  CD  ARG H  69      49.703  81.670  -0.678  1.00 33.94           C  
ATOM  11670  NE  ARG H  69      50.960  82.376  -0.643  1.00 34.19           N  
ATOM  11671  CZ  ARG H  69      51.123  83.531  -1.254  1.00 29.12           C  
ATOM  11672  NH1 ARG H  69      50.095  84.075  -1.908  1.00 28.84           N  
ATOM  11673  NH2 ARG H  69      52.301  84.107  -1.250  1.00 29.96           N  
ATOM  11674  N   ILE H  70      48.127  76.757  -1.721  1.00 26.84           N  
ATOM  11675  CA  ILE H  70      47.281  75.983  -2.608  1.00 25.24           C  
ATOM  11676  C   ILE H  70      46.664  74.834  -1.859  1.00 25.40           C  
ATOM  11677  O   ILE H  70      45.451  74.601  -1.968  1.00 27.05           O  
ATOM  11678  CB  ILE H  70      48.082  75.457  -3.820  1.00 24.60           C  
ATOM  11679  CG1 ILE H  70      48.385  76.610  -4.769  1.00 22.65           C  
ATOM  11680  CG2 ILE H  70      47.301  74.335  -4.535  1.00 26.14           C  
ATOM  11681  CD1 ILE H  70      49.280  76.189  -5.996  1.00 25.89           C  
ATOM  11682  N   ALA H  71      47.475  74.125  -1.076  1.00 25.77           N  
ATOM  11683  CA  ALA H  71      46.964  72.979  -0.310  1.00 24.80           C  
ATOM  11684  C   ALA H  71      45.894  73.403   0.711  1.00 27.41           C  
ATOM  11685  O   ALA H  71      44.860  72.728   0.852  1.00 24.08           O  
ATOM  11686  CB  ALA H  71      48.118  72.266   0.418  1.00 26.31           C  
ATOM  11687  N   GLY H  72      46.144  74.507   1.426  1.00 26.07           N  
ATOM  11688  CA  GLY H  72      45.166  74.972   2.407  1.00 28.97           C  
ATOM  11689  C   GLY H  72      43.837  75.359   1.758  1.00 30.47           C  
ATOM  11690  O   GLY H  72      42.752  75.065   2.274  1.00 29.69           O  
ATOM  11691  N   GLU H  73      43.922  76.053   0.622  1.00 31.56           N  
ATOM  11692  CA  GLU H  73      42.736  76.461  -0.120  1.00 30.08           C  
ATOM  11693  C   GLU H  73      41.999  75.205  -0.589  1.00 28.85           C  
ATOM  11694  O   GLU H  73      40.773  75.134  -0.529  1.00 29.23           O  
ATOM  11695  CB  GLU H  73      43.162  77.289  -1.333  1.00 33.01           C  
ATOM  11696  CG  GLU H  73      42.073  78.130  -1.924  1.00 42.57           C  
ATOM  11697  CD  GLU H  73      41.882  79.441  -1.146  1.00 46.68           C  
ATOM  11698  OE1 GLU H  73      40.728  79.714  -0.762  1.00 45.30           O  
ATOM  11699  OE2 GLU H  73      42.874  80.194  -0.931  1.00 44.29           O  
ATOM  11700  N   ALA H  74      42.741  74.203  -1.070  1.00 27.08           N  
ATOM  11701  CA  ALA H  74      42.107  72.961  -1.536  1.00 23.51           C  
ATOM  11702  C   ALA H  74      41.470  72.261  -0.350  1.00 24.64           C  
ATOM  11703  O   ALA H  74      40.391  71.678  -0.461  1.00 26.38           O  
ATOM  11704  CB  ALA H  74      43.140  72.029  -2.198  1.00 24.35           C  
ATOM  11705  N   SER H  75      42.143  72.304   0.789  1.00 26.19           N  
ATOM  11706  CA  SER H  75      41.608  71.674   1.992  1.00 26.65           C  
ATOM  11707  C   SER H  75      40.253  72.300   2.352  1.00 29.63           C  
ATOM  11708  O   SER H  75      39.279  71.603   2.604  1.00 28.65           O  
ATOM  11709  CB  SER H  75      42.560  71.887   3.156  1.00 23.55           C  
ATOM  11710  OG  SER H  75      42.047  71.272   4.323  1.00 28.74           O  
ATOM  11711  N   ARG H  76      40.214  73.629   2.394  1.00 29.18           N  
ATOM  11712  CA  ARG H  76      38.986  74.345   2.722  1.00 30.20           C  
ATOM  11713  C   ARG H  76      37.905  74.037   1.688  1.00 29.71           C  
ATOM  11714  O   ARG H  76      36.735  73.845   2.032  1.00 30.14           O  
ATOM  11715  CB  ARG H  76      39.262  75.862   2.777  1.00 31.76           C  
ATOM  11716  CG  ARG H  76      40.124  76.295   3.977  1.00 33.47           C  
ATOM  11717  CD  ARG H  76      40.485  77.824   3.923  1.00 40.07           C  
ATOM  11718  NE  ARG H  76      41.855  77.993   4.384  1.00 45.48           N  
ATOM  11719  CZ  ARG H  76      42.889  78.286   3.608  1.00 44.40           C  
ATOM  11720  NH1 ARG H  76      42.734  78.491   2.315  1.00 46.63           N  
ATOM  11721  NH2 ARG H  76      44.106  78.277   4.124  1.00 50.83           N  
ATOM  11722  N   LEU H  77      38.284  74.006   0.414  1.00 26.88           N  
ATOM  11723  CA  LEU H  77      37.305  73.685  -0.607  1.00 30.10           C  
ATOM  11724  C   LEU H  77      36.635  72.330  -0.355  1.00 31.58           C  
ATOM  11725  O   LEU H  77      35.429  72.208  -0.453  1.00 32.67           O  
ATOM  11726  CB  LEU H  77      37.957  73.642  -1.977  1.00 33.79           C  
ATOM  11727  CG  LEU H  77      37.973  74.904  -2.810  1.00 37.59           C  
ATOM  11728  CD1 LEU H  77      38.896  74.657  -3.986  1.00 39.54           C  
ATOM  11729  CD2 LEU H  77      36.537  75.245  -3.264  1.00 35.91           C  
ATOM  11730  N   ALA H  78      37.423  71.297  -0.075  1.00 30.33           N  
ATOM  11731  CA  ALA H  78      36.836  69.984   0.168  1.00 31.38           C  
ATOM  11732  C   ALA H  78      35.966  69.994   1.425  1.00 33.80           C  
ATOM  11733  O   ALA H  78      34.878  69.420   1.413  1.00 35.99           O  
ATOM  11734  CB  ALA H  78      37.923  68.933   0.301  1.00 27.00           C  
ATOM  11735  N   HIS H  79      36.436  70.623   2.508  1.00 33.47           N  
ATOM  11736  CA  HIS H  79      35.639  70.667   3.742  1.00 35.58           C  
ATOM  11737  C   HIS H  79      34.318  71.403   3.509  1.00 35.14           C  
ATOM  11738  O   HIS H  79      33.272  70.934   3.936  1.00 36.05           O  
ATOM  11739  CB  HIS H  79      36.403  71.339   4.884  1.00 39.19           C  
ATOM  11740  CG  HIS H  79      37.432  70.462   5.529  1.00 48.57           C  
ATOM  11741  ND1 HIS H  79      37.102  69.403   6.353  1.00 52.89           N  
ATOM  11742  CD2 HIS H  79      38.784  70.478   5.463  1.00 50.95           C  
ATOM  11743  CE1 HIS H  79      38.207  68.805   6.761  1.00 52.72           C  
ATOM  11744  NE2 HIS H  79      39.241  69.436   6.235  1.00 53.15           N  
ATOM  11745  N   TYR H  80      34.368  72.548   2.832  1.00 34.78           N  
ATOM  11746  CA  TYR H  80      33.166  73.311   2.530  1.00 36.57           C  
ATOM  11747  C   TYR H  80      32.157  72.427   1.817  1.00 36.37           C  
ATOM  11748  O   TYR H  80      30.965  72.522   2.051  1.00 36.75           O  
ATOM  11749  CB  TYR H  80      33.466  74.493   1.595  1.00 36.70           C  
ATOM  11750  CG  TYR H  80      34.340  75.568   2.202  1.00 41.10           C  
ATOM  11751  CD1 TYR H  80      34.519  75.653   3.588  1.00 39.57           C  
ATOM  11752  CD2 TYR H  80      34.965  76.521   1.396  1.00 40.85           C  
ATOM  11753  CE1 TYR H  80      35.290  76.644   4.142  1.00 38.48           C  
ATOM  11754  CE2 TYR H  80      35.732  77.521   1.948  1.00 37.08           C  
ATOM  11755  CZ  TYR H  80      35.891  77.576   3.320  1.00 36.57           C  
ATOM  11756  OH  TYR H  80      36.633  78.588   3.878  1.00 38.21           O  
ATOM  11757  N   ASN H  81      32.645  71.584   0.917  1.00 34.92           N  
ATOM  11758  CA  ASN H  81      31.762  70.708   0.162  1.00 34.13           C  
ATOM  11759  C   ASN H  81      31.621  69.325   0.781  1.00 34.04           C  
ATOM  11760  O   ASN H  81      31.184  68.402   0.117  1.00 34.78           O  
ATOM  11761  CB  ASN H  81      32.278  70.589  -1.274  1.00 34.01           C  
ATOM  11762  CG  ASN H  81      32.154  71.879  -2.025  1.00 35.76           C  
ATOM  11763  OD1 ASN H  81      31.095  72.190  -2.563  1.00 37.78           O  
ATOM  11764  ND2 ASN H  81      33.223  72.659  -2.049  1.00 32.62           N  
ATOM  11765  N   LYS H  82      32.005  69.185   2.044  1.00 35.79           N  
ATOM  11766  CA  LYS H  82      31.896  67.906   2.739  1.00 41.23           C  
ATOM  11767  C   LYS H  82      32.433  66.713   1.968  1.00 41.91           C  
ATOM  11768  O   LYS H  82      31.763  65.696   1.872  1.00 41.85           O  
ATOM  11769  CB  LYS H  82      30.440  67.635   3.129  1.00 43.30           C  
ATOM  11770  CG  LYS H  82      29.925  68.574   4.220  1.00 50.95           C  
ATOM  11771  CD  LYS H  82      28.526  68.187   4.710  1.00 55.77           C  
ATOM  11772  CE  LYS H  82      27.456  68.494   3.675  1.00 59.31           C  
ATOM  11773  NZ  LYS H  82      26.078  68.093   4.139  1.00 65.59           N  
ATOM  11774  N   ARG H  83      33.639  66.848   1.420  1.00 42.30           N  
ATOM  11775  CA  ARG H  83      34.288  65.773   0.686  1.00 42.66           C  
ATOM  11776  C   ARG H  83      35.530  65.397   1.479  1.00 43.35           C  
ATOM  11777  O   ARG H  83      36.234  66.273   2.000  1.00 41.59           O  
ATOM  11778  CB  ARG H  83      34.732  66.233  -0.704  1.00 47.80           C  
ATOM  11779  CG  ARG H  83      33.654  66.848  -1.566  1.00 53.12           C  
ATOM  11780  CD  ARG H  83      32.568  65.865  -1.935  1.00 59.61           C  
ATOM  11781  NE  ARG H  83      31.435  66.580  -2.519  1.00 67.47           N  
ATOM  11782  CZ  ARG H  83      30.207  66.089  -2.614  1.00 69.36           C  
ATOM  11783  NH1 ARG H  83      29.945  64.869  -2.164  1.00 69.88           N  
ATOM  11784  NH2 ARG H  83      29.236  66.826  -3.140  1.00 71.72           N  
ATOM  11785  N   SER H  84      35.810  64.102   1.548  1.00 41.93           N  
ATOM  11786  CA  SER H  84      36.970  63.592   2.268  1.00 42.10           C  
ATOM  11787  C   SER H  84      38.215  63.651   1.400  1.00 39.57           C  
ATOM  11788  O   SER H  84      39.319  63.488   1.902  1.00 40.32           O  
ATOM  11789  CB  SER H  84      36.780  62.106   2.635  1.00 44.71           C  
ATOM  11790  OG  SER H  84      35.456  61.786   3.027  1.00 54.66           O  
ATOM  11791  N   THR H  85      38.033  63.869   0.103  1.00 38.31           N  
ATOM  11792  CA  THR H  85      39.146  63.826  -0.844  1.00 37.17           C  
ATOM  11793  C   THR H  85      39.580  65.099  -1.554  1.00 36.14           C  
ATOM  11794  O   THR H  85      38.763  65.862  -2.064  1.00 36.79           O  
ATOM  11795  CB  THR H  85      38.839  62.771  -1.952  1.00 39.75           C  
ATOM  11796  OG1 THR H  85      38.364  61.571  -1.333  1.00 36.32           O  
ATOM  11797  CG2 THR H  85      40.082  62.440  -2.777  1.00 38.77           C  
ATOM  11798  N   ILE H  86      40.886  65.332  -1.557  1.00 33.81           N  
ATOM  11799  CA  ILE H  86      41.442  66.459  -2.282  1.00 33.08           C  
ATOM  11800  C   ILE H  86      41.904  65.802  -3.597  1.00 36.18           C  
ATOM  11801  O   ILE H  86      42.799  64.940  -3.595  1.00 31.88           O  
ATOM  11802  CB  ILE H  86      42.649  67.062  -1.541  1.00 30.75           C  
ATOM  11803  CG1 ILE H  86      42.148  68.029  -0.447  1.00 33.44           C  
ATOM  11804  CG2 ILE H  86      43.543  67.797  -2.517  1.00 31.55           C  
ATOM  11805  CD1 ILE H  86      43.270  68.574   0.429  1.00 32.72           C  
ATOM  11806  N   THR H  87      41.260  66.184  -4.697  1.00 34.61           N  
ATOM  11807  CA  THR H  87      41.583  65.640  -6.012  1.00 36.91           C  
ATOM  11808  C   THR H  87      42.146  66.765  -6.841  1.00 36.77           C  
ATOM  11809  O   THR H  87      42.242  67.893  -6.380  1.00 34.53           O  
ATOM  11810  CB  THR H  87      40.341  65.161  -6.750  1.00 35.41           C  
ATOM  11811  OG1 THR H  87      39.532  66.298  -7.072  1.00 35.70           O  
ATOM  11812  CG2 THR H  87      39.523  64.166  -5.888  1.00 35.89           C  
ATOM  11813  N   SER H  88      42.480  66.465  -8.084  1.00 33.58           N  
ATOM  11814  CA  SER H  88      43.029  67.469  -8.974  1.00 32.45           C  
ATOM  11815  C   SER H  88      42.039  68.632  -9.146  1.00 32.32           C  
ATOM  11816  O   SER H  88      42.425  69.762  -9.426  1.00 31.79           O  
ATOM  11817  CB  SER H  88      43.308  66.832 -10.335  1.00 35.55           C  
ATOM  11818  OG  SER H  88      42.066  66.406 -10.877  1.00 43.61           O  
ATOM  11819  N   ARG H  89      40.758  68.351  -8.987  1.00 31.29           N  
ATOM  11820  CA  ARG H  89      39.756  69.388  -9.140  1.00 32.40           C  
ATOM  11821  C   ARG H  89      39.856  70.477  -8.038  1.00 31.15           C  
ATOM  11822  O   ARG H  89      39.706  71.653  -8.332  1.00 29.87           O  
ATOM  11823  CB  ARG H  89      38.366  68.754  -9.144  1.00 35.77           C  
ATOM  11824  CG  ARG H  89      37.271  69.729  -9.523  1.00 43.36           C  
ATOM  11825  CD  ARG H  89      36.054  69.028 -10.121  1.00 44.19           C  
ATOM  11826  NE  ARG H  89      35.083  70.032 -10.547  1.00 49.09           N  
ATOM  11827  CZ  ARG H  89      34.176  70.565  -9.745  1.00 45.33           C  
ATOM  11828  NH1 ARG H  89      34.117  70.176  -8.484  1.00 45.56           N  
ATOM  11829  NH2 ARG H  89      33.346  71.488 -10.204  1.00 48.76           N  
ATOM  11830  N   GLU H  90      40.094  70.081  -6.785  1.00 30.10           N  
ATOM  11831  CA  GLU H  90      40.247  71.061  -5.704  1.00 28.30           C  
ATOM  11832  C   GLU H  90      41.552  71.832  -5.928  1.00 28.09           C  
ATOM  11833  O   GLU H  90      41.637  73.037  -5.639  1.00 27.47           O  
ATOM  11834  CB  GLU H  90      40.259  70.368  -4.324  1.00 26.42           C  
ATOM  11835  CG  GLU H  90      38.896  69.887  -3.852  1.00 29.54           C  
ATOM  11836  CD  GLU H  90      38.312  68.787  -4.747  1.00 35.42           C  
ATOM  11837  OE1 GLU H  90      39.028  67.811  -5.053  1.00 33.56           O  
ATOM  11838  OE2 GLU H  90      37.135  68.892  -5.134  1.00 37.25           O  
ATOM  11839  N   ILE H  91      42.580  71.147  -6.431  1.00 28.80           N  
ATOM  11840  CA  ILE H  91      43.863  71.822  -6.707  1.00 27.86           C  
ATOM  11841  C   ILE H  91      43.632  72.886  -7.767  1.00 28.88           C  
ATOM  11842  O   ILE H  91      44.117  74.017  -7.630  1.00 29.01           O  
ATOM  11843  CB  ILE H  91      44.980  70.833  -7.194  1.00 29.04           C  
ATOM  11844  CG1 ILE H  91      45.297  69.813  -6.079  1.00 30.88           C  
ATOM  11845  CG2 ILE H  91      46.239  71.588  -7.559  1.00 25.96           C  
ATOM  11846  CD1 ILE H  91      45.823  70.423  -4.733  1.00 24.85           C  
ATOM  11847  N   GLN H  92      42.861  72.545  -8.799  1.00 27.56           N  
ATOM  11848  CA  GLN H  92      42.538  73.487  -9.886  1.00 29.00           C  
ATOM  11849  C   GLN H  92      41.765  74.737  -9.388  1.00 27.57           C  
ATOM  11850  O   GLN H  92      42.134  75.856  -9.671  1.00 27.04           O  
ATOM  11851  CB  GLN H  92      41.691  72.783 -10.960  1.00 29.63           C  
ATOM  11852  CG  GLN H  92      41.292  73.700 -12.088  1.00 31.71           C  
ATOM  11853  CD  GLN H  92      41.039  72.951 -13.398  1.00 39.71           C  
ATOM  11854  OE1 GLN H  92      39.897  72.682 -13.757  1.00 40.45           O  
ATOM  11855  NE2 GLN H  92      42.107  72.612 -14.100  1.00 29.02           N  
ATOM  11856  N   THR H  93      40.670  74.522  -8.673  1.00 27.24           N  
ATOM  11857  CA  THR H  93      39.900  75.639  -8.133  1.00 27.18           C  
ATOM  11858  C   THR H  93      40.797  76.471  -7.184  1.00 26.97           C  
ATOM  11859  O   THR H  93      40.778  77.697  -7.251  1.00 29.20           O  
ATOM  11860  CB  THR H  93      38.668  75.085  -7.418  1.00 29.77           C  
ATOM  11861  OG1 THR H  93      37.880  74.383  -8.388  1.00 31.34           O  
ATOM  11862  CG2 THR H  93      37.816  76.190  -6.807  1.00 31.05           C  
ATOM  11863  N   ALA H  94      41.613  75.810  -6.350  1.00 24.55           N  
ATOM  11864  CA  ALA H  94      42.508  76.524  -5.436  1.00 24.58           C  
ATOM  11865  C   ALA H  94      43.401  77.435  -6.227  1.00 28.78           C  
ATOM  11866  O   ALA H  94      43.612  78.601  -5.827  1.00 28.16           O  
ATOM  11867  CB  ALA H  94      43.359  75.567  -4.623  1.00 24.26           C  
ATOM  11868