PDB Full entry for 1KX4
HEADER    STRUCTURAL PROTEIN/DNA                  31-JAN-02   1KX4              
TITLE     X-RAY STRUCTURE OF THE NUCLEOSOME CORE PARTICLE, NCP146B,             
TITLE    2 AT 2.6 A RESOLUTION                                                  
COMPND    MOL_ID: 1;                                                            
COMPND   2 MOLECULE: DNA                                                        
COMPND   3 (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAA          
COMPND   4 AGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACT          
COMPND   5 TTTTCTACGATCCGCAAGGGATATTTGGAGAT)3');                                
COMPND   6 CHAIN: I, J;                                                         
COMPND   7 ENGINEERED: YES;                                                     
COMPND   8 OTHER_DETAILS: PALINDROMIC 146 BASE PAIR DNA DUPLEX;                 
COMPND   9 MOL_ID: 2;                                                           
COMPND  10 MOLECULE: HISTONE H3;                                                
COMPND  11 CHAIN: A, E;                                                         
COMPND  12 ENGINEERED: YES;                                                     
COMPND  13 MOL_ID: 3;                                                           
COMPND  14 MOLECULE: HISTONE H4;                                                
COMPND  15 CHAIN: B, F;                                                         
COMPND  16 ENGINEERED: YES;                                                     
COMPND  17 MOL_ID: 4;                                                           
COMPND  18 MOLECULE: HISTONE H2A.1;                                             
COMPND  19 CHAIN: C, G;                                                         
COMPND  20 ENGINEERED: YES;                                                     
COMPND  21 MOL_ID: 5;                                                           
COMPND  22 MOLECULE: HISTONE H2B.2;                                             
COMPND  23 CHAIN: D, H;                                                         
COMPND  24 ENGINEERED: YES                                                      
SOURCE    MOL_ID: 1;                                                            
SOURCE   2 ORGANISM_SCIENTIFIC: HOMO SAPIENS;                                   
SOURCE   3 ORGANISM_COMMON: HUMAN;                                              
SOURCE   4 ORGANISM_TAXID: 9606;                                                
SOURCE   5 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE   6 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE   7 OTHER_DETAILS: DNA SEQUENCE SYNTHESIZED, CLONED,                     
SOURCE   8 MULTIMERIZED, AND EXCISED FROM PLASMID;                              
SOURCE   9 MOL_ID: 2;                                                           
SOURCE  10 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  11 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  12 ORGANISM_TAXID: 8355;                                                
SOURCE  13 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  14 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE  15 MOL_ID: 3;                                                           
SOURCE  16 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  17 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  18 ORGANISM_TAXID: 8355;                                                
SOURCE  19 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  20 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE  21 MOL_ID: 4;                                                           
SOURCE  22 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  23 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  24 ORGANISM_TAXID: 8355;                                                
SOURCE  25 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  26 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE  27 MOL_ID: 5;                                                           
SOURCE  28 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  29 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  30 ORGANISM_TAXID: 8355;                                                
SOURCE  31 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  32 EXPRESSION_SYSTEM_TAXID: 562                                         
KEYWDS    NUCLEOSOME, CHROMATIN, HISTONE, PROTEIN-DNA INTERACTION,              
KEYWDS   2 NUCLEOPROTEIN, SUPERCOILED DNA, NUCLEOSOME CORE, PROTEIN-            
KEYWDS   3 DNA COMPLEX, STRUCTURAL PROTEIN/DNA COMPLEX                          
EXPDTA    X-RAY DIFFRACTION                                                     
AUTHOR    C.A.DAVEY,D.F.SARGENT,K.LUGER,A.W.MAEDER,T.J.RICHMOND                 
REVDAT   2   24-FEB-09 1KX4    1       VERSN                                    
REVDAT   1   25-DEC-02 1KX4    0                                                
JRNL        AUTH   C.A.DAVEY,D.F.SARGENT,K.LUGER,A.W.MAEDER,                    
JRNL        AUTH 2 T.J.RICHMOND                                                 
JRNL        TITL   SOLVENT MEDIATED INTERACTIONS IN THE STRUCTURE OF            
JRNL        TITL 2 THE NUCLEOSOME CORE PARTICLE AT 1.9 A RESOLUTION             
JRNL        REF    J.MOL.BIOL.                   V. 319  1097 2002              
JRNL        REFN                   ISSN 0022-2836                               
JRNL        PMID   12079350                                                     
JRNL        DOI    10.1016/S0022-2836(02)00386-8                                
REMARK   1                                                                      
REMARK   1 REFERENCE 1                                                          
REMARK   1  AUTH   K.LUGER,A.W.MAEDER,R.K.RICHMOND,D.F.SARGENT,                 
REMARK   1  AUTH 2 T.J.RICHMOND                                                 
REMARK   1  TITL   CRYSTAL STRUCTURE OF THE NUCLEOSOME CORE PARTICLE            
REMARK   1  TITL 2 AT 2.8 A RESOLUTION                                          
REMARK   1  REF    NATURE                        V. 389   251 1997              
REMARK   1  REFN                   ISSN 0028-0836                               
REMARK   1  DOI    10.1038/38444                                                
REMARK   2                                                                      
REMARK   2 RESOLUTION.    2.60 ANGSTROMS.                                       
REMARK   3                                                                      
REMARK   3 REFINEMENT.                                                          
REMARK   3   PROGRAM     : CNS 0.5                                              
REMARK   3   AUTHORS     : BRUNGER,ADAMS,CLORE,DELANO,GROS,GROSSE-              
REMARK   3               : KUNSTLEVE,JIANG,KUSZEWSKI,NILGES, PANNU,             
REMARK   3               : READ,RICE,SIMONSON,WARREN                            
REMARK   3                                                                      
REMARK   3  REFINEMENT TARGET : ENGH & HUBER                                    
REMARK   3                                                                      
REMARK   3  DATA USED IN REFINEMENT.                                            
REMARK   3   RESOLUTION RANGE HIGH (ANGSTROMS) : 2.60                           
REMARK   3   RESOLUTION RANGE LOW  (ANGSTROMS) : 6.00                           
REMARK   3   DATA CUTOFF            (SIGMA(F)) : 0.000                          
REMARK   3   DATA CUTOFF HIGH         (ABS(F)) : 2275168.460                    
REMARK   3   DATA CUTOFF LOW          (ABS(F)) : 0.0000                         
REMARK   3   COMPLETENESS (WORKING+TEST)   (%) : 91.6                           
REMARK   3   NUMBER OF REFLECTIONS             : 52906                          
REMARK   3                                                                      
REMARK   3  FIT TO DATA USED IN REFINEMENT.                                     
REMARK   3   CROSS-VALIDATION METHOD          : THROUGHOUT                      
REMARK   3   FREE R VALUE TEST SET SELECTION  : RANDOM                          
REMARK   3   R VALUE            (WORKING SET) : 0.246                           
REMARK   3   FREE R VALUE                     : 0.300                           
REMARK   3   FREE R VALUE TEST SET SIZE   (%) : 2.000                           
REMARK   3   FREE R VALUE TEST SET COUNT      : 1043                            
REMARK   3   ESTIMATED ERROR OF FREE R VALUE  : 0.009                           
REMARK   3                                                                      
REMARK   3  FIT IN THE HIGHEST RESOLUTION BIN.                                  
REMARK   3   TOTAL NUMBER OF BINS USED           : 6                            
REMARK   3   BIN RESOLUTION RANGE HIGH       (A) : 2.60                         
REMARK   3   BIN RESOLUTION RANGE LOW        (A) : 2.75                         
REMARK   3   BIN COMPLETENESS (WORKING+TEST) (%) : 79.90                        
REMARK   3   REFLECTIONS IN BIN    (WORKING SET) : 7486                         
REMARK   3   BIN R VALUE           (WORKING SET) : 0.3260                       
REMARK   3   BIN FREE R VALUE                    : 0.3740                       
REMARK   3   BIN FREE R VALUE TEST SET SIZE  (%) : 1.80                         
REMARK   3   BIN FREE R VALUE TEST SET COUNT     : 134                          
REMARK   3   ESTIMATED ERROR OF BIN FREE R VALUE : 0.032                        
REMARK   3                                                                      
REMARK   3  NUMBER OF NON-HYDROGEN ATOMS USED IN REFINEMENT.                    
REMARK   3   PROTEIN ATOMS            : 6015                                    
REMARK   3   NUCLEIC ACID ATOMS       : 5980                                    
REMARK   3   HETEROGEN ATOMS          : 10                                      
REMARK   3   SOLVENT ATOMS            : 433                                     
REMARK   3                                                                      
REMARK   3  B VALUES.                                                           
REMARK   3   FROM WILSON PLOT           (A**2) : 54.80                          
REMARK   3   MEAN B VALUE      (OVERALL, A**2) : 51.60                          
REMARK   3   OVERALL ANISOTROPIC B VALUE.                                       
REMARK   3    B11 (A**2) : 5.75000                                              
REMARK   3    B22 (A**2) : 6.40000                                              
REMARK   3    B33 (A**2) : -12.15000                                            
REMARK   3    B12 (A**2) : 0.00000                                              
REMARK   3    B13 (A**2) : 0.00000                                              
REMARK   3    B23 (A**2) : 0.00000                                              
REMARK   3                                                                      
REMARK   3  ESTIMATED COORDINATE ERROR.                                         
REMARK   3   ESD FROM LUZZATI PLOT        (A) : 0.35                            
REMARK   3   ESD FROM SIGMAA              (A) : 0.12                            
REMARK   3   LOW RESOLUTION CUTOFF        (A) : 6.00                            
REMARK   3                                                                      
REMARK   3  CROSS-VALIDATED ESTIMATED COORDINATE ERROR.                         
REMARK   3   ESD FROM C-V LUZZATI PLOT    (A) : 0.44                            
REMARK   3   ESD FROM C-V SIGMAA          (A) : 0.20                            
REMARK   3                                                                      
REMARK   3  RMS DEVIATIONS FROM IDEAL VALUES.                                   
REMARK   3   BOND LENGTHS                 (A) : 0.006                           
REMARK   3   BOND ANGLES            (DEGREES) : 1.00                            
REMARK   3   DIHEDRAL ANGLES        (DEGREES) : 18.50                           
REMARK   3   IMPROPER ANGLES        (DEGREES) : 1.00                            
REMARK   3                                                                      
REMARK   3  ISOTROPIC THERMAL MODEL : RESTRAINED                                
REMARK   3                                                                      
REMARK   3  ISOTROPIC THERMAL FACTOR RESTRAINTS.    RMS    SIGMA                
REMARK   3   MAIN-CHAIN BOND              (A**2) : 1.590 ; 1.500                
REMARK   3   MAIN-CHAIN ANGLE             (A**2) : 2.580 ; 2.000                
REMARK   3   SIDE-CHAIN BOND              (A**2) : 2.070 ; 2.000                
REMARK   3   SIDE-CHAIN ANGLE             (A**2) : 3.030 ; 2.500                
REMARK   3                                                                      
REMARK   3  BULK SOLVENT MODELING.                                              
REMARK   3   METHOD USED : NULL                                                 
REMARK   3   KSOL        : NULL                                                 
REMARK   3   BSOL        : NULL                                                 
REMARK   3                                                                      
REMARK   3  NCS MODEL : NULL                                                    
REMARK   3                                                                      
REMARK   3  NCS RESTRAINTS.                         RMS   SIGMA/WEIGHT          
REMARK   3   GROUP  1  POSITIONAL            (A) : NULL  ; NULL                 
REMARK   3   GROUP  1  B-FACTOR           (A**2) : NULL  ; NULL                 
REMARK   3                                                                      
REMARK   3  PARAMETER FILE  1  : PROTEIN_REP.PARAM                              
REMARK   3  PARAMETER FILE  2  : DNA-RNA_REP.PARAM                              
REMARK   3  PARAMETER FILE  3  : WATER_REP.PARAM                                
REMARK   3  PARAMETER FILE  4  : ION.PARAM                                      
REMARK   3  PARAMETER FILE  5  : NULL                                           
REMARK   3  TOPOLOGY FILE  1   : PROTEIN.TOP                                    
REMARK   3  TOPOLOGY FILE  2   : DNA-RNA.TOP                                    
REMARK   3  TOPOLOGY FILE  3   : WATER.TOP                                      
REMARK   3  TOPOLOGY FILE  4   : ION.TOP                                        
REMARK   3  TOPOLOGY FILE  5   : NULL                                           
REMARK   3                                                                      
REMARK   3  OTHER REFINEMENT REMARKS: NULL                                      
REMARK   4                                                                      
REMARK   4 1KX4 COMPLIES WITH FORMAT V. 3.15, 01-DEC-08                         
REMARK 100                                                                      
REMARK 100 THIS ENTRY HAS BEEN PROCESSED BY RCSB ON 08-FEB-02.                  
REMARK 100 THE RCSB ID CODE IS RCSB015430.                                      
REMARK 200                                                                      
REMARK 200 EXPERIMENTAL DETAILS                                                 
REMARK 200  EXPERIMENT TYPE                : X-RAY DIFFRACTION                  
REMARK 200  DATE OF DATA COLLECTION        : 02-JUN-96                          
REMARK 200  TEMPERATURE           (KELVIN) : 103                                
REMARK 200  PH                             : 6.0                                
REMARK 200  NUMBER OF CRYSTALS USED        : 5                                  
REMARK 200                                                                      
REMARK 200  SYNCHROTRON              (Y/N) : Y                                  
REMARK 200  RADIATION SOURCE               : ESRF                               
REMARK 200  BEAMLINE                       : ID09                               
REMARK 200  X-RAY GENERATOR MODEL          : NULL                               
REMARK 200  MONOCHROMATIC OR LAUE    (M/L) : M                                  
REMARK 200  WAVELENGTH OR RANGE        (A) : 0.85                               
REMARK 200  MONOCHROMATOR                  : SI 111 CHANNEL                     
REMARK 200  OPTICS                         : NULL                               
REMARK 200                                                                      
REMARK 200  DETECTOR TYPE                  : IMAGE PLATE                        
REMARK 200  DETECTOR MANUFACTURER          : MARRESEARCH                        
REMARK 200  INTENSITY-INTEGRATION SOFTWARE : DENZO                              
REMARK 200  DATA SCALING SOFTWARE          : SCALEPACK                          
REMARK 200                                                                      
REMARK 200  NUMBER OF UNIQUE REFLECTIONS   : 60481                              
REMARK 200  RESOLUTION RANGE HIGH      (A) : 2.600                              
REMARK 200  RESOLUTION RANGE LOW       (A) : 30.000                             
REMARK 200  REJECTION CRITERIA  (SIGMA(I)) : 1.000                              
REMARK 200                                                                      
REMARK 200 OVERALL.                                                             
REMARK 200  COMPLETENESS FOR RANGE     (%) : 89.5                               
REMARK 200  DATA REDUNDANCY                : 3.700                              
REMARK 200  R MERGE                    (I) : 0.07200                            
REMARK 200  R SYM                      (I) : NULL                               
REMARK 200  <I/SIGMA(I)> FOR THE DATA SET  : NULL                               
REMARK 200                                                                      
REMARK 200 IN THE HIGHEST RESOLUTION SHELL.                                     
REMARK 200  HIGHEST RESOLUTION SHELL, RANGE HIGH (A) : 2.60                     
REMARK 200  HIGHEST RESOLUTION SHELL, RANGE LOW  (A) : 2.69                     
REMARK 200  COMPLETENESS FOR SHELL     (%) : 45.7                               
REMARK 200  DATA REDUNDANCY IN SHELL       : NULL                               
REMARK 200  R MERGE FOR SHELL          (I) : 0.15700                            
REMARK 200  R SYM FOR SHELL            (I) : NULL                               
REMARK 200  <I/SIGMA(I)> FOR SHELL         : NULL                               
REMARK 200                                                                      
REMARK 200 DIFFRACTION PROTOCOL: SINGLE WAVELENGTH                              
REMARK 200 METHOD USED TO DETERMINE THE STRUCTURE: MOLECULAR REPLACEMENT        
REMARK 200 SOFTWARE USED: CNS                                                   
REMARK 200 STARTING MODEL: PDB ENTRY 1AOI                                       
REMARK 200                                                                      
REMARK 200 REMARK: NULL                                                         
REMARK 280                                                                      
REMARK 280 CRYSTAL                                                              
REMARK 280 SOLVENT CONTENT, VS   (%): 50.93                                     
REMARK 280 MATTHEWS COEFFICIENT, VM (ANGSTROMS**3/DA): 2.51                     
REMARK 280                                                                      
REMARK 280 CRYSTALLIZATION CONDITIONS: MANGANESE CHLORIDE, POTASSIUM            
REMARK 280  CHLORIDE, POTASSIUM CACODYLATE, PH 6.0, VAPOR DIFFUSION,            
REMARK 280  SITTING DROP, TEMPERATURE 293K                                      
REMARK 290                                                                      
REMARK 290 CRYSTALLOGRAPHIC SYMMETRY                                            
REMARK 290 SYMMETRY OPERATORS FOR SPACE GROUP: P 21 21 21                       
REMARK 290                                                                      
REMARK 290      SYMOP   SYMMETRY                                                
REMARK 290     NNNMMM   OPERATOR                                                
REMARK 290       1555   X,Y,Z                                                   
REMARK 290       2555   -X+1/2,-Y,Z+1/2                                         
REMARK 290       3555   -X,Y+1/2,-Z+1/2                                         
REMARK 290       4555   X+1/2,-Y+1/2,-Z                                         
REMARK 290                                                                      
REMARK 290     WHERE NNN -> OPERATOR NUMBER                                     
REMARK 290           MMM -> TRANSLATION VECTOR                                  
REMARK 290                                                                      
REMARK 290 CRYSTALLOGRAPHIC SYMMETRY TRANSFORMATIONS                            
REMARK 290 THE FOLLOWING TRANSFORMATIONS OPERATE ON THE ATOM/HETATM             
REMARK 290 RECORDS IN THIS ENTRY TO PRODUCE CRYSTALLOGRAPHICALLY                
REMARK 290 RELATED MOLECULES.                                                   
REMARK 290   SMTRY1   1  1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY2   1  0.000000  1.000000  0.000000        0.00000            
REMARK 290   SMTRY3   1  0.000000  0.000000  1.000000        0.00000            
REMARK 290   SMTRY1   2 -1.000000  0.000000  0.000000       52.65000            
REMARK 290   SMTRY2   2  0.000000 -1.000000  0.000000        0.00000            
REMARK 290   SMTRY3   2  0.000000  0.000000  1.000000       54.76500            
REMARK 290   SMTRY1   3 -1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY2   3  0.000000  1.000000  0.000000       87.84500            
REMARK 290   SMTRY3   3  0.000000  0.000000 -1.000000       54.76500            
REMARK 290   SMTRY1   4  1.000000  0.000000  0.000000       52.65000            
REMARK 290   SMTRY2   4  0.000000 -1.000000  0.000000       87.84500            
REMARK 290   SMTRY3   4  0.000000  0.000000 -1.000000        0.00000            
REMARK 290                                                                      
REMARK 290 REMARK: NULL                                                         
REMARK 300                                                                      
REMARK 300 BIOMOLECULE: 1                                                       
REMARK 300 SEE REMARK 350 FOR THE AUTHOR PROVIDED AND/OR PROGRAM                
REMARK 300 GENERATED ASSEMBLY INFORMATION FOR THE STRUCTURE IN                  
REMARK 300 THIS ENTRY. THE REMARK MAY ALSO PROVIDE INFORMATION ON               
REMARK 300 BURIED SURFACE AREA.                                                 
REMARK 350                                                                      
REMARK 350 COORDINATES FOR A COMPLETE MULTIMER REPRESENTING THE KNOWN           
REMARK 350 BIOLOGICALLY SIGNIFICANT OLIGOMERIZATION STATE OF THE                
REMARK 350 MOLECULE CAN BE GENERATED BY APPLYING BIOMT TRANSFORMATIONS          
REMARK 350 GIVEN BELOW.  BOTH NON-CRYSTALLOGRAPHIC AND                          
REMARK 350 CRYSTALLOGRAPHIC OPERATIONS ARE GIVEN.                               
REMARK 350                                                                      
REMARK 350 BIOMOLECULE: 1                                                       
REMARK 350 AUTHOR DETERMINED BIOLOGICAL UNIT: DECAMERIC                         
REMARK 350 APPLY THE FOLLOWING TO CHAINS: I, J, A, B, C, D, E, F, G, H          
REMARK 350   BIOMT1   1  1.000000  0.000000  0.000000        0.00000            
REMARK 350   BIOMT2   1  0.000000  1.000000  0.000000        0.00000            
REMARK 350   BIOMT3   1  0.000000  0.000000  1.000000        0.00000            
REMARK 465                                                                      
REMARK 465 MISSING RESIDUES                                                     
REMARK 465 THE FOLLOWING RESIDUES WERE NOT LOCATED IN THE                       
REMARK 465 EXPERIMENT. (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN               
REMARK 465 IDENTIFIER; SSSEQ=SEQUENCE NUMBER; I=INSERTION CODE.)                
REMARK 465                                                                      
REMARK 465   M RES C SSSEQI                                                     
REMARK 465     ALA A     1                                                      
REMARK 465     ARG A     2                                                      
REMARK 465     THR A     3                                                      
REMARK 465     LYS A     4                                                      
REMARK 465     GLN A     5                                                      
REMARK 465     THR A     6                                                      
REMARK 465     ALA A     7                                                      
REMARK 465     ARG A     8                                                      
REMARK 465     LYS A     9                                                      
REMARK 465     SER A    10                                                      
REMARK 465     THR A    11                                                      
REMARK 465     GLY A    12                                                      
REMARK 465     GLY A    13                                                      
REMARK 465     LYS A    14                                                      
REMARK 465     ALA A    15                                                      
REMARK 465     PRO A    16                                                      
REMARK 465     ARG A    17                                                      
REMARK 465     LYS A    18                                                      
REMARK 465     GLN A    19                                                      
REMARK 465     LEU A    20                                                      
REMARK 465     ALA A    21                                                      
REMARK 465     THR A    22                                                      
REMARK 465     LYS A    23                                                      
REMARK 465     ALA A    24                                                      
REMARK 465     ALA A    25                                                      
REMARK 465     ARG A    26                                                      
REMARK 465     LYS A    27                                                      
REMARK 465     SER A    28                                                      
REMARK 465     ALA A    29                                                      
REMARK 465     PRO A    30                                                      
REMARK 465     ALA A    31                                                      
REMARK 465     THR A    32                                                      
REMARK 465     GLY A    33                                                      
REMARK 465     GLY A    34                                                      
REMARK 465     VAL A    35                                                      
REMARK 465     LYS A    36                                                      
REMARK 465     LYS A    37                                                      
REMARK 465     SER B     1                                                      
REMARK 465     GLY B     2                                                      
REMARK 465     ARG B     3                                                      
REMARK 465     GLY B     4                                                      
REMARK 465     LYS B     5                                                      
REMARK 465     GLY B     6                                                      
REMARK 465     GLY B     7                                                      
REMARK 465     LYS B     8                                                      
REMARK 465     GLY B     9                                                      
REMARK 465     LEU B    10                                                      
REMARK 465     GLY B    11                                                      
REMARK 465     LYS B    12                                                      
REMARK 465     GLY B    13                                                      
REMARK 465     GLY B    14                                                      
REMARK 465     ALA B    15                                                      
REMARK 465     LYS B    16                                                      
REMARK 465     ARG B    17                                                      
REMARK 465     HIS B    18                                                      
REMARK 465     ARG B    19                                                      
REMARK 465     SER C     1                                                      
REMARK 465     GLY C     2                                                      
REMARK 465     ARG C     3                                                      
REMARK 465     GLY C     4                                                      
REMARK 465     LYS C     5                                                      
REMARK 465     GLN C     6                                                      
REMARK 465     GLY C     7                                                      
REMARK 465     GLY C     8                                                      
REMARK 465     LYS C     9                                                      
REMARK 465     THR C    10                                                      
REMARK 465     ARG C    11                                                      
REMARK 465     ALA C    12                                                      
REMARK 465     LYS C    13                                                      
REMARK 465     ALA C    14                                                      
REMARK 465     LYS C    15                                                      
REMARK 465     LYS C   119                                                      
REMARK 465     THR C   120                                                      
REMARK 465     GLU C   121                                                      
REMARK 465     SER C   122                                                      
REMARK 465     SER C   123                                                      
REMARK 465     LYS C   124                                                      
REMARK 465     SER C   125                                                      
REMARK 465     LYS C   126                                                      
REMARK 465     SER C   127                                                      
REMARK 465     LYS C   128                                                      
REMARK 465     PRO D    -2                                                      
REMARK 465     GLU D    -1                                                      
REMARK 465     PRO D     0                                                      
REMARK 465     ALA D     1                                                      
REMARK 465     LYS D     2                                                      
REMARK 465     SER D     3                                                      
REMARK 465     ALA D     4                                                      
REMARK 465     PRO D     5                                                      
REMARK 465     ALA D     6                                                      
REMARK 465     PRO D     7                                                      
REMARK 465     LYS D     8                                                      
REMARK 465     LYS D     9                                                      
REMARK 465     GLY D    10                                                      
REMARK 465     SER D    11                                                      
REMARK 465     LYS D    12                                                      
REMARK 465     LYS D    13                                                      
REMARK 465     ALA D    14                                                      
REMARK 465     VAL D    15                                                      
REMARK 465     THR D    16                                                      
REMARK 465     LYS D    17                                                      
REMARK 465     THR D    18                                                      
REMARK 465     GLN D    19                                                      
REMARK 465     LYS D    20                                                      
REMARK 465     LYS D    21                                                      
REMARK 465     ASP D    22                                                      
REMARK 465     GLY D    23                                                      
REMARK 465     ALA E     1                                                      
REMARK 465     ARG E     2                                                      
REMARK 465     THR E     3                                                      
REMARK 465     LYS E     4                                                      
REMARK 465     GLN E     5                                                      
REMARK 465     THR E     6                                                      
REMARK 465     ALA E     7                                                      
REMARK 465     ARG E     8                                                      
REMARK 465     LYS E     9                                                      
REMARK 465     SER E    10                                                      
REMARK 465     THR E    11                                                      
REMARK 465     GLY E    12                                                      
REMARK 465     GLY E    13                                                      
REMARK 465     LYS E    14                                                      
REMARK 465     ALA E    15                                                      
REMARK 465     PRO E    16                                                      
REMARK 465     ARG E    17                                                      
REMARK 465     LYS E    18                                                      
REMARK 465     GLN E    19                                                      
REMARK 465     LEU E    20                                                      
REMARK 465     ALA E    21                                                      
REMARK 465     THR E    22                                                      
REMARK 465     LYS E    23                                                      
REMARK 465     ALA E    24                                                      
REMARK 465     ALA E    25                                                      
REMARK 465     ARG E    26                                                      
REMARK 465     LYS E    27                                                      
REMARK 465     SER E    28                                                      
REMARK 465     ALA E    29                                                      
REMARK 465     PRO E    30                                                      
REMARK 465     ALA E    31                                                      
REMARK 465     THR E    32                                                      
REMARK 465     GLY E    33                                                      
REMARK 465     GLY E    34                                                      
REMARK 465     VAL E    35                                                      
REMARK 465     LYS E    36                                                      
REMARK 465     LYS E    37                                                      
REMARK 465     PRO E    38                                                      
REMARK 465     SER F     1                                                      
REMARK 465     GLY F     2                                                      
REMARK 465     ARG F     3                                                      
REMARK 465     GLY F     4                                                      
REMARK 465     LYS F     5                                                      
REMARK 465     GLY F     6                                                      
REMARK 465     GLY F     7                                                      
REMARK 465     LYS F     8                                                      
REMARK 465     GLY F     9                                                      
REMARK 465     LEU F    10                                                      
REMARK 465     GLY F    11                                                      
REMARK 465     LYS F    12                                                      
REMARK 465     GLY F    13                                                      
REMARK 465     GLY F    14                                                      
REMARK 465     ALA F    15                                                      
REMARK 465     LYS F    16                                                      
REMARK 465     ARG F    17                                                      
REMARK 465     HIS F    18                                                      
REMARK 465     ARG F    19                                                      
REMARK 465     LYS F    20                                                      
REMARK 465     VAL F    21                                                      
REMARK 465     LEU F    22                                                      
REMARK 465     ARG F    23                                                      
REMARK 465     ASP F    24                                                      
REMARK 465     SER G     1                                                      
REMARK 465     GLY G     2                                                      
REMARK 465     ARG G     3                                                      
REMARK 465     GLY G     4                                                      
REMARK 465     LYS G     5                                                      
REMARK 465     GLN G     6                                                      
REMARK 465     GLY G     7                                                      
REMARK 465     GLY G     8                                                      
REMARK 465     LYS G     9                                                      
REMARK 465     THR G    10                                                      
REMARK 465     ARG G    11                                                      
REMARK 465     ALA G    12                                                      
REMARK 465     LYS G    13                                                      
REMARK 465     LYS G   119                                                      
REMARK 465     THR G   120                                                      
REMARK 465     GLU G   121                                                      
REMARK 465     SER G   122                                                      
REMARK 465     SER G   123                                                      
REMARK 465     LYS G   124                                                      
REMARK 465     SER G   125                                                      
REMARK 465     LYS G   126                                                      
REMARK 465     SER G   127                                                      
REMARK 465     LYS G   128                                                      
REMARK 465     PRO H    -2                                                      
REMARK 465     GLU H    -1                                                      
REMARK 465     PRO H     0                                                      
REMARK 465     ALA H     1                                                      
REMARK 465     LYS H     2                                                      
REMARK 465     SER H     3                                                      
REMARK 465     ALA H     4                                                      
REMARK 465     PRO H     5                                                      
REMARK 465     ALA H     6                                                      
REMARK 465     PRO H     7                                                      
REMARK 465     LYS H     8                                                      
REMARK 465     LYS H     9                                                      
REMARK 465     GLY H    10                                                      
REMARK 465     SER H    11                                                      
REMARK 465     LYS H    12                                                      
REMARK 465     LYS H    13                                                      
REMARK 465     ALA H    14                                                      
REMARK 465     VAL H    15                                                      
REMARK 465     THR H    16                                                      
REMARK 465     LYS H    17                                                      
REMARK 465     THR H    18                                                      
REMARK 465     GLN H    19                                                      
REMARK 465     LYS H    20                                                      
REMARK 465     LYS H    21                                                      
REMARK 465     ASP H    22                                                      
REMARK 465     GLY H    23                                                      
REMARK 465     LYS H    24                                                      
REMARK 465     LYS H    25                                                      
REMARK 465     ARG H    26                                                      
REMARK 465     ARG H    27                                                      
REMARK 465     LYS H    28                                                      
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: TORSION ANGLES                                             
REMARK 500                                                                      
REMARK 500 TORSION ANGLES OUTSIDE THE EXPECTED RAMACHANDRAN REGIONS:            
REMARK 500 (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN IDENTIFIER;               
REMARK 500 SSEQ=SEQUENCE NUMBER; I=INSERTION CODE).                             
REMARK 500                                                                      
REMARK 500 STANDARD TABLE:                                                      
REMARK 500 FORMAT:(10X,I3,1X,A3,1X,A1,I4,A1,4X,F7.2,3X,F7.2)                    
REMARK 500                                                                      
REMARK 500 EXPECTED VALUES: GJ KLEYWEGT AND TA JONES (1996). PHI/PSI-           
REMARK 500 CHOLOGY: RAMACHANDRAN REVISITED. STRUCTURE 4, 1395 - 1400            
REMARK 500                                                                      
REMARK 500  M RES CSSEQI        PSI       PHI                                   
REMARK 500    ARG B  95       56.78   -140.98                                   
REMARK 500    PRO C  26       98.43    -60.46                                   
REMARK 500    LYS C  74       74.77     56.15                                   
REMARK 500    ASN C 110      114.32   -160.87                                   
REMARK 500    SER C 113      -60.09    -29.90                                   
REMARK 500    LYS D  25      -80.11     71.57                                   
REMARK 500    LYS D  28       80.38    -64.16                                   
REMARK 500    THR D  29     -139.40     32.49                                   
REMARK 500    ARG D  30      102.39    173.01                                   
REMARK 500    GLU D  32      116.81   -172.35                                   
REMARK 500    ALA D 121      104.61    -43.01                                   
REMARK 500    LYS E  79      117.04   -161.76                                   
REMARK 500    ASP E  81       79.38     57.49                                   
REMARK 500    THR F  96      127.44    -39.85                                   
REMARK 500    LYS G  15      -70.10    -80.79                                   
REMARK 500    ASN G 110      116.65   -161.18                                   
REMARK 500    GLU H 102      -52.06    114.65                                   
REMARK 500    ALA H 121     -163.60   -126.30                                   
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: PLANAR GROUPS                                              
REMARK 500                                                                      
REMARK 500 PLANAR GROUPS IN THE FOLLOWING RESIDUES HAVE A TOTAL                 
REMARK 500 RMS DISTANCE OF ALL ATOMS FROM THE BEST-FIT PLANE                    
REMARK 500 BY MORE THAN AN EXPECTED VALUE OF 6*RMSD, WITH AN                    
REMARK 500 RMSD 0.02 ANGSTROMS, OR AT LEAST ONE ATOM HAS                        
REMARK 500 AN RMSD GREATER THAN THIS VALUE                                      
REMARK 500 (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN IDENTIFIER;               
REMARK 500 SSEQ=SEQUENCE NUMBER; I=INSERTION CODE).                             
REMARK 500                                                                      
REMARK 500  M RES CSSEQI        RMS     TYPE                                    
REMARK 500    TYR A  54         0.07    SIDE_CHAIN                              
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 620                                                                      
REMARK 620 METAL COORDINATION                                                   
REMARK 620  (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN IDENTIFIER;              
REMARK 620  SSEQ=SEQUENCE NUMBER; I=INSERTION CODE):                            
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN A 434  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 ASP A  77   OD1                                                    
REMARK 620 2 HOH A 460   O    97.2                                              
REMARK 620 3 HOH A 457   O    80.2 174.8                                        
REMARK 620 4 VAL H  45   O    90.1  95.0  80.5                                  
REMARK 620 N                    1     2     3                                   
REMARK 800                                                                      
REMARK 800 SITE                                                                 
REMARK 800 SITE_IDENTIFIER: AC1                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN A 434                  
REMARK 800 SITE_IDENTIFIER: AC2                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN J 435                  
REMARK 800 SITE_IDENTIFIER: AC3                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 436                  
REMARK 800 SITE_IDENTIFIER: AC4                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 437                  
REMARK 800 SITE_IDENTIFIER: AC5                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 438                  
REMARK 800 SITE_IDENTIFIER: AC6                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 439                  
REMARK 800 SITE_IDENTIFIER: AC7                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE CL G 440                  
REMARK 800 SITE_IDENTIFIER: AC8                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE CL C 441                  
REMARK 800 SITE_IDENTIFIER: AC9                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE CL A 442                  
REMARK 800 SITE_IDENTIFIER: BC1                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE CL E 443                  
REMARK 900                                                                      
REMARK 900 RELATED ENTRIES                                                      
REMARK 900 RELATED ID: 1AOI   RELATED DB: PDB                                   
REMARK 900 NCP146 AT 2.8 A                                                      
REMARK 900 RELATED ID: 1KX3   RELATED DB: PDB                                   
REMARK 900 NCP146 AT 2.0 A                                                      
REMARK 900 RELATED ID: 1KX5   RELATED DB: PDB                                   
REMARK 900 NCP147 AT 1.9 A                                                      
DBREF  1KX4 A    1   135  UNP    P16105   H32_BOVIN        1    135             
DBREF  1KX4 E    1   135  UNP    P16105   H32_BOVIN        1    135             
DBREF  1KX4 B    1   102  UNP    P02304   H4_HUMANX        1    102             
DBREF  1KX4 F    1   102  UNP    P02304   H4_HUMANX        1    102             
DBREF  1KX4 C    1   128  UNP    P06897   H2A1_XENLA       1    129             
DBREF  1KX4 G    1   128  UNP    P06897   H2A1_XENLA       1    129             
DBREF  1KX4 D   -2   122  UNP    P02281   H2B1_XENLA       1    125             
DBREF  1KX4 H   -2   122  UNP    P02281   H2B1_XENLA       1    125             
DBREF  1KX4 I  -72    73  PDB    1KX4     1KX4           -72     73             
DBREF  1KX4 J  -73    72  PDB    1KX4     1KX4           -73     72             
SEQADV 1KX4 ALA A  102  UNP  P16105    GLY   102 CONFLICT                       
SEQADV 1KX4 ALA E  102  UNP  P16105    GLY   102 CONFLICT                       
SEQADV 1KX4 ARG C   99  UNP  P06897    GLY    99 VARIANT                        
SEQADV 1KX4 SER C  123  UNP  P06897    ALA   123 CONFLICT                       
SEQADV 1KX4     C       UNP  P06897    ALA   126 DELETION                       
SEQADV 1KX4 ARG G   99  UNP  P06897    GLY    99 VARIANT                        
SEQADV 1KX4 SER G  123  UNP  P06897    ALA   123 CONFLICT                       
SEQADV 1KX4     G       UNP  P06897    ALA   126 DELETION                       
SEQADV 1KX4 THR D   29  UNP  P02281    SER    32 VARIANT                        
SEQADV 1KX4 THR H   29  UNP  P02281    SER    32 VARIANT                        
SEQRES   1 I  146   DA  DT  DC  DT  DC  DC  DA  DA  DA  DT  DA  DT  DC          
SEQRES   2 I  146   DC  DC  DT  DT  DG  DC  DG  DG  DA  DT  DC  DG  DT          
SEQRES   3 I  146   DA  DG  DA  DA  DA  DA  DA  DG  DT  DG  DT  DG  DT          
SEQRES   4 I  146   DC  DA  DA  DA  DC  DT  DG  DC  DG  DC  DT  DA  DT          
SEQRES   5 I  146   DC  DA  DA  DA  DG  DG  DG  DA  DA  DA  DC  DT  DT          
SEQRES   6 I  146   DC  DA  DA  DC  DT  DG  DA  DA  DT  DT  DC  DA  DG          
SEQRES   7 I  146   DT  DT  DG  DA  DA  DG  DT  DT  DT  DC  DC  DC  DT          
SEQRES   8 I  146   DT  DT  DG  DA  DT  DA  DG  DC  DG  DC  DA  DG  DT          
SEQRES   9 I  146   DT  DT  DG  DA  DC  DA  DC  DA  DC  DT  DT  DT  DT          
SEQRES  10 I  146   DT  DC  DT  DA  DC  DG  DA  DT  DC  DC  DG  DC  DA          
SEQRES  11 I  146   DA  DG  DG  DG  DA  DT  DA  DT  DT  DT  DG  DG  DA          
SEQRES  12 I  146   DG  DA  DT                                                  
SEQRES   1 J  146   DA  DT  DC  DT  DC  DC  DA  DA  DA  DT  DA  DT  DC          
SEQRES   2 J  146   DC  DC  DT  DT  DG  DC  DG  DG  DA  DT  DC  DG  DT          
SEQRES   3 J  146   DA  DG  DA  DA  DA  DA  DA  DG  DT  DG  DT  DG  DT          
SEQRES   4 J  146   DC  DA  DA  DA  DC  DT  DG  DC  DG  DC  DT  DA  DT          
SEQRES   5 J  146   DC  DA  DA  DA  DG  DG  DG  DA  DA  DA  DC  DT  DT          
SEQRES   6 J  146   DC  DA  DA  DC  DT  DG  DA  DA  DT  DT  DC  DA  DG          
SEQRES   7 J  146   DT  DT  DG  DA  DA  DG  DT  DT  DT  DC  DC  DC  DT          
SEQRES   8 J  146   DT  DT  DG  DA  DT  DA  DG  DC  DG  DC  DA  DG  DT          
SEQRES   9 J  146   DT  DT  DG  DA  DC  DA  DC  DA  DC  DT  DT  DT  DT          
SEQRES  10 J  146   DT  DC  DT  DA  DC  DG  DA  DT  DC  DC  DG  DC  DA          
SEQRES  11 J  146   DA  DG  DG  DG  DA  DT  DA  DT  DT  DT  DG  DG  DA          
SEQRES  12 J  146   DG  DA  DT                                                  
SEQRES   1 A  135  ALA ARG THR LYS GLN THR ALA ARG LYS SER THR GLY GLY          
SEQRES   2 A  135  LYS ALA PRO ARG LYS GLN LEU ALA THR LYS ALA ALA ARG          
SEQRES   3 A  135  LYS SER ALA PRO ALA THR GLY GLY VAL LYS LYS PRO HIS          
SEQRES   4 A  135  ARG TYR ARG PRO GLY THR VAL ALA LEU ARG GLU ILE ARG          
SEQRES   5 A  135  ARG TYR GLN LYS SER THR GLU LEU LEU ILE ARG LYS LEU          
SEQRES   6 A  135  PRO PHE GLN ARG LEU VAL ARG GLU ILE ALA GLN ASP PHE          
SEQRES   7 A  135  LYS THR ASP LEU ARG PHE GLN SER SER ALA VAL MET ALA          
SEQRES   8 A  135  LEU GLN GLU ALA SER GLU ALA TYR LEU VAL ALA LEU PHE          
SEQRES   9 A  135  GLU ASP THR ASN LEU CYS ALA ILE HIS ALA LYS ARG VAL          
SEQRES  10 A  135  THR ILE MET PRO LYS ASP ILE GLN LEU ALA ARG ARG ILE          
SEQRES  11 A  135  ARG GLY GLU ARG ALA                                          
SEQRES   1 B  102  SER GLY ARG GLY LYS GLY GLY LYS GLY LEU GLY LYS GLY          
SEQRES   2 B  102  GLY ALA LYS ARG HIS ARG LYS VAL LEU ARG ASP ASN ILE          
SEQRES   3 B  102  GLN GLY ILE THR LYS PRO ALA ILE ARG ARG LEU ALA ARG          
SEQRES   4 B  102  ARG GLY GLY VAL LYS ARG ILE SER GLY LEU ILE TYR GLU          
SEQRES   5 B  102  GLU THR ARG GLY VAL LEU LYS VAL PHE LEU GLU ASN VAL          
SEQRES   6 B  102  ILE ARG ASP ALA VAL THR TYR THR GLU HIS ALA LYS ARG          
SEQRES   7 B  102  LYS THR VAL THR ALA MET ASP VAL VAL TYR ALA LEU LYS          
SEQRES   8 B  102  ARG GLN GLY ARG THR LEU TYR GLY PHE GLY GLY                  
SEQRES   1 C  128  SER GLY ARG GLY LYS GLN GLY GLY LYS THR ARG ALA LYS          
SEQRES   2 C  128  ALA LYS THR ARG SER SER ARG ALA GLY LEU GLN PHE PRO          
SEQRES   3 C  128  VAL GLY ARG VAL HIS ARG LEU LEU ARG LYS GLY ASN TYR          
SEQRES   4 C  128  ALA GLU ARG VAL GLY ALA GLY ALA PRO VAL TYR LEU ALA          
SEQRES   5 C  128  ALA VAL LEU GLU TYR LEU THR ALA GLU ILE LEU GLU LEU          
SEQRES   6 C  128  ALA GLY ASN ALA ALA ARG ASP ASN LYS LYS THR ARG ILE          
SEQRES   7 C  128  ILE PRO ARG HIS LEU GLN LEU ALA VAL ARG ASN ASP GLU          
SEQRES   8 C  128  GLU LEU ASN LYS LEU LEU GLY ARG VAL THR ILE ALA GLN          
SEQRES   9 C  128  GLY GLY VAL LEU PRO ASN ILE GLN SER VAL LEU LEU PRO          
SEQRES  10 C  128  LYS LYS THR GLU SER SER LYS SER LYS SER LYS                  
SEQRES   1 D  125  PRO GLU PRO ALA LYS SER ALA PRO ALA PRO LYS LYS GLY          
SEQRES   2 D  125  SER LYS LYS ALA VAL THR LYS THR GLN LYS LYS ASP GLY          
SEQRES   3 D  125  LYS LYS ARG ARG LYS THR ARG LYS GLU SER TYR ALA ILE          
SEQRES   4 D  125  TYR VAL TYR LYS VAL LEU LYS GLN VAL HIS PRO ASP THR          
SEQRES   5 D  125  GLY ILE SER SER LYS ALA MET SER ILE MET ASN SER PHE          
SEQRES   6 D  125  VAL ASN ASP VAL PHE GLU ARG ILE ALA GLY GLU ALA SER          
SEQRES   7 D  125  ARG LEU ALA HIS TYR ASN LYS ARG SER THR ILE THR SER          
SEQRES   8 D  125  ARG GLU ILE GLN THR ALA VAL ARG LEU LEU LEU PRO GLY          
SEQRES   9 D  125  GLU LEU ALA LYS HIS ALA VAL SER GLU GLY THR LYS ALA          
SEQRES  10 D  125  VAL THR LYS TYR THR SER ALA LYS                              
SEQRES   1 E  135  ALA ARG THR LYS GLN THR ALA ARG LYS SER THR GLY GLY          
SEQRES   2 E  135  LYS ALA PRO ARG LYS GLN LEU ALA THR LYS ALA ALA ARG          
SEQRES   3 E  135  LYS SER ALA PRO ALA THR GLY GLY VAL LYS LYS PRO HIS          
SEQRES   4 E  135  ARG TYR ARG PRO GLY THR VAL ALA LEU ARG GLU ILE ARG          
SEQRES   5 E  135  ARG TYR GLN LYS SER THR GLU LEU LEU ILE ARG LYS LEU          
SEQRES   6 E  135  PRO PHE GLN ARG LEU VAL ARG GLU ILE ALA GLN ASP PHE          
SEQRES   7 E  135  LYS THR ASP LEU ARG PHE GLN SER SER ALA VAL MET ALA          
SEQRES   8 E  135  LEU GLN GLU ALA SER GLU ALA TYR LEU VAL ALA LEU PHE          
SEQRES   9 E  135  GLU ASP THR ASN LEU CYS ALA ILE HIS ALA LYS ARG VAL          
SEQRES  10 E  135  THR ILE MET PRO LYS ASP ILE GLN LEU ALA ARG ARG ILE          
SEQRES  11 E  135  ARG GLY GLU ARG ALA                                          
SEQRES   1 F  102  SER GLY ARG GLY LYS GLY GLY LYS GLY LEU GLY LYS GLY          
SEQRES   2 F  102  GLY ALA LYS ARG HIS ARG LYS VAL LEU ARG ASP ASN ILE          
SEQRES   3 F  102  GLN GLY ILE THR LYS PRO ALA ILE ARG ARG LEU ALA ARG          
SEQRES   4 F  102  ARG GLY GLY VAL LYS ARG ILE SER GLY LEU ILE TYR GLU          
SEQRES   5 F  102  GLU THR ARG GLY VAL LEU LYS VAL PHE LEU GLU ASN VAL          
SEQRES   6 F  102  ILE ARG ASP ALA VAL THR TYR THR GLU HIS ALA LYS ARG          
SEQRES   7 F  102  LYS THR VAL THR ALA MET ASP VAL VAL TYR ALA LEU LYS          
SEQRES   8 F  102  ARG GLN GLY ARG THR LEU TYR GLY PHE GLY GLY                  
SEQRES   1 G  128  SER GLY ARG GLY LYS GLN GLY GLY LYS THR ARG ALA LYS          
SEQRES   2 G  128  ALA LYS THR ARG SER SER ARG ALA GLY LEU GLN PHE PRO          
SEQRES   3 G  128  VAL GLY ARG VAL HIS ARG LEU LEU ARG LYS GLY ASN TYR          
SEQRES   4 G  128  ALA GLU ARG VAL GLY ALA GLY ALA PRO VAL TYR LEU ALA          
SEQRES   5 G  128  ALA VAL LEU GLU TYR LEU THR ALA GLU ILE LEU GLU LEU          
SEQRES   6 G  128  ALA GLY ASN ALA ALA ARG ASP ASN LYS LYS THR ARG ILE          
SEQRES   7 G  128  ILE PRO ARG HIS LEU GLN LEU ALA VAL ARG ASN ASP GLU          
SEQRES   8 G  128  GLU LEU ASN LYS LEU LEU GLY ARG VAL THR ILE ALA GLN          
SEQRES   9 G  128  GLY GLY VAL LEU PRO ASN ILE GLN SER VAL LEU LEU PRO          
SEQRES  10 G  128  LYS LYS THR GLU SER SER LYS SER LYS SER LYS                  
SEQRES   1 H  125  PRO GLU PRO ALA LYS SER ALA PRO ALA PRO LYS LYS GLY          
SEQRES   2 H  125  SER LYS LYS ALA VAL THR LYS THR GLN LYS LYS ASP GLY          
SEQRES   3 H  125  LYS LYS ARG ARG LYS THR ARG LYS GLU SER TYR ALA ILE          
SEQRES   4 H  125  TYR VAL TYR LYS VAL LEU LYS GLN VAL HIS PRO ASP THR          
SEQRES   5 H  125  GLY ILE SER SER LYS ALA MET SER ILE MET ASN SER PHE          
SEQRES   6 H  125  VAL ASN ASP VAL PHE GLU ARG ILE ALA GLY GLU ALA SER          
SEQRES   7 H  125  ARG LEU ALA HIS TYR ASN LYS ARG SER THR ILE THR SER          
SEQRES   8 H  125  ARG GLU ILE GLN THR ALA VAL ARG LEU LEU LEU PRO GLY          
SEQRES   9 H  125  GLU LEU ALA LYS HIS ALA VAL SER GLU GLY THR LYS ALA          
SEQRES  10 H  125  VAL THR LYS TYR THR SER ALA LYS                              
HET     MN  A 434       1                                                       
HET     MN  J 435       1                                                       
HET     MN  I 436       1                                                       
HET     MN  I 437       1                                                       
HET     MN  I 438       1                                                       
HET     MN  I 439       1                                                       
HET     CL  G 440       1                                                       
HET     CL  C 441       1                                                       
HET     CL  A 442       1                                                       
HET     CL  E 443       1                                                       
HETNAM      MN MANGANESE (II) ION                                               
HETNAM      CL CHLORIDE ION                                                     
FORMUL  11   MN    6(MN 2+)                                                     
FORMUL  17   CL    4(CL 1-)                                                     
FORMUL  21  HOH   *433(H2 O)                                                    
HELIX    1   1 GLY A   44  SER A   57  1                                  14    
HELIX    2   2 ARG A   63  ASP A   77  1                                  15    
HELIX    3   3 GLN A   85  ALA A  114  1                                  30    
HELIX    4   4 MET A  120  ARG A  131  1                                  12    
HELIX    5   5 ASP B   24  ILE B   29  5                                   6    
HELIX    6   6 THR B   30  GLY B   41  1                                  12    
HELIX    7   7 LEU B   49  ALA B   76  1                                  28    
HELIX    8   8 THR B   82  GLN B   93  1                                  12    
HELIX    9   9 THR C   16  ALA C   21  1                                   6    
HELIX   10  10 PRO C   26  GLY C   37  1                                  12    
HELIX   11  11 ALA C   45  ASN C   73  1                                  29    
HELIX   12  12 ILE C   79  ASN C   89  1                                  11    
HELIX   13  13 ASP C   90  LEU C   97  1                                   8    
HELIX   14  14 GLN C  112  LEU C  116  5                                   5    
HELIX   15  15 TYR D   34  HIS D   46  1                                  13    
HELIX   16  16 SER D   52  ASN D   81  1                                  30    
HELIX   17  17 THR D   87  LEU D   99  1                                  13    
HELIX   18  18 PRO D  100  ALA D  121  1                                  22    
HELIX   19  19 GLY E   44  GLN E   55  1                                  12    
HELIX   20  20 ARG E   63  ASP E   77  1                                  15    
HELIX   21  21 GLN E   85  ALA E  114  1                                  30    
HELIX   22  22 MET E  120  ARG E  131  1                                  12    
HELIX   23  23 ASN F   25  ILE F   29  5                                   5    
HELIX   24  24 THR F   30  GLY F   41  1                                  12    
HELIX   25  25 LEU F   49  ALA F   76  1                                  28    
HELIX   26  26 THR F   82  GLN F   93  1                                  12    
HELIX   27  27 THR G   16  GLY G   22  1                                   7    
HELIX   28  28 PRO G   26  LYS G   36  1                                  11    
HELIX   29  29 GLY G   46  ASN G   73  1                                  28    
HELIX   30  30 ILE G   79  ASN G   89  1                                  11    
HELIX   31  31 ASP G   90  LEU G   97  1                                   8    
HELIX   32  32 GLN G  112  LEU G  116  5                                   5    
HELIX   33  33 TYR H   34  HIS H   46  1                                  13    
HELIX   34  34 SER H   52  ASN H   81  1                                  30    
HELIX   35  35 THR H   87  LEU H   99  1                                  13    
HELIX   36  36 GLU H  102  SER H  120  1                                  19    
SHEET    1   A 2 ARG A  83  PHE A  84  0                                        
SHEET    2   A 2 THR B  80  VAL B  81  1  O  VAL B  81   N  ARG A  83           
SHEET    1   B 2 THR A 118  ILE A 119  0                                        
SHEET    2   B 2 ARG B  45  ILE B  46  1  O  ARG B  45   N  ILE A 119           
SHEET    1   C 2 THR B  96  TYR B  98  0                                        
SHEET    2   C 2 VAL G 100  ILE G 102  1  O  THR G 101   N  TYR B  98           
SHEET    1   D 2 ARG C  42  VAL C  43  0                                        
SHEET    2   D 2 THR D  85  ILE D  86  1  O  ILE D  86   N  ARG C  42           
SHEET    1   E 2 ARG C  77  ILE C  78  0                                        
SHEET    2   E 2 GLY D  50  ILE D  51  1  O  GLY D  50   N  ILE C  78           
SHEET    1   F 2 THR C 101  ILE C 102  0                                        
SHEET    2   F 2 LEU F  97  TYR F  98  1  O  TYR F  98   N  THR C 101           
SHEET    1   G 2 ARG E  83  PHE E  84  0                                        
SHEET    2   G 2 THR F  80  VAL F  81  1  O  VAL F  81   N  ARG E  83           
SHEET    1   H 2 THR E 118  ILE E 119  0                                        
SHEET    2   H 2 ARG F  45  ILE F  46  1  O  ARG F  45   N  ILE E 119           
SHEET    1   I 2 ARG G  42  VAL G  43  0                                        
SHEET    2   I 2 THR H  85  ILE H  86  1  O  ILE H  86   N  ARG G  42           
SHEET    1   J 2 ARG G  77  ILE G  78  0                                        
SHEET    2   J 2 GLY H  50  ILE H  51  1  O  GLY H  50   N  ILE G  78           
LINK        MN    MN A 434                 OD1 ASP A  77     1555   1555  2.34  
LINK        MN    MN A 434                 O   HOH A 460     1555   1555  2.51  
LINK        MN    MN A 434                 O   HOH A 457     1555   1555  2.43  
LINK        MN    MN I 436                 N7   DG I -53     1555   1555  2.41  
LINK        MN    MN I 438                 N7   DG I  27     1555   1555  2.74  
LINK        MN    MN I 439                 N7   DG I -14     1555   1555  2.66  
LINK        MN    MN A 434                 O   VAL H  45     1555   2675  2.40  
LINK        MN    MN J 435                 OD2 ASP E  81     1555   2575  2.58  
SITE     1 AC1  4 ASP A  77  HOH A 457  HOH A 460  VAL H  45                    
SITE     1 AC2  2 ASP E  81   DT J  66                                          
SITE     1 AC3  1  DG I -53                                                     
SITE     1 AC4  2  DG I  68   DG I  69                                          
SITE     1 AC5  1  DG I  27                                                     
SITE     1 AC6  1  DG I -14                                                     
SITE     1 AC7  4 GLY G  46  ALA G  47  THR H  87  SER H  88                    
SITE     1 AC8  3 GLY C  46  THR D  87  SER D  88                               
SITE     1 AC9  1 LYS A 122                                                     
SITE     1 BC1  1 LYS E 122                                                     
CRYST1  105.300  175.690  109.530  90.00  90.00  90.00 P 21 21 21    8          
ORIGX1      1.000000  0.000000  0.000000        0.00000                         
ORIGX2      0.000000  1.000000  0.000000        0.00000                         
ORIGX3      0.000000  0.000000  1.000000        0.00000                         
SCALE1      0.009497  0.000000  0.000000        0.00000                         
SCALE2      0.000000  0.005692  0.000000        0.00000                         
SCALE3      0.000000  0.000000  0.009130        0.00000                         
ATOM      1  O5'  DA I -72      32.851 209.088  78.399  1.00106.73           O  
ATOM      2  C5'  DA I -72      32.674 209.861  79.590  1.00107.17           C  
ATOM      3  C4'  DA I -72      31.218 209.956  79.981  1.00107.36           C  
ATOM      4  O4'  DA I -72      30.458 210.438  78.846  1.00107.47           O  
ATOM      5  C3'  DA I -72      30.581 208.624  80.372  1.00107.91           C  
ATOM      6  O3'  DA I -72      29.598 208.821  81.392  1.00108.24           O  
ATOM      7  C2'  DA I -72      29.917 208.165  79.089  1.00107.63           C  
ATOM      8  C1'  DA I -72      29.484 209.477  78.461  1.00106.91           C  
ATOM      9  N9   DA I -72      29.453 209.434  77.001  1.00105.78           N  
ATOM     10  C8   DA I -72      30.448 209.012  76.154  1.00106.02           C  
ATOM     11  N7   DA I -72      30.125 209.078  74.886  1.00106.30           N  
ATOM     12  C5   DA I -72      28.832 209.580  74.898  1.00105.82           C  
ATOM     13  C6   DA I -72      27.926 209.884  73.868  1.00106.05           C  
ATOM     14  N6   DA I -72      28.198 209.718  72.573  1.00105.81           N  
ATOM     15  N1   DA I -72      26.715 210.371  74.219  1.00106.09           N  
ATOM     16  C2   DA I -72      26.446 210.538  75.520  1.00105.56           C  
ATOM     17  N3   DA I -72      27.214 210.290  76.579  1.00105.09           N  
ATOM     18  C4   DA I -72      28.407 209.807  76.195  1.00105.26           C  
ATOM     19  P    DT I -71      28.607 207.619  81.780  1.00108.94           P  
ATOM     20  OP1  DT I -71      28.060 207.918  83.127  1.00109.15           O  
ATOM     21  OP2  DT I -71      29.320 206.336  81.545  1.00108.76           O  
ATOM     22  O5'  DT I -71      27.422 207.745  80.723  1.00108.24           O  
ATOM     23  C5'  DT I -71      26.638 208.933  80.654  1.00108.94           C  
ATOM     24  C4'  DT I -71      25.546 208.790  79.618  1.00109.42           C  
ATOM     25  O4'  DT I -71      26.134 208.690  78.298  1.00109.20           O  
ATOM     26  C3'  DT I -71      24.645 207.563  79.774  1.00109.24           C  
ATOM     27  O3'  DT I -71      23.292 207.911  79.455  1.00108.50           O  
ATOM     28  C2'  DT I -71      25.184 206.601  78.731  1.00109.22           C  
ATOM     29  C1'  DT I -71      25.603 207.556  77.630  1.00108.79           C  
ATOM     30  N1   DT I -71      26.633 207.043  76.707  1.00108.03           N  
ATOM     31  C2   DT I -71      26.387 207.129  75.355  1.00107.39           C  
ATOM     32  O2   DT I -71      25.357 207.594  74.893  1.00106.55           O  
ATOM     33  N3   DT I -71      27.396 206.646  74.559  1.00106.93           N  
ATOM     34  C4   DT I -71      28.595 206.094  74.971  1.00107.00           C  
ATOM     35  O4   DT I -71      29.409 205.707  74.138  1.00106.60           O  
ATOM     36  C5   DT I -71      28.781 206.026  76.402  1.00107.16           C  
ATOM     37  C7   DT I -71      30.045 205.435  76.941  1.00106.98           C  
ATOM     38  C6   DT I -71      27.805 206.499  77.188  1.00107.65           C  
ATOM     39  P    DC I -70      22.103 206.880  79.782  1.00108.43           P  
ATOM     40  OP1  DC I -70      21.137 207.579  80.666  1.00108.27           O  
ATOM     41  OP2  DC I -70      22.704 205.595  80.225  1.00108.30           O  
ATOM     42  O5'  DC I -70      21.399 206.650  78.371  1.00107.49           O  
ATOM     43  C5'  DC I -70      20.816 207.741  77.658  1.00106.33           C  
ATOM     44  C4'  DC I -70      20.439 207.314  76.258  1.00105.79           C  
ATOM     45  O4'  DC I -70      21.638 206.926  75.543  1.00104.98           O  
ATOM     46  C3'  DC I -70      19.494 206.113  76.178  1.00105.46           C  
ATOM     47  O3'  DC I -70      18.580 206.266  75.086  1.00104.84           O  
ATOM     48  C2'  DC I -70      20.429 204.950  75.904  1.00105.20           C  
ATOM     49  C1'  DC I -70      21.503 205.601  75.051  1.00104.68           C  
ATOM     50  N1   DC I -70      22.823 204.953  75.126  1.00103.92           N  
ATOM     51  C2   DC I -70      23.616 204.916  73.976  1.00102.85           C  
ATOM     52  O2   DC I -70      23.186 205.437  72.936  1.00101.59           O  
ATOM     53  N3   DC I -70      24.827 204.314  74.027  1.00102.46           N  
ATOM     54  C4   DC I -70      25.252 203.766  75.167  1.00102.50           C  
ATOM     55  N4   DC I -70      26.450 203.177  75.169  1.00102.28           N  
ATOM     56  C5   DC I -70      24.466 203.795  76.356  1.00102.57           C  
ATOM     57  C6   DC I -70      23.271 204.394  76.292  1.00103.23           C  
ATOM     58  P    DT I -69      17.245 205.372  75.036  1.00105.06           P  
ATOM     59  OP1  DT I -69      16.086 206.298  75.087  1.00105.00           O  
ATOM     60  OP2  DT I -69      17.369 204.291  76.049  1.00104.75           O  
ATOM     61  O5'  DT I -69      17.270 204.709  73.586  1.00104.30           O  
ATOM     62  C5'  DT I -69      17.006 205.490  72.424  1.00102.69           C  
ATOM     63  C4'  DT I -69      17.298 204.697  71.170  1.00101.62           C  
ATOM     64  O4'  DT I -69      18.709 204.376  71.109  1.00100.77           O  
ATOM     65  C3'  DT I -69      16.558 203.364  71.030  1.00100.87           C  
ATOM     66  O3'  DT I -69      16.175 203.182  69.663  1.00100.70           O  
ATOM     67  C2'  DT I -69      17.607 202.340  71.419  1.00100.03           C  
ATOM     68  C1'  DT I -69      18.873 202.983  70.892  1.00 99.48           C  
ATOM     69  N1   DT I -69      20.109 202.557  71.571  1.00 98.60           N  
ATOM     70  C2   DT I -69      21.214 202.291  70.793  1.00 98.17           C  
ATOM     71  O2   DT I -69      21.213 202.392  69.576  1.00 97.56           O  
ATOM     72  N3   DT I -69      22.326 201.902  71.495  1.00 97.94           N  
ATOM     73  C4   DT I -69      22.441 201.753  72.863  1.00 98.29           C  
ATOM     74  O4   DT I -69      23.510 201.402  73.352  1.00 98.07           O  
ATOM     75  C5   DT I -69      21.243 202.041  73.616  1.00 98.91           C  
ATOM     76  C7   DT I -69      21.270 201.891  75.105  1.00 98.86           C  
ATOM     77  C6   DT I -69      20.152 202.427  72.942  1.00 98.61           C  
ATOM     78  P    DC I -68      15.566 201.773  69.178  1.00101.44           P  
ATOM     79  OP1  DC I -68      14.340 202.066  68.392  1.00101.70           O  
ATOM     80  OP2  DC I -68      15.492 200.841  70.335  1.00100.82           O  
ATOM     81  O5'  DC I -68      16.666 201.237  68.160  1.00 99.80           O  
ATOM     82  C5'  DC I -68      17.284 202.129  67.233  1.00 96.93           C  
ATOM     83  C4'  DC I -68      18.423 201.440  66.519  1.00 94.28           C  
ATOM     84  O4'  DC I -68      19.462 201.107  67.470  1.00 93.21           O  
ATOM     85  C3'  DC I -68      18.045 200.131  65.831  1.00 92.45           C  
ATOM     86  O3'  DC I -68      18.766 200.015  64.602  1.00 89.96           O  
ATOM     87  C2'  DC I -68      18.484 199.071  66.826  1.00 91.69           C  
ATOM     88  C1'  DC I -68      19.705 199.709  67.468  1.00 91.79           C  
ATOM     89  N1   DC I -68      19.957 199.302  68.859  1.00 91.48           N  
ATOM     90  C2   DC I -68      21.112 198.572  69.152  1.00 91.43           C  
ATOM     91  O2   DC I -68      21.879 198.268  68.228  1.00 91.95           O  
ATOM     92  N3   DC I -68      21.363 198.215  70.432  1.00 91.02           N  
ATOM     93  C4   DC I -68      20.510 198.558  71.398  1.00 91.37           C  
ATOM     94  N4   DC I -68      20.801 198.192  72.649  1.00 91.54           N  
ATOM     95  C5   DC I -68      19.320 199.293  71.127  1.00 91.93           C  
ATOM     96  C6   DC I -68      19.084 199.640  69.854  1.00 91.81           C  
ATOM     97  P    DC I -67      18.124 199.202  63.375  1.00 88.53           P  
ATOM     98  OP1  DC I -67      17.977 200.142  62.235  1.00 88.78           O  
ATOM     99  OP2  DC I -67      16.936 198.465  63.882  1.00 90.35           O  
ATOM    100  O5'  DC I -67      19.249 198.136  63.020  1.00 86.38           O  
ATOM    101  C5'  DC I -67      20.077 197.617  64.052  1.00 81.65           C  
ATOM    102  C4'  DC I -67      21.240 196.847  63.476  1.00 77.14           C  
ATOM    103  O4'  DC I -67      22.134 196.557  64.570  1.00 76.42           O  
ATOM    104  C3'  DC I -67      20.877 195.494  62.873  1.00 75.70           C  
ATOM    105  O3'  DC I -67      21.800 195.163  61.827  1.00 74.62           O  
ATOM    106  C2'  DC I -67      20.993 194.551  64.058  1.00 74.98           C  
ATOM    107  C1'  DC I -67      22.089 195.180  64.909  1.00 73.79           C  
ATOM    108  N1   DC I -67      21.853 195.103  66.359  1.00 73.02           N  
ATOM    109  C2   DC I -67      22.921 194.779  67.200  1.00 73.17           C  
ATOM    110  O2   DC I -67      24.033 194.550  66.695  1.00 74.26           O  
ATOM    111  N3   DC I -67      22.717 194.726  68.538  1.00 72.21           N  
ATOM    112  C4   DC I -67      21.506 194.980  69.039  1.00 71.74           C  
ATOM    113  N4   DC I -67      21.352 194.924  70.366  1.00 70.65           N  
ATOM    114  C5   DC I -67      20.399 195.304  68.204  1.00 70.73           C  
ATOM    115  C6   DC I -67      20.614 195.352  66.883  1.00 72.06           C  
ATOM    116  P    DA I -66      21.750 193.706  61.141  1.00 74.93           P  
ATOM    117  OP1  DA I -66      22.320 193.850  59.779  1.00 74.31           O  
ATOM    118  OP2  DA I -66      20.387 193.137  61.309  1.00 74.90           O  
ATOM    119  O5'  DA I -66      22.762 192.837  62.018  1.00 73.41           O  
ATOM    120  C5'  DA I -66      24.119 193.247  62.174  1.00 70.66           C  
ATOM    121  C4'  DA I -66      24.867 192.288  63.070  1.00 68.90           C  
ATOM    122  O4'  DA I -66      24.410 192.413  64.440  1.00 69.15           O  
ATOM    123  C3'  DA I -66      24.736 190.808  62.710  1.00 68.92           C  
ATOM    124  O3'  DA I -66      26.009 190.176  62.881  1.00 68.71           O  
ATOM    125  C2'  DA I -66      23.732 190.288  63.726  1.00 68.97           C  
ATOM    126  C1'  DA I -66      24.052 191.134  64.947  1.00 68.59           C  
ATOM    127  N9   DA I -66      22.952 191.317  65.899  1.00 67.03           N  
ATOM    128  C8   DA I -66      21.645 191.646  65.635  1.00 66.77           C  
ATOM    129  N7   DA I -66      20.906 191.781  66.710  1.00 65.48           N  
ATOM    130  C5   DA I -66      21.781 191.514  67.753  1.00 66.40           C  
ATOM    131  C6   DA I -66      21.615 191.501  69.152  1.00 66.27           C  
ATOM    132  N6   DA I -66      20.465 191.788  69.766  1.00 66.81           N  
ATOM    133  N1   DA I -66      22.688 191.187  69.909  1.00 64.00           N  
ATOM    134  C2   DA I -66      23.844 190.914  69.296  1.00 64.86           C  
ATOM    135  N3   DA I -66      24.128 190.901  67.996  1.00 66.39           N  
ATOM    136  C4   DA I -66      23.041 191.213  67.268  1.00 66.81           C  
ATOM    137  P    DA I -65      26.178 188.607  62.574  1.00 68.55           P  
ATOM    138  OP1  DA I -65      27.198 188.468  61.507  1.00 68.83           O  
ATOM    139  OP2  DA I -65      24.840 187.994  62.388  1.00 69.32           O  
ATOM    140  O5'  DA I -65      26.811 188.048  63.923  1.00 66.55           O  
ATOM    141  C5'  DA I -65      27.937 188.693  64.507  1.00 66.08           C  
ATOM    142  C4'  DA I -65      28.210 188.133  65.882  1.00 66.93           C  
ATOM    143  O4'  DA I -65      27.092 188.441  66.746  1.00 67.58           O  
ATOM    144  C3'  DA I -65      28.378 186.617  65.932  1.00 67.37           C  
ATOM    145  O3'  DA I -65      29.369 186.268  66.898  1.00 67.94           O  
ATOM    146  C2'  DA I -65      27.015 186.126  66.378  1.00 67.96           C  
ATOM    147  C1'  DA I -65      26.547 187.246  67.285  1.00 69.12           C  
ATOM    148  N9   DA I -65      25.095 187.400  67.322  1.00 70.85           N  
ATOM    149  C8   DA I -65      24.227 187.409  66.259  1.00 70.39           C  
ATOM    150  N7   DA I -65      22.975 187.576  66.603  1.00 71.47           N  
ATOM    151  C5   DA I -65      23.020 187.681  67.986  1.00 71.24           C  
ATOM    152  C6   DA I -65      22.019 187.872  68.950  1.00 71.35           C  
ATOM    153  N6   DA I -65      20.725 187.996  68.654  1.00 71.11           N  
ATOM    154  N1   DA I -65      22.397 187.933  70.246  1.00 71.73           N  
ATOM    155  C2   DA I -65      23.697 187.810  70.540  1.00 71.55           C  
ATOM    156  N3   DA I -65      24.732 187.628  69.722  1.00 71.87           N  
ATOM    157  C4   DA I -65      24.319 187.572  68.443  1.00 71.32           C  
ATOM    158  P    DA I -64      29.661 184.720  67.212  1.00 70.10           P  
ATOM    159  OP1  DA I -64      31.134 184.546  67.270  1.00 70.55           O  
ATOM    160  OP2  DA I -64      28.855 183.871  66.293  1.00 68.13           O  
ATOM    161  O5'  DA I -64      29.085 184.530  68.681  1.00 71.19           O  
ATOM    162  C5'  DA I -64      29.357 185.488  69.699  1.00 71.50           C  
ATOM    163  C4'  DA I -64      28.599 185.137  70.955  1.00 72.03           C  
ATOM    164  O4'  DA I -64      27.183 185.393  70.771  1.00 71.08           O  
ATOM    165  C3'  DA I -64      28.716 183.666  71.348  1.00 73.17           C  
ATOM    166  O3'  DA I -64      28.845 183.546  72.765  1.00 75.28           O  
ATOM    167  C2'  DA I -64      27.409 183.063  70.865  1.00 72.35           C  
ATOM    168  C1'  DA I -64      26.436 184.216  71.036  1.00 70.80           C  
ATOM    169  N9   DA I -64      25.303 184.191  70.114  1.00 70.26           N  
ATOM    170  C8   DA I -64      25.318 183.913  68.772  1.00 70.40           C  
ATOM    171  N7   DA I -64      24.139 183.978  68.204  1.00 70.15           N  
ATOM    172  C5   DA I -64      23.288 184.321  69.243  1.00 71.00           C  
ATOM    173  C6   DA I -64      21.902 184.549  69.293  1.00 72.18           C  
ATOM    174  N6   DA I -64      21.097 184.461  68.231  1.00 71.81           N  
ATOM    175  N1   DA I -64      21.363 184.878  70.487  1.00 72.50           N  
ATOM    176  C2   DA I -64      22.170 184.965  71.551  1.00 71.98           C  
ATOM    177  N3   DA I -64      23.484 184.772  71.630  1.00 72.33           N  
ATOM    178  C4   DA I -64      23.990 184.451  70.426  1.00 71.41           C  
ATOM    179  P    DT I -63      28.814 182.093  73.440  1.00 77.74           P  
ATOM    180  OP1  DT I -63      29.567 182.168  74.720  1.00 77.79           O  
ATOM    181  OP2  DT I -63      29.199 181.085  72.417  1.00 78.49           O  
ATOM    182  O5'  DT I -63      27.275 181.899  73.783  1.00 76.59           O  
ATOM    183  C5'  DT I -63      26.618 182.821  74.637  1.00 75.89           C  
ATOM    184  C4'  DT I -63      25.247 182.309  74.997  1.00 75.45           C  
ATOM    185  O4'  DT I -63      24.344 182.476  73.877  1.00 75.93           O  
ATOM    186  C3'  DT I -63      25.195 180.829  75.378  1.00 74.49           C  
ATOM    187  O3'  DT I -63      24.358 180.674  76.524  1.00 73.54           O  
ATOM    188  C2'  DT I -63      24.574 180.170  74.158  1.00 73.88           C  
ATOM    189  C1'  DT I -63      23.654 181.262  73.645  1.00 75.92           C  
ATOM    190  N1   DT I -63      23.324 181.194  72.207  1.00 77.17           N  
ATOM    191  C2   DT I -63      22.062 181.582  71.817  1.00 77.00           C  
ATOM    192  O2   DT I -63      21.215 181.977  72.599  1.00 77.84           O  
ATOM    193  N3   DT I -63      21.827 181.490  70.469  1.00 77.80           N  
ATOM    194  C4   DT I -63      22.705 181.059  69.494  1.00 78.44           C  
ATOM    195  O4   DT I -63      22.349 181.033  68.320  1.00 79.64           O  
ATOM    196  C5   DT I -63      24.010 180.666  69.972  1.00 78.23           C  
ATOM    197  C7   DT I -63      25.027 180.179  68.990  1.00 78.32           C  
ATOM    198  C6   DT I -63      24.252 180.754  71.287  1.00 78.42           C  
ATOM    199  P    DA I -62      24.091 179.213  77.132  1.00 74.20           P  
ATOM    200  OP1  DA I -62      24.349 179.292  78.591  1.00 74.58           O  
ATOM    201  OP2  DA I -62      24.789 178.184  76.322  1.00 73.86           O  
ATOM    202  O5'  DA I -62      22.528 179.041  76.910  1.00 74.47           O  
ATOM    203  C5'  DA I -62      21.628 180.055  77.337  1.00 75.42           C  
ATOM    204  C4'  DA I -62      20.206 179.596  77.133  1.00 76.94           C  
ATOM    205  O4'  DA I -62      19.869 179.665  75.729  1.00 77.89           O  
ATOM    206  C3'  DA I -62      19.963 178.151  77.559  1.00 77.22           C  
ATOM    207  O3'  DA I -62      18.691 178.049  78.197  1.00 77.98           O  
ATOM    208  C2'  DA I -62      20.014 177.381  76.250  1.00 77.18           C  
ATOM    209  C1'  DA I -62      19.487 178.389  75.245  1.00 78.04           C  
ATOM    210  N9   DA I -62      20.038 178.251  73.897  1.00 80.04           N  
ATOM    211  C8   DA I -62      21.317 177.900  73.532  1.00 80.42           C  
ATOM    212  N7   DA I -62      21.510 177.880  72.235  1.00 80.41           N  
ATOM    213  C5   DA I -62      20.277 178.241  71.709  1.00 81.70           C  
ATOM    214  C6   DA I -62      19.820 178.404  70.387  1.00 82.14           C  
ATOM    215  N6   DA I -62      20.589 178.230  69.311  1.00 83.08           N  
ATOM    216  N1   DA I -62      18.529 178.758  70.207  1.00 82.81           N  
ATOM    217  C2   DA I -62      17.759 178.942  71.288  1.00 83.44           C  
ATOM    218  N3   DA I -62      18.073 178.828  72.578  1.00 82.85           N  
ATOM    219  C4   DA I -62      19.360 178.468  72.722  1.00 81.48           C  
ATOM    220  P    DT I -61      18.032 176.608  78.438  1.00 77.93           P  
ATOM    221  OP1  DT I -61      17.034 176.791  79.520  1.00 80.22           O  
ATOM    222  OP2  DT I -61      19.095 175.581  78.584  1.00 78.86           O  
ATOM    223  O5'  DT I -61      17.249 176.344  77.080  1.00 78.90           O  
ATOM    224  C5'  DT I -61      16.217 177.231  76.664  1.00 79.17           C  
ATOM    225  C4'  DT I -61      15.330 176.553  75.649  1.00 80.06           C  
ATOM    226  O4'  DT I -61      15.933 176.608  74.335  1.00 79.94           O  
ATOM    227  C3'  DT I -61      15.076 175.076  75.949  1.00 80.81           C  
ATOM    228  O3'  DT I -61      13.704 174.760  75.710  1.00 82.08           O  
ATOM    229  C2'  DT I -61      15.985 174.357  74.968  1.00 80.46           C  
ATOM    230  C1'  DT I -61      15.991 175.305  73.780  1.00 81.15           C  
ATOM    231  N1   DT I -61      17.187 175.230  72.911  1.00 81.26           N  
ATOM    232  C2   DT I -61      17.027 175.497  71.568  1.00 81.31           C  
ATOM    233  O2   DT I -61      15.956 175.799  71.069  1.00 81.61           O  
ATOM    234  N3   DT I -61      18.175 175.399  70.824  1.00 81.87           N  
ATOM    235  C4   DT I -61      19.439 175.072  71.276  1.00 82.13           C  
ATOM    236  O4   DT I -61      20.378 175.024  70.487  1.00 80.92           O  
ATOM    237  C5   DT I -61      19.536 174.809  72.693  1.00 82.47           C  
ATOM    238  C7   DT I -61      20.868 174.451  73.273  1.00 83.48           C  
ATOM    239  C6   DT I -61      18.420 174.900  73.431  1.00 81.88           C  
ATOM    240  P    DC I -60      13.103 173.360  76.229  1.00 83.45           P  
ATOM    241  OP1  DC I -60      11.777 173.672  76.822  1.00 84.36           O  
ATOM    242  OP2  DC I -60      14.117 172.633  77.039  1.00 80.88           O  
ATOM    243  O5'  DC I -60      12.853 172.566  74.874  1.00 82.43           O  
ATOM    244  C5'  DC I -60      12.105 173.176  73.827  1.00 82.88           C  
ATOM    245  C4'  DC I -60      12.248 172.389  72.548  1.00 82.98           C  
ATOM    246  O4'  DC I -60      13.555 172.595  71.956  1.00 83.15           O  
ATOM    247  C3'  DC I -60      12.089 170.878  72.717  1.00 83.40           C  
ATOM    248  O3'  DC I -60      11.318 170.365  71.634  1.00 83.71           O  
ATOM    249  C2'  DC I -60      13.513 170.365  72.604  1.00 83.03           C  
ATOM    250  C1'  DC I -60      14.081 171.334  71.587  1.00 82.32           C  
ATOM    251  N1   DC I -60      15.548 171.440  71.524  1.00 81.12           N  
ATOM    252  C2   DC I -60      16.129 171.915  70.345  1.00 80.51           C  
ATOM    253  O2   DC I -60      15.390 172.241  69.406  1.00 80.17           O  
ATOM    254  N3   DC I -60      17.475 172.006  70.257  1.00 80.13           N  
ATOM    255  C4   DC I -60      18.235 171.647  71.293  1.00 80.96           C  
ATOM    256  N4   DC I -60      19.561 171.754  71.162  1.00 80.71           N  
ATOM    257  C5   DC I -60      17.670 171.163  72.511  1.00 80.92           C  
ATOM    258  C6   DC I -60      16.334 171.078  72.583  1.00 80.97           C  
ATOM    259  P    DC I -59      10.477 169.016  71.829  1.00 84.13           P  
ATOM    260  OP1  DC I -59       9.111 169.410  72.263  1.00 83.60           O  
ATOM    261  OP2  DC I -59      11.277 168.086  72.669  1.00 83.96           O  
ATOM    262  O5'  DC I -59      10.397 168.422  70.354  1.00 83.43           O  
ATOM    263  C5'  DC I -59       9.971 169.237  69.264  1.00 83.41           C  
ATOM    264  C4'  DC I -59      10.700 168.848  67.999  1.00 84.51           C  
ATOM    265  O4'  DC I -59      12.086 169.272  68.065  1.00 84.91           O  
ATOM    266  C3'  DC I -59      10.727 167.347  67.702  1.00 84.32           C  
ATOM    267  O3'  DC I -59      10.530 167.120  66.309  1.00 84.70           O  
ATOM    268  C2'  DC I -59      12.133 166.933  68.094  1.00 84.05           C  
ATOM    269  C1'  DC I -59      12.939 168.177  67.768  1.00 84.11           C  
ATOM    270  N1   DC I -59      14.162 168.317  68.579  1.00 84.09           N  
ATOM    271  C2   DC I -59      15.379 168.581  67.934  1.00 83.52           C  
ATOM    272  O2   DC I -59      15.391 168.722  66.701  1.00 82.87           O  
ATOM    273  N3   DC I -59      16.509 168.674  68.673  1.00 82.88           N  
ATOM    274  C4   DC I -59      16.454 168.519  69.998  1.00 83.47           C  
ATOM    275  N4   DC I -59      17.595 168.603  70.686  1.00 83.17           N  
ATOM    276  C5   DC I -59      15.228 168.264  70.677  1.00 83.37           C  
ATOM    277  C6   DC I -59      14.116 168.176  69.936  1.00 83.22           C  
ATOM    278  P    DC I -58      10.464 165.618  65.749  1.00 85.28           P  
ATOM    279  OP1  DC I -58       9.116 165.414  65.163  1.00 85.72           O  
ATOM    280  OP2  DC I -58      10.953 164.692  66.804  1.00 85.30           O  
ATOM    281  O5'  DC I -58      11.517 165.637  64.555  1.00 85.78           O  
ATOM    282  C5'  DC I -58      11.558 166.737  63.646  1.00 85.05           C  
ATOM    283  C4'  DC I -58      12.788 166.653  62.773  1.00 85.09           C  
ATOM    284  O4'  DC I -58      13.978 166.898  63.562  1.00 83.93           O  
ATOM    285  C3'  DC I -58      12.991 165.295  62.104  1.00 85.37           C  
ATOM    286  O3'  DC I -58      13.452 165.474  60.764  1.00 87.02           O  
ATOM    287  C2'  DC I -58      14.047 164.625  62.968  1.00 83.35           C  
ATOM    288  C1'  DC I -58      14.874 165.800  63.466  1.00 81.55           C  
ATOM    289  N1   DC I -58      15.466 165.590  64.798  1.00 79.62           N  
ATOM    290  C2   DC I -58      16.857 165.657  64.941  1.00 79.02           C  
ATOM    291  O2   DC I -58      17.552 165.905  63.945  1.00 79.63           O  
ATOM    292  N3   DC I -58      17.408 165.456  66.159  1.00 77.79           N  
ATOM    293  C4   DC I -58      16.626 165.204  67.211  1.00 77.76           C  
ATOM    294  N4   DC I -58      17.213 165.019  68.397  1.00 76.27           N  
ATOM    295  C5   DC I -58      15.207 165.133  67.095  1.00 78.10           C  
ATOM    296  C6   DC I -58      14.675 165.330  65.882  1.00 78.42           C  
ATOM    297  P    DT I -57      13.798 164.190  59.869  1.00 89.28           P  
ATOM    298  OP1  DT I -57      13.363 164.476  58.478  1.00 88.85           O  
ATOM    299  OP2  DT I -57      13.290 162.979  60.566  1.00 88.58           O  
ATOM    300  O5'  DT I -57      15.388 164.148  59.900  1.00 89.21           O  
ATOM    301  C5'  DT I -57      16.147 165.292  59.521  1.00 88.16           C  
ATOM    302  C4'  DT I -57      17.607 164.931  59.400  1.00 86.97           C  
ATOM    303  O4'  DT I -57      18.173 164.727  60.717  1.00 86.65           O  
ATOM    304  C3'  DT I -57      17.870 163.642  58.621  1.00 87.08           C  
ATOM    305  O3'  DT I -57      19.025 163.799  57.793  1.00 86.89           O  
ATOM    306  C2'  DT I -57      18.123 162.617  59.711  1.00 86.10           C  
ATOM    307  C1'  DT I -57      18.798 163.456  60.778  1.00 85.56           C  
ATOM    308  N1   DT I -57      18.657 162.946  62.153  1.00 84.84           N  
ATOM    309  C2   DT I -57      19.733 163.081  63.001  1.00 85.15           C  
ATOM    310  O2   DT I -57      20.782 163.608  62.668  1.00 84.64           O  
ATOM    311  N3   DT I -57      19.535 162.575  64.261  1.00 85.66           N  
ATOM    312  C4   DT I -57      18.394 161.965  64.747  1.00 86.30           C  
ATOM    313  O4   DT I -57      18.363 161.557  65.907  1.00 86.97           O  
ATOM    314  C5   DT I -57      17.303 161.862  63.805  1.00 85.92           C  
ATOM    315  C7   DT I -57      16.026 161.217  64.242  1.00 85.64           C  
ATOM    316  C6   DT I -57      17.487 162.352  62.572  1.00 85.10           C  
ATOM    317  P    DT I -56      19.532 162.571  56.889  1.00 87.93           P  
ATOM    318  OP1  DT I -56      19.951 163.142  55.581  1.00 87.30           O  
ATOM    319  OP2  DT I -56      18.525 161.476  56.929  1.00 85.99           O  
ATOM    320  O5'  DT I -56      20.832 162.068  57.657  1.00 86.35           O  
ATOM    321  C5'  DT I -56      21.821 162.996  58.092  1.00 84.19           C  
ATOM    322  C4'  DT I -56      22.927 162.271  58.820  1.00 83.12           C  
ATOM    323  O4'  DT I -56      22.466 161.836  60.123  1.00 83.14           O  
ATOM    324  C3'  DT I -56      23.418 161.013  58.103  1.00 81.94           C  
ATOM    325  O3'  DT I -56      24.825 160.871  58.306  1.00 79.27           O  
ATOM    326  C2'  DT I -56      22.686 159.902  58.833  1.00 82.56           C  
ATOM    327  C1'  DT I -56      22.675 160.440  60.252  1.00 83.30           C  
ATOM    328  N1   DT I -56      21.627 159.901  61.135  1.00 84.01           N  
ATOM    329  C2   DT I -56      21.958 159.679  62.451  1.00 84.80           C  
ATOM    330  O2   DT I -56      23.065 159.907  62.908  1.00 85.99           O  
ATOM    331  N3   DT I -56      20.939 159.179  63.220  1.00 85.18           N  
ATOM    332  C4   DT I -56      19.652 158.891  62.815  1.00 85.34           C  
ATOM    333  O4   DT I -56      18.843 158.450  63.622  1.00 85.72           O  
ATOM    334  C5   DT I -56      19.373 159.149  61.423  1.00 85.24           C  
ATOM    335  C7   DT I -56      18.002 158.869  60.896  1.00 86.24           C  
ATOM    336  C6   DT I -56      20.362 159.633  60.661  1.00 84.51           C  
ATOM    337  P    DG I -55      25.838 161.103  57.082  1.00 76.25           P  
ATOM    338  OP1  DG I -55      25.634 162.488  56.584  1.00 75.01           O  
ATOM    339  OP2  DG I -55      25.725 159.958  56.143  1.00 76.66           O  
ATOM    340  O5'  DG I -55      27.263 161.043  57.782  1.00 72.59           O  
ATOM    341  C5'  DG I -55      27.591 161.954  58.825  1.00 68.33           C  
ATOM    342  C4'  DG I -55      27.966 161.198  60.078  1.00 64.31           C  
ATOM    343  O4'  DG I -55      26.808 160.514  60.610  1.00 64.40           O  
ATOM    344  C3'  DG I -55      29.028 160.118  59.880  1.00 61.86           C  
ATOM    345  O3'  DG I -55      29.822 160.043  61.058  1.00 57.31           O  
ATOM    346  C2'  DG I -55      28.207 158.849  59.769  1.00 62.69           C  
ATOM    347  C1'  DG I -55      27.119 159.141  60.779  1.00 65.27           C  
ATOM    348  N9   DG I -55      25.890 158.379  60.607  1.00 66.43           N  
ATOM    349  C8   DG I -55      25.287 158.027  59.427  1.00 67.34           C  
ATOM    350  N7   DG I -55      24.179 157.360  59.599  1.00 68.39           N  
ATOM    351  C5   DG I -55      24.047 157.264  60.976  1.00 68.12           C  
ATOM    352  C6   DG I -55      23.037 156.659  61.757  1.00 68.71           C  
ATOM    353  O6   DG I -55      22.014 156.078  61.377  1.00 70.14           O  
ATOM    354  N1   DG I -55      23.302 156.782  63.118  1.00 68.27           N  
ATOM    355  C2   DG I -55      24.393 157.414  63.657  1.00 66.63           C  
ATOM    356  N2   DG I -55      24.472 157.422  64.995  1.00 66.48           N  
ATOM    357  N3   DG I -55      25.338 157.994  62.937  1.00 66.76           N  
ATOM    358  C4   DG I -55      25.101 157.880  61.612  1.00 67.61           C  
ATOM    359  P    DC I -54      31.332 159.527  60.967  1.00 53.55           P  
ATOM    360  OP1  DC I -54      32.133 160.700  60.543  1.00 56.38           O  
ATOM    361  OP2  DC I -54      31.386 158.280  60.170  1.00 53.72           O  
ATOM    362  O5'  DC I -54      31.680 159.187  62.481  1.00 52.64           O  
ATOM    363  C5'  DC I -54      31.453 160.156  63.499  1.00 54.07           C  
ATOM    364  C4'  DC I -54      30.863 159.511  64.733  1.00 54.12           C  
ATOM    365  O4'  DC I -54      29.617 158.856  64.401  1.00 53.75           O  
ATOM    366  C3'  DC I -54      31.718 158.457  65.437  1.00 54.32           C  
ATOM    367  O3'  DC I -54      31.551 158.617  66.850  1.00 56.65           O  
ATOM    368  C2'  DC I -54      31.099 157.149  64.977  1.00 51.92           C  
ATOM    369  C1'  DC I -54      29.634 157.519  64.877  1.00 50.22           C  
ATOM    370  N1   DC I -54      28.827 156.704  63.953  1.00 48.95           N  
ATOM    371  C2   DC I -54      27.691 156.018  64.452  1.00 47.52           C  
ATOM    372  O2   DC I -54      27.419 156.090  65.660  1.00 44.60           O  
ATOM    373  N3   DC I -54      26.927 155.301  63.597  1.00 45.92           N  
ATOM    374  C4   DC I -54      27.246 155.247  62.301  1.00 46.32           C  
ATOM    375  N4   DC I -54      26.451 154.550  61.494  1.00 44.24           N  
ATOM    376  C5   DC I -54      28.399 155.912  61.776  1.00 48.06           C  
ATOM    377  C6   DC I -54      29.154 156.621  62.629  1.00 47.44           C  
ATOM    378  P    DG I -53      32.688 158.098  67.860  1.00 61.16           P  
ATOM    379  OP1  DG I -53      32.488 158.841  69.131  1.00 57.58           O  
ATOM    380  OP2  DG I -53      34.016 158.112  67.195  1.00 58.82           O  
ATOM    381  O5'  DG I -53      32.307 156.575  68.111  1.00 62.05           O  
ATOM    382  C5'  DG I -53      31.149 156.229  68.858  1.00 63.35           C  
ATOM    383  C4'  DG I -53      30.892 154.746  68.747  1.00 64.74           C  
ATOM    384  O4'  DG I -53      30.320 154.425  67.457  1.00 64.45           O  
ATOM    385  C3'  DG I -53      32.144 153.878  68.880  1.00 65.63           C  
ATOM    386  O3'  DG I -53      31.821 152.706  69.615  1.00 68.53           O  
ATOM    387  C2'  DG I -53      32.441 153.478  67.448  1.00 65.66           C  
ATOM    388  C1'  DG I -53      31.039 153.340  66.899  1.00 65.89           C  
ATOM    389  N9   DG I -53      30.916 153.416  65.448  1.00 66.69           N  
ATOM    390  C8   DG I -53      31.772 154.029  64.572  1.00 67.50           C  
ATOM    391  N7   DG I -53      31.379 153.946  63.331  1.00 68.86           N  
ATOM    392  C5   DG I -53      30.196 153.225  63.392  1.00 69.02           C  
ATOM    393  C6   DG I -53      29.310 152.822  62.359  1.00 69.37           C  
ATOM    394  O6   DG I -53      29.394 153.038  61.143  1.00 69.41           O  
ATOM    395  N1   DG I -53      28.231 152.104  62.863  1.00 69.07           N  
ATOM    396  C2   DG I -53      28.026 151.816  64.189  1.00 68.28           C  
ATOM    397  N2   DG I -53      26.922 151.117  64.479  1.00 69.36           N  
ATOM    398  N3   DG I -53      28.842 152.188  65.160  1.00 68.23           N  
ATOM    399  C4   DG I -53      29.899 152.885  64.692  1.00 68.18           C  
ATOM    400  P    DG I -52      32.829 152.164  70.736  1.00 70.78           P  
ATOM    401  OP1  DG I -52      32.902 153.198  71.798  1.00 69.43           O  
ATOM    402  OP2  DG I -52      34.075 151.685  70.082  1.00 69.25           O  
ATOM    403  O5'  DG I -52      32.064 150.894  71.309  1.00 71.90           O  
ATOM    404  C5'  DG I -52      30.667 150.949  71.563  1.00 71.90           C  
ATOM    405  C4'  DG I -52      29.970 149.797  70.880  1.00 73.76           C  
ATOM    406  O4'  DG I -52      29.867 150.026  69.452  1.00 73.31           O  
ATOM    407  C3'  DG I -52      30.666 148.444  71.045  1.00 75.21           C  
ATOM    408  O3'  DG I -52      29.682 147.431  71.287  1.00 76.57           O  
ATOM    409  C2'  DG I -52      31.319 148.224  69.691  1.00 73.78           C  
ATOM    410  C1'  DG I -52      30.296 148.858  68.772  1.00 73.86           C  
ATOM    411  N9   DG I -52      30.778 149.242  67.449  1.00 74.59           N  
ATOM    412  C8   DG I -52      31.954 149.883  67.138  1.00 75.09           C  
ATOM    413  N7   DG I -52      32.103 150.087  65.855  1.00 73.66           N  
ATOM    414  C5   DG I -52      30.957 149.548  65.285  1.00 73.12           C  
ATOM    415  C6   DG I -52      30.552 149.475  63.925  1.00 72.57           C  
ATOM    416  O6   DG I -52      31.146 149.881  62.919  1.00 71.85           O  
ATOM    417  N1   DG I -52      29.314 148.853  63.794  1.00 71.46           N  
ATOM    418  C2   DG I -52      28.562 148.366  64.832  1.00 71.20           C  
ATOM    419  N2   DG I -52      27.390 147.809  64.501  1.00 70.01           N  
ATOM    420  N3   DG I -52      28.929 148.424  66.102  1.00 72.33           N  
ATOM    421  C4   DG I -52      30.129 149.024  66.254  1.00 73.43           C  
ATOM    422  P    DA I -51      30.128 145.995  71.854  1.00 75.79           P  
ATOM    423  OP1  DA I -51      29.643 145.902  73.254  1.00 76.04           O  
ATOM    424  OP2  DA I -51      31.566 145.775  71.561  1.00 76.06           O  
ATOM    425  O5'  DA I -51      29.280 144.992  70.957  1.00 76.76           O  
ATOM    426  C5'  DA I -51      29.065 145.279  69.578  1.00 78.23           C  
ATOM    427  C4'  DA I -51      28.313 144.151  68.916  1.00 79.39           C  
ATOM    428  O4'  DA I -51      28.144 144.481  67.518  1.00 78.79           O  
ATOM    429  C3'  DA I -51      29.053 142.818  68.940  1.00 80.94           C  
ATOM    430  O3'  DA I -51      28.122 141.735  69.026  1.00 84.28           O  
ATOM    431  C2'  DA I -51      29.822 142.814  67.632  1.00 80.16           C  
ATOM    432  C1'  DA I -51      28.983 143.677  66.697  1.00 78.95           C  
ATOM    433  N9   DA I -51      29.798 144.587  65.890  1.00 78.37           N  
ATOM    434  C8   DA I -51      30.776 145.438  66.346  1.00 77.31           C  
ATOM    435  N7   DA I -51      31.346 146.144  65.401  1.00 76.52           N  
ATOM    436  C5   DA I -51      30.700 145.734  64.244  1.00 76.77           C  
ATOM    437  C6   DA I -51      30.844 146.111  62.899  1.00 76.70           C  
ATOM    438  N6   DA I -51      31.720 147.028  62.476  1.00 76.65           N  
ATOM    439  N1   DA I -51      30.047 145.510  61.990  1.00 76.55           N  
ATOM    440  C2   DA I -51      29.168 144.595  62.416  1.00 76.35           C  
ATOM    441  N3   DA I -51      28.937 144.158  63.651  1.00 76.80           N  
ATOM    442  C4   DA I -51      29.746 144.773  64.529  1.00 77.04           C  
ATOM    443  P    DT I -50      28.622 140.230  68.773  1.00 86.06           P  
ATOM    444  OP1  DT I -50      27.584 139.339  69.347  1.00 86.76           O  
ATOM    445  OP2  DT I -50      30.034 140.100  69.220  1.00 86.27           O  
ATOM    446  O5'  DT I -50      28.592 140.090  67.186  1.00 85.87           O  
ATOM    447  C5'  DT I -50      27.363 140.185  66.468  1.00 86.56           C  
ATOM    448  C4'  DT I -50      27.538 139.656  65.064  1.00 87.38           C  
ATOM    449  O4'  DT I -50      28.286 140.604  64.264  1.00 87.40           O  
ATOM    450  C3'  DT I -50      28.309 138.338  64.990  1.00 87.70           C  
ATOM    451  O3'  DT I -50      27.753 137.492  63.981  1.00 88.24           O  
ATOM    452  C2'  DT I -50      29.710 138.774  64.603  1.00 87.24           C  
ATOM    453  C1'  DT I -50      29.435 139.974  63.715  1.00 87.29           C  
ATOM    454  N1   DT I -50      30.525 140.969  63.678  1.00 87.09           N  
ATOM    455  C2   DT I -50      30.928 141.447  62.450  1.00 86.83           C  
ATOM    456  O2   DT I -50      30.434 141.081  61.397  1.00 87.31           O  
ATOM    457  N3   DT I -50      31.941 142.371  62.502  1.00 86.50           N  
ATOM    458  C4   DT I -50      32.580 142.848  63.630  1.00 86.71           C  
ATOM    459  O4   DT I -50      33.478 143.681  63.520  1.00 86.34           O  
ATOM    460  C5   DT I -50      32.114 142.298  64.880  1.00 86.60           C  
ATOM    461  C7   DT I -50      32.760 142.743  66.154  1.00 87.21           C  
ATOM    462  C6   DT I -50      31.120 141.402  64.843  1.00 86.87           C  
ATOM    463  P    DC I -49      28.275 135.980  63.839  1.00 88.33           P  
ATOM    464  OP1  DC I -49      27.088 135.134  63.561  1.00 88.49           O  
ATOM    465  OP2  DC I -49      29.144 135.666  65.004  1.00 88.19           O  
ATOM    466  O5'  DC I -49      29.182 136.018  62.531  1.00 86.67           O  
ATOM    467  C5'  DC I -49      28.600 136.241  61.249  1.00 86.30           C  
ATOM    468  C4'  DC I -49      29.666 136.197  60.179  1.00 86.20           C  
ATOM    469  O4'  DC I -49      30.497 137.382  60.261  1.00 85.28           O  
ATOM    470  C3'  DC I -49      30.614 135.004  60.299  1.00 86.61           C  
ATOM    471  O3'  DC I -49      30.962 134.517  59.004  1.00 88.20           O  
ATOM    472  C2'  DC I -49      31.842 135.603  60.956  1.00 86.69           C  
ATOM    473  C1'  DC I -49      31.859 136.998  60.361  1.00 86.08           C  
ATOM    474  N1   DC I -49      32.561 137.998  61.180  1.00 85.37           N  
ATOM    475  C2   DC I -49      33.494 138.843  60.564  1.00 85.15           C  
ATOM    476  O2   DC I -49      33.692 138.735  59.344  1.00 83.79           O  
ATOM    477  N3   DC I -49      34.156 139.753  61.314  1.00 84.98           N  
ATOM    478  C4   DC I -49      33.918 139.835  62.625  1.00 84.92           C  
ATOM    479  N4   DC I -49      34.602 140.738  63.329  1.00 84.30           N  
ATOM    480  C5   DC I -49      32.970 138.992  63.275  1.00 85.37           C  
ATOM    481  C6   DC I -49      32.319 138.099  62.521  1.00 84.98           C  
ATOM    482  P    DG I -48      31.658 133.077  58.859  1.00 90.31           P  
ATOM    483  OP1  DG I -48      30.586 132.095  58.557  1.00 90.24           O  
ATOM    484  OP2  DG I -48      32.551 132.854  60.025  1.00 90.13           O  
ATOM    485  O5'  DG I -48      32.568 133.241  57.564  1.00 90.58           O  
ATOM    486  C5'  DG I -48      32.161 134.094  56.500  1.00 91.29           C  
ATOM    487  C4'  DG I -48      33.351 134.849  55.956  1.00 91.90           C  
ATOM    488  O4'  DG I -48      33.822 135.797  56.945  1.00 92.43           O  
ATOM    489  C3'  DG I -48      34.548 133.966  55.609  1.00 91.92           C  
ATOM    490  O3'  DG I -48      35.172 134.439  54.416  1.00 91.96           O  
ATOM    491  C2'  DG I -48      35.474 134.141  56.798  1.00 92.79           C  
ATOM    492  C1'  DG I -48      35.198 135.574  57.215  1.00 93.30           C  
ATOM    493  N9   DG I -48      35.426 135.845  58.632  1.00 94.07           N  
ATOM    494  C8   DG I -48      34.906 135.157  59.701  1.00 94.11           C  
ATOM    495  N7   DG I -48      35.283 135.641  60.854  1.00 94.46           N  
ATOM    496  C5   DG I -48      36.102 136.712  60.526  1.00 94.60           C  
ATOM    497  C6   DG I -48      36.799 137.627  61.359  1.00 94.57           C  
ATOM    498  O6   DG I -48      36.831 137.676  62.594  1.00 95.12           O  
ATOM    499  N1   DG I -48      37.512 138.555  60.612  1.00 94.02           N  
ATOM    500  C2   DG I -48      37.556 138.601  59.243  1.00 94.12           C  
ATOM    501  N2   DG I -48      38.312 139.570  58.709  1.00 95.14           N  
ATOM    502  N3   DG I -48      36.909 137.760  58.455  1.00 94.48           N  
ATOM    503  C4   DG I -48      36.206 136.848  59.159  1.00 94.50           C  
ATOM    504  P    DT I -47      36.369 133.597  53.760  1.00 91.98           P  
ATOM    505  OP1  DT I -47      36.168 133.610  52.289  1.00 92.40           O  
ATOM    506  OP2  DT I -47      36.495 132.301  54.474  1.00 92.11           O  
ATOM    507  O5'  DT I -47      37.653 134.474  54.086  1.00 92.79           O  
ATOM    508  C5'  DT I -47      37.740 135.821  53.633  1.00 93.61           C  
ATOM    509  C4'  DT I -47      39.095 136.393  53.969  1.00 94.02           C  
ATOM    510  O4'  DT I -47      39.201 136.569  55.402  1.00 94.11           O  
ATOM    511  C3'  DT I -47      40.263 135.495  53.560  1.00 93.25           C  
ATOM    512  O3'  DT I -47      41.339 136.294  53.073  1.00 92.28           O  
ATOM    513  C2'  DT I -47      40.650 134.808  54.856  1.00 93.63           C  
ATOM    514  C1'  DT I -47      40.332 135.871  55.893  1.00 94.69           C  
ATOM    515  N1   DT I -47      39.991 135.344  57.224  1.00 95.75           N  
ATOM    516  C2   DT I -47      40.579 135.936  58.315  1.00 96.41           C  
ATOM    517  O2   DT I -47      41.342 136.882  58.225  1.00 95.84           O  
ATOM    518  N3   DT I -47      40.236 135.379  59.524  1.00 97.21           N  
ATOM    519  C4   DT I -47      39.377 134.317  59.740  1.00 97.79           C  
ATOM    520  O4   DT I -47      39.169 133.918  60.886  1.00 97.95           O  
ATOM    521  C5   DT I -47      38.784 133.754  58.548  1.00 97.54           C  
ATOM    522  C7   DT I -47      37.835 132.605  58.683  1.00 97.73           C  
ATOM    523  C6   DT I -47      39.116 134.289  57.366  1.00 96.64           C  
ATOM    524  P    DA I -46      41.662 136.312  51.502  1.00 91.66           P  
ATOM    525  OP1  DA I -46      40.422 136.733  50.806  1.00 92.04           O  
ATOM    526  OP2  DA I -46      42.309 135.026  51.142  1.00 92.06           O  
ATOM    527  O5'  DA I -46      42.732 137.478  51.348  1.00 90.93           O  
ATOM    528  C5'  DA I -46      42.408 138.817  51.714  1.00 88.50           C  
ATOM    529  C4'  DA I -46      43.423 139.343  52.701  1.00 86.25           C  
ATOM    530  O4'  DA I -46      43.291 138.623  53.951  1.00 86.54           O  
ATOM    531  C3'  DA I -46      44.875 139.161  52.260  1.00 84.80           C  
ATOM    532  O3'  DA I -46      45.663 140.278  52.673  1.00 81.00           O  
ATOM    533  C2'  DA I -46      45.310 137.905  52.990  1.00 85.54           C  
ATOM    534  C1'  DA I -46      44.518 137.985  54.284  1.00 87.18           C  
ATOM    535  N9   DA I -46      44.203 136.680  54.866  1.00 88.31           N  
ATOM    536  C8   DA I -46      43.930 135.511  54.200  1.00 88.24           C  
ATOM    537  N7   DA I -46      43.681 134.497  54.991  1.00 88.44           N  
ATOM    538  C5   DA I -46      43.800 135.031  56.265  1.00 88.70           C  
ATOM    539  C6   DA I -46      43.659 134.466  57.543  1.00 88.46           C  
ATOM    540  N6   DA I -46      43.356 133.183  57.755  1.00 88.49           N  
ATOM    541  N1   DA I -46      43.844 135.272  58.610  1.00 88.68           N  
ATOM    542  C2   DA I -46      44.154 136.555  58.397  1.00 88.67           C  
ATOM    543  N3   DA I -46      44.317 137.203  57.245  1.00 89.77           N  
ATOM    544  C4   DA I -46      44.123 136.375  56.204  1.00 89.11           C  
ATOM    545  P    DG I -45      47.205 140.365  52.236  1.00 79.13           P  
ATOM    546  OP1  DG I -45      47.359 141.598  51.428  1.00 79.63           O  
ATOM    547  OP2  DG I -45      47.626 139.056  51.668  1.00 79.06           O  
ATOM    548  O5'  DG I -45      47.970 140.554  53.618  1.00 76.41           O  
ATOM    549  C5'  DG I -45      47.367 141.268  54.691  1.00 72.15           C  
ATOM    550  C4'  DG I -45      47.867 140.739  56.014  1.00 69.22           C  
ATOM    551  O4'  DG I -45      47.309 139.426  56.266  1.00 70.18           O  
ATOM    552  C3'  DG I -45      49.386 140.579  56.095  1.00 65.83           C  
ATOM    553  O3'  DG I -45      49.844 140.940  57.397  1.00 58.98           O  
ATOM    554  C2'  DG I -45      49.590 139.090  55.883  1.00 67.28           C  
ATOM    555  C1'  DG I -45      48.357 138.512  56.550  1.00 70.70           C  
ATOM    556  N9   DG I -45      47.958 137.199  56.054  1.00 73.78           N  
ATOM    557  C8   DG I -45      47.923 136.783  54.746  1.00 75.08           C  
ATOM    558  N7   DG I -45      47.528 135.547  54.612  1.00 75.66           N  
ATOM    559  C5   DG I -45      47.288 135.120  55.910  1.00 75.15           C  
ATOM    560  C6   DG I -45      46.850 133.865  56.394  1.00 75.92           C  
ATOM    561  O6   DG I -45      46.581 132.842  55.752  1.00 76.91           O  
ATOM    562  N1   DG I -45      46.735 133.864  57.779  1.00 75.29           N  
ATOM    563  C2   DG I -45      47.010 134.931  58.595  1.00 74.78           C  
ATOM    564  N2   DG I -45      46.825 134.733  59.906  1.00 74.29           N  
ATOM    565  N3   DG I -45      47.431 136.105  58.157  1.00 75.46           N  
ATOM    566  C4   DG I -45      47.545 136.128  56.812  1.00 74.64           C  
ATOM    567  P    DA I -44      51.220 141.745  57.557  1.00 55.05           P  
ATOM    568  OP1  DA I -44      50.869 143.177  57.408  1.00 57.09           O  
ATOM    569  OP2  DA I -44      52.260 141.148  56.678  1.00 52.38           O  
ATOM    570  O5'  DA I -44      51.636 141.474  59.070  1.00 55.51           O  
ATOM    571  C5'  DA I -44      50.678 141.567  60.124  1.00 54.42           C  
ATOM    572  C4'  DA I -44      50.940 140.503  61.165  1.00 55.56           C  
ATOM    573  O4'  DA I -44      50.545 139.196  60.675  1.00 56.50           O  
ATOM    574  C3'  DA I -44      52.406 140.369  61.582  1.00 54.98           C  
ATOM    575  O3'  DA I -44      52.504 140.173  62.992  1.00 50.83           O  
ATOM    576  C2'  DA I -44      52.866 139.117  60.855  1.00 56.66           C  
ATOM    577  C1'  DA I -44      51.608 138.277  60.874  1.00 58.03           C  
ATOM    578  N9   DA I -44      51.528 137.255  59.829  1.00 62.42           N  
ATOM    579  C8   DA I -44      51.953 137.335  58.525  1.00 64.02           C  
ATOM    580  N7   DA I -44      51.711 136.253  57.823  1.00 63.91           N  
ATOM    581  C5   DA I -44      51.092 135.402  58.727  1.00 64.65           C  
ATOM    582  C6   DA I -44      50.580 134.102  58.600  1.00 66.30           C  
ATOM    583  N6   DA I -44      50.605 133.404  57.463  1.00 67.55           N  
ATOM    584  N1   DA I -44      50.030 133.534  59.696  1.00 66.38           N  
ATOM    585  C2   DA I -44      50.000 134.234  60.834  1.00 65.25           C  
ATOM    586  N3   DA I -44      50.442 135.463  61.076  1.00 65.38           N  
ATOM    587  C4   DA I -44      50.983 136.000  59.968  1.00 64.20           C  
ATOM    588  P    DA I -43      53.920 139.786  63.638  1.00 49.94           P  
ATOM    589  OP1  DA I -43      54.060 140.555  64.899  1.00 47.88           O  
ATOM    590  OP2  DA I -43      54.975 139.873  62.598  1.00 49.65           O  
ATOM    591  O5'  DA I -43      53.766 138.247  64.001  1.00 50.05           O  
ATOM    592  C5'  DA I -43      52.692 137.793  64.813  1.00 52.45           C  
ATOM    593  C4'  DA I -43      52.813 136.305  65.031  1.00 55.06           C  
ATOM    594  O4'  DA I -43      52.573 135.616  63.782  1.00 54.72           O  
ATOM    595  C3'  DA I -43      54.198 135.863  65.498  1.00 55.66           C  
ATOM    596  O3'  DA I -43      54.072 134.816  66.459  1.00 56.70           O  
ATOM    597  C2'  DA I -43      54.856 135.358  64.228  1.00 54.55           C  
ATOM    598  C1'  DA I -43      53.677 134.788  63.467  1.00 57.12           C  
ATOM    599  N9   DA I -43      53.828 134.780  62.013  1.00 62.56           N  
ATOM    600  C8   DA I -43      54.200 135.811  61.186  1.00 63.93           C  
ATOM    601  N7   DA I -43      54.255 135.480  59.919  1.00 65.14           N  
ATOM    602  C5   DA I -43      53.893 134.140  59.910  1.00 66.54           C  
ATOM    603  C6   DA I -43      53.763 133.202  58.873  1.00 67.46           C  
ATOM    604  N6   DA I -43      53.992 133.479  57.587  1.00 68.86           N  
ATOM    605  N1   DA I -43      53.384 131.952  59.205  1.00 67.76           N  
ATOM    606  C2   DA I -43      53.149 131.673  60.491  1.00 67.31           C  
ATOM    607  N3   DA I -43      53.235 132.464  61.553  1.00 65.89           N  
ATOM    608  C4   DA I -43      53.620 133.699  61.191  1.00 65.68           C  
ATOM    609  P    DA I -42      55.338 134.399  67.352  1.00 57.97           P  
ATOM    610  OP1  DA I -42      54.923 134.471  68.774  1.00 58.49           O  
ATOM    611  OP2  DA I -42      56.527 135.156  66.896  1.00 60.01           O  
ATOM    612  O5'  DA I -42      55.556 132.872  66.974  1.00 62.50           O  
ATOM    613  C5'  DA I -42      54.479 131.944  67.042  1.00 66.69           C  
ATOM    614  C4'  DA I -42      54.909 130.624  66.452  1.00 70.91           C  
ATOM    615  O4'  DA I -42      54.891 130.695  65.007  1.00 71.17           O  
ATOM    616  C3'  DA I -42      56.332 130.231  66.842  1.00 73.12           C  
ATOM    617  O3'  DA I -42      56.408 128.828  67.086  1.00 77.70           O  
ATOM    618  C2'  DA I -42      57.152 130.613  65.623  1.00 72.61           C  
ATOM    619  C1'  DA I -42      56.175 130.389  64.484  1.00 72.92           C  
ATOM    620  N9   DA I -42      56.396 131.254  63.327  1.00 75.64           N  
ATOM    621  C8   DA I -42      56.606 132.610  63.323  1.00 76.47           C  
ATOM    622  N7   DA I -42      56.744 133.121  62.125  1.00 76.93           N  
ATOM    623  C5   DA I -42      56.623 132.027  61.281  1.00 77.55           C  
ATOM    624  C6   DA I -42      56.670 131.905  59.884  1.00 78.26           C  
ATOM    625  N6   DA I -42      56.868 132.934  59.058  1.00 78.40           N  
ATOM    626  N1   DA I -42      56.508 130.673  59.356  1.00 77.60           N  
ATOM    627  C2   DA I -42      56.318 129.642  60.187  1.00 77.81           C  
ATOM    628  N3   DA I -42      56.258 129.629  61.517  1.00 77.51           N  
ATOM    629  C4   DA I -42      56.416 130.869  62.008  1.00 77.39           C  
ATOM    630  P    DA I -41      57.569 128.250  68.028  1.00 80.34           P  
ATOM    631  OP1  DA I -41      56.913 127.413  69.064  1.00 80.73           O  
ATOM    632  OP2  DA I -41      58.469 129.358  68.441  1.00 80.07           O  
ATOM    633  O5'  DA I -41      58.370 127.289  67.049  1.00 82.72           O  
ATOM    634  C5'  DA I -41      57.751 126.123  66.525  1.00 87.66           C  
ATOM    635  C4'  DA I -41      58.624 125.511  65.457  1.00 91.13           C  
ATOM    636  O4'  DA I -41      58.589 126.336  64.266  1.00 92.69           O  
ATOM    637  C3'  DA I -41      60.095 125.395  65.850  1.00 92.41           C  
ATOM    638  O3'  DA I -41      60.621 124.154  65.372  1.00 93.84           O  
ATOM    639  C2'  DA I -41      60.738 126.584  65.157  1.00 93.29           C  
ATOM    640  C1'  DA I -41      59.908 126.702  63.893  1.00 93.82           C  
ATOM    641  N9   DA I -41      59.859 128.047  63.317  1.00 95.23           N  
ATOM    642  C8   DA I -41      59.960 129.252  63.969  1.00 95.88           C  
ATOM    643  N7   DA I -41      59.887 130.291  63.172  1.00 96.10           N  
ATOM    644  C5   DA I -41      59.726 129.734  61.912  1.00 96.01           C  
ATOM    645  C6   DA I -41      59.588 130.306  60.636  1.00 96.20           C  
ATOM    646  N6   DA I -41      59.593 131.621  60.410  1.00 96.72           N  
ATOM    647  N1   DA I -41      59.444 129.470  59.586  1.00 96.08           N  
ATOM    648  C2   DA I -41      59.440 128.153  59.812  1.00 95.74           C  
ATOM    649  N3   DA I -41      59.563 127.495  60.962  1.00 96.15           N  
ATOM    650  C4   DA I -41      59.705 128.353  61.986  1.00 95.83           C  
ATOM    651  P    DA I -40      62.166 124.050  64.957  1.00 94.84           P  
ATOM    652  OP1  DA I -40      62.505 122.605  64.881  1.00 95.32           O  
ATOM    653  OP2  DA I -40      62.967 124.946  65.830  1.00 95.01           O  
ATOM    654  O5'  DA I -40      62.174 124.632  63.477  1.00 95.19           O  
ATOM    655  C5'  DA I -40      61.447 123.976  62.443  1.00 96.27           C  
ATOM    656  C4'  DA I -40      62.246 123.992  61.163  1.00 97.29           C  
ATOM    657  O4'  DA I -40      62.198 125.314  60.577  1.00 97.02           O  
ATOM    658  C3'  DA I -40      63.724 123.671  61.368  1.00 98.18           C  
ATOM    659  O3'  DA I -40      64.217 122.905  60.268  1.00 98.96           O  
ATOM    660  C2'  DA I -40      64.376 125.042  61.413  1.00 97.75           C  
ATOM    661  C1'  DA I -40      63.507 125.850  60.463  1.00 97.18           C  
ATOM    662  N9   DA I -40      63.425 127.275  60.776  1.00 97.54           N  
ATOM    663  C8   DA I -40      63.220 127.859  62.001  1.00 97.72           C  
ATOM    664  N7   DA I -40      63.163 129.167  61.959  1.00 97.61           N  
ATOM    665  C5   DA I -40      63.350 129.466  60.617  1.00 97.67           C  
ATOM    666  C6   DA I -40      63.392 130.684  59.916  1.00 98.07           C  
ATOM    667  N6   DA I -40      63.239 131.877  60.494  1.00 98.55           N  
ATOM    668  N1   DA I -40      63.599 130.633  58.583  1.00 97.94           N  
ATOM    669  C2   DA I -40      63.749 129.436  58.004  1.00 97.99           C  
ATOM    670  N3   DA I -40      63.727 128.225  58.554  1.00 97.44           N  
ATOM    671  C4   DA I -40      63.520 128.310  59.879  1.00 97.51           C  
ATOM    672  P    DG I -39      65.607 122.115  60.407  1.00 98.84           P  
ATOM    673  OP1  DG I -39      65.309 120.674  60.199  1.00 98.70           O  
ATOM    674  OP2  DG I -39      66.277 122.552  61.659  1.00 98.02           O  
ATOM    675  O5'  DG I -39      66.447 122.644  59.161  1.00 98.53           O  
ATOM    676  C5'  DG I -39      65.888 122.615  57.848  1.00 98.33           C  
ATOM    677  C4'  DG I -39      66.526 123.671  56.975  1.00 98.36           C  
ATOM    678  O4'  DG I -39      66.184 124.993  57.462  1.00 99.06           O  
ATOM    679  C3'  DG I -39      68.055 123.632  56.909  1.00 98.01           C  
ATOM    680  O3'  DG I -39      68.483 123.938  55.577  1.00 96.40           O  
ATOM    681  C2'  DG I -39      68.470 124.749  57.848  1.00 98.82           C  
ATOM    682  C1'  DG I -39      67.373 125.757  57.587  1.00 99.40           C  
ATOM    683  N9   DG I -39      67.177 126.756  58.632  1.00100.44           N  
ATOM    684  C8   DG I -39      67.087 126.552  59.989  1.00100.99           C  
ATOM    685  N7   DG I -39      66.917 127.658  60.663  1.00100.64           N  
ATOM    686  C5   DG I -39      66.893 128.651  59.692  1.00101.34           C  
ATOM    687  C6   DG I -39      66.737 130.057  59.814  1.00101.07           C  
ATOM    688  O6   DG I -39      66.579 130.729  60.839  1.00100.53           O  
ATOM    689  N1   DG I -39      66.778 130.686  58.573  1.00101.53           N  
ATOM    690  C2   DG I -39      66.945 130.046  57.367  1.00102.05           C  
ATOM    691  N2   DG I -39      66.960 130.825  56.275  1.00102.07           N  
ATOM    692  N3   DG I -39      67.087 128.739  57.240  1.00101.97           N  
ATOM    693  C4   DG I -39      67.052 128.108  58.434  1.00101.44           C  
ATOM    694  P    DT I -38      70.048 124.137  55.266  1.00 96.54           P  
ATOM    695  OP1  DT I -38      70.322 123.466  53.969  1.00 96.05           O  
ATOM    696  OP2  DT I -38      70.835 123.762  56.470  1.00 96.12           O  
ATOM    697  O5'  DT I -38      70.198 125.707  55.044  1.00 95.65           O  
ATOM    698  C5'  DT I -38      69.606 126.335  53.909  1.00 94.17           C  
ATOM    699  C4'  DT I -38      70.278 127.658  53.622  1.00 91.94           C  
ATOM    700  O4'  DT I -38      69.850 128.665  54.574  1.00 91.77           O  
ATOM    701  C3'  DT I -38      71.806 127.633  53.682  1.00 90.18           C  
ATOM    702  O3'  DT I -38      72.344 128.411  52.614  1.00 87.84           O  
ATOM    703  C2'  DT I -38      72.114 128.295  55.014  1.00 90.46           C  
ATOM    704  C1'  DT I -38      70.989 129.307  55.124  1.00 90.77           C  
ATOM    705  N1   DT I -38      70.659 129.734  56.500  1.00 90.18           N  
ATOM    706  C2   DT I -38      70.434 131.077  56.721  1.00 89.58           C  
ATOM    707  O2   DT I -38      70.488 131.917  55.836  1.00 89.88           O  
ATOM    708  N3   DT I -38      70.141 131.402  58.022  1.00 88.33           N  
ATOM    709  C4   DT I -38      70.050 130.541  59.098  1.00 88.18           C  
ATOM    710  O4   DT I -38      69.774 130.980  60.212  1.00 86.43           O  
ATOM    711  C5   DT I -38      70.296 129.149  58.795  1.00 88.39           C  
ATOM    712  C7   DT I -38      70.220 128.144  59.900  1.00 88.36           C  
ATOM    713  C6   DT I -38      70.583 128.820  57.529  1.00 88.95           C  
ATOM    714  P    DG I -37      73.932 128.450  52.377  1.00 86.41           P  
ATOM    715  OP1  DG I -37      74.191 127.968  50.998  1.00 87.45           O  
ATOM    716  OP2  DG I -37      74.622 127.802  53.523  1.00 86.52           O  
ATOM    717  O5'  DG I -37      74.273 130.002  52.417  1.00 85.55           O  
ATOM    718  C5'  DG I -37      73.529 130.934  51.637  1.00 84.22           C  
ATOM    719  C4'  DG I -37      73.901 132.343  52.030  1.00 82.32           C  
ATOM    720  O4'  DG I -37      73.459 132.598  53.385  1.00 82.33           O  
ATOM    721  C3'  DG I -37      75.408 132.596  52.031  1.00 81.30           C  
ATOM    722  O3'  DG I -37      75.648 133.965  51.724  1.00 79.02           O  
ATOM    723  C2'  DG I -37      75.783 132.358  53.481  1.00 82.54           C  
ATOM    724  C1'  DG I -37      74.577 132.947  54.186  1.00 82.84           C  
ATOM    725  N9   DG I -37      74.336 132.455  55.536  1.00 83.22           N  
ATOM    726  C8   DG I -37      74.695 131.240  56.063  1.00 83.53           C  
ATOM    727  N7   DG I -37      74.337 131.098  57.310  1.00 84.75           N  
ATOM    728  C5   DG I -37      73.703 132.291  57.622  1.00 84.87           C  
ATOM    729  C6   DG I -37      73.100 132.726  58.830  1.00 86.02           C  
ATOM    730  O6   DG I -37      72.998 132.119  59.902  1.00 87.36           O  
ATOM    731  N1   DG I -37      72.580 134.010  58.708  1.00 86.03           N  
ATOM    732  C2   DG I -37      72.630 134.776  57.571  1.00 85.29           C  
ATOM    733  N2   DG I -37      72.081 135.994  57.650  1.00 85.08           N  
ATOM    734  N3   DG I -37      73.182 134.379  56.439  1.00 85.16           N  
ATOM    735  C4   DG I -37      73.696 133.137  56.537  1.00 84.15           C  
ATOM    736  P    DT I -36      76.070 134.393  50.240  1.00 77.06           P  
ATOM    737  OP1  DT I -36      74.994 133.954  49.318  1.00 77.11           O  
ATOM    738  OP2  DT I -36      77.471 133.974  49.990  1.00 78.11           O  
ATOM    739  O5'  DT I -36      76.027 135.979  50.322  1.00 76.37           O  
ATOM    740  C5'  DT I -36      74.836 136.648  50.721  1.00 72.99           C  
ATOM    741  C4'  DT I -36      75.103 137.537  51.913  1.00 71.32           C  
ATOM    742  O4'  DT I -36      75.087 136.807  53.163  1.00 70.20           O  
ATOM    743  C3'  DT I -36      76.434 138.290  51.882  1.00 70.39           C  
ATOM    744  O3'  DT I -36      76.215 139.617  52.348  1.00 69.97           O  
ATOM    745  C2'  DT I -36      77.262 137.557  52.921  1.00 70.80           C  
ATOM    746  C1'  DT I -36      76.182 137.261  53.934  1.00 71.47           C  
ATOM    747  N1   DT I -36      76.482 136.260  54.973  1.00 73.21           N  
ATOM    748  C2   DT I -36      75.894 136.453  56.200  1.00 73.38           C  
ATOM    749  O2   DT I -36      75.180 137.411  56.449  1.00 73.45           O  
ATOM    750  N3   DT I -36      76.178 135.488  57.132  1.00 74.66           N  
ATOM    751  C4   DT I -36      76.982 134.380  56.966  1.00 75.15           C  
ATOM    752  O4   DT I -36      77.132 133.591  57.894  1.00 74.68           O  
ATOM    753  C5   DT I -36      77.590 134.250  55.659  1.00 74.85           C  
ATOM    754  C7   DT I -36      78.505 133.096  55.398  1.00 76.06           C  
ATOM    755  C6   DT I -36      77.307 135.181  54.736  1.00 74.12           C  
ATOM    756  P    DG I -35      76.164 140.824  51.301  1.00 69.50           P  
ATOM    757  OP1  DG I -35      75.000 140.564  50.413  1.00 69.00           O  
ATOM    758  OP2  DG I -35      77.519 140.992  50.713  1.00 70.63           O  
ATOM    759  O5'  DG I -35      75.825 142.087  52.205  1.00 67.81           O  
ATOM    760  C5'  DG I -35      74.497 142.300  52.674  1.00 65.34           C  
ATOM    761  C4'  DG I -35      74.519 142.774  54.108  1.00 63.46           C  
ATOM    762  O4'  DG I -35      75.093 141.747  54.949  1.00 63.64           O  
ATOM    763  C3'  DG I -35      75.342 144.032  54.371  1.00 61.17           C  
ATOM    764  O3'  DG I -35      74.688 144.778  55.398  1.00 60.11           O  
ATOM    765  C2'  DG I -35      76.671 143.483  54.854  1.00 60.68           C  
ATOM    766  C1'  DG I -35      76.252 142.234  55.608  1.00 61.02           C  
ATOM    767  N9   DG I -35      77.238 141.160  55.602  1.00 61.17           N  
ATOM    768  C8   DG I -35      78.035 140.768  54.553  1.00 61.76           C  
ATOM    769  N7   DG I -35      78.795 139.746  54.841  1.00 61.71           N  
ATOM    770  C5   DG I -35      78.483 139.449  56.160  1.00 63.23           C  
ATOM    771  C6   DG I -35      78.974 138.429  57.013  1.00 64.67           C  
ATOM    772  O6   DG I -35      79.809 137.551  56.764  1.00 66.55           O  
ATOM    773  N1   DG I -35      78.388 138.491  58.274  1.00 65.06           N  
ATOM    774  C2   DG I -35      77.446 139.413  58.664  1.00 63.92           C  
ATOM    775  N2   DG I -35      76.995 139.308  59.925  1.00 64.05           N  
ATOM    776  N3   DG I -35      76.979 140.367  57.877  1.00 63.31           N  
ATOM    777  C4   DG I -35      77.534 140.324  56.648  1.00 62.19           C  
ATOM    778  P    DT I -34      75.365 146.105  55.984  1.00 56.54           P  
ATOM    779  OP1  DT I -34      74.279 147.111  56.080  1.00 59.36           O  
ATOM    780  OP2  DT I -34      76.599 146.421  55.225  1.00 59.09           O  
ATOM    781  O5'  DT I -34      75.778 145.677  57.453  1.00 57.94           O  
ATOM    782  C5'  DT I -34      74.876 144.930  58.260  1.00 62.39           C  
ATOM    783  C4'  DT I -34      75.528 144.589  59.576  1.00 64.48           C  
ATOM    784  O4'  DT I -34      76.503 143.529  59.398  1.00 63.75           O  
ATOM    785  C3'  DT I -34      76.291 145.772  60.165  1.00 65.33           C  
ATOM    786  O3'  DT I -34      76.121 145.810  61.578  1.00 66.76           O  
ATOM    787  C2'  DT I -34      77.735 145.467  59.813  1.00 64.98           C  
ATOM    788  C1'  DT I -34      77.754 143.954  59.911  1.00 64.66           C  
ATOM    789  N1   DT I -34      78.820 143.286  59.142  1.00 65.80           N  
ATOM    790  C2   DT I -34      79.284 142.075  59.607  1.00 65.93           C  
ATOM    791  O2   DT I -34      78.843 141.534  60.611  1.00 65.57           O  
ATOM    792  N3   DT I -34      80.286 141.519  58.850  1.00 64.61           N  
ATOM    793  C4   DT I -34      80.853 142.042  57.703  1.00 65.84           C  
ATOM    794  O4   DT I -34      81.750 141.433  57.133  1.00 66.38           O  
ATOM    795  C5   DT I -34      80.314 143.308  57.269  1.00 65.72           C  
ATOM    796  C7   DT I -34      80.862 143.943  56.032  1.00 65.05           C  
ATOM    797  C6   DT I -34      79.338 143.860  58.001  1.00 66.21           C  
ATOM    798  P    DC I -33      76.763 147.016  62.414  1.00 68.04           P  
ATOM    799  OP1  DC I -33      75.697 147.516  63.312  1.00 70.56           O  
ATOM    800  OP2  DC I -33      77.443 147.951  61.483  1.00 68.40           O  
ATOM    801  O5'  DC I -33      77.886 146.308  63.287  1.00 70.88           O  
ATOM    802  C5'  DC I -33      77.567 145.197  64.118  1.00 74.25           C  
ATOM    803  C4'  DC I -33      78.808 144.716  64.828  1.00 75.75           C  
ATOM    804  O4'  DC I -33      79.665 143.997  63.907  1.00 76.31           O  
ATOM    805  C3'  DC I -33      79.656 145.851  65.402  1.00 77.32           C  
ATOM    806  O3'  DC I -33      80.144 145.496  66.694  1.00 77.92           O  
ATOM    807  C2'  DC I -33      80.801 145.975  64.412  1.00 77.56           C  
ATOM    808  C1'  DC I -33      80.974 144.540  63.952  1.00 78.45           C  
ATOM    809  N1   DC I -33      81.588 144.372  62.624  1.00 80.29           N  
ATOM    810  C2   DC I -33      81.790 143.078  62.137  1.00 80.79           C  
ATOM    811  O2   DC I -33      81.415 142.117  62.822  1.00 81.29           O  
ATOM    812  N3   DC I -33      82.381 142.907  60.933  1.00 80.97           N  
ATOM    813  C4   DC I -33      82.758 143.967  60.219  1.00 81.74           C  
ATOM    814  N4   DC I -33      83.340 143.749  59.035  1.00 82.41           N  
ATOM    815  C5   DC I -33      82.554 145.301  60.683  1.00 81.31           C  
ATOM    816  C6   DC I -33      81.971 145.455  61.880  1.00 81.38           C  
ATOM    817  P    DA I -32      81.121 146.500  67.475  1.00 79.03           P  
ATOM    818  OP1  DA I -32      80.551 146.707  68.830  1.00 79.85           O  
ATOM    819  OP2  DA I -32      81.412 147.673  66.613  1.00 77.72           O  
ATOM    820  O5'  DA I -32      82.461 145.658  67.608  1.00 79.99           O  
ATOM    821  C5'  DA I -32      82.412 144.254  67.834  1.00 80.30           C  
ATOM    822  C4'  DA I -32      83.775 143.646  67.608  1.00 81.16           C  
ATOM    823  O4'  DA I -32      84.069 143.591  66.190  1.00 80.07           O  
ATOM    824  C3'  DA I -32      84.917 144.431  68.253  1.00 81.80           C  
ATOM    825  O3'  DA I -32      85.852 143.529  68.846  1.00 83.88           O  
ATOM    826  C2'  DA I -32      85.547 145.169  67.085  1.00 79.92           C  
ATOM    827  C1'  DA I -32      85.319 144.208  65.932  1.00 80.39           C  
ATOM    828  N9   DA I -32      85.245 144.841  64.614  1.00 80.63           N  
ATOM    829  C8   DA I -32      84.628 146.019  64.278  1.00 80.49           C  
ATOM    830  N7   DA I -32      84.741 146.334  63.011  1.00 80.53           N  
ATOM    831  C5   DA I -32      85.481 145.290  62.473  1.00 81.10           C  
ATOM    832  C6   DA I -32      85.944 145.030  61.170  1.00 81.41           C  
ATOM    833  N6   DA I -32      85.714 145.832  60.127  1.00 81.00           N  
ATOM    834  N1   DA I -32      86.662 143.903  60.974  1.00 80.99           N  
ATOM    835  C2   DA I -32      86.889 143.098  62.018  1.00 79.34           C  
ATOM    836  N3   DA I -32      86.506 143.232  63.284  1.00 79.64           N  
ATOM    837  C4   DA I -32      85.798 144.363  63.449  1.00 80.29           C  
ATOM    838  P    DA I -31      86.943 144.083  69.884  1.00 84.22           P  
ATOM    839  OP1  DA I -31      86.945 143.155  71.041  1.00 83.84           O  
ATOM    840  OP2  DA I -31      86.713 145.535  70.105  1.00 84.68           O  
ATOM    841  O5'  DA I -31      88.309 143.905  69.091  1.00 84.51           O  
ATOM    842  C5'  DA I -31      88.690 142.625  68.599  1.00 86.77           C  
ATOM    843  C4'  DA I -31      89.844 142.757  67.635  1.00 88.35           C  
ATOM    844  O4'  DA I -31      89.388 143.215  66.337  1.00 88.64           O  
ATOM    845  C3'  DA I -31      90.922 143.744  68.083  1.00 89.46           C  
ATOM    846  O3'  DA I -31      92.212 143.202  67.803  1.00 92.25           O  
ATOM    847  C2'  DA I -31      90.670 144.954  67.203  1.00 89.03           C  
ATOM    848  C1'  DA I -31      90.205 144.295  65.920  1.00 88.99           C  
ATOM    849  N9   DA I -31      89.422 145.153  65.029  1.00 89.59           N  
ATOM    850  C8   DA I -31      88.362 145.968  65.339  1.00 89.99           C  
ATOM    851  N7   DA I -31      87.888 146.634  64.314  1.00 89.58           N  
ATOM    852  C5   DA I -31      88.688 146.226  63.254  1.00 89.92           C  
ATOM    853  C6   DA I -31      88.702 146.571  61.889  1.00 89.55           C  
ATOM    854  N6   DA I -31      87.858 147.445  61.335  1.00 88.60           N  
ATOM    855  N1   DA I -31      89.626 145.980  61.102  1.00 89.60           N  
ATOM    856  C2   DA I -31      90.474 145.106  61.656  1.00 89.99           C  
ATOM    857  N3   DA I -31      90.563 144.704  62.922  1.00 90.56           N  
ATOM    858  C4   DA I -31      89.631 145.309  63.679  1.00 89.97           C  
ATOM    859  P    DA I -30      93.524 143.933  68.370  1.00 94.31           P  
ATOM    860  OP1  DA I -30      94.206 142.962  69.264  1.00 94.23           O  
ATOM    861  OP2  DA I -30      93.147 145.272  68.890  1.00 93.90           O  
ATOM    862  O5'  DA I -30      94.417 144.131  67.068  1.00 95.15           O  
ATOM    863  C5'  DA I -30      94.665 143.034  66.192  1.00 98.22           C  
ATOM    864  C4'  DA I -30      95.083 143.538  64.832  1.00100.23           C  
ATOM    865  O4'  DA I -30      93.976 144.249  64.230  1.00100.66           O  
ATOM    866  C3'  DA I -30      96.248 144.526  64.874  1.00101.96           C  
ATOM    867  O3'  DA I -30      97.111 144.327  63.757  1.00104.61           O  
ATOM    868  C2'  DA I -30      95.569 145.877  64.768  1.00101.87           C  
ATOM    869  C1'  DA I -30      94.376 145.565  63.887  1.00101.94           C  
ATOM    870  N9   DA I -30      93.241 146.458  64.111  1.00102.74           N  
ATOM    871  C8   DA I -30      92.631 146.761  65.303  1.00103.23           C  
ATOM    872  N7   DA I -30      91.656 147.631  65.192  1.00103.33           N  
ATOM    873  C5   DA I -30      91.615 147.914  63.835  1.00103.37           C  
ATOM    874  C6   DA I -30      90.802 148.768  63.072  1.00103.38           C  
ATOM    875  N6   DA I -30      89.838 149.530  63.591  1.00103.01           N  
ATOM    876  N1   DA I -30      91.018 148.813  61.740  1.00103.63           N  
ATOM    877  C2   DA I -30      91.989 148.051  61.220  1.00103.60           C  
ATOM    878  N3   DA I -30      92.820 147.212  61.833  1.00103.23           N  
ATOM    879  C4   DA I -30      92.578 147.189  63.155  1.00103.19           C  
ATOM    880  P    DC I -29      98.467 145.182  63.640  1.00107.08           P  
ATOM    881  OP1  DC I -29      99.522 144.269  63.128  1.00107.29           O  
ATOM    882  OP2  DC I -29      98.680 145.906  64.921  1.00107.16           O  
ATOM    883  O5'  DC I -29      98.141 146.248  62.503  1.00106.65           O  
ATOM    884  C5'  DC I -29      98.098 145.855  61.134  1.00106.73           C  
ATOM    885  C4'  DC I -29      98.280 147.058  60.239  1.00106.64           C  
ATOM    886  O4'  DC I -29      97.046 147.812  60.143  1.00106.12           O  
ATOM    887  C3'  DC I -29      99.346 148.046  60.716  1.00106.92           C  
ATOM    888  O3'  DC I -29     100.112 148.514  59.602  1.00107.35           O  
ATOM    889  C2'  DC I -29      98.533 149.167  61.337  1.00106.65           C  
ATOM    890  C1'  DC I -29      97.290 149.170  60.472  1.00106.08           C  
ATOM    891  N1   DC I -29      96.095 149.698  61.148  1.00105.95           N  
ATOM    892  C2   DC I -29      95.423 150.785  60.578  1.00105.46           C  
ATOM    893  O2   DC I -29      95.860 151.274  59.526  1.00104.43           O  
ATOM    894  N3   DC I -29      94.320 151.276  61.193  1.00105.33           N  
ATOM    895  C4   DC I -29      93.889 150.724  62.331  1.00105.02           C  
ATOM    896  N4   DC I -29      92.799 151.235  62.900  1.00104.60           N  
ATOM    897  C5   DC I -29      94.559 149.620  62.936  1.00105.02           C  
ATOM    898  C6   DC I -29      95.645 149.141  62.314  1.00105.45           C  
ATOM    899  P    DT I -28     100.818 149.955  59.662  1.00107.58           P  
ATOM    900  OP1  DT I -28     101.917 149.961  58.662  1.00107.64           O  
ATOM    901  OP2  DT I -28     101.111 150.306  61.077  1.00107.87           O  
ATOM    902  O5'  DT I -28      99.681 150.932  59.130  1.00106.97           O  
ATOM    903  C5'  DT I -28      99.127 150.762  57.824  1.00105.66           C  
ATOM    904  C4'  DT I -28      98.691 152.099  57.272  1.00104.08           C  
ATOM    905  O4'  DT I -28      97.527 152.562  57.998  1.00103.65           O  
ATOM    906  C3'  DT I -28      99.752 153.184  57.434  1.00102.58           C  
ATOM    907  O3'  DT I -28      99.738 154.074  56.316  1.00 99.79           O  
ATOM    908  C2'  DT I -28      99.333 153.894  58.709  1.00102.72           C  
ATOM    909  C1'  DT I -28      97.817 153.766  58.691  1.00103.10           C  
ATOM    910  N1   DT I -28      97.197 153.671  60.025  1.00102.89           N  
ATOM    911  C2   DT I -28      95.987 154.290  60.220  1.00102.91           C  
ATOM    912  O2   DT I -28      95.423 154.933  59.350  1.00103.45           O  
ATOM    913  N3   DT I -28      95.461 154.135  61.479  1.00102.51           N  
ATOM    914  C4   DT I -28      96.018 153.444  62.539  1.00102.56           C  
ATOM    915  O4   DT I -28      95.423 153.383  63.610  1.00102.12           O  
ATOM    916  C5   DT I -28      97.298 152.833  62.269  1.00102.81           C  
ATOM    917  C7   DT I -28      97.985 152.078  63.361  1.00102.77           C  
ATOM    918  C6   DT I -28      97.816 152.973  61.042  1.00103.24           C  
ATOM    919  P    DG I -27     101.103 154.367  55.521  1.00 97.83           P  
ATOM    920  OP1  DG I -27     101.258 153.309  54.488  1.00 97.37           O  
ATOM    921  OP2  DG I -27     102.184 154.588  56.516  1.00 97.48           O  
ATOM    922  O5'  DG I -27     100.816 155.744  54.776  1.00 96.41           O  
ATOM    923  C5'  DG I -27      99.697 155.882  53.900  1.00 92.57           C  
ATOM    924  C4'  DG I -27      98.945 157.152  54.218  1.00 89.59           C  
ATOM    925  O4'  DG I -27      98.360 157.040  55.538  1.00 89.01           O  
ATOM    926  C3'  DG I -27      99.815 158.407  54.254  1.00 87.87           C  
ATOM    927  O3'  DG I -27      99.046 159.523  53.807  1.00 86.26           O  
ATOM    928  C2'  DG I -27     100.122 158.561  55.732  1.00 87.50           C  
ATOM    929  C1'  DG I -27      98.818 158.103  56.355  1.00 88.01           C  
ATOM    930  N9   DG I -27      98.915 157.607  57.724  1.00 87.89           N  
ATOM    931  C8   DG I -27     100.013 157.053  58.334  1.00 87.85           C  
ATOM    932  N7   DG I -27      99.789 156.704  59.572  1.00 87.37           N  
ATOM    933  C5   DG I -27      98.463 157.048  59.794  1.00 87.54           C  
ATOM    934  C6   DG I -27      97.658 156.911  60.956  1.00 87.32           C  
ATOM    935  O6   DG I -27      97.965 156.441  62.056  1.00 86.81           O  
ATOM    936  N1   DG I -27      96.369 157.393  60.745  1.00 87.53           N  
ATOM    937  C2   DG I -27      95.911 157.938  59.572  1.00 87.51           C  
ATOM    938  N2   DG I -27      94.635 158.354  59.571  1.00 86.90           N  
ATOM    939  N3   DG I -27      96.650 158.069  58.480  1.00 87.64           N  
ATOM    940  C4   DG I -27      97.908 157.607  58.663  1.00 87.99           C  
ATOM    941  P    DC I -26      99.339 160.169  52.367  1.00 86.44           P  
ATOM    942  OP1  DC I -26      99.374 159.049  51.392  1.00 86.92           O  
ATOM    943  OP2  DC I -26     100.497 161.097  52.464  1.00 85.93           O  
ATOM    944  O5'  DC I -26      98.034 161.035  52.081  1.00 85.31           O  
ATOM    945  C5'  DC I -26      96.805 160.407  51.720  1.00 82.73           C  
ATOM    946  C4'  DC I -26      95.655 161.010  52.493  1.00 80.87           C  
ATOM    947  O4'  DC I -26      95.787 160.699  53.900  1.00 80.74           O  
ATOM    948  C3'  DC I -26      95.534 162.530  52.410  1.00 79.28           C  
ATOM    949  O3'  DC I -26      94.151 162.884  52.365  1.00 77.93           O  
ATOM    950  C2'  DC I -26      96.172 163.003  53.704  1.00 79.00           C  
ATOM    951  C1'  DC I -26      95.804 161.892  54.671  1.00 80.76           C  
ATOM    952  N1   DC I -26      96.752 161.688  55.780  1.00 82.24           N  
ATOM    953  C2   DC I -26      96.256 161.557  57.088  1.00 83.18           C  
ATOM    954  O2   DC I -26      95.037 161.665  57.287  1.00 82.64           O  
ATOM    955  N3   DC I -26      97.120 161.315  58.099  1.00 84.12           N  
ATOM    956  C4   DC I -26      98.427 161.209  57.849  1.00 83.99           C  
ATOM    957  N4   DC I -26      99.239 160.934  58.873  1.00 84.21           N  
ATOM    958  C5   DC I -26      98.959 161.371  56.536  1.00 83.32           C  
ATOM    959  C6   DC I -26      98.094 161.607  55.542  1.00 82.67           C  
ATOM    960  P    DG I -25      93.717 164.352  51.877  1.00 77.82           P  
ATOM    961  OP1  DG I -25      92.354 164.235  51.291  1.00 77.77           O  
ATOM    962  OP2  DG I -25      94.817 164.931  51.066  1.00 77.15           O  
ATOM    963  O5'  DG I -25      93.608 165.173  53.237  1.00 74.86           O  
ATOM    964  C5'  DG I -25      92.708 164.758  54.259  1.00 69.99           C  
ATOM    965  C4'  DG I -25      92.949 165.544  55.525  1.00 68.16           C  
ATOM    966  O4'  DG I -25      94.049 165.000  56.291  1.00 68.68           O  
ATOM    967  C3'  DG I -25      93.256 167.028  55.323  1.00 65.51           C  
ATOM    968  O3'  DG I -25      92.561 167.780  56.318  1.00 61.48           O  
ATOM    969  C2'  DG I -25      94.749 167.107  55.595  1.00 67.96           C  
ATOM    970  C1'  DG I -25      94.899 166.063  56.687  1.00 71.20           C  
ATOM    971  N9   DG I -25      96.239 165.520  56.902  1.00 74.31           N  
ATOM    972  C8   DG I -25      97.209 165.282  55.958  1.00 76.12           C  
ATOM    973  N7   DG I -25      98.304 164.778  56.462  1.00 76.55           N  
ATOM    974  C5   DG I -25      98.044 164.680  57.823  1.00 76.51           C  
ATOM    975  C6   DG I -25      98.861 164.206  58.887  1.00 77.28           C  
ATOM    976  O6   DG I -25     100.016 163.769  58.838  1.00 78.82           O  
ATOM    977  N1   DG I -25      98.202 164.277  60.110  1.00 76.69           N  
ATOM    978  C2   DG I -25      96.928 164.748  60.292  1.00 76.94           C  
ATOM    979  N2   DG I -25      96.468 164.729  61.551  1.00 76.06           N  
ATOM    980  N3   DG I -25      96.158 165.200  59.311  1.00 77.28           N  
ATOM    981  C4   DG I -25      96.776 165.135  58.112  1.00 75.83           C  
ATOM    982  P    DC I -24      90.979 168.033  56.173  1.00 57.31           P  
ATOM    983  OP1  DC I -24      90.340 166.735  55.814  1.00 53.00           O  
ATOM    984  OP2  DC I -24      90.753 169.231  55.325  1.00 55.37           O  
ATOM    985  O5'  DC I -24      90.533 168.403  57.653  1.00 56.27           O  
ATOM    986  C5'  DC I -24      90.299 167.384  58.618  1.00 51.35           C  
ATOM    987  C4'  DC I -24      90.935 167.764  59.933  1.00 49.62           C  
ATOM    988  O4'  DC I -24      92.361 167.503  59.890  1.00 50.61           O  
ATOM    989  C3'  DC I -24      90.779 169.244  60.286  1.00 48.87           C  
ATOM    990  O3'  DC I -24      90.403 169.417  61.648  1.00 45.69           O  
ATOM    991  C2'  DC I -24      92.164 169.816  60.057  1.00 49.93           C  
ATOM    992  C1'  DC I -24      93.053 168.635  60.379  1.00 51.97           C  
ATOM    993  N1   DC I -24      94.375 168.685  59.738  1.00 53.70           N  
ATOM    994  C2   DC I -24      95.491 168.231  60.453  1.00 55.50           C  
ATOM    995  O2   DC I -24      95.326 167.751  61.587  1.00 54.88           O  
ATOM    996  N3   DC I -24      96.719 168.320  59.888  1.00 56.21           N  
ATOM    997  C4   DC I -24      96.851 168.823  58.658  1.00 56.37           C  
ATOM    998  N4   DC I -24      98.076 168.898  58.139  1.00 56.95           N  
ATOM    999  C5   DC I -24      95.731 169.271  57.902  1.00 56.70           C  
ATOM   1000  C6   DC I -24      94.523 169.184  58.475  1.00 55.55           C  
ATOM   1001  P    DT I -23      90.214 170.900  62.231  1.00 46.26           P  
ATOM   1002  OP1  DT I -23      88.867 170.997  62.838  1.00 41.72           O  
ATOM   1003  OP2  DT I -23      90.629 171.875  61.194  1.00 46.69           O  
ATOM   1004  O5'  DT I -23      91.286 170.968  63.402  1.00 52.32           O  
ATOM   1005  C5'  DT I -23      91.421 169.889  64.322  1.00 56.45           C  
ATOM   1006  C4'  DT I -23      92.558 170.164  65.274  1.00 60.63           C  
ATOM   1007  O4'  DT I -23      93.817 170.044  64.569  1.00 62.26           O  
ATOM   1008  C3'  DT I -23      92.523 171.574  65.857  1.00 63.18           C  
ATOM   1009  O3'  DT I -23      92.873 171.547  67.242  1.00 66.57           O  
ATOM   1010  C2'  DT I -23      93.548 172.331  65.030  1.00 63.12           C  
ATOM   1011  C1'  DT I -23      94.557 171.251  64.677  1.00 64.88           C  
ATOM   1012  N1   DT I -23      95.285 171.454  63.403  1.00 66.45           N  
ATOM   1013  C2   DT I -23      96.470 170.775  63.231  1.00 69.03           C  
ATOM   1014  O2   DT I -23      96.946 170.041  64.084  1.00 71.71           O  
ATOM   1015  N3   DT I -23      97.087 170.991  62.022  1.00 69.05           N  
ATOM   1016  C4   DT I -23      96.651 171.805  60.997  1.00 69.91           C  
ATOM   1017  O4   DT I -23      97.309 171.891  59.959  1.00 69.47           O  
ATOM   1018  C5   DT I -23      95.409 172.503  61.252  1.00 68.91           C  
ATOM   1019  C7   DT I -23      94.870 173.427  60.208  1.00 67.94           C  
ATOM   1020  C6   DT I -23      94.795 172.291  62.424  1.00 67.66           C  
ATOM   1021  P    DA I -22      92.918 172.918  68.073  1.00 68.91           P  
ATOM   1022  OP1  DA I -22      92.501 172.622  69.468  1.00 69.26           O  
ATOM   1023  OP2  DA I -22      92.210 173.969  67.302  1.00 70.27           O  
ATOM   1024  O5'  DA I -22      94.463 173.275  68.064  1.00 70.60           O  
ATOM   1025  C5'  DA I -22      95.413 172.349  68.567  1.00 74.62           C  
ATOM   1026  C4'  DA I -22      96.767 173.005  68.644  1.00 78.19           C  
ATOM   1027  O4'  DA I -22      97.394 172.989  67.339  1.00 77.71           O  
ATOM   1028  C3'  DA I -22      96.692 174.472  69.072  1.00 80.41           C  
ATOM   1029  O3'  DA I -22      97.718 174.770  70.024  1.00 84.08           O  
ATOM   1030  C2'  DA I -22      96.887 175.228  67.768  1.00 79.43           C  
ATOM   1031  C1'  DA I -22      97.811 174.302  67.000  1.00 79.25           C  
ATOM   1032  N9   DA I -22      97.754 174.434  65.544  1.00 80.01           N  
ATOM   1033  C8   DA I -22      96.737 174.947  64.780  1.00 80.69           C  
ATOM   1034  N7   DA I -22      96.981 174.928  63.492  1.00 80.76           N  
ATOM   1035  C5   DA I -22      98.246 174.365  63.401  1.00 80.56           C  
ATOM   1036  C6   DA I -22      99.074 174.070  62.303  1.00 80.37           C  
ATOM   1037  N6   DA I -22      98.733 174.302  61.034  1.00 80.18           N  
ATOM   1038  N1   DA I -22     100.280 173.519  62.556  1.00 80.38           N  
ATOM   1039  C2   DA I -22     100.618 173.279  63.828  1.00 81.26           C  
ATOM   1040  N3   DA I -22      99.925 173.506  64.944  1.00 81.58           N  
ATOM   1041  C4   DA I -22      98.734 174.058  64.658  1.00 80.70           C  
ATOM   1042  P    DT I -21      98.301 176.261  70.124  1.00 86.48           P  
ATOM   1043  OP1  DT I -21      99.181 176.322  71.319  1.00 86.88           O  
ATOM   1044  OP2  DT I -21      97.188 177.233  69.978  1.00 87.23           O  
ATOM   1045  O5'  DT I -21      99.231 176.355  68.840  1.00 89.22           O  
ATOM   1046  C5'  DT I -21     100.449 175.625  68.782  1.00 92.40           C  
ATOM   1047  C4'  DT I -21     101.516 176.486  68.158  1.00 95.01           C  
ATOM   1048  O4'  DT I -21     101.542 176.315  66.720  1.00 96.29           O  
ATOM   1049  C3'  DT I -21     101.274 177.974  68.411  1.00 96.24           C  
ATOM   1050  O3'  DT I -21     102.504 178.622  68.703  1.00 97.22           O  
ATOM   1051  C2'  DT I -21     100.730 178.469  67.085  1.00 96.88           C  
ATOM   1052  C1'  DT I -21     101.478 177.588  66.105  1.00 97.90           C  
ATOM   1053  N1   DT I -21     100.838 177.436  64.786  1.00 99.66           N  
ATOM   1054  C2   DT I -21     101.634 177.070  63.726  1.00100.60           C  
ATOM   1055  O2   DT I -21     102.825 176.822  63.840  1.00100.38           O  
ATOM   1056  N3   DT I -21     100.982 177.002  62.520  1.00101.48           N  
ATOM   1057  C4   DT I -21      99.645 177.250  62.279  1.00101.53           C  
ATOM   1058  O4   DT I -21      99.203 177.166  61.137  1.00102.13           O  
ATOM   1059  C5   DT I -21      98.864 177.602  63.441  1.00101.52           C  
ATOM   1060  C7   DT I -21      97.403 177.875  63.276  1.00102.20           C  
ATOM   1061  C6   DT I -21      99.490 177.673  64.621  1.00100.60           C  
ATOM   1062  P    DC I -20     102.517 180.184  69.065  1.00 97.04           P  
ATOM   1063  OP1  DC I -20     102.707 180.305  70.533  1.00 97.82           O  
ATOM   1064  OP2  DC I -20     101.373 180.868  68.412  1.00 96.98           O  
ATOM   1065  O5'  DC I -20     103.846 180.658  68.346  1.00 97.64           O  
ATOM   1066  C5'  DC I -20     104.769 179.687  67.868  1.00 99.75           C  
ATOM   1067  C4'  DC I -20     105.211 180.041  66.470  1.00101.36           C  
ATOM   1068  O4'  DC I -20     104.217 179.668  65.484  1.00101.32           O  
ATOM   1069  C3'  DC I -20     105.444 181.539  66.299  1.00102.19           C  
ATOM   1070  O3'  DC I -20     106.651 181.756  65.585  1.00103.21           O  
ATOM   1071  C2'  DC I -20     104.252 181.994  65.479  1.00102.15           C  
ATOM   1072  C1'  DC I -20     104.002 180.772  64.621  1.00102.04           C  
ATOM   1073  N1   DC I -20     102.649 180.667  64.057  1.00102.10           N  
ATOM   1074  C2   DC I -20     102.506 180.177  62.757  1.00102.02           C  
ATOM   1075  O2   DC I -20     103.521 179.833  62.136  1.00101.86           O  
ATOM   1076  N3   DC I -20     101.273 180.087  62.212  1.00102.18           N  
ATOM   1077  C4   DC I -20     100.205 180.464  62.917  1.00102.67           C  
ATOM   1078  N4   DC I -20      99.007 180.358  62.341  1.00102.92           N  
ATOM   1079  C5   DC I -20     100.318 180.964  64.248  1.00102.96           C  
ATOM   1080  C6   DC I -20     101.548 181.046  64.774  1.00102.60           C  
ATOM   1081  P    DA I -19     107.810 182.622  66.264  1.00104.33           P  
ATOM   1082  OP1  DA I -19     108.935 181.700  66.572  1.00104.31           O  
ATOM   1083  OP2  DA I -19     107.197 183.426  67.354  1.00104.48           O  
ATOM   1084  O5'  DA I -19     108.253 183.607  65.101  1.00104.25           O  
ATOM   1085  C5'  DA I -19     108.871 183.109  63.921  1.00103.72           C  
ATOM   1086  C4'  DA I -19     108.601 184.048  62.772  1.00102.49           C  
ATOM   1087  O4'  DA I -19     107.337 183.737  62.135  1.00102.38           O  
ATOM   1088  C3'  DA I -19     108.510 185.507  63.216  1.00101.47           C  
ATOM   1089  O3'  DA I -19     109.155 186.350  62.272  1.00100.54           O  
ATOM   1090  C2'  DA I -19     107.017 185.779  63.226  1.00101.54           C  
ATOM   1091  C1'  DA I -19     106.533 184.905  62.083  1.00101.88           C  
ATOM   1092  N9   DA I -19     105.130 184.493  62.176  1.00101.64           N  
ATOM   1093  C8   DA I -19     104.378 184.297  63.308  1.00101.86           C  
ATOM   1094  N7   DA I -19     103.145 183.921  63.067  1.00100.79           N  
ATOM   1095  C5   DA I -19     103.079 183.869  61.683  1.00101.08           C  
ATOM   1096  C6   DA I -19     102.039 183.537  60.800  1.00101.44           C  
ATOM   1097  N6   DA I -19     100.818 183.178  61.200  1.00101.59           N  
ATOM   1098  N1   DA I -19     102.300 183.586  59.476  1.00101.74           N  
ATOM   1099  C2   DA I -19     103.527 183.945  59.078  1.00101.74           C  
ATOM   1100  N3   DA I -19     104.587 184.279  59.811  1.00101.25           N  
ATOM   1101  C4   DA I -19     104.294 184.220  61.121  1.00101.15           C  
ATOM   1102  P    DA I -18     109.492 187.865  62.667  1.00 99.71           P  
ATOM   1103  OP1  DA I -18     110.946 187.944  62.956  1.00 99.50           O  
ATOM   1104  OP2  DA I -18     108.512 188.326  63.684  1.00 99.81           O  
ATOM   1105  O5'  DA I -18     109.213 188.640  61.312  1.00 97.44           O  
ATOM   1106  C5'  DA I -18     109.583 188.060  60.070  1.00 95.10           C  
ATOM   1107  C4'  DA I -18     108.720 188.618  58.967  1.00 93.91           C  
ATOM   1108  O4'  DA I -18     107.409 188.001  58.984  1.00 93.24           O  
ATOM   1109  C3'  DA I -18     108.492 190.121  59.089  1.00 93.07           C  
ATOM   1110  O3'  DA I -18     108.648 190.729  57.809  1.00 92.99           O  
ATOM   1111  C2'  DA I -18     107.069 190.231  59.617  1.00 91.54           C  
ATOM   1112  C1'  DA I -18     106.396 188.996  59.044  1.00 91.37           C  
ATOM   1113  N9   DA I -18     105.295 188.465  59.854  1.00 88.97           N  
ATOM   1114  C8   DA I -18     105.257 188.315  61.219  1.00 88.22           C  
ATOM   1115  N7   DA I -18     104.142 187.787  61.664  1.00 86.78           N  
ATOM   1116  C5   DA I -18     103.390 187.578  60.517  1.00 86.22           C  
ATOM   1117  C6   DA I -18     102.108 187.035  60.311  1.00 84.84           C  
ATOM   1118  N6   DA I -18     101.327 186.586  61.295  1.00 83.80           N  
ATOM   1119  N1   DA I -18     101.649 186.968  59.043  1.00 83.93           N  
ATOM   1120  C2   DA I -18     102.432 187.419  58.055  1.00 85.14           C  
ATOM   1121  N3   DA I -18     103.655 187.948  58.120  1.00 86.72           N  
ATOM   1122  C4   DA I -18     104.084 187.998  59.394  1.00 87.39           C  
ATOM   1123  P    DA I -17     108.091 192.207  57.560  1.00 92.81           P  
ATOM   1124  OP1  DA I -17     108.988 192.853  56.568  1.00 93.53           O  
ATOM   1125  OP2  DA I -17     107.846 192.866  58.870  1.00 92.56           O  
ATOM   1126  O5'  DA I -17     106.699 191.915  56.852  1.00 91.49           O  
ATOM   1127  C5'  DA I -17     106.632 190.986  55.773  1.00 87.81           C  
ATOM   1128  C4'  DA I -17     105.363 191.204  54.987  1.00 84.84           C  
ATOM   1129  O4'  DA I -17     104.234 190.683  55.725  1.00 83.76           O  
ATOM   1130  C3'  DA I -17     105.065 192.676  54.732  1.00 82.69           C  
ATOM   1131  O3'  DA I -17     104.526 192.831  53.422  1.00 82.03           O  
ATOM   1132  C2'  DA I -17     104.066 193.031  55.821  1.00 80.81           C  
ATOM   1133  C1'  DA I -17     103.322 191.722  56.046  1.00 80.35           C  
ATOM   1134  N9   DA I -17     102.871 191.499  57.422  1.00 76.73           N  
ATOM   1135  C8   DA I -17     103.542 191.773  58.588  1.00 75.38           C  
ATOM   1136  N7   DA I -17     102.876 191.449  59.671  1.00 73.62           N  
ATOM   1137  C5   DA I -17     101.685 190.929  59.186  1.00 73.68           C  
ATOM   1138  C6   DA I -17     100.547 190.406  59.829  1.00 72.31           C  
ATOM   1139  N6   DA I -17     100.419 190.307  61.153  1.00 71.53           N  
ATOM   1140  N1   DA I -17      99.530 189.978  59.052  1.00 71.74           N  
ATOM   1141  C2   DA I -17      99.658 190.067  57.722  1.00 72.23           C  
ATOM   1142  N3   DA I -17     100.674 190.534  57.002  1.00 73.10           N  
ATOM   1143  C4   DA I -17     101.667 190.955  57.802  1.00 74.61           C  
ATOM   1144  P    DG I -16     104.210 194.300  52.860  1.00 82.53           P  
ATOM   1145  OP1  DG I -16     104.226 194.205  51.376  1.00 82.76           O  
ATOM   1146  OP2  DG I -16     105.079 195.296  53.542  1.00 82.56           O  
ATOM   1147  O5'  DG I -16     102.711 194.527  53.335  1.00 78.03           O  
ATOM   1148  C5'  DG I -16     101.718 193.550  53.043  1.00 69.50           C  
ATOM   1149  C4'  DG I -16     100.385 193.976  53.606  1.00 63.89           C  
ATOM   1150  O4'  DG I -16     100.306 193.714  55.027  1.00 61.42           O  
ATOM   1151  C3'  DG I -16     100.069 195.460  53.426  1.00 60.83           C  
ATOM   1152  O3'  DG I -16      98.718 195.585  53.003  1.00 58.83           O  
ATOM   1153  C2'  DG I -16     100.224 196.022  54.828  1.00 59.33           C  
ATOM   1154  C1'  DG I -16      99.736 194.848  55.648  1.00 60.08           C  
ATOM   1155  N9   DG I -16     100.102 194.832  57.059  1.00 59.38           N  
ATOM   1156  C8   DG I -16     101.147 195.481  57.664  1.00 59.59           C  
ATOM   1157  N7   DG I -16     101.207 195.265  58.949  1.00 60.21           N  
ATOM   1158  C5   DG I -16     100.136 194.422  59.206  1.00 60.09           C  
ATOM   1159  C6   DG I -16      99.691 193.846  60.422  1.00 61.03           C  
ATOM   1160  O6   DG I -16     100.166 193.974  61.554  1.00 62.69           O  
ATOM   1161  N1   DG I -16      98.567 193.051  60.230  1.00 62.53           N  
ATOM   1162  C2   DG I -16      97.946 192.839  59.026  1.00 62.61           C  
ATOM   1163  N2   DG I -16      96.873 192.033  59.046  1.00 63.47           N  
ATOM   1164  N3   DG I -16      98.349 193.375  57.886  1.00 62.08           N  
ATOM   1165  C4   DG I -16      99.444 194.147  58.050  1.00 60.20           C  
ATOM   1166  P    DG I -15      98.375 195.522  51.441  1.00 56.62           P  
ATOM   1167  OP1  DG I -15      99.330 194.566  50.834  1.00 58.14           O  
ATOM   1168  OP2  DG I -15      98.274 196.899  50.905  1.00 56.90           O  
ATOM   1169  O5'  DG I -15      96.931 194.861  51.407  1.00 56.21           O  
ATOM   1170  C5'  DG I -15      96.770 193.460  51.600  1.00 54.20           C  
ATOM   1171  C4'  DG I -15      95.528 193.197  52.415  1.00 51.56           C  
ATOM   1172  O4'  DG I -15      95.758 193.559  53.797  1.00 50.97           O  
ATOM   1173  C3'  DG I -15      94.334 194.028  51.961  1.00 50.59           C  
ATOM   1174  O3'  DG I -15      93.138 193.270  52.112  1.00 49.53           O  
ATOM   1175  C2'  DG I -15      94.344 195.206  52.919  1.00 48.99           C  
ATOM   1176  C1'  DG I -15      94.827 194.554  54.199  1.00 49.36           C  
ATOM   1177  N9   DG I -15      95.502 195.439  55.144  1.00 47.50           N  
ATOM   1178  C8   DG I -15      96.344 196.486  54.857  1.00 44.43           C  
ATOM   1179  N7   DG I -15      96.831 197.059  55.925  1.00 43.26           N  
ATOM   1180  C5   DG I -15      96.271 196.352  56.980  1.00 44.04           C  
ATOM   1181  C6   DG I -15      96.437 196.505  58.381  1.00 43.33           C  
ATOM   1182  O6   DG I -15      97.134 197.321  58.988  1.00 44.83           O  
ATOM   1183  N1   DG I -15      95.683 195.577  59.092  1.00 42.50           N  
ATOM   1184  C2   DG I -15      94.870 194.627  58.533  1.00 44.89           C  
ATOM   1185  N2   DG I -15      94.228 193.823  59.392  1.00 43.43           N  
ATOM   1186  N3   DG I -15      94.701 194.474  57.225  1.00 45.27           N  
ATOM   1187  C4   DG I -15      95.433 195.361  56.515  1.00 46.22           C  
ATOM   1188  P    DG I -14      91.747 193.903  51.643  1.00 50.44           P  
ATOM   1189  OP1  DG I -14      91.084 192.921  50.753  1.00 50.26           O  
ATOM   1190  OP2  DG I -14      92.015 195.287  51.157  1.00 52.15           O  
ATOM   1191  O5'  DG I -14      90.920 194.033  52.991  1.00 44.42           O  
ATOM   1192  C5'  DG I -14      90.959 193.006  53.961  1.00 40.53           C  
ATOM   1193  C4'  DG I -14      90.464 193.535  55.283  1.00 38.44           C  
ATOM   1194  O4'  DG I -14      91.428 194.458  55.842  1.00 32.98           O  
ATOM   1195  C3'  DG I -14      89.140 194.298  55.210  1.00 37.67           C  
ATOM   1196  O3'  DG I -14      88.376 193.948  56.365  1.00 35.79           O  
ATOM   1197  C2'  DG I -14      89.578 195.752  55.276  1.00 35.44           C  
ATOM   1198  C1'  DG I -14      90.776 195.658  56.198  1.00 35.15           C  
ATOM   1199  N9   DG I -14      91.753 196.739  56.108  1.00 38.90           N  
ATOM   1200  C8   DG I -14      92.111 197.453  54.992  1.00 37.68           C  
ATOM   1201  N7   DG I -14      93.036 198.341  55.228  1.00 39.30           N  
ATOM   1202  C5   DG I -14      93.299 198.213  56.586  1.00 41.03           C  
ATOM   1203  C6   DG I -14      94.206 198.923  57.424  1.00 41.18           C  
ATOM   1204  O6   DG I -14      94.986 199.833  57.123  1.00 41.93           O  
ATOM   1205  N1   DG I -14      94.145 198.474  58.738  1.00 41.53           N  
ATOM   1206  C2   DG I -14      93.321 197.479  59.194  1.00 43.34           C  
ATOM   1207  N2   DG I -14      93.406 197.195  60.503  1.00 42.49           N  
ATOM   1208  N3   DG I -14      92.473 196.810  58.426  1.00 43.59           N  
ATOM   1209  C4   DG I -14      92.514 197.230  57.143  1.00 39.77           C  
ATOM   1210  P    DA I -13      86.823 194.329  56.460  1.00 33.04           P  
ATOM   1211  OP1  DA I -13      86.093 193.074  56.178  1.00 33.76           O  
ATOM   1212  OP2  DA I -13      86.520 195.551  55.682  1.00 29.07           O  
ATOM   1213  O5'  DA I -13      86.681 194.640  58.010  1.00 32.90           O  
ATOM   1214  C5'  DA I -13      87.291 193.765  58.958  1.00 30.63           C  
ATOM   1215  C4'  DA I -13      87.463 194.458  60.286  1.00 28.51           C  
ATOM   1216  O4'  DA I -13      88.514 195.446  60.184  1.00 26.93           O  
ATOM   1217  C3'  DA I -13      86.225 195.191  60.802  1.00 28.47           C  
ATOM   1218  O3'  DA I -13      86.119 194.970  62.213  1.00 23.98           O  
ATOM   1219  C2'  DA I -13      86.509 196.646  60.460  1.00 27.19           C  
ATOM   1220  C1'  DA I -13      88.029 196.732  60.528  1.00 29.79           C  
ATOM   1221  N9   DA I -13      88.638 197.682  59.594  1.00 35.13           N  
ATOM   1222  C8   DA I -13      88.374 197.807  58.255  1.00 36.72           C  
ATOM   1223  N7   DA I -13      89.097 198.717  57.657  1.00 37.90           N  
ATOM   1224  C5   DA I -13      89.887 199.234  58.670  1.00 40.33           C  
ATOM   1225  C6   DA I -13      90.876 200.236  58.679  1.00 42.21           C  
ATOM   1226  N6   DA I -13      91.254 200.908  57.591  1.00 41.53           N  
ATOM   1227  N1   DA I -13      91.472 200.520  59.858  1.00 41.97           N  
ATOM   1228  C2   DA I -13      91.094 199.838  60.946  1.00 40.81           C  
ATOM   1229  N3   DA I -13      90.182 198.875  61.063  1.00 42.39           N  
ATOM   1230  C4   DA I -13      89.608 198.615  59.872  1.00 38.53           C  
ATOM   1231  P    DA I -12      84.844 195.504  63.020  1.00 23.41           P  
ATOM   1232  OP1  DA I -12      84.566 194.505  64.082  1.00 27.70           O  
ATOM   1233  OP2  DA I -12      83.753 195.940  62.124  1.00 25.97           O  
ATOM   1234  O5'  DA I -12      85.400 196.820  63.705  1.00 27.61           O  
ATOM   1235  C5'  DA I -12      86.599 196.787  64.456  1.00 26.44           C  
ATOM   1236  C4'  DA I -12      86.947 198.179  64.911  1.00 31.91           C  
ATOM   1237  O4'  DA I -12      87.520 198.951  63.828  1.00 30.45           O  
ATOM   1238  C3'  DA I -12      85.763 198.988  65.434  1.00 34.71           C  
ATOM   1239  O3'  DA I -12      86.173 199.610  66.647  1.00 43.19           O  
ATOM   1240  C2'  DA I -12      85.521 200.021  64.340  1.00 31.61           C  
ATOM   1241  C1'  DA I -12      86.911 200.223  63.775  1.00 29.44           C  
ATOM   1242  N9   DA I -12      87.003 200.686  62.389  1.00 36.09           N  
ATOM   1243  C8   DA I -12      86.264 200.290  61.304  1.00 35.54           C  
ATOM   1244  N7   DA I -12      86.643 200.838  60.177  1.00 33.87           N  
ATOM   1245  C5   DA I -12      87.695 201.665  60.546  1.00 39.33           C  
ATOM   1246  C6   DA I -12      88.539 202.525  59.803  1.00 42.52           C  
ATOM   1247  N6   DA I -12      88.459 202.685  58.480  1.00 42.41           N  
ATOM   1248  N1   DA I -12      89.481 203.219  60.478  1.00 43.78           N  
ATOM   1249  C2   DA I -12      89.566 203.053  61.805  1.00 43.08           C  
ATOM   1250  N3   DA I -12      88.840 202.276  62.609  1.00 40.39           N  
ATOM   1251  C4   DA I -12      87.913 201.599  61.908  1.00 38.15           C  
ATOM   1252  P    DA I -11      85.082 200.118  67.699  1.00 46.61           P  
ATOM   1253  OP1  DA I -11      85.581 199.678  69.027  1.00 49.10           O  
ATOM   1254  OP2  DA I -11      83.720 199.735  67.262  1.00 51.52           O  
ATOM   1255  O5'  DA I -11      85.237 201.692  67.596  1.00 46.27           O  
ATOM   1256  C5'  DA I -11      86.520 202.275  67.776  1.00 46.69           C  
ATOM   1257  C4'  DA I -11      86.541 203.684  67.242  1.00 48.09           C  
ATOM   1258  O4'  DA I -11      86.737 203.715  65.808  1.00 46.83           O  
ATOM   1259  C3'  DA I -11      85.286 204.505  67.527  1.00 49.41           C  
ATOM   1260  O3'  DA I -11      85.696 205.774  68.023  1.00 53.74           O  
ATOM   1261  C2'  DA I -11      84.641 204.649  66.157  1.00 47.52           C  
ATOM   1262  C1'  DA I -11      85.860 204.671  65.254  1.00 47.98           C  
ATOM   1263  N9   DA I -11      85.641 204.329  63.846  1.00 49.19           N  
ATOM   1264  C8   DA I -11      84.784 203.400  63.311  1.00 48.64           C  
ATOM   1265  N7   DA I -11      84.819 203.341  62.002  1.00 49.61           N  
ATOM   1266  C5   DA I -11      85.763 204.295  61.649  1.00 48.40           C  
ATOM   1267  C6   DA I -11      86.254 204.730  60.402  1.00 47.86           C  
ATOM   1268  N6   DA I -11      85.853 204.236  59.233  1.00 46.64           N  
ATOM   1269  N1   DA I -11      87.189 205.704  60.401  1.00 48.75           N  
ATOM   1270  C2   DA I -11      87.598 206.201  61.572  1.00 49.05           C  
ATOM   1271  N3   DA I -11      87.215 205.878  62.804  1.00 51.45           N  
ATOM   1272  C4   DA I -11      86.281 204.908  62.773  1.00 49.85           C  
ATOM   1273  P    DC I -10      84.636 206.733  68.745  1.00 54.91           P  
ATOM   1274  OP1  DC I -10      85.070 206.855  70.154  1.00 58.55           O  
ATOM   1275  OP2  DC I -10      83.253 206.297  68.436  1.00 53.50           O  
ATOM   1276  O5'  DC I -10      84.912 208.123  68.028  1.00 55.93           O  
ATOM   1277  C5'  DC I -10      86.252 208.538  67.771  1.00 56.40           C  
ATOM   1278  C4'  DC I -10      86.277 209.568  66.669  1.00 57.53           C  
ATOM   1279  O4'  DC I -10      86.239 208.939  65.359  1.00 57.79           O  
ATOM   1280  C3'  DC I -10      85.086 210.524  66.724  1.00 56.65           C  
ATOM   1281  O3'  DC I -10      85.493 211.870  66.530  1.00 54.12           O  
ATOM   1282  C2'  DC I -10      84.226 210.088  65.554  1.00 57.50           C  
ATOM   1283  C1'  DC I -10      85.262 209.594  64.568  1.00 57.59           C  
ATOM   1284  N1   DC I -10      84.738 208.636  63.580  1.00 59.33           N  
ATOM   1285  C2   DC I -10      84.979 208.873  62.224  1.00 59.46           C  
ATOM   1286  O2   DC I -10      85.656 209.856  61.899  1.00 60.65           O  
ATOM   1287  N3   DC I -10      84.469 208.028  61.304  1.00 60.46           N  
ATOM   1288  C4   DC I -10      83.751 206.973  61.693  1.00 60.23           C  
ATOM   1289  N4   DC I -10      83.259 206.166  60.745  1.00 58.01           N  
ATOM   1290  C5   DC I -10      83.505 206.696  63.070  1.00 58.62           C  
ATOM   1291  C6   DC I -10      84.015 207.544  63.971  1.00 58.55           C  
ATOM   1292  P    DT I  -9      84.448 213.049  66.808  1.00 53.20           P  
ATOM   1293  OP1  DT I  -9      84.952 213.862  67.942  1.00 56.49           O  
ATOM   1294  OP2  DT I  -9      83.094 212.441  66.883  1.00 51.35           O  
ATOM   1295  O5'  DT I  -9      84.525 213.920  65.481  1.00 51.32           O  
ATOM   1296  C5'  DT I  -9      85.778 214.190  64.863  1.00 48.19           C  
ATOM   1297  C4'  DT I  -9      85.560 214.822  63.509  1.00 47.56           C  
ATOM   1298  O4'  DT I  -9      85.197 213.813  62.536  1.00 46.73           O  
ATOM   1299  C3'  DT I  -9      84.440 215.859  63.493  1.00 47.19           C  
ATOM   1300  O3'  DT I  -9      84.818 216.979  62.699  1.00 49.99           O  
ATOM   1301  C2'  DT I  -9      83.268 215.110  62.882  1.00 47.64           C  
ATOM   1302  C1'  DT I  -9      83.945 214.119  61.944  1.00 47.08           C  
ATOM   1303  N1   DT I  -9      83.212 212.846  61.758  1.00 46.59           N  
ATOM   1304  C2   DT I  -9      82.977 212.398  60.468  1.00 45.61           C  
ATOM   1305  O2   DT I  -9      83.327 213.010  59.472  1.00 44.79           O  
ATOM   1306  N3   DT I  -9      82.310 211.199  60.391  1.00 44.58           N  
ATOM   1307  C4   DT I  -9      81.856 210.423  61.444  1.00 44.69           C  
ATOM   1308  O4   DT I  -9      81.299 209.348  61.219  1.00 41.63           O  
ATOM   1309  C5   DT I  -9      82.104 210.970  62.764  1.00 44.95           C  
ATOM   1310  C7   DT I  -9      81.588 210.235  63.959  1.00 43.05           C  
ATOM   1311  C6   DT I  -9      82.775 212.127  62.853  1.00 45.05           C  
ATOM   1312  P    DT I  -8      83.782 218.182  62.485  1.00 52.76           P  
ATOM   1313  OP1  DT I  -8      84.547 219.443  62.298  1.00 52.50           O  
ATOM   1314  OP2  DT I  -8      82.766 218.085  63.563  1.00 51.02           O  
ATOM   1315  O5'  DT I  -8      83.079 217.828  61.103  1.00 51.04           O  
ATOM   1316  C5'  DT I  -8      83.852 217.682  59.919  1.00 48.19           C  
ATOM   1317  C4'  DT I  -8      82.947 217.570  58.715  1.00 48.34           C  
ATOM   1318  O4'  DT I  -8      82.371 216.240  58.626  1.00 47.75           O  
ATOM   1319  C3'  DT I  -8      81.776 218.551  58.712  1.00 46.50           C  
ATOM   1320  O3'  DT I  -8      81.653 219.145  57.424  1.00 46.86           O  
ATOM   1321  C2'  DT I  -8      80.570 217.677  59.021  1.00 45.81           C  
ATOM   1322  C1'  DT I  -8      80.966 216.330  58.436  1.00 45.19           C  
ATOM   1323  N1   DT I  -8      80.344 215.149  59.086  1.00 44.97           N  
ATOM   1324  C2   DT I  -8      79.964 214.071  58.301  1.00 43.46           C  
ATOM   1325  O2   DT I  -8      80.085 214.042  57.086  1.00 42.38           O  
ATOM   1326  N3   DT I  -8      79.431 213.018  58.998  1.00 42.96           N  
ATOM   1327  C4   DT I  -8      79.243 212.928  60.366  1.00 46.14           C  
ATOM   1328  O4   DT I  -8      78.771 211.900  60.854  1.00 44.94           O  
ATOM   1329  C5   DT I  -8      79.642 214.096  61.121  1.00 45.80           C  
ATOM   1330  C7   DT I  -8      79.455 214.099  62.604  1.00 44.20           C  
ATOM   1331  C6   DT I  -8      80.165 215.130  60.452  1.00 45.89           C  
ATOM   1332  P    DC I  -7      80.570 220.300  57.185  1.00 48.82           P  
ATOM   1333  OP1  DC I  -7      81.125 221.261  56.201  1.00 49.27           O  
ATOM   1334  OP2  DC I  -7      80.117 220.782  58.511  1.00 49.53           O  
ATOM   1335  O5'  DC I  -7      79.361 219.533  56.496  1.00 47.50           O  
ATOM   1336  C5'  DC I  -7      79.558 218.842  55.267  1.00 44.09           C  
ATOM   1337  C4'  DC I  -7      78.308 218.084  54.890  1.00 43.10           C  
ATOM   1338  O4'  DC I  -7      78.118 216.973  55.797  1.00 39.09           O  
ATOM   1339  C3'  DC I  -7      77.017 218.903  54.950  1.00 44.64           C  
ATOM   1340  O3'  DC I  -7      76.159 218.484  53.894  1.00 43.65           O  
ATOM   1341  C2'  DC I  -7      76.402 218.476  56.270  1.00 42.66           C  
ATOM   1342  C1'  DC I  -7      76.799 217.016  56.294  1.00 40.56           C  
ATOM   1343  N1   DC I  -7      76.791 216.356  57.599  1.00 40.85           N  
ATOM   1344  C2   DC I  -7      76.627 214.974  57.620  1.00 38.66           C  
ATOM   1345  O2   DC I  -7      76.519 214.381  56.541  1.00 38.39           O  
ATOM   1346  N3   DC I  -7      76.591 214.324  58.803  1.00 35.95           N  
ATOM   1347  C4   DC I  -7      76.720 215.010  59.938  1.00 39.52           C  
ATOM   1348  N4   DC I  -7      76.681 214.329  61.084  1.00 40.03           N  
ATOM   1349  C5   DC I  -7      76.898 216.429  59.948  1.00 40.30           C  
ATOM   1350  C6   DC I  -7      76.929 217.057  58.763  1.00 37.34           C  
ATOM   1351  P    DA I  -6      76.164 219.277  52.510  1.00 44.38           P  
ATOM   1352  OP1  DA I  -6      77.576 219.604  52.178  1.00 43.80           O  
ATOM   1353  OP2  DA I  -6      75.164 220.360  52.622  1.00 44.92           O  
ATOM   1354  O5'  DA I  -6      75.618 218.204  51.467  1.00 44.49           O  
ATOM   1355  C5'  DA I  -6      76.455 217.140  51.005  1.00 43.67           C  
ATOM   1356  C4'  DA I  -6      75.623 215.922  50.675  1.00 41.70           C  
ATOM   1357  O4'  DA I  -6      75.126 215.319  51.892  1.00 42.45           O  
ATOM   1358  C3'  DA I  -6      74.392 216.228  49.831  1.00 41.68           C  
ATOM   1359  O3'  DA I  -6      74.138 215.152  48.937  1.00 39.99           O  
ATOM   1360  C2'  DA I  -6      73.284 216.375  50.857  1.00 41.01           C  
ATOM   1361  C1'  DA I  -6      73.709 215.426  51.968  1.00 41.84           C  
ATOM   1362  N9   DA I  -6      73.390 215.900  53.313  1.00 41.98           N  
ATOM   1363  C8   DA I  -6      73.324 217.198  53.748  1.00 42.17           C  
ATOM   1364  N7   DA I  -6      73.096 217.312  55.034  1.00 44.16           N  
ATOM   1365  C5   DA I  -6      72.991 216.000  55.472  1.00 41.51           C  
ATOM   1366  C6   DA I  -6      72.767 215.442  56.741  1.00 42.66           C  
ATOM   1367  N6   DA I  -6      72.641 216.161  57.857  1.00 40.37           N  
ATOM   1368  N1   DA I  -6      72.687 214.096  56.829  1.00 42.87           N  
ATOM   1369  C2   DA I  -6      72.840 213.374  55.715  1.00 40.82           C  
ATOM   1370  N3   DA I  -6      73.071 213.782  54.473  1.00 40.32           N  
ATOM   1371  C4   DA I  -6      73.138 215.122  54.418  1.00 41.72           C  
ATOM   1372  P    DA I  -5      72.870 215.219  47.967  1.00 40.91           P  
ATOM   1373  OP1  DA I  -5      73.211 214.463  46.745  1.00 42.51           O  
ATOM   1374  OP2  DA I  -5      72.427 216.626  47.854  1.00 45.02           O  
ATOM   1375  O5'  DA I  -5      71.755 214.429  48.778  1.00 41.32           O  
ATOM   1376  C5'  DA I  -5      71.972 213.087  49.194  1.00 40.03           C  
ATOM   1377  C4'  DA I  -5      70.777 212.597  49.973  1.00 42.32           C  
ATOM   1378  O4'  DA I  -5      70.781 213.175  51.301  1.00 40.16           O  
ATOM   1379  C3'  DA I  -5      69.442 212.995  49.338  1.00 42.73           C  
ATOM   1380  O3'  DA I  -5      68.471 211.977  49.572  1.00 46.18           O  
ATOM   1381  C2'  DA I  -5      69.039 214.206  50.153  1.00 42.84           C  
ATOM   1382  C1'  DA I  -5      69.522 213.777  51.525  1.00 43.27           C  
ATOM   1383  N9   DA I  -5      69.677 214.842  52.517  1.00 45.19           N  
ATOM   1384  C8   DA I  -5      69.852 216.187  52.312  1.00 43.85           C  
ATOM   1385  N7   DA I  -5      69.917 216.883  53.417  1.00 46.34           N  
ATOM   1386  C5   DA I  -5      69.783 215.932  54.419  1.00 46.49           C  
ATOM   1387  C6   DA I  -5      69.767 216.029  55.820  1.00 48.04           C  
ATOM   1388  N6   DA I  -5      69.882 217.180  56.484  1.00 48.78           N  
ATOM   1389  N1   DA I  -5      69.626 214.886  56.528  1.00 49.12           N  
ATOM   1390  C2   DA I  -5      69.504 213.735  55.864  1.00 48.71           C  
ATOM   1391  N3   DA I  -5      69.500 213.517  54.552  1.00 49.21           N  
ATOM   1392  C4   DA I  -5      69.645 214.672  53.879  1.00 46.45           C  
ATOM   1393  P    DC I  -4      68.259 210.799  48.500  1.00 48.54           P  
ATOM   1394  OP1  DC I  -4      69.597 210.267  48.128  1.00 48.62           O  
ATOM   1395  OP2  DC I  -4      67.326 211.246  47.434  1.00 45.17           O  
ATOM   1396  O5'  DC I  -4      67.532 209.689  49.376  1.00 45.13           O  
ATOM   1397  C5'  DC I  -4      68.295 208.854  50.233  1.00 40.58           C  
ATOM   1398  C4'  DC I  -4      67.592 208.661  51.554  1.00 38.88           C  
ATOM   1399  O4'  DC I  -4      67.729 209.830  52.401  1.00 40.74           O  
ATOM   1400  C3'  DC I  -4      66.097 208.348  51.471  1.00 36.12           C  
ATOM   1401  O3'  DC I  -4      65.818 207.230  52.310  1.00 31.51           O  
ATOM   1402  C2'  DC I  -4      65.435 209.601  52.023  1.00 39.42           C  
ATOM   1403  C1'  DC I  -4      66.479 210.145  52.989  1.00 40.91           C  
ATOM   1404  N1   DC I  -4      66.423 211.606  53.187  1.00 43.48           N  
ATOM   1405  C2   DC I  -4      66.234 212.119  54.484  1.00 44.63           C  
ATOM   1406  O2   DC I  -4      66.120 211.335  55.437  1.00 47.92           O  
ATOM   1407  N3   DC I  -4      66.175 213.454  54.662  1.00 43.01           N  
ATOM   1408  C4   DC I  -4      66.289 214.272  53.614  1.00 45.95           C  
ATOM   1409  N4   DC I  -4      66.218 215.589  53.837  1.00 50.07           N  
ATOM   1410  C5   DC I  -4      66.478 213.782  52.291  1.00 43.98           C  
ATOM   1411  C6   DC I  -4      66.544 212.457  52.124  1.00 44.09           C  
ATOM   1412  P    DT I  -3      64.391 206.509  52.239  1.00 24.84           P  
ATOM   1413  OP1  DT I  -3      64.648 205.055  52.107  1.00 26.81           O  
ATOM   1414  OP2  DT I  -3      63.572 207.200  51.224  1.00 20.13           O  
ATOM   1415  O5'  DT I  -3      63.824 206.757  53.701  1.00 24.91           O  
ATOM   1416  C5'  DT I  -3      64.646 206.447  54.826  1.00 28.16           C  
ATOM   1417  C4'  DT I  -3      64.044 206.986  56.101  1.00 30.59           C  
ATOM   1418  O4'  DT I  -3      64.076 208.432  56.090  1.00 34.84           O  
ATOM   1419  C3'  DT I  -3      62.593 206.590  56.347  1.00 31.56           C  
ATOM   1420  O3'  DT I  -3      62.419 206.264  57.720  1.00 35.55           O  
ATOM   1421  C2'  DT I  -3      61.805 207.838  55.988  1.00 31.74           C  
ATOM   1422  C1'  DT I  -3      62.777 208.960  56.303  1.00 32.97           C  
ATOM   1423  N1   DT I  -3      62.631 210.131  55.427  1.00 33.65           N  
ATOM   1424  C2   DT I  -3      62.482 211.377  56.002  1.00 35.24           C  
ATOM   1425  O2   DT I  -3      62.471 211.561  57.212  1.00 34.83           O  
ATOM   1426  N3   DT I  -3      62.354 212.404  55.103  1.00 32.35           N  
ATOM   1427  C4   DT I  -3      62.363 212.314  53.726  1.00 34.99           C  
ATOM   1428  O4   DT I  -3      62.252 213.327  53.046  1.00 35.35           O  
ATOM   1429  C5   DT I  -3      62.514 210.977  53.195  1.00 37.11           C  
ATOM   1430  C7   DT I  -3      62.516 210.777  51.711  1.00 35.67           C  
ATOM   1431  C6   DT I  -3      62.643 209.969  54.063  1.00 35.52           C  
ATOM   1432  P    DG I  -2      61.041 205.615  58.206  1.00 36.17           P  
ATOM   1433  OP1  DG I  -2      61.329 204.858  59.444  1.00 35.46           O  
ATOM   1434  OP2  DG I  -2      60.404 204.933  57.054  1.00 40.78           O  
ATOM   1435  O5'  DG I  -2      60.142 206.878  58.550  1.00 38.28           O  
ATOM   1436  C5'  DG I  -2      60.537 207.781  59.573  1.00 41.89           C  
ATOM   1437  C4'  DG I  -2      59.593 208.956  59.611  1.00 44.89           C  
ATOM   1438  O4'  DG I  -2      59.845 209.865  58.513  1.00 45.36           O  
ATOM   1439  C3'  DG I  -2      58.120 208.569  59.500  1.00 47.53           C  
ATOM   1440  O3'  DG I  -2      57.375 209.475  60.295  1.00 53.26           O  
ATOM   1441  C2'  DG I  -2      57.803 208.870  58.047  1.00 47.72           C  
ATOM   1442  C1'  DG I  -2      58.612 210.129  57.875  1.00 46.40           C  
ATOM   1443  N9   DG I  -2      58.875 210.574  56.512  1.00 46.33           N  
ATOM   1444  C8   DG I  -2      58.995 209.820  55.370  1.00 47.18           C  
ATOM   1445  N7   DG I  -2      59.188 210.544  54.296  1.00 49.55           N  
ATOM   1446  C5   DG I  -2      59.203 211.854  54.767  1.00 50.01           C  
ATOM   1447  C6   DG I  -2      59.370 213.091  54.076  1.00 48.13           C  
ATOM   1448  O6   DG I  -2      59.538 213.285  52.868  1.00 47.78           O  
ATOM   1449  N1   DG I  -2      59.330 214.172  54.949  1.00 45.24           N  
ATOM   1450  C2   DG I  -2      59.156 214.084  56.306  1.00 46.39           C  
ATOM   1451  N2   DG I  -2      59.160 215.237  56.980  1.00 46.65           N  
ATOM   1452  N3   DG I  -2      58.993 212.950  56.958  1.00 47.08           N  
ATOM   1453  C4   DG I  -2      59.026 211.883  56.133  1.00 48.28           C  
ATOM   1454  P    DA I  -1      56.520 208.938  61.537  1.00 58.56           P  
ATOM   1455  OP1  DA I  -1      57.450 208.341  62.531  1.00 55.88           O  
ATOM   1456  OP2  DA I  -1      55.411 208.112  60.980  1.00 54.30           O  
ATOM   1457  O5'  DA I  -1      55.955 210.300  62.140  1.00 53.57           O  
ATOM   1458  C5'  DA I  -1      56.845 211.256  62.713  1.00 52.99           C  
ATOM   1459  C4'  DA I  -1      56.330 212.661  62.495  1.00 53.86           C  
ATOM   1460  O4'  DA I  -1      56.607 213.121  61.149  1.00 52.01           O  
ATOM   1461  C3'  DA I  -1      54.828 212.833  62.707  1.00 53.95           C  
ATOM   1462  O3'  DA I  -1      54.571 214.049  63.415  1.00 55.95           O  
ATOM   1463  C2'  DA I  -1      54.278 212.891  61.292  1.00 50.70           C  
ATOM   1464  C1'  DA I  -1      55.409 213.552  60.522  1.00 50.05           C  
ATOM   1465  N9   DA I  -1      55.471 213.153  59.117  1.00 50.63           N  
ATOM   1466  C8   DA I  -1      55.366 211.880  58.608  1.00 51.02           C  
ATOM   1467  N7   DA I  -1      55.440 211.826  57.301  1.00 49.50           N  
ATOM   1468  C5   DA I  -1      55.614 213.147  56.922  1.00 48.05           C  
ATOM   1469  C6   DA I  -1      55.768 213.754  55.670  1.00 47.26           C  
ATOM   1470  N6   DA I  -1      55.783 213.083  54.520  1.00 47.61           N  
ATOM   1471  N1   DA I  -1      55.913 215.093  55.635  1.00 46.65           N  
ATOM   1472  C2   DA I  -1      55.915 215.765  56.788  1.00 47.69           C  
ATOM   1473  N3   DA I  -1      55.788 215.308  58.030  1.00 50.09           N  
ATOM   1474  C4   DA I  -1      55.636 213.975  58.029  1.00 48.71           C  
ATOM   1475  P    DA I   0      53.056 214.522  63.659  1.00 56.35           P  
ATOM   1476  OP1  DA I   0      53.079 215.446  64.823  1.00 58.46           O  
ATOM   1477  OP2  DA I   0      52.171 213.327  63.682  1.00 56.05           O  
ATOM   1478  O5'  DA I   0      52.727 215.380  62.363  1.00 52.06           O  
ATOM   1479  C5'  DA I   0      53.395 216.610  62.140  1.00 53.10           C  
ATOM   1480  C4'  DA I   0      52.661 217.417  61.098  1.00 54.54           C  
ATOM   1481  O4'  DA I   0      52.973 216.911  59.779  1.00 55.25           O  
ATOM   1482  C3'  DA I   0      51.139 217.377  61.235  1.00 55.77           C  
ATOM   1483  O3'  DA I   0      50.598 218.690  61.090  1.00 58.17           O  
ATOM   1484  C2'  DA I   0      50.697 216.462  60.104  1.00 54.90           C  
ATOM   1485  C1'  DA I   0      51.783 216.653  59.057  1.00 53.95           C  
ATOM   1486  N9   DA I   0      52.017 215.473  58.224  1.00 52.90           N  
ATOM   1487  C8   DA I   0      52.069 214.162  58.628  1.00 52.34           C  
ATOM   1488  N7   DA I   0      52.256 213.314  57.646  1.00 52.38           N  
ATOM   1489  C5   DA I   0      52.344 214.120  56.521  1.00 50.24           C  
ATOM   1490  C6   DA I   0      52.541 213.826  55.163  1.00 49.79           C  
ATOM   1491  N6   DA I   0      52.682 212.589  54.684  1.00 46.88           N  
ATOM   1492  N1   DA I   0      52.589 214.862  54.298  1.00 51.14           N  
ATOM   1493  C2   DA I   0      52.448 216.103  54.779  1.00 51.03           C  
ATOM   1494  N3   DA I   0      52.256 216.505  56.033  1.00 50.51           N  
ATOM   1495  C4   DA I   0      52.211 215.453  56.864  1.00 50.87           C  
ATOM   1496  P    DT I   1      49.007 218.903  61.103  1.00 60.86           P  
ATOM   1497  OP1  DT I   1      48.744 220.242  61.686  1.00 63.00           O  
ATOM   1498  OP2  DT I   1      48.366 217.701  61.699  1.00 60.72           O  
ATOM   1499  O5'  DT I   1      48.654 218.981  59.556  1.00 60.16           O  
ATOM   1500  C5'  DT I   1      49.372 219.880  58.721  1.00 60.32           C  
ATOM   1501  C4'  DT I   1      48.738 219.944  57.356  1.00 61.20           C  
ATOM   1502  O4'  DT I   1      49.205 218.862  56.518  1.00 61.98           O  
ATOM   1503  C3'  DT I   1      47.212 219.860  57.364  1.00 62.28           C  
ATOM   1504  O3'  DT I   1      46.686 220.843  56.476  1.00 63.25           O  
ATOM   1505  C2'  DT I   1      46.932 218.462  56.843  1.00 62.40           C  
ATOM   1506  C1'  DT I   1      48.095 218.244  55.893  1.00 62.38           C  
ATOM   1507  N1   DT I   1      48.437 216.829  55.639  1.00 61.12           N  
ATOM   1508  C2   DT I   1      48.652 216.437  54.335  1.00 60.09           C  
ATOM   1509  O2   DT I   1      48.608 217.205  53.389  1.00 60.54           O  
ATOM   1510  N3   DT I   1      48.923 215.102  54.180  1.00 59.90           N  
ATOM   1511  C4   DT I   1      49.003 214.145  55.171  1.00 58.78           C  
ATOM   1512  O4   DT I   1      49.235 212.981  54.874  1.00 58.67           O  
ATOM   1513  C5   DT I   1      48.793 214.628  56.512  1.00 58.50           C  
ATOM   1514  C7   DT I   1      48.887 213.667  57.652  1.00 58.66           C  
ATOM   1515  C6   DT I   1      48.523 215.928  56.678  1.00 60.21           C  
ATOM   1516  P    DT I   2      45.116 220.885  56.176  1.00 64.53           P  
ATOM   1517  OP1  DT I   2      44.698 222.309  56.175  1.00 66.66           O  
ATOM   1518  OP2  DT I   2      44.435 219.918  57.076  1.00 64.45           O  
ATOM   1519  O5'  DT I   2      45.037 220.334  54.688  1.00 62.66           O  
ATOM   1520  C5'  DT I   2      45.987 220.754  53.716  1.00 59.91           C  
ATOM   1521  C4'  DT I   2      45.685 220.105  52.389  1.00 59.55           C  
ATOM   1522  O4'  DT I   2      46.181 218.743  52.374  1.00 57.48           O  
ATOM   1523  C3'  DT I   2      44.188 220.027  52.091  1.00 58.80           C  
ATOM   1524  O3'  DT I   2      43.914 220.376  50.738  1.00 59.05           O  
ATOM   1525  C2'  DT I   2      43.842 218.572  52.346  1.00 58.66           C  
ATOM   1526  C1'  DT I   2      45.138 217.852  52.004  1.00 57.45           C  
ATOM   1527  N1   DT I   2      45.340 216.584  52.740  1.00 55.51           N  
ATOM   1528  C2   DT I   2      45.752 215.484  52.028  1.00 53.77           C  
ATOM   1529  O2   DT I   2      45.941 215.508  50.826  1.00 56.02           O  
ATOM   1530  N3   DT I   2      45.932 214.349  52.778  1.00 52.81           N  
ATOM   1531  C4   DT I   2      45.738 214.209  54.140  1.00 53.76           C  
ATOM   1532  O4   DT I   2      45.952 213.129  54.685  1.00 52.40           O  
ATOM   1533  C5   DT I   2      45.286 215.402  54.822  1.00 53.21           C  
ATOM   1534  C7   DT I   2      45.024 215.341  56.294  1.00 51.51           C  
ATOM   1535  C6   DT I   2      45.119 216.514  54.098  1.00 53.47           C  
ATOM   1536  P    DC I   3      42.448 220.896  50.343  1.00 60.80           P  
ATOM   1537  OP1  DC I   3      42.608 222.038  49.402  1.00 59.15           O  
ATOM   1538  OP2  DC I   3      41.683 221.082  51.606  1.00 58.73           O  
ATOM   1539  O5'  DC I   3      41.809 219.667  49.555  1.00 59.44           O  
ATOM   1540  C5'  DC I   3      42.285 219.311  48.259  1.00 57.37           C  
ATOM   1541  C4'  DC I   3      41.693 217.991  47.821  1.00 56.47           C  
ATOM   1542  O4'  DC I   3      42.230 216.903  48.611  1.00 55.43           O  
ATOM   1543  C3'  DC I   3      40.172 217.878  47.929  1.00 57.23           C  
ATOM   1544  O3'  DC I   3      39.693 217.134  46.812  1.00 61.86           O  
ATOM   1545  C2'  DC I   3      39.981 217.026  49.170  1.00 57.10           C  
ATOM   1546  C1'  DC I   3      41.157 216.083  49.038  1.00 53.72           C  
ATOM   1547  N1   DC I   3      41.575 215.363  50.253  1.00 51.45           N  
ATOM   1548  C2   DC I   3      42.118 214.078  50.109  1.00 51.00           C  
ATOM   1549  O2   DC I   3      42.226 213.599  48.970  1.00 51.03           O  
ATOM   1550  N3   DC I   3      42.511 213.395  51.210  1.00 48.55           N  
ATOM   1551  C4   DC I   3      42.379 213.949  52.418  1.00 49.16           C  
ATOM   1552  N4   DC I   3      42.783 213.240  53.478  1.00 47.27           N  
ATOM   1553  C5   DC I   3      41.827 215.255  52.594  1.00 47.33           C  
ATOM   1554  C6   DC I   3      41.443 215.920  51.494  1.00 48.50           C  
ATOM   1555  P    DA I   4      38.951 217.891  45.611  1.00 64.75           P  
ATOM   1556  OP1  DA I   4      39.738 219.121  45.331  1.00 64.42           O  
ATOM   1557  OP2  DA I   4      37.502 217.992  45.948  1.00 62.62           O  
ATOM   1558  O5'  DA I   4      39.113 216.896  44.378  1.00 61.42           O  
ATOM   1559  C5'  DA I   4      40.382 216.706  43.754  1.00 61.23           C  
ATOM   1560  C4'  DA I   4      40.575 215.250  43.399  1.00 61.14           C  
ATOM   1561  O4'  DA I   4      40.706 214.478  44.614  1.00 60.87           O  
ATOM   1562  C3'  DA I   4      39.420 214.618  42.625  1.00 60.95           C  
ATOM   1563  O3'  DA I   4      39.925 213.685  41.672  1.00 62.34           O  
ATOM   1564  C2'  DA I   4      38.607 213.919  43.701  1.00 59.42           C  
ATOM   1565  C1'  DA I   4      39.665 213.515  44.713  1.00 59.67           C  
ATOM   1566  N9   DA I   4      39.213 213.517  46.102  1.00 58.81           N  
ATOM   1567  C8   DA I   4      38.359 214.399  46.713  1.00 59.39           C  
ATOM   1568  N7   DA I   4      38.195 214.175  47.994  1.00 59.70           N  
ATOM   1569  C5   DA I   4      38.986 213.063  48.240  1.00 59.44           C  
ATOM   1570  C6   DA I   4      39.259 212.339  49.407  1.00 58.06           C  
ATOM   1571  N6   DA I   4      38.756 212.649  50.598  1.00 58.45           N  
ATOM   1572  N1   DA I   4      40.083 211.274  49.310  1.00 59.15           N  
ATOM   1573  C2   DA I   4      40.601 210.973  48.114  1.00 57.42           C  
ATOM   1574  N3   DA I   4      40.430 211.582  46.947  1.00 58.21           N  
ATOM   1575  C4   DA I   4      39.603 212.634  47.079  1.00 59.62           C  
ATOM   1576  P    DG I   5      38.901 212.835  40.773  1.00 63.91           P  
ATOM   1577  OP1  DG I   5      39.623 212.371  39.561  1.00 64.35           O  
ATOM   1578  OP2  DG I   5      37.643 213.608  40.629  1.00 63.58           O  
ATOM   1579  O5'  DG I   5      38.601 211.568  41.683  1.00 64.87           O  
ATOM   1580  C5'  DG I   5      39.647 210.669  42.020  1.00 61.51           C  
ATOM   1581  C4'  DG I   5      39.104 209.519  42.832  1.00 61.67           C  
ATOM   1582  O4'  DG I   5      38.791 209.958  44.172  1.00 59.37           O  
ATOM   1583  C3'  DG I   5      37.825 208.878  42.284  1.00 62.14           C  
ATOM   1584  O3'  DG I   5      37.913 207.463  42.450  1.00 64.24           O  
ATOM   1585  C2'  DG I   5      36.753 209.396  43.226  1.00 61.48           C  
ATOM   1586  C1'  DG I   5      37.533 209.418  44.521  1.00 60.21           C  
ATOM   1587  N9   DG I   5      36.985 210.208  45.616  1.00 60.18           N  
ATOM   1588  C8   DG I   5      36.276 211.381  45.539  1.00 59.47           C  
ATOM   1589  N7   DG I   5      35.940 211.852  46.710  1.00 60.32           N  
ATOM   1590  C5   DG I   5      36.456 210.933  47.613  1.00 58.96           C  
ATOM   1591  C6   DG I   5      36.419 210.915  49.028  1.00 57.76           C  
ATOM   1592  O6   DG I   5      35.915 211.738  49.791  1.00 56.87           O  
ATOM   1593  N1   DG I   5      37.061 209.795  49.545  1.00 57.49           N  
ATOM   1594  C2   DG I   5      37.670 208.819  48.796  1.00 58.48           C  
ATOM   1595  N2   DG I   5      38.232 207.803  49.481  1.00 58.54           N  
ATOM   1596  N3   DG I   5      37.722 208.831  47.474  1.00 57.16           N  
ATOM   1597  C4   DG I   5      37.098 209.909  46.954  1.00 59.19           C  
ATOM   1598  P    DT I   6      38.118 206.519  41.171  1.00 65.52           P  
ATOM   1599  OP1  DT I   6      39.130 207.162  40.294  1.00 64.64           O  
ATOM   1600  OP2  DT I   6      36.781 206.165  40.624  1.00 63.65           O  
ATOM   1601  O5'  DT I   6      38.775 205.210  41.792  1.00 64.07           O  
ATOM   1602  C5'  DT I   6      39.985 205.291  42.542  1.00 61.82           C  
ATOM   1603  C4'  DT I   6      39.831 204.561  43.856  1.00 60.45           C  
ATOM   1604  O4'  DT I   6      38.918 205.276  44.723  1.00 61.48           O  
ATOM   1605  C3'  DT I   6      39.261 203.150  43.725  1.00 59.78           C  
ATOM   1606  O3'  DT I   6      39.883 202.307  44.698  1.00 56.53           O  
ATOM   1607  C2'  DT I   6      37.785 203.345  44.029  1.00 59.05           C  
ATOM   1608  C1'  DT I   6      37.835 204.429  45.088  1.00 61.92           C  
ATOM   1609  N1   DT I   6      36.625 205.266  45.209  1.00 63.00           N  
ATOM   1610  C2   DT I   6      36.227 205.641  46.474  1.00 64.18           C  
ATOM   1611  O2   DT I   6      36.804 205.285  47.490  1.00 63.62           O  
ATOM   1612  N3   DT I   6      35.123 206.453  46.509  1.00 66.14           N  
ATOM   1613  C4   DT I   6      34.391 206.914  45.434  1.00 67.64           C  
ATOM   1614  O4   DT I   6      33.428 207.653  45.622  1.00 70.56           O  
ATOM   1615  C5   DT I   6      34.849 206.468  44.140  1.00 66.58           C  
ATOM   1616  C7   DT I   6      34.106 206.910  42.919  1.00 65.34           C  
ATOM   1617  C6   DT I   6      35.927 205.673  44.092  1.00 65.36           C  
ATOM   1618  P    DT I   7      39.818 200.713  44.535  1.00 55.87           P  
ATOM   1619  OP1  DT I   7      41.205 200.192  44.582  1.00 57.92           O  
ATOM   1620  OP2  DT I   7      38.947 200.392  43.377  1.00 54.99           O  
ATOM   1621  O5'  DT I   7      39.035 200.271  45.843  1.00 54.83           O  
ATOM   1622  C5'  DT I   7      37.954 201.069  46.282  1.00 52.82           C  
ATOM   1623  C4'  DT I   7      37.598 200.766  47.713  1.00 49.93           C  
ATOM   1624  O4'  DT I   7      36.700 201.824  48.111  1.00 47.89           O  
ATOM   1625  C3'  DT I   7      36.826 199.462  47.883  1.00 48.34           C  
ATOM   1626  O3'  DT I   7      37.053 198.877  49.163  1.00 47.98           O  
ATOM   1627  C2'  DT I   7      35.379 199.886  47.744  1.00 49.84           C  
ATOM   1628  C1'  DT I   7      35.363 201.353  48.167  1.00 50.06           C  
ATOM   1629  N1   DT I   7      34.569 202.180  47.240  1.00 49.00           N  
ATOM   1630  C2   DT I   7      33.844 203.235  47.742  1.00 47.33           C  
ATOM   1631  O2   DT I   7      33.844 203.538  48.924  1.00 47.74           O  
ATOM   1632  N3   DT I   7      33.115 203.922  46.803  1.00 46.38           N  
ATOM   1633  C4   DT I   7      33.040 203.656  45.445  1.00 49.47           C  
ATOM   1634  O4   DT I   7      32.324 204.344  44.721  1.00 50.27           O  
ATOM   1635  C5   DT I   7      33.843 202.542  44.991  1.00 48.72           C  
ATOM   1636  C7   DT I   7      33.843 202.186  43.538  1.00 48.45           C  
ATOM   1637  C6   DT I   7      34.556 201.874  45.897  1.00 46.75           C  
ATOM   1638  P    DG I   8      36.222 197.571  49.593  1.00 46.78           P  
ATOM   1639  OP1  DG I   8      37.147 196.657  50.308  1.00 47.84           O  
ATOM   1640  OP2  DG I   8      35.485 197.085  48.398  1.00 44.84           O  
ATOM   1641  O5'  DG I   8      35.133 198.114  50.623  1.00 42.95           O  
ATOM   1642  C5'  DG I   8      35.515 198.707  51.860  1.00 40.39           C  
ATOM   1643  C4'  DG I   8      34.287 199.139  52.629  1.00 43.19           C  
ATOM   1644  O4'  DG I   8      33.551 200.110  51.850  1.00 43.83           O  
ATOM   1645  C3'  DG I   8      33.292 198.022  52.935  1.00 43.78           C  
ATOM   1646  O3'  DG I   8      32.671 198.265  54.198  1.00 42.53           O  
ATOM   1647  C2'  DG I   8      32.276 198.132  51.814  1.00 42.98           C  
ATOM   1648  C1'  DG I   8      32.247 199.623  51.541  1.00 44.14           C  
ATOM   1649  N9   DG I   8      31.971 199.967  50.150  1.00 46.25           N  
ATOM   1650  C8   DG I   8      32.527 199.393  49.036  1.00 46.58           C  
ATOM   1651  N7   DG I   8      32.129 199.943  47.921  1.00 47.28           N  
ATOM   1652  C5   DG I   8      31.245 200.933  48.323  1.00 49.52           C  
ATOM   1653  C6   DG I   8      30.509 201.875  47.557  1.00 50.96           C  
ATOM   1654  O6   DG I   8      30.495 202.029  46.328  1.00 52.22           O  
ATOM   1655  N1   DG I   8      29.737 202.700  48.367  1.00 50.77           N  
ATOM   1656  C2   DG I   8      29.681 202.634  49.737  1.00 51.08           C  
ATOM   1657  N2   DG I   8      28.879 203.522  50.337  1.00 52.17           N  
ATOM   1658  N3   DG I   8      30.364 201.764  50.464  1.00 50.77           N  
ATOM   1659  C4   DG I   8      31.123 200.952  49.697  1.00 49.27           C  
ATOM   1660  P    DA I   9      31.650 197.187  54.801  1.00 43.23           P  
ATOM   1661  OP1  DA I   9      32.005 197.019  56.235  1.00 43.28           O  
ATOM   1662  OP2  DA I   9      31.594 196.005  53.915  1.00 44.32           O  
ATOM   1663  O5'  DA I   9      30.242 197.910  54.703  1.00 44.92           O  
ATOM   1664  C5'  DA I   9      30.021 199.151  55.361  1.00 46.15           C  
ATOM   1665  C4'  DA I   9      28.608 199.614  55.113  1.00 45.68           C  
ATOM   1666  O4'  DA I   9      28.467 200.025  53.733  1.00 43.12           O  
ATOM   1667  C3'  DA I   9      27.561 198.525  55.338  1.00 45.59           C  
ATOM   1668  O3'  DA I   9      26.394 199.113  55.906  1.00 48.20           O  
ATOM   1669  C2'  DA I   9      27.260 198.037  53.935  1.00 43.83           C  
ATOM   1670  C1'  DA I   9      27.395 199.317  53.137  1.00 45.06           C  
ATOM   1671  N9   DA I   9      27.717 199.132  51.724  1.00 47.49           N  
ATOM   1672  C8   DA I   9      28.486 198.157  51.141  1.00 47.64           C  
ATOM   1673  N7   DA I   9      28.596 198.279  49.843  1.00 47.85           N  
ATOM   1674  C5   DA I   9      27.850 199.410  49.552  1.00 47.45           C  
ATOM   1675  C6   DA I   9      27.572 200.068  48.351  1.00 48.19           C  
ATOM   1676  N6   DA I   9      28.044 199.677  47.168  1.00 50.12           N  
ATOM   1677  N1   DA I   9      26.782 201.159  48.403  1.00 50.25           N  
ATOM   1678  C2   DA I   9      26.315 201.558  49.591  1.00 50.00           C  
ATOM   1679  N3   DA I   9      26.510 201.024  50.791  1.00 50.18           N  
ATOM   1680  C4   DA I   9      27.296 199.939  50.699  1.00 48.65           C  
ATOM   1681  P    DA I  10      25.273 198.179  56.570  1.00 44.25           P  
ATOM   1682  OP1  DA I  10      25.073 198.708  57.938  1.00 45.93           O  
ATOM   1683  OP2  DA I  10      25.609 196.749  56.373  1.00 48.68           O  
ATOM   1684  O5'  DA I  10      23.987 198.503  55.702  1.00 50.16           O  
ATOM   1685  C5'  DA I  10      23.608 199.855  55.464  1.00 53.65           C  
ATOM   1686  C4'  DA I  10      22.706 199.933  54.258  1.00 55.31           C  
ATOM   1687  O4'  DA I  10      23.479 199.750  53.048  1.00 54.39           O  
ATOM   1688  C3'  DA I  10      21.606 198.867  54.230  1.00 57.43           C  
ATOM   1689  O3'  DA I  10      20.385 199.451  53.775  1.00 61.97           O  
ATOM   1690  C2'  DA I  10      22.112 197.873  53.202  1.00 55.11           C  
ATOM   1691  C1'  DA I  10      22.839 198.785  52.237  1.00 53.96           C  
ATOM   1692  N9   DA I  10      23.851 198.129  51.411  1.00 55.55           N  
ATOM   1693  C8   DA I  10      24.721 197.121  51.754  1.00 55.16           C  
ATOM   1694  N7   DA I  10      25.464 196.704  50.758  1.00 54.02           N  
ATOM   1695  C5   DA I  10      25.066 197.498  49.691  1.00 53.84           C  
ATOM   1696  C6   DA I  10      25.467 197.546  48.347  1.00 53.47           C  
ATOM   1697  N6   DA I  10      26.382 196.736  47.819  1.00 55.20           N  
ATOM   1698  N1   DA I  10      24.884 198.465  47.551  1.00 53.34           N  
ATOM   1699  C2   DA I  10      23.960 199.272  48.076  1.00 53.01           C  
ATOM   1700  N3   DA I  10      23.492 199.320  49.319  1.00 53.14           N  
ATOM   1701  C4   DA I  10      24.090 198.394  50.084  1.00 54.39           C  
ATOM   1702  P    DG I  11      18.999 198.673  53.989  1.00 63.46           P  
ATOM   1703  OP1  DG I  11      18.198 199.493  54.931  1.00 63.58           O  
ATOM   1704  OP2  DG I  11      19.271 197.248  54.305  1.00 62.87           O  
ATOM   1705  O5'  DG I  11      18.322 198.766  52.552  1.00 65.75           O  
ATOM   1706  C5'  DG I  11      18.108 200.037  51.940  1.00 71.13           C  
ATOM   1707  C4'  DG I  11      17.831 199.870  50.465  1.00 74.95           C  
ATOM   1708  O4'  DG I  11      19.049 199.508  49.765  1.00 75.59           O  
ATOM   1709  C3'  DG I  11      16.812 198.776  50.141  1.00 76.34           C  
ATOM   1710  O3'  DG I  11      15.982 199.177  49.051  1.00 77.30           O  
ATOM   1711  C2'  DG I  11      17.680 197.619  49.695  1.00 76.56           C  
ATOM   1712  C1'  DG I  11      18.809 198.344  48.993  1.00 76.54           C  
ATOM   1713  N9   DG I  11      20.043 197.570  48.923  1.00 76.69           N  
ATOM   1714  C8   DG I  11      20.621 196.831  49.928  1.00 75.99           C  
ATOM   1715  N7   DG I  11      21.692 196.194  49.542  1.00 76.55           N  
ATOM   1716  C5   DG I  11      21.834 196.543  48.205  1.00 77.19           C  
ATOM   1717  C6   DG I  11      22.807 196.152  47.254  1.00 77.24           C  
ATOM   1718  O6   DG I  11      23.760 195.382  47.403  1.00 79.09           O  
ATOM   1719  N1   DG I  11      22.587 196.754  46.020  1.00 76.75           N  
ATOM   1720  C2   DG I  11      21.559 197.617  45.734  1.00 76.29           C  
ATOM   1721  N2   DG I  11      21.524 198.105  44.485  1.00 74.93           N  
ATOM   1722  N3   DG I  11      20.637 197.978  46.610  1.00 76.08           N  
ATOM   1723  C4   DG I  11      20.836 197.407  47.816  1.00 76.16           C  
ATOM   1724  P    DT I  12      14.780 198.224  48.574  1.00 78.22           P  
ATOM   1725  OP1  DT I  12      13.534 199.018  48.731  1.00 79.64           O  
ATOM   1726  OP2  DT I  12      14.892 196.892  49.228  1.00 76.54           O  
ATOM   1727  O5'  DT I  12      15.058 198.041  47.018  1.00 77.51           O  
ATOM   1728  C5'  DT I  12      15.286 199.176  46.189  1.00 77.68           C  
ATOM   1729  C4'  DT I  12      15.525 198.738  44.765  1.00 77.62           C  
ATOM   1730  O4'  DT I  12      16.824 198.103  44.659  1.00 77.72           O  
ATOM   1731  C3'  DT I  12      14.507 197.716  44.264  1.00 78.05           C  
ATOM   1732  O3'  DT I  12      14.170 197.986  42.903  1.00 78.45           O  
ATOM   1733  C2'  DT I  12      15.237 196.392  44.402  1.00 78.28           C  
ATOM   1734  C1'  DT I  12      16.687 196.779  44.160  1.00 77.36           C  
ATOM   1735  N1   DT I  12      17.663 195.921  44.869  1.00 76.06           N  
ATOM   1736  C2   DT I  12      18.653 195.302  44.134  1.00 75.44           C  
ATOM   1737  O2   DT I  12      18.766 195.423  42.923  1.00 74.94           O  
ATOM   1738  N3   DT I  12      19.510 194.524  44.875  1.00 74.74           N  
ATOM   1739  C4   DT I  12      19.472 194.304  46.240  1.00 74.37           C  
ATOM   1740  O4   DT I  12      20.311 193.578  46.768  1.00 72.87           O  
ATOM   1741  C5   DT I  12      18.407 194.977  46.942  1.00 73.98           C  
ATOM   1742  C7   DT I  12      18.278 194.782  48.418  1.00 73.73           C  
ATOM   1743  C6   DT I  12      17.572 195.747  46.233  1.00 74.85           C  
ATOM   1744  P    DT I  13      13.406 196.871  42.037  1.00 77.84           P  
ATOM   1745  OP1  DT I  13      12.643 197.585  40.981  1.00 78.42           O  
ATOM   1746  OP2  DT I  13      12.703 195.941  42.957  1.00 77.66           O  
ATOM   1747  O5'  DT I  13      14.594 196.083  41.336  1.00 76.06           O  
ATOM   1748  C5'  DT I  13      15.571 196.788  40.576  1.00 74.63           C  
ATOM   1749  C4'  DT I  13      16.360 195.821  39.729  1.00 72.71           C  
ATOM   1750  O4'  DT I  13      17.242 195.040  40.575  1.00 71.87           O  
ATOM   1751  C3'  DT I  13      15.484 194.818  38.979  1.00 72.35           C  
ATOM   1752  O3'  DT I  13      16.004 194.612  37.667  1.00 74.05           O  
ATOM   1753  C2'  DT I  13      15.587 193.560  39.824  1.00 70.95           C  
ATOM   1754  C1'  DT I  13      16.998 193.655  40.379  1.00 69.59           C  
ATOM   1755  N1   DT I  13      17.204 192.961  41.670  1.00 65.82           N  
ATOM   1756  C2   DT I  13      18.106 191.919  41.710  1.00 63.11           C  
ATOM   1757  O2   DT I  13      18.743 191.549  40.738  1.00 62.01           O  
ATOM   1758  N3   DT I  13      18.237 191.320  42.938  1.00 61.00           N  
ATOM   1759  C4   DT I  13      17.579 191.654  44.104  1.00 60.27           C  
ATOM   1760  O4   DT I  13      17.809 191.027  45.138  1.00 56.33           O  
ATOM   1761  C5   DT I  13      16.650 192.757  43.991  1.00 61.11           C  
ATOM   1762  C7   DT I  13      15.891 193.192  45.204  1.00 61.26           C  
ATOM   1763  C6   DT I  13      16.510 193.346  42.796  1.00 63.36           C  
ATOM   1764  P    DT I  14      15.431 193.421  36.760  1.00 77.14           P  
ATOM   1765  OP1  DT I  14      15.359 193.918  35.359  1.00 76.08           O  
ATOM   1766  OP2  DT I  14      14.220 192.856  37.407  1.00 76.63           O  
ATOM   1767  O5'  DT I  14      16.582 192.323  36.830  1.00 78.07           O  
ATOM   1768  C5'  DT I  14      17.922 192.653  36.467  1.00 76.74           C  
ATOM   1769  C4'  DT I  14      18.748 191.396  36.327  1.00 75.94           C  
ATOM   1770  O4'  DT I  14      18.974 190.818  37.633  1.00 75.83           O  
ATOM   1771  C3'  DT I  14      18.097 190.302  35.482  1.00 75.49           C  
ATOM   1772  O3'  DT I  14      19.080 189.681  34.647  1.00 74.66           O  
ATOM   1773  C2'  DT I  14      17.532 189.341  36.513  1.00 75.34           C  
ATOM   1774  C1'  DT I  14      18.492 189.483  37.679  1.00 75.95           C  
ATOM   1775  N1   DT I  14      17.869 189.277  39.001  1.00 77.10           N  
ATOM   1776  C2   DT I  14      18.537 188.504  39.930  1.00 78.20           C  
ATOM   1777  O2   DT I  14      19.612 187.970  39.708  1.00 78.85           O  
ATOM   1778  N3   DT I  14      17.895 188.380  41.136  1.00 77.54           N  
ATOM   1779  C4   DT I  14      16.683 188.936  41.499  1.00 77.52           C  
ATOM   1780  O4   DT I  14      16.236 188.745  42.626  1.00 78.11           O  
ATOM   1781  C5   DT I  14      16.036 189.724  40.475  1.00 77.31           C  
ATOM   1782  C7   DT I  14      14.716 190.361  40.778  1.00 76.55           C  
ATOM   1783  C6   DT I  14      16.652 189.852  39.294  1.00 76.73           C  
ATOM   1784  P    DC I  15      18.759 188.278  33.934  1.00 75.58           P  
ATOM   1785  OP1  DC I  15      19.438 188.286  32.613  1.00 75.87           O  
ATOM   1786  OP2  DC I  15      17.303 187.989  34.008  1.00 74.58           O  
ATOM   1787  O5'  DC I  15      19.532 187.253  34.869  1.00 75.94           O  
ATOM   1788  C5'  DC I  15      20.784 187.624  35.439  1.00 74.90           C  
ATOM   1789  C4'  DC I  15      21.393 186.453  36.169  1.00 74.22           C  
ATOM   1790  O4'  DC I  15      20.743 186.249  37.445  1.00 74.66           O  
ATOM   1791  C3'  DC I  15      21.281 185.129  35.419  1.00 73.95           C  
ATOM   1792  O3'  DC I  15      22.488 184.396  35.601  1.00 73.51           O  
ATOM   1793  C2'  DC I  15      20.135 184.425  36.124  1.00 73.53           C  
ATOM   1794  C1'  DC I  15      20.341 184.893  37.550  1.00 74.48           C  
ATOM   1795  N1   DC I  15      19.166 184.832  38.434  1.00 74.54           N  
ATOM   1796  C2   DC I  15      19.265 184.095  39.620  1.00 75.08           C  
ATOM   1797  O2   DC I  15      20.324 183.497  39.867  1.00 75.02           O  
ATOM   1798  N3   DC I  15      18.209 184.052  40.464  1.00 74.93           N  
ATOM   1799  C4   DC I  15      17.087 184.705  40.160  1.00 74.74           C  
ATOM   1800  N4   DC I  15      16.079 184.648  41.033  1.00 73.35           N  
ATOM   1801  C5   DC I  15      16.951 185.450  38.949  1.00 74.87           C  
ATOM   1802  C6   DC I  15      18.006 185.485  38.122  1.00 74.26           C  
ATOM   1803  P    DC I  16      22.865 183.223  34.581  1.00 72.21           P  
ATOM   1804  OP1  DC I  16      24.075 183.662  33.838  1.00 74.38           O  
ATOM   1805  OP2  DC I  16      21.642 182.835  33.833  1.00 71.16           O  
ATOM   1806  O5'  DC I  16      23.271 182.032  35.553  1.00 70.16           O  
ATOM   1807  C5'  DC I  16      24.074 182.276  36.704  1.00 67.88           C  
ATOM   1808  C4'  DC I  16      23.830 181.204  37.740  1.00 67.71           C  
ATOM   1809  O4'  DC I  16      22.571 181.413  38.424  1.00 67.39           O  
ATOM   1810  C3'  DC I  16      23.764 179.793  37.159  1.00 66.09           C  
ATOM   1811  O3'  DC I  16      24.322 178.883  38.097  1.00 64.60           O  
ATOM   1812  C2'  DC I  16      22.272 179.534  37.070  1.00 66.93           C  
ATOM   1813  C1'  DC I  16      21.785 180.235  38.322  1.00 68.09           C  
ATOM   1814  N1   DC I  16      20.371 180.632  38.301  1.00 69.67           N  
ATOM   1815  C2   DC I  16      19.598 180.405  39.439  1.00 69.27           C  
ATOM   1816  O2   DC I  16      20.121 179.849  40.417  1.00 68.23           O  
ATOM   1817  N3   DC I  16      18.304 180.793  39.445  1.00 69.83           N  
ATOM   1818  C4   DC I  16      17.778 181.375  38.367  1.00 71.31           C  
ATOM   1819  N4   DC I  16      16.498 181.749  38.420  1.00 73.45           N  
ATOM   1820  C5   DC I  16      18.540 181.603  37.186  1.00 71.82           C  
ATOM   1821  C6   DC I  16      19.821 181.219  37.196  1.00 70.67           C  
ATOM   1822  P    DC I  17      25.805 178.325  37.879  1.00 60.94           P  
ATOM   1823  OP1  DC I  17      26.672 179.472  37.497  1.00 56.58           O  
ATOM   1824  OP2  DC I  17      25.725 177.132  36.999  1.00 61.29           O  
ATOM   1825  O5'  DC I  17      26.205 177.863  39.343  1.00 59.42           O  
ATOM   1826  C5'  DC I  17      26.351 178.827  40.376  1.00 59.14           C  
ATOM   1827  C4'  DC I  17      25.733 178.317  41.654  1.00 59.50           C  
ATOM   1828  O4'  DC I  17      24.290 178.355  41.559  1.00 60.97           O  
ATOM   1829  C3'  DC I  17      26.100 176.876  41.991  1.00 58.30           C  
ATOM   1830  O3'  DC I  17      26.369 176.757  43.383  1.00 54.54           O  
ATOM   1831  C2'  DC I  17      24.860 176.088  41.607  1.00 59.38           C  
ATOM   1832  C1'  DC I  17      23.740 177.082  41.851  1.00 60.25           C  
ATOM   1833  N1   DC I  17      22.567 176.902  40.981  1.00 61.03           N  
ATOM   1834  C2   DC I  17      21.286 176.847  41.561  1.00 61.36           C  
ATOM   1835  O2   DC I  17      21.177 176.917  42.796  1.00 58.98           O  
ATOM   1836  N3   DC I  17      20.204 176.716  40.758  1.00 62.78           N  
ATOM   1837  C4   DC I  17      20.361 176.632  39.434  1.00 62.79           C  
ATOM   1838  N4   DC I  17      19.268 176.518  38.680  1.00 61.20           N  
ATOM   1839  C5   DC I  17      21.651 176.666  38.823  1.00 63.44           C  
ATOM   1840  C6   DC I  17      22.715 176.801  39.626  1.00 61.32           C  
ATOM   1841  P    DT I  18      26.771 175.331  43.983  1.00 55.40           P  
ATOM   1842  OP1  DT I  18      27.652 175.567  45.157  1.00 56.29           O  
ATOM   1843  OP2  DT I  18      27.235 174.457  42.872  1.00 51.33           O  
ATOM   1844  O5'  DT I  18      25.384 174.782  44.529  1.00 58.84           O  
ATOM   1845  C5'  DT I  18      24.617 175.573  45.426  1.00 61.90           C  
ATOM   1846  C4'  DT I  18      23.424 174.798  45.925  1.00 62.53           C  
ATOM   1847  O4'  DT I  18      22.367 174.787  44.938  1.00 62.55           O  
ATOM   1848  C3'  DT I  18      23.707 173.340  46.272  1.00 63.74           C  
ATOM   1849  O3'  DT I  18      23.070 173.037  47.506  1.00 65.67           O  
ATOM   1850  C2'  DT I  18      23.079 172.565  45.123  1.00 63.21           C  
ATOM   1851  C1'  DT I  18      21.917 173.459  44.726  1.00 63.51           C  
ATOM   1852  N1   DT I  18      21.466 173.364  43.321  1.00 62.60           N  
ATOM   1853  C2   DT I  18      20.117 173.512  43.070  1.00 62.13           C  
ATOM   1854  O2   DT I  18      19.286 173.663  43.951  1.00 62.79           O  
ATOM   1855  N3   DT I  18      19.773 173.476  41.745  1.00 60.42           N  
ATOM   1856  C4   DT I  18      20.617 173.304  40.670  1.00 61.58           C  
ATOM   1857  O4   DT I  18      20.159 173.319  39.529  1.00 60.49           O  
ATOM   1858  C5   DT I  18      22.018 173.123  41.006  1.00 61.72           C  
ATOM   1859  C7   DT I  18      23.008 172.909  39.905  1.00 59.66           C  
ATOM   1860  C6   DT I  18      22.365 173.159  42.298  1.00 61.59           C  
ATOM   1861  P    DT I  19      23.126 171.547  48.077  1.00 68.55           P  
ATOM   1862  OP1  DT I  19      23.201 171.656  49.553  1.00 68.37           O  
ATOM   1863  OP2  DT I  19      24.176 170.801  47.341  1.00 69.89           O  
ATOM   1864  O5'  DT I  19      21.707 170.957  47.657  1.00 70.76           O  
ATOM   1865  C5'  DT I  19      20.505 171.656  47.976  1.00 71.22           C  
ATOM   1866  C4'  DT I  19      19.303 170.861  47.524  1.00 72.67           C  
ATOM   1867  O4'  DT I  19      19.108 171.013  46.097  1.00 71.98           O  
ATOM   1868  C3'  DT I  19      19.411 169.359  47.786  1.00 74.23           C  
ATOM   1869  O3'  DT I  19      18.171 168.839  48.270  1.00 78.73           O  
ATOM   1870  C2'  DT I  19      19.724 168.782  46.417  1.00 72.75           C  
ATOM   1871  C1'  DT I  19      18.997 169.737  45.488  1.00 70.51           C  
ATOM   1872  N1   DT I  19      19.567 169.831  44.130  1.00 69.29           N  
ATOM   1873  C2   DT I  19      18.708 170.052  43.076  1.00 68.74           C  
ATOM   1874  O2   DT I  19      17.503 170.161  43.210  1.00 69.83           O  
ATOM   1875  N3   DT I  19      19.318 170.140  41.850  1.00 68.08           N  
ATOM   1876  C4   DT I  19      20.668 170.030  41.578  1.00 68.87           C  
ATOM   1877  O4   DT I  19      21.069 170.140  40.421  1.00 69.70           O  
ATOM   1878  C5   DT I  19      21.510 169.789  42.729  1.00 68.42           C  
ATOM   1879  C7   DT I  19      22.985 169.644  42.533  1.00 67.57           C  
ATOM   1880  C6   DT I  19      20.925 169.704  43.929  1.00 69.39           C  
ATOM   1881  P    DT I  20      18.064 167.284  48.666  1.00 81.44           P  
ATOM   1882  OP1  DT I  20      17.335 167.204  49.958  1.00 80.05           O  
ATOM   1883  OP2  DT I  20      19.414 166.671  48.547  1.00 80.75           O  
ATOM   1884  O5'  DT I  20      17.144 166.674  47.518  1.00 82.29           O  
ATOM   1885  C5'  DT I  20      15.793 167.098  47.366  1.00 86.04           C  
ATOM   1886  C4'  DT I  20      15.066 166.180  46.413  1.00 89.29           C  
ATOM   1887  O4'  DT I  20      15.548 166.406  45.067  1.00 90.25           O  
ATOM   1888  C3'  DT I  20      15.277 164.692  46.696  1.00 91.27           C  
ATOM   1889  O3'  DT I  20      14.067 163.964  46.467  1.00 93.66           O  
ATOM   1890  C2'  DT I  20      16.348 164.291  45.698  1.00 90.83           C  
ATOM   1891  C1'  DT I  20      16.053 165.198  44.515  1.00 90.28           C  
ATOM   1892  N1   DT I  20      17.240 165.535  43.703  1.00 89.98           N  
ATOM   1893  C2   DT I  20      17.115 165.534  42.331  1.00 89.72           C  
ATOM   1894  O2   DT I  20      16.074 165.255  41.755  1.00 90.67           O  
ATOM   1895  N3   DT I  20      18.263 165.867  41.652  1.00 88.11           N  
ATOM   1896  C4   DT I  20      19.494 166.182  42.198  1.00 86.56           C  
ATOM   1897  O4   DT I  20      20.436 166.458  41.466  1.00 84.70           O  
ATOM   1898  C5   DT I  20      19.555 166.153  43.639  1.00 87.09           C  
ATOM   1899  C7   DT I  20      20.851 166.462  44.315  1.00 87.27           C  
ATOM   1900  C6   DT I  20      18.439 165.841  44.310  1.00 88.97           C  
ATOM   1901  P    DG I  21      14.053 162.365  46.631  1.00 95.23           P  
ATOM   1902  OP1  DG I  21      12.812 162.004  47.362  1.00 95.21           O  
ATOM   1903  OP2  DG I  21      15.369 161.909  47.150  1.00 94.99           O  
ATOM   1904  O5'  DG I  21      13.902 161.849  45.135  1.00 96.96           O  
ATOM   1905  C5'  DG I  21      12.707 162.100  44.401  1.00101.10           C  
ATOM   1906  C4'  DG I  21      12.720 161.319  43.110  1.00104.01           C  
ATOM   1907  O4'  DG I  21      13.703 161.888  42.211  1.00105.17           O  
ATOM   1908  C3'  DG I  21      13.108 159.852  43.280  1.00105.38           C  
ATOM   1909  O3'  DG I  21      12.355 159.043  42.371  1.00107.05           O  
ATOM   1910  C2'  DG I  21      14.586 159.842  42.934  1.00105.69           C  
ATOM   1911  C1'  DG I  21      14.662 160.905  41.854  1.00105.84           C  
ATOM   1912  N9   DG I  21      15.955 161.572  41.729  1.00107.05           N  
ATOM   1913  C8   DG I  21      16.781 161.991  42.744  1.00107.75           C  
ATOM   1914  N7   DG I  21      17.864 162.582  42.314  1.00107.63           N  
ATOM   1915  C5   DG I  21      17.747 162.548  40.930  1.00107.56           C  
ATOM   1916  C6   DG I  21      18.612 163.043  39.920  1.00107.50           C  
ATOM   1917  O6   DG I  21      19.690 163.638  40.049  1.00106.55           O  
ATOM   1918  N1   DG I  21      18.111 162.788  38.648  1.00107.95           N  
ATOM   1919  C2   DG I  21      16.928 162.144  38.379  1.00107.60           C  
ATOM   1920  N2   DG I  21      16.618 161.990  37.083  1.00107.69           N  
ATOM   1921  N3   DG I  21      16.111 161.685  39.310  1.00107.71           N  
ATOM   1922  C4   DG I  21      16.578 161.920  40.554  1.00107.44           C  
ATOM   1923  P    DA I  22      12.776 157.512  42.137  1.00108.62           P  
ATOM   1924  OP1  DA I  22      11.702 156.854  41.345  1.00107.99           O  
ATOM   1925  OP2  DA I  22      13.178 156.939  43.449  1.00108.57           O  
ATOM   1926  O5'  DA I  22      14.071 157.632  41.221  1.00107.60           O  
ATOM   1927  C5'  DA I  22      14.919 156.514  41.001  1.00106.82           C  
ATOM   1928  C4'  DA I  22      15.510 156.584  39.614  1.00106.63           C  
ATOM   1929  O4'  DA I  22      16.229 157.832  39.443  1.00107.01           O  
ATOM   1930  C3'  DA I  22      16.514 155.475  39.303  1.00106.19           C  
ATOM   1931  O3'  DA I  22      16.391 155.109  37.931  1.00105.04           O  
ATOM   1932  C2'  DA I  22      17.851 156.155  39.520  1.00106.46           C  
ATOM   1933  C1'  DA I  22      17.555 157.554  39.019  1.00106.87           C  
ATOM   1934  N9   DA I  22      18.441 158.586  39.557  1.00106.76           N  
ATOM   1935  C8   DA I  22      18.533 159.052  40.846  1.00106.25           C  
ATOM   1936  N7   DA I  22      19.451 159.974  41.009  1.00105.90           N  
ATOM   1937  C5   DA I  22      19.996 160.129  39.741  1.00106.05           C  
ATOM   1938  C6   DA I  22      21.015 160.960  39.243  1.00106.06           C  
ATOM   1939  N6   DA I  22      21.699 161.825  39.995  1.00105.98           N  
ATOM   1940  N1   DA I  22      21.312 160.872  37.928  1.00106.22           N  
ATOM   1941  C2   DA I  22      20.626 160.004  37.174  1.00106.34           C  
ATOM   1942  N3   DA I  22      19.650 159.171  37.526  1.00106.12           N  
ATOM   1943  C4   DA I  22      19.379 159.285  38.837  1.00106.23           C  
ATOM   1944  P    DT I  23      16.354 153.561  37.521  1.00103.74           P  
ATOM   1945  OP1  DT I  23      15.031 153.034  37.940  1.00104.55           O  
ATOM   1946  OP2  DT I  23      17.595 152.908  38.012  1.00103.90           O  
ATOM   1947  O5'  DT I  23      16.401 153.610  35.930  1.00103.14           O  
ATOM   1948  C5'  DT I  23      15.537 154.483  35.202  1.00100.87           C  
ATOM   1949  C4'  DT I  23      16.269 155.078  34.021  1.00 99.18           C  
ATOM   1950  O4'  DT I  23      17.260 156.030  34.483  1.00 98.37           O  
ATOM   1951  C3'  DT I  23      17.028 154.058  33.173  1.00 98.26           C  
ATOM   1952  O3'  DT I  23      16.934 154.393  31.786  1.00 96.14           O  
ATOM   1953  C2'  DT I  23      18.460 154.192  33.657  1.00 98.35           C  
ATOM   1954  C1'  DT I  23      18.546 155.670  33.998  1.00 98.16           C  
ATOM   1955  N1   DT I  23      19.536 155.998  35.043  1.00 97.99           N  
ATOM   1956  C2   DT I  23      20.432 157.015  34.795  1.00 98.38           C  
ATOM   1957  O2   DT I  23      20.458 157.644  33.749  1.00 98.90           O  
ATOM   1958  N3   DT I  23      21.308 157.268  35.823  1.00 97.96           N  
ATOM   1959  C4   DT I  23      21.382 156.614  37.038  1.00 97.73           C  
ATOM   1960  O4   DT I  23      22.218 156.957  37.869  1.00 97.50           O  
ATOM   1961  C5   DT I  23      20.427 155.547  37.222  1.00 97.60           C  
ATOM   1962  C7   DT I  23      20.455 154.763  38.495  1.00 97.77           C  
ATOM   1963  C6   DT I  23      19.558 155.301  36.233  1.00 97.51           C  
ATOM   1964  P    DA I  24      17.778 153.553  30.710  1.00 95.37           P  
ATOM   1965  OP1  DA I  24      17.065 153.621  29.407  1.00 95.19           O  
ATOM   1966  OP2  DA I  24      18.114 152.229  31.298  1.00 94.73           O  
ATOM   1967  O5'  DA I  24      19.129 154.381  30.579  1.00 92.69           O  
ATOM   1968  C5'  DA I  24      19.216 155.503  29.708  1.00 88.70           C  
ATOM   1969  C4'  DA I  24      20.644 155.680  29.251  1.00 85.68           C  
ATOM   1970  O4'  DA I  24      21.453 156.108  30.373  1.00 85.61           O  
ATOM   1971  C3'  DA I  24      21.275 154.383  28.746  1.00 83.02           C  
ATOM   1972  O3'  DA I  24      22.161 154.655  27.663  1.00 78.07           O  
ATOM   1973  C2'  DA I  24      22.040 153.870  29.952  1.00 83.96           C  
ATOM   1974  C1'  DA I  24      22.482 155.160  30.623  1.00 85.35           C  
ATOM   1975  N9   DA I  24      22.655 155.058  32.071  1.00 83.83           N  
ATOM   1976  C8   DA I  24      21.832 154.448  32.983  1.00 83.07           C  
ATOM   1977  N7   DA I  24      22.261 154.529  34.219  1.00 82.72           N  
ATOM   1978  C5   DA I  24      23.447 155.240  34.114  1.00 82.54           C  
ATOM   1979  C6   DA I  24      24.387 155.658  35.070  1.00 81.38           C  
ATOM   1980  N6   DA I  24      24.281 155.405  36.376  1.00 80.83           N  
ATOM   1981  N1   DA I  24      25.459 156.353  34.633  1.00 81.66           N  
ATOM   1982  C2   DA I  24      25.572 156.598  33.321  1.00 82.26           C  
ATOM   1983  N3   DA I  24      24.760 156.256  32.327  1.00 82.72           N  
ATOM   1984  C4   DA I  24      23.703 155.571  32.796  1.00 83.38           C  
ATOM   1985  P    DG I  25      22.833 153.436  26.868  1.00 76.31           P  
ATOM   1986  OP1  DG I  25      22.973 153.874  25.458  1.00 74.63           O  
ATOM   1987  OP2  DG I  25      22.094 152.188  27.183  1.00 76.90           O  
ATOM   1988  O5'  DG I  25      24.281 153.318  27.516  1.00 75.26           O  
ATOM   1989  C5'  DG I  25      25.174 154.428  27.493  1.00 71.35           C  
ATOM   1990  C4'  DG I  25      26.418 154.121  28.291  1.00 68.31           C  
ATOM   1991  O4'  DG I  25      26.123 154.079  29.709  1.00 68.19           O  
ATOM   1992  C3'  DG I  25      27.091 152.786  27.964  1.00 66.62           C  
ATOM   1993  O3'  DG I  25      28.501 152.968  28.040  1.00 64.29           O  
ATOM   1994  C2'  DG I  25      26.681 151.907  29.131  1.00 67.47           C  
ATOM   1995  C1'  DG I  25      26.746 152.928  30.241  1.00 68.58           C  
ATOM   1996  N9   DG I  25      26.112 152.594  31.512  1.00 70.65           N  
ATOM   1997  C8   DG I  25      24.974 151.856  31.732  1.00 71.12           C  
ATOM   1998  N7   DG I  25      24.685 151.730  32.999  1.00 71.68           N  
ATOM   1999  C5   DG I  25      25.693 152.428  33.653  1.00 71.79           C  
ATOM   2000  C6   DG I  25      25.924 152.642  35.041  1.00 72.30           C  
ATOM   2001  O6   DG I  25      25.263 152.245  36.007  1.00 73.22           O  
ATOM   2002  N1   DG I  25      27.065 153.407  35.256  1.00 73.15           N  
ATOM   2003  C2   DG I  25      27.881 153.905  34.271  1.00 72.69           C  
ATOM   2004  N2   DG I  25      28.935 154.623  34.679  1.00 72.56           N  
ATOM   2005  N3   DG I  25      27.678 153.713  32.981  1.00 72.70           N  
ATOM   2006  C4   DG I  25      26.576 152.970  32.747  1.00 71.86           C  
ATOM   2007  P    DC I  26      29.360 153.127  26.699  1.00 64.10           P  
ATOM   2008  OP1  DC I  26      28.549 153.912  25.737  1.00 64.40           O  
ATOM   2009  OP2  DC I  26      29.884 151.792  26.308  1.00 64.77           O  
ATOM   2010  O5'  DC I  26      30.585 154.029  27.160  1.00 62.31           O  
ATOM   2011  C5'  DC I  26      30.389 155.393  27.515  1.00 59.11           C  
ATOM   2012  C4'  DC I  26      31.222 155.735  28.726  1.00 56.90           C  
ATOM   2013  O4'  DC I  26      30.661 155.116  29.908  1.00 56.61           O  
ATOM   2014  C3'  DC I  26      32.667 155.250  28.643  1.00 55.19           C  
ATOM   2015  O3'  DC I  26      33.531 156.219  29.245  1.00 53.56           O  
ATOM   2016  C2'  DC I  26      32.649 153.966  29.453  1.00 55.20           C  
ATOM   2017  C1'  DC I  26      31.638 154.299  30.535  1.00 56.50           C  
ATOM   2018  N1   DC I  26      30.944 153.146  31.132  1.00 57.10           N  
ATOM   2019  C2   DC I  26      30.822 153.085  32.525  1.00 57.93           C  
ATOM   2020  O2   DC I  26      31.335 153.976  33.212  1.00 59.62           O  
ATOM   2021  N3   DC I  26      30.152 152.055  33.086  1.00 59.30           N  
ATOM   2022  C4   DC I  26      29.621 151.106  32.312  1.00 58.25           C  
ATOM   2023  N4   DC I  26      28.948 150.122  32.910  1.00 57.92           N  
ATOM   2024  C5   DC I  26      29.752 151.128  30.893  1.00 57.04           C  
ATOM   2025  C6   DC I  26      30.415 152.158  30.350  1.00 56.67           C  
ATOM   2026  P    DG I  27      35.093 156.211  28.895  1.00 52.40           P  
ATOM   2027  OP1  DG I  27      35.584 157.599  29.088  1.00 53.67           O  
ATOM   2028  OP2  DG I  27      35.285 155.540  27.582  1.00 52.33           O  
ATOM   2029  O5'  DG I  27      35.721 155.268  30.011  1.00 51.62           O  
ATOM   2030  C5'  DG I  27      35.740 155.668  31.376  1.00 50.38           C  
ATOM   2031  C4'  DG I  27      36.243 154.537  32.243  1.00 49.70           C  
ATOM   2032  O4'  DG I  27      35.253 153.492  32.340  1.00 49.84           O  
ATOM   2033  C3'  DG I  27      37.519 153.841  31.762  1.00 47.48           C  
ATOM   2034  O3'  DG I  27      38.205 153.359  32.913  1.00 46.26           O  
ATOM   2035  C2'  DG I  27      36.970 152.616  31.062  1.00 49.43           C  
ATOM   2036  C1'  DG I  27      35.899 152.266  32.063  1.00 50.49           C  
ATOM   2037  N9   DG I  27      34.886 151.295  31.678  1.00 53.41           N  
ATOM   2038  C8   DG I  27      34.489 150.927  30.416  1.00 53.53           C  
ATOM   2039  N7   DG I  27      33.528 150.043  30.423  1.00 55.17           N  
ATOM   2040  C5   DG I  27      33.286 149.813  31.772  1.00 56.19           C  
ATOM   2041  C6   DG I  27      32.350 148.956  32.409  1.00 57.09           C  
ATOM   2042  O6   DG I  27      31.511 148.210  31.891  1.00 58.81           O  
ATOM   2043  N1   DG I  27      32.452 149.028  33.796  1.00 57.05           N  
ATOM   2044  C2   DG I  27      33.335 149.829  34.483  1.00 55.95           C  
ATOM   2045  N2   DG I  27      33.287 149.763  35.822  1.00 53.86           N  
ATOM   2046  N3   DG I  27      34.203 150.634  33.900  1.00 55.03           N  
ATOM   2047  C4   DG I  27      34.124 150.573  32.554  1.00 54.84           C  
ATOM   2048  P    DC I  28      39.543 154.074  33.406  1.00 44.84           P  
ATOM   2049  OP1  DC I  28      39.391 155.533  33.196  1.00 45.42           O  
ATOM   2050  OP2  DC I  28      40.682 153.353  32.788  1.00 47.77           O  
ATOM   2051  O5'  DC I  28      39.575 153.760  34.965  1.00 45.04           O  
ATOM   2052  C5'  DC I  28      38.582 154.280  35.844  1.00 50.32           C  
ATOM   2053  C4'  DC I  28      38.269 153.270  36.925  1.00 54.83           C  
ATOM   2054  O4'  DC I  28      37.391 152.239  36.409  1.00 57.35           O  
ATOM   2055  C3'  DC I  28      39.508 152.546  37.445  1.00 56.99           C  
ATOM   2056  O3'  DC I  28      39.430 152.322  38.848  1.00 59.36           O  
ATOM   2057  C2'  DC I  28      39.488 151.223  36.704  1.00 55.49           C  
ATOM   2058  C1'  DC I  28      38.003 150.961  36.527  1.00 56.07           C  
ATOM   2059  N1   DC I  28      37.678 150.202  35.310  1.00 57.08           N  
ATOM   2060  C2   DC I  28      36.768 149.140  35.392  1.00 57.21           C  
ATOM   2061  O2   DC I  28      36.273 148.857  36.491  1.00 57.87           O  
ATOM   2062  N3   DC I  28      36.455 148.452  34.271  1.00 57.12           N  
ATOM   2063  C4   DC I  28      37.011 148.791  33.104  1.00 58.35           C  
ATOM   2064  N4   DC I  28      36.662 148.098  32.019  1.00 59.58           N  
ATOM   2065  C5   DC I  28      37.949 149.858  32.996  1.00 57.89           C  
ATOM   2066  C6   DC I  28      38.250 150.530  34.112  1.00 57.38           C  
ATOM   2067  P    DA I  29      40.677 151.652  39.597  1.00 63.88           P  
ATOM   2068  OP1  DA I  29      40.838 152.300  40.924  1.00 64.29           O  
ATOM   2069  OP2  DA I  29      41.812 151.644  38.631  1.00 59.90           O  
ATOM   2070  O5'  DA I  29      40.232 150.140  39.808  1.00 63.71           O  
ATOM   2071  C5'  DA I  29      39.103 149.813  40.607  1.00 65.50           C  
ATOM   2072  C4'  DA I  29      38.873 148.321  40.577  1.00 66.67           C  
ATOM   2073  O4'  DA I  29      38.404 147.933  39.261  1.00 66.77           O  
ATOM   2074  C3'  DA I  29      40.142 147.507  40.832  1.00 67.73           C  
ATOM   2075  O3'  DA I  29      39.842 146.347  41.607  1.00 69.85           O  
ATOM   2076  C2'  DA I  29      40.575 147.090  39.440  1.00 67.31           C  
ATOM   2077  C1'  DA I  29      39.237 146.903  38.756  1.00 68.30           C  
ATOM   2078  N9   DA I  29      39.282 147.011  37.300  1.00 68.79           N  
ATOM   2079  C8   DA I  29      40.065 147.837  36.535  1.00 69.62           C  
ATOM   2080  N7   DA I  29      39.908 147.668  35.244  1.00 69.86           N  
ATOM   2081  C5   DA I  29      38.951 146.668  35.153  1.00 69.44           C  
ATOM   2082  C6   DA I  29      38.353 146.029  34.054  1.00 69.30           C  
ATOM   2083  N6   DA I  29      38.649 146.313  32.783  1.00 66.94           N  
ATOM   2084  N1   DA I  29      37.429 145.076  34.308  1.00 69.48           N  
ATOM   2085  C2   DA I  29      37.136 144.792  35.584  1.00 69.74           C  
ATOM   2086  N3   DA I  29      37.633 145.321  36.700  1.00 68.59           N  
ATOM   2087  C4   DA I  29      38.547 146.263  36.412  1.00 69.61           C  
ATOM   2088  P    DG I  30      41.026 145.349  42.032  1.00 72.51           P  
ATOM   2089  OP1  DG I  30      41.394 145.661  43.433  1.00 71.63           O  
ATOM   2090  OP2  DG I  30      42.076 145.355  40.980  1.00 71.84           O  
ATOM   2091  O5'  DG I  30      40.327 143.920  42.012  1.00 73.26           O  
ATOM   2092  C5'  DG I  30      38.988 143.755  42.473  1.00 73.66           C  
ATOM   2093  C4'  DG I  30      38.388 142.508  41.869  1.00 73.06           C  
ATOM   2094  O4'  DG I  30      38.166 142.710  40.454  1.00 73.34           O  
ATOM   2095  C3'  DG I  30      39.295 141.288  41.976  1.00 72.57           C  
ATOM   2096  O3'  DG I  30      38.500 140.115  42.132  1.00 73.97           O  
ATOM   2097  C2'  DG I  30      40.006 141.270  40.637  1.00 72.05           C  
ATOM   2098  C1'  DG I  30      38.927 141.776  39.703  1.00 72.10           C  
ATOM   2099  N9   DG I  30      39.431 142.464  38.521  1.00 72.21           N  
ATOM   2100  C8   DG I  30      40.144 143.637  38.482  1.00 71.74           C  
ATOM   2101  N7   DG I  30      40.446 144.014  37.270  1.00 72.13           N  
ATOM   2102  C5   DG I  30      39.899 143.030  36.460  1.00 72.56           C  
ATOM   2103  C6   DG I  30      39.893 142.900  35.049  1.00 72.11           C  
ATOM   2104  O6   DG I  30      40.379 143.660  34.204  1.00 71.99           O  
ATOM   2105  N1   DG I  30      39.230 141.747  34.647  1.00 72.52           N  
ATOM   2106  C2   DG I  30      38.639 140.837  35.491  1.00 72.21           C  
ATOM   2107  N2   DG I  30      38.047 139.781  34.910  1.00 72.57           N  
ATOM   2108  N3   DG I  30      38.630 140.951  36.806  1.00 72.21           N  
ATOM   2109  C4   DG I  30      39.274 142.063  37.219  1.00 72.69           C  
ATOM   2110  P    DT I  31      39.139 138.811  42.813  1.00 75.40           P  
ATOM   2111  OP1  DT I  31      38.207 138.361  43.882  1.00 75.67           O  
ATOM   2112  OP2  DT I  31      40.557 139.109  43.145  1.00 73.72           O  
ATOM   2113  O5'  DT I  31      39.120 137.736  41.643  1.00 75.03           O  
ATOM   2114  C5'  DT I  31      39.261 138.143  40.290  1.00 76.51           C  
ATOM   2115  C4'  DT I  31      39.233 136.940  39.380  1.00 77.29           C  
ATOM   2116  O4'  DT I  31      39.392 137.398  38.020  1.00 77.73           O  
ATOM   2117  C3'  DT I  31      40.376 135.963  39.627  1.00 77.90           C  
ATOM   2118  O3'  DT I  31      39.945 134.629  39.362  1.00 80.53           O  
ATOM   2119  C2'  DT I  31      41.444 136.414  38.650  1.00 77.31           C  
ATOM   2120  C1'  DT I  31      40.642 136.981  37.488  1.00 77.93           C  
ATOM   2121  N1   DT I  31      41.264 138.160  36.857  1.00 78.51           N  
ATOM   2122  C2   DT I  31      41.090 138.342  35.508  1.00 78.28           C  
ATOM   2123  O2   DT I  31      40.444 137.578  34.813  1.00 78.35           O  
ATOM   2124  N3   DT I  31      41.701 139.460  34.999  1.00 79.53           N  
ATOM   2125  C4   DT I  31      42.451 140.393  35.691  1.00 79.41           C  
ATOM   2126  O4   DT I  31      42.943 141.349  35.096  1.00 79.60           O  
ATOM   2127  C5   DT I  31      42.590 140.142  37.106  1.00 79.16           C  
ATOM   2128  C7   DT I  31      43.382 141.099  37.940  1.00 78.19           C  
ATOM   2129  C6   DT I  31      41.998 139.053  37.611  1.00 78.93           C  
ATOM   2130  P    DT I  32      40.953 133.406  39.611  1.00 81.87           P  
ATOM   2131  OP1  DT I  32      40.129 132.204  39.896  1.00 81.86           O  
ATOM   2132  OP2  DT I  32      41.990 133.841  40.585  1.00 81.16           O  
ATOM   2133  O5'  DT I  32      41.645 133.210  38.192  1.00 82.23           O  
ATOM   2134  C5'  DT I  32      40.856 132.947  37.037  1.00 82.43           C  
ATOM   2135  C4'  DT I  32      41.745 132.765  35.831  1.00 83.21           C  
ATOM   2136  O4'  DT I  32      42.239 134.047  35.374  1.00 83.52           O  
ATOM   2137  C3'  DT I  32      42.977 131.897  36.087  1.00 83.26           C  
ATOM   2138  O3'  DT I  32      43.197 131.035  34.971  1.00 84.30           O  
ATOM   2139  C2'  DT I  32      44.102 132.909  36.214  1.00 83.26           C  
ATOM   2140  C1'  DT I  32      43.653 133.998  35.256  1.00 83.26           C  
ATOM   2141  N1   DT I  32      44.185 135.350  35.538  1.00 82.31           N  
ATOM   2142  C2   DT I  32      44.598 136.119  34.471  1.00 81.68           C  
ATOM   2143  O2   DT I  32      44.562 135.732  33.313  1.00 80.48           O  
ATOM   2144  N3   DT I  32      45.060 137.365  34.811  1.00 81.56           N  
ATOM   2145  C4   DT I  32      45.154 137.905  36.078  1.00 81.19           C  
ATOM   2146  O4   DT I  32      45.582 139.046  36.227  1.00 81.20           O  
ATOM   2147  C5   DT I  32      44.721 137.042  37.148  1.00 80.71           C  
ATOM   2148  C7   DT I  32      44.807 137.537  38.557  1.00 80.64           C  
ATOM   2149  C6   DT I  32      44.261 135.825  36.830  1.00 81.37           C  
ATOM   2150  P    DT I  33      44.417 129.993  34.996  1.00 83.70           P  
ATOM   2151  OP1  DT I  33      43.929 128.748  34.355  1.00 84.49           O  
ATOM   2152  OP2  DT I  33      44.993 129.938  36.363  1.00 82.68           O  
ATOM   2153  O5'  DT I  33      45.483 130.666  34.026  1.00 83.96           O  
ATOM   2154  C5'  DT I  33      45.162 130.913  32.659  1.00 84.15           C  
ATOM   2155  C4'  DT I  33      46.380 131.417  31.926  1.00 84.35           C  
ATOM   2156  O4'  DT I  33      46.610 132.815  32.227  1.00 84.13           O  
ATOM   2157  C3'  DT I  33      47.660 130.680  32.313  1.00 85.11           C  
ATOM   2158  O3'  DT I  33      48.462 130.426  31.164  1.00 85.10           O  
ATOM   2159  C2'  DT I  33      48.365 131.653  33.239  1.00 84.50           C  
ATOM   2160  C1'  DT I  33      47.948 132.991  32.663  1.00 83.92           C  
ATOM   2161  N1   DT I  33      47.974 134.103  33.633  1.00 83.50           N  
ATOM   2162  C2   DT I  33      48.184 135.380  33.157  1.00 82.67           C  
ATOM   2163  O2   DT I  33      48.318 135.637  31.969  1.00 81.58           O  
ATOM   2164  N3   DT I  33      48.229 136.350  34.128  1.00 81.88           N  
ATOM   2165  C4   DT I  33      48.086 136.175  35.492  1.00 81.90           C  
ATOM   2166  O4   DT I  33      48.166 137.141  36.246  1.00 81.23           O  
ATOM   2167  C5   DT I  33      47.851 134.814  35.917  1.00 81.96           C  
ATOM   2168  C7   DT I  33      47.670 134.528  37.374  1.00 82.46           C  
ATOM   2169  C6   DT I  33      47.806 133.861  34.980  1.00 82.45           C  
ATOM   2170  P    DG I  34      48.883 128.919  30.821  1.00 84.41           P  
ATOM   2171  OP1  DG I  34      47.721 128.304  30.130  1.00 84.59           O  
ATOM   2172  OP2  DG I  34      49.434 128.290  32.048  1.00 83.74           O  
ATOM   2173  O5'  DG I  34      50.058 129.087  29.765  1.00 84.14           O  
ATOM   2174  C5'  DG I  34      49.874 129.883  28.603  1.00 82.98           C  
ATOM   2175  C4'  DG I  34      51.012 130.866  28.473  1.00 82.38           C  
ATOM   2176  O4'  DG I  34      50.914 131.882  29.499  1.00 82.61           O  
ATOM   2177  C3'  DG I  34      52.392 130.233  28.641  1.00 81.84           C  
ATOM   2178  O3'  DG I  34      53.298 130.866  27.747  1.00 80.96           O  
ATOM   2179  C2'  DG I  34      52.761 130.580  30.071  1.00 81.77           C  
ATOM   2180  C1'  DG I  34      52.145 131.957  30.198  1.00 82.11           C  
ATOM   2181  N9   DG I  34      51.870 132.410  31.556  1.00 81.91           N  
ATOM   2182  C8   DG I  34      51.662 131.641  32.675  1.00 82.70           C  
ATOM   2183  N7   DG I  34      51.432 132.349  33.748  1.00 82.72           N  
ATOM   2184  C5   DG I  34      51.493 133.665  33.310  1.00 83.10           C  
ATOM   2185  C6   DG I  34      51.322 134.884  34.021  1.00 82.66           C  
ATOM   2186  O6   DG I  34      51.066 135.050  35.221  1.00 82.62           O  
ATOM   2187  N1   DG I  34      51.472 135.987  33.186  1.00 81.67           N  
ATOM   2188  C2   DG I  34      51.747 135.929  31.843  1.00 81.34           C  
ATOM   2189  N2   DG I  34      51.853 137.104  31.206  1.00 80.94           N  
ATOM   2190  N3   DG I  34      51.907 134.803  31.170  1.00 82.20           N  
ATOM   2191  C4   DG I  34      51.766 133.718  31.960  1.00 82.82           C  
ATOM   2192  P    DA I  35      54.264 129.974  26.839  1.00 82.20           P  
ATOM   2193  OP1  DA I  35      53.417 128.968  26.148  1.00 82.09           O  
ATOM   2194  OP2  DA I  35      55.401 129.526  27.685  1.00 81.14           O  
ATOM   2195  O5'  DA I  35      54.797 131.007  25.752  1.00 80.68           O  
ATOM   2196  C5'  DA I  35      53.896 131.882  25.081  1.00 77.93           C  
ATOM   2197  C4'  DA I  35      54.401 133.304  25.154  1.00 77.27           C  
ATOM   2198  O4'  DA I  35      54.329 133.771  26.523  1.00 77.47           O  
ATOM   2199  C3'  DA I  35      55.857 133.479  24.723  1.00 76.05           C  
ATOM   2200  O3'  DA I  35      56.014 134.703  24.006  1.00 73.35           O  
ATOM   2201  C2'  DA I  35      56.615 133.520  26.036  1.00 76.43           C  
ATOM   2202  C1'  DA I  35      55.614 134.159  26.985  1.00 77.31           C  
ATOM   2203  N9   DA I  35      55.743 133.710  28.371  1.00 77.71           N  
ATOM   2204  C8   DA I  35      56.205 132.497  28.820  1.00 78.47           C  
ATOM   2205  N7   DA I  35      56.202 132.379  30.125  1.00 78.58           N  
ATOM   2206  C5   DA I  35      55.704 133.596  30.568  1.00 78.31           C  
ATOM   2207  C6   DA I  35      55.455 134.103  31.853  1.00 77.94           C  
ATOM   2208  N6   DA I  35      55.671 133.416  32.976  1.00 78.48           N  
ATOM   2209  N1   DA I  35      54.965 135.357  31.949  1.00 77.29           N  
ATOM   2210  C2   DA I  35      54.741 136.042  30.823  1.00 78.18           C  
ATOM   2211  N3   DA I  35      54.929 135.673  29.559  1.00 78.91           N  
ATOM   2212  C4   DA I  35      55.419 134.425  29.498  1.00 78.31           C  
ATOM   2213  P    DC I  36      57.469 135.139  23.487  1.00 74.09           P  
ATOM   2214  OP1  DC I  36      57.266 136.079  22.353  1.00 73.54           O  
ATOM   2215  OP2  DC I  36      58.305 133.926  23.299  1.00 72.66           O  
ATOM   2216  O5'  DC I  36      58.069 135.962  24.709  1.00 72.73           O  
ATOM   2217  C5'  DC I  36      57.409 137.127  25.193  1.00 70.46           C  
ATOM   2218  C4'  DC I  36      58.210 137.746  26.311  1.00 69.41           C  
ATOM   2219  O4'  DC I  36      58.146 136.899  27.486  1.00 69.75           O  
ATOM   2220  C3'  DC I  36      59.696 137.904  25.980  1.00 68.91           C  
ATOM   2221  O3'  DC I  36      60.192 139.123  26.537  1.00 65.36           O  
ATOM   2222  C2'  DC I  36      60.331 136.721  26.686  1.00 69.91           C  
ATOM   2223  C1'  DC I  36      59.462 136.619  27.926  1.00 70.40           C  
ATOM   2224  N1   DC I  36      59.460 135.311  28.597  1.00 71.18           N  
ATOM   2225  C2   DC I  36      59.157 135.261  29.961  1.00 72.38           C  
ATOM   2226  O2   DC I  36      58.861 136.313  30.549  1.00 71.74           O  
ATOM   2227  N3   DC I  36      59.192 134.072  30.604  1.00 73.03           N  
ATOM   2228  C4   DC I  36      59.502 132.961  29.934  1.00 72.34           C  
ATOM   2229  N4   DC I  36      59.542 131.815  30.615  1.00 73.11           N  
ATOM   2230  C5   DC I  36      59.791 132.979  28.539  1.00 72.10           C  
ATOM   2231  C6   DC I  36      59.759 134.164  27.915  1.00 71.95           C  
ATOM   2232  P    DA I  37      60.832 140.239  25.575  1.00 62.94           P  
ATOM   2233  OP1  DA I  37      59.820 140.598  24.547  1.00 61.08           O  
ATOM   2234  OP2  DA I  37      62.188 139.798  25.158  1.00 61.82           O  
ATOM   2235  O5'  DA I  37      60.991 141.495  26.533  1.00 61.91           O  
ATOM   2236  C5'  DA I  37      59.900 141.938  27.327  1.00 59.76           C  
ATOM   2237  C4'  DA I  37      60.298 141.948  28.781  1.00 58.91           C  
ATOM   2238  O4'  DA I  37      60.459 140.586  29.243  1.00 60.26           O  
ATOM   2239  C3'  DA I  37      61.631 142.646  29.052  1.00 56.82           C  
ATOM   2240  O3'  DA I  37      61.562 143.359  30.290  1.00 53.62           O  
ATOM   2241  C2'  DA I  37      62.614 141.496  29.154  1.00 57.37           C  
ATOM   2242  C1'  DA I  37      61.760 140.412  29.782  1.00 61.05           C  
ATOM   2243  N9   DA I  37      62.187 139.047  29.480  1.00 63.56           N  
ATOM   2244  C8   DA I  37      62.595 138.536  28.273  1.00 64.62           C  
ATOM   2245  N7   DA I  37      62.896 137.262  28.314  1.00 65.60           N  
ATOM   2246  C5   DA I  37      62.674 136.909  29.638  1.00 65.55           C  
ATOM   2247  C6   DA I  37      62.800 135.690  30.328  1.00 66.90           C  
ATOM   2248  N6   DA I  37      63.195 134.551  29.754  1.00 66.94           N  
ATOM   2249  N1   DA I  37      62.499 135.679  31.644  1.00 67.27           N  
ATOM   2250  C2   DA I  37      62.098 136.821  32.219  1.00 66.07           C  
ATOM   2251  N3   DA I  37      61.938 138.026  31.678  1.00 65.72           N  
ATOM   2252  C4   DA I  37      62.245 138.001  30.369  1.00 64.29           C  
ATOM   2253  P    DC I  38      62.642 144.502  30.614  1.00 48.63           P  
ATOM   2254  OP1  DC I  38      61.857 145.697  30.997  1.00 47.66           O  
ATOM   2255  OP2  DC I  38      63.616 144.590  29.501  1.00 48.40           O  
ATOM   2256  O5'  DC I  38      63.405 143.936  31.892  1.00 46.33           O  
ATOM   2257  C5'  DC I  38      62.677 143.606  33.065  1.00 44.21           C  
ATOM   2258  C4'  DC I  38      63.466 142.661  33.941  1.00 43.57           C  
ATOM   2259  O4'  DC I  38      63.522 141.330  33.367  1.00 44.75           O  
ATOM   2260  C3'  DC I  38      64.911 143.055  34.262  1.00 44.17           C  
ATOM   2261  O3'  DC I  38      65.120 142.837  35.658  1.00 44.71           O  
ATOM   2262  C2'  DC I  38      65.729 142.051  33.466  1.00 45.05           C  
ATOM   2263  C1'  DC I  38      64.834 140.829  33.540  1.00 45.70           C  
ATOM   2264  N1   DC I  38      65.081 139.775  32.536  1.00 46.68           N  
ATOM   2265  C2   DC I  38      64.948 138.430  32.928  1.00 46.15           C  
ATOM   2266  O2   DC I  38      64.581 138.175  34.080  1.00 45.76           O  
ATOM   2267  N3   DC I  38      65.219 137.450  32.041  1.00 45.58           N  
ATOM   2268  C4   DC I  38      65.589 137.760  30.799  1.00 47.45           C  
ATOM   2269  N4   DC I  38      65.839 136.754  29.957  1.00 45.82           N  
ATOM   2270  C5   DC I  38      65.715 139.119  30.363  1.00 47.14           C  
ATOM   2271  C6   DC I  38      65.451 140.084  31.256  1.00 47.42           C  
ATOM   2272  P    DA I  39      66.508 143.253  36.352  1.00 44.32           P  
ATOM   2273  OP1  DA I  39      66.244 144.445  37.189  1.00 47.16           O  
ATOM   2274  OP2  DA I  39      67.619 143.276  35.375  1.00 45.81           O  
ATOM   2275  O5'  DA I  39      66.754 142.047  37.348  1.00 48.16           O  
ATOM   2276  C5'  DA I  39      65.679 141.528  38.127  1.00 55.65           C  
ATOM   2277  C4'  DA I  39      66.118 140.259  38.813  1.00 60.71           C  
ATOM   2278  O4'  DA I  39      66.113 139.168  37.865  1.00 61.04           O  
ATOM   2279  C3'  DA I  39      67.546 140.368  39.331  1.00 64.16           C  
ATOM   2280  O3'  DA I  39      67.682 139.720  40.588  1.00 67.97           O  
ATOM   2281  C2'  DA I  39      68.378 139.708  38.247  1.00 64.15           C  
ATOM   2282  C1'  DA I  39      67.429 138.686  37.639  1.00 63.55           C  
ATOM   2283  N9   DA I  39      67.587 138.524  36.195  1.00 64.14           N  
ATOM   2284  C8   DA I  39      67.343 139.463  35.227  1.00 64.66           C  
ATOM   2285  N7   DA I  39      67.553 139.035  34.007  1.00 65.30           N  
ATOM   2286  C5   DA I  39      67.964 137.722  34.183  1.00 65.68           C  
ATOM   2287  C6   DA I  39      68.331 136.720  33.273  1.00 65.94           C  
ATOM   2288  N6   DA I  39      68.321 136.883  31.948  1.00 66.93           N  
ATOM   2289  N1   DA I  39      68.707 135.524  33.774  1.00 66.05           N  
ATOM   2290  C2   DA I  39      68.695 135.353  35.101  1.00 65.75           C  
ATOM   2291  N3   DA I  39      68.357 136.213  36.057  1.00 66.54           N  
ATOM   2292  C4   DA I  39      67.998 137.395  35.525  1.00 65.76           C  
ATOM   2293  P    DC I  40      69.071 139.831  41.378  1.00 71.72           P  
ATOM   2294  OP1  DC I  40      68.761 139.722  42.827  1.00 71.40           O  
ATOM   2295  OP2  DC I  40      69.815 141.014  40.870  1.00 70.05           O  
ATOM   2296  O5'  DC I  40      69.832 138.514  40.916  1.00 70.88           O  
ATOM   2297  C5'  DC I  40      69.223 137.239  41.086  1.00 71.23           C  
ATOM   2298  C4'  DC I  40      70.187 136.149  40.689  1.00 72.21           C  
ATOM   2299  O4'  DC I  40      70.172 135.954  39.255  1.00 71.34           O  
ATOM   2300  C3'  DC I  40      71.634 136.450  41.072  1.00 73.57           C  
ATOM   2301  O3'  DC I  40      72.252 135.298  41.640  1.00 76.91           O  
ATOM   2302  C2'  DC I  40      72.284 136.821  39.750  1.00 72.43           C  
ATOM   2303  C1'  DC I  40      71.494 135.998  38.751  1.00 71.99           C  
ATOM   2304  N1   DC I  40      71.443 136.578  37.400  1.00 73.27           N  
ATOM   2305  C2   DC I  40      71.802 135.781  36.311  1.00 73.88           C  
ATOM   2306  O2   DC I  40      72.141 134.608  36.515  1.00 75.14           O  
ATOM   2307  N3   DC I  40      71.771 136.310  35.065  1.00 73.42           N  
ATOM   2308  C4   DC I  40      71.402 137.581  34.890  1.00 72.71           C  
ATOM   2309  N4   DC I  40      71.394 138.066  33.647  1.00 71.34           N  
ATOM   2310  C5   DC I  40      71.026 138.413  35.983  1.00 72.40           C  
ATOM   2311  C6   DC I  40      71.058 137.876  37.208  1.00 73.20           C  
ATOM   2312  P    DT I  41      73.813 135.335  41.999  1.00 79.40           P  
ATOM   2313  OP1  DT I  41      74.015 134.564  43.252  1.00 80.57           O  
ATOM   2314  OP2  DT I  41      74.292 136.739  41.915  1.00 79.84           O  
ATOM   2315  O5'  DT I  41      74.461 134.512  40.807  1.00 80.39           O  
ATOM   2316  C5'  DT I  41      74.006 133.200  40.507  1.00 82.43           C  
ATOM   2317  C4'  DT I  41      74.970 132.536  39.558  1.00 83.92           C  
ATOM   2318  O4'  DT I  41      74.812 133.091  38.231  1.00 84.46           O  
ATOM   2319  C3'  DT I  41      76.428 132.774  39.944  1.00 84.79           C  
ATOM   2320  O3'  DT I  41      77.193 131.605  39.670  1.00 86.55           O  
ATOM   2321  C2'  DT I  41      76.848 133.922  39.044  1.00 84.27           C  
ATOM   2322  C1'  DT I  41      76.042 133.646  37.788  1.00 84.35           C  
ATOM   2323  N1   DT I  41      75.732 134.828  36.960  1.00 83.29           N  
ATOM   2324  C2   DT I  41      75.983 134.742  35.613  1.00 83.37           C  
ATOM   2325  O2   DT I  41      76.482 133.760  35.092  1.00 84.51           O  
ATOM   2326  N3   DT I  41      75.632 135.856  34.893  1.00 84.19           N  
ATOM   2327  C4   DT I  41      75.077 137.024  35.378  1.00 83.53           C  
ATOM   2328  O4   DT I  41      74.797 137.936  34.606  1.00 82.90           O  
ATOM   2329  C5   DT I  41      74.867 137.058  36.805  1.00 83.45           C  
ATOM   2330  C7   DT I  41      74.298 138.296  37.424  1.00 82.85           C  
ATOM   2331  C6   DT I  41      75.197 135.970  37.517  1.00 83.74           C  
ATOM   2332  P    DT I  42      78.730 131.543  40.116  1.00 87.93           P  
ATOM   2333  OP1  DT I  42      78.925 130.234  40.787  1.00 88.79           O  
ATOM   2334  OP2  DT I  42      79.084 132.798  40.832  1.00 87.94           O  
ATOM   2335  O5'  DT I  42      79.500 131.526  38.727  1.00 86.35           O  
ATOM   2336  C5'  DT I  42      79.203 130.534  37.755  1.00 86.33           C  
ATOM   2337  C4'  DT I  42      80.068 130.737  36.536  1.00 87.09           C  
ATOM   2338  O4'  DT I  42      79.574 131.860  35.764  1.00 87.49           O  
ATOM   2339  C3'  DT I  42      81.525 131.056  36.872  1.00 87.08           C  
ATOM   2340  O3'  DT I  42      82.394 130.380  35.962  1.00 86.00           O  
ATOM   2341  C2'  DT I  42      81.603 132.561  36.692  1.00 87.44           C  
ATOM   2342  C1'  DT I  42      80.621 132.796  35.560  1.00 88.19           C  
ATOM   2343  N1   DT I  42      80.027 134.149  35.520  1.00 88.80           N  
ATOM   2344  C2   DT I  42      79.934 134.775  34.299  1.00 88.39           C  
ATOM   2345  O2   DT I  42      80.325 134.268  33.260  1.00 88.66           O  
ATOM   2346  N3   DT I  42      79.366 136.025  34.338  1.00 88.04           N  
ATOM   2347  C4   DT I  42      78.902 136.697  35.454  1.00 87.87           C  
ATOM   2348  O4   DT I  42      78.412 137.816  35.335  1.00 87.90           O  
ATOM   2349  C5   DT I  42      79.041 135.989  36.701  1.00 87.91           C  
ATOM   2350  C7   DT I  42      78.581 136.648  37.962  1.00 87.21           C  
ATOM   2351  C6   DT I  42      79.585 134.764  36.674  1.00 88.87           C  
ATOM   2352  P    DT I  43      83.972 130.685  35.984  1.00 86.21           P  
ATOM   2353  OP1  DT I  43      84.670 129.372  35.982  1.00 86.54           O  
ATOM   2354  OP2  DT I  43      84.280 131.679  37.048  1.00 85.44           O  
ATOM   2355  O5'  DT I  43      84.209 131.364  34.566  1.00 83.66           O  
ATOM   2356  C5'  DT I  43      83.625 130.793  33.400  1.00 81.65           C  
ATOM   2357  C4'  DT I  43      83.929 131.642  32.190  1.00 79.40           C  
ATOM   2358  O4'  DT I  43      83.166 132.871  32.246  1.00 78.56           O  
ATOM   2359  C3'  DT I  43      85.394 132.052  32.060  1.00 78.37           C  
ATOM   2360  O3'  DT I  43      85.795 131.970  30.691  1.00 78.00           O  
ATOM   2361  C2'  DT I  43      85.406 133.487  32.555  1.00 77.43           C  
ATOM   2362  C1'  DT I  43      84.035 133.987  32.134  1.00 77.60           C  
ATOM   2363  N1   DT I  43      83.485 135.075  32.970  1.00 76.33           N  
ATOM   2364  C2   DT I  43      82.904 136.150  32.333  1.00 74.69           C  
ATOM   2365  O2   DT I  43      82.824 136.243  31.120  1.00 72.52           O  
ATOM   2366  N3   DT I  43      82.416 137.116  33.176  1.00 74.89           N  
ATOM   2367  C4   DT I  43      82.448 137.115  34.558  1.00 75.20           C  
ATOM   2368  O4   DT I  43      81.961 138.051  35.183  1.00 75.28           O  
ATOM   2369  C5   DT I  43      83.073 135.963  35.159  1.00 74.63           C  
ATOM   2370  C7   DT I  43      83.159 135.883  36.650  1.00 73.52           C  
ATOM   2371  C6   DT I  43      83.552 135.011  34.347  1.00 75.15           C  
ATOM   2372  P    DT I  44      87.253 132.482  30.256  1.00 78.19           P  
ATOM   2373  OP1  DT I  44      87.816 131.480  29.316  1.00 77.23           O  
ATOM   2374  OP2  DT I  44      88.011 132.848  31.486  1.00 77.72           O  
ATOM   2375  O5'  DT I  44      86.938 133.810  29.435  1.00 74.97           O  
ATOM   2376  C5'  DT I  44      85.895 133.824  28.462  1.00 71.27           C  
ATOM   2377  C4'  DT I  44      85.779 135.192  27.830  1.00 69.61           C  
ATOM   2378  O4'  DT I  44      85.164 136.133  28.747  1.00 67.73           O  
ATOM   2379  C3'  DT I  44      87.109 135.816  27.406  1.00 68.40           C  
ATOM   2380  O3'  DT I  44      86.957 136.428  26.125  1.00 66.54           O  
ATOM   2381  C2'  DT I  44      87.384 136.844  28.492  1.00 66.81           C  
ATOM   2382  C1'  DT I  44      85.985 137.283  28.887  1.00 65.32           C  
ATOM   2383  N1   DT I  44      85.842 137.770  30.271  1.00 62.96           N  
ATOM   2384  C2   DT I  44      85.346 139.043  30.462  1.00 63.00           C  
ATOM   2385  O2   DT I  44      85.074 139.798  29.543  1.00 63.60           O  
ATOM   2386  N3   DT I  44      85.185 139.405  31.777  1.00 61.94           N  
ATOM   2387  C4   DT I  44      85.473 138.645  32.895  1.00 63.01           C  
ATOM   2388  O4   DT I  44      85.248 139.095  34.020  1.00 60.78           O  
ATOM   2389  C5   DT I  44      86.026 137.335  32.620  1.00 63.05           C  
ATOM   2390  C7   DT I  44      86.404 136.455  33.768  1.00 62.13           C  
ATOM   2391  C6   DT I  44      86.177 136.968  31.339  1.00 63.04           C  
ATOM   2392  P    DT I  45      88.125 137.360  25.544  1.00 69.06           P  
ATOM   2393  OP1  DT I  45      88.223 137.099  24.084  1.00 67.05           O  
ATOM   2394  OP2  DT I  45      89.332 137.229  26.398  1.00 66.58           O  
ATOM   2395  O5'  DT I  45      87.526 138.823  25.733  1.00 69.64           O  
ATOM   2396  C5'  DT I  45      86.206 139.123  25.280  1.00 67.23           C  
ATOM   2397  C4'  DT I  45      85.943 140.606  25.377  1.00 66.13           C  
ATOM   2398  O4'  DT I  45      85.799 140.989  26.764  1.00 67.00           O  
ATOM   2399  C3'  DT I  45      87.062 141.477  24.811  1.00 65.73           C  
ATOM   2400  O3'  DT I  45      86.506 142.584  24.101  1.00 62.38           O  
ATOM   2401  C2'  DT I  45      87.820 141.927  26.049  1.00 65.97           C  
ATOM   2402  C1'  DT I  45      86.717 142.023  27.084  1.00 66.36           C  
ATOM   2403  N1   DT I  45      87.143 141.824  28.483  1.00 67.14           N  
ATOM   2404  C2   DT I  45      86.714 142.731  29.430  1.00 67.80           C  
ATOM   2405  O2   DT I  45      86.028 143.706  29.165  1.00 68.66           O  
ATOM   2406  N3   DT I  45      87.122 142.456  30.707  1.00 67.32           N  
ATOM   2407  C4   DT I  45      87.902 141.400  31.126  1.00 67.43           C  
ATOM   2408  O4   DT I  45      88.184 141.285  32.314  1.00 68.01           O  
ATOM   2409  C5   DT I  45      88.329 140.497  30.083  1.00 67.44           C  
ATOM   2410  C7   DT I  45      89.184 139.323  30.444  1.00 66.84           C  
ATOM   2411  C6   DT I  45      87.935 140.754  28.829  1.00 67.03           C  
ATOM   2412  P    DC I  46      87.467 143.762  23.594  1.00 62.65           P  
ATOM   2413  OP1  DC I  46      86.868 144.333  22.363  1.00 63.68           O  
ATOM   2414  OP2  DC I  46      88.870 143.274  23.571  1.00 62.72           O  
ATOM   2415  O5'  DC I  46      87.354 144.848  24.752  1.00 64.89           O  
ATOM   2416  C5'  DC I  46      86.089 145.397  25.114  1.00 62.26           C  
ATOM   2417  C4'  DC I  46      86.260 146.429  26.204  1.00 61.11           C  
ATOM   2418  O4'  DC I  46      86.649 145.785  27.442  1.00 62.71           O  
ATOM   2419  C3'  DC I  46      87.322 147.496  25.929  1.00 59.52           C  
ATOM   2420  O3'  DC I  46      86.867 148.746  26.436  1.00 55.88           O  
ATOM   2421  C2'  DC I  46      88.492 147.042  26.782  1.00 61.74           C  
ATOM   2422  C1'  DC I  46      87.765 146.468  27.981  1.00 64.16           C  
ATOM   2423  N1   DC I  46      88.538 145.520  28.801  1.00 68.21           N  
ATOM   2424  C2   DC I  46      88.358 145.534  30.187  1.00 69.89           C  
ATOM   2425  O2   DC I  46      87.539 146.325  30.677  1.00 71.32           O  
ATOM   2426  N3   DC I  46      89.079 144.689  30.957  1.00 70.50           N  
ATOM   2427  C4   DC I  46      89.949 143.853  30.393  1.00 70.70           C  
ATOM   2428  N4   DC I  46      90.650 143.046  31.195  1.00 71.97           N  
ATOM   2429  C5   DC I  46      90.143 143.807  28.981  1.00 70.52           C  
ATOM   2430  C6   DC I  46      89.422 144.649  28.230  1.00 69.48           C  
ATOM   2431  P    DT I  47      86.776 150.026  25.469  1.00 52.77           P  
ATOM   2432  OP1  DT I  47      85.970 149.678  24.274  1.00 52.15           O  
ATOM   2433  OP2  DT I  47      88.129 150.610  25.302  1.00 53.47           O  
ATOM   2434  O5'  DT I  47      85.898 151.021  26.335  1.00 52.92           O  
ATOM   2435  C5'  DT I  47      84.739 150.535  27.000  1.00 49.98           C  
ATOM   2436  C4'  DT I  47      84.799 150.888  28.465  1.00 47.18           C  
ATOM   2437  O4'  DT I  47      85.843 150.138  29.136  1.00 47.85           O  
ATOM   2438  C3'  DT I  47      85.102 152.363  28.721  1.00 46.19           C  
ATOM   2439  O3'  DT I  47      84.247 152.838  29.746  1.00 39.51           O  
ATOM   2440  C2'  DT I  47      86.542 152.361  29.201  1.00 47.14           C  
ATOM   2441  C1'  DT I  47      86.617 151.031  29.924  1.00 48.78           C  
ATOM   2442  N1   DT I  47      87.974 150.475  30.058  1.00 49.70           N  
ATOM   2443  C2   DT I  47      88.458 150.224  31.328  1.00 50.57           C  
ATOM   2444  O2   DT I  47      87.824 150.454  32.346  1.00 48.69           O  
ATOM   2445  N3   DT I  47      89.722 149.692  31.361  1.00 51.67           N  
ATOM   2446  C4   DT I  47      90.533 149.399  30.283  1.00 52.06           C  
ATOM   2447  O4   DT I  47      91.645 148.924  30.468  1.00 54.12           O  
ATOM   2448  C5   DT I  47      89.969 149.695  28.987  1.00 52.55           C  
ATOM   2449  C7   DT I  47      90.782 149.417  27.764  1.00 52.95           C  
ATOM   2450  C6   DT I  47      88.733 150.212  28.939  1.00 51.30           C  
ATOM   2451  P    DA I  48      84.020 154.407  29.923  1.00 36.21           P  
ATOM   2452  OP1  DA I  48      82.574 154.565  30.216  1.00 36.23           O  
ATOM   2453  OP2  DA I  48      84.628 155.151  28.799  1.00 33.83           O  
ATOM   2454  O5'  DA I  48      84.843 154.734  31.240  1.00 35.52           O  
ATOM   2455  C5'  DA I  48      84.525 154.088  32.463  1.00 33.69           C  
ATOM   2456  C4'  DA I  48      85.632 154.306  33.462  1.00 36.18           C  
ATOM   2457  O4'  DA I  48      86.822 153.600  33.031  1.00 38.59           O  
ATOM   2458  C3'  DA I  48      86.043 155.769  33.634  1.00 37.03           C  
ATOM   2459  O3'  DA I  48      86.295 156.018  35.013  1.00 37.05           O  
ATOM   2460  C2'  DA I  48      87.336 155.871  32.841  1.00 38.23           C  
ATOM   2461  C1'  DA I  48      87.929 154.485  33.037  1.00 41.29           C  
ATOM   2462  N9   DA I  48      88.875 154.039  32.009  1.00 43.38           N  
ATOM   2463  C8   DA I  48      88.898 154.349  30.671  1.00 45.34           C  
ATOM   2464  N7   DA I  48      89.880 153.781  30.012  1.00 44.84           N  
ATOM   2465  C5   DA I  48      90.553 153.051  30.982  1.00 46.00           C  
ATOM   2466  C6   DA I  48      91.696 152.225  30.928  1.00 47.73           C  
ATOM   2467  N6   DA I  48      92.395 151.991  29.810  1.00 46.50           N  
ATOM   2468  N1   DA I  48      92.102 151.642  32.077  1.00 47.62           N  
ATOM   2469  C2   DA I  48      91.406 151.879  33.197  1.00 47.70           C  
ATOM   2470  N3   DA I  48      90.323 152.635  33.374  1.00 47.64           N  
ATOM   2471  C4   DA I  48      89.943 153.199  32.216  1.00 45.01           C  
ATOM   2472  P    DC I  49      86.071 157.488  35.614  1.00 32.00           P  
ATOM   2473  OP1  DC I  49      84.646 157.592  35.995  1.00 30.15           O  
ATOM   2474  OP2  DC I  49      86.660 158.461  34.659  1.00 31.72           O  
ATOM   2475  O5'  DC I  49      86.964 157.463  36.929  1.00 35.54           O  
ATOM   2476  C5'  DC I  49      87.042 156.280  37.727  1.00 44.53           C  
ATOM   2477  C4'  DC I  49      88.466 156.033  38.173  1.00 49.06           C  
ATOM   2478  O4'  DC I  49      89.253 155.407  37.125  1.00 50.26           O  
ATOM   2479  C3'  DC I  49      89.229 157.293  38.580  1.00 49.58           C  
ATOM   2480  O3'  DC I  49      89.969 157.070  39.775  1.00 48.03           O  
ATOM   2481  C2'  DC I  49      90.194 157.509  37.428  1.00 49.70           C  
ATOM   2482  C1'  DC I  49      90.491 156.086  37.010  1.00 49.58           C  
ATOM   2483  N1   DC I  49      90.980 155.935  35.629  1.00 50.54           N  
ATOM   2484  C2   DC I  49      92.046 155.071  35.389  1.00 48.33           C  
ATOM   2485  O2   DC I  49      92.528 154.453  36.337  1.00 49.00           O  
ATOM   2486  N3   DC I  49      92.522 154.935  34.133  1.00 47.69           N  
ATOM   2487  C4   DC I  49      91.972 155.626  33.133  1.00 49.28           C  
ATOM   2488  N4   DC I  49      92.481 155.473  31.906  1.00 47.57           N  
ATOM   2489  C5   DC I  49      90.876 156.509  33.345  1.00 50.69           C  
ATOM   2490  C6   DC I  49      90.413 156.631  34.598  1.00 51.45           C  
ATOM   2491  P    DG I  50      90.473 158.328  40.632  1.00 51.20           P  
ATOM   2492  OP1  DG I  50      89.660 158.379  41.872  1.00 49.97           O  
ATOM   2493  OP2  DG I  50      90.539 159.520  39.748  1.00 51.37           O  
ATOM   2494  O5'  DG I  50      91.969 157.952  41.009  1.00 54.28           O  
ATOM   2495  C5'  DG I  50      92.279 156.737  41.678  1.00 59.47           C  
ATOM   2496  C4'  DG I  50      93.764 156.487  41.595  1.00 64.12           C  
ATOM   2497  O4'  DG I  50      94.105 156.102  40.240  1.00 62.67           O  
ATOM   2498  C3'  DG I  50      94.579 157.744  41.895  1.00 67.86           C  
ATOM   2499  O3'  DG I  50      95.770 157.414  42.610  1.00 74.45           O  
ATOM   2500  C2'  DG I  50      94.901 158.291  40.515  1.00 66.27           C  
ATOM   2501  C1'  DG I  50      95.026 157.027  39.681  1.00 64.42           C  
ATOM   2502  N9   DG I  50      94.689 157.200  38.270  1.00 64.75           N  
ATOM   2503  C8   DG I  50      93.572 157.814  37.760  1.00 64.58           C  
ATOM   2504  N7   DG I  50      93.538 157.814  36.456  1.00 63.65           N  
ATOM   2505  C5   DG I  50      94.702 157.161  36.079  1.00 63.57           C  
ATOM   2506  C6   DG I  50      95.209 156.859  34.790  1.00 63.59           C  
ATOM   2507  O6   DG I  50      94.715 157.113  33.688  1.00 63.63           O  
ATOM   2508  N1   DG I  50      96.423 156.190  34.863  1.00 64.20           N  
ATOM   2509  C2   DG I  50      97.068 155.852  36.021  1.00 64.17           C  
ATOM   2510  N2   DG I  50      98.230 155.206  35.874  1.00 67.04           N  
ATOM   2511  N3   DG I  50      96.608 156.125  37.231  1.00 64.62           N  
ATOM   2512  C4   DG I  50      95.427 156.777  37.186  1.00 64.71           C  
ATOM   2513  P    DA I  51      96.796 158.580  43.021  1.00 79.37           P  
ATOM   2514  OP1  DA I  51      97.230 158.327  44.419  1.00 77.96           O  
ATOM   2515  OP2  DA I  51      96.189 159.890  42.664  1.00 79.65           O  
ATOM   2516  O5'  DA I  51      98.034 158.339  42.053  1.00 80.75           O  
ATOM   2517  C5'  DA I  51      98.732 157.100  42.060  1.00 84.49           C  
ATOM   2518  C4'  DA I  51      99.842 157.131  41.038  1.00 87.73           C  
ATOM   2519  O4'  DA I  51      99.268 157.143  39.710  1.00 87.18           O  
ATOM   2520  C3'  DA I  51     100.729 158.372  41.129  1.00 90.37           C  
ATOM   2521  O3'  DA I  51     102.093 158.028  40.876  1.00 94.95           O  
ATOM   2522  C2'  DA I  51     100.191 159.273  40.033  1.00 89.21           C  
ATOM   2523  C1'  DA I  51      99.729 158.274  38.988  1.00 88.19           C  
ATOM   2524  N9   DA I  51      98.628 158.753  38.154  1.00 88.36           N  
ATOM   2525  C8   DA I  51      97.390 159.188  38.561  1.00 88.03           C  
ATOM   2526  N7   DA I  51      96.611 159.563  37.575  1.00 87.82           N  
ATOM   2527  C5   DA I  51      97.387 159.362  36.442  1.00 87.58           C  
ATOM   2528  C6   DA I  51      97.137 159.569  35.073  1.00 87.71           C  
ATOM   2529  N6   DA I  51      95.986 160.049  34.594  1.00 86.67           N  
ATOM   2530  N1   DA I  51      98.123 159.263  34.202  1.00 87.70           N  
ATOM   2531  C2   DA I  51      99.277 158.785  34.683  1.00 87.34           C  
ATOM   2532  N3   DA I  51      99.633 158.549  35.945  1.00 87.02           N  
ATOM   2533  C4   DA I  51      98.631 158.861  36.784  1.00 87.78           C  
ATOM   2534  P    DT I  52     103.253 159.097  41.178  1.00 98.55           P  
ATOM   2535  OP1  DT I  52     104.414 158.324  41.688  1.00 98.56           O  
ATOM   2536  OP2  DT I  52     102.689 160.201  41.999  1.00 98.44           O  
ATOM   2537  O5'  DT I  52     103.625 159.667  39.736  1.00 98.19           O  
ATOM   2538  C5'  DT I  52     104.266 158.827  38.781  1.00 98.98           C  
ATOM   2539  C4'  DT I  52     104.453 159.548  37.466  1.00 99.43           C  
ATOM   2540  O4'  DT I  52     103.183 159.731  36.791  1.00 99.56           O  
ATOM   2541  C3'  DT I  52     105.104 160.933  37.534  1.00 99.77           C  
ATOM   2542  O3'  DT I  52     106.044 161.062  36.461  1.00101.06           O  
ATOM   2543  C2'  DT I  52     103.939 161.871  37.278  1.00 99.67           C  
ATOM   2544  C1'  DT I  52     103.139 161.052  36.287  1.00 99.26           C  
ATOM   2545  N1   DT I  52     101.730 161.453  36.116  1.00 98.09           N  
ATOM   2546  C2   DT I  52     101.260 161.578  34.829  1.00 96.76           C  
ATOM   2547  O2   DT I  52     101.936 161.325  33.847  1.00 95.77           O  
ATOM   2548  N3   DT I  52      99.962 162.010  34.731  1.00 96.79           N  
ATOM   2549  C4   DT I  52      99.106 162.316  35.771  1.00 97.89           C  
ATOM   2550  O4   DT I  52      97.970 162.715  35.530  1.00 98.94           O  
ATOM   2551  C5   DT I  52      99.654 162.136  37.096  1.00 98.05           C  
ATOM   2552  C7   DT I  52      98.790 162.424  38.282  1.00 97.86           C  
ATOM   2553  C6   DT I  52     100.922 161.716  37.202  1.00 98.18           C  
ATOM   2554  P    DC I  53     106.968 162.374  36.353  1.00102.28           P  
ATOM   2555  OP1  DC I  53     108.383 161.930  36.410  1.00102.14           O  
ATOM   2556  OP2  DC I  53     106.474 163.381  37.328  1.00102.30           O  
ATOM   2557  O5'  DC I  53     106.681 162.911  34.880  1.00102.56           O  
ATOM   2558  C5'  DC I  53     107.047 162.129  33.747  1.00103.76           C  
ATOM   2559  C4'  DC I  53     106.736 162.865  32.464  1.00104.72           C  
ATOM   2560  O4'  DC I  53     105.308 162.896  32.220  1.00104.57           O  
ATOM   2561  C3'  DC I  53     107.209 164.319  32.398  1.00105.66           C  
ATOM   2562  O3'  DC I  53     107.761 164.584  31.104  1.00106.67           O  
ATOM   2563  C2'  DC I  53     105.926 165.111  32.576  1.00105.19           C  
ATOM   2564  C1'  DC I  53     104.934 164.216  31.864  1.00104.65           C  
ATOM   2565  N1   DC I  53     103.524 164.418  32.234  1.00104.25           N  
ATOM   2566  C2   DC I  53     102.585 164.598  31.212  1.00103.96           C  
ATOM   2567  O2   DC I  53     102.970 164.580  30.032  1.00103.03           O  
ATOM   2568  N3   DC I  53     101.285 164.788  31.534  1.00103.97           N  
ATOM   2569  C4   DC I  53     100.911 164.803  32.815  1.00104.17           C  
ATOM   2570  N4   DC I  53      99.617 164.990  33.085  1.00104.50           N  
ATOM   2571  C5   DC I  53     101.848 164.624  33.877  1.00103.96           C  
ATOM   2572  C6   DC I  53     103.131 164.433  33.544  1.00104.13           C  
ATOM   2573  P    DC I  54     108.116 166.093  30.681  1.00107.43           P  
ATOM   2574  OP1  DC I  54     109.352 166.057  29.857  1.00107.47           O  
ATOM   2575  OP2  DC I  54     108.076 166.932  31.908  1.00106.74           O  
ATOM   2576  O5'  DC I  54     106.901 166.517  29.742  1.00106.45           O  
ATOM   2577  C5'  DC I  54     106.736 165.925  28.453  1.00105.91           C  
ATOM   2578  C4'  DC I  54     105.902 166.821  27.567  1.00105.25           C  
ATOM   2579  O4'  DC I  54     104.521 166.801  28.003  1.00105.45           O  
ATOM   2580  C3'  DC I  54     106.330 168.288  27.582  1.00104.77           C  
ATOM   2581  O3'  DC I  54     106.189 168.862  26.281  1.00104.05           O  
ATOM   2582  C2'  DC I  54     105.343 168.928  28.541  1.00104.77           C  
ATOM   2583  C1'  DC I  54     104.082 168.122  28.281  1.00104.84           C  
ATOM   2584  N1   DC I  54     103.145 168.060  29.415  1.00104.61           N  
ATOM   2585  C2   DC I  54     101.771 168.128  29.156  1.00104.57           C  
ATOM   2586  O2   DC I  54     101.386 168.236  27.981  1.00104.55           O  
ATOM   2587  N3   DC I  54     100.900 168.076  30.190  1.00104.27           N  
ATOM   2588  C4   DC I  54     101.354 167.961  31.440  1.00103.75           C  
ATOM   2589  N4   DC I  54     100.459 167.913  32.428  1.00103.46           N  
ATOM   2590  C5   DC I  54     102.748 167.890  31.732  1.00103.39           C  
ATOM   2591  C6   DC I  54     103.599 167.941  30.700  1.00103.75           C  
ATOM   2592  P    DG I  55     107.169 170.051  25.830  1.00103.78           P  
ATOM   2593  OP1  DG I  55     108.297 169.463  25.062  1.00103.94           O  
ATOM   2594  OP2  DG I  55     107.448 170.877  27.034  1.00103.67           O  
ATOM   2595  O5'  DG I  55     106.282 170.923  24.835  1.00104.23           O  
ATOM   2596  C5'  DG I  55     105.625 170.322  23.721  1.00103.54           C  
ATOM   2597  C4'  DG I  55     104.369 171.091  23.385  1.00102.39           C  
ATOM   2598  O4'  DG I  55     103.431 170.973  24.482  1.00102.85           O  
ATOM   2599  C3'  DG I  55     104.584 172.589  23.186  1.00101.58           C  
ATOM   2600  O3'  DG I  55     103.682 173.069  22.186  1.00101.48           O  
ATOM   2601  C2'  DG I  55     104.243 173.171  24.545  1.00101.45           C  
ATOM   2602  C1'  DG I  55     103.120 172.259  25.000  1.00102.14           C  
ATOM   2603  N9   DG I  55     102.978 172.137  26.448  1.00101.88           N  
ATOM   2604  C8   DG I  55     103.974 171.901  27.365  1.00101.38           C  
ATOM   2605  N7   DG I  55     103.533 171.828  28.592  1.00101.22           N  
ATOM   2606  C5   DG I  55     102.164 172.029  28.478  1.00102.29           C  
ATOM   2607  C6   DG I  55     101.147 172.053  29.475  1.00102.63           C  
ATOM   2608  O6   DG I  55     101.257 171.888  30.696  1.00103.12           O  
ATOM   2609  N1   DG I  55      99.895 172.297  28.921  1.00102.46           N  
ATOM   2610  C2   DG I  55      99.646 172.490  27.586  1.00102.49           C  
ATOM   2611  N2   DG I  55      98.367 172.717  27.254  1.00102.62           N  
ATOM   2612  N3   DG I  55     100.579 172.463  26.647  1.00102.57           N  
ATOM   2613  C4   DG I  55     101.807 172.230  27.162  1.00102.29           C  
ATOM   2614  P    DC I  56     103.602 174.641  21.872  1.00101.46           P  
ATOM   2615  OP1  DC I  56     102.659 174.811  20.736  1.00100.92           O  
ATOM   2616  OP2  DC I  56     104.983 175.183  21.769  1.00101.35           O  
ATOM   2617  O5'  DC I  56     102.911 175.244  23.175  1.00101.07           O  
ATOM   2618  C5'  DC I  56     101.502 175.133  23.366  1.00 99.56           C  
ATOM   2619  C4'  DC I  56     101.019 176.173  24.351  1.00 98.47           C  
ATOM   2620  O4'  DC I  56     101.111 175.703  25.717  1.00 97.70           O  
ATOM   2621  C3'  DC I  56     101.766 177.506  24.301  1.00 97.91           C  
ATOM   2622  O3'  DC I  56     100.832 178.576  24.392  1.00 98.20           O  
ATOM   2623  C2'  DC I  56     102.617 177.473  25.557  1.00 97.33           C  
ATOM   2624  C1'  DC I  56     101.713 176.711  26.508  1.00 97.41           C  
ATOM   2625  N1   DC I  56     102.390 176.060  27.640  1.00 97.58           N  
ATOM   2626  C2   DC I  56     101.708 175.952  28.857  1.00 97.86           C  
ATOM   2627  O2   DC I  56     100.549 176.387  28.935  1.00 97.38           O  
ATOM   2628  N3   DC I  56     102.327 175.374  29.912  1.00 97.68           N  
ATOM   2629  C4   DC I  56     103.572 174.911  29.782  1.00 97.83           C  
ATOM   2630  N4   DC I  56     104.148 174.354  30.849  1.00 98.54           N  
ATOM   2631  C5   DC I  56     104.284 174.999  28.552  1.00 98.01           C  
ATOM   2632  C6   DC I  56     103.662 175.575  27.517  1.00 97.80           C  
ATOM   2633  P    DA I  57     100.711 179.623  23.186  1.00 98.92           P  
ATOM   2634  OP1  DA I  57     100.770 178.842  21.926  1.00 98.75           O  
ATOM   2635  OP2  DA I  57     101.681 180.727  23.415  1.00 99.76           O  
ATOM   2636  O5'  DA I  57      99.232 180.187  23.342  1.00 99.36           O  
ATOM   2637  C5'  DA I  57      98.118 179.307  23.246  1.00100.92           C  
ATOM   2638  C4'  DA I  57      97.296 179.365  24.510  1.00102.24           C  
ATOM   2639  O4'  DA I  57      98.110 178.966  25.639  1.00102.34           O  
ATOM   2640  C3'  DA I  57      96.749 180.748  24.859  1.00102.65           C  
ATOM   2641  O3'  DA I  57      95.455 180.585  25.430  1.00103.91           O  
ATOM   2642  C2'  DA I  57      97.718 181.259  25.910  1.00102.03           C  
ATOM   2643  C1'  DA I  57      98.105 179.983  26.630  1.00102.64           C  
ATOM   2644  N9   DA I  57      99.429 180.010  27.246  1.00103.22           N  
ATOM   2645  C8   DA I  57     100.603 180.465  26.699  1.00103.80           C  
ATOM   2646  N7   DA I  57     101.641 180.336  27.491  1.00104.44           N  
ATOM   2647  C5   DA I  57     101.114 179.763  28.640  1.00104.05           C  
ATOM   2648  C6   DA I  57     101.700 179.371  29.854  1.00104.24           C  
ATOM   2649  N6   DA I  57     103.002 179.499  30.121  1.00104.71           N  
ATOM   2650  N1   DA I  57     100.895 178.835  30.796  1.00104.41           N  
ATOM   2651  C2   DA I  57      99.590 178.705  30.524  1.00104.47           C  
ATOM   2652  N3   DA I  57      98.921 179.034  29.420  1.00104.12           N  
ATOM   2653  C4   DA I  57      99.751 179.563  28.506  1.00103.56           C  
ATOM   2654  P    DA I  58      94.498 181.856  25.617  1.00105.02           P  
ATOM   2655  OP1  DA I  58      93.408 181.765  24.610  1.00104.07           O  
ATOM   2656  OP2  DA I  58      95.340 183.076  25.680  1.00105.62           O  
ATOM   2657  O5'  DA I  58      93.872 181.614  27.060  1.00105.52           O  
ATOM   2658  C5'  DA I  58      93.547 180.296  27.508  1.00106.21           C  
ATOM   2659  C4'  DA I  58      93.576 180.244  29.018  1.00106.21           C  
ATOM   2660  O4'  DA I  58      94.946 180.269  29.490  1.00105.96           O  
ATOM   2661  C3'  DA I  58      92.882 181.437  29.672  1.00106.62           C  
ATOM   2662  O3'  DA I  58      92.164 181.031  30.837  1.00106.36           O  
ATOM   2663  C2'  DA I  58      94.032 182.361  30.033  1.00106.33           C  
ATOM   2664  C1'  DA I  58      95.149 181.385  30.350  1.00106.47           C  
ATOM   2665  N9   DA I  58      96.488 181.917  30.089  1.00107.01           N  
ATOM   2666  C8   DA I  58      96.895 182.664  29.010  1.00106.99           C  
ATOM   2667  N7   DA I  58      98.162 183.000  29.046  1.00106.39           N  
ATOM   2668  C5   DA I  58      98.621 182.440  30.230  1.00106.43           C  
ATOM   2669  C6   DA I  58      99.886 182.439  30.851  1.00105.85           C  
ATOM   2670  N6   DA I  58     100.960 183.049  30.349  1.00105.83           N  
ATOM   2671  N1   DA I  58     100.008 181.783  32.026  1.00105.37           N  
ATOM   2672  C2   DA I  58      98.930 181.180  32.538  1.00105.86           C  
ATOM   2673  N3   DA I  58      97.691 181.114  32.054  1.00106.87           N  
ATOM   2674  C4   DA I  58      97.602 181.771  30.884  1.00106.92           C  
ATOM   2675  P    DG I  59      91.505 182.147  31.783  1.00107.39           P  
ATOM   2676  OP1  DG I  59      90.590 181.439  32.718  1.00107.12           O  
ATOM   2677  OP2  DG I  59      90.977 183.248  30.934  1.00107.05           O  
ATOM   2678  O5'  DG I  59      92.756 182.699  32.598  1.00106.19           O  
ATOM   2679  C5'  DG I  59      93.469 181.845  33.491  1.00104.20           C  
ATOM   2680  C4'  DG I  59      94.231 182.670  34.499  1.00102.83           C  
ATOM   2681  O4'  DG I  59      95.575 182.967  34.046  1.00101.89           O  
ATOM   2682  C3'  DG I  59      93.579 184.016  34.817  1.00102.73           C  
ATOM   2683  O3'  DG I  59      93.677 184.271  36.217  1.00103.19           O  
ATOM   2684  C2'  DG I  59      94.459 185.002  34.068  1.00101.48           C  
ATOM   2685  C1'  DG I  59      95.812 184.348  34.252  1.00101.00           C  
ATOM   2686  N9   DG I  59      96.880 184.777  33.354  1.00 99.14           N  
ATOM   2687  C8   DG I  59      96.762 185.280  32.080  1.00 98.59           C  
ATOM   2688  N7   DG I  59      97.912 185.584  31.541  1.00 97.50           N  
ATOM   2689  C5   DG I  59      98.845 185.258  32.516  1.00 97.04           C  
ATOM   2690  C6   DG I  59     100.260 185.368  32.509  1.00 96.64           C  
ATOM   2691  O6   DG I  59     100.997 185.787  31.609  1.00 96.02           O  
ATOM   2692  N1   DG I  59     100.812 184.927  33.706  1.00 96.57           N  
ATOM   2693  C2   DG I  59     100.097 184.442  34.774  1.00 96.56           C  
ATOM   2694  N2   DG I  59     100.810 184.063  35.840  1.00 96.74           N  
ATOM   2695  N3   DG I  59      98.780 184.336  34.794  1.00 96.62           N  
ATOM   2696  C4   DG I  59      98.224 184.758  33.640  1.00 97.70           C  
ATOM   2697  P    DG I  60      92.353 184.585  37.064  1.00103.37           P  
ATOM   2698  OP1  DG I  60      91.672 183.289  37.322  1.00102.64           O  
ATOM   2699  OP2  DG I  60      91.613 185.686  36.394  1.00103.31           O  
ATOM   2700  O5'  DG I  60      92.931 185.130  38.440  1.00102.34           O  
ATOM   2701  C5'  DG I  60      93.946 184.411  39.134  1.00101.67           C  
ATOM   2702  C4'  DG I  60      95.080 185.339  39.500  1.00100.98           C  
ATOM   2703  O4'  DG I  60      95.912 185.604  38.341  1.00100.76           O  
ATOM   2704  C3'  DG I  60      94.625 186.706  40.019  1.00101.22           C  
ATOM   2705  O3'  DG I  60      95.465 187.127  41.095  1.00101.27           O  
ATOM   2706  C2'  DG I  60      94.850 187.615  38.827  1.00101.05           C  
ATOM   2707  C1'  DG I  60      96.103 187.004  38.235  1.00100.84           C  
ATOM   2708  N9   DG I  60      96.343 187.344  36.836  1.00100.36           N  
ATOM   2709  C8   DG I  60      95.403 187.558  35.859  1.00100.21           C  
ATOM   2710  N7   DG I  60      95.924 187.899  34.711  1.00 99.71           N  
ATOM   2711  C5   DG I  60      97.292 187.897  34.943  1.00100.02           C  
ATOM   2712  C6   DG I  60      98.373 188.194  34.071  1.00 99.99           C  
ATOM   2713  O6   DG I  60      98.333 188.536  32.883  1.00100.22           O  
ATOM   2714  N1   DG I  60      99.599 188.065  34.715  1.00 99.86           N  
ATOM   2715  C2   DG I  60      99.766 187.702  36.030  1.00 99.86           C  
ATOM   2716  N2   DG I  60     101.031 187.633  36.468  1.00100.04           N  
ATOM   2717  N3   DG I  60      98.768 187.427  36.853  1.00100.13           N  
ATOM   2718  C4   DG I  60      97.568 187.544  36.247  1.00100.18           C  
ATOM   2719  P    DG I  61      95.188 188.534  41.819  1.00101.64           P  
ATOM   2720  OP1  DG I  61      94.500 188.251  43.105  1.00101.82           O  
ATOM   2721  OP2  DG I  61      94.569 189.468  40.844  1.00101.26           O  
ATOM   2722  O5'  DG I  61      96.652 189.061  42.147  1.00102.14           O  
ATOM   2723  C5'  DG I  61      97.674 188.156  42.558  1.00102.17           C  
ATOM   2724  C4'  DG I  61      99.032 188.784  42.358  1.00102.35           C  
ATOM   2725  O4'  DG I  61      99.318 188.895  40.943  1.00101.87           O  
ATOM   2726  C3'  DG I  61      99.145 190.198  42.922  1.00102.77           C  
ATOM   2727  O3'  DG I  61     100.448 190.400  43.466  1.00104.63           O  
ATOM   2728  C2'  DG I  61      98.951 191.076  41.700  1.00101.87           C  
ATOM   2729  C1'  DG I  61      99.618 190.245  40.622  1.00100.83           C  
ATOM   2730  N9   DG I  61      99.145 190.500  39.265  1.00 98.99           N  
ATOM   2731  C8   DG I  61      97.844 190.515  38.828  1.00 98.52           C  
ATOM   2732  N7   DG I  61      97.736 190.748  37.549  1.00 98.05           N  
ATOM   2733  C5   DG I  61      99.046 190.899  37.116  1.00 97.79           C  
ATOM   2734  C6   DG I  61      99.561 191.155  35.819  1.00 97.52           C  
ATOM   2735  O6   DG I  61      98.941 191.298  34.757  1.00 97.05           O  
ATOM   2736  N1   DG I  61     100.949 191.239  35.829  1.00 96.70           N  
ATOM   2737  C2   DG I  61     101.741 191.091  36.940  1.00 96.81           C  
ATOM   2738  N2   DG I  61     103.060 191.214  36.746  1.00 97.08           N  
ATOM   2739  N3   DG I  61     101.274 190.842  38.151  1.00 97.30           N  
ATOM   2740  C4   DG I  61      99.927 190.759  38.165  1.00 97.96           C  
ATOM   2741  P    DA I  62     100.707 191.633  44.455  1.00107.08           P  
ATOM   2742  OP1  DA I  62     101.244 191.080  45.724  1.00106.85           O  
ATOM   2743  OP2  DA I  62      99.473 192.459  44.478  1.00107.79           O  
ATOM   2744  O5'  DA I  62     101.853 192.471  43.729  1.00107.41           O  
ATOM   2745  C5'  DA I  62     103.157 191.923  43.542  1.00107.81           C  
ATOM   2746  C4'  DA I  62     103.986 192.831  42.662  1.00108.14           C  
ATOM   2747  O4'  DA I  62     103.464 192.814  41.310  1.00108.68           O  
ATOM   2748  C3'  DA I  62     104.000 194.299  43.089  1.00107.98           C  
ATOM   2749  O3'  DA I  62     105.296 194.865  42.870  1.00107.47           O  
ATOM   2750  C2'  DA I  62     102.990 194.943  42.159  1.00108.47           C  
ATOM   2751  C1'  DA I  62     103.179 194.140  40.886  1.00108.56           C  
ATOM   2752  N9   DA I  62     101.996 194.095  40.028  1.00108.49           N  
ATOM   2753  C8   DA I  62     100.694 193.868  40.400  1.00108.74           C  
ATOM   2754  N7   DA I  62      99.845 193.896  39.401  1.00108.66           N  
ATOM   2755  C5   DA I  62     100.641 194.157  38.296  1.00108.23           C  
ATOM   2756  C6   DA I  62     100.343 194.312  36.931  1.00107.69           C  
ATOM   2757  N6   DA I  62      99.109 194.226  36.430  1.00107.29           N  
ATOM   2758  N1   DA I  62     101.368 194.563  36.089  1.00107.59           N  
ATOM   2759  C2   DA I  62     102.605 194.653  36.594  1.00108.21           C  
ATOM   2760  N3   DA I  62     103.011 194.530  37.857  1.00108.44           N  
ATOM   2761  C4   DA I  62     101.969 194.280  38.667  1.00108.45           C  
ATOM   2762  P    DT I  63     105.532 196.433  43.132  1.00107.68           P  
ATOM   2763  OP1  DT I  63     106.999 196.655  43.206  1.00107.26           O  
ATOM   2764  OP2  DT I  63     104.667 196.848  44.267  1.00108.17           O  
ATOM   2765  O5'  DT I  63     104.998 197.129  41.799  1.00106.28           O  
ATOM   2766  C5'  DT I  63     105.744 197.029  40.588  1.00103.62           C  
ATOM   2767  C4'  DT I  63     105.272 198.049  39.576  1.00101.65           C  
ATOM   2768  O4'  DT I  63     104.041 197.625  38.938  1.00100.46           O  
ATOM   2769  C3'  DT I  63     105.018 199.469  40.095  1.00100.36           C  
ATOM   2770  O3'  DT I  63     105.536 200.411  39.148  1.00100.24           O  
ATOM   2771  C2'  DT I  63     103.502 199.560  40.104  1.00 99.27           C  
ATOM   2772  C1'  DT I  63     103.166 198.737  38.878  1.00 98.15           C  
ATOM   2773  N1   DT I  63     101.781 198.241  38.786  1.00 95.91           N  
ATOM   2774  C2   DT I  63     101.174 198.286  37.551  1.00 94.19           C  
ATOM   2775  O2   DT I  63     101.734 198.700  36.549  1.00 92.53           O  
ATOM   2776  N3   DT I  63      99.880 197.829  37.533  1.00 93.55           N  
ATOM   2777  C4   DT I  63      99.149 197.347  38.603  1.00 93.74           C  
ATOM   2778  O4   DT I  63      97.987 196.982  38.437  1.00 94.03           O  
ATOM   2779  C5   DT I  63      99.849 197.322  39.866  1.00 93.90           C  
ATOM   2780  C7   DT I  63      99.136 196.816  41.080  1.00 93.45           C  
ATOM   2781  C6   DT I  63     101.116 197.761  39.894  1.00 95.07           C  
ATOM   2782  P    DA I  64     105.414 201.990  39.432  1.00100.18           P  
ATOM   2783  OP1  DA I  64     106.794 202.502  39.632  1.00100.85           O  
ATOM   2784  OP2  DA I  64     104.385 202.228  40.476  1.00100.74           O  
ATOM   2785  O5'  DA I  64     104.870 202.574  38.053  1.00 97.73           O  
ATOM   2786  C5'  DA I  64     105.537 202.274  36.829  1.00 94.35           C  
ATOM   2787  C4'  DA I  64     104.728 202.758  35.647  1.00 91.41           C  
ATOM   2788  O4'  DA I  64     103.525 201.962  35.503  1.00 89.58           O  
ATOM   2789  C3'  DA I  64     104.270 204.217  35.710  1.00 89.88           C  
ATOM   2790  O3'  DA I  64     104.431 204.828  34.427  1.00 89.23           O  
ATOM   2791  C2'  DA I  64     102.797 204.110  36.058  1.00 89.08           C  
ATOM   2792  C1'  DA I  64     102.405 202.821  35.362  1.00 88.62           C  
ATOM   2793  N9   DA I  64     101.239 202.153  35.941  1.00 87.51           N  
ATOM   2794  C8   DA I  64     100.997 201.867  37.263  1.00 87.21           C  
ATOM   2795  N7   DA I  64      99.844 201.280  37.474  1.00 85.75           N  
ATOM   2796  C5   DA I  64      99.291 201.166  36.206  1.00 84.56           C  
ATOM   2797  C6   DA I  64      98.072 200.636  35.751  1.00 83.43           C  
ATOM   2798  N6   DA I  64      97.151 200.104  36.557  1.00 82.14           N  
ATOM   2799  N1   DA I  64      97.827 200.673  34.424  1.00 82.98           N  
ATOM   2800  C2   DA I  64      98.750 201.211  33.618  1.00 83.35           C  
ATOM   2801  N3   DA I  64      99.929 201.745  33.926  1.00 84.14           N  
ATOM   2802  C4   DA I  64     100.142 201.692  35.252  1.00 85.39           C  
ATOM   2803  P    DT I  65     103.879 206.317  34.173  1.00 89.03           P  
ATOM   2804  OP1  DT I  65     104.892 207.033  33.356  1.00 89.63           O  
ATOM   2805  OP2  DT I  65     103.436 206.898  35.465  1.00 88.74           O  
ATOM   2806  O5'  DT I  65     102.602 206.078  33.256  1.00 87.43           O  
ATOM   2807  C5'  DT I  65     102.709 205.289  32.076  1.00 86.27           C  
ATOM   2808  C4'  DT I  65     101.419 205.332  31.293  1.00 85.17           C  
ATOM   2809  O4'  DT I  65     100.394 204.569  31.973  1.00 83.99           O  
ATOM   2810  C3'  DT I  65     100.840 206.731  31.080  1.00 83.46           C  
ATOM   2811  O3'  DT I  65     100.310 206.822  29.757  1.00 81.26           O  
ATOM   2812  C2'  DT I  65      99.727 206.808  32.111  1.00 83.64           C  
ATOM   2813  C1'  DT I  65      99.238 205.373  32.150  1.00 83.92           C  
ATOM   2814  N1   DT I  65      98.594 204.970  33.414  1.00 83.55           N  
ATOM   2815  C2   DT I  65      97.316 204.458  33.356  1.00 83.01           C  
ATOM   2816  O2   DT I  65      96.695 204.329  32.314  1.00 81.28           O  
ATOM   2817  N3   DT I  65      96.790 204.096  34.572  1.00 83.46           N  
ATOM   2818  C4   DT I  65      97.400 204.192  35.808  1.00 83.50           C  
ATOM   2819  O4   DT I  65      96.804 203.821  36.816  1.00 81.95           O  
ATOM   2820  C5   DT I  65      98.738 204.741  35.794  1.00 84.09           C  
ATOM   2821  C7   DT I  65      99.478 204.882  37.086  1.00 84.82           C  
ATOM   2822  C6   DT I  65      99.259 205.101  34.613  1.00 83.83           C  
ATOM   2823  P    DT I  66      99.533 208.146  29.295  1.00 80.67           P  
ATOM   2824  OP1  DT I  66     100.121 208.570  28.000  1.00 81.87           O  
ATOM   2825  OP2  DT I  66      99.478 209.106  30.428  1.00 80.68           O  
ATOM   2826  O5'  DT I  66      98.059 207.620  29.012  1.00 80.72           O  
ATOM   2827  C5'  DT I  66      97.854 206.428  28.259  1.00 79.28           C  
ATOM   2828  C4'  DT I  66      96.379 206.120  28.154  1.00 78.38           C  
ATOM   2829  O4'  DT I  66      95.864 205.719  29.446  1.00 77.64           O  
ATOM   2830  C3'  DT I  66      95.510 207.289  27.694  1.00 77.66           C  
ATOM   2831  O3'  DT I  66      94.512 206.807  26.792  1.00 77.66           O  
ATOM   2832  C2'  DT I  66      94.890 207.799  28.983  1.00 76.56           C  
ATOM   2833  C1'  DT I  66      94.758 206.531  29.807  1.00 76.51           C  
ATOM   2834  N1   DT I  66      94.813 206.735  31.268  1.00 75.82           N  
ATOM   2835  C2   DT I  66      93.885 206.089  32.055  1.00 74.54           C  
ATOM   2836  O2   DT I  66      92.994 205.392  31.602  1.00 74.20           O  
ATOM   2837  N3   DT I  66      94.038 206.292  33.402  1.00 74.06           N  
ATOM   2838  C4   DT I  66      94.993 207.068  34.026  1.00 74.94           C  
ATOM   2839  O4   DT I  66      95.022 207.133  35.251  1.00 74.56           O  
ATOM   2840  C5   DT I  66      95.911 207.747  33.138  1.00 75.67           C  
ATOM   2841  C7   DT I  66      96.958 208.642  33.720  1.00 76.58           C  
ATOM   2842  C6   DT I  66      95.780 207.544  31.822  1.00 75.67           C  
ATOM   2843  P    DT I  67      93.201 207.685  26.512  1.00 80.83           P  
ATOM   2844  OP1  DT I  67      92.628 207.214  25.222  1.00 80.77           O  
ATOM   2845  OP2  DT I  67      93.519 209.127  26.696  1.00 80.70           O  
ATOM   2846  O5'  DT I  67      92.212 207.235  27.672  1.00 81.25           O  
ATOM   2847  C5'  DT I  67      91.758 205.887  27.745  1.00 80.96           C  
ATOM   2848  C4'  DT I  67      90.440 205.824  28.475  1.00 80.28           C  
ATOM   2849  O4'  DT I  67      90.660 206.062  29.883  1.00 80.78           O  
ATOM   2850  C3'  DT I  67      89.429 206.873  28.019  1.00 80.00           C  
ATOM   2851  O3'  DT I  67      88.116 206.321  28.072  1.00 79.60           O  
ATOM   2852  C2'  DT I  67      89.586 207.976  29.050  1.00 80.64           C  
ATOM   2853  C1'  DT I  67      89.924 207.197  30.310  1.00 81.10           C  
ATOM   2854  N1   DT I  67      90.753 207.925  31.293  1.00 81.22           N  
ATOM   2855  C2   DT I  67      90.402 207.838  32.619  1.00 81.03           C  
ATOM   2856  O2   DT I  67      89.435 207.210  33.013  1.00 80.65           O  
ATOM   2857  N3   DT I  67      91.228 208.519  33.474  1.00 81.80           N  
ATOM   2858  C4   DT I  67      92.341 209.266  33.145  1.00 81.57           C  
ATOM   2859  O4   DT I  67      92.994 209.814  34.030  1.00 81.82           O  
ATOM   2860  C5   DT I  67      92.642 209.330  31.735  1.00 81.81           C  
ATOM   2861  C7   DT I  67      93.817 210.136  31.280  1.00 81.73           C  
ATOM   2862  C6   DT I  67      91.846 208.661  30.890  1.00 81.73           C  
ATOM   2863  P    DG I  68      86.929 207.005  27.236  1.00 80.53           P  
ATOM   2864  OP1  DG I  68      86.604 206.090  26.109  1.00 79.36           O  
ATOM   2865  OP2  DG I  68      87.277 208.423  26.958  1.00 80.34           O  
ATOM   2866  O5'  DG I  68      85.711 206.993  28.261  1.00 79.49           O  
ATOM   2867  C5'  DG I  68      85.364 205.800  28.957  1.00 79.35           C  
ATOM   2868  C4'  DG I  68      84.543 206.128  30.180  1.00 78.36           C  
ATOM   2869  O4'  DG I  68      85.375 206.803  31.155  1.00 77.54           O  
ATOM   2870  C3'  DG I  68      83.364 207.061  29.906  1.00 77.46           C  
ATOM   2871  O3'  DG I  68      82.234 206.673  30.690  1.00 75.90           O  
ATOM   2872  C2'  DG I  68      83.879 208.419  30.345  1.00 78.01           C  
ATOM   2873  C1'  DG I  68      84.797 208.053  31.499  1.00 78.61           C  
ATOM   2874  N9   DG I  68      85.884 208.998  31.730  1.00 78.57           N  
ATOM   2875  C8   DG I  68      86.514 209.786  30.797  1.00 78.68           C  
ATOM   2876  N7   DG I  68      87.459 210.527  31.307  1.00 78.82           N  
ATOM   2877  C5   DG I  68      87.452 210.212  32.658  1.00 77.72           C  
ATOM   2878  C6   DG I  68      88.258 210.696  33.718  1.00 76.63           C  
ATOM   2879  O6   DG I  68      89.168 211.530  33.675  1.00 74.64           O  
ATOM   2880  N1   DG I  68      87.915 210.106  34.930  1.00 77.86           N  
ATOM   2881  C2   DG I  68      86.924 209.170  35.102  1.00 77.41           C  
ATOM   2882  N2   DG I  68      86.746 208.714  36.348  1.00 76.45           N  
ATOM   2883  N3   DG I  68      86.164 208.714  34.122  1.00 78.46           N  
ATOM   2884  C4   DG I  68      86.482 209.272  32.936  1.00 78.33           C  
ATOM   2885  P    DG I  69      80.883 207.537  30.614  1.00 75.22           P  
ATOM   2886  OP1  DG I  69      79.751 206.634  30.948  1.00 76.70           O  
ATOM   2887  OP2  DG I  69      80.878 208.274  29.324  1.00 75.57           O  
ATOM   2888  O5'  DG I  69      81.043 208.594  31.795  1.00 73.02           O  
ATOM   2889  C5'  DG I  69      81.114 208.162  33.150  1.00 69.63           C  
ATOM   2890  C4'  DG I  69      81.166 209.351  34.082  1.00 68.67           C  
ATOM   2891  O4'  DG I  69      82.442 210.028  33.982  1.00 70.16           O  
ATOM   2892  C3'  DG I  69      80.101 210.429  33.850  1.00 66.74           C  
ATOM   2893  O3'  DG I  69      79.683 210.939  35.114  1.00 61.78           O  
ATOM   2894  C2'  DG I  69      80.881 211.531  33.158  1.00 67.66           C  
ATOM   2895  C1'  DG I  69      82.186 211.419  33.909  1.00 69.48           C  
ATOM   2896  N9   DG I  69      83.349 212.077  33.327  1.00 72.05           N  
ATOM   2897  C8   DG I  69      83.521 212.514  32.035  1.00 73.19           C  
ATOM   2898  N7   DG I  69      84.674 213.097  31.842  1.00 73.49           N  
ATOM   2899  C5   DG I  69      85.299 213.035  33.080  1.00 73.18           C  
ATOM   2900  C6   DG I  69      86.567 213.507  33.492  1.00 74.17           C  
ATOM   2901  O6   DG I  69      87.418 214.108  32.828  1.00 76.27           O  
ATOM   2902  N1   DG I  69      86.808 213.220  34.833  1.00 74.85           N  
ATOM   2903  C2   DG I  69      85.936 212.568  35.671  1.00 74.37           C  
ATOM   2904  N2   DG I  69      86.351 212.367  36.929  1.00 73.75           N  
ATOM   2905  N3   DG I  69      84.746 212.139  35.300  1.00 73.77           N  
ATOM   2906  C4   DG I  69      84.497 212.400  34.002  1.00 72.79           C  
ATOM   2907  P    DA I  70      78.313 210.428  35.768  1.00 59.43           P  
ATOM   2908  OP1  DA I  70      78.220 208.965  35.512  1.00 60.16           O  
ATOM   2909  OP2  DA I  70      77.200 211.321  35.349  1.00 54.76           O  
ATOM   2910  O5'  DA I  70      78.562 210.642  37.324  1.00 55.31           O  
ATOM   2911  C5'  DA I  70      79.410 209.768  38.058  1.00 50.56           C  
ATOM   2912  C4'  DA I  70      80.109 210.536  39.153  1.00 49.86           C  
ATOM   2913  O4'  DA I  70      81.177 211.329  38.585  1.00 49.89           O  
ATOM   2914  C3'  DA I  70      79.190 211.519  39.872  1.00 46.63           C  
ATOM   2915  O3'  DA I  70      79.539 211.596  41.254  1.00 41.05           O  
ATOM   2916  C2'  DA I  70      79.448 212.829  39.151  1.00 49.18           C  
ATOM   2917  C1'  DA I  70      80.910 212.716  38.745  1.00 52.56           C  
ATOM   2918  N9   DA I  70      81.238 213.375  37.480  1.00 56.94           N  
ATOM   2919  C8   DA I  70      80.527 213.335  36.304  1.00 58.07           C  
ATOM   2920  N7   DA I  70      81.084 214.009  35.326  1.00 58.75           N  
ATOM   2921  C5   DA I  70      82.236 214.533  35.896  1.00 59.20           C  
ATOM   2922  C6   DA I  70      83.264 215.343  35.380  1.00 59.54           C  
ATOM   2923  N6   DA I  70      83.300 215.779  34.118  1.00 58.40           N  
ATOM   2924  N1   DA I  70      84.267 215.694  36.215  1.00 59.64           N  
ATOM   2925  C2   DA I  70      84.231 215.254  37.478  1.00 58.68           C  
ATOM   2926  N3   DA I  70      83.325 214.489  38.080  1.00 58.92           N  
ATOM   2927  C4   DA I  70      82.341 214.158  37.225  1.00 58.76           C  
ATOM   2928  P    DG I  71      78.737 212.589  42.219  1.00 38.12           P  
ATOM   2929  OP1  DG I  71      78.782 212.022  43.590  1.00 36.59           O  
ATOM   2930  OP2  DG I  71      77.431 212.896  41.596  1.00 39.32           O  
ATOM   2931  O5'  DG I  71      79.622 213.911  42.205  1.00 42.18           O  
ATOM   2932  C5'  DG I  71      80.987 213.862  42.611  1.00 45.50           C  
ATOM   2933  C4'  DG I  71      81.644 215.216  42.466  1.00 49.60           C  
ATOM   2934  O4'  DG I  71      81.838 215.546  41.070  1.00 49.84           O  
ATOM   2935  C3'  DG I  71      80.901 216.405  43.083  1.00 50.94           C  
ATOM   2936  O3'  DG I  71      81.856 217.245  43.744  1.00 56.35           O  
ATOM   2937  C2'  DG I  71      80.323 217.115  41.871  1.00 48.99           C  
ATOM   2938  C1'  DG I  71      81.433 216.887  40.874  1.00 50.58           C  
ATOM   2939  N9   DG I  71      81.114 217.079  39.463  1.00 53.73           N  
ATOM   2940  C8   DG I  71      79.961 216.743  38.796  1.00 54.96           C  
ATOM   2941  N7   DG I  71      79.993 217.057  37.528  1.00 54.68           N  
ATOM   2942  C5   DG I  71      81.244 217.631  37.348  1.00 57.27           C  
ATOM   2943  C6   DG I  71      81.860 218.166  36.179  1.00 58.20           C  
ATOM   2944  O6   DG I  71      81.406 218.237  35.029  1.00 58.29           O  
ATOM   2945  N1   DG I  71      83.137 218.650  36.451  1.00 57.44           N  
ATOM   2946  C2   DG I  71      83.748 218.624  37.683  1.00 57.47           C  
ATOM   2947  N2   DG I  71      84.985 219.141  37.748  1.00 55.15           N  
ATOM   2948  N3   DG I  71      83.188 218.129  38.774  1.00 56.84           N  
ATOM   2949  C4   DG I  71      81.946 217.653  38.534  1.00 56.25           C  
ATOM   2950  P    DA I  72      81.391 218.641  44.397  1.00 60.18           P  
ATOM   2951  OP1  DA I  72      81.791 218.622  45.826  1.00 59.49           O  
ATOM   2952  OP2  DA I  72      79.975 218.912  44.032  1.00 58.59           O  
ATOM   2953  O5'  DA I  72      82.319 219.707  43.668  1.00 62.18           O  
ATOM   2954  C5'  DA I  72      83.736 219.539  43.650  1.00 65.15           C  
ATOM   2955  C4'  DA I  72      84.387 220.672  42.892  1.00 67.40           C  
ATOM   2956  O4'  DA I  72      84.025 220.588  41.493  1.00 67.20           O  
ATOM   2957  C3'  DA I  72      83.959 222.064  43.354  1.00 68.20           C  
ATOM   2958  O3'  DA I  72      85.064 222.964  43.248  1.00 71.42           O  
ATOM   2959  C2'  DA I  72      82.866 222.434  42.370  1.00 67.44           C  
ATOM   2960  C1'  DA I  72      83.334 221.762  41.091  1.00 67.59           C  
ATOM   2961  N9   DA I  72      82.242 221.354  40.207  1.00 68.71           N  
ATOM   2962  C8   DA I  72      81.070 220.728  40.557  1.00 68.38           C  
ATOM   2963  N7   DA I  72      80.276 220.489  39.542  1.00 68.97           N  
ATOM   2964  C5   DA I  72      80.971 220.990  38.450  1.00 69.33           C  
ATOM   2965  C6   DA I  72      80.668 221.041  37.078  1.00 68.74           C  
ATOM   2966  N6   DA I  72      79.543 220.554  36.552  1.00 68.72           N  
ATOM   2967  N1   DA I  72      81.573 221.611  36.255  1.00 67.76           N  
ATOM   2968  C2   DA I  72      82.706 222.090  36.782  1.00 67.95           C  
ATOM   2969  N3   DA I  72      83.108 222.097  38.051  1.00 69.09           N  
ATOM   2970  C4   DA I  72      82.184 221.527  38.844  1.00 69.13           C  
ATOM   2971  P    DT I  73      84.913 224.483  43.751  1.00 73.00           P  
ATOM   2972  OP1  DT I  73      85.915 224.692  44.827  1.00 71.73           O  
ATOM   2973  OP2  DT I  73      83.479 224.778  44.015  1.00 71.91           O  
ATOM   2974  O5'  DT I  73      85.372 225.319  42.478  1.00 74.02           O  
ATOM   2975  C5'  DT I  73      86.599 225.013  41.820  1.00 75.34           C  
ATOM   2976  C4'  DT I  73      86.774 225.887  40.601  1.00 76.41           C  
ATOM   2977  O4'  DT I  73      85.828 225.491  39.578  1.00 77.61           O  
ATOM   2978  C3'  DT I  73      86.530 227.379  40.842  1.00 77.01           C  
ATOM   2979  O3'  DT I  73      87.343 228.138  39.941  1.00 76.65           O  
ATOM   2980  C2'  DT I  73      85.093 227.560  40.384  1.00 76.96           C  
ATOM   2981  C1'  DT I  73      85.048 226.614  39.198  1.00 77.19           C  
ATOM   2982  N1   DT I  73      83.708 226.136  38.807  1.00 76.96           N  
ATOM   2983  C2   DT I  73      83.370 226.217  37.474  1.00 77.54           C  
ATOM   2984  O2   DT I  73      84.138 226.624  36.617  1.00 79.22           O  
ATOM   2985  N3   DT I  73      82.096 225.796  37.178  1.00 77.27           N  
ATOM   2986  C4   DT I  73      81.155 225.302  38.060  1.00 77.06           C  
ATOM   2987  O4   DT I  73      80.039 224.983  37.649  1.00 76.14           O  
ATOM   2988  C5   DT I  73      81.589 225.213  39.439  1.00 76.04           C  
ATOM   2989  C7   DT I  73      80.651 224.653  40.460  1.00 75.54           C  
ATOM   2990  C6   DT I  73      82.825 225.636  39.740  1.00 76.56           C  
TER    2991       DT I  73                                                      
ATOM   2992  O5'  DA J -73      77.218 222.877  27.318  1.00100.77           O  
ATOM   2993  C5'  DA J -73      77.103 223.934  26.360  1.00100.88           C  
ATOM   2994  C4'  DA J -73      77.991 225.109  26.697  1.00100.13           C  
ATOM   2995  O4'  DA J -73      77.614 225.636  27.992  1.00 99.88           O  
ATOM   2996  C3'  DA J -73      79.475 224.765  26.799  1.00100.02           C  
ATOM   2997  O3'  DA J -73      80.274 225.842  26.302  1.00100.73           O  
ATOM   2998  C2'  DA J -73      79.693 224.580  28.289  1.00 99.65           C  
ATOM   2999  C1'  DA J -73      78.709 225.563  28.896  1.00 98.97           C  
ATOM   3000  N9   DA J -73      78.186 225.150  30.200  1.00 97.75           N  
ATOM   3001  C8   DA J -73      76.906 224.755  30.509  1.00 97.09           C  
ATOM   3002  N7   DA J -73      76.739 224.445  31.772  1.00 96.04           N  
ATOM   3003  C5   DA J -73      77.992 224.648  32.333  1.00 95.39           C  
ATOM   3004  C6   DA J -73      78.476 224.497  33.643  1.00 94.61           C  
ATOM   3005  N6   DA J -73      77.726 224.086  34.668  1.00 93.75           N  
ATOM   3006  N1   DA J -73      79.776 224.786  33.869  1.00 93.99           N  
ATOM   3007  C2   DA J -73      80.528 225.197  32.842  1.00 94.11           C  
ATOM   3008  N3   DA J -73      80.190 225.376  31.568  1.00 95.14           N  
ATOM   3009  C4   DA J -73      78.893 225.082  31.377  1.00 96.09           C  
ATOM   3010  P    DT J -72      81.793 225.561  25.854  1.00102.07           P  
ATOM   3011  OP1  DT J -72      82.315 226.811  25.244  1.00101.86           O  
ATOM   3012  OP2  DT J -72      81.829 224.295  25.076  1.00101.53           O  
ATOM   3013  O5'  DT J -72      82.562 225.326  27.231  1.00100.05           O  
ATOM   3014  C5'  DT J -72      83.185 226.414  27.905  1.00 97.76           C  
ATOM   3015  C4'  DT J -72      84.160 225.910  28.944  1.00 96.43           C  
ATOM   3016  O4'  DT J -72      83.455 225.410  30.106  1.00 96.35           O  
ATOM   3017  C3'  DT J -72      85.094 224.784  28.494  1.00 95.57           C  
ATOM   3018  O3'  DT J -72      86.407 225.021  29.009  1.00 93.66           O  
ATOM   3019  C2'  DT J -72      84.498 223.556  29.158  1.00 96.14           C  
ATOM   3020  C1'  DT J -72      83.984 224.142  30.457  1.00 96.24           C  
ATOM   3021  N1   DT J -72      82.921 223.362  31.120  1.00 95.93           N  
ATOM   3022  C2   DT J -72      83.061 223.099  32.465  1.00 95.45           C  
ATOM   3023  O2   DT J -72      84.014 223.483  33.125  1.00 94.72           O  
ATOM   3024  N3   DT J -72      82.040 222.366  33.013  1.00 95.55           N  
ATOM   3025  C4   DT J -72      80.920 221.880  32.367  1.00 95.48           C  
ATOM   3026  O4   DT J -72      80.087 221.235  32.992  1.00 95.19           O  
ATOM   3027  C5   DT J -72      80.837 222.191  30.960  1.00 95.51           C  
ATOM   3028  C7   DT J -72      79.658 221.703  30.179  1.00 95.33           C  
ATOM   3029  C6   DT J -72      81.827 222.909  30.414  1.00 95.67           C  
ATOM   3030  P    DC J -71      87.563 223.921  28.805  1.00 92.45           P  
ATOM   3031  OP1  DC J -71      88.665 224.557  28.038  1.00 91.69           O  
ATOM   3032  OP2  DC J -71      86.964 222.656  28.310  1.00 92.08           O  
ATOM   3033  O5'  DC J -71      88.087 223.686  30.289  1.00 91.22           O  
ATOM   3034  C5'  DC J -71      88.231 224.790  31.179  1.00 88.57           C  
ATOM   3035  C4'  DC J -71      88.498 224.305  32.584  1.00 86.59           C  
ATOM   3036  O4'  DC J -71      87.323 223.638  33.110  1.00 85.43           O  
ATOM   3037  C3'  DC J -71      89.647 223.306  32.713  1.00 85.30           C  
ATOM   3038  O3'  DC J -71      90.379 223.579  33.909  1.00 84.10           O  
ATOM   3039  C2'  DC J -71      88.936 221.969  32.815  1.00 85.35           C  
ATOM   3040  C1'  DC J -71      87.674 222.342  33.571  1.00 84.90           C  
ATOM   3041  N1   DC J -71      86.526 221.450  33.339  1.00 83.96           N  
ATOM   3042  C2   DC J -71      85.963 220.781  34.431  1.00 82.91           C  
ATOM   3043  O2   DC J -71      86.455 220.952  35.556  1.00 81.52           O  
ATOM   3044  N3   DC J -71      84.900 219.968  34.232  1.00 82.87           N  
ATOM   3045  C4   DC J -71      84.400 219.810  33.004  1.00 82.56           C  
ATOM   3046  N4   DC J -71      83.345 219.006  32.857  1.00 80.87           N  
ATOM   3047  C5   DC J -71      84.959 220.474  31.872  1.00 82.87           C  
ATOM   3048  C6   DC J -71      86.011 221.277  32.084  1.00 83.94           C  
ATOM   3049  P    DT J -70      91.579 222.609  34.352  1.00 84.15           P  
ATOM   3050  OP1  DT J -70      92.711 223.473  34.772  1.00 84.78           O  
ATOM   3051  OP2  DT J -70      91.790 221.582  33.301  1.00 85.75           O  
ATOM   3052  O5'  DT J -70      91.008 221.878  35.644  1.00 82.38           O  
ATOM   3053  C5'  DT J -70      90.555 222.633  36.765  1.00 80.17           C  
ATOM   3054  C4'  DT J -70      90.259 221.715  37.926  1.00 77.91           C  
ATOM   3055  O4'  DT J -70      89.093 220.913  37.622  1.00 77.80           O  
ATOM   3056  C3'  DT J -70      91.381 220.728  38.242  1.00 77.40           C  
ATOM   3057  O3'  DT J -70      91.493 220.550  39.655  1.00 77.82           O  
ATOM   3058  C2'  DT J -70      90.930 219.447  37.563  1.00 77.08           C  
ATOM   3059  C1'  DT J -70      89.417 219.530  37.672  1.00 77.57           C  
ATOM   3060  N1   DT J -70      88.681 218.859  36.580  1.00 77.03           N  
ATOM   3061  C2   DT J -70      87.612 218.056  36.911  1.00 76.27           C  
ATOM   3062  O2   DT J -70      87.268 217.846  38.061  1.00 75.38           O  
ATOM   3063  N3   DT J -70      86.957 217.503  35.839  1.00 75.56           N  
ATOM   3064  C4   DT J -70      87.263 217.663  34.501  1.00 76.00           C  
ATOM   3065  O4   DT J -70      86.573 217.119  33.646  1.00 75.23           O  
ATOM   3066  C5   DT J -70      88.412 218.496  34.228  1.00 76.80           C  
ATOM   3067  C7   DT J -70      88.834 218.702  32.808  1.00 77.41           C  
ATOM   3068  C6   DT J -70      89.052 219.047  35.266  1.00 76.78           C  
ATOM   3069  P    DC J -69      92.564 219.508  40.239  1.00 77.70           P  
ATOM   3070  OP1  DC J -69      92.779 219.832  41.673  1.00 76.87           O  
ATOM   3071  OP2  DC J -69      93.724 219.474  39.314  1.00 79.80           O  
ATOM   3072  O5'  DC J -69      91.799 218.117  40.142  1.00 76.62           O  
ATOM   3073  C5'  DC J -69      90.542 217.938  40.793  1.00 75.34           C  
ATOM   3074  C4'  DC J -69      90.084 216.506  40.656  1.00 73.44           C  
ATOM   3075  O4'  DC J -69      89.511 216.270  39.348  1.00 73.74           O  
ATOM   3076  C3'  DC J -69      91.204 215.480  40.820  1.00 72.21           C  
ATOM   3077  O3'  DC J -69      90.709 214.355  41.536  1.00 69.97           O  
ATOM   3078  C2'  DC J -69      91.513 215.078  39.388  1.00 72.71           C  
ATOM   3079  C1'  DC J -69      90.132 215.137  38.768  1.00 72.66           C  
ATOM   3080  N1   DC J -69      90.083 215.290  37.309  1.00 72.30           N  
ATOM   3081  C2   DC J -69      89.026 214.699  36.621  1.00 72.68           C  
ATOM   3082  O2   DC J -69      88.187 214.057  37.264  1.00 71.02           O  
ATOM   3083  N3   DC J -69      88.943 214.842  35.277  1.00 73.08           N  
ATOM   3084  C4   DC J -69      89.871 215.545  34.624  1.00 73.41           C  
ATOM   3085  N4   DC J -69      89.738 215.679  33.302  1.00 72.58           N  
ATOM   3086  C5   DC J -69      90.972 216.149  35.301  1.00 74.15           C  
ATOM   3087  C6   DC J -69      91.038 215.997  36.633  1.00 73.43           C  
ATOM   3088  P    DC J -68      91.343 213.977  42.958  1.00 69.70           P  
ATOM   3089  OP1  DC J -68      90.963 215.043  43.917  1.00 69.96           O  
ATOM   3090  OP2  DC J -68      92.774 213.635  42.768  1.00 70.95           O  
ATOM   3091  O5'  DC J -68      90.559 212.656  43.358  1.00 69.04           O  
ATOM   3092  C5'  DC J -68      89.161 212.694  43.622  1.00 67.49           C  
ATOM   3093  C4'  DC J -68      88.520 211.388  43.219  1.00 67.45           C  
ATOM   3094  O4'  DC J -68      88.315 211.348  41.786  1.00 66.46           O  
ATOM   3095  C3'  DC J -68      89.363 210.162  43.566  1.00 67.01           C  
ATOM   3096  O3'  DC J -68      88.535 209.110  44.058  1.00 65.57           O  
ATOM   3097  C2'  DC J -68      90.001 209.783  42.240  1.00 66.82           C  
ATOM   3098  C1'  DC J -68      88.942 210.199  41.235  1.00 66.80           C  
ATOM   3099  N1   DC J -68      89.459 210.564  39.904  1.00 65.27           N  
ATOM   3100  C2   DC J -68      88.798 210.083  38.767  1.00 65.14           C  
ATOM   3101  O2   DC J -68      87.821 209.334  38.913  1.00 65.43           O  
ATOM   3102  N3   DC J -68      89.242 210.442  37.541  1.00 65.55           N  
ATOM   3103  C4   DC J -68      90.309 211.238  37.425  1.00 64.72           C  
ATOM   3104  N4   DC J -68      90.706 211.577  36.197  1.00 62.55           N  
ATOM   3105  C5   DC J -68      91.013 211.725  38.564  1.00 64.94           C  
ATOM   3106  C6   DC J -68      90.558 211.367  39.774  1.00 64.99           C  
ATOM   3107  P    DA J -67      89.209 207.758  44.602  1.00 68.19           P  
ATOM   3108  OP1  DA J -67      88.655 207.525  45.961  1.00 65.70           O  
ATOM   3109  OP2  DA J -67      90.682 207.810  44.407  1.00 66.56           O  
ATOM   3110  O5'  DA J -67      88.644 206.652  43.607  1.00 66.76           O  
ATOM   3111  C5'  DA J -67      87.302 206.721  43.138  1.00 66.13           C  
ATOM   3112  C4'  DA J -67      87.115 205.794  41.962  1.00 66.15           C  
ATOM   3113  O4'  DA J -67      87.793 206.313  40.792  1.00 67.38           O  
ATOM   3114  C3'  DA J -67      87.667 204.387  42.177  1.00 66.44           C  
ATOM   3115  O3'  DA J -67      86.800 203.454  41.543  1.00 65.79           O  
ATOM   3116  C2'  DA J -67      89.005 204.423  41.463  1.00 65.92           C  
ATOM   3117  C1'  DA J -67      88.705 205.341  40.292  1.00 67.53           C  
ATOM   3118  N9   DA J -67      89.863 206.053  39.755  1.00 66.97           N  
ATOM   3119  C8   DA J -67      91.063 206.314  40.371  1.00 66.94           C  
ATOM   3120  N7   DA J -67      91.884 207.033  39.646  1.00 68.33           N  
ATOM   3121  C5   DA J -67      91.184 207.248  38.466  1.00 67.83           C  
ATOM   3122  C6   DA J -67      91.500 207.958  37.290  1.00 67.49           C  
ATOM   3123  N6   DA J -67      92.646 208.619  37.109  1.00 67.58           N  
ATOM   3124  N1   DA J -67      90.581 207.971  36.299  1.00 66.20           N  
ATOM   3125  C2   DA J -67      89.427 207.319  36.487  1.00 66.17           C  
ATOM   3126  N3   DA J -67      89.011 206.627  37.548  1.00 66.39           N  
ATOM   3127  C4   DA J -67      89.946 206.633  38.513  1.00 67.11           C  
ATOM   3128  P    DA J -66      87.131 201.893  41.609  1.00 65.13           P  
ATOM   3129  OP1  DA J -66      86.165 201.281  42.550  1.00 65.69           O  
ATOM   3130  OP2  DA J -66      88.588 201.724  41.833  1.00 66.51           O  
ATOM   3131  O5'  DA J -66      86.773 201.390  40.143  1.00 64.22           O  
ATOM   3132  C5'  DA J -66      85.580 201.832  39.502  1.00 62.38           C  
ATOM   3133  C4'  DA J -66      85.694 201.653  38.007  1.00 61.45           C  
ATOM   3134  O4'  DA J -66      86.714 202.540  37.486  1.00 59.56           O  
ATOM   3135  C3'  DA J -66      86.100 200.244  37.580  1.00 61.20           C  
ATOM   3136  O3'  DA J -66      85.410 199.882  36.380  1.00 62.21           O  
ATOM   3137  C2'  DA J -66      87.592 200.370  37.336  1.00 59.40           C  
ATOM   3138  C1'  DA J -66      87.710 201.788  36.809  1.00 59.86           C  
ATOM   3139  N9   DA J -66      89.005 202.417  37.065  1.00 59.39           N  
ATOM   3140  C8   DA J -66      89.786 202.316  38.187  1.00 58.85           C  
ATOM   3141  N7   DA J -66      90.908 202.988  38.113  1.00 58.36           N  
ATOM   3142  C5   DA J -66      90.861 203.574  36.857  1.00 59.40           C  
ATOM   3143  C6   DA J -66      91.756 204.409  36.172  1.00 59.61           C  
ATOM   3144  N6   DA J -66      92.925 204.811  36.678  1.00 60.31           N  
ATOM   3145  N1   DA J -66      91.409 204.823  34.935  1.00 58.99           N  
ATOM   3146  C2   DA J -66      90.241 204.410  34.427  1.00 60.59           C  
ATOM   3147  N3   DA J -66      89.317 203.620  34.970  1.00 60.44           N  
ATOM   3148  C4   DA J -66      89.693 203.233  36.201  1.00 59.80           C  
ATOM   3149  P    DA J -65      85.885 198.596  35.548  1.00 62.31           P  
ATOM   3150  OP1  DA J -65      84.693 198.090  34.824  1.00 62.42           O  
ATOM   3151  OP2  DA J -65      86.643 197.692  36.453  1.00 62.11           O  
ATOM   3152  O5'  DA J -65      86.909 199.189  34.481  1.00 63.20           O  
ATOM   3153  C5'  DA J -65      86.510 200.244  33.610  1.00 62.23           C  
ATOM   3154  C4'  DA J -65      87.583 200.516  32.581  1.00 62.91           C  
ATOM   3155  O4'  DA J -65      88.745 201.122  33.202  1.00 62.02           O  
ATOM   3156  C3'  DA J -65      88.094 199.292  31.818  1.00 62.59           C  
ATOM   3157  O3'  DA J -65      88.216 199.625  30.431  1.00 64.05           O  
ATOM   3158  C2'  DA J -65      89.465 199.046  32.425  1.00 61.77           C  
ATOM   3159  C1'  DA J -65      89.913 200.460  32.746  1.00 62.44           C  
ATOM   3160  N9   DA J -65      90.943 200.577  33.781  1.00 61.39           N  
ATOM   3161  C8   DA J -65      91.003 199.941  34.995  1.00 61.68           C  
ATOM   3162  N7   DA J -65      92.055 200.258  35.708  1.00 60.87           N  
ATOM   3163  C5   DA J -65      92.736 201.165  34.912  1.00 61.56           C  
ATOM   3164  C6   DA J -65      93.938 201.878  35.101  1.00 62.81           C  
ATOM   3165  N6   DA J -65      94.690 201.783  36.201  1.00 61.03           N  
ATOM   3166  N1   DA J -65      94.344 202.702  34.108  1.00 61.81           N  
ATOM   3167  C2   DA J -65      93.587 202.795  33.006  1.00 61.88           C  
ATOM   3168  N3   DA J -65      92.442 202.178  32.712  1.00 61.99           N  
ATOM   3169  C4   DA J -65      92.066 201.369  33.719  1.00 61.23           C  
ATOM   3170  P    DT J -64      88.715 198.519  29.375  1.00 64.18           P  
ATOM   3171  OP1  DT J -64      87.960 198.781  28.123  1.00 61.76           O  
ATOM   3172  OP2  DT J -64      88.679 197.162  29.988  1.00 63.35           O  
ATOM   3173  O5'  DT J -64      90.233 198.927  29.133  1.00 63.50           O  
ATOM   3174  C5'  DT J -64      90.549 200.238  28.673  1.00 64.98           C  
ATOM   3175  C4'  DT J -64      92.035 200.381  28.447  1.00 64.87           C  
ATOM   3176  O4'  DT J -64      92.735 200.516  29.706  1.00 63.88           O  
ATOM   3177  C3'  DT J -64      92.699 199.219  27.708  1.00 65.18           C  
ATOM   3178  O3'  DT J -64      93.629 199.747  26.758  1.00 67.77           O  
ATOM   3179  C2'  DT J -64      93.431 198.476  28.811  1.00 62.75           C  
ATOM   3180  C1'  DT J -64      93.831 199.617  29.727  1.00 62.38           C  
ATOM   3181  N1   DT J -64      94.095 199.255  31.132  1.00 61.29           N  
ATOM   3182  C2   DT J -64      95.153 199.873  31.760  1.00 60.01           C  
ATOM   3183  O2   DT J -64      95.871 200.687  31.203  1.00 58.44           O  
ATOM   3184  N3   DT J -64      95.338 199.501  33.071  1.00 57.54           N  
ATOM   3185  C4   DT J -64      94.582 198.598  33.796  1.00 56.22           C  
ATOM   3186  O4   DT J -64      94.855 198.375  34.969  1.00 50.92           O  
ATOM   3187  C5   DT J -64      93.492 197.984  33.071  1.00 57.78           C  
ATOM   3188  C7   DT J -64      92.622 196.992  33.774  1.00 59.24           C  
ATOM   3189  C6   DT J -64      93.307 198.337  31.793  1.00 60.03           C  
ATOM   3190  P    DA J -63      94.335 198.769  25.698  1.00 70.87           P  
ATOM   3191  OP1  DA J -63      94.304 199.473  24.390  1.00 69.67           O  
ATOM   3192  OP2  DA J -63      93.766 197.399  25.813  1.00 69.72           O  
ATOM   3193  O5'  DA J -63      95.843 198.725  26.202  1.00 71.25           O  
ATOM   3194  C5'  DA J -63      96.597 199.926  26.311  1.00 75.30           C  
ATOM   3195  C4'  DA J -63      97.940 199.639  26.934  1.00 78.32           C  
ATOM   3196  O4'  DA J -63      97.825 199.505  28.371  1.00 79.70           O  
ATOM   3197  C3'  DA J -63      98.583 198.346  26.437  1.00 79.90           C  
ATOM   3198  O3'  DA J -63      99.979 198.552  26.239  1.00 81.07           O  
ATOM   3199  C2'  DA J -63      98.350 197.376  27.583  1.00 80.03           C  
ATOM   3200  C1'  DA J -63      98.453 198.301  28.778  1.00 79.93           C  
ATOM   3201  N9   DA J -63      97.801 197.835  30.002  1.00 80.04           N  
ATOM   3202  C8   DA J -63      96.519 197.375  30.169  1.00 80.88           C  
ATOM   3203  N7   DA J -63      96.238 197.030  31.403  1.00 81.09           N  
ATOM   3204  C5   DA J -63      97.415 197.276  32.095  1.00 80.56           C  
ATOM   3205  C6   DA J -63      97.775 197.112  33.448  1.00 81.53           C  
ATOM   3206  N6   DA J -63      96.951 196.636  34.386  1.00 81.14           N  
ATOM   3207  N1   DA J -63      99.030 197.458  33.809  1.00 81.42           N  
ATOM   3208  C2   DA J -63      99.858 197.930  32.870  1.00 81.04           C  
ATOM   3209  N3   DA J -63      99.640 198.124  31.572  1.00 80.10           N  
ATOM   3210  C4   DA J -63      98.385 197.775  31.245  1.00 79.97           C  
ATOM   3211  P    DT J -62     100.825 197.482  25.399  1.00 82.67           P  
ATOM   3212  OP1  DT J -62     101.327 198.165  24.178  1.00 82.85           O  
ATOM   3213  OP2  DT J -62     100.028 196.235  25.274  1.00 81.85           O  
ATOM   3214  O5'  DT J -62     102.060 197.168  26.346  1.00 85.06           O  
ATOM   3215  C5'  DT J -62     102.928 198.205  26.778  1.00 87.62           C  
ATOM   3216  C4'  DT J -62     103.919 197.653  27.772  1.00 89.51           C  
ATOM   3217  O4'  DT J -62     103.268 197.464  29.052  1.00 89.75           O  
ATOM   3218  C3'  DT J -62     104.468 196.286  27.363  1.00 90.94           C  
ATOM   3219  O3'  DT J -62     105.868 196.207  27.613  1.00 93.35           O  
ATOM   3220  C2'  DT J -62     103.711 195.315  28.250  1.00 90.44           C  
ATOM   3221  C1'  DT J -62     103.481 196.137  29.503  1.00 90.89           C  
ATOM   3222  N1   DT J -62     102.309 195.728  30.306  1.00 90.53           N  
ATOM   3223  C2   DT J -62     102.461 195.634  31.672  1.00 90.54           C  
ATOM   3224  O2   DT J -62     103.508 195.888  32.247  1.00 91.81           O  
ATOM   3225  N3   DT J -62     101.338 195.229  32.346  1.00 90.19           N  
ATOM   3226  C4   DT J -62     100.106 194.921  31.806  1.00 90.07           C  
ATOM   3227  O4   DT J -62      99.189 194.566  32.541  1.00 89.71           O  
ATOM   3228  C5   DT J -62     100.012 195.051  30.371  1.00 90.10           C  
ATOM   3229  C7   DT J -62      98.711 194.747  29.699  1.00 89.77           C  
ATOM   3230  C6   DT J -62     101.104 195.443  29.701  1.00 90.08           C  
ATOM   3231  P    DC J -61     106.670 194.881  27.199  1.00 95.96           P  
ATOM   3232  OP1  DC J -61     107.906 195.307  26.496  1.00 96.42           O  
ATOM   3233  OP2  DC J -61     105.736 193.939  26.531  1.00 95.85           O  
ATOM   3234  O5'  DC J -61     107.086 194.267  28.604  1.00 97.13           O  
ATOM   3235  C5'  DC J -61     107.878 195.026  29.512  1.00100.47           C  
ATOM   3236  C4'  DC J -61     108.200 194.199  30.733  1.00102.50           C  
ATOM   3237  O4'  DC J -61     107.012 194.060  31.549  1.00103.10           O  
ATOM   3238  C3'  DC J -61     108.658 192.781  30.401  1.00103.67           C  
ATOM   3239  O3'  DC J -61     109.711 192.382  31.278  1.00104.89           O  
ATOM   3240  C2'  DC J -61     107.411 191.944  30.620  1.00103.67           C  
ATOM   3241  C1'  DC J -61     106.705 192.687  31.741  1.00103.03           C  
ATOM   3242  N1   DC J -61     105.239 192.548  31.737  1.00102.45           N  
ATOM   3243  C2   DC J -61     104.576 192.383  32.958  1.00102.15           C  
ATOM   3244  O2   DC J -61     105.241 192.364  34.005  1.00102.26           O  
ATOM   3245  N3   DC J -61     103.229 192.250  32.966  1.00101.38           N  
ATOM   3246  C4   DC J -61     102.549 192.277  31.818  1.00100.85           C  
ATOM   3247  N4   DC J -61     101.223 192.141  31.875  1.00100.11           N  
ATOM   3248  C5   DC J -61     103.199 192.446  30.561  1.00100.93           C  
ATOM   3249  C6   DC J -61     104.532 192.576  30.567  1.00101.93           C  
ATOM   3250  P    DC J -60     110.101 190.830  31.389  1.00106.92           P  
ATOM   3251  OP1  DC J -60     111.504 190.755  31.871  1.00106.51           O  
ATOM   3252  OP2  DC J -60     109.721 190.150  30.123  1.00107.01           O  
ATOM   3253  O5'  DC J -60     109.142 190.304  32.543  1.00106.52           O  
ATOM   3254  C5'  DC J -60     109.231 190.845  33.857  1.00106.55           C  
ATOM   3255  C4'  DC J -60     108.727 189.839  34.862  1.00106.63           C  
ATOM   3256  O4'  DC J -60     107.284 189.769  34.796  1.00106.56           O  
ATOM   3257  C3'  DC J -60     109.236 188.420  34.610  1.00106.99           C  
ATOM   3258  O3'  DC J -60     109.529 187.772  35.848  1.00108.07           O  
ATOM   3259  C2'  DC J -60     108.071 187.747  33.908  1.00107.01           C  
ATOM   3260  C1'  DC J -60     106.872 188.436  34.534  1.00106.39           C  
ATOM   3261  N1   DC J -60     105.677 188.493  33.676  1.00105.54           N  
ATOM   3262  C2   DC J -60     104.475 187.973  34.165  1.00105.59           C  
ATOM   3263  O2   DC J -60     104.454 187.481  35.304  1.00106.57           O  
ATOM   3264  N3   DC J -60     103.369 188.018  33.387  1.00104.56           N  
ATOM   3265  C4   DC J -60     103.434 188.553  32.167  1.00104.24           C  
ATOM   3266  N4   DC J -60     102.319 188.569  31.433  1.00103.55           N  
ATOM   3267  C5   DC J -60     104.646 189.092  31.644  1.00104.49           C  
ATOM   3268  C6   DC J -60     105.733 189.041  32.425  1.00104.77           C  
ATOM   3269  P    DC J -59     110.172 186.302  35.841  1.00109.15           P  
ATOM   3270  OP1  DC J -59     111.168 186.245  36.943  1.00109.58           O  
ATOM   3271  OP2  DC J -59     110.592 185.975  34.453  1.00109.30           O  
ATOM   3272  O5'  DC J -59     108.947 185.364  36.230  1.00107.56           O  
ATOM   3273  C5'  DC J -59     108.255 185.552  37.461  1.00106.17           C  
ATOM   3274  C4'  DC J -59     107.108 184.577  37.569  1.00105.22           C  
ATOM   3275  O4'  DC J -59     106.071 184.934  36.625  1.00105.27           O  
ATOM   3276  C3'  DC J -59     107.488 183.128  37.263  1.00104.15           C  
ATOM   3277  O3'  DC J -59     106.785 182.249  38.141  1.00102.73           O  
ATOM   3278  C2'  DC J -59     107.008 182.936  35.836  1.00104.61           C  
ATOM   3279  C1'  DC J -59     105.775 183.824  35.793  1.00105.26           C  
ATOM   3280  N1   DC J -59     105.428 184.341  34.459  1.00105.35           N  
ATOM   3281  C2   DC J -59     104.087 184.613  34.174  1.00105.25           C  
ATOM   3282  O2   DC J -59     103.237 184.422  35.056  1.00105.15           O  
ATOM   3283  N3   DC J -59     103.752 185.080  32.949  1.00105.15           N  
ATOM   3284  C4   DC J -59     104.699 185.280  32.029  1.00104.85           C  
ATOM   3285  N4   DC J -59     104.324 185.738  30.833  1.00104.73           N  
ATOM   3286  C5   DC J -59     106.074 185.017  32.295  1.00104.96           C  
ATOM   3287  C6   DC J -59     106.390 184.553  33.511  1.00105.42           C  
ATOM   3288  P    DT J -58     107.587 181.464  39.291  1.00102.04           P  
ATOM   3289  OP1  DT J -58     108.152 182.485  40.210  1.00101.87           O  
ATOM   3290  OP2  DT J -58     108.485 180.463  38.664  1.00101.71           O  
ATOM   3291  O5'  DT J -58     106.440 180.687  40.071  1.00102.04           O  
ATOM   3292  C5'  DT J -58     105.345 181.397  40.641  1.00101.84           C  
ATOM   3293  C4'  DT J -58     104.039 180.865  40.099  1.00101.01           C  
ATOM   3294  O4'  DT J -58     103.860 181.253  38.715  1.00100.56           O  
ATOM   3295  C3'  DT J -58     103.908 179.342  40.129  1.00100.32           C  
ATOM   3296  O3'  DT J -58     102.559 179.010  40.434  1.00100.46           O  
ATOM   3297  C2'  DT J -58     104.191 178.946  38.692  1.00 99.75           C  
ATOM   3298  C1'  DT J -58     103.544 180.100  37.953  1.00 99.71           C  
ATOM   3299  N1   DT J -58     103.994 180.324  36.567  1.00 99.46           N  
ATOM   3300  C2   DT J -58     103.222 181.147  35.781  1.00 99.56           C  
ATOM   3301  O2   DT J -58     102.206 181.689  36.185  1.00100.05           O  
ATOM   3302  N3   DT J -58     103.681 181.315  34.500  1.00 98.92           N  
ATOM   3303  C4   DT J -58     104.809 180.755  33.939  1.00 98.89           C  
ATOM   3304  O4   DT J -58     105.095 181.004  32.771  1.00 99.13           O  
ATOM   3305  C5   DT J -58     105.575 179.898  34.821  1.00 99.01           C  
ATOM   3306  C7   DT J -58     106.813 179.238  34.301  1.00 99.07           C  
ATOM   3307  C6   DT J -58     105.136 179.731  36.075  1.00 98.82           C  
ATOM   3308  P    DT J -57     102.233 178.010  41.642  1.00101.20           P  
ATOM   3309  OP1  DT J -57     102.092 178.837  42.867  1.00100.94           O  
ATOM   3310  OP2  DT J -57     103.198 176.880  41.624  1.00101.15           O  
ATOM   3311  O5'  DT J -57     100.794 177.461  41.249  1.00100.81           O  
ATOM   3312  C5'  DT J -57      99.733 178.364  40.945  1.00100.05           C  
ATOM   3313  C4'  DT J -57      98.902 177.826  39.805  1.00 99.08           C  
ATOM   3314  O4'  DT J -57      99.401 178.250  38.510  1.00 99.29           O  
ATOM   3315  C3'  DT J -57      98.832 176.299  39.758  1.00 97.97           C  
ATOM   3316  O3'  DT J -57      97.502 175.900  39.442  1.00 95.36           O  
ATOM   3317  C2'  DT J -57      99.734 175.958  38.586  1.00 98.65           C  
ATOM   3318  C1'  DT J -57      99.416 177.116  37.662  1.00 99.66           C  
ATOM   3319  N1   DT J -57     100.357 177.359  36.548  1.00100.95           N  
ATOM   3320  C2   DT J -57      99.863 177.989  35.423  1.00101.38           C  
ATOM   3321  O2   DT J -57      98.705 178.361  35.319  1.00101.34           O  
ATOM   3322  N3   DT J -57     100.780 178.167  34.417  1.00101.41           N  
ATOM   3323  C4   DT J -57     102.109 177.788  34.420  1.00101.53           C  
ATOM   3324  O4   DT J -57     102.812 178.016  33.440  1.00100.93           O  
ATOM   3325  C5   DT J -57     102.560 177.135  35.628  1.00101.85           C  
ATOM   3326  C7   DT J -57     103.983 176.680  35.717  1.00102.24           C  
ATOM   3327  C6   DT J -57     101.675 176.960  36.621  1.00101.47           C  
ATOM   3328  P    DG J -56      96.566 175.270  40.583  1.00 93.78           P  
ATOM   3329  OP1  DG J -56      96.418 176.280  41.663  1.00 93.23           O  
ATOM   3330  OP2  DG J -56      97.052 173.903  40.912  1.00 93.82           O  
ATOM   3331  O5'  DG J -56      95.165 175.144  39.847  1.00 90.11           O  
ATOM   3332  C5'  DG J -56      94.629 176.251  39.130  1.00 83.05           C  
ATOM   3333  C4'  DG J -56      94.432 175.884  37.679  1.00 78.02           C  
ATOM   3334  O4'  DG J -56      95.681 175.905  36.946  1.00 77.16           O  
ATOM   3335  C3'  DG J -56      93.832 174.497  37.441  1.00 74.64           C  
ATOM   3336  O3'  DG J -56      92.912 174.591  36.359  1.00 70.05           O  
ATOM   3337  C2'  DG J -56      95.030 173.678  37.000  1.00 73.81           C  
ATOM   3338  C1'  DG J -56      95.780 174.710  36.192  1.00 75.79           C  
ATOM   3339  N9   DG J -56      97.192 174.430  35.955  1.00 77.34           N  
ATOM   3340  C8   DG J -56      98.117 173.982  36.864  1.00 77.64           C  
ATOM   3341  N7   DG J -56      99.305 173.821  36.348  1.00 78.42           N  
ATOM   3342  C5   DG J -56      99.155 174.183  35.017  1.00 78.93           C  
ATOM   3343  C6   DG J -56     100.100 174.206  33.953  1.00 80.11           C  
ATOM   3344  O6   DG J -56     101.302 173.912  33.981  1.00 81.98           O  
ATOM   3345  N1   DG J -56      99.519 174.626  32.761  1.00 79.83           N  
ATOM   3346  C2   DG J -56      98.203 174.982  32.607  1.00 78.99           C  
ATOM   3347  N2   DG J -56      97.830 175.351  31.372  1.00 78.18           N  
ATOM   3348  N3   DG J -56      97.315 174.972  33.589  1.00 79.41           N  
ATOM   3349  C4   DG J -56      97.857 174.563  34.758  1.00 78.60           C  
ATOM   3350  P    DC J -55      91.746 173.509  36.205  1.00 64.51           P  
ATOM   3351  OP1  DC J -55      90.481 174.202  36.538  1.00 64.95           O  
ATOM   3352  OP2  DC J -55      92.114 172.267  36.927  1.00 64.54           O  
ATOM   3353  O5'  DC J -55      91.770 173.218  34.643  1.00 66.62           O  
ATOM   3354  C5'  DC J -55      91.693 174.293  33.710  1.00 67.46           C  
ATOM   3355  C4'  DC J -55      92.168 173.841  32.350  1.00 68.19           C  
ATOM   3356  O4'  DC J -55      93.617 173.819  32.304  1.00 68.30           O  
ATOM   3357  C3'  DC J -55      91.701 172.431  31.985  1.00 67.79           C  
ATOM   3358  O3'  DC J -55      91.286 172.357  30.622  1.00 65.21           O  
ATOM   3359  C2'  DC J -55      92.942 171.585  32.193  1.00 69.10           C  
ATOM   3360  C1'  DC J -55      94.047 172.557  31.820  1.00 69.79           C  
ATOM   3361  N1   DC J -55      95.354 172.245  32.423  1.00 69.56           N  
ATOM   3362  C2   DC J -55      96.506 172.344  31.629  1.00 69.92           C  
ATOM   3363  O2   DC J -55      96.400 172.743  30.459  1.00 70.83           O  
ATOM   3364  N3   DC J -55      97.703 172.009  32.157  1.00 69.72           N  
ATOM   3365  C4   DC J -55      97.781 171.607  33.427  1.00 70.27           C  
ATOM   3366  N4   DC J -55      98.985 171.286  33.908  1.00 71.03           N  
ATOM   3367  C5   DC J -55      96.628 171.517  34.262  1.00 70.37           C  
ATOM   3368  C6   DC J -55      95.448 171.845  33.726  1.00 69.15           C  
ATOM   3369  P    DG J -54      90.121 171.332  30.207  1.00 64.24           P  
ATOM   3370  OP1  DG J -54      88.859 172.096  30.087  1.00 59.90           O  
ATOM   3371  OP2  DG J -54      90.185 170.148  31.106  1.00 60.55           O  
ATOM   3372  O5'  DG J -54      90.527 170.882  28.737  1.00 68.16           O  
ATOM   3373  C5'  DG J -54      90.745 171.853  27.717  1.00 70.66           C  
ATOM   3374  C4'  DG J -54      91.843 171.390  26.790  1.00 72.95           C  
ATOM   3375  O4'  DG J -54      93.091 171.333  27.525  1.00 73.35           O  
ATOM   3376  C3'  DG J -54      91.630 169.993  26.209  1.00 74.15           C  
ATOM   3377  O3'  DG J -54      92.044 169.961  24.845  1.00 77.15           O  
ATOM   3378  C2'  DG J -54      92.533 169.113  27.052  1.00 72.93           C  
ATOM   3379  C1'  DG J -54      93.677 170.051  27.377  1.00 72.60           C  
ATOM   3380  N9   DG J -54      94.377 169.728  28.615  1.00 71.64           N  
ATOM   3381  C8   DG J -54      93.814 169.474  29.839  1.00 71.46           C  
ATOM   3382  N7   DG J -54      94.695 169.183  30.757  1.00 72.45           N  
ATOM   3383  C5   DG J -54      95.914 169.256  30.099  1.00 71.92           C  
ATOM   3384  C6   DG J -54      97.236 169.031  30.577  1.00 71.92           C  
ATOM   3385  O6   DG J -54      97.604 168.713  31.714  1.00 69.98           O  
ATOM   3386  N1   DG J -54      98.179 169.210  29.570  1.00 73.03           N  
ATOM   3387  C2   DG J -54      97.893 169.560  28.273  1.00 72.84           C  
ATOM   3388  N2   DG J -54      98.943 169.686  27.449  1.00 72.51           N  
ATOM   3389  N3   DG J -54      96.668 169.771  27.817  1.00 72.61           N  
ATOM   3390  C4   DG J -54      95.735 169.601  28.778  1.00 71.50           C  
ATOM   3391  P    DG J -53      91.822 168.626  23.980  1.00 79.49           P  
ATOM   3392  OP1  DG J -53      91.547 169.064  22.589  1.00 79.34           O  
ATOM   3393  OP2  DG J -53      90.847 167.756  24.681  1.00 79.93           O  
ATOM   3394  O5'  DG J -53      93.246 167.909  24.021  1.00 81.09           O  
ATOM   3395  C5'  DG J -53      94.308 168.355  23.179  1.00 83.56           C  
ATOM   3396  C4'  DG J -53      95.431 167.343  23.163  1.00 86.08           C  
ATOM   3397  O4'  DG J -53      96.194 167.410  24.394  1.00 85.61           O  
ATOM   3398  C3'  DG J -53      94.994 165.884  23.013  1.00 87.84           C  
ATOM   3399  O3'  DG J -53      95.897 165.194  22.139  1.00 91.38           O  
ATOM   3400  C2'  DG J -53      95.119 165.343  24.425  1.00 86.94           C  
ATOM   3401  C1'  DG J -53      96.331 166.102  24.922  1.00 86.34           C  
ATOM   3402  N9   DG J -53      96.451 166.201  26.372  1.00 86.38           N  
ATOM   3403  C8   DG J -53      95.476 166.568  27.264  1.00 87.22           C  
ATOM   3404  N7   DG J -53      95.884 166.553  28.504  1.00 87.74           N  
ATOM   3405  C5   DG J -53      97.210 166.153  28.423  1.00 88.09           C  
ATOM   3406  C6   DG J -53      98.175 165.953  29.446  1.00 89.55           C  
ATOM   3407  O6   DG J -53      98.043 166.091  30.669  1.00 90.61           O  
ATOM   3408  N1   DG J -53      99.399 165.551  28.921  1.00 89.78           N  
ATOM   3409  C2   DG J -53      99.663 165.364  27.587  1.00 89.51           C  
ATOM   3410  N2   DG J -53     100.909 164.978  27.276  1.00 89.43           N  
ATOM   3411  N3   DG J -53      98.771 165.543  26.626  1.00 88.86           N  
ATOM   3412  C4   DG J -53      97.575 165.935  27.114  1.00 87.32           C  
ATOM   3413  P    DA J -52      95.706 163.620  21.868  1.00 93.98           P  
ATOM   3414  OP1  DA J -52      95.659 163.415  20.396  1.00 94.76           O  
ATOM   3415  OP2  DA J -52      94.591 163.126  22.715  1.00 93.85           O  
ATOM   3416  O5'  DA J -52      97.057 162.982  22.419  1.00 94.57           O  
ATOM   3417  C5'  DA J -52      97.477 163.241  23.752  1.00 97.02           C  
ATOM   3418  C4'  DA J -52      98.953 162.964  23.909  1.00 98.64           C  
ATOM   3419  O4'  DA J -52      99.336 163.333  25.251  1.00 99.14           O  
ATOM   3420  C3'  DA J -52      99.319 161.493  23.770  1.00 99.62           C  
ATOM   3421  O3'  DA J -52     100.646 161.362  23.254  1.00101.51           O  
ATOM   3422  C2'  DA J -52      99.202 160.968  25.189  1.00 99.43           C  
ATOM   3423  C1'  DA J -52      99.486 162.182  26.069  1.00 98.91           C  
ATOM   3424  N9   DA J -52      98.535 162.316  27.173  1.00 99.05           N  
ATOM   3425  C8   DA J -52      97.203 162.638  27.071  1.00 98.78           C  
ATOM   3426  N7   DA J -52      96.581 162.690  28.223  1.00 98.69           N  
ATOM   3427  C5   DA J -52      97.568 162.382  29.148  1.00 98.65           C  
ATOM   3428  C6   DA J -52      97.547 162.271  30.547  1.00 98.77           C  
ATOM   3429  N6   DA J -52      96.453 162.468  31.287  1.00 99.08           N  
ATOM   3430  N1   DA J -52      98.700 161.946  31.169  1.00 98.87           N  
ATOM   3431  C2   DA J -52      99.795 161.750  30.424  1.00 99.21           C  
ATOM   3432  N3   DA J -52      99.942 161.826  29.103  1.00 99.28           N  
ATOM   3433  C4   DA J -52      98.777 162.150  28.515  1.00 99.03           C  
ATOM   3434  P    DT J -51     101.134 159.949  22.667  1.00102.23           P  
ATOM   3435  OP1  DT J -51     102.393 160.202  21.916  1.00101.16           O  
ATOM   3436  OP2  DT J -51      99.989 159.291  21.985  1.00101.68           O  
ATOM   3437  O5'  DT J -51     101.496 159.110  23.971  1.00101.35           O  
ATOM   3438  C5'  DT J -51     102.735 159.322  24.640  1.00100.74           C  
ATOM   3439  C4'  DT J -51     102.899 158.336  25.771  1.00100.16           C  
ATOM   3440  O4'  DT J -51     102.089 158.724  26.907  1.00 99.22           O  
ATOM   3441  C3'  DT J -51     102.511 156.893  25.440  1.00 99.74           C  
ATOM   3442  O3'  DT J -51     103.490 155.999  25.980  1.00 99.96           O  
ATOM   3443  C2'  DT J -51     101.173 156.721  26.139  1.00 98.85           C  
ATOM   3444  C1'  DT J -51     101.346 157.605  27.359  1.00 98.45           C  
ATOM   3445  N1   DT J -51     100.095 158.100  27.967  1.00 97.56           N  
ATOM   3446  C2   DT J -51     100.039 158.193  29.343  1.00 97.02           C  
ATOM   3447  O2   DT J -51     100.963 157.871  30.073  1.00 97.06           O  
ATOM   3448  N3   DT J -51      98.851 158.676  29.835  1.00 96.06           N  
ATOM   3449  C4   DT J -51      97.740 159.059  29.108  1.00 95.55           C  
ATOM   3450  O4   DT J -51      96.745 159.482  29.688  1.00 93.86           O  
ATOM   3451  C5   DT J -51      97.865 158.922  27.674  1.00 95.86           C  
ATOM   3452  C7   DT J -51      96.705 159.298  26.808  1.00 96.68           C  
ATOM   3453  C6   DT J -51      99.021 158.458  27.182  1.00 96.22           C  
ATOM   3454  P    DC J -50     103.154 154.435  26.122  1.00100.09           P  
ATOM   3455  OP1  DC J -50     104.440 153.699  26.019  1.00100.11           O  
ATOM   3456  OP2  DC J -50     102.035 154.089  25.208  1.00 99.40           O  
ATOM   3457  O5'  DC J -50     102.642 154.320  27.625  1.00 99.75           O  
ATOM   3458  C5'  DC J -50     103.489 154.711  28.702  1.00 99.76           C  
ATOM   3459  C4'  DC J -50     103.077 154.008  29.972  1.00 99.46           C  
ATOM   3460  O4'  DC J -50     101.941 154.675  30.574  1.00 99.53           O  
ATOM   3461  C3'  DC J -50     102.660 152.552  29.760  1.00 99.35           C  
ATOM   3462  O3'  DC J -50     103.165 151.726  30.807  1.00 98.54           O  
ATOM   3463  C2'  DC J -50     101.146 152.606  29.835  1.00 99.61           C  
ATOM   3464  C1'  DC J -50     100.922 153.725  30.835  1.00 99.24           C  
ATOM   3465  N1   DC J -50      99.624 154.403  30.708  1.00 98.84           N  
ATOM   3466  C2   DC J -50      98.871 154.632  31.863  1.00 98.58           C  
ATOM   3467  O2   DC J -50      99.330 154.276  32.959  1.00 98.55           O  
ATOM   3468  N3   DC J -50      97.665 155.235  31.757  1.00 98.01           N  
ATOM   3469  C4   DC J -50      97.208 155.604  30.558  1.00 98.06           C  
ATOM   3470  N4   DC J -50      96.009 156.186  30.497  1.00 97.96           N  
ATOM   3471  C5   DC J -50      97.960 155.392  29.366  1.00 98.19           C  
ATOM   3472  C6   DC J -50      99.152 154.795  29.486  1.00 98.53           C  
ATOM   3473  P    DG J -49     103.247 150.139  30.589  1.00 98.37           P  
ATOM   3474  OP1  DG J -49     104.686 149.767  30.583  1.00 97.53           O  
ATOM   3475  OP2  DG J -49     102.392 149.786  29.425  1.00 97.15           O  
ATOM   3476  O5'  DG J -49     102.582 149.551  31.910  1.00 96.08           O  
ATOM   3477  C5'  DG J -49     103.165 149.797  33.188  1.00 94.15           C  
ATOM   3478  C4'  DG J -49     102.201 149.410  34.283  1.00 92.46           C  
ATOM   3479  O4'  DG J -49     101.085 150.333  34.294  1.00 91.75           O  
ATOM   3480  C3'  DG J -49     101.593 148.018  34.119  1.00 91.97           C  
ATOM   3481  O3'  DG J -49     101.454 147.393  35.399  1.00 91.63           O  
ATOM   3482  C2'  DG J -49     100.240 148.299  33.493  1.00 91.39           C  
ATOM   3483  C1'  DG J -49      99.863 149.628  34.119  1.00 90.75           C  
ATOM   3484  N9   DG J -49      98.988 150.453  33.292  1.00 89.40           N  
ATOM   3485  C8   DG J -49      99.109 150.693  31.945  1.00 89.13           C  
ATOM   3486  N7   DG J -49      98.184 151.489  31.481  1.00 88.73           N  
ATOM   3487  C5   DG J -49      97.403 151.791  32.588  1.00 88.41           C  
ATOM   3488  C6   DG J -49      96.254 152.619  32.705  1.00 87.71           C  
ATOM   3489  O6   DG J -49      95.682 153.272  31.824  1.00 86.88           O  
ATOM   3490  N1   DG J -49      95.775 152.646  34.010  1.00 86.47           N  
ATOM   3491  C2   DG J -49      96.326 151.967  35.066  1.00 86.09           C  
ATOM   3492  N2   DG J -49      95.716 152.122  36.248  1.00 85.28           N  
ATOM   3493  N3   DG J -49      97.396 151.195  34.972  1.00 87.47           N  
ATOM   3494  C4   DG J -49      97.880 151.154  33.713  1.00 88.30           C  
ATOM   3495  P    DT J -48     100.398 146.198  35.592  1.00 91.46           P  
ATOM   3496  OP1  DT J -48     100.749 145.488  36.849  1.00 91.60           O  
ATOM   3497  OP2  DT J -48     100.298 145.436  34.320  1.00 91.66           O  
ATOM   3498  O5'  DT J -48      99.025 146.966  35.832  1.00 90.74           O  
ATOM   3499  C5'  DT J -48      98.874 147.847  36.944  1.00 88.19           C  
ATOM   3500  C4'  DT J -48      97.420 147.946  37.335  1.00 86.32           C  
ATOM   3501  O4'  DT J -48      96.702 148.708  36.336  1.00 85.18           O  
ATOM   3502  C3'  DT J -48      96.706 146.597  37.433  1.00 85.88           C  
ATOM   3503  O3'  DT J -48      95.779 146.609  38.518  1.00 85.99           O  
ATOM   3504  C2'  DT J -48      95.951 146.507  36.120  1.00 85.66           C  
ATOM   3505  C1'  DT J -48      95.586 147.959  35.886  1.00 84.71           C  
ATOM   3506  N1   DT J -48      95.317 148.337  34.486  1.00 83.28           N  
ATOM   3507  C2   DT J -48      94.273 149.199  34.257  1.00 82.54           C  
ATOM   3508  O2   DT J -48      93.567 149.639  35.150  1.00 82.96           O  
ATOM   3509  N3   DT J -48      94.082 149.530  32.939  1.00 81.64           N  
ATOM   3510  C4   DT J -48      94.814 149.093  31.855  1.00 81.42           C  
ATOM   3511  O4   DT J -48      94.530 149.487  30.728  1.00 80.07           O  
ATOM   3512  C5   DT J -48      95.890 148.179  32.166  1.00 82.07           C  
ATOM   3513  C7   DT J -48      96.734 147.642  31.053  1.00 81.18           C  
ATOM   3514  C6   DT J -48      96.085 147.851  33.451  1.00 82.64           C  
ATOM   3515  P    DA J -47      95.624 145.306  39.440  1.00 86.79           P  
ATOM   3516  OP1  DA J -47      96.856 145.227  40.272  1.00 85.90           O  
ATOM   3517  OP2  DA J -47      95.239 144.159  38.576  1.00 86.10           O  
ATOM   3518  O5'  DA J -47      94.394 145.649  40.392  1.00 85.17           O  
ATOM   3519  C5'  DA J -47      94.449 146.764  41.279  1.00 82.51           C  
ATOM   3520  C4'  DA J -47      93.114 147.469  41.317  1.00 80.15           C  
ATOM   3521  O4'  DA J -47      92.791 147.940  39.989  1.00 80.08           O  
ATOM   3522  C3'  DA J -47      91.933 146.603  41.750  1.00 78.16           C  
ATOM   3523  O3'  DA J -47      91.017 147.402  42.504  1.00 76.24           O  
ATOM   3524  C2'  DA J -47      91.328 146.149  40.434  1.00 78.40           C  
ATOM   3525  C1'  DA J -47      91.603 147.324  39.510  1.00 78.97           C  
ATOM   3526  N9   DA J -47      91.842 146.956  38.117  1.00 79.16           N  
ATOM   3527  C8   DA J -47      92.687 145.986  37.639  1.00 79.50           C  
ATOM   3528  N7   DA J -47      92.740 145.928  36.331  1.00 79.78           N  
ATOM   3529  C5   DA J -47      91.859 146.918  35.918  1.00 79.62           C  
ATOM   3530  C6   DA J -47      91.477 147.373  34.645  1.00 79.47           C  
ATOM   3531  N6   DA J -47      91.965 146.880  33.504  1.00 80.15           N  
ATOM   3532  N1   DA J -47      90.572 148.371  34.581  1.00 79.38           N  
ATOM   3533  C2   DA J -47      90.097 148.878  35.722  1.00 79.74           C  
ATOM   3534  N3   DA J -47      90.385 148.544  36.977  1.00 80.86           N  
ATOM   3535  C4   DA J -47      91.285 147.546  37.007  1.00 80.25           C  
ATOM   3536  P    DG J -46      89.701 146.730  43.133  1.00 75.50           P  
ATOM   3537  OP1  DG J -46      89.326 147.519  44.333  1.00 74.30           O  
ATOM   3538  OP2  DG J -46      89.915 145.267  43.251  1.00 76.10           O  
ATOM   3539  O5'  DG J -46      88.605 146.987  42.012  1.00 74.78           O  
ATOM   3540  C5'  DG J -46      88.418 148.299  41.488  1.00 72.71           C  
ATOM   3541  C4'  DG J -46      87.370 148.287  40.402  1.00 68.92           C  
ATOM   3542  O4'  DG J -46      87.904 147.713  39.186  1.00 67.60           O  
ATOM   3543  C3'  DG J -46      86.118 147.481  40.745  1.00 66.59           C  
ATOM   3544  O3'  DG J -46      84.973 148.185  40.282  1.00 63.98           O  
ATOM   3545  C2'  DG J -46      86.297 146.205  39.944  1.00 66.00           C  
ATOM   3546  C1'  DG J -46      87.019 146.714  38.713  1.00 67.47           C  
ATOM   3547  N9   DG J -46      87.808 145.709  38.014  1.00 68.31           N  
ATOM   3548  C8   DG J -46      88.381 144.586  38.557  1.00 69.83           C  
ATOM   3549  N7   DG J -46      89.028 143.867  37.681  1.00 70.89           N  
ATOM   3550  C5   DG J -46      88.875 144.558  36.487  1.00 69.24           C  
ATOM   3551  C6   DG J -46      89.357 144.261  35.189  1.00 68.04           C  
ATOM   3552  O6   DG J -46      90.042 143.303  34.824  1.00 69.86           O  
ATOM   3553  N1   DG J -46      88.965 145.221  34.266  1.00 67.86           N  
ATOM   3554  C2   DG J -46      88.209 146.328  34.554  1.00 67.64           C  
ATOM   3555  N2   DG J -46      87.930 147.134  33.524  1.00 66.26           N  
ATOM   3556  N3   DG J -46      87.757 146.620  35.763  1.00 68.41           N  
ATOM   3557  C4   DG J -46      88.124 145.697  36.675  1.00 68.91           C  
ATOM   3558  P    DA J -45      83.512 147.728  40.751  1.00 60.21           P  
ATOM   3559  OP1  DA J -45      83.176 148.504  41.967  1.00 61.92           O  
ATOM   3560  OP2  DA J -45      83.457 146.245  40.783  1.00 63.27           O  
ATOM   3561  O5'  DA J -45      82.596 148.237  39.559  1.00 57.73           O  
ATOM   3562  C5'  DA J -45      83.028 149.318  38.742  1.00 53.52           C  
ATOM   3563  C4'  DA J -45      82.812 148.986  37.287  1.00 51.02           C  
ATOM   3564  O4'  DA J -45      83.767 148.000  36.825  1.00 52.32           O  
ATOM   3565  C3'  DA J -45      81.432 148.402  36.993  1.00 49.95           C  
ATOM   3566  O3'  DA J -45      80.974 148.906  35.753  1.00 46.04           O  
ATOM   3567  C2'  DA J -45      81.702 146.920  36.834  1.00 48.90           C  
ATOM   3568  C1'  DA J -45      83.064 146.947  36.177  1.00 51.41           C  
ATOM   3569  N9   DA J -45      83.831 145.714  36.331  1.00 52.64           N  
ATOM   3570  C8   DA J -45      84.004 144.952  37.460  1.00 54.05           C  
ATOM   3571  N7   DA J -45      84.749 143.890  37.271  1.00 55.52           N  
ATOM   3572  C5   DA J -45      85.092 143.960  35.928  1.00 55.91           C  
ATOM   3573  C6   DA J -45      85.868 143.127  35.106  1.00 55.99           C  
ATOM   3574  N6   DA J -45      86.471 142.020  35.537  1.00 59.04           N  
ATOM   3575  N1   DA J -45      86.006 143.475  33.809  1.00 56.32           N  
ATOM   3576  C2   DA J -45      85.403 144.590  33.379  1.00 56.31           C  
ATOM   3577  N3   DA J -45      84.650 145.454  34.054  1.00 56.06           N  
ATOM   3578  C4   DA J -45      84.532 145.077  35.338  1.00 54.05           C  
ATOM   3579  P    DA J -44      79.424 149.208  35.551  1.00 43.16           P  
ATOM   3580  OP1  DA J -44      79.279 150.671  35.741  1.00 43.76           O  
ATOM   3581  OP2  DA J -44      78.609 148.279  36.370  1.00 41.54           O  
ATOM   3582  O5'  DA J -44      79.207 148.866  34.012  1.00 45.59           O  
ATOM   3583  C5'  DA J -44      79.904 149.600  33.010  1.00 47.34           C  
ATOM   3584  C4'  DA J -44      80.113 148.752  31.777  1.00 49.53           C  
ATOM   3585  O4'  DA J -44      81.016 147.658  32.071  1.00 51.51           O  
ATOM   3586  C3'  DA J -44      78.853 148.120  31.185  1.00 49.68           C  
ATOM   3587  O3'  DA J -44      78.869 148.280  29.765  1.00 44.76           O  
ATOM   3588  C2'  DA J -44      78.953 146.656  31.594  1.00 50.92           C  
ATOM   3589  C1'  DA J -44      80.452 146.424  31.657  1.00 53.28           C  
ATOM   3590  N9   DA J -44      80.887 145.399  32.610  1.00 58.59           N  
ATOM   3591  C8   DA J -44      80.532 145.261  33.930  1.00 59.78           C  
ATOM   3592  N7   DA J -44      81.110 144.248  34.533  1.00 60.17           N  
ATOM   3593  C5   DA J -44      81.897 143.677  33.544  1.00 62.08           C  
ATOM   3594  C6   DA J -44      82.763 142.560  33.544  1.00 63.23           C  
ATOM   3595  N6   DA J -44      82.993 141.799  34.616  1.00 60.87           N  
ATOM   3596  N1   DA J -44      83.390 142.252  32.387  1.00 63.82           N  
ATOM   3597  C2   DA J -44      83.160 143.019  31.307  1.00 64.91           C  
ATOM   3598  N3   DA J -44      82.374 144.091  31.183  1.00 63.54           N  
ATOM   3599  C4   DA J -44      81.765 144.371  32.351  1.00 61.74           C  
ATOM   3600  P    DA J -43      77.682 147.666  28.882  1.00 43.97           P  
ATOM   3601  OP1  DA J -43      77.492 148.536  27.695  1.00 45.08           O  
ATOM   3602  OP2  DA J -43      76.527 147.367  29.765  1.00 44.60           O  
ATOM   3603  O5'  DA J -43      78.311 146.306  28.355  1.00 47.36           O  
ATOM   3604  C5'  DA J -43      79.521 146.331  27.601  1.00 49.42           C  
ATOM   3605  C4'  DA J -43      79.859 144.948  27.100  1.00 50.13           C  
ATOM   3606  O4'  DA J -43      80.327 144.118  28.186  1.00 49.88           O  
ATOM   3607  C3'  DA J -43      78.697 144.195  26.460  1.00 50.94           C  
ATOM   3608  O3'  DA J -43      79.196 143.456  25.348  1.00 52.70           O  
ATOM   3609  C2'  DA J -43      78.243 143.257  27.565  1.00 49.06           C  
ATOM   3610  C1'  DA J -43      79.554 142.931  28.252  1.00 48.99           C  
ATOM   3611  N9   DA J -43      79.454 142.552  29.661  1.00 49.67           N  
ATOM   3612  C8   DA J -43      78.714 143.150  30.648  1.00 49.49           C  
ATOM   3613  N7   DA J -43      78.868 142.604  31.829  1.00 49.49           N  
ATOM   3614  C5   DA J -43      79.760 141.568  31.604  1.00 50.48           C  
ATOM   3615  C6   DA J -43      80.324 140.605  32.456  1.00 49.65           C  
ATOM   3616  N6   DA J -43      80.070 140.535  33.763  1.00 47.84           N  
ATOM   3617  N1   DA J -43      81.171 139.706  31.912  1.00 49.14           N  
ATOM   3618  C2   DA J -43      81.429 139.778  30.600  1.00 49.07           C  
ATOM   3619  N3   DA J -43      80.965 140.637  29.697  1.00 50.68           N  
ATOM   3620  C4   DA J -43      80.124 141.518  30.270  1.00 51.30           C  
ATOM   3621  P    DA J -42      78.179 142.873  24.257  1.00 55.48           P  
ATOM   3622  OP1  DA J -42      78.592 143.435  22.948  1.00 55.45           O  
ATOM   3623  OP2  DA J -42      76.783 143.056  24.724  1.00 58.02           O  
ATOM   3624  O5'  DA J -42      78.505 141.317  24.287  1.00 57.97           O  
ATOM   3625  C5'  DA J -42      79.853 140.856  24.203  1.00 59.84           C  
ATOM   3626  C4'  DA J -42      79.943 139.418  24.652  1.00 61.33           C  
ATOM   3627  O4'  DA J -42      79.901 139.334  26.098  1.00 60.95           O  
ATOM   3628  C3'  DA J -42      78.801 138.542  24.138  1.00 63.91           C  
ATOM   3629  O3'  DA J -42      79.298 137.264  23.743  1.00 67.77           O  
ATOM   3630  C2'  DA J -42      77.883 138.416  25.340  1.00 62.20           C  
ATOM   3631  C1'  DA J -42      78.865 138.449  26.497  1.00 61.95           C  
ATOM   3632  N9   DA J -42      78.297 138.949  27.748  1.00 62.28           N  
ATOM   3633  C8   DA J -42      77.499 140.052  27.930  1.00 61.99           C  
ATOM   3634  N7   DA J -42      77.129 140.238  29.174  1.00 62.45           N  
ATOM   3635  C5   DA J -42      77.725 139.189  29.860  1.00 62.80           C  
ATOM   3636  C6   DA J -42      77.718 138.822  31.218  1.00 63.38           C  
ATOM   3637  N6   DA J -42      77.067 139.503  32.163  1.00 63.98           N  
ATOM   3638  N1   DA J -42      78.413 137.719  31.576  1.00 62.75           N  
ATOM   3639  C2   DA J -42      79.070 137.041  30.626  1.00 64.17           C  
ATOM   3640  N3   DA J -42      79.154 137.289  29.316  1.00 64.19           N  
ATOM   3641  C4   DA J -42      78.450 138.389  28.995  1.00 63.28           C  
ATOM   3642  P    DA J -41      78.334 136.237  22.972  1.00 70.76           P  
ATOM   3643  OP1  DA J -41      79.170 135.582  21.934  1.00 70.97           O  
ATOM   3644  OP2  DA J -41      77.084 136.931  22.570  1.00 69.33           O  
ATOM   3645  O5'  DA J -41      77.979 135.169  24.100  1.00 71.33           O  
ATOM   3646  C5'  DA J -41      79.011 134.409  24.723  1.00 73.66           C  
ATOM   3647  C4'  DA J -41      78.430 133.493  25.775  1.00 77.18           C  
ATOM   3648  O4'  DA J -41      78.177 134.213  27.007  1.00 76.66           O  
ATOM   3649  C3'  DA J -41      77.107 132.828  25.388  1.00 79.61           C  
ATOM   3650  O3'  DA J -41      77.104 131.455  25.790  1.00 81.78           O  
ATOM   3651  C2'  DA J -41      76.080 133.597  26.198  1.00 77.92           C  
ATOM   3652  C1'  DA J -41      76.867 133.907  27.454  1.00 76.54           C  
ATOM   3653  N9   DA J -41      76.366 135.043  28.226  1.00 76.34           N  
ATOM   3654  C8   DA J -41      75.997 136.286  27.781  1.00 75.05           C  
ATOM   3655  N7   DA J -41      75.563 137.079  28.731  1.00 74.93           N  
ATOM   3656  C5   DA J -41      75.659 136.306  29.880  1.00 74.90           C  
ATOM   3657  C6   DA J -41      75.354 136.569  31.226  1.00 75.72           C  
ATOM   3658  N6   DA J -41      74.865 137.730  31.664  1.00 76.93           N  
ATOM   3659  N1   DA J -41      75.569 135.583  32.122  1.00 75.42           N  
ATOM   3660  C2   DA J -41      76.059 134.418  31.686  1.00 75.96           C  
ATOM   3661  N3   DA J -41      76.385 134.052  30.449  1.00 75.31           N  
ATOM   3662  C4   DA J -41      76.158 135.053  29.584  1.00 75.61           C  
ATOM   3663  P    DG J -40      75.874 130.508  25.375  1.00 82.74           P  
ATOM   3664  OP1  DG J -40      76.452 129.340  24.669  1.00 84.58           O  
ATOM   3665  OP2  DG J -40      74.834 131.327  24.701  1.00 81.80           O  
ATOM   3666  O5'  DG J -40      75.308 130.016  26.780  1.00 84.28           O  
ATOM   3667  C5'  DG J -40      76.176 129.405  27.735  1.00 87.03           C  
ATOM   3668  C4'  DG J -40      75.426 129.096  29.011  1.00 88.46           C  
ATOM   3669  O4'  DG J -40      75.181 130.307  29.767  1.00 88.42           O  
ATOM   3670  C3'  DG J -40      74.060 128.445  28.799  1.00 89.28           C  
ATOM   3671  O3'  DG J -40      73.836 127.445  29.792  1.00 90.81           O  
ATOM   3672  C2'  DG J -40      73.090 129.595  28.992  1.00 88.51           C  
ATOM   3673  C1'  DG J -40      73.795 130.422  30.051  1.00 88.10           C  
ATOM   3674  N9   DG J -40      73.447 131.839  30.034  1.00 87.27           N  
ATOM   3675  C8   DG J -40      73.378 132.662  28.936  1.00 87.20           C  
ATOM   3676  N7   DG J -40      73.042 133.887  29.236  1.00 86.95           N  
ATOM   3677  C5   DG J -40      72.879 133.871  30.614  1.00 86.33           C  
ATOM   3678  C6   DG J -40      72.517 134.911  31.508  1.00 85.29           C  
ATOM   3679  O6   DG J -40      72.264 136.093  31.252  1.00 84.31           O  
ATOM   3680  N1   DG J -40      72.461 134.460  32.821  1.00 85.34           N  
ATOM   3681  C2   DG J -40      72.721 133.174  33.225  1.00 86.30           C  
ATOM   3682  N2   DG J -40      72.611 132.933  34.540  1.00 86.65           N  
ATOM   3683  N3   DG J -40      73.063 132.196  32.402  1.00 86.26           N  
ATOM   3684  C4   DG J -40      73.122 132.613  31.121  1.00 86.39           C  
ATOM   3685  P    DT J -39      72.509 126.546  29.725  1.00 91.99           P  
ATOM   3686  OP1  DT J -39      72.851 125.234  30.333  1.00 91.82           O  
ATOM   3687  OP2  DT J -39      71.967 126.598  28.343  1.00 92.05           O  
ATOM   3688  O5'  DT J -39      71.494 127.301  30.690  1.00 91.63           O  
ATOM   3689  C5'  DT J -39      71.661 127.235  32.102  1.00 91.91           C  
ATOM   3690  C4'  DT J -39      70.509 127.915  32.802  1.00 91.63           C  
ATOM   3691  O4'  DT J -39      70.575 129.349  32.605  1.00 92.55           O  
ATOM   3692  C3'  DT J -39      69.111 127.492  32.345  1.00 91.67           C  
ATOM   3693  O3'  DT J -39      68.258 127.478  33.489  1.00 91.51           O  
ATOM   3694  C2'  DT J -39      68.688 128.637  31.444  1.00 91.83           C  
ATOM   3695  C1'  DT J -39      69.300 129.804  32.190  1.00 91.77           C  
ATOM   3696  N1   DT J -39      69.471 131.052  31.426  1.00 91.51           N  
ATOM   3697  C2   DT J -39      69.359 132.238  32.119  1.00 91.30           C  
ATOM   3698  O2   DT J -39      69.158 132.289  33.323  1.00 89.69           O  
ATOM   3699  N3   DT J -39      69.493 133.366  31.348  1.00 91.07           N  
ATOM   3700  C4   DT J -39      69.733 133.424  29.989  1.00 91.22           C  
ATOM   3701  O4   DT J -39      69.824 134.515  29.431  1.00 90.52           O  
ATOM   3702  C5   DT J -39      69.858 132.142  29.329  1.00 91.19           C  
ATOM   3703  C7   DT J -39      70.133 132.106  27.859  1.00 91.25           C  
ATOM   3704  C6   DT J -39      69.722 131.035  30.071  1.00 91.18           C  
ATOM   3705  P    DG J -38      66.882 126.653  33.462  1.00 90.68           P  
ATOM   3706  OP1  DG J -38      67.231 125.223  33.257  1.00 91.23           O  
ATOM   3707  OP2  DG J -38      65.927 127.314  32.538  1.00 90.32           O  
ATOM   3708  O5'  DG J -38      66.355 126.843  34.951  1.00 88.99           O  
ATOM   3709  C5'  DG J -38      67.275 126.818  36.041  1.00 87.38           C  
ATOM   3710  C4'  DG J -38      67.141 128.071  36.876  1.00 87.14           C  
ATOM   3711  O4'  DG J -38      67.441 129.236  36.066  1.00 87.07           O  
ATOM   3712  C3'  DG J -38      65.750 128.309  37.461  1.00 86.10           C  
ATOM   3713  O3'  DG J -38      65.863 128.825  38.787  1.00 85.03           O  
ATOM   3714  C2'  DG J -38      65.148 129.351  36.537  1.00 86.35           C  
ATOM   3715  C1'  DG J -38      66.362 130.159  36.115  1.00 86.12           C  
ATOM   3716  N9   DG J -38      66.235 130.769  34.795  1.00 85.70           N  
ATOM   3717  C8   DG J -38      66.335 130.134  33.581  1.00 85.88           C  
ATOM   3718  N7   DG J -38      66.178 130.939  32.565  1.00 85.81           N  
ATOM   3719  C5   DG J -38      65.965 132.183  33.143  1.00 85.80           C  
ATOM   3720  C6   DG J -38      65.740 133.451  32.540  1.00 85.33           C  
ATOM   3721  O6   DG J -38      65.689 133.737  31.337  1.00 85.68           O  
ATOM   3722  N1   DG J -38      65.568 134.447  33.495  1.00 84.00           N  
ATOM   3723  C2   DG J -38      65.611 134.255  34.852  1.00 84.41           C  
ATOM   3724  N2   DG J -38      65.421 135.345  35.606  1.00 83.89           N  
ATOM   3725  N3   DG J -38      65.825 133.080  35.428  1.00 85.67           N  
ATOM   3726  C4   DG J -38      65.992 132.096  34.519  1.00 85.69           C  
ATOM   3727  P    DT J -37      64.561 128.902  39.721  1.00 86.57           P  
ATOM   3728  OP1  DT J -37      65.031 129.181  41.104  1.00 86.20           O  
ATOM   3729  OP2  DT J -37      63.701 127.717  39.461  1.00 86.23           O  
ATOM   3730  O5'  DT J -37      63.793 130.189  39.184  1.00 85.04           O  
ATOM   3731  C5'  DT J -37      64.152 131.492  39.634  1.00 82.03           C  
ATOM   3732  C4'  DT J -37      63.084 132.486  39.248  1.00 80.26           C  
ATOM   3733  O4'  DT J -37      63.176 132.812  37.840  1.00 79.63           O  
ATOM   3734  C3'  DT J -37      61.656 131.991  39.476  1.00 78.78           C  
ATOM   3735  O3'  DT J -37      60.853 133.057  39.979  1.00 77.84           O  
ATOM   3736  C2'  DT J -37      61.194 131.612  38.080  1.00 78.29           C  
ATOM   3737  C1'  DT J -37      61.902 132.656  37.241  1.00 78.70           C  
ATOM   3738  N1   DT J -37      62.099 132.317  35.818  1.00 78.75           N  
ATOM   3739  C2   DT J -37      61.793 133.281  34.885  1.00 79.01           C  
ATOM   3740  O2   DT J -37      61.365 134.384  35.181  1.00 79.65           O  
ATOM   3741  N3   DT J -37      62.006 132.906  33.584  1.00 79.31           N  
ATOM   3742  C4   DT J -37      62.474 131.690  33.132  1.00 80.23           C  
ATOM   3743  O4   DT J -37      62.622 131.502  31.927  1.00 81.11           O  
ATOM   3744  C5   DT J -37      62.760 130.719  34.162  1.00 79.89           C  
ATOM   3745  C7   DT J -37      63.242 129.360  33.762  1.00 79.13           C  
ATOM   3746  C6   DT J -37      62.569 131.080  35.438  1.00 79.23           C  
ATOM   3747  P    DG J -36      59.677 132.739  41.021  1.00 77.57           P  
ATOM   3748  OP1  DG J -36      60.307 132.298  42.292  1.00 78.16           O  
ATOM   3749  OP2  DG J -36      58.690 131.860  40.342  1.00 78.25           O  
ATOM   3750  O5'  DG J -36      58.991 134.153  41.266  1.00 75.96           O  
ATOM   3751  C5'  DG J -36      59.770 135.344  41.303  1.00 74.13           C  
ATOM   3752  C4'  DG J -36      59.245 136.333  40.290  1.00 72.28           C  
ATOM   3753  O4'  DG J -36      59.491 135.841  38.951  1.00 72.51           O  
ATOM   3754  C3'  DG J -36      57.738 136.578  40.369  1.00 70.71           C  
ATOM   3755  O3'  DG J -36      57.476 137.911  39.945  1.00 69.04           O  
ATOM   3756  C2'  DG J -36      57.197 135.640  39.307  1.00 71.95           C  
ATOM   3757  C1'  DG J -36      58.263 135.796  38.245  1.00 72.45           C  
ATOM   3758  N9   DG J -36      58.350 134.733  37.251  1.00 73.43           N  
ATOM   3759  C8   DG J -36      58.606 133.401  37.467  1.00 74.17           C  
ATOM   3760  N7   DG J -36      58.668 132.707  36.361  1.00 74.46           N  
ATOM   3761  C5   DG J -36      58.426 133.636  35.358  1.00 73.96           C  
ATOM   3762  C6   DG J -36      58.377 133.480  33.950  1.00 73.67           C  
ATOM   3763  O6   DG J -36      58.552 132.459  33.280  1.00 74.18           O  
ATOM   3764  N1   DG J -36      58.095 134.683  33.312  1.00 74.90           N  
ATOM   3765  C2   DG J -36      57.892 135.886  33.944  1.00 74.20           C  
ATOM   3766  N2   DG J -36      57.625 136.936  33.152  1.00 73.47           N  
ATOM   3767  N3   DG J -36      57.944 136.047  35.253  1.00 73.76           N  
ATOM   3768  C4   DG J -36      58.214 134.889  35.893  1.00 74.11           C  
ATOM   3769  P    DT J -35      56.819 138.966  40.956  1.00 68.46           P  
ATOM   3770  OP1  DT J -35      57.775 139.154  42.074  1.00 68.56           O  
ATOM   3771  OP2  DT J -35      55.413 138.586  41.246  1.00 67.85           O  
ATOM   3772  O5'  DT J -35      56.815 140.294  40.085  1.00 65.86           O  
ATOM   3773  C5'  DT J -35      58.000 140.707  39.415  1.00 63.87           C  
ATOM   3774  C4'  DT J -35      57.685 141.121  37.998  1.00 62.82           C  
ATOM   3775  O4'  DT J -35      57.411 139.959  37.179  1.00 63.99           O  
ATOM   3776  C3'  DT J -35      56.463 142.027  37.875  1.00 61.61           C  
ATOM   3777  O3'  DT J -35      56.716 143.089  36.961  1.00 59.93           O  
ATOM   3778  C2'  DT J -35      55.389 141.114  37.318  1.00 62.90           C  
ATOM   3779  C1'  DT J -35      56.196 140.150  36.475  1.00 63.97           C  
ATOM   3780  N1   DT J -35      55.562 138.833  36.288  1.00 65.45           N  
ATOM   3781  C2   DT J -35      55.426 138.367  35.001  1.00 66.16           C  
ATOM   3782  O2   DT J -35      55.786 138.997  34.025  1.00 65.35           O  
ATOM   3783  N3   DT J -35      54.841 137.132  34.895  1.00 67.98           N  
ATOM   3784  C4   DT J -35      54.384 136.336  35.927  1.00 68.84           C  
ATOM   3785  O4   DT J -35      53.894 135.239  35.678  1.00 70.63           O  
ATOM   3786  C5   DT J -35      54.540 136.894  37.256  1.00 68.32           C  
ATOM   3787  C7   DT J -35      54.042 136.116  38.434  1.00 66.86           C  
ATOM   3788  C6   DT J -35      55.122 138.096  37.367  1.00 66.18           C  
ATOM   3789  P    DC J -34      55.702 144.320  36.904  1.00 55.95           P  
ATOM   3790  OP1  DC J -34      56.488 145.568  36.848  1.00 58.80           O  
ATOM   3791  OP2  DC J -34      54.713 144.129  37.993  1.00 59.14           O  
ATOM   3792  O5'  DC J -34      54.947 144.111  35.524  1.00 56.01           O  
ATOM   3793  C5'  DC J -34      55.664 143.815  34.337  1.00 55.39           C  
ATOM   3794  C4'  DC J -34      54.721 143.265  33.295  1.00 57.23           C  
ATOM   3795  O4'  DC J -34      54.343 141.908  33.629  1.00 55.61           O  
ATOM   3796  C3'  DC J -34      53.411 144.043  33.163  1.00 58.34           C  
ATOM   3797  O3'  DC J -34      53.018 144.058  31.793  1.00 61.74           O  
ATOM   3798  C2'  DC J -34      52.428 143.195  33.950  1.00 57.22           C  
ATOM   3799  C1'  DC J -34      52.928 141.807  33.607  1.00 56.35           C  
ATOM   3800  N1   DC J -34      52.535 140.708  34.503  1.00 56.78           N  
ATOM   3801  C2   DC J -34      52.546 139.408  33.990  1.00 54.88           C  
ATOM   3802  O2   DC J -34      52.856 139.238  32.802  1.00 53.35           O  
ATOM   3803  N3   DC J -34      52.223 138.374  34.796  1.00 54.33           N  
ATOM   3804  C4   DC J -34      51.894 138.599  36.069  1.00 55.73           C  
ATOM   3805  N4   DC J -34      51.603 137.541  36.830  1.00 56.04           N  
ATOM   3806  C5   DC J -34      51.854 139.915  36.619  1.00 54.79           C  
ATOM   3807  C6   DC J -34      52.179 140.933  35.806  1.00 56.82           C  
ATOM   3808  P    DA J -33      52.658 145.447  31.081  1.00 65.09           P  
ATOM   3809  OP1  DA J -33      53.951 146.126  30.805  1.00 64.09           O  
ATOM   3810  OP2  DA J -33      51.604 146.147  31.859  1.00 63.42           O  
ATOM   3811  O5'  DA J -33      52.022 144.995  29.697  1.00 67.41           O  
ATOM   3812  C5'  DA J -33      52.780 144.242  28.753  1.00 71.87           C  
ATOM   3813  C4'  DA J -33      51.849 143.433  27.884  1.00 74.40           C  
ATOM   3814  O4'  DA J -33      51.321 142.330  28.662  1.00 75.56           O  
ATOM   3815  C3'  DA J -33      50.641 144.236  27.409  1.00 75.97           C  
ATOM   3816  O3'  DA J -33      50.286 143.886  26.071  1.00 78.24           O  
ATOM   3817  C2'  DA J -33      49.552 143.866  28.401  1.00 75.80           C  
ATOM   3818  C1'  DA J -33      49.912 142.445  28.815  1.00 75.25           C  
ATOM   3819  N9   DA J -33      49.595 142.151  30.213  1.00 74.44           N  
ATOM   3820  C8   DA J -33      49.429 143.054  31.233  1.00 74.36           C  
ATOM   3821  N7   DA J -33      49.160 142.503  32.390  1.00 73.99           N  
ATOM   3822  C5   DA J -33      49.145 141.144  32.115  1.00 73.63           C  
ATOM   3823  C6   DA J -33      48.916 140.021  32.926  1.00 73.63           C  
ATOM   3824  N6   DA J -33      48.660 140.093  34.233  1.00 74.54           N  
ATOM   3825  N1   DA J -33      48.964 138.805  32.344  1.00 72.68           N  
ATOM   3826  C2   DA J -33      49.230 138.735  31.037  1.00 73.39           C  
ATOM   3827  N3   DA J -33      49.466 139.717  30.169  1.00 74.80           N  
ATOM   3828  C4   DA J -33      49.408 140.912  30.779  1.00 73.82           C  
ATOM   3829  P    DA J -32      48.907 144.426  25.448  1.00 80.86           P  
ATOM   3830  OP1  DA J -32      49.167 144.795  24.033  1.00 80.99           O  
ATOM   3831  OP2  DA J -32      48.318 145.428  26.373  1.00 80.45           O  
ATOM   3832  O5'  DA J -32      47.984 143.133  25.466  1.00 80.91           O  
ATOM   3833  C5'  DA J -32      48.521 141.873  25.089  1.00 84.57           C  
ATOM   3834  C4'  DA J -32      47.540 140.772  25.406  1.00 86.73           C  
ATOM   3835  O4'  DA J -32      47.490 140.532  26.833  1.00 86.93           O  
ATOM   3836  C3'  DA J -32      46.106 141.067  24.973  1.00 88.36           C  
ATOM   3837  O3'  DA J -32      45.524 139.863  24.479  1.00 91.11           O  
ATOM   3838  C2'  DA J -32      45.434 141.484  26.270  1.00 87.29           C  
ATOM   3839  C1'  DA J -32      46.146 140.598  27.276  1.00 87.01           C  
ATOM   3840  N9   DA J -32      46.153 141.086  28.654  1.00 86.77           N  
ATOM   3841  C8   DA J -32      46.523 142.324  29.113  1.00 87.19           C  
ATOM   3842  N7   DA J -32      46.444 142.452  30.415  1.00 87.17           N  
ATOM   3843  C5   DA J -32      45.986 141.214  30.843  1.00 87.12           C  
ATOM   3844  C6   DA J -32      45.698 140.701  32.121  1.00 87.27           C  
ATOM   3845  N6   DA J -32      45.842 141.401  33.251  1.00 86.81           N  
ATOM   3846  N1   DA J -32      45.253 139.428  32.200  1.00 86.97           N  
ATOM   3847  C2   DA J -32      45.113 138.727  31.068  1.00 86.78           C  
ATOM   3848  N3   DA J -32      45.355 139.097  29.813  1.00 86.78           N  
ATOM   3849  C4   DA J -32      45.795 140.366  29.768  1.00 86.83           C  
ATOM   3850  P    DA J -31      44.286 139.928  23.463  1.00 93.06           P  
ATOM   3851  OP1  DA J -31      44.809 139.727  22.086  1.00 93.55           O  
ATOM   3852  OP2  DA J -31      43.492 141.145  23.779  1.00 92.98           O  
ATOM   3853  O5'  DA J -31      43.434 138.655  23.891  1.00 93.25           O  
ATOM   3854  C5'  DA J -31      43.509 138.181  25.231  1.00 94.69           C  
ATOM   3855  C4'  DA J -31      42.127 137.924  25.778  1.00 95.43           C  
ATOM   3856  O4'  DA J -31      42.162 138.216  27.197  1.00 94.56           O  
ATOM   3857  C3'  DA J -31      41.045 138.832  25.196  1.00 96.37           C  
ATOM   3858  O3'  DA J -31      39.802 138.126  25.169  1.00 98.64           O  
ATOM   3859  C2'  DA J -31      40.981 139.976  26.186  1.00 95.41           C  
ATOM   3860  C1'  DA J -31      41.274 139.282  27.502  1.00 95.03           C  
ATOM   3861  N9   DA J -31      41.925 140.152  28.482  1.00 95.24           N  
ATOM   3862  C8   DA J -31      42.795 141.185  28.232  1.00 94.91           C  
ATOM   3863  N7   DA J -31      43.193 141.814  29.310  1.00 94.49           N  
ATOM   3864  C5   DA J -31      42.547 141.148  30.341  1.00 94.00           C  
ATOM   3865  C6   DA J -31      42.545 141.339  31.729  1.00 93.15           C  
ATOM   3866  N6   DA J -31      43.236 142.300  32.342  1.00 93.21           N  
ATOM   3867  N1   DA J -31      41.797 140.502  32.478  1.00 92.98           N  
ATOM   3868  C2   DA J -31      41.098 139.544  31.860  1.00 93.89           C  
ATOM   3869  N3   DA J -31      41.014 139.267  30.562  1.00 94.65           N  
ATOM   3870  C4   DA J -31      41.772 140.115  29.848  1.00 94.61           C  
ATOM   3871  P    DC J -30      38.542 138.745  24.387  1.00100.06           P  
ATOM   3872  OP1  DC J -30      38.508 138.165  23.022  1.00100.48           O  
ATOM   3873  OP2  DC J -30      38.561 140.222  24.556  1.00100.59           O  
ATOM   3874  O5'  DC J -30      37.302 138.178  25.205  1.00 99.71           O  
ATOM   3875  C5'  DC J -30      37.326 136.853  25.730  1.00 98.89           C  
ATOM   3876  C4'  DC J -30      36.681 136.820  27.096  1.00 98.69           C  
ATOM   3877  O4'  DC J -30      37.518 137.517  28.054  1.00 98.83           O  
ATOM   3878  C3'  DC J -30      35.309 137.492  27.161  1.00 97.78           C  
ATOM   3879  O3'  DC J -30      34.418 136.730  27.979  1.00 97.09           O  
ATOM   3880  C2'  DC J -30      35.604 138.836  27.802  1.00 97.62           C  
ATOM   3881  C1'  DC J -30      36.753 138.503  28.733  1.00 98.02           C  
ATOM   3882  N1   DC J -30      37.629 139.650  29.025  1.00 97.94           N  
ATOM   3883  C2   DC J -30      37.917 139.961  30.360  1.00 97.54           C  
ATOM   3884  O2   DC J -30      37.454 139.245  31.257  1.00 97.34           O  
ATOM   3885  N3   DC J -30      38.690 141.033  30.636  1.00 98.08           N  
ATOM   3886  C4   DC J -30      39.174 141.781  29.642  1.00 98.33           C  
ATOM   3887  N4   DC J -30      39.922 142.839  29.964  1.00 98.84           N  
ATOM   3888  C5   DC J -30      38.911 141.478  28.275  1.00 98.38           C  
ATOM   3889  C6   DC J -30      38.144 140.412  28.015  1.00 98.55           C  
ATOM   3890  P    DT J -29      33.091 137.420  28.567  1.00 96.49           P  
ATOM   3891  OP1  DT J -29      32.157 136.353  29.004  1.00 97.03           O  
ATOM   3892  OP2  DT J -29      32.631 138.448  27.600  1.00 96.10           O  
ATOM   3893  O5'  DT J -29      33.623 138.167  29.865  1.00 95.54           O  
ATOM   3894  C5'  DT J -29      34.101 137.421  30.979  1.00 93.55           C  
ATOM   3895  C4'  DT J -29      33.771 138.148  32.258  1.00 92.45           C  
ATOM   3896  O4'  DT J -29      34.711 139.230  32.467  1.00 92.06           O  
ATOM   3897  C3'  DT J -29      32.382 138.785  32.239  1.00 91.38           C  
ATOM   3898  O3'  DT J -29      31.754 138.643  33.510  1.00 89.71           O  
ATOM   3899  C2'  DT J -29      32.668 140.248  31.950  1.00 91.21           C  
ATOM   3900  C1'  DT J -29      34.008 140.451  32.634  1.00 91.64           C  
ATOM   3901  N1   DT J -29      34.836 141.534  32.071  1.00 91.04           N  
ATOM   3902  C2   DT J -29      35.463 142.394  32.946  1.00 90.48           C  
ATOM   3903  O2   DT J -29      35.363 142.304  34.160  1.00 89.15           O  
ATOM   3904  N3   DT J -29      36.217 143.372  32.344  1.00 90.17           N  
ATOM   3905  C4   DT J -29      36.398 143.571  30.988  1.00 90.25           C  
ATOM   3906  O4   DT J -29      37.106 144.494  30.593  1.00 89.33           O  
ATOM   3907  C5   DT J -29      35.707 142.633  30.130  1.00 90.21           C  
ATOM   3908  C7   DT J -29      35.839 142.773  28.646  1.00 90.33           C  
ATOM   3909  C6   DT J -29      34.973 141.675  30.707  1.00 90.61           C  
ATOM   3910  P    DG J -28      30.180 138.915  33.652  1.00 89.58           P  
ATOM   3911  OP1  DG J -28      29.495 137.612  33.849  1.00 90.70           O  
ATOM   3912  OP2  DG J -28      29.762 139.805  32.539  1.00 90.10           O  
ATOM   3913  O5'  DG J -28      30.080 139.733  35.010  1.00 86.95           O  
ATOM   3914  C5'  DG J -28      30.808 139.313  36.157  1.00 83.57           C  
ATOM   3915  C4'  DG J -28      30.937 140.457  37.131  1.00 81.35           C  
ATOM   3916  O4'  DG J -28      31.805 141.468  36.564  1.00 80.42           O  
ATOM   3917  C3'  DG J -28      29.610 141.151  37.428  1.00 80.03           C  
ATOM   3918  O3'  DG J -28      29.541 141.503  38.806  1.00 78.02           O  
ATOM   3919  C2'  DG J -28      29.648 142.390  36.552  1.00 79.96           C  
ATOM   3920  C1'  DG J -28      31.131 142.714  36.498  1.00 81.06           C  
ATOM   3921  N9   DG J -28      31.555 143.386  35.272  1.00 81.76           N  
ATOM   3922  C8   DG J -28      31.119 143.133  33.993  1.00 82.36           C  
ATOM   3923  N7   DG J -28      31.674 143.906  33.100  1.00 81.76           N  
ATOM   3924  C5   DG J -28      32.530 144.717  33.830  1.00 80.31           C  
ATOM   3925  C6   DG J -28      33.395 145.754  33.405  1.00 79.74           C  
ATOM   3926  O6   DG J -28      33.584 146.178  32.260  1.00 78.94           O  
ATOM   3927  N1   DG J -28      34.083 146.315  34.474  1.00 80.28           N  
ATOM   3928  C2   DG J -28      33.956 145.928  35.785  1.00 81.38           C  
ATOM   3929  N2   DG J -28      34.712 146.589  36.674  1.00 82.13           N  
ATOM   3930  N3   DG J -28      33.150 144.965  36.196  1.00 81.36           N  
ATOM   3931  C4   DG J -28      32.471 144.407  35.173  1.00 81.15           C  
ATOM   3932  P    DC J -27      28.124 141.873  39.457  1.00 77.30           P  
ATOM   3933  OP1  DC J -27      27.983 141.048  40.686  1.00 76.50           O  
ATOM   3934  OP2  DC J -27      27.083 141.805  38.400  1.00 76.59           O  
ATOM   3935  O5'  DC J -27      28.304 143.397  39.880  1.00 74.86           O  
ATOM   3936  C5'  DC J -27      29.461 143.814  40.600  1.00 72.07           C  
ATOM   3937  C4'  DC J -27      29.706 145.290  40.394  1.00 70.48           C  
ATOM   3938  O4'  DC J -27      30.169 145.548  39.046  1.00 69.46           O  
ATOM   3939  C3'  DC J -27      28.477 146.178  40.599  1.00 71.08           C  
ATOM   3940  O3'  DC J -27      28.867 147.364  41.282  1.00 72.15           O  
ATOM   3941  C2'  DC J -27      28.067 146.540  39.184  1.00 70.06           C  
ATOM   3942  C1'  DC J -27      29.419 146.624  38.508  1.00 69.36           C  
ATOM   3943  N1   DC J -27      29.411 146.503  37.042  1.00 68.04           N  
ATOM   3944  C2   DC J -27      30.253 147.336  36.301  1.00 67.70           C  
ATOM   3945  O2   DC J -27      30.981 148.137  36.904  1.00 67.27           O  
ATOM   3946  N3   DC J -27      30.252 147.248  34.952  1.00 66.75           N  
ATOM   3947  C4   DC J -27      29.452 146.371  34.343  1.00 66.19           C  
ATOM   3948  N4   DC J -27      29.482 146.318  33.011  1.00 65.72           N  
ATOM   3949  C5   DC J -27      28.586 145.509  35.075  1.00 66.93           C  
ATOM   3950  C6   DC J -27      28.599 145.606  36.410  1.00 67.26           C  
ATOM   3951  P    DG J -26      28.461 147.563  42.819  1.00 74.58           P  
ATOM   3952  OP1  DG J -26      28.789 146.295  43.526  1.00 73.80           O  
ATOM   3953  OP2  DG J -26      27.079 148.107  42.878  1.00 74.65           O  
ATOM   3954  O5'  DG J -26      29.472 148.682  43.324  1.00 73.54           O  
ATOM   3955  C5'  DG J -26      30.875 148.438  43.328  1.00 71.79           C  
ATOM   3956  C4'  DG J -26      31.610 149.610  42.722  1.00 69.77           C  
ATOM   3957  O4'  DG J -26      31.383 149.666  41.293  1.00 70.41           O  
ATOM   3958  C3'  DG J -26      31.184 150.969  43.271  1.00 68.09           C  
ATOM   3959  O3'  DG J -26      32.336 151.796  43.414  1.00 66.21           O  
ATOM   3960  C2'  DG J -26      30.268 151.515  42.192  1.00 68.94           C  
ATOM   3961  C1'  DG J -26      30.886 150.947  40.930  1.00 70.89           C  
ATOM   3962  N9   DG J -26      29.955 150.765  39.820  1.00 72.43           N  
ATOM   3963  C8   DG J -26      28.748 150.111  39.852  1.00 72.57           C  
ATOM   3964  N7   DG J -26      28.151 150.080  38.692  1.00 73.37           N  
ATOM   3965  C5   DG J -26      29.012 150.761  37.842  1.00 73.10           C  
ATOM   3966  C6   DG J -26      28.902 151.043  36.454  1.00 73.46           C  
ATOM   3967  O6   DG J -26      28.001 150.728  35.672  1.00 73.85           O  
ATOM   3968  N1   DG J -26      29.994 151.767  35.993  1.00 74.36           N  
ATOM   3969  C2   DG J -26      31.058 152.166  36.760  1.00 73.63           C  
ATOM   3970  N2   DG J -26      32.009 152.865  36.124  1.00 73.62           N  
ATOM   3971  N3   DG J -26      31.180 151.901  38.052  1.00 72.99           N  
ATOM   3972  C4   DG J -26      30.126 151.200  38.524  1.00 72.90           C  
ATOM   3973  P    DC J -25      32.245 153.141  44.276  1.00 64.91           P  
ATOM   3974  OP1  DC J -25      33.585 153.321  44.885  1.00 64.45           O  
ATOM   3975  OP2  DC J -25      31.042 153.098  45.146  1.00 64.52           O  
ATOM   3976  O5'  DC J -25      32.014 154.264  43.171  1.00 64.86           O  
ATOM   3977  C5'  DC J -25      32.837 154.311  42.009  1.00 63.43           C  
ATOM   3978  C4'  DC J -25      32.192 155.157  40.936  1.00 63.59           C  
ATOM   3979  O4'  DC J -25      31.081 154.461  40.319  1.00 63.76           O  
ATOM   3980  C3'  DC J -25      31.641 156.503  41.413  1.00 62.85           C  
ATOM   3981  O3'  DC J -25      31.931 157.501  40.436  1.00 61.15           O  
ATOM   3982  C2'  DC J -25      30.142 156.276  41.416  1.00 63.75           C  
ATOM   3983  C1'  DC J -25      30.000 155.367  40.214  1.00 65.73           C  
ATOM   3984  N1   DC J -25      28.746 154.599  40.140  1.00 69.37           N  
ATOM   3985  C2   DC J -25      28.031 154.603  38.936  1.00 70.50           C  
ATOM   3986  O2   DC J -25      28.492 155.230  37.966  1.00 70.70           O  
ATOM   3987  N3   DC J -25      26.863 153.926  38.859  1.00 71.48           N  
ATOM   3988  C4   DC J -25      26.407 153.259  39.922  1.00 72.02           C  
ATOM   3989  N4   DC J -25      25.242 152.610  39.804  1.00 72.30           N  
ATOM   3990  C5   DC J -25      27.122 153.227  41.155  1.00 71.85           C  
ATOM   3991  C6   DC J -25      28.276 153.905  41.219  1.00 70.86           C  
ATOM   3992  P    DT J -24      32.975 158.674  40.772  1.00 58.69           P  
ATOM   3993  OP1  DT J -24      34.265 158.024  41.121  1.00 55.73           O  
ATOM   3994  OP2  DT J -24      32.359 159.640  41.715  1.00 58.62           O  
ATOM   3995  O5'  DT J -24      33.134 159.399  39.369  1.00 55.49           O  
ATOM   3996  C5'  DT J -24      33.559 158.667  38.229  1.00 53.34           C  
ATOM   3997  C4'  DT J -24      32.808 159.135  37.009  1.00 51.65           C  
ATOM   3998  O4'  DT J -24      31.544 158.441  36.871  1.00 52.08           O  
ATOM   3999  C3'  DT J -24      32.480 160.625  37.038  1.00 51.40           C  
ATOM   4000  O3'  DT J -24      32.757 161.213  35.771  1.00 47.53           O  
ATOM   4001  C2'  DT J -24      30.990 160.659  37.327  1.00 52.23           C  
ATOM   4002  C1'  DT J -24      30.509 159.385  36.664  1.00 53.75           C  
ATOM   4003  N1   DT J -24      29.260 158.828  37.225  1.00 55.98           N  
ATOM   4004  C2   DT J -24      28.341 158.286  36.347  1.00 58.38           C  
ATOM   4005  O2   DT J -24      28.503 158.266  35.134  1.00 59.04           O  
ATOM   4006  N3   DT J -24      27.218 157.771  36.943  1.00 57.93           N  
ATOM   4007  C4   DT J -24      26.923 157.752  38.293  1.00 58.09           C  
ATOM   4008  O4   DT J -24      25.878 157.235  38.683  1.00 59.43           O  
ATOM   4009  C5   DT J -24      27.918 158.359  39.152  1.00 55.85           C  
ATOM   4010  C7   DT J -24      27.665 158.417  40.625  1.00 53.51           C  
ATOM   4011  C6   DT J -24      29.025 158.851  38.583  1.00 54.20           C  
ATOM   4012  P    DA J -23      32.472 162.769  35.547  1.00 45.03           P  
ATOM   4013  OP1  DA J -23      33.690 163.364  34.946  1.00 46.05           O  
ATOM   4014  OP2  DA J -23      31.921 163.341  36.793  1.00 47.45           O  
ATOM   4015  O5'  DA J -23      31.320 162.738  34.458  1.00 47.07           O  
ATOM   4016  C5'  DA J -23      31.401 161.824  33.370  1.00 48.14           C  
ATOM   4017  C4'  DA J -23      30.103 161.810  32.602  1.00 51.31           C  
ATOM   4018  O4'  DA J -23      29.097 161.055  33.318  1.00 53.64           O  
ATOM   4019  C3'  DA J -23      29.512 163.194  32.355  1.00 52.28           C  
ATOM   4020  O3'  DA J -23      29.091 163.291  31.004  1.00 52.73           O  
ATOM   4021  C2'  DA J -23      28.338 163.269  33.317  1.00 53.43           C  
ATOM   4022  C1'  DA J -23      27.912 161.818  33.457  1.00 54.42           C  
ATOM   4023  N9   DA J -23      27.322 161.475  34.751  1.00 57.28           N  
ATOM   4024  C8   DA J -23      27.771 161.834  35.997  1.00 59.22           C  
ATOM   4025  N7   DA J -23      27.046 161.359  36.981  1.00 59.59           N  
ATOM   4026  C5   DA J -23      26.048 160.640  36.340  1.00 61.22           C  
ATOM   4027  C6   DA J -23      24.962 159.894  36.827  1.00 61.89           C  
ATOM   4028  N6   DA J -23      24.695 159.741  38.127  1.00 63.35           N  
ATOM   4029  N1   DA J -23      24.151 159.301  35.923  1.00 59.75           N  
ATOM   4030  C2   DA J -23      24.423 159.454  34.624  1.00 59.52           C  
ATOM   4031  N3   DA J -23      25.412 160.131  34.042  1.00 60.17           N  
ATOM   4032  C4   DA J -23      26.201 160.708  34.966  1.00 60.41           C  
ATOM   4033  P    DT J -22      28.404 164.636  30.488  1.00 56.37           P  
ATOM   4034  OP1  DT J -22      28.719 164.755  29.042  1.00 55.94           O  
ATOM   4035  OP2  DT J -22      28.745 165.747  31.408  1.00 57.30           O  
ATOM   4036  O5'  DT J -22      26.859 164.309  30.652  1.00 58.29           O  
ATOM   4037  C5'  DT J -22      26.337 163.080  30.158  1.00 61.68           C  
ATOM   4038  C4'  DT J -22      24.841 163.040  30.346  1.00 63.75           C  
ATOM   4039  O4'  DT J -22      24.485 162.517  31.648  1.00 62.46           O  
ATOM   4040  C3'  DT J -22      24.184 164.413  30.236  1.00 65.26           C  
ATOM   4041  O3'  DT J -22      23.025 164.329  29.421  1.00 67.11           O  
ATOM   4042  C2'  DT J -22      23.807 164.745  31.670  1.00 63.46           C  
ATOM   4043  C1'  DT J -22      23.537 163.373  32.251  1.00 61.74           C  
ATOM   4044  N1   DT J -22      23.688 163.259  33.712  1.00 62.95           N  
ATOM   4045  C2   DT J -22      22.999 162.252  34.338  1.00 63.84           C  
ATOM   4046  O2   DT J -22      22.300 161.456  33.739  1.00 66.01           O  
ATOM   4047  N3   DT J -22      23.159 162.204  35.699  1.00 64.47           N  
ATOM   4048  C4   DT J -22      23.928 163.045  36.479  1.00 64.33           C  
ATOM   4049  O4   DT J -22      23.971 162.879  37.695  1.00 64.48           O  
ATOM   4050  C5   DT J -22      24.637 164.079  35.755  1.00 63.74           C  
ATOM   4051  C7   DT J -22      25.500 165.038  36.515  1.00 62.54           C  
ATOM   4052  C6   DT J -22      24.484 164.132  34.424  1.00 63.93           C  
ATOM   4053  P    DC J -21      22.310 165.673  28.928  1.00 71.00           P  
ATOM   4054  OP1  DC J -21      22.442 165.749  27.451  1.00 70.50           O  
ATOM   4055  OP2  DC J -21      22.772 166.809  29.769  1.00 69.27           O  
ATOM   4056  O5'  DC J -21      20.791 165.380  29.273  1.00 75.41           O  
ATOM   4057  C5'  DC J -21      20.225 164.104  29.000  1.00 81.22           C  
ATOM   4058  C4'  DC J -21      18.886 163.993  29.680  1.00 85.03           C  
ATOM   4059  O4'  DC J -21      19.060 163.622  31.069  1.00 86.00           O  
ATOM   4060  C3'  DC J -21      18.152 165.331  29.680  1.00 88.13           C  
ATOM   4061  O3'  DC J -21      16.781 165.166  29.339  1.00 92.66           O  
ATOM   4062  C2'  DC J -21      18.314 165.836  31.104  1.00 87.23           C  
ATOM   4063  C1'  DC J -21      18.383 164.548  31.902  1.00 85.66           C  
ATOM   4064  N1   DC J -21      19.120 164.639  33.177  1.00 84.21           N  
ATOM   4065  C2   DC J -21      18.959 163.615  34.120  1.00 83.72           C  
ATOM   4066  O2   DC J -21      18.220 162.655  33.846  1.00 82.92           O  
ATOM   4067  N3   DC J -21      19.613 163.697  35.303  1.00 82.96           N  
ATOM   4068  C4   DC J -21      20.403 164.743  35.558  1.00 82.47           C  
ATOM   4069  N4   DC J -21      21.022 164.785  36.740  1.00 81.78           N  
ATOM   4070  C5   DC J -21      20.593 165.793  34.612  1.00 82.01           C  
ATOM   4071  C6   DC J -21      19.939 165.701  33.446  1.00 82.98           C  
ATOM   4072  P    DA J -20      15.889 166.463  29.050  1.00 95.99           P  
ATOM   4073  OP1  DA J -20      14.814 166.069  28.102  1.00 96.37           O  
ATOM   4074  OP2  DA J -20      16.797 167.591  28.707  1.00 94.80           O  
ATOM   4075  O5'  DA J -20      15.227 166.754  30.466  1.00 96.14           O  
ATOM   4076  C5'  DA J -20      14.217 165.892  30.979  1.00 97.87           C  
ATOM   4077  C4'  DA J -20      13.452 166.594  32.072  1.00 98.96           C  
ATOM   4078  O4'  DA J -20      14.220 166.578  33.298  1.00 98.67           O  
ATOM   4079  C3'  DA J -20      13.172 168.065  31.762  1.00100.17           C  
ATOM   4080  O3'  DA J -20      11.875 168.425  32.233  1.00102.73           O  
ATOM   4081  C2'  DA J -20      14.243 168.794  32.552  1.00 99.20           C  
ATOM   4082  C1'  DA J -20      14.388 167.903  33.772  1.00 98.14           C  
ATOM   4083  N9   DA J -20      15.682 167.982  34.450  1.00 96.83           N  
ATOM   4084  C8   DA J -20      16.882 168.425  33.951  1.00 95.67           C  
ATOM   4085  N7   DA J -20      17.862 168.385  34.820  1.00 95.13           N  
ATOM   4086  C5   DA J -20      17.269 167.878  35.969  1.00 94.84           C  
ATOM   4087  C6   DA J -20      17.774 167.596  37.250  1.00 94.57           C  
ATOM   4088  N6   DA J -20      19.045 167.796  37.608  1.00 93.96           N  
ATOM   4089  N1   DA J -20      16.917 167.096  38.167  1.00 95.12           N  
ATOM   4090  C2   DA J -20      15.643 166.898  37.810  1.00 95.13           C  
ATOM   4091  N3   DA J -20      15.051 167.126  36.641  1.00 95.28           N  
ATOM   4092  C4   DA J -20      15.929 167.622  35.753  1.00 95.51           C  
ATOM   4093  P    DA J -19      11.213 169.813  31.765  1.00104.99           P  
ATOM   4094  OP1  DA J -19      10.133 169.487  30.799  1.00105.50           O  
ATOM   4095  OP2  DA J -19      12.284 170.768  31.377  1.00104.48           O  
ATOM   4096  O5'  DA J -19      10.528 170.336  33.100  1.00104.99           O  
ATOM   4097  C5'  DA J -19       9.923 169.415  33.999  1.00105.78           C  
ATOM   4098  C4'  DA J -19      10.116 169.875  35.422  1.00106.55           C  
ATOM   4099  O4'  DA J -19      11.513 169.769  35.791  1.00106.66           O  
ATOM   4100  C3'  DA J -19       9.721 171.332  35.661  1.00107.32           C  
ATOM   4101  O3'  DA J -19       9.071 171.448  36.925  1.00107.81           O  
ATOM   4102  C2'  DA J -19      11.055 172.057  35.691  1.00107.28           C  
ATOM   4103  C1'  DA J -19      11.960 171.011  36.311  1.00107.17           C  
ATOM   4104  N9   DA J -19      13.379 171.155  35.988  1.00107.46           N  
ATOM   4105  C8   DA J -19      13.964 171.246  34.749  1.00107.66           C  
ATOM   4106  N7   DA J -19      15.270 171.359  34.788  1.00107.78           N  
ATOM   4107  C5   DA J -19      15.565 171.345  36.144  1.00107.41           C  
ATOM   4108  C6   DA J -19      16.778 171.428  36.849  1.00107.40           C  
ATOM   4109  N6   DA J -19      17.970 171.543  36.258  1.00107.58           N  
ATOM   4110  N1   DA J -19      16.725 171.386  38.198  1.00107.39           N  
ATOM   4111  C2   DA J -19      15.529 171.267  38.788  1.00107.09           C  
ATOM   4112  N3   DA J -19      14.322 171.180  38.236  1.00106.77           N  
ATOM   4113  C4   DA J -19      14.410 171.224  36.895  1.00107.21           C  
ATOM   4114  P    DA J -18       7.995 172.613  37.166  1.00107.82           P  
ATOM   4115  OP1  DA J -18       6.645 172.049  36.911  1.00107.54           O  
ATOM   4116  OP2  DA J -18       8.437 173.826  36.429  1.00107.63           O  
ATOM   4117  O5'  DA J -18       8.139 172.897  38.723  1.00106.87           O  
ATOM   4118  C5'  DA J -18       9.427 172.898  39.327  1.00105.02           C  
ATOM   4119  C4'  DA J -18       9.479 173.914  40.441  1.00104.18           C  
ATOM   4120  O4'  DA J -18      10.833 173.951  40.950  1.00103.72           O  
ATOM   4121  C3'  DA J -18       9.154 175.340  40.000  1.00103.10           C  
ATOM   4122  O3'  DA J -18       8.399 176.005  41.022  1.00101.74           O  
ATOM   4123  C2'  DA J -18      10.517 175.954  39.736  1.00102.48           C  
ATOM   4124  C1'  DA J -18      11.450 175.201  40.670  1.00102.51           C  
ATOM   4125  N9   DA J -18      12.750 174.925  40.057  1.00101.63           N  
ATOM   4126  C8   DA J -18      13.042 174.897  38.714  1.00101.05           C  
ATOM   4127  N7   DA J -18      14.299 174.640  38.451  1.00100.60           N  
ATOM   4128  C5   DA J -18      14.876 174.487  39.703  1.00100.42           C  
ATOM   4129  C6   DA J -18      16.192 174.207  40.108  1.00 99.51           C  
ATOM   4130  N6   DA J -18      17.205 174.034  39.258  1.00 98.21           N  
ATOM   4131  N1   DA J -18      16.434 174.110  41.432  1.00100.10           N  
ATOM   4132  C2   DA J -18      15.416 174.291  42.285  1.00100.46           C  
ATOM   4133  N3   DA J -18      14.139 174.566  42.028  1.00100.81           N  
ATOM   4134  C4   DA J -18      13.932 174.652  40.702  1.00101.07           C  
ATOM   4135  P    DG J -17       8.651 177.562  41.338  1.00101.53           P  
ATOM   4136  OP1  DG J -17       7.374 178.101  41.880  1.00101.52           O  
ATOM   4137  OP2  DG J -17       9.297 178.237  40.179  1.00100.66           O  
ATOM   4138  O5'  DG J -17       9.694 177.496  42.537  1.00 98.97           O  
ATOM   4139  C5'  DG J -17       9.677 176.389  43.434  1.00 95.83           C  
ATOM   4140  C4'  DG J -17      10.755 176.543  44.478  1.00 93.78           C  
ATOM   4141  O4'  DG J -17      12.055 176.454  43.848  1.00 92.37           O  
ATOM   4142  C3'  DG J -17      10.727 177.883  45.207  1.00 92.76           C  
ATOM   4143  O3'  DG J -17      11.062 177.689  46.582  1.00 91.64           O  
ATOM   4144  C2'  DG J -17      11.780 178.704  44.485  1.00 91.88           C  
ATOM   4145  C1'  DG J -17      12.787 177.657  44.037  1.00 91.13           C  
ATOM   4146  N9   DG J -17      13.447 177.971  42.773  1.00 89.72           N  
ATOM   4147  C8   DG J -17      12.871 178.529  41.656  1.00 88.81           C  
ATOM   4148  N7   DG J -17      13.710 178.681  40.668  1.00 87.37           N  
ATOM   4149  C5   DG J -17      14.914 178.199  41.163  1.00 87.44           C  
ATOM   4150  C6   DG J -17      16.188 178.105  40.547  1.00 86.62           C  
ATOM   4151  O6   DG J -17      16.517 178.443  39.403  1.00 85.60           O  
ATOM   4152  N1   DG J -17      17.131 177.550  41.406  1.00 86.61           N  
ATOM   4153  C2   DG J -17      16.884 177.139  42.693  1.00 87.21           C  
ATOM   4154  N2   DG J -17      17.927 176.624  43.361  1.00 86.04           N  
ATOM   4155  N3   DG J -17      15.701 177.225  43.280  1.00 88.11           N  
ATOM   4156  C4   DG J -17      14.769 177.759  42.462  1.00 88.38           C  
ATOM   4157  P    DG J -16      11.068 178.944  47.581  1.00 91.71           P  
ATOM   4158  OP1  DG J -16      10.536 178.482  48.892  1.00 91.56           O  
ATOM   4159  OP2  DG J -16      10.441 180.107  46.898  1.00 90.39           O  
ATOM   4160  O5'  DG J -16      12.617 179.246  47.765  1.00 89.00           O  
ATOM   4161  C5'  DG J -16      13.502 178.226  48.214  1.00 84.96           C  
ATOM   4162  C4'  DG J -16      14.904 178.773  48.330  1.00 81.76           C  
ATOM   4163  O4'  DG J -16      15.429 179.057  47.012  1.00 80.01           O  
ATOM   4164  C3'  DG J -16      14.992 180.083  49.108  1.00 80.23           C  
ATOM   4165  O3'  DG J -16      16.212 180.106  49.837  1.00 79.45           O  
ATOM   4166  C2'  DG J -16      15.023 181.135  48.015  1.00 79.52           C  
ATOM   4167  C1'  DG J -16      15.801 180.424  46.923  1.00 78.72           C  
ATOM   4168  N9   DG J -16      15.506 180.876  45.568  1.00 77.55           N  
ATOM   4169  C8   DG J -16      14.375 181.522  45.131  1.00 76.50           C  
ATOM   4170  N7   DG J -16      14.402 181.790  43.853  1.00 76.70           N  
ATOM   4171  C5   DG J -16      15.624 181.293  43.423  1.00 75.96           C  
ATOM   4172  C6   DG J -16      16.210 181.288  42.134  1.00 75.32           C  
ATOM   4173  O6   DG J -16      15.753 181.733  41.077  1.00 74.28           O  
ATOM   4174  N1   DG J -16      17.462 180.681  42.145  1.00 75.63           N  
ATOM   4175  C2   DG J -16      18.070 180.146  43.253  1.00 75.91           C  
ATOM   4176  N2   DG J -16      19.279 179.600  43.061  1.00 76.88           N  
ATOM   4177  N3   DG J -16      17.534 180.143  44.459  1.00 76.64           N  
ATOM   4178  C4   DG J -16      16.318 180.729  44.471  1.00 76.99           C  
ATOM   4179  P    DG J -15      16.431 181.191  50.993  1.00 79.61           P  
ATOM   4180  OP1  DG J -15      15.884 180.617  52.248  1.00 80.66           O  
ATOM   4181  OP2  DG J -15      15.956 182.518  50.517  1.00 79.26           O  
ATOM   4182  O5'  DG J -15      18.011 181.242  51.119  1.00 77.63           O  
ATOM   4183  C5'  DG J -15      18.807 180.234  50.507  1.00 74.22           C  
ATOM   4184  C4'  DG J -15      19.703 180.847  49.458  1.00 71.53           C  
ATOM   4185  O4'  DG J -15      18.955 181.226  48.272  1.00 71.86           O  
ATOM   4186  C3'  DG J -15      20.419 182.114  49.922  1.00 69.71           C  
ATOM   4187  O3'  DG J -15      21.747 182.103  49.421  1.00 65.46           O  
ATOM   4188  C2'  DG J -15      19.649 183.223  49.229  1.00 70.18           C  
ATOM   4189  C1'  DG J -15      19.335 182.546  47.915  1.00 70.58           C  
ATOM   4190  N9   DG J -15      18.264 183.149  47.131  1.00 69.01           N  
ATOM   4191  C8   DG J -15      17.064 183.628  47.588  1.00 70.39           C  
ATOM   4192  N7   DG J -15      16.313 184.119  46.640  1.00 70.94           N  
ATOM   4193  C5   DG J -15      17.065 183.952  45.485  1.00 70.41           C  
ATOM   4194  C6   DG J -15      16.770 184.289  44.135  1.00 71.53           C  
ATOM   4195  O6   DG J -15      15.749 184.820  43.675  1.00 72.06           O  
ATOM   4196  N1   DG J -15      17.814 183.943  43.283  1.00 71.20           N  
ATOM   4197  C2   DG J -15      18.987 183.347  43.674  1.00 70.15           C  
ATOM   4198  N2   DG J -15      19.871 183.088  42.698  1.00 69.15           N  
ATOM   4199  N3   DG J -15      19.272 183.027  44.927  1.00 69.21           N  
ATOM   4200  C4   DG J -15      18.273 183.356  45.772  1.00 69.09           C  
ATOM   4201  P    DA J -14      22.882 182.930  50.181  1.00 64.13           P  
ATOM   4202  OP1  DA J -14      23.338 182.107  51.326  1.00 63.44           O  
ATOM   4203  OP2  DA J -14      22.403 184.318  50.411  1.00 61.69           O  
ATOM   4204  O5'  DA J -14      24.052 182.970  49.111  1.00 63.65           O  
ATOM   4205  C5'  DA J -14      24.274 181.863  48.250  1.00 60.74           C  
ATOM   4206  C4'  DA J -14      24.642 182.356  46.874  1.00 59.60           C  
ATOM   4207  O4'  DA J -14      23.474 182.897  46.209  1.00 59.76           O  
ATOM   4208  C3'  DA J -14      25.677 183.479  46.890  1.00 59.08           C  
ATOM   4209  O3'  DA J -14      26.591 183.291  45.812  1.00 55.34           O  
ATOM   4210  C2'  DA J -14      24.839 184.732  46.692  1.00 58.87           C  
ATOM   4211  C1'  DA J -14      23.728 184.228  45.793  1.00 59.47           C  
ATOM   4212  N9   DA J -14      22.472 184.973  45.882  1.00 60.64           N  
ATOM   4213  C8   DA J -14      21.728 185.252  47.004  1.00 59.59           C  
ATOM   4214  N7   DA J -14      20.634 185.931  46.756  1.00 58.43           N  
ATOM   4215  C5   DA J -14      20.659 186.114  45.380  1.00 59.00           C  
ATOM   4216  C6   DA J -14      19.776 186.752  44.495  1.00 59.33           C  
ATOM   4217  N6   DA J -14      18.649 187.351  44.881  1.00 60.19           N  
ATOM   4218  N1   DA J -14      20.092 186.755  43.184  1.00 58.89           N  
ATOM   4219  C2   DA J -14      21.220 186.154  42.798  1.00 59.12           C  
ATOM   4220  N3   DA J -14      22.131 185.521  43.531  1.00 59.14           N  
ATOM   4221  C4   DA J -14      21.787 185.535  44.830  1.00 59.47           C  
ATOM   4222  P    DA J -13      27.737 184.373  45.547  1.00 55.51           P  
ATOM   4223  OP1  DA J -13      28.973 183.591  45.252  1.00 56.87           O  
ATOM   4224  OP2  DA J -13      27.735 185.359  46.659  1.00 54.32           O  
ATOM   4225  O5'  DA J -13      27.267 185.089  44.206  1.00 50.14           O  
ATOM   4226  C5'  DA J -13      27.043 184.319  43.031  1.00 48.97           C  
ATOM   4227  C4'  DA J -13      26.685 185.216  41.873  1.00 48.47           C  
ATOM   4228  O4'  DA J -13      25.388 185.809  42.104  1.00 51.84           O  
ATOM   4229  C3'  DA J -13      27.647 186.378  41.637  1.00 49.70           C  
ATOM   4230  O3'  DA J -13      27.817 186.570  40.236  1.00 44.95           O  
ATOM   4231  C2'  DA J -13      26.936 187.565  42.267  1.00 51.02           C  
ATOM   4232  C1'  DA J -13      25.476 187.225  42.033  1.00 53.91           C  
ATOM   4233  N9   DA J -13      24.548 187.777  43.021  1.00 55.58           N  
ATOM   4234  C8   DA J -13      24.597 187.655  44.386  1.00 57.11           C  
ATOM   4235  N7   DA J -13      23.598 188.238  45.006  1.00 57.19           N  
ATOM   4236  C5   DA J -13      22.844 188.786  43.979  1.00 57.30           C  
ATOM   4237  C6   DA J -13      21.649 189.524  43.975  1.00 56.98           C  
ATOM   4238  N6   DA J -13      20.976 189.844  45.081  1.00 56.98           N  
ATOM   4239  N1   DA J -13      21.160 189.924  42.781  1.00 56.25           N  
ATOM   4240  C2   DA J -13      21.832 189.595  41.671  1.00 57.27           C  
ATOM   4241  N3   DA J -13      22.963 188.901  41.545  1.00 58.11           N  
ATOM   4242  C4   DA J -13      23.423 188.520  42.751  1.00 57.46           C  
ATOM   4243  P    DA J -12      28.611 187.848  39.705  1.00 45.04           P  
ATOM   4244  OP1  DA J -12      29.188 187.489  38.383  1.00 43.58           O  
ATOM   4245  OP2  DA J -12      29.493 188.332  40.790  1.00 45.78           O  
ATOM   4246  O5'  DA J -12      27.461 188.926  39.477  1.00 49.23           O  
ATOM   4247  C5'  DA J -12      26.353 188.620  38.635  1.00 52.07           C  
ATOM   4248  C4'  DA J -12      25.519 189.853  38.381  1.00 54.47           C  
ATOM   4249  O4'  DA J -12      24.691 190.146  39.532  1.00 54.34           O  
ATOM   4250  C3'  DA J -12      26.310 191.126  38.078  1.00 56.76           C  
ATOM   4251  O3'  DA J -12      25.715 191.812  36.973  1.00 58.67           O  
ATOM   4252  C2'  DA J -12      26.190 191.934  39.361  1.00 55.23           C  
ATOM   4253  C1'  DA J -12      24.835 191.508  39.897  1.00 54.32           C  
ATOM   4254  N9   DA J -12      24.693 191.589  41.351  1.00 53.31           N  
ATOM   4255  C8   DA J -12      25.563 191.123  42.301  1.00 52.81           C  
ATOM   4256  N7   DA J -12      25.155 191.313  43.531  1.00 51.62           N  
ATOM   4257  C5   DA J -12      23.936 191.955  43.383  1.00 51.61           C  
ATOM   4258  C6   DA J -12      22.998 192.425  44.316  1.00 50.92           C  
ATOM   4259  N6   DA J -12      23.150 192.316  45.637  1.00 49.44           N  
ATOM   4260  N1   DA J -12      21.882 193.016  43.840  1.00 51.31           N  
ATOM   4261  C2   DA J -12      21.731 193.123  42.514  1.00 52.15           C  
ATOM   4262  N3   DA J -12      22.543 192.722  41.537  1.00 52.44           N  
ATOM   4263  C4   DA J -12      23.641 192.138  42.045  1.00 52.58           C  
ATOM   4264  P    DC J -11      26.348 193.194  36.455  1.00 62.11           P  
ATOM   4265  OP1  DC J -11      26.253 193.181  34.975  1.00 63.60           O  
ATOM   4266  OP2  DC J -11      27.668 193.412  37.105  1.00 61.65           O  
ATOM   4267  O5'  DC J -11      25.328 194.286  37.003  1.00 62.54           O  
ATOM   4268  C5'  DC J -11      23.933 194.150  36.763  1.00 62.73           C  
ATOM   4269  C4'  DC J -11      23.169 195.239  37.475  1.00 65.18           C  
ATOM   4270  O4'  DC J -11      23.112 194.975  38.899  1.00 64.57           O  
ATOM   4271  C3'  DC J -11      23.761 196.642  37.323  1.00 66.14           C  
ATOM   4272  O3'  DC J -11      22.713 197.589  37.087  1.00 68.72           O  
ATOM   4273  C2'  DC J -11      24.407 196.895  38.674  1.00 66.02           C  
ATOM   4274  C1'  DC J -11      23.475 196.147  39.606  1.00 65.06           C  
ATOM   4275  N1   DC J -11      24.069 195.748  40.895  1.00 66.23           N  
ATOM   4276  C2   DC J -11      23.374 196.042  42.076  1.00 67.56           C  
ATOM   4277  O2   DC J -11      22.271 196.607  42.001  1.00 69.19           O  
ATOM   4278  N3   DC J -11      23.919 195.700  43.266  1.00 66.81           N  
ATOM   4279  C4   DC J -11      25.101 195.082  43.305  1.00 66.66           C  
ATOM   4280  N4   DC J -11      25.601 194.765  44.503  1.00 65.62           N  
ATOM   4281  C5   DC J -11      25.823 194.761  42.119  1.00 66.19           C  
ATOM   4282  C6   DC J -11      25.276 195.109  40.947  1.00 66.94           C  
ATOM   4283  P    DT J -10      23.058 199.155  36.995  1.00 70.59           P  
ATOM   4284  OP1  DT J -10      22.148 199.740  35.981  1.00 71.68           O  
ATOM   4285  OP2  DT J -10      24.526 199.321  36.841  1.00 71.44           O  
ATOM   4286  O5'  DT J -10      22.629 199.709  38.425  1.00 69.88           O  
ATOM   4287  C5'  DT J -10      21.297 199.522  38.896  1.00 70.51           C  
ATOM   4288  C4'  DT J -10      21.028 200.399  40.098  1.00 70.57           C  
ATOM   4289  O4'  DT J -10      21.626 199.841  41.295  1.00 70.03           O  
ATOM   4290  C3'  DT J -10      21.542 201.833  39.989  1.00 69.26           C  
ATOM   4291  O3'  DT J -10      20.554 202.729  40.507  1.00 69.04           O  
ATOM   4292  C2'  DT J -10      22.786 201.828  40.863  1.00 68.34           C  
ATOM   4293  C1'  DT J -10      22.419 200.823  41.942  1.00 68.49           C  
ATOM   4294  N1   DT J -10      23.560 200.132  42.572  1.00 69.34           N  
ATOM   4295  C2   DT J -10      23.662 200.159  43.949  1.00 70.25           C  
ATOM   4296  O2   DT J -10      22.869 200.748  44.669  1.00 70.33           O  
ATOM   4297  N3   DT J -10      24.735 199.469  44.456  1.00 69.90           N  
ATOM   4298  C4   DT J -10      25.697 198.776  43.743  1.00 69.01           C  
ATOM   4299  O4   DT J -10      26.596 198.188  44.342  1.00 68.10           O  
ATOM   4300  C5   DT J -10      25.540 198.807  42.306  1.00 67.97           C  
ATOM   4301  C7   DT J -10      26.547 198.107  41.451  1.00 66.72           C  
ATOM   4302  C6   DT J -10      24.493 199.471  41.800  1.00 68.44           C  
ATOM   4303  P    DT J  -9      20.883 204.295  40.636  1.00 68.29           P  
ATOM   4304  OP1  DT J  -9      19.609 205.021  40.409  1.00 70.70           O  
ATOM   4305  OP2  DT J  -9      22.069 204.618  39.805  1.00 67.71           O  
ATOM   4306  O5'  DT J  -9      21.268 204.452  42.168  1.00 66.27           O  
ATOM   4307  C5'  DT J  -9      20.310 204.158  43.177  1.00 67.70           C  
ATOM   4308  C4'  DT J  -9      20.719 204.798  44.479  1.00 67.65           C  
ATOM   4309  O4'  DT J  -9      21.747 203.998  45.112  1.00 67.95           O  
ATOM   4310  C3'  DT J  -9      21.311 206.193  44.290  1.00 68.58           C  
ATOM   4311  O3'  DT J  -9      20.839 207.085  45.298  1.00 69.76           O  
ATOM   4312  C2'  DT J  -9      22.808 205.964  44.407  1.00 68.24           C  
ATOM   4313  C1'  DT J  -9      22.892 204.794  45.372  1.00 67.23           C  
ATOM   4314  N1   DT J  -9      24.088 203.939  45.209  1.00 64.83           N  
ATOM   4315  C2   DT J  -9      24.702 203.465  46.344  1.00 64.08           C  
ATOM   4316  O2   DT J  -9      24.303 203.714  47.467  1.00 64.64           O  
ATOM   4317  N3   DT J  -9      25.805 202.681  46.114  1.00 63.53           N  
ATOM   4318  C4   DT J  -9      26.339 202.328  44.891  1.00 63.63           C  
ATOM   4319  O4   DT J  -9      27.330 201.607  44.839  1.00 61.76           O  
ATOM   4320  C5   DT J  -9      25.647 202.864  43.743  1.00 63.98           C  
ATOM   4321  C7   DT J  -9      26.157 202.543  42.375  1.00 63.56           C  
ATOM   4322  C6   DT J  -9      24.570 203.631  43.956  1.00 64.47           C  
ATOM   4323  P    DC J  -8      21.497 208.540  45.437  1.00 70.33           P  
ATOM   4324  OP1  DC J  -8      20.465 209.477  45.947  1.00 72.04           O  
ATOM   4325  OP2  DC J  -8      22.208 208.846  44.169  1.00 70.94           O  
ATOM   4326  O5'  DC J  -8      22.579 208.328  46.582  1.00 69.70           O  
ATOM   4327  C5'  DC J  -8      22.186 207.800  47.843  1.00 68.56           C  
ATOM   4328  C4'  DC J  -8      23.338 207.864  48.814  1.00 68.21           C  
ATOM   4329  O4'  DC J  -8      24.294 206.820  48.506  1.00 66.29           O  
ATOM   4330  C3'  DC J  -8      24.101 209.187  48.763  1.00 67.31           C  
ATOM   4331  O3'  DC J  -8      24.405 209.651  50.079  1.00 65.61           O  
ATOM   4332  C2'  DC J  -8      25.370 208.838  48.003  1.00 68.00           C  
ATOM   4333  C1'  DC J  -8      25.588 207.379  48.372  1.00 67.38           C  
ATOM   4334  N1   DC J  -8      26.320 206.600  47.358  1.00 66.30           N  
ATOM   4335  C2   DC J  -8      27.318 205.711  47.780  1.00 64.83           C  
ATOM   4336  O2   DC J  -8      27.522 205.568  48.994  1.00 62.50           O  
ATOM   4337  N3   DC J  -8      28.029 205.030  46.853  1.00 64.80           N  
ATOM   4338  C4   DC J  -8      27.771 205.202  45.555  1.00 64.87           C  
ATOM   4339  N4   DC J  -8      28.516 204.526  44.675  1.00 64.21           N  
ATOM   4340  C5   DC J  -8      26.744 206.078  45.100  1.00 64.19           C  
ATOM   4341  C6   DC J  -8      26.049 206.750  46.026  1.00 65.29           C  
ATOM   4342  P    DA J  -7      24.952 211.148  50.283  1.00 65.73           P  
ATOM   4343  OP1  DA J  -7      24.031 211.870  51.200  1.00 66.40           O  
ATOM   4344  OP2  DA J  -7      25.242 211.712  48.940  1.00 64.59           O  
ATOM   4345  O5'  DA J  -7      26.341 210.935  51.027  1.00 61.34           O  
ATOM   4346  C5'  DA J  -7      26.477 209.938  52.033  1.00 56.32           C  
ATOM   4347  C4'  DA J  -7      27.930 209.564  52.207  1.00 53.70           C  
ATOM   4348  O4'  DA J  -7      28.398 208.771  51.090  1.00 49.72           O  
ATOM   4349  C3'  DA J  -7      28.884 210.756  52.306  1.00 53.15           C  
ATOM   4350  O3'  DA J  -7      29.862 210.480  53.301  1.00 53.77           O  
ATOM   4351  C2'  DA J  -7      29.545 210.786  50.940  1.00 49.88           C  
ATOM   4352  C1'  DA J  -7      29.628 209.307  50.643  1.00 48.88           C  
ATOM   4353  N9   DA J  -7      29.818 208.925  49.244  1.00 47.77           N  
ATOM   4354  C8   DA J  -7      29.511 209.613  48.095  1.00 47.16           C  
ATOM   4355  N7   DA J  -7      29.830 208.973  46.996  1.00 44.55           N  
ATOM   4356  C5   DA J  -7      30.383 207.784  47.454  1.00 45.40           C  
ATOM   4357  C6   DA J  -7      30.918 206.668  46.788  1.00 44.95           C  
ATOM   4358  N6   DA J  -7      31.005 206.564  45.460  1.00 43.33           N  
ATOM   4359  N1   DA J  -7      31.373 205.646  47.544  1.00 46.31           N  
ATOM   4360  C2   DA J  -7      31.300 205.750  48.874  1.00 46.74           C  
ATOM   4361  N3   DA J  -7      30.830 206.745  49.614  1.00 47.03           N  
ATOM   4362  C4   DA J  -7      30.379 207.742  48.834  1.00 45.98           C  
ATOM   4363  P    DA J  -6      29.506 210.732  54.841  1.00 57.88           P  
ATOM   4364  OP1  DA J  -6      28.112 210.250  55.017  1.00 58.03           O  
ATOM   4365  OP2  DA J  -6      29.855 212.129  55.209  1.00 56.11           O  
ATOM   4366  O5'  DA J  -6      30.473 209.739  55.624  1.00 53.40           O  
ATOM   4367  C5'  DA J  -6      30.043 208.425  55.966  1.00 49.71           C  
ATOM   4368  C4'  DA J  -6      31.210 207.468  55.924  1.00 48.91           C  
ATOM   4369  O4'  DA J  -6      31.678 207.354  54.559  1.00 48.36           O  
ATOM   4370  C3'  DA J  -6      32.417 207.896  56.756  1.00 46.43           C  
ATOM   4371  O3'  DA J  -6      32.992 206.766  57.414  1.00 46.08           O  
ATOM   4372  C2'  DA J  -6      33.365 208.503  55.737  1.00 46.02           C  
ATOM   4373  C1'  DA J  -6      33.034 207.762  54.449  1.00 47.90           C  
ATOM   4374  N9   DA J  -6      33.139 208.583  53.241  1.00 49.11           N  
ATOM   4375  C8   DA J  -6      32.854 209.920  53.121  1.00 49.20           C  
ATOM   4376  N7   DA J  -6      32.981 210.380  51.901  1.00 48.63           N  
ATOM   4377  C5   DA J  -6      33.390 209.278  51.169  1.00 48.12           C  
ATOM   4378  C6   DA J  -6      33.687 209.110  49.810  1.00 48.50           C  
ATOM   4379  N6   DA J  -6      33.595 210.091  48.910  1.00 49.43           N  
ATOM   4380  N1   DA J  -6      34.081 207.884  49.397  1.00 47.55           N  
ATOM   4381  C2   DA J  -6      34.162 206.903  50.301  1.00 48.28           C  
ATOM   4382  N3   DA J  -6      33.900 206.935  51.609  1.00 50.35           N  
ATOM   4383  C4   DA J  -6      33.512 208.167  51.984  1.00 49.94           C  
ATOM   4384  P    DC J  -5      34.229 206.973  58.419  1.00 47.42           P  
ATOM   4385  OP1  DC J  -5      34.241 205.849  59.384  1.00 47.16           O  
ATOM   4386  OP2  DC J  -5      34.197 208.368  58.926  1.00 47.82           O  
ATOM   4387  O5'  DC J  -5      35.498 206.846  57.464  1.00 48.55           O  
ATOM   4388  C5'  DC J  -5      35.737 205.650  56.721  1.00 50.51           C  
ATOM   4389  C4'  DC J  -5      36.995 205.787  55.894  1.00 51.94           C  
ATOM   4390  O4'  DC J  -5      36.760 206.644  54.751  1.00 51.14           O  
ATOM   4391  C3'  DC J  -5      38.188 206.392  56.639  1.00 52.48           C  
ATOM   4392  O3'  DC J  -5      39.401 205.785  56.185  1.00 51.75           O  
ATOM   4393  C2'  DC J  -5      38.177 207.834  56.168  1.00 52.48           C  
ATOM   4394  C1'  DC J  -5      37.755 207.651  54.722  1.00 53.09           C  
ATOM   4395  N1   DC J  -5      37.189 208.837  54.062  1.00 55.26           N  
ATOM   4396  C2   DC J  -5      37.094 208.842  52.668  1.00 55.90           C  
ATOM   4397  O2   DC J  -5      37.480 207.843  52.038  1.00 55.84           O  
ATOM   4398  N3   DC J  -5      36.588 209.933  52.044  1.00 56.12           N  
ATOM   4399  C4   DC J  -5      36.190 210.986  52.762  1.00 55.88           C  
ATOM   4400  N4   DC J  -5      35.717 212.049  52.107  1.00 53.97           N  
ATOM   4401  C5   DC J  -5      36.265 211.000  54.184  1.00 55.93           C  
ATOM   4402  C6   DC J  -5      36.766 209.917  54.787  1.00 56.32           C  
ATOM   4403  P    DT J  -4      39.923 204.425  56.864  1.00 51.80           P  
ATOM   4404  OP1  DT J  -4      38.757 203.521  57.060  1.00 49.78           O  
ATOM   4405  OP2  DT J  -4      40.788 204.776  58.021  1.00 47.37           O  
ATOM   4406  O5'  DT J  -4      40.829 203.796  55.718  1.00 48.04           O  
ATOM   4407  C5'  DT J  -4      40.231 203.184  54.582  1.00 41.97           C  
ATOM   4408  C4'  DT J  -4      40.941 203.612  53.321  1.00 40.80           C  
ATOM   4409  O4'  DT J  -4      40.508 204.922  52.889  1.00 42.83           O  
ATOM   4410  C3'  DT J  -4      42.464 203.680  53.423  1.00 42.12           C  
ATOM   4411  O3'  DT J  -4      43.020 203.113  52.246  1.00 41.35           O  
ATOM   4412  C2'  DT J  -4      42.753 205.171  53.436  1.00 42.76           C  
ATOM   4413  C1'  DT J  -4      41.645 205.703  52.551  1.00 43.74           C  
ATOM   4414  N1   DT J  -4      41.307 207.129  52.761  1.00 45.23           N  
ATOM   4415  C2   DT J  -4      40.995 207.905  51.662  1.00 46.07           C  
ATOM   4416  O2   DT J  -4      41.001 207.483  50.515  1.00 47.23           O  
ATOM   4417  N3   DT J  -4      40.674 209.206  51.956  1.00 47.01           N  
ATOM   4418  C4   DT J  -4      40.638 209.797  53.203  1.00 46.27           C  
ATOM   4419  O4   DT J  -4      40.314 210.975  53.310  1.00 48.51           O  
ATOM   4420  C5   DT J  -4      40.995 208.935  54.304  1.00 45.94           C  
ATOM   4421  C7   DT J  -4      41.007 209.495  55.690  1.00 44.76           C  
ATOM   4422  C6   DT J  -4      41.304 207.662  54.032  1.00 46.04           C  
ATOM   4423  P    DG J  -3      44.575 202.749  52.191  1.00 39.48           P  
ATOM   4424  OP1  DG J  -3      44.662 201.272  52.045  1.00 42.39           O  
ATOM   4425  OP2  DG J  -3      45.312 203.416  53.291  1.00 36.77           O  
ATOM   4426  O5'  DG J  -3      45.018 203.407  50.815  1.00 39.50           O  
ATOM   4427  C5'  DG J  -3      44.291 203.135  49.623  1.00 39.56           C  
ATOM   4428  C4'  DG J  -3      44.737 204.069  48.526  1.00 42.68           C  
ATOM   4429  O4'  DG J  -3      44.371 205.421  48.889  1.00 43.17           O  
ATOM   4430  C3'  DG J  -3      46.247 204.089  48.308  1.00 44.25           C  
ATOM   4431  O3'  DG J  -3      46.528 204.286  46.923  1.00 45.88           O  
ATOM   4432  C2'  DG J  -3      46.712 205.273  49.140  1.00 43.09           C  
ATOM   4433  C1'  DG J  -3      45.531 206.227  49.056  1.00 44.55           C  
ATOM   4434  N9   DG J  -3      45.322 207.031  50.254  1.00 44.43           N  
ATOM   4435  C8   DG J  -3      45.562 206.664  51.557  1.00 44.20           C  
ATOM   4436  N7   DG J  -3      45.220 207.581  52.417  1.00 41.96           N  
ATOM   4437  C5   DG J  -3      44.735 208.620  51.634  1.00 45.40           C  
ATOM   4438  C6   DG J  -3      44.202 209.878  52.005  1.00 44.80           C  
ATOM   4439  O6   DG J  -3      44.029 210.334  53.138  1.00 44.79           O  
ATOM   4440  N1   DG J  -3      43.843 210.629  50.892  1.00 45.58           N  
ATOM   4441  C2   DG J  -3      43.967 210.219  49.589  1.00 46.20           C  
ATOM   4442  N2   DG J  -3      43.566 211.088  48.651  1.00 44.63           N  
ATOM   4443  N3   DG J  -3      44.448 209.042  49.230  1.00 46.46           N  
ATOM   4444  C4   DG J  -3      44.810 208.301  50.296  1.00 44.62           C  
ATOM   4445  P    DA J  -2      48.051 204.329  46.421  1.00 48.82           P  
ATOM   4446  OP1  DA J  -2      48.157 203.466  45.221  1.00 46.49           O  
ATOM   4447  OP2  DA J  -2      48.952 204.105  47.580  1.00 47.10           O  
ATOM   4448  O5'  DA J  -2      48.248 205.840  45.980  1.00 49.38           O  
ATOM   4449  C5'  DA J  -2      47.305 206.463  45.128  1.00 51.04           C  
ATOM   4450  C4'  DA J  -2      47.581 207.942  45.057  1.00 53.51           C  
ATOM   4451  O4'  DA J  -2      47.206 208.583  46.300  1.00 53.69           O  
ATOM   4452  C3'  DA J  -2      49.049 208.292  44.822  1.00 54.96           C  
ATOM   4453  O3'  DA J  -2      49.105 209.364  43.888  1.00 57.85           O  
ATOM   4454  C2'  DA J  -2      49.531 208.738  46.193  1.00 53.42           C  
ATOM   4455  C1'  DA J  -2      48.280 209.378  46.765  1.00 53.64           C  
ATOM   4456  N9   DA J  -2      48.194 209.435  48.224  1.00 53.29           N  
ATOM   4457  C8   DA J  -2      48.522 208.469  49.145  1.00 55.50           C  
ATOM   4458  N7   DA J  -2      48.312 208.831  50.390  1.00 54.56           N  
ATOM   4459  C5   DA J  -2      47.813 210.122  50.281  1.00 53.34           C  
ATOM   4460  C6   DA J  -2      47.382 211.055  51.240  1.00 52.85           C  
ATOM   4461  N6   DA J  -2      47.373 210.818  52.555  1.00 50.43           N  
ATOM   4462  N1   DA J  -2      46.948 212.255  50.796  1.00 52.49           N  
ATOM   4463  C2   DA J  -2      46.942 212.488  49.477  1.00 52.13           C  
ATOM   4464  N3   DA J  -2      47.313 211.691  48.479  1.00 52.78           N  
ATOM   4465  C4   DA J  -2      47.743 210.509  48.953  1.00 53.27           C  
ATOM   4466  P    DA J  -1      50.486 209.724  43.159  1.00 60.99           P  
ATOM   4467  OP1  DA J  -1      50.239 209.618  41.695  1.00 60.47           O  
ATOM   4468  OP2  DA J  -1      51.589 208.951  43.780  1.00 59.17           O  
ATOM   4469  O5'  DA J  -1      50.667 211.260  43.531  1.00 62.06           O  
ATOM   4470  C5'  DA J  -1      49.565 212.153  43.403  1.00 60.75           C  
ATOM   4471  C4'  DA J  -1      49.809 213.411  44.199  1.00 60.89           C  
ATOM   4472  O4'  DA J  -1      49.517 213.226  45.606  1.00 59.41           O  
ATOM   4473  C3'  DA J  -1      51.238 213.938  44.118  1.00 62.29           C  
ATOM   4474  O3'  DA J  -1      51.205 215.339  43.879  1.00 66.29           O  
ATOM   4475  C2'  DA J  -1      51.803 213.653  45.498  1.00 60.76           C  
ATOM   4476  C1'  DA J  -1      50.575 213.760  46.381  1.00 58.16           C  
ATOM   4477  N9   DA J  -1      50.654 212.998  47.627  1.00 57.86           N  
ATOM   4478  C8   DA J  -1      51.071 211.700  47.795  1.00 57.47           C  
ATOM   4479  N7   DA J  -1      51.040 211.290  49.040  1.00 56.22           N  
ATOM   4480  C5   DA J  -1      50.569 212.390  49.741  1.00 56.05           C  
ATOM   4481  C6   DA J  -1      50.305 212.599  51.106  1.00 55.87           C  
ATOM   4482  N6   DA J  -1      50.492 211.671  52.045  1.00 56.26           N  
ATOM   4483  N1   DA J  -1      49.837 213.808  51.479  1.00 55.74           N  
ATOM   4484  C2   DA J  -1      49.652 214.740  50.538  1.00 56.60           C  
ATOM   4485  N3   DA J  -1      49.865 214.667  49.224  1.00 58.30           N  
ATOM   4486  C4   DA J  -1      50.327 213.450  48.886  1.00 57.56           C  
ATOM   4487  P    DT J   0      52.552 216.111  43.493  1.00 68.78           P  
ATOM   4488  OP1  DT J   0      52.281 216.832  42.226  1.00 69.68           O  
ATOM   4489  OP2  DT J   0      53.708 215.182  43.580  1.00 69.80           O  
ATOM   4490  O5'  DT J   0      52.676 217.169  44.666  1.00 69.00           O  
ATOM   4491  C5'  DT J   0      51.554 217.954  45.036  1.00 70.69           C  
ATOM   4492  C4'  DT J   0      51.889 218.780  46.252  1.00 72.48           C  
ATOM   4493  O4'  DT J   0      51.718 217.998  47.460  1.00 72.93           O  
ATOM   4494  C3'  DT J   0      53.334 219.275  46.252  1.00 73.58           C  
ATOM   4495  O3'  DT J   0      53.379 220.653  46.610  1.00 75.47           O  
ATOM   4496  C2'  DT J   0      54.014 218.405  47.296  1.00 72.66           C  
ATOM   4497  C1'  DT J   0      52.881 218.098  48.260  1.00 72.90           C  
ATOM   4498  N1   DT J   0      53.037 216.830  49.005  1.00 73.20           N  
ATOM   4499  C2   DT J   0      52.828 216.845  50.369  1.00 72.26           C  
ATOM   4500  O2   DT J   0      52.489 217.844  50.981  1.00 73.14           O  
ATOM   4501  N3   DT J   0      53.031 215.640  50.992  1.00 70.32           N  
ATOM   4502  C4   DT J   0      53.404 214.448  50.404  1.00 71.33           C  
ATOM   4503  O4   DT J   0      53.557 213.445  51.097  1.00 69.84           O  
ATOM   4504  C5   DT J   0      53.588 214.499  48.970  1.00 72.73           C  
ATOM   4505  C7   DT J   0      53.984 213.251  48.245  1.00 72.94           C  
ATOM   4506  C6   DT J   0      53.395 215.671  48.350  1.00 72.67           C  
ATOM   4507  P    DT J   1      54.785 221.417  46.656  1.00 76.00           P  
ATOM   4508  OP1  DT J   1      54.541 222.805  46.191  1.00 76.26           O  
ATOM   4509  OP2  DT J   1      55.803 220.580  45.970  1.00 75.44           O  
ATOM   4510  O5'  DT J   1      55.099 221.446  48.214  1.00 74.55           O  
ATOM   4511  C5'  DT J   1      54.111 221.920  49.122  1.00 74.69           C  
ATOM   4512  C4'  DT J   1      54.694 222.069  50.506  1.00 74.21           C  
ATOM   4513  O4'  DT J   1      54.707 220.794  51.191  1.00 73.52           O  
ATOM   4514  C3'  DT J   1      56.127 222.596  50.537  1.00 74.74           C  
ATOM   4515  O3'  DT J   1      56.248 223.603  51.544  1.00 77.07           O  
ATOM   4516  C2'  DT J   1      56.956 221.362  50.865  1.00 73.70           C  
ATOM   4517  C1'  DT J   1      56.002 220.528  51.707  1.00 71.89           C  
ATOM   4518  N1   DT J   1      56.213 219.064  51.647  1.00 68.51           N  
ATOM   4519  C2   DT J   1      56.195 218.353  52.826  1.00 66.64           C  
ATOM   4520  O2   DT J   1      56.053 218.874  53.918  1.00 66.80           O  
ATOM   4521  N3   DT J   1      56.352 217.001  52.679  1.00 65.19           N  
ATOM   4522  C4   DT J   1      56.528 216.303  51.503  1.00 65.70           C  
ATOM   4523  O4   DT J   1      56.635 215.080  51.526  1.00 67.19           O  
ATOM   4524  C5   DT J   1      56.562 217.111  50.310  1.00 64.94           C  
ATOM   4525  C7   DT J   1      56.771 216.442  48.989  1.00 65.47           C  
ATOM   4526  C6   DT J   1      56.405 218.432  50.439  1.00 66.57           C  
ATOM   4527  P    DC J   2      57.700 224.139  51.964  1.00 78.59           P  
ATOM   4528  OP1  DC J   2      57.559 225.508  52.517  1.00 78.49           O  
ATOM   4529  OP2  DC J   2      58.625 223.895  50.824  1.00 77.71           O  
ATOM   4530  O5'  DC J   2      58.083 223.173  53.164  1.00 77.23           O  
ATOM   4531  C5'  DC J   2      57.183 223.011  54.253  1.00 76.66           C  
ATOM   4532  C4'  DC J   2      57.844 222.222  55.354  1.00 75.19           C  
ATOM   4533  O4'  DC J   2      57.901 220.822  54.989  1.00 73.89           O  
ATOM   4534  C3'  DC J   2      59.284 222.653  55.629  1.00 74.58           C  
ATOM   4535  O3'  DC J   2      59.539 222.643  57.033  1.00 75.38           O  
ATOM   4536  C2'  DC J   2      60.106 221.575  54.945  1.00 74.15           C  
ATOM   4537  C1'  DC J   2      59.226 220.358  55.157  1.00 72.13           C  
ATOM   4538  N1   DC J   2      59.446 219.236  54.231  1.00 68.10           N  
ATOM   4539  C2   DC J   2      59.500 217.947  54.755  1.00 65.12           C  
ATOM   4540  O2   DC J   2      59.355 217.794  55.975  1.00 62.14           O  
ATOM   4541  N3   DC J   2      59.711 216.902  53.926  1.00 65.77           N  
ATOM   4542  C4   DC J   2      59.867 217.110  52.619  1.00 65.42           C  
ATOM   4543  N4   DC J   2      60.079 216.048  51.840  1.00 64.39           N  
ATOM   4544  C5   DC J   2      59.813 218.417  52.053  1.00 66.69           C  
ATOM   4545  C6   DC J   2      59.599 219.443  52.889  1.00 67.56           C  
ATOM   4546  P    DA J   3      60.788 223.463  57.614  1.00 75.02           P  
ATOM   4547  OP1  DA J   3      60.273 224.505  58.541  1.00 75.73           O  
ATOM   4548  OP2  DA J   3      61.638 223.856  56.459  1.00 74.82           O  
ATOM   4549  O5'  DA J   3      61.589 222.382  58.463  1.00 73.26           O  
ATOM   4550  C5'  DA J   3      61.007 221.780  59.615  1.00 71.43           C  
ATOM   4551  C4'  DA J   3      61.878 220.645  60.101  1.00 70.12           C  
ATOM   4552  O4'  DA J   3      61.852 219.548  59.156  1.00 69.05           O  
ATOM   4553  C3'  DA J   3      63.352 221.009  60.269  1.00 68.31           C  
ATOM   4554  O3'  DA J   3      63.883 220.232  61.333  1.00 68.46           O  
ATOM   4555  C2'  DA J   3      63.968 220.521  58.973  1.00 68.07           C  
ATOM   4556  C1'  DA J   3      63.176 219.251  58.741  1.00 66.96           C  
ATOM   4557  N9   DA J   3      63.119 218.795  57.356  1.00 65.35           N  
ATOM   4558  C8   DA J   3      63.258 219.523  56.200  1.00 65.00           C  
ATOM   4559  N7   DA J   3      63.155 218.804  55.109  1.00 64.43           N  
ATOM   4560  C5   DA J   3      62.935 217.516  55.580  1.00 64.08           C  
ATOM   4561  C6   DA J   3      62.742 216.287  54.925  1.00 62.86           C  
ATOM   4562  N6   DA J   3      62.750 216.141  53.598  1.00 61.62           N  
ATOM   4563  N1   DA J   3      62.540 215.195  55.692  1.00 63.36           N  
ATOM   4564  C2   DA J   3      62.539 215.336  57.022  1.00 63.52           C  
ATOM   4565  N3   DA J   3      62.714 216.430  57.752  1.00 64.21           N  
ATOM   4566  C4   DA J   3      62.908 217.499  56.960  1.00 64.47           C  
ATOM   4567  P    DG J   4      64.466 220.957  62.627  1.00 68.35           P  
ATOM   4568  OP1  DG J   4      63.388 221.822  63.174  1.00 68.36           O  
ATOM   4569  OP2  DG J   4      65.775 221.548  62.253  1.00 69.02           O  
ATOM   4570  O5'  DG J   4      64.721 219.756  63.637  1.00 65.64           O  
ATOM   4571  C5'  DG J   4      63.631 218.990  64.136  1.00 62.45           C  
ATOM   4572  C4'  DG J   4      63.943 217.513  64.054  1.00 61.62           C  
ATOM   4573  O4'  DG J   4      64.004 217.088  62.671  1.00 60.15           O  
ATOM   4574  C3'  DG J   4      65.261 217.077  64.689  1.00 59.18           C  
ATOM   4575  O3'  DG J   4      65.045 215.842  65.372  1.00 59.59           O  
ATOM   4576  C2'  DG J   4      66.194 216.917  63.501  1.00 57.88           C  
ATOM   4577  C1'  DG J   4      65.257 216.482  62.388  1.00 57.51           C  
ATOM   4578  N9   DG J   4      65.647 216.903  61.046  1.00 56.71           N  
ATOM   4579  C8   DG J   4      66.016 218.166  60.651  1.00 56.97           C  
ATOM   4580  N7   DG J   4      66.235 218.260  59.367  1.00 56.81           N  
ATOM   4581  C5   DG J   4      66.014 216.976  58.884  1.00 55.30           C  
ATOM   4582  C6   DG J   4      66.081 216.465  57.561  1.00 53.32           C  
ATOM   4583  O6   DG J   4      66.353 217.063  56.514  1.00 52.09           O  
ATOM   4584  N1   DG J   4      65.784 215.107  57.522  1.00 53.32           N  
ATOM   4585  C2   DG J   4      65.462 214.337  58.608  1.00 53.69           C  
ATOM   4586  N2   DG J   4      65.208 213.049  58.358  1.00 54.23           N  
ATOM   4587  N3   DG J   4      65.393 214.796  59.846  1.00 55.99           N  
ATOM   4588  C4   DG J   4      65.674 216.119  59.911  1.00 56.55           C  
ATOM   4589  P    DT J   5      66.291 215.008  65.944  1.00 62.08           P  
ATOM   4590  OP1  DT J   5      65.851 214.380  67.217  1.00 62.47           O  
ATOM   4591  OP2  DT J   5      67.521 215.837  65.917  1.00 62.17           O  
ATOM   4592  O5'  DT J   5      66.427 213.850  64.869  1.00 61.99           O  
ATOM   4593  C5'  DT J   5      65.255 213.285  64.297  1.00 60.20           C  
ATOM   4594  C4'  DT J   5      65.627 212.247  63.270  1.00 59.01           C  
ATOM   4595  O4'  DT J   5      66.092 212.883  62.057  1.00 58.77           O  
ATOM   4596  C3'  DT J   5      66.738 211.304  63.722  1.00 57.08           C  
ATOM   4597  O3'  DT J   5      66.397 209.978  63.337  1.00 54.45           O  
ATOM   4598  C2'  DT J   5      67.967 211.811  62.986  1.00 57.40           C  
ATOM   4599  C1'  DT J   5      67.381 212.400  61.711  1.00 59.21           C  
ATOM   4600  N1   DT J   5      68.134 213.531  61.131  1.00 60.48           N  
ATOM   4601  C2   DT J   5      68.403 213.505  59.780  1.00 60.43           C  
ATOM   4602  O2   DT J   5      68.076 212.585  59.053  1.00 62.10           O  
ATOM   4603  N3   DT J   5      69.067 214.605  59.307  1.00 59.25           N  
ATOM   4604  C4   DT J   5      69.476 215.704  60.028  1.00 59.29           C  
ATOM   4605  O4   DT J   5      70.044 216.628  59.457  1.00 60.94           O  
ATOM   4606  C5   DT J   5      69.176 215.661  61.441  1.00 59.58           C  
ATOM   4607  C7   DT J   5      69.589 216.811  62.305  1.00 60.45           C  
ATOM   4608  C6   DT J   5      68.534 214.589  61.918  1.00 58.99           C  
ATOM   4609  P    DT J   6      67.151 208.735  64.004  1.00 53.91           P  
ATOM   4610  OP1  DT J   6      66.126 207.675  64.187  1.00 54.45           O  
ATOM   4611  OP2  DT J   6      67.951 209.191  65.166  1.00 51.39           O  
ATOM   4612  O5'  DT J   6      68.153 208.299  62.850  1.00 53.00           O  
ATOM   4613  C5'  DT J   6      67.679 208.151  61.513  1.00 51.50           C  
ATOM   4614  C4'  DT J   6      68.839 208.068  60.554  1.00 49.92           C  
ATOM   4615  O4'  DT J   6      69.350 209.375  60.187  1.00 50.15           O  
ATOM   4616  C3'  DT J   6      70.033 207.289  61.104  1.00 49.22           C  
ATOM   4617  O3'  DT J   6      70.618 206.577  60.028  1.00 47.94           O  
ATOM   4618  C2'  DT J   6      71.000 208.390  61.490  1.00 50.85           C  
ATOM   4619  C1'  DT J   6      70.761 209.330  60.329  1.00 52.69           C  
ATOM   4620  N1   DT J   6      71.281 210.702  60.457  1.00 52.88           N  
ATOM   4621  C2   DT J   6      71.567 211.373  59.291  1.00 53.51           C  
ATOM   4622  O2   DT J   6      71.383 210.890  58.187  1.00 54.96           O  
ATOM   4623  N3   DT J   6      72.073 212.635  59.464  1.00 52.52           N  
ATOM   4624  C4   DT J   6      72.304 213.281  60.661  1.00 53.25           C  
ATOM   4625  O4   DT J   6      72.756 214.418  60.661  1.00 56.01           O  
ATOM   4626  C5   DT J   6      71.973 212.523  61.847  1.00 54.57           C  
ATOM   4627  C7   DT J   6      72.189 213.147  63.191  1.00 52.46           C  
ATOM   4628  C6   DT J   6      71.484 211.285  61.688  1.00 53.91           C  
ATOM   4629  P    DG J   7      70.792 204.995  60.122  1.00 48.67           P  
ATOM   4630  OP1  DG J   7      69.440 204.394  60.279  1.00 45.64           O  
ATOM   4631  OP2  DG J   7      71.864 204.701  61.117  1.00 47.50           O  
ATOM   4632  O5'  DG J   7      71.340 204.636  58.678  1.00 45.10           O  
ATOM   4633  C5'  DG J   7      70.643 205.065  57.518  1.00 41.05           C  
ATOM   4634  C4'  DG J   7      71.631 205.606  56.519  1.00 40.22           C  
ATOM   4635  O4'  DG J   7      72.117 206.892  56.975  1.00 42.71           O  
ATOM   4636  C3'  DG J   7      72.861 204.715  56.390  1.00 40.52           C  
ATOM   4637  O3'  DG J   7      73.282 204.688  55.032  1.00 39.05           O  
ATOM   4638  C2'  DG J   7      73.890 205.405  57.269  1.00 41.33           C  
ATOM   4639  C1'  DG J   7      73.534 206.864  57.070  1.00 43.51           C  
ATOM   4640  N9   DG J   7      73.938 207.771  58.146  1.00 43.64           N  
ATOM   4641  C8   DG J   7      73.894 207.532  59.497  1.00 43.01           C  
ATOM   4642  N7   DG J   7      74.291 208.550  60.211  1.00 43.37           N  
ATOM   4643  C5   DG J   7      74.619 209.522  59.275  1.00 43.66           C  
ATOM   4644  C6   DG J   7      75.099 210.850  59.453  1.00 41.15           C  
ATOM   4645  O6   DG J   7      75.302 211.462  60.505  1.00 37.73           O  
ATOM   4646  N1   DG J   7      75.336 211.473  58.235  1.00 40.45           N  
ATOM   4647  C2   DG J   7      75.127 210.906  57.003  1.00 43.18           C  
ATOM   4648  N2   DG J   7      75.435 211.669  55.936  1.00 41.98           N  
ATOM   4649  N3   DG J   7      74.657 209.682  56.825  1.00 44.25           N  
ATOM   4650  C4   DG J   7      74.428 209.051  57.996  1.00 43.66           C  
ATOM   4651  P    DA J   8      74.583 203.853  54.618  1.00 37.07           P  
ATOM   4652  OP1  DA J   8      74.125 202.665  53.870  1.00 40.69           O  
ATOM   4653  OP2  DA J   8      75.462 203.680  55.800  1.00 37.93           O  
ATOM   4654  O5'  DA J   8      75.329 204.833  53.612  1.00 35.45           O  
ATOM   4655  C5'  DA J   8      74.587 205.684  52.746  1.00 35.39           C  
ATOM   4656  C4'  DA J   8      75.495 206.739  52.161  1.00 35.88           C  
ATOM   4657  O4'  DA J   8      75.850 207.713  53.170  1.00 37.34           O  
ATOM   4658  C3'  DA J   8      76.813 206.169  51.652  1.00 35.49           C  
ATOM   4659  O3'  DA J   8      77.218 206.882  50.483  1.00 32.43           O  
ATOM   4660  C2'  DA J   8      77.761 206.386  52.819  1.00 32.37           C  
ATOM   4661  C1'  DA J   8      77.247 207.672  53.439  1.00 34.86           C  
ATOM   4662  N9   DA J   8      77.419 207.762  54.892  1.00 38.04           N  
ATOM   4663  C8   DA J   8      77.136 206.801  55.836  1.00 39.22           C  
ATOM   4664  N7   DA J   8      77.358 207.189  57.069  1.00 38.57           N  
ATOM   4665  C5   DA J   8      77.828 208.489  56.929  1.00 39.54           C  
ATOM   4666  C6   DA J   8      78.240 209.455  57.866  1.00 38.59           C  
ATOM   4667  N6   DA J   8      78.252 209.257  59.183  1.00 35.59           N  
ATOM   4668  N1   DA J   8      78.648 210.650  57.394  1.00 37.90           N  
ATOM   4669  C2   DA J   8      78.646 210.852  56.076  1.00 34.92           C  
ATOM   4670  N3   DA J   8      78.290 210.029  55.099  1.00 38.57           N  
ATOM   4671  C4   DA J   8      77.881 208.850  55.595  1.00 38.10           C  
ATOM   4672  P    DA J   9      78.461 206.351  49.619  1.00 34.86           P  
ATOM   4673  OP1  DA J   9      78.066 206.534  48.194  1.00 24.82           O  
ATOM   4674  OP2  DA J   9      78.870 205.014  50.119  1.00 29.78           O  
ATOM   4675  O5'  DA J   9      79.636 207.357  49.990  1.00 30.61           O  
ATOM   4676  C5'  DA J   9      79.469 208.751  49.766  1.00 30.10           C  
ATOM   4677  C4'  DA J   9      80.634 209.519  50.334  1.00 28.35           C  
ATOM   4678  O4'  DA J   9      80.522 209.618  51.772  1.00 23.15           O  
ATOM   4679  C3'  DA J   9      82.005 208.911  50.039  1.00 28.52           C  
ATOM   4680  O3'  DA J   9      82.869 209.928  49.563  1.00 31.36           O  
ATOM   4681  C2'  DA J   9      82.486 208.414  51.390  1.00 26.81           C  
ATOM   4682  C1'  DA J   9      81.778 209.346  52.355  1.00 27.47           C  
ATOM   4683  N9   DA J   9      81.537 208.764  53.668  1.00 27.30           N  
ATOM   4684  C8   DA J   9      81.037 207.526  53.957  1.00 28.99           C  
ATOM   4685  N7   DA J   9      80.931 207.285  55.239  1.00 32.73           N  
ATOM   4686  C5   DA J   9      81.395 208.446  55.835  1.00 30.46           C  
ATOM   4687  C6   DA J   9      81.540 208.826  57.180  1.00 29.90           C  
ATOM   4688  N6   DA J   9      81.215 208.042  58.206  1.00 28.63           N  
ATOM   4689  N1   DA J   9      82.040 210.054  57.435  1.00 29.30           N  
ATOM   4690  C2   DA J   9      82.369 210.837  56.402  1.00 30.34           C  
ATOM   4691  N3   DA J   9      82.277 210.591  55.093  1.00 31.38           N  
ATOM   4692  C4   DA J   9      81.776 209.365  54.877  1.00 30.05           C  
ATOM   4693  P    DG J  10      84.308 209.543  48.986  1.00 32.50           P  
ATOM   4694  OP1  DG J  10      84.511 210.462  47.839  1.00 34.71           O  
ATOM   4695  OP2  DG J  10      84.393 208.077  48.788  1.00 37.15           O  
ATOM   4696  O5'  DG J  10      85.283 209.969  50.164  1.00 34.12           O  
ATOM   4697  C5'  DG J  10      85.179 211.279  50.709  1.00 38.67           C  
ATOM   4698  C4'  DG J  10      86.067 211.417  51.917  1.00 40.99           C  
ATOM   4699  O4'  DG J  10      85.485 210.767  53.076  1.00 39.04           O  
ATOM   4700  C3'  DG J  10      87.462 210.821  51.736  1.00 42.15           C  
ATOM   4701  O3'  DG J  10      88.424 211.751  52.241  1.00 45.49           O  
ATOM   4702  C2'  DG J  10      87.421 209.567  52.597  1.00 41.29           C  
ATOM   4703  C1'  DG J  10      86.497 210.012  53.716  1.00 42.18           C  
ATOM   4704  N9   DG J  10      85.865 208.945  54.490  1.00 42.90           N  
ATOM   4705  C8   DG J  10      85.305 207.790  54.011  1.00 43.08           C  
ATOM   4706  N7   DG J  10      84.829 207.023  54.951  1.00 43.85           N  
ATOM   4707  C5   DG J  10      85.092 207.714  56.125  1.00 43.53           C  
ATOM   4708  C6   DG J  10      84.811 207.372  57.479  1.00 45.22           C  
ATOM   4709  O6   DG J  10      84.259 206.354  57.922  1.00 45.85           O  
ATOM   4710  N1   DG J  10      85.247 208.363  58.355  1.00 44.28           N  
ATOM   4711  C2   DG J  10      85.876 209.525  57.981  1.00 41.45           C  
ATOM   4712  N2   DG J  10      86.220 210.357  58.975  1.00 38.00           N  
ATOM   4713  N3   DG J  10      86.148 209.846  56.727  1.00 40.92           N  
ATOM   4714  C4   DG J  10      85.728 208.903  55.859  1.00 41.79           C  
ATOM   4715  P    DT J  11      89.989 211.437  52.100  1.00 46.67           P  
ATOM   4716  OP1  DT J  11      90.606 212.615  51.438  1.00 48.18           O  
ATOM   4717  OP2  DT J  11      90.165 210.089  51.502  1.00 52.17           O  
ATOM   4718  O5'  DT J  11      90.475 211.342  53.613  1.00 43.48           O  
ATOM   4719  C5'  DT J  11      90.061 212.305  54.571  1.00 43.83           C  
ATOM   4720  C4'  DT J  11      90.528 211.901  55.951  1.00 47.12           C  
ATOM   4721  O4'  DT J  11      89.627 210.936  56.549  1.00 45.89           O  
ATOM   4722  C3'  DT J  11      91.923 211.275  55.991  1.00 48.69           C  
ATOM   4723  O3'  DT J  11      92.693 211.836  57.053  1.00 52.75           O  
ATOM   4724  C2'  DT J  11      91.656 209.807  56.272  1.00 47.20           C  
ATOM   4725  C1'  DT J  11      90.377 209.857  57.090  1.00 46.51           C  
ATOM   4726  N1   DT J  11      89.544 208.632  57.015  1.00 45.75           N  
ATOM   4727  C2   DT J  11      88.976 208.141  58.178  1.00 45.91           C  
ATOM   4728  O2   DT J  11      89.132 208.655  59.280  1.00 42.79           O  
ATOM   4729  N3   DT J  11      88.215 207.013  58.004  1.00 45.03           N  
ATOM   4730  C4   DT J  11      87.977 206.338  56.825  1.00 45.40           C  
ATOM   4731  O4   DT J  11      87.257 205.337  56.824  1.00 46.58           O  
ATOM   4732  C5   DT J  11      88.613 206.896  55.658  1.00 44.32           C  
ATOM   4733  C7   DT J  11      88.427 206.217  54.339  1.00 42.98           C  
ATOM   4734  C6   DT J  11      89.348 208.002  55.808  1.00 43.34           C  
ATOM   4735  P    DT J  12      94.256 211.496  57.158  1.00 55.57           P  
ATOM   4736  OP1  DT J  12      94.994 212.781  57.235  1.00 58.59           O  
ATOM   4737  OP2  DT J  12      94.615 210.500  56.114  1.00 55.70           O  
ATOM   4738  O5'  DT J  12      94.362 210.779  58.563  1.00 52.88           O  
ATOM   4739  C5'  DT J  12      93.580 211.229  59.655  1.00 52.19           C  
ATOM   4740  C4'  DT J  12      93.691 210.239  60.783  1.00 51.53           C  
ATOM   4741  O4'  DT J  12      92.739 209.162  60.593  1.00 49.91           O  
ATOM   4742  C3'  DT J  12      95.075 209.597  60.823  1.00 52.25           C  
ATOM   4743  O3'  DT J  12      95.577 209.569  62.153  1.00 55.40           O  
ATOM   4744  C2'  DT J  12      94.846 208.199  60.270  1.00 50.74           C  
ATOM   4745  C1'  DT J  12      93.400 207.910  60.644  1.00 49.04           C  
ATOM   4746  N1   DT J  12      92.691 206.978  59.727  1.00 47.28           N  
ATOM   4747  C2   DT J  12      91.913 205.973  60.270  1.00 44.53           C  
ATOM   4748  O2   DT J  12      91.772 205.804  61.468  1.00 44.95           O  
ATOM   4749  N3   DT J  12      91.301 205.163  59.346  1.00 42.94           N  
ATOM   4750  C4   DT J  12      91.388 205.248  57.970  1.00 40.97           C  
ATOM   4751  O4   DT J  12      90.777 204.451  57.267  1.00 37.78           O  
ATOM   4752  C5   DT J  12      92.223 206.312  57.471  1.00 40.70           C  
ATOM   4753  C7   DT J  12      92.393 206.466  55.994  1.00 36.76           C  
ATOM   4754  C6   DT J  12      92.819 207.117  58.361  1.00 44.45           C  
ATOM   4755  P    DT J  13      97.012 208.915  62.444  1.00 61.35           P  
ATOM   4756  OP1  DT J  13      97.725 209.828  63.382  1.00 60.72           O  
ATOM   4757  OP2  DT J  13      97.649 208.542  61.152  1.00 60.51           O  
ATOM   4758  O5'  DT J  13      96.628 207.575  63.214  1.00 57.90           O  
ATOM   4759  C5'  DT J  13      95.534 207.569  64.129  1.00 53.69           C  
ATOM   4760  C4'  DT J  13      95.201 206.157  64.548  1.00 50.36           C  
ATOM   4761  O4'  DT J  13      94.484 205.466  63.494  1.00 48.19           O  
ATOM   4762  C3'  DT J  13      96.410 205.288  64.892  1.00 48.11           C  
ATOM   4763  O3'  DT J  13      96.153 204.566  66.097  1.00 48.33           O  
ATOM   4764  C2'  DT J  13      96.509 204.337  63.710  1.00 47.76           C  
ATOM   4765  C1'  DT J  13      95.055 204.185  63.302  1.00 46.56           C  
ATOM   4766  N1   DT J  13      94.813 203.776  61.897  1.00 46.23           N  
ATOM   4767  C2   DT J  13      93.705 202.990  61.625  1.00 44.11           C  
ATOM   4768  O2   DT J  13      92.916 202.615  62.481  1.00 41.21           O  
ATOM   4769  N3   DT J  13      93.553 202.657  60.304  1.00 42.37           N  
ATOM   4770  C4   DT J  13      94.360 203.020  59.248  1.00 42.73           C  
ATOM   4771  O4   DT J  13      94.081 202.647  58.108  1.00 38.78           O  
ATOM   4772  C5   DT J  13      95.500 203.842  59.601  1.00 44.68           C  
ATOM   4773  C7   DT J  13      96.434 204.291  58.520  1.00 41.17           C  
ATOM   4774  C6   DT J  13      95.667 204.171  60.890  1.00 45.28           C  
ATOM   4775  P    DC J  14      97.372 203.909  66.909  1.00 45.78           P  
ATOM   4776  OP1  DC J  14      97.122 204.219  68.335  1.00 49.40           O  
ATOM   4777  OP2  DC J  14      98.651 204.309  66.281  1.00 48.63           O  
ATOM   4778  O5'  DC J  14      97.193 202.343  66.677  1.00 45.81           O  
ATOM   4779  C5'  DC J  14      95.941 201.713  66.938  1.00 44.97           C  
ATOM   4780  C4'  DC J  14      95.873 200.365  66.259  1.00 44.99           C  
ATOM   4781  O4'  DC J  14      95.648 200.506  64.834  1.00 44.50           O  
ATOM   4782  C3'  DC J  14      97.129 199.500  66.406  1.00 45.15           C  
ATOM   4783  O3'  DC J  14      96.733 198.145  66.603  1.00 45.41           O  
ATOM   4784  C2'  DC J  14      97.777 199.605  65.037  1.00 42.98           C  
ATOM   4785  C1'  DC J  14      96.536 199.625  64.174  1.00 42.73           C  
ATOM   4786  N1   DC J  14      96.673 200.046  62.773  1.00 39.67           N  
ATOM   4787  C2   DC J  14      95.963 199.330  61.809  1.00 39.50           C  
ATOM   4788  O2   DC J  14      95.251 198.385  62.175  1.00 38.87           O  
ATOM   4789  N3   DC J  14      96.067 199.678  60.509  1.00 39.35           N  
ATOM   4790  C4   DC J  14      96.846 200.698  60.155  1.00 38.63           C  
ATOM   4791  N4   DC J  14      96.915 200.999  58.857  1.00 35.10           N  
ATOM   4792  C5   DC J  14      97.585 201.452  61.117  1.00 38.64           C  
ATOM   4793  C6   DC J  14      97.467 201.095  62.406  1.00 39.38           C  
ATOM   4794  P    DC J  15      96.549 197.577  68.091  1.00 46.81           P  
ATOM   4795  OP1  DC J  15      96.120 198.712  68.947  1.00 43.86           O  
ATOM   4796  OP2  DC J  15      97.751 196.792  68.452  1.00 45.75           O  
ATOM   4797  O5'  DC J  15      95.314 196.583  67.952  1.00 45.56           O  
ATOM   4798  C5'  DC J  15      93.985 197.092  67.840  1.00 43.79           C  
ATOM   4799  C4'  DC J  15      93.163 196.211  66.929  1.00 43.66           C  
ATOM   4800  O4'  DC J  15      93.612 196.355  65.561  1.00 42.53           O  
ATOM   4801  C3'  DC J  15      93.247 194.719  67.245  1.00 44.39           C  
ATOM   4802  O3'  DC J  15      91.968 194.123  67.021  1.00 42.57           O  
ATOM   4803  C2'  DC J  15      94.278 194.208  66.253  1.00 43.90           C  
ATOM   4804  C1'  DC J  15      94.041 195.102  65.049  1.00 43.80           C  
ATOM   4805  N1   DC J  15      95.214 195.358  64.199  1.00 46.90           N  
ATOM   4806  C2   DC J  15      95.052 195.348  62.802  1.00 47.79           C  
ATOM   4807  O2   DC J  15      93.944 195.054  62.321  1.00 44.23           O  
ATOM   4808  N3   DC J  15      96.107 195.660  62.014  1.00 49.93           N  
ATOM   4809  C4   DC J  15      97.284 195.968  62.563  1.00 48.30           C  
ATOM   4810  N4   DC J  15      98.281 196.312  61.742  1.00 46.80           N  
ATOM   4811  C5   DC J  15      97.486 195.946  63.976  1.00 48.34           C  
ATOM   4812  C6   DC J  15      96.435 195.634  64.749  1.00 47.06           C  
ATOM   4813  P    DC J  16      91.675 192.648  67.565  1.00 38.77           P  
ATOM   4814  OP1  DC J  16      90.205 192.541  67.730  1.00 44.77           O  
ATOM   4815  OP2  DC J  16      92.565 192.383  68.714  1.00 43.36           O  
ATOM   4816  O5'  DC J  16      92.109 191.705  66.360  1.00 43.54           O  
ATOM   4817  C5'  DC J  16      91.420 191.754  65.111  1.00 41.29           C  
ATOM   4818  C4'  DC J  16      92.081 190.835  64.110  1.00 41.90           C  
ATOM   4819  O4'  DC J  16      93.379 191.349  63.735  1.00 45.01           O  
ATOM   4820  C3'  DC J  16      92.321 189.402  64.593  1.00 41.72           C  
ATOM   4821  O3'  DC J  16      92.133 188.507  63.494  1.00 41.12           O  
ATOM   4822  C2'  DC J  16      93.792 189.411  64.963  1.00 42.71           C  
ATOM   4823  C1'  DC J  16      94.337 190.310  63.872  1.00 48.57           C  
ATOM   4824  N1   DC J  16      95.655 190.920  64.119  1.00 52.20           N  
ATOM   4825  C2   DC J  16      96.400 191.365  63.019  1.00 55.57           C  
ATOM   4826  O2   DC J  16      95.925 191.234  61.878  1.00 55.62           O  
ATOM   4827  N3   DC J  16      97.616 191.922  63.225  1.00 57.34           N  
ATOM   4828  C4   DC J  16      98.095 192.035  64.466  1.00 56.82           C  
ATOM   4829  N4   DC J  16      99.306 192.576  64.621  1.00 58.33           N  
ATOM   4830  C5   DC J  16      97.356 191.594  65.602  1.00 55.60           C  
ATOM   4831  C6   DC J  16      96.152 191.048  65.385  1.00 54.57           C  
ATOM   4832  P    DT J  17      90.836 187.556  63.442  1.00 37.31           P  
ATOM   4833  OP1  DT J  17      89.632 188.346  63.806  1.00 37.18           O  
ATOM   4834  OP2  DT J  17      91.129 186.295  64.159  1.00 38.53           O  
ATOM   4835  O5'  DT J  17      90.708 187.255  61.889  1.00 37.68           O  
ATOM   4836  C5'  DT J  17      90.155 188.238  61.026  1.00 35.35           C  
ATOM   4837  C4'  DT J  17      90.952 188.334  59.748  1.00 34.94           C  
ATOM   4838  O4'  DT J  17      92.282 188.832  60.037  1.00 37.64           O  
ATOM   4839  C3'  DT J  17      91.139 187.025  58.979  1.00 33.83           C  
ATOM   4840  O3'  DT J  17      90.865 187.253  57.594  1.00 30.40           O  
ATOM   4841  C2'  DT J  17      92.604 186.678  59.205  1.00 34.37           C  
ATOM   4842  C1'  DT J  17      93.235 188.055  59.338  1.00 40.01           C  
ATOM   4843  N1   DT J  17      94.525 188.124  60.073  1.00 44.24           N  
ATOM   4844  C2   DT J  17      95.611 188.693  59.430  1.00 47.82           C  
ATOM   4845  O2   DT J  17      95.563 189.156  58.299  1.00 50.80           O  
ATOM   4846  N3   DT J  17      96.765 188.702  60.164  1.00 49.77           N  
ATOM   4847  C4   DT J  17      96.949 188.219  61.442  1.00 51.52           C  
ATOM   4848  O4   DT J  17      98.055 188.300  61.976  1.00 56.02           O  
ATOM   4849  C5   DT J  17      95.781 187.644  62.055  1.00 49.64           C  
ATOM   4850  C7   DT J  17      95.899 187.090  63.440  1.00 50.45           C  
ATOM   4851  C6   DT J  17      94.638 187.629  61.353  1.00 47.31           C  
ATOM   4852  P    DT J  18      90.735 186.007  56.585  1.00 34.44           P  
ATOM   4853  OP1  DT J  18      89.698 186.377  55.586  1.00 32.85           O  
ATOM   4854  OP2  DT J  18      90.602 184.733  57.348  1.00 33.35           O  
ATOM   4855  O5'  DT J  18      92.143 185.999  55.850  1.00 32.73           O  
ATOM   4856  C5'  DT J  18      92.646 187.194  55.272  1.00 32.00           C  
ATOM   4857  C4'  DT J  18      94.047 186.980  54.765  1.00 34.59           C  
ATOM   4858  O4'  DT J  18      94.978 187.043  55.868  1.00 37.28           O  
ATOM   4859  C3'  DT J  18      94.281 185.639  54.072  1.00 37.56           C  
ATOM   4860  O3'  DT J  18      94.964 185.835  52.839  1.00 40.97           O  
ATOM   4861  C2'  DT J  18      95.149 184.861  55.051  1.00 37.85           C  
ATOM   4862  C1'  DT J  18      95.884 185.956  55.798  1.00 38.46           C  
ATOM   4863  N1   DT J  18      96.288 185.627  57.179  1.00 40.54           N  
ATOM   4864  C2   DT J  18      97.480 186.141  57.628  1.00 41.59           C  
ATOM   4865  O2   DT J  18      98.219 186.820  56.931  1.00 43.39           O  
ATOM   4866  N3   DT J  18      97.781 185.832  58.930  1.00 42.08           N  
ATOM   4867  C4   DT J  18      97.034 185.070  59.803  1.00 41.50           C  
ATOM   4868  O4   DT J  18      97.434 184.886  60.947  1.00 44.81           O  
ATOM   4869  C5   DT J  18      95.805 184.545  59.263  1.00 40.24           C  
ATOM   4870  C7   DT J  18      94.935 183.695  60.134  1.00 38.47           C  
ATOM   4871  C6   DT J  18      95.496 184.847  57.994  1.00 40.55           C  
ATOM   4872  P    DT J  19      95.227 184.584  51.869  1.00 46.39           P  
ATOM   4873  OP1  DT J  19      94.951 185.073  50.496  1.00 47.12           O  
ATOM   4874  OP2  DT J  19      94.516 183.383  52.379  1.00 46.23           O  
ATOM   4875  O5'  DT J  19      96.785 184.334  52.035  1.00 45.01           O  
ATOM   4876  C5'  DT J  19      97.682 185.432  52.012  1.00 46.75           C  
ATOM   4877  C4'  DT J  19      99.066 184.982  52.406  1.00 49.59           C  
ATOM   4878  O4'  DT J  19      99.189 184.879  53.845  1.00 47.71           O  
ATOM   4879  C3'  DT J  19      99.472 183.623  51.838  1.00 52.62           C  
ATOM   4880  O3'  DT J  19     100.807 183.708  51.330  1.00 60.41           O  
ATOM   4881  C2'  DT J  19      99.399 182.702  53.045  1.00 49.95           C  
ATOM   4882  C1'  DT J  19      99.787 183.641  54.172  1.00 47.26           C  
ATOM   4883  N1   DT J  19      99.338 183.256  55.523  1.00 46.03           N  
ATOM   4884  C2   DT J  19     100.141 183.600  56.592  1.00 47.83           C  
ATOM   4885  O2   DT J  19     101.180 184.227  56.474  1.00 49.62           O  
ATOM   4886  N3   DT J  19      99.675 183.187  57.815  1.00 46.43           N  
ATOM   4887  C4   DT J  19      98.510 182.496  58.074  1.00 42.34           C  
ATOM   4888  O4   DT J  19      98.224 182.200  59.222  1.00 39.36           O  
ATOM   4889  C5   DT J  19      97.708 182.182  56.914  1.00 43.03           C  
ATOM   4890  C7   DT J  19      96.418 181.448  57.103  1.00 39.28           C  
ATOM   4891  C6   DT J  19      98.158 182.570  55.711  1.00 45.25           C  
ATOM   4892  P    DG J  20     101.431 182.477  50.512  1.00 66.10           P  
ATOM   4893  OP1  DG J  20     102.338 183.052  49.484  1.00 66.47           O  
ATOM   4894  OP2  DG J  20     100.340 181.557  50.096  1.00 64.39           O  
ATOM   4895  O5'  DG J  20     102.338 181.764  51.603  1.00 66.16           O  
ATOM   4896  C5'  DG J  20     103.409 182.479  52.207  1.00 70.74           C  
ATOM   4897  C4'  DG J  20     104.187 181.566  53.119  1.00 74.22           C  
ATOM   4898  O4'  DG J  20     103.501 181.415  54.385  1.00 74.11           O  
ATOM   4899  C3'  DG J  20     104.349 180.157  52.553  1.00 77.41           C  
ATOM   4900  O3'  DG J  20     105.643 179.654  52.871  1.00 82.52           O  
ATOM   4901  C2'  DG J  20     103.290 179.363  53.293  1.00 76.04           C  
ATOM   4902  C1'  DG J  20     103.315 180.038  54.649  1.00 74.49           C  
ATOM   4903  N9   DG J  20     102.105 179.885  55.448  1.00 74.13           N  
ATOM   4904  C8   DG J  20     100.850 179.521  55.018  1.00 74.11           C  
ATOM   4905  N7   DG J  20      99.982 179.435  55.990  1.00 73.67           N  
ATOM   4906  C5   DG J  20     100.707 179.769  57.126  1.00 73.81           C  
ATOM   4907  C6   DG J  20     100.308 179.841  58.486  1.00 73.89           C  
ATOM   4908  O6   DG J  20      99.197 179.601  58.978  1.00 74.26           O  
ATOM   4909  N1   DG J  20     101.364 180.228  59.307  1.00 73.60           N  
ATOM   4910  C2   DG J  20     102.640 180.505  58.877  1.00 73.10           C  
ATOM   4911  N2   DG J  20     103.520 180.866  59.816  1.00 72.08           N  
ATOM   4912  N3   DG J  20     103.023 180.433  57.617  1.00 73.29           N  
ATOM   4913  C4   DG J  20     102.015 180.062  56.803  1.00 73.44           C  
ATOM   4914  P    DA J  21     106.167 178.316  52.162  1.00 86.41           P  
ATOM   4915  OP1  DA J  21     107.342 178.701  51.338  1.00 86.32           O  
ATOM   4916  OP2  DA J  21     105.017 177.623  51.522  1.00 85.59           O  
ATOM   4917  O5'  DA J  21     106.672 177.442  53.389  1.00 85.38           O  
ATOM   4918  C5'  DA J  21     107.702 177.927  54.240  1.00 87.55           C  
ATOM   4919  C4'  DA J  21     107.818 177.052  55.465  1.00 89.27           C  
ATOM   4920  O4'  DA J  21     106.693 177.295  56.348  1.00 88.38           O  
ATOM   4921  C3'  DA J  21     107.804 175.551  55.159  1.00 89.75           C  
ATOM   4922  O3'  DA J  21     108.748 174.865  55.991  1.00 91.54           O  
ATOM   4923  C2'  DA J  21     106.381 175.147  55.495  1.00 88.39           C  
ATOM   4924  C1'  DA J  21     106.079 176.059  56.665  1.00 86.77           C  
ATOM   4925  N9   DA J  21     104.654 176.287  56.891  1.00 84.98           N  
ATOM   4926  C8   DA J  21     103.625 176.110  56.003  1.00 84.28           C  
ATOM   4927  N7   DA J  21     102.440 176.325  56.517  1.00 83.44           N  
ATOM   4928  C5   DA J  21     102.708 176.683  57.829  1.00 83.40           C  
ATOM   4929  C6   DA J  21     101.871 177.019  58.903  1.00 83.58           C  
ATOM   4930  N6   DA J  21     100.540 177.031  58.822  1.00 84.28           N  
ATOM   4931  N1   DA J  21     102.453 177.335  60.079  1.00 83.16           N  
ATOM   4932  C2   DA J  21     103.788 177.301  60.161  1.00 83.71           C  
ATOM   4933  N3   DA J  21     104.682 176.988  59.224  1.00 84.48           N  
ATOM   4934  C4   DA J  21     104.068 176.684  58.068  1.00 84.13           C  
ATOM   4935  P    DT J  22     108.373 173.432  56.617  1.00 93.03           P  
ATOM   4936  OP1  DT J  22     109.627 172.840  57.149  1.00 93.37           O  
ATOM   4937  OP2  DT J  22     107.552 172.660  55.647  1.00 92.84           O  
ATOM   4938  O5'  DT J  22     107.456 173.814  57.860  1.00 93.84           O  
ATOM   4939  C5'  DT J  22     108.005 174.514  58.974  1.00 95.67           C  
ATOM   4940  C4'  DT J  22     107.639 173.798  60.249  1.00 96.80           C  
ATOM   4941  O4'  DT J  22     106.256 174.070  60.581  1.00 97.36           O  
ATOM   4942  C3'  DT J  22     107.748 172.285  60.092  1.00 98.27           C  
ATOM   4943  O3'  DT J  22     108.220 171.680  61.291  1.00100.34           O  
ATOM   4944  C2'  DT J  22     106.321 171.861  59.803  1.00 98.39           C  
ATOM   4945  C1'  DT J  22     105.515 172.860  60.614  1.00 98.01           C  
ATOM   4946  N1   DT J  22     104.172 173.137  60.071  1.00 98.60           N  
ATOM   4947  C2   DT J  22     103.194 173.559  60.943  1.00 99.00           C  
ATOM   4948  O2   DT J  22     103.388 173.714  62.138  1.00 99.59           O  
ATOM   4949  N3   DT J  22     101.972 173.794  60.360  1.00 98.90           N  
ATOM   4950  C4   DT J  22     101.641 173.653  59.024  1.00 98.71           C  
ATOM   4951  O4   DT J  22     100.502 173.910  58.646  1.00 99.24           O  
ATOM   4952  C5   DT J  22     102.715 173.202  58.168  1.00 98.30           C  
ATOM   4953  C7   DT J  22     102.449 173.010  56.709  1.00 97.37           C  
ATOM   4954  C6   DT J  22     103.910 172.973  58.726  1.00 98.49           C  
ATOM   4955  P    DA J  23     109.072 170.324  61.207  1.00101.22           P  
ATOM   4956  OP1  DA J  23     110.411 170.677  60.673  1.00101.28           O  
ATOM   4957  OP2  DA J  23     108.253 169.293  60.515  1.00100.87           O  
ATOM   4958  O5'  DA J  23     109.230 169.893  62.727  1.00101.20           O  
ATOM   4959  C5'  DA J  23     108.970 170.818  63.777  1.00102.43           C  
ATOM   4960  C4'  DA J  23     107.823 170.321  64.626  1.00103.67           C  
ATOM   4961  O4'  DA J  23     106.555 170.597  63.981  1.00104.74           O  
ATOM   4962  C3'  DA J  23     107.853 168.813  64.869  1.00103.91           C  
ATOM   4963  O3'  DA J  23     107.469 168.520  66.210  1.00102.62           O  
ATOM   4964  C2'  DA J  23     106.813 168.278  63.902  1.00104.15           C  
ATOM   4965  C1'  DA J  23     105.795 169.400  63.904  1.00105.24           C  
ATOM   4966  N9   DA J  23     104.956 169.470  62.708  1.00106.17           N  
ATOM   4967  C8   DA J  23     105.342 169.357  61.396  1.00106.63           C  
ATOM   4968  N7   DA J  23     104.356 169.482  60.541  1.00106.71           N  
ATOM   4969  C5   DA J  23     103.242 169.685  61.344  1.00106.25           C  
ATOM   4970  C6   DA J  23     101.885 169.889  61.044  1.00106.19           C  
ATOM   4971  N6   DA J  23     101.400 169.931  59.801  1.00105.66           N  
ATOM   4972  N1   DA J  23     101.031 170.053  62.078  1.00106.19           N  
ATOM   4973  C2   DA J  23     101.520 170.013  63.325  1.00105.96           C  
ATOM   4974  N3   DA J  23     102.773 169.832  63.733  1.00106.02           N  
ATOM   4975  C4   DA J  23     103.596 169.673  62.681  1.00106.18           C  
ATOM   4976  P    DG J  24     107.407 166.995  66.697  1.00101.07           P  
ATOM   4977  OP1  DG J  24     107.960 166.957  68.076  1.00101.91           O  
ATOM   4978  OP2  DG J  24     108.004 166.137  65.642  1.00100.96           O  
ATOM   4979  O5'  DG J  24     105.847 166.694  66.764  1.00 99.66           O  
ATOM   4980  C5'  DG J  24     105.029 167.332  67.740  1.00 98.51           C  
ATOM   4981  C4'  DG J  24     103.690 166.640  67.825  1.00 97.58           C  
ATOM   4982  O4'  DG J  24     102.858 167.014  66.699  1.00 98.54           O  
ATOM   4983  C3'  DG J  24     103.785 165.116  67.792  1.00 96.45           C  
ATOM   4984  O3'  DG J  24     102.810 164.554  68.664  1.00 94.38           O  
ATOM   4985  C2'  DG J  24     103.433 164.780  66.356  1.00 96.93           C  
ATOM   4986  C1'  DG J  24     102.395 165.840  66.052  1.00 98.24           C  
ATOM   4987  N9   DG J  24     102.209 166.139  64.635  1.00 98.81           N  
ATOM   4988  C8   DG J  24     103.157 166.094  63.640  1.00 98.84           C  
ATOM   4989  N7   DG J  24     102.677 166.387  62.461  1.00 98.64           N  
ATOM   4990  C5   DG J  24     101.332 166.649  62.692  1.00 98.61           C  
ATOM   4991  C6   DG J  24     100.296 167.013  61.790  1.00 97.98           C  
ATOM   4992  O6   DG J  24     100.361 167.173  60.566  1.00 97.54           O  
ATOM   4993  N1   DG J  24      99.084 167.188  62.449  1.00 97.32           N  
ATOM   4994  C2   DG J  24      98.886 167.028  63.798  1.00 97.05           C  
ATOM   4995  N2   DG J  24      97.639 167.243  64.241  1.00 96.28           N  
ATOM   4996  N3   DG J  24      99.839 166.682  64.648  1.00 97.53           N  
ATOM   4997  C4   DG J  24     101.029 166.510  64.030  1.00 98.60           C  
ATOM   4998  P    DC J  25     102.853 162.986  68.999  1.00 93.90           P  
ATOM   4999  OP1  DC J  25     103.445 162.842  70.354  1.00 94.83           O  
ATOM   5000  OP2  DC J  25     103.451 162.252  67.854  1.00 93.55           O  
ATOM   5001  O5'  DC J  25     101.313 162.596  69.080  1.00 93.00           O  
ATOM   5002  C5'  DC J  25     100.340 163.563  69.469  1.00 89.25           C  
ATOM   5003  C4'  DC J  25      99.107 163.439  68.605  1.00 86.55           C  
ATOM   5004  O4'  DC J  25      99.366 163.934  67.269  1.00 84.89           O  
ATOM   5005  C3'  DC J  25      98.600 162.008  68.434  1.00 85.35           C  
ATOM   5006  O3'  DC J  25      97.179 162.014  68.461  1.00 85.32           O  
ATOM   5007  C2'  DC J  25      99.074 161.637  67.041  1.00 84.91           C  
ATOM   5008  C1'  DC J  25      98.946 162.965  66.326  1.00 84.69           C  
ATOM   5009  N1   DC J  25      99.768 163.113  65.116  1.00 85.32           N  
ATOM   5010  C2   DC J  25      99.154 163.555  63.938  1.00 86.01           C  
ATOM   5011  O2   DC J  25      97.939 163.804  63.949  1.00 86.68           O  
ATOM   5012  N3   DC J  25      99.897 163.697  62.818  1.00 86.05           N  
ATOM   5013  C4   DC J  25     101.198 163.413  62.842  1.00 85.97           C  
ATOM   5014  N4   DC J  25     101.888 163.566  61.712  1.00 86.66           N  
ATOM   5015  C5   DC J  25     101.849 162.960  64.026  1.00 86.30           C  
ATOM   5016  C6   DC J  25     101.103 162.827  65.131  1.00 85.62           C  
ATOM   5017  P    DG J  26      96.410 161.463  69.753  1.00 85.67           P  
ATOM   5018  OP1  DG J  26      96.990 162.149  70.935  1.00 85.02           O  
ATOM   5019  OP2  DG J  26      96.402 159.979  69.691  1.00 86.10           O  
ATOM   5020  O5'  DG J  26      94.922 161.990  69.551  1.00 84.39           O  
ATOM   5021  C5'  DG J  26      94.666 163.376  69.335  1.00 81.82           C  
ATOM   5022  C4'  DG J  26      93.827 163.565  68.093  1.00 79.59           C  
ATOM   5023  O4'  DG J  26      94.616 163.290  66.908  1.00 80.40           O  
ATOM   5024  C3'  DG J  26      92.613 162.640  68.018  1.00 77.04           C  
ATOM   5025  O3'  DG J  26      91.494 163.332  67.468  1.00 70.91           O  
ATOM   5026  C2'  DG J  26      93.060 161.546  67.067  1.00 79.55           C  
ATOM   5027  C1'  DG J  26      93.962 162.309  66.115  1.00 81.48           C  
ATOM   5028  N9   DG J  26      94.984 161.485  65.480  1.00 83.82           N  
ATOM   5029  C8   DG J  26      95.798 160.558  66.085  1.00 84.67           C  
ATOM   5030  N7   DG J  26      96.615 159.974  65.252  1.00 85.41           N  
ATOM   5031  C5   DG J  26      96.326 160.552  64.025  1.00 85.60           C  
ATOM   5032  C6   DG J  26      96.892 160.323  62.748  1.00 86.24           C  
ATOM   5033  O6   DG J  26      97.798 159.546  62.436  1.00 86.81           O  
ATOM   5034  N1   DG J  26      96.296 161.118  61.775  1.00 87.43           N  
ATOM   5035  C2   DG J  26      95.287 162.023  62.002  1.00 87.83           C  
ATOM   5036  N2   DG J  26      94.836 162.692  60.929  1.00 88.34           N  
ATOM   5037  N3   DG J  26      94.757 162.252  63.192  1.00 86.66           N  
ATOM   5038  C4   DG J  26      95.319 161.486  64.149  1.00 85.27           C  
ATOM   5039  P    DC J  27      90.049 162.639  67.493  1.00 67.65           P  
ATOM   5040  OP1  DC J  27      89.052 163.739  67.533  1.00 65.98           O  
ATOM   5041  OP2  DC J  27      90.050 161.603  68.558  1.00 68.34           O  
ATOM   5042  O5'  DC J  27      89.968 161.893  66.088  1.00 64.39           O  
ATOM   5043  C5'  DC J  27      90.201 162.611  64.881  1.00 59.39           C  
ATOM   5044  C4'  DC J  27      90.201 161.675  63.696  1.00 55.18           C  
ATOM   5045  O4'  DC J  27      91.462 160.981  63.558  1.00 52.99           O  
ATOM   5046  C3'  DC J  27      89.115 160.596  63.693  1.00 54.35           C  
ATOM   5047  O3'  DC J  27      88.562 160.511  62.380  1.00 51.55           O  
ATOM   5048  C2'  DC J  27      89.896 159.322  63.963  1.00 53.21           C  
ATOM   5049  C1'  DC J  27      91.182 159.633  63.221  1.00 53.70           C  
ATOM   5050  N1   DC J  27      92.359 158.812  63.554  1.00 54.23           N  
ATOM   5051  C2   DC J  27      93.494 158.911  62.744  1.00 55.16           C  
ATOM   5052  O2   DC J  27      93.471 159.675  61.769  1.00 57.36           O  
ATOM   5053  N3   DC J  27      94.585 158.174  63.040  1.00 56.08           N  
ATOM   5054  C4   DC J  27      94.571 157.357  64.093  1.00 55.81           C  
ATOM   5055  N4   DC J  27      95.674 156.651  64.351  1.00 53.84           N  
ATOM   5056  C5   DC J  27      93.427 157.228  64.930  1.00 56.45           C  
ATOM   5057  C6   DC J  27      92.353 157.968  64.628  1.00 55.58           C  
ATOM   5058  P    DA J  28      86.982 160.343  62.183  1.00 48.20           P  
ATOM   5059  OP1  DA J  28      86.339 161.570  62.705  1.00 49.88           O  
ATOM   5060  OP2  DA J  28      86.531 159.022  62.675  1.00 52.76           O  
ATOM   5061  O5'  DA J  28      86.859 160.332  60.603  1.00 52.65           O  
ATOM   5062  C5'  DA J  28      87.449 161.370  59.834  1.00 58.65           C  
ATOM   5063  C4'  DA J  28      88.184 160.783  58.655  1.00 63.46           C  
ATOM   5064  O4'  DA J  28      89.281 159.971  59.138  1.00 64.81           O  
ATOM   5065  C3'  DA J  28      87.328 159.863  57.791  1.00 66.43           C  
ATOM   5066  O3'  DA J  28      87.669 160.036  56.417  1.00 69.37           O  
ATOM   5067  C2'  DA J  28      87.686 158.472  58.284  1.00 65.79           C  
ATOM   5068  C1'  DA J  28      89.139 158.629  58.699  1.00 66.25           C  
ATOM   5069  N9   DA J  28      89.551 157.767  59.804  1.00 67.90           N  
ATOM   5070  C8   DA J  28      88.967 157.656  61.040  1.00 68.87           C  
ATOM   5071  N7   DA J  28      89.588 156.832  61.847  1.00 69.59           N  
ATOM   5072  C5   DA J  28      90.650 156.361  61.089  1.00 69.78           C  
ATOM   5073  C6   DA J  28      91.691 155.468  61.377  1.00 70.04           C  
ATOM   5074  N6   DA J  28      91.851 154.879  62.563  1.00 72.27           N  
ATOM   5075  N1   DA J  28      92.581 155.202  60.397  1.00 70.25           N  
ATOM   5076  C2   DA J  28      92.431 155.809  59.214  1.00 70.54           C  
ATOM   5077  N3   DA J  28      91.501 156.678  58.826  1.00 70.78           N  
ATOM   5078  C4   DA J  28      90.630 156.915  59.822  1.00 69.54           C  
ATOM   5079  P    DG J  29      86.806 159.295  55.291  1.00 72.88           P  
ATOM   5080  OP1  DG J  29      86.958 160.073  54.034  1.00 71.74           O  
ATOM   5081  OP2  DG J  29      85.453 159.059  55.853  1.00 71.42           O  
ATOM   5082  O5'  DG J  29      87.559 157.902  55.105  1.00 73.99           O  
ATOM   5083  C5'  DG J  29      88.856 157.868  54.511  1.00 76.29           C  
ATOM   5084  C4'  DG J  29      89.370 156.450  54.406  1.00 78.11           C  
ATOM   5085  O4'  DG J  29      89.825 155.941  55.684  1.00 78.32           O  
ATOM   5086  C3'  DG J  29      88.396 155.407  53.856  1.00 79.82           C  
ATOM   5087  O3'  DG J  29      89.122 154.534  52.991  1.00 83.47           O  
ATOM   5088  C2'  DG J  29      88.005 154.626  55.096  1.00 79.93           C  
ATOM   5089  C1'  DG J  29      89.328 154.624  55.832  1.00 79.62           C  
ATOM   5090  N9   DG J  29      89.279 154.294  57.253  1.00 80.05           N  
ATOM   5091  C8   DG J  29      88.283 154.590  58.154  1.00 80.01           C  
ATOM   5092  N7   DG J  29      88.521 154.126  59.352  1.00 79.40           N  
ATOM   5093  C5   DG J  29      89.751 153.492  59.237  1.00 79.65           C  
ATOM   5094  C6   DG J  29      90.526 152.799  60.205  1.00 78.76           C  
ATOM   5095  O6   DG J  29      90.273 152.603  61.398  1.00 77.51           O  
ATOM   5096  N1   DG J  29      91.708 152.312  59.660  1.00 78.65           N  
ATOM   5097  C2   DG J  29      92.098 152.467  58.354  1.00 79.01           C  
ATOM   5098  N2   DG J  29      93.274 151.920  58.019  1.00 79.43           N  
ATOM   5099  N3   DG J  29      91.389 153.110  57.443  1.00 79.49           N  
ATOM   5100  C4   DG J  29      90.234 153.592  57.950  1.00 79.82           C  
ATOM   5101  P    DT J  30      88.344 153.646  51.904  1.00 86.05           P  
ATOM   5102  OP1  DT J  30      88.405 154.398  50.623  1.00 85.67           O  
ATOM   5103  OP2  DT J  30      87.025 153.234  52.453  1.00 85.31           O  
ATOM   5104  O5'  DT J  30      89.267 152.354  51.775  1.00 86.21           O  
ATOM   5105  C5'  DT J  30      90.663 152.489  51.519  1.00 88.70           C  
ATOM   5106  C4'  DT J  30      91.426 151.306  52.070  1.00 91.10           C  
ATOM   5107  O4'  DT J  30      91.424 151.327  53.522  1.00 92.18           O  
ATOM   5108  C3'  DT J  30      90.900 149.925  51.664  1.00 91.79           C  
ATOM   5109  O3'  DT J  30      92.001 149.066  51.333  1.00 92.19           O  
ATOM   5110  C2'  DT J  30      90.220 149.425  52.927  1.00 92.05           C  
ATOM   5111  C1'  DT J  30      91.109 150.028  53.995  1.00 92.71           C  
ATOM   5112  N1   DT J  30      90.504 150.144  55.340  1.00 93.59           N  
ATOM   5113  C2   DT J  30      91.245 149.694  56.411  1.00 93.45           C  
ATOM   5114  O2   DT J  30      92.370 149.237  56.296  1.00 93.87           O  
ATOM   5115  N3   DT J  30      90.620 149.801  57.628  1.00 93.12           N  
ATOM   5116  C4   DT J  30      89.358 150.305  57.878  1.00 92.89           C  
ATOM   5117  O4   DT J  30      88.927 150.334  59.028  1.00 91.88           O  
ATOM   5118  C5   DT J  30      88.638 150.768  56.712  1.00 93.00           C  
ATOM   5119  C7   DT J  30      87.263 151.332  56.888  1.00 92.05           C  
ATOM   5120  C6   DT J  30      89.240 150.668  55.517  1.00 93.48           C  
ATOM   5121  P    DT J  31      91.729 147.536  50.919  1.00 91.23           P  
ATOM   5122  OP1  DT J  31      92.827 147.123  50.011  1.00 91.28           O  
ATOM   5123  OP2  DT J  31      90.317 147.395  50.478  1.00 91.76           O  
ATOM   5124  O5'  DT J  31      91.909 146.746  52.285  1.00 92.18           O  
ATOM   5125  C5'  DT J  31      93.186 146.669  52.908  1.00 95.25           C  
ATOM   5126  C4'  DT J  31      93.167 145.623  53.996  1.00 96.65           C  
ATOM   5127  O4'  DT J  31      92.395 146.106  55.120  1.00 97.64           O  
ATOM   5128  C3'  DT J  31      92.524 144.303  53.571  1.00 96.56           C  
ATOM   5129  O3'  DT J  31      93.232 143.204  54.144  1.00 95.32           O  
ATOM   5130  C2'  DT J  31      91.125 144.392  54.152  1.00 97.84           C  
ATOM   5131  C1'  DT J  31      91.354 145.193  55.421  1.00 99.33           C  
ATOM   5132  N1   DT J  31      90.190 145.974  55.874  1.00101.55           N  
ATOM   5133  C2   DT J  31      89.911 145.989  57.219  1.00102.81           C  
ATOM   5134  O2   DT J  31      90.576 145.384  58.043  1.00104.12           O  
ATOM   5135  N3   DT J  31      88.817 146.740  57.568  1.00103.56           N  
ATOM   5136  C4   DT J  31      87.993 147.457  56.724  1.00104.29           C  
ATOM   5137  O4   DT J  31      87.046 148.091  57.184  1.00104.98           O  
ATOM   5138  C5   DT J  31      88.340 147.390  55.322  1.00103.83           C  
ATOM   5139  C7   DT J  31      87.493 148.121  54.329  1.00104.25           C  
ATOM   5140  C6   DT J  31      89.410 146.666  54.973  1.00102.64           C  
ATOM   5141  P    DT J  32      93.191 141.773  53.420  1.00 93.43           P  
ATOM   5142  OP1  DT J  32      94.598 141.350  53.203  1.00 93.37           O  
ATOM   5143  OP2  DT J  32      92.261 141.849  52.265  1.00 92.85           O  
ATOM   5144  O5'  DT J  32      92.540 140.825  54.519  1.00 93.68           O  
ATOM   5145  C5'  DT J  32      93.234 140.516  55.726  1.00 93.59           C  
ATOM   5146  C4'  DT J  32      92.303 139.825  56.693  1.00 93.41           C  
ATOM   5147  O4'  DT J  32      91.409 140.790  57.303  1.00 93.25           O  
ATOM   5148  C3'  DT J  32      91.408 138.786  56.017  1.00 94.13           C  
ATOM   5149  O3'  DT J  32      91.230 137.644  56.854  1.00 95.27           O  
ATOM   5150  C2'  DT J  32      90.090 139.517  55.860  1.00 93.82           C  
ATOM   5151  C1'  DT J  32      90.069 140.368  57.114  1.00 92.93           C  
ATOM   5152  N1   DT J  32      89.202 141.565  57.048  1.00 91.77           N  
ATOM   5153  C2   DT J  32      88.672 142.040  58.225  1.00 90.57           C  
ATOM   5154  O2   DT J  32      88.917 141.547  59.312  1.00 89.88           O  
ATOM   5155  N3   DT J  32      87.837 143.119  58.080  1.00 90.13           N  
ATOM   5156  C4   DT J  32      87.491 143.758  56.906  1.00 89.66           C  
ATOM   5157  O4   DT J  32      86.713 144.706  56.931  1.00 88.13           O  
ATOM   5158  C5   DT J  32      88.100 143.224  55.714  1.00 90.33           C  
ATOM   5159  C7   DT J  32      87.792 143.863  54.397  1.00 91.00           C  
ATOM   5160  C6   DT J  32      88.918 142.171  55.842  1.00 91.28           C  
ATOM   5161  P    DG J  33      90.880 136.226  56.187  1.00 97.02           P  
ATOM   5162  OP1  DG J  33      92.160 135.622  55.738  1.00 97.20           O  
ATOM   5163  OP2  DG J  33      89.780 136.435  55.208  1.00 95.97           O  
ATOM   5164  O5'  DG J  33      90.320 135.358  57.398  1.00 96.36           O  
ATOM   5165  C5'  DG J  33      91.007 135.320  58.646  1.00 96.58           C  
ATOM   5166  C4'  DG J  33      90.020 135.456  59.779  1.00 96.57           C  
ATOM   5167  O4'  DG J  33      89.364 136.742  59.672  1.00 97.35           O  
ATOM   5168  C3'  DG J  33      88.903 134.416  59.754  1.00 96.33           C  
ATOM   5169  O3'  DG J  33      88.508 134.104  61.088  1.00 96.37           O  
ATOM   5170  C2'  DG J  33      87.777 135.130  59.032  1.00 96.92           C  
ATOM   5171  C1'  DG J  33      87.966 136.569  59.481  1.00 97.70           C  
ATOM   5172  N9   DG J  33      87.526 137.558  58.503  1.00 97.53           N  
ATOM   5173  C8   DG J  33      87.872 137.616  57.176  1.00 97.75           C  
ATOM   5174  N7   DG J  33      87.332 138.623  56.548  1.00 98.21           N  
ATOM   5175  C5   DG J  33      86.581 139.270  57.519  1.00 98.17           C  
ATOM   5176  C6   DG J  33      85.771 140.435  57.432  1.00 98.16           C  
ATOM   5177  O6   DG J  33      85.557 141.157  56.448  1.00 97.44           O  
ATOM   5178  N1   DG J  33      85.182 140.737  58.655  1.00 97.74           N  
ATOM   5179  C2   DG J  33      85.349 140.016  59.812  1.00 98.36           C  
ATOM   5180  N2   DG J  33      84.689 140.466  60.889  1.00 99.33           N  
ATOM   5181  N3   DG J  33      86.105 138.935  59.907  1.00 98.19           N  
ATOM   5182  C4   DG J  33      86.686 138.622  58.731  1.00 97.74           C  
ATOM   5183  P    DA J  34      87.728 132.736  61.384  1.00 96.58           P  
ATOM   5184  OP1  DA J  34      88.682 131.807  62.040  1.00 95.92           O  
ATOM   5185  OP2  DA J  34      87.031 132.320  60.139  1.00 96.60           O  
ATOM   5186  O5'  DA J  34      86.632 133.158  62.454  1.00 95.68           O  
ATOM   5187  C5'  DA J  34      87.006 133.826  63.655  1.00 94.80           C  
ATOM   5188  C4'  DA J  34      85.782 134.401  64.326  1.00 93.75           C  
ATOM   5189  O4'  DA J  34      85.284 135.513  63.545  1.00 93.11           O  
ATOM   5190  C3'  DA J  34      84.627 133.408  64.433  1.00 93.24           C  
ATOM   5191  O3'  DA J  34      83.944 133.574  65.678  1.00 92.16           O  
ATOM   5192  C2'  DA J  34      83.745 133.758  63.247  1.00 93.16           C  
ATOM   5193  C1'  DA J  34      83.964 135.255  63.084  1.00 93.06           C  
ATOM   5194  N9   DA J  34      83.877 135.739  61.704  1.00 92.80           N  
ATOM   5195  C8   DA J  34      84.522 135.236  60.600  1.00 92.60           C  
ATOM   5196  N7   DA J  34      84.274 135.898  59.495  1.00 92.10           N  
ATOM   5197  C5   DA J  34      83.402 136.900  59.894  1.00 92.17           C  
ATOM   5198  C6   DA J  34      82.774 137.944  59.189  1.00 92.09           C  
ATOM   5199  N6   DA J  34      82.943 138.163  57.882  1.00 91.52           N  
ATOM   5200  N1   DA J  34      81.961 138.770  59.882  1.00 91.12           N  
ATOM   5201  C2   DA J  34      81.803 138.558  61.194  1.00 91.88           C  
ATOM   5202  N3   DA J  34      82.342 137.617  61.970  1.00 92.38           N  
ATOM   5203  C4   DA J  34      83.142 136.810  61.251  1.00 92.66           C  
ATOM   5204  P    DC J  35      82.605 132.738  65.963  1.00 92.28           P  
ATOM   5205  OP1  DC J  35      82.330 132.790  67.421  1.00 91.71           O  
ATOM   5206  OP2  DC J  35      82.711 131.421  65.281  1.00 92.42           O  
ATOM   5207  O5'  DC J  35      81.490 133.596  65.224  1.00 90.36           O  
ATOM   5208  C5'  DC J  35      81.220 134.928  65.640  1.00 85.82           C  
ATOM   5209  C4'  DC J  35      79.864 135.359  65.140  1.00 83.51           C  
ATOM   5210  O4'  DC J  35      79.946 135.761  63.754  1.00 83.95           O  
ATOM   5211  C3'  DC J  35      78.800 134.263  65.212  1.00 81.84           C  
ATOM   5212  O3'  DC J  35      77.574 134.816  65.677  1.00 79.16           O  
ATOM   5213  C2'  DC J  35      78.661 133.810  63.769  1.00 82.91           C  
ATOM   5214  C1'  DC J  35      78.942 135.094  63.008  1.00 83.74           C  
ATOM   5215  N1   DC J  35      79.439 134.925  61.634  1.00 83.22           N  
ATOM   5216  C2   DC J  35      79.191 135.940  60.704  1.00 82.96           C  
ATOM   5217  O2   DC J  35      78.562 136.944  61.068  1.00 82.11           O  
ATOM   5218  N3   DC J  35      79.642 135.803  59.437  1.00 83.30           N  
ATOM   5219  C4   DC J  35      80.315 134.705  59.085  1.00 83.51           C  
ATOM   5220  N4   DC J  35      80.736 134.608  57.824  1.00 84.07           N  
ATOM   5221  C5   DC J  35      80.583 133.656  60.013  1.00 83.47           C  
ATOM   5222  C6   DC J  35      80.131 133.806  61.264  1.00 83.19           C  
ATOM   5223  P    DA J  36      77.061 134.468  67.154  1.00 78.17           P  
ATOM   5224  OP1  DA J  36      78.248 134.519  68.043  1.00 78.20           O  
ATOM   5225  OP2  DA J  36      76.235 133.236  67.097  1.00 79.32           O  
ATOM   5226  O5'  DA J  36      76.121 135.699  67.519  1.00 78.15           O  
ATOM   5227  C5'  DA J  36      76.662 137.014  67.597  1.00 75.84           C  
ATOM   5228  C4'  DA J  36      75.945 137.935  66.638  1.00 73.99           C  
ATOM   5229  O4'  DA J  36      76.139 137.468  65.282  1.00 73.79           O  
ATOM   5230  C3'  DA J  36      74.435 138.020  66.840  1.00 72.70           C  
ATOM   5231  O3'  DA J  36      73.998 139.359  66.614  1.00 71.91           O  
ATOM   5232  C2'  DA J  36      73.880 137.085  65.784  1.00 72.54           C  
ATOM   5233  C1'  DA J  36      74.889 137.211  64.661  1.00 73.28           C  
ATOM   5234  N9   DA J  36      75.034 135.994  63.863  1.00 75.10           N  
ATOM   5235  C8   DA J  36      74.908 134.694  64.290  1.00 75.56           C  
ATOM   5236  N7   DA J  36      75.097 133.807  63.344  1.00 76.23           N  
ATOM   5237  C5   DA J  36      75.367 134.572  62.218  1.00 76.38           C  
ATOM   5238  C6   DA J  36      75.656 134.225  60.889  1.00 77.47           C  
ATOM   5239  N6   DA J  36      75.732 132.967  60.455  1.00 78.23           N  
ATOM   5240  N1   DA J  36      75.868 135.229  60.009  1.00 77.72           N  
ATOM   5241  C2   DA J  36      75.797 136.491  60.449  1.00 76.71           C  
ATOM   5242  N3   DA J  36      75.539 136.943  61.674  1.00 76.81           N  
ATOM   5243  C4   DA J  36      75.329 135.921  62.522  1.00 76.08           C  
ATOM   5244  P    DC J  37      72.440 139.716  66.727  1.00 72.11           P  
ATOM   5245  OP1  DC J  37      72.345 141.120  67.204  1.00 71.17           O  
ATOM   5246  OP2  DC J  37      71.743 138.635  67.470  1.00 70.89           O  
ATOM   5247  O5'  DC J  37      71.954 139.677  65.215  1.00 70.68           O  
ATOM   5248  C5'  DC J  37      72.535 140.544  64.251  1.00 69.27           C  
ATOM   5249  C4'  DC J  37      71.817 140.401  62.933  1.00 69.16           C  
ATOM   5250  O4'  DC J  37      72.196 139.154  62.305  1.00 68.91           O  
ATOM   5251  C3'  DC J  37      70.295 140.374  63.061  1.00 69.70           C  
ATOM   5252  O3'  DC J  37      69.711 141.099  61.978  1.00 69.45           O  
ATOM   5253  C2'  DC J  37      69.961 138.896  62.953  1.00 70.34           C  
ATOM   5254  C1'  DC J  37      71.035 138.400  62.000  1.00 71.48           C  
ATOM   5255  N1   DC J  37      71.382 136.973  62.116  1.00 73.52           N  
ATOM   5256  C2   DC J  37      71.696 136.269  60.954  1.00 75.29           C  
ATOM   5257  O2   DC J  37      71.654 136.862  59.871  1.00 77.54           O  
ATOM   5258  N3   DC J  37      72.035 134.964  61.039  1.00 75.80           N  
ATOM   5259  C4   DC J  37      72.061 134.359  62.227  1.00 76.37           C  
ATOM   5260  N4   DC J  37      72.410 133.070  62.264  1.00 76.35           N  
ATOM   5261  C5   DC J  37      71.734 135.050  63.431  1.00 75.44           C  
ATOM   5262  C6   DC J  37      71.404 136.345  63.330  1.00 74.82           C  
ATOM   5263  P    DA J  38      68.194 141.620  62.085  1.00 69.56           P  
ATOM   5264  OP1  DA J  38      68.206 142.956  62.730  1.00 68.16           O  
ATOM   5265  OP2  DA J  38      67.336 140.539  62.643  1.00 68.17           O  
ATOM   5266  O5'  DA J  38      67.793 141.823  60.563  1.00 70.14           O  
ATOM   5267  C5'  DA J  38      68.778 142.164  59.595  1.00 69.57           C  
ATOM   5268  C4'  DA J  38      68.567 141.352  58.339  1.00 69.87           C  
ATOM   5269  O4'  DA J  38      69.028 139.995  58.544  1.00 69.45           O  
ATOM   5270  C3'  DA J  38      67.100 141.249  57.929  1.00 69.67           C  
ATOM   5271  O3'  DA J  38      66.957 141.381  56.516  1.00 68.57           O  
ATOM   5272  C2'  DA J  38      66.696 139.859  58.386  1.00 70.03           C  
ATOM   5273  C1'  DA J  38      67.989 139.078  58.246  1.00 71.37           C  
ATOM   5274  N9   DA J  38      68.111 137.953  59.172  1.00 73.61           N  
ATOM   5275  C8   DA J  38      67.827 137.940  60.515  1.00 75.48           C  
ATOM   5276  N7   DA J  38      68.051 136.786  61.093  1.00 75.38           N  
ATOM   5277  C5   DA J  38      68.512 135.982  60.062  1.00 75.49           C  
ATOM   5278  C6   DA J  38      68.930 134.642  60.027  1.00 75.66           C  
ATOM   5279  N6   DA J  38      68.964 133.852  61.102  1.00 74.36           N  
ATOM   5280  N1   DA J  38      69.322 134.138  58.836  1.00 76.19           N  
ATOM   5281  C2   DA J  38      69.298 134.939  57.763  1.00 76.45           C  
ATOM   5282  N3   DA J  38      68.933 136.218  57.671  1.00 75.72           N  
ATOM   5283  C4   DA J  38      68.546 136.685  58.870  1.00 74.65           C  
ATOM   5284  P    DC J  39      65.492 141.362  55.869  1.00 67.61           P  
ATOM   5285  OP1  DC J  39      65.394 142.447  54.865  1.00 69.80           O  
ATOM   5286  OP2  DC J  39      64.504 141.295  56.972  1.00 66.94           O  
ATOM   5287  O5'  DC J  39      65.482 139.981  55.094  1.00 70.55           O  
ATOM   5288  C5'  DC J  39      66.617 139.572  54.336  1.00 73.81           C  
ATOM   5289  C4'  DC J  39      66.373 138.197  53.769  1.00 76.07           C  
ATOM   5290  O4'  DC J  39      66.623 137.180  54.771  1.00 76.37           O  
ATOM   5291  C3'  DC J  39      64.919 138.026  53.343  1.00 77.47           C  
ATOM   5292  O3'  DC J  39      64.847 137.269  52.146  1.00 79.39           O  
ATOM   5293  C2'  DC J  39      64.299 137.264  54.499  1.00 77.08           C  
ATOM   5294  C1'  DC J  39      65.455 136.400  54.966  1.00 77.21           C  
ATOM   5295  N1   DC J  39      65.402 136.003  56.382  1.00 78.24           N  
ATOM   5296  C2   DC J  39      66.143 134.897  56.790  1.00 79.43           C  
ATOM   5297  O2   DC J  39      66.831 134.300  55.951  1.00 80.97           O  
ATOM   5298  N3   DC J  39      66.095 134.503  58.083  1.00 80.16           N  
ATOM   5299  C4   DC J  39      65.343 135.176  58.956  1.00 79.98           C  
ATOM   5300  N4   DC J  39      65.323 134.752  60.224  1.00 79.61           N  
ATOM   5301  C5   DC J  39      64.579 136.315  58.569  1.00 79.33           C  
ATOM   5302  C6   DC J  39      64.639 136.691  57.284  1.00 78.94           C  
ATOM   5303  P    DT J  40      63.522 137.331  51.254  1.00 81.21           P  
ATOM   5304  OP1  DT J  40      63.741 138.318  50.162  1.00 79.78           O  
ATOM   5305  OP2  DT J  40      62.351 137.473  52.156  1.00 80.14           O  
ATOM   5306  O5'  DT J  40      63.484 135.881  50.614  1.00 82.53           O  
ATOM   5307  C5'  DT J  40      64.692 135.170  50.375  1.00 85.19           C  
ATOM   5308  C4'  DT J  40      64.442 133.693  50.533  1.00 87.78           C  
ATOM   5309  O4'  DT J  40      64.485 133.331  51.935  1.00 88.27           O  
ATOM   5310  C3'  DT J  40      63.055 133.306  50.027  1.00 88.89           C  
ATOM   5311  O3'  DT J  40      63.098 132.108  49.263  1.00 91.04           O  
ATOM   5312  C2'  DT J  40      62.242 133.119  51.296  1.00 89.09           C  
ATOM   5313  C1'  DT J  40      63.285 132.672  52.305  1.00 89.23           C  
ATOM   5314  N1   DT J  40      62.975 133.045  53.700  1.00 89.78           N  
ATOM   5315  C2   DT J  40      63.359 132.193  54.710  1.00 90.70           C  
ATOM   5316  O2   DT J  40      63.951 131.144  54.512  1.00 92.00           O  
ATOM   5317  N3   DT J  40      63.022 132.615  55.973  1.00 90.89           N  
ATOM   5318  C4   DT J  40      62.361 133.778  56.317  1.00 90.74           C  
ATOM   5319  O4   DT J  40      62.133 134.027  57.499  1.00 91.02           O  
ATOM   5320  C5   DT J  40      61.988 134.623  55.208  1.00 90.23           C  
ATOM   5321  C7   DT J  40      61.262 135.901  55.482  1.00 90.48           C  
ATOM   5322  C6   DT J  40      62.312 134.220  53.973  1.00 90.31           C  
ATOM   5323  P    DT J  41      61.780 131.626  48.495  1.00 92.97           P  
ATOM   5324  OP1  DT J  41      62.201 131.011  47.211  1.00 92.59           O  
ATOM   5325  OP2  DT J  41      60.803 132.748  48.485  1.00 92.27           O  
ATOM   5326  O5'  DT J  41      61.224 130.488  49.455  1.00 93.78           O  
ATOM   5327  C5'  DT J  41      62.032 129.362  49.773  1.00 96.54           C  
ATOM   5328  C4'  DT J  41      61.222 128.342  50.533  1.00 98.90           C  
ATOM   5329  O4'  DT J  41      61.179 128.666  51.944  1.00100.10           O  
ATOM   5330  C3'  DT J  41      59.772 128.248  50.064  1.00 99.44           C  
ATOM   5331  O3'  DT J  41      59.373 126.881  49.977  1.00 99.08           O  
ATOM   5332  C2'  DT J  41      59.000 128.980  51.148  1.00100.67           C  
ATOM   5333  C1'  DT J  41      59.832 128.695  52.390  1.00101.94           C  
ATOM   5334  N1   DT J  41      59.727 129.719  53.451  1.00104.42           N  
ATOM   5335  C2   DT J  41      59.983 129.336  54.749  1.00105.94           C  
ATOM   5336  O2   DT J  41      60.295 128.199  55.061  1.00107.38           O  
ATOM   5337  N3   DT J  41      59.857 130.342  55.678  1.00106.20           N  
ATOM   5338  C4   DT J  41      59.512 131.659  55.441  1.00106.39           C  
ATOM   5339  O4   DT J  41      59.432 132.449  56.377  1.00107.01           O  
ATOM   5340  C5   DT J  41      59.269 131.993  54.057  1.00105.98           C  
ATOM   5341  C7   DT J  41      58.906 133.401  53.706  1.00105.72           C  
ATOM   5342  C6   DT J  41      59.383 131.018  53.144  1.00105.40           C  
ATOM   5343  P    DT J  42      57.834 126.518  49.700  1.00 98.36           P  
ATOM   5344  OP1  DT J  42      57.817 125.237  48.951  1.00 99.33           O  
ATOM   5345  OP2  DT J  42      57.149 127.706  49.133  1.00 98.85           O  
ATOM   5346  O5'  DT J  42      57.266 126.253  51.161  1.00 96.69           O  
ATOM   5347  C5'  DT J  42      57.939 125.356  52.039  1.00 94.95           C  
ATOM   5348  C4'  DT J  42      57.124 125.140  53.291  1.00 94.69           C  
ATOM   5349  O4'  DT J  42      57.251 126.269  54.190  1.00 94.96           O  
ATOM   5350  C3'  DT J  42      55.628 124.962  53.032  1.00 94.29           C  
ATOM   5351  O3'  DT J  42      55.110 123.920  53.856  1.00 94.12           O  
ATOM   5352  C2'  DT J  42      55.036 126.296  53.451  1.00 94.42           C  
ATOM   5353  C1'  DT J  42      55.959 126.701  54.584  1.00 94.95           C  
ATOM   5354  N1   DT J  42      56.020 128.151  54.854  1.00 95.06           N  
ATOM   5355  C2   DT J  42      56.037 128.556  56.169  1.00 95.02           C  
ATOM   5356  O2   DT J  42      56.001 127.777  57.109  1.00 94.22           O  
ATOM   5357  N3   DT J  42      56.096 129.915  56.346  1.00 95.33           N  
ATOM   5358  C4   DT J  42      56.134 130.885  55.363  1.00 94.95           C  
ATOM   5359  O4   DT J  42      56.195 132.070  55.676  1.00 95.03           O  
ATOM   5360  C5   DT J  42      56.102 130.390  54.008  1.00 94.40           C  
ATOM   5361  C7   DT J  42      56.116 131.370  52.878  1.00 94.14           C  
ATOM   5362  C6   DT J  42      56.055 129.065  53.823  1.00 94.73           C  
ATOM   5363  P    DT J  43      53.584 123.460  53.687  1.00 93.30           P  
ATOM   5364  OP1  DT J  43      53.601 122.009  53.377  1.00 94.27           O  
ATOM   5365  OP2  DT J  43      52.895 124.402  52.767  1.00 93.55           O  
ATOM   5366  O5'  DT J  43      52.987 123.650  55.149  1.00 91.21           O  
ATOM   5367  C5'  DT J  43      53.601 123.016  56.265  1.00 89.28           C  
ATOM   5368  C4'  DT J  43      52.898 123.410  57.541  1.00 88.51           C  
ATOM   5369  O4'  DT J  43      53.219 124.783  57.880  1.00 89.42           O  
ATOM   5370  C3'  DT J  43      51.374 123.331  57.466  1.00 87.43           C  
ATOM   5371  O3'  DT J  43      50.859 122.779  58.677  1.00 86.39           O  
ATOM   5372  C2'  DT J  43      50.951 124.780  57.303  1.00 88.25           C  
ATOM   5373  C1'  DT J  43      52.023 125.525  58.077  1.00 89.03           C  
ATOM   5374  N1   DT J  43      52.250 126.906  57.596  1.00 89.23           N  
ATOM   5375  C2   DT J  43      52.326 127.928  58.524  1.00 88.59           C  
ATOM   5376  O2   DT J  43      52.242 127.750  59.728  1.00 87.40           O  
ATOM   5377  N3   DT J  43      52.507 129.177  57.981  1.00 88.15           N  
ATOM   5378  C4   DT J  43      52.615 129.499  56.639  1.00 87.90           C  
ATOM   5379  O4   DT J  43      52.760 130.671  56.298  1.00 87.58           O  
ATOM   5380  C5   DT J  43      52.539 128.381  55.729  1.00 87.53           C  
ATOM   5381  C7   DT J  43      52.653 128.634  54.260  1.00 87.28           C  
ATOM   5382  C6   DT J  43      52.367 127.159  56.245  1.00 88.23           C  
ATOM   5383  P    DT J  44      49.367 123.134  59.145  1.00 86.40           P  
ATOM   5384  OP1  DT J  44      48.891 122.007  59.985  1.00 87.81           O  
ATOM   5385  OP2  DT J  44      48.562 123.566  57.973  1.00 85.97           O  
ATOM   5386  O5'  DT J  44      49.580 124.394  60.092  1.00 86.50           O  
ATOM   5387  C5'  DT J  44      50.575 124.373  61.113  1.00 85.81           C  
ATOM   5388  C4'  DT J  44      50.281 125.440  62.139  1.00 85.82           C  
ATOM   5389  O4'  DT J  44      50.492 126.743  61.543  1.00 86.07           O  
ATOM   5390  C3'  DT J  44      48.835 125.426  62.631  1.00 85.64           C  
ATOM   5391  O3'  DT J  44      48.773 125.743  64.019  1.00 84.97           O  
ATOM   5392  C2'  DT J  44      48.170 126.511  61.805  1.00 86.01           C  
ATOM   5393  C1'  DT J  44      49.295 127.507  61.593  1.00 86.76           C  
ATOM   5394  N1   DT J  44      49.187 128.262  60.329  1.00 87.67           N  
ATOM   5395  C2   DT J  44      49.325 129.632  60.370  1.00 87.89           C  
ATOM   5396  O2   DT J  44      49.526 130.250  61.401  1.00 88.12           O  
ATOM   5397  N3   DT J  44      49.213 130.254  59.151  1.00 87.95           N  
ATOM   5398  C4   DT J  44      48.977 129.658  57.926  1.00 87.93           C  
ATOM   5399  O4   DT J  44      48.904 130.347  56.913  1.00 87.15           O  
ATOM   5400  C5   DT J  44      48.835 128.221  57.959  1.00 88.26           C  
ATOM   5401  C7   DT J  44      48.564 127.489  56.682  1.00 89.01           C  
ATOM   5402  C6   DT J  44      48.950 127.603  59.141  1.00 88.00           C  
ATOM   5403  P    DC J  45      47.349 125.792  64.759  1.00 84.91           P  
ATOM   5404  OP1  DC J  45      47.429 124.924  65.961  1.00 84.47           O  
ATOM   5405  OP2  DC J  45      46.281 125.563  63.753  1.00 84.78           O  
ATOM   5406  O5'  DC J  45      47.254 127.300  65.254  1.00 86.50           O  
ATOM   5407  C5'  DC J  45      48.409 127.956  65.766  1.00 85.90           C  
ATOM   5408  C4'  DC J  45      48.251 129.453  65.659  1.00 84.91           C  
ATOM   5409  O4'  DC J  45      48.236 129.858  64.268  1.00 84.93           O  
ATOM   5410  C3'  DC J  45      46.964 130.000  66.273  1.00 84.57           C  
ATOM   5411  O3'  DC J  45      47.261 131.226  66.941  1.00 84.06           O  
ATOM   5412  C2'  DC J  45      46.077 130.253  65.067  1.00 84.42           C  
ATOM   5413  C1'  DC J  45      47.100 130.676  64.031  1.00 85.22           C  
ATOM   5414  N1   DC J  45      46.701 130.511  62.623  1.00 85.40           N  
ATOM   5415  C2   DC J  45      46.632 131.646  61.804  1.00 85.71           C  
ATOM   5416  O2   DC J  45      46.868 132.761  62.298  1.00 85.57           O  
ATOM   5417  N3   DC J  45      46.307 131.501  60.501  1.00 85.06           N  
ATOM   5418  C4   DC J  45      46.047 130.290  60.009  1.00 85.52           C  
ATOM   5419  N4   DC J  45      45.750 130.193  58.710  1.00 85.52           N  
ATOM   5420  C5   DC J  45      46.084 129.122  60.824  1.00 85.60           C  
ATOM   5421  C6   DC J  45      46.413 129.277  62.113  1.00 86.00           C  
ATOM   5422  P    DT J  46      46.123 131.962  67.792  1.00 85.13           P  
ATOM   5423  OP1  DT J  46      46.769 132.471  69.030  1.00 83.83           O  
ATOM   5424  OP2  DT J  46      44.948 131.059  67.887  1.00 84.80           O  
ATOM   5425  O5'  DT J  46      45.718 133.206  66.883  1.00 83.57           O  
ATOM   5426  C5'  DT J  46      46.660 134.239  66.605  1.00 81.12           C  
ATOM   5427  C4'  DT J  46      45.999 135.356  65.833  1.00 79.40           C  
ATOM   5428  O4'  DT J  46      45.738 134.940  64.470  1.00 79.81           O  
ATOM   5429  C3'  DT J  46      44.656 135.819  66.403  1.00 77.75           C  
ATOM   5430  O3'  DT J  46      44.551 137.239  66.279  1.00 72.79           O  
ATOM   5431  C2'  DT J  46      43.647 135.154  65.483  1.00 79.06           C  
ATOM   5432  C1'  DT J  46      44.381 135.198  64.158  1.00 80.01           C  
ATOM   5433  N1   DT J  46      43.948 134.213  63.155  1.00 81.42           N  
ATOM   5434  C2   DT J  46      43.653 134.678  61.894  1.00 83.07           C  
ATOM   5435  O2   DT J  46      43.738 135.854  61.583  1.00 82.84           O  
ATOM   5436  N3   DT J  46      43.256 133.712  61.004  1.00 83.92           N  
ATOM   5437  C4   DT J  46      43.130 132.358  61.243  1.00 84.09           C  
ATOM   5438  O4   DT J  46      42.767 131.610  60.339  1.00 84.58           O  
ATOM   5439  C5   DT J  46      43.453 131.938  62.591  1.00 83.81           C  
ATOM   5440  C7   DT J  46      43.343 130.489  62.946  1.00 83.73           C  
ATOM   5441  C6   DT J  46      43.841 132.875  63.467  1.00 82.98           C  
ATOM   5442  P    DA J  47      44.680 138.165  67.584  1.00 70.18           P  
ATOM   5443  OP1  DA J  47      45.795 137.627  68.408  1.00 68.45           O  
ATOM   5444  OP2  DA J  47      43.336 138.338  68.188  1.00 70.96           O  
ATOM   5445  O5'  DA J  47      45.141 139.564  66.986  1.00 68.87           O  
ATOM   5446  C5'  DA J  47      46.330 139.655  66.210  1.00 65.40           C  
ATOM   5447  C4'  DA J  47      46.054 140.377  64.914  1.00 63.69           C  
ATOM   5448  O4'  DA J  47      45.100 139.623  64.127  1.00 64.65           O  
ATOM   5449  C3'  DA J  47      45.457 141.772  65.080  1.00 61.91           C  
ATOM   5450  O3'  DA J  47      46.023 142.650  64.107  1.00 56.01           O  
ATOM   5451  C2'  DA J  47      43.976 141.561  64.825  1.00 63.69           C  
ATOM   5452  C1'  DA J  47      43.974 140.431  63.813  1.00 66.56           C  
ATOM   5453  N9   DA J  47      42.786 139.580  63.879  1.00 70.51           N  
ATOM   5454  C8   DA J  47      41.967 139.357  64.962  1.00 71.81           C  
ATOM   5455  N7   DA J  47      40.977 138.533  64.715  1.00 72.95           N  
ATOM   5456  C5   DA J  47      41.155 138.189  63.382  1.00 72.40           C  
ATOM   5457  C6   DA J  47      40.434 137.344  62.519  1.00 72.39           C  
ATOM   5458  N6   DA J  47      39.347 136.661  62.887  1.00 71.50           N  
ATOM   5459  N1   DA J  47      40.874 137.223  61.249  1.00 72.16           N  
ATOM   5460  C2   DA J  47      41.963 137.909  60.880  1.00 72.94           C  
ATOM   5461  N3   DA J  47      42.726 138.731  61.597  1.00 72.64           N  
ATOM   5462  C4   DA J  47      42.262 138.830  62.854  1.00 71.90           C  
ATOM   5463  P    DC J  48      45.635 144.204  64.118  1.00 51.01           P  
ATOM   5464  OP1  DC J  48      46.887 144.959  63.861  1.00 51.19           O  
ATOM   5465  OP2  DC J  48      44.828 144.505  65.327  1.00 50.21           O  
ATOM   5466  O5'  DC J  48      44.685 144.347  62.852  1.00 51.52           O  
ATOM   5467  C5'  DC J  48      45.090 143.851  61.578  1.00 48.54           C  
ATOM   5468  C4'  DC J  48      43.932 143.901  60.611  1.00 48.73           C  
ATOM   5469  O4'  DC J  48      42.970 142.858  60.899  1.00 50.00           O  
ATOM   5470  C3'  DC J  48      43.142 145.209  60.632  1.00 49.43           C  
ATOM   5471  O3'  DC J  48      42.688 145.472  59.311  1.00 50.27           O  
ATOM   5472  C2'  DC J  48      41.940 144.864  61.489  1.00 48.21           C  
ATOM   5473  C1'  DC J  48      41.684 143.442  61.037  1.00 50.57           C  
ATOM   5474  N1   DC J  48      40.896 142.609  61.958  1.00 52.01           N  
ATOM   5475  C2   DC J  48      40.246 141.479  61.445  1.00 52.52           C  
ATOM   5476  O2   DC J  48      40.331 141.238  60.227  1.00 51.91           O  
ATOM   5477  N3   DC J  48      39.542 140.687  62.284  1.00 53.34           N  
ATOM   5478  C4   DC J  48      39.467 140.989  63.582  1.00 53.44           C  
ATOM   5479  N4   DC J  48      38.780 140.165  64.379  1.00 52.10           N  
ATOM   5480  C5   DC J  48      40.100 142.147  64.125  1.00 53.17           C  
ATOM   5481  C6   DC J  48      40.799 142.919  63.285  1.00 51.67           C  
ATOM   5482  P    DG J  49      42.381 146.974  58.850  1.00 49.20           P  
ATOM   5483  OP1  DG J  49      43.686 147.587  58.521  1.00 48.28           O  
ATOM   5484  OP2  DG J  49      41.478 147.633  59.828  1.00 48.74           O  
ATOM   5485  O5'  DG J  49      41.582 146.738  57.496  1.00 53.94           O  
ATOM   5486  C5'  DG J  49      42.069 145.805  56.530  1.00 57.23           C  
ATOM   5487  C4'  DG J  49      40.917 145.127  55.830  1.00 58.50           C  
ATOM   5488  O4'  DG J  49      40.301 144.166  56.721  1.00 58.08           O  
ATOM   5489  C3'  DG J  49      39.818 146.102  55.423  1.00 59.88           C  
ATOM   5490  O3'  DG J  49      39.272 145.767  54.152  1.00 61.12           O  
ATOM   5491  C2'  DG J  49      38.773 145.939  56.510  1.00 60.15           C  
ATOM   5492  C1'  DG J  49      38.929 144.483  56.918  1.00 60.71           C  
ATOM   5493  N9   DG J  49      38.617 144.264  58.327  1.00 61.86           N  
ATOM   5494  C8   DG J  49      39.165 144.930  59.396  1.00 62.18           C  
ATOM   5495  N7   DG J  49      38.679 144.547  60.543  1.00 61.56           N  
ATOM   5496  C5   DG J  49      37.759 143.562  60.217  1.00 61.60           C  
ATOM   5497  C6   DG J  49      36.917 142.787  61.050  1.00 60.36           C  
ATOM   5498  O6   DG J  49      36.823 142.809  62.281  1.00 59.80           O  
ATOM   5499  N1   DG J  49      36.131 141.913  60.309  1.00 59.72           N  
ATOM   5500  C2   DG J  49      36.160 141.790  58.942  1.00 60.64           C  
ATOM   5501  N2   DG J  49      35.331 140.879  58.417  1.00 62.00           N  
ATOM   5502  N3   DG J  49      36.944 142.506  58.151  1.00 61.46           N  
ATOM   5503  C4   DG J  49      37.711 143.369  58.852  1.00 62.00           C  
ATOM   5504  P    DA J  50      38.276 146.797  53.435  1.00 62.93           P  
ATOM   5505  OP1  DA J  50      38.783 147.009  52.060  1.00 63.45           O  
ATOM   5506  OP2  DA J  50      38.082 147.959  54.336  1.00 63.40           O  
ATOM   5507  O5'  DA J  50      36.884 146.026  53.371  1.00 67.27           O  
ATOM   5508  C5'  DA J  50      36.734 144.832  52.609  1.00 70.17           C  
ATOM   5509  C4'  DA J  50      35.331 144.294  52.764  1.00 72.84           C  
ATOM   5510  O4'  DA J  50      35.136 143.884  54.141  1.00 73.88           O  
ATOM   5511  C3'  DA J  50      34.224 145.305  52.461  1.00 74.67           C  
ATOM   5512  O3'  DA J  50      33.147 144.671  51.760  1.00 76.84           O  
ATOM   5513  C2'  DA J  50      33.786 145.777  53.835  1.00 74.91           C  
ATOM   5514  C1'  DA J  50      34.026 144.559  54.709  1.00 74.77           C  
ATOM   5515  N9   DA J  50      34.364 144.887  56.094  1.00 77.22           N  
ATOM   5516  C8   DA J  50      35.157 145.918  56.538  1.00 78.22           C  
ATOM   5517  N7   DA J  50      35.265 145.979  57.843  1.00 77.26           N  
ATOM   5518  C5   DA J  50      34.497 144.916  58.291  1.00 77.71           C  
ATOM   5519  C6   DA J  50      34.204 144.443  59.578  1.00 78.28           C  
ATOM   5520  N6   DA J  50      34.674 145.001  60.695  1.00 78.57           N  
ATOM   5521  N1   DA J  50      33.403 143.360  59.682  1.00 78.99           N  
ATOM   5522  C2   DA J  50      32.938 142.798  58.560  1.00 78.78           C  
ATOM   5523  N3   DA J  50      33.145 143.148  57.293  1.00 79.60           N  
ATOM   5524  C4   DA J  50      33.941 144.229  57.225  1.00 78.33           C  
ATOM   5525  P    DT J  51      31.798 145.492  51.450  1.00 77.13           P  
ATOM   5526  OP1  DT J  51      31.168 144.853  50.271  1.00 77.08           O  
ATOM   5527  OP2  DT J  51      32.104 146.940  51.418  1.00 78.32           O  
ATOM   5528  O5'  DT J  51      30.894 145.199  52.729  1.00 78.30           O  
ATOM   5529  C5'  DT J  51      30.691 143.857  53.161  1.00 79.69           C  
ATOM   5530  C4'  DT J  51      29.743 143.806  54.336  1.00 81.11           C  
ATOM   5531  O4'  DT J  51      30.417 144.119  55.581  1.00 81.07           O  
ATOM   5532  C3'  DT J  51      28.528 144.733  54.256  1.00 81.38           C  
ATOM   5533  O3'  DT J  51      27.365 144.009  54.669  1.00 82.33           O  
ATOM   5534  C2'  DT J  51      28.850 145.813  55.274  1.00 80.69           C  
ATOM   5535  C1'  DT J  51      29.610 145.017  56.319  1.00 81.22           C  
ATOM   5536  N1   DT J  51      30.484 145.797  57.221  1.00 81.44           N  
ATOM   5537  C2   DT J  51      30.562 145.404  58.541  1.00 80.54           C  
ATOM   5538  O2   DT J  51      29.968 144.437  58.985  1.00 79.61           O  
ATOM   5539  N3   DT J  51      31.369 146.188  59.326  1.00 80.35           N  
ATOM   5540  C4   DT J  51      32.094 147.296  58.934  1.00 80.44           C  
ATOM   5541  O4   DT J  51      32.771 147.904  59.758  1.00 80.31           O  
ATOM   5542  C5   DT J  51      31.978 147.645  57.535  1.00 80.58           C  
ATOM   5543  C7   DT J  51      32.735 148.827  57.017  1.00 79.63           C  
ATOM   5544  C6   DT J  51      31.190 146.888  56.759  1.00 81.46           C  
ATOM   5545  P    DC J  52      25.903 144.554  54.289  1.00 81.95           P  
ATOM   5546  OP1  DC J  52      25.258 143.519  53.443  1.00 82.54           O  
ATOM   5547  OP2  DC J  52      26.014 145.950  53.791  1.00 80.89           O  
ATOM   5548  O5'  DC J  52      25.170 144.584  55.699  1.00 82.37           O  
ATOM   5549  C5'  DC J  52      25.921 144.844  56.877  1.00 85.11           C  
ATOM   5550  C4'  DC J  52      25.043 144.739  58.099  1.00 86.61           C  
ATOM   5551  O4'  DC J  52      25.869 145.012  59.252  1.00 86.68           O  
ATOM   5552  C3'  DC J  52      23.914 145.764  58.143  1.00 87.46           C  
ATOM   5553  O3'  DC J  52      22.784 145.222  58.831  1.00 88.82           O  
ATOM   5554  C2'  DC J  52      24.526 146.927  58.899  1.00 86.91           C  
ATOM   5555  C1'  DC J  52      25.520 146.257  59.839  1.00 87.05           C  
ATOM   5556  N1   DC J  52      26.764 147.020  60.011  1.00 87.12           N  
ATOM   5557  C2   DC J  52      27.227 147.271  61.302  1.00 87.74           C  
ATOM   5558  O2   DC J  52      26.576 146.839  62.266  1.00 88.03           O  
ATOM   5559  N3   DC J  52      28.371 147.975  61.469  1.00 88.28           N  
ATOM   5560  C4   DC J  52      29.042 148.418  60.402  1.00 88.52           C  
ATOM   5561  N4   DC J  52      30.164 149.108  60.611  1.00 88.92           N  
ATOM   5562  C5   DC J  52      28.592 148.171  59.074  1.00 88.14           C  
ATOM   5563  C6   DC J  52      27.459 147.475  58.926  1.00 87.33           C  
ATOM   5564  P    DC J  53      21.340 145.898  58.647  1.00 90.35           P  
ATOM   5565  OP1  DC J  53      20.344 144.799  58.704  1.00 89.93           O  
ATOM   5566  OP2  DC J  53      21.371 146.800  57.466  1.00 88.86           O  
ATOM   5567  O5'  DC J  53      21.172 146.791  59.958  1.00 90.69           O  
ATOM   5568  C5'  DC J  53      21.071 146.179  61.243  1.00 90.76           C  
ATOM   5569  C4'  DC J  53      21.107 147.224  62.336  1.00 90.96           C  
ATOM   5570  O4'  DC J  53      22.416 147.842  62.397  1.00 90.30           O  
ATOM   5571  C3'  DC J  53      20.105 148.372  62.197  1.00 91.01           C  
ATOM   5572  O3'  DC J  53      19.620 148.726  63.494  1.00 91.19           O  
ATOM   5573  C2'  DC J  53      20.955 149.508  61.658  1.00 90.23           C  
ATOM   5574  C1'  DC J  53      22.270 149.253  62.370  1.00 89.07           C  
ATOM   5575  N1   DC J  53      23.460 149.821  61.720  1.00 87.86           N  
ATOM   5576  C2   DC J  53      24.411 150.464  62.517  1.00 87.43           C  
ATOM   5577  O2   DC J  53      24.217 150.537  63.740  1.00 86.55           O  
ATOM   5578  N3   DC J  53      25.515 150.989  61.937  1.00 86.88           N  
ATOM   5579  C4   DC J  53      25.685 150.888  60.617  1.00 87.25           C  
ATOM   5580  N4   DC J  53      26.791 151.417  60.086  1.00 86.30           N  
ATOM   5581  C5   DC J  53      24.730 150.238  59.781  1.00 87.35           C  
ATOM   5582  C6   DC J  53      23.642 149.725  60.369  1.00 87.55           C  
ATOM   5583  P    DG J  54      18.225 149.508  63.644  1.00 92.14           P  
ATOM   5584  OP1  DG J  54      17.150 148.548  63.289  1.00 94.05           O  
ATOM   5585  OP2  DG J  54      18.316 150.802  62.923  1.00 91.76           O  
ATOM   5586  O5'  DG J  54      18.146 149.801  65.208  1.00 91.27           O  
ATOM   5587  C5'  DG J  54      18.513 148.795  66.155  1.00 90.16           C  
ATOM   5588  C4'  DG J  54      19.363 149.390  67.255  1.00 89.42           C  
ATOM   5589  O4'  DG J  54      20.588 149.910  66.686  1.00 89.56           O  
ATOM   5590  C3'  DG J  54      18.724 150.555  68.010  1.00 88.64           C  
ATOM   5591  O3'  DG J  54      19.101 150.511  69.389  1.00 87.96           O  
ATOM   5592  C2'  DG J  54      19.306 151.780  67.329  1.00 88.44           C  
ATOM   5593  C1'  DG J  54      20.691 151.312  66.908  1.00 89.19           C  
ATOM   5594  N9   DG J  54      21.157 151.919  65.666  1.00 88.71           N  
ATOM   5595  C8   DG J  54      20.487 151.948  64.467  1.00 88.74           C  
ATOM   5596  N7   DG J  54      21.154 152.545  63.518  1.00 88.89           N  
ATOM   5597  C5   DG J  54      22.338 152.937  64.127  1.00 89.29           C  
ATOM   5598  C6   DG J  54      23.457 153.619  63.592  1.00 89.09           C  
ATOM   5599  O6   DG J  54      23.636 154.015  62.437  1.00 89.06           O  
ATOM   5600  N1   DG J  54      24.439 153.823  64.555  1.00 88.91           N  
ATOM   5601  C2   DG J  54      24.360 153.417  65.863  1.00 88.74           C  
ATOM   5602  N2   DG J  54      25.417 153.709  66.634  1.00 88.91           N  
ATOM   5603  N3   DG J  54      23.322 152.772  66.376  1.00 89.33           N  
ATOM   5604  C4   DG J  54      22.354 152.566  65.455  1.00 89.19           C  
ATOM   5605  P    DC J  55      18.495 151.591  70.411  1.00 87.43           P  
ATOM   5606  OP1  DC J  55      18.580 151.030  71.783  1.00 87.61           O  
ATOM   5607  OP2  DC J  55      17.185 152.043  69.880  1.00 88.35           O  
ATOM   5608  O5'  DC J  55      19.509 152.812  70.313  1.00 86.17           O  
ATOM   5609  C5'  DC J  55      20.874 152.658  70.687  1.00 83.00           C  
ATOM   5610  C4'  DC J  55      21.602 153.973  70.538  1.00 80.25           C  
ATOM   5611  O4'  DC J  55      21.721 154.305  69.133  1.00 79.84           O  
ATOM   5612  C3'  DC J  55      20.891 155.157  71.192  1.00 79.14           C  
ATOM   5613  O3'  DC J  55      21.861 156.050  71.736  1.00 79.60           O  
ATOM   5614  C2'  DC J  55      20.183 155.820  70.024  1.00 78.45           C  
ATOM   5615  C1'  DC J  55      21.185 155.597  68.907  1.00 78.68           C  
ATOM   5616  N1   DC J  55      20.651 155.636  67.535  1.00 78.00           N  
ATOM   5617  C2   DC J  55      21.542 155.863  66.483  1.00 78.43           C  
ATOM   5618  O2   DC J  55      22.745 156.014  66.741  1.00 80.05           O  
ATOM   5619  N3   DC J  55      21.074 155.911  65.215  1.00 77.79           N  
ATOM   5620  C4   DC J  55      19.771 155.743  64.980  1.00 78.08           C  
ATOM   5621  N4   DC J  55      19.352 155.803  63.713  1.00 77.20           N  
ATOM   5622  C5   DC J  55      18.840 155.507  66.034  1.00 77.57           C  
ATOM   5623  C6   DC J  55      19.319 155.461  67.285  1.00 77.44           C  
ATOM   5624  P    DA J  56      21.773 156.481  73.279  1.00 81.29           P  
ATOM   5625  OP1  DA J  56      22.376 155.386  74.083  1.00 79.65           O  
ATOM   5626  OP2  DA J  56      20.383 156.925  73.563  1.00 81.77           O  
ATOM   5627  O5'  DA J  56      22.733 157.749  73.369  1.00 79.77           O  
ATOM   5628  C5'  DA J  56      24.107 157.646  73.010  1.00 78.17           C  
ATOM   5629  C4'  DA J  56      24.493 158.770  72.076  1.00 77.15           C  
ATOM   5630  O4'  DA J  56      23.807 158.621  70.808  1.00 76.35           O  
ATOM   5631  C3'  DA J  56      24.156 160.174  72.578  1.00 76.04           C  
ATOM   5632  O3'  DA J  56      25.189 161.076  72.181  1.00 76.01           O  
ATOM   5633  C2'  DA J  56      22.882 160.511  71.825  1.00 76.35           C  
ATOM   5634  C1'  DA J  56      23.120 159.821  70.496  1.00 77.37           C  
ATOM   5635  N9   DA J  56      21.901 159.465  69.772  1.00 79.16           N  
ATOM   5636  C8   DA J  56      20.703 159.052  70.298  1.00 80.54           C  
ATOM   5637  N7   DA J  56      19.783 158.811  69.395  1.00 81.68           N  
ATOM   5638  C5   DA J  56      20.418 159.083  68.192  1.00 81.26           C  
ATOM   5639  C6   DA J  56      19.980 159.026  66.856  1.00 81.55           C  
ATOM   5640  N6   DA J  56      18.746 158.662  66.498  1.00 82.20           N  
ATOM   5641  N1   DA J  56      20.862 159.361  65.890  1.00 81.05           N  
ATOM   5642  C2   DA J  56      22.096 159.729  66.252  1.00 81.53           C  
ATOM   5643  N3   DA J  56      22.626 159.825  67.472  1.00 81.85           N  
ATOM   5644  C4   DA J  56      21.724 159.484  68.408  1.00 80.75           C  
ATOM   5645  P    DA J  57      25.959 161.953  73.286  1.00 74.44           P  
ATOM   5646  OP1  DA J  57      26.694 161.012  74.169  1.00 74.40           O  
ATOM   5647  OP2  DA J  57      25.015 162.936  73.877  1.00 74.29           O  
ATOM   5648  O5'  DA J  57      27.031 162.747  72.425  1.00 71.81           O  
ATOM   5649  C5'  DA J  57      27.915 162.046  71.561  1.00 69.98           C  
ATOM   5650  C4'  DA J  57      27.937 162.693  70.198  1.00 67.98           C  
ATOM   5651  O4'  DA J  57      26.683 162.475  69.508  1.00 68.46           O  
ATOM   5652  C3'  DA J  57      28.156 164.202  70.206  1.00 65.95           C  
ATOM   5653  O3'  DA J  57      29.008 164.541  69.120  1.00 64.43           O  
ATOM   5654  C2'  DA J  57      26.763 164.765  69.987  1.00 67.06           C  
ATOM   5655  C1'  DA J  57      26.116 163.712  69.107  1.00 68.06           C  
ATOM   5656  N9   DA J  57      24.666 163.595  69.260  1.00 71.10           N  
ATOM   5657  C8   DA J  57      23.953 163.494  70.428  1.00 71.50           C  
ATOM   5658  N7   DA J  57      22.662 163.349  70.249  1.00 72.86           N  
ATOM   5659  C5   DA J  57      22.513 163.363  68.870  1.00 73.13           C  
ATOM   5660  C6   DA J  57      21.387 163.233  68.038  1.00 74.08           C  
ATOM   5661  N6   DA J  57      20.147 163.039  68.493  1.00 75.25           N  
ATOM   5662  N1   DA J  57      21.581 163.301  66.705  1.00 74.40           N  
ATOM   5663  C2   DA J  57      22.826 163.476  66.247  1.00 74.29           C  
ATOM   5664  N3   DA J  57      23.964 163.599  66.926  1.00 73.71           N  
ATOM   5665  C4   DA J  57      23.737 163.531  68.248  1.00 72.61           C  
ATOM   5666  P    DG J  58      29.466 166.057  68.916  1.00 61.89           P  
ATOM   5667  OP1  DG J  58      30.882 166.003  68.478  1.00 65.45           O  
ATOM   5668  OP2  DG J  58      29.099 166.837  70.122  1.00 64.51           O  
ATOM   5669  O5'  DG J  58      28.572 166.551  67.698  1.00 62.34           O  
ATOM   5670  C5'  DG J  58      28.597 165.848  66.464  1.00 63.08           C  
ATOM   5671  C4'  DG J  58      27.568 166.409  65.512  1.00 63.43           C  
ATOM   5672  O4'  DG J  58      26.232 166.073  65.953  1.00 64.01           O  
ATOM   5673  C3'  DG J  58      27.582 167.926  65.324  1.00 63.72           C  
ATOM   5674  O3'  DG J  58      27.385 168.195  63.936  1.00 64.11           O  
ATOM   5675  C2'  DG J  58      26.382 168.387  66.134  1.00 64.10           C  
ATOM   5676  C1'  DG J  58      25.423 167.234  65.929  1.00 65.01           C  
ATOM   5677  N9   DG J  58      24.397 167.085  66.956  1.00 67.14           N  
ATOM   5678  C8   DG J  58      24.565 167.175  68.316  1.00 68.85           C  
ATOM   5679  N7   DG J  58      23.460 166.980  68.983  1.00 69.20           N  
ATOM   5680  C5   DG J  58      22.503 166.750  68.004  1.00 69.10           C  
ATOM   5681  C6   DG J  58      21.116 166.474  68.122  1.00 69.02           C  
ATOM   5682  O6   DG J  58      20.437 166.364  69.150  1.00 69.50           O  
ATOM   5683  N1   DG J  58      20.519 166.316  66.876  1.00 68.57           N  
ATOM   5684  C2   DG J  58      21.169 166.408  65.671  1.00 68.63           C  
ATOM   5685  N2   DG J  58      20.414 166.237  64.575  1.00 67.35           N  
ATOM   5686  N3   DG J  58      22.464 166.656  65.547  1.00 68.88           N  
ATOM   5687  C4   DG J  58      23.064 166.816  66.747  1.00 68.00           C  
ATOM   5688  P    DG J  59      27.124 169.694  63.433  1.00 62.60           P  
ATOM   5689  OP1  DG J  59      28.141 169.980  62.393  1.00 64.16           O  
ATOM   5690  OP2  DG J  59      26.989 170.601  64.598  1.00 62.24           O  
ATOM   5691  O5'  DG J  59      25.715 169.572  62.708  1.00 64.86           O  
ATOM   5692  C5'  DG J  59      25.438 168.454  61.865  1.00 68.23           C  
ATOM   5693  C4'  DG J  59      24.032 168.541  61.321  1.00 70.25           C  
ATOM   5694  O4'  DG J  59      23.078 168.294  62.381  1.00 70.31           O  
ATOM   5695  C3'  DG J  59      23.682 169.910  60.747  1.00 71.28           C  
ATOM   5696  O3'  DG J  59      22.870 169.767  59.583  1.00 72.70           O  
ATOM   5697  C2'  DG J  59      22.924 170.585  61.877  1.00 70.82           C  
ATOM   5698  C1'  DG J  59      22.231 169.420  62.564  1.00 70.54           C  
ATOM   5699  N9   DG J  59      22.046 169.597  64.001  1.00 70.77           N  
ATOM   5700  C8   DG J  59      23.014 169.902  64.926  1.00 71.17           C  
ATOM   5701  N7   DG J  59      22.557 169.960  66.146  1.00 70.34           N  
ATOM   5702  C5   DG J  59      21.205 169.682  66.019  1.00 71.19           C  
ATOM   5703  C6   DG J  59      20.191 169.588  67.005  1.00 71.32           C  
ATOM   5704  O6   DG J  59      20.290 169.729  68.231  1.00 71.73           O  
ATOM   5705  N1   DG J  59      18.957 169.292  66.440  1.00 71.32           N  
ATOM   5706  C2   DG J  59      18.726 169.102  65.102  1.00 72.34           C  
ATOM   5707  N2   DG J  59      17.460 168.821  64.753  1.00 73.29           N  
ATOM   5708  N3   DG J  59      19.664 169.179  64.172  1.00 72.95           N  
ATOM   5709  C4   DG J  59      20.871 169.470  64.699  1.00 71.48           C  
ATOM   5710  P    DG J  60      22.321 171.077  58.842  1.00 75.75           P  
ATOM   5711  OP1  DG J  60      21.778 170.656  57.522  1.00 74.08           O  
ATOM   5712  OP2  DG J  60      23.359 172.136  58.907  1.00 75.54           O  
ATOM   5713  O5'  DG J  60      21.106 171.524  59.764  1.00 77.48           O  
ATOM   5714  C5'  DG J  60      19.934 170.719  59.850  1.00 79.02           C  
ATOM   5715  C4'  DG J  60      18.817 171.500  60.498  1.00 79.36           C  
ATOM   5716  O4'  DG J  60      18.963 171.496  61.938  1.00 79.35           O  
ATOM   5717  C3'  DG J  60      18.759 172.967  60.077  1.00 79.78           C  
ATOM   5718  O3'  DG J  60      17.402 173.361  59.905  1.00 82.15           O  
ATOM   5719  C2'  DG J  60      19.356 173.694  61.267  1.00 79.26           C  
ATOM   5720  C1'  DG J  60      18.890 172.825  62.417  1.00 79.39           C  
ATOM   5721  N9   DG J  60      19.700 172.910  63.627  1.00 80.48           N  
ATOM   5722  C8   DG J  60      21.044 173.184  63.716  1.00 81.19           C  
ATOM   5723  N7   DG J  60      21.483 173.200  64.945  1.00 81.05           N  
ATOM   5724  C5   DG J  60      20.361 172.919  65.713  1.00 81.32           C  
ATOM   5725  C6   DG J  60      20.216 172.804  67.118  1.00 81.45           C  
ATOM   5726  O6   DG J  60      21.076 172.943  67.995  1.00 82.26           O  
ATOM   5727  N1   DG J  60      18.907 172.497  67.473  1.00 82.05           N  
ATOM   5728  C2   DG J  60      17.868 172.326  66.590  1.00 81.93           C  
ATOM   5729  N2   DG J  60      16.676 172.022  67.128  1.00 81.26           N  
ATOM   5730  N3   DG J  60      17.988 172.441  65.279  1.00 81.24           N  
ATOM   5731  C4   DG J  60      19.254 172.733  64.913  1.00 81.07           C  
ATOM   5732  P    DA J  61      17.060 174.696  59.088  1.00 83.29           P  
ATOM   5733  OP1  DA J  61      16.663 174.294  57.715  1.00 82.85           O  
ATOM   5734  OP2  DA J  61      18.165 175.670  59.280  1.00 82.38           O  
ATOM   5735  O5'  DA J  61      15.774 175.248  59.842  1.00 85.16           O  
ATOM   5736  C5'  DA J  61      14.750 174.357  60.270  1.00 86.97           C  
ATOM   5737  C4'  DA J  61      14.107 174.874  61.534  1.00 89.54           C  
ATOM   5738  O4'  DA J  61      14.970 174.652  62.678  1.00 90.24           O  
ATOM   5739  C3'  DA J  61      13.801 176.373  61.521  1.00 90.52           C  
ATOM   5740  O3'  DA J  61      12.527 176.609  62.120  1.00 91.75           O  
ATOM   5741  C2'  DA J  61      14.890 176.961  62.400  1.00 90.16           C  
ATOM   5742  C1'  DA J  61      15.068 175.856  63.420  1.00 90.06           C  
ATOM   5743  N9   DA J  61      16.343 175.855  64.136  1.00 90.29           N  
ATOM   5744  C8   DA J  61      17.614 176.001  63.634  1.00 89.98           C  
ATOM   5745  N7   DA J  61      18.552 175.960  64.551  1.00 88.65           N  
ATOM   5746  C5   DA J  61      17.852 175.772  65.735  1.00 88.82           C  
ATOM   5747  C6   DA J  61      18.269 175.648  67.073  1.00 88.21           C  
ATOM   5748  N6   DA J  61      19.544 175.699  67.461  1.00 87.25           N  
ATOM   5749  N1   DA J  61      17.316 175.468  68.013  1.00 88.50           N  
ATOM   5750  C2   DA J  61      16.035 175.423  67.627  1.00 88.77           C  
ATOM   5751  N3   DA J  61      15.520 175.531  66.404  1.00 89.34           N  
ATOM   5752  C4   DA J  61      16.492 175.704  65.494  1.00 89.39           C  
ATOM   5753  P    DT J  62      11.822 178.039  61.947  1.00 93.25           P  
ATOM   5754  OP1  DT J  62      10.455 177.782  61.423  1.00 92.06           O  
ATOM   5755  OP2  DT J  62      12.742 178.937  61.199  1.00 91.69           O  
ATOM   5756  O5'  DT J  62      11.700 178.575  63.442  1.00 91.48           O  
ATOM   5757  C5'  DT J  62      10.895 177.887  64.393  1.00 89.47           C  
ATOM   5758  C4'  DT J  62      11.021 178.528  65.755  1.00 88.12           C  
ATOM   5759  O4'  DT J  62      12.327 178.252  66.320  1.00 88.13           O  
ATOM   5760  C3'  DT J  62      10.856 180.048  65.784  1.00 87.08           C  
ATOM   5761  O3'  DT J  62      10.061 180.418  66.919  1.00 85.51           O  
ATOM   5762  C2'  DT J  62      12.284 180.555  65.910  1.00 86.96           C  
ATOM   5763  C1'  DT J  62      12.933 179.465  66.742  1.00 87.40           C  
ATOM   5764  N1   DT J  62      14.396 179.330  66.578  1.00 87.34           N  
ATOM   5765  C2   DT J  62      15.154 179.130  67.710  1.00 87.32           C  
ATOM   5766  O2   DT J  62      14.677 179.062  68.830  1.00 88.61           O  
ATOM   5767  N3   DT J  62      16.502 179.009  67.483  1.00 87.03           N  
ATOM   5768  C4   DT J  62      17.153 179.062  66.266  1.00 85.98           C  
ATOM   5769  O4   DT J  62      18.373 178.930  66.218  1.00 83.99           O  
ATOM   5770  C5   DT J  62      16.300 179.275  65.120  1.00 86.31           C  
ATOM   5771  C7   DT J  62      16.919 179.346  63.760  1.00 86.80           C  
ATOM   5772  C6   DT J  62      14.981 179.399  65.331  1.00 86.99           C  
ATOM   5773  P    DA J  63      10.049 181.942  67.435  1.00 84.49           P  
ATOM   5774  OP1  DA J  63       8.663 182.248  67.868  1.00 83.96           O  
ATOM   5775  OP2  DA J  63      10.709 182.808  66.423  1.00 83.70           O  
ATOM   5776  O5'  DA J  63      10.964 181.881  68.736  1.00 82.18           O  
ATOM   5777  C5'  DA J  63      10.791 180.825  69.681  1.00 81.25           C  
ATOM   5778  C4'  DA J  63      11.593 181.099  70.931  1.00 80.43           C  
ATOM   5779  O4'  DA J  63      13.004 180.902  70.676  1.00 80.04           O  
ATOM   5780  C3'  DA J  63      11.451 182.522  71.465  1.00 79.18           C  
ATOM   5781  O3'  DA J  63      11.438 182.504  72.893  1.00 76.85           O  
ATOM   5782  C2'  DA J  63      12.698 183.215  70.946  1.00 79.64           C  
ATOM   5783  C1'  DA J  63      13.723 182.093  70.966  1.00 80.26           C  
ATOM   5784  N9   DA J  63      14.788 182.223  69.971  1.00 79.59           N  
ATOM   5785  C8   DA J  63      14.656 182.377  68.614  1.00 78.67           C  
ATOM   5786  N7   DA J  63      15.798 182.445  67.976  1.00 78.92           N  
ATOM   5787  C5   DA J  63      16.748 182.334  68.981  1.00 78.59           C  
ATOM   5788  C6   DA J  63      18.155 182.329  68.958  1.00 78.13           C  
ATOM   5789  N6   DA J  63      18.876 182.433  67.841  1.00 77.39           N  
ATOM   5790  N1   DA J  63      18.803 182.206  70.136  1.00 78.46           N  
ATOM   5791  C2   DA J  63      18.078 182.090  71.255  1.00 78.87           C  
ATOM   5792  N3   DA J  63      16.753 182.074  71.405  1.00 78.88           N  
ATOM   5793  C4   DA J  63      16.141 182.203  70.216  1.00 78.60           C  
ATOM   5794  P    DT J  64      11.276 183.880  73.699  1.00 77.07           P  
ATOM   5795  OP1  DT J  64      10.311 183.634  74.799  1.00 76.81           O  
ATOM   5796  OP2  DT J  64      11.024 184.978  72.725  1.00 75.43           O  
ATOM   5797  O5'  DT J  64      12.713 184.102  74.349  1.00 74.36           O  
ATOM   5798  C5'  DT J  64      13.250 183.140  75.246  1.00 69.90           C  
ATOM   5799  C4'  DT J  64      14.528 183.652  75.864  1.00 67.77           C  
ATOM   5800  O4'  DT J  64      15.593 183.641  74.884  1.00 68.63           O  
ATOM   5801  C3'  DT J  64      14.466 185.075  76.415  1.00 66.66           C  
ATOM   5802  O3'  DT J  64      15.132 185.114  77.683  1.00 64.78           O  
ATOM   5803  C2'  DT J  64      15.190 185.898  75.363  1.00 66.52           C  
ATOM   5804  C1'  DT J  64      16.217 184.916  74.827  1.00 67.69           C  
ATOM   5805  N1   DT J  64      16.637 185.150  73.428  1.00 67.04           N  
ATOM   5806  C2   DT J  64      17.952 184.910  73.093  1.00 67.06           C  
ATOM   5807  O2   DT J  64      18.796 184.554  73.902  1.00 67.78           O  
ATOM   5808  N3   DT J  64      18.249 185.109  71.768  1.00 66.58           N  
ATOM   5809  C4   DT J  64      17.387 185.523  70.772  1.00 66.46           C  
ATOM   5810  O4   DT J  64      17.791 185.629  69.618  1.00 64.72           O  
ATOM   5811  C5   DT J  64      16.034 185.790  71.201  1.00 66.89           C  
ATOM   5812  C7   DT J  64      15.038 186.282  70.199  1.00 67.87           C  
ATOM   5813  C6   DT J  64      15.730 185.587  72.488  1.00 66.69           C  
ATOM   5814  P    DT J  65      15.825 186.470  78.187  1.00 61.24           P  
ATOM   5815  OP1  DT J  65      15.984 186.330  79.652  1.00 65.18           O  
ATOM   5816  OP2  DT J  65      15.105 187.643  77.634  1.00 63.57           O  
ATOM   5817  O5'  DT J  65      17.274 186.374  77.545  1.00 63.12           O  
ATOM   5818  C5'  DT J  65      17.999 185.149  77.640  1.00 64.07           C  
ATOM   5819  C4'  DT J  65      19.482 185.393  77.497  1.00 62.76           C  
ATOM   5820  O4'  DT J  65      19.818 185.619  76.109  1.00 61.13           O  
ATOM   5821  C3'  DT J  65      20.036 186.583  78.278  1.00 61.41           C  
ATOM   5822  O3'  DT J  65      21.278 186.197  78.873  1.00 61.54           O  
ATOM   5823  C2'  DT J  65      20.218 187.652  77.211  1.00 60.02           C  
ATOM   5824  C1'  DT J  65      20.535 186.833  75.969  1.00 60.03           C  
ATOM   5825  N1   DT J  65      20.120 187.433  74.692  1.00 59.87           N  
ATOM   5826  C2   DT J  65      21.049 187.516  73.676  1.00 58.94           C  
ATOM   5827  O2   DT J  65      22.210 187.156  73.801  1.00 56.28           O  
ATOM   5828  N3   DT J  65      20.565 188.041  72.501  1.00 59.05           N  
ATOM   5829  C4   DT J  65      19.278 188.485  72.251  1.00 58.77           C  
ATOM   5830  O4   DT J  65      18.983 188.917  71.140  1.00 57.60           O  
ATOM   5831  C5   DT J  65      18.365 188.388  73.369  1.00 58.01           C  
ATOM   5832  C7   DT J  65      16.956 188.855  73.199  1.00 56.17           C  
ATOM   5833  C6   DT J  65      18.827 187.878  74.518  1.00 59.08           C  
ATOM   5834  P    DT J  66      22.233 187.302  79.536  1.00 61.11           P  
ATOM   5835  OP1  DT J  66      23.045 186.584  80.551  1.00 60.75           O  
ATOM   5836  OP2  DT J  66      21.443 188.494  79.931  1.00 61.72           O  
ATOM   5837  O5'  DT J  66      23.189 187.715  78.334  1.00 63.01           O  
ATOM   5838  C5'  DT J  66      23.960 186.725  77.663  1.00 62.12           C  
ATOM   5839  C4'  DT J  66      24.995 187.375  76.779  1.00 63.00           C  
ATOM   5840  O4'  DT J  66      24.393 187.885  75.565  1.00 62.96           O  
ATOM   5841  C3'  DT J  66      25.736 188.548  77.416  1.00 63.19           C  
ATOM   5842  O3'  DT J  66      27.119 188.452  77.084  1.00 63.56           O  
ATOM   5843  C2'  DT J  66      25.104 189.766  76.761  1.00 62.59           C  
ATOM   5844  C1'  DT J  66      24.758 189.244  75.379  1.00 62.75           C  
ATOM   5845  N1   DT J  66      23.631 189.916  74.706  1.00 63.36           N  
ATOM   5846  C2   DT J  66      23.757 190.200  73.364  1.00 63.58           C  
ATOM   5847  O2   DT J  66      24.773 189.976  72.728  1.00 65.45           O  
ATOM   5848  N3   DT J  66      22.645 190.762  72.792  1.00 62.97           N  
ATOM   5849  C4   DT J  66      21.454 191.074  73.414  1.00 61.79           C  
ATOM   5850  O4   DT J  66      20.531 191.552  72.759  1.00 61.40           O  
ATOM   5851  C5   DT J  66      21.406 190.786  74.831  1.00 61.29           C  
ATOM   5852  C7   DT J  66      20.168 191.125  75.599  1.00 60.32           C  
ATOM   5853  C6   DT J  66      22.481 190.228  75.397  1.00 61.74           C  
ATOM   5854  P    DG J  67      28.163 189.487  77.718  1.00 64.17           P  
ATOM   5855  OP1  DG J  67      29.185 188.685  78.434  1.00 64.68           O  
ATOM   5856  OP2  DG J  67      27.416 190.546  78.444  1.00 64.55           O  
ATOM   5857  O5'  DG J  67      28.833 190.133  76.429  1.00 64.25           O  
ATOM   5858  C5'  DG J  67      29.228 189.306  75.338  1.00 63.23           C  
ATOM   5859  C4'  DG J  67      29.526 190.151  74.123  1.00 61.20           C  
ATOM   5860  O4'  DG J  67      28.291 190.628  73.532  1.00 59.34           O  
ATOM   5861  C3'  DG J  67      30.367 191.390  74.429  1.00 61.24           C  
ATOM   5862  O3'  DG J  67      31.366 191.573  73.422  1.00 63.86           O  
ATOM   5863  C2'  DG J  67      29.352 192.519  74.397  1.00 60.39           C  
ATOM   5864  C1'  DG J  67      28.357 192.033  73.359  1.00 58.20           C  
ATOM   5865  N9   DG J  67      27.013 192.581  73.528  1.00 56.68           N  
ATOM   5866  C8   DG J  67      26.303 192.678  74.700  1.00 56.74           C  
ATOM   5867  N7   DG J  67      25.150 193.271  74.553  1.00 55.42           N  
ATOM   5868  C5   DG J  67      25.087 193.571  73.201  1.00 54.50           C  
ATOM   5869  C6   DG J  67      24.073 194.228  72.450  1.00 54.47           C  
ATOM   5870  O6   DG J  67      22.999 194.691  72.844  1.00 53.07           O  
ATOM   5871  N1   DG J  67      24.415 194.322  71.105  1.00 54.29           N  
ATOM   5872  C2   DG J  67      25.577 193.844  70.553  1.00 53.03           C  
ATOM   5873  N2   DG J  67      25.721 194.024  69.235  1.00 54.29           N  
ATOM   5874  N3   DG J  67      26.527 193.235  71.241  1.00 53.19           N  
ATOM   5875  C4   DG J  67      26.220 193.136  72.550  1.00 54.14           C  
ATOM   5876  P    DG J  68      32.528 192.662  73.639  1.00 63.84           P  
ATOM   5877  OP1  DG J  68      33.828 192.005  73.349  1.00 64.43           O  
ATOM   5878  OP2  DG J  68      32.313 193.323  74.951  1.00 65.11           O  
ATOM   5879  O5'  DG J  68      32.221 193.733  72.508  1.00 64.47           O  
ATOM   5880  C5'  DG J  68      30.880 194.105  72.241  1.00 64.92           C  
ATOM   5881  C4'  DG J  68      30.771 194.763  70.890  1.00 65.06           C  
ATOM   5882  O4'  DG J  68      29.365 194.967  70.624  1.00 65.67           O  
ATOM   5883  C3'  DG J  68      31.416 196.142  70.828  1.00 65.86           C  
ATOM   5884  O3'  DG J  68      31.909 196.393  69.510  1.00 66.34           O  
ATOM   5885  C2'  DG J  68      30.269 197.072  71.174  1.00 66.70           C  
ATOM   5886  C1'  DG J  68      29.056 196.350  70.608  1.00 67.20           C  
ATOM   5887  N9   DG J  68      27.852 196.539  71.410  1.00 67.93           N  
ATOM   5888  C8   DG J  68      27.701 196.270  72.748  1.00 68.20           C  
ATOM   5889  N7   DG J  68      26.515 196.574  73.200  1.00 68.41           N  
ATOM   5890  C5   DG J  68      25.841 197.066  72.092  1.00 67.68           C  
ATOM   5891  C6   DG J  68      24.521 197.556  71.967  1.00 68.58           C  
ATOM   5892  O6   DG J  68      23.652 197.659  72.842  1.00 68.78           O  
ATOM   5893  N1   DG J  68      24.243 197.950  70.662  1.00 69.00           N  
ATOM   5894  C2   DG J  68      25.124 197.876  69.612  1.00 68.41           C  
ATOM   5895  N2   DG J  68      24.668 198.295  68.425  1.00 69.09           N  
ATOM   5896  N3   DG J  68      26.360 197.426  69.717  1.00 68.07           N  
ATOM   5897  C4   DG J  68      26.650 197.041  70.976  1.00 67.94           C  
ATOM   5898  P    DA J  69      32.589 197.807  69.169  1.00 66.50           P  
ATOM   5899  OP1  DA J  69      33.904 197.525  68.535  1.00 66.77           O  
ATOM   5900  OP2  DA J  69      32.525 198.668  70.379  1.00 66.50           O  
ATOM   5901  O5'  DA J  69      31.625 198.426  68.066  1.00 63.40           O  
ATOM   5902  C5'  DA J  69      31.168 197.634  66.977  1.00 61.90           C  
ATOM   5903  C4'  DA J  69      30.057 198.350  66.247  1.00 62.47           C  
ATOM   5904  O4'  DA J  69      28.904 198.479  67.111  1.00 63.16           O  
ATOM   5905  C3'  DA J  69      30.413 199.768  65.816  1.00 61.85           C  
ATOM   5906  O3'  DA J  69      29.782 200.055  64.570  1.00 59.96           O  
ATOM   5907  C2'  DA J  69      29.840 200.629  66.926  1.00 61.82           C  
ATOM   5908  C1'  DA J  69      28.599 199.852  67.331  1.00 63.28           C  
ATOM   5909  N9   DA J  69      28.219 199.999  68.737  1.00 63.80           N  
ATOM   5910  C8   DA J  69      28.983 199.728  69.845  1.00 64.33           C  
ATOM   5911  N7   DA J  69      28.355 199.913  70.979  1.00 64.27           N  
ATOM   5912  C5   DA J  69      27.094 200.345  70.594  1.00 64.72           C  
ATOM   5913  C6   DA J  69      25.952 200.700  71.329  1.00 64.72           C  
ATOM   5914  N6   DA J  69      25.890 200.664  72.660  1.00 64.89           N  
ATOM   5915  N1   DA J  69      24.860 201.094  70.641  1.00 65.32           N  
ATOM   5916  C2   DA J  69      24.918 201.118  69.306  1.00 65.31           C  
ATOM   5917  N3   DA J  69      25.929 200.799  68.500  1.00 66.14           N  
ATOM   5918  C4   DA J  69      27.001 200.416  69.216  1.00 64.85           C  
ATOM   5919  P    DG J  70      30.161 201.395  63.788  1.00 59.28           P  
ATOM   5920  OP1  DG J  70      30.133 201.090  62.332  1.00 59.55           O  
ATOM   5921  OP2  DG J  70      31.388 201.959  64.402  1.00 59.72           O  
ATOM   5922  O5'  DG J  70      28.953 202.370  64.125  1.00 61.02           O  
ATOM   5923  C5'  DG J  70      27.644 202.091  63.646  1.00 62.07           C  
ATOM   5924  C4'  DG J  70      26.674 203.134  64.145  1.00 62.25           C  
ATOM   5925  O4'  DG J  70      26.508 202.996  65.575  1.00 61.28           O  
ATOM   5926  C3'  DG J  70      27.114 204.580  63.913  1.00 63.26           C  
ATOM   5927  O3'  DG J  70      25.975 205.371  63.580  1.00 66.00           O  
ATOM   5928  C2'  DG J  70      27.654 204.998  65.267  1.00 61.87           C  
ATOM   5929  C1'  DG J  70      26.712 204.255  66.184  1.00 61.58           C  
ATOM   5930  N9   DG J  70      27.184 204.032  67.543  1.00 61.63           N  
ATOM   5931  C8   DG J  70      28.444 203.675  67.958  1.00 61.80           C  
ATOM   5932  N7   DG J  70      28.537 203.550  69.254  1.00 61.76           N  
ATOM   5933  C5   DG J  70      27.261 203.842  69.718  1.00 61.97           C  
ATOM   5934  C6   DG J  70      26.742 203.866  71.037  1.00 61.20           C  
ATOM   5935  O6   DG J  70      27.322 203.623  72.099  1.00 60.12           O  
ATOM   5936  N1   DG J  70      25.397 204.217  71.048  1.00 62.59           N  
ATOM   5937  C2   DG J  70      24.646 204.511  69.938  1.00 63.34           C  
ATOM   5938  N2   DG J  70      23.364 204.842  70.150  1.00 63.49           N  
ATOM   5939  N3   DG J  70      25.117 204.485  68.707  1.00 63.89           N  
ATOM   5940  C4   DG J  70      26.420 204.145  68.672  1.00 62.44           C  
ATOM   5941  P    DA J  71      26.150 206.942  63.300  1.00 70.94           P  
ATOM   5942  OP1  DA J  71      25.739 207.182  61.890  1.00 69.67           O  
ATOM   5943  OP2  DA J  71      27.499 207.368  63.757  1.00 70.62           O  
ATOM   5944  O5'  DA J  71      25.069 207.613  64.258  1.00 70.68           O  
ATOM   5945  C5'  DA J  71      23.694 207.249  64.169  1.00 72.95           C  
ATOM   5946  C4'  DA J  71      22.896 207.932  65.254  1.00 73.31           C  
ATOM   5947  O4'  DA J  71      23.345 207.469  66.550  1.00 74.05           O  
ATOM   5948  C3'  DA J  71      23.011 209.455  65.291  1.00 74.14           C  
ATOM   5949  O3'  DA J  71      21.745 210.006  65.668  1.00 75.64           O  
ATOM   5950  C2'  DA J  71      24.054 209.701  66.366  1.00 73.46           C  
ATOM   5951  C1'  DA J  71      23.787 208.565  67.338  1.00 74.63           C  
ATOM   5952  N9   DA J  71      24.965 208.126  68.085  1.00 75.54           N  
ATOM   5953  C8   DA J  71      26.169 207.702  67.578  1.00 75.94           C  
ATOM   5954  N7   DA J  71      27.040 207.362  68.497  1.00 75.98           N  
ATOM   5955  C5   DA J  71      26.365 207.576  69.690  1.00 76.20           C  
ATOM   5956  C6   DA J  71      26.742 207.405  71.032  1.00 75.77           C  
ATOM   5957  N6   DA J  71      27.939 206.952  71.410  1.00 76.17           N  
ATOM   5958  N1   DA J  71      25.837 207.718  71.985  1.00 75.21           N  
ATOM   5959  C2   DA J  71      24.635 208.167  71.602  1.00 75.35           C  
ATOM   5960  N3   DA J  71      24.160 208.366  70.373  1.00 75.66           N  
ATOM   5961  C4   DA J  71      25.086 208.049  69.452  1.00 76.07           C  
ATOM   5962  P    DT J  72      21.582 211.594  65.846  1.00 75.09           P  
ATOM   5963  OP1  DT J  72      20.282 211.960  65.225  1.00 75.27           O  
ATOM   5964  OP2  DT J  72      22.828 212.263  65.390  1.00 76.31           O  
ATOM   5965  O5'  DT J  72      21.463 211.777  67.424  1.00 74.00           O  
ATOM   5966  C5'  DT J  72      20.504 211.031  68.167  1.00 73.62           C  
ATOM   5967  C4'  DT J  72      20.516 211.454  69.617  1.00 73.68           C  
ATOM   5968  O4'  DT J  72      21.738 211.007  70.252  1.00 73.81           O  
ATOM   5969  C3'  DT J  72      20.455 212.964  69.845  1.00 74.56           C  
ATOM   5970  O3'  DT J  72      19.793 213.208  71.094  1.00 75.57           O  
ATOM   5971  C2'  DT J  72      21.918 213.333  70.018  1.00 73.18           C  
ATOM   5972  C1'  DT J  72      22.435 212.127  70.782  1.00 73.50           C  
ATOM   5973  N1   DT J  72      23.885 211.863  70.671  1.00 72.09           N  
ATOM   5974  C2   DT J  72      24.573 211.626  71.837  1.00 71.57           C  
ATOM   5975  O2   DT J  72      24.042 211.636  72.932  1.00 72.10           O  
ATOM   5976  N3   DT J  72      25.911 211.378  71.675  1.00 71.61           N  
ATOM   5977  C4   DT J  72      26.615 211.345  70.489  1.00 72.24           C  
ATOM   5978  O4   DT J  72      27.821 211.109  70.501  1.00 72.26           O  
ATOM   5979  C5   DT J  72      25.833 211.605  69.300  1.00 72.28           C  
ATOM   5980  C7   DT J  72      26.513 211.593  67.967  1.00 72.67           C  
ATOM   5981  C6   DT J  72      24.522 211.848  69.449  1.00 71.86           C  
TER    5982       DT J  72                                                      
ATOM   5983  N   PRO A  38      88.773 219.492  49.029  1.00 50.27           N  
ATOM   5984  CA  PRO A  38      89.072 218.139  48.500  1.00 48.65           C  
ATOM   5985  C   PRO A  38      87.822 217.451  47.954  1.00 47.93           C  
ATOM   5986  O   PRO A  38      86.724 217.617  48.487  1.00 47.64           O  
ATOM   5987  CB  PRO A  38      89.686 217.347  49.642  1.00 48.87           C  
ATOM   5988  CG  PRO A  38      89.094 218.061  50.853  1.00 48.58           C  
ATOM   5989  CD  PRO A  38      89.078 219.545  50.470  1.00 49.08           C  
ATOM   5990  N   HIS A  39      88.011 216.674  46.890  1.00 47.12           N  
ATOM   5991  CA  HIS A  39      86.930 215.957  46.219  1.00 44.74           C  
ATOM   5992  C   HIS A  39      86.050 215.122  47.130  1.00 44.62           C  
ATOM   5993  O   HIS A  39      86.503 214.596  48.146  1.00 44.52           O  
ATOM   5994  CB  HIS A  39      87.499 215.079  45.111  1.00 43.83           C  
ATOM   5995  CG  HIS A  39      86.475 214.225  44.437  1.00 43.86           C  
ATOM   5996  ND1 HIS A  39      86.072 213.008  44.943  1.00 43.09           N  
ATOM   5997  CD2 HIS A  39      85.748 214.426  43.312  1.00 44.16           C  
ATOM   5998  CE1 HIS A  39      85.141 212.497  44.158  1.00 42.82           C  
ATOM   5999  NE2 HIS A  39      84.925 213.337  43.162  1.00 43.25           N  
ATOM   6000  N   ARG A  40      84.784 214.999  46.740  1.00 44.49           N  
ATOM   6001  CA  ARG A  40      83.799 214.255  47.517  1.00 43.77           C  
ATOM   6002  C   ARG A  40      82.627 213.774  46.670  1.00 41.57           C  
ATOM   6003  O   ARG A  40      81.862 214.593  46.167  1.00 42.67           O  
ATOM   6004  CB  ARG A  40      83.237 215.156  48.611  1.00 44.31           C  
ATOM   6005  CG  ARG A  40      83.155 214.521  49.959  1.00 48.28           C  
ATOM   6006  CD  ARG A  40      84.275 215.023  50.841  1.00 50.87           C  
ATOM   6007  NE  ARG A  40      84.367 214.243  52.069  1.00 53.54           N  
ATOM   6008  CZ  ARG A  40      83.343 214.019  52.880  1.00 51.57           C  
ATOM   6009  NH1 ARG A  40      82.147 214.519  52.591  1.00 49.80           N  
ATOM   6010  NH2 ARG A  40      83.518 213.289  53.970  1.00 49.99           N  
ATOM   6011  N   TYR A  41      82.469 212.463  46.512  1.00 38.93           N  
ATOM   6012  CA  TYR A  41      81.316 211.962  45.755  1.00 36.12           C  
ATOM   6013  C   TYR A  41      80.081 212.128  46.636  1.00 33.85           C  
ATOM   6014  O   TYR A  41      80.158 212.026  47.854  1.00 33.69           O  
ATOM   6015  CB  TYR A  41      81.455 210.479  45.403  1.00 31.46           C  
ATOM   6016  CG  TYR A  41      82.629 210.141  44.522  1.00 29.89           C  
ATOM   6017  CD1 TYR A  41      83.773 209.555  45.056  1.00 28.06           C  
ATOM   6018  CD2 TYR A  41      82.596 210.402  43.151  1.00 29.35           C  
ATOM   6019  CE1 TYR A  41      84.853 209.235  44.253  1.00 32.46           C  
ATOM   6020  CE2 TYR A  41      83.673 210.086  42.335  1.00 28.46           C  
ATOM   6021  CZ  TYR A  41      84.797 209.504  42.892  1.00 32.43           C  
ATOM   6022  OH  TYR A  41      85.883 209.203  42.102  1.00 38.79           O  
ATOM   6023  N   ARG A  42      78.941 212.382  46.021  1.00 33.74           N  
ATOM   6024  CA  ARG A  42      77.708 212.535  46.772  1.00 34.15           C  
ATOM   6025  C   ARG A  42      77.350 211.192  47.416  1.00 32.44           C  
ATOM   6026  O   ARG A  42      77.692 210.131  46.899  1.00 30.63           O  
ATOM   6027  CB  ARG A  42      76.590 212.984  45.828  1.00 37.30           C  
ATOM   6028  CG  ARG A  42      76.971 214.202  44.998  1.00 43.74           C  
ATOM   6029  CD  ARG A  42      75.862 214.635  44.058  1.00 48.56           C  
ATOM   6030  NE  ARG A  42      74.692 215.135  44.769  1.00 51.33           N  
ATOM   6031  CZ  ARG A  42      73.577 215.534  44.169  1.00 54.16           C  
ATOM   6032  NH1 ARG A  42      73.489 215.488  42.847  1.00 56.90           N  
ATOM   6033  NH2 ARG A  42      72.551 215.978  44.885  1.00 56.38           N  
ATOM   6034  N   PRO A  43      76.673 211.221  48.568  1.00 32.24           N  
ATOM   6035  CA  PRO A  43      76.321 209.942  49.188  1.00 32.54           C  
ATOM   6036  C   PRO A  43      75.427 209.099  48.275  1.00 32.81           C  
ATOM   6037  O   PRO A  43      74.413 209.579  47.772  1.00 31.11           O  
ATOM   6038  CB  PRO A  43      75.621 210.367  50.481  1.00 32.53           C  
ATOM   6039  CG  PRO A  43      75.104 211.737  50.170  1.00 32.49           C  
ATOM   6040  CD  PRO A  43      76.232 212.352  49.399  1.00 30.90           C  
ATOM   6041  N   GLY A  44      75.820 207.845  48.049  1.00 33.32           N  
ATOM   6042  CA  GLY A  44      75.030 206.979  47.193  1.00 33.00           C  
ATOM   6043  C   GLY A  44      75.691 206.694  45.861  1.00 33.63           C  
ATOM   6044  O   GLY A  44      75.322 205.749  45.166  1.00 36.25           O  
ATOM   6045  N   THR A  45      76.668 207.516  45.496  1.00 32.38           N  
ATOM   6046  CA  THR A  45      77.383 207.332  44.245  1.00 29.53           C  
ATOM   6047  C   THR A  45      78.363 206.177  44.358  1.00 29.15           C  
ATOM   6048  O   THR A  45      78.523 205.397  43.425  1.00 28.80           O  
ATOM   6049  CB  THR A  45      78.121 208.612  43.856  1.00 27.87           C  
ATOM   6050  OG1 THR A  45      77.154 209.582  43.452  1.00 28.71           O  
ATOM   6051  CG2 THR A  45      79.088 208.366  42.700  1.00 26.04           C  
ATOM   6052  N   VAL A  46      79.013 206.068  45.509  1.00 29.27           N  
ATOM   6053  CA  VAL A  46      79.963 204.994  45.744  1.00 27.58           C  
ATOM   6054  C   VAL A  46      79.158 203.732  46.051  1.00 28.26           C  
ATOM   6055  O   VAL A  46      79.589 202.614  45.773  1.00 27.10           O  
ATOM   6056  CB  VAL A  46      80.890 205.346  46.926  1.00 23.63           C  
ATOM   6057  CG1 VAL A  46      81.929 204.243  47.150  1.00 21.90           C  
ATOM   6058  CG2 VAL A  46      81.581 206.661  46.641  1.00 20.46           C  
ATOM   6059  N   ALA A  47      77.975 203.926  46.621  1.00 28.62           N  
ATOM   6060  CA  ALA A  47      77.108 202.805  46.950  1.00 29.18           C  
ATOM   6061  C   ALA A  47      76.799 202.063  45.650  1.00 27.36           C  
ATOM   6062  O   ALA A  47      76.938 200.847  45.573  1.00 27.57           O  
ATOM   6063  CB  ALA A  47      75.826 203.308  47.605  1.00 30.29           C  
ATOM   6064  N   LEU A  48      76.398 202.812  44.630  1.00 26.87           N  
ATOM   6065  CA  LEU A  48      76.097 202.243  43.324  1.00 25.47           C  
ATOM   6066  C   LEU A  48      77.282 201.533  42.672  1.00 24.60           C  
ATOM   6067  O   LEU A  48      77.124 200.445  42.131  1.00 26.70           O  
ATOM   6068  CB  LEU A  48      75.595 203.327  42.376  1.00 25.13           C  
ATOM   6069  CG  LEU A  48      74.099 203.512  42.131  1.00 25.31           C  
ATOM   6070  CD1 LEU A  48      73.276 202.518  42.923  1.00 22.40           C  
ATOM   6071  CD2 LEU A  48      73.738 204.929  42.484  1.00 22.02           C  
ATOM   6072  N   ARG A  49      78.471 202.117  42.701  1.00 24.39           N  
ATOM   6073  CA  ARG A  49      79.574 201.415  42.063  1.00 25.62           C  
ATOM   6074  C   ARG A  49      79.948 200.185  42.877  1.00 24.86           C  
ATOM   6075  O   ARG A  49      80.465 199.203  42.339  1.00 26.38           O  
ATOM   6076  CB  ARG A  49      80.771 202.345  41.811  1.00 26.32           C  
ATOM   6077  CG  ARG A  49      81.778 202.512  42.897  1.00 32.09           C  
ATOM   6078  CD  ARG A  49      82.768 203.613  42.478  1.00 35.95           C  
ATOM   6079  NE  ARG A  49      83.580 204.118  43.588  1.00 36.50           N  
ATOM   6080  CZ  ARG A  49      83.927 205.394  43.735  1.00 35.28           C  
ATOM   6081  NH1 ARG A  49      83.536 206.299  42.847  1.00 35.37           N  
ATOM   6082  NH2 ARG A  49      84.662 205.767  44.770  1.00 36.85           N  
ATOM   6083  N   GLU A  50      79.644 200.222  44.169  1.00 23.65           N  
ATOM   6084  CA  GLU A  50      79.898 199.080  45.032  1.00 21.27           C  
ATOM   6085  C   GLU A  50      78.949 197.940  44.632  1.00 18.84           C  
ATOM   6086  O   GLU A  50      79.335 196.775  44.617  1.00 18.20           O  
ATOM   6087  CB  GLU A  50      79.685 199.467  46.489  1.00 24.76           C  
ATOM   6088  CG  GLU A  50      80.969 199.691  47.254  1.00 25.04           C  
ATOM   6089  CD  GLU A  50      80.715 200.339  48.577  1.00 27.02           C  
ATOM   6090  OE1 GLU A  50      79.675 200.033  49.185  1.00 31.36           O  
ATOM   6091  OE2 GLU A  50      81.549 201.149  49.020  1.00 32.58           O  
ATOM   6092  N   ILE A  51      77.707 198.270  44.306  1.00 15.81           N  
ATOM   6093  CA  ILE A  51      76.784 197.242  43.868  1.00 16.63           C  
ATOM   6094  C   ILE A  51      77.295 196.613  42.557  1.00 18.82           C  
ATOM   6095  O   ILE A  51      77.230 195.391  42.382  1.00 18.62           O  
ATOM   6096  CB  ILE A  51      75.380 197.805  43.623  1.00 15.04           C  
ATOM   6097  CG1 ILE A  51      74.756 198.226  44.948  1.00 15.46           C  
ATOM   6098  CG2 ILE A  51      74.510 196.764  42.932  1.00 13.47           C  
ATOM   6099  CD1 ILE A  51      73.340 198.703  44.819  1.00 15.25           C  
ATOM   6100  N   ARG A  52      77.805 197.440  41.640  1.00 18.05           N  
ATOM   6101  CA  ARG A  52      78.313 196.924  40.366  1.00 18.55           C  
ATOM   6102  C   ARG A  52      79.589 196.109  40.553  1.00 17.76           C  
ATOM   6103  O   ARG A  52      79.803 195.111  39.864  1.00 16.00           O  
ATOM   6104  CB  ARG A  52      78.584 198.062  39.385  1.00 19.55           C  
ATOM   6105  CG  ARG A  52      77.376 198.902  39.095  1.00 23.73           C  
ATOM   6106  CD  ARG A  52      77.653 199.953  38.038  1.00 25.49           C  
ATOM   6107  NE  ARG A  52      76.470 200.788  37.824  1.00 29.32           N  
ATOM   6108  CZ  ARG A  52      76.283 201.975  38.389  1.00 30.04           C  
ATOM   6109  NH1 ARG A  52      77.209 202.480  39.198  1.00 31.33           N  
ATOM   6110  NH2 ARG A  52      75.167 202.649  38.152  1.00 30.57           N  
ATOM   6111  N   ARG A  53      80.437 196.526  41.489  1.00 17.54           N  
ATOM   6112  CA  ARG A  53      81.668 195.786  41.723  1.00 17.27           C  
ATOM   6113  C   ARG A  53      81.367 194.402  42.257  1.00 17.76           C  
ATOM   6114  O   ARG A  53      81.894 193.411  41.741  1.00 18.91           O  
ATOM   6115  CB  ARG A  53      82.577 196.494  42.716  1.00 18.65           C  
ATOM   6116  CG  ARG A  53      83.707 195.599  43.178  1.00 19.80           C  
ATOM   6117  CD  ARG A  53      84.553 196.213  44.282  1.00 20.50           C  
ATOM   6118  NE  ARG A  53      85.458 195.205  44.835  1.00 26.08           N  
ATOM   6119  CZ  ARG A  53      86.359 195.429  45.788  1.00 30.80           C  
ATOM   6120  NH1 ARG A  53      86.501 196.638  46.318  1.00 30.31           N  
ATOM   6121  NH2 ARG A  53      87.114 194.432  46.223  1.00 32.31           N  
ATOM   6122  N   TYR A  54      80.520 194.332  43.284  1.00 15.34           N  
ATOM   6123  CA  TYR A  54      80.181 193.049  43.886  1.00 14.90           C  
ATOM   6124  C   TYR A  54      79.264 192.179  43.053  1.00 15.43           C  
ATOM   6125  O   TYR A  54      79.283 190.958  43.196  1.00 16.86           O  
ATOM   6126  CB  TYR A  54      79.616 193.245  45.305  1.00 11.91           C  
ATOM   6127  CG  TYR A  54      80.701 193.662  46.256  1.00  8.19           C  
ATOM   6128  CD1 TYR A  54      80.655 194.896  46.905  1.00 12.65           C  
ATOM   6129  CD2 TYR A  54      81.863 192.905  46.371  1.00  8.93           C  
ATOM   6130  CE1 TYR A  54      81.757 195.380  47.628  1.00 11.78           C  
ATOM   6131  CE2 TYR A  54      82.963 193.376  47.087  1.00 12.97           C  
ATOM   6132  CZ  TYR A  54      82.902 194.615  47.704  1.00 13.75           C  
ATOM   6133  OH  TYR A  54      84.006 195.103  48.353  1.00 23.16           O  
ATOM   6134  N   GLN A  55      78.471 192.783  42.173  1.00 16.94           N  
ATOM   6135  CA  GLN A  55      77.602 191.972  41.334  1.00 18.24           C  
ATOM   6136  C   GLN A  55      78.393 191.345  40.190  1.00 18.25           C  
ATOM   6137  O   GLN A  55      77.933 190.399  39.575  1.00 18.39           O  
ATOM   6138  CB  GLN A  55      76.425 192.790  40.788  1.00 17.45           C  
ATOM   6139  CG  GLN A  55      75.464 193.289  41.874  1.00 20.50           C  
ATOM   6140  CD  GLN A  55      74.094 193.658  41.331  1.00 19.98           C  
ATOM   6141  OE1 GLN A  55      73.978 194.332  40.309  1.00 22.39           O  
ATOM   6142  NE2 GLN A  55      73.053 193.227  42.020  1.00 14.05           N  
ATOM   6143  N   LYS A  56      79.589 191.862  39.916  1.00 21.86           N  
ATOM   6144  CA  LYS A  56      80.423 191.321  38.835  1.00 23.28           C  
ATOM   6145  C   LYS A  56      81.242 190.148  39.324  1.00 21.12           C  
ATOM   6146  O   LYS A  56      81.579 189.272  38.549  1.00 23.11           O  
ATOM   6147  CB  LYS A  56      81.440 192.345  38.304  1.00 27.10           C  
ATOM   6148  CG  LYS A  56      80.955 193.480  37.419  1.00 30.92           C  
ATOM   6149  CD  LYS A  56      82.179 194.186  36.799  1.00 31.50           C  
ATOM   6150  CE  LYS A  56      81.891 195.621  36.329  1.00 35.32           C  
ATOM   6151  NZ  LYS A  56      81.802 196.603  37.461  1.00 36.34           N  
ATOM   6152  N   SER A  57      81.582 190.145  40.605  1.00 19.24           N  
ATOM   6153  CA  SER A  57      82.429 189.091  41.145  1.00 20.12           C  
ATOM   6154  C   SER A  57      81.721 187.972  41.897  1.00 19.51           C  
ATOM   6155  O   SER A  57      80.512 188.035  42.142  1.00 19.90           O  
ATOM   6156  CB  SER A  57      83.522 189.706  42.026  1.00 20.96           C  
ATOM   6157  OG  SER A  57      82.977 190.543  43.036  1.00 28.09           O  
ATOM   6158  N   THR A  58      82.501 186.959  42.271  1.00 17.20           N  
ATOM   6159  CA  THR A  58      81.988 185.776  42.950  1.00 15.30           C  
ATOM   6160  C   THR A  58      82.754 185.341  44.223  1.00 16.55           C  
ATOM   6161  O   THR A  58      82.470 184.287  44.789  1.00 17.80           O  
ATOM   6162  CB  THR A  58      82.001 184.591  41.973  1.00 13.33           C  
ATOM   6163  OG1 THR A  58      83.355 184.191  41.753  1.00 14.62           O  
ATOM   6164  CG2 THR A  58      81.403 184.987  40.631  1.00 11.06           C  
ATOM   6165  N   GLU A  59      83.728 186.121  44.673  1.00 15.62           N  
ATOM   6166  CA  GLU A  59      84.460 185.723  45.860  1.00 17.17           C  
ATOM   6167  C   GLU A  59      83.717 185.961  47.168  1.00 15.02           C  
ATOM   6168  O   GLU A  59      82.956 186.915  47.297  1.00 14.59           O  
ATOM   6169  CB  GLU A  59      85.834 186.396  45.908  1.00 19.57           C  
ATOM   6170  CG  GLU A  59      85.927 187.734  45.229  1.00 28.75           C  
ATOM   6171  CD  GLU A  59      85.140 188.792  45.926  1.00 29.67           C  
ATOM   6172  OE1 GLU A  59      85.037 188.705  47.166  1.00 35.03           O  
ATOM   6173  OE2 GLU A  59      84.647 189.712  45.240  1.00 31.02           O  
ATOM   6174  N   LEU A  60      83.931 185.066  48.130  1.00 13.48           N  
ATOM   6175  CA  LEU A  60      83.286 185.179  49.433  1.00 13.30           C  
ATOM   6176  C   LEU A  60      83.554 186.559  50.017  1.00 15.16           C  
ATOM   6177  O   LEU A  60      84.668 187.092  49.936  1.00 17.07           O  
ATOM   6178  CB  LEU A  60      83.788 184.075  50.365  1.00 10.40           C  
ATOM   6179  CG  LEU A  60      83.489 182.689  49.785  1.00 10.89           C  
ATOM   6180  CD1 LEU A  60      84.103 181.649  50.637  1.00 12.12           C  
ATOM   6181  CD2 LEU A  60      81.998 182.460  49.671  1.00 11.09           C  
ATOM   6182  N   LEU A  61      82.516 187.132  50.607  1.00 14.26           N  
ATOM   6183  CA  LEU A  61      82.593 188.466  51.170  1.00 14.10           C  
ATOM   6184  C   LEU A  61      82.829 188.537  52.683  1.00 15.53           C  
ATOM   6185  O   LEU A  61      83.090 189.614  53.216  1.00 17.34           O  
ATOM   6186  CB  LEU A  61      81.314 189.217  50.806  1.00 11.00           C  
ATOM   6187  CG  LEU A  61      80.986 189.169  49.312  1.00 13.94           C  
ATOM   6188  CD1 LEU A  61      79.657 189.822  49.041  1.00 11.53           C  
ATOM   6189  CD2 LEU A  61      82.093 189.869  48.533  1.00 16.51           C  
ATOM   6190  N   ILE A  62      82.722 187.408  53.373  1.00 15.38           N  
ATOM   6191  CA  ILE A  62      82.927 187.371  54.821  1.00 16.29           C  
ATOM   6192  C   ILE A  62      84.333 186.849  55.104  1.00 16.54           C  
ATOM   6193  O   ILE A  62      84.753 185.847  54.519  1.00 13.92           O  
ATOM   6194  CB  ILE A  62      81.890 186.426  55.509  1.00 18.44           C  
ATOM   6195  CG1 ILE A  62      80.488 187.022  55.405  1.00 15.83           C  
ATOM   6196  CG2 ILE A  62      82.269 186.179  56.973  1.00 14.97           C  
ATOM   6197  CD1 ILE A  62      79.392 186.041  55.764  1.00 18.52           C  
ATOM   6198  N   ARG A  63      85.058 187.533  55.986  1.00 18.25           N  
ATOM   6199  CA  ARG A  63      86.412 187.112  56.335  1.00 20.14           C  
ATOM   6200  C   ARG A  63      86.380 185.626  56.656  1.00 21.57           C  
ATOM   6201  O   ARG A  63      85.459 185.137  57.302  1.00 24.47           O  
ATOM   6202  CB  ARG A  63      86.931 187.932  57.520  1.00 22.86           C  
ATOM   6203  CG  ARG A  63      87.422 189.337  57.124  1.00 22.56           C  
ATOM   6204  CD  ARG A  63      86.985 190.393  58.123  1.00 33.05           C  
ATOM   6205  NE  ARG A  63      87.639 190.238  59.423  1.00 37.67           N  
ATOM   6206  CZ  ARG A  63      87.017 190.362  60.590  1.00 37.82           C  
ATOM   6207  NH1 ARG A  63      85.723 190.637  60.635  1.00 37.43           N  
ATOM   6208  NH2 ARG A  63      87.696 190.224  61.716  1.00 46.00           N  
ATOM   6209  N   LYS A  64      87.393 184.907  56.201  1.00 22.24           N  
ATOM   6210  CA  LYS A  64      87.450 183.467  56.369  1.00 21.21           C  
ATOM   6211  C   LYS A  64      87.615 182.888  57.768  1.00 22.58           C  
ATOM   6212  O   LYS A  64      86.888 181.975  58.147  1.00 21.96           O  
ATOM   6213  CB  LYS A  64      88.539 182.916  55.455  1.00 25.17           C  
ATOM   6214  CG  LYS A  64      88.579 181.407  55.362  1.00 29.83           C  
ATOM   6215  CD  LYS A  64      89.844 180.952  54.658  1.00 31.76           C  
ATOM   6216  CE  LYS A  64      89.992 179.440  54.697  1.00 32.95           C  
ATOM   6217  NZ  LYS A  64      91.307 179.054  54.115  1.00 40.38           N  
ATOM   6218  N   LEU A  65      88.571 183.380  58.547  1.00 25.51           N  
ATOM   6219  CA  LEU A  65      88.745 182.810  59.883  1.00 24.87           C  
ATOM   6220  C   LEU A  65      87.562 183.115  60.806  1.00 24.92           C  
ATOM   6221  O   LEU A  65      87.102 182.236  61.526  1.00 27.54           O  
ATOM   6222  CB  LEU A  65      90.056 183.288  60.515  1.00 25.63           C  
ATOM   6223  CG  LEU A  65      90.355 182.750  61.921  1.00 26.96           C  
ATOM   6224  CD1 LEU A  65      90.194 181.238  61.944  1.00 23.58           C  
ATOM   6225  CD2 LEU A  65      91.768 183.136  62.336  1.00 25.41           C  
ATOM   6226  N   PRO A  66      87.062 184.361  60.809  1.00 23.32           N  
ATOM   6227  CA  PRO A  66      85.927 184.657  61.682  1.00 23.93           C  
ATOM   6228  C   PRO A  66      84.745 183.724  61.413  1.00 24.69           C  
ATOM   6229  O   PRO A  66      84.109 183.235  62.346  1.00 23.46           O  
ATOM   6230  CB  PRO A  66      85.607 186.108  61.345  1.00 20.20           C  
ATOM   6231  CG  PRO A  66      86.940 186.672  61.115  1.00 23.39           C  
ATOM   6232  CD  PRO A  66      87.623 185.607  60.262  1.00 23.86           C  
ATOM   6233  N   PHE A  67      84.462 183.479  60.134  1.00 25.41           N  
ATOM   6234  CA  PHE A  67      83.355 182.611  59.759  1.00 23.76           C  
ATOM   6235  C   PHE A  67      83.556 181.222  60.336  1.00 24.40           C  
ATOM   6236  O   PHE A  67      82.632 180.613  60.866  1.00 28.78           O  
ATOM   6237  CB  PHE A  67      83.227 182.482  58.240  1.00 18.36           C  
ATOM   6238  CG  PHE A  67      82.056 181.654  57.829  1.00 11.85           C  
ATOM   6239  CD1 PHE A  67      80.768 182.160  57.939  1.00  8.79           C  
ATOM   6240  CD2 PHE A  67      82.221 180.332  57.487  1.00  8.80           C  
ATOM   6241  CE1 PHE A  67      79.671 181.360  57.728  1.00  7.35           C  
ATOM   6242  CE2 PHE A  67      81.126 179.519  57.278  1.00  9.88           C  
ATOM   6243  CZ  PHE A  67      79.845 180.035  57.400  1.00  7.65           C  
ATOM   6244  N   GLN A  68      84.773 180.723  60.207  1.00 25.15           N  
ATOM   6245  CA  GLN A  68      85.142 179.406  60.708  1.00 26.25           C  
ATOM   6246  C   GLN A  68      84.974 179.281  62.221  1.00 25.55           C  
ATOM   6247  O   GLN A  68      84.551 178.239  62.712  1.00 24.51           O  
ATOM   6248  CB  GLN A  68      86.586 179.109  60.313  1.00 27.07           C  
ATOM   6249  CG  GLN A  68      87.199 177.935  61.009  1.00 29.68           C  
ATOM   6250  CD  GLN A  68      87.810 176.973  60.041  1.00 32.12           C  
ATOM   6251  OE1 GLN A  68      88.302 177.368  58.983  1.00 32.88           O  
ATOM   6252  NE2 GLN A  68      87.794 175.694  60.393  1.00 36.88           N  
ATOM   6253  N   ARG A  69      85.311 180.338  62.957  1.00 25.13           N  
ATOM   6254  CA  ARG A  69      85.170 180.315  64.408  1.00 24.93           C  
ATOM   6255  C   ARG A  69      83.698 180.241  64.776  1.00 23.55           C  
ATOM   6256  O   ARG A  69      83.315 179.499  65.685  1.00 22.67           O  
ATOM   6257  CB  ARG A  69      85.763 181.570  65.055  1.00 28.38           C  
ATOM   6258  CG  ARG A  69      87.269 181.660  65.036  1.00 30.01           C  
ATOM   6259  CD  ARG A  69      87.750 182.584  66.145  1.00 31.61           C  
ATOM   6260  NE  ARG A  69      88.519 183.716  65.638  1.00 33.07           N  
ATOM   6261  CZ  ARG A  69      87.985 184.875  65.265  1.00 34.01           C  
ATOM   6262  NH1 ARG A  69      86.676 185.064  65.343  1.00 36.33           N  
ATOM   6263  NH2 ARG A  69      88.762 185.850  64.820  1.00 33.74           N  
ATOM   6264  N   LEU A  70      82.879 181.019  64.073  1.00 20.83           N  
ATOM   6265  CA  LEU A  70      81.449 181.037  64.340  1.00 20.97           C  
ATOM   6266  C   LEU A  70      80.878 179.640  64.100  1.00 22.06           C  
ATOM   6267  O   LEU A  70      80.064 179.144  64.886  1.00 21.46           O  
ATOM   6268  CB  LEU A  70      80.764 182.076  63.448  1.00 18.63           C  
ATOM   6269  CG  LEU A  70      79.233 182.084  63.382  1.00 20.03           C  
ATOM   6270  CD1 LEU A  70      78.643 182.071  64.761  1.00 21.21           C  
ATOM   6271  CD2 LEU A  70      78.763 183.308  62.616  1.00 16.73           C  
ATOM   6272  N   VAL A  71      81.328 178.995  63.026  1.00 20.26           N  
ATOM   6273  CA  VAL A  71      80.864 177.653  62.714  1.00 17.46           C  
ATOM   6274  C   VAL A  71      81.243 176.682  63.831  1.00 18.61           C  
ATOM   6275  O   VAL A  71      80.417 175.885  64.259  1.00 21.21           O  
ATOM   6276  CB  VAL A  71      81.442 177.161  61.360  1.00 14.22           C  
ATOM   6277  CG1 VAL A  71      81.221 175.670  61.179  1.00 11.41           C  
ATOM   6278  CG2 VAL A  71      80.790 177.901  60.237  1.00 12.20           C  
ATOM   6279  N   ARG A  72      82.479 176.754  64.316  1.00 20.15           N  
ATOM   6280  CA  ARG A  72      82.936 175.844  65.374  1.00 21.61           C  
ATOM   6281  C   ARG A  72      82.259 176.084  66.723  1.00 21.29           C  
ATOM   6282  O   ARG A  72      82.101 175.167  67.521  1.00 23.39           O  
ATOM   6283  CB  ARG A  72      84.449 175.945  65.550  1.00 23.33           C  
ATOM   6284  CG  ARG A  72      85.267 175.402  64.394  1.00 25.34           C  
ATOM   6285  CD  ARG A  72      86.727 175.774  64.588  1.00 24.72           C  
ATOM   6286  NE  ARG A  72      87.576 175.294  63.510  1.00 29.07           N  
ATOM   6287  CZ  ARG A  72      87.872 174.015  63.303  1.00 33.86           C  
ATOM   6288  NH1 ARG A  72      87.381 173.078  64.108  1.00 35.75           N  
ATOM   6289  NH2 ARG A  72      88.671 173.670  62.298  1.00 33.93           N  
ATOM   6290  N   GLU A  73      81.870 177.323  66.980  1.00 18.00           N  
ATOM   6291  CA  GLU A  73      81.204 177.656  68.219  1.00 15.80           C  
ATOM   6292  C   GLU A  73      79.794 177.060  68.226  1.00 16.75           C  
ATOM   6293  O   GLU A  73      79.327 176.554  69.245  1.00 17.80           O  
ATOM   6294  CB  GLU A  73      81.135 179.185  68.368  1.00 16.75           C  
ATOM   6295  CG  GLU A  73      80.265 179.681  69.499  1.00 15.89           C  
ATOM   6296  CD  GLU A  73      80.039 181.168  69.437  1.00 21.10           C  
ATOM   6297  OE1 GLU A  73      81.038 181.910  69.265  1.00 20.83           O  
ATOM   6298  OE2 GLU A  73      78.867 181.597  69.565  1.00 18.07           O  
ATOM   6299  N   ILE A  74      79.115 177.135  67.084  1.00 18.55           N  
ATOM   6300  CA  ILE A  74      77.757 176.622  66.946  1.00 16.95           C  
ATOM   6301  C   ILE A  74      77.725 175.102  66.971  1.00 19.17           C  
ATOM   6302  O   ILE A  74      76.888 174.507  67.649  1.00 20.36           O  
ATOM   6303  CB  ILE A  74      77.115 177.153  65.651  1.00 15.69           C  
ATOM   6304  CG1 ILE A  74      76.762 178.628  65.850  1.00  9.32           C  
ATOM   6305  CG2 ILE A  74      75.878 176.309  65.258  1.00 11.95           C  
ATOM   6306  CD1 ILE A  74      76.402 179.350  64.579  1.00 11.45           C  
ATOM   6307  N   ALA A  75      78.633 174.468  66.243  1.00 19.37           N  
ATOM   6308  CA  ALA A  75      78.678 173.014  66.245  1.00 24.06           C  
ATOM   6309  C   ALA A  75      78.871 172.539  67.681  1.00 27.03           C  
ATOM   6310  O   ALA A  75      78.125 171.691  68.164  1.00 28.57           O  
ATOM   6311  CB  ALA A  75      79.833 172.519  65.392  1.00 25.86           C  
ATOM   6312  N   GLN A  76      79.875 173.113  68.347  1.00 27.66           N  
ATOM   6313  CA  GLN A  76      80.241 172.775  69.713  1.00 26.22           C  
ATOM   6314  C   GLN A  76      79.082 172.799  70.692  1.00 26.38           C  
ATOM   6315  O   GLN A  76      79.107 172.085  71.688  1.00 28.33           O  
ATOM   6316  CB  GLN A  76      81.356 173.699  70.201  1.00 27.44           C  
ATOM   6317  CG  GLN A  76      82.085 173.199  71.438  1.00 27.52           C  
ATOM   6318  CD  GLN A  76      83.215 174.121  71.847  1.00 29.89           C  
ATOM   6319  OE1 GLN A  76      83.021 175.332  71.999  1.00 30.73           O  
ATOM   6320  NE2 GLN A  76      84.403 173.557  72.032  1.00 25.96           N  
ATOM   6321  N   ASP A  77      78.071 173.617  70.432  1.00 24.98           N  
ATOM   6322  CA  ASP A  77      76.914 173.632  71.313  1.00 24.37           C  
ATOM   6323  C   ASP A  77      76.031 172.402  71.045  1.00 25.93           C  
ATOM   6324  O   ASP A  77      75.143 172.097  71.845  1.00 28.20           O  
ATOM   6325  CB  ASP A  77      76.080 174.899  71.124  1.00 20.35           C  
ATOM   6326  CG  ASP A  77      76.734 176.103  71.712  1.00 26.90           C  
ATOM   6327  OD1 ASP A  77      77.503 175.919  72.676  1.00 30.45           O  
ATOM   6328  OD2 ASP A  77      76.479 177.235  71.240  1.00 30.25           O  
ATOM   6329  N   PHE A  78      76.272 171.712  69.926  1.00 23.00           N  
ATOM   6330  CA  PHE A  78      75.511 170.513  69.567  1.00 25.54           C  
ATOM   6331  C   PHE A  78      76.275 169.250  69.945  1.00 26.04           C  
ATOM   6332  O   PHE A  78      75.680 168.249  70.317  1.00 26.54           O  
ATOM   6333  CB  PHE A  78      75.217 170.453  68.058  1.00 24.65           C  
ATOM   6334  CG  PHE A  78      74.286 171.530  67.560  1.00 24.90           C  
ATOM   6335  CD1 PHE A  78      74.657 172.345  66.485  1.00 22.52           C  
ATOM   6336  CD2 PHE A  78      73.038 171.721  68.141  1.00 25.62           C  
ATOM   6337  CE1 PHE A  78      73.801 173.333  66.000  1.00 22.24           C  
ATOM   6338  CE2 PHE A  78      72.162 172.718  67.654  1.00 25.79           C  
ATOM   6339  CZ  PHE A  78      72.553 173.523  66.583  1.00 22.25           C  
ATOM   6340  N   LYS A  79      77.595 169.300  69.814  1.00 28.36           N  
ATOM   6341  CA  LYS A  79      78.467 168.173  70.142  1.00 30.30           C  
ATOM   6342  C   LYS A  79      79.860 168.729  70.404  1.00 33.40           C  
ATOM   6343  O   LYS A  79      80.228 169.767  69.843  1.00 35.92           O  
ATOM   6344  CB  LYS A  79      78.535 167.178  68.985  1.00 30.02           C  
ATOM   6345  CG  LYS A  79      79.506 166.022  69.215  1.00 29.04           C  
ATOM   6346  CD  LYS A  79      78.942 165.001  70.186  1.00 32.73           C  
ATOM   6347  CE  LYS A  79      79.986 163.947  70.598  1.00 37.55           C  
ATOM   6348  NZ  LYS A  79      80.927 164.393  71.687  1.00 37.29           N  
ATOM   6349  N   THR A  80      80.636 168.046  71.242  1.00 32.49           N  
ATOM   6350  CA  THR A  80      81.978 168.516  71.563  1.00 31.43           C  
ATOM   6351  C   THR A  80      83.018 167.645  70.882  1.00 31.64           C  
ATOM   6352  O   THR A  80      82.749 166.493  70.536  1.00 30.84           O  
ATOM   6353  CB  THR A  80      82.235 168.497  73.091  1.00 33.41           C  
ATOM   6354  OG1 THR A  80      82.338 167.140  73.543  1.00 34.18           O  
ATOM   6355  CG2 THR A  80      81.094 169.186  73.837  1.00 32.12           C  
ATOM   6356  N   ASP A  81      84.207 168.201  70.683  1.00 31.63           N  
ATOM   6357  CA  ASP A  81      85.283 167.468  70.042  1.00 34.57           C  
ATOM   6358  C   ASP A  81      85.060 167.165  68.572  1.00 34.87           C  
ATOM   6359  O   ASP A  81      85.423 166.088  68.089  1.00 36.44           O  
ATOM   6360  CB  ASP A  81      85.539 166.164  70.784  1.00 40.00           C  
ATOM   6361  CG  ASP A  81      86.652 166.289  71.771  1.00 46.01           C  
ATOM   6362  OD1 ASP A  81      86.554 167.157  72.672  1.00 48.33           O  
ATOM   6363  OD2 ASP A  81      87.632 165.525  71.636  1.00 53.12           O  
ATOM   6364  N   LEU A  82      84.452 168.105  67.858  1.00 33.94           N  
ATOM   6365  CA  LEU A  82      84.227 167.911  66.438  1.00 31.11           C  
ATOM   6366  C   LEU A  82      85.376 168.563  65.702  1.00 31.42           C  
ATOM   6367  O   LEU A  82      85.996 169.503  66.196  1.00 31.62           O  
ATOM   6368  CB  LEU A  82      82.913 168.550  65.985  1.00 25.74           C  
ATOM   6369  CG  LEU A  82      81.608 167.939  66.497  1.00 26.87           C  
ATOM   6370  CD1 LEU A  82      80.439 168.788  66.017  1.00 24.29           C  
ATOM   6371  CD2 LEU A  82      81.456 166.507  66.005  1.00 23.55           C  
ATOM   6372  N   ARG A  83      85.666 168.031  64.529  1.00 31.79           N  
ATOM   6373  CA  ARG A  83      86.700 168.565  63.672  1.00 33.08           C  
ATOM   6374  C   ARG A  83      86.007 168.739  62.319  1.00 32.12           C  
ATOM   6375  O   ARG A  83      85.062 168.021  62.008  1.00 32.09           O  
ATOM   6376  CB  ARG A  83      87.858 167.576  63.557  1.00 36.55           C  
ATOM   6377  CG  ARG A  83      88.456 167.180  64.897  1.00 40.04           C  
ATOM   6378  CD  ARG A  83      89.656 166.281  64.699  1.00 43.60           C  
ATOM   6379  NE  ARG A  83      90.901 166.959  65.033  1.00 49.86           N  
ATOM   6380  CZ  ARG A  83      92.102 166.534  64.653  1.00 53.55           C  
ATOM   6381  NH1 ARG A  83      92.211 165.433  63.917  1.00 53.90           N  
ATOM   6382  NH2 ARG A  83      93.195 167.196  65.021  1.00 54.20           N  
ATOM   6383  N   PHE A  84      86.469 169.694  61.524  1.00 30.48           N  
ATOM   6384  CA  PHE A  84      85.873 169.947  60.221  1.00 26.53           C  
ATOM   6385  C   PHE A  84      86.884 169.801  59.098  1.00 24.13           C  
ATOM   6386  O   PHE A  84      88.056 170.115  59.266  1.00 21.58           O  
ATOM   6387  CB  PHE A  84      85.312 171.379  60.150  1.00 22.06           C  
ATOM   6388  CG  PHE A  84      84.171 171.643  61.082  1.00 20.91           C  
ATOM   6389  CD1 PHE A  84      84.381 171.742  62.462  1.00 20.52           C  
ATOM   6390  CD2 PHE A  84      82.875 171.801  60.585  1.00 20.83           C  
ATOM   6391  CE1 PHE A  84      83.307 171.997  63.344  1.00 14.19           C  
ATOM   6392  CE2 PHE A  84      81.796 172.054  61.453  1.00 21.47           C  
ATOM   6393  CZ  PHE A  84      82.019 172.152  62.845  1.00 14.69           C  
ATOM   6394  N   GLN A  85      86.440 169.316  57.946  1.00 23.61           N  
ATOM   6395  CA  GLN A  85      87.352 169.272  56.812  1.00 22.37           C  
ATOM   6396  C   GLN A  85      87.343 170.736  56.382  1.00 21.20           C  
ATOM   6397  O   GLN A  85      86.409 171.471  56.703  1.00 20.72           O  
ATOM   6398  CB  GLN A  85      86.807 168.394  55.702  1.00 19.83           C  
ATOM   6399  CG  GLN A  85      86.575 166.982  56.121  1.00 20.62           C  
ATOM   6400  CD  GLN A  85      86.085 166.129  54.977  1.00 23.95           C  
ATOM   6401  OE1 GLN A  85      85.213 166.549  54.214  1.00 23.02           O  
ATOM   6402  NE2 GLN A  85      86.631 164.919  54.855  1.00 21.68           N  
ATOM   6403  N   SER A  86      88.367 171.179  55.674  1.00 22.16           N  
ATOM   6404  CA  SER A  86      88.404 172.574  55.274  1.00 23.55           C  
ATOM   6405  C   SER A  86      87.261 172.868  54.311  1.00 23.29           C  
ATOM   6406  O   SER A  86      86.629 173.919  54.389  1.00 24.88           O  
ATOM   6407  CB  SER A  86      89.734 172.908  54.613  1.00 24.53           C  
ATOM   6408  OG  SER A  86      89.756 172.415  53.290  1.00 34.98           O  
ATOM   6409  N   SER A  87      86.997 171.939  53.404  1.00 20.30           N  
ATOM   6410  CA  SER A  87      85.922 172.122  52.445  1.00 21.39           C  
ATOM   6411  C   SER A  87      84.532 172.163  53.102  1.00 19.84           C  
ATOM   6412  O   SER A  87      83.620 172.814  52.585  1.00 18.19           O  
ATOM   6413  CB  SER A  87      85.976 171.021  51.372  1.00 20.77           C  
ATOM   6414  OG  SER A  87      85.854 169.732  51.942  1.00 24.52           O  
ATOM   6415  N   ALA A  88      84.371 171.482  54.236  1.00 20.03           N  
ATOM   6416  CA  ALA A  88      83.082 171.468  54.931  1.00 20.91           C  
ATOM   6417  C   ALA A  88      82.731 172.869  55.374  1.00 21.37           C  
ATOM   6418  O   ALA A  88      81.557 173.251  55.350  1.00 22.71           O  
ATOM   6419  CB  ALA A  88      83.117 170.538  56.142  1.00 22.40           C  
ATOM   6420  N   VAL A  89      83.745 173.634  55.785  1.00 21.36           N  
ATOM   6421  CA  VAL A  89      83.527 175.013  56.209  1.00 18.42           C  
ATOM   6422  C   VAL A  89      83.278 175.843  54.954  1.00 19.10           C  
ATOM   6423  O   VAL A  89      82.408 176.711  54.938  1.00 21.33           O  
ATOM   6424  CB  VAL A  89      84.752 175.588  56.981  1.00 19.00           C  
ATOM   6425  CG1 VAL A  89      84.530 177.070  57.297  1.00 17.91           C  
ATOM   6426  CG2 VAL A  89      84.974 174.820  58.284  1.00 13.82           C  
ATOM   6427  N   MET A  90      84.031 175.556  53.894  1.00 20.75           N  
ATOM   6428  CA  MET A  90      83.885 176.270  52.629  1.00 20.90           C  
ATOM   6429  C   MET A  90      82.457 176.157  52.156  1.00 19.91           C  
ATOM   6430  O   MET A  90      81.837 177.157  51.778  1.00 18.97           O  
ATOM   6431  CB  MET A  90      84.784 175.684  51.542  1.00 27.13           C  
ATOM   6432  CG  MET A  90      86.193 176.261  51.425  1.00 32.83           C  
ATOM   6433  SD  MET A  90      86.857 175.874  49.750  1.00 43.69           S  
ATOM   6434  CE  MET A  90      87.003 174.054  49.837  1.00 36.67           C  
ATOM   6435  N   ALA A  91      81.942 174.930  52.163  1.00 17.44           N  
ATOM   6436  CA  ALA A  91      80.569 174.688  51.740  1.00 17.06           C  
ATOM   6437  C   ALA A  91      79.600 175.532  52.572  1.00 17.52           C  
ATOM   6438  O   ALA A  91      78.716 176.188  52.016  1.00 17.82           O  
ATOM   6439  CB  ALA A  91      80.225 173.211  51.865  1.00 14.34           C  
ATOM   6440  N   LEU A  92      79.774 175.526  53.895  1.00 16.66           N  
ATOM   6441  CA  LEU A  92      78.906 176.302  54.774  1.00 15.36           C  
ATOM   6442  C   LEU A  92      78.952 177.774  54.415  1.00 15.57           C  
ATOM   6443  O   LEU A  92      77.909 178.428  54.324  1.00 16.41           O  
ATOM   6444  CB  LEU A  92      79.294 176.101  56.248  1.00 15.72           C  
ATOM   6445  CG  LEU A  92      78.847 174.762  56.864  1.00 15.34           C  
ATOM   6446  CD1 LEU A  92      79.535 174.522  58.195  1.00 11.47           C  
ATOM   6447  CD2 LEU A  92      77.336 174.756  57.020  1.00 14.58           C  
ATOM   6448  N   GLN A  93      80.151 178.303  54.191  1.00 15.61           N  
ATOM   6449  CA  GLN A  93      80.262 179.710  53.827  1.00 13.78           C  
ATOM   6450  C   GLN A  93      79.639 180.005  52.460  1.00 13.09           C  
ATOM   6451  O   GLN A  93      79.011 181.045  52.288  1.00 15.41           O  
ATOM   6452  CB  GLN A  93      81.720 180.187  53.846  1.00 12.74           C  
ATOM   6453  CG  GLN A  93      81.817 181.690  54.098  1.00 13.80           C  
ATOM   6454  CD  GLN A  93      83.233 182.195  54.163  1.00 16.53           C  
ATOM   6455  OE1 GLN A  93      84.177 181.418  54.271  1.00 15.63           O  
ATOM   6456  NE2 GLN A  93      83.393 183.515  54.114  1.00 17.36           N  
ATOM   6457  N   GLU A  94      79.796 179.110  51.488  1.00 13.49           N  
ATOM   6458  CA  GLU A  94      79.197 179.358  50.174  1.00 15.61           C  
ATOM   6459  C   GLU A  94      77.673 179.391  50.319  1.00 17.06           C  
ATOM   6460  O   GLU A  94      77.006 180.280  49.785  1.00 16.89           O  
ATOM   6461  CB  GLU A  94      79.608 178.278  49.167  1.00 16.03           C  
ATOM   6462  CG  GLU A  94      81.054 178.383  48.672  1.00 19.73           C  
ATOM   6463  CD  GLU A  94      81.275 179.520  47.670  1.00 23.32           C  
ATOM   6464  OE1 GLU A  94      82.440 179.787  47.320  1.00 28.61           O  
ATOM   6465  OE2 GLU A  94      80.297 180.144  47.216  1.00 25.77           O  
ATOM   6466  N   ALA A  95      77.129 178.433  51.068  1.00 15.41           N  
ATOM   6467  CA  ALA A  95      75.692 178.370  51.286  1.00 14.64           C  
ATOM   6468  C   ALA A  95      75.172 179.575  52.075  1.00 14.46           C  
ATOM   6469  O   ALA A  95      74.126 180.107  51.736  1.00 13.27           O  
ATOM   6470  CB  ALA A  95      75.317 177.074  52.012  1.00 12.65           C  
ATOM   6471  N   SER A  96      75.899 179.998  53.114  1.00 13.63           N  
ATOM   6472  CA  SER A  96      75.487 181.141  53.946  1.00 13.53           C  
ATOM   6473  C   SER A  96      75.454 182.453  53.182  1.00 14.04           C  
ATOM   6474  O   SER A  96      74.503 183.227  53.290  1.00 14.99           O  
ATOM   6475  CB  SER A  96      76.421 181.308  55.147  1.00 12.95           C  
ATOM   6476  OG  SER A  96      76.397 180.168  55.973  1.00 14.49           O  
ATOM   6477  N   GLU A  97      76.510 182.713  52.424  1.00 16.05           N  
ATOM   6478  CA  GLU A  97      76.584 183.928  51.631  1.00 15.53           C  
ATOM   6479  C   GLU A  97      75.534 183.937  50.524  1.00 13.75           C  
ATOM   6480  O   GLU A  97      74.932 184.975  50.251  1.00 17.26           O  
ATOM   6481  CB  GLU A  97      77.992 184.096  51.061  1.00 15.71           C  
ATOM   6482  CG  GLU A  97      79.032 184.257  52.168  1.00 18.49           C  
ATOM   6483  CD  GLU A  97      80.158 185.192  51.785  1.00 18.77           C  
ATOM   6484  OE1 GLU A  97      80.023 185.891  50.768  1.00 20.04           O  
ATOM   6485  OE2 GLU A  97      81.172 185.242  52.506  1.00 19.51           O  
ATOM   6486  N   ALA A  98      75.284 182.801  49.885  1.00 11.45           N  
ATOM   6487  CA  ALA A  98      74.252 182.818  48.849  1.00 14.44           C  
ATOM   6488  C   ALA A  98      72.892 183.059  49.518  1.00 14.90           C  
ATOM   6489  O   ALA A  98      72.040 183.779  48.993  1.00 15.61           O  
ATOM   6490  CB  ALA A  98      74.244 181.522  48.064  1.00  7.60           C  
ATOM   6491  N   TYR A  99      72.698 182.469  50.692  1.00 15.46           N  
ATOM   6492  CA  TYR A  99      71.453 182.652  51.422  1.00 14.47           C  
ATOM   6493  C   TYR A  99      71.277 184.130  51.758  1.00 14.04           C  
ATOM   6494  O   TYR A  99      70.267 184.718  51.424  1.00 15.20           O  
ATOM   6495  CB  TYR A  99      71.452 181.817  52.709  1.00 15.02           C  
ATOM   6496  CG  TYR A  99      70.348 182.191  53.670  1.00 14.52           C  
ATOM   6497  CD1 TYR A  99      69.029 181.821  53.435  1.00 13.68           C  
ATOM   6498  CD2 TYR A  99      70.620 182.971  54.782  1.00 15.33           C  
ATOM   6499  CE1 TYR A  99      68.013 182.225  54.284  1.00 11.73           C  
ATOM   6500  CE2 TYR A  99      69.620 183.380  55.629  1.00 13.89           C  
ATOM   6501  CZ  TYR A  99      68.320 183.010  55.380  1.00 13.35           C  
ATOM   6502  OH  TYR A  99      67.338 183.460  56.225  1.00 15.49           O  
ATOM   6503  N   LEU A 100      72.267 184.736  52.406  1.00 14.33           N  
ATOM   6504  CA  LEU A 100      72.168 186.148  52.767  1.00 13.38           C  
ATOM   6505  C   LEU A 100      72.016 187.081  51.577  1.00 13.70           C  
ATOM   6506  O   LEU A 100      71.205 187.997  51.613  1.00 18.22           O  
ATOM   6507  CB  LEU A 100      73.371 186.574  53.609  1.00 13.12           C  
ATOM   6508  CG  LEU A 100      73.398 185.983  55.015  1.00 12.84           C  
ATOM   6509  CD1 LEU A 100      74.496 186.633  55.794  1.00  6.85           C  
ATOM   6510  CD2 LEU A 100      72.040 186.212  55.710  1.00 13.68           C  
ATOM   6511  N   VAL A 101      72.793 186.868  50.523  1.00 13.87           N  
ATOM   6512  CA  VAL A 101      72.673 187.709  49.334  1.00 11.16           C  
ATOM   6513  C   VAL A 101      71.235 187.672  48.793  1.00 10.75           C  
ATOM   6514  O   VAL A 101      70.678 188.703  48.439  1.00 10.80           O  
ATOM   6515  CB  VAL A 101      73.659 187.264  48.214  1.00  8.25           C  
ATOM   6516  CG1 VAL A 101      73.270 187.896  46.897  1.00  5.38           C  
ATOM   6517  CG2 VAL A 101      75.096 187.676  48.576  1.00  5.45           C  
ATOM   6518  N   ALA A 102      70.618 186.496  48.746  1.00 11.56           N  
ATOM   6519  CA  ALA A 102      69.255 186.419  48.220  1.00 11.24           C  
ATOM   6520  C   ALA A 102      68.231 186.998  49.189  1.00 13.12           C  
ATOM   6521  O   ALA A 102      67.202 187.516  48.761  1.00 15.78           O  
ATOM   6522  CB  ALA A 102      68.901 184.993  47.844  1.00  2.00           C  
ATOM   6523  N   LEU A 103      68.508 186.916  50.486  1.00 14.14           N  
ATOM   6524  CA  LEU A 103      67.609 187.494  51.479  1.00 16.23           C  
ATOM   6525  C   LEU A 103      67.638 189.026  51.311  1.00 17.37           C  
ATOM   6526  O   LEU A 103      66.599 189.682  51.395  1.00 20.61           O  
ATOM   6527  CB  LEU A 103      68.041 187.114  52.913  1.00 15.97           C  
ATOM   6528  CG  LEU A 103      67.192 187.729  54.052  1.00 15.95           C  
ATOM   6529  CD1 LEU A 103      65.747 187.285  53.889  1.00 12.01           C  
ATOM   6530  CD2 LEU A 103      67.721 187.317  55.417  1.00 12.20           C  
ATOM   6531  N   PHE A 104      68.823 189.595  51.079  1.00 17.10           N  
ATOM   6532  CA  PHE A 104      68.944 191.048  50.877  1.00 17.49           C  
ATOM   6533  C   PHE A 104      68.221 191.543  49.612  1.00 16.64           C  
ATOM   6534  O   PHE A 104      67.714 192.656  49.588  1.00 17.04           O  
ATOM   6535  CB  PHE A 104      70.416 191.464  50.827  1.00 13.30           C  
ATOM   6536  CG  PHE A 104      71.057 191.563  52.182  1.00 10.66           C  
ATOM   6537  CD1 PHE A 104      72.298 190.970  52.432  1.00  3.98           C  
ATOM   6538  CD2 PHE A 104      70.431 192.269  53.204  1.00  7.71           C  
ATOM   6539  CE1 PHE A 104      72.900 191.085  53.677  1.00  6.75           C  
ATOM   6540  CE2 PHE A 104      71.030 192.392  54.454  1.00  6.79           C  
ATOM   6541  CZ  PHE A 104      72.267 191.800  54.692  1.00  5.93           C  
ATOM   6542  N   GLU A 105      68.191 190.724  48.566  1.00 16.16           N  
ATOM   6543  CA  GLU A 105      67.486 191.082  47.339  1.00 20.68           C  
ATOM   6544  C   GLU A 105      65.989 191.220  47.662  1.00 20.18           C  
ATOM   6545  O   GLU A 105      65.339 192.206  47.290  1.00 16.77           O  
ATOM   6546  CB  GLU A 105      67.665 189.993  46.273  1.00 21.21           C  
ATOM   6547  CG  GLU A 105      69.014 189.998  45.573  1.00 29.00           C  
ATOM   6548  CD  GLU A 105      69.275 188.712  44.789  1.00 29.90           C  
ATOM   6549  OE1 GLU A 105      68.323 187.920  44.614  1.00 31.58           O  
ATOM   6550  OE2 GLU A 105      70.429 188.498  44.351  1.00 27.59           O  
ATOM   6551  N   ASP A 106      65.445 190.216  48.347  1.00 19.19           N  
ATOM   6552  CA  ASP A 106      64.044 190.248  48.717  1.00 19.11           C  
ATOM   6553  C   ASP A 106      63.785 191.369  49.707  1.00 18.86           C  
ATOM   6554  O   ASP A 106      62.751 192.019  49.644  1.00 17.36           O  
ATOM   6555  CB  ASP A 106      63.613 188.926  49.338  1.00 17.98           C  
ATOM   6556  CG  ASP A 106      63.595 187.803  48.343  1.00 20.69           C  
ATOM   6557  OD1 ASP A 106      63.657 188.095  47.129  1.00 19.22           O  
ATOM   6558  OD2 ASP A 106      63.514 186.632  48.773  1.00 23.19           O  
ATOM   6559  N   THR A 107      64.733 191.581  50.618  1.00 18.38           N  
ATOM   6560  CA  THR A 107      64.615 192.613  51.635  1.00 18.66           C  
ATOM   6561  C   THR A 107      64.493 193.975  50.952  1.00 21.14           C  
ATOM   6562  O   THR A 107      63.717 194.839  51.382  1.00 23.47           O  
ATOM   6563  CB  THR A 107      65.850 192.599  52.559  1.00 20.18           C  
ATOM   6564  OG1 THR A 107      65.932 191.336  53.225  1.00 17.42           O  
ATOM   6565  CG2 THR A 107      65.779 193.714  53.588  1.00 16.47           C  
ATOM   6566  N   ASN A 108      65.252 194.150  49.875  1.00 19.48           N  
ATOM   6567  CA  ASN A 108      65.248 195.385  49.107  1.00 18.07           C  
ATOM   6568  C   ASN A 108      63.920 195.597  48.406  1.00 18.66           C  
ATOM   6569  O   ASN A 108      63.442 196.728  48.281  1.00 19.70           O  
ATOM   6570  CB  ASN A 108      66.335 195.349  48.054  1.00 18.07           C  
ATOM   6571  CG  ASN A 108      66.852 196.721  47.711  1.00 20.34           C  
ATOM   6572  OD1 ASN A 108      67.353 196.947  46.614  1.00 22.84           O  
ATOM   6573  ND2 ASN A 108      66.747 197.646  48.654  1.00 21.99           N  
ATOM   6574  N   LEU A 109      63.327 194.505  47.935  1.00 19.09           N  
ATOM   6575  CA  LEU A 109      62.059 194.587  47.242  1.00 17.31           C  
ATOM   6576  C   LEU A 109      61.002 195.025  48.231  1.00 18.74           C  
ATOM   6577  O   LEU A 109      60.056 195.727  47.873  1.00 19.59           O  
ATOM   6578  CB  LEU A 109      61.681 193.232  46.640  1.00 16.90           C  
ATOM   6579  CG  LEU A 109      62.522 192.632  45.503  1.00 18.44           C  
ATOM   6580  CD1 LEU A 109      61.857 191.350  45.005  1.00 10.05           C  
ATOM   6581  CD2 LEU A 109      62.646 193.633  44.364  1.00 19.08           C  
ATOM   6582  N   CYS A 110      61.174 194.613  49.483  1.00 18.86           N  
ATOM   6583  CA  CYS A 110      60.226 194.954  50.531  1.00 20.31           C  
ATOM   6584  C   CYS A 110      60.411 196.417  50.928  1.00 23.00           C  
ATOM   6585  O   CYS A 110      59.445 197.120  51.243  1.00 23.71           O  
ATOM   6586  CB  CYS A 110      60.416 194.030  51.741  1.00 19.30           C  
ATOM   6587  SG  CYS A 110      59.907 192.306  51.454  1.00 19.94           S  
ATOM   6588  N   ALA A 111      61.657 196.877  50.912  1.00 21.98           N  
ATOM   6589  CA  ALA A 111      61.920 198.258  51.242  1.00 20.88           C  
ATOM   6590  C   ALA A 111      61.308 199.106  50.116  1.00 21.20           C  
ATOM   6591  O   ALA A 111      60.520 200.011  50.374  1.00 22.03           O  
ATOM   6592  CB  ALA A 111      63.408 198.492  51.354  1.00 19.05           C  
ATOM   6593  N   ILE A 112      61.648 198.790  48.870  1.00 19.79           N  
ATOM   6594  CA  ILE A 112      61.119 199.528  47.720  1.00 18.31           C  
ATOM   6595  C   ILE A 112      59.581 199.508  47.705  1.00 18.59           C  
ATOM   6596  O   ILE A 112      58.952 200.503  47.373  1.00 18.54           O  
ATOM   6597  CB  ILE A 112      61.683 198.947  46.385  1.00 16.06           C  
ATOM   6598  CG1 ILE A 112      63.182 199.223  46.296  1.00 15.01           C  
ATOM   6599  CG2 ILE A 112      60.975 199.543  45.199  1.00 12.68           C  
ATOM   6600  CD1 ILE A 112      63.889 198.458  45.189  1.00 12.23           C  
ATOM   6601  N   HIS A 113      58.976 198.381  48.073  1.00 19.76           N  
ATOM   6602  CA  HIS A 113      57.514 198.273  48.107  1.00 19.66           C  
ATOM   6603  C   HIS A 113      56.966 199.353  49.060  1.00 20.84           C  
ATOM   6604  O   HIS A 113      55.921 199.937  48.820  1.00 22.19           O  
ATOM   6605  CB  HIS A 113      57.116 196.872  48.597  1.00 18.18           C  
ATOM   6606  CG  HIS A 113      55.643 196.595  48.562  1.00 16.42           C  
ATOM   6607  ND1 HIS A 113      54.950 196.386  47.390  1.00 16.68           N  
ATOM   6608  CD2 HIS A 113      54.744 196.437  49.563  1.00 15.49           C  
ATOM   6609  CE1 HIS A 113      53.688 196.106  47.670  1.00 16.80           C  
ATOM   6610  NE2 HIS A 113      53.537 196.129  48.983  1.00 14.76           N  
ATOM   6611  N   ALA A 114      57.702 199.622  50.132  1.00 21.47           N  
ATOM   6612  CA  ALA A 114      57.311 200.621  51.118  1.00 22.25           C  
ATOM   6613  C   ALA A 114      57.801 202.020  50.732  1.00 24.99           C  
ATOM   6614  O   ALA A 114      57.897 202.906  51.582  1.00 25.94           O  
ATOM   6615  CB  ALA A 114      57.863 200.232  52.492  1.00 17.71           C  
ATOM   6616  N   LYS A 115      58.121 202.212  49.454  1.00 27.67           N  
ATOM   6617  CA  LYS A 115      58.582 203.507  48.951  1.00 29.65           C  
ATOM   6618  C   LYS A 115      59.868 204.026  49.602  1.00 30.20           C  
ATOM   6619  O   LYS A 115      60.088 205.240  49.703  1.00 30.23           O  
ATOM   6620  CB  LYS A 115      57.470 204.544  49.103  1.00 31.34           C  
ATOM   6621  CG  LYS A 115      56.259 204.268  48.218  1.00 38.45           C  
ATOM   6622  CD  LYS A 115      54.959 204.524  48.971  1.00 42.06           C  
ATOM   6623  CE  LYS A 115      54.875 203.626  50.211  1.00 43.87           C  
ATOM   6624  NZ  LYS A 115      53.663 203.877  51.036  1.00 43.81           N  
ATOM   6625  N   ARG A 116      60.710 203.105  50.051  1.00 28.33           N  
ATOM   6626  CA  ARG A 116      61.980 203.474  50.651  1.00 26.88           C  
ATOM   6627  C   ARG A 116      63.112 202.979  49.754  1.00 25.79           C  
ATOM   6628  O   ARG A 116      62.874 202.333  48.736  1.00 26.38           O  
ATOM   6629  CB  ARG A 116      62.114 202.869  52.048  1.00 28.41           C  
ATOM   6630  CG  ARG A 116      61.410 203.664  53.134  1.00 27.04           C  
ATOM   6631  CD  ARG A 116      61.582 203.032  54.505  1.00 24.21           C  
ATOM   6632  NE  ARG A 116      60.815 201.799  54.641  1.00 20.82           N  
ATOM   6633  CZ  ARG A 116      61.334 200.579  54.573  1.00 23.70           C  
ATOM   6634  NH1 ARG A 116      62.629 200.408  54.370  1.00 21.15           N  
ATOM   6635  NH2 ARG A 116      60.550 199.520  54.716  1.00 26.50           N  
ATOM   6636  N   VAL A 117      64.341 203.301  50.131  1.00 22.91           N  
ATOM   6637  CA  VAL A 117      65.525 202.891  49.385  1.00 21.72           C  
ATOM   6638  C   VAL A 117      66.525 202.391  50.431  1.00 21.30           C  
ATOM   6639  O   VAL A 117      67.646 202.019  50.124  1.00 22.21           O  
ATOM   6640  CB  VAL A 117      66.116 204.104  48.593  1.00 21.55           C  
ATOM   6641  CG1 VAL A 117      67.478 203.775  48.071  1.00 24.71           C  
ATOM   6642  CG2 VAL A 117      65.211 204.462  47.421  1.00 20.44           C  
ATOM   6643  N   THR A 118      66.084 202.375  51.680  1.00 20.86           N  
ATOM   6644  CA  THR A 118      66.913 201.960  52.796  1.00 21.30           C  
ATOM   6645  C   THR A 118      66.370 200.688  53.432  1.00 22.05           C  
ATOM   6646  O   THR A 118      65.284 200.708  54.003  1.00 24.73           O  
ATOM   6647  CB  THR A 118      66.920 203.059  53.866  1.00 21.11           C  
ATOM   6648  OG1 THR A 118      67.181 204.320  53.237  1.00 23.76           O  
ATOM   6649  CG2 THR A 118      67.969 202.775  54.931  1.00 21.60           C  
ATOM   6650  N   ILE A 119      67.108 199.583  53.354  1.00 19.78           N  
ATOM   6651  CA  ILE A 119      66.608 198.359  53.964  1.00 17.92           C  
ATOM   6652  C   ILE A 119      66.570 198.517  55.468  1.00 19.88           C  
ATOM   6653  O   ILE A 119      67.449 199.139  56.078  1.00 20.36           O  
ATOM   6654  CB  ILE A 119      67.452 197.105  53.612  1.00 15.20           C  
ATOM   6655  CG1 ILE A 119      68.912 197.300  54.009  1.00 13.83           C  
ATOM   6656  CG2 ILE A 119      67.298 196.782  52.131  1.00 17.31           C  
ATOM   6657  CD1 ILE A 119      69.767 196.063  53.764  1.00 14.66           C  
ATOM   6658  N   MET A 120      65.529 197.955  56.062  1.00 20.99           N  
ATOM   6659  CA  MET A 120      65.339 198.024  57.496  1.00 20.53           C  
ATOM   6660  C   MET A 120      64.915 196.673  58.033  1.00 20.86           C  
ATOM   6661  O   MET A 120      64.350 195.849  57.314  1.00 22.58           O  
ATOM   6662  CB  MET A 120      64.256 199.049  57.830  1.00 21.42           C  
ATOM   6663  CG  MET A 120      64.446 200.386  57.148  1.00 24.81           C  
ATOM   6664  SD  MET A 120      63.164 201.544  57.602  1.00 30.25           S  
ATOM   6665  CE  MET A 120      63.866 202.165  59.130  1.00 25.52           C  
ATOM   6666  N   PRO A 121      65.193 196.431  59.314  1.00 18.28           N  
ATOM   6667  CA  PRO A 121      64.855 195.199  60.008  1.00 16.20           C  
ATOM   6668  C   PRO A 121      63.467 194.674  59.634  1.00 18.06           C  
ATOM   6669  O   PRO A 121      63.275 193.458  59.470  1.00 18.29           O  
ATOM   6670  CB  PRO A 121      64.924 195.616  61.470  1.00 17.79           C  
ATOM   6671  CG  PRO A 121      66.076 196.581  61.475  1.00 20.73           C  
ATOM   6672  CD  PRO A 121      65.882 197.382  60.212  1.00 19.53           C  
ATOM   6673  N   LYS A 122      62.495 195.575  59.503  1.00 17.36           N  
ATOM   6674  CA  LYS A 122      61.150 195.133  59.175  1.00 19.57           C  
ATOM   6675  C   LYS A 122      61.038 194.678  57.733  1.00 19.57           C  
ATOM   6676  O   LYS A 122      60.081 194.001  57.365  1.00 23.64           O  
ATOM   6677  CB  LYS A 122      60.099 196.212  59.469  1.00 18.59           C  
ATOM   6678  CG  LYS A 122      60.161 197.434  58.593  1.00 21.90           C  
ATOM   6679  CD  LYS A 122      58.858 198.198  58.680  1.00 21.99           C  
ATOM   6680  CE  LYS A 122      59.115 199.675  58.820  1.00 25.22           C  
ATOM   6681  NZ  LYS A 122      59.899 199.953  60.052  1.00 27.79           N  
ATOM   6682  N   ASP A 123      61.997 195.052  56.905  1.00 18.62           N  
ATOM   6683  CA  ASP A 123      61.953 194.591  55.528  1.00 18.08           C  
ATOM   6684  C   ASP A 123      62.426 193.129  55.550  1.00 16.78           C  
ATOM   6685  O   ASP A 123      61.839 192.279  54.903  1.00 17.53           O  
ATOM   6686  CB  ASP A 123      62.862 195.448  54.627  1.00 18.19           C  
ATOM   6687  CG  ASP A 123      62.346 196.867  54.450  1.00 21.25           C  
ATOM   6688  OD1 ASP A 123      61.157 197.037  54.103  1.00 20.14           O  
ATOM   6689  OD2 ASP A 123      63.136 197.820  54.637  1.00 23.26           O  
ATOM   6690  N   ILE A 124      63.487 192.845  56.302  1.00 17.07           N  
ATOM   6691  CA  ILE A 124      64.009 191.481  56.409  1.00 18.86           C  
ATOM   6692  C   ILE A 124      62.946 190.575  57.046  1.00 21.19           C  
ATOM   6693  O   ILE A 124      62.771 189.423  56.655  1.00 21.67           O  
ATOM   6694  CB  ILE A 124      65.269 191.414  57.303  1.00 16.65           C  
ATOM   6695  CG1 ILE A 124      66.415 192.213  56.682  1.00 17.19           C  
ATOM   6696  CG2 ILE A 124      65.683 189.978  57.498  1.00 14.19           C  
ATOM   6697  CD1 ILE A 124      67.737 192.115  57.462  1.00 11.94           C  
ATOM   6698  N   GLN A 125      62.249 191.108  58.044  1.00 20.77           N  
ATOM   6699  CA  GLN A 125      61.216 190.355  58.724  1.00 19.17           C  
ATOM   6700  C   GLN A 125      60.070 190.054  57.770  1.00 18.51           C  
ATOM   6701  O   GLN A 125      59.574 188.936  57.733  1.00 21.43           O  
ATOM   6702  CB  GLN A 125      60.738 191.118  59.961  1.00 17.22           C  
ATOM   6703  CG  GLN A 125      61.682 190.983  61.157  1.00 17.65           C  
ATOM   6704  CD  GLN A 125      61.689 192.211  62.081  1.00 24.50           C  
ATOM   6705  OE1 GLN A 125      60.648 192.831  62.337  1.00 22.09           O  
ATOM   6706  NE2 GLN A 125      62.874 192.555  62.596  1.00 24.04           N  
ATOM   6707  N   LEU A 126      59.646 191.026  56.979  1.00 18.09           N  
ATOM   6708  CA  LEU A 126      58.564 190.745  56.043  1.00 18.32           C  
ATOM   6709  C   LEU A 126      59.016 189.642  55.098  1.00 18.79           C  
ATOM   6710  O   LEU A 126      58.277 188.696  54.839  1.00 18.83           O  
ATOM   6711  CB  LEU A 126      58.187 191.983  55.227  1.00 15.28           C  
ATOM   6712  CG  LEU A 126      57.143 191.659  54.142  1.00 19.05           C  
ATOM   6713  CD1 LEU A 126      55.859 191.162  54.805  1.00 18.28           C  
ATOM   6714  CD2 LEU A 126      56.849 192.890  53.284  1.00 20.38           C  
ATOM   6715  N   ALA A 127      60.240 189.770  54.589  1.00 19.46           N  
ATOM   6716  CA  ALA A 127      60.795 188.786  53.670  1.00 19.73           C  
ATOM   6717  C   ALA A 127      60.830 187.370  54.255  1.00 19.65           C  
ATOM   6718  O   ALA A 127      60.427 186.418  53.592  1.00 19.94           O  
ATOM   6719  CB  ALA A 127      62.207 189.212  53.226  1.00 17.33           C  
ATOM   6720  N   ARG A 128      61.301 187.219  55.487  1.00 18.70           N  
ATOM   6721  CA  ARG A 128      61.370 185.889  56.062  1.00 22.68           C  
ATOM   6722  C   ARG A 128      59.995 185.336  56.418  1.00 24.43           C  
ATOM   6723  O   ARG A 128      59.781 184.114  56.410  1.00 23.32           O  
ATOM   6724  CB  ARG A 128      62.278 185.870  57.294  1.00 23.78           C  
ATOM   6725  CG  ARG A 128      63.709 186.290  57.014  1.00 23.53           C  
ATOM   6726  CD  ARG A 128      64.547 186.140  58.263  1.00 22.36           C  
ATOM   6727  NE  ARG A 128      64.600 184.745  58.675  1.00 27.33           N  
ATOM   6728  CZ  ARG A 128      64.416 184.323  59.921  1.00 27.18           C  
ATOM   6729  NH1 ARG A 128      64.162 185.196  60.888  1.00 23.90           N  
ATOM   6730  NH2 ARG A 128      64.489 183.026  60.199  1.00 21.82           N  
ATOM   6731  N   ARG A 129      59.057 186.222  56.722  1.00 24.62           N  
ATOM   6732  CA  ARG A 129      57.724 185.760  57.067  1.00 28.05           C  
ATOM   6733  C   ARG A 129      57.045 185.152  55.836  1.00 28.96           C  
ATOM   6734  O   ARG A 129      56.489 184.063  55.901  1.00 30.00           O  
ATOM   6735  CB  ARG A 129      56.891 186.907  57.638  1.00 31.15           C  
ATOM   6736  CG  ARG A 129      55.568 186.458  58.226  1.00 38.56           C  
ATOM   6737  CD  ARG A 129      54.753 187.629  58.769  1.00 45.61           C  
ATOM   6738  NE  ARG A 129      54.967 187.869  60.197  1.00 49.16           N  
ATOM   6739  CZ  ARG A 129      56.111 188.285  60.732  1.00 51.66           C  
ATOM   6740  NH1 ARG A 129      57.162 188.516  59.959  1.00 53.65           N  
ATOM   6741  NH2 ARG A 129      56.206 188.464  62.044  1.00 51.49           N  
ATOM   6742  N   ILE A 130      57.104 185.845  54.705  1.00 29.90           N  
ATOM   6743  CA  ILE A 130      56.490 185.339  53.481  1.00 28.48           C  
ATOM   6744  C   ILE A 130      57.213 184.097  52.948  1.00 29.02           C  
ATOM   6745  O   ILE A 130      56.594 183.209  52.364  1.00 28.58           O  
ATOM   6746  CB  ILE A 130      56.449 186.435  52.412  1.00 26.41           C  
ATOM   6747  CG1 ILE A 130      55.525 187.564  52.896  1.00 25.27           C  
ATOM   6748  CG2 ILE A 130      55.942 185.863  51.089  1.00 25.36           C  
ATOM   6749  CD1 ILE A 130      55.665 188.858  52.133  1.00 25.94           C  
ATOM   6750  N   ARG A 131      58.520 184.031  53.161  1.00 28.26           N  
ATOM   6751  CA  ARG A 131      59.292 182.877  52.724  1.00 27.14           C  
ATOM   6752  C   ARG A 131      58.969 181.652  53.571  1.00 28.18           C  
ATOM   6753  O   ARG A 131      59.395 180.547  53.256  1.00 27.29           O  
ATOM   6754  CB  ARG A 131      60.778 183.150  52.865  1.00 26.24           C  
ATOM   6755  CG  ARG A 131      61.432 183.836  51.705  1.00 19.77           C  
ATOM   6756  CD  ARG A 131      62.833 184.146  52.152  1.00 20.96           C  
ATOM   6757  NE  ARG A 131      63.672 184.678  51.098  1.00 17.67           N  
ATOM   6758  CZ  ARG A 131      64.972 184.462  51.044  1.00 18.49           C  
ATOM   6759  NH1 ARG A 131      65.547 183.723  51.990  1.00 17.14           N  
ATOM   6760  NH2 ARG A 131      65.689 184.982  50.060  1.00 18.36           N  
ATOM   6761  N   GLY A 132      58.239 181.854  54.663  1.00 30.68           N  
ATOM   6762  CA  GLY A 132      57.904 180.742  55.531  1.00 31.71           C  
ATOM   6763  C   GLY A 132      59.031 180.433  56.494  1.00 34.65           C  
ATOM   6764  O   GLY A 132      58.969 179.466  57.240  1.00 36.72           O  
ATOM   6765  N   GLU A 133      60.079 181.246  56.471  1.00 38.50           N  
ATOM   6766  CA  GLU A 133      61.201 181.048  57.374  1.00 40.32           C  
ATOM   6767  C   GLU A 133      60.735 181.485  58.754  1.00 45.77           C  
ATOM   6768  O   GLU A 133      60.003 182.469  58.893  1.00 48.41           O  
ATOM   6769  CB  GLU A 133      62.406 181.881  56.936  1.00 34.25           C  
ATOM   6770  CG  GLU A 133      63.183 181.276  55.797  1.00 31.26           C  
ATOM   6771  CD  GLU A 133      64.330 182.158  55.329  1.00 30.56           C  
ATOM   6772  OE1 GLU A 133      64.942 182.834  56.177  1.00 23.10           O  
ATOM   6773  OE2 GLU A 133      64.624 182.164  54.111  1.00 33.93           O  
ATOM   6774  N   ARG A 134      61.159 180.758  59.776  1.00 49.91           N  
ATOM   6775  CA  ARG A 134      60.744 181.075  61.128  1.00 54.30           C  
ATOM   6776  C   ARG A 134      61.909 180.931  62.108  1.00 56.53           C  
ATOM   6777  O   ARG A 134      62.994 180.475  61.737  1.00 56.67           O  
ATOM   6778  CB  ARG A 134      59.563 180.169  61.499  1.00 56.60           C  
ATOM   6779  CG  ARG A 134      58.402 180.273  60.482  1.00 58.11           C  
ATOM   6780  CD  ARG A 134      57.442 179.094  60.557  1.00 61.57           C  
ATOM   6781  NE  ARG A 134      56.280 179.250  59.679  1.00 64.01           N  
ATOM   6782  CZ  ARG A 134      55.340 178.320  59.502  1.00 65.86           C  
ATOM   6783  NH1 ARG A 134      55.419 177.154  60.140  1.00 64.57           N  
ATOM   6784  NH2 ARG A 134      54.313 178.554  58.693  1.00 65.49           N  
ATOM   6785  N   ALA A 135      61.683 181.332  63.354  1.00 57.97           N  
ATOM   6786  CA  ALA A 135      62.719 181.285  64.378  1.00 58.87           C  
ATOM   6787  C   ALA A 135      63.769 182.345  64.053  1.00 59.72           C  
ATOM   6788  O   ALA A 135      64.795 182.391  64.771  1.00 60.12           O  
ATOM   6789  CB  ALA A 135      63.366 179.903  64.424  1.00 59.03           C  
ATOM   6790  OXT ALA A 135      63.544 183.118  63.090  1.00 57.86           O  
TER    6791      ALA A 135                                                      
ATOM   6792  N   LYS B  20      90.542 176.674  74.499  1.00 37.90           N  
ATOM   6793  CA  LYS B  20      89.918 177.930  74.993  1.00 38.09           C  
ATOM   6794  C   LYS B  20      88.450 178.033  74.588  1.00 37.66           C  
ATOM   6795  O   LYS B  20      88.073 177.677  73.471  1.00 38.69           O  
ATOM   6796  CB  LYS B  20      90.683 179.141  74.461  1.00 40.08           C  
ATOM   6797  CG  LYS B  20      90.105 180.466  74.931  1.00 46.94           C  
ATOM   6798  CD  LYS B  20      90.974 181.643  74.522  1.00 50.77           C  
ATOM   6799  CE  LYS B  20      90.388 182.956  75.026  1.00 53.18           C  
ATOM   6800  NZ  LYS B  20      91.239 184.123  74.657  1.00 54.43           N  
ATOM   6801  N   VAL B  21      87.624 178.526  75.504  1.00 35.77           N  
ATOM   6802  CA  VAL B  21      86.196 178.671  75.255  1.00 33.33           C  
ATOM   6803  C   VAL B  21      85.906 179.630  74.098  1.00 33.01           C  
ATOM   6804  O   VAL B  21      86.577 180.650  73.944  1.00 35.05           O  
ATOM   6805  CB  VAL B  21      85.476 179.140  76.545  1.00 33.22           C  
ATOM   6806  CG1 VAL B  21      86.381 180.067  77.326  1.00 36.01           C  
ATOM   6807  CG2 VAL B  21      84.178 179.858  76.208  1.00 34.84           C  
ATOM   6808  N   LEU B  22      84.913 179.281  73.281  1.00 30.89           N  
ATOM   6809  CA  LEU B  22      84.505 180.090  72.131  1.00 26.52           C  
ATOM   6810  C   LEU B  22      83.260 180.907  72.477  1.00 25.61           C  
ATOM   6811  O   LEU B  22      82.229 180.336  72.809  1.00 27.59           O  
ATOM   6812  CB  LEU B  22      84.187 179.182  70.946  1.00 25.89           C  
ATOM   6813  CG  LEU B  22      85.222 178.142  70.531  1.00 24.76           C  
ATOM   6814  CD1 LEU B  22      84.721 177.400  69.294  1.00 23.90           C  
ATOM   6815  CD2 LEU B  22      86.543 178.818  70.231  1.00 25.58           C  
ATOM   6816  N   ARG B  23      83.344 182.232  72.371  1.00 23.19           N  
ATOM   6817  CA  ARG B  23      82.221 183.098  72.711  1.00 21.77           C  
ATOM   6818  C   ARG B  23      82.055 184.293  71.774  1.00 23.65           C  
ATOM   6819  O   ARG B  23      83.022 184.843  71.247  1.00 24.45           O  
ATOM   6820  CB  ARG B  23      82.397 183.699  74.118  1.00 20.14           C  
ATOM   6821  CG  ARG B  23      82.796 182.760  75.230  1.00 22.69           C  
ATOM   6822  CD  ARG B  23      83.606 183.528  76.279  1.00 17.58           C  
ATOM   6823  NE  ARG B  23      82.891 184.717  76.710  1.00 18.26           N  
ATOM   6824  CZ  ARG B  23      83.459 185.812  77.212  1.00 13.21           C  
ATOM   6825  NH1 ARG B  23      84.771 185.883  77.361  1.00 10.66           N  
ATOM   6826  NH2 ARG B  23      82.701 186.847  77.541  1.00  8.31           N  
ATOM   6827  N   ASP B  24      80.815 184.723  71.604  1.00 22.78           N  
ATOM   6828  CA  ASP B  24      80.540 185.895  70.802  1.00 22.82           C  
ATOM   6829  C   ASP B  24      81.104 185.925  69.386  1.00 22.67           C  
ATOM   6830  O   ASP B  24      81.325 187.004  68.839  1.00 23.22           O  
ATOM   6831  CB  ASP B  24      81.051 187.106  71.554  1.00 21.45           C  
ATOM   6832  CG  ASP B  24      80.097 188.240  71.499  1.00 26.38           C  
ATOM   6833  OD1 ASP B  24      78.885 187.956  71.396  1.00 31.03           O  
ATOM   6834  OD2 ASP B  24      80.541 189.404  71.567  1.00 29.84           O  
ATOM   6835  N   ASN B  25      81.328 184.777  68.764  1.00 21.04           N  
ATOM   6836  CA  ASN B  25      81.887 184.841  67.430  1.00 23.17           C  
ATOM   6837  C   ASN B  25      80.962 185.404  66.340  1.00 24.62           C  
ATOM   6838  O   ASN B  25      81.420 185.722  65.244  1.00 25.67           O  
ATOM   6839  CB  ASN B  25      82.465 183.485  67.060  1.00 24.76           C  
ATOM   6840  CG  ASN B  25      83.734 183.177  67.856  1.00 28.68           C  
ATOM   6841  OD1 ASN B  25      84.748 183.862  67.700  1.00 33.86           O  
ATOM   6842  ND2 ASN B  25      83.678 182.168  68.724  1.00 21.77           N  
ATOM   6843  N   ILE B  26      79.676 185.569  66.649  1.00 23.63           N  
ATOM   6844  CA  ILE B  26      78.750 186.124  65.684  1.00 23.06           C  
ATOM   6845  C   ILE B  26      79.183 187.554  65.390  1.00 25.66           C  
ATOM   6846  O   ILE B  26      78.712 188.174  64.435  1.00 25.92           O  
ATOM   6847  CB  ILE B  26      77.283 186.131  66.209  1.00 22.59           C  
ATOM   6848  CG1 ILE B  26      76.326 186.536  65.086  1.00 17.20           C  
ATOM   6849  CG2 ILE B  26      77.123 187.125  67.337  1.00 18.03           C  
ATOM   6850  CD1 ILE B  26      76.430 185.678  63.843  1.00 15.31           C  
ATOM   6851  N   GLN B  27      80.090 188.079  66.206  1.00 27.53           N  
ATOM   6852  CA  GLN B  27      80.567 189.448  66.002  1.00 30.93           C  
ATOM   6853  C   GLN B  27      81.614 189.492  64.905  1.00 32.28           C  
ATOM   6854  O   GLN B  27      81.785 190.515  64.250  1.00 33.66           O  
ATOM   6855  CB  GLN B  27      81.140 190.030  67.293  1.00 29.60           C  
ATOM   6856  CG  GLN B  27      80.085 190.303  68.353  1.00 32.57           C  
ATOM   6857  CD  GLN B  27      79.026 191.278  67.869  1.00 34.74           C  
ATOM   6858  OE1 GLN B  27      79.344 192.367  67.392  1.00 35.45           O  
ATOM   6859  NE2 GLN B  27      77.758 190.893  67.994  1.00 36.29           N  
ATOM   6860  N   GLY B  28      82.306 188.373  64.703  1.00 33.28           N  
ATOM   6861  CA  GLY B  28      83.310 188.312  63.658  1.00 32.39           C  
ATOM   6862  C   GLY B  28      82.672 188.675  62.327  1.00 32.84           C  
ATOM   6863  O   GLY B  28      83.358 189.093  61.397  1.00 33.84           O  
ATOM   6864  N   ILE B  29      81.355 188.498  62.238  1.00 30.63           N  
ATOM   6865  CA  ILE B  29      80.603 188.830  61.034  1.00 27.36           C  
ATOM   6866  C   ILE B  29      80.396 190.339  61.103  1.00 26.66           C  
ATOM   6867  O   ILE B  29      79.322 190.813  61.465  1.00 27.12           O  
ATOM   6868  CB  ILE B  29      79.229 188.133  61.026  1.00 25.95           C  
ATOM   6869  CG1 ILE B  29      79.388 186.646  61.354  1.00 25.01           C  
ATOM   6870  CG2 ILE B  29      78.580 188.288  59.674  1.00 28.90           C  
ATOM   6871  CD1 ILE B  29      80.214 185.872  60.361  1.00 21.55           C  
ATOM   6872  N   THR B  30      81.436 191.085  60.745  1.00 25.68           N  
ATOM   6873  CA  THR B  30      81.427 192.545  60.810  1.00 24.70           C  
ATOM   6874  C   THR B  30      80.482 193.340  59.927  1.00 25.70           C  
ATOM   6875  O   THR B  30      79.907 192.828  58.957  1.00 26.96           O  
ATOM   6876  CB  THR B  30      82.823 193.094  60.561  1.00 24.95           C  
ATOM   6877  OG1 THR B  30      83.228 192.779  59.221  1.00 25.47           O  
ATOM   6878  CG2 THR B  30      83.798 192.483  61.544  1.00 21.25           C  
ATOM   6879  N   LYS B  31      80.342 194.616  60.275  1.00 24.15           N  
ATOM   6880  CA  LYS B  31      79.490 195.534  59.532  1.00 23.92           C  
ATOM   6881  C   LYS B  31      79.903 195.624  58.055  1.00 22.13           C  
ATOM   6882  O   LYS B  31      79.070 195.481  57.167  1.00 21.90           O  
ATOM   6883  CB  LYS B  31      79.525 196.923  60.171  1.00 25.81           C  
ATOM   6884  CG  LYS B  31      78.779 197.985  59.382  1.00 28.44           C  
ATOM   6885  CD  LYS B  31      78.946 199.333  60.035  1.00 31.62           C  
ATOM   6886  CE  LYS B  31      78.259 200.424  59.257  1.00 31.76           C  
ATOM   6887  NZ  LYS B  31      78.496 201.730  59.936  1.00 33.93           N  
ATOM   6888  N   PRO B  32      81.188 195.895  57.774  1.00 21.06           N  
ATOM   6889  CA  PRO B  32      81.577 195.969  56.357  1.00 19.93           C  
ATOM   6890  C   PRO B  32      81.295 194.673  55.572  1.00 19.69           C  
ATOM   6891  O   PRO B  32      80.876 194.725  54.414  1.00 17.51           O  
ATOM   6892  CB  PRO B  32      83.066 196.342  56.409  1.00 18.10           C  
ATOM   6893  CG  PRO B  32      83.478 196.068  57.843  1.00 21.01           C  
ATOM   6894  CD  PRO B  32      82.266 196.377  58.653  1.00 17.60           C  
ATOM   6895  N   ALA B  33      81.510 193.513  56.192  1.00 20.74           N  
ATOM   6896  CA  ALA B  33      81.218 192.247  55.505  1.00 20.93           C  
ATOM   6897  C   ALA B  33      79.713 192.120  55.197  1.00 21.43           C  
ATOM   6898  O   ALA B  33      79.332 191.642  54.134  1.00 26.00           O  
ATOM   6899  CB  ALA B  33      81.677 191.068  56.334  1.00 12.54           C  
ATOM   6900  N   ILE B  34      78.855 192.546  56.114  1.00 20.79           N  
ATOM   6901  CA  ILE B  34      77.416 192.455  55.871  1.00 20.66           C  
ATOM   6902  C   ILE B  34      77.026 193.457  54.791  1.00 20.43           C  
ATOM   6903  O   ILE B  34      76.101 193.231  54.008  1.00 19.31           O  
ATOM   6904  CB  ILE B  34      76.610 192.749  57.161  1.00 19.02           C  
ATOM   6905  CG1 ILE B  34      76.813 191.619  58.174  1.00 20.32           C  
ATOM   6906  CG2 ILE B  34      75.143 192.907  56.838  1.00 18.35           C  
ATOM   6907  CD1 ILE B  34      76.365 191.973  59.592  1.00 17.78           C  
ATOM   6908  N   ARG B  35      77.751 194.566  54.757  1.00 21.09           N  
ATOM   6909  CA  ARG B  35      77.513 195.621  53.784  1.00 22.46           C  
ATOM   6910  C   ARG B  35      77.829 195.099  52.379  1.00 22.26           C  
ATOM   6911  O   ARG B  35      77.034 195.267  51.453  1.00 21.43           O  
ATOM   6912  CB  ARG B  35      78.374 196.834  54.145  1.00 23.16           C  
ATOM   6913  CG  ARG B  35      78.366 197.971  53.147  1.00 29.98           C  
ATOM   6914  CD  ARG B  35      79.104 199.186  53.721  1.00 34.09           C  
ATOM   6915  NE  ARG B  35      78.273 199.878  54.699  1.00 34.45           N  
ATOM   6916  CZ  ARG B  35      77.703 201.052  54.466  1.00 41.25           C  
ATOM   6917  NH1 ARG B  35      77.894 201.661  53.301  1.00 44.18           N  
ATOM   6918  NH2 ARG B  35      76.908 201.601  55.370  1.00 46.32           N  
ATOM   6919  N   ARG B  36      78.979 194.449  52.224  1.00 21.39           N  
ATOM   6920  CA  ARG B  36      79.345 193.898  50.934  1.00 20.65           C  
ATOM   6921  C   ARG B  36      78.243 192.951  50.438  1.00 20.70           C  
ATOM   6922  O   ARG B  36      77.834 193.021  49.267  1.00 19.59           O  
ATOM   6923  CB  ARG B  36      80.687 193.161  51.021  1.00 22.08           C  
ATOM   6924  CG  ARG B  36      81.916 194.075  51.163  1.00 20.42           C  
ATOM   6925  CD  ARG B  36      83.228 193.287  51.036  1.00 21.17           C  
ATOM   6926  NE  ARG B  36      83.523 192.412  52.182  1.00 21.48           N  
ATOM   6927  CZ  ARG B  36      84.090 192.819  53.320  1.00 21.95           C  
ATOM   6928  NH1 ARG B  36      84.429 194.091  53.484  1.00 16.49           N  
ATOM   6929  NH2 ARG B  36      84.345 191.948  54.292  1.00 20.88           N  
ATOM   6930  N   LEU B  37      77.768 192.074  51.323  1.00 18.22           N  
ATOM   6931  CA  LEU B  37      76.698 191.128  50.986  1.00 15.76           C  
ATOM   6932  C   LEU B  37      75.462 191.853  50.459  1.00 15.97           C  
ATOM   6933  O   LEU B  37      74.862 191.440  49.465  1.00 16.22           O  
ATOM   6934  CB  LEU B  37      76.312 190.296  52.213  1.00 13.73           C  
ATOM   6935  CG  LEU B  37      77.382 189.299  52.648  1.00 12.87           C  
ATOM   6936  CD1 LEU B  37      77.132 188.830  54.098  1.00 12.72           C  
ATOM   6937  CD2 LEU B  37      77.396 188.140  51.664  1.00  8.72           C  
ATOM   6938  N   ALA B  38      75.077 192.932  51.131  1.00 16.64           N  
ATOM   6939  CA  ALA B  38      73.922 193.718  50.705  1.00 16.51           C  
ATOM   6940  C   ALA B  38      74.156 194.385  49.346  1.00 17.50           C  
ATOM   6941  O   ALA B  38      73.204 194.673  48.625  1.00 20.50           O  
ATOM   6942  CB  ALA B  38      73.593 194.771  51.742  1.00 14.18           C  
ATOM   6943  N   ARG B  39      75.413 194.655  49.003  1.00 18.07           N  
ATOM   6944  CA  ARG B  39      75.714 195.269  47.712  1.00 16.88           C  
ATOM   6945  C   ARG B  39      75.472 194.225  46.622  1.00 17.08           C  
ATOM   6946  O   ARG B  39      74.731 194.486  45.675  1.00 16.10           O  
ATOM   6947  CB  ARG B  39      77.163 195.751  47.646  1.00 17.04           C  
ATOM   6948  CG  ARG B  39      77.497 196.879  48.598  1.00 20.87           C  
ATOM   6949  CD  ARG B  39      76.654 198.106  48.313  1.00 22.51           C  
ATOM   6950  NE  ARG B  39      77.069 199.218  49.158  1.00 25.11           N  
ATOM   6951  CZ  ARG B  39      76.240 199.928  49.917  1.00 29.77           C  
ATOM   6952  NH1 ARG B  39      74.936 199.642  49.926  1.00 25.93           N  
ATOM   6953  NH2 ARG B  39      76.720 200.897  50.695  1.00 25.09           N  
ATOM   6954  N   ARG B  40      76.084 193.046  46.760  1.00 14.76           N  
ATOM   6955  CA  ARG B  40      75.899 191.994  45.772  1.00 16.50           C  
ATOM   6956  C   ARG B  40      74.400 191.751  45.617  1.00 17.43           C  
ATOM   6957  O   ARG B  40      73.919 191.402  44.546  1.00 20.22           O  
ATOM   6958  CB  ARG B  40      76.624 190.706  46.205  1.00 15.97           C  
ATOM   6959  CG  ARG B  40      76.547 189.531  45.205  1.00 14.73           C  
ATOM   6960  CD  ARG B  40      77.623 188.459  45.507  1.00 10.96           C  
ATOM   6961  NE  ARG B  40      78.951 188.953  45.178  1.00 10.78           N  
ATOM   6962  CZ  ARG B  40      80.095 188.395  45.561  1.00 12.01           C  
ATOM   6963  NH1 ARG B  40      80.085 187.304  46.300  1.00 14.03           N  
ATOM   6964  NH2 ARG B  40      81.256 188.937  45.202  1.00  7.99           N  
ATOM   6965  N   GLY B  41      73.656 191.968  46.690  1.00 18.68           N  
ATOM   6966  CA  GLY B  41      72.221 191.773  46.629  1.00 17.44           C  
ATOM   6967  C   GLY B  41      71.490 193.003  46.126  1.00 17.02           C  
ATOM   6968  O   GLY B  41      70.260 193.053  46.205  1.00 17.30           O  
ATOM   6969  N   GLY B  42      72.246 193.994  45.647  1.00 15.76           N  
ATOM   6970  CA  GLY B  42      71.675 195.223  45.099  1.00 17.85           C  
ATOM   6971  C   GLY B  42      71.168 196.324  46.020  1.00 19.30           C  
ATOM   6972  O   GLY B  42      70.537 197.276  45.569  1.00 16.75           O  
ATOM   6973  N   VAL B  43      71.448 196.210  47.312  1.00 21.78           N  
ATOM   6974  CA  VAL B  43      70.990 197.200  48.276  1.00 20.33           C  
ATOM   6975  C   VAL B  43      71.897 198.425  48.253  1.00 21.76           C  
ATOM   6976  O   VAL B  43      73.125 198.309  48.305  1.00 23.14           O  
ATOM   6977  CB  VAL B  43      70.942 196.588  49.697  1.00 18.57           C  
ATOM   6978  CG1 VAL B  43      70.399 197.591  50.694  1.00 15.45           C  
ATOM   6979  CG2 VAL B  43      70.069 195.350  49.681  1.00 20.33           C  
ATOM   6980  N   LYS B  44      71.276 199.600  48.185  1.00 21.47           N  
ATOM   6981  CA  LYS B  44      72.004 200.859  48.124  1.00 21.43           C  
ATOM   6982  C   LYS B  44      72.078 201.642  49.436  1.00 20.14           C  
ATOM   6983  O   LYS B  44      73.042 202.359  49.666  1.00 18.80           O  
ATOM   6984  CB  LYS B  44      71.381 201.737  47.051  1.00 22.98           C  
ATOM   6985  CG  LYS B  44      72.042 203.095  46.881  1.00 28.20           C  
ATOM   6986  CD  LYS B  44      71.175 203.951  45.958  1.00 29.30           C  
ATOM   6987  CE  LYS B  44      71.836 205.237  45.586  1.00 27.23           C  
ATOM   6988  NZ  LYS B  44      70.972 205.981  44.633  1.00 31.64           N  
ATOM   6989  N   ARG B  45      71.068 201.504  50.291  1.00 19.21           N  
ATOM   6990  CA  ARG B  45      71.050 202.219  51.557  1.00 19.61           C  
ATOM   6991  C   ARG B  45      70.640 201.274  52.671  1.00 20.53           C  
ATOM   6992  O   ARG B  45      69.594 200.634  52.602  1.00 20.39           O  
ATOM   6993  CB  ARG B  45      70.100 203.420  51.482  1.00 21.02           C  
ATOM   6994  CG  ARG B  45      70.479 204.562  52.420  1.00 20.43           C  
ATOM   6995  CD  ARG B  45      69.800 205.865  52.003  1.00 27.92           C  
ATOM   6996  NE  ARG B  45      70.085 206.964  52.926  1.00 33.43           N  
ATOM   6997  CZ  ARG B  45      69.668 207.010  54.190  1.00 37.37           C  
ATOM   6998  NH1 ARG B  45      68.937 206.018  54.693  1.00 35.50           N  
ATOM   6999  NH2 ARG B  45      69.987 208.044  54.958  1.00 37.79           N  
ATOM   7000  N   ILE B  46      71.472 201.228  53.708  1.00 20.90           N  
ATOM   7001  CA  ILE B  46      71.307 200.336  54.843  1.00 21.75           C  
ATOM   7002  C   ILE B  46      71.075 201.001  56.207  1.00 24.17           C  
ATOM   7003  O   ILE B  46      71.828 201.876  56.613  1.00 25.72           O  
ATOM   7004  CB  ILE B  46      72.559 199.450  54.934  1.00 18.75           C  
ATOM   7005  CG1 ILE B  46      72.728 198.675  53.624  1.00 23.06           C  
ATOM   7006  CG2 ILE B  46      72.473 198.524  56.113  1.00 22.02           C  
ATOM   7007  CD1 ILE B  46      74.004 197.836  53.564  1.00 25.71           C  
ATOM   7008  N   SER B  47      70.042 200.578  56.928  1.00 24.56           N  
ATOM   7009  CA  SER B  47      69.786 201.145  58.248  1.00 22.42           C  
ATOM   7010  C   SER B  47      70.769 200.569  59.246  1.00 23.80           C  
ATOM   7011  O   SER B  47      71.140 199.394  59.158  1.00 24.10           O  
ATOM   7012  CB  SER B  47      68.377 200.822  58.712  1.00 23.87           C  
ATOM   7013  OG  SER B  47      68.341 200.791  60.128  1.00 29.52           O  
ATOM   7014  N   GLY B  48      71.186 201.388  60.206  1.00 24.23           N  
ATOM   7015  CA  GLY B  48      72.143 200.924  61.199  1.00 21.63           C  
ATOM   7016  C   GLY B  48      71.640 199.760  62.033  1.00 23.00           C  
ATOM   7017  O   GLY B  48      72.415 199.091  62.719  1.00 22.63           O  
ATOM   7018  N   LEU B  49      70.340 199.505  61.985  1.00 23.12           N  
ATOM   7019  CA  LEU B  49      69.783 198.406  62.763  1.00 24.88           C  
ATOM   7020  C   LEU B  49      69.859 197.065  62.023  1.00 25.47           C  
ATOM   7021  O   LEU B  49      69.540 196.021  62.589  1.00 26.68           O  
ATOM   7022  CB  LEU B  49      68.328 198.714  63.120  1.00 24.55           C  
ATOM   7023  CG  LEU B  49      68.085 199.955  63.985  1.00 26.39           C  
ATOM   7024  CD1 LEU B  49      66.599 200.317  63.948  1.00 26.74           C  
ATOM   7025  CD2 LEU B  49      68.556 199.694  65.405  1.00 20.11           C  
ATOM   7026  N   ILE B  50      70.287 197.101  60.763  1.00 23.45           N  
ATOM   7027  CA  ILE B  50      70.386 195.902  59.936  1.00 21.09           C  
ATOM   7028  C   ILE B  50      71.445 194.902  60.358  1.00 19.54           C  
ATOM   7029  O   ILE B  50      71.222 193.697  60.287  1.00 21.06           O  
ATOM   7030  CB  ILE B  50      70.651 196.274  58.440  1.00 20.47           C  
ATOM   7031  CG1 ILE B  50      69.337 196.671  57.764  1.00 20.68           C  
ATOM   7032  CG2 ILE B  50      71.341 195.115  57.700  1.00 13.74           C  
ATOM   7033  CD1 ILE B  50      68.353 195.535  57.606  1.00 19.33           C  
ATOM   7034  N   TYR B  51      72.596 195.387  60.796  1.00 18.90           N  
ATOM   7035  CA  TYR B  51      73.687 194.487  61.156  1.00 19.09           C  
ATOM   7036  C   TYR B  51      73.367 193.456  62.221  1.00 19.19           C  
ATOM   7037  O   TYR B  51      73.771 192.301  62.092  1.00 20.84           O  
ATOM   7038  CB  TYR B  51      74.931 195.302  61.527  1.00 18.98           C  
ATOM   7039  CG  TYR B  51      75.210 196.356  60.486  1.00 19.02           C  
ATOM   7040  CD1 TYR B  51      75.341 196.007  59.136  1.00 21.49           C  
ATOM   7041  CD2 TYR B  51      75.230 197.707  60.819  1.00 18.69           C  
ATOM   7042  CE1 TYR B  51      75.467 196.982  58.137  1.00 19.35           C  
ATOM   7043  CE2 TYR B  51      75.361 198.690  59.831  1.00 21.65           C  
ATOM   7044  CZ  TYR B  51      75.473 198.311  58.491  1.00 22.81           C  
ATOM   7045  OH  TYR B  51      75.563 199.266  57.510  1.00 29.57           O  
ATOM   7046  N   GLU B  52      72.647 193.847  63.265  1.00 19.86           N  
ATOM   7047  CA  GLU B  52      72.298 192.889  64.305  1.00 20.79           C  
ATOM   7048  C   GLU B  52      71.171 192.000  63.805  1.00 19.11           C  
ATOM   7049  O   GLU B  52      71.086 190.827  64.166  1.00 20.50           O  
ATOM   7050  CB  GLU B  52      71.884 193.600  65.603  1.00 25.00           C  
ATOM   7051  CG  GLU B  52      73.050 193.949  66.535  1.00 27.19           C  
ATOM   7052  CD  GLU B  52      73.766 192.719  67.063  1.00 32.81           C  
ATOM   7053  OE1 GLU B  52      73.075 191.798  67.549  1.00 36.85           O  
ATOM   7054  OE2 GLU B  52      75.016 192.666  67.003  1.00 34.49           O  
ATOM   7055  N   GLU B  53      70.306 192.550  62.966  1.00 16.67           N  
ATOM   7056  CA  GLU B  53      69.219 191.755  62.427  1.00 19.00           C  
ATOM   7057  C   GLU B  53      69.817 190.636  61.564  1.00 20.75           C  
ATOM   7058  O   GLU B  53      69.358 189.494  61.626  1.00 22.93           O  
ATOM   7059  CB  GLU B  53      68.278 192.628  61.594  1.00 18.34           C  
ATOM   7060  CG  GLU B  53      66.968 191.953  61.179  1.00 22.44           C  
ATOM   7061  CD  GLU B  53      66.075 191.562  62.358  1.00 23.89           C  
ATOM   7062  OE1 GLU B  53      66.244 192.107  63.465  1.00 25.86           O  
ATOM   7063  OE2 GLU B  53      65.183 190.711  62.174  1.00 27.48           O  
ATOM   7064  N   THR B  54      70.851 190.959  60.782  1.00 19.89           N  
ATOM   7065  CA  THR B  54      71.496 189.972  59.916  1.00 18.75           C  
ATOM   7066  C   THR B  54      72.247 188.919  60.735  1.00 18.86           C  
ATOM   7067  O   THR B  54      72.146 187.726  60.444  1.00 19.11           O  
ATOM   7068  CB  THR B  54      72.470 190.648  58.889  1.00 19.37           C  
ATOM   7069  OG1 THR B  54      71.744 191.553  58.053  1.00 17.96           O  
ATOM   7070  CG2 THR B  54      73.111 189.621  57.995  1.00 15.83           C  
ATOM   7071  N   ARG B  55      72.986 189.339  61.760  1.00 18.39           N  
ATOM   7072  CA  ARG B  55      73.716 188.377  62.601  1.00 17.71           C  
ATOM   7073  C   ARG B  55      72.759 187.363  63.207  1.00 18.65           C  
ATOM   7074  O   ARG B  55      73.070 186.173  63.299  1.00 18.39           O  
ATOM   7075  CB  ARG B  55      74.460 189.080  63.724  1.00 16.84           C  
ATOM   7076  CG  ARG B  55      75.583 189.951  63.231  1.00 21.54           C  
ATOM   7077  CD  ARG B  55      76.425 190.538  64.343  1.00 20.51           C  
ATOM   7078  NE  ARG B  55      77.424 191.421  63.758  1.00 26.15           N  
ATOM   7079  CZ  ARG B  55      77.278 192.732  63.607  1.00 27.43           C  
ATOM   7080  NH1 ARG B  55      76.177 193.338  64.019  1.00 28.81           N  
ATOM   7081  NH2 ARG B  55      78.221 193.430  62.993  1.00 30.68           N  
ATOM   7082  N   GLY B  56      71.587 187.844  63.610  1.00 18.39           N  
ATOM   7083  CA  GLY B  56      70.594 186.971  64.199  1.00 16.25           C  
ATOM   7084  C   GLY B  56      70.137 185.961  63.179  1.00 16.77           C  
ATOM   7085  O   GLY B  56      70.139 184.760  63.443  1.00 19.02           O  
ATOM   7086  N   VAL B  57      69.747 186.455  62.006  1.00 17.23           N  
ATOM   7087  CA  VAL B  57      69.284 185.614  60.906  1.00 15.82           C  
ATOM   7088  C   VAL B  57      70.346 184.606  60.449  1.00 15.91           C  
ATOM   7089  O   VAL B  57      70.050 183.440  60.240  1.00 18.21           O  
ATOM   7090  CB  VAL B  57      68.865 186.489  59.725  1.00 15.99           C  
ATOM   7091  CG1 VAL B  57      68.725 185.654  58.463  1.00 15.24           C  
ATOM   7092  CG2 VAL B  57      67.565 187.170  60.056  1.00 15.06           C  
ATOM   7093  N   LEU B  58      71.582 185.056  60.291  1.00 14.56           N  
ATOM   7094  CA  LEU B  58      72.646 184.157  59.890  1.00 13.78           C  
ATOM   7095  C   LEU B  58      72.823 183.059  60.943  1.00 13.73           C  
ATOM   7096  O   LEU B  58      73.012 181.891  60.612  1.00 13.13           O  
ATOM   7097  CB  LEU B  58      73.961 184.939  59.705  1.00 12.82           C  
ATOM   7098  CG  LEU B  58      75.258 184.135  59.539  1.00 12.22           C  
ATOM   7099  CD1 LEU B  58      75.134 183.195  58.369  1.00 15.07           C  
ATOM   7100  CD2 LEU B  58      76.426 185.070  59.329  1.00 12.14           C  
ATOM   7101  N   LYS B  59      72.750 183.442  62.214  1.00 14.70           N  
ATOM   7102  CA  LYS B  59      72.917 182.508  63.318  1.00 13.14           C  
ATOM   7103  C   LYS B  59      71.867 181.408  63.275  1.00 14.85           C  
ATOM   7104  O   LYS B  59      72.188 180.223  63.408  1.00 17.45           O  
ATOM   7105  CB  LYS B  59      72.853 183.266  64.635  1.00 16.26           C  
ATOM   7106  CG  LYS B  59      73.345 182.472  65.809  1.00 22.85           C  
ATOM   7107  CD  LYS B  59      73.881 183.388  66.866  1.00 25.72           C  
ATOM   7108  CE  LYS B  59      74.671 182.606  67.914  1.00 32.07           C  
ATOM   7109  NZ  LYS B  59      73.782 181.903  68.874  1.00 37.36           N  
ATOM   7110  N   VAL B  60      70.610 181.790  63.083  1.00 13.83           N  
ATOM   7111  CA  VAL B  60      69.544 180.808  62.992  1.00 13.02           C  
ATOM   7112  C   VAL B  60      69.813 179.897  61.791  1.00 15.69           C  
ATOM   7113  O   VAL B  60      69.595 178.682  61.852  1.00 18.95           O  
ATOM   7114  CB  VAL B  60      68.171 181.499  62.830  1.00 15.22           C  
ATOM   7115  CG1 VAL B  60      67.095 180.470  62.457  1.00 12.40           C  
ATOM   7116  CG2 VAL B  60      67.806 182.226  64.122  1.00  8.90           C  
ATOM   7117  N   PHE B  61      70.299 180.480  60.699  1.00 14.38           N  
ATOM   7118  CA  PHE B  61      70.591 179.703  59.511  1.00 14.31           C  
ATOM   7119  C   PHE B  61      71.705 178.661  59.729  1.00 15.04           C  
ATOM   7120  O   PHE B  61      71.544 177.495  59.376  1.00 16.36           O  
ATOM   7121  CB  PHE B  61      70.969 180.632  58.352  1.00 11.88           C  
ATOM   7122  CG  PHE B  61      71.336 179.904  57.099  1.00  8.30           C  
ATOM   7123  CD1 PHE B  61      70.366 179.601  56.143  1.00 12.68           C  
ATOM   7124  CD2 PHE B  61      72.648 179.513  56.872  1.00  4.32           C  
ATOM   7125  CE1 PHE B  61      70.704 178.914  54.961  1.00 10.96           C  
ATOM   7126  CE2 PHE B  61      73.002 178.830  55.707  1.00  7.62           C  
ATOM   7127  CZ  PHE B  61      72.023 178.531  54.745  1.00 10.65           C  
ATOM   7128  N   LEU B  62      72.836 179.078  60.289  1.00 15.48           N  
ATOM   7129  CA  LEU B  62      73.938 178.150  60.536  1.00 15.20           C  
ATOM   7130  C   LEU B  62      73.552 177.107  61.588  1.00 17.56           C  
ATOM   7131  O   LEU B  62      74.024 175.967  61.549  1.00 17.44           O  
ATOM   7132  CB  LEU B  62      75.188 178.905  60.986  1.00 13.09           C  
ATOM   7133  CG  LEU B  62      75.975 179.572  59.859  1.00 15.20           C  
ATOM   7134  CD1 LEU B  62      77.061 180.470  60.459  1.00 16.80           C  
ATOM   7135  CD2 LEU B  62      76.589 178.515  58.953  1.00 13.26           C  
ATOM   7136  N   GLU B  63      72.700 177.501  62.533  1.00 17.51           N  
ATOM   7137  CA  GLU B  63      72.240 176.580  63.559  1.00 17.24           C  
ATOM   7138  C   GLU B  63      71.452 175.440  62.918  1.00 17.50           C  
ATOM   7139  O   GLU B  63      71.698 174.266  63.206  1.00 19.32           O  
ATOM   7140  CB  GLU B  63      71.358 177.312  64.567  1.00 18.40           C  
ATOM   7141  CG  GLU B  63      72.050 177.703  65.865  1.00 19.72           C  
ATOM   7142  CD  GLU B  63      71.378 178.887  66.523  1.00 22.11           C  
ATOM   7143  OE1 GLU B  63      70.132 178.952  66.520  1.00 25.87           O  
ATOM   7144  OE2 GLU B  63      72.089 179.759  67.050  1.00 26.40           O  
ATOM   7145  N   ASN B  64      70.510 175.773  62.040  1.00 15.59           N  
ATOM   7146  CA  ASN B  64      69.720 174.732  61.401  1.00 14.29           C  
ATOM   7147  C   ASN B  64      70.533 173.822  60.521  1.00 15.47           C  
ATOM   7148  O   ASN B  64      70.354 172.606  60.561  1.00 18.17           O  
ATOM   7149  CB  ASN B  64      68.587 175.319  60.574  1.00 14.97           C  
ATOM   7150  CG  ASN B  64      67.575 176.028  61.424  1.00 15.67           C  
ATOM   7151  OD1 ASN B  64      67.384 175.672  62.577  1.00 21.38           O  
ATOM   7152  ND2 ASN B  64      66.909 177.021  60.862  1.00 16.94           N  
ATOM   7153  N   VAL B  65      71.424 174.389  59.715  1.00 14.87           N  
ATOM   7154  CA  VAL B  65      72.223 173.554  58.834  1.00 14.07           C  
ATOM   7155  C   VAL B  65      73.239 172.750  59.635  1.00 13.16           C  
ATOM   7156  O   VAL B  65      73.324 171.533  59.488  1.00 13.49           O  
ATOM   7157  CB  VAL B  65      72.965 174.385  57.751  1.00 12.49           C  
ATOM   7158  CG1 VAL B  65      73.815 173.469  56.879  1.00 11.50           C  
ATOM   7159  CG2 VAL B  65      71.976 175.095  56.887  1.00 13.06           C  
ATOM   7160  N   ILE B  66      73.997 173.418  60.494  1.00 13.49           N  
ATOM   7161  CA  ILE B  66      75.001 172.713  61.276  1.00 15.94           C  
ATOM   7162  C   ILE B  66      74.382 171.611  62.130  1.00 16.63           C  
ATOM   7163  O   ILE B  66      74.946 170.525  62.240  1.00 16.84           O  
ATOM   7164  CB  ILE B  66      75.816 173.682  62.150  1.00 16.17           C  
ATOM   7165  CG1 ILE B  66      76.654 174.594  61.245  1.00 15.28           C  
ATOM   7166  CG2 ILE B  66      76.728 172.907  63.092  1.00 15.73           C  
ATOM   7167  CD1 ILE B  66      77.628 175.468  62.000  1.00 18.66           C  
ATOM   7168  N   ARG B  67      73.209 171.871  62.696  1.00 17.80           N  
ATOM   7169  CA  ARG B  67      72.539 170.866  63.507  1.00 20.03           C  
ATOM   7170  C   ARG B  67      72.347 169.581  62.714  1.00 21.62           C  
ATOM   7171  O   ARG B  67      72.537 168.480  63.249  1.00 23.84           O  
ATOM   7172  CB  ARG B  67      71.185 171.371  63.987  1.00 22.21           C  
ATOM   7173  CG  ARG B  67      70.447 170.359  64.838  1.00 24.65           C  
ATOM   7174  CD  ARG B  67      68.990 170.727  64.982  1.00 22.89           C  
ATOM   7175  NE  ARG B  67      68.828 171.947  65.758  1.00 28.77           N  
ATOM   7176  CZ  ARG B  67      68.416 173.109  65.264  1.00 30.98           C  
ATOM   7177  NH1 ARG B  67      68.117 173.230  63.975  1.00 34.24           N  
ATOM   7178  NH2 ARG B  67      68.284 174.150  66.069  1.00 32.41           N  
ATOM   7179  N   ASP B  68      71.972 169.711  61.440  1.00 22.54           N  
ATOM   7180  CA  ASP B  68      71.788 168.536  60.587  1.00 20.69           C  
ATOM   7181  C   ASP B  68      73.125 167.982  60.105  1.00 20.18           C  
ATOM   7182  O   ASP B  68      73.277 166.764  59.962  1.00 21.54           O  
ATOM   7183  CB  ASP B  68      70.876 168.855  59.398  1.00 17.25           C  
ATOM   7184  CG  ASP B  68      69.433 169.047  59.824  1.00 19.41           C  
ATOM   7185  OD1 ASP B  68      69.170 168.998  61.050  1.00 19.06           O  
ATOM   7186  OD2 ASP B  68      68.565 169.250  58.953  1.00 12.14           O  
ATOM   7187  N   ALA B  69      74.098 168.855  59.871  1.00 17.18           N  
ATOM   7188  CA  ALA B  69      75.406 168.374  59.441  1.00 19.47           C  
ATOM   7189  C   ALA B  69      75.972 167.487  60.556  1.00 20.68           C  
ATOM   7190  O   ALA B  69      76.455 166.380  60.295  1.00 22.79           O  
ATOM   7191  CB  ALA B  69      76.364 169.554  59.151  1.00 18.36           C  
ATOM   7192  N   VAL B  70      75.891 167.959  61.799  1.00 18.17           N  
ATOM   7193  CA  VAL B  70      76.396 167.192  62.935  1.00 19.39           C  
ATOM   7194  C   VAL B  70      75.636 165.877  63.198  1.00 21.28           C  
ATOM   7195  O   VAL B  70      76.217 164.924  63.718  1.00 22.43           O  
ATOM   7196  CB  VAL B  70      76.422 168.062  64.220  1.00 20.09           C  
ATOM   7197  CG1 VAL B  70      76.699 167.204  65.430  1.00 20.41           C  
ATOM   7198  CG2 VAL B  70      77.502 169.140  64.088  1.00 17.29           C  
ATOM   7199  N   THR B  71      74.351 165.816  62.843  1.00 20.85           N  
ATOM   7200  CA  THR B  71      73.580 164.586  63.028  1.00 18.91           C  
ATOM   7201  C   THR B  71      74.066 163.528  62.028  1.00 22.08           C  
ATOM   7202  O   THR B  71      74.052 162.341  62.338  1.00 22.07           O  
ATOM   7203  CB  THR B  71      72.079 164.814  62.813  1.00 18.83           C  
ATOM   7204  OG1 THR B  71      71.548 165.617  63.873  1.00 19.85           O  
ATOM   7205  CG2 THR B  71      71.352 163.514  62.771  1.00 15.42           C  
ATOM   7206  N   TYR B  72      74.484 163.947  60.826  1.00 22.81           N  
ATOM   7207  CA  TYR B  72      75.005 162.988  59.835  1.00 21.27           C  
ATOM   7208  C   TYR B  72      76.375 162.470  60.283  1.00 21.28           C  
ATOM   7209  O   TYR B  72      76.703 161.306  60.064  1.00 18.25           O  
ATOM   7210  CB  TYR B  72      75.161 163.621  58.447  1.00 18.98           C  
ATOM   7211  CG  TYR B  72      73.868 163.764  57.694  1.00 19.64           C  
ATOM   7212  CD1 TYR B  72      73.236 165.002  57.588  1.00 16.99           C  
ATOM   7213  CD2 TYR B  72      73.246 162.652  57.128  1.00 19.47           C  
ATOM   7214  CE1 TYR B  72      72.026 165.123  56.956  1.00 19.23           C  
ATOM   7215  CE2 TYR B  72      72.033 162.766  56.485  1.00 20.62           C  
ATOM   7216  CZ  TYR B  72      71.426 164.005  56.404  1.00 22.54           C  
ATOM   7217  OH  TYR B  72      70.211 164.132  55.776  1.00 27.82           O  
ATOM   7218  N   THR B  73      77.164 163.360  60.893  1.00 21.94           N  
ATOM   7219  CA  THR B  73      78.498 163.045  61.405  1.00 22.11           C  
ATOM   7220  C   THR B  73      78.397 162.003  62.520  1.00 23.85           C  
ATOM   7221  O   THR B  73      79.040 160.947  62.472  1.00 20.89           O  
ATOM   7222  CB  THR B  73      79.174 164.277  62.032  1.00 22.64           C  
ATOM   7223  OG1 THR B  73      79.161 165.373  61.107  1.00 27.23           O  
ATOM   7224  CG2 THR B  73      80.609 163.939  62.424  1.00 17.15           C  
ATOM   7225  N   GLU B  74      77.590 162.324  63.530  1.00 24.97           N  
ATOM   7226  CA  GLU B  74      77.392 161.438  64.663  1.00 28.48           C  
ATOM   7227  C   GLU B  74      76.858 160.081  64.221  1.00 29.79           C  
ATOM   7228  O   GLU B  74      77.243 159.057  64.774  1.00 32.10           O  
ATOM   7229  CB  GLU B  74      76.438 162.075  65.672  1.00 29.89           C  
ATOM   7230  CG  GLU B  74      76.981 163.355  66.289  1.00 38.33           C  
ATOM   7231  CD  GLU B  74      75.980 164.033  67.205  1.00 43.41           C  
ATOM   7232  OE1 GLU B  74      74.862 164.360  66.746  1.00 46.21           O  
ATOM   7233  OE2 GLU B  74      76.312 164.240  68.389  1.00 47.49           O  
ATOM   7234  N   HIS B  75      75.987 160.066  63.215  1.00 30.23           N  
ATOM   7235  CA  HIS B  75      75.439 158.806  62.743  1.00 29.88           C  
ATOM   7236  C   HIS B  75      76.487 157.964  62.050  1.00 31.28           C  
ATOM   7237  O   HIS B  75      76.462 156.743  62.147  1.00 34.23           O  
ATOM   7238  CB  HIS B  75      74.270 159.032  61.792  1.00 27.16           C  
ATOM   7239  CG  HIS B  75      73.693 157.763  61.244  1.00 28.21           C  
ATOM   7240  ND1 HIS B  75      74.223 157.115  60.149  1.00 30.70           N  
ATOM   7241  CD2 HIS B  75      72.641 157.014  61.648  1.00 22.39           C  
ATOM   7242  CE1 HIS B  75      73.517 156.027  59.899  1.00 24.42           C  
ATOM   7243  NE2 HIS B  75      72.552 155.945  60.795  1.00 20.08           N  
ATOM   7244  N   ALA B  76      77.408 158.608  61.344  1.00 30.87           N  
ATOM   7245  CA  ALA B  76      78.451 157.867  60.650  1.00 30.41           C  
ATOM   7246  C   ALA B  76      79.517 157.471  61.657  1.00 30.35           C  
ATOM   7247  O   ALA B  76      80.564 156.941  61.289  1.00 30.56           O  
ATOM   7248  CB  ALA B  76      79.063 158.726  59.557  1.00 31.30           C  
ATOM   7249  N   LYS B  77      79.240 157.741  62.928  1.00 29.65           N  
ATOM   7250  CA  LYS B  77      80.179 157.451  64.003  1.00 31.26           C  
ATOM   7251  C   LYS B  77      81.515 158.149  63.765  1.00 30.62           C  
ATOM   7252  O   LYS B  77      82.573 157.614  64.097  1.00 32.99           O  
ATOM   7253  CB  LYS B  77      80.395 155.939  64.148  1.00 32.55           C  
ATOM   7254  CG  LYS B  77      79.155 155.178  64.595  1.00 36.72           C  
ATOM   7255  CD  LYS B  77      79.500 153.748  64.969  1.00 42.55           C  
ATOM   7256  CE  LYS B  77      78.255 152.887  65.181  1.00 46.01           C  
ATOM   7257  NZ  LYS B  77      77.712 152.355  63.889  1.00 47.95           N  
ATOM   7258  N   ARG B  78      81.459 159.348  63.193  1.00 29.32           N  
ATOM   7259  CA  ARG B  78      82.663 160.131  62.921  1.00 28.40           C  
ATOM   7260  C   ARG B  78      82.778 161.330  63.854  1.00 27.05           C  
ATOM   7261  O   ARG B  78      81.814 161.712  64.514  1.00 27.03           O  
ATOM   7262  CB  ARG B  78      82.675 160.623  61.466  1.00 27.51           C  
ATOM   7263  CG  ARG B  78      83.166 159.594  60.467  1.00 27.07           C  
ATOM   7264  CD  ARG B  78      83.329 160.169  59.062  1.00 25.82           C  
ATOM   7265  NE  ARG B  78      82.052 160.371  58.364  1.00 27.54           N  
ATOM   7266  CZ  ARG B  78      81.282 161.454  58.460  1.00 22.66           C  
ATOM   7267  NH1 ARG B  78      81.636 162.468  59.232  1.00 23.50           N  
ATOM   7268  NH2 ARG B  78      80.154 161.525  57.767  1.00 20.90           N  
ATOM   7269  N   LYS B  79      83.967 161.921  63.898  1.00 26.52           N  
ATOM   7270  CA  LYS B  79      84.213 163.079  64.738  1.00 27.51           C  
ATOM   7271  C   LYS B  79      84.542 164.279  63.865  1.00 26.61           C  
ATOM   7272  O   LYS B  79      84.614 165.409  64.342  1.00 26.53           O  
ATOM   7273  CB  LYS B  79      85.389 162.813  65.683  1.00 30.31           C  
ATOM   7274  CG  LYS B  79      85.197 161.637  66.628  1.00 34.32           C  
ATOM   7275  CD  LYS B  79      86.368 161.519  67.600  1.00 40.26           C  
ATOM   7276  CE  LYS B  79      86.479 162.784  68.462  1.00 46.64           C  
ATOM   7277  NZ  LYS B  79      87.605 162.769  69.448  1.00 48.53           N  
ATOM   7278  N   THR B  80      84.743 164.018  62.580  1.00 26.36           N  
ATOM   7279  CA  THR B  80      85.102 165.052  61.617  1.00 25.38           C  
ATOM   7280  C   THR B  80      83.936 165.355  60.693  1.00 23.29           C  
ATOM   7281  O   THR B  80      83.582 164.520  59.878  1.00 25.77           O  
ATOM   7282  CB  THR B  80      86.295 164.578  60.739  1.00 27.89           C  
ATOM   7283  OG1 THR B  80      87.441 164.329  61.560  1.00 24.78           O  
ATOM   7284  CG2 THR B  80      86.632 165.609  59.669  1.00 25.46           C  
ATOM   7285  N   VAL B  81      83.331 166.533  60.827  1.00 23.05           N  
ATOM   7286  CA  VAL B  81      82.224 166.939  59.955  1.00 19.50           C  
ATOM   7287  C   VAL B  81      82.806 167.051  58.544  1.00 17.30           C  
ATOM   7288  O   VAL B  81      83.772 167.777  58.325  1.00 19.35           O  
ATOM   7289  CB  VAL B  81      81.647 168.305  60.397  1.00 21.63           C  
ATOM   7290  CG1 VAL B  81      80.539 168.779  59.433  1.00 20.01           C  
ATOM   7291  CG2 VAL B  81      81.090 168.174  61.801  1.00 24.21           C  
ATOM   7292  N   THR B  82      82.230 166.327  57.594  1.00 13.63           N  
ATOM   7293  CA  THR B  82      82.740 166.340  56.226  1.00 16.17           C  
ATOM   7294  C   THR B  82      81.946 167.256  55.291  1.00 16.86           C  
ATOM   7295  O   THR B  82      80.861 167.719  55.627  1.00 20.81           O  
ATOM   7296  CB  THR B  82      82.748 164.903  55.638  1.00 15.63           C  
ATOM   7297  OG1 THR B  82      81.402 164.468  55.394  1.00 17.91           O  
ATOM   7298  CG2 THR B  82      83.372 163.943  56.618  1.00 13.83           C  
ATOM   7299  N   ALA B  83      82.492 167.515  54.111  1.00 17.31           N  
ATOM   7300  CA  ALA B  83      81.818 168.359  53.131  1.00 15.98           C  
ATOM   7301  C   ALA B  83      80.469 167.733  52.746  1.00 13.95           C  
ATOM   7302  O   ALA B  83      79.495 168.442  52.509  1.00 14.05           O  
ATOM   7303  CB  ALA B  83      82.715 168.553  51.886  1.00 10.21           C  
ATOM   7304  N   MET B  84      80.412 166.408  52.695  1.00 13.66           N  
ATOM   7305  CA  MET B  84      79.161 165.722  52.374  1.00 16.67           C  
ATOM   7306  C   MET B  84      78.088 165.857  53.475  1.00 17.74           C  
ATOM   7307  O   MET B  84      76.889 165.903  53.162  1.00 20.31           O  
ATOM   7308  CB  MET B  84      79.405 164.229  52.087  1.00 14.64           C  
ATOM   7309  CG  MET B  84      80.176 163.949  50.791  1.00 20.43           C  
ATOM   7310  SD  MET B  84      79.607 164.946  49.344  1.00 27.08           S  
ATOM   7311  CE  MET B  84      77.967 164.261  49.051  1.00 19.33           C  
ATOM   7312  N   ASP B  85      78.487 165.908  54.748  1.00 15.13           N  
ATOM   7313  CA  ASP B  85      77.482 166.058  55.802  1.00 15.97           C  
ATOM   7314  C   ASP B  85      76.850 167.409  55.584  1.00 14.62           C  
ATOM   7315  O   ASP B  85      75.639 167.569  55.715  1.00 14.53           O  
ATOM   7316  CB  ASP B  85      78.080 166.018  57.228  1.00 17.98           C  
ATOM   7317  CG  ASP B  85      78.831 164.720  57.529  1.00 22.89           C  
ATOM   7318  OD1 ASP B  85      78.327 163.624  57.192  1.00 24.47           O  
ATOM   7319  OD2 ASP B  85      79.927 164.803  58.121  1.00 24.17           O  
ATOM   7320  N   VAL B  86      77.678 168.392  55.244  1.00 13.23           N  
ATOM   7321  CA  VAL B  86      77.163 169.726  55.003  1.00 12.12           C  
ATOM   7322  C   VAL B  86      76.269 169.713  53.765  1.00 14.16           C  
ATOM   7323  O   VAL B  86      75.164 170.254  53.798  1.00 15.85           O  
ATOM   7324  CB  VAL B  86      78.306 170.756  54.810  1.00  9.20           C  
ATOM   7325  CG1 VAL B  86      77.730 172.110  54.437  1.00  5.94           C  
ATOM   7326  CG2 VAL B  86      79.118 170.885  56.099  1.00  9.26           C  
ATOM   7327  N   VAL B  87      76.742 169.083  52.685  1.00 12.91           N  
ATOM   7328  CA  VAL B  87      75.993 169.017  51.442  1.00 11.60           C  
ATOM   7329  C   VAL B  87      74.664 168.292  51.644  1.00 13.18           C  
ATOM   7330  O   VAL B  87      73.624 168.740  51.164  1.00 11.77           O  
ATOM   7331  CB  VAL B  87      76.833 168.326  50.332  1.00 13.40           C  
ATOM   7332  CG1 VAL B  87      75.972 168.034  49.095  1.00  3.53           C  
ATOM   7333  CG2 VAL B  87      78.020 169.215  49.967  1.00  8.17           C  
ATOM   7334  N   TYR B  88      74.695 167.177  52.363  1.00 16.02           N  
ATOM   7335  CA  TYR B  88      73.468 166.427  52.649  1.00 17.76           C  
ATOM   7336  C   TYR B  88      72.521 167.252  53.535  1.00 17.03           C  
ATOM   7337  O   TYR B  88      71.307 167.177  53.386  1.00 20.68           O  
ATOM   7338  CB  TYR B  88      73.802 165.109  53.352  1.00 18.63           C  
ATOM   7339  CG  TYR B  88      74.552 164.106  52.505  1.00 24.40           C  
ATOM   7340  CD1 TYR B  88      75.443 163.210  53.091  1.00 26.78           C  
ATOM   7341  CD2 TYR B  88      74.351 164.022  51.124  1.00 27.35           C  
ATOM   7342  CE1 TYR B  88      76.116 162.261  52.335  1.00 26.24           C  
ATOM   7343  CE2 TYR B  88      75.024 163.065  50.353  1.00 26.18           C  
ATOM   7344  CZ  TYR B  88      75.903 162.191  50.972  1.00 28.34           C  
ATOM   7345  OH  TYR B  88      76.563 161.224  50.246  1.00 31.69           O  
ATOM   7346  N   ALA B  89      73.080 168.028  54.462  1.00 15.83           N  
ATOM   7347  CA  ALA B  89      72.276 168.861  55.354  1.00 16.28           C  
ATOM   7348  C   ALA B  89      71.597 169.959  54.540  1.00 17.29           C  
ATOM   7349  O   ALA B  89      70.395 170.179  54.666  1.00 17.73           O  
ATOM   7350  CB  ALA B  89      73.148 169.481  56.445  1.00  7.61           C  
ATOM   7351  N   LEU B  90      72.368 170.646  53.702  1.00 16.99           N  
ATOM   7352  CA  LEU B  90      71.808 171.708  52.878  1.00 18.63           C  
ATOM   7353  C   LEU B  90      70.696 171.165  51.983  1.00 19.43           C  
ATOM   7354  O   LEU B  90      69.647 171.801  51.835  1.00 21.08           O  
ATOM   7355  CB  LEU B  90      72.899 172.370  52.026  1.00 16.85           C  
ATOM   7356  CG  LEU B  90      73.829 173.344  52.748  1.00 15.43           C  
ATOM   7357  CD1 LEU B  90      75.044 173.643  51.877  1.00 13.02           C  
ATOM   7358  CD2 LEU B  90      73.064 174.617  53.090  1.00 14.41           C  
ATOM   7359  N   LYS B  91      70.910 169.992  51.395  1.00 19.08           N  
ATOM   7360  CA  LYS B  91      69.879 169.406  50.535  1.00 22.38           C  
ATOM   7361  C   LYS B  91      68.597 169.193  51.348  1.00 22.87           C  
ATOM   7362  O   LYS B  91      67.498 169.547  50.894  1.00 22.49           O  
ATOM   7363  CB  LYS B  91      70.351 168.080  49.917  1.00 20.45           C  
ATOM   7364  CG  LYS B  91      69.427 167.550  48.837  1.00 21.93           C  
ATOM   7365  CD  LYS B  91      70.117 166.512  47.962  1.00 29.18           C  
ATOM   7366  CE  LYS B  91      70.711 165.378  48.810  1.00 35.99           C  
ATOM   7367  NZ  LYS B  91      71.385 164.309  48.012  1.00 38.44           N  
ATOM   7368  N   ARG B  92      68.740 168.632  52.549  1.00 21.80           N  
ATOM   7369  CA  ARG B  92      67.585 168.417  53.416  1.00 22.13           C  
ATOM   7370  C   ARG B  92      66.778 169.690  53.627  1.00 20.15           C  
ATOM   7371  O   ARG B  92      65.555 169.636  53.665  1.00 20.90           O  
ATOM   7372  CB  ARG B  92      67.999 167.924  54.806  1.00 24.30           C  
ATOM   7373  CG  ARG B  92      68.024 166.442  54.974  1.00 27.67           C  
ATOM   7374  CD  ARG B  92      67.788 166.069  56.420  1.00 26.84           C  
ATOM   7375  NE  ARG B  92      66.366 166.149  56.742  1.00 28.53           N  
ATOM   7376  CZ  ARG B  92      65.798 167.123  57.446  1.00 27.47           C  
ATOM   7377  NH1 ARG B  92      66.525 168.123  57.926  1.00 22.27           N  
ATOM   7378  NH2 ARG B  92      64.489 167.101  57.653  1.00 27.53           N  
ATOM   7379  N   GLN B  93      67.461 170.823  53.781  1.00 19.15           N  
ATOM   7380  CA  GLN B  93      66.789 172.100  54.042  1.00 21.73           C  
ATOM   7381  C   GLN B  93      66.286 172.766  52.779  1.00 20.89           C  
ATOM   7382  O   GLN B  93      65.993 173.959  52.791  1.00 22.27           O  
ATOM   7383  CB  GLN B  93      67.739 173.089  54.733  1.00 24.81           C  
ATOM   7384  CG  GLN B  93      68.443 172.610  56.004  1.00 28.28           C  
ATOM   7385  CD  GLN B  93      67.551 172.632  57.217  1.00 31.22           C  
ATOM   7386  OE1 GLN B  93      66.789 173.580  57.424  1.00 30.17           O  
ATOM   7387  NE2 GLN B  93      67.650 171.592  58.047  1.00 30.74           N  
ATOM   7388  N   GLY B  94      66.208 172.011  51.689  1.00 21.02           N  
ATOM   7389  CA  GLY B  94      65.774 172.580  50.429  1.00 17.76           C  
ATOM   7390  C   GLY B  94      66.756 173.638  49.938  1.00 19.28           C  
ATOM   7391  O   GLY B  94      66.345 174.670  49.425  1.00 23.92           O  
ATOM   7392  N   ARG B  95      68.053 173.415  50.117  1.00 16.09           N  
ATOM   7393  CA  ARG B  95      69.038 174.377  49.644  1.00 16.32           C  
ATOM   7394  C   ARG B  95      70.262 173.682  49.059  1.00 16.16           C  
ATOM   7395  O   ARG B  95      71.388 173.916  49.483  1.00 20.89           O  
ATOM   7396  CB  ARG B  95      69.451 175.326  50.773  1.00 18.70           C  
ATOM   7397  CG  ARG B  95      68.278 176.126  51.320  1.00 23.44           C  
ATOM   7398  CD  ARG B  95      68.731 177.363  52.059  1.00 21.73           C  
ATOM   7399  NE  ARG B  95      69.399 178.277  51.139  1.00 29.41           N  
ATOM   7400  CZ  ARG B  95      68.791 179.210  50.411  1.00 30.02           C  
ATOM   7401  NH1 ARG B  95      67.469 179.378  50.493  1.00 28.35           N  
ATOM   7402  NH2 ARG B  95      69.513 179.966  49.587  1.00 25.91           N  
ATOM   7403  N   THR B  96      70.025 172.837  48.068  1.00 12.99           N  
ATOM   7404  CA  THR B  96      71.074 172.078  47.417  1.00 12.53           C  
ATOM   7405  C   THR B  96      72.277 172.901  46.992  1.00 10.92           C  
ATOM   7406  O   THR B  96      72.144 173.987  46.439  1.00 10.19           O  
ATOM   7407  CB  THR B  96      70.518 171.360  46.185  1.00 12.23           C  
ATOM   7408  OG1 THR B  96      69.557 170.388  46.610  1.00 17.89           O  
ATOM   7409  CG2 THR B  96      71.632 170.690  45.406  1.00  3.66           C  
ATOM   7410  N   LEU B  97      73.458 172.357  47.223  1.00  9.46           N  
ATOM   7411  CA  LEU B  97      74.676 173.055  46.862  1.00 11.54           C  
ATOM   7412  C   LEU B  97      75.481 172.248  45.871  1.00 12.00           C  
ATOM   7413  O   LEU B  97      75.703 171.050  46.073  1.00 15.30           O  
ATOM   7414  CB  LEU B  97      75.525 173.315  48.108  1.00 11.93           C  
ATOM   7415  CG  LEU B  97      76.792 174.141  47.918  1.00 10.62           C  
ATOM   7416  CD1 LEU B  97      76.429 175.512  47.397  1.00  6.31           C  
ATOM   7417  CD2 LEU B  97      77.521 174.254  49.243  1.00 13.74           C  
ATOM   7418  N   TYR B  98      75.911 172.906  44.801  1.00 11.99           N  
ATOM   7419  CA  TYR B  98      76.725 172.275  43.767  1.00 14.47           C  
ATOM   7420  C   TYR B  98      78.183 172.691  43.973  1.00 15.96           C  
ATOM   7421  O   TYR B  98      78.462 173.863  44.266  1.00 12.41           O  
ATOM   7422  CB  TYR B  98      76.299 172.746  42.376  1.00 14.09           C  
ATOM   7423  CG  TYR B  98      75.055 172.119  41.794  1.00 11.94           C  
ATOM   7424  CD1 TYR B  98      74.237 171.264  42.548  1.00 12.69           C  
ATOM   7425  CD2 TYR B  98      74.682 172.407  40.482  1.00  2.00           C  
ATOM   7426  CE1 TYR B  98      73.076 170.715  41.991  1.00 12.39           C  
ATOM   7427  CE2 TYR B  98      73.543 171.887  39.928  1.00  6.31           C  
ATOM   7428  CZ  TYR B  98      72.735 171.036  40.672  1.00 12.23           C  
ATOM   7429  OH  TYR B  98      71.611 170.499  40.076  1.00  8.33           O  
ATOM   7430  N   GLY B  99      79.102 171.735  43.818  1.00 16.77           N  
ATOM   7431  CA  GLY B  99      80.517 172.036  43.959  1.00 16.72           C  
ATOM   7432  C   GLY B  99      81.304 171.381  45.079  1.00 19.68           C  
ATOM   7433  O   GLY B  99      82.524 171.544  45.138  1.00 22.08           O  
ATOM   7434  N   PHE B 100      80.643 170.637  45.962  1.00 18.88           N  
ATOM   7435  CA  PHE B 100      81.348 170.006  47.068  1.00 16.77           C  
ATOM   7436  C   PHE B 100      81.056 168.511  47.244  1.00 19.36           C  
ATOM   7437  O   PHE B 100      81.253 167.949  48.338  1.00 19.31           O  
ATOM   7438  CB  PHE B 100      81.030 170.759  48.362  1.00 15.19           C  
ATOM   7439  CG  PHE B 100      81.588 172.159  48.402  1.00 14.52           C  
ATOM   7440  CD1 PHE B 100      80.859 173.234  47.905  1.00 11.25           C  
ATOM   7441  CD2 PHE B 100      82.865 172.397  48.916  1.00 13.21           C  
ATOM   7442  CE1 PHE B 100      81.392 174.518  47.920  1.00 12.38           C  
ATOM   7443  CE2 PHE B 100      83.412 173.686  48.934  1.00  9.94           C  
ATOM   7444  CZ  PHE B 100      82.679 174.744  48.438  1.00  7.59           C  
ATOM   7445  N   GLY B 101      80.585 167.867  46.177  1.00 17.85           N  
ATOM   7446  CA  GLY B 101      80.277 166.449  46.262  1.00 19.25           C  
ATOM   7447  C   GLY B 101      78.822 166.090  46.029  1.00 22.35           C  
ATOM   7448  O   GLY B 101      77.959 166.950  45.848  1.00 21.50           O  
ATOM   7449  N   GLY B 102      78.543 164.795  46.023  1.00 26.69           N  
ATOM   7450  CA  GLY B 102      77.180 164.345  45.799  1.00 32.04           C  
ATOM   7451  C   GLY B 102      76.664 164.742  44.427  1.00 34.61           C  
ATOM   7452  O   GLY B 102      75.535 165.267  44.333  1.00 37.79           O  
ATOM   7453  OXT GLY B 102      77.383 164.518  43.432  1.00 37.23           O  
TER    7454      GLY B 102                                                      
ATOM   7455  N   THR C  16      52.042 138.741  69.049  1.00 40.56           N  
ATOM   7456  CA  THR C  16      52.357 139.864  68.115  1.00 39.92           C  
ATOM   7457  C   THR C  16      53.542 140.648  68.636  1.00 38.39           C  
ATOM   7458  O   THR C  16      53.705 140.807  69.842  1.00 40.29           O  
ATOM   7459  CB  THR C  16      51.204 140.866  68.007  1.00 40.02           C  
ATOM   7460  OG1 THR C  16      51.210 141.709  69.170  1.00 42.28           O  
ATOM   7461  CG2 THR C  16      49.862 140.144  67.893  1.00 37.96           C  
ATOM   7462  N   ARG C  17      54.360 141.150  67.725  1.00 37.00           N  
ATOM   7463  CA  ARG C  17      55.515 141.942  68.107  1.00 36.77           C  
ATOM   7464  C   ARG C  17      55.104 143.249  68.804  1.00 36.90           C  
ATOM   7465  O   ARG C  17      55.831 143.765  69.651  1.00 38.15           O  
ATOM   7466  CB  ARG C  17      56.366 142.225  66.870  1.00 36.80           C  
ATOM   7467  CG  ARG C  17      57.021 140.970  66.317  1.00 36.24           C  
ATOM   7468  CD  ARG C  17      57.925 141.272  65.155  1.00 35.19           C  
ATOM   7469  NE  ARG C  17      57.185 141.366  63.903  1.00 35.47           N  
ATOM   7470  CZ  ARG C  17      57.730 141.721  62.746  1.00 34.79           C  
ATOM   7471  NH1 ARG C  17      59.022 142.027  62.687  1.00 35.87           N  
ATOM   7472  NH2 ARG C  17      56.992 141.737  61.646  1.00 32.25           N  
ATOM   7473  N   SER C  18      53.940 143.786  68.466  1.00 35.80           N  
ATOM   7474  CA  SER C  18      53.504 145.006  69.122  1.00 38.49           C  
ATOM   7475  C   SER C  18      53.422 144.789  70.632  1.00 41.06           C  
ATOM   7476  O   SER C  18      54.008 145.550  71.411  1.00 42.19           O  
ATOM   7477  CB  SER C  18      52.144 145.448  68.594  1.00 36.52           C  
ATOM   7478  OG  SER C  18      52.270 145.935  67.275  1.00 39.79           O  
ATOM   7479  N   SER C  19      52.692 143.751  71.038  1.00 41.83           N  
ATOM   7480  CA  SER C  19      52.530 143.432  72.453  1.00 41.40           C  
ATOM   7481  C   SER C  19      53.899 143.290  73.101  1.00 40.89           C  
ATOM   7482  O   SER C  19      54.190 143.931  74.114  1.00 40.32           O  
ATOM   7483  CB  SER C  19      51.729 142.137  72.612  1.00 44.07           C  
ATOM   7484  OG  SER C  19      52.300 141.087  71.849  1.00 46.14           O  
ATOM   7485  N   ARG C  20      54.748 142.461  72.507  1.00 40.44           N  
ATOM   7486  CA  ARG C  20      56.090 142.273  73.037  1.00 41.68           C  
ATOM   7487  C   ARG C  20      56.801 143.622  73.157  1.00 42.76           C  
ATOM   7488  O   ARG C  20      57.824 143.727  73.829  1.00 44.57           O  
ATOM   7489  CB  ARG C  20      56.906 141.362  72.117  1.00 42.11           C  
ATOM   7490  CG  ARG C  20      56.506 139.902  72.137  1.00 46.01           C  
ATOM   7491  CD  ARG C  20      57.330 139.128  71.136  1.00 51.37           C  
ATOM   7492  NE  ARG C  20      57.067 137.690  71.161  1.00 57.77           N  
ATOM   7493  CZ  ARG C  20      57.554 136.848  72.072  1.00 59.83           C  
ATOM   7494  NH1 ARG C  20      58.336 137.292  73.051  1.00 59.53           N  
ATOM   7495  NH2 ARG C  20      57.271 135.552  71.990  1.00 60.24           N  
ATOM   7496  N   ALA C  21      56.252 144.648  72.509  1.00 42.36           N  
ATOM   7497  CA  ALA C  21      56.854 145.977  72.523  1.00 42.01           C  
ATOM   7498  C   ALA C  21      56.020 147.029  73.250  1.00 40.97           C  
ATOM   7499  O   ALA C  21      56.432 148.183  73.370  1.00 39.69           O  
ATOM   7500  CB  ALA C  21      57.129 146.431  71.094  1.00 44.03           C  
ATOM   7501  N   GLY C  22      54.846 146.632  73.721  1.00 39.19           N  
ATOM   7502  CA  GLY C  22      54.000 147.564  74.442  1.00 38.41           C  
ATOM   7503  C   GLY C  22      53.425 148.672  73.593  1.00 38.03           C  
ATOM   7504  O   GLY C  22      53.193 149.771  74.082  1.00 36.93           O  
ATOM   7505  N   LEU C  23      53.170 148.379  72.324  1.00 39.47           N  
ATOM   7506  CA  LEU C  23      52.620 149.371  71.411  1.00 39.98           C  
ATOM   7507  C   LEU C  23      51.232 149.004  70.881  1.00 40.94           C  
ATOM   7508  O   LEU C  23      50.885 147.831  70.759  1.00 40.83           O  
ATOM   7509  CB  LEU C  23      53.566 149.557  70.222  1.00 40.80           C  
ATOM   7510  CG  LEU C  23      55.014 149.934  70.521  1.00 40.44           C  
ATOM   7511  CD1 LEU C  23      55.790 150.028  69.217  1.00 39.55           C  
ATOM   7512  CD2 LEU C  23      55.052 151.250  71.270  1.00 38.67           C  
ATOM   7513  N   GLN C  24      50.446 150.026  70.564  1.00 42.25           N  
ATOM   7514  CA  GLN C  24      49.115 149.837  70.007  1.00 42.98           C  
ATOM   7515  C   GLN C  24      49.252 149.740  68.483  1.00 43.25           C  
ATOM   7516  O   GLN C  24      48.439 149.100  67.820  1.00 44.23           O  
ATOM   7517  CB  GLN C  24      48.222 151.024  70.363  1.00 44.92           C  
ATOM   7518  CG  GLN C  24      48.051 151.271  71.856  1.00 49.23           C  
ATOM   7519  CD  GLN C  24      47.306 150.146  72.548  1.00 52.29           C  
ATOM   7520  OE1 GLN C  24      46.150 149.855  72.226  1.00 52.41           O  
ATOM   7521  NE2 GLN C  24      47.967 149.504  73.505  1.00 54.60           N  
ATOM   7522  N   PHE C  25      50.290 150.378  67.940  1.00 42.44           N  
ATOM   7523  CA  PHE C  25      50.546 150.379  66.499  1.00 40.42           C  
ATOM   7524  C   PHE C  25      51.162 149.075  66.011  1.00 39.31           C  
ATOM   7525  O   PHE C  25      52.056 148.527  66.645  1.00 39.99           O  
ATOM   7526  CB  PHE C  25      51.436 151.570  66.109  1.00 38.73           C  
ATOM   7527  CG  PHE C  25      50.657 152.808  65.738  1.00 34.55           C  
ATOM   7528  CD1 PHE C  25      49.791 153.402  66.652  1.00 31.21           C  
ATOM   7529  CD2 PHE C  25      50.747 153.345  64.452  1.00 29.96           C  
ATOM   7530  CE1 PHE C  25      49.020 154.509  66.289  1.00 29.51           C  
ATOM   7531  CE2 PHE C  25      49.984 154.444  64.085  1.00 27.58           C  
ATOM   7532  CZ  PHE C  25      49.115 155.029  65.005  1.00 26.66           C  
ATOM   7533  N   PRO C  26      50.699 148.585  64.848  1.00 38.74           N  
ATOM   7534  CA  PRO C  26      51.097 147.353  64.159  1.00 36.47           C  
ATOM   7535  C   PRO C  26      52.557 147.264  63.753  1.00 35.66           C  
ATOM   7536  O   PRO C  26      52.942 147.790  62.714  1.00 38.34           O  
ATOM   7537  CB  PRO C  26      50.178 147.341  62.950  1.00 36.57           C  
ATOM   7538  CG  PRO C  26      50.144 148.788  62.588  1.00 37.48           C  
ATOM   7539  CD  PRO C  26      49.916 149.442  63.935  1.00 39.11           C  
ATOM   7540  N   VAL C  27      53.359 146.577  64.558  1.00 33.69           N  
ATOM   7541  CA  VAL C  27      54.785 146.419  64.282  1.00 30.36           C  
ATOM   7542  C   VAL C  27      55.024 145.513  63.097  1.00 30.91           C  
ATOM   7543  O   VAL C  27      56.030 145.636  62.408  1.00 34.46           O  
ATOM   7544  CB  VAL C  27      55.517 145.832  65.487  1.00 28.83           C  
ATOM   7545  CG1 VAL C  27      56.992 145.702  65.194  1.00 30.79           C  
ATOM   7546  CG2 VAL C  27      55.292 146.710  66.694  1.00 28.13           C  
ATOM   7547  N   GLY C  28      54.099 144.596  62.855  1.00 31.25           N  
ATOM   7548  CA  GLY C  28      54.256 143.690  61.737  1.00 29.18           C  
ATOM   7549  C   GLY C  28      53.982 144.418  60.441  1.00 29.63           C  
ATOM   7550  O   GLY C  28      54.744 144.304  59.484  1.00 29.20           O  
ATOM   7551  N   ARG C  29      52.886 145.169  60.415  1.00 29.51           N  
ATOM   7552  CA  ARG C  29      52.497 145.931  59.237  1.00 28.78           C  
ATOM   7553  C   ARG C  29      53.598 146.911  58.854  1.00 30.55           C  
ATOM   7554  O   ARG C  29      54.019 146.985  57.696  1.00 30.78           O  
ATOM   7555  CB  ARG C  29      51.216 146.709  59.516  1.00 26.90           C  
ATOM   7556  CG  ARG C  29      50.742 147.514  58.335  1.00 25.59           C  
ATOM   7557  CD  ARG C  29      49.344 147.101  57.975  1.00 29.67           C  
ATOM   7558  NE  ARG C  29      48.347 148.013  58.508  1.00 29.26           N  
ATOM   7559  CZ  ARG C  29      47.050 147.740  58.576  1.00 30.86           C  
ATOM   7560  NH1 ARG C  29      46.595 146.567  58.159  1.00 32.19           N  
ATOM   7561  NH2 ARG C  29      46.203 148.659  59.017  1.00 29.71           N  
ATOM   7562  N   VAL C  30      54.054 147.676  59.840  1.00 31.01           N  
ATOM   7563  CA  VAL C  30      55.105 148.646  59.609  1.00 30.52           C  
ATOM   7564  C   VAL C  30      56.315 147.939  59.018  1.00 31.85           C  
ATOM   7565  O   VAL C  30      57.003 148.484  58.160  1.00 33.85           O  
ATOM   7566  CB  VAL C  30      55.499 149.350  60.914  1.00 28.58           C  
ATOM   7567  CG1 VAL C  30      56.728 150.221  60.688  1.00 27.03           C  
ATOM   7568  CG2 VAL C  30      54.327 150.187  61.417  1.00 23.49           C  
ATOM   7569  N   HIS C  31      56.563 146.714  59.463  1.00 32.86           N  
ATOM   7570  CA  HIS C  31      57.695 145.948  58.954  1.00 33.72           C  
ATOM   7571  C   HIS C  31      57.458 145.526  57.506  1.00 33.17           C  
ATOM   7572  O   HIS C  31      58.387 145.509  56.694  1.00 34.08           O  
ATOM   7573  CB  HIS C  31      57.938 144.719  59.823  1.00 34.70           C  
ATOM   7574  CG  HIS C  31      59.191 143.986  59.481  1.00 37.91           C  
ATOM   7575  ND1 HIS C  31      60.387 144.630  59.255  1.00 41.29           N  
ATOM   7576  CD2 HIS C  31      59.447 142.664  59.357  1.00 41.85           C  
ATOM   7577  CE1 HIS C  31      61.328 143.737  59.009  1.00 40.16           C  
ATOM   7578  NE2 HIS C  31      60.783 142.536  59.065  1.00 42.43           N  
ATOM   7579  N   ARG C  32      56.213 145.190  57.181  1.00 31.08           N  
ATOM   7580  CA  ARG C  32      55.875 144.793  55.821  1.00 30.13           C  
ATOM   7581  C   ARG C  32      56.036 146.003  54.898  1.00 30.60           C  
ATOM   7582  O   ARG C  32      56.625 145.904  53.822  1.00 27.92           O  
ATOM   7583  CB  ARG C  32      54.434 144.296  55.757  1.00 29.01           C  
ATOM   7584  CG  ARG C  32      53.947 143.984  54.351  1.00 27.15           C  
ATOM   7585  CD  ARG C  32      52.438 143.873  54.346  1.00 26.23           C  
ATOM   7586  NE  ARG C  32      51.798 145.158  54.083  1.00 28.87           N  
ATOM   7587  CZ  ARG C  32      50.635 145.539  54.604  1.00 29.39           C  
ATOM   7588  NH1 ARG C  32      49.974 144.743  55.435  1.00 27.05           N  
ATOM   7589  NH2 ARG C  32      50.116 146.706  54.264  1.00 29.83           N  
ATOM   7590  N   LEU C  33      55.500 147.143  55.332  1.00 31.47           N  
ATOM   7591  CA  LEU C  33      55.595 148.368  54.558  1.00 33.08           C  
ATOM   7592  C   LEU C  33      57.047 148.817  54.362  1.00 34.07           C  
ATOM   7593  O   LEU C  33      57.393 149.357  53.313  1.00 35.20           O  
ATOM   7594  CB  LEU C  33      54.771 149.471  55.217  1.00 33.21           C  
ATOM   7595  CG  LEU C  33      53.260 149.202  55.224  1.00 35.75           C  
ATOM   7596  CD1 LEU C  33      52.530 150.322  55.953  1.00 33.20           C  
ATOM   7597  CD2 LEU C  33      52.753 149.087  53.789  1.00 34.76           C  
ATOM   7598  N   LEU C  34      57.907 148.594  55.349  1.00 34.45           N  
ATOM   7599  CA  LEU C  34      59.307 148.982  55.185  1.00 37.08           C  
ATOM   7600  C   LEU C  34      60.012 148.115  54.135  1.00 40.65           C  
ATOM   7601  O   LEU C  34      60.981 148.551  53.515  1.00 42.00           O  
ATOM   7602  CB  LEU C  34      60.065 148.870  56.509  1.00 34.37           C  
ATOM   7603  CG  LEU C  34      60.086 150.067  57.461  1.00 34.39           C  
ATOM   7604  CD1 LEU C  34      60.684 149.619  58.783  1.00 30.17           C  
ATOM   7605  CD2 LEU C  34      60.897 151.223  56.861  1.00 32.54           C  
ATOM   7606  N   ARG C  35      59.537 146.885  53.939  1.00 43.11           N  
ATOM   7607  CA  ARG C  35      60.158 145.993  52.963  1.00 44.62           C  
ATOM   7608  C   ARG C  35      59.605 146.167  51.554  1.00 45.01           C  
ATOM   7609  O   ARG C  35      60.284 145.844  50.579  1.00 45.04           O  
ATOM   7610  CB  ARG C  35      60.006 144.528  53.384  1.00 47.05           C  
ATOM   7611  CG  ARG C  35      60.749 144.163  54.658  1.00 50.96           C  
ATOM   7612  CD  ARG C  35      60.766 142.655  54.905  1.00 51.34           C  
ATOM   7613  NE  ARG C  35      61.385 142.334  56.190  1.00 54.28           N  
ATOM   7614  CZ  ARG C  35      61.689 141.105  56.605  1.00 56.77           C  
ATOM   7615  NH1 ARG C  35      61.441 140.046  55.840  1.00 55.70           N  
ATOM   7616  NH2 ARG C  35      62.247 140.933  57.797  1.00 58.23           N  
ATOM   7617  N   LYS C  36      58.381 146.674  51.441  1.00 44.84           N  
ATOM   7618  CA  LYS C  36      57.772 146.874  50.127  1.00 44.81           C  
ATOM   7619  C   LYS C  36      58.070 148.243  49.528  1.00 43.60           C  
ATOM   7620  O   LYS C  36      57.966 148.429  48.318  1.00 44.56           O  
ATOM   7621  CB  LYS C  36      56.255 146.677  50.201  1.00 48.18           C  
ATOM   7622  CG  LYS C  36      55.806 145.219  50.311  1.00 52.48           C  
ATOM   7623  CD  LYS C  36      54.282 145.133  50.381  1.00 57.22           C  
ATOM   7624  CE  LYS C  36      53.786 143.687  50.466  1.00 58.85           C  
ATOM   7625  NZ  LYS C  36      52.290 143.617  50.477  1.00 57.50           N  
ATOM   7626  N   GLY C  37      58.446 149.195  50.375  1.00 41.51           N  
ATOM   7627  CA  GLY C  37      58.740 150.536  49.902  1.00 38.87           C  
ATOM   7628  C   GLY C  37      60.086 150.722  49.219  1.00 37.34           C  
ATOM   7629  O   GLY C  37      60.404 151.818  48.760  1.00 33.72           O  
ATOM   7630  N   ASN C  38      60.879 149.660  49.142  1.00 37.67           N  
ATOM   7631  CA  ASN C  38      62.190 149.751  48.505  1.00 38.79           C  
ATOM   7632  C   ASN C  38      63.065 150.819  49.147  1.00 37.14           C  
ATOM   7633  O   ASN C  38      63.610 151.689  48.460  1.00 37.04           O  
ATOM   7634  CB  ASN C  38      62.041 150.067  47.016  1.00 41.11           C  
ATOM   7635  CG  ASN C  38      61.497 148.906  46.237  1.00 42.87           C  
ATOM   7636  OD1 ASN C  38      62.128 147.848  46.158  1.00 42.24           O  
ATOM   7637  ND2 ASN C  38      60.312 149.086  45.658  1.00 44.68           N  
ATOM   7638  N   TYR C  39      63.201 150.759  50.464  1.00 34.37           N  
ATOM   7639  CA  TYR C  39      64.015 151.741  51.148  1.00 31.00           C  
ATOM   7640  C   TYR C  39      65.439 151.244  51.246  1.00 31.18           C  
ATOM   7641  O   TYR C  39      66.381 152.012  51.142  1.00 31.84           O  
ATOM   7642  CB  TYR C  39      63.434 152.024  52.520  1.00 25.98           C  
ATOM   7643  CG  TYR C  39      62.020 152.536  52.447  1.00 20.49           C  
ATOM   7644  CD1 TYR C  39      60.947 151.705  52.722  1.00 19.58           C  
ATOM   7645  CD2 TYR C  39      61.755 153.849  52.074  1.00 19.02           C  
ATOM   7646  CE1 TYR C  39      59.639 152.163  52.626  1.00 19.66           C  
ATOM   7647  CE2 TYR C  39      60.453 154.318  51.979  1.00 18.56           C  
ATOM   7648  CZ  TYR C  39      59.404 153.467  52.257  1.00 19.68           C  
ATOM   7649  OH  TYR C  39      58.116 153.921  52.176  1.00 25.02           O  
ATOM   7650  N   ALA C  40      65.592 149.943  51.413  1.00 34.12           N  
ATOM   7651  CA  ALA C  40      66.913 149.347  51.513  1.00 36.30           C  
ATOM   7652  C   ALA C  40      66.825 147.859  51.234  1.00 37.65           C  
ATOM   7653  O   ALA C  40      65.760 147.248  51.344  1.00 38.25           O  
ATOM   7654  CB  ALA C  40      67.495 149.583  52.905  1.00 34.97           C  
ATOM   7655  N   GLU C  41      67.959 147.285  50.870  1.00 39.81           N  
ATOM   7656  CA  GLU C  41      68.054 145.866  50.576  1.00 41.76           C  
ATOM   7657  C   GLU C  41      67.520 145.014  51.733  1.00 41.16           C  
ATOM   7658  O   GLU C  41      66.945 143.953  51.507  1.00 42.64           O  
ATOM   7659  CB  GLU C  41      69.519 145.517  50.290  1.00 43.33           C  
ATOM   7660  CG  GLU C  41      69.823 144.044  50.096  1.00 48.01           C  
ATOM   7661  CD  GLU C  41      71.318 143.796  49.942  1.00 51.09           C  
ATOM   7662  OE1 GLU C  41      71.924 144.376  49.011  1.00 51.72           O  
ATOM   7663  OE2 GLU C  41      71.888 143.030  50.751  1.00 50.51           O  
ATOM   7664  N   ARG C  42      67.701 145.479  52.966  1.00 39.23           N  
ATOM   7665  CA  ARG C  42      67.243 144.723  54.130  1.00 39.41           C  
ATOM   7666  C   ARG C  42      66.769 145.624  55.268  1.00 38.98           C  
ATOM   7667  O   ARG C  42      67.165 146.782  55.363  1.00 39.55           O  
ATOM   7668  CB  ARG C  42      68.376 143.834  54.639  1.00 42.34           C  
ATOM   7669  CG  ARG C  42      69.428 143.536  53.588  1.00 45.15           C  
ATOM   7670  CD  ARG C  42      70.665 142.946  54.205  1.00 48.09           C  
ATOM   7671  NE  ARG C  42      70.479 141.560  54.610  1.00 52.81           N  
ATOM   7672  CZ  ARG C  42      71.354 140.890  55.346  1.00 54.83           C  
ATOM   7673  NH1 ARG C  42      72.464 141.488  55.754  1.00 55.36           N  
ATOM   7674  NH2 ARG C  42      71.126 139.624  55.666  1.00 58.14           N  
ATOM   7675  N   VAL C  43      65.932 145.076  56.141  1.00 38.45           N  
ATOM   7676  CA  VAL C  43      65.401 145.822  57.277  1.00 37.63           C  
ATOM   7677  C   VAL C  43      65.631 145.078  58.586  1.00 36.76           C  
ATOM   7678  O   VAL C  43      65.126 143.975  58.772  1.00 37.63           O  
ATOM   7679  CB  VAL C  43      63.879 146.062  57.124  1.00 38.47           C  
ATOM   7680  CG1 VAL C  43      63.361 146.917  58.275  1.00 35.26           C  
ATOM   7681  CG2 VAL C  43      63.589 146.722  55.791  1.00 34.93           C  
ATOM   7682  N   GLY C  44      66.393 145.685  59.492  1.00 36.32           N  
ATOM   7683  CA  GLY C  44      66.652 145.067  60.784  1.00 32.40           C  
ATOM   7684  C   GLY C  44      65.368 144.840  61.565  1.00 31.78           C  
ATOM   7685  O   GLY C  44      64.324 145.394  61.230  1.00 29.82           O  
ATOM   7686  N   ALA C  45      65.452 144.039  62.624  1.00 33.89           N  
ATOM   7687  CA  ALA C  45      64.290 143.704  63.450  1.00 33.09           C  
ATOM   7688  C   ALA C  45      63.782 144.822  64.335  1.00 32.23           C  
ATOM   7689  O   ALA C  45      62.581 144.928  64.570  1.00 33.54           O  
ATOM   7690  CB  ALA C  45      64.598 142.491  64.305  1.00 35.13           C  
ATOM   7691  N   GLY C  46      64.692 145.647  64.836  1.00 31.19           N  
ATOM   7692  CA  GLY C  46      64.301 146.749  65.703  1.00 30.32           C  
ATOM   7693  C   GLY C  46      63.772 147.986  64.991  1.00 29.78           C  
ATOM   7694  O   GLY C  46      63.094 148.807  65.609  1.00 29.58           O  
ATOM   7695  N   ALA C  47      64.068 148.119  63.700  1.00 29.10           N  
ATOM   7696  CA  ALA C  47      63.617 149.267  62.911  1.00 28.47           C  
ATOM   7697  C   ALA C  47      62.090 149.436  62.878  1.00 28.21           C  
ATOM   7698  O   ALA C  47      61.575 150.527  63.106  1.00 29.87           O  
ATOM   7699  CB  ALA C  47      64.174 149.169  61.492  1.00 28.71           C  
ATOM   7700  N   PRO C  48      61.340 148.365  62.587  1.00 27.46           N  
ATOM   7701  CA  PRO C  48      59.891 148.571  62.574  1.00 26.59           C  
ATOM   7702  C   PRO C  48      59.324 148.876  63.968  1.00 27.72           C  
ATOM   7703  O   PRO C  48      58.318 149.575  64.095  1.00 26.68           O  
ATOM   7704  CB  PRO C  48      59.364 147.267  61.973  1.00 26.58           C  
ATOM   7705  CG  PRO C  48      60.412 146.273  62.319  1.00 24.42           C  
ATOM   7706  CD  PRO C  48      61.683 147.025  62.085  1.00 26.99           C  
ATOM   7707  N   VAL C  49      59.976 148.359  65.011  1.00 28.34           N  
ATOM   7708  CA  VAL C  49      59.536 148.607  66.390  1.00 26.60           C  
ATOM   7709  C   VAL C  49      59.732 150.090  66.701  1.00 25.94           C  
ATOM   7710  O   VAL C  49      58.809 150.797  67.137  1.00 24.85           O  
ATOM   7711  CB  VAL C  49      60.365 147.781  67.425  1.00 25.81           C  
ATOM   7712  CG1 VAL C  49      60.052 148.249  68.848  1.00 24.63           C  
ATOM   7713  CG2 VAL C  49      60.052 146.287  67.285  1.00 25.66           C  
ATOM   7714  N   TYR C  50      60.952 150.552  66.468  1.00 25.34           N  
ATOM   7715  CA  TYR C  50      61.294 151.941  66.717  1.00 25.42           C  
ATOM   7716  C   TYR C  50      60.385 152.864  65.911  1.00 24.94           C  
ATOM   7717  O   TYR C  50      59.856 153.832  66.438  1.00 24.45           O  
ATOM   7718  CB  TYR C  50      62.750 152.172  66.352  1.00 24.44           C  
ATOM   7719  CG  TYR C  50      63.357 153.388  66.986  1.00 26.71           C  
ATOM   7720  CD1 TYR C  50      64.613 153.322  67.571  1.00 25.62           C  
ATOM   7721  CD2 TYR C  50      62.705 154.621  66.957  1.00 28.62           C  
ATOM   7722  CE1 TYR C  50      65.214 154.444  68.109  1.00 26.06           C  
ATOM   7723  CE2 TYR C  50      63.303 155.755  67.494  1.00 29.81           C  
ATOM   7724  CZ  TYR C  50      64.564 155.652  68.068  1.00 28.75           C  
ATOM   7725  OH  TYR C  50      65.187 156.757  68.591  1.00 32.14           O  
ATOM   7726  N   LEU C  51      60.184 152.549  64.637  1.00 25.72           N  
ATOM   7727  CA  LEU C  51      59.322 153.375  63.803  1.00 27.77           C  
ATOM   7728  C   LEU C  51      57.862 153.331  64.245  1.00 28.04           C  
ATOM   7729  O   LEU C  51      57.185 154.363  64.278  1.00 29.94           O  
ATOM   7730  CB  LEU C  51      59.434 152.964  62.331  1.00 29.78           C  
ATOM   7731  CG  LEU C  51      58.569 153.804  61.392  1.00 30.25           C  
ATOM   7732  CD1 LEU C  51      58.887 155.283  61.620  1.00 31.34           C  
ATOM   7733  CD2 LEU C  51      58.825 153.404  59.940  1.00 28.63           C  
ATOM   7734  N   ALA C  52      57.369 152.143  64.580  1.00 28.63           N  
ATOM   7735  CA  ALA C  52      55.989 152.015  65.031  1.00 28.95           C  
ATOM   7736  C   ALA C  52      55.767 152.833  66.305  1.00 29.35           C  
ATOM   7737  O   ALA C  52      54.711 153.449  66.476  1.00 31.61           O  
ATOM   7738  CB  ALA C  52      55.646 150.554  65.281  1.00 31.33           C  
ATOM   7739  N   ALA C  53      56.755 152.845  67.198  1.00 27.21           N  
ATOM   7740  CA  ALA C  53      56.637 153.604  68.447  1.00 25.02           C  
ATOM   7741  C   ALA C  53      56.534 155.102  68.170  1.00 24.57           C  
ATOM   7742  O   ALA C  53      55.705 155.800  68.766  1.00 21.24           O  
ATOM   7743  CB  ALA C  53      57.840 153.323  69.356  1.00 24.38           C  
ATOM   7744  N   VAL C  54      57.389 155.590  67.271  1.00 24.24           N  
ATOM   7745  CA  VAL C  54      57.402 157.003  66.904  1.00 25.63           C  
ATOM   7746  C   VAL C  54      56.058 157.393  66.287  1.00 26.96           C  
ATOM   7747  O   VAL C  54      55.443 158.391  66.684  1.00 25.88           O  
ATOM   7748  CB  VAL C  54      58.531 157.302  65.894  1.00 28.36           C  
ATOM   7749  CG1 VAL C  54      58.442 158.741  65.431  1.00 27.90           C  
ATOM   7750  CG2 VAL C  54      59.894 157.027  66.528  1.00 26.95           C  
ATOM   7751  N   LEU C  55      55.602 156.604  65.314  1.00 27.41           N  
ATOM   7752  CA  LEU C  55      54.320 156.876  64.679  1.00 28.94           C  
ATOM   7753  C   LEU C  55      53.243 156.997  65.737  1.00 28.56           C  
ATOM   7754  O   LEU C  55      52.431 157.913  65.696  1.00 30.02           O  
ATOM   7755  CB  LEU C  55      53.938 155.762  63.702  1.00 31.12           C  
ATOM   7756  CG  LEU C  55      54.700 155.689  62.378  1.00 31.42           C  
ATOM   7757  CD1 LEU C  55      54.064 154.625  61.498  1.00 29.71           C  
ATOM   7758  CD2 LEU C  55      54.658 157.053  61.680  1.00 32.56           C  
ATOM   7759  N   GLU C  56      53.244 156.070  66.691  1.00 29.82           N  
ATOM   7760  CA  GLU C  56      52.264 156.070  67.780  1.00 28.03           C  
ATOM   7761  C   GLU C  56      52.374 157.321  68.641  1.00 26.23           C  
ATOM   7762  O   GLU C  56      51.372 157.965  68.954  1.00 26.99           O  
ATOM   7763  CB  GLU C  56      52.454 154.838  68.661  1.00 29.19           C  
ATOM   7764  CG  GLU C  56      51.403 154.704  69.748  1.00 31.44           C  
ATOM   7765  CD  GLU C  56      51.428 153.347  70.400  1.00 30.93           C  
ATOM   7766  OE1 GLU C  56      51.495 152.341  69.666  1.00 28.96           O  
ATOM   7767  OE2 GLU C  56      51.374 153.286  71.641  1.00 32.57           O  
ATOM   7768  N   TYR C  57      53.592 157.665  69.034  1.00 26.17           N  
ATOM   7769  CA  TYR C  57      53.782 158.851  69.852  1.00 26.76           C  
ATOM   7770  C   TYR C  57      53.193 160.077  69.186  1.00 26.96           C  
ATOM   7771  O   TYR C  57      52.411 160.802  69.800  1.00 27.94           O  
ATOM   7772  CB  TYR C  57      55.259 159.103  70.116  1.00 29.59           C  
ATOM   7773  CG  TYR C  57      55.518 160.511  70.596  1.00 33.11           C  
ATOM   7774  CD1 TYR C  57      55.011 160.959  71.820  1.00 30.08           C  
ATOM   7775  CD2 TYR C  57      56.232 161.416  69.803  1.00 32.33           C  
ATOM   7776  CE1 TYR C  57      55.209 162.272  72.236  1.00 31.81           C  
ATOM   7777  CE2 TYR C  57      56.434 162.726  70.213  1.00 31.67           C  
ATOM   7778  CZ  TYR C  57      55.921 163.149  71.424  1.00 32.02           C  
ATOM   7779  OH  TYR C  57      56.115 164.451  71.813  1.00 34.92           O  
ATOM   7780  N   LEU C  58      53.567 160.309  67.928  1.00 26.49           N  
ATOM   7781  CA  LEU C  58      53.070 161.471  67.196  1.00 24.87           C  
ATOM   7782  C   LEU C  58      51.557 161.528  67.026  1.00 24.21           C  
ATOM   7783  O   LEU C  58      50.979 162.615  67.087  1.00 22.60           O  
ATOM   7784  CB  LEU C  58      53.743 161.573  65.827  1.00 23.36           C  
ATOM   7785  CG  LEU C  58      55.215 161.966  65.868  1.00 21.07           C  
ATOM   7786  CD1 LEU C  58      55.803 161.825  64.479  1.00 20.64           C  
ATOM   7787  CD2 LEU C  58      55.355 163.396  66.406  1.00 19.12           C  
ATOM   7788  N   THR C  59      50.905 160.389  66.797  1.00 24.06           N  
ATOM   7789  CA  THR C  59      49.453 160.438  66.649  1.00 27.91           C  
ATOM   7790  C   THR C  59      48.812 160.624  68.034  1.00 30.13           C  
ATOM   7791  O   THR C  59      47.704 161.157  68.154  1.00 31.31           O  
ATOM   7792  CB  THR C  59      48.873 159.173  65.952  1.00 28.02           C  
ATOM   7793  OG1 THR C  59      48.269 158.313  66.923  1.00 30.63           O  
ATOM   7794  CG2 THR C  59      49.952 158.426  65.217  1.00 21.64           C  
ATOM   7795  N   ALA C  60      49.521 160.196  69.076  1.00 31.31           N  
ATOM   7796  CA  ALA C  60      49.039 160.357  70.449  1.00 32.04           C  
ATOM   7797  C   ALA C  60      49.088 161.839  70.763  1.00 33.10           C  
ATOM   7798  O   ALA C  60      48.162 162.407  71.349  1.00 35.14           O  
ATOM   7799  CB  ALA C  60      49.938 159.606  71.415  1.00 30.60           C  
ATOM   7800  N   GLU C  61      50.191 162.457  70.355  1.00 33.79           N  
ATOM   7801  CA  GLU C  61      50.435 163.880  70.568  1.00 33.22           C  
ATOM   7802  C   GLU C  61      49.396 164.762  69.885  1.00 31.52           C  
ATOM   7803  O   GLU C  61      48.937 165.740  70.460  1.00 31.73           O  
ATOM   7804  CB  GLU C  61      51.824 164.234  70.052  1.00 33.44           C  
ATOM   7805  CG  GLU C  61      52.251 165.649  70.332  1.00 38.20           C  
ATOM   7806  CD  GLU C  61      52.577 165.873  71.790  1.00 41.39           C  
ATOM   7807  OE1 GLU C  61      53.189 164.974  72.416  1.00 42.39           O  
ATOM   7808  OE2 GLU C  61      52.230 166.955  72.304  1.00 42.73           O  
ATOM   7809  N   ILE C  62      49.024 164.409  68.658  1.00 32.07           N  
ATOM   7810  CA  ILE C  62      48.036 165.180  67.907  1.00 31.50           C  
ATOM   7811  C   ILE C  62      46.663 165.028  68.536  1.00 29.14           C  
ATOM   7812  O   ILE C  62      46.009 166.015  68.863  1.00 28.53           O  
ATOM   7813  CB  ILE C  62      47.928 164.708  66.438  1.00 32.68           C  
ATOM   7814  CG1 ILE C  62      49.320 164.528  65.844  1.00 31.73           C  
ATOM   7815  CG2 ILE C  62      47.144 165.732  65.618  1.00 30.44           C  
ATOM   7816  CD1 ILE C  62      50.120 165.799  65.790  1.00 35.20           C  
ATOM   7817  N   LEU C  63      46.227 163.782  68.697  1.00 29.32           N  
ATOM   7818  CA  LEU C  63      44.914 163.506  69.288  1.00 30.72           C  
ATOM   7819  C   LEU C  63      44.741 164.131  70.675  1.00 29.48           C  
ATOM   7820  O   LEU C  63      43.650 164.563  71.023  1.00 29.76           O  
ATOM   7821  CB  LEU C  63      44.671 161.997  69.344  1.00 28.25           C  
ATOM   7822  CG  LEU C  63      44.672 161.380  67.942  1.00 25.20           C  
ATOM   7823  CD1 LEU C  63      44.516 159.883  68.056  1.00 25.94           C  
ATOM   7824  CD2 LEU C  63      43.547 161.996  67.099  1.00 18.69           C  
ATOM   7825  N   GLU C  64      45.819 164.185  71.449  1.00 28.90           N  
ATOM   7826  CA  GLU C  64      45.788 164.787  72.776  1.00 31.86           C  
ATOM   7827  C   GLU C  64      45.380 166.263  72.680  1.00 33.14           C  
ATOM   7828  O   GLU C  64      44.547 166.724  73.455  1.00 33.45           O  
ATOM   7829  CB  GLU C  64      47.172 164.675  73.424  1.00 35.30           C  
ATOM   7830  CG  GLU C  64      47.288 165.235  74.842  1.00 39.93           C  
ATOM   7831  CD  GLU C  64      46.698 164.300  75.897  1.00 45.98           C  
ATOM   7832  OE1 GLU C  64      45.459 164.304  76.086  1.00 44.87           O  
ATOM   7833  OE2 GLU C  64      47.480 163.549  76.530  1.00 47.18           O  
ATOM   7834  N   LEU C  65      45.961 167.000  71.726  1.00 34.12           N  
ATOM   7835  CA  LEU C  65      45.644 168.424  71.544  1.00 32.12           C  
ATOM   7836  C   LEU C  65      44.357 168.664  70.754  1.00 31.73           C  
ATOM   7837  O   LEU C  65      43.625 169.612  71.022  1.00 30.29           O  
ATOM   7838  CB  LEU C  65      46.798 169.155  70.852  1.00 34.26           C  
ATOM   7839  CG  LEU C  65      48.104 169.385  71.627  1.00 37.00           C  
ATOM   7840  CD1 LEU C  65      49.061 170.166  70.738  1.00 37.29           C  
ATOM   7841  CD2 LEU C  65      47.849 170.155  72.920  1.00 31.68           C  
ATOM   7842  N   ALA C  66      44.086 167.819  69.768  1.00 32.55           N  
ATOM   7843  CA  ALA C  66      42.863 167.968  68.983  1.00 34.12           C  
ATOM   7844  C   ALA C  66      41.679 167.748  69.935  1.00 34.10           C  
ATOM   7845  O   ALA C  66      40.664 168.457  69.873  1.00 34.44           O  
ATOM   7846  CB  ALA C  66      42.836 166.944  67.833  1.00 30.10           C  
ATOM   7847  N   GLY C  67      41.827 166.769  70.826  1.00 33.66           N  
ATOM   7848  CA  GLY C  67      40.781 166.481  71.791  1.00 34.97           C  
ATOM   7849  C   GLY C  67      40.393 167.702  72.612  1.00 34.93           C  
ATOM   7850  O   GLY C  67      39.207 167.991  72.780  1.00 35.29           O  
ATOM   7851  N   ASN C  68      41.387 168.425  73.122  1.00 34.41           N  
ATOM   7852  CA  ASN C  68      41.122 169.607  73.930  1.00 34.42           C  
ATOM   7853  C   ASN C  68      40.469 170.697  73.097  1.00 35.78           C  
ATOM   7854  O   ASN C  68      39.685 171.504  73.610  1.00 35.35           O  
ATOM   7855  CB  ASN C  68      42.414 170.145  74.541  1.00 34.85           C  
ATOM   7856  CG  ASN C  68      43.206 169.081  75.251  1.00 36.55           C  
ATOM   7857  OD1 ASN C  68      42.650 168.094  75.741  1.00 39.47           O  
ATOM   7858  ND2 ASN C  68      44.518 169.278  75.330  1.00 36.32           N  
ATOM   7859  N   ALA C  69      40.811 170.735  71.814  1.00 35.49           N  
ATOM   7860  CA  ALA C  69      40.233 171.725  70.926  1.00 35.81           C  
ATOM   7861  C   ALA C  69      38.760 171.371  70.803  1.00 36.94           C  
ATOM   7862  O   ALA C  69      37.904 172.247  70.784  1.00 36.88           O  
ATOM   7863  CB  ALA C  69      40.909 171.681  69.565  1.00 35.69           C  
ATOM   7864  N   ALA C  70      38.470 170.077  70.717  1.00 38.63           N  
ATOM   7865  CA  ALA C  70      37.084 169.624  70.623  1.00 41.07           C  
ATOM   7866  C   ALA C  70      36.380 170.003  71.929  1.00 41.62           C  
ATOM   7867  O   ALA C  70      35.234 170.449  71.925  1.00 40.14           O  
ATOM   7868  CB  ALA C  70      37.030 168.107  70.406  1.00 39.87           C  
ATOM   7869  N   ARG C  71      37.076 169.822  73.045  1.00 43.42           N  
ATOM   7870  CA  ARG C  71      36.521 170.172  74.344  1.00 48.01           C  
ATOM   7871  C   ARG C  71      36.231 171.675  74.411  1.00 48.94           C  
ATOM   7872  O   ARG C  71      35.111 172.080  74.721  1.00 48.02           O  
ATOM   7873  CB  ARG C  71      37.492 169.781  75.468  1.00 51.22           C  
ATOM   7874  CG  ARG C  71      37.685 168.273  75.657  1.00 56.91           C  
ATOM   7875  CD  ARG C  71      38.657 167.966  76.802  1.00 59.27           C  
ATOM   7876  NE  ARG C  71      38.784 166.532  77.064  1.00 60.51           N  
ATOM   7877  CZ  ARG C  71      39.620 166.001  77.955  1.00 61.77           C  
ATOM   7878  NH1 ARG C  71      40.413 166.783  78.680  1.00 59.68           N  
ATOM   7879  NH2 ARG C  71      39.666 164.682  78.122  1.00 60.41           N  
ATOM   7880  N   ASP C  72      37.240 172.496  74.114  1.00 50.10           N  
ATOM   7881  CA  ASP C  72      37.077 173.946  74.157  1.00 51.52           C  
ATOM   7882  C   ASP C  72      35.926 174.386  73.272  1.00 51.82           C  
ATOM   7883  O   ASP C  72      35.244 175.364  73.572  1.00 53.10           O  
ATOM   7884  CB  ASP C  72      38.353 174.669  73.704  1.00 53.65           C  
ATOM   7885  CG  ASP C  72      39.552 174.363  74.586  1.00 57.64           C  
ATOM   7886  OD1 ASP C  72      39.385 174.285  75.823  1.00 59.18           O  
ATOM   7887  OD2 ASP C  72      40.671 174.216  74.040  1.00 59.52           O  
ATOM   7888  N   ASN C  73      35.716 173.667  72.176  1.00 52.27           N  
ATOM   7889  CA  ASN C  73      34.640 173.990  71.245  1.00 53.15           C  
ATOM   7890  C   ASN C  73      33.352 173.272  71.644  1.00 53.28           C  
ATOM   7891  O   ASN C  73      32.337 173.360  70.950  1.00 54.42           O  
ATOM   7892  CB  ASN C  73      35.037 173.591  69.815  1.00 53.28           C  
ATOM   7893  CG  ASN C  73      36.137 174.476  69.238  1.00 54.03           C  
ATOM   7894  OD1 ASN C  73      35.921 175.656  68.949  1.00 52.74           O  
ATOM   7895  ND2 ASN C  73      37.324 173.905  69.070  1.00 53.75           N  
ATOM   7896  N   LYS C  74      33.399 172.563  72.766  1.00 52.40           N  
ATOM   7897  CA  LYS C  74      32.242 171.826  73.249  1.00 51.61           C  
ATOM   7898  C   LYS C  74      31.724 170.846  72.202  1.00 50.17           C  
ATOM   7899  O   LYS C  74      30.701 171.083  71.567  1.00 51.55           O  
ATOM   7900  CB  LYS C  74      31.127 172.795  73.648  1.00 54.60           C  
ATOM   7901  CG  LYS C  74      31.449 173.650  74.871  1.00 57.82           C  
ATOM   7902  CD  LYS C  74      30.235 174.465  75.296  1.00 60.69           C  
ATOM   7903  CE  LYS C  74      30.447 175.152  76.639  1.00 60.68           C  
ATOM   7904  NZ  LYS C  74      29.182 175.784  77.118  1.00 61.02           N  
ATOM   7905  N   LYS C  75      32.451 169.747  72.028  1.00 48.18           N  
ATOM   7906  CA  LYS C  75      32.106 168.687  71.081  1.00 44.81           C  
ATOM   7907  C   LYS C  75      32.833 167.459  71.600  1.00 43.83           C  
ATOM   7908  O   LYS C  75      33.970 167.563  72.063  1.00 42.06           O  
ATOM   7909  CB  LYS C  75      32.629 169.007  69.681  1.00 44.57           C  
ATOM   7910  CG  LYS C  75      32.145 170.315  69.087  1.00 43.70           C  
ATOM   7911  CD  LYS C  75      30.764 170.186  68.500  1.00 44.26           C  
ATOM   7912  CE  LYS C  75      30.387 171.466  67.782  1.00 46.28           C  
ATOM   7913  NZ  LYS C  75      30.575 172.656  68.676  1.00 49.11           N  
ATOM   7914  N   THR C  76      32.199 166.295  71.536  1.00 42.63           N  
ATOM   7915  CA  THR C  76      32.868 165.100  72.031  1.00 42.83           C  
ATOM   7916  C   THR C  76      33.566 164.408  70.875  1.00 41.46           C  
ATOM   7917  O   THR C  76      34.326 163.460  71.068  1.00 42.02           O  
ATOM   7918  CB  THR C  76      31.870 164.105  72.688  1.00 43.59           C  
ATOM   7919  OG1 THR C  76      31.176 163.362  71.675  1.00 45.00           O  
ATOM   7920  CG2 THR C  76      30.859 164.857  73.535  1.00 43.95           C  
ATOM   7921  N   ARG C  77      33.313 164.903  69.672  1.00 40.79           N  
ATOM   7922  CA  ARG C  77      33.883 164.311  68.473  1.00 41.06           C  
ATOM   7923  C   ARG C  77      34.914 165.208  67.777  1.00 38.71           C  
ATOM   7924  O   ARG C  77      34.625 166.352  67.415  1.00 37.04           O  
ATOM   7925  CB  ARG C  77      32.743 163.952  67.514  1.00 42.89           C  
ATOM   7926  CG  ARG C  77      32.913 162.616  66.829  1.00 48.28           C  
ATOM   7927  CD  ARG C  77      31.564 162.026  66.452  1.00 51.43           C  
ATOM   7928  NE  ARG C  77      30.806 162.877  65.537  1.00 56.00           N  
ATOM   7929  CZ  ARG C  77      29.573 162.607  65.113  1.00 56.70           C  
ATOM   7930  NH1 ARG C  77      28.958 161.503  65.525  1.00 56.34           N  
ATOM   7931  NH2 ARG C  77      28.951 163.443  64.286  1.00 53.13           N  
ATOM   7932  N   ILE C  78      36.119 164.672  67.599  1.00 35.86           N  
ATOM   7933  CA  ILE C  78      37.202 165.398  66.943  1.00 32.92           C  
ATOM   7934  C   ILE C  78      36.950 165.501  65.447  1.00 32.39           C  
ATOM   7935  O   ILE C  78      36.809 164.485  64.771  1.00 33.41           O  
ATOM   7936  CB  ILE C  78      38.564 164.678  67.142  1.00 31.08           C  
ATOM   7937  CG1 ILE C  78      39.052 164.854  68.579  1.00 26.55           C  
ATOM   7938  CG2 ILE C  78      39.600 165.205  66.141  1.00 30.56           C  
ATOM   7939  CD1 ILE C  78      40.330 164.093  68.859  1.00 21.02           C  
ATOM   7940  N   ILE C  79      36.893 166.723  64.929  1.00 30.68           N  
ATOM   7941  CA  ILE C  79      36.694 166.917  63.499  1.00 30.02           C  
ATOM   7942  C   ILE C  79      37.920 167.606  62.882  1.00 30.37           C  
ATOM   7943  O   ILE C  79      38.798 168.097  63.604  1.00 30.31           O  
ATOM   7944  CB  ILE C  79      35.432 167.756  63.209  1.00 29.05           C  
ATOM   7945  CG1 ILE C  79      35.543 169.135  63.865  1.00 29.07           C  
ATOM   7946  CG2 ILE C  79      34.217 167.008  63.684  1.00 26.48           C  
ATOM   7947  CD1 ILE C  79      34.381 170.080  63.534  1.00 26.29           C  
ATOM   7948  N   PRO C  80      38.005 167.640  61.538  1.00 29.15           N  
ATOM   7949  CA  PRO C  80      39.143 168.277  60.873  1.00 27.09           C  
ATOM   7950  C   PRO C  80      39.524 169.628  61.449  1.00 27.86           C  
ATOM   7951  O   PRO C  80      40.702 169.888  61.679  1.00 29.15           O  
ATOM   7952  CB  PRO C  80      38.688 168.349  59.427  1.00 27.17           C  
ATOM   7953  CG  PRO C  80      37.983 167.042  59.277  1.00 28.29           C  
ATOM   7954  CD  PRO C  80      37.140 166.967  60.550  1.00 27.28           C  
ATOM   7955  N   ARG C  81      38.538 170.486  61.689  1.00 27.83           N  
ATOM   7956  CA  ARG C  81      38.814 171.808  62.255  1.00 27.93           C  
ATOM   7957  C   ARG C  81      39.566 171.737  63.579  1.00 27.82           C  
ATOM   7958  O   ARG C  81      40.365 172.610  63.893  1.00 30.91           O  
ATOM   7959  CB  ARG C  81      37.518 172.596  62.476  1.00 27.21           C  
ATOM   7960  CG  ARG C  81      37.564 173.477  63.713  1.00 29.65           C  
ATOM   7961  CD  ARG C  81      37.628 174.979  63.436  1.00 30.75           C  
ATOM   7962  NE  ARG C  81      38.786 175.415  62.672  1.00 31.62           N  
ATOM   7963  CZ  ARG C  81      39.144 176.693  62.533  1.00 35.09           C  
ATOM   7964  NH1 ARG C  81      38.441 177.655  63.116  1.00 30.83           N  
ATOM   7965  NH2 ARG C  81      40.188 177.023  61.781  1.00 35.51           N  
ATOM   7966  N   HIS C  82      39.303 170.713  64.370  1.00 26.96           N  
ATOM   7967  CA  HIS C  82      39.981 170.604  65.645  1.00 28.87           C  
ATOM   7968  C   HIS C  82      41.437 170.207  65.423  1.00 29.70           C  
ATOM   7969  O   HIS C  82      42.334 170.750  66.069  1.00 28.98           O  
ATOM   7970  CB  HIS C  82      39.243 169.602  66.535  1.00 30.65           C  
ATOM   7971  CG  HIS C  82      37.807 169.959  66.763  1.00 30.50           C  
ATOM   7972  ND1 HIS C  82      36.813 169.013  66.891  1.00 31.49           N  
ATOM   7973  CD2 HIS C  82      37.195 171.163  66.871  1.00 29.84           C  
ATOM   7974  CE1 HIS C  82      35.651 169.617  67.065  1.00 30.01           C  
ATOM   7975  NE2 HIS C  82      35.856 170.922  67.055  1.00 32.62           N  
ATOM   7976  N   LEU C  83      41.680 169.273  64.502  1.00 29.57           N  
ATOM   7977  CA  LEU C  83      43.053 168.862  64.201  1.00 28.16           C  
ATOM   7978  C   LEU C  83      43.844 170.079  63.663  1.00 28.86           C  
ATOM   7979  O   LEU C  83      45.038 170.216  63.922  1.00 29.48           O  
ATOM   7980  CB  LEU C  83      43.060 167.714  63.182  1.00 24.06           C  
ATOM   7981  CG  LEU C  83      42.559 166.333  63.647  1.00 22.61           C  
ATOM   7982  CD1 LEU C  83      42.414 165.398  62.453  1.00 16.81           C  
ATOM   7983  CD2 LEU C  83      43.519 165.732  64.665  1.00 17.02           C  
ATOM   7984  N   GLN C  84      43.170 170.969  62.938  1.00 27.88           N  
ATOM   7985  CA  GLN C  84      43.820 172.163  62.405  1.00 28.19           C  
ATOM   7986  C   GLN C  84      44.210 173.125  63.524  1.00 30.53           C  
ATOM   7987  O   GLN C  84      45.269 173.748  63.464  1.00 31.17           O  
ATOM   7988  CB  GLN C  84      42.901 172.881  61.416  1.00 26.40           C  
ATOM   7989  CG  GLN C  84      43.316 174.315  61.103  1.00 27.17           C  
ATOM   7990  CD  GLN C  84      44.538 174.419  60.185  1.00 26.08           C  
ATOM   7991  OE1 GLN C  84      45.429 173.579  60.209  1.00 22.05           O  
ATOM   7992  NE2 GLN C  84      44.579 175.472  59.388  1.00 24.68           N  
ATOM   7993  N   LEU C  85      43.352 173.261  64.537  1.00 32.21           N  
ATOM   7994  CA  LEU C  85      43.647 174.150  65.658  1.00 30.79           C  
ATOM   7995  C   LEU C  85      44.769 173.567  66.492  1.00 30.51           C  
ATOM   7996  O   LEU C  85      45.692 174.280  66.877  1.00 34.01           O  
ATOM   7997  CB  LEU C  85      42.419 174.361  66.536  1.00 30.58           C  
ATOM   7998  CG  LEU C  85      41.301 175.192  65.906  1.00 34.93           C  
ATOM   7999  CD1 LEU C  85      40.129 175.272  66.871  1.00 36.28           C  
ATOM   8000  CD2 LEU C  85      41.802 176.581  65.573  1.00 32.48           C  
ATOM   8001  N   ALA C  86      44.700 172.273  66.768  1.00 28.09           N  
ATOM   8002  CA  ALA C  86      45.743 171.626  67.548  1.00 27.69           C  
ATOM   8003  C   ALA C  86      47.103 171.826  66.877  1.00 28.31           C  
ATOM   8004  O   ALA C  86      48.083 172.180  67.535  1.00 29.23           O  
ATOM   8005  CB  ALA C  86      45.450 170.139  67.689  1.00 28.68           C  
ATOM   8006  N   VAL C  87      47.155 171.588  65.568  1.00 26.68           N  
ATOM   8007  CA  VAL C  87      48.390 171.731  64.810  1.00 24.49           C  
ATOM   8008  C   VAL C  87      48.922 173.166  64.790  1.00 24.63           C  
ATOM   8009  O   VAL C  87      50.068 173.411  65.171  1.00 26.07           O  
ATOM   8010  CB  VAL C  87      48.225 171.267  63.327  1.00 24.12           C  
ATOM   8011  CG1 VAL C  87      49.531 171.470  62.580  1.00 22.39           C  
ATOM   8012  CG2 VAL C  87      47.828 169.789  63.258  1.00 21.56           C  
ATOM   8013  N   ARG C  88      48.092 174.110  64.360  1.00 23.43           N  
ATOM   8014  CA  ARG C  88      48.517 175.501  64.248  1.00 23.53           C  
ATOM   8015  C   ARG C  88      48.759 176.273  65.550  1.00 25.97           C  
ATOM   8016  O   ARG C  88      49.496 177.256  65.549  1.00 26.11           O  
ATOM   8017  CB  ARG C  88      47.541 176.266  63.349  1.00 23.19           C  
ATOM   8018  CG  ARG C  88      47.272 175.582  62.010  1.00 20.41           C  
ATOM   8019  CD  ARG C  88      48.568 175.060  61.398  1.00 21.44           C  
ATOM   8020  NE  ARG C  88      48.339 174.212  60.233  1.00 15.85           N  
ATOM   8021  CZ  ARG C  88      49.304 173.618  59.544  1.00 15.55           C  
ATOM   8022  NH1 ARG C  88      50.565 173.787  59.921  1.00 19.19           N  
ATOM   8023  NH2 ARG C  88      49.015 172.871  58.476  1.00  8.84           N  
ATOM   8024  N   ASN C  89      48.149 175.857  66.656  1.00 26.27           N  
ATOM   8025  CA  ASN C  89      48.403 176.539  67.922  1.00 25.85           C  
ATOM   8026  C   ASN C  89      49.612 175.890  68.572  1.00 25.64           C  
ATOM   8027  O   ASN C  89      50.048 176.314  69.632  1.00 29.43           O  
ATOM   8028  CB  ASN C  89      47.219 176.426  68.885  1.00 27.08           C  
ATOM   8029  CG  ASN C  89      45.982 177.136  68.380  1.00 28.09           C  
ATOM   8030  OD1 ASN C  89      46.018 178.319  68.045  1.00 29.23           O  
ATOM   8031  ND2 ASN C  89      44.872 176.417  68.340  1.00 28.78           N  
ATOM   8032  N   ASP C  90      50.150 174.853  67.949  1.00 24.79           N  
ATOM   8033  CA  ASP C  90      51.306 174.184  68.510  1.00 27.96           C  
ATOM   8034  C   ASP C  90      52.510 174.469  67.643  1.00 31.76           C  
ATOM   8035  O   ASP C  90      52.586 174.033  66.499  1.00 35.83           O  
ATOM   8036  CB  ASP C  90      51.090 172.673  68.583  1.00 28.73           C  
ATOM   8037  CG  ASP C  90      52.206 171.971  69.325  1.00 27.16           C  
ATOM   8038  OD1 ASP C  90      52.492 170.794  69.034  1.00 30.28           O  
ATOM   8039  OD2 ASP C  90      52.803 172.599  70.215  1.00 30.86           O  
ATOM   8040  N   GLU C  91      53.466 175.184  68.206  1.00 33.35           N  
ATOM   8041  CA  GLU C  91      54.663 175.555  67.481  1.00 33.91           C  
ATOM   8042  C   GLU C  91      55.332 174.424  66.704  1.00 31.39           C  
ATOM   8043  O   GLU C  91      55.526 174.531  65.496  1.00 34.21           O  
ATOM   8044  CB  GLU C  91      55.665 176.185  68.448  1.00 36.92           C  
ATOM   8045  CG  GLU C  91      56.918 176.695  67.788  1.00 43.56           C  
ATOM   8046  CD  GLU C  91      57.883 177.276  68.784  1.00 49.63           C  
ATOM   8047  OE1 GLU C  91      58.358 176.514  69.660  1.00 53.88           O  
ATOM   8048  OE2 GLU C  91      58.160 178.493  68.695  1.00 50.55           O  
ATOM   8049  N   GLU C  92      55.676 173.343  67.387  1.00 29.73           N  
ATOM   8050  CA  GLU C  92      56.363 172.228  66.745  1.00 29.43           C  
ATOM   8051  C   GLU C  92      55.542 171.420  65.745  1.00 30.86           C  
ATOM   8052  O   GLU C  92      56.066 171.022  64.705  1.00 31.30           O  
ATOM   8053  CB  GLU C  92      56.973 171.308  67.809  1.00 27.16           C  
ATOM   8054  CG  GLU C  92      57.907 172.055  68.758  1.00 28.65           C  
ATOM   8055  CD  GLU C  92      58.789 171.149  69.583  1.00 31.91           C  
ATOM   8056  OE1 GLU C  92      58.311 170.079  70.004  1.00 36.15           O  
ATOM   8057  OE2 GLU C  92      59.965 171.513  69.826  1.00 35.73           O  
ATOM   8058  N   LEU C  93      54.269 171.171  66.032  1.00 30.68           N  
ATOM   8059  CA  LEU C  93      53.462 170.420  65.076  1.00 31.05           C  
ATOM   8060  C   LEU C  93      53.246 171.283  63.834  1.00 30.52           C  
ATOM   8061  O   LEU C  93      53.169 170.771  62.717  1.00 30.59           O  
ATOM   8062  CB  LEU C  93      52.110 170.017  65.685  1.00 31.65           C  
ATOM   8063  CG  LEU C  93      52.150 168.909  66.739  1.00 31.40           C  
ATOM   8064  CD1 LEU C  93      50.783 168.738  67.362  1.00 32.04           C  
ATOM   8065  CD2 LEU C  93      52.623 167.616  66.107  1.00 32.96           C  
ATOM   8066  N   ASN C  94      53.155 172.596  64.042  1.00 29.76           N  
ATOM   8067  CA  ASN C  94      52.965 173.550  62.950  1.00 28.14           C  
ATOM   8068  C   ASN C  94      54.208 173.569  62.064  1.00 27.53           C  
ATOM   8069  O   ASN C  94      54.120 173.823  60.865  1.00 27.66           O  
ATOM   8070  CB  ASN C  94      52.706 174.958  63.497  1.00 26.71           C  
ATOM   8071  CG  ASN C  94      52.644 176.006  62.398  1.00 29.15           C  
ATOM   8072  OD1 ASN C  94      51.816 175.920  61.491  1.00 31.49           O  
ATOM   8073  ND2 ASN C  94      53.523 177.001  62.472  1.00 24.41           N  
ATOM   8074  N   LYS C  95      55.365 173.306  62.663  1.00 25.39           N  
ATOM   8075  CA  LYS C  95      56.609 173.275  61.917  1.00 26.30           C  
ATOM   8076  C   LYS C  95      56.665 171.978  61.090  1.00 25.92           C  
ATOM   8077  O   LYS C  95      56.958 172.003  59.891  1.00 26.96           O  
ATOM   8078  CB  LYS C  95      57.782 173.339  62.884  1.00 28.81           C  
ATOM   8079  CG  LYS C  95      59.058 173.886  62.283  1.00 34.30           C  
ATOM   8080  CD  LYS C  95      60.100 174.141  63.371  1.00 39.96           C  
ATOM   8081  CE  LYS C  95      59.563 175.087  64.460  1.00 40.79           C  
ATOM   8082  NZ  LYS C  95      60.491 175.217  65.616  1.00 38.47           N  
ATOM   8083  N   LEU C  96      56.368 170.856  61.742  1.00 23.26           N  
ATOM   8084  CA  LEU C  96      56.358 169.541  61.107  1.00 22.37           C  
ATOM   8085  C   LEU C  96      55.363 169.482  59.934  1.00 23.48           C  
ATOM   8086  O   LEU C  96      55.590 168.787  58.941  1.00 22.64           O  
ATOM   8087  CB  LEU C  96      56.012 168.475  62.155  1.00 21.76           C  
ATOM   8088  CG  LEU C  96      55.773 167.032  61.705  1.00 22.55           C  
ATOM   8089  CD1 LEU C  96      57.008 166.493  61.023  1.00 17.97           C  
ATOM   8090  CD2 LEU C  96      55.378 166.174  62.906  1.00 20.74           C  
ATOM   8091  N   LEU C  97      54.265 170.221  60.042  1.00 23.08           N  
ATOM   8092  CA  LEU C  97      53.274 170.233  58.974  1.00 24.19           C  
ATOM   8093  C   LEU C  97      53.204 171.615  58.323  1.00 25.96           C  
ATOM   8094  O   LEU C  97      52.126 172.074  57.927  1.00 25.94           O  
ATOM   8095  CB  LEU C  97      51.899 169.832  59.530  1.00 23.40           C  
ATOM   8096  CG  LEU C  97      51.844 168.463  60.227  1.00 19.59           C  
ATOM   8097  CD1 LEU C  97      50.475 168.229  60.789  1.00 17.88           C  
ATOM   8098  CD2 LEU C  97      52.207 167.369  59.244  1.00 20.38           C  
ATOM   8099  N   GLY C  98      54.364 172.268  58.210  1.00 25.09           N  
ATOM   8100  CA  GLY C  98      54.417 173.592  57.620  1.00 22.00           C  
ATOM   8101  C   GLY C  98      53.993 173.631  56.165  1.00 22.87           C  
ATOM   8102  O   GLY C  98      53.542 174.660  55.672  1.00 23.29           O  
ATOM   8103  N   ARG C  99      54.124 172.504  55.478  1.00 22.56           N  
ATOM   8104  CA  ARG C  99      53.777 172.417  54.062  1.00 24.26           C  
ATOM   8105  C   ARG C  99      52.574 171.520  53.783  1.00 23.27           C  
ATOM   8106  O   ARG C  99      52.403 171.043  52.668  1.00 23.11           O  
ATOM   8107  CB  ARG C  99      54.974 171.878  53.282  1.00 26.85           C  
ATOM   8108  CG  ARG C  99      56.151 172.802  53.292  1.00 31.63           C  
ATOM   8109  CD  ARG C  99      55.786 174.116  52.643  1.00 34.11           C  
ATOM   8110  NE  ARG C  99      56.858 175.089  52.769  1.00 40.61           N  
ATOM   8111  CZ  ARG C  99      56.834 176.292  52.209  1.00 45.05           C  
ATOM   8112  NH1 ARG C  99      55.783 176.655  51.481  1.00 44.80           N  
ATOM   8113  NH2 ARG C  99      57.849 177.133  52.392  1.00 43.71           N  
ATOM   8114  N   VAL C 100      51.743 171.302  54.795  1.00 21.46           N  
ATOM   8115  CA  VAL C 100      50.585 170.433  54.672  1.00 18.11           C  
ATOM   8116  C   VAL C 100      49.302 171.216  54.802  1.00 18.34           C  
ATOM   8117  O   VAL C 100      49.253 172.213  55.502  1.00 20.11           O  
ATOM   8118  CB  VAL C 100      50.599 169.365  55.787  1.00 17.62           C  
ATOM   8119  CG1 VAL C 100      49.282 168.613  55.822  1.00 16.67           C  
ATOM   8120  CG2 VAL C 100      51.756 168.399  55.569  1.00 16.91           C  
ATOM   8121  N   THR C 101      48.262 170.788  54.105  1.00 18.94           N  
ATOM   8122  CA  THR C 101      46.983 171.452  54.252  1.00 22.11           C  
ATOM   8123  C   THR C 101      45.995 170.386  54.723  1.00 22.79           C  
ATOM   8124  O   THR C 101      45.872 169.322  54.123  1.00 22.91           O  
ATOM   8125  CB  THR C 101      46.456 172.068  52.946  1.00 22.05           C  
ATOM   8126  OG1 THR C 101      45.882 171.040  52.142  1.00 32.18           O  
ATOM   8127  CG2 THR C 101      47.563 172.712  52.168  1.00 22.18           C  
ATOM   8128  N   ILE C 102      45.344 170.672  55.841  1.00 23.50           N  
ATOM   8129  CA  ILE C 102      44.335 169.805  56.416  1.00 23.56           C  
ATOM   8130  C   ILE C 102      43.022 170.255  55.773  1.00 24.28           C  
ATOM   8131  O   ILE C 102      42.568 171.377  55.997  1.00 23.93           O  
ATOM   8132  CB  ILE C 102      44.259 170.013  57.947  1.00 24.13           C  
ATOM   8133  CG1 ILE C 102      45.571 169.548  58.593  1.00 23.54           C  
ATOM   8134  CG2 ILE C 102      43.051 169.297  58.516  1.00 20.69           C  
ATOM   8135  CD1 ILE C 102      45.622 169.727  60.087  1.00 18.56           C  
ATOM   8136  N   ALA C 103      42.427 169.399  54.953  1.00 25.84           N  
ATOM   8137  CA  ALA C 103      41.176 169.750  54.297  1.00 26.92           C  
ATOM   8138  C   ALA C 103      40.153 170.086  55.368  1.00 27.39           C  
ATOM   8139  O   ALA C 103      40.178 169.499  56.450  1.00 28.40           O  
ATOM   8140  CB  ALA C 103      40.684 168.588  53.425  1.00 25.82           C  
ATOM   8141  N   GLN C 104      39.273 171.043  55.067  1.00 27.28           N  
ATOM   8142  CA  GLN C 104      38.225 171.477  55.993  1.00 27.00           C  
ATOM   8143  C   GLN C 104      38.777 171.968  57.326  1.00 28.01           C  
ATOM   8144  O   GLN C 104      38.099 171.908  58.349  1.00 30.42           O  
ATOM   8145  CB  GLN C 104      37.220 170.344  56.249  1.00 26.37           C  
ATOM   8146  CG  GLN C 104      36.240 170.120  55.119  1.00 28.50           C  
ATOM   8147  CD  GLN C 104      35.616 171.425  54.639  1.00 33.93           C  
ATOM   8148  OE1 GLN C 104      34.864 172.078  55.372  1.00 35.81           O  
ATOM   8149  NE2 GLN C 104      35.940 171.818  53.405  1.00 32.21           N  
ATOM   8150  N   GLY C 105      39.995 172.486  57.310  1.00 27.65           N  
ATOM   8151  CA  GLY C 105      40.591 172.953  58.543  1.00 28.22           C  
ATOM   8152  C   GLY C 105      40.405 174.424  58.833  1.00 27.79           C  
ATOM   8153  O   GLY C 105      40.410 174.835  59.999  1.00 28.49           O  
ATOM   8154  N   GLY C 106      40.232 175.219  57.784  1.00 26.75           N  
ATOM   8155  CA  GLY C 106      40.078 176.652  57.972  1.00 24.07           C  
ATOM   8156  C   GLY C 106      41.382 177.248  58.473  1.00 23.19           C  
ATOM   8157  O   GLY C 106      42.444 176.666  58.283  1.00 21.68           O  
ATOM   8158  N   VAL C 107      41.302 178.390  59.143  1.00 24.71           N  
ATOM   8159  CA  VAL C 107      42.489 179.068  59.652  1.00 25.53           C  
ATOM   8160  C   VAL C 107      42.296 179.582  61.081  1.00 26.72           C  
ATOM   8161  O   VAL C 107      41.176 179.769  61.530  1.00 28.87           O  
ATOM   8162  CB  VAL C 107      42.853 180.297  58.763  1.00 25.77           C  
ATOM   8163  CG1 VAL C 107      42.937 179.894  57.293  1.00 22.46           C  
ATOM   8164  CG2 VAL C 107      41.812 181.392  58.946  1.00 27.33           C  
ATOM   8165  N   LEU C 108      43.395 179.818  61.787  1.00 26.88           N  
ATOM   8166  CA  LEU C 108      43.323 180.362  63.132  1.00 27.57           C  
ATOM   8167  C   LEU C 108      42.750 181.776  63.064  1.00 29.68           C  
ATOM   8168  O   LEU C 108      43.174 182.581  62.238  1.00 32.38           O  
ATOM   8169  CB  LEU C 108      44.716 180.448  63.749  1.00 24.67           C  
ATOM   8170  CG  LEU C 108      45.309 179.157  64.297  1.00 26.72           C  
ATOM   8171  CD1 LEU C 108      46.669 179.416  64.936  1.00 18.02           C  
ATOM   8172  CD2 LEU C 108      44.327 178.589  65.320  1.00 26.77           C  
ATOM   8173  N   PRO C 109      41.761 182.094  63.909  1.00 31.31           N  
ATOM   8174  CA  PRO C 109      41.214 183.453  63.860  1.00 31.42           C  
ATOM   8175  C   PRO C 109      42.360 184.433  64.116  1.00 31.83           C  
ATOM   8176  O   PRO C 109      43.051 184.330  65.123  1.00 33.29           O  
ATOM   8177  CB  PRO C 109      40.195 183.439  64.989  1.00 31.65           C  
ATOM   8178  CG  PRO C 109      39.674 182.041  64.930  1.00 30.10           C  
ATOM   8179  CD  PRO C 109      40.937 181.227  64.770  1.00 31.09           C  
ATOM   8180  N   ASN C 110      42.566 185.382  63.212  1.00 32.80           N  
ATOM   8181  CA  ASN C 110      43.664 186.320  63.375  1.00 32.13           C  
ATOM   8182  C   ASN C 110      43.491 187.589  62.542  1.00 32.03           C  
ATOM   8183  O   ASN C 110      43.501 187.542  61.317  1.00 33.37           O  
ATOM   8184  CB  ASN C 110      44.967 185.606  63.007  1.00 33.29           C  
ATOM   8185  CG  ASN C 110      46.198 186.462  63.239  1.00 38.10           C  
ATOM   8186  OD1 ASN C 110      46.372 187.059  64.304  1.00 40.58           O  
ATOM   8187  ND2 ASN C 110      47.069 186.511  62.246  1.00 41.57           N  
ATOM   8188  N   ILE C 111      43.325 188.726  63.213  1.00 31.64           N  
ATOM   8189  CA  ILE C 111      43.165 190.005  62.526  1.00 30.74           C  
ATOM   8190  C   ILE C 111      44.314 190.904  62.933  1.00 29.36           C  
ATOM   8191  O   ILE C 111      44.587 191.066  64.117  1.00 29.81           O  
ATOM   8192  CB  ILE C 111      41.851 190.736  62.903  1.00 30.32           C  
ATOM   8193  CG1 ILE C 111      40.646 189.814  62.749  1.00 31.43           C  
ATOM   8194  CG2 ILE C 111      41.662 191.920  62.004  1.00 26.51           C  
ATOM   8195  CD1 ILE C 111      40.537 188.757  63.834  1.00 36.92           C  
ATOM   8196  N   GLN C 112      44.983 191.489  61.948  1.00 29.90           N  
ATOM   8197  CA  GLN C 112      46.118 192.367  62.205  1.00 31.16           C  
ATOM   8198  C   GLN C 112      45.703 193.664  62.905  1.00 32.36           C  
ATOM   8199  O   GLN C 112      44.851 194.406  62.421  1.00 33.40           O  
ATOM   8200  CB  GLN C 112      46.833 192.685  60.887  1.00 30.67           C  
ATOM   8201  CG  GLN C 112      47.311 191.453  60.110  1.00 30.31           C  
ATOM   8202  CD  GLN C 112      48.469 190.738  60.785  1.00 31.39           C  
ATOM   8203  OE1 GLN C 112      49.511 191.333  61.027  1.00 33.89           O  
ATOM   8204  NE2 GLN C 112      48.290 189.453  61.088  1.00 29.82           N  
ATOM   8205  N   SER C 113      46.331 193.922  64.046  1.00 33.97           N  
ATOM   8206  CA  SER C 113      46.086 195.105  64.865  1.00 35.86           C  
ATOM   8207  C   SER C 113      45.644 196.364  64.124  1.00 37.25           C  
ATOM   8208  O   SER C 113      44.567 196.894  64.394  1.00 39.32           O  
ATOM   8209  CB  SER C 113      47.343 195.435  65.665  1.00 35.91           C  
ATOM   8210  OG  SER C 113      47.774 194.308  66.400  1.00 44.26           O  
ATOM   8211  N   VAL C 114      46.474 196.855  63.205  1.00 35.72           N  
ATOM   8212  CA  VAL C 114      46.136 198.072  62.481  1.00 35.60           C  
ATOM   8213  C   VAL C 114      44.831 198.030  61.712  1.00 35.41           C  
ATOM   8214  O   VAL C 114      44.374 199.062  61.224  1.00 35.96           O  
ATOM   8215  CB  VAL C 114      47.238 198.482  61.494  1.00 36.30           C  
ATOM   8216  CG1 VAL C 114      48.513 198.809  62.264  1.00 38.69           C  
ATOM   8217  CG2 VAL C 114      47.455 197.388  60.466  1.00 32.94           C  
ATOM   8218  N   LEU C 115      44.235 196.849  61.589  1.00 33.92           N  
ATOM   8219  CA  LEU C 115      42.978 196.726  60.866  1.00 32.96           C  
ATOM   8220  C   LEU C 115      41.818 196.988  61.812  1.00 34.68           C  
ATOM   8221  O   LEU C 115      40.734 197.390  61.385  1.00 34.37           O  
ATOM   8222  CB  LEU C 115      42.839 195.327  60.254  1.00 29.06           C  
ATOM   8223  CG  LEU C 115      43.860 194.889  59.200  1.00 24.37           C  
ATOM   8224  CD1 LEU C 115      43.446 193.537  58.636  1.00 19.82           C  
ATOM   8225  CD2 LEU C 115      43.942 195.927  58.086  1.00 20.97           C  
ATOM   8226  N   LEU C 116      42.060 196.760  63.099  1.00 36.62           N  
ATOM   8227  CA  LEU C 116      41.045 196.956  64.127  1.00 40.40           C  
ATOM   8228  C   LEU C 116      40.750 198.424  64.403  1.00 43.51           C  
ATOM   8229  O   LEU C 116      41.590 199.300  64.184  1.00 43.05           O  
ATOM   8230  CB  LEU C 116      41.482 196.296  65.436  1.00 39.58           C  
ATOM   8231  CG  LEU C 116      41.622 194.775  65.449  1.00 40.14           C  
ATOM   8232  CD1 LEU C 116      42.372 194.322  66.694  1.00 37.93           C  
ATOM   8233  CD2 LEU C 116      40.240 194.152  65.393  1.00 39.62           C  
ATOM   8234  N   PRO C 117      39.532 198.711  64.876  1.00 47.08           N  
ATOM   8235  CA  PRO C 117      39.126 200.080  65.193  1.00 49.54           C  
ATOM   8236  C   PRO C 117      39.612 200.370  66.602  1.00 52.66           C  
ATOM   8237  O   PRO C 117      39.596 199.484  67.462  1.00 52.05           O  
ATOM   8238  CB  PRO C 117      37.612 200.004  65.126  1.00 49.81           C  
ATOM   8239  CG  PRO C 117      37.346 198.637  65.691  1.00 48.33           C  
ATOM   8240  CD  PRO C 117      38.384 197.790  64.977  1.00 47.85           C  
ATOM   8241  N   LYS C 118      40.049 201.597  66.848  1.00 57.13           N  
ATOM   8242  CA  LYS C 118      40.524 201.947  68.181  1.00 60.66           C  
ATOM   8243  C   LYS C 118      39.385 201.923  69.202  1.00 61.53           C  
ATOM   8244  O   LYS C 118      38.907 200.813  69.545  1.00 62.56           O  
ATOM   8245  CB  LYS C 118      41.171 203.328  68.177  1.00 61.17           C  
ATOM   8246  CG  LYS C 118      42.100 203.562  69.358  1.00 63.52           C  
ATOM   8247  CD  LYS C 118      43.374 202.720  69.244  1.00 64.32           C  
ATOM   8248  CE  LYS C 118      43.114 201.239  69.493  1.00 64.65           C  
ATOM   8249  NZ  LYS C 118      44.311 200.402  69.213  1.00 66.26           N  
TER    8250      LYS C 118                                                      
ATOM   8251  N   LYS D  24      30.927 135.591  47.449  1.00 91.75           N  
ATOM   8252  CA  LYS D  24      32.385 135.293  47.360  1.00 91.51           C  
ATOM   8253  C   LYS D  24      32.914 135.331  45.929  1.00 91.06           C  
ATOM   8254  O   LYS D  24      32.297 135.918  45.039  1.00 91.41           O  
ATOM   8255  CB  LYS D  24      32.685 133.922  47.978  1.00 92.17           C  
ATOM   8256  CG  LYS D  24      32.788 133.925  49.498  1.00 92.13           C  
ATOM   8257  CD  LYS D  24      33.996 134.725  49.977  1.00 91.28           C  
ATOM   8258  CE  LYS D  24      35.297 134.148  49.438  1.00 90.36           C  
ATOM   8259  NZ  LYS D  24      36.486 134.882  49.945  1.00 88.90           N  
ATOM   8260  N   LYS D  25      34.064 134.693  45.729  1.00 90.09           N  
ATOM   8261  CA  LYS D  25      34.735 134.632  44.436  1.00 88.60           C  
ATOM   8262  C   LYS D  25      35.336 135.989  44.069  1.00 87.60           C  
ATOM   8263  O   LYS D  25      36.540 136.198  44.236  1.00 87.53           O  
ATOM   8264  CB  LYS D  25      33.771 134.162  43.345  1.00 89.03           C  
ATOM   8265  CG  LYS D  25      34.429 133.893  41.993  1.00 90.40           C  
ATOM   8266  CD  LYS D  25      35.541 132.841  42.076  1.00 91.51           C  
ATOM   8267  CE  LYS D  25      36.847 133.424  42.620  1.00 92.21           C  
ATOM   8268  NZ  LYS D  25      37.932 132.412  42.743  1.00 92.11           N  
ATOM   8269  N   ARG D  26      34.514 136.906  43.567  1.00 85.85           N  
ATOM   8270  CA  ARG D  26      35.012 138.235  43.216  1.00 84.57           C  
ATOM   8271  C   ARG D  26      34.900 139.176  44.414  1.00 83.16           C  
ATOM   8272  O   ARG D  26      33.868 139.819  44.624  1.00 82.62           O  
ATOM   8273  CB  ARG D  26      34.240 138.832  42.034  1.00 84.56           C  
ATOM   8274  CG  ARG D  26      34.537 140.315  41.842  1.00 85.11           C  
ATOM   8275  CD  ARG D  26      33.884 140.908  40.613  1.00 86.33           C  
ATOM   8276  NE  ARG D  26      34.502 140.436  39.378  1.00 87.53           N  
ATOM   8277  CZ  ARG D  26      34.374 141.046  38.205  1.00 88.51           C  
ATOM   8278  NH1 ARG D  26      33.651 142.155  38.111  1.00 89.46           N  
ATOM   8279  NH2 ARG D  26      34.964 140.549  37.125  1.00 88.54           N  
ATOM   8280  N   ARG D  27      35.969 139.254  45.197  1.00 81.56           N  
ATOM   8281  CA  ARG D  27      35.978 140.112  46.370  1.00 79.74           C  
ATOM   8282  C   ARG D  27      36.364 141.540  46.012  1.00 78.50           C  
ATOM   8283  O   ARG D  27      37.349 141.772  45.314  1.00 78.07           O  
ATOM   8284  CB  ARG D  27      36.940 139.555  47.425  1.00 79.20           C  
ATOM   8285  CG  ARG D  27      37.069 140.419  48.673  1.00 78.24           C  
ATOM   8286  CD  ARG D  27      35.705 140.788  49.243  1.00 77.55           C  
ATOM   8287  NE  ARG D  27      34.901 139.613  49.559  1.00 76.50           N  
ATOM   8288  CZ  ARG D  27      35.211 138.727  50.499  1.00 76.02           C  
ATOM   8289  NH1 ARG D  27      36.311 138.880  51.223  1.00 75.76           N  
ATOM   8290  NH2 ARG D  27      34.423 137.683  50.710  1.00 75.21           N  
ATOM   8291  N   LYS D  28      35.569 142.491  46.490  1.00 77.83           N  
ATOM   8292  CA  LYS D  28      35.815 143.905  46.240  1.00 77.15           C  
ATOM   8293  C   LYS D  28      37.128 144.337  46.883  1.00 76.11           C  
ATOM   8294  O   LYS D  28      37.135 144.920  47.965  1.00 76.22           O  
ATOM   8295  CB  LYS D  28      34.669 144.744  46.808  1.00 77.59           C  
ATOM   8296  CG  LYS D  28      34.906 146.241  46.738  1.00 79.03           C  
ATOM   8297  CD  LYS D  28      34.006 146.976  47.718  1.00 80.88           C  
ATOM   8298  CE  LYS D  28      34.409 148.434  47.856  1.00 81.12           C  
ATOM   8299  NZ  LYS D  28      33.595 149.113  48.901  1.00 82.28           N  
ATOM   8300  N   THR D  29      38.233 144.041  46.206  1.00 75.44           N  
ATOM   8301  CA  THR D  29      39.573 144.384  46.674  1.00 74.20           C  
ATOM   8302  C   THR D  29      39.662 144.350  48.198  1.00 73.35           C  
ATOM   8303  O   THR D  29      39.092 143.461  48.838  1.00 73.89           O  
ATOM   8304  CB  THR D  29      39.984 145.785  46.186  1.00 75.02           C  
ATOM   8305  OG1 THR D  29      39.508 145.985  44.847  1.00 74.02           O  
ATOM   8306  CG2 THR D  29      41.506 145.927  46.214  1.00 73.59           C  
ATOM   8307  N   ARG D  30      40.369 145.325  48.767  1.00 70.81           N  
ATOM   8308  CA  ARG D  30      40.543 145.425  50.215  1.00 68.91           C  
ATOM   8309  C   ARG D  30      41.528 146.521  50.610  1.00 65.72           C  
ATOM   8310  O   ARG D  30      42.743 146.338  50.509  1.00 64.79           O  
ATOM   8311  CB  ARG D  30      41.024 144.089  50.788  1.00 70.71           C  
ATOM   8312  CG  ARG D  30      41.521 144.166  52.225  1.00 73.64           C  
ATOM   8313  CD  ARG D  30      41.712 142.777  52.809  1.00 75.97           C  
ATOM   8314  NE  ARG D  30      42.412 142.805  54.089  1.00 77.25           N  
ATOM   8315  CZ  ARG D  30      42.454 141.782  54.937  1.00 77.70           C  
ATOM   8316  NH1 ARG D  30      41.830 140.648  54.642  1.00 77.27           N  
ATOM   8317  NH2 ARG D  30      43.121 141.892  56.078  1.00 77.71           N  
ATOM   8318  N   LYS D  31      41.003 147.656  51.062  1.00 62.38           N  
ATOM   8319  CA  LYS D  31      41.856 148.759  51.478  1.00 60.67           C  
ATOM   8320  C   LYS D  31      42.547 148.375  52.783  1.00 57.98           C  
ATOM   8321  O   LYS D  31      42.462 147.228  53.216  1.00 59.87           O  
ATOM   8322  CB  LYS D  31      41.037 150.047  51.640  1.00 62.19           C  
ATOM   8323  CG  LYS D  31      39.888 149.964  52.629  1.00 64.64           C  
ATOM   8324  CD  LYS D  31      39.103 151.270  52.666  1.00 65.86           C  
ATOM   8325  CE  LYS D  31      38.001 151.221  53.715  1.00 67.24           C  
ATOM   8326  NZ  LYS D  31      37.168 152.457  53.730  1.00 68.29           N  
ATOM   8327  N   GLU D  32      43.222 149.323  53.418  1.00 54.49           N  
ATOM   8328  CA  GLU D  32      43.943 149.021  54.650  1.00 49.65           C  
ATOM   8329  C   GLU D  32      44.456 150.316  55.249  1.00 46.96           C  
ATOM   8330  O   GLU D  32      45.280 150.981  54.626  1.00 48.19           O  
ATOM   8331  CB  GLU D  32      45.122 148.113  54.309  1.00 49.04           C  
ATOM   8332  CG  GLU D  32      46.076 147.810  55.432  1.00 47.78           C  
ATOM   8333  CD  GLU D  32      47.406 147.293  54.911  1.00 46.72           C  
ATOM   8334  OE1 GLU D  32      48.132 148.081  54.274  1.00 44.76           O  
ATOM   8335  OE2 GLU D  32      47.723 146.106  55.126  1.00 46.67           O  
ATOM   8336  N   SER D  33      43.986 150.672  56.446  1.00 42.66           N  
ATOM   8337  CA  SER D  33      44.422 151.909  57.093  1.00 39.39           C  
ATOM   8338  C   SER D  33      44.851 151.746  58.557  1.00 39.42           C  
ATOM   8339  O   SER D  33      44.836 150.643  59.106  1.00 40.81           O  
ATOM   8340  CB  SER D  33      43.312 152.950  57.029  1.00 36.64           C  
ATOM   8341  OG  SER D  33      42.350 152.706  58.036  1.00 36.14           O  
ATOM   8342  N   TYR D  34      45.224 152.863  59.178  1.00 35.35           N  
ATOM   8343  CA  TYR D  34      45.658 152.887  60.570  1.00 31.78           C  
ATOM   8344  C   TYR D  34      44.495 153.234  61.480  1.00 31.68           C  
ATOM   8345  O   TYR D  34      44.658 153.347  62.689  1.00 30.05           O  
ATOM   8346  CB  TYR D  34      46.751 153.944  60.778  1.00 28.91           C  
ATOM   8347  CG  TYR D  34      48.097 153.592  60.198  1.00 25.33           C  
ATOM   8348  CD1 TYR D  34      48.450 153.979  58.905  1.00 22.06           C  
ATOM   8349  CD2 TYR D  34      49.020 152.858  60.944  1.00 21.77           C  
ATOM   8350  CE1 TYR D  34      49.690 153.639  58.373  1.00 18.80           C  
ATOM   8351  CE2 TYR D  34      50.250 152.520  60.425  1.00 18.76           C  
ATOM   8352  CZ  TYR D  34      50.577 152.908  59.145  1.00 21.02           C  
ATOM   8353  OH  TYR D  34      51.788 152.530  58.635  1.00 25.57           O  
ATOM   8354  N   ALA D  35      43.321 153.406  60.891  1.00 32.98           N  
ATOM   8355  CA  ALA D  35      42.132 153.780  61.642  1.00 34.10           C  
ATOM   8356  C   ALA D  35      41.973 153.156  63.030  1.00 36.47           C  
ATOM   8357  O   ALA D  35      41.726 153.881  63.993  1.00 39.53           O  
ATOM   8358  CB  ALA D  35      40.891 153.516  60.802  1.00 31.92           C  
ATOM   8359  N   ILE D  36      42.116 151.838  63.165  1.00 36.75           N  
ATOM   8360  CA  ILE D  36      41.930 151.245  64.488  1.00 37.28           C  
ATOM   8361  C   ILE D  36      43.036 151.534  65.494  1.00 38.09           C  
ATOM   8362  O   ILE D  36      42.748 151.825  66.658  1.00 38.20           O  
ATOM   8363  CB  ILE D  36      41.706 149.717  64.433  1.00 36.64           C  
ATOM   8364  CG1 ILE D  36      42.950 149.011  63.903  1.00 35.79           C  
ATOM   8365  CG2 ILE D  36      40.468 149.413  63.599  1.00 34.69           C  
ATOM   8366  CD1 ILE D  36      42.846 147.502  63.982  1.00 34.20           C  
ATOM   8367  N   TYR D  37      44.293 151.448  65.067  1.00 37.15           N  
ATOM   8368  CA  TYR D  37      45.395 151.741  65.975  1.00 36.34           C  
ATOM   8369  C   TYR D  37      45.274 153.215  66.380  1.00 36.98           C  
ATOM   8370  O   TYR D  37      45.691 153.615  67.470  1.00 36.23           O  
ATOM   8371  CB  TYR D  37      46.724 151.487  65.289  1.00 36.23           C  
ATOM   8372  CG  TYR D  37      46.707 150.277  64.386  1.00 37.52           C  
ATOM   8373  CD1 TYR D  37      46.541 150.417  63.006  1.00 37.60           C  
ATOM   8374  CD2 TYR D  37      46.882 148.993  64.902  1.00 35.33           C  
ATOM   8375  CE1 TYR D  37      46.556 149.310  62.159  1.00 37.26           C  
ATOM   8376  CE2 TYR D  37      46.902 147.881  64.064  1.00 38.06           C  
ATOM   8377  CZ  TYR D  37      46.742 148.047  62.694  1.00 38.54           C  
ATOM   8378  OH  TYR D  37      46.805 146.959  61.858  1.00 39.71           O  
ATOM   8379  N   VAL D  38      44.689 154.019  65.497  1.00 35.51           N  
ATOM   8380  CA  VAL D  38      44.483 155.422  65.802  1.00 36.57           C  
ATOM   8381  C   VAL D  38      43.421 155.483  66.891  1.00 38.55           C  
ATOM   8382  O   VAL D  38      43.675 155.991  67.981  1.00 41.45           O  
ATOM   8383  CB  VAL D  38      43.986 156.231  64.573  1.00 35.43           C  
ATOM   8384  CG1 VAL D  38      43.580 157.637  65.002  1.00 33.22           C  
ATOM   8385  CG2 VAL D  38      45.086 156.321  63.526  1.00 33.96           C  
ATOM   8386  N   TYR D  39      42.242 154.940  66.606  1.00 38.87           N  
ATOM   8387  CA  TYR D  39      41.150 154.954  67.576  1.00 39.43           C  
ATOM   8388  C   TYR D  39      41.587 154.475  68.971  1.00 38.74           C  
ATOM   8389  O   TYR D  39      41.144 155.021  69.983  1.00 40.52           O  
ATOM   8390  CB  TYR D  39      39.965 154.117  67.066  1.00 39.18           C  
ATOM   8391  CG  TYR D  39      38.661 154.454  67.753  1.00 41.56           C  
ATOM   8392  CD1 TYR D  39      38.094 155.723  67.629  1.00 43.93           C  
ATOM   8393  CD2 TYR D  39      38.028 153.529  68.589  1.00 45.56           C  
ATOM   8394  CE1 TYR D  39      36.938 156.070  68.330  1.00 45.34           C  
ATOM   8395  CE2 TYR D  39      36.869 153.861  69.291  1.00 44.24           C  
ATOM   8396  CZ  TYR D  39      36.334 155.134  69.162  1.00 46.06           C  
ATOM   8397  OH  TYR D  39      35.220 155.479  69.894  1.00 48.12           O  
ATOM   8398  N   LYS D  40      42.451 153.469  69.041  1.00 37.08           N  
ATOM   8399  CA  LYS D  40      42.913 153.001  70.346  1.00 38.52           C  
ATOM   8400  C   LYS D  40      43.649 154.134  71.053  1.00 39.51           C  
ATOM   8401  O   LYS D  40      43.356 154.460  72.202  1.00 41.58           O  
ATOM   8402  CB  LYS D  40      43.861 151.806  70.212  1.00 39.26           C  
ATOM   8403  CG  LYS D  40      43.191 150.518  69.801  1.00 42.26           C  
ATOM   8404  CD  LYS D  40      44.167 149.362  69.795  1.00 45.83           C  
ATOM   8405  CE  LYS D  40      43.442 148.043  69.538  1.00 49.80           C  
ATOM   8406  NZ  LYS D  40      44.361 146.869  69.667  1.00 53.79           N  
ATOM   8407  N   VAL D  41      44.609 154.733  70.360  1.00 38.50           N  
ATOM   8408  CA  VAL D  41      45.381 155.819  70.933  1.00 35.71           C  
ATOM   8409  C   VAL D  41      44.458 156.944  71.396  1.00 35.37           C  
ATOM   8410  O   VAL D  41      44.691 157.560  72.438  1.00 35.35           O  
ATOM   8411  CB  VAL D  41      46.412 156.354  69.911  1.00 33.53           C  
ATOM   8412  CG1 VAL D  41      47.123 157.583  70.466  1.00 31.76           C  
ATOM   8413  CG2 VAL D  41      47.416 155.262  69.587  1.00 30.56           C  
ATOM   8414  N   LEU D  42      43.407 157.212  70.631  1.00 35.51           N  
ATOM   8415  CA  LEU D  42      42.469 158.262  71.010  1.00 37.38           C  
ATOM   8416  C   LEU D  42      41.821 157.908  72.346  1.00 40.76           C  
ATOM   8417  O   LEU D  42      41.547 158.789  73.160  1.00 42.11           O  
ATOM   8418  CB  LEU D  42      41.387 158.442  69.943  1.00 35.13           C  
ATOM   8419  CG  LEU D  42      40.273 159.426  70.308  1.00 36.07           C  
ATOM   8420  CD1 LEU D  42      40.861 160.775  70.657  1.00 36.90           C  
ATOM   8421  CD2 LEU D  42      39.304 159.559  69.145  1.00 37.80           C  
ATOM   8422  N   LYS D  43      41.579 156.619  72.577  1.00 42.54           N  
ATOM   8423  CA  LYS D  43      40.974 156.196  73.832  1.00 44.50           C  
ATOM   8424  C   LYS D  43      41.935 156.378  74.990  1.00 45.90           C  
ATOM   8425  O   LYS D  43      41.551 156.880  76.049  1.00 48.78           O  
ATOM   8426  CB  LYS D  43      40.509 154.738  73.757  1.00 43.92           C  
ATOM   8427  CG  LYS D  43      39.302 154.544  72.857  1.00 43.87           C  
ATOM   8428  CD  LYS D  43      38.247 155.610  73.146  1.00 45.83           C  
ATOM   8429  CE  LYS D  43      37.068 155.498  72.203  1.00 48.31           C  
ATOM   8430  NZ  LYS D  43      36.169 156.686  72.259  1.00 48.35           N  
ATOM   8431  N   GLN D  44      43.186 155.986  74.788  1.00 45.51           N  
ATOM   8432  CA  GLN D  44      44.197 156.121  75.825  1.00 46.75           C  
ATOM   8433  C   GLN D  44      44.400 157.568  76.300  1.00 47.61           C  
ATOM   8434  O   GLN D  44      44.811 157.782  77.445  1.00 49.99           O  
ATOM   8435  CB  GLN D  44      45.540 155.572  75.336  1.00 47.97           C  
ATOM   8436  CG  GLN D  44      45.467 154.183  74.734  1.00 53.43           C  
ATOM   8437  CD  GLN D  44      46.839 153.581  74.479  1.00 56.89           C  
ATOM   8438  OE1 GLN D  44      47.738 154.242  73.956  1.00 60.31           O  
ATOM   8439  NE2 GLN D  44      47.001 152.315  74.839  1.00 58.70           N  
ATOM   8440  N   VAL D  45      44.125 158.554  75.444  1.00 44.31           N  
ATOM   8441  CA  VAL D  45      44.324 159.951  75.830  1.00 42.90           C  
ATOM   8442  C   VAL D  45      43.033 160.733  76.007  1.00 42.97           C  
ATOM   8443  O   VAL D  45      43.011 161.766  76.670  1.00 41.35           O  
ATOM   8444  CB  VAL D  45      45.211 160.726  74.802  1.00 44.07           C  
ATOM   8445  CG1 VAL D  45      46.637 160.195  74.818  1.00 42.13           C  
ATOM   8446  CG2 VAL D  45      44.611 160.619  73.402  1.00 41.31           C  
ATOM   8447  N   HIS D  46      41.960 160.258  75.389  1.00 44.52           N  
ATOM   8448  CA  HIS D  46      40.668 160.924  75.506  1.00 46.54           C  
ATOM   8449  C   HIS D  46      39.547 159.902  75.467  1.00 47.02           C  
ATOM   8450  O   HIS D  46      38.801 159.824  74.492  1.00 47.39           O  
ATOM   8451  CB  HIS D  46      40.481 161.957  74.393  1.00 48.19           C  
ATOM   8452  CG  HIS D  46      41.174 163.256  74.660  1.00 51.42           C  
ATOM   8453  ND1 HIS D  46      42.526 163.435  74.461  1.00 52.06           N  
ATOM   8454  CD2 HIS D  46      40.711 164.425  75.164  1.00 52.77           C  
ATOM   8455  CE1 HIS D  46      42.865 164.656  74.834  1.00 53.55           C  
ATOM   8456  NE2 HIS D  46      41.783 165.278  75.265  1.00 51.74           N  
ATOM   8457  N   PRO D  47      39.404 159.122  76.556  1.00 47.73           N  
ATOM   8458  CA  PRO D  47      38.412 158.060  76.764  1.00 47.16           C  
ATOM   8459  C   PRO D  47      37.004 158.421  76.320  1.00 46.91           C  
ATOM   8460  O   PRO D  47      36.305 157.614  75.713  1.00 47.89           O  
ATOM   8461  CB  PRO D  47      38.484 157.814  78.269  1.00 47.41           C  
ATOM   8462  CG  PRO D  47      39.912 158.133  78.591  1.00 47.90           C  
ATOM   8463  CD  PRO D  47      40.119 159.407  77.815  1.00 46.73           C  
ATOM   8464  N   ASP D  48      36.594 159.642  76.623  1.00 47.02           N  
ATOM   8465  CA  ASP D  48      35.261 160.097  76.275  1.00 47.84           C  
ATOM   8466  C   ASP D  48      35.214 160.919  74.982  1.00 47.20           C  
ATOM   8467  O   ASP D  48      34.211 161.581  74.708  1.00 46.85           O  
ATOM   8468  CB  ASP D  48      34.687 160.910  77.447  1.00 51.96           C  
ATOM   8469  CG  ASP D  48      34.468 160.061  78.718  1.00 57.52           C  
ATOM   8470  OD1 ASP D  48      35.424 159.411  79.204  1.00 56.43           O  
ATOM   8471  OD2 ASP D  48      33.330 160.051  79.241  1.00 61.18           O  
ATOM   8472  N   THR D  49      36.280 160.866  74.180  1.00 46.00           N  
ATOM   8473  CA  THR D  49      36.336 161.631  72.927  1.00 44.36           C  
ATOM   8474  C   THR D  49      36.234 160.762  71.674  1.00 42.58           C  
ATOM   8475  O   THR D  49      36.950 159.774  71.537  1.00 42.79           O  
ATOM   8476  CB  THR D  49      37.650 162.452  72.820  1.00 46.15           C  
ATOM   8477  OG1 THR D  49      37.807 163.281  73.979  1.00 46.72           O  
ATOM   8478  CG2 THR D  49      37.622 163.342  71.580  1.00 45.63           C  
ATOM   8479  N   GLY D  50      35.353 161.144  70.754  1.00 40.11           N  
ATOM   8480  CA  GLY D  50      35.191 160.383  69.527  1.00 39.77           C  
ATOM   8481  C   GLY D  50      35.925 161.005  68.352  1.00 40.51           C  
ATOM   8482  O   GLY D  50      36.717 161.933  68.540  1.00 40.88           O  
ATOM   8483  N   ILE D  51      35.661 160.513  67.140  1.00 38.17           N  
ATOM   8484  CA  ILE D  51      36.324 161.031  65.944  1.00 36.58           C  
ATOM   8485  C   ILE D  51      35.503 160.832  64.666  1.00 36.77           C  
ATOM   8486  O   ILE D  51      34.955 159.757  64.425  1.00 38.53           O  
ATOM   8487  CB  ILE D  51      37.701 160.371  65.778  1.00 35.35           C  
ATOM   8488  CG1 ILE D  51      38.412 160.920  64.540  1.00 35.55           C  
ATOM   8489  CG2 ILE D  51      37.539 158.878  65.691  1.00 33.89           C  
ATOM   8490  CD1 ILE D  51      39.892 160.598  64.507  1.00 31.61           C  
ATOM   8491  N   SER D  52      35.414 161.870  63.844  1.00 34.21           N  
ATOM   8492  CA  SER D  52      34.638 161.770  62.619  1.00 33.55           C  
ATOM   8493  C   SER D  52      35.399 161.031  61.524  1.00 32.63           C  
ATOM   8494  O   SER D  52      36.615 160.881  61.598  1.00 32.59           O  
ATOM   8495  CB  SER D  52      34.258 163.162  62.122  1.00 34.17           C  
ATOM   8496  OG  SER D  52      35.326 163.739  61.401  1.00 37.82           O  
ATOM   8497  N   SER D  53      34.676 160.581  60.504  1.00 30.91           N  
ATOM   8498  CA  SER D  53      35.289 159.868  59.397  1.00 33.49           C  
ATOM   8499  C   SER D  53      36.282 160.755  58.645  1.00 32.72           C  
ATOM   8500  O   SER D  53      37.329 160.285  58.219  1.00 34.33           O  
ATOM   8501  CB  SER D  53      34.217 159.346  58.432  1.00 36.22           C  
ATOM   8502  OG  SER D  53      33.518 160.414  57.814  1.00 44.27           O  
ATOM   8503  N   LYS D  54      35.963 162.031  58.472  1.00 32.76           N  
ATOM   8504  CA  LYS D  54      36.889 162.929  57.790  1.00 35.53           C  
ATOM   8505  C   LYS D  54      38.175 163.144  58.595  1.00 36.76           C  
ATOM   8506  O   LYS D  54      39.278 163.105  58.036  1.00 37.13           O  
ATOM   8507  CB  LYS D  54      36.241 164.283  57.509  1.00 34.42           C  
ATOM   8508  CG  LYS D  54      35.360 164.288  56.281  1.00 38.73           C  
ATOM   8509  CD  LYS D  54      34.783 165.671  56.021  1.00 42.08           C  
ATOM   8510  CE  LYS D  54      33.859 165.661  54.815  1.00 44.11           C  
ATOM   8511  NZ  LYS D  54      33.345 167.029  54.516  1.00 47.85           N  
ATOM   8512  N   ALA D  55      38.043 163.368  59.901  1.00 35.03           N  
ATOM   8513  CA  ALA D  55      39.224 163.580  60.728  1.00 33.99           C  
ATOM   8514  C   ALA D  55      40.106 162.333  60.750  1.00 33.22           C  
ATOM   8515  O   ALA D  55      41.328 162.435  60.872  1.00 33.65           O  
ATOM   8516  CB  ALA D  55      38.816 163.968  62.149  1.00 34.31           C  
ATOM   8517  N   MET D  56      39.490 161.160  60.622  1.00 31.05           N  
ATOM   8518  CA  MET D  56      40.236 159.906  60.638  1.00 29.24           C  
ATOM   8519  C   MET D  56      41.035 159.807  59.359  1.00 28.25           C  
ATOM   8520  O   MET D  56      42.162 159.306  59.337  1.00 26.58           O  
ATOM   8521  CB  MET D  56      39.287 158.715  60.729  1.00 30.68           C  
ATOM   8522  CG  MET D  56      39.981 157.358  60.710  1.00 30.30           C  
ATOM   8523  SD  MET D  56      40.877 157.069  62.225  1.00 42.66           S  
ATOM   8524  CE  MET D  56      42.531 157.340  61.714  1.00 40.08           C  
ATOM   8525  N   SER D  57      40.429 160.275  58.279  1.00 28.30           N  
ATOM   8526  CA  SER D  57      41.091 160.259  56.999  1.00 28.09           C  
ATOM   8527  C   SER D  57      42.322 161.172  57.126  1.00 27.04           C  
ATOM   8528  O   SER D  57      43.405 160.853  56.650  1.00 26.77           O  
ATOM   8529  CB  SER D  57      40.140 160.768  55.924  1.00 29.73           C  
ATOM   8530  OG  SER D  57      40.614 160.415  54.634  1.00 39.52           O  
ATOM   8531  N   ILE D  58      42.162 162.295  57.805  1.00 25.58           N  
ATOM   8532  CA  ILE D  58      43.277 163.205  57.978  1.00 28.19           C  
ATOM   8533  C   ILE D  58      44.376 162.544  58.812  1.00 30.49           C  
ATOM   8534  O   ILE D  58      45.562 162.692  58.510  1.00 32.01           O  
ATOM   8535  CB  ILE D  58      42.792 164.539  58.606  1.00 25.43           C  
ATOM   8536  CG1 ILE D  58      42.025 165.332  57.538  1.00 24.64           C  
ATOM   8537  CG2 ILE D  58      43.956 165.326  59.164  1.00 20.55           C  
ATOM   8538  CD1 ILE D  58      41.292 166.537  58.053  1.00 24.52           C  
ATOM   8539  N   MET D  59      43.984 161.792  59.838  1.00 31.41           N  
ATOM   8540  CA  MET D  59      44.952 161.101  60.688  1.00 31.52           C  
ATOM   8541  C   MET D  59      45.675 159.982  59.952  1.00 31.69           C  
ATOM   8542  O   MET D  59      46.836 159.695  60.237  1.00 33.29           O  
ATOM   8543  CB  MET D  59      44.269 160.522  61.921  1.00 33.17           C  
ATOM   8544  CG  MET D  59      43.800 161.561  62.917  1.00 35.53           C  
ATOM   8545  SD  MET D  59      45.147 162.595  63.493  1.00 37.08           S  
ATOM   8546  CE  MET D  59      46.189 161.347  64.246  1.00 35.67           C  
ATOM   8547  N   ASN D  60      44.991 159.339  59.011  1.00 33.24           N  
ATOM   8548  CA  ASN D  60      45.601 158.253  58.240  1.00 31.83           C  
ATOM   8549  C   ASN D  60      46.654 158.832  57.309  1.00 30.19           C  
ATOM   8550  O   ASN D  60      47.717 158.241  57.109  1.00 29.84           O  
ATOM   8551  CB  ASN D  60      44.547 157.514  57.420  1.00 32.89           C  
ATOM   8552  CG  ASN D  60      45.103 156.278  56.745  1.00 33.43           C  
ATOM   8553  OD1 ASN D  60      45.581 155.369  57.406  1.00 33.57           O  
ATOM   8554  ND2 ASN D  60      45.041 156.242  55.418  1.00 36.89           N  
ATOM   8555  N   SER D  61      46.351 159.998  56.745  1.00 28.57           N  
ATOM   8556  CA  SER D  61      47.278 160.675  55.853  1.00 27.45           C  
ATOM   8557  C   SER D  61      48.525 161.080  56.626  1.00 28.88           C  
ATOM   8558  O   SER D  61      49.650 160.859  56.164  1.00 28.54           O  
ATOM   8559  CB  SER D  61      46.621 161.913  55.239  1.00 26.90           C  
ATOM   8560  OG  SER D  61      45.719 161.553  54.203  1.00 24.69           O  
ATOM   8561  N   PHE D  62      48.313 161.676  57.801  1.00 29.54           N  
ATOM   8562  CA  PHE D  62      49.404 162.111  58.670  1.00 28.61           C  
ATOM   8563  C   PHE D  62      50.370 160.965  58.954  1.00 28.63           C  
ATOM   8564  O   PHE D  62      51.584 161.118  58.799  1.00 28.85           O  
ATOM   8565  CB  PHE D  62      48.846 162.655  59.989  1.00 28.70           C  
ATOM   8566  CG  PHE D  62      49.902 162.953  61.022  1.00 31.58           C  
ATOM   8567  CD1 PHE D  62      50.831 163.965  60.820  1.00 30.97           C  
ATOM   8568  CD2 PHE D  62      49.954 162.227  62.217  1.00 33.99           C  
ATOM   8569  CE1 PHE D  62      51.798 164.254  61.792  1.00 30.22           C  
ATOM   8570  CE2 PHE D  62      50.917 162.509  63.194  1.00 30.76           C  
ATOM   8571  CZ  PHE D  62      51.836 163.523  62.980  1.00 29.97           C  
ATOM   8572  N   VAL D  63      49.830 159.818  59.366  1.00 27.57           N  
ATOM   8573  CA  VAL D  63      50.653 158.650  59.664  1.00 23.73           C  
ATOM   8574  C   VAL D  63      51.415 158.172  58.430  1.00 22.91           C  
ATOM   8575  O   VAL D  63      52.619 157.945  58.500  1.00 24.50           O  
ATOM   8576  CB  VAL D  63      49.793 157.494  60.248  1.00 24.58           C  
ATOM   8577  CG1 VAL D  63      50.617 156.221  60.372  1.00 22.05           C  
ATOM   8578  CG2 VAL D  63      49.266 157.893  61.628  1.00 22.50           C  
ATOM   8579  N   ASN D  64      50.729 158.027  57.296  1.00 23.44           N  
ATOM   8580  CA  ASN D  64      51.393 157.583  56.066  1.00 21.82           C  
ATOM   8581  C   ASN D  64      52.463 158.575  55.657  1.00 20.73           C  
ATOM   8582  O   ASN D  64      53.551 158.203  55.223  1.00 20.58           O  
ATOM   8583  CB  ASN D  64      50.399 157.449  54.917  1.00 22.89           C  
ATOM   8584  CG  ASN D  64      49.624 156.162  54.966  1.00 24.88           C  
ATOM   8585  OD1 ASN D  64      50.203 155.084  55.091  1.00 28.59           O  
ATOM   8586  ND2 ASN D  64      48.303 156.258  54.853  1.00 25.58           N  
ATOM   8587  N   ASP D  65      52.137 159.851  55.795  1.00 21.45           N  
ATOM   8588  CA  ASP D  65      53.057 160.920  55.449  1.00 20.06           C  
ATOM   8589  C   ASP D  65      54.311 160.858  56.313  1.00 20.69           C  
ATOM   8590  O   ASP D  65      55.421 160.851  55.790  1.00 21.54           O  
ATOM   8591  CB  ASP D  65      52.349 162.269  55.606  1.00 22.59           C  
ATOM   8592  CG  ASP D  65      53.265 163.438  55.348  1.00 28.54           C  
ATOM   8593  OD1 ASP D  65      54.346 163.225  54.759  1.00 30.21           O  
ATOM   8594  OD2 ASP D  65      52.901 164.570  55.729  1.00 30.00           O  
ATOM   8595  N   VAL D  66      54.139 160.792  57.633  1.00 20.27           N  
ATOM   8596  CA  VAL D  66      55.286 160.737  58.526  1.00 20.64           C  
ATOM   8597  C   VAL D  66      56.143 159.510  58.283  1.00 20.93           C  
ATOM   8598  O   VAL D  66      57.376 159.608  58.269  1.00 20.56           O  
ATOM   8599  CB  VAL D  66      54.866 160.743  60.006  1.00 23.18           C  
ATOM   8600  CG1 VAL D  66      56.081 160.429  60.883  1.00 22.68           C  
ATOM   8601  CG2 VAL D  66      54.288 162.104  60.373  1.00 21.13           C  
ATOM   8602  N   PHE D  67      55.488 158.358  58.112  1.00 20.07           N  
ATOM   8603  CA  PHE D  67      56.183 157.097  57.860  1.00 20.04           C  
ATOM   8604  C   PHE D  67      57.126 157.248  56.661  1.00 20.61           C  
ATOM   8605  O   PHE D  67      58.312 156.924  56.738  1.00 18.55           O  
ATOM   8606  CB  PHE D  67      55.163 155.981  57.572  1.00 20.78           C  
ATOM   8607  CG  PHE D  67      55.779 154.714  57.026  1.00 21.84           C  
ATOM   8608  CD1 PHE D  67      56.081 153.649  57.866  1.00 24.71           C  
ATOM   8609  CD2 PHE D  67      56.079 154.597  55.671  1.00 22.69           C  
ATOM   8610  CE1 PHE D  67      56.681 152.473  57.367  1.00 25.99           C  
ATOM   8611  CE2 PHE D  67      56.678 153.436  55.159  1.00 25.83           C  
ATOM   8612  CZ  PHE D  67      56.979 152.369  56.012  1.00 24.94           C  
ATOM   8613  N   GLU D  68      56.571 157.737  55.554  1.00 21.92           N  
ATOM   8614  CA  GLU D  68      57.318 157.937  54.323  1.00 24.11           C  
ATOM   8615  C   GLU D  68      58.486 158.885  54.515  1.00 21.91           C  
ATOM   8616  O   GLU D  68      59.589 158.605  54.075  1.00 19.22           O  
ATOM   8617  CB  GLU D  68      56.386 158.465  53.228  1.00 30.91           C  
ATOM   8618  CG  GLU D  68      55.235 157.521  52.933  1.00 40.80           C  
ATOM   8619  CD  GLU D  68      54.476 157.882  51.678  1.00 46.27           C  
ATOM   8620  OE1 GLU D  68      53.892 158.993  51.620  1.00 46.30           O  
ATOM   8621  OE2 GLU D  68      54.468 157.039  50.750  1.00 49.78           O  
ATOM   8622  N   ARG D  69      58.245 160.009  55.179  1.00 22.32           N  
ATOM   8623  CA  ARG D  69      59.315 160.956  55.416  1.00 22.58           C  
ATOM   8624  C   ARG D  69      60.440 160.302  56.208  1.00 25.47           C  
ATOM   8625  O   ARG D  69      61.611 160.413  55.828  1.00 27.40           O  
ATOM   8626  CB  ARG D  69      58.807 162.162  56.181  1.00 22.92           C  
ATOM   8627  CG  ARG D  69      57.668 162.914  55.522  1.00 23.74           C  
ATOM   8628  CD  ARG D  69      57.513 164.237  56.247  1.00 26.46           C  
ATOM   8629  NE  ARG D  69      56.186 164.819  56.128  1.00 27.87           N  
ATOM   8630  CZ  ARG D  69      55.839 165.972  56.692  1.00 27.23           C  
ATOM   8631  NH1 ARG D  69      56.727 166.659  57.405  1.00 25.04           N  
ATOM   8632  NH2 ARG D  69      54.603 166.428  56.556  1.00 24.95           N  
ATOM   8633  N   ILE D  70      60.093 159.607  57.294  1.00 24.98           N  
ATOM   8634  CA  ILE D  70      61.108 158.959  58.121  1.00 24.23           C  
ATOM   8635  C   ILE D  70      61.899 157.868  57.394  1.00 25.53           C  
ATOM   8636  O   ILE D  70      63.134 157.847  57.460  1.00 26.58           O  
ATOM   8637  CB  ILE D  70      60.488 158.398  59.426  1.00 25.64           C  
ATOM   8638  CG1 ILE D  70      60.020 159.561  60.312  1.00 25.82           C  
ATOM   8639  CG2 ILE D  70      61.509 157.567  60.194  1.00 24.43           C  
ATOM   8640  CD1 ILE D  70      59.318 159.135  61.573  1.00 20.70           C  
ATOM   8641  N   ALA D  71      61.210 156.972  56.694  1.00 23.97           N  
ATOM   8642  CA  ALA D  71      61.899 155.901  55.968  1.00 23.82           C  
ATOM   8643  C   ALA D  71      62.770 156.425  54.812  1.00 23.99           C  
ATOM   8644  O   ALA D  71      63.833 155.850  54.512  1.00 24.16           O  
ATOM   8645  CB  ALA D  71      60.888 154.893  55.439  1.00 24.66           C  
ATOM   8646  N   GLY D  72      62.317 157.499  54.161  1.00 20.50           N  
ATOM   8647  CA  GLY D  72      63.076 158.077  53.063  1.00 19.83           C  
ATOM   8648  C   GLY D  72      64.435 158.561  53.539  1.00 21.59           C  
ATOM   8649  O   GLY D  72      65.437 158.425  52.845  1.00 20.92           O  
ATOM   8650  N   GLU D  73      64.469 159.129  54.738  1.00 23.71           N  
ATOM   8651  CA  GLU D  73      65.711 159.603  55.314  1.00 25.16           C  
ATOM   8652  C   GLU D  73      66.585 158.421  55.664  1.00 25.25           C  
ATOM   8653  O   GLU D  73      67.735 158.348  55.252  1.00 27.48           O  
ATOM   8654  CB  GLU D  73      65.446 160.406  56.583  1.00 25.99           C  
ATOM   8655  CG  GLU D  73      65.049 161.824  56.344  1.00 29.20           C  
ATOM   8656  CD  GLU D  73      66.218 162.713  55.931  1.00 32.67           C  
ATOM   8657  OE1 GLU D  73      67.343 162.197  55.676  1.00 29.57           O  
ATOM   8658  OE2 GLU D  73      65.988 163.943  55.866  1.00 32.40           O  
ATOM   8659  N   ALA D  74      66.031 157.500  56.443  1.00 26.36           N  
ATOM   8660  CA  ALA D  74      66.768 156.322  56.874  1.00 24.56           C  
ATOM   8661  C   ALA D  74      67.377 155.655  55.662  1.00 24.68           C  
ATOM   8662  O   ALA D  74      68.516 155.202  55.705  1.00 25.43           O  
ATOM   8663  CB  ALA D  74      65.837 155.363  57.600  1.00 22.97           C  
ATOM   8664  N   SER D  75      66.607 155.611  54.577  1.00 27.52           N  
ATOM   8665  CA  SER D  75      67.047 155.009  53.321  1.00 27.75           C  
ATOM   8666  C   SER D  75      68.268 155.759  52.809  1.00 29.03           C  
ATOM   8667  O   SER D  75      69.235 155.152  52.352  1.00 30.54           O  
ATOM   8668  CB  SER D  75      65.916 155.072  52.287  1.00 28.31           C  
ATOM   8669  OG  SER D  75      66.295 154.480  51.052  1.00 27.44           O  
ATOM   8670  N   ARG D  76      68.220 157.084  52.884  1.00 28.99           N  
ATOM   8671  CA  ARG D  76      69.344 157.897  52.440  1.00 30.62           C  
ATOM   8672  C   ARG D  76      70.527 157.712  53.379  1.00 31.32           C  
ATOM   8673  O   ARG D  76      71.668 157.635  52.921  1.00 33.52           O  
ATOM   8674  CB  ARG D  76      68.951 159.379  52.359  1.00 30.93           C  
ATOM   8675  CG  ARG D  76      67.864 159.649  51.325  1.00 30.47           C  
ATOM   8676  CD  ARG D  76      67.679 161.129  51.040  1.00 25.11           C  
ATOM   8677  NE  ARG D  76      66.274 161.436  50.809  1.00 20.16           N  
ATOM   8678  CZ  ARG D  76      65.399 161.704  51.775  1.00 26.18           C  
ATOM   8679  NH1 ARG D  76      65.784 161.712  53.040  1.00 29.27           N  
ATOM   8680  NH2 ARG D  76      64.134 161.956  51.482  1.00 29.62           N  
ATOM   8681  N   LEU D  77      70.259 157.638  54.685  1.00 31.09           N  
ATOM   8682  CA  LEU D  77      71.326 157.425  55.664  1.00 29.57           C  
ATOM   8683  C   LEU D  77      72.039 156.145  55.301  1.00 28.62           C  
ATOM   8684  O   LEU D  77      73.259 156.101  55.272  1.00 27.93           O  
ATOM   8685  CB  LEU D  77      70.784 157.254  57.084  1.00 28.03           C  
ATOM   8686  CG  LEU D  77      70.381 158.435  57.958  1.00 26.70           C  
ATOM   8687  CD1 LEU D  77      71.445 159.520  57.891  1.00 23.82           C  
ATOM   8688  CD2 LEU D  77      69.049 158.942  57.516  1.00 28.53           C  
ATOM   8689  N   ALA D  78      71.257 155.098  55.049  1.00 30.18           N  
ATOM   8690  CA  ALA D  78      71.794 153.785  54.693  1.00 31.60           C  
ATOM   8691  C   ALA D  78      72.712 153.882  53.487  1.00 31.87           C  
ATOM   8692  O   ALA D  78      73.836 153.390  53.510  1.00 30.30           O  
ATOM   8693  CB  ALA D  78      70.659 152.819  54.400  1.00 29.76           C  
ATOM   8694  N   HIS D  79      72.211 154.521  52.434  1.00 34.87           N  
ATOM   8695  CA  HIS D  79      72.965 154.712  51.199  1.00 37.11           C  
ATOM   8696  C   HIS D  79      74.217 155.563  51.446  1.00 36.87           C  
ATOM   8697  O   HIS D  79      75.324 155.168  51.088  1.00 37.95           O  
ATOM   8698  CB  HIS D  79      72.080 155.392  50.140  1.00 38.85           C  
ATOM   8699  CG  HIS D  79      70.992 154.516  49.597  1.00 42.74           C  
ATOM   8700  ND1 HIS D  79      71.249 153.337  48.928  1.00 43.29           N  
ATOM   8701  CD2 HIS D  79      69.644 154.662  49.597  1.00 44.90           C  
ATOM   8702  CE1 HIS D  79      70.107 152.796  48.540  1.00 44.72           C  
ATOM   8703  NE2 HIS D  79      69.118 153.579  48.933  1.00 45.41           N  
ATOM   8704  N   TYR D  80      74.044 156.730  52.056  1.00 35.68           N  
ATOM   8705  CA  TYR D  80      75.181 157.598  52.324  1.00 37.75           C  
ATOM   8706  C   TYR D  80      76.330 156.831  52.968  1.00 38.77           C  
ATOM   8707  O   TYR D  80      77.496 156.999  52.600  1.00 40.54           O  
ATOM   8708  CB  TYR D  80      74.769 158.747  53.244  1.00 35.73           C  
ATOM   8709  CG  TYR D  80      73.751 159.689  52.638  1.00 41.37           C  
ATOM   8710  CD1 TYR D  80      73.064 160.606  53.438  1.00 40.80           C  
ATOM   8711  CD2 TYR D  80      73.476 159.675  51.262  1.00 40.46           C  
ATOM   8712  CE1 TYR D  80      72.129 161.481  52.889  1.00 42.13           C  
ATOM   8713  CE2 TYR D  80      72.548 160.545  50.708  1.00 40.61           C  
ATOM   8714  CZ  TYR D  80      71.875 161.444  51.527  1.00 43.02           C  
ATOM   8715  OH  TYR D  80      70.919 162.282  50.998  1.00 45.97           O  
ATOM   8716  N   ASN D  81      75.989 155.970  53.916  1.00 38.08           N  
ATOM   8717  CA  ASN D  81      76.984 155.208  54.645  1.00 38.05           C  
ATOM   8718  C   ASN D  81      77.269 153.828  54.074  1.00 39.20           C  
ATOM   8719  O   ASN D  81      77.768 152.944  54.775  1.00 37.49           O  
ATOM   8720  CB  ASN D  81      76.545 155.114  56.102  1.00 35.25           C  
ATOM   8721  CG  ASN D  81      76.689 156.429  56.826  1.00 34.29           C  
ATOM   8722  OD1 ASN D  81      77.776 156.769  57.286  1.00 35.89           O  
ATOM   8723  ND2 ASN D  81      75.602 157.191  56.911  1.00 31.72           N  
ATOM   8724  N   LYS D  82      76.958 153.657  52.793  1.00 40.76           N  
ATOM   8725  CA  LYS D  82      77.172 152.392  52.104  1.00 40.21           C  
ATOM   8726  C   LYS D  82      76.774 151.184  52.929  1.00 39.31           C  
ATOM   8727  O   LYS D  82      77.556 150.256  53.091  1.00 40.15           O  
ATOM   8728  CB  LYS D  82      78.633 152.270  51.680  1.00 42.48           C  
ATOM   8729  CG  LYS D  82      79.035 153.341  50.680  1.00 49.96           C  
ATOM   8730  CD  LYS D  82      80.361 153.040  50.011  1.00 54.86           C  
ATOM   8731  CE  LYS D  82      80.632 154.033  48.888  1.00 58.56           C  
ATOM   8732  NZ  LYS D  82      81.872 153.698  48.122  1.00 61.16           N  
ATOM   8733  N   ARG D  83      75.556 151.199  53.455  1.00 38.60           N  
ATOM   8734  CA  ARG D  83      75.060 150.080  54.241  1.00 40.57           C  
ATOM   8735  C   ARG D  83      73.803 149.520  53.588  1.00 40.70           C  
ATOM   8736  O   ARG D  83      72.985 150.265  53.054  1.00 41.86           O  
ATOM   8737  CB  ARG D  83      74.798 150.516  55.684  1.00 42.78           C  
ATOM   8738  CG  ARG D  83      76.084 150.874  56.428  1.00 45.96           C  
ATOM   8739  CD  ARG D  83      75.868 151.048  57.921  1.00 50.72           C  
ATOM   8740  NE  ARG D  83      75.361 149.822  58.532  1.00 55.44           N  
ATOM   8741  CZ  ARG D  83      74.074 149.488  58.594  1.00 55.91           C  
ATOM   8742  NH1 ARG D  83      73.147 150.296  58.091  1.00 54.78           N  
ATOM   8743  NH2 ARG D  83      73.717 148.333  59.143  1.00 55.73           N  
ATOM   8744  N   SER D  84      73.659 148.201  53.631  1.00 40.13           N  
ATOM   8745  CA  SER D  84      72.535 147.528  52.993  1.00 39.55           C  
ATOM   8746  C   SER D  84      71.321 147.354  53.877  1.00 38.99           C  
ATOM   8747  O   SER D  84      70.348 146.715  53.467  1.00 39.68           O  
ATOM   8748  CB  SER D  84      72.967 146.140  52.503  1.00 40.37           C  
ATOM   8749  OG  SER D  84      74.177 146.201  51.768  1.00 45.36           O  
ATOM   8750  N   THR D  85      71.353 147.926  55.073  1.00 37.17           N  
ATOM   8751  CA  THR D  85      70.238 147.735  55.984  1.00 36.38           C  
ATOM   8752  C   THR D  85      69.717 148.945  56.742  1.00 33.63           C  
ATOM   8753  O   THR D  85      70.479 149.803  57.174  1.00 33.44           O  
ATOM   8754  CB  THR D  85      70.594 146.646  57.020  1.00 40.13           C  
ATOM   8755  OG1 THR D  85      71.852 146.962  57.634  1.00 42.62           O  
ATOM   8756  CG2 THR D  85      70.711 145.300  56.348  1.00 41.67           C  
ATOM   8757  N   ILE D  86      68.401 148.992  56.908  1.00 31.08           N  
ATOM   8758  CA  ILE D  86      67.754 150.058  57.652  1.00 29.93           C  
ATOM   8759  C   ILE D  86      67.447 149.513  59.047  1.00 29.09           C  
ATOM   8760  O   ILE D  86      66.535 148.703  59.225  1.00 30.22           O  
ATOM   8761  CB  ILE D  86      66.466 150.512  56.947  1.00 30.42           C  
ATOM   8762  CG1 ILE D  86      66.842 151.408  55.760  1.00 30.59           C  
ATOM   8763  CG2 ILE D  86      65.546 151.229  57.922  1.00 30.24           C  
ATOM   8764  CD1 ILE D  86      65.677 151.845  54.920  1.00 28.44           C  
ATOM   8765  N   THR D  87      68.232 149.948  60.029  1.00 26.77           N  
ATOM   8766  CA  THR D  87      68.076 149.493  61.407  1.00 24.84           C  
ATOM   8767  C   THR D  87      67.356 150.533  62.254  1.00 23.75           C  
ATOM   8768  O   THR D  87      66.857 151.516  61.726  1.00 25.64           O  
ATOM   8769  CB  THR D  87      69.458 149.172  62.031  1.00 25.31           C  
ATOM   8770  OG1 THR D  87      70.250 150.365  62.110  1.00 25.08           O  
ATOM   8771  CG2 THR D  87      70.189 148.141  61.184  1.00 20.48           C  
ATOM   8772  N   SER D  88      67.286 150.330  63.564  1.00 22.83           N  
ATOM   8773  CA  SER D  88      66.598 151.306  64.403  1.00 23.34           C  
ATOM   8774  C   SER D  88      67.494 152.530  64.564  1.00 24.09           C  
ATOM   8775  O   SER D  88      67.052 153.579  65.000  1.00 24.36           O  
ATOM   8776  CB  SER D  88      66.248 150.718  65.771  1.00 21.14           C  
ATOM   8777  OG  SER D  88      67.412 150.454  66.523  1.00 26.47           O  
ATOM   8778  N   ARG D  89      68.759 152.382  64.197  1.00 25.82           N  
ATOM   8779  CA  ARG D  89      69.703 153.479  64.274  1.00 27.85           C  
ATOM   8780  C   ARG D  89      69.393 154.497  63.154  1.00 29.47           C  
ATOM   8781  O   ARG D  89      69.443 155.703  63.384  1.00 30.74           O  
ATOM   8782  CB  ARG D  89      71.128 152.942  64.153  1.00 27.12           C  
ATOM   8783  CG  ARG D  89      72.196 153.926  64.563  1.00 31.63           C  
ATOM   8784  CD  ARG D  89      73.560 153.246  64.659  1.00 36.31           C  
ATOM   8785  NE  ARG D  89      74.585 154.150  65.171  1.00 37.13           N  
ATOM   8786  CZ  ARG D  89      75.056 155.196  64.504  1.00 40.39           C  
ATOM   8787  NH1 ARG D  89      74.597 155.464  63.287  1.00 41.34           N  
ATOM   8788  NH2 ARG D  89      75.962 155.988  65.064  1.00 39.47           N  
ATOM   8789  N   GLU D  90      69.062 154.026  61.952  1.00 27.80           N  
ATOM   8790  CA  GLU D  90      68.723 154.955  60.876  1.00 26.24           C  
ATOM   8791  C   GLU D  90      67.351 155.550  61.125  1.00 24.98           C  
ATOM   8792  O   GLU D  90      67.068 156.672  60.706  1.00 27.17           O  
ATOM   8793  CB  GLU D  90      68.703 154.275  59.507  1.00 26.63           C  
ATOM   8794  CG  GLU D  90      70.050 154.126  58.858  1.00 29.08           C  
ATOM   8795  CD  GLU D  90      70.877 153.052  59.501  1.00 30.90           C  
ATOM   8796  OE1 GLU D  90      70.352 151.929  59.667  1.00 32.90           O  
ATOM   8797  OE2 GLU D  90      72.050 153.327  59.828  1.00 31.57           O  
ATOM   8798  N   ILE D  91      66.485 154.801  61.790  1.00 22.56           N  
ATOM   8799  CA  ILE D  91      65.156 155.322  62.070  1.00 22.25           C  
ATOM   8800  C   ILE D  91      65.318 156.466  63.067  1.00 24.86           C  
ATOM   8801  O   ILE D  91      64.695 157.523  62.929  1.00 26.43           O  
ATOM   8802  CB  ILE D  91      64.225 154.212  62.653  1.00 20.19           C  
ATOM   8803  CG1 ILE D  91      63.920 153.166  61.574  1.00 19.48           C  
ATOM   8804  CG2 ILE D  91      62.928 154.808  63.177  1.00 18.47           C  
ATOM   8805  CD1 ILE D  91      63.170 153.712  60.344  1.00 20.27           C  
ATOM   8806  N   GLN D  92      66.193 156.266  64.049  1.00 25.58           N  
ATOM   8807  CA  GLN D  92      66.418 157.264  65.081  1.00 25.52           C  
ATOM   8808  C   GLN D  92      66.955 158.607  64.593  1.00 25.06           C  
ATOM   8809  O   GLN D  92      66.353 159.656  64.869  1.00 23.61           O  
ATOM   8810  CB  GLN D  92      67.346 156.717  66.163  1.00 27.36           C  
ATOM   8811  CG  GLN D  92      67.484 157.678  67.331  1.00 29.66           C  
ATOM   8812  CD  GLN D  92      68.236 157.092  68.484  1.00 30.08           C  
ATOM   8813  OE1 GLN D  92      69.429 156.803  68.381  1.00 35.96           O  
ATOM   8814  NE2 GLN D  92      67.547 156.906  69.599  1.00 31.33           N  
ATOM   8815  N   THR D  93      68.083 158.600  63.884  1.00 23.68           N  
ATOM   8816  CA  THR D  93      68.619 159.870  63.399  1.00 22.16           C  
ATOM   8817  C   THR D  93      67.776 160.480  62.290  1.00 20.76           C  
ATOM   8818  O   THR D  93      67.892 161.671  62.015  1.00 20.90           O  
ATOM   8819  CB  THR D  93      70.058 159.765  62.911  1.00 21.85           C  
ATOM   8820  OG1 THR D  93      70.136 160.268  61.572  1.00 22.02           O  
ATOM   8821  CG2 THR D  93      70.545 158.360  62.998  1.00 15.41           C  
ATOM   8822  N   ALA D  94      66.944 159.661  61.649  1.00 19.58           N  
ATOM   8823  CA  ALA D  94      66.037 160.159  60.625  1.00 18.97           C  
ATOM   8824  C   ALA D  94      65.017 160.977  61.414  1.00 21.53           C  
ATOM   8825  O   ALA D  94      64.602 162.054  60.989  1.00 23.31           O  
ATOM   8826  CB  ALA D  94      65.355 159.011  59.919  1.00 16.61           C  
ATOM   8827  N   VAL D  95      64.627 160.449  62.574  1.00 22.39           N  
ATOM   8828  CA  VAL D  95      63.692 161.117  63.478  1.00 21.40           C  
ATOM   8829  C   VAL D  95      64.300 162.432  63.980  1.00 20.27           C  
ATOM   8830  O   VAL D  95      63.596 163.410  64.154  1.00 19.01           O  
ATOM   8831  CB  VAL D  95      63.357 160.212  64.714  1.00 23.98           C  
ATOM   8832  CG1 VAL D  95      62.644 161.022  65.799  1.00 20.54           C  
ATOM   8833  CG2 VAL D  95      62.484 159.040  64.288  1.00 25.19           C  
ATOM   8834  N   ARG D  96      65.608 162.454  64.220  1.00 22.82           N  
ATOM   8835  CA  ARG D  96      66.255 163.681  64.706  1.00 25.99           C  
ATOM   8836  C   ARG D  96      66.316 164.762  63.636  1.00 24.88           C  
ATOM   8837  O   ARG D  96      66.273 165.945  63.945  1.00 25.69           O  
ATOM   8838  CB  ARG D  96      67.679 163.407  65.206  1.00 27.08           C  
ATOM   8839  CG  ARG D  96      67.760 162.560  66.460  1.00 30.41           C  
ATOM   8840  CD  ARG D  96      69.167 162.604  67.027  1.00 36.00           C  
ATOM   8841  NE  ARG D  96      69.483 161.422  67.827  1.00 41.93           N  
ATOM   8842  CZ  ARG D  96      70.539 160.640  67.605  1.00 43.59           C  
ATOM   8843  NH1 ARG D  96      71.376 160.923  66.611  1.00 46.24           N  
ATOM   8844  NH2 ARG D  96      70.754 159.574  68.365  1.00 42.28           N  
ATOM   8845  N   LEU D  97      66.409 164.343  62.380  1.00 24.57           N  
ATOM   8846  CA  LEU D  97      66.466 165.260  61.250  1.00 23.84           C  
ATOM   8847  C   LEU D  97      65.074 165.780  60.891  1.00 25.08           C  
ATOM   8848  O   LEU D  97      64.899 166.954  60.596  1.00 26.32           O  
ATOM   8849  CB  LEU D  97      67.071 164.540  60.035  1.00 22.56           C  
ATOM   8850  CG  LEU D  97      68.543 164.118  60.139  1.00 20.51           C  
ATOM   8851  CD1 LEU D  97      68.856 162.927  59.240  1.00 15.98           C  
ATOM   8852  CD2 LEU D  97      69.400 165.318  59.795  1.00 21.09           C  
ATOM   8853  N   LEU D  98      64.080 164.906  60.946  1.00 25.91           N  
ATOM   8854  CA  LEU D  98      62.727 165.274  60.575  1.00 27.52           C  
ATOM   8855  C   LEU D  98      61.893 166.038  61.583  1.00 29.34           C  
ATOM   8856  O   LEU D  98      61.148 166.957  61.218  1.00 30.35           O  
ATOM   8857  CB  LEU D  98      61.940 164.032  60.189  1.00 30.28           C  
ATOM   8858  CG  LEU D  98      60.603 164.400  59.548  1.00 33.82           C  
ATOM   8859  CD1 LEU D  98      60.875 164.858  58.128  1.00 29.24           C  
ATOM   8860  CD2 LEU D  98      59.645 163.203  59.557  1.00 38.67           C  
ATOM   8861  N   LEU D  99      61.991 165.645  62.847  1.00 28.63           N  
ATOM   8862  CA  LEU D  99      61.193 166.275  63.886  1.00 25.87           C  
ATOM   8863  C   LEU D  99      61.866 167.431  64.595  1.00 26.21           C  
ATOM   8864  O   LEU D  99      63.059 167.390  64.891  1.00 27.25           O  
ATOM   8865  CB  LEU D  99      60.782 165.231  64.925  1.00 22.46           C  
ATOM   8866  CG  LEU D  99      60.005 164.005  64.453  1.00 21.19           C  
ATOM   8867  CD1 LEU D  99      59.496 163.248  65.686  1.00 20.93           C  
ATOM   8868  CD2 LEU D  99      58.838 164.422  63.576  1.00 16.61           C  
ATOM   8869  N   PRO D 100      61.100 168.488  64.879  1.00 26.09           N  
ATOM   8870  CA  PRO D 100      61.663 169.646  65.575  1.00 27.80           C  
ATOM   8871  C   PRO D 100      61.974 169.308  67.041  1.00 30.25           C  
ATOM   8872  O   PRO D 100      61.482 168.307  67.581  1.00 30.55           O  
ATOM   8873  CB  PRO D 100      60.564 170.701  65.432  1.00 26.06           C  
ATOM   8874  CG  PRO D 100      59.305 169.879  65.353  1.00 24.22           C  
ATOM   8875  CD  PRO D 100      59.712 168.743  64.455  1.00 25.33           C  
ATOM   8876  N   GLY D 101      62.789 170.157  67.663  1.00 29.81           N  
ATOM   8877  CA  GLY D 101      63.203 170.001  69.053  1.00 29.63           C  
ATOM   8878  C   GLY D 101      62.573 169.020  70.037  1.00 30.99           C  
ATOM   8879  O   GLY D 101      63.016 167.872  70.146  1.00 30.11           O  
ATOM   8880  N   GLU D 102      61.555 169.474  70.771  1.00 31.34           N  
ATOM   8881  CA  GLU D 102      60.897 168.656  71.796  1.00 32.42           C  
ATOM   8882  C   GLU D 102      60.233 167.372  71.291  1.00 32.88           C  
ATOM   8883  O   GLU D 102      60.312 166.323  71.940  1.00 34.04           O  
ATOM   8884  CB  GLU D 102      59.877 169.510  72.552  1.00 34.30           C  
ATOM   8885  CG  GLU D 102      59.728 169.179  74.036  1.00 37.54           C  
ATOM   8886  CD  GLU D 102      61.028 169.337  74.826  1.00 37.86           C  
ATOM   8887  OE1 GLU D 102      61.794 170.286  74.550  1.00 35.50           O  
ATOM   8888  OE2 GLU D 102      61.274 168.519  75.737  1.00 37.05           O  
ATOM   8889  N   LEU D 103      59.573 167.453  70.144  1.00 31.45           N  
ATOM   8890  CA  LEU D 103      58.913 166.292  69.554  1.00 29.61           C  
ATOM   8891  C   LEU D 103      59.921 165.172  69.277  1.00 30.18           C  
ATOM   8892  O   LEU D 103      59.627 163.991  69.474  1.00 30.19           O  
ATOM   8893  CB  LEU D 103      58.242 166.714  68.256  1.00 29.87           C  
ATOM   8894  CG  LEU D 103      56.733 166.573  68.075  1.00 31.67           C  
ATOM   8895  CD1 LEU D 103      55.986 166.619  69.409  1.00 28.06           C  
ATOM   8896  CD2 LEU D 103      56.284 167.672  67.132  1.00 27.35           C  
ATOM   8897  N   ALA D 104      61.115 165.550  68.827  1.00 31.48           N  
ATOM   8898  CA  ALA D 104      62.176 164.589  68.517  1.00 30.31           C  
ATOM   8899  C   ALA D 104      62.708 163.901  69.775  1.00 31.70           C  
ATOM   8900  O   ALA D 104      62.858 162.677  69.816  1.00 31.38           O  
ATOM   8901  CB  ALA D 104      63.304 165.295  67.801  1.00 28.10           C  
ATOM   8902  N   LYS D 105      63.000 164.707  70.791  1.00 31.62           N  
ATOM   8903  CA  LYS D 105      63.503 164.220  72.069  1.00 31.29           C  
ATOM   8904  C   LYS D 105      62.558 163.146  72.618  1.00 29.88           C  
ATOM   8905  O   LYS D 105      62.979 162.053  73.007  1.00 28.73           O  
ATOM   8906  CB  LYS D 105      63.605 165.388  73.046  1.00 33.39           C  
ATOM   8907  CG  LYS D 105      64.255 165.063  74.374  1.00 39.89           C  
ATOM   8908  CD  LYS D 105      64.025 166.185  75.377  1.00 42.95           C  
ATOM   8909  CE  LYS D 105      64.543 167.525  74.853  1.00 47.08           C  
ATOM   8910  NZ  LYS D 105      64.157 168.656  75.751  1.00 49.52           N  
ATOM   8911  N   HIS D 106      61.274 163.463  72.650  1.00 29.95           N  
ATOM   8912  CA  HIS D 106      60.282 162.509  73.127  1.00 31.77           C  
ATOM   8913  C   HIS D 106      60.231 161.284  72.224  1.00 31.58           C  
ATOM   8914  O   HIS D 106      60.309 160.161  72.709  1.00 34.59           O  
ATOM   8915  CB  HIS D 106      58.904 163.161  73.171  1.00 33.49           C  
ATOM   8916  CG  HIS D 106      58.745 164.154  74.275  1.00 38.13           C  
ATOM   8917  ND1 HIS D 106      57.884 165.226  74.193  1.00 41.67           N  
ATOM   8918  CD2 HIS D 106      59.319 164.223  75.499  1.00 37.98           C  
ATOM   8919  CE1 HIS D 106      57.934 165.914  75.319  1.00 40.82           C  
ATOM   8920  NE2 HIS D 106      58.797 165.326  76.127  1.00 40.61           N  
ATOM   8921  N   ALA D 107      60.104 161.506  70.914  1.00 29.47           N  
ATOM   8922  CA  ALA D 107      60.027 160.415  69.948  1.00 27.01           C  
ATOM   8923  C   ALA D 107      61.202 159.453  70.080  1.00 25.34           C  
ATOM   8924  O   ALA D 107      61.031 158.249  69.950  1.00 25.76           O  
ATOM   8925  CB  ALA D 107      59.945 160.975  68.517  1.00 26.38           C  
ATOM   8926  N   VAL D 108      62.393 159.985  70.327  1.00 25.82           N  
ATOM   8927  CA  VAL D 108      63.575 159.150  70.502  1.00 26.36           C  
ATOM   8928  C   VAL D 108      63.453 158.390  71.834  1.00 29.02           C  
ATOM   8929  O   VAL D 108      64.074 157.346  72.026  1.00 30.28           O  
ATOM   8930  CB  VAL D 108      64.873 160.004  70.496  1.00 24.14           C  
ATOM   8931  CG1 VAL D 108      66.079 159.153  70.867  1.00 17.76           C  
ATOM   8932  CG2 VAL D 108      65.080 160.607  69.127  1.00 23.53           C  
ATOM   8933  N   SER D 109      62.643 158.917  72.748  1.00 30.96           N  
ATOM   8934  CA  SER D 109      62.422 158.265  74.034  1.00 32.47           C  
ATOM   8935  C   SER D 109      61.506 157.074  73.844  1.00 32.20           C  
ATOM   8936  O   SER D 109      61.802 155.974  74.313  1.00 33.32           O  
ATOM   8937  CB  SER D 109      61.766 159.215  75.038  1.00 34.03           C  
ATOM   8938  OG  SER D 109      62.635 160.280  75.376  1.00 41.81           O  
ATOM   8939  N   GLU D 110      60.387 157.290  73.163  1.00 29.96           N  
ATOM   8940  CA  GLU D 110      59.433 156.210  72.948  1.00 30.44           C  
ATOM   8941  C   GLU D 110      60.003 155.104  72.073  1.00 31.68           C  
ATOM   8942  O   GLU D 110      59.776 153.923  72.342  1.00 32.14           O  
ATOM   8943  CB  GLU D 110      58.142 156.759  72.353  1.00 27.29           C  
ATOM   8944  CG  GLU D 110      57.559 157.878  73.199  1.00 30.17           C  
ATOM   8945  CD  GLU D 110      57.282 157.443  74.635  1.00 33.18           C  
ATOM   8946  OE1 GLU D 110      56.328 156.674  74.857  1.00 38.99           O  
ATOM   8947  OE2 GLU D 110      58.020 157.858  75.549  1.00 35.78           O  
ATOM   8948  N   GLY D 111      60.758 155.485  71.043  1.00 32.26           N  
ATOM   8949  CA  GLY D 111      61.345 154.499  70.158  1.00 31.35           C  
ATOM   8950  C   GLY D 111      62.367 153.639  70.883  1.00 33.29           C  
ATOM   8951  O   GLY D 111      62.325 152.408  70.816  1.00 32.21           O  
ATOM   8952  N   THR D 112      63.288 154.293  71.585  1.00 33.51           N  
ATOM   8953  CA  THR D 112      64.332 153.593  72.315  1.00 31.51           C  
ATOM   8954  C   THR D 112      63.738 152.669  73.350  1.00 31.41           C  
ATOM   8955  O   THR D 112      64.249 151.573  73.578  1.00 32.23           O  
ATOM   8956  CB  THR D 112      65.267 154.570  73.031  1.00 30.14           C  
ATOM   8957  OG1 THR D 112      65.897 155.417  72.064  1.00 35.15           O  
ATOM   8958  CG2 THR D 112      66.332 153.817  73.798  1.00 24.94           C  
ATOM   8959  N   LYS D 113      62.661 153.113  73.980  1.00 31.33           N  
ATOM   8960  CA  LYS D 113      62.012 152.309  74.997  1.00 33.46           C  
ATOM   8961  C   LYS D 113      61.364 151.086  74.388  1.00 33.85           C  
ATOM   8962  O   LYS D 113      61.537 149.976  74.890  1.00 36.12           O  
ATOM   8963  CB  LYS D 113      60.977 153.135  75.741  1.00 34.11           C  
ATOM   8964  CG  LYS D 113      61.612 154.173  76.640  1.00 39.08           C  
ATOM   8965  CD  LYS D 113      60.583 154.962  77.416  1.00 43.20           C  
ATOM   8966  CE  LYS D 113      59.669 154.038  78.183  1.00 47.52           C  
ATOM   8967  NZ  LYS D 113      58.674 153.330  77.310  1.00 51.57           N  
ATOM   8968  N   ALA D 114      60.633 151.292  73.295  1.00 33.58           N  
ATOM   8969  CA  ALA D 114      59.961 150.205  72.603  1.00 29.54           C  
ATOM   8970  C   ALA D 114      60.975 149.136  72.233  1.00 28.89           C  
ATOM   8971  O   ALA D 114      60.760 147.953  72.471  1.00 28.26           O  
ATOM   8972  CB  ALA D 114      59.277 150.728  71.363  1.00 28.92           C  
ATOM   8973  N   VAL D 115      62.092 149.546  71.655  1.00 29.40           N  
ATOM   8974  CA  VAL D 115      63.102 148.572  71.279  1.00 29.76           C  
ATOM   8975  C   VAL D 115      63.658 147.831  72.488  1.00 33.00           C  
ATOM   8976  O   VAL D 115      63.900 146.631  72.412  1.00 35.77           O  
ATOM   8977  CB  VAL D 115      64.258 149.222  70.515  1.00 24.54           C  
ATOM   8978  CG1 VAL D 115      65.370 148.216  70.300  1.00 20.95           C  
ATOM   8979  CG2 VAL D 115      63.760 149.718  69.178  1.00 24.39           C  
ATOM   8980  N   THR D 116      63.859 148.536  73.598  1.00 34.31           N  
ATOM   8981  CA  THR D 116      64.389 147.907  74.796  1.00 35.35           C  
ATOM   8982  C   THR D 116      63.412 146.864  75.315  1.00 37.58           C  
ATOM   8983  O   THR D 116      63.793 145.715  75.576  1.00 37.07           O  
ATOM   8984  CB  THR D 116      64.640 148.929  75.912  1.00 37.34           C  
ATOM   8985  OG1 THR D 116      65.681 149.832  75.513  1.00 40.55           O  
ATOM   8986  CG2 THR D 116      65.070 148.217  77.186  1.00 36.32           C  
ATOM   8987  N   LYS D 117      62.155 147.272  75.474  1.00 37.53           N  
ATOM   8988  CA  LYS D 117      61.121 146.366  75.947  1.00 38.11           C  
ATOM   8989  C   LYS D 117      60.964 145.188  74.992  1.00 39.15           C  
ATOM   8990  O   LYS D 117      61.060 144.033  75.397  1.00 40.36           O  
ATOM   8991  CB  LYS D 117      59.788 147.098  76.086  1.00 38.83           C  
ATOM   8992  CG  LYS D 117      58.641 146.171  76.456  1.00 43.32           C  
ATOM   8993  CD  LYS D 117      57.370 146.916  76.867  1.00 45.19           C  
ATOM   8994  CE  LYS D 117      56.362 145.922  77.461  1.00 50.96           C  
ATOM   8995  NZ  LYS D 117      55.043 146.515  77.850  1.00 55.07           N  
ATOM   8996  N   TYR D 118      60.743 145.483  73.718  1.00 40.19           N  
ATOM   8997  CA  TYR D 118      60.565 144.444  72.718  1.00 41.25           C  
ATOM   8998  C   TYR D 118      61.624 143.350  72.753  1.00 44.81           C  
ATOM   8999  O   TYR D 118      61.295 142.175  72.629  1.00 46.24           O  
ATOM   9000  CB  TYR D 118      60.528 145.058  71.322  1.00 38.59           C  
ATOM   9001  CG  TYR D 118      60.600 144.034  70.215  1.00 36.57           C  
ATOM   9002  CD1 TYR D 118      59.476 143.300  69.840  1.00 37.26           C  
ATOM   9003  CD2 TYR D 118      61.800 143.789  69.552  1.00 34.64           C  
ATOM   9004  CE1 TYR D 118      59.546 142.348  68.825  1.00 36.47           C  
ATOM   9005  CE2 TYR D 118      61.884 142.846  68.544  1.00 35.81           C  
ATOM   9006  CZ  TYR D 118      60.754 142.129  68.180  1.00 37.43           C  
ATOM   9007  OH  TYR D 118      60.829 141.220  67.147  1.00 38.04           O  
ATOM   9008  N   THR D 119      62.893 143.720  72.899  1.00 47.85           N  
ATOM   9009  CA  THR D 119      63.951 142.715  72.934  1.00 52.23           C  
ATOM   9010  C   THR D 119      63.844 141.862  74.193  1.00 54.86           C  
ATOM   9011  O   THR D 119      64.152 140.672  74.169  1.00 55.94           O  
ATOM   9012  CB  THR D 119      65.346 143.350  72.891  1.00 51.74           C  
ATOM   9013  OG1 THR D 119      65.486 144.251  73.992  1.00 56.18           O  
ATOM   9014  CG2 THR D 119      65.549 144.101  71.596  1.00 51.10           C  
ATOM   9015  N   SER D 120      63.415 142.469  75.294  1.00 57.42           N  
ATOM   9016  CA  SER D 120      63.258 141.723  76.534  1.00 60.89           C  
ATOM   9017  C   SER D 120      62.314 140.557  76.275  1.00 63.18           C  
ATOM   9018  O   SER D 120      62.692 139.398  76.412  1.00 64.36           O  
ATOM   9019  CB  SER D 120      62.660 142.605  77.632  1.00 60.50           C  
ATOM   9020  OG  SER D 120      63.532 143.655  77.991  1.00 62.23           O  
ATOM   9021  N   ALA D 121      61.084 140.884  75.892  1.00 65.75           N  
ATOM   9022  CA  ALA D 121      60.048 139.892  75.621  1.00 68.89           C  
ATOM   9023  C   ALA D 121      60.529 138.684  74.824  1.00 71.34           C  
ATOM   9024  O   ALA D 121      60.735 138.764  73.615  1.00 71.36           O  
ATOM   9025  CB  ALA D 121      58.882 140.553  74.899  1.00 68.41           C  
ATOM   9026  N   LYS D 122      60.698 137.563  75.517  1.00 74.34           N  
ATOM   9027  CA  LYS D 122      61.134 136.322  74.888  1.00 76.80           C  
ATOM   9028  C   LYS D 122      60.164 135.198  75.246  1.00 77.56           C  
ATOM   9029  O   LYS D 122      59.677 134.520  74.315  1.00 78.03           O  
ATOM   9030  CB  LYS D 122      62.550 135.947  75.345  1.00 78.03           C  
ATOM   9031  CG  LYS D 122      63.038 134.617  74.779  1.00 80.07           C  
ATOM   9032  CD  LYS D 122      64.504 134.356  75.094  1.00 80.92           C  
ATOM   9033  CE  LYS D 122      64.970 133.054  74.448  1.00 81.51           C  
ATOM   9034  NZ  LYS D 122      66.437 132.819  74.600  1.00 81.40           N  
ATOM   9035  OXT LYS D 122      59.904 135.010  76.456  1.00 77.71           O  
TER    9036      LYS D 122                                                      
ATOM   9037  N   HIS E  39      19.819 203.093  60.192  1.00 58.74           N  
ATOM   9038  CA  HIS E  39      21.132 202.759  60.815  1.00 57.53           C  
ATOM   9039  C   HIS E  39      22.105 202.336  59.734  1.00 55.78           C  
ATOM   9040  O   HIS E  39      21.730 201.675  58.765  1.00 55.04           O  
ATOM   9041  CB  HIS E  39      20.978 201.627  61.838  1.00 58.79           C  
ATOM   9042  CG  HIS E  39      22.199 201.400  62.674  1.00 58.88           C  
ATOM   9043  ND1 HIS E  39      23.395 200.966  62.144  1.00 60.04           N  
ATOM   9044  CD2 HIS E  39      22.417 201.573  63.999  1.00 58.67           C  
ATOM   9045  CE1 HIS E  39      24.297 200.883  63.106  1.00 59.01           C  
ATOM   9046  NE2 HIS E  39      23.729 201.247  64.242  1.00 57.23           N  
ATOM   9047  N   ARG E  40      23.360 202.731  59.906  1.00 54.98           N  
ATOM   9048  CA  ARG E  40      24.403 202.410  58.941  1.00 52.55           C  
ATOM   9049  C   ARG E  40      25.692 202.082  59.671  1.00 50.31           C  
ATOM   9050  O   ARG E  40      26.133 202.831  60.540  1.00 50.93           O  
ATOM   9051  CB  ARG E  40      24.659 203.604  58.024  1.00 52.02           C  
ATOM   9052  CG  ARG E  40      24.757 203.261  56.559  1.00 54.15           C  
ATOM   9053  CD  ARG E  40      23.444 203.538  55.857  1.00 55.68           C  
ATOM   9054  NE  ARG E  40      23.417 203.029  54.487  1.00 56.82           N  
ATOM   9055  CZ  ARG E  40      24.353 203.268  53.575  1.00 57.01           C  
ATOM   9056  NH1 ARG E  40      25.413 204.008  53.881  1.00 56.87           N  
ATOM   9057  NH2 ARG E  40      24.218 202.782  52.349  1.00 55.90           N  
ATOM   9058  N   TYR E  41      26.292 200.952  59.333  1.00 48.09           N  
ATOM   9059  CA  TYR E  41      27.555 200.589  59.949  1.00 44.45           C  
ATOM   9060  C   TYR E  41      28.634 201.288  59.131  1.00 43.34           C  
ATOM   9061  O   TYR E  41      28.538 201.372  57.905  1.00 42.83           O  
ATOM   9062  CB  TYR E  41      27.751 199.079  59.916  1.00 41.11           C  
ATOM   9063  CG  TYR E  41      26.970 198.347  60.976  1.00 38.58           C  
ATOM   9064  CD1 TYR E  41      25.968 197.440  60.632  1.00 36.90           C  
ATOM   9065  CD2 TYR E  41      27.253 198.540  62.330  1.00 37.28           C  
ATOM   9066  CE1 TYR E  41      25.270 196.737  61.612  1.00 35.94           C  
ATOM   9067  CE2 TYR E  41      26.561 197.844  63.312  1.00 35.88           C  
ATOM   9068  CZ  TYR E  41      25.574 196.942  62.947  1.00 36.72           C  
ATOM   9069  OH  TYR E  41      24.914 196.223  63.919  1.00 36.87           O  
ATOM   9070  N   ARG E  42      29.646 201.808  59.810  1.00 42.29           N  
ATOM   9071  CA  ARG E  42      30.729 202.509  59.134  1.00 42.91           C  
ATOM   9072  C   ARG E  42      31.560 201.550  58.278  1.00 41.47           C  
ATOM   9073  O   ARG E  42      31.675 200.361  58.591  1.00 40.54           O  
ATOM   9074  CB  ARG E  42      31.633 203.168  60.174  1.00 46.67           C  
ATOM   9075  CG  ARG E  42      30.889 203.946  61.243  1.00 50.13           C  
ATOM   9076  CD  ARG E  42      30.835 205.414  60.897  1.00 54.92           C  
ATOM   9077  NE  ARG E  42      31.449 206.225  61.944  1.00 59.66           N  
ATOM   9078  CZ  ARG E  42      32.673 206.023  62.426  1.00 61.83           C  
ATOM   9079  NH1 ARG E  42      33.422 205.034  61.957  1.00 62.18           N  
ATOM   9080  NH2 ARG E  42      33.151 206.814  63.380  1.00 64.66           N  
ATOM   9081  N   PRO E  43      32.139 202.053  57.176  1.00 40.76           N  
ATOM   9082  CA  PRO E  43      32.968 201.244  56.278  1.00 40.18           C  
ATOM   9083  C   PRO E  43      34.116 200.563  57.025  1.00 39.06           C  
ATOM   9084  O   PRO E  43      34.925 201.227  57.680  1.00 38.54           O  
ATOM   9085  CB  PRO E  43      33.466 202.267  55.268  1.00 40.48           C  
ATOM   9086  CG  PRO E  43      32.288 203.159  55.125  1.00 42.60           C  
ATOM   9087  CD  PRO E  43      31.872 203.372  56.577  1.00 42.63           C  
ATOM   9088  N   GLY E  44      34.174 199.238  56.921  1.00 38.15           N  
ATOM   9089  CA  GLY E  44      35.211 198.478  57.594  1.00 37.33           C  
ATOM   9090  C   GLY E  44      34.579 197.602  58.653  1.00 39.31           C  
ATOM   9091  O   GLY E  44      34.962 196.448  58.852  1.00 40.82           O  
ATOM   9092  N   THR E  45      33.584 198.161  59.328  1.00 39.57           N  
ATOM   9093  CA  THR E  45      32.872 197.466  60.384  1.00 37.46           C  
ATOM   9094  C   THR E  45      32.240 196.158  59.938  1.00 37.96           C  
ATOM   9095  O   THR E  45      32.350 195.154  60.637  1.00 37.74           O  
ATOM   9096  CB  THR E  45      31.806 198.380  60.980  1.00 38.10           C  
ATOM   9097  OG1 THR E  45      32.455 199.366  61.792  1.00 38.95           O  
ATOM   9098  CG2 THR E  45      30.805 197.587  61.818  1.00 36.96           C  
ATOM   9099  N   VAL E  46      31.570 196.155  58.790  1.00 37.50           N  
ATOM   9100  CA  VAL E  46      30.960 194.914  58.321  1.00 38.42           C  
ATOM   9101  C   VAL E  46      32.066 193.976  57.823  1.00 38.27           C  
ATOM   9102  O   VAL E  46      32.027 192.771  58.067  1.00 36.88           O  
ATOM   9103  CB  VAL E  46      29.936 195.162  57.179  1.00 36.68           C  
ATOM   9104  CG1 VAL E  46      29.326 193.844  56.736  1.00 34.54           C  
ATOM   9105  CG2 VAL E  46      28.845 196.098  57.657  1.00 37.29           C  
ATOM   9106  N   ALA E  47      33.051 194.546  57.131  1.00 37.86           N  
ATOM   9107  CA  ALA E  47      34.178 193.785  56.612  1.00 36.62           C  
ATOM   9108  C   ALA E  47      34.867 193.094  57.782  1.00 36.20           C  
ATOM   9109  O   ALA E  47      35.136 191.894  57.736  1.00 36.43           O  
ATOM   9110  CB  ALA E  47      35.150 194.710  55.899  1.00 36.69           C  
ATOM   9111  N   LEU E  48      35.152 193.848  58.835  1.00 35.24           N  
ATOM   9112  CA  LEU E  48      35.782 193.253  60.006  1.00 36.54           C  
ATOM   9113  C   LEU E  48      34.909 192.121  60.519  1.00 37.12           C  
ATOM   9114  O   LEU E  48      35.412 191.065  60.909  1.00 37.33           O  
ATOM   9115  CB  LEU E  48      35.969 194.293  61.105  1.00 36.49           C  
ATOM   9116  CG  LEU E  48      37.287 195.054  61.061  1.00 38.86           C  
ATOM   9117  CD1 LEU E  48      37.234 196.234  62.008  1.00 37.88           C  
ATOM   9118  CD2 LEU E  48      38.419 194.101  61.440  1.00 38.57           C  
ATOM   9119  N   ARG E  49      33.595 192.337  60.503  1.00 37.45           N  
ATOM   9120  CA  ARG E  49      32.669 191.316  60.972  1.00 37.50           C  
ATOM   9121  C   ARG E  49      32.841 190.067  60.125  1.00 37.18           C  
ATOM   9122  O   ARG E  49      32.929 188.958  60.657  1.00 37.87           O  
ATOM   9123  CB  ARG E  49      31.223 191.795  60.873  1.00 40.57           C  
ATOM   9124  CG  ARG E  49      30.260 190.973  61.711  1.00 42.94           C  
ATOM   9125  CD  ARG E  49      28.852 190.936  61.118  1.00 45.87           C  
ATOM   9126  NE  ARG E  49      28.335 192.254  60.755  1.00 49.17           N  
ATOM   9127  CZ  ARG E  49      28.307 193.304  61.569  1.00 50.31           C  
ATOM   9128  NH1 ARG E  49      28.775 193.197  62.806  1.00 52.51           N  
ATOM   9129  NH2 ARG E  49      27.802 194.460  61.149  1.00 49.75           N  
ATOM   9130  N   GLU E  50      32.898 190.250  58.806  1.00 35.52           N  
ATOM   9131  CA  GLU E  50      33.067 189.127  57.888  1.00 34.85           C  
ATOM   9132  C   GLU E  50      34.357 188.334  58.137  1.00 35.10           C  
ATOM   9133  O   GLU E  50      34.368 187.112  58.002  1.00 35.72           O  
ATOM   9134  CB  GLU E  50      33.032 189.610  56.441  1.00 33.71           C  
ATOM   9135  CG  GLU E  50      31.666 190.060  55.987  1.00 35.03           C  
ATOM   9136  CD  GLU E  50      31.666 190.580  54.570  1.00 36.44           C  
ATOM   9137  OE1 GLU E  50      30.666 191.217  54.170  1.00 37.54           O  
ATOM   9138  OE2 GLU E  50      32.662 190.348  53.854  1.00 36.67           O  
ATOM   9139  N   ILE E  51      35.435 189.022  58.504  1.00 33.55           N  
ATOM   9140  CA  ILE E  51      36.690 188.343  58.769  1.00 32.27           C  
ATOM   9141  C   ILE E  51      36.494 187.358  59.919  1.00 33.55           C  
ATOM   9142  O   ILE E  51      36.867 186.190  59.810  1.00 34.70           O  
ATOM   9143  CB  ILE E  51      37.826 189.352  59.126  1.00 31.60           C  
ATOM   9144  CG1 ILE E  51      38.099 190.273  57.930  1.00 31.61           C  
ATOM   9145  CG2 ILE E  51      39.109 188.598  59.495  1.00 29.21           C  
ATOM   9146  CD1 ILE E  51      39.240 191.244  58.138  1.00 28.32           C  
ATOM   9147  N   ARG E  52      35.903 187.825  61.016  1.00 34.83           N  
ATOM   9148  CA  ARG E  52      35.655 186.972  62.184  1.00 35.45           C  
ATOM   9149  C   ARG E  52      34.810 185.756  61.827  1.00 33.47           C  
ATOM   9150  O   ARG E  52      35.092 184.645  62.278  1.00 32.81           O  
ATOM   9151  CB  ARG E  52      34.936 187.752  63.285  1.00 37.32           C  
ATOM   9152  CG  ARG E  52      35.733 188.888  63.860  1.00 41.38           C  
ATOM   9153  CD  ARG E  52      34.921 189.650  64.875  1.00 44.19           C  
ATOM   9154  NE  ARG E  52      35.601 190.871  65.285  1.00 49.18           N  
ATOM   9155  CZ  ARG E  52      36.767 190.892  65.920  1.00 53.27           C  
ATOM   9156  NH1 ARG E  52      37.378 189.752  66.218  1.00 55.83           N  
ATOM   9157  NH2 ARG E  52      37.322 192.052  66.255  1.00 56.24           N  
ATOM   9158  N   ARG E  53      33.777 185.983  61.020  1.00 31.41           N  
ATOM   9159  CA  ARG E  53      32.881 184.921  60.593  1.00 32.26           C  
ATOM   9160  C   ARG E  53      33.594 183.823  59.809  1.00 32.23           C  
ATOM   9161  O   ARG E  53      33.483 182.641  60.144  1.00 31.56           O  
ATOM   9162  CB  ARG E  53      31.751 185.479  59.723  1.00 35.61           C  
ATOM   9163  CG  ARG E  53      30.900 184.380  59.086  1.00 37.22           C  
ATOM   9164  CD  ARG E  53      30.000 184.903  57.983  1.00 43.18           C  
ATOM   9165  NE  ARG E  53      29.252 183.816  57.352  1.00 48.95           N  
ATOM   9166  CZ  ARG E  53      28.385 183.975  56.355  1.00 51.02           C  
ATOM   9167  NH1 ARG E  53      28.146 185.185  55.863  1.00 52.23           N  
ATOM   9168  NH2 ARG E  53      27.758 182.922  55.848  1.00 50.16           N  
ATOM   9169  N   TYR E  54      34.316 184.205  58.760  1.00 30.34           N  
ATOM   9170  CA  TYR E  54      35.006 183.217  57.954  1.00 30.81           C  
ATOM   9171  C   TYR E  54      36.250 182.611  58.613  1.00 30.21           C  
ATOM   9172  O   TYR E  54      36.628 181.483  58.312  1.00 29.31           O  
ATOM   9173  CB  TYR E  54      35.326 183.806  56.577  1.00 30.82           C  
ATOM   9174  CG  TYR E  54      34.072 184.069  55.763  1.00 28.79           C  
ATOM   9175  CD1 TYR E  54      33.741 185.356  55.356  1.00 29.84           C  
ATOM   9176  CD2 TYR E  54      33.180 183.033  55.467  1.00 27.99           C  
ATOM   9177  CE1 TYR E  54      32.551 185.614  54.679  1.00 30.63           C  
ATOM   9178  CE2 TYR E  54      31.990 183.275  54.797  1.00 27.38           C  
ATOM   9179  CZ  TYR E  54      31.677 184.573  54.405  1.00 31.92           C  
ATOM   9180  OH  TYR E  54      30.487 184.837  53.752  1.00 33.80           O  
ATOM   9181  N   GLN E  55      36.881 183.336  59.524  1.00 30.70           N  
ATOM   9182  CA  GLN E  55      38.048 182.773  60.184  1.00 31.63           C  
ATOM   9183  C   GLN E  55      37.593 181.814  61.284  1.00 33.84           C  
ATOM   9184  O   GLN E  55      38.405 181.331  62.074  1.00 34.52           O  
ATOM   9185  CB  GLN E  55      38.932 183.867  60.794  1.00 29.97           C  
ATOM   9186  CG  GLN E  55      39.583 184.812  59.804  1.00 28.92           C  
ATOM   9187  CD  GLN E  55      40.760 185.538  60.420  1.00 29.78           C  
ATOM   9188  OE1 GLN E  55      40.749 185.845  61.603  1.00 30.68           O  
ATOM   9189  NE2 GLN E  55      41.780 185.817  59.619  1.00 29.43           N  
ATOM   9190  N   LYS E  56      36.291 181.540  61.333  1.00 35.11           N  
ATOM   9191  CA  LYS E  56      35.740 180.637  62.339  1.00 35.13           C  
ATOM   9192  C   LYS E  56      35.066 179.419  61.736  1.00 33.39           C  
ATOM   9193  O   LYS E  56      34.660 178.521  62.467  1.00 33.10           O  
ATOM   9194  CB  LYS E  56      34.733 181.369  63.234  1.00 38.98           C  
ATOM   9195  CG  LYS E  56      35.365 182.212  64.319  1.00 42.54           C  
ATOM   9196  CD  LYS E  56      34.322 182.987  65.099  1.00 45.95           C  
ATOM   9197  CE  LYS E  56      34.952 183.670  66.308  1.00 50.81           C  
ATOM   9198  NZ  LYS E  56      36.137 184.507  65.941  1.00 53.49           N  
ATOM   9199  N   SER E  57      34.934 179.389  60.412  1.00 31.09           N  
ATOM   9200  CA  SER E  57      34.303 178.252  59.745  1.00 30.53           C  
ATOM   9201  C   SER E  57      35.285 177.584  58.774  1.00 30.42           C  
ATOM   9202  O   SER E  57      36.357 178.126  58.511  1.00 29.66           O  
ATOM   9203  CB  SER E  57      33.042 178.711  59.007  1.00 28.45           C  
ATOM   9204  OG  SER E  57      33.357 179.506  57.881  1.00 30.80           O  
ATOM   9205  N   THR E  58      34.929 176.415  58.241  1.00 30.85           N  
ATOM   9206  CA  THR E  58      35.827 175.706  57.321  1.00 31.20           C  
ATOM   9207  C   THR E  58      35.181 175.395  55.975  1.00 32.08           C  
ATOM   9208  O   THR E  58      35.729 174.647  55.167  1.00 33.65           O  
ATOM   9209  CB  THR E  58      36.305 174.381  57.932  1.00 31.02           C  
ATOM   9210  OG1 THR E  58      35.254 173.414  57.852  1.00 31.77           O  
ATOM   9211  CG2 THR E  58      36.689 174.583  59.395  1.00 32.01           C  
ATOM   9212  N   GLU E  59      34.003 175.967  55.764  1.00 31.59           N  
ATOM   9213  CA  GLU E  59      33.202 175.814  54.542  1.00 31.00           C  
ATOM   9214  C   GLU E  59      33.942 176.350  53.311  1.00 28.99           C  
ATOM   9215  O   GLU E  59      34.539 177.418  53.381  1.00 29.16           O  
ATOM   9216  CB  GLU E  59      31.922 176.642  54.719  1.00 32.96           C  
ATOM   9217  CG  GLU E  59      32.287 178.024  55.303  1.00 35.63           C  
ATOM   9218  CD  GLU E  59      31.216 179.063  55.170  1.00 37.65           C  
ATOM   9219  OE1 GLU E  59      30.503 179.060  54.150  1.00 41.67           O  
ATOM   9220  OE2 GLU E  59      31.100 179.911  56.081  1.00 43.10           O  
ATOM   9221  N   LEU E  60      33.890 175.642  52.186  1.00 28.79           N  
ATOM   9222  CA  LEU E  60      34.538 176.156  50.978  1.00 28.92           C  
ATOM   9223  C   LEU E  60      33.796 177.443  50.628  1.00 30.18           C  
ATOM   9224  O   LEU E  60      32.599 177.559  50.898  1.00 33.04           O  
ATOM   9225  CB  LEU E  60      34.456 175.149  49.834  1.00 27.06           C  
ATOM   9226  CG  LEU E  60      35.299 173.886  50.086  1.00 29.72           C  
ATOM   9227  CD1 LEU E  60      35.196 172.949  48.895  1.00 31.19           C  
ATOM   9228  CD2 LEU E  60      36.756 174.269  50.324  1.00 28.95           C  
ATOM   9229  N   LEU E  61      34.499 178.414  50.050  1.00 28.92           N  
ATOM   9230  CA  LEU E  61      33.891 179.701  49.737  1.00 27.37           C  
ATOM   9231  C   LEU E  61      33.620 180.001  48.252  1.00 28.49           C  
ATOM   9232  O   LEU E  61      33.000 181.016  47.926  1.00 29.59           O  
ATOM   9233  CB  LEU E  61      34.747 180.793  50.358  1.00 25.45           C  
ATOM   9234  CG  LEU E  61      35.021 180.547  51.842  1.00 28.91           C  
ATOM   9235  CD1 LEU E  61      36.274 181.304  52.260  1.00 29.65           C  
ATOM   9236  CD2 LEU E  61      33.813 180.960  52.685  1.00 24.49           C  
ATOM   9237  N   ILE E  62      34.091 179.135  47.360  1.00 27.83           N  
ATOM   9238  CA  ILE E  62      33.848 179.291  45.925  1.00 30.25           C  
ATOM   9239  C   ILE E  62      32.657 178.360  45.602  1.00 32.57           C  
ATOM   9240  O   ILE E  62      32.631 177.218  46.059  1.00 31.46           O  
ATOM   9241  CB  ILE E  62      35.095 178.849  45.088  1.00 28.87           C  
ATOM   9242  CG1 ILE E  62      36.257 179.819  45.312  1.00 28.08           C  
ATOM   9243  CG2 ILE E  62      34.754 178.797  43.610  1.00 27.02           C  
ATOM   9244  CD1 ILE E  62      37.595 179.346  44.729  1.00 22.71           C  
ATOM   9245  N   ARG E  63      31.664 178.839  44.852  1.00 36.09           N  
ATOM   9246  CA  ARG E  63      30.516 177.985  44.516  1.00 39.20           C  
ATOM   9247  C   ARG E  63      31.044 176.756  43.788  1.00 39.74           C  
ATOM   9248  O   ARG E  63      31.866 176.868  42.878  1.00 41.65           O  
ATOM   9249  CB  ARG E  63      29.515 178.716  43.616  1.00 42.88           C  
ATOM   9250  CG  ARG E  63      28.912 179.971  44.218  1.00 47.04           C  
ATOM   9251  CD  ARG E  63      27.758 180.498  43.357  1.00 52.43           C  
ATOM   9252  NE  ARG E  63      28.103 180.644  41.940  1.00 53.49           N  
ATOM   9253  CZ  ARG E  63      28.961 181.537  41.454  1.00 54.41           C  
ATOM   9254  NH1 ARG E  63      29.581 182.385  42.267  1.00 55.19           N  
ATOM   9255  NH2 ARG E  63      29.196 181.584  40.149  1.00 53.54           N  
ATOM   9256  N   LYS E  64      30.559 175.588  44.186  1.00 39.49           N  
ATOM   9257  CA  LYS E  64      31.004 174.324  43.619  1.00 40.93           C  
ATOM   9258  C   LYS E  64      30.896 174.117  42.114  1.00 40.57           C  
ATOM   9259  O   LYS E  64      31.901 173.855  41.460  1.00 43.12           O  
ATOM   9260  CB  LYS E  64      30.315 173.164  44.342  1.00 43.34           C  
ATOM   9261  CG  LYS E  64      30.676 173.078  45.817  1.00 48.60           C  
ATOM   9262  CD  LYS E  64      30.255 171.743  46.412  1.00 53.62           C  
ATOM   9263  CE  LYS E  64      30.526 171.679  47.914  1.00 54.63           C  
ATOM   9264  NZ  LYS E  64      30.218 170.324  48.459  1.00 55.96           N  
ATOM   9265  N   LEU E  65      29.695 174.214  41.553  1.00 40.46           N  
ATOM   9266  CA  LEU E  65      29.549 174.002  40.119  1.00 37.90           C  
ATOM   9267  C   LEU E  65      30.488 174.891  39.296  1.00 38.04           C  
ATOM   9268  O   LEU E  65      31.159 174.415  38.381  1.00 37.44           O  
ATOM   9269  CB  LEU E  65      28.098 174.215  39.683  1.00 35.75           C  
ATOM   9270  CG  LEU E  65      27.841 173.873  38.207  1.00 36.35           C  
ATOM   9271  CD1 LEU E  65      28.380 172.476  37.911  1.00 33.54           C  
ATOM   9272  CD2 LEU E  65      26.349 173.970  37.885  1.00 33.28           C  
ATOM   9273  N   PRO E  66      30.543 176.195  39.599  1.00 38.81           N  
ATOM   9274  CA  PRO E  66      31.447 177.046  38.815  1.00 40.18           C  
ATOM   9275  C   PRO E  66      32.878 176.491  38.850  1.00 41.77           C  
ATOM   9276  O   PRO E  66      33.516 176.306  37.812  1.00 42.16           O  
ATOM   9277  CB  PRO E  66      31.344 178.396  39.516  1.00 40.06           C  
ATOM   9278  CG  PRO E  66      29.942 178.390  40.050  1.00 41.37           C  
ATOM   9279  CD  PRO E  66      29.790 176.989  40.585  1.00 39.13           C  
ATOM   9280  N   PHE E  67      33.369 176.210  40.053  1.00 40.76           N  
ATOM   9281  CA  PHE E  67      34.713 175.694  40.207  1.00 39.87           C  
ATOM   9282  C   PHE E  67      34.961 174.403  39.434  1.00 41.73           C  
ATOM   9283  O   PHE E  67      36.060 174.182  38.914  1.00 43.74           O  
ATOM   9284  CB  PHE E  67      35.034 175.449  41.675  1.00 36.50           C  
ATOM   9285  CG  PHE E  67      36.459 175.048  41.906  1.00 34.45           C  
ATOM   9286  CD1 PHE E  67      37.466 176.004  41.916  1.00 31.85           C  
ATOM   9287  CD2 PHE E  67      36.805 173.706  42.031  1.00 31.36           C  
ATOM   9288  CE1 PHE E  67      38.795 175.629  42.041  1.00 31.98           C  
ATOM   9289  CE2 PHE E  67      38.125 173.324  42.156  1.00 31.39           C  
ATOM   9290  CZ  PHE E  67      39.125 174.287  42.160  1.00 31.63           C  
ATOM   9291  N   GLN E  68      33.953 173.543  39.361  1.00 41.82           N  
ATOM   9292  CA  GLN E  68      34.108 172.276  38.654  1.00 41.91           C  
ATOM   9293  C   GLN E  68      34.288 172.476  37.157  1.00 40.23           C  
ATOM   9294  O   GLN E  68      35.093 171.798  36.526  1.00 41.31           O  
ATOM   9295  CB  GLN E  68      32.904 171.371  38.917  1.00 43.83           C  
ATOM   9296  CG  GLN E  68      33.063 169.979  38.349  1.00 47.32           C  
ATOM   9297  CD  GLN E  68      31.970 169.048  38.812  1.00 51.29           C  
ATOM   9298  OE1 GLN E  68      30.789 169.266  38.528  1.00 54.91           O  
ATOM   9299  NE2 GLN E  68      32.354 168.001  39.539  1.00 52.75           N  
ATOM   9300  N   ARG E  69      33.531 173.404  36.587  1.00 39.06           N  
ATOM   9301  CA  ARG E  69      33.636 173.681  35.164  1.00 39.84           C  
ATOM   9302  C   ARG E  69      35.050 174.131  34.828  1.00 39.23           C  
ATOM   9303  O   ARG E  69      35.654 173.648  33.876  1.00 39.32           O  
ATOM   9304  CB  ARG E  69      32.640 174.774  34.745  1.00 42.35           C  
ATOM   9305  CG  ARG E  69      31.198 174.306  34.629  1.00 41.72           C  
ATOM   9306  CD  ARG E  69      30.329 175.357  33.948  1.00 44.33           C  
ATOM   9307  NE  ARG E  69      29.323 175.915  34.844  1.00 44.48           N  
ATOM   9308  CZ  ARG E  69      29.415 177.103  35.429  1.00 46.27           C  
ATOM   9309  NH1 ARG E  69      30.470 177.876  35.209  1.00 47.44           N  
ATOM   9310  NH2 ARG E  69      28.454 177.512  36.244  1.00 47.76           N  
ATOM   9311  N   LEU E  70      35.565 175.066  35.620  1.00 39.09           N  
ATOM   9312  CA  LEU E  70      36.902 175.603  35.421  1.00 37.91           C  
ATOM   9313  C   LEU E  70      37.927 174.482  35.344  1.00 38.60           C  
ATOM   9314  O   LEU E  70      38.769 174.453  34.440  1.00 39.25           O  
ATOM   9315  CB  LEU E  70      37.244 176.552  36.564  1.00 38.35           C  
ATOM   9316  CG  LEU E  70      38.593 177.264  36.528  1.00 36.59           C  
ATOM   9317  CD1 LEU E  70      38.763 178.002  35.210  1.00 35.58           C  
ATOM   9318  CD2 LEU E  70      38.669 178.223  37.709  1.00 33.42           C  
ATOM   9319  N   VAL E  71      37.851 173.552  36.289  1.00 37.43           N  
ATOM   9320  CA  VAL E  71      38.773 172.428  36.311  1.00 36.20           C  
ATOM   9321  C   VAL E  71      38.682 171.610  35.020  1.00 36.60           C  
ATOM   9322  O   VAL E  71      39.702 171.296  34.410  1.00 38.68           O  
ATOM   9323  CB  VAL E  71      38.502 171.512  37.533  1.00 35.83           C  
ATOM   9324  CG1 VAL E  71      39.409 170.295  37.496  1.00 35.88           C  
ATOM   9325  CG2 VAL E  71      38.742 172.288  38.817  1.00 33.36           C  
ATOM   9326  N   ARG E  72      37.468 171.270  34.595  1.00 35.59           N  
ATOM   9327  CA  ARG E  72      37.288 170.476  33.375  1.00 33.54           C  
ATOM   9328  C   ARG E  72      37.782 171.206  32.135  1.00 31.98           C  
ATOM   9329  O   ARG E  72      38.367 170.605  31.242  1.00 32.22           O  
ATOM   9330  CB  ARG E  72      35.817 170.083  33.209  1.00 32.90           C  
ATOM   9331  CG  ARG E  72      35.378 169.016  34.195  1.00 32.89           C  
ATOM   9332  CD  ARG E  72      33.867 168.861  34.241  1.00 32.78           C  
ATOM   9333  NE  ARG E  72      33.472 167.878  35.247  1.00 33.85           N  
ATOM   9334  CZ  ARG E  72      33.555 166.562  35.083  1.00 30.06           C  
ATOM   9335  NH1 ARG E  72      34.007 166.062  33.948  1.00 33.26           N  
ATOM   9336  NH2 ARG E  72      33.214 165.746  36.062  1.00 32.02           N  
ATOM   9337  N   GLU E  73      37.547 172.508  32.086  1.00 31.39           N  
ATOM   9338  CA  GLU E  73      37.993 173.317  30.964  1.00 30.72           C  
ATOM   9339  C   GLU E  73      39.519 173.254  30.893  1.00 31.45           C  
ATOM   9340  O   GLU E  73      40.088 173.026  29.825  1.00 30.63           O  
ATOM   9341  CB  GLU E  73      37.521 174.757  31.162  1.00 31.39           C  
ATOM   9342  CG  GLU E  73      38.129 175.774  30.221  1.00 36.09           C  
ATOM   9343  CD  GLU E  73      37.536 177.160  30.424  1.00 41.50           C  
ATOM   9344  OE1 GLU E  73      36.374 177.387  30.015  1.00 44.79           O  
ATOM   9345  OE2 GLU E  73      38.224 178.022  31.008  1.00 43.65           O  
ATOM   9346  N   ILE E  74      40.167 173.438  32.047  1.00 31.08           N  
ATOM   9347  CA  ILE E  74      41.624 173.408  32.153  1.00 28.79           C  
ATOM   9348  C   ILE E  74      42.153 172.017  31.848  1.00 28.47           C  
ATOM   9349  O   ILE E  74      43.097 171.864  31.071  1.00 27.27           O  
ATOM   9350  CB  ILE E  74      42.087 173.832  33.571  1.00 30.62           C  
ATOM   9351  CG1 ILE E  74      41.860 175.334  33.763  1.00 27.81           C  
ATOM   9352  CG2 ILE E  74      43.547 173.464  33.784  1.00 29.96           C  
ATOM   9353  CD1 ILE E  74      42.156 175.833  35.158  1.00 25.28           C  
ATOM   9354  N   ALA E  75      41.550 170.998  32.453  1.00 29.29           N  
ATOM   9355  CA  ALA E  75      41.991 169.627  32.198  1.00 31.72           C  
ATOM   9356  C   ALA E  75      41.928 169.350  30.701  1.00 32.17           C  
ATOM   9357  O   ALA E  75      42.855 168.788  30.121  1.00 32.72           O  
ATOM   9358  CB  ALA E  75      41.110 168.634  32.940  1.00 31.28           C  
ATOM   9359  N   GLN E  76      40.823 169.773  30.093  1.00 33.99           N  
ATOM   9360  CA  GLN E  76      40.554 169.593  28.670  1.00 36.54           C  
ATOM   9361  C   GLN E  76      41.655 170.138  27.758  1.00 38.97           C  
ATOM   9362  O   GLN E  76      41.874 169.624  26.661  1.00 37.35           O  
ATOM   9363  CB  GLN E  76      39.221 170.260  28.338  1.00 36.33           C  
ATOM   9364  CG  GLN E  76      38.812 170.214  26.882  1.00 35.42           C  
ATOM   9365  CD  GLN E  76      38.723 168.813  26.360  1.00 37.24           C  
ATOM   9366  OE1 GLN E  76      38.246 167.908  27.046  1.00 38.49           O  
ATOM   9367  NE2 GLN E  76      39.173 168.619  25.132  1.00 40.08           N  
ATOM   9368  N   ASP E  77      42.342 171.180  28.212  1.00 42.00           N  
ATOM   9369  CA  ASP E  77      43.417 171.775  27.435  1.00 44.33           C  
ATOM   9370  C   ASP E  77      44.704 170.954  27.472  1.00 44.96           C  
ATOM   9371  O   ASP E  77      45.679 171.297  26.808  1.00 46.42           O  
ATOM   9372  CB  ASP E  77      43.698 173.189  27.935  1.00 48.00           C  
ATOM   9373  CG  ASP E  77      42.931 174.242  27.163  1.00 54.59           C  
ATOM   9374  OD1 ASP E  77      41.688 174.132  27.050  1.00 56.83           O  
ATOM   9375  OD2 ASP E  77      43.578 175.188  26.664  1.00 59.81           O  
ATOM   9376  N   PHE E  78      44.719 169.872  28.242  1.00 44.88           N  
ATOM   9377  CA  PHE E  78      45.916 169.045  28.318  1.00 45.48           C  
ATOM   9378  C   PHE E  78      45.629 167.628  27.879  1.00 45.12           C  
ATOM   9379  O   PHE E  78      46.542 166.892  27.506  1.00 46.26           O  
ATOM   9380  CB  PHE E  78      46.492 169.049  29.740  1.00 47.91           C  
ATOM   9381  CG  PHE E  78      47.671 168.129  29.922  1.00 50.31           C  
ATOM   9382  CD1 PHE E  78      48.653 168.027  28.941  1.00 52.34           C  
ATOM   9383  CD2 PHE E  78      47.804 167.369  31.078  1.00 51.50           C  
ATOM   9384  CE1 PHE E  78      49.747 167.178  29.110  1.00 53.19           C  
ATOM   9385  CE2 PHE E  78      48.894 166.518  31.256  1.00 51.57           C  
ATOM   9386  CZ  PHE E  78      49.866 166.423  30.271  1.00 52.47           C  
ATOM   9387  N   LYS E  79      44.357 167.247  27.927  1.00 43.62           N  
ATOM   9388  CA  LYS E  79      43.942 165.913  27.514  1.00 42.19           C  
ATOM   9389  C   LYS E  79      42.444 165.908  27.247  1.00 41.58           C  
ATOM   9390  O   LYS E  79      41.641 166.153  28.152  1.00 40.93           O  
ATOM   9391  CB  LYS E  79      44.262 164.882  28.597  1.00 42.88           C  
ATOM   9392  CG  LYS E  79      44.817 163.573  28.065  1.00 46.14           C  
ATOM   9393  CD  LYS E  79      44.021 163.037  26.885  1.00 49.96           C  
ATOM   9394  CE  LYS E  79      44.770 161.907  26.175  1.00 50.92           C  
ATOM   9395  NZ  LYS E  79      44.039 161.394  24.979  1.00 50.62           N  
ATOM   9396  N   THR E  80      42.067 165.639  26.003  1.00 40.98           N  
ATOM   9397  CA  THR E  80      40.658 165.598  25.642  1.00 41.55           C  
ATOM   9398  C   THR E  80      40.073 164.301  26.166  1.00 42.35           C  
ATOM   9399  O   THR E  80      40.801 163.342  26.413  1.00 43.78           O  
ATOM   9400  CB  THR E  80      40.459 165.628  24.120  1.00 40.84           C  
ATOM   9401  OG1 THR E  80      41.241 164.590  23.522  1.00 42.13           O  
ATOM   9402  CG2 THR E  80      40.870 166.964  23.550  1.00 36.48           C  
ATOM   9403  N   ASP E  81      38.759 164.277  26.340  1.00 42.40           N  
ATOM   9404  CA  ASP E  81      38.078 163.085  26.821  1.00 43.38           C  
ATOM   9405  C   ASP E  81      38.637 162.646  28.171  1.00 42.16           C  
ATOM   9406  O   ASP E  81      39.452 161.734  28.246  1.00 43.65           O  
ATOM   9407  CB  ASP E  81      38.220 161.958  25.784  1.00 47.10           C  
ATOM   9408  CG  ASP E  81      37.458 160.694  26.168  1.00 52.55           C  
ATOM   9409  OD1 ASP E  81      37.819 160.056  27.185  1.00 58.06           O  
ATOM   9410  OD2 ASP E  81      36.496 160.335  25.454  1.00 50.38           O  
ATOM   9411  N   LEU E  82      38.206 163.314  29.235  1.00 40.80           N  
ATOM   9412  CA  LEU E  82      38.647 162.982  30.584  1.00 38.09           C  
ATOM   9413  C   LEU E  82      37.500 163.075  31.568  1.00 36.75           C  
ATOM   9414  O   LEU E  82      36.679 163.983  31.490  1.00 36.63           O  
ATOM   9415  CB  LEU E  82      39.762 163.924  31.046  1.00 37.98           C  
ATOM   9416  CG  LEU E  82      41.215 163.581  30.708  1.00 37.01           C  
ATOM   9417  CD1 LEU E  82      42.127 164.727  31.115  1.00 33.18           C  
ATOM   9418  CD2 LEU E  82      41.611 162.309  31.431  1.00 37.41           C  
ATOM   9419  N   ARG E  83      37.448 162.124  32.489  1.00 36.96           N  
ATOM   9420  CA  ARG E  83      36.432 162.100  33.533  1.00 37.89           C  
ATOM   9421  C   ARG E  83      37.112 162.484  34.847  1.00 37.52           C  
ATOM   9422  O   ARG E  83      38.336 162.538  34.917  1.00 36.47           O  
ATOM   9423  CB  ARG E  83      35.837 160.700  33.647  1.00 38.52           C  
ATOM   9424  CG  ARG E  83      34.832 160.385  32.563  1.00 41.76           C  
ATOM   9425  CD  ARG E  83      34.738 158.897  32.295  1.00 44.63           C  
ATOM   9426  NE  ARG E  83      33.504 158.563  31.596  1.00 48.01           N  
ATOM   9427  CZ  ARG E  83      32.319 158.482  32.187  1.00 49.30           C  
ATOM   9428  NH1 ARG E  83      32.213 158.703  33.490  1.00 51.08           N  
ATOM   9429  NH2 ARG E  83      31.238 158.193  31.477  1.00 50.95           N  
ATOM   9430  N   PHE E  84      36.322 162.754  35.881  1.00 37.46           N  
ATOM   9431  CA  PHE E  84      36.864 163.116  37.189  1.00 35.99           C  
ATOM   9432  C   PHE E  84      36.114 162.435  38.321  1.00 36.46           C  
ATOM   9433  O   PHE E  84      34.883 162.439  38.353  1.00 36.75           O  
ATOM   9434  CB  PHE E  84      36.782 164.628  37.427  1.00 36.08           C  
ATOM   9435  CG  PHE E  84      37.925 165.405  36.853  1.00 37.46           C  
ATOM   9436  CD1 PHE E  84      37.997 165.665  35.485  1.00 39.43           C  
ATOM   9437  CD2 PHE E  84      38.933 165.883  37.683  1.00 36.81           C  
ATOM   9438  CE1 PHE E  84      39.066 166.397  34.953  1.00 39.18           C  
ATOM   9439  CE2 PHE E  84      40.001 166.612  37.166  1.00 37.98           C  
ATOM   9440  CZ  PHE E  84      40.070 166.871  35.799  1.00 39.39           C  
ATOM   9441  N   GLN E  85      36.852 161.848  39.255  1.00 36.57           N  
ATOM   9442  CA  GLN E  85      36.209 161.231  40.397  1.00 35.61           C  
ATOM   9443  C   GLN E  85      35.668 162.438  41.140  1.00 35.03           C  
ATOM   9444  O   GLN E  85      36.309 163.486  41.148  1.00 33.76           O  
ATOM   9445  CB  GLN E  85      37.223 160.501  41.271  1.00 36.78           C  
ATOM   9446  CG  GLN E  85      37.965 159.389  40.577  1.00 39.38           C  
ATOM   9447  CD  GLN E  85      38.735 158.527  41.558  1.00 44.22           C  
ATOM   9448  OE1 GLN E  85      39.472 159.036  42.405  1.00 44.19           O  
ATOM   9449  NE2 GLN E  85      38.571 157.211  41.447  1.00 45.90           N  
ATOM   9450  N   SER E  86      34.498 162.316  41.756  1.00 35.34           N  
ATOM   9451  CA  SER E  86      33.944 163.461  42.466  1.00 35.74           C  
ATOM   9452  C   SER E  86      34.912 163.997  43.524  1.00 33.63           C  
ATOM   9453  O   SER E  86      34.987 165.203  43.749  1.00 36.58           O  
ATOM   9454  CB  SER E  86      32.609 163.102  43.121  1.00 38.10           C  
ATOM   9455  OG  SER E  86      32.781 162.109  44.121  1.00 46.79           O  
ATOM   9456  N   SER E  87      35.663 163.117  44.169  1.00 29.65           N  
ATOM   9457  CA  SER E  87      36.579 163.583  45.190  1.00 29.24           C  
ATOM   9458  C   SER E  87      37.812 164.260  44.594  1.00 28.70           C  
ATOM   9459  O   SER E  87      38.485 165.034  45.268  1.00 29.38           O  
ATOM   9460  CB  SER E  87      36.973 162.431  46.140  1.00 27.24           C  
ATOM   9461  OG  SER E  87      37.535 161.334  45.450  1.00 25.27           O  
ATOM   9462  N   ALA E  88      38.111 163.978  43.333  1.00 27.54           N  
ATOM   9463  CA  ALA E  88      39.255 164.619  42.702  1.00 28.03           C  
ATOM   9464  C   ALA E  88      38.978 166.120  42.639  1.00 28.10           C  
ATOM   9465  O   ALA E  88      39.770 166.927  43.114  1.00 29.46           O  
ATOM   9466  CB  ALA E  88      39.480 164.068  41.294  1.00 27.28           C  
ATOM   9467  N   VAL E  89      37.848 166.492  42.051  1.00 27.32           N  
ATOM   9468  CA  VAL E  89      37.498 167.900  41.941  1.00 26.98           C  
ATOM   9469  C   VAL E  89      37.519 168.565  43.311  1.00 28.76           C  
ATOM   9470  O   VAL E  89      38.033 169.674  43.455  1.00 31.09           O  
ATOM   9471  CB  VAL E  89      36.110 168.083  41.280  1.00 24.17           C  
ATOM   9472  CG1 VAL E  89      35.748 169.555  41.201  1.00 22.71           C  
ATOM   9473  CG2 VAL E  89      36.134 167.493  39.879  1.00 21.64           C  
ATOM   9474  N   MET E  90      36.986 167.881  44.320  1.00 29.50           N  
ATOM   9475  CA  MET E  90      36.952 168.427  45.671  1.00 29.70           C  
ATOM   9476  C   MET E  90      38.346 168.578  46.247  1.00 30.08           C  
ATOM   9477  O   MET E  90      38.605 169.500  47.028  1.00 31.21           O  
ATOM   9478  CB  MET E  90      36.105 167.550  46.591  1.00 32.03           C  
ATOM   9479  CG  MET E  90      34.630 167.554  46.244  1.00 36.53           C  
ATOM   9480  SD  MET E  90      34.010 169.230  46.034  1.00 41.89           S  
ATOM   9481  CE  MET E  90      33.793 169.734  47.746  1.00 39.47           C  
ATOM   9482  N   ALA E  91      39.247 167.673  45.877  1.00 28.21           N  
ATOM   9483  CA  ALA E  91      40.623 167.772  46.355  1.00 27.92           C  
ATOM   9484  C   ALA E  91      41.163 169.108  45.831  1.00 26.88           C  
ATOM   9485  O   ALA E  91      41.607 169.961  46.604  1.00 27.78           O  
ATOM   9486  CB  ALA E  91      41.462 166.610  45.829  1.00 24.57           C  
ATOM   9487  N   LEU E  92      41.085 169.295  44.519  1.00 24.92           N  
ATOM   9488  CA  LEU E  92      41.557 170.525  43.899  1.00 25.74           C  
ATOM   9489  C   LEU E  92      40.978 171.779  44.540  1.00 27.31           C  
ATOM   9490  O   LEU E  92      41.680 172.777  44.689  1.00 28.90           O  
ATOM   9491  CB  LEU E  92      41.253 170.517  42.396  1.00 21.36           C  
ATOM   9492  CG  LEU E  92      42.174 169.574  41.624  1.00 20.19           C  
ATOM   9493  CD1 LEU E  92      41.616 169.263  40.267  1.00 24.13           C  
ATOM   9494  CD2 LEU E  92      43.529 170.208  41.501  1.00 22.89           C  
ATOM   9495  N   GLN E  93      39.713 171.745  44.941  1.00 27.73           N  
ATOM   9496  CA  GLN E  93      39.142 172.941  45.550  1.00 27.91           C  
ATOM   9497  C   GLN E  93      39.715 173.200  46.934  1.00 25.06           C  
ATOM   9498  O   GLN E  93      40.016 174.342  47.278  1.00 25.62           O  
ATOM   9499  CB  GLN E  93      37.609 172.871  45.625  1.00 29.21           C  
ATOM   9500  CG  GLN E  93      36.989 174.251  45.599  1.00 27.06           C  
ATOM   9501  CD  GLN E  93      35.488 174.246  45.727  1.00 30.53           C  
ATOM   9502  OE1 GLN E  93      34.788 173.497  45.045  1.00 33.27           O  
ATOM   9503  NE2 GLN E  93      34.977 175.106  46.594  1.00 32.33           N  
ATOM   9504  N   GLU E  94      39.882 172.146  47.723  1.00 24.64           N  
ATOM   9505  CA  GLU E  94      40.438 172.307  49.063  1.00 24.23           C  
ATOM   9506  C   GLU E  94      41.809 172.935  48.932  1.00 22.56           C  
ATOM   9507  O   GLU E  94      42.117 173.929  49.593  1.00 21.27           O  
ATOM   9508  CB  GLU E  94      40.554 170.958  49.769  1.00 27.38           C  
ATOM   9509  CG  GLU E  94      39.223 170.309  50.100  1.00 30.78           C  
ATOM   9510  CD  GLU E  94      38.439 171.087  51.123  1.00 32.62           C  
ATOM   9511  OE1 GLU E  94      39.003 171.402  52.185  1.00 36.18           O  
ATOM   9512  OE2 GLU E  94      37.255 171.375  50.875  1.00 38.13           O  
ATOM   9513  N   ALA E  95      42.629 172.357  48.061  1.00 22.31           N  
ATOM   9514  CA  ALA E  95      43.970 172.881  47.831  1.00 23.65           C  
ATOM   9515  C   ALA E  95      43.931 174.291  47.234  1.00 23.18           C  
ATOM   9516  O   ALA E  95      44.693 175.161  47.651  1.00 24.83           O  
ATOM   9517  CB  ALA E  95      44.764 171.941  46.920  1.00 24.42           C  
ATOM   9518  N   SER E  96      43.042 174.528  46.278  1.00 21.89           N  
ATOM   9519  CA  SER E  96      42.963 175.844  45.646  1.00 22.09           C  
ATOM   9520  C   SER E  96      42.611 176.946  46.643  1.00 23.70           C  
ATOM   9521  O   SER E  96      43.182 178.046  46.626  1.00 23.44           O  
ATOM   9522  CB  SER E  96      41.932 175.832  44.516  1.00 20.91           C  
ATOM   9523  OG  SER E  96      42.324 174.956  43.472  1.00 24.38           O  
ATOM   9524  N   GLU E  97      41.664 176.658  47.519  1.00 24.38           N  
ATOM   9525  CA  GLU E  97      41.263 177.659  48.484  1.00 23.83           C  
ATOM   9526  C   GLU E  97      42.271 177.850  49.604  1.00 21.00           C  
ATOM   9527  O   GLU E  97      42.538 178.976  49.998  1.00 21.04           O  
ATOM   9528  CB  GLU E  97      39.865 177.338  49.020  1.00 25.56           C  
ATOM   9529  CG  GLU E  97      38.797 177.699  48.005  1.00 30.76           C  
ATOM   9530  CD  GLU E  97      37.384 177.527  48.514  1.00 34.65           C  
ATOM   9531  OE1 GLU E  97      37.116 177.892  49.678  1.00 37.67           O  
ATOM   9532  OE2 GLU E  97      36.532 177.046  47.736  1.00 36.60           O  
ATOM   9533  N   ALA E  98      42.856 176.771  50.107  1.00 19.52           N  
ATOM   9534  CA  ALA E  98      43.837 176.933  51.176  1.00 18.04           C  
ATOM   9535  C   ALA E  98      44.975 177.783  50.635  1.00 17.84           C  
ATOM   9536  O   ALA E  98      45.572 178.578  51.358  1.00 20.94           O  
ATOM   9537  CB  ALA E  98      44.367 175.574  51.658  1.00 14.29           C  
ATOM   9538  N   TYR E  99      45.262 177.620  49.352  1.00 17.56           N  
ATOM   9539  CA  TYR E  99      46.322 178.371  48.717  1.00 17.89           C  
ATOM   9540  C   TYR E  99      45.981 179.856  48.592  1.00 19.52           C  
ATOM   9541  O   TYR E  99      46.791 180.706  48.951  1.00 21.37           O  
ATOM   9542  CB  TYR E  99      46.625 177.785  47.340  1.00 17.76           C  
ATOM   9543  CG  TYR E  99      47.444 178.707  46.468  1.00 19.87           C  
ATOM   9544  CD1 TYR E  99      48.814 178.899  46.696  1.00 18.60           C  
ATOM   9545  CD2 TYR E  99      46.846 179.401  45.420  1.00 17.16           C  
ATOM   9546  CE1 TYR E  99      49.554 179.754  45.892  1.00 16.36           C  
ATOM   9547  CE2 TYR E  99      47.570 180.253  44.621  1.00 15.96           C  
ATOM   9548  CZ  TYR E  99      48.915 180.425  44.853  1.00 17.41           C  
ATOM   9549  OH  TYR E  99      49.615 181.259  44.022  1.00 24.11           O  
ATOM   9550  N   LEU E 100      44.793 180.175  48.082  1.00 21.28           N  
ATOM   9551  CA  LEU E 100      44.395 181.579  47.922  1.00 21.31           C  
ATOM   9552  C   LEU E 100      44.303 182.291  49.264  1.00 21.80           C  
ATOM   9553  O   LEU E 100      44.788 183.420  49.415  1.00 22.23           O  
ATOM   9554  CB  LEU E 100      43.060 181.685  47.179  1.00 20.35           C  
ATOM   9555  CG  LEU E 100      43.137 181.226  45.714  1.00 23.36           C  
ATOM   9556  CD1 LEU E 100      41.736 181.166  45.108  1.00 23.46           C  
ATOM   9557  CD2 LEU E 100      44.028 182.176  44.919  1.00 18.27           C  
ATOM   9558  N   VAL E 101      43.697 181.621  50.241  1.00 21.26           N  
ATOM   9559  CA  VAL E 101      43.553 182.179  51.576  1.00 19.79           C  
ATOM   9560  C   VAL E 101      44.925 182.535  52.171  1.00 20.23           C  
ATOM   9561  O   VAL E 101      45.122 183.644  52.675  1.00 20.26           O  
ATOM   9562  CB  VAL E 101      42.798 181.188  52.506  1.00 19.54           C  
ATOM   9563  CG1 VAL E 101      42.856 181.656  53.960  1.00 16.57           C  
ATOM   9564  CG2 VAL E 101      41.355 181.086  52.061  1.00 17.64           C  
ATOM   9565  N   ALA E 102      45.879 181.612  52.099  1.00 19.37           N  
ATOM   9566  CA  ALA E 102      47.212 181.882  52.648  1.00 19.79           C  
ATOM   9567  C   ALA E 102      47.897 183.001  51.854  1.00 19.84           C  
ATOM   9568  O   ALA E 102      48.600 183.844  52.426  1.00 18.92           O  
ATOM   9569  CB  ALA E 102      48.069 180.614  52.629  1.00 15.97           C  
ATOM   9570  N   LEU E 103      47.678 183.014  50.541  1.00 20.03           N  
ATOM   9571  CA  LEU E 103      48.262 184.042  49.689  1.00 19.71           C  
ATOM   9572  C   LEU E 103      47.717 185.411  50.085  1.00 22.07           C  
ATOM   9573  O   LEU E 103      48.472 186.386  50.122  1.00 23.87           O  
ATOM   9574  CB  LEU E 103      47.964 183.757  48.214  1.00 15.57           C  
ATOM   9575  CG  LEU E 103      48.505 184.794  47.230  1.00 14.34           C  
ATOM   9576  CD1 LEU E 103      50.017 184.841  47.302  1.00 14.87           C  
ATOM   9577  CD2 LEU E 103      48.048 184.463  45.830  1.00 13.50           C  
ATOM   9578  N   PHE E 104      46.418 185.494  50.390  1.00 22.61           N  
ATOM   9579  CA  PHE E 104      45.836 186.777  50.804  1.00 21.45           C  
ATOM   9580  C   PHE E 104      46.460 187.218  52.116  1.00 21.89           C  
ATOM   9581  O   PHE E 104      46.644 188.405  52.352  1.00 24.73           O  
ATOM   9582  CB  PHE E 104      44.309 186.689  50.948  1.00 20.12           C  
ATOM   9583  CG  PHE E 104      43.574 186.830  49.642  1.00 19.21           C  
ATOM   9584  CD1 PHE E 104      42.704 185.836  49.204  1.00 16.43           C  
ATOM   9585  CD2 PHE E 104      43.798 187.936  48.824  1.00 22.39           C  
ATOM   9586  CE1 PHE E 104      42.069 185.931  47.962  1.00 21.66           C  
ATOM   9587  CE2 PHE E 104      43.168 188.052  47.571  1.00 25.32           C  
ATOM   9588  CZ  PHE E 104      42.301 187.043  47.137  1.00 23.99           C  
ATOM   9589  N   GLU E 105      46.793 186.264  52.973  1.00 23.13           N  
ATOM   9590  CA  GLU E 105      47.426 186.605  54.240  1.00 25.61           C  
ATOM   9591  C   GLU E 105      48.767 187.288  53.940  1.00 25.85           C  
ATOM   9592  O   GLU E 105      49.108 188.302  54.558  1.00 27.54           O  
ATOM   9593  CB  GLU E 105      47.661 185.345  55.074  1.00 28.79           C  
ATOM   9594  CG  GLU E 105      46.389 184.591  55.463  1.00 33.46           C  
ATOM   9595  CD  GLU E 105      46.685 183.250  56.127  1.00 35.54           C  
ATOM   9596  OE1 GLU E 105      47.828 183.080  56.607  1.00 35.12           O  
ATOM   9597  OE2 GLU E 105      45.780 182.377  56.176  1.00 33.71           O  
ATOM   9598  N   ASP E 106      49.521 186.737  52.985  1.00 23.02           N  
ATOM   9599  CA  ASP E 106      50.813 187.308  52.610  1.00 20.71           C  
ATOM   9600  C   ASP E 106      50.614 188.665  51.936  1.00 22.41           C  
ATOM   9601  O   ASP E 106      51.288 189.651  52.261  1.00 19.20           O  
ATOM   9602  CB  ASP E 106      51.567 186.379  51.652  1.00 15.48           C  
ATOM   9603  CG  ASP E 106      52.022 185.099  52.315  1.00 17.86           C  
ATOM   9604  OD1 ASP E 106      52.174 185.095  53.554  1.00 18.43           O  
ATOM   9605  OD2 ASP E 106      52.247 184.097  51.601  1.00 16.78           O  
ATOM   9606  N   THR E 107      49.691 188.695  50.981  1.00 22.78           N  
ATOM   9607  CA  THR E 107      49.374 189.909  50.252  1.00 23.14           C  
ATOM   9608  C   THR E 107      48.965 191.017  51.233  1.00 22.83           C  
ATOM   9609  O   THR E 107      49.416 192.162  51.119  1.00 22.05           O  
ATOM   9610  CB  THR E 107      48.237 189.630  49.272  1.00 24.31           C  
ATOM   9611  OG1 THR E 107      48.659 188.614  48.358  1.00 26.13           O  
ATOM   9612  CG2 THR E 107      47.841 190.881  48.511  1.00 22.07           C  
ATOM   9613  N   ASN E 108      48.128 190.671  52.205  1.00 21.71           N  
ATOM   9614  CA  ASN E 108      47.671 191.650  53.193  1.00 21.98           C  
ATOM   9615  C   ASN E 108      48.811 192.245  54.013  1.00 20.11           C  
ATOM   9616  O   ASN E 108      48.782 193.436  54.343  1.00 17.98           O  
ATOM   9617  CB  ASN E 108      46.645 191.027  54.138  1.00 21.10           C  
ATOM   9618  CG  ASN E 108      45.975 192.053  55.007  1.00 20.00           C  
ATOM   9619  OD1 ASN E 108      45.466 193.060  54.518  1.00 24.06           O  
ATOM   9620  ND2 ASN E 108      45.968 191.811  56.304  1.00 21.65           N  
ATOM   9621  N   LEU E 109      49.806 191.418  54.342  1.00 17.78           N  
ATOM   9622  CA  LEU E 109      50.960 191.881  55.116  1.00 15.70           C  
ATOM   9623  C   LEU E 109      51.787 192.881  54.315  1.00 16.92           C  
ATOM   9624  O   LEU E 109      52.302 193.856  54.870  1.00 17.72           O  
ATOM   9625  CB  LEU E 109      51.851 190.704  55.539  1.00 11.92           C  
ATOM   9626  CG  LEU E 109      51.422 189.907  56.780  1.00 16.55           C  
ATOM   9627  CD1 LEU E 109      52.313 188.666  56.939  1.00  9.10           C  
ATOM   9628  CD2 LEU E 109      51.508 190.807  58.034  1.00  9.76           C  
ATOM   9629  N   CYS E 110      51.906 192.636  53.012  1.00 15.06           N  
ATOM   9630  CA  CYS E 110      52.673 193.506  52.137  1.00 19.09           C  
ATOM   9631  C   CYS E 110      51.958 194.842  52.020  1.00 22.26           C  
ATOM   9632  O   CYS E 110      52.583 195.906  52.067  1.00 21.71           O  
ATOM   9633  CB  CYS E 110      52.842 192.873  50.750  1.00 20.48           C  
ATOM   9634  SG  CYS E 110      53.887 191.397  50.698  1.00 21.25           S  
ATOM   9635  N   ALA E 111      50.640 194.784  51.870  1.00 23.26           N  
ATOM   9636  CA  ALA E 111      49.856 195.995  51.787  1.00 22.79           C  
ATOM   9637  C   ALA E 111      50.152 196.780  53.057  1.00 24.74           C  
ATOM   9638  O   ALA E 111      50.561 197.938  53.005  1.00 26.18           O  
ATOM   9639  CB  ALA E 111      48.387 195.658  51.715  1.00 22.28           C  
ATOM   9640  N   ILE E 112      49.957 196.130  54.200  1.00 25.95           N  
ATOM   9641  CA  ILE E 112      50.188 196.759  55.491  1.00 25.08           C  
ATOM   9642  C   ILE E 112      51.633 197.239  55.586  1.00 27.23           C  
ATOM   9643  O   ILE E 112      51.914 198.267  56.201  1.00 29.88           O  
ATOM   9644  CB  ILE E 112      49.861 195.765  56.638  1.00 25.67           C  
ATOM   9645  CG1 ILE E 112      48.367 195.445  56.612  1.00 26.06           C  
ATOM   9646  CG2 ILE E 112      50.256 196.346  58.000  1.00 22.02           C  
ATOM   9647  CD1 ILE E 112      47.970 194.287  57.476  1.00 24.02           C  
ATOM   9648  N   HIS E 113      52.553 196.505  54.969  1.00 26.86           N  
ATOM   9649  CA  HIS E 113      53.960 196.895  55.004  1.00 26.62           C  
ATOM   9650  C   HIS E 113      54.152 198.270  54.378  1.00 26.13           C  
ATOM   9651  O   HIS E 113      55.084 198.988  54.715  1.00 26.77           O  
ATOM   9652  CB  HIS E 113      54.829 195.892  54.237  1.00 23.52           C  
ATOM   9653  CG  HIS E 113      56.292 196.221  54.274  1.00 23.01           C  
ATOM   9654  ND1 HIS E 113      57.055 196.090  55.413  1.00 21.31           N  
ATOM   9655  CD2 HIS E 113      57.127 196.693  53.317  1.00 23.72           C  
ATOM   9656  CE1 HIS E 113      58.297 196.461  55.158  1.00 18.32           C  
ATOM   9657  NE2 HIS E 113      58.368 196.832  53.893  1.00 19.06           N  
ATOM   9658  N   ALA E 114      53.259 198.619  53.461  1.00 25.53           N  
ATOM   9659  CA  ALA E 114      53.324 199.883  52.755  1.00 27.47           C  
ATOM   9660  C   ALA E 114      52.378 200.931  53.331  1.00 28.98           C  
ATOM   9661  O   ALA E 114      51.895 201.802  52.606  1.00 28.98           O  
ATOM   9662  CB  ALA E 114      53.021 199.654  51.265  1.00 26.17           C  
ATOM   9663  N   LYS E 115      52.114 200.842  54.632  1.00 31.41           N  
ATOM   9664  CA  LYS E 115      51.235 201.796  55.315  1.00 33.51           C  
ATOM   9665  C   LYS E 115      49.821 201.809  54.732  1.00 31.89           C  
ATOM   9666  O   LYS E 115      49.114 202.797  54.861  1.00 31.76           O  
ATOM   9667  CB  LYS E 115      51.793 203.219  55.202  1.00 36.09           C  
ATOM   9668  CG  LYS E 115      53.288 203.364  55.418  1.00 39.64           C  
ATOM   9669  CD  LYS E 115      53.684 203.285  56.875  1.00 40.88           C  
ATOM   9670  CE  LYS E 115      55.054 203.938  57.079  1.00 42.31           C  
ATOM   9671  NZ  LYS E 115      55.632 203.730  58.439  1.00 43.57           N  
ATOM   9672  N   ARG E 116      49.411 200.729  54.082  1.00 31.43           N  
ATOM   9673  CA  ARG E 116      48.079 200.678  53.500  1.00 29.42           C  
ATOM   9674  C   ARG E 116      47.215 199.644  54.197  1.00 28.53           C  
ATOM   9675  O   ARG E 116      47.702 198.852  54.991  1.00 29.83           O  
ATOM   9676  CB  ARG E 116      48.166 200.385  52.001  1.00 28.87           C  
ATOM   9677  CG  ARG E 116      48.652 201.578  51.203  1.00 30.50           C  
ATOM   9678  CD  ARG E 116      48.581 201.379  49.684  1.00 27.62           C  
ATOM   9679  NE  ARG E 116      49.661 200.543  49.162  1.00 26.25           N  
ATOM   9680  CZ  ARG E 116      49.624 199.212  49.075  1.00 28.38           C  
ATOM   9681  NH1 ARG E 116      48.547 198.537  49.470  1.00 23.83           N  
ATOM   9682  NH2 ARG E 116      50.676 198.551  48.595  1.00 22.71           N  
ATOM   9683  N   VAL E 117      45.924 199.661  53.893  1.00 27.25           N  
ATOM   9684  CA  VAL E 117      44.967 198.745  54.498  1.00 24.97           C  
ATOM   9685  C   VAL E 117      44.193 198.057  53.382  1.00 23.89           C  
ATOM   9686  O   VAL E 117      43.365 197.181  53.627  1.00 23.21           O  
ATOM   9687  CB  VAL E 117      43.988 199.541  55.423  1.00 27.12           C  
ATOM   9688  CG1 VAL E 117      42.858 198.664  55.883  1.00 30.91           C  
ATOM   9689  CG2 VAL E 117      44.750 200.084  56.633  1.00 22.97           C  
ATOM   9690  N   THR E 118      44.490 198.463  52.151  1.00 22.51           N  
ATOM   9691  CA  THR E 118      43.846 197.939  50.950  1.00 22.84           C  
ATOM   9692  C   THR E 118      44.838 197.092  50.152  1.00 24.43           C  
ATOM   9693  O   THR E 118      45.857 197.606  49.699  1.00 25.64           O  
ATOM   9694  CB  THR E 118      43.376 199.106  50.036  1.00 23.28           C  
ATOM   9695  OG1 THR E 118      42.598 200.038  50.798  1.00 27.48           O  
ATOM   9696  CG2 THR E 118      42.544 198.592  48.892  1.00 22.62           C  
ATOM   9697  N   ILE E 119      44.561 195.802  49.976  1.00 24.70           N  
ATOM   9698  CA  ILE E 119      45.473 194.969  49.200  1.00 25.60           C  
ATOM   9699  C   ILE E 119      45.335 195.353  47.727  1.00 27.58           C  
ATOM   9700  O   ILE E 119      44.267 195.774  47.278  1.00 28.29           O  
ATOM   9701  CB  ILE E 119      45.187 193.448  49.373  1.00 23.91           C  
ATOM   9702  CG1 ILE E 119      43.752 193.130  48.953  1.00 23.93           C  
ATOM   9703  CG2 ILE E 119      45.458 193.028  50.812  1.00 23.94           C  
ATOM   9704  CD1 ILE E 119      43.371 191.674  49.059  1.00 20.19           C  
ATOM   9705  N   MET E 120      46.425 195.211  46.982  1.00 28.45           N  
ATOM   9706  CA  MET E 120      46.441 195.559  45.565  1.00 28.00           C  
ATOM   9707  C   MET E 120      47.283 194.566  44.792  1.00 26.89           C  
ATOM   9708  O   MET E 120      48.058 193.817  45.376  1.00 28.39           O  
ATOM   9709  CB  MET E 120      47.026 196.960  45.371  1.00 27.50           C  
ATOM   9710  CG  MET E 120      46.206 198.062  45.992  1.00 29.48           C  
ATOM   9711  SD  MET E 120      46.930 199.689  45.720  1.00 36.26           S  
ATOM   9712  CE  MET E 120      47.364 200.073  47.290  1.00 28.17           C  
ATOM   9713  N   PRO E 121      47.136 194.540  43.463  1.00 26.50           N  
ATOM   9714  CA  PRO E 121      47.927 193.606  42.670  1.00 25.14           C  
ATOM   9715  C   PRO E 121      49.410 193.639  43.021  1.00 24.77           C  
ATOM   9716  O   PRO E 121      50.025 192.592  43.184  1.00 25.99           O  
ATOM   9717  CB  PRO E 121      47.628 194.047  41.254  1.00 24.21           C  
ATOM   9718  CG  PRO E 121      46.166 194.333  41.350  1.00 25.66           C  
ATOM   9719  CD  PRO E 121      46.072 195.141  42.639  1.00 27.62           C  
ATOM   9720  N   LYS E 122      49.980 194.830  43.162  1.00 22.04           N  
ATOM   9721  CA  LYS E 122      51.392 194.932  43.506  1.00 22.19           C  
ATOM   9722  C   LYS E 122      51.694 194.094  44.744  1.00 22.61           C  
ATOM   9723  O   LYS E 122      52.775 193.529  44.854  1.00 22.51           O  
ATOM   9724  CB  LYS E 122      51.802 196.392  43.746  1.00 19.96           C  
ATOM   9725  CG  LYS E 122      50.978 197.107  44.814  1.00 24.99           C  
ATOM   9726  CD  LYS E 122      51.459 198.536  45.077  1.00 23.28           C  
ATOM   9727  CE  LYS E 122      51.472 199.365  43.818  1.00 27.54           C  
ATOM   9728  NZ  LYS E 122      51.823 200.781  44.085  1.00 31.59           N  
ATOM   9729  N   ASP E 123      50.734 194.009  45.667  1.00 23.68           N  
ATOM   9730  CA  ASP E 123      50.906 193.228  46.893  1.00 21.14           C  
ATOM   9731  C   ASP E 123      50.896 191.748  46.564  1.00 21.66           C  
ATOM   9732  O   ASP E 123      51.790 191.004  46.974  1.00 22.69           O  
ATOM   9733  CB  ASP E 123      49.799 193.534  47.909  1.00 20.09           C  
ATOM   9734  CG  ASP E 123      49.849 194.961  48.418  1.00 23.09           C  
ATOM   9735  OD1 ASP E 123      50.967 195.488  48.620  1.00 25.47           O  
ATOM   9736  OD2 ASP E 123      48.771 195.553  48.634  1.00 22.17           O  
ATOM   9737  N   ILE E 124      49.887 191.303  45.832  1.00 20.16           N  
ATOM   9738  CA  ILE E 124      49.857 189.891  45.461  1.00 22.35           C  
ATOM   9739  C   ILE E 124      51.148 189.555  44.694  1.00 20.04           C  
ATOM   9740  O   ILE E 124      51.776 188.531  44.930  1.00 19.75           O  
ATOM   9741  CB  ILE E 124      48.644 189.561  44.556  1.00 21.98           C  
ATOM   9742  CG1 ILE E 124      47.340 189.772  45.333  1.00 23.10           C  
ATOM   9743  CG2 ILE E 124      48.748 188.135  44.057  1.00 17.39           C  
ATOM   9744  CD1 ILE E 124      46.089 189.607  44.489  1.00 22.26           C  
ATOM   9745  N   GLN E 125      51.540 190.442  43.791  1.00 18.31           N  
ATOM   9746  CA  GLN E 125      52.731 190.242  42.995  1.00 20.42           C  
ATOM   9747  C   GLN E 125      53.995 190.173  43.856  1.00 21.24           C  
ATOM   9748  O   GLN E 125      54.862 189.332  43.605  1.00 22.42           O  
ATOM   9749  CB  GLN E 125      52.824 191.346  41.936  1.00 21.88           C  
ATOM   9750  CG  GLN E 125      51.559 191.410  41.063  1.00 26.98           C  
ATOM   9751  CD  GLN E 125      51.511 192.599  40.099  1.00 32.07           C  
ATOM   9752  OE1 GLN E 125      52.134 193.650  40.329  1.00 31.74           O  
ATOM   9753  NE2 GLN E 125      50.742 192.442  39.022  1.00 30.07           N  
ATOM   9754  N   LEU E 126      54.104 191.023  44.878  1.00 17.94           N  
ATOM   9755  CA  LEU E 126      55.279 190.977  45.735  1.00 17.22           C  
ATOM   9756  C   LEU E 126      55.312 189.693  46.565  1.00 19.89           C  
ATOM   9757  O   LEU E 126      56.377 189.116  46.785  1.00 22.76           O  
ATOM   9758  CB  LEU E 126      55.322 192.176  46.664  1.00 16.77           C  
ATOM   9759  CG  LEU E 126      56.447 192.122  47.704  1.00 17.27           C  
ATOM   9760  CD1 LEU E 126      57.834 192.201  47.029  1.00 13.84           C  
ATOM   9761  CD2 LEU E 126      56.239 193.269  48.691  1.00 18.26           C  
ATOM   9762  N   ALA E 127      54.151 189.245  47.027  1.00 20.00           N  
ATOM   9763  CA  ALA E 127      54.075 188.019  47.800  1.00 19.32           C  
ATOM   9764  C   ALA E 127      54.539 186.833  46.958  1.00 21.59           C  
ATOM   9765  O   ALA E 127      55.313 185.986  47.420  1.00 20.31           O  
ATOM   9766  CB  ALA E 127      52.652 187.785  48.279  1.00 16.66           C  
ATOM   9767  N   ARG E 128      54.070 186.755  45.719  1.00 22.81           N  
ATOM   9768  CA  ARG E 128      54.471 185.626  44.888  1.00 25.08           C  
ATOM   9769  C   ARG E 128      55.930 185.711  44.464  1.00 25.12           C  
ATOM   9770  O   ARG E 128      56.584 184.686  44.291  1.00 27.37           O  
ATOM   9771  CB  ARG E 128      53.564 185.498  43.665  1.00 24.54           C  
ATOM   9772  CG  ARG E 128      52.100 185.341  44.027  1.00 26.16           C  
ATOM   9773  CD  ARG E 128      51.404 184.451  43.026  1.00 30.16           C  
ATOM   9774  NE  ARG E 128      51.491 185.016  41.691  1.00 36.36           N  
ATOM   9775  CZ  ARG E 128      51.819 184.333  40.599  1.00 34.53           C  
ATOM   9776  NH1 ARG E 128      52.101 183.040  40.673  1.00 27.85           N  
ATOM   9777  NH2 ARG E 128      51.863 184.956  39.430  1.00 35.28           N  
ATOM   9778  N   ARG E 129      56.450 186.924  44.310  1.00 24.52           N  
ATOM   9779  CA  ARG E 129      57.844 187.086  43.921  1.00 25.82           C  
ATOM   9780  C   ARG E 129      58.730 186.582  45.066  1.00 25.89           C  
ATOM   9781  O   ARG E 129      59.658 185.811  44.848  1.00 24.15           O  
ATOM   9782  CB  ARG E 129      58.139 188.557  43.609  1.00 31.48           C  
ATOM   9783  CG  ARG E 129      59.534 188.833  43.047  1.00 38.18           C  
ATOM   9784  CD  ARG E 129      59.619 190.269  42.511  1.00 43.80           C  
ATOM   9785  NE  ARG E 129      58.577 190.547  41.518  1.00 45.66           N  
ATOM   9786  CZ  ARG E 129      57.867 191.674  41.456  1.00 48.27           C  
ATOM   9787  NH1 ARG E 129      58.077 192.654  42.331  1.00 45.50           N  
ATOM   9788  NH2 ARG E 129      56.921 191.814  40.530  1.00 48.51           N  
ATOM   9789  N   ILE E 130      58.441 186.990  46.295  1.00 25.29           N  
ATOM   9790  CA  ILE E 130      59.255 186.517  47.406  1.00 26.95           C  
ATOM   9791  C   ILE E 130      59.051 185.030  47.678  1.00 28.14           C  
ATOM   9792  O   ILE E 130      59.996 184.330  48.028  1.00 30.54           O  
ATOM   9793  CB  ILE E 130      58.992 187.323  48.690  1.00 27.44           C  
ATOM   9794  CG1 ILE E 130      59.479 188.760  48.489  1.00 23.56           C  
ATOM   9795  CG2 ILE E 130      59.730 186.691  49.872  1.00 24.18           C  
ATOM   9796  CD1 ILE E 130      59.199 189.646  49.651  1.00 27.90           C  
ATOM   9797  N   ARG E 131      57.829 184.541  47.516  1.00 28.88           N  
ATOM   9798  CA  ARG E 131      57.563 183.124  47.726  1.00 30.98           C  
ATOM   9799  C   ARG E 131      58.419 182.274  46.786  1.00 33.85           C  
ATOM   9800  O   ARG E 131      58.689 181.110  47.056  1.00 34.46           O  
ATOM   9801  CB  ARG E 131      56.092 182.806  47.452  1.00 29.53           C  
ATOM   9802  CG  ARG E 131      55.137 183.121  48.587  1.00 27.75           C  
ATOM   9803  CD  ARG E 131      53.705 182.884  48.143  1.00 26.88           C  
ATOM   9804  NE  ARG E 131      52.774 182.888  49.263  1.00 26.16           N  
ATOM   9805  CZ  ARG E 131      51.648 182.186  49.287  1.00 24.87           C  
ATOM   9806  NH1 ARG E 131      51.322 181.438  48.242  1.00 20.61           N  
ATOM   9807  NH2 ARG E 131      50.877 182.192  50.372  1.00 22.09           N  
ATOM   9808  N   GLY E 132      58.845 182.857  45.674  1.00 35.83           N  
ATOM   9809  CA  GLY E 132      59.628 182.097  44.725  1.00 38.03           C  
ATOM   9810  C   GLY E 132      58.679 181.559  43.675  1.00 40.69           C  
ATOM   9811  O   GLY E 132      59.076 180.849  42.766  1.00 43.32           O  
ATOM   9812  N   GLU E 133      57.404 181.897  43.809  1.00 42.90           N  
ATOM   9813  CA  GLU E 133      56.396 181.464  42.854  1.00 43.99           C  
ATOM   9814  C   GLU E 133      56.614 182.163  41.529  1.00 47.18           C  
ATOM   9815  O   GLU E 133      56.212 181.662  40.482  1.00 47.52           O  
ATOM   9816  CB  GLU E 133      54.999 181.805  43.364  1.00 40.50           C  
ATOM   9817  CG  GLU E 133      54.352 180.724  44.194  1.00 38.42           C  
ATOM   9818  CD  GLU E 133      52.997 181.146  44.718  1.00 36.73           C  
ATOM   9819  OE1 GLU E 133      52.220 181.735  43.937  1.00 33.94           O  
ATOM   9820  OE2 GLU E 133      52.709 180.882  45.904  1.00 34.67           O  
ATOM   9821  N   ARG E 134      57.244 183.331  41.586  1.00 51.64           N  
ATOM   9822  CA  ARG E 134      57.511 184.129  40.398  1.00 56.31           C  
ATOM   9823  C   ARG E 134      58.996 184.476  40.334  1.00 58.69           C  
ATOM   9824  O   ARG E 134      59.691 184.465  41.355  1.00 58.47           O  
ATOM   9825  CB  ARG E 134      56.671 185.414  40.443  1.00 58.59           C  
ATOM   9826  CG  ARG E 134      56.938 186.400  39.310  1.00 64.52           C  
ATOM   9827  CD  ARG E 134      56.197 186.045  38.022  1.00 67.77           C  
ATOM   9828  NE  ARG E 134      54.754 186.228  38.152  1.00 72.09           N  
ATOM   9829  CZ  ARG E 134      53.903 186.215  37.129  1.00 74.99           C  
ATOM   9830  NH1 ARG E 134      54.349 186.029  35.892  1.00 77.35           N  
ATOM   9831  NH2 ARG E 134      52.604 186.386  37.342  1.00 75.11           N  
ATOM   9832  N   ALA E 135      59.476 184.782  39.130  1.00 61.04           N  
ATOM   9833  CA  ALA E 135      60.879 185.134  38.921  1.00 62.34           C  
ATOM   9834  C   ALA E 135      61.210 186.468  39.574  1.00 63.40           C  
ATOM   9835  O   ALA E 135      62.207 186.522  40.332  1.00 63.56           O  
ATOM   9836  CB  ALA E 135      61.186 185.198  37.434  1.00 62.84           C  
ATOM   9837  OXT ALA E 135      60.468 187.441  39.310  1.00 64.18           O  
TER    9838      ALA E 135                                                      
ATOM   9839  N   ASN F  25      34.496 180.475  31.925  1.00 41.76           N  
ATOM   9840  CA  ASN F  25      34.372 179.779  33.235  1.00 41.56           C  
ATOM   9841  C   ASN F  25      35.177 180.494  34.311  1.00 41.19           C  
ATOM   9842  O   ASN F  25      34.785 180.524  35.474  1.00 41.55           O  
ATOM   9843  CB  ASN F  25      34.839 178.321  33.113  1.00 40.61           C  
ATOM   9844  CG  ASN F  25      33.829 177.445  32.378  1.00 41.27           C  
ATOM   9845  OD1 ASN F  25      32.666 177.358  32.771  1.00 38.71           O  
ATOM   9846  ND2 ASN F  25      34.275 176.791  31.310  1.00 41.40           N  
ATOM   9847  N   ILE F  26      36.295 181.082  33.909  1.00 40.78           N  
ATOM   9848  CA  ILE F  26      37.156 181.799  34.831  1.00 40.46           C  
ATOM   9849  C   ILE F  26      36.338 182.809  35.639  1.00 40.68           C  
ATOM   9850  O   ILE F  26      36.672 183.118  36.780  1.00 41.85           O  
ATOM   9851  CB  ILE F  26      38.298 182.520  34.056  1.00 40.00           C  
ATOM   9852  CG1 ILE F  26      39.640 182.283  34.757  1.00 39.51           C  
ATOM   9853  CG2 ILE F  26      37.996 183.998  33.908  1.00 42.61           C  
ATOM   9854  CD1 ILE F  26      39.623 182.465  36.253  1.00 39.18           C  
ATOM   9855  N   GLN F  27      35.261 183.316  35.045  1.00 41.10           N  
ATOM   9856  CA  GLN F  27      34.400 184.286  35.718  1.00 40.61           C  
ATOM   9857  C   GLN F  27      33.487 183.608  36.744  1.00 40.73           C  
ATOM   9858  O   GLN F  27      32.813 184.276  37.536  1.00 40.29           O  
ATOM   9859  CB  GLN F  27      33.557 185.044  34.697  1.00 41.27           C  
ATOM   9860  CG  GLN F  27      34.367 185.877  33.717  1.00 43.48           C  
ATOM   9861  CD  GLN F  27      35.294 186.851  34.411  1.00 45.12           C  
ATOM   9862  OE1 GLN F  27      34.892 187.555  35.337  1.00 46.22           O  
ATOM   9863  NE2 GLN F  27      36.544 186.903  33.961  1.00 44.64           N  
ATOM   9864  N   GLY F  28      33.468 182.278  36.726  1.00 39.22           N  
ATOM   9865  CA  GLY F  28      32.657 181.545  37.675  1.00 38.53           C  
ATOM   9866  C   GLY F  28      33.152 181.849  39.071  1.00 39.24           C  
ATOM   9867  O   GLY F  28      32.396 181.790  40.037  1.00 40.33           O  
ATOM   9868  N   ILE F  29      34.439 182.161  39.180  1.00 39.78           N  
ATOM   9869  CA  ILE F  29      35.032 182.511  40.465  1.00 39.63           C  
ATOM   9870  C   ILE F  29      34.688 183.987  40.635  1.00 40.94           C  
ATOM   9871  O   ILE F  29      35.481 184.876  40.325  1.00 42.97           O  
ATOM   9872  CB  ILE F  29      36.557 182.311  40.442  1.00 38.70           C  
ATOM   9873  CG1 ILE F  29      36.885 180.943  39.839  1.00 38.78           C  
ATOM   9874  CG2 ILE F  29      37.118 182.409  41.847  1.00 36.61           C  
ATOM   9875  CD1 ILE F  29      36.168 179.774  40.522  1.00 37.17           C  
ATOM   9876  N   THR F  30      33.475 184.224  41.117  1.00 40.56           N  
ATOM   9877  CA  THR F  30      32.926 185.557  41.304  1.00 40.28           C  
ATOM   9878  C   THR F  30      33.600 186.476  42.315  1.00 41.25           C  
ATOM   9879  O   THR F  30      34.307 186.034  43.216  1.00 42.91           O  
ATOM   9880  CB  THR F  30      31.444 185.450  41.668  1.00 40.90           C  
ATOM   9881  OG1 THR F  30      31.309 184.754  42.916  1.00 42.63           O  
ATOM   9882  CG2 THR F  30      30.696 184.682  40.588  1.00 38.72           C  
ATOM   9883  N   LYS F  31      33.350 187.771  42.146  1.00 41.30           N  
ATOM   9884  CA  LYS F  31      33.886 188.812  43.012  1.00 40.06           C  
ATOM   9885  C   LYS F  31      33.542 188.499  44.469  1.00 39.64           C  
ATOM   9886  O   LYS F  31      34.425 188.448  45.318  1.00 40.61           O  
ATOM   9887  CB  LYS F  31      33.304 190.163  42.575  1.00 42.49           C  
ATOM   9888  CG  LYS F  31      33.670 191.389  43.407  1.00 43.33           C  
ATOM   9889  CD  LYS F  31      32.980 192.608  42.787  1.00 45.76           C  
ATOM   9890  CE  LYS F  31      32.946 193.830  43.702  1.00 50.11           C  
ATOM   9891  NZ  LYS F  31      34.289 194.388  44.001  1.00 52.14           N  
ATOM   9892  N   PRO F  32      32.251 188.289  44.785  1.00 37.92           N  
ATOM   9893  CA  PRO F  32      31.927 187.981  46.183  1.00 36.34           C  
ATOM   9894  C   PRO F  32      32.646 186.729  46.678  1.00 36.00           C  
ATOM   9895  O   PRO F  32      32.981 186.625  47.863  1.00 36.93           O  
ATOM   9896  CB  PRO F  32      30.401 187.820  46.170  1.00 35.36           C  
ATOM   9897  CG  PRO F  32      30.088 187.485  44.736  1.00 36.62           C  
ATOM   9898  CD  PRO F  32      31.028 188.387  43.974  1.00 35.19           C  
ATOM   9899  N   ALA F  33      32.889 185.779  45.779  1.00 33.37           N  
ATOM   9900  CA  ALA F  33      33.588 184.561  46.173  1.00 33.37           C  
ATOM   9901  C   ALA F  33      35.024 184.895  46.559  1.00 32.88           C  
ATOM   9902  O   ALA F  33      35.548 184.378  47.542  1.00 35.15           O  
ATOM   9903  CB  ALA F  33      33.581 183.554  45.033  1.00 32.80           C  
ATOM   9904  N   ILE F  34      35.651 185.765  45.776  1.00 31.58           N  
ATOM   9905  CA  ILE F  34      37.026 186.174  46.014  1.00 31.39           C  
ATOM   9906  C   ILE F  34      37.142 187.012  47.272  1.00 31.36           C  
ATOM   9907  O   ILE F  34      38.197 187.039  47.912  1.00 30.83           O  
ATOM   9908  CB  ILE F  34      37.578 186.972  44.817  1.00 31.95           C  
ATOM   9909  CG1 ILE F  34      37.675 186.057  43.591  1.00 29.49           C  
ATOM   9910  CG2 ILE F  34      38.926 187.577  45.167  1.00 30.71           C  
ATOM   9911  CD1 ILE F  34      38.106 186.769  42.329  1.00 29.18           C  
ATOM   9912  N   ARG F  35      36.055 187.689  47.629  1.00 31.95           N  
ATOM   9913  CA  ARG F  35      36.029 188.522  48.829  1.00 32.20           C  
ATOM   9914  C   ARG F  35      36.072 187.613  50.053  1.00 32.58           C  
ATOM   9915  O   ARG F  35      36.907 187.797  50.936  1.00 32.36           O  
ATOM   9916  CB  ARG F  35      34.759 189.368  48.865  1.00 34.17           C  
ATOM   9917  CG  ARG F  35      34.901 190.659  49.640  1.00 41.21           C  
ATOM   9918  CD  ARG F  35      33.563 191.362  49.864  1.00 45.52           C  
ATOM   9919  NE  ARG F  35      32.819 190.751  50.966  1.00 51.27           N  
ATOM   9920  CZ  ARG F  35      31.963 189.739  50.840  1.00 53.37           C  
ATOM   9921  NH1 ARG F  35      31.711 189.206  49.649  1.00 54.55           N  
ATOM   9922  NH2 ARG F  35      31.370 189.244  51.919  1.00 53.48           N  
ATOM   9923  N   ARG F  36      35.178 186.622  50.093  1.00 32.38           N  
ATOM   9924  CA  ARG F  36      35.126 185.681  51.213  1.00 32.20           C  
ATOM   9925  C   ARG F  36      36.516 185.072  51.437  1.00 31.85           C  
ATOM   9926  O   ARG F  36      37.008 185.022  52.571  1.00 29.68           O  
ATOM   9927  CB  ARG F  36      34.105 184.560  50.942  1.00 31.55           C  
ATOM   9928  CG  ARG F  36      32.682 185.039  50.676  1.00 29.89           C  
ATOM   9929  CD  ARG F  36      31.679 183.880  50.712  1.00 31.24           C  
ATOM   9930  NE  ARG F  36      31.510 183.169  49.441  1.00 29.01           N  
ATOM   9931  CZ  ARG F  36      30.801 183.626  48.408  1.00 29.88           C  
ATOM   9932  NH1 ARG F  36      30.190 184.802  48.479  1.00 28.04           N  
ATOM   9933  NH2 ARG F  36      30.685 182.901  47.300  1.00 28.04           N  
ATOM   9934  N   LEU F  37      37.136 184.610  50.348  1.00 29.77           N  
ATOM   9935  CA  LEU F  37      38.478 184.029  50.402  1.00 27.91           C  
ATOM   9936  C   LEU F  37      39.445 185.018  51.055  1.00 28.08           C  
ATOM   9937  O   LEU F  37      40.163 184.677  51.992  1.00 28.78           O  
ATOM   9938  CB  LEU F  37      38.972 183.695  48.990  1.00 24.14           C  
ATOM   9939  CG  LEU F  37      38.280 182.536  48.277  1.00 22.11           C  
ATOM   9940  CD1 LEU F  37      38.548 182.586  46.783  1.00 19.14           C  
ATOM   9941  CD2 LEU F  37      38.750 181.231  48.883  1.00 20.34           C  
ATOM   9942  N   ALA F  38      39.460 186.250  50.564  1.00 28.08           N  
ATOM   9943  CA  ALA F  38      40.352 187.245  51.128  1.00 28.57           C  
ATOM   9944  C   ALA F  38      40.001 187.549  52.582  1.00 28.67           C  
ATOM   9945  O   ALA F  38      40.866 187.934  53.361  1.00 31.10           O  
ATOM   9946  CB  ALA F  38      40.316 188.512  50.294  1.00 29.20           C  
ATOM   9947  N   ARG F  39      38.737 187.379  52.950  1.00 28.87           N  
ATOM   9948  CA  ARG F  39      38.314 187.637  54.321  1.00 29.55           C  
ATOM   9949  C   ARG F  39      38.922 186.588  55.251  1.00 30.91           C  
ATOM   9950  O   ARG F  39      39.411 186.912  56.340  1.00 32.16           O  
ATOM   9951  CB  ARG F  39      36.783 187.598  54.432  1.00 33.39           C  
ATOM   9952  CG  ARG F  39      36.066 188.776  53.787  1.00 31.20           C  
ATOM   9953  CD  ARG F  39      36.174 190.035  54.620  1.00 30.64           C  
ATOM   9954  NE  ARG F  39      35.408 191.116  54.012  1.00 31.71           N  
ATOM   9955  CZ  ARG F  39      35.937 192.136  53.349  1.00 31.60           C  
ATOM   9956  NH1 ARG F  39      37.249 192.239  53.210  1.00 34.49           N  
ATOM   9957  NH2 ARG F  39      35.148 193.036  52.786  1.00 35.05           N  
ATOM   9958  N   ARG F  40      38.878 185.328  54.833  1.00 28.34           N  
ATOM   9959  CA  ARG F  40      39.452 184.271  55.643  1.00 28.62           C  
ATOM   9960  C   ARG F  40      40.930 184.606  55.821  1.00 29.52           C  
ATOM   9961  O   ARG F  40      41.531 184.351  56.870  1.00 31.17           O  
ATOM   9962  CB  ARG F  40      39.281 182.926  54.944  1.00 27.83           C  
ATOM   9963  CG  ARG F  40      39.741 181.732  55.751  1.00 26.21           C  
ATOM   9964  CD  ARG F  40      39.022 180.478  55.285  1.00 25.55           C  
ATOM   9965  NE  ARG F  40      37.671 180.431  55.825  1.00 26.55           N  
ATOM   9966  CZ  ARG F  40      36.714 179.607  55.412  1.00 30.92           C  
ATOM   9967  NH1 ARG F  40      36.937 178.740  54.432  1.00 28.99           N  
ATOM   9968  NH2 ARG F  40      35.523 179.649  55.991  1.00 33.13           N  
ATOM   9969  N   GLY F  41      41.506 185.200  54.786  1.00 28.41           N  
ATOM   9970  CA  GLY F  41      42.902 185.584  54.840  1.00 28.01           C  
ATOM   9971  C   GLY F  41      43.079 186.786  55.739  1.00 26.54           C  
ATOM   9972  O   GLY F  41      44.200 187.187  56.036  1.00 26.50           O  
ATOM   9973  N   GLY F  42      41.960 187.359  56.169  1.00 26.47           N  
ATOM   9974  CA  GLY F  42      41.994 188.513  57.052  1.00 24.63           C  
ATOM   9975  C   GLY F  42      42.028 189.866  56.368  1.00 24.25           C  
ATOM   9976  O   GLY F  42      42.349 190.868  57.006  1.00 25.70           O  
ATOM   9977  N   VAL F  43      41.702 189.907  55.080  1.00 21.95           N  
ATOM   9978  CA  VAL F  43      41.718 191.162  54.340  1.00 22.68           C  
ATOM   9979  C   VAL F  43      40.488 192.013  54.653  1.00 25.10           C  
ATOM   9980  O   VAL F  43      39.368 191.522  54.629  1.00 24.05           O  
ATOM   9981  CB  VAL F  43      41.790 190.914  52.815  1.00 19.55           C  
ATOM   9982  CG1 VAL F  43      41.741 192.245  52.068  1.00 16.63           C  
ATOM   9983  CG2 VAL F  43      43.070 190.165  52.477  1.00 15.54           C  
ATOM   9984  N   LYS F  44      40.712 193.297  54.927  1.00 27.98           N  
ATOM   9985  CA  LYS F  44      39.632 194.219  55.275  1.00 30.07           C  
ATOM   9986  C   LYS F  44      39.165 195.139  54.160  1.00 30.90           C  
ATOM   9987  O   LYS F  44      37.985 195.467  54.088  1.00 30.98           O  
ATOM   9988  CB  LYS F  44      40.053 195.082  56.462  1.00 30.38           C  
ATOM   9989  CG  LYS F  44      39.109 196.231  56.764  1.00 31.14           C  
ATOM   9990  CD  LYS F  44      39.585 196.972  57.989  1.00 32.86           C  
ATOM   9991  CE  LYS F  44      38.597 198.025  58.442  1.00 32.69           C  
ATOM   9992  NZ  LYS F  44      39.066 198.658  59.714  1.00 31.48           N  
ATOM   9993  N   ARG F  45      40.097 195.565  53.309  1.00 32.30           N  
ATOM   9994  CA  ARG F  45      39.796 196.473  52.204  1.00 31.78           C  
ATOM   9995  C   ARG F  45      40.441 195.919  50.938  1.00 31.93           C  
ATOM   9996  O   ARG F  45      41.620 195.575  50.933  1.00 31.82           O  
ATOM   9997  CB  ARG F  45      40.341 197.865  52.534  1.00 34.25           C  
ATOM   9998  CG  ARG F  45      39.617 199.002  51.849  1.00 36.50           C  
ATOM   9999  CD  ARG F  45      39.927 200.313  52.530  1.00 35.83           C  
ATOM  10000  NE  ARG F  45      39.279 201.442  51.871  1.00 42.23           N  
ATOM  10001  CZ  ARG F  45      39.526 201.837  50.623  1.00 43.83           C  
ATOM  10002  NH1 ARG F  45      40.413 201.196  49.873  1.00 43.47           N  
ATOM  10003  NH2 ARG F  45      38.892 202.890  50.125  1.00 43.12           N  
ATOM  10004  N   ILE F  46      39.666 195.858  49.861  1.00 30.94           N  
ATOM  10005  CA  ILE F  46      40.132 195.283  48.609  1.00 28.88           C  
ATOM  10006  C   ILE F  46      40.047 196.184  47.382  1.00 30.51           C  
ATOM  10007  O   ILE F  46      38.961 196.564  46.952  1.00 30.03           O  
ATOM  10008  CB  ILE F  46      39.328 194.005  48.302  1.00 26.70           C  
ATOM  10009  CG1 ILE F  46      39.485 193.011  49.447  1.00 27.18           C  
ATOM  10010  CG2 ILE F  46      39.763 193.406  46.979  1.00 25.79           C  
ATOM  10011  CD1 ILE F  46      38.586 191.797  49.318  1.00 29.35           C  
ATOM  10012  N   SER F  47      41.198 196.507  46.801  1.00 31.11           N  
ATOM  10013  CA  SER F  47      41.210 197.327  45.602  1.00 29.03           C  
ATOM  10014  C   SER F  47      40.390 196.601  44.541  1.00 29.92           C  
ATOM  10015  O   SER F  47      40.330 195.372  44.531  1.00 29.46           O  
ATOM  10016  CB  SER F  47      42.633 197.518  45.109  1.00 28.61           C  
ATOM  10017  OG  SER F  47      42.636 197.669  43.703  1.00 30.31           O  
ATOM  10018  N   GLY F  48      39.766 197.366  43.649  1.00 30.24           N  
ATOM  10019  CA  GLY F  48      38.936 196.788  42.606  1.00 27.35           C  
ATOM  10020  C   GLY F  48      39.627 195.935  41.560  1.00 28.75           C  
ATOM  10021  O   GLY F  48      38.970 195.169  40.852  1.00 30.02           O  
ATOM  10022  N   LEU F  49      40.942 196.059  41.434  1.00 28.34           N  
ATOM  10023  CA  LEU F  49      41.663 195.259  40.447  1.00 28.76           C  
ATOM  10024  C   LEU F  49      42.122 193.899  40.990  1.00 29.17           C  
ATOM  10025  O   LEU F  49      42.704 193.102  40.257  1.00 30.99           O  
ATOM  10026  CB  LEU F  49      42.866 196.044  39.920  1.00 29.01           C  
ATOM  10027  CG  LEU F  49      42.530 197.118  38.871  1.00 31.77           C  
ATOM  10028  CD1 LEU F  49      43.527 198.276  38.908  1.00 25.90           C  
ATOM  10029  CD2 LEU F  49      42.502 196.463  37.503  1.00 28.79           C  
ATOM  10030  N   ILE F  50      41.859 193.627  42.265  1.00 28.10           N  
ATOM  10031  CA  ILE F  50      42.274 192.360  42.853  1.00 29.29           C  
ATOM  10032  C   ILE F  50      41.573 191.160  42.222  1.00 32.30           C  
ATOM  10033  O   ILE F  50      42.213 190.125  41.984  1.00 35.15           O  
ATOM  10034  CB  ILE F  50      42.022 192.327  44.388  1.00 26.17           C  
ATOM  10035  CG1 ILE F  50      43.102 193.116  45.125  1.00 26.06           C  
ATOM  10036  CG2 ILE F  50      41.984 190.905  44.882  1.00 21.75           C  
ATOM  10037  CD1 ILE F  50      44.507 192.549  44.989  1.00 25.91           C  
ATOM  10038  N   TYR F  51      40.275 191.293  41.942  1.00 30.84           N  
ATOM  10039  CA  TYR F  51      39.501 190.187  41.368  1.00 32.08           C  
ATOM  10040  C   TYR F  51      40.075 189.598  40.091  1.00 33.06           C  
ATOM  10041  O   TYR F  51      40.032 188.386  39.898  1.00 36.20           O  
ATOM  10042  CB  TYR F  51      38.039 190.606  41.146  1.00 29.11           C  
ATOM  10043  CG  TYR F  51      37.473 191.307  42.354  1.00 23.50           C  
ATOM  10044  CD1 TYR F  51      37.274 192.683  42.342  1.00 22.99           C  
ATOM  10045  CD2 TYR F  51      37.285 190.621  43.556  1.00 21.79           C  
ATOM  10046  CE1 TYR F  51      36.921 193.372  43.495  1.00 24.14           C  
ATOM  10047  CE2 TYR F  51      36.926 191.301  44.726  1.00 23.05           C  
ATOM  10048  CZ  TYR F  51      36.753 192.680  44.682  1.00 23.42           C  
ATOM  10049  OH  TYR F  51      36.434 193.379  45.819  1.00 25.49           O  
ATOM  10050  N   GLU F  52      40.609 190.442  39.216  1.00 34.62           N  
ATOM  10051  CA  GLU F  52      41.205 189.954  37.976  1.00 34.32           C  
ATOM  10052  C   GLU F  52      42.562 189.302  38.239  1.00 33.37           C  
ATOM  10053  O   GLU F  52      42.917 188.338  37.573  1.00 32.50           O  
ATOM  10054  CB  GLU F  52      41.359 191.090  36.963  1.00 35.39           C  
ATOM  10055  CG  GLU F  52      40.145 191.275  36.089  1.00 40.49           C  
ATOM  10056  CD  GLU F  52      39.844 190.035  35.287  1.00 44.93           C  
ATOM  10057  OE1 GLU F  52      40.710 189.637  34.480  1.00 48.06           O  
ATOM  10058  OE2 GLU F  52      38.752 189.450  35.468  1.00 46.46           O  
ATOM  10059  N   GLU F  53      43.320 189.830  39.200  1.00 32.25           N  
ATOM  10060  CA  GLU F  53      44.616 189.251  39.542  1.00 32.09           C  
ATOM  10061  C   GLU F  53      44.394 187.855  40.103  1.00 31.00           C  
ATOM  10062  O   GLU F  53      45.031 186.891  39.683  1.00 32.38           O  
ATOM  10063  CB  GLU F  53      45.331 190.076  40.611  1.00 33.95           C  
ATOM  10064  CG  GLU F  53      45.956 191.325  40.114  1.00 37.89           C  
ATOM  10065  CD  GLU F  53      47.104 191.048  39.194  1.00 39.23           C  
ATOM  10066  OE1 GLU F  53      47.080 191.550  38.053  1.00 42.00           O  
ATOM  10067  OE2 GLU F  53      48.029 190.330  39.616  1.00 39.82           O  
ATOM  10068  N   THR F  54      43.488 187.752  41.066  1.00 28.21           N  
ATOM  10069  CA  THR F  54      43.219 186.465  41.673  1.00 29.24           C  
ATOM  10070  C   THR F  54      42.810 185.439  40.621  1.00 28.35           C  
ATOM  10071  O   THR F  54      43.284 184.309  40.658  1.00 31.80           O  
ATOM  10072  CB  THR F  54      42.138 186.583  42.765  1.00 28.71           C  
ATOM  10073  OG1 THR F  54      42.503 187.628  43.671  1.00 28.52           O  
ATOM  10074  CG2 THR F  54      42.022 185.296  43.549  1.00 27.22           C  
ATOM  10075  N   ARG F  55      41.963 185.820  39.670  1.00 25.88           N  
ATOM  10076  CA  ARG F  55      41.550 184.864  38.645  1.00 25.96           C  
ATOM  10077  C   ARG F  55      42.758 184.379  37.857  1.00 25.09           C  
ATOM  10078  O   ARG F  55      42.870 183.192  37.556  1.00 24.80           O  
ATOM  10079  CB  ARG F  55      40.520 185.480  37.687  1.00 28.74           C  
ATOM  10080  CG  ARG F  55      39.252 185.960  38.369  1.00 31.39           C  
ATOM  10081  CD  ARG F  55      38.119 186.191  37.380  1.00 34.10           C  
ATOM  10082  NE  ARG F  55      36.896 186.579  38.077  1.00 34.83           N  
ATOM  10083  CZ  ARG F  55      36.650 187.806  38.514  1.00 34.96           C  
ATOM  10084  NH1 ARG F  55      37.540 188.768  38.307  1.00 39.00           N  
ATOM  10085  NH2 ARG F  55      35.544 188.060  39.199  1.00 31.95           N  
ATOM  10086  N   GLY F  56      43.660 185.301  37.529  1.00 23.13           N  
ATOM  10087  CA  GLY F  56      44.857 184.947  36.785  1.00 22.16           C  
ATOM  10088  C   GLY F  56      45.767 184.036  37.587  1.00 24.27           C  
ATOM  10089  O   GLY F  56      46.343 183.096  37.039  1.00 26.88           O  
ATOM  10090  N   VAL F  57      45.887 184.311  38.886  1.00 22.29           N  
ATOM  10091  CA  VAL F  57      46.709 183.511  39.782  1.00 22.51           C  
ATOM  10092  C   VAL F  57      46.106 182.119  40.041  1.00 24.13           C  
ATOM  10093  O   VAL F  57      46.834 181.132  40.165  1.00 25.61           O  
ATOM  10094  CB  VAL F  57      46.918 184.244  41.131  1.00 23.90           C  
ATOM  10095  CG1 VAL F  57      47.477 183.290  42.157  1.00 21.12           C  
ATOM  10096  CG2 VAL F  57      47.869 185.443  40.947  1.00 20.00           C  
ATOM  10097  N   LEU F  58      44.781 182.031  40.120  1.00 24.20           N  
ATOM  10098  CA  LEU F  58      44.138 180.741  40.349  1.00 23.97           C  
ATOM  10099  C   LEU F  58      44.278 179.864  39.115  1.00 24.68           C  
ATOM  10100  O   LEU F  58      44.516 178.663  39.216  1.00 27.29           O  
ATOM  10101  CB  LEU F  58      42.655 180.921  40.686  1.00 25.63           C  
ATOM  10102  CG  LEU F  58      41.880 179.610  40.849  1.00 26.82           C  
ATOM  10103  CD1 LEU F  58      42.501 178.797  41.978  1.00 27.62           C  
ATOM  10104  CD2 LEU F  58      40.414 179.893  41.139  1.00 27.84           C  
ATOM  10105  N   LYS F  59      44.147 180.467  37.940  1.00 25.28           N  
ATOM  10106  CA  LYS F  59      44.271 179.716  36.702  1.00 26.43           C  
ATOM  10107  C   LYS F  59      45.668 179.074  36.602  1.00 26.91           C  
ATOM  10108  O   LYS F  59      45.786 177.901  36.264  1.00 26.41           O  
ATOM  10109  CB  LYS F  59      44.015 180.639  35.511  1.00 29.35           C  
ATOM  10110  CG  LYS F  59      43.675 179.926  34.216  1.00 32.07           C  
ATOM  10111  CD  LYS F  59      43.421 180.944  33.111  1.00 37.51           C  
ATOM  10112  CE  LYS F  59      43.222 180.286  31.752  1.00 39.46           C  
ATOM  10113  NZ  LYS F  59      42.016 179.405  31.735  1.00 43.67           N  
ATOM  10114  N   VAL F  60      46.721 179.835  36.901  1.00 24.99           N  
ATOM  10115  CA  VAL F  60      48.074 179.287  36.850  1.00 23.35           C  
ATOM  10116  C   VAL F  60      48.232 178.164  37.878  1.00 24.14           C  
ATOM  10117  O   VAL F  60      48.856 177.141  37.601  1.00 23.10           O  
ATOM  10118  CB  VAL F  60      49.150 180.374  37.127  1.00 23.63           C  
ATOM  10119  CG1 VAL F  60      50.482 179.727  37.423  1.00 17.18           C  
ATOM  10120  CG2 VAL F  60      49.281 181.291  35.928  1.00 20.11           C  
ATOM  10121  N   PHE F  61      47.664 178.354  39.065  1.00 24.13           N  
ATOM  10122  CA  PHE F  61      47.755 177.342  40.109  1.00 23.05           C  
ATOM  10123  C   PHE F  61      47.105 176.047  39.614  1.00 23.72           C  
ATOM  10124  O   PHE F  61      47.752 175.003  39.595  1.00 27.67           O  
ATOM  10125  CB  PHE F  61      47.063 177.838  41.381  1.00 22.36           C  
ATOM  10126  CG  PHE F  61      47.073 176.847  42.502  1.00 20.79           C  
ATOM  10127  CD1 PHE F  61      48.132 176.801  43.398  1.00 21.01           C  
ATOM  10128  CD2 PHE F  61      46.040 175.924  42.636  1.00 16.60           C  
ATOM  10129  CE1 PHE F  61      48.162 175.836  44.416  1.00 21.65           C  
ATOM  10130  CE2 PHE F  61      46.059 174.966  43.641  1.00 17.92           C  
ATOM  10131  CZ  PHE F  61      47.123 174.919  44.535  1.00 19.78           C  
ATOM  10132  N   LEU F  62      45.835 176.110  39.211  1.00 22.11           N  
ATOM  10133  CA  LEU F  62      45.126 174.927  38.700  1.00 21.13           C  
ATOM  10134  C   LEU F  62      45.825 174.284  37.506  1.00 21.48           C  
ATOM  10135  O   LEU F  62      45.955 173.061  37.437  1.00 22.97           O  
ATOM  10136  CB  LEU F  62      43.701 175.291  38.293  1.00 20.25           C  
ATOM  10137  CG  LEU F  62      42.722 175.458  39.444  1.00 18.05           C  
ATOM  10138  CD1 LEU F  62      41.430 176.094  38.952  1.00 15.90           C  
ATOM  10139  CD2 LEU F  62      42.482 174.089  40.063  1.00 15.30           C  
ATOM  10140  N   GLU F  63      46.257 175.108  36.559  1.00 21.52           N  
ATOM  10141  CA  GLU F  63      46.966 174.608  35.395  1.00 23.22           C  
ATOM  10142  C   GLU F  63      48.140 173.733  35.830  1.00 23.27           C  
ATOM  10143  O   GLU F  63      48.286 172.622  35.334  1.00 23.51           O  
ATOM  10144  CB  GLU F  63      47.482 175.767  34.530  1.00 26.07           C  
ATOM  10145  CG  GLU F  63      46.393 176.570  33.828  1.00 30.64           C  
ATOM  10146  CD  GLU F  63      46.957 177.661  32.929  1.00 34.23           C  
ATOM  10147  OE1 GLU F  63      47.897 178.358  33.360  1.00 34.81           O  
ATOM  10148  OE2 GLU F  63      46.457 177.828  31.794  1.00 35.85           O  
ATOM  10149  N   ASN F  64      48.966 174.225  36.757  1.00 22.66           N  
ATOM  10150  CA  ASN F  64      50.123 173.466  37.231  1.00 22.62           C  
ATOM  10151  C   ASN F  64      49.743 172.167  37.929  1.00 22.55           C  
ATOM  10152  O   ASN F  64      50.294 171.109  37.631  1.00 22.45           O  
ATOM  10153  CB  ASN F  64      50.980 174.286  38.200  1.00 26.37           C  
ATOM  10154  CG  ASN F  64      51.670 175.451  37.537  1.00 26.50           C  
ATOM  10155  OD1 ASN F  64      52.016 175.399  36.359  1.00 29.93           O  
ATOM  10156  ND2 ASN F  64      51.890 176.509  38.300  1.00 28.65           N  
ATOM  10157  N   VAL F  65      48.822 172.241  38.879  1.00 21.65           N  
ATOM  10158  CA  VAL F  65      48.417 171.033  39.573  1.00 20.14           C  
ATOM  10159  C   VAL F  65      47.763 170.047  38.608  1.00 20.28           C  
ATOM  10160  O   VAL F  65      48.182 168.892  38.522  1.00 21.09           O  
ATOM  10161  CB  VAL F  65      47.442 171.336  40.701  1.00 17.74           C  
ATOM  10162  CG1 VAL F  65      46.976 170.039  41.328  1.00 19.43           C  
ATOM  10163  CG2 VAL F  65      48.116 172.184  41.734  1.00 20.62           C  
ATOM  10164  N   ILE F  66      46.746 170.507  37.878  1.00 19.61           N  
ATOM  10165  CA  ILE F  66      46.035 169.652  36.925  1.00 20.04           C  
ATOM  10166  C   ILE F  66      46.965 169.083  35.862  1.00 19.08           C  
ATOM  10167  O   ILE F  66      46.816 167.935  35.465  1.00 22.06           O  
ATOM  10168  CB  ILE F  66      44.874 170.412  36.261  1.00 19.78           C  
ATOM  10169  CG1 ILE F  66      43.859 170.789  37.343  1.00 18.67           C  
ATOM  10170  CG2 ILE F  66      44.267 169.578  35.123  1.00 10.68           C  
ATOM  10171  CD1 ILE F  66      42.803 171.754  36.885  1.00 24.21           C  
ATOM  10172  N   ARG F  67      47.926 169.875  35.407  1.00 17.85           N  
ATOM  10173  CA  ARG F  67      48.882 169.376  34.434  1.00 19.24           C  
ATOM  10174  C   ARG F  67      49.555 168.119  35.013  1.00 19.45           C  
ATOM  10175  O   ARG F  67      49.546 167.060  34.381  1.00 20.63           O  
ATOM  10176  CB  ARG F  67      49.960 170.426  34.118  1.00 20.02           C  
ATOM  10177  CG  ARG F  67      50.948 169.950  33.052  1.00 25.13           C  
ATOM  10178  CD  ARG F  67      52.189 170.836  32.896  1.00 29.00           C  
ATOM  10179  NE  ARG F  67      51.865 172.160  32.377  1.00 35.53           N  
ATOM  10180  CZ  ARG F  67      51.665 173.231  33.136  1.00 36.98           C  
ATOM  10181  NH1 ARG F  67      51.765 173.138  34.456  1.00 38.09           N  
ATOM  10182  NH2 ARG F  67      51.342 174.388  32.578  1.00 37.99           N  
ATOM  10183  N   ASP F  68      50.136 168.224  36.208  1.00 17.19           N  
ATOM  10184  CA  ASP F  68      50.797 167.059  36.808  1.00 18.52           C  
ATOM  10185  C   ASP F  68      49.815 165.919  37.110  1.00 20.49           C  
ATOM  10186  O   ASP F  68      50.130 164.740  36.894  1.00 17.77           O  
ATOM  10187  CB  ASP F  68      51.534 167.449  38.091  1.00 18.90           C  
ATOM  10188  CG  ASP F  68      52.783 168.266  37.830  1.00 18.28           C  
ATOM  10189  OD1 ASP F  68      53.014 168.698  36.688  1.00 23.86           O  
ATOM  10190  OD2 ASP F  68      53.541 168.495  38.779  1.00 20.55           O  
ATOM  10191  N   ALA F  69      48.623 166.257  37.602  1.00 20.29           N  
ATOM  10192  CA  ALA F  69      47.643 165.222  37.905  1.00 21.66           C  
ATOM  10193  C   ALA F  69      47.314 164.418  36.653  1.00 22.90           C  
ATOM  10194  O   ALA F  69      47.298 163.187  36.699  1.00 23.75           O  
ATOM  10195  CB  ALA F  69      46.373 165.836  38.484  1.00 22.71           C  
ATOM  10196  N   VAL F  70      47.066 165.112  35.538  1.00 22.54           N  
ATOM  10197  CA  VAL F  70      46.725 164.450  34.280  1.00 22.81           C  
ATOM  10198  C   VAL F  70      47.891 163.641  33.721  1.00 24.45           C  
ATOM  10199  O   VAL F  70      47.694 162.714  32.929  1.00 25.41           O  
ATOM  10200  CB  VAL F  70      46.254 165.459  33.210  1.00 23.31           C  
ATOM  10201  CG1 VAL F  70      46.007 164.745  31.878  1.00 23.24           C  
ATOM  10202  CG2 VAL F  70      44.984 166.139  33.675  1.00 22.12           C  
ATOM  10203  N   THR F  71      49.110 163.982  34.126  1.00 23.65           N  
ATOM  10204  CA  THR F  71      50.264 163.230  33.666  1.00 20.91           C  
ATOM  10205  C   THR F  71      50.246 161.869  34.341  1.00 23.35           C  
ATOM  10206  O   THR F  71      50.554 160.859  33.718  1.00 23.93           O  
ATOM  10207  CB  THR F  71      51.530 163.956  33.995  1.00 19.32           C  
ATOM  10208  OG1 THR F  71      51.619 165.101  33.146  1.00 21.21           O  
ATOM  10209  CG2 THR F  71      52.739 163.063  33.804  1.00 17.76           C  
ATOM  10210  N   TYR F  72      49.876 161.846  35.620  1.00 24.58           N  
ATOM  10211  CA  TYR F  72      49.779 160.594  36.352  1.00 23.60           C  
ATOM  10212  C   TYR F  72      48.640 159.768  35.740  1.00 25.46           C  
ATOM  10213  O   TYR F  72      48.794 158.568  35.496  1.00 26.43           O  
ATOM  10214  CB  TYR F  72      49.497 160.848  37.832  1.00 21.27           C  
ATOM  10215  CG  TYR F  72      50.700 161.298  38.625  1.00 20.89           C  
ATOM  10216  CD1 TYR F  72      50.758 162.574  39.188  1.00 19.69           C  
ATOM  10217  CD2 TYR F  72      51.797 160.456  38.792  1.00 21.73           C  
ATOM  10218  CE1 TYR F  72      51.879 162.997  39.888  1.00 18.01           C  
ATOM  10219  CE2 TYR F  72      52.921 160.871  39.491  1.00 18.93           C  
ATOM  10220  CZ  TYR F  72      52.958 162.141  40.033  1.00 19.34           C  
ATOM  10221  OH  TYR F  72      54.085 162.550  40.709  1.00 17.77           O  
ATOM  10222  N   THR F  73      47.508 160.417  35.478  1.00 25.88           N  
ATOM  10223  CA  THR F  73      46.349 159.745  34.893  1.00 26.86           C  
ATOM  10224  C   THR F  73      46.696 159.019  33.594  1.00 28.71           C  
ATOM  10225  O   THR F  73      46.317 157.867  33.389  1.00 27.66           O  
ATOM  10226  CB  THR F  73      45.226 160.735  34.580  1.00 25.42           C  
ATOM  10227  OG1 THR F  73      44.752 161.321  35.793  1.00 24.41           O  
ATOM  10228  CG2 THR F  73      44.076 160.022  33.886  1.00 27.36           C  
ATOM  10229  N   GLU F  74      47.408 159.707  32.712  1.00 31.33           N  
ATOM  10230  CA  GLU F  74      47.796 159.117  31.445  1.00 33.56           C  
ATOM  10231  C   GLU F  74      48.806 157.996  31.677  1.00 32.16           C  
ATOM  10232  O   GLU F  74      48.712 156.936  31.064  1.00 33.95           O  
ATOM  10233  CB  GLU F  74      48.397 160.181  30.523  1.00 37.70           C  
ATOM  10234  CG  GLU F  74      47.446 161.316  30.172  1.00 46.57           C  
ATOM  10235  CD  GLU F  74      46.634 161.047  28.916  1.00 54.69           C  
ATOM  10236  OE1 GLU F  74      47.227 161.082  27.810  1.00 56.34           O  
ATOM  10237  OE2 GLU F  74      45.405 160.797  29.031  1.00 59.27           O  
ATOM  10238  N   HIS F  75      49.768 158.206  32.567  1.00 30.74           N  
ATOM  10239  CA  HIS F  75      50.759 157.161  32.800  1.00 29.60           C  
ATOM  10240  C   HIS F  75      50.121 155.856  33.272  1.00 31.09           C  
ATOM  10241  O   HIS F  75      50.641 154.772  33.005  1.00 30.75           O  
ATOM  10242  CB  HIS F  75      51.816 157.610  33.801  1.00 24.86           C  
ATOM  10243  CG  HIS F  75      52.862 156.574  34.055  1.00 24.97           C  
ATOM  10244  ND1 HIS F  75      52.700 155.563  34.978  1.00 26.47           N  
ATOM  10245  CD2 HIS F  75      54.044 156.336  33.443  1.00 23.26           C  
ATOM  10246  CE1 HIS F  75      53.735 154.745  34.921  1.00 25.98           C  
ATOM  10247  NE2 HIS F  75      54.566 155.192  33.996  1.00 26.68           N  
ATOM  10248  N   ALA F  76      48.998 155.966  33.976  1.00 30.95           N  
ATOM  10249  CA  ALA F  76      48.280 154.797  34.463  1.00 31.40           C  
ATOM  10250  C   ALA F  76      47.316 154.306  33.374  1.00 33.42           C  
ATOM  10251  O   ALA F  76      46.470 153.447  33.623  1.00 34.69           O  
ATOM  10252  CB  ALA F  76      47.504 155.152  35.721  1.00 28.94           C  
ATOM  10253  N   LYS F  77      47.451 154.858  32.174  1.00 32.56           N  
ATOM  10254  CA  LYS F  77      46.590 154.495  31.052  1.00 34.43           C  
ATOM  10255  C   LYS F  77      45.102 154.554  31.401  1.00 35.28           C  
ATOM  10256  O   LYS F  77      44.319 153.705  30.970  1.00 36.39           O  
ATOM  10257  CB  LYS F  77      46.961 153.104  30.531  1.00 32.93           C  
ATOM  10258  CG  LYS F  77      48.335 153.072  29.891  1.00 35.55           C  
ATOM  10259  CD  LYS F  77      48.742 151.697  29.389  1.00 35.87           C  
ATOM  10260  CE  LYS F  77      50.143 151.767  28.783  1.00 38.87           C  
ATOM  10261  NZ  LYS F  77      50.610 150.489  28.162  1.00 39.18           N  
ATOM  10262  N   ARG F  78      44.727 155.563  32.185  1.00 34.99           N  
ATOM  10263  CA  ARG F  78      43.340 155.768  32.596  1.00 34.14           C  
ATOM  10264  C   ARG F  78      42.753 156.992  31.913  1.00 34.89           C  
ATOM  10265  O   ARG F  78      43.475 157.786  31.322  1.00 36.34           O  
ATOM  10266  CB  ARG F  78      43.242 155.956  34.114  1.00 31.11           C  
ATOM  10267  CG  ARG F  78      43.558 154.714  34.904  1.00 28.14           C  
ATOM  10268  CD  ARG F  78      43.201 154.866  36.365  1.00 25.38           C  
ATOM  10269  NE  ARG F  78      44.290 155.401  37.185  1.00 22.25           N  
ATOM  10270  CZ  ARG F  78      44.485 156.690  37.442  1.00 20.33           C  
ATOM  10271  NH1 ARG F  78      43.671 157.603  36.946  1.00 21.77           N  
ATOM  10272  NH2 ARG F  78      45.486 157.065  38.216  1.00 22.19           N  
ATOM  10273  N   LYS F  79      41.437 157.136  31.995  1.00 36.30           N  
ATOM  10274  CA  LYS F  79      40.749 158.272  31.401  1.00 37.27           C  
ATOM  10275  C   LYS F  79      40.031 159.030  32.497  1.00 36.77           C  
ATOM  10276  O   LYS F  79      39.411 160.057  32.250  1.00 36.64           O  
ATOM  10277  CB  LYS F  79      39.721 157.811  30.368  1.00 41.48           C  
ATOM  10278  CG  LYS F  79      40.297 157.410  29.028  1.00 45.53           C  
ATOM  10279  CD  LYS F  79      39.199 157.381  27.970  1.00 48.39           C  
ATOM  10280  CE  LYS F  79      39.793 157.415  26.572  1.00 50.85           C  
ATOM  10281  NZ  LYS F  79      38.747 157.590  25.528  1.00 54.77           N  
ATOM  10282  N   THR F  80      40.104 158.499  33.711  1.00 36.50           N  
ATOM  10283  CA  THR F  80      39.463 159.120  34.860  1.00 36.65           C  
ATOM  10284  C   THR F  80      40.515 159.700  35.802  1.00 34.83           C  
ATOM  10285  O   THR F  80      41.398 158.982  36.261  1.00 34.00           O  
ATOM  10286  CB  THR F  80      38.619 158.098  35.647  1.00 39.64           C  
ATOM  10287  OG1 THR F  80      37.578 157.578  34.805  1.00 41.24           O  
ATOM  10288  CG2 THR F  80      38.002 158.760  36.874  1.00 41.51           C  
ATOM  10289  N   VAL F  81      40.417 161.000  36.074  1.00 32.37           N  
ATOM  10290  CA  VAL F  81      41.344 161.681  36.969  1.00 29.16           C  
ATOM  10291  C   VAL F  81      40.920 161.334  38.385  1.00 29.81           C  
ATOM  10292  O   VAL F  81      39.822 161.692  38.814  1.00 29.92           O  
ATOM  10293  CB  VAL F  81      41.287 163.218  36.780  1.00 28.05           C  
ATOM  10294  CG1 VAL F  81      42.197 163.907  37.786  1.00 27.72           C  
ATOM  10295  CG2 VAL F  81      41.711 163.578  35.383  1.00 26.99           C  
ATOM  10296  N   THR F  82      41.789 160.635  39.109  1.00 30.05           N  
ATOM  10297  CA  THR F  82      41.492 160.220  40.478  1.00 30.06           C  
ATOM  10298  C   THR F  82      41.944 161.230  41.531  1.00 28.20           C  
ATOM  10299  O   THR F  82      42.711 162.143  41.237  1.00 29.46           O  
ATOM  10300  CB  THR F  82      42.166 158.877  40.791  1.00 32.19           C  
ATOM  10301  OG1 THR F  82      43.586 159.062  40.834  1.00 33.01           O  
ATOM  10302  CG2 THR F  82      41.841 157.858  39.713  1.00 33.18           C  
ATOM  10303  N   ALA F  83      41.461 161.058  42.760  1.00 27.59           N  
ATOM  10304  CA  ALA F  83      41.830 161.935  43.871  1.00 25.48           C  
ATOM  10305  C   ALA F  83      43.307 161.725  44.179  1.00 25.93           C  
ATOM  10306  O   ALA F  83      44.023 162.678  44.477  1.00 27.67           O  
ATOM  10307  CB  ALA F  83      40.989 161.624  45.110  1.00 20.46           C  
ATOM  10308  N   MET F  84      43.755 160.473  44.107  1.00 24.15           N  
ATOM  10309  CA  MET F  84      45.153 160.154  44.348  1.00 25.68           C  
ATOM  10310  C   MET F  84      46.028 160.843  43.311  1.00 26.17           C  
ATOM  10311  O   MET F  84      47.110 161.332  43.638  1.00 27.42           O  
ATOM  10312  CB  MET F  84      45.393 158.641  44.302  1.00 24.57           C  
ATOM  10313  CG  MET F  84      44.825 157.900  45.501  1.00 27.04           C  
ATOM  10314  SD  MET F  84      45.259 158.703  47.073  1.00 34.23           S  
ATOM  10315  CE  MET F  84      47.043 158.512  47.090  1.00 26.48           C  
ATOM  10316  N   ASP F  85      45.565 160.873  42.061  1.00 25.89           N  
ATOM  10317  CA  ASP F  85      46.308 161.540  40.997  1.00 25.02           C  
ATOM  10318  C   ASP F  85      46.514 162.996  41.398  1.00 23.59           C  
ATOM  10319  O   ASP F  85      47.588 163.553  41.197  1.00 24.45           O  
ATOM  10320  CB  ASP F  85      45.542 161.510  39.671  1.00 26.59           C  
ATOM  10321  CG  ASP F  85      45.650 160.188  38.952  1.00 27.94           C  
ATOM  10322  OD1 ASP F  85      46.477 159.341  39.360  1.00 28.24           O  
ATOM  10323  OD2 ASP F  85      44.906 160.008  37.961  1.00 28.97           O  
ATOM  10324  N   VAL F  86      45.472 163.609  41.951  1.00 21.64           N  
ATOM  10325  CA  VAL F  86      45.552 164.999  42.384  1.00 21.23           C  
ATOM  10326  C   VAL F  86      46.468 165.160  43.592  1.00 22.31           C  
ATOM  10327  O   VAL F  86      47.267 166.097  43.651  1.00 21.09           O  
ATOM  10328  CB  VAL F  86      44.155 165.553  42.741  1.00 20.07           C  
ATOM  10329  CG1 VAL F  86      44.276 166.932  43.401  1.00 13.15           C  
ATOM  10330  CG2 VAL F  86      43.297 165.643  41.466  1.00 20.57           C  
ATOM  10331  N   VAL F  87      46.353 164.234  44.543  1.00 23.16           N  
ATOM  10332  CA  VAL F  87      47.152 164.256  45.761  1.00 21.97           C  
ATOM  10333  C   VAL F  87      48.628 164.049  45.462  1.00 24.44           C  
ATOM  10334  O   VAL F  87      49.489 164.635  46.119  1.00 26.56           O  
ATOM  10335  CB  VAL F  87      46.660 163.182  46.762  1.00 20.53           C  
ATOM  10336  CG1 VAL F  87      47.628 163.044  47.929  1.00 16.95           C  
ATOM  10337  CG2 VAL F  87      45.274 163.564  47.270  1.00 18.19           C  
ATOM  10338  N   TYR F  88      48.932 163.222  44.474  1.00 23.87           N  
ATOM  10339  CA  TYR F  88      50.325 163.003  44.127  1.00 25.24           C  
ATOM  10340  C   TYR F  88      50.864 164.264  43.466  1.00 26.81           C  
ATOM  10341  O   TYR F  88      52.015 164.650  43.693  1.00 30.08           O  
ATOM  10342  CB  TYR F  88      50.471 161.808  43.184  1.00 25.37           C  
ATOM  10343  CG  TYR F  88      50.224 160.479  43.848  1.00 28.16           C  
ATOM  10344  CD1 TYR F  88      49.646 159.427  43.146  1.00 32.00           C  
ATOM  10345  CD2 TYR F  88      50.572 160.266  45.181  1.00 30.60           C  
ATOM  10346  CE1 TYR F  88      49.414 158.196  43.751  1.00 32.88           C  
ATOM  10347  CE2 TYR F  88      50.347 159.038  45.797  1.00 31.67           C  
ATOM  10348  CZ  TYR F  88      49.766 158.010  45.073  1.00 34.13           C  
ATOM  10349  OH  TYR F  88      49.524 156.796  45.671  1.00 37.90           O  
ATOM  10350  N   ALA F  89      50.028 164.912  42.658  1.00 23.70           N  
ATOM  10351  CA  ALA F  89      50.439 166.131  41.981  1.00 24.00           C  
ATOM  10352  C   ALA F  89      50.653 167.236  43.019  1.00 23.95           C  
ATOM  10353  O   ALA F  89      51.624 167.996  42.940  1.00 24.42           O  
ATOM  10354  CB  ALA F  89      49.381 166.555  40.945  1.00 21.77           C  
ATOM  10355  N   LEU F  90      49.750 167.320  43.993  1.00 23.92           N  
ATOM  10356  CA  LEU F  90      49.872 168.328  45.045  1.00 23.72           C  
ATOM  10357  C   LEU F  90      51.094 168.062  45.921  1.00 25.11           C  
ATOM  10358  O   LEU F  90      51.624 168.978  46.527  1.00 26.60           O  
ATOM  10359  CB  LEU F  90      48.609 168.366  45.910  1.00 20.21           C  
ATOM  10360  CG  LEU F  90      47.406 169.069  45.274  1.00 17.77           C  
ATOM  10361  CD1 LEU F  90      46.159 168.781  46.093  1.00 16.92           C  
ATOM  10362  CD2 LEU F  90      47.662 170.577  45.199  1.00 17.00           C  
ATOM  10363  N   LYS F  91      51.542 166.810  45.986  1.00 26.11           N  
ATOM  10364  CA  LYS F  91      52.717 166.477  46.779  1.00 27.59           C  
ATOM  10365  C   LYS F  91      53.977 166.876  45.995  1.00 29.63           C  
ATOM  10366  O   LYS F  91      54.981 167.290  46.584  1.00 30.42           O  
ATOM  10367  CB  LYS F  91      52.738 164.987  47.092  1.00 30.08           C  
ATOM  10368  CG  LYS F  91      53.649 164.610  48.244  1.00 30.86           C  
ATOM  10369  CD  LYS F  91      53.526 163.137  48.542  1.00 34.05           C  
ATOM  10370  CE  LYS F  91      53.964 162.818  49.957  1.00 38.85           C  
ATOM  10371  NZ  LYS F  91      53.579 161.429  50.350  1.00 39.76           N  
ATOM  10372  N   ARG F  92      53.918 166.749  44.670  1.00 29.24           N  
ATOM  10373  CA  ARG F  92      55.037 167.147  43.803  1.00 30.44           C  
ATOM  10374  C   ARG F  92      55.264 168.664  43.851  1.00 29.52           C  
ATOM  10375  O   ARG F  92      56.394 169.122  43.774  1.00 31.52           O  
ATOM  10376  CB  ARG F  92      54.776 166.786  42.334  1.00 28.94           C  
ATOM  10377  CG  ARG F  92      55.195 165.423  41.913  1.00 27.29           C  
ATOM  10378  CD  ARG F  92      55.369 165.370  40.396  1.00 27.93           C  
ATOM  10379  NE  ARG F  92      56.643 165.966  40.011  1.00 29.03           N  
ATOM  10380  CZ  ARG F  92      56.820 167.239  39.682  1.00 28.24           C  
ATOM  10381  NH1 ARG F  92      55.799 168.088  39.664  1.00 28.97           N  
ATOM  10382  NH2 ARG F  92      58.040 167.671  39.415  1.00 30.44           N  
ATOM  10383  N   GLN F  93      54.186 169.437  43.936  1.00 27.73           N  
ATOM  10384  CA  GLN F  93      54.299 170.893  43.967  1.00 27.11           C  
ATOM  10385  C   GLN F  93      54.597 171.382  45.382  1.00 22.64           C  
ATOM  10386  O   GLN F  93      54.566 172.570  45.644  1.00 20.15           O  
ATOM  10387  CB  GLN F  93      52.993 171.558  43.495  1.00 31.09           C  
ATOM  10388  CG  GLN F  93      52.391 171.045  42.184  1.00 34.08           C  
ATOM  10389  CD  GLN F  93      53.147 171.504  40.951  1.00 37.84           C  
ATOM  10390  OE1 GLN F  93      53.509 172.674  40.821  1.00 35.85           O  
ATOM  10391  NE2 GLN F  93      53.375 170.581  40.028  1.00 41.76           N  
ATOM  10392  N   GLY F  94      54.861 170.466  46.301  1.00 21.65           N  
ATOM  10393  CA  GLY F  94      55.146 170.885  47.659  1.00 19.70           C  
ATOM  10394  C   GLY F  94      53.911 171.388  48.372  1.00 20.98           C  
ATOM  10395  O   GLY F  94      53.987 172.285  49.212  1.00 22.18           O  
ATOM  10396  N   ARG F  95      52.759 170.823  48.033  1.00 19.75           N  
ATOM  10397  CA  ARG F  95      51.525 171.228  48.674  1.00 20.91           C  
ATOM  10398  C   ARG F  95      50.705 170.046  49.161  1.00 21.48           C  
ATOM  10399  O   ARG F  95      49.495 169.987  48.941  1.00 23.88           O  
ATOM  10400  CB  ARG F  95      50.711 172.105  47.730  1.00 24.81           C  
ATOM  10401  CG  ARG F  95      51.433 173.397  47.431  1.00 29.87           C  
ATOM  10402  CD  ARG F  95      50.526 174.489  46.920  1.00 32.57           C  
ATOM  10403  NE  ARG F  95      50.905 175.759  47.530  1.00 37.46           N  
ATOM  10404  CZ  ARG F  95      50.428 176.209  48.689  1.00 37.99           C  
ATOM  10405  NH1 ARG F  95      49.534 175.501  49.365  1.00 36.69           N  
ATOM  10406  NH2 ARG F  95      50.870 177.357  49.188  1.00 40.40           N  
ATOM  10407  N   THR F  96      51.390 169.118  49.827  1.00 19.42           N  
ATOM  10408  CA  THR F  96      50.796 167.910  50.390  1.00 20.62           C  
ATOM  10409  C   THR F  96      49.442 168.193  51.007  1.00 20.60           C  
ATOM  10410  O   THR F  96      49.320 169.085  51.846  1.00 20.26           O  
ATOM  10411  CB  THR F  96      51.698 167.306  51.496  1.00 19.78           C  
ATOM  10412  OG1 THR F  96      52.892 166.782  50.906  1.00 25.30           O  
ATOM  10413  CG2 THR F  96      50.985 166.192  52.216  1.00 15.72           C  
ATOM  10414  N   LEU F  97      48.439 167.420  50.598  1.00 19.67           N  
ATOM  10415  CA  LEU F  97      47.075 167.579  51.104  1.00 22.10           C  
ATOM  10416  C   LEU F  97      46.612 166.344  51.875  1.00 21.02           C  
ATOM  10417  O   LEU F  97      46.775 165.227  51.407  1.00 20.39           O  
ATOM  10418  CB  LEU F  97      46.111 167.842  49.941  1.00 22.93           C  
ATOM  10419  CG  LEU F  97      44.609 167.780  50.252  1.00 24.41           C  
ATOM  10420  CD1 LEU F  97      44.196 169.007  51.029  1.00 24.36           C  
ATOM  10421  CD2 LEU F  97      43.819 167.696  48.960  1.00 22.36           C  
ATOM  10422  N   TYR F  98      46.037 166.561  53.053  1.00 21.42           N  
ATOM  10423  CA  TYR F  98      45.534 165.483  53.899  1.00 22.42           C  
ATOM  10424  C   TYR F  98      44.010 165.391  53.775  1.00 25.75           C  
ATOM  10425  O   TYR F  98      43.318 166.425  53.745  1.00 24.86           O  
ATOM  10426  CB  TYR F  98      45.838 165.754  55.376  1.00 22.72           C  
ATOM  10427  CG  TYR F  98      47.247 165.478  55.873  1.00 21.81           C  
ATOM  10428  CD1 TYR F  98      48.224 164.901  55.057  1.00 19.08           C  
ATOM  10429  CD2 TYR F  98      47.591 165.798  57.183  1.00 16.41           C  
ATOM  10430  CE1 TYR F  98      49.514 164.661  55.551  1.00 19.68           C  
ATOM  10431  CE2 TYR F  98      48.856 165.560  57.681  1.00 17.48           C  
ATOM  10432  CZ  TYR F  98      49.816 165.000  56.873  1.00 20.36           C  
ATOM  10433  OH  TYR F  98      51.074 164.817  57.401  1.00 17.13           O  
ATOM  10434  N   GLY F  99      43.491 164.163  53.717  1.00 26.17           N  
ATOM  10435  CA  GLY F  99      42.055 163.974  53.645  1.00 25.87           C  
ATOM  10436  C   GLY F  99      41.486 163.197  52.472  1.00 28.49           C  
ATOM  10437  O   GLY F  99      40.303 162.846  52.488  1.00 30.01           O  
ATOM  10438  N   PHE F 100      42.295 162.911  51.457  1.00 28.14           N  
ATOM  10439  CA  PHE F 100      41.773 162.195  50.299  1.00 26.06           C  
ATOM  10440  C   PHE F 100      42.543 160.969  49.855  1.00 28.15           C  
ATOM  10441  O   PHE F 100      42.399 160.556  48.706  1.00 30.33           O  
ATOM  10442  CB  PHE F 100      41.646 163.144  49.099  1.00 22.61           C  
ATOM  10443  CG  PHE F 100      40.793 164.357  49.366  1.00 19.28           C  
ATOM  10444  CD1 PHE F 100      41.315 165.458  50.038  1.00 16.63           C  
ATOM  10445  CD2 PHE F 100      39.457 164.384  48.966  1.00 16.54           C  
ATOM  10446  CE1 PHE F 100      40.513 166.574  50.313  1.00 16.95           C  
ATOM  10447  CE2 PHE F 100      38.646 165.483  49.231  1.00 15.57           C  
ATOM  10448  CZ  PHE F 100      39.171 166.585  49.908  1.00 18.63           C  
ATOM  10449  N   GLY F 101      43.353 160.380  50.733  1.00 29.26           N  
ATOM  10450  CA  GLY F 101      44.112 159.201  50.337  1.00 31.68           C  
ATOM  10451  C   GLY F 101      45.617 159.248  50.551  1.00 34.92           C  
ATOM  10452  O   GLY F 101      46.345 158.324  50.167  1.00 34.04           O  
ATOM  10453  N   GLY F 102      46.098 160.328  51.158  1.00 39.53           N  
ATOM  10454  CA  GLY F 102      47.521 160.449  51.436  1.00 42.88           C  
ATOM  10455  C   GLY F 102      48.181 159.104  51.740  1.00 44.00           C  
ATOM  10456  O   GLY F 102      49.293 158.856  51.227  1.00 44.58           O  
ATOM  10457  OXT GLY F 102      47.598 158.297  52.502  1.00 43.18           O  
TER   10458      GLY F 102                                                      
ATOM  10459  N   ALA G  14      78.581 146.548  17.497  1.00 51.18           N  
ATOM  10460  CA  ALA G  14      78.804 147.517  18.610  1.00 50.17           C  
ATOM  10461  C   ALA G  14      78.750 146.791  19.946  1.00 50.03           C  
ATOM  10462  O   ALA G  14      77.776 146.104  20.259  1.00 51.94           O  
ATOM  10463  CB  ALA G  14      77.745 148.628  18.565  1.00 50.34           C  
ATOM  10464  N   LYS G  15      79.800 146.948  20.737  1.00 48.83           N  
ATOM  10465  CA  LYS G  15      79.874 146.290  22.030  1.00 46.85           C  
ATOM  10466  C   LYS G  15      79.092 147.019  23.128  1.00 43.21           C  
ATOM  10467  O   LYS G  15      78.063 146.527  23.587  1.00 43.09           O  
ATOM  10468  CB  LYS G  15      81.340 146.131  22.441  1.00 49.95           C  
ATOM  10469  CG  LYS G  15      82.199 145.429  21.404  1.00 51.51           C  
ATOM  10470  CD  LYS G  15      81.688 144.024  21.152  1.00 58.87           C  
ATOM  10471  CE  LYS G  15      82.431 143.341  20.012  1.00 58.49           C  
ATOM  10472  NZ  LYS G  15      81.776 142.053  19.649  1.00 62.46           N  
ATOM  10473  N   THR G  16      79.572 148.185  23.553  1.00 39.31           N  
ATOM  10474  CA  THR G  16      78.891 148.931  24.612  1.00 36.18           C  
ATOM  10475  C   THR G  16      77.460 149.337  24.257  1.00 34.08           C  
ATOM  10476  O   THR G  16      77.151 149.668  23.110  1.00 32.31           O  
ATOM  10477  CB  THR G  16      79.629 150.223  24.979  1.00 35.68           C  
ATOM  10478  OG1 THR G  16      79.427 151.189  23.938  1.00 39.22           O  
ATOM  10479  CG2 THR G  16      81.106 149.969  25.177  1.00 31.27           C  
ATOM  10480  N   ARG G  17      76.594 149.316  25.262  1.00 32.38           N  
ATOM  10481  CA  ARG G  17      75.204 149.706  25.085  1.00 32.37           C  
ATOM  10482  C   ARG G  17      75.089 151.174  24.690  1.00 32.85           C  
ATOM  10483  O   ARG G  17      74.156 151.563  23.983  1.00 34.55           O  
ATOM  10484  CB  ARG G  17      74.421 149.447  26.367  1.00 31.37           C  
ATOM  10485  CG  ARG G  17      74.247 147.985  26.639  1.00 27.38           C  
ATOM  10486  CD  ARG G  17      73.269 147.754  27.742  1.00 28.57           C  
ATOM  10487  NE  ARG G  17      73.905 147.769  29.050  1.00 29.15           N  
ATOM  10488  CZ  ARG G  17      73.226 147.783  30.189  1.00 26.55           C  
ATOM  10489  NH1 ARG G  17      71.900 147.791  30.160  1.00 23.63           N  
ATOM  10490  NH2 ARG G  17      73.868 147.774  31.345  1.00 24.29           N  
ATOM  10491  N   SER G  18      76.030 151.994  25.149  1.00 31.57           N  
ATOM  10492  CA  SER G  18      76.009 153.402  24.783  1.00 31.99           C  
ATOM  10493  C   SER G  18      76.239 153.459  23.265  1.00 31.66           C  
ATOM  10494  O   SER G  18      75.507 154.128  22.531  1.00 30.12           O  
ATOM  10495  CB  SER G  18      77.109 154.172  25.531  1.00 30.20           C  
ATOM  10496  OG  SER G  18      76.848 154.205  26.925  1.00 24.39           O  
ATOM  10497  N   SER G  19      77.253 152.735  22.805  1.00 32.42           N  
ATOM  10498  CA  SER G  19      77.570 152.678  21.379  1.00 34.51           C  
ATOM  10499  C   SER G  19      76.305 152.382  20.576  1.00 34.71           C  
ATOM  10500  O   SER G  19      76.025 153.041  19.578  1.00 32.41           O  
ATOM  10501  CB  SER G  19      78.608 151.586  21.123  1.00 35.49           C  
ATOM  10502  OG  SER G  19      78.797 151.388  19.736  1.00 40.33           O  
ATOM  10503  N   ARG G  20      75.547 151.385  21.035  1.00 36.95           N  
ATOM  10504  CA  ARG G  20      74.296 150.975  20.397  1.00 38.57           C  
ATOM  10505  C   ARG G  20      73.244 152.072  20.403  1.00 39.14           C  
ATOM  10506  O   ARG G  20      72.474 152.211  19.458  1.00 41.32           O  
ATOM  10507  CB  ARG G  20      73.686 149.776  21.113  1.00 40.82           C  
ATOM  10508  CG  ARG G  20      74.418 148.465  20.981  1.00 43.63           C  
ATOM  10509  CD  ARG G  20      73.550 147.356  21.565  1.00 45.16           C  
ATOM  10510  NE  ARG G  20      74.132 146.045  21.318  1.00 51.08           N  
ATOM  10511  CZ  ARG G  20      75.237 145.604  21.903  1.00 52.05           C  
ATOM  10512  NH1 ARG G  20      75.873 146.375  22.777  1.00 51.48           N  
ATOM  10513  NH2 ARG G  20      75.712 144.402  21.601  1.00 52.13           N  
ATOM  10514  N   ALA G  21      73.193 152.833  21.488  1.00 38.20           N  
ATOM  10515  CA  ALA G  21      72.203 153.888  21.612  1.00 35.86           C  
ATOM  10516  C   ALA G  21      72.637 155.158  20.904  1.00 34.32           C  
ATOM  10517  O   ALA G  21      71.840 156.079  20.735  1.00 33.65           O  
ATOM  10518  CB  ALA G  21      71.938 154.166  23.085  1.00 38.06           C  
ATOM  10519  N   GLY G  22      73.896 155.194  20.471  1.00 32.96           N  
ATOM  10520  CA  GLY G  22      74.413 156.378  19.805  1.00 29.78           C  
ATOM  10521  C   GLY G  22      74.562 157.459  20.856  1.00 27.76           C  
ATOM  10522  O   GLY G  22      74.212 158.613  20.629  1.00 28.32           O  
ATOM  10523  N   LEU G  23      75.096 157.069  22.011  1.00 25.35           N  
ATOM  10524  CA  LEU G  23      75.257 157.969  23.139  1.00 23.48           C  
ATOM  10525  C   LEU G  23      76.670 158.110  23.692  1.00 24.09           C  
ATOM  10526  O   LEU G  23      77.461 157.173  23.655  1.00 25.18           O  
ATOM  10527  CB  LEU G  23      74.345 157.501  24.276  1.00 21.88           C  
ATOM  10528  CG  LEU G  23      72.826 157.468  24.079  1.00 20.89           C  
ATOM  10529  CD1 LEU G  23      72.199 156.884  25.332  1.00 21.31           C  
ATOM  10530  CD2 LEU G  23      72.274 158.873  23.825  1.00 16.73           C  
ATOM  10531  N   GLN G  24      76.967 159.291  24.231  1.00 26.12           N  
ATOM  10532  CA  GLN G  24      78.257 159.571  24.857  1.00 26.02           C  
ATOM  10533  C   GLN G  24      78.198 159.125  26.325  1.00 27.76           C  
ATOM  10534  O   GLN G  24      79.148 158.528  26.844  1.00 28.96           O  
ATOM  10535  CB  GLN G  24      78.566 161.060  24.806  1.00 28.76           C  
ATOM  10536  CG  GLN G  24      78.690 161.638  23.414  1.00 31.02           C  
ATOM  10537  CD  GLN G  24      79.677 160.863  22.569  1.00 34.27           C  
ATOM  10538  OE1 GLN G  24      80.767 160.503  23.031  1.00 29.10           O  
ATOM  10539  NE2 GLN G  24      79.302 160.601  21.321  1.00 34.26           N  
ATOM  10540  N   PHE G  25      77.082 159.407  26.996  1.00 27.72           N  
ATOM  10541  CA  PHE G  25      76.943 159.019  28.398  1.00 28.35           C  
ATOM  10542  C   PHE G  25      76.901 157.510  28.548  1.00 28.41           C  
ATOM  10543  O   PHE G  25      76.347 156.820  27.706  1.00 29.70           O  
ATOM  10544  CB  PHE G  25      75.712 159.683  29.034  1.00 26.51           C  
ATOM  10545  CG  PHE G  25      76.024 161.000  29.693  1.00 20.93           C  
ATOM  10546  CD1 PHE G  25      76.699 161.993  28.998  1.00 16.68           C  
ATOM  10547  CD2 PHE G  25      75.658 161.243  31.013  1.00 21.37           C  
ATOM  10548  CE1 PHE G  25      77.006 163.202  29.602  1.00 16.22           C  
ATOM  10549  CE2 PHE G  25      75.965 162.462  31.631  1.00 14.97           C  
ATOM  10550  CZ  PHE G  25      76.636 163.436  30.924  1.00 15.32           C  
ATOM  10551  N   PRO G  26      77.483 156.985  29.642  1.00 29.67           N  
ATOM  10552  CA  PRO G  26      77.577 155.557  29.974  1.00 30.02           C  
ATOM  10553  C   PRO G  26      76.303 154.844  30.389  1.00 30.62           C  
ATOM  10554  O   PRO G  26      75.915 154.877  31.557  1.00 32.93           O  
ATOM  10555  CB  PRO G  26      78.639 155.541  31.071  1.00 29.33           C  
ATOM  10556  CG  PRO G  26      78.323 156.782  31.825  1.00 30.38           C  
ATOM  10557  CD  PRO G  26      78.026 157.807  30.743  1.00 30.29           C  
ATOM  10558  N   VAL G  27      75.667 154.176  29.432  1.00 29.64           N  
ATOM  10559  CA  VAL G  27      74.437 153.453  29.708  1.00 28.07           C  
ATOM  10560  C   VAL G  27      74.664 152.401  30.780  1.00 31.11           C  
ATOM  10561  O   VAL G  27      73.818 152.196  31.657  1.00 33.72           O  
ATOM  10562  CB  VAL G  27      73.905 152.774  28.443  1.00 26.82           C  
ATOM  10563  CG1 VAL G  27      72.660 151.966  28.767  1.00 25.63           C  
ATOM  10564  CG2 VAL G  27      73.611 153.827  27.379  1.00 25.61           C  
ATOM  10565  N   GLY G  28      75.819 151.748  30.719  1.00 30.25           N  
ATOM  10566  CA  GLY G  28      76.131 150.715  31.684  1.00 28.82           C  
ATOM  10567  C   GLY G  28      76.189 151.195  33.117  1.00 28.56           C  
ATOM  10568  O   GLY G  28      75.695 150.509  34.012  1.00 28.40           O  
ATOM  10569  N   ARG G  29      76.791 152.363  33.342  1.00 28.78           N  
ATOM  10570  CA  ARG G  29      76.911 152.921  34.692  1.00 26.64           C  
ATOM  10571  C   ARG G  29      75.554 153.373  35.223  1.00 26.34           C  
ATOM  10572  O   ARG G  29      75.250 153.193  36.401  1.00 26.46           O  
ATOM  10573  CB  ARG G  29      77.893 154.100  34.700  1.00 26.89           C  
ATOM  10574  CG  ARG G  29      78.155 154.710  36.090  1.00 28.73           C  
ATOM  10575  CD  ARG G  29      79.221 155.821  36.059  1.00 28.19           C  
ATOM  10576  NE  ARG G  29      80.555 155.335  35.698  1.00 28.41           N  
ATOM  10577  CZ  ARG G  29      81.648 156.099  35.631  1.00 30.84           C  
ATOM  10578  NH1 ARG G  29      81.585 157.401  35.897  1.00 28.59           N  
ATOM  10579  NH2 ARG G  29      82.817 155.560  35.305  1.00 27.73           N  
ATOM  10580  N   VAL G  30      74.728 153.938  34.347  1.00 26.94           N  
ATOM  10581  CA  VAL G  30      73.409 154.421  34.756  1.00 27.62           C  
ATOM  10582  C   VAL G  30      72.480 153.269  35.149  1.00 28.60           C  
ATOM  10583  O   VAL G  30      71.672 153.398  36.067  1.00 29.29           O  
ATOM  10584  CB  VAL G  30      72.750 155.274  33.629  1.00 25.75           C  
ATOM  10585  CG1 VAL G  30      71.334 155.651  34.012  1.00 24.72           C  
ATOM  10586  CG2 VAL G  30      73.566 156.538  33.392  1.00 26.25           C  
ATOM  10587  N   HIS G  31      72.594 152.149  34.448  1.00 29.56           N  
ATOM  10588  CA  HIS G  31      71.770 150.984  34.729  1.00 30.78           C  
ATOM  10589  C   HIS G  31      72.152 150.460  36.103  1.00 31.87           C  
ATOM  10590  O   HIS G  31      71.310 150.078  36.913  1.00 32.60           O  
ATOM  10591  CB  HIS G  31      72.032 149.901  33.693  1.00 32.11           C  
ATOM  10592  CG  HIS G  31      71.031 148.791  33.714  1.00 34.96           C  
ATOM  10593  ND1 HIS G  31      70.404 148.377  34.869  1.00 35.19           N  
ATOM  10594  CD2 HIS G  31      70.564 147.994  32.724  1.00 33.66           C  
ATOM  10595  CE1 HIS G  31      69.591 147.374  34.588  1.00 36.54           C  
ATOM  10596  NE2 HIS G  31      69.670 147.122  33.294  1.00 35.81           N  
ATOM  10597  N   ARG G  32      73.445 150.451  36.361  1.00 31.89           N  
ATOM  10598  CA  ARG G  32      73.941 149.972  37.628  1.00 32.50           C  
ATOM  10599  C   ARG G  32      73.549 150.912  38.760  1.00 33.13           C  
ATOM  10600  O   ARG G  32      73.204 150.461  39.853  1.00 33.46           O  
ATOM  10601  CB  ARG G  32      75.453 149.841  37.550  1.00 31.59           C  
ATOM  10602  CG  ARG G  32      76.124 149.606  38.869  1.00 28.75           C  
ATOM  10603  CD  ARG G  32      77.568 149.936  38.696  1.00 27.25           C  
ATOM  10604  NE  ARG G  32      77.945 151.043  39.549  1.00 26.48           N  
ATOM  10605  CZ  ARG G  32      78.907 151.902  39.264  1.00 25.00           C  
ATOM  10606  NH1 ARG G  32      79.581 151.789  38.135  1.00 25.11           N  
ATOM  10607  NH2 ARG G  32      79.217 152.848  40.130  1.00 26.75           N  
ATOM  10608  N   LEU G  33      73.621 152.218  38.505  1.00 32.97           N  
ATOM  10609  CA  LEU G  33      73.259 153.202  39.514  1.00 31.51           C  
ATOM  10610  C   LEU G  33      71.773 153.100  39.857  1.00 32.93           C  
ATOM  10611  O   LEU G  33      71.390 153.265  41.011  1.00 35.29           O  
ATOM  10612  CB  LEU G  33      73.615 154.610  39.033  1.00 28.19           C  
ATOM  10613  CG  LEU G  33      75.099 154.960  39.179  1.00 25.97           C  
ATOM  10614  CD1 LEU G  33      75.414 156.334  38.567  1.00 16.03           C  
ATOM  10615  CD2 LEU G  33      75.457 154.928  40.654  1.00 18.88           C  
ATOM  10616  N   LEU G  34      70.936 152.817  38.865  1.00 33.71           N  
ATOM  10617  CA  LEU G  34      69.504 152.669  39.116  1.00 35.99           C  
ATOM  10618  C   LEU G  34      69.252 151.420  39.969  1.00 39.51           C  
ATOM  10619  O   LEU G  34      68.360 151.405  40.817  1.00 40.81           O  
ATOM  10620  CB  LEU G  34      68.732 152.541  37.796  1.00 32.98           C  
ATOM  10621  CG  LEU G  34      68.415 153.793  36.969  1.00 32.18           C  
ATOM  10622  CD1 LEU G  34      67.742 153.386  35.667  1.00 29.68           C  
ATOM  10623  CD2 LEU G  34      67.504 154.730  37.759  1.00 27.30           C  
ATOM  10624  N   ARG G  35      70.041 150.373  39.734  1.00 41.70           N  
ATOM  10625  CA  ARG G  35      69.910 149.117  40.470  1.00 42.97           C  
ATOM  10626  C   ARG G  35      70.414 149.218  41.910  1.00 43.20           C  
ATOM  10627  O   ARG G  35      69.844 148.618  42.819  1.00 44.14           O  
ATOM  10628  CB  ARG G  35      70.659 147.991  39.740  1.00 43.00           C  
ATOM  10629  CG  ARG G  35      70.063 147.638  38.381  1.00 47.47           C  
ATOM  10630  CD  ARG G  35      70.621 146.330  37.791  1.00 51.77           C  
ATOM  10631  NE  ARG G  35      71.667 146.545  36.794  1.00 54.31           N  
ATOM  10632  CZ  ARG G  35      72.971 146.475  37.044  1.00 57.14           C  
ATOM  10633  NH1 ARG G  35      73.403 146.186  38.268  1.00 57.73           N  
ATOM  10634  NH2 ARG G  35      73.848 146.708  36.073  1.00 56.71           N  
ATOM  10635  N   LYS G  36      71.470 149.994  42.116  1.00 43.79           N  
ATOM  10636  CA  LYS G  36      72.062 150.156  43.437  1.00 43.26           C  
ATOM  10637  C   LYS G  36      71.490 151.349  44.181  1.00 41.55           C  
ATOM  10638  O   LYS G  36      72.081 151.829  45.147  1.00 42.89           O  
ATOM  10639  CB  LYS G  36      73.577 150.324  43.305  1.00 46.57           C  
ATOM  10640  CG  LYS G  36      74.301 149.104  42.737  1.00 51.52           C  
ATOM  10641  CD  LYS G  36      74.383 147.970  43.753  1.00 54.07           C  
ATOM  10642  CE  LYS G  36      75.304 146.859  43.264  1.00 56.06           C  
ATOM  10643  NZ  LYS G  36      75.517 145.799  44.295  1.00 56.77           N  
ATOM  10644  N   GLY G  37      70.344 151.834  43.723  1.00 39.09           N  
ATOM  10645  CA  GLY G  37      69.724 152.975  44.367  1.00 33.55           C  
ATOM  10646  C   GLY G  37      68.386 152.629  44.982  1.00 31.71           C  
ATOM  10647  O   GLY G  37      67.718 153.498  45.530  1.00 30.29           O  
ATOM  10648  N   ASN G  38      67.992 151.360  44.882  1.00 32.50           N  
ATOM  10649  CA  ASN G  38      66.726 150.892  45.444  1.00 32.20           C  
ATOM  10650  C   ASN G  38      65.524 151.716  44.995  1.00 32.06           C  
ATOM  10651  O   ASN G  38      64.777 152.226  45.820  1.00 33.32           O  
ATOM  10652  CB  ASN G  38      66.789 150.926  46.970  1.00 35.58           C  
ATOM  10653  CG  ASN G  38      67.710 149.875  47.538  1.00 36.99           C  
ATOM  10654  OD1 ASN G  38      67.407 148.680  47.493  1.00 36.42           O  
ATOM  10655  ND2 ASN G  38      68.848 150.312  48.073  1.00 34.33           N  
ATOM  10656  N   TYR G  39      65.334 151.856  43.693  1.00 32.00           N  
ATOM  10657  CA  TYR G  39      64.204 152.623  43.195  1.00 29.48           C  
ATOM  10658  C   TYR G  39      63.089 151.649  42.848  1.00 29.41           C  
ATOM  10659  O   TYR G  39      61.909 152.001  42.846  1.00 28.28           O  
ATOM  10660  CB  TYR G  39      64.615 153.421  41.957  1.00 28.88           C  
ATOM  10661  CG  TYR G  39      65.737 154.403  42.208  1.00 26.26           C  
ATOM  10662  CD1 TYR G  39      67.053 154.075  41.909  1.00 24.62           C  
ATOM  10663  CD2 TYR G  39      65.480 155.658  42.758  1.00 25.08           C  
ATOM  10664  CE1 TYR G  39      68.091 154.967  42.150  1.00 24.37           C  
ATOM  10665  CE2 TYR G  39      66.512 156.556  43.006  1.00 26.54           C  
ATOM  10666  CZ  TYR G  39      67.818 156.202  42.703  1.00 27.25           C  
ATOM  10667  OH  TYR G  39      68.855 157.070  42.994  1.00 31.03           O  
ATOM  10668  N   ALA G  40      63.482 150.413  42.569  1.00 28.51           N  
ATOM  10669  CA  ALA G  40      62.542 149.364  42.219  1.00 31.99           C  
ATOM  10670  C   ALA G  40      63.308 148.062  42.238  1.00 34.29           C  
ATOM  10671  O   ALA G  40      64.534 148.058  42.153  1.00 36.56           O  
ATOM  10672  CB  ALA G  40      61.966 149.609  40.827  1.00 32.38           C  
ATOM  10673  N   GLU G  41      62.599 146.951  42.347  1.00 35.89           N  
ATOM  10674  CA  GLU G  41      63.279 145.669  42.368  1.00 39.37           C  
ATOM  10675  C   GLU G  41      63.857 145.340  41.001  1.00 38.24           C  
ATOM  10676  O   GLU G  41      64.877 144.676  40.902  1.00 41.26           O  
ATOM  10677  CB  GLU G  41      62.321 144.561  42.812  1.00 42.83           C  
ATOM  10678  CG  GLU G  41      61.761 144.777  44.210  1.00 51.95           C  
ATOM  10679  CD  GLU G  41      61.619 143.483  44.994  1.00 56.99           C  
ATOM  10680  OE1 GLU G  41      60.890 142.570  44.530  1.00 57.05           O  
ATOM  10681  OE2 GLU G  41      62.245 143.387  46.077  1.00 58.35           O  
ATOM  10682  N   ARG G  42      63.215 145.820  39.946  1.00 37.38           N  
ATOM  10683  CA  ARG G  42      63.687 145.532  38.600  1.00 36.87           C  
ATOM  10684  C   ARG G  42      63.809 146.797  37.747  1.00 34.85           C  
ATOM  10685  O   ARG G  42      63.016 147.736  37.880  1.00 33.15           O  
ATOM  10686  CB  ARG G  42      62.731 144.526  37.934  1.00 40.08           C  
ATOM  10687  CG  ARG G  42      62.395 143.342  38.838  1.00 40.82           C  
ATOM  10688  CD  ARG G  42      61.172 142.566  38.381  1.00 45.37           C  
ATOM  10689  NE  ARG G  42      61.480 141.512  37.417  1.00 48.93           N  
ATOM  10690  CZ  ARG G  42      61.314 141.618  36.102  1.00 52.77           C  
ATOM  10691  NH1 ARG G  42      60.835 142.740  35.569  1.00 50.99           N  
ATOM  10692  NH2 ARG G  42      61.628 140.593  35.315  1.00 54.85           N  
ATOM  10693  N   VAL G  43      64.812 146.803  36.872  1.00 33.08           N  
ATOM  10694  CA  VAL G  43      65.069 147.925  35.978  1.00 30.54           C  
ATOM  10695  C   VAL G  43      65.097 147.443  34.537  1.00 30.35           C  
ATOM  10696  O   VAL G  43      65.962 146.658  34.160  1.00 33.20           O  
ATOM  10697  CB  VAL G  43      66.419 148.586  36.299  1.00 27.87           C  
ATOM  10698  CG1 VAL G  43      66.676 149.749  35.349  1.00 24.76           C  
ATOM  10699  CG2 VAL G  43      66.427 149.054  37.737  1.00 27.15           C  
ATOM  10700  N   GLY G  44      64.154 147.916  33.735  1.00 30.02           N  
ATOM  10701  CA  GLY G  44      64.090 147.516  32.338  1.00 29.50           C  
ATOM  10702  C   GLY G  44      65.325 147.824  31.508  1.00 29.94           C  
ATOM  10703  O   GLY G  44      66.145 148.666  31.878  1.00 29.57           O  
ATOM  10704  N   ALA G  45      65.446 147.151  30.367  1.00 29.07           N  
ATOM  10705  CA  ALA G  45      66.598 147.331  29.480  1.00 27.75           C  
ATOM  10706  C   ALA G  45      66.725 148.749  28.898  1.00 25.97           C  
ATOM  10707  O   ALA G  45      67.832 149.259  28.720  1.00 24.13           O  
ATOM  10708  CB  ALA G  45      66.548 146.293  28.349  1.00 23.99           C  
ATOM  10709  N   GLY G  46      65.591 149.378  28.615  1.00 24.80           N  
ATOM  10710  CA  GLY G  46      65.600 150.724  28.058  1.00 25.67           C  
ATOM  10711  C   GLY G  46      65.630 151.865  29.074  1.00 25.72           C  
ATOM  10712  O   GLY G  46      65.902 153.005  28.694  1.00 26.04           O  
ATOM  10713  N   ALA G  47      65.380 151.579  30.353  1.00 22.76           N  
ATOM  10714  CA  ALA G  47      65.393 152.633  31.375  1.00 22.12           C  
ATOM  10715  C   ALA G  47      66.718 153.411  31.416  1.00 20.81           C  
ATOM  10716  O   ALA G  47      66.709 154.636  31.378  1.00 22.34           O  
ATOM  10717  CB  ALA G  47      65.060 152.052  32.764  1.00 19.81           C  
ATOM  10718  N   PRO G  48      67.867 152.717  31.499  1.00 19.14           N  
ATOM  10719  CA  PRO G  48      69.134 153.454  31.530  1.00 18.29           C  
ATOM  10720  C   PRO G  48      69.549 154.077  30.199  1.00 19.90           C  
ATOM  10721  O   PRO G  48      70.399 154.968  30.172  1.00 22.31           O  
ATOM  10722  CB  PRO G  48      70.138 152.417  32.033  1.00 19.25           C  
ATOM  10723  CG  PRO G  48      69.537 151.114  31.601  1.00 18.11           C  
ATOM  10724  CD  PRO G  48      68.073 151.308  31.877  1.00 17.34           C  
ATOM  10725  N   VAL G  49      68.976 153.621  29.088  1.00 20.95           N  
ATOM  10726  CA  VAL G  49      69.321 154.228  27.802  1.00 19.02           C  
ATOM  10727  C   VAL G  49      68.608 155.585  27.778  1.00 20.37           C  
ATOM  10728  O   VAL G  49      69.209 156.630  27.493  1.00 21.93           O  
ATOM  10729  CB  VAL G  49      68.847 153.366  26.592  1.00 19.76           C  
ATOM  10730  CG1 VAL G  49      69.138 154.096  25.288  1.00 16.56           C  
ATOM  10731  CG2 VAL G  49      69.559 151.989  26.590  1.00 14.35           C  
ATOM  10732  N   TYR G  50      67.328 155.569  28.114  1.00 19.11           N  
ATOM  10733  CA  TYR G  50      66.530 156.791  28.132  1.00 19.38           C  
ATOM  10734  C   TYR G  50      67.105 157.791  29.144  1.00 21.03           C  
ATOM  10735  O   TYR G  50      67.314 158.966  28.832  1.00 22.39           O  
ATOM  10736  CB  TYR G  50      65.090 156.445  28.492  1.00 17.22           C  
ATOM  10737  CG  TYR G  50      64.066 157.450  28.052  1.00 15.19           C  
ATOM  10738  CD1 TYR G  50      63.086 157.106  27.120  1.00 18.49           C  
ATOM  10739  CD2 TYR G  50      64.030 158.725  28.600  1.00 18.77           C  
ATOM  10740  CE1 TYR G  50      62.089 158.005  26.748  1.00 18.52           C  
ATOM  10741  CE2 TYR G  50      63.036 159.642  28.233  1.00 20.25           C  
ATOM  10742  CZ  TYR G  50      62.069 159.270  27.308  1.00 21.67           C  
ATOM  10743  OH  TYR G  50      61.079 160.156  26.952  1.00 24.30           O  
ATOM  10744  N   LEU G  51      67.376 157.322  30.355  1.00 19.61           N  
ATOM  10745  CA  LEU G  51      67.925 158.194  31.375  1.00 16.66           C  
ATOM  10746  C   LEU G  51      69.304 158.737  30.980  1.00 17.72           C  
ATOM  10747  O   LEU G  51      69.601 159.908  31.224  1.00 17.12           O  
ATOM  10748  CB  LEU G  51      67.985 157.454  32.708  1.00 14.87           C  
ATOM  10749  CG  LEU G  51      68.467 158.222  33.940  1.00 15.00           C  
ATOM  10750  CD1 LEU G  51      67.845 159.608  34.003  1.00 11.61           C  
ATOM  10751  CD2 LEU G  51      68.120 157.405  35.171  1.00 12.52           C  
ATOM  10752  N   ALA G  52      70.142 157.910  30.358  1.00 18.69           N  
ATOM  10753  CA  ALA G  52      71.468 158.378  29.938  1.00 17.81           C  
ATOM  10754  C   ALA G  52      71.340 159.391  28.803  1.00 21.08           C  
ATOM  10755  O   ALA G  52      72.144 160.311  28.688  1.00 23.12           O  
ATOM  10756  CB  ALA G  52      72.323 157.215  29.495  1.00 18.22           C  
ATOM  10757  N   ALA G  53      70.326 159.222  27.962  1.00 22.89           N  
ATOM  10758  CA  ALA G  53      70.104 160.140  26.859  1.00 22.59           C  
ATOM  10759  C   ALA G  53      69.614 161.482  27.394  1.00 22.67           C  
ATOM  10760  O   ALA G  53      69.993 162.550  26.881  1.00 23.12           O  
ATOM  10761  CB  ALA G  53      69.083 159.558  25.883  1.00 24.34           C  
ATOM  10762  N   VAL G  54      68.770 161.431  28.421  1.00 20.59           N  
ATOM  10763  CA  VAL G  54      68.249 162.659  29.007  1.00 18.87           C  
ATOM  10764  C   VAL G  54      69.346 163.412  29.759  1.00 19.17           C  
ATOM  10765  O   VAL G  54      69.442 164.629  29.656  1.00 20.50           O  
ATOM  10766  CB  VAL G  54      67.081 162.377  29.957  1.00 17.77           C  
ATOM  10767  CG1 VAL G  54      66.613 163.681  30.610  1.00 16.81           C  
ATOM  10768  CG2 VAL G  54      65.931 161.723  29.179  1.00 18.49           C  
ATOM  10769  N   LEU G  55      70.176 162.697  30.513  1.00 18.97           N  
ATOM  10770  CA  LEU G  55      71.261 163.346  31.238  1.00 18.36           C  
ATOM  10771  C   LEU G  55      72.275 163.925  30.249  1.00 18.40           C  
ATOM  10772  O   LEU G  55      72.823 164.991  30.481  1.00 17.73           O  
ATOM  10773  CB  LEU G  55      71.972 162.361  32.174  1.00 16.67           C  
ATOM  10774  CG  LEU G  55      71.199 161.705  33.325  1.00 15.25           C  
ATOM  10775  CD1 LEU G  55      72.163 160.747  34.013  1.00 16.59           C  
ATOM  10776  CD2 LEU G  55      70.655 162.724  34.324  1.00  7.05           C  
ATOM  10777  N   GLU G  56      72.518 163.225  29.145  1.00 19.40           N  
ATOM  10778  CA  GLU G  56      73.474 163.702  28.146  1.00 19.64           C  
ATOM  10779  C   GLU G  56      72.949 164.973  27.513  1.00 19.59           C  
ATOM  10780  O   GLU G  56      73.694 165.925  27.262  1.00 21.63           O  
ATOM  10781  CB  GLU G  56      73.687 162.664  27.045  1.00 20.54           C  
ATOM  10782  CG  GLU G  56      74.808 163.026  26.071  1.00 20.98           C  
ATOM  10783  CD  GLU G  56      75.035 161.963  25.013  1.00 24.67           C  
ATOM  10784  OE1 GLU G  56      75.113 160.761  25.367  1.00 26.39           O  
ATOM  10785  OE2 GLU G  56      75.146 162.327  23.824  1.00 22.80           O  
ATOM  10786  N   TYR G  57      71.652 164.977  27.250  1.00 19.59           N  
ATOM  10787  CA  TYR G  57      71.011 166.123  26.648  1.00 17.25           C  
ATOM  10788  C   TYR G  57      71.098 167.344  27.549  1.00 16.29           C  
ATOM  10789  O   TYR G  57      71.452 168.429  27.096  1.00 17.03           O  
ATOM  10790  CB  TYR G  57      69.555 165.797  26.352  1.00 17.90           C  
ATOM  10791  CG  TYR G  57      68.691 167.008  26.140  1.00 21.32           C  
ATOM  10792  CD1 TYR G  57      68.898 167.859  25.057  1.00 24.32           C  
ATOM  10793  CD2 TYR G  57      67.666 167.306  27.022  1.00 23.52           C  
ATOM  10794  CE1 TYR G  57      68.104 168.966  24.862  1.00 24.62           C  
ATOM  10795  CE2 TYR G  57      66.868 168.413  26.838  1.00 26.31           C  
ATOM  10796  CZ  TYR G  57      67.092 169.236  25.759  1.00 25.44           C  
ATOM  10797  OH  TYR G  57      66.295 170.330  25.583  1.00 31.44           O  
ATOM  10798  N   LEU G  58      70.793 167.177  28.828  1.00 15.20           N  
ATOM  10799  CA  LEU G  58      70.831 168.324  29.725  1.00 15.55           C  
ATOM  10800  C   LEU G  58      72.212 168.950  29.905  1.00 14.37           C  
ATOM  10801  O   LEU G  58      72.333 170.171  29.995  1.00 13.28           O  
ATOM  10802  CB  LEU G  58      70.205 167.963  31.071  1.00 15.13           C  
ATOM  10803  CG  LEU G  58      68.691 167.815  30.898  1.00 12.19           C  
ATOM  10804  CD1 LEU G  58      68.035 167.274  32.177  1.00  8.51           C  
ATOM  10805  CD2 LEU G  58      68.129 169.183  30.530  1.00  7.85           C  
ATOM  10806  N   THR G  59      73.258 168.138  29.931  1.00 13.28           N  
ATOM  10807  CA  THR G  59      74.576 168.711  30.093  1.00 13.86           C  
ATOM  10808  C   THR G  59      75.011 169.384  28.790  1.00 13.68           C  
ATOM  10809  O   THR G  59      75.777 170.341  28.812  1.00 13.92           O  
ATOM  10810  CB  THR G  59      75.618 167.655  30.558  1.00 14.49           C  
ATOM  10811  OG1 THR G  59      76.332 167.138  29.437  1.00 19.75           O  
ATOM  10812  CG2 THR G  59      74.941 166.529  31.268  1.00  7.47           C  
ATOM  10813  N   ALA G  60      74.522 168.900  27.652  1.00 15.78           N  
ATOM  10814  CA  ALA G  60      74.856 169.543  26.367  1.00 16.20           C  
ATOM  10815  C   ALA G  60      74.238 170.954  26.346  1.00 16.53           C  
ATOM  10816  O   ALA G  60      74.838 171.915  25.858  1.00 16.28           O  
ATOM  10817  CB  ALA G  60      74.301 168.724  25.196  1.00 12.72           C  
ATOM  10818  N   GLU G  61      73.026 171.058  26.878  1.00 16.13           N  
ATOM  10819  CA  GLU G  61      72.305 172.315  26.937  1.00 16.52           C  
ATOM  10820  C   GLU G  61      72.979 173.313  27.880  1.00 17.38           C  
ATOM  10821  O   GLU G  61      73.025 174.512  27.589  1.00 20.48           O  
ATOM  10822  CB  GLU G  61      70.860 172.046  27.378  1.00 18.70           C  
ATOM  10823  CG  GLU G  61      70.021 173.269  27.609  1.00 22.35           C  
ATOM  10824  CD  GLU G  61      69.678 173.984  26.333  1.00 27.79           C  
ATOM  10825  OE1 GLU G  61      70.204 173.591  25.276  1.00 32.07           O  
ATOM  10826  OE2 GLU G  61      68.884 174.948  26.387  1.00 32.15           O  
ATOM  10827  N   ILE G  62      73.500 172.841  29.013  1.00 15.75           N  
ATOM  10828  CA  ILE G  62      74.168 173.758  29.927  1.00 14.59           C  
ATOM  10829  C   ILE G  62      75.582 174.109  29.433  1.00 12.61           C  
ATOM  10830  O   ILE G  62      76.000 175.253  29.547  1.00  8.65           O  
ATOM  10831  CB  ILE G  62      74.314 173.191  31.355  1.00 18.23           C  
ATOM  10832  CG1 ILE G  62      73.009 172.596  31.833  1.00 21.81           C  
ATOM  10833  CG2 ILE G  62      74.659 174.337  32.336  1.00 21.63           C  
ATOM  10834  CD1 ILE G  62      73.012 172.366  33.331  1.00 27.88           C  
ATOM  10835  N   LEU G  63      76.325 173.127  28.917  1.00  9.90           N  
ATOM  10836  CA  LEU G  63      77.667 173.413  28.420  1.00 13.57           C  
ATOM  10837  C   LEU G  63      77.570 174.417  27.280  1.00 14.60           C  
ATOM  10838  O   LEU G  63      78.371 175.344  27.186  1.00 15.12           O  
ATOM  10839  CB  LEU G  63      78.373 172.138  27.956  1.00 12.07           C  
ATOM  10840  CG  LEU G  63      78.715 171.185  29.104  1.00 10.04           C  
ATOM  10841  CD1 LEU G  63      79.348 169.949  28.568  1.00 10.26           C  
ATOM  10842  CD2 LEU G  63      79.646 171.859  30.086  1.00  8.63           C  
ATOM  10843  N   GLU G  64      76.568 174.236  26.429  1.00 16.30           N  
ATOM  10844  CA  GLU G  64      76.325 175.136  25.316  1.00 16.88           C  
ATOM  10845  C   GLU G  64      76.147 176.570  25.831  1.00 19.58           C  
ATOM  10846  O   GLU G  64      76.918 177.457  25.484  1.00 21.23           O  
ATOM  10847  CB  GLU G  64      75.071 174.673  24.574  1.00 16.57           C  
ATOM  10848  CG  GLU G  64      74.465 175.648  23.580  1.00 14.76           C  
ATOM  10849  CD  GLU G  64      75.255 175.775  22.296  1.00 19.32           C  
ATOM  10850  OE1 GLU G  64      74.725 176.350  21.327  1.00 26.28           O  
ATOM  10851  OE2 GLU G  64      76.407 175.324  22.241  1.00 19.22           O  
ATOM  10852  N   LEU G  65      75.141 176.789  26.677  1.00 20.03           N  
ATOM  10853  CA  LEU G  65      74.859 178.117  27.213  1.00 17.99           C  
ATOM  10854  C   LEU G  65      75.968 178.702  28.076  1.00 16.86           C  
ATOM  10855  O   LEU G  65      76.239 179.898  28.012  1.00 18.44           O  
ATOM  10856  CB  LEU G  65      73.541 178.100  27.995  1.00 19.53           C  
ATOM  10857  CG  LEU G  65      72.277 177.807  27.166  1.00 23.04           C  
ATOM  10858  CD1 LEU G  65      71.038 177.727  28.075  1.00 19.03           C  
ATOM  10859  CD2 LEU G  65      72.107 178.905  26.116  1.00 13.34           C  
ATOM  10860  N   ALA G  66      76.606 177.884  28.897  1.00 15.61           N  
ATOM  10861  CA  ALA G  66      77.690 178.397  29.727  1.00 15.45           C  
ATOM  10862  C   ALA G  66      78.852 178.698  28.776  1.00 16.97           C  
ATOM  10863  O   ALA G  66      79.608 179.651  28.981  1.00 15.86           O  
ATOM  10864  CB  ALA G  66      78.102 177.376  30.773  1.00  9.54           C  
ATOM  10865  N   GLY G  67      78.971 177.887  27.724  1.00 17.16           N  
ATOM  10866  CA  GLY G  67      80.016 178.097  26.734  1.00 17.50           C  
ATOM  10867  C   GLY G  67      79.886 179.455  26.059  1.00 18.83           C  
ATOM  10868  O   GLY G  67      80.890 180.120  25.812  1.00 20.97           O  
ATOM  10869  N   ASN G  68      78.657 179.872  25.758  1.00 16.67           N  
ATOM  10870  CA  ASN G  68      78.434 181.166  25.138  1.00 17.29           C  
ATOM  10871  C   ASN G  68      78.723 182.277  26.146  1.00 20.70           C  
ATOM  10872  O   ASN G  68      79.258 183.330  25.793  1.00 21.25           O  
ATOM  10873  CB  ASN G  68      76.986 181.312  24.639  1.00 16.38           C  
ATOM  10874  CG  ASN G  68      76.662 180.390  23.467  1.00 19.16           C  
ATOM  10875  OD1 ASN G  68      77.543 179.984  22.703  1.00 18.17           O  
ATOM  10876  ND2 ASN G  68      75.385 180.069  23.313  1.00 19.60           N  
ATOM  10877  N   ALA G  69      78.353 182.054  27.404  1.00 21.73           N  
ATOM  10878  CA  ALA G  69      78.594 183.057  28.428  1.00 21.94           C  
ATOM  10879  C   ALA G  69      80.097 183.288  28.553  1.00 22.96           C  
ATOM  10880  O   ALA G  69      80.538 184.417  28.723  1.00 24.81           O  
ATOM  10881  CB  ALA G  69      78.013 182.607  29.762  1.00 23.20           C  
ATOM  10882  N   ALA G  70      80.879 182.216  28.469  1.00 22.67           N  
ATOM  10883  CA  ALA G  70      82.324 182.326  28.561  1.00 23.77           C  
ATOM  10884  C   ALA G  70      82.901 183.170  27.419  1.00 28.37           C  
ATOM  10885  O   ALA G  70      83.849 183.923  27.625  1.00 29.11           O  
ATOM  10886  CB  ALA G  70      82.943 180.964  28.533  1.00 19.79           C  
ATOM  10887  N   ARG G  71      82.340 183.049  26.217  1.00 31.41           N  
ATOM  10888  CA  ARG G  71      82.850 183.820  25.090  1.00 34.89           C  
ATOM  10889  C   ARG G  71      82.458 185.293  25.195  1.00 35.55           C  
ATOM  10890  O   ARG G  71      83.138 186.166  24.660  1.00 34.79           O  
ATOM  10891  CB  ARG G  71      82.359 183.248  23.760  1.00 38.42           C  
ATOM  10892  CG  ARG G  71      82.872 184.049  22.569  1.00 44.88           C  
ATOM  10893  CD  ARG G  71      82.293 183.623  21.229  1.00 49.09           C  
ATOM  10894  NE  ARG G  71      82.631 184.610  20.198  1.00 56.66           N  
ATOM  10895  CZ  ARG G  71      82.375 184.473  18.899  1.00 58.31           C  
ATOM  10896  NH1 ARG G  71      81.774 183.379  18.445  1.00 58.29           N  
ATOM  10897  NH2 ARG G  71      82.714 185.438  18.052  1.00 58.61           N  
ATOM  10898  N   ASP G  72      81.354 185.561  25.882  1.00 37.00           N  
ATOM  10899  CA  ASP G  72      80.880 186.924  26.086  1.00 39.02           C  
ATOM  10900  C   ASP G  72      81.824 187.663  27.037  1.00 39.71           C  
ATOM  10901  O   ASP G  72      81.972 188.885  26.959  1.00 38.39           O  
ATOM  10902  CB  ASP G  72      79.476 186.904  26.689  1.00 40.94           C  
ATOM  10903  CG  ASP G  72      78.447 186.376  25.730  1.00 44.73           C  
ATOM  10904  OD1 ASP G  72      78.838 185.620  24.816  1.00 47.95           O  
ATOM  10905  OD2 ASP G  72      77.253 186.706  25.892  1.00 45.72           O  
ATOM  10906  N   ASN G  73      82.442 186.913  27.943  1.00 39.28           N  
ATOM  10907  CA  ASN G  73      83.367 187.483  28.909  1.00 41.25           C  
ATOM  10908  C   ASN G  73      84.775 187.298  28.379  1.00 41.87           C  
ATOM  10909  O   ASN G  73      85.738 187.268  29.142  1.00 41.79           O  
ATOM  10910  CB  ASN G  73      83.234 186.779  30.268  1.00 42.50           C  
ATOM  10911  CG  ASN G  73      81.885 187.010  30.921  1.00 44.20           C  
ATOM  10912  OD1 ASN G  73      81.537 188.137  31.281  1.00 44.95           O  
ATOM  10913  ND2 ASN G  73      81.117 185.939  31.081  1.00 45.16           N  
ATOM  10914  N   LYS G  74      84.885 187.146  27.066  1.00 43.14           N  
ATOM  10915  CA  LYS G  74      86.184 186.971  26.430  1.00 44.53           C  
ATOM  10916  C   LYS G  74      86.972 185.872  27.128  1.00 43.79           C  
ATOM  10917  O   LYS G  74      88.137 186.052  27.479  1.00 44.38           O  
ATOM  10918  CB  LYS G  74      86.955 188.293  26.481  1.00 46.52           C  
ATOM  10919  CG  LYS G  74      86.201 189.446  25.831  1.00 49.89           C  
ATOM  10920  CD  LYS G  74      86.948 190.768  25.940  1.00 54.38           C  
ATOM  10921  CE  LYS G  74      86.241 191.854  25.130  1.00 56.75           C  
ATOM  10922  NZ  LYS G  74      86.879 193.190  25.274  1.00 58.53           N  
ATOM  10923  N   LYS G  75      86.323 184.730  27.325  1.00 43.11           N  
ATOM  10924  CA  LYS G  75      86.946 183.594  27.989  1.00 41.55           C  
ATOM  10925  C   LYS G  75      86.920 182.324  27.148  1.00 39.78           C  
ATOM  10926  O   LYS G  75      85.991 182.087  26.378  1.00 40.13           O  
ATOM  10927  CB  LYS G  75      86.270 183.346  29.336  1.00 41.93           C  
ATOM  10928  CG  LYS G  75      86.564 184.426  30.360  1.00 43.00           C  
ATOM  10929  CD  LYS G  75      88.065 184.556  30.583  1.00 42.59           C  
ATOM  10930  CE  LYS G  75      88.379 185.493  31.732  1.00 43.10           C  
ATOM  10931  NZ  LYS G  75      87.753 186.824  31.534  1.00 45.62           N  
ATOM  10932  N   THR G  76      87.954 181.512  27.325  1.00 36.95           N  
ATOM  10933  CA  THR G  76      88.132 180.267  26.596  1.00 34.75           C  
ATOM  10934  C   THR G  76      87.810 179.072  27.475  1.00 32.77           C  
ATOM  10935  O   THR G  76      87.552 177.970  26.985  1.00 34.65           O  
ATOM  10936  CB  THR G  76      89.606 180.152  26.100  1.00 36.99           C  
ATOM  10937  OG1 THR G  76      89.807 181.029  24.984  1.00 37.12           O  
ATOM  10938  CG2 THR G  76      89.940 178.726  25.691  1.00 40.64           C  
ATOM  10939  N   ARG G  77      87.838 179.291  28.781  1.00 29.63           N  
ATOM  10940  CA  ARG G  77      87.561 178.232  29.732  1.00 27.14           C  
ATOM  10941  C   ARG G  77      86.304 178.555  30.532  1.00 25.53           C  
ATOM  10942  O   ARG G  77      86.045 179.713  30.856  1.00 25.71           O  
ATOM  10943  CB  ARG G  77      88.748 178.070  30.665  1.00 28.11           C  
ATOM  10944  CG  ARG G  77      88.706 176.824  31.506  1.00 34.79           C  
ATOM  10945  CD  ARG G  77      89.967 176.733  32.337  1.00 36.54           C  
ATOM  10946  NE  ARG G  77      91.142 176.587  31.489  1.00 37.44           N  
ATOM  10947  CZ  ARG G  77      92.347 177.051  31.801  1.00 41.33           C  
ATOM  10948  NH1 ARG G  77      92.541 177.701  32.947  1.00 41.16           N  
ATOM  10949  NH2 ARG G  77      93.362 176.859  30.970  1.00 43.61           N  
ATOM  10950  N   ILE G  78      85.522 177.523  30.832  1.00 22.76           N  
ATOM  10951  CA  ILE G  78      84.286 177.671  31.588  1.00 19.55           C  
ATOM  10952  C   ILE G  78      84.524 177.537  33.088  1.00 19.61           C  
ATOM  10953  O   ILE G  78      85.144 176.579  33.540  1.00 20.88           O  
ATOM  10954  CB  ILE G  78      83.255 176.592  31.165  1.00 19.78           C  
ATOM  10955  CG1 ILE G  78      82.817 176.821  29.710  1.00 17.17           C  
ATOM  10956  CG2 ILE G  78      82.045 176.598  32.115  1.00 16.96           C  
ATOM  10957  CD1 ILE G  78      82.065 175.643  29.134  1.00  4.58           C  
ATOM  10958  N   ILE G  79      84.043 178.511  33.852  1.00 18.55           N  
ATOM  10959  CA  ILE G  79      84.153 178.474  35.306  1.00 18.68           C  
ATOM  10960  C   ILE G  79      82.723 178.625  35.862  1.00 19.37           C  
ATOM  10961  O   ILE G  79      81.796 178.977  35.108  1.00 17.53           O  
ATOM  10962  CB  ILE G  79      85.080 179.617  35.869  1.00 18.89           C  
ATOM  10963  CG1 ILE G  79      84.606 180.992  35.402  1.00 20.04           C  
ATOM  10964  CG2 ILE G  79      86.509 179.393  35.419  1.00 19.07           C  
ATOM  10965  CD1 ILE G  79      85.297 182.144  36.115  1.00 19.40           C  
ATOM  10966  N   PRO G  80      82.524 178.358  37.175  1.00 16.94           N  
ATOM  10967  CA  PRO G  80      81.216 178.456  37.834  1.00 15.02           C  
ATOM  10968  C   PRO G  80      80.399 179.684  37.466  1.00 13.92           C  
ATOM  10969  O   PRO G  80      79.191 179.597  37.266  1.00 14.98           O  
ATOM  10970  CB  PRO G  80      81.578 178.421  39.314  1.00 15.11           C  
ATOM  10971  CG  PRO G  80      82.743 177.473  39.318  1.00 14.66           C  
ATOM  10972  CD  PRO G  80      83.563 177.978  38.151  1.00 16.10           C  
ATOM  10973  N   ARG G  81      81.048 180.833  37.376  1.00 14.20           N  
ATOM  10974  CA  ARG G  81      80.330 182.049  37.017  1.00 15.79           C  
ATOM  10975  C   ARG G  81      79.622 181.864  35.666  1.00 17.09           C  
ATOM  10976  O   ARG G  81      78.484 182.298  35.481  1.00 19.60           O  
ATOM  10977  CB  ARG G  81      81.303 183.240  36.952  1.00 13.07           C  
ATOM  10978  CG  ARG G  81      80.841 184.352  36.052  1.00 17.38           C  
ATOM  10979  CD  ARG G  81      80.457 185.631  36.758  1.00 16.50           C  
ATOM  10980  NE  ARG G  81      79.242 185.510  37.538  1.00 20.56           N  
ATOM  10981  CZ  ARG G  81      78.438 186.532  37.830  1.00 23.28           C  
ATOM  10982  NH1 ARG G  81      78.716 187.749  37.392  1.00 16.74           N  
ATOM  10983  NH2 ARG G  81      77.367 186.338  38.592  1.00 24.02           N  
ATOM  10984  N   HIS G  82      80.290 181.215  34.720  1.00 14.11           N  
ATOM  10985  CA  HIS G  82      79.686 181.021  33.410  1.00 14.19           C  
ATOM  10986  C   HIS G  82      78.431 180.162  33.477  1.00 12.77           C  
ATOM  10987  O   HIS G  82      77.424 180.480  32.828  1.00 11.02           O  
ATOM  10988  CB  HIS G  82      80.715 180.426  32.459  1.00 12.42           C  
ATOM  10989  CG  HIS G  82      81.904 181.305  32.268  1.00 10.15           C  
ATOM  10990  ND1 HIS G  82      83.160 180.813  31.984  1.00 11.61           N  
ATOM  10991  CD2 HIS G  82      82.035 182.649  32.351  1.00  9.05           C  
ATOM  10992  CE1 HIS G  82      84.014 181.819  31.904  1.00 10.59           C  
ATOM  10993  NE2 HIS G  82      83.356 182.942  32.122  1.00  6.13           N  
ATOM  10994  N   LEU G  83      78.498 179.092  34.269  1.00 10.52           N  
ATOM  10995  CA  LEU G  83      77.365 178.195  34.459  1.00 11.81           C  
ATOM  10996  C   LEU G  83      76.224 178.943  35.168  1.00 14.25           C  
ATOM  10997  O   LEU G  83      75.049 178.724  34.870  1.00 14.54           O  
ATOM  10998  CB  LEU G  83      77.791 176.960  35.262  1.00 10.66           C  
ATOM  10999  CG  LEU G  83      78.710 175.951  34.549  1.00 11.95           C  
ATOM  11000  CD1 LEU G  83      79.347 175.000  35.563  1.00 11.69           C  
ATOM  11001  CD2 LEU G  83      77.921 175.158  33.516  1.00  7.19           C  
ATOM  11002  N   GLN G  84      76.585 179.846  36.082  1.00 14.39           N  
ATOM  11003  CA  GLN G  84      75.611 180.638  36.815  1.00 12.17           C  
ATOM  11004  C   GLN G  84      74.916 181.615  35.868  1.00 14.39           C  
ATOM  11005  O   GLN G  84      73.690 181.685  35.835  1.00 16.13           O  
ATOM  11006  CB  GLN G  84      76.303 181.381  37.961  1.00  7.96           C  
ATOM  11007  CG  GLN G  84      75.459 182.438  38.677  1.00  9.19           C  
ATOM  11008  CD  GLN G  84      74.276 181.872  39.457  1.00 12.23           C  
ATOM  11009  OE1 GLN G  84      73.754 182.523  40.369  1.00 10.16           O  
ATOM  11010  NE2 GLN G  84      73.839 180.670  39.096  1.00  5.22           N  
ATOM  11011  N   LEU G  85      75.687 182.367  35.090  1.00 15.86           N  
ATOM  11012  CA  LEU G  85      75.096 183.310  34.138  1.00 15.99           C  
ATOM  11013  C   LEU G  85      74.214 182.554  33.140  1.00 17.18           C  
ATOM  11014  O   LEU G  85      73.130 183.014  32.781  1.00 16.53           O  
ATOM  11015  CB  LEU G  85      76.184 184.042  33.349  1.00 16.14           C  
ATOM  11016  CG  LEU G  85      77.113 184.987  34.102  1.00 17.02           C  
ATOM  11017  CD1 LEU G  85      78.090 185.583  33.124  1.00  8.59           C  
ATOM  11018  CD2 LEU G  85      76.282 186.081  34.805  1.00 16.41           C  
ATOM  11019  N   ALA G  86      74.694 181.396  32.694  1.00 14.24           N  
ATOM  11020  CA  ALA G  86      73.961 180.592  31.729  1.00 14.10           C  
ATOM  11021  C   ALA G  86      72.639 180.112  32.291  1.00 13.65           C  
ATOM  11022  O   ALA G  86      71.604 180.201  31.632  1.00 13.51           O  
ATOM  11023  CB  ALA G  86      74.811 179.381  31.292  1.00 15.33           C  
ATOM  11024  N   VAL G  87      72.687 179.585  33.508  1.00 14.91           N  
ATOM  11025  CA  VAL G  87      71.501 179.067  34.164  1.00 14.33           C  
ATOM  11026  C   VAL G  87      70.470 180.149  34.498  1.00 15.99           C  
ATOM  11027  O   VAL G  87      69.287 179.981  34.210  1.00 15.45           O  
ATOM  11028  CB  VAL G  87      71.881 178.294  35.467  1.00 14.40           C  
ATOM  11029  CG1 VAL G  87      70.644 178.095  36.369  1.00 13.36           C  
ATOM  11030  CG2 VAL G  87      72.480 176.941  35.110  1.00  7.93           C  
ATOM  11031  N   ARG G  88      70.911 181.263  35.080  1.00 16.46           N  
ATOM  11032  CA  ARG G  88      69.974 182.307  35.481  1.00 16.74           C  
ATOM  11033  C   ARG G  88      69.453 183.156  34.318  1.00 17.93           C  
ATOM  11034  O   ARG G  88      68.398 183.792  34.430  1.00 16.41           O  
ATOM  11035  CB  ARG G  88      70.600 183.206  36.554  1.00 17.38           C  
ATOM  11036  CG  ARG G  88      71.658 182.535  37.440  1.00 19.76           C  
ATOM  11037  CD  ARG G  88      71.172 181.801  38.708  1.00 20.83           C  
ATOM  11038  NE  ARG G  88      70.027 180.906  38.564  1.00 23.78           N  
ATOM  11039  CZ  ARG G  88      69.809 179.827  39.326  1.00 22.45           C  
ATOM  11040  NH1 ARG G  88      70.663 179.485  40.272  1.00 12.41           N  
ATOM  11041  NH2 ARG G  88      68.698 179.112  39.178  1.00 22.68           N  
ATOM  11042  N   ASN G  89      70.172 183.172  33.200  1.00 16.55           N  
ATOM  11043  CA  ASN G  89      69.714 183.952  32.060  1.00 16.20           C  
ATOM  11044  C   ASN G  89      68.787 183.113  31.174  1.00 16.41           C  
ATOM  11045  O   ASN G  89      68.229 183.613  30.205  1.00 15.36           O  
ATOM  11046  CB  ASN G  89      70.891 184.481  31.236  1.00 16.56           C  
ATOM  11047  CG  ASN G  89      71.481 185.756  31.813  1.00 20.14           C  
ATOM  11048  OD1 ASN G  89      70.749 186.660  32.208  1.00 22.11           O  
ATOM  11049  ND2 ASN G  89      72.808 185.841  31.848  1.00 16.18           N  
ATOM  11050  N   ASP G  90      68.610 181.849  31.538  1.00 14.91           N  
ATOM  11051  CA  ASP G  90      67.752 180.930  30.804  1.00 17.00           C  
ATOM  11052  C   ASP G  90      66.531 180.574  31.654  1.00 17.64           C  
ATOM  11053  O   ASP G  90      66.659 179.986  32.715  1.00 21.82           O  
ATOM  11054  CB  ASP G  90      68.544 179.668  30.467  1.00 18.95           C  
ATOM  11055  CG  ASP G  90      67.777 178.717  29.596  1.00 23.13           C  
ATOM  11056  OD1 ASP G  90      67.448 179.084  28.449  1.00 25.82           O  
ATOM  11057  OD2 ASP G  90      67.505 177.590  30.052  1.00 31.40           O  
ATOM  11058  N   GLU G  91      65.343 180.919  31.186  1.00 18.84           N  
ATOM  11059  CA  GLU G  91      64.124 180.658  31.937  1.00 21.14           C  
ATOM  11060  C   GLU G  91      63.873 179.218  32.397  1.00 22.45           C  
ATOM  11061  O   GLU G  91      63.377 179.004  33.496  1.00 25.21           O  
ATOM  11062  CB  GLU G  91      62.919 181.135  31.135  1.00 24.40           C  
ATOM  11063  CG  GLU G  91      62.068 182.173  31.838  1.00 35.82           C  
ATOM  11064  CD  GLU G  91      60.824 182.538  31.042  1.00 42.44           C  
ATOM  11065  OE1 GLU G  91      59.951 181.656  30.870  1.00 42.68           O  
ATOM  11066  OE2 GLU G  91      60.725 183.704  30.587  1.00 45.53           O  
ATOM  11067  N   GLU G  92      64.207 178.233  31.572  1.00 23.00           N  
ATOM  11068  CA  GLU G  92      63.960 176.837  31.927  1.00 22.01           C  
ATOM  11069  C   GLU G  92      64.983 176.244  32.892  1.00 18.88           C  
ATOM  11070  O   GLU G  92      64.626 175.560  33.859  1.00 16.27           O  
ATOM  11071  CB  GLU G  92      63.905 175.973  30.667  1.00 23.18           C  
ATOM  11072  CG  GLU G  92      63.005 176.520  29.566  1.00 32.34           C  
ATOM  11073  CD  GLU G  92      61.788 175.649  29.290  1.00 34.01           C  
ATOM  11074  OE1 GLU G  92      61.920 174.406  29.302  1.00 36.29           O  
ATOM  11075  OE2 GLU G  92      60.702 176.213  29.041  1.00 36.42           O  
ATOM  11076  N   LEU G  93      66.256 176.485  32.614  1.00 17.63           N  
ATOM  11077  CA  LEU G  93      67.307 175.971  33.466  1.00 15.33           C  
ATOM  11078  C   LEU G  93      67.204 176.642  34.832  1.00 14.98           C  
ATOM  11079  O   LEU G  93      67.378 175.999  35.854  1.00 14.21           O  
ATOM  11080  CB  LEU G  93      68.657 176.250  32.844  1.00 13.63           C  
ATOM  11081  CG  LEU G  93      69.026 175.423  31.629  1.00 15.45           C  
ATOM  11082  CD1 LEU G  93      70.349 175.970  31.037  1.00 14.00           C  
ATOM  11083  CD2 LEU G  93      69.176 173.955  32.031  1.00 17.68           C  
ATOM  11084  N   ASN G  94      66.911 177.937  34.835  1.00 14.93           N  
ATOM  11085  CA  ASN G  94      66.762 178.683  36.077  1.00 16.35           C  
ATOM  11086  C   ASN G  94      65.662 178.098  36.953  1.00 16.96           C  
ATOM  11087  O   ASN G  94      65.776 178.077  38.176  1.00 19.00           O  
ATOM  11088  CB  ASN G  94      66.446 180.148  35.791  1.00 15.46           C  
ATOM  11089  CG  ASN G  94      66.130 180.926  37.054  1.00 19.55           C  
ATOM  11090  OD1 ASN G  94      66.973 181.045  37.948  1.00 22.39           O  
ATOM  11091  ND2 ASN G  94      64.909 181.452  37.142  1.00 15.32           N  
ATOM  11092  N   LYS G  95      64.586 177.642  36.326  1.00 18.98           N  
ATOM  11093  CA  LYS G  95      63.476 177.050  37.052  1.00 18.62           C  
ATOM  11094  C   LYS G  95      63.858 175.640  37.484  1.00 18.57           C  
ATOM  11095  O   LYS G  95      63.522 175.199  38.587  1.00 21.51           O  
ATOM  11096  CB  LYS G  95      62.235 177.009  36.169  1.00 22.24           C  
ATOM  11097  CG  LYS G  95      61.017 176.398  36.826  1.00 28.29           C  
ATOM  11098  CD  LYS G  95      59.826 176.511  35.885  1.00 39.28           C  
ATOM  11099  CE  LYS G  95      58.574 175.819  36.421  1.00 43.90           C  
ATOM  11100  NZ  LYS G  95      57.403 176.044  35.520  1.00 44.10           N  
ATOM  11101  N   LEU G  96      64.570 174.929  36.623  1.00 14.88           N  
ATOM  11102  CA  LEU G  96      64.981 173.583  36.971  1.00 16.04           C  
ATOM  11103  C   LEU G  96      65.939 173.631  38.166  1.00 16.48           C  
ATOM  11104  O   LEU G  96      65.976 172.721  38.986  1.00 18.99           O  
ATOM  11105  CB  LEU G  96      65.672 172.907  35.784  1.00 14.63           C  
ATOM  11106  CG  LEU G  96      66.166 171.484  36.071  1.00 18.02           C  
ATOM  11107  CD1 LEU G  96      64.992 170.591  36.458  1.00 13.67           C  
ATOM  11108  CD2 LEU G  96      66.876 170.935  34.853  1.00 14.36           C  
ATOM  11109  N   LEU G  97      66.720 174.696  38.253  1.00 14.86           N  
ATOM  11110  CA  LEU G  97      67.668 174.841  39.334  1.00 16.02           C  
ATOM  11111  C   LEU G  97      67.250 176.006  40.235  1.00 18.67           C  
ATOM  11112  O   LEU G  97      68.080 176.639  40.902  1.00 16.09           O  
ATOM  11113  CB  LEU G  97      69.074 175.071  38.765  1.00 14.72           C  
ATOM  11114  CG  LEU G  97      69.603 174.048  37.748  1.00 15.28           C  
ATOM  11115  CD1 LEU G  97      71.059 174.384  37.459  1.00 15.20           C  
ATOM  11116  CD2 LEU G  97      69.473 172.622  38.263  1.00  9.67           C  
ATOM  11117  N   GLY G  98      65.948 176.280  40.260  1.00 18.17           N  
ATOM  11118  CA  GLY G  98      65.474 177.367  41.078  1.00 18.03           C  
ATOM  11119  C   GLY G  98      65.795 177.228  42.554  1.00 19.49           C  
ATOM  11120  O   GLY G  98      65.774 178.212  43.279  1.00 20.65           O  
ATOM  11121  N   ARG G  99      66.086 176.016  43.009  1.00 19.38           N  
ATOM  11122  CA  ARG G  99      66.378 175.801  44.419  1.00 19.56           C  
ATOM  11123  C   ARG G  99      67.756 175.207  44.581  1.00 18.69           C  
ATOM  11124  O   ARG G  99      67.999 174.391  45.463  1.00 20.96           O  
ATOM  11125  CB  ARG G  99      65.327 174.871  45.028  1.00 23.60           C  
ATOM  11126  CG  ARG G  99      64.033 175.576  45.375  1.00 30.01           C  
ATOM  11127  CD  ARG G  99      64.258 176.496  46.559  1.00 38.24           C  
ATOM  11128  NE  ARG G  99      63.415 177.687  46.531  1.00 45.83           N  
ATOM  11129  CZ  ARG G  99      63.567 178.712  47.366  1.00 49.66           C  
ATOM  11130  NH1 ARG G  99      64.525 178.669  48.285  1.00 49.00           N  
ATOM  11131  NH2 ARG G  99      62.784 179.786  47.274  1.00 49.96           N  
ATOM  11132  N   VAL G 100      68.660 175.625  43.712  1.00 16.13           N  
ATOM  11133  CA  VAL G 100      70.020 175.133  43.721  1.00 11.83           C  
ATOM  11134  C   VAL G 100      70.945 176.333  43.768  1.00 11.76           C  
ATOM  11135  O   VAL G 100      70.590 177.409  43.292  1.00  7.60           O  
ATOM  11136  CB  VAL G 100      70.302 174.313  42.425  1.00 11.70           C  
ATOM  11137  CG1 VAL G 100      71.808 174.090  42.247  1.00 10.65           C  
ATOM  11138  CG2 VAL G 100      69.566 172.953  42.493  1.00  8.91           C  
ATOM  11139  N   THR G 101      72.109 176.166  44.384  1.00 12.28           N  
ATOM  11140  CA  THR G 101      73.073 177.240  44.417  1.00 13.87           C  
ATOM  11141  C   THR G 101      74.394 176.729  43.862  1.00 13.72           C  
ATOM  11142  O   THR G 101      74.914 175.706  44.281  1.00 11.00           O  
ATOM  11143  CB  THR G 101      73.260 177.861  45.842  1.00 18.19           C  
ATOM  11144  OG1 THR G 101      74.661 177.960  46.163  1.00 19.21           O  
ATOM  11145  CG2 THR G 101      72.515 177.070  46.872  1.00 19.64           C  
ATOM  11146  N   ILE G 102      74.894 177.454  42.870  1.00 14.40           N  
ATOM  11147  CA  ILE G 102      76.139 177.137  42.205  1.00 11.77           C  
ATOM  11148  C   ILE G 102      77.253 177.853  42.934  1.00 12.59           C  
ATOM  11149  O   ILE G 102      77.306 179.100  42.958  1.00 11.02           O  
ATOM  11150  CB  ILE G 102      76.112 177.604  40.722  1.00  9.06           C  
ATOM  11151  CG1 ILE G 102      74.976 176.896  39.973  1.00 11.40           C  
ATOM  11152  CG2 ILE G 102      77.436 177.299  40.061  1.00  9.24           C  
ATOM  11153  CD1 ILE G 102      74.912 177.216  38.480  1.00 11.17           C  
ATOM  11154  N   ALA G 103      78.136 177.065  43.541  1.00 13.12           N  
ATOM  11155  CA  ALA G 103      79.274 177.621  44.275  1.00 17.20           C  
ATOM  11156  C   ALA G 103      80.076 178.523  43.337  1.00 17.25           C  
ATOM  11157  O   ALA G 103      80.246 178.210  42.165  1.00 19.72           O  
ATOM  11158  CB  ALA G 103      80.170 176.483  44.825  1.00 15.51           C  
ATOM  11159  N   GLN G 104      80.560 179.641  43.865  1.00 18.98           N  
ATOM  11160  CA  GLN G 104      81.338 180.609  43.095  1.00 18.84           C  
ATOM  11161  C   GLN G 104      80.652 181.053  41.795  1.00 21.10           C  
ATOM  11162  O   GLN G 104      81.293 181.211  40.748  1.00 23.89           O  
ATOM  11163  CB  GLN G 104      82.736 180.044  42.810  1.00 19.67           C  
ATOM  11164  CG  GLN G 104      83.673 180.088  44.012  1.00 20.79           C  
ATOM  11165  CD  GLN G 104      83.930 181.529  44.487  1.00 25.81           C  
ATOM  11166  OE1 GLN G 104      84.307 182.398  43.690  1.00 23.72           O  
ATOM  11167  NE2 GLN G 104      83.724 181.781  45.783  1.00 19.72           N  
ATOM  11168  N   GLY G 105      79.345 181.273  41.870  1.00 18.57           N  
ATOM  11169  CA  GLY G 105      78.613 181.701  40.700  1.00 14.63           C  
ATOM  11170  C   GLY G 105      78.240 183.163  40.773  1.00 14.13           C  
ATOM  11171  O   GLY G 105      78.057 183.827  39.747  1.00 15.88           O  
ATOM  11172  N   GLY G 106      78.145 183.683  41.987  1.00 11.51           N  
ATOM  11173  CA  GLY G 106      77.770 185.072  42.151  1.00 10.73           C  
ATOM  11174  C   GLY G 106      76.349 185.261  41.658  1.00 10.91           C  
ATOM  11175  O   GLY G 106      75.619 184.289  41.467  1.00 10.20           O  
ATOM  11176  N   VAL G 107      75.950 186.505  41.436  1.00 11.25           N  
ATOM  11177  CA  VAL G 107      74.601 186.775  40.957  1.00 10.83           C  
ATOM  11178  C   VAL G 107      74.646 187.518  39.627  1.00 12.65           C  
ATOM  11179  O   VAL G 107      75.712 187.890  39.158  1.00 14.36           O  
ATOM  11180  CB  VAL G 107      73.813 187.640  41.977  1.00  7.84           C  
ATOM  11181  CG1 VAL G 107      73.908 187.034  43.349  1.00  2.51           C  
ATOM  11182  CG2 VAL G 107      74.337 189.062  41.969  1.00  9.37           C  
ATOM  11183  N   LEU G 108      73.479 187.724  39.027  1.00 14.93           N  
ATOM  11184  CA  LEU G 108      73.361 188.456  37.771  1.00 15.12           C  
ATOM  11185  C   LEU G 108      73.432 189.938  38.067  1.00 17.48           C  
ATOM  11186  O   LEU G 108      72.880 190.391  39.058  1.00 14.47           O  
ATOM  11187  CB  LEU G 108      72.005 188.220  37.112  1.00 12.38           C  
ATOM  11188  CG  LEU G 108      71.616 186.903  36.448  1.00 13.74           C  
ATOM  11189  CD1 LEU G 108      70.316 187.126  35.706  1.00  8.61           C  
ATOM  11190  CD2 LEU G 108      72.691 186.451  35.495  1.00 11.44           C  
ATOM  11191  N   PRO G 109      74.111 190.717  37.210  1.00 21.84           N  
ATOM  11192  CA  PRO G 109      74.196 192.168  37.437  1.00 23.66           C  
ATOM  11193  C   PRO G 109      72.765 192.704  37.392  1.00 25.02           C  
ATOM  11194  O   PRO G 109      72.086 192.562  36.381  1.00 27.74           O  
ATOM  11195  CB  PRO G 109      75.015 192.656  36.247  1.00 20.05           C  
ATOM  11196  CG  PRO G 109      75.933 191.502  35.984  1.00 22.27           C  
ATOM  11197  CD  PRO G 109      75.013 190.299  36.121  1.00 22.96           C  
ATOM  11198  N   ASN G 110      72.297 193.310  38.472  1.00 27.23           N  
ATOM  11199  CA  ASN G 110      70.931 193.815  38.480  1.00 28.17           C  
ATOM  11200  C   ASN G 110      70.707 194.859  39.577  1.00 27.23           C  
ATOM  11201  O   ASN G 110      70.823 194.564  40.764  1.00 26.38           O  
ATOM  11202  CB  ASN G 110      69.968 192.627  38.632  1.00 30.27           C  
ATOM  11203  CG  ASN G 110      68.513 193.022  38.463  1.00 33.28           C  
ATOM  11204  OD1 ASN G 110      68.188 193.922  37.693  1.00 39.25           O  
ATOM  11205  ND2 ASN G 110      67.628 192.335  39.171  1.00 35.42           N  
ATOM  11206  N   ILE G 111      70.393 196.082  39.157  1.00 27.40           N  
ATOM  11207  CA  ILE G 111      70.154 197.197  40.071  1.00 29.63           C  
ATOM  11208  C   ILE G 111      68.753 197.769  39.899  1.00 30.00           C  
ATOM  11209  O   ILE G 111      68.435 198.307  38.848  1.00 33.92           O  
ATOM  11210  CB  ILE G 111      71.130 198.362  39.809  1.00 30.75           C  
ATOM  11211  CG1 ILE G 111      72.572 197.846  39.768  1.00 31.02           C  
ATOM  11212  CG2 ILE G 111      70.949 199.436  40.890  1.00 28.96           C  
ATOM  11213  CD1 ILE G 111      73.603 198.918  39.418  1.00 30.24           C  
ATOM  11214  N   GLN G 112      67.918 197.676  40.921  1.00 29.71           N  
ATOM  11215  CA  GLN G 112      66.573 198.228  40.813  1.00 31.00           C  
ATOM  11216  C   GLN G 112      66.633 199.691  40.345  1.00 31.59           C  
ATOM  11217  O   GLN G 112      67.486 200.465  40.781  1.00 30.95           O  
ATOM  11218  CB  GLN G 112      65.861 198.128  42.162  1.00 30.28           C  
ATOM  11219  CG  GLN G 112      65.725 196.698  42.675  1.00 33.48           C  
ATOM  11220  CD  GLN G 112      65.039 195.770  41.682  1.00 32.74           C  
ATOM  11221  OE1 GLN G 112      63.902 195.995  41.277  1.00 33.23           O  
ATOM  11222  NE2 GLN G 112      65.737 194.719  41.289  1.00 37.81           N  
ATOM  11223  N   SER G 113      65.724 200.061  39.453  1.00 32.64           N  
ATOM  11224  CA  SER G 113      65.670 201.416  38.905  1.00 32.59           C  
ATOM  11225  C   SER G 113      65.668 202.559  39.916  1.00 32.93           C  
ATOM  11226  O   SER G 113      66.531 203.427  39.867  1.00 34.41           O  
ATOM  11227  CB  SER G 113      64.450 201.546  37.997  1.00 33.80           C  
ATOM  11228  OG  SER G 113      64.565 200.667  36.893  1.00 36.43           O  
ATOM  11229  N   VAL G 114      64.703 202.568  40.828  1.00 32.96           N  
ATOM  11230  CA  VAL G 114      64.609 203.635  41.825  1.00 32.56           C  
ATOM  11231  C   VAL G 114      65.922 203.984  42.497  1.00 31.65           C  
ATOM  11232  O   VAL G 114      66.058 205.062  43.067  1.00 32.56           O  
ATOM  11233  CB  VAL G 114      63.632 203.282  42.953  1.00 34.26           C  
ATOM  11234  CG1 VAL G 114      62.243 203.078  42.393  1.00 36.27           C  
ATOM  11235  CG2 VAL G 114      64.128 202.036  43.685  1.00 34.00           C  
ATOM  11236  N   LEU G 115      66.883 203.074  42.453  1.00 32.17           N  
ATOM  11237  CA  LEU G 115      68.168 203.315  43.093  1.00 30.69           C  
ATOM  11238  C   LEU G 115      69.118 204.098  42.184  1.00 31.31           C  
ATOM  11239  O   LEU G 115      70.091 204.691  42.662  1.00 29.58           O  
ATOM  11240  CB  LEU G 115      68.799 201.976  43.512  1.00 28.96           C  
ATOM  11241  CG  LEU G 115      67.882 200.967  44.237  1.00 29.81           C  
ATOM  11242  CD1 LEU G 115      68.665 199.701  44.578  1.00 26.07           C  
ATOM  11243  CD2 LEU G 115      67.304 201.575  45.502  1.00 25.79           C  
ATOM  11244  N   LEU G 116      68.844 204.105  40.879  1.00 32.25           N  
ATOM  11245  CA  LEU G 116      69.696 204.840  39.933  1.00 35.70           C  
ATOM  11246  C   LEU G 116      69.621 206.358  40.141  1.00 37.86           C  
ATOM  11247  O   LEU G 116      68.562 206.905  40.447  1.00 36.20           O  
ATOM  11248  CB  LEU G 116      69.325 204.501  38.492  1.00 33.33           C  
ATOM  11249  CG  LEU G 116      69.618 203.059  38.088  1.00 34.81           C  
ATOM  11250  CD1 LEU G 116      69.259 202.849  36.626  1.00 32.29           C  
ATOM  11251  CD2 LEU G 116      71.093 202.756  38.322  1.00 36.16           C  
ATOM  11252  N   PRO G 117      70.755 207.055  39.975  1.00 41.72           N  
ATOM  11253  CA  PRO G 117      70.808 208.508  40.152  1.00 45.34           C  
ATOM  11254  C   PRO G 117      69.818 209.234  39.250  1.00 50.33           C  
ATOM  11255  O   PRO G 117      69.440 208.726  38.192  1.00 50.83           O  
ATOM  11256  CB  PRO G 117      72.259 208.837  39.823  1.00 43.59           C  
ATOM  11257  CG  PRO G 117      72.592 207.831  38.787  1.00 43.36           C  
ATOM  11258  CD  PRO G 117      72.004 206.564  39.366  1.00 43.49           C  
ATOM  11259  N   LYS G 118      69.395 210.422  39.668  1.00 54.83           N  
ATOM  11260  CA  LYS G 118      68.434 211.184  38.886  1.00 59.94           C  
ATOM  11261  C   LYS G 118      68.733 212.676  38.881  1.00 61.85           C  
ATOM  11262  O   LYS G 118      67.873 213.447  39.360  1.00 63.52           O  
ATOM  11263  CB  LYS G 118      67.027 210.935  39.430  1.00 61.97           C  
ATOM  11264  CG  LYS G 118      66.890 211.155  40.931  1.00 65.75           C  
ATOM  11265  CD  LYS G 118      65.491 210.771  41.409  1.00 67.75           C  
ATOM  11266  CE  LYS G 118      65.322 210.981  42.909  1.00 67.79           C  
ATOM  11267  NZ  LYS G 118      63.928 210.685  43.353  1.00 67.36           N  
TER   11268      LYS G 118                                                      
ATOM  11269  N   THR H  29      90.924 154.892  47.312  1.00 64.17           N  
ATOM  11270  CA  THR H  29      90.083 154.081  46.383  1.00 63.75           C  
ATOM  11271  C   THR H  29      89.713 154.850  45.122  1.00 63.20           C  
ATOM  11272  O   THR H  29      90.121 155.997  44.931  1.00 64.29           O  
ATOM  11273  CB  THR H  29      88.771 153.641  47.053  1.00 64.90           C  
ATOM  11274  OG1 THR H  29      88.125 154.788  47.626  1.00 66.97           O  
ATOM  11275  CG2 THR H  29      89.040 152.598  48.131  1.00 64.99           C  
ATOM  11276  N   ARG H  30      88.923 154.208  44.271  1.00 61.54           N  
ATOM  11277  CA  ARG H  30      88.482 154.805  43.020  1.00 59.25           C  
ATOM  11278  C   ARG H  30      87.431 155.868  43.301  1.00 57.21           C  
ATOM  11279  O   ARG H  30      86.763 155.843  44.333  1.00 57.45           O  
ATOM  11280  CB  ARG H  30      87.889 153.726  42.116  1.00 61.34           C  
ATOM  11281  CG  ARG H  30      88.743 152.474  42.032  1.00 65.10           C  
ATOM  11282  CD  ARG H  30      89.418 152.327  40.679  1.00 67.10           C  
ATOM  11283  NE  ARG H  30      88.464 151.996  39.622  1.00 68.15           N  
ATOM  11284  CZ  ARG H  30      88.816 151.549  38.422  1.00 68.33           C  
ATOM  11285  NH1 ARG H  30      90.100 151.380  38.130  1.00 68.24           N  
ATOM  11286  NH2 ARG H  30      87.889 151.267  37.517  1.00 69.01           N  
ATOM  11287  N   LYS H  31      87.288 156.803  42.371  1.00 54.64           N  
ATOM  11288  CA  LYS H  31      86.316 157.877  42.502  1.00 50.89           C  
ATOM  11289  C   LYS H  31      85.603 158.100  41.167  1.00 47.41           C  
ATOM  11290  O   LYS H  31      86.165 158.706  40.249  1.00 45.72           O  
ATOM  11291  CB  LYS H  31      87.022 159.165  42.937  1.00 52.98           C  
ATOM  11292  CG  LYS H  31      86.597 159.694  44.290  1.00 52.96           C  
ATOM  11293  CD  LYS H  31      85.111 160.016  44.294  1.00 56.82           C  
ATOM  11294  CE  LYS H  31      84.667 160.592  45.630  1.00 58.17           C  
ATOM  11295  NZ  LYS H  31      83.195 160.765  45.671  1.00 60.65           N  
ATOM  11296  N   GLU H  32      84.375 157.595  41.055  1.00 44.05           N  
ATOM  11297  CA  GLU H  32      83.601 157.768  39.827  1.00 40.47           C  
ATOM  11298  C   GLU H  32      83.192 159.219  39.639  1.00 37.89           C  
ATOM  11299  O   GLU H  32      83.096 159.993  40.599  1.00 38.34           O  
ATOM  11300  CB  GLU H  32      82.325 156.932  39.833  1.00 39.28           C  
ATOM  11301  CG  GLU H  32      82.508 155.458  39.613  1.00 41.84           C  
ATOM  11302  CD  GLU H  32      81.172 154.739  39.529  1.00 44.70           C  
ATOM  11303  OE1 GLU H  32      80.219 155.160  40.233  1.00 40.08           O  
ATOM  11304  OE2 GLU H  32      81.080 153.750  38.769  1.00 46.24           O  
ATOM  11305  N   SER H  33      82.921 159.566  38.390  1.00 33.65           N  
ATOM  11306  CA  SER H  33      82.517 160.911  38.033  1.00 28.88           C  
ATOM  11307  C   SER H  33      82.072 160.888  36.576  1.00 26.96           C  
ATOM  11308  O   SER H  33      82.407 159.969  35.832  1.00 28.94           O  
ATOM  11309  CB  SER H  33      83.705 161.853  38.237  1.00 28.34           C  
ATOM  11310  OG  SER H  33      83.666 162.964  37.370  1.00 29.90           O  
ATOM  11311  N   TYR H  34      81.295 161.881  36.175  1.00 24.70           N  
ATOM  11312  CA  TYR H  34      80.833 161.971  34.802  1.00 21.14           C  
ATOM  11313  C   TYR H  34      81.821 162.797  33.991  1.00 20.45           C  
ATOM  11314  O   TYR H  34      81.629 163.013  32.807  1.00 22.17           O  
ATOM  11315  CB  TYR H  34      79.443 162.614  34.748  1.00 19.65           C  
ATOM  11316  CG  TYR H  34      78.331 161.714  35.239  1.00 18.33           C  
ATOM  11317  CD1 TYR H  34      77.908 161.750  36.565  1.00 18.36           C  
ATOM  11318  CD2 TYR H  34      77.717 160.805  34.378  1.00 17.60           C  
ATOM  11319  CE1 TYR H  34      76.895 160.904  37.023  1.00 15.75           C  
ATOM  11320  CE2 TYR H  34      76.712 159.954  34.820  1.00 18.43           C  
ATOM  11321  CZ  TYR H  34      76.303 160.010  36.142  1.00 18.46           C  
ATOM  11322  OH  TYR H  34      75.293 159.189  36.571  1.00 19.83           O  
ATOM  11323  N   ALA H  35      82.896 163.242  34.626  1.00 20.18           N  
ATOM  11324  CA  ALA H  35      83.893 164.063  33.952  1.00 21.65           C  
ATOM  11325  C   ALA H  35      84.204 163.726  32.483  1.00 24.31           C  
ATOM  11326  O   ALA H  35      84.010 164.573  31.609  1.00 27.03           O  
ATOM  11327  CB  ALA H  35      85.168 164.072  34.758  1.00 18.08           C  
ATOM  11328  N   ILE H  36      84.677 162.511  32.197  1.00 24.82           N  
ATOM  11329  CA  ILE H  36      85.023 162.151  30.821  1.00 25.20           C  
ATOM  11330  C   ILE H  36      83.887 162.363  29.837  1.00 25.00           C  
ATOM  11331  O   ILE H  36      84.113 162.850  28.734  1.00 26.67           O  
ATOM  11332  CB  ILE H  36      85.520 160.681  30.686  1.00 29.55           C  
ATOM  11333  CG1 ILE H  36      84.495 159.714  31.263  1.00 31.97           C  
ATOM  11334  CG2 ILE H  36      86.850 160.506  31.393  1.00 24.30           C  
ATOM  11335  CD1 ILE H  36      84.881 158.282  31.060  1.00 33.68           C  
ATOM  11336  N   TYR H  37      82.668 162.007  30.226  1.00 23.27           N  
ATOM  11337  CA  TYR H  37      81.514 162.203  29.352  1.00 21.55           C  
ATOM  11338  C   TYR H  37      81.229 163.693  29.190  1.00 21.89           C  
ATOM  11339  O   TYR H  37      80.974 164.165  28.085  1.00 24.31           O  
ATOM  11340  CB  TYR H  37      80.290 161.500  29.929  1.00 20.63           C  
ATOM  11341  CG  TYR H  37      80.640 160.177  30.542  1.00 20.62           C  
ATOM  11342  CD1 TYR H  37      80.756 160.042  31.929  1.00 19.31           C  
ATOM  11343  CD2 TYR H  37      80.932 159.075  29.739  1.00 19.30           C  
ATOM  11344  CE1 TYR H  37      81.160 158.847  32.504  1.00 21.10           C  
ATOM  11345  CE2 TYR H  37      81.343 157.863  30.308  1.00 24.24           C  
ATOM  11346  CZ  TYR H  37      81.454 157.761  31.689  1.00 24.75           C  
ATOM  11347  OH  TYR H  37      81.864 156.584  32.257  1.00 26.11           O  
ATOM  11348  N   VAL H  38      81.273 164.438  30.287  1.00 21.50           N  
ATOM  11349  CA  VAL H  38      81.043 165.871  30.213  1.00 20.74           C  
ATOM  11350  C   VAL H  38      82.056 166.516  29.264  1.00 23.06           C  
ATOM  11351  O   VAL H  38      81.682 167.386  28.474  1.00 24.34           O  
ATOM  11352  CB  VAL H  38      81.142 166.535  31.596  1.00 19.13           C  
ATOM  11353  CG1 VAL H  38      81.075 168.056  31.454  1.00 12.77           C  
ATOM  11354  CG2 VAL H  38      80.010 166.034  32.478  1.00 18.18           C  
ATOM  11355  N   TYR H  39      83.327 166.106  29.326  1.00 22.85           N  
ATOM  11356  CA  TYR H  39      84.314 166.684  28.402  1.00 25.22           C  
ATOM  11357  C   TYR H  39      83.864 166.403  26.976  1.00 24.19           C  
ATOM  11358  O   TYR H  39      83.878 167.296  26.119  1.00 24.84           O  
ATOM  11359  CB  TYR H  39      85.718 166.081  28.570  1.00 23.63           C  
ATOM  11360  CG  TYR H  39      86.490 166.615  29.737  1.00 23.57           C  
ATOM  11361  CD1 TYR H  39      86.710 165.830  30.871  1.00 26.88           C  
ATOM  11362  CD2 TYR H  39      86.976 167.916  29.730  1.00 25.94           C  
ATOM  11363  CE1 TYR H  39      87.395 166.334  31.976  1.00 30.43           C  
ATOM  11364  CE2 TYR H  39      87.660 168.434  30.832  1.00 30.34           C  
ATOM  11365  CZ  TYR H  39      87.861 167.641  31.952  1.00 30.44           C  
ATOM  11366  OH  TYR H  39      88.476 168.172  33.063  1.00 34.98           O  
ATOM  11367  N   LYS H  40      83.465 165.157  26.739  1.00 22.22           N  
ATOM  11368  CA  LYS H  40      83.026 164.732  25.423  1.00 23.61           C  
ATOM  11369  C   LYS H  40      81.910 165.591  24.881  1.00 23.09           C  
ATOM  11370  O   LYS H  40      82.033 166.153  23.786  1.00 23.62           O  
ATOM  11371  CB  LYS H  40      82.591 163.267  25.452  1.00 26.45           C  
ATOM  11372  CG  LYS H  40      83.755 162.307  25.556  1.00 29.31           C  
ATOM  11373  CD  LYS H  40      83.294 160.857  25.543  1.00 36.57           C  
ATOM  11374  CE  LYS H  40      84.489 159.911  25.691  1.00 39.34           C  
ATOM  11375  NZ  LYS H  40      84.062 158.493  25.853  1.00 43.64           N  
ATOM  11376  N   VAL H  41      80.825 165.710  25.640  1.00 20.67           N  
ATOM  11377  CA  VAL H  41      79.707 166.515  25.182  1.00 19.21           C  
ATOM  11378  C   VAL H  41      80.151 167.974  25.019  1.00 20.40           C  
ATOM  11379  O   VAL H  41      79.615 168.696  24.180  1.00 20.47           O  
ATOM  11380  CB  VAL H  41      78.521 166.418  26.157  1.00 19.85           C  
ATOM  11381  CG1 VAL H  41      77.403 167.349  25.720  1.00 19.79           C  
ATOM  11382  CG2 VAL H  41      78.022 164.985  26.218  1.00 17.19           C  
ATOM  11383  N   LEU H  42      81.134 168.409  25.808  1.00 19.05           N  
ATOM  11384  CA  LEU H  42      81.617 169.779  25.689  1.00 19.58           C  
ATOM  11385  C   LEU H  42      82.336 169.973  24.351  1.00 22.50           C  
ATOM  11386  O   LEU H  42      82.138 170.973  23.664  1.00 23.88           O  
ATOM  11387  CB  LEU H  42      82.573 170.132  26.833  1.00 19.34           C  
ATOM  11388  CG  LEU H  42      83.275 171.496  26.690  1.00 18.24           C  
ATOM  11389  CD1 LEU H  42      82.257 172.596  26.706  1.00 14.09           C  
ATOM  11390  CD2 LEU H  42      84.281 171.707  27.809  1.00 17.25           C  
ATOM  11391  N   LYS H  43      83.169 169.017  23.965  1.00 25.15           N  
ATOM  11392  CA  LYS H  43      83.871 169.168  22.705  1.00 25.69           C  
ATOM  11393  C   LYS H  43      82.922 169.164  21.510  1.00 24.46           C  
ATOM  11394  O   LYS H  43      83.165 169.870  20.537  1.00 26.57           O  
ATOM  11395  CB  LYS H  43      84.975 168.109  22.569  1.00 27.03           C  
ATOM  11396  CG  LYS H  43      86.158 168.391  23.507  1.00 32.66           C  
ATOM  11397  CD  LYS H  43      86.635 169.844  23.346  1.00 38.09           C  
ATOM  11398  CE  LYS H  43      87.370 170.373  24.584  1.00 41.27           C  
ATOM  11399  NZ  LYS H  43      88.861 170.413  24.460  1.00 41.49           N  
ATOM  11400  N   GLN H  44      81.831 168.404  21.583  1.00 21.95           N  
ATOM  11401  CA  GLN H  44      80.874 168.386  20.480  1.00 19.42           C  
ATOM  11402  C   GLN H  44      80.173 169.727  20.366  1.00 22.04           C  
ATOM  11403  O   GLN H  44      79.809 170.161  19.272  1.00 24.07           O  
ATOM  11404  CB  GLN H  44      79.808 167.320  20.694  1.00 15.47           C  
ATOM  11405  CG  GLN H  44      80.349 165.939  20.908  1.00 18.95           C  
ATOM  11406  CD  GLN H  44      79.257 164.928  21.087  1.00 22.35           C  
ATOM  11407  OE1 GLN H  44      78.397 165.087  21.948  1.00 30.13           O  
ATOM  11408  NE2 GLN H  44      79.278 163.874  20.276  1.00 25.68           N  
ATOM  11409  N   VAL H  45      79.995 170.384  21.508  1.00 22.60           N  
ATOM  11410  CA  VAL H  45      79.295 171.656  21.566  1.00 22.98           C  
ATOM  11411  C   VAL H  45      80.198 172.897  21.440  1.00 23.29           C  
ATOM  11412  O   VAL H  45      79.835 173.875  20.800  1.00 20.48           O  
ATOM  11413  CB  VAL H  45      78.445 171.703  22.859  1.00 22.25           C  
ATOM  11414  CG1 VAL H  45      77.677 172.983  22.940  1.00 23.11           C  
ATOM  11415  CG2 VAL H  45      77.470 170.547  22.862  1.00 20.59           C  
ATOM  11416  N   HIS H  46      81.369 172.867  22.060  1.00 24.54           N  
ATOM  11417  CA  HIS H  46      82.295 173.990  21.958  1.00 24.31           C  
ATOM  11418  C   HIS H  46      83.703 173.433  21.855  1.00 25.85           C  
ATOM  11419  O   HIS H  46      84.475 173.497  22.800  1.00 26.66           O  
ATOM  11420  CB  HIS H  46      82.169 174.915  23.163  1.00 21.59           C  
ATOM  11421  CG  HIS H  46      80.959 175.793  23.124  1.00 20.13           C  
ATOM  11422  ND1 HIS H  46      79.892 175.634  23.983  1.00 22.16           N  
ATOM  11423  CD2 HIS H  46      80.659 176.863  22.352  1.00 19.33           C  
ATOM  11424  CE1 HIS H  46      78.992 176.571  23.744  1.00 18.28           C  
ATOM  11425  NE2 HIS H  46      79.434 177.332  22.760  1.00 16.50           N  
ATOM  11426  N   PRO H  47      84.050 172.881  20.678  1.00 27.99           N  
ATOM  11427  CA  PRO H  47      85.353 172.276  20.373  1.00 28.59           C  
ATOM  11428  C   PRO H  47      86.627 172.953  20.891  1.00 29.27           C  
ATOM  11429  O   PRO H  47      87.604 172.267  21.186  1.00 32.77           O  
ATOM  11430  CB  PRO H  47      85.329 172.138  18.841  1.00 26.47           C  
ATOM  11431  CG  PRO H  47      84.299 173.129  18.399  1.00 26.40           C  
ATOM  11432  CD  PRO H  47      83.243 173.012  19.453  1.00 25.24           C  
ATOM  11433  N   ASP H  48      86.642 174.272  21.023  1.00 28.03           N  
ATOM  11434  CA  ASP H  48      87.860 174.925  21.510  1.00 30.45           C  
ATOM  11435  C   ASP H  48      87.723 175.556  22.888  1.00 30.17           C  
ATOM  11436  O   ASP H  48      88.423 176.515  23.210  1.00 32.17           O  
ATOM  11437  CB  ASP H  48      88.313 175.994  20.519  1.00 32.94           C  
ATOM  11438  CG  ASP H  48      88.689 175.413  19.188  1.00 35.67           C  
ATOM  11439  OD1 ASP H  48      89.526 174.482  19.179  1.00 37.94           O  
ATOM  11440  OD2 ASP H  48      88.147 175.878  18.162  1.00 35.31           O  
ATOM  11441  N   THR H  49      86.838 175.004  23.708  1.00 27.29           N  
ATOM  11442  CA  THR H  49      86.592 175.547  25.026  1.00 23.25           C  
ATOM  11443  C   THR H  49      86.871 174.547  26.127  1.00 21.98           C  
ATOM  11444  O   THR H  49      86.472 173.399  26.048  1.00 23.86           O  
ATOM  11445  CB  THR H  49      85.135 176.028  25.124  1.00 24.63           C  
ATOM  11446  OG1 THR H  49      84.897 176.999  24.089  1.00 20.96           O  
ATOM  11447  CG2 THR H  49      84.841 176.631  26.508  1.00 16.36           C  
ATOM  11448  N   GLY H  50      87.566 174.992  27.158  1.00 19.83           N  
ATOM  11449  CA  GLY H  50      87.860 174.106  28.257  1.00 19.48           C  
ATOM  11450  C   GLY H  50      86.951 174.400  29.434  1.00 22.54           C  
ATOM  11451  O   GLY H  50      86.089 175.287  29.380  1.00 22.64           O  
ATOM  11452  N   ILE H  51      87.145 173.648  30.509  1.00 22.04           N  
ATOM  11453  CA  ILE H  51      86.350 173.814  31.708  1.00 21.80           C  
ATOM  11454  C   ILE H  51      87.268 173.652  32.917  1.00 22.96           C  
ATOM  11455  O   ILE H  51      88.161 172.805  32.924  1.00 23.30           O  
ATOM  11456  CB  ILE H  51      85.200 172.769  31.731  1.00 19.87           C  
ATOM  11457  CG1 ILE H  51      84.302 172.994  32.955  1.00 16.01           C  
ATOM  11458  CG2 ILE H  51      85.778 171.367  31.673  1.00 12.87           C  
ATOM  11459  CD1 ILE H  51      83.050 172.151  32.962  1.00  7.42           C  
ATOM  11460  N   SER H  52      87.068 174.476  33.936  1.00 22.99           N  
ATOM  11461  CA  SER H  52      87.912 174.394  35.126  1.00 21.56           C  
ATOM  11462  C   SER H  52      87.456 173.289  36.050  1.00 22.61           C  
ATOM  11463  O   SER H  52      86.323 172.814  35.963  1.00 24.03           O  
ATOM  11464  CB  SER H  52      87.903 175.719  35.890  1.00 20.14           C  
ATOM  11465  OG  SER H  52      86.654 175.946  36.521  1.00 17.59           O  
ATOM  11466  N   SER H  53      88.354 172.891  36.940  1.00 23.52           N  
ATOM  11467  CA  SER H  53      88.097 171.844  37.920  1.00 24.36           C  
ATOM  11468  C   SER H  53      86.786 172.055  38.686  1.00 23.40           C  
ATOM  11469  O   SER H  53      85.941 171.169  38.751  1.00 23.24           O  
ATOM  11470  CB  SER H  53      89.257 171.802  38.910  1.00 26.56           C  
ATOM  11471  OG  SER H  53      88.968 170.929  39.980  1.00 35.91           O  
ATOM  11472  N   LYS H  54      86.633 173.237  39.272  1.00 22.66           N  
ATOM  11473  CA  LYS H  54      85.440 173.572  40.034  1.00 21.49           C  
ATOM  11474  C   LYS H  54      84.180 173.532  39.194  1.00 19.96           C  
ATOM  11475  O   LYS H  54      83.149 173.076  39.661  1.00 20.32           O  
ATOM  11476  CB  LYS H  54      85.587 174.956  40.665  1.00 24.26           C  
ATOM  11477  CG  LYS H  54      86.551 175.005  41.828  1.00 27.81           C  
ATOM  11478  CD  LYS H  54      86.799 176.443  42.247  1.00 35.83           C  
ATOM  11479  CE  LYS H  54      87.984 176.539  43.201  1.00 38.84           C  
ATOM  11480  NZ  LYS H  54      88.509 177.934  43.269  1.00 42.31           N  
ATOM  11481  N   ALA H  55      84.263 174.016  37.959  1.00 20.08           N  
ATOM  11482  CA  ALA H  55      83.117 174.012  37.062  1.00 18.11           C  
ATOM  11483  C   ALA H  55      82.682 172.576  36.734  1.00 19.22           C  
ATOM  11484  O   ALA H  55      81.495 172.299  36.541  1.00 20.67           O  
ATOM  11485  CB  ALA H  55      83.457 174.754  35.801  1.00 16.06           C  
ATOM  11486  N   MET H  56      83.648 171.666  36.689  1.00 18.64           N  
ATOM  11487  CA  MET H  56      83.375 170.269  36.393  1.00 19.01           C  
ATOM  11488  C   MET H  56      82.720 169.612  37.597  1.00 19.25           C  
ATOM  11489  O   MET H  56      81.847 168.743  37.446  1.00 15.55           O  
ATOM  11490  CB  MET H  56      84.676 169.536  36.049  1.00 19.21           C  
ATOM  11491  CG  MET H  56      84.491 168.078  35.684  1.00 18.78           C  
ATOM  11492  SD  MET H  56      83.641 167.907  34.116  1.00 27.56           S  
ATOM  11493  CE  MET H  56      82.144 167.242  34.658  1.00 26.28           C  
ATOM  11494  N   SER H  57      83.157 170.019  38.790  1.00 18.50           N  
ATOM  11495  CA  SER H  57      82.595 169.478  40.020  1.00 18.74           C  
ATOM  11496  C   SER H  57      81.113 169.867  40.021  1.00 17.31           C  
ATOM  11497  O   SER H  57      80.242 169.063  40.354  1.00 17.41           O  
ATOM  11498  CB  SER H  57      83.320 170.062  41.242  1.00 21.03           C  
ATOM  11499  OG  SER H  57      82.863 169.478  42.458  1.00 23.67           O  
ATOM  11500  N   ILE H  58      80.834 171.099  39.618  1.00 14.06           N  
ATOM  11501  CA  ILE H  58      79.464 171.575  39.535  1.00 14.56           C  
ATOM  11502  C   ILE H  58      78.681 170.733  38.523  1.00 18.15           C  
ATOM  11503  O   ILE H  58      77.576 170.275  38.817  1.00 20.97           O  
ATOM  11504  CB  ILE H  58      79.438 173.060  39.132  1.00 13.55           C  
ATOM  11505  CG1 ILE H  58      79.856 173.903  40.345  1.00 14.60           C  
ATOM  11506  CG2 ILE H  58      78.057 173.455  38.584  1.00 10.75           C  
ATOM  11507  CD1 ILE H  58      80.173 175.340  40.009  1.00 17.23           C  
ATOM  11508  N   MET H  59      79.252 170.527  37.337  1.00 18.06           N  
ATOM  11509  CA  MET H  59      78.599 169.727  36.306  1.00 16.72           C  
ATOM  11510  C   MET H  59      78.329 168.317  36.821  1.00 16.64           C  
ATOM  11511  O   MET H  59      77.252 167.758  36.597  1.00 17.50           O  
ATOM  11512  CB  MET H  59      79.462 169.660  35.039  1.00 16.51           C  
ATOM  11513  CG  MET H  59      79.409 170.907  34.176  1.00 13.47           C  
ATOM  11514  SD  MET H  59      77.718 171.293  33.719  1.00 19.51           S  
ATOM  11515  CE  MET H  59      77.292 169.831  32.700  1.00 10.41           C  
ATOM  11516  N   ASN H  60      79.302 167.735  37.509  1.00 15.43           N  
ATOM  11517  CA  ASN H  60      79.105 166.402  38.052  1.00 17.09           C  
ATOM  11518  C   ASN H  60      77.961 166.406  39.061  1.00 17.60           C  
ATOM  11519  O   ASN H  60      77.211 165.434  39.143  1.00 17.30           O  
ATOM  11520  CB  ASN H  60      80.374 165.893  38.725  1.00 19.62           C  
ATOM  11521  CG  ASN H  60      80.259 164.446  39.138  1.00 23.85           C  
ATOM  11522  OD1 ASN H  60      80.259 164.128  40.326  1.00 26.78           O  
ATOM  11523  ND2 ASN H  60      80.138 163.557  38.156  1.00 22.34           N  
ATOM  11524  N   SER H  61      77.838 167.496  39.827  1.00 16.75           N  
ATOM  11525  CA  SER H  61      76.767 167.654  40.818  1.00 16.15           C  
ATOM  11526  C   SER H  61      75.425 167.722  40.115  1.00 17.03           C  
ATOM  11527  O   SER H  61      74.448 167.125  40.555  1.00 18.39           O  
ATOM  11528  CB  SER H  61      76.934 168.952  41.616  1.00 17.41           C  
ATOM  11529  OG  SER H  61      77.757 168.782  42.748  1.00 17.55           O  
ATOM  11530  N   PHE H  62      75.387 168.489  39.032  1.00 18.22           N  
ATOM  11531  CA  PHE H  62      74.184 168.668  38.224  1.00 16.46           C  
ATOM  11532  C   PHE H  62      73.669 167.308  37.721  1.00 15.09           C  
ATOM  11533  O   PHE H  62      72.488 166.987  37.869  1.00 14.69           O  
ATOM  11534  CB  PHE H  62      74.518 169.598  37.050  1.00 17.61           C  
ATOM  11535  CG  PHE H  62      73.429 169.712  36.026  1.00 22.25           C  
ATOM  11536  CD1 PHE H  62      72.201 170.288  36.350  1.00 23.49           C  
ATOM  11537  CD2 PHE H  62      73.633 169.242  34.734  1.00 21.44           C  
ATOM  11538  CE1 PHE H  62      71.190 170.395  35.402  1.00 24.18           C  
ATOM  11539  CE2 PHE H  62      72.629 169.340  33.773  1.00 26.38           C  
ATOM  11540  CZ  PHE H  62      71.400 169.920  34.108  1.00 28.51           C  
ATOM  11541  N   VAL H  63      74.557 166.514  37.132  1.00 12.67           N  
ATOM  11542  CA  VAL H  63      74.176 165.211  36.615  1.00 13.78           C  
ATOM  11543  C   VAL H  63      73.664 164.308  37.746  1.00 15.37           C  
ATOM  11544  O   VAL H  63      72.585 163.737  37.633  1.00 17.62           O  
ATOM  11545  CB  VAL H  63      75.370 164.519  35.881  1.00 15.06           C  
ATOM  11546  CG1 VAL H  63      74.946 163.153  35.376  1.00 12.16           C  
ATOM  11547  CG2 VAL H  63      75.867 165.399  34.700  1.00 13.54           C  
ATOM  11548  N   ASN H  64      74.423 164.180  38.834  1.00 15.00           N  
ATOM  11549  CA  ASN H  64      73.986 163.355  39.958  1.00 14.34           C  
ATOM  11550  C   ASN H  64      72.661 163.864  40.516  1.00 13.07           C  
ATOM  11551  O   ASN H  64      71.825 163.080  40.951  1.00 15.02           O  
ATOM  11552  CB  ASN H  64      75.033 163.338  41.074  1.00 15.98           C  
ATOM  11553  CG  ASN H  64      76.206 162.424  40.768  1.00 20.54           C  
ATOM  11554  OD1 ASN H  64      76.025 161.280  40.362  1.00 26.39           O  
ATOM  11555  ND2 ASN H  64      77.415 162.920  40.980  1.00 23.19           N  
ATOM  11556  N   ASP H  65      72.467 165.177  40.507  1.00 11.66           N  
ATOM  11557  CA  ASP H  65      71.224 165.749  40.998  1.00 12.47           C  
ATOM  11558  C   ASP H  65      70.023 165.388  40.094  1.00 15.43           C  
ATOM  11559  O   ASP H  65      69.053 164.794  40.573  1.00 15.68           O  
ATOM  11560  CB  ASP H  65      71.364 167.270  41.132  1.00 12.56           C  
ATOM  11561  CG  ASP H  65      70.092 167.935  41.646  1.00 18.49           C  
ATOM  11562  OD1 ASP H  65      69.303 167.262  42.340  1.00 23.01           O  
ATOM  11563  OD2 ASP H  65      69.877 169.130  41.363  1.00 14.45           O  
ATOM  11564  N   VAL H  66      70.091 165.722  38.800  1.00 14.69           N  
ATOM  11565  CA  VAL H  66      68.986 165.428  37.875  1.00 17.40           C  
ATOM  11566  C   VAL H  66      68.644 163.942  37.855  1.00 18.24           C  
ATOM  11567  O   VAL H  66      67.482 163.564  37.741  1.00 19.39           O  
ATOM  11568  CB  VAL H  66      69.295 165.885  36.406  1.00 16.99           C  
ATOM  11569  CG1 VAL H  66      68.139 165.539  35.507  1.00 11.49           C  
ATOM  11570  CG2 VAL H  66      69.541 167.373  36.354  1.00 14.44           C  
ATOM  11571  N   PHE H  67      69.672 163.108  37.955  1.00 19.83           N  
ATOM  11572  CA  PHE H  67      69.508 161.659  37.980  1.00 20.33           C  
ATOM  11573  C   PHE H  67      68.629 161.315  39.189  1.00 21.75           C  
ATOM  11574  O   PHE H  67      67.613 160.623  39.083  1.00 21.01           O  
ATOM  11575  CB  PHE H  67      70.885 161.007  38.130  1.00 17.32           C  
ATOM  11576  CG  PHE H  67      70.851 159.512  38.229  1.00 19.59           C  
ATOM  11577  CD1 PHE H  67      71.354 158.726  37.204  1.00 20.61           C  
ATOM  11578  CD2 PHE H  67      70.336 158.883  39.356  1.00 21.42           C  
ATOM  11579  CE1 PHE H  67      71.345 157.331  37.302  1.00 21.39           C  
ATOM  11580  CE2 PHE H  67      70.322 157.491  39.460  1.00 21.94           C  
ATOM  11581  CZ  PHE H  67      70.825 156.718  38.435  1.00 16.81           C  
ATOM  11582  N   GLU H  68      69.048 161.817  40.343  1.00 23.10           N  
ATOM  11583  CA  GLU H  68      68.348 161.587  41.594  1.00 23.44           C  
ATOM  11584  C   GLU H  68      66.879 162.005  41.456  1.00 22.09           C  
ATOM  11585  O   GLU H  68      65.965 161.236  41.776  1.00 18.94           O  
ATOM  11586  CB  GLU H  68      69.039 162.394  42.695  1.00 26.85           C  
ATOM  11587  CG  GLU H  68      69.273 161.669  43.991  1.00 29.00           C  
ATOM  11588  CD  GLU H  68      70.697 161.884  44.519  1.00 35.85           C  
ATOM  11589  OE1 GLU H  68      71.164 163.055  44.563  1.00 32.33           O  
ATOM  11590  OE2 GLU H  68      71.347 160.878  44.894  1.00 36.42           O  
ATOM  11591  N   ARG H  69      66.656 163.222  40.966  1.00 20.13           N  
ATOM  11592  CA  ARG H  69      65.301 163.714  40.802  1.00 19.79           C  
ATOM  11593  C   ARG H  69      64.481 162.859  39.846  1.00 21.63           C  
ATOM  11594  O   ARG H  69      63.293 162.640  40.072  1.00 25.22           O  
ATOM  11595  CB  ARG H  69      65.301 165.151  40.302  1.00 18.04           C  
ATOM  11596  CG  ARG H  69      66.102 166.112  41.138  1.00 20.52           C  
ATOM  11597  CD  ARG H  69      65.679 167.527  40.805  1.00 25.29           C  
ATOM  11598  NE  ARG H  69      66.786 168.477  40.838  1.00 26.12           N  
ATOM  11599  CZ  ARG H  69      66.647 169.774  40.596  1.00 24.00           C  
ATOM  11600  NH1 ARG H  69      65.452 170.266  40.311  1.00 21.67           N  
ATOM  11601  NH2 ARG H  69      67.701 170.573  40.634  1.00 23.78           N  
ATOM  11602  N   ILE H  70      65.098 162.371  38.776  1.00 21.46           N  
ATOM  11603  CA  ILE H  70      64.356 161.553  37.826  1.00 21.28           C  
ATOM  11604  C   ILE H  70      64.124 160.131  38.353  1.00 22.00           C  
ATOM  11605  O   ILE H  70      62.977 159.670  38.418  1.00 23.21           O  
ATOM  11606  CB  ILE H  70      65.060 161.531  36.435  1.00 20.85           C  
ATOM  11607  CG1 ILE H  70      65.049 162.947  35.841  1.00 20.39           C  
ATOM  11608  CG2 ILE H  70      64.338 160.571  35.486  1.00 17.79           C  
ATOM  11609  CD1 ILE H  70      65.859 163.115  34.565  1.00 19.56           C  
ATOM  11610  N   ALA H  71      65.187 159.441  38.747  1.00 19.20           N  
ATOM  11611  CA  ALA H  71      65.026 158.088  39.268  1.00 21.07           C  
ATOM  11612  C   ALA H  71      64.026 158.089  40.421  1.00 21.73           C  
ATOM  11613  O   ALA H  71      63.200 157.183  40.541  1.00 23.84           O  
ATOM  11614  CB  ALA H  71      66.357 157.544  39.747  1.00 21.92           C  
ATOM  11615  N   GLY H  72      64.111 159.114  41.264  1.00 21.25           N  
ATOM  11616  CA  GLY H  72      63.222 159.227  42.402  1.00 22.72           C  
ATOM  11617  C   GLY H  72      61.757 159.256  42.030  1.00 25.44           C  
ATOM  11618  O   GLY H  72      60.962 158.509  42.592  1.00 25.42           O  
ATOM  11619  N   GLU H  73      61.390 160.122  41.087  1.00 27.31           N  
ATOM  11620  CA  GLU H  73      60.002 160.208  40.654  1.00 28.23           C  
ATOM  11621  C   GLU H  73      59.577 158.918  39.961  1.00 27.93           C  
ATOM  11622  O   GLU H  73      58.497 158.394  40.225  1.00 29.28           O  
ATOM  11623  CB  GLU H  73      59.797 161.385  39.700  1.00 29.47           C  
ATOM  11624  CG  GLU H  73      58.378 161.451  39.125  1.00 33.28           C  
ATOM  11625  CD  GLU H  73      57.318 161.725  40.187  1.00 35.18           C  
ATOM  11626  OE1 GLU H  73      56.402 160.887  40.372  1.00 26.47           O  
ATOM  11627  OE2 GLU H  73      57.408 162.793  40.834  1.00 38.91           O  
ATOM  11628  N   ALA H  74      60.417 158.411  39.064  1.00 27.60           N  
ATOM  11629  CA  ALA H  74      60.092 157.175  38.368  1.00 26.79           C  
ATOM  11630  C   ALA H  74      59.763 156.119  39.423  1.00 26.04           C  
ATOM  11631  O   ALA H  74      58.813 155.355  39.282  1.00 25.02           O  
ATOM  11632  CB  ALA H  74      61.265 156.724  37.516  1.00 24.72           C  
ATOM  11633  N   SER H  75      60.555 156.094  40.486  1.00 27.41           N  
ATOM  11634  CA  SER H  75      60.350 155.146  41.581  1.00 28.23           C  
ATOM  11635  C   SER H  75      58.931 155.250  42.139  1.00 27.46           C  
ATOM  11636  O   SER H  75      58.251 154.245  42.318  1.00 26.23           O  
ATOM  11637  CB  SER H  75      61.353 155.411  42.700  1.00 26.88           C  
ATOM  11638  OG  SER H  75      61.351 154.344  43.620  1.00 29.12           O  
ATOM  11639  N   ARG H  76      58.496 156.475  42.414  1.00 27.59           N  
ATOM  11640  CA  ARG H  76      57.159 156.713  42.937  1.00 28.50           C  
ATOM  11641  C   ARG H  76      56.088 156.291  41.950  1.00 28.96           C  
ATOM  11642  O   ARG H  76      55.141 155.608  42.320  1.00 30.25           O  
ATOM  11643  CB  ARG H  76      56.987 158.187  43.293  1.00 28.44           C  
ATOM  11644  CG  ARG H  76      57.862 158.605  44.443  1.00 26.30           C  
ATOM  11645  CD  ARG H  76      57.851 160.101  44.676  1.00 26.07           C  
ATOM  11646  NE  ARG H  76      59.112 160.474  45.302  1.00 26.39           N  
ATOM  11647  CZ  ARG H  76      60.002 161.296  44.763  1.00 28.41           C  
ATOM  11648  NH1 ARG H  76      59.772 161.858  43.583  1.00 28.19           N  
ATOM  11649  NH2 ARG H  76      61.153 161.516  45.385  1.00 33.24           N  
ATOM  11650  N   LEU H  77      56.237 156.699  40.695  1.00 30.23           N  
ATOM  11651  CA  LEU H  77      55.279 156.338  39.653  1.00 30.42           C  
ATOM  11652  C   LEU H  77      55.018 154.836  39.618  1.00 29.45           C  
ATOM  11653  O   LEU H  77      53.869 154.404  39.586  1.00 29.09           O  
ATOM  11654  CB  LEU H  77      55.792 156.785  38.287  1.00 32.26           C  
ATOM  11655  CG  LEU H  77      55.410 158.199  37.871  1.00 34.61           C  
ATOM  11656  CD1 LEU H  77      56.260 158.636  36.689  1.00 37.64           C  
ATOM  11657  CD2 LEU H  77      53.935 158.229  37.516  1.00 34.84           C  
ATOM  11658  N   ALA H  78      56.093 154.053  39.605  1.00 30.13           N  
ATOM  11659  CA  ALA H  78      55.998 152.600  39.576  1.00 32.18           C  
ATOM  11660  C   ALA H  78      55.280 152.086  40.828  1.00 33.75           C  
ATOM  11661  O   ALA H  78      54.409 151.228  40.743  1.00 35.09           O  
ATOM  11662  CB  ALA H  78      57.390 151.992  39.472  1.00 32.20           C  
ATOM  11663  N   HIS H  79      55.648 152.609  41.990  1.00 34.31           N  
ATOM  11664  CA  HIS H  79      54.998 152.205  43.224  1.00 36.38           C  
ATOM  11665  C   HIS H  79      53.507 152.552  43.139  1.00 37.34           C  
ATOM  11666  O   HIS H  79      52.652 151.720  43.428  1.00 38.63           O  
ATOM  11667  CB  HIS H  79      55.625 152.923  44.426  1.00 37.23           C  
ATOM  11668  CG  HIS H  79      56.934 152.345  44.866  1.00 40.99           C  
ATOM  11669  ND1 HIS H  79      58.048 153.122  45.111  1.00 41.79           N  
ATOM  11670  CD2 HIS H  79      57.305 151.067  45.121  1.00 43.05           C  
ATOM  11671  CE1 HIS H  79      59.046 152.347  45.495  1.00 43.40           C  
ATOM  11672  NE2 HIS H  79      58.622 151.096  45.510  1.00 43.01           N  
ATOM  11673  N   TYR H  80      53.195 153.777  42.736  1.00 36.79           N  
ATOM  11674  CA  TYR H  80      51.803 154.199  42.642  1.00 37.77           C  
ATOM  11675  C   TYR H  80      50.959 153.247  41.807  1.00 37.42           C  
ATOM  11676  O   TYR H  80      49.797 153.018  42.114  1.00 38.01           O  
ATOM  11677  CB  TYR H  80      51.687 155.601  42.035  1.00 38.41           C  
ATOM  11678  CG  TYR H  80      52.305 156.723  42.843  1.00 40.16           C  
ATOM  11679  CD1 TYR H  80      52.622 156.561  44.195  1.00 40.33           C  
ATOM  11680  CD2 TYR H  80      52.528 157.969  42.261  1.00 39.77           C  
ATOM  11681  CE1 TYR H  80      53.141 157.618  44.939  1.00 40.60           C  
ATOM  11682  CE2 TYR H  80      53.043 159.025  42.991  1.00 40.05           C  
ATOM  11683  CZ  TYR H  80      53.344 158.849  44.326  1.00 43.18           C  
ATOM  11684  OH  TYR H  80      53.826 159.923  45.043  1.00 45.92           O  
ATOM  11685  N   ASN H  81      51.548 152.699  40.750  1.00 36.94           N  
ATOM  11686  CA  ASN H  81      50.834 151.793  39.857  1.00 36.01           C  
ATOM  11687  C   ASN H  81      51.146 150.328  40.108  1.00 35.74           C  
ATOM  11688  O   ASN H  81      51.042 149.506  39.204  1.00 33.03           O  
ATOM  11689  CB  ASN H  81      51.162 152.147  38.406  1.00 35.88           C  
ATOM  11690  CG  ASN H  81      50.572 153.467  37.990  1.00 34.59           C  
ATOM  11691  OD1 ASN H  81      49.362 153.581  37.826  1.00 35.40           O  
ATOM  11692  ND2 ASN H  81      51.419 154.483  37.834  1.00 32.92           N  
ATOM  11693  N   LYS H  82      51.527 150.014  41.340  1.00 37.76           N  
ATOM  11694  CA  LYS H  82      51.860 148.647  41.736  1.00 38.10           C  
ATOM  11695  C   LYS H  82      52.712 147.888  40.723  1.00 36.74           C  
ATOM  11696  O   LYS H  82      52.374 146.777  40.326  1.00 36.46           O  
ATOM  11697  CB  LYS H  82      50.580 147.855  42.039  1.00 39.44           C  
ATOM  11698  CG  LYS H  82      49.805 148.383  43.243  1.00 45.12           C  
ATOM  11699  CD  LYS H  82      48.508 149.080  42.838  1.00 51.11           C  
ATOM  11700  CE  LYS H  82      47.434 148.073  42.401  1.00 55.57           C  
ATOM  11701  NZ  LYS H  82      46.196 148.692  41.824  1.00 54.13           N  
ATOM  11702  N   ARG H  83      53.815 148.490  40.301  1.00 36.97           N  
ATOM  11703  CA  ARG H  83      54.722 147.841  39.359  1.00 38.81           C  
ATOM  11704  C   ARG H  83      56.016 147.539  40.084  1.00 38.00           C  
ATOM  11705  O   ARG H  83      56.396 148.271  40.990  1.00 39.19           O  
ATOM  11706  CB  ARG H  83      55.006 148.742  38.156  1.00 42.44           C  
ATOM  11707  CG  ARG H  83      54.385 148.226  36.882  1.00 47.22           C  
ATOM  11708  CD  ARG H  83      52.873 148.210  36.984  1.00 51.19           C  
ATOM  11709  NE  ARG H  83      52.279 147.077  36.279  1.00 53.84           N  
ATOM  11710  CZ  ARG H  83      51.044 147.081  35.786  1.00 55.83           C  
ATOM  11711  NH1 ARG H  83      50.286 148.165  35.921  1.00 55.07           N  
ATOM  11712  NH2 ARG H  83      50.564 146.006  35.168  1.00 56.35           N  
ATOM  11713  N   SER H  84      56.695 146.469  39.682  1.00 36.94           N  
ATOM  11714  CA  SER H  84      57.949 146.065  40.319  1.00 36.03           C  
ATOM  11715  C   SER H  84      59.161 146.544  39.531  1.00 34.85           C  
ATOM  11716  O   SER H  84      60.304 146.406  39.979  1.00 33.14           O  
ATOM  11717  CB  SER H  84      58.013 144.540  40.416  1.00 38.12           C  
ATOM  11718  OG  SER H  84      56.741 143.992  40.718  1.00 42.86           O  
ATOM  11719  N   THR H  85      58.914 147.098  38.351  1.00 33.95           N  
ATOM  11720  CA  THR H  85      60.011 147.544  37.503  1.00 32.56           C  
ATOM  11721  C   THR H  85      59.906 148.958  36.973  1.00 30.26           C  
ATOM  11722  O   THR H  85      58.822 149.436  36.652  1.00 30.37           O  
ATOM  11723  CB  THR H  85      60.197 146.581  36.293  1.00 33.91           C  
ATOM  11724  OG1 THR H  85      60.656 147.310  35.145  1.00 34.70           O  
ATOM  11725  CG2 THR H  85      58.897 145.894  35.957  1.00 31.71           C  
ATOM  11726  N   ILE H  86      61.053 149.625  36.906  1.00 28.43           N  
ATOM  11727  CA  ILE H  86      61.135 150.973  36.361  1.00 25.87           C  
ATOM  11728  C   ILE H  86      61.516 150.816  34.889  1.00 23.10           C  
ATOM  11729  O   ILE H  86      62.568 150.279  34.566  1.00 22.83           O  
ATOM  11730  CB  ILE H  86      62.209 151.801  37.092  1.00 28.10           C  
ATOM  11731  CG1 ILE H  86      61.640 152.300  38.422  1.00 26.28           C  
ATOM  11732  CG2 ILE H  86      62.675 152.974  36.212  1.00 28.64           C  
ATOM  11733  CD1 ILE H  86      62.683 152.732  39.394  1.00 26.32           C  
ATOM  11734  N   THR H  87      60.642 151.246  33.996  1.00 21.56           N  
ATOM  11735  CA  THR H  87      60.934 151.134  32.574  1.00 23.10           C  
ATOM  11736  C   THR H  87      61.146 152.524  31.951  1.00 23.76           C  
ATOM  11737  O   THR H  87      60.972 153.559  32.613  1.00 23.88           O  
ATOM  11738  CB  THR H  87      59.781 150.434  31.801  1.00 20.62           C  
ATOM  11739  OG1 THR H  87      58.748 151.388  31.537  1.00 27.14           O  
ATOM  11740  CG2 THR H  87      59.206 149.280  32.609  1.00 17.25           C  
ATOM  11741  N   SER H  88      61.499 152.538  30.673  1.00 22.24           N  
ATOM  11742  CA  SER H  88      61.727 153.777  29.966  1.00 23.13           C  
ATOM  11743  C   SER H  88      60.462 154.626  30.020  1.00 25.51           C  
ATOM  11744  O   SER H  88      60.504 155.840  29.829  1.00 27.86           O  
ATOM  11745  CB  SER H  88      62.092 153.485  28.520  1.00 23.05           C  
ATOM  11746  OG  SER H  88      60.948 153.055  27.820  1.00 25.54           O  
ATOM  11747  N   ARG H  89      59.332 153.992  30.294  1.00 25.57           N  
ATOM  11748  CA  ARG H  89      58.082 154.725  30.367  1.00 26.27           C  
ATOM  11749  C   ARG H  89      58.036 155.570  31.639  1.00 26.62           C  
ATOM  11750  O   ARG H  89      57.676 156.745  31.584  1.00 25.93           O  
ATOM  11751  CB  ARG H  89      56.906 153.749  30.320  1.00 27.77           C  
ATOM  11752  CG  ARG H  89      55.567 154.379  30.007  1.00 31.16           C  
ATOM  11753  CD  ARG H  89      54.518 153.289  29.814  1.00 39.63           C  
ATOM  11754  NE  ARG H  89      53.199 153.827  29.492  1.00 45.13           N  
ATOM  11755  CZ  ARG H  89      52.406 154.435  30.367  1.00 46.99           C  
ATOM  11756  NH1 ARG H  89      52.798 154.575  31.622  1.00 46.27           N  
ATOM  11757  NH2 ARG H  89      51.231 154.918  29.981  1.00 49.41           N  
ATOM  11758  N   GLU H  90      58.398 154.972  32.779  1.00 26.27           N  
ATOM  11759  CA  GLU H  90      58.411 155.689  34.052  1.00 22.88           C  
ATOM  11760  C   GLU H  90      59.482 156.761  33.979  1.00 23.68           C  
ATOM  11761  O   GLU H  90      59.367 157.799  34.628  1.00 26.90           O  
ATOM  11762  CB  GLU H  90      58.742 154.767  35.233  1.00 26.67           C  
ATOM  11763  CG  GLU H  90      57.650 153.794  35.639  1.00 30.04           C  
ATOM  11764  CD  GLU H  90      57.273 152.853  34.526  1.00 32.46           C  
ATOM  11765  OE1 GLU H  90      58.171 152.148  34.012  1.00 29.23           O  
ATOM  11766  OE2 GLU H  90      56.078 152.826  34.163  1.00 36.45           O  
ATOM  11767  N   ILE H  91      60.539 156.517  33.212  1.00 19.90           N  
ATOM  11768  CA  ILE H  91      61.575 157.533  33.097  1.00 19.53           C  
ATOM  11769  C   ILE H  91      61.032 158.684  32.258  1.00 19.15           C  
ATOM  11770  O   ILE H  91      61.336 159.853  32.494  1.00 17.80           O  
ATOM  11771  CB  ILE H  91      62.855 157.009  32.407  1.00 17.38           C  
ATOM  11772  CG1 ILE H  91      63.484 155.885  33.237  1.00 17.39           C  
ATOM  11773  CG2 ILE H  91      63.824 158.164  32.200  1.00  8.74           C  
ATOM  11774  CD1 ILE H  91      63.855 156.280  34.666  1.00 15.44           C  
ATOM  11775  N   GLN H  92      60.211 158.342  31.278  1.00 19.69           N  
ATOM  11776  CA  GLN H  92      59.654 159.355  30.407  1.00 20.96           C  
ATOM  11777  C   GLN H  92      58.682 160.277  31.106  1.00 20.17           C  
ATOM  11778  O   GLN H  92      58.838 161.499  31.045  1.00 21.32           O  
ATOM  11779  CB  GLN H  92      58.971 158.722  29.201  1.00 21.88           C  
ATOM  11780  CG  GLN H  92      58.100 159.704  28.449  1.00 23.33           C  
ATOM  11781  CD  GLN H  92      57.951 159.338  27.004  1.00 22.77           C  
ATOM  11782  OE1 GLN H  92      56.868 159.406  26.453  1.00 26.90           O  
ATOM  11783  NE2 GLN H  92      59.044 158.953  26.378  1.00 24.86           N  
ATOM  11784  N   THR H  93      57.677 159.723  31.772  1.00 19.48           N  
ATOM  11785  CA  THR H  93      56.737 160.612  32.429  1.00 20.37           C  
ATOM  11786  C   THR H  93      57.364 161.293  33.644  1.00 19.91           C  
ATOM  11787  O   THR H  93      56.836 162.288  34.126  1.00 22.19           O  
ATOM  11788  CB  THR H  93      55.403 159.898  32.759  1.00 20.01           C  
ATOM  11789  OG1 THR H  93      55.136 159.938  34.166  1.00 22.60           O  
ATOM  11790  CG2 THR H  93      55.447 158.501  32.266  1.00 20.55           C  
ATOM  11791  N   ALA H  94      58.497 160.779  34.122  1.00 19.02           N  
ATOM  11792  CA  ALA H  94      59.207 161.419  35.233  1.00 18.69           C  
ATOM  11793  C   ALA H  94      59.915 162.645  34.641  1.00 18.98           C  
ATOM  11794  O   ALA H  94      60.080 163.662  35.304  1.00 20.40           O  
ATOM  11795  CB  ALA H  94      60.237 160.481  35.835  1.00 16.57           C  
ATOM  11796  N   VAL H  95      60.343 162.527  33.385  1.00 20.05           N  
ATOM  11797  CA  VAL H  95      61.012 163.614  32.684  1.00 20.14           C  
ATOM  11798  C   VAL H  95      60.011 164.729  32.375  1.00 21.83           C  
ATOM  11799  O   VAL H  95      60.349 165.910  32.430  1.00 22.48           O  
ATOM  11800  CB  VAL H  95      61.647 163.116  31.361  1.00 18.60           C  
ATOM  11801  CG1 VAL H  95      61.958 164.287  30.441  1.00 18.11           C  
ATOM  11802  CG2 VAL H  95      62.928 162.377  31.662  1.00 20.82           C  
ATOM  11803  N   ARG H  96      58.776 164.356  32.059  1.00 22.73           N  
ATOM  11804  CA  ARG H  96      57.765 165.357  31.751  1.00 23.70           C  
ATOM  11805  C   ARG H  96      57.334 166.109  33.003  1.00 22.63           C  
ATOM  11806  O   ARG H  96      56.991 167.291  32.928  1.00 21.52           O  
ATOM  11807  CB  ARG H  96      56.543 164.717  31.085  1.00 25.50           C  
ATOM  11808  CG  ARG H  96      56.783 164.229  29.665  1.00 30.32           C  
ATOM  11809  CD  ARG H  96      55.458 164.123  28.917  1.00 35.63           C  
ATOM  11810  NE  ARG H  96      55.639 163.943  27.482  1.00 38.13           N  
ATOM  11811  CZ  ARG H  96      55.588 162.772  26.857  1.00 41.89           C  
ATOM  11812  NH1 ARG H  96      55.353 161.657  27.540  1.00 41.86           N  
ATOM  11813  NH2 ARG H  96      55.777 162.717  25.544  1.00 44.51           N  
ATOM  11814  N   LEU H  97      57.357 165.418  34.143  1.00 21.13           N  
ATOM  11815  CA  LEU H  97      56.977 166.008  35.433  1.00 22.49           C  
ATOM  11816  C   LEU H  97      58.064 166.916  36.029  1.00 23.46           C  
ATOM  11817  O   LEU H  97      57.763 167.934  36.646  1.00 21.55           O  
ATOM  11818  CB  LEU H  97      56.668 164.905  36.449  1.00 20.03           C  
ATOM  11819  CG  LEU H  97      55.366 164.113  36.319  1.00 19.19           C  
ATOM  11820  CD1 LEU H  97      55.459 162.834  37.129  1.00 17.38           C  
ATOM  11821  CD2 LEU H  97      54.202 164.968  36.779  1.00 17.95           C  
ATOM  11822  N   LEU H  98      59.324 166.545  35.823  1.00 25.51           N  
ATOM  11823  CA  LEU H  98      60.454 167.287  36.364  1.00 27.42           C  
ATOM  11824  C   LEU H  98      61.017 168.460  35.559  1.00 26.34           C  
ATOM  11825  O   LEU H  98      61.370 169.488  36.126  1.00 26.33           O  
ATOM  11826  CB  LEU H  98      61.575 166.302  36.676  1.00 31.14           C  
ATOM  11827  CG  LEU H  98      61.083 165.200  37.617  1.00 36.55           C  
ATOM  11828  CD1 LEU H  98      62.148 164.125  37.764  1.00 38.11           C  
ATOM  11829  CD2 LEU H  98      60.723 165.814  38.970  1.00 37.60           C  
ATOM  11830  N   LEU H  99      61.100 168.321  34.244  1.00 25.85           N  
ATOM  11831  CA  LEU H  99      61.650 169.395  33.427  1.00 25.91           C  
ATOM  11832  C   LEU H  99      60.642 170.460  32.998  1.00 26.11           C  
ATOM  11833  O   LEU H  99      59.481 170.170  32.750  1.00 26.48           O  
ATOM  11834  CB  LEU H  99      62.345 168.796  32.198  1.00 22.60           C  
ATOM  11835  CG  LEU H  99      63.460 167.802  32.566  1.00 24.12           C  
ATOM  11836  CD1 LEU H  99      64.179 167.304  31.317  1.00 19.74           C  
ATOM  11837  CD2 LEU H  99      64.443 168.485  33.508  1.00 24.17           C  
ATOM  11838  N   PRO H 100      61.075 171.725  32.942  1.00 27.69           N  
ATOM  11839  CA  PRO H 100      60.161 172.794  32.525  1.00 28.15           C  
ATOM  11840  C   PRO H 100      59.835 172.569  31.052  1.00 30.51           C  
ATOM  11841  O   PRO H 100      60.665 172.051  30.302  1.00 29.90           O  
ATOM  11842  CB  PRO H 100      60.973 174.062  32.769  1.00 29.40           C  
ATOM  11843  CG  PRO H 100      62.392 173.598  32.588  1.00 31.26           C  
ATOM  11844  CD  PRO H 100      62.398 172.263  33.298  1.00 27.62           C  
ATOM  11845  N   GLY H 101      58.632 172.956  30.643  1.00 31.74           N  
ATOM  11846  CA  GLY H 101      58.212 172.739  29.270  1.00 32.18           C  
ATOM  11847  C   GLY H 101      59.185 173.230  28.229  1.00 32.97           C  
ATOM  11848  O   GLY H 101      59.572 174.388  28.278  1.00 36.18           O  
ATOM  11849  N   GLU H 102      59.570 172.353  27.301  1.00 32.27           N  
ATOM  11850  CA  GLU H 102      60.511 172.655  26.207  1.00 32.59           C  
ATOM  11851  C   GLU H 102      61.778 171.841  26.379  1.00 31.43           C  
ATOM  11852  O   GLU H 102      62.232 171.164  25.454  1.00 31.95           O  
ATOM  11853  CB  GLU H 102      60.889 174.130  26.163  1.00 33.32           C  
ATOM  11854  CG  GLU H 102      61.289 174.623  24.785  1.00 38.83           C  
ATOM  11855  CD  GLU H 102      60.108 174.704  23.834  1.00 42.33           C  
ATOM  11856  OE1 GLU H 102      59.673 173.657  23.306  1.00 42.48           O  
ATOM  11857  OE2 GLU H 102      59.605 175.828  23.631  1.00 46.69           O  
ATOM  11858  N   LEU H 103      62.352 171.929  27.572  1.00 30.28           N  
ATOM  11859  CA  LEU H 103      63.554 171.183  27.910  1.00 27.70           C  
ATOM  11860  C   LEU H 103      63.089 169.721  27.967  1.00 27.89           C  
ATOM  11861  O   LEU H 103      63.855 168.796  27.692  1.00 28.29           O  
ATOM  11862  CB  LEU H 103      64.064 171.667  29.266  1.00 26.58           C  
ATOM  11863  CG  LEU H 103      65.547 171.821  29.610  1.00 26.74           C  
ATOM  11864  CD1 LEU H 103      66.350 172.376  28.449  1.00 18.43           C  
ATOM  11865  CD2 LEU H 103      65.645 172.736  30.829  1.00 22.80           C  
ATOM  11866  N   ALA H 104      61.810 169.528  28.294  1.00 27.28           N  
ATOM  11867  CA  ALA H 104      61.225 168.191  28.362  1.00 28.69           C  
ATOM  11868  C   ALA H 104      60.909 167.620  26.968  1.00 29.47           C  
ATOM  11869  O   ALA H 104      61.147 166.439  26.713  1.00 30.16           O  
ATOM  11870  CB  ALA H 104      59.962 168.207  29.223  1.00 24.90           C  
ATOM  11871  N   LYS H 105      60.376 168.446  26.071  1.00 29.85           N  
ATOM  11872  CA  LYS H 105      60.059 167.982  24.723  1.00 30.70           C  
ATOM  11873  C   LYS H 105      61.322 167.411  24.095  1.00 31.00           C  
ATOM  11874  O   LYS H 105      61.321 166.304  23.559  1.00 31.48           O  
ATOM  11875  CB  LYS H 105      59.545 169.131  23.851  1.00 33.32           C  
ATOM  11876  CG  LYS H 105      59.510 168.790  22.357  1.00 37.61           C  
ATOM  11877  CD  LYS H 105      59.617 170.024  21.457  1.00 39.23           C  
ATOM  11878  CE  LYS H 105      58.364 170.871  21.496  1.00 42.97           C  
ATOM  11879  NZ  LYS H 105      58.529 172.108  20.687  1.00 44.73           N  
ATOM  11880  N   HIS H 106      62.406 168.172  24.179  1.00 31.04           N  
ATOM  11881  CA  HIS H 106      63.688 167.750  23.624  1.00 29.83           C  
ATOM  11882  C   HIS H 106      64.299 166.541  24.326  1.00 26.48           C  
ATOM  11883  O   HIS H 106      64.834 165.654  23.671  1.00 27.40           O  
ATOM  11884  CB  HIS H 106      64.672 168.923  23.652  1.00 32.18           C  
ATOM  11885  CG  HIS H 106      64.236 170.088  22.820  1.00 37.53           C  
ATOM  11886  ND1 HIS H 106      64.803 171.340  22.932  1.00 40.80           N  
ATOM  11887  CD2 HIS H 106      63.280 170.192  21.866  1.00 36.98           C  
ATOM  11888  CE1 HIS H 106      64.211 172.165  22.086  1.00 38.19           C  
ATOM  11889  NE2 HIS H 106      63.284 171.493  21.428  1.00 38.74           N  
ATOM  11890  N   ALA H 107      64.233 166.504  25.652  1.00 24.46           N  
ATOM  11891  CA  ALA H 107      64.790 165.373  26.388  1.00 24.35           C  
ATOM  11892  C   ALA H 107      64.005 164.131  26.002  1.00 23.54           C  
ATOM  11893  O   ALA H 107      64.584 163.078  25.738  1.00 21.05           O  
ATOM  11894  CB  ALA H 107      64.704 165.612  27.898  1.00 23.34           C  
ATOM  11895  N   VAL H 108      62.683 164.279  25.969  1.00 23.60           N  
ATOM  11896  CA  VAL H 108      61.772 163.207  25.594  1.00 23.45           C  
ATOM  11897  C   VAL H 108      62.096 162.649  24.209  1.00 25.26           C  
ATOM  11898  O   VAL H 108      62.061 161.439  24.003  1.00 27.39           O  
ATOM  11899  CB  VAL H 108      60.311 163.714  25.587  1.00 24.43           C  
ATOM  11900  CG1 VAL H 108      59.414 162.737  24.838  1.00 17.24           C  
ATOM  11901  CG2 VAL H 108      59.821 163.910  27.024  1.00 20.41           C  
ATOM  11902  N   SER H 109      62.416 163.523  23.260  1.00 26.97           N  
ATOM  11903  CA  SER H 109      62.725 163.065  21.913  1.00 27.79           C  
ATOM  11904  C   SER H 109      64.133 162.481  21.812  1.00 28.73           C  
ATOM  11905  O   SER H 109      64.374 161.574  21.013  1.00 30.60           O  
ATOM  11906  CB  SER H 109      62.522 164.196  20.889  1.00 29.39           C  
ATOM  11907  OG  SER H 109      63.704 164.938  20.646  1.00 35.05           O  
ATOM  11908  N   GLU H 110      65.071 162.977  22.611  1.00 28.19           N  
ATOM  11909  CA  GLU H 110      66.410 162.405  22.561  1.00 27.91           C  
ATOM  11910  C   GLU H 110      66.340 161.063  23.276  1.00 27.94           C  
ATOM  11911  O   GLU H 110      67.039 160.116  22.928  1.00 28.07           O  
ATOM  11912  CB  GLU H 110      67.434 163.314  23.244  1.00 29.72           C  
ATOM  11913  CG  GLU H 110      67.656 164.648  22.540  1.00 36.84           C  
ATOM  11914  CD  GLU H 110      68.072 164.488  21.077  1.00 41.78           C  
ATOM  11915  OE1 GLU H 110      69.198 164.008  20.818  1.00 38.80           O  
ATOM  11916  OE2 GLU H 110      67.261 164.839  20.184  1.00 45.46           O  
ATOM  11917  N   GLY H 111      65.475 160.979  24.279  1.00 28.94           N  
ATOM  11918  CA  GLY H 111      65.336 159.737  25.012  1.00 29.19           C  
ATOM  11919  C   GLY H 111      64.710 158.682  24.119  1.00 31.42           C  
ATOM  11920  O   GLY H 111      65.281 157.608  23.913  1.00 31.08           O  
ATOM  11921  N   THR H 112      63.536 158.991  23.575  1.00 30.99           N  
ATOM  11922  CA  THR H 112      62.840 158.056  22.704  1.00 30.47           C  
ATOM  11923  C   THR H 112      63.717 157.656  21.523  1.00 27.87           C  
ATOM  11924  O   THR H 112      63.738 156.493  21.127  1.00 26.77           O  
ATOM  11925  CB  THR H 112      61.537 158.659  22.184  1.00 32.03           C  
ATOM  11926  OG1 THR H 112      61.832 159.868  21.481  1.00 38.15           O  
ATOM  11927  CG2 THR H 112      60.600 158.978  23.339  1.00 27.94           C  
ATOM  11928  N   LYS H 113      64.455 158.615  20.975  1.00 27.21           N  
ATOM  11929  CA  LYS H 113      65.346 158.331  19.849  1.00 28.11           C  
ATOM  11930  C   LYS H 113      66.476 157.376  20.220  1.00 27.56           C  
ATOM  11931  O   LYS H 113      66.864 156.533  19.418  1.00 29.60           O  
ATOM  11932  CB  LYS H 113      65.946 159.624  19.301  1.00 31.31           C  
ATOM  11933  CG  LYS H 113      67.177 159.412  18.444  1.00 34.41           C  
ATOM  11934  CD  LYS H 113      67.778 160.730  18.001  1.00 37.66           C  
ATOM  11935  CE  LYS H 113      69.170 160.522  17.442  1.00 42.48           C  
ATOM  11936  NZ  LYS H 113      69.655 161.712  16.673  1.00 47.97           N  
ATOM  11937  N   ALA H 114      67.001 157.499  21.435  1.00 27.06           N  
ATOM  11938  CA  ALA H 114      68.084 156.631  21.877  1.00 25.55           C  
ATOM  11939  C   ALA H 114      67.623 155.193  22.107  1.00 26.25           C  
ATOM  11940  O   ALA H 114      68.347 154.249  21.799  1.00 26.97           O  
ATOM  11941  CB  ALA H 114      68.710 157.179  23.150  1.00 23.84           C  
ATOM  11942  N   VAL H 115      66.424 155.021  22.654  1.00 25.81           N  
ATOM  11943  CA  VAL H 115      65.916 153.680  22.926  1.00 26.90           C  
ATOM  11944  C   VAL H 115      65.548 152.992  21.617  1.00 28.15           C  
ATOM  11945  O   VAL H 115      65.781 151.799  21.443  1.00 27.99           O  
ATOM  11946  CB  VAL H 115      64.681 153.726  23.867  1.00 26.11           C  
ATOM  11947  CG1 VAL H 115      64.083 152.345  24.009  1.00 23.57           C  
ATOM  11948  CG2 VAL H 115      65.091 154.257  25.233  1.00 17.79           C  
ATOM  11949  N   THR H 116      64.977 153.763  20.698  1.00 29.24           N  
ATOM  11950  CA  THR H 116      64.595 153.258  19.392  1.00 27.08           C  
ATOM  11951  C   THR H 116      65.821 152.711  18.677  1.00 27.57           C  
ATOM  11952  O   THR H 116      65.785 151.621  18.123  1.00 30.19           O  
ATOM  11953  CB  THR H 116      63.961 154.370  18.545  1.00 27.79           C  
ATOM  11954  OG1 THR H 116      62.657 154.664  19.057  1.00 28.93           O  
ATOM  11955  CG2 THR H 116      63.843 153.947  17.082  1.00 29.27           C  
ATOM  11956  N   LYS H 117      66.909 153.464  18.693  1.00 27.76           N  
ATOM  11957  CA  LYS H 117      68.129 153.024  18.035  1.00 28.75           C  
ATOM  11958  C   LYS H 117      68.743 151.823  18.744  1.00 32.06           C  
ATOM  11959  O   LYS H 117      69.145 150.850  18.107  1.00 32.97           O  
ATOM  11960  CB  LYS H 117      69.152 154.166  17.991  1.00 26.91           C  
ATOM  11961  CG  LYS H 117      70.484 153.751  17.418  1.00 21.76           C  
ATOM  11962  CD  LYS H 117      71.434 154.917  17.283  1.00 22.50           C  
ATOM  11963  CE  LYS H 117      72.773 154.471  16.686  1.00 22.25           C  
ATOM  11964  NZ  LYS H 117      72.688 154.054  15.247  1.00 20.58           N  
ATOM  11965  N   TYR H 118      68.812 151.905  20.070  1.00 35.81           N  
ATOM  11966  CA  TYR H 118      69.389 150.850  20.890  1.00 38.31           C  
ATOM  11967  C   TYR H 118      68.694 149.506  20.677  1.00 42.07           C  
ATOM  11968  O   TYR H 118      69.361 148.491  20.505  1.00 42.45           O  
ATOM  11969  CB  TYR H 118      69.333 151.250  22.374  1.00 34.56           C  
ATOM  11970  CG  TYR H 118      69.727 150.144  23.325  1.00 31.92           C  
ATOM  11971  CD1 TYR H 118      71.065 149.826  23.548  1.00 31.43           C  
ATOM  11972  CD2 TYR H 118      68.752 149.376  23.960  1.00 32.02           C  
ATOM  11973  CE1 TYR H 118      71.421 148.767  24.379  1.00 32.37           C  
ATOM  11974  CE2 TYR H 118      69.092 148.318  24.786  1.00 31.79           C  
ATOM  11975  CZ  TYR H 118      70.425 148.015  24.990  1.00 34.17           C  
ATOM  11976  OH  TYR H 118      70.752 146.935  25.779  1.00 37.72           O  
ATOM  11977  N   THR H 119      67.361 149.500  20.698  1.00 46.54           N  
ATOM  11978  CA  THR H 119      66.596 148.269  20.501  1.00 50.92           C  
ATOM  11979  C   THR H 119      66.877 147.703  19.113  1.00 53.62           C  
ATOM  11980  O   THR H 119      66.756 146.504  18.880  1.00 55.85           O  
ATOM  11981  CB  THR H 119      65.068 148.509  20.623  1.00 51.78           C  
ATOM  11982  OG1 THR H 119      64.760 149.023  21.922  1.00 51.92           O  
ATOM  11983  CG2 THR H 119      64.309 147.207  20.421  1.00 49.92           C  
ATOM  11984  N   SER H 120      67.251 148.581  18.195  1.00 56.65           N  
ATOM  11985  CA  SER H 120      67.558 148.194  16.825  1.00 60.21           C  
ATOM  11986  C   SER H 120      68.869 147.419  16.725  1.00 62.16           C  
ATOM  11987  O   SER H 120      69.349 147.151  15.626  1.00 62.55           O  
ATOM  11988  CB  SER H 120      67.645 149.448  15.948  1.00 60.73           C  
ATOM  11989  OG  SER H 120      68.155 149.149  14.659  1.00 63.28           O  
ATOM  11990  N   ALA H 121      69.450 147.064  17.866  1.00 64.56           N  
ATOM  11991  CA  ALA H 121      70.714 146.334  17.872  1.00 67.36           C  
ATOM  11992  C   ALA H 121      70.674 145.038  18.688  1.00 68.95           C  
ATOM  11993  O   ALA H 121      69.600 144.532  19.013  1.00 69.05           O  
ATOM  11994  CB  ALA H 121      71.831 147.240  18.382  1.00 66.78           C  
ATOM  11995  N   LYS H 122      71.868 144.529  19.001  1.00 70.52           N  
ATOM  11996  CA  LYS H 122      72.102 143.297  19.763  1.00 71.99           C  
ATOM  11997  C   LYS H 122      72.682 142.223  18.840  1.00 72.97           C  
ATOM  11998  O   LYS H 122      72.726 142.465  17.612  1.00 72.96           O  
ATOM  11999  CB  LYS H 122      70.812 142.771  20.417  1.00 72.63           C  
ATOM  12000  CG  LYS H 122      71.010 141.511  21.257  1.00 74.33           C  
ATOM  12001  CD  LYS H 122      69.749 141.105  22.006  1.00 75.12           C  
ATOM  12002  CE  LYS H 122      70.000 139.874  22.878  1.00 75.73           C  
ATOM  12003  NZ  LYS H 122      68.817 139.497  23.713  1.00 75.81           N  
ATOM  12004  OXT LYS H 122      73.090 141.156  19.351  1.00 73.17           O  
TER   12005      LYS H 122                                                      
HETATM12006 MN    MN I 436      32.813 154.047  61.392  1.00 71.99          MN  
HETATM12007 MN    MN I 437      87.873 213.861  30.071  1.00 85.39          MN  
HETATM12008 MN    MN I 438      33.037 148.927  27.972  1.00 74.23          MN  
HETATM12009 MN    MN I 439      93.607 199.928  53.167  1.00 82.11          MN  
HETATM12010 MN    MN J 435      18.414 190.171  81.100  1.00 77.41          MN  
HETATM12011 MN    MN A 434      79.384 176.954  73.606  1.00 24.01          MN  
HETATM12012 CL    CL A 442      62.533 198.487  61.482  1.00 48.55          CL  
HETATM12013 CL    CL C 441      67.680 146.862  64.231  1.00 43.93          CL  
HETATM12014 CL    CL E 443      48.809 197.814  41.840  1.00 55.57          CL  
HETATM12015 CL    CL G 440      62.501 149.512  29.594  1.00 36.93          CL  
HETATM12016  O   HOH I 440      28.121 194.462  48.438  1.00 51.07           O  
HETATM12017  O   HOH I 441      27.569 190.724  68.104  1.00 60.78           O  
HETATM12018  O   HOH I 442      57.929 124.370  60.315  1.00 58.84           O  
HETATM12019  O   HOH I 443      78.004 140.678  63.125  1.00 58.49           O  
HETATM12020  O   HOH I 444      92.992 162.876  56.599  1.00 27.80           O  
HETATM12021  O   HOH I 445      34.069 213.743  46.536  1.00 29.81           O  
HETATM12022  O   HOH I 446      25.087 158.123  30.437  1.00 61.54           O  
HETATM12023  O   HOH I 447      57.251 139.565  29.955  1.00 65.72           O  
HETATM12024  O   HOH I 448      37.243 138.167  55.518  1.00 52.66           O  
HETATM12025  O   HOH I 449      31.818 185.656  64.234  1.00 43.70           O  
HETATM12026  O   HOH I 450      32.974 130.702  56.033  1.00 43.88           O  
HETATM12027  O   HOH I 451      28.822 155.487  31.500  1.00 33.18           O  
HETATM12028  O   HOH I 452      95.016 198.725  50.394  1.00 60.38           O  
HETATM12029  O   HOH I 453      79.710 217.331  63.468  1.00 35.63           O  
HETATM12030  O   HOH I 454      34.829 151.107  38.809  1.00 48.64           O  
HETATM12031  O   HOH I 455      33.787 203.161  51.859  1.00 56.44           O  
HETATM12032  O   HOH I 456      62.459 206.282  46.776  1.00 39.68           O  
HETATM12033  O   HOH I 457      24.295 149.798  37.058  1.00 44.92           O  
HETATM12034  O   HOH I 458      27.21