PDB Short entry for 1KX4
HEADER    STRUCTURAL PROTEIN/DNA                  31-JAN-02   1KX4              
TITLE     X-RAY STRUCTURE OF THE NUCLEOSOME CORE PARTICLE, NCP146B,             
TITLE    2 AT 2.6 A RESOLUTION                                                  
COMPND    MOL_ID: 1;                                                            
COMPND   2 MOLECULE: DNA                                                        
COMPND   3 (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAA          
COMPND   4 AGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACT          
COMPND   5 TTTTCTACGATCCGCAAGGGATATTTGGAGAT)3');                                
COMPND   6 CHAIN: I, J;                                                         
COMPND   7 ENGINEERED: YES;                                                     
COMPND   8 OTHER_DETAILS: PALINDROMIC 146 BASE PAIR DNA DUPLEX;                 
COMPND   9 MOL_ID: 2;                                                           
COMPND  10 MOLECULE: HISTONE H3;                                                
COMPND  11 CHAIN: A, E;                                                         
COMPND  12 ENGINEERED: YES;                                                     
COMPND  13 MOL_ID: 3;                                                           
COMPND  14 MOLECULE: HISTONE H4;                                                
COMPND  15 CHAIN: B, F;                                                         
COMPND  16 ENGINEERED: YES;                                                     
COMPND  17 MOL_ID: 4;                                                           
COMPND  18 MOLECULE: HISTONE H2A.1;                                             
COMPND  19 CHAIN: C, G;                                                         
COMPND  20 ENGINEERED: YES;                                                     
COMPND  21 MOL_ID: 5;                                                           
COMPND  22 MOLECULE: HISTONE H2B.2;                                             
COMPND  23 CHAIN: D, H;                                                         
COMPND  24 ENGINEERED: YES                                                      
SOURCE    MOL_ID: 1;                                                            
SOURCE   2 ORGANISM_SCIENTIFIC: HOMO SAPIENS;                                   
SOURCE   3 ORGANISM_COMMON: HUMAN;                                              
SOURCE   4 ORGANISM_TAXID: 9606;                                                
SOURCE   5 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE   6 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE   7 OTHER_DETAILS: DNA SEQUENCE SYNTHESIZED, CLONED,                     
SOURCE   8 MULTIMERIZED, AND EXCISED FROM PLASMID;                              
SOURCE   9 MOL_ID: 2;                                                           
SOURCE  10 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  11 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  12 ORGANISM_TAXID: 8355;                                                
SOURCE  13 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  14 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE  15 MOL_ID: 3;                                                           
SOURCE  16 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  17 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  18 ORGANISM_TAXID: 8355;                                                
SOURCE  19 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  20 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE  21 MOL_ID: 4;                                                           
SOURCE  22 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  23 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  24 ORGANISM_TAXID: 8355;                                                
SOURCE  25 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  26 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE  27 MOL_ID: 5;                                                           
SOURCE  28 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  29 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  30 ORGANISM_TAXID: 8355;                                                
SOURCE  31 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  32 EXPRESSION_SYSTEM_TAXID: 562                                         
KEYWDS    NUCLEOSOME, CHROMATIN, HISTONE, PROTEIN-DNA INTERACTION,              
KEYWDS   2 NUCLEOPROTEIN, SUPERCOILED DNA, NUCLEOSOME CORE, PROTEIN-            
KEYWDS   3 DNA COMPLEX, STRUCTURAL PROTEIN/DNA COMPLEX                          
EXPDTA    X-RAY DIFFRACTION                                                     
AUTHOR    C.A.DAVEY,D.F.SARGENT,K.LUGER,A.W.MAEDER,T.J.RICHMOND                 
REVDAT   2   24-FEB-09 1KX4    1       VERSN                                    
REVDAT   1   25-DEC-02 1KX4    0                                                
JRNL        AUTH   C.A.DAVEY,D.F.SARGENT,K.LUGER,A.W.MAEDER,                    
JRNL        AUTH 2 T.J.RICHMOND                                                 
JRNL        TITL   SOLVENT MEDIATED INTERACTIONS IN THE STRUCTURE OF            
JRNL        TITL 2 THE NUCLEOSOME CORE PARTICLE AT 1.9 A RESOLUTION             
JRNL        REF    J.MOL.BIOL.                   V. 319  1097 2002              
JRNL        REFN                   ISSN 0022-2836                               
JRNL        PMID   12079350                                                     
JRNL        DOI    10.1016/S0022-2836(02)00386-8                                
REMARK   1                                                                      
REMARK   1 REFERENCE 1                                                          
REMARK   1  AUTH   K.LUGER,A.W.MAEDER,R.K.RICHMOND,D.F.SARGENT,                 
REMARK   1  AUTH 2 T.J.RICHMOND                                                 
REMARK   1  TITL   CRYSTAL STRUCTURE OF THE NUCLEOSOME CORE PARTICLE            
REMARK   1  TITL 2 AT 2.8 A RESOLUTION                                          
REMARK   1  REF    NATURE                        V. 389   251 1997              
REMARK   1  REFN                   ISSN 0028-0836                               
REMARK   1  DOI    10.1038/38444                                                
REMARK   2                                                                      
REMARK   2 RESOLUTION.    2.60 ANGSTROMS.                                       
REMARK   3                                                                      
REMARK   3 REFINEMENT.                                                          
REMARK   3   PROGRAM     : CNS 0.5                                              
REMARK   3   AUTHORS     : BRUNGER,ADAMS,CLORE,DELANO,GROS,GROSSE-              
REMARK   3               : KUNSTLEVE,JIANG,KUSZEWSKI,NILGES, PANNU,             
REMARK   3               : READ,RICE,SIMONSON,WARREN                            
REMARK   3                                                                      
REMARK   3  REFINEMENT TARGET : ENGH & HUBER                                    
REMARK   3                                                                      
REMARK   3  DATA USED IN REFINEMENT.                                            
REMARK   3   RESOLUTION RANGE HIGH (ANGSTROMS) : 2.60                           
REMARK   3   RESOLUTION RANGE LOW  (ANGSTROMS) : 6.00                           
REMARK   3   DATA CUTOFF            (SIGMA(F)) : 0.000                          
REMARK   3   DATA CUTOFF HIGH         (ABS(F)) : 2275168.460                    
REMARK   3   DATA CUTOFF LOW          (ABS(F)) : 0.0000                         
REMARK   3   COMPLETENESS (WORKING+TEST)   (%) : 91.6                           
REMARK   3   NUMBER OF REFLECTIONS             : 52906                          
REMARK   3                                                                      
REMARK   3  FIT TO DATA USED IN REFINEMENT.                                     
REMARK   3   CROSS-VALIDATION METHOD          : THROUGHOUT                      
REMARK   3   FREE R VALUE TEST SET SELECTION  : RANDOM                          
REMARK   3   R VALUE            (WORKING SET) : 0.246                           
REMARK   3   FREE R VALUE                     : 0.300                           
REMARK   3   FREE R VALUE TEST SET SIZE   (%) : 2.000                           
REMARK   3   FREE R VALUE TEST SET COUNT      : 1043                            
REMARK   3   ESTIMATED ERROR OF FREE R VALUE  : 0.009                           
REMARK   3                                                                      
REMARK   3  FIT IN THE HIGHEST RESOLUTION BIN.                                  
REMARK   3   TOTAL NUMBER OF BINS USED           : 6                            
REMARK   3   BIN RESOLUTION RANGE HIGH       (A) : 2.60                         
REMARK   3   BIN RESOLUTION RANGE LOW        (A) : 2.75                         
REMARK   3   BIN COMPLETENESS (WORKING+TEST) (%) : 79.90                        
REMARK   3   REFLECTIONS IN BIN    (WORKING SET) : 7486                         
REMARK   3   BIN R VALUE           (WORKING SET) : 0.3260                       
REMARK   3   BIN FREE R VALUE                    : 0.3740                       
REMARK   3   BIN FREE R VALUE TEST SET SIZE  (%) : 1.80                         
REMARK   3   BIN FREE R VALUE TEST SET COUNT     : 134                          
REMARK   3   ESTIMATED ERROR OF BIN FREE R VALUE : 0.032                        
REMARK   3                                                                      
REMARK   3  NUMBER OF NON-HYDROGEN ATOMS USED IN REFINEMENT.                    
REMARK   3   PROTEIN ATOMS            : 6015                                    
REMARK   3   NUCLEIC ACID ATOMS       : 5980                                    
REMARK   3   HETEROGEN ATOMS          : 10                                      
REMARK   3   SOLVENT ATOMS            : 433                                     
REMARK   3                                                                      
REMARK   3  B VALUES.                                                           
REMARK   3   FROM WILSON PLOT           (A**2) : 54.80                          
REMARK   3   MEAN B VALUE      (OVERALL, A**2) : 51.60                          
REMARK   3   OVERALL ANISOTROPIC B VALUE.                                       
REMARK   3    B11 (A**2) : 5.75000                                              
REMARK   3    B22 (A**2) : 6.40000                                              
REMARK   3    B33 (A**2) : -12.15000                                            
REMARK   3    B12 (A**2) : 0.00000                                              
REMARK   3    B13 (A**2) : 0.00000                                              
REMARK   3    B23 (A**2) : 0.00000                                              
REMARK   3                                                                      
REMARK   3  ESTIMATED COORDINATE ERROR.                                         
REMARK   3   ESD FROM LUZZATI PLOT        (A) : 0.35                            
REMARK   3   ESD FROM SIGMAA              (A) : 0.12                            
REMARK   3   LOW RESOLUTION CUTOFF        (A) : 6.00                            
REMARK   3                                                                      
REMARK   3  CROSS-VALIDATED ESTIMATED COORDINATE ERROR.                         
REMARK   3   ESD FROM C-V LUZZATI PLOT    (A) : 0.44                            
REMARK   3   ESD FROM C-V SIGMAA          (A) : 0.20                            
REMARK   3                                                                      
REMARK   3  RMS DEVIATIONS FROM IDEAL VALUES.                                   
REMARK   3   BOND LENGTHS                 (A) : 0.006                           
REMARK   3   BOND ANGLES            (DEGREES) : 1.00                            
REMARK   3   DIHEDRAL ANGLES        (DEGREES) : 18.50                           
REMARK   3   IMPROPER ANGLES        (DEGREES) : 1.00                            
REMARK   3                                                                      
REMARK   3  ISOTROPIC THERMAL MODEL : RESTRAINED                                
REMARK   3                                                                      
REMARK   3  ISOTROPIC THERMAL FACTOR RESTRAINTS.    RMS    SIGMA                
REMARK   3   MAIN-CHAIN BOND              (A**2) : 1.590 ; 1.500                
REMARK   3   MAIN-CHAIN ANGLE             (A**2) : 2.580 ; 2.000                
REMARK   3   SIDE-CHAIN BOND              (A**2) : 2.070 ; 2.000                
REMARK   3   SIDE-CHAIN ANGLE             (A**2) : 3.030 ; 2.500                
REMARK   3                                                                      
REMARK   3  BULK SOLVENT MODELING.                                              
REMARK   3   METHOD USED : NULL                                                 
REMARK   3   KSOL        : NULL                                                 
REMARK   3   BSOL        : NULL                                                 
REMARK   3                                                                      
REMARK   3  NCS MODEL : NULL                                                    
REMARK   3                                                                      
REMARK   3  NCS RESTRAINTS.                         RMS   SIGMA/WEIGHT          
REMARK   3   GROUP  1  POSITIONAL            (A) : NULL  ; NULL                 
REMARK   3   GROUP  1  B-FACTOR           (A**2) : NULL  ; NULL                 
REMARK   3                                                                      
REMARK   3  PARAMETER FILE  1  : PROTEIN_REP.PARAM                              
REMARK   3  PARAMETER FILE  2  : DNA-RNA_REP.PARAM                              
REMARK   3  PARAMETER FILE  3  : WATER_REP.PARAM                                
REMARK   3  PARAMETER FILE  4  : ION.PARAM                                      
REMARK   3  PARAMETER FILE  5  : NULL                                           
REMARK   3  TOPOLOGY FILE  1   : PROTEIN.TOP                                    
REMARK   3  TOPOLOGY FILE  2   : DNA-RNA.TOP                                    
REMARK   3  TOPOLOGY FILE  3   : WATER.TOP                                      
REMARK   3  TOPOLOGY FILE  4   : ION.TOP                                        
REMARK   3  TOPOLOGY FILE  5   : NULL                                           
REMARK   3                                                                      
REMARK   3  OTHER REFINEMENT REMARKS: NULL                                      
REMARK   4                                                                      
REMARK   4 1KX4 COMPLIES WITH FORMAT V. 3.15, 01-DEC-08                         
REMARK 100                                                                      
REMARK 100 THIS ENTRY HAS BEEN PROCESSED BY RCSB ON 08-FEB-02.                  
REMARK 100 THE RCSB ID CODE IS RCSB015430.                                      
REMARK 200                                                                      
REMARK 200 EXPERIMENTAL DETAILS                                                 
REMARK 200  EXPERIMENT TYPE                : X-RAY DIFFRACTION                  
REMARK 200  DATE OF DATA COLLECTION        : 02-JUN-96                          
REMARK 200  TEMPERATURE           (KELVIN) : 103                                
REMARK 200  PH                             : 6.0                                
REMARK 200  NUMBER OF CRYSTALS USED        : 5                                  
REMARK 200                                                                      
REMARK 200  SYNCHROTRON              (Y/N) : Y                                  
REMARK 200  RADIATION SOURCE               : ESRF                               
REMARK 200  BEAMLINE                       : ID09                               
REMARK 200  X-RAY GENERATOR MODEL          : NULL                               
REMARK 200  MONOCHROMATIC OR LAUE    (M/L) : M                                  
REMARK 200  WAVELENGTH OR RANGE        (A) : 0.85                               
REMARK 200  MONOCHROMATOR                  : SI 111 CHANNEL                     
REMARK 200  OPTICS                         : NULL                               
REMARK 200                                                                      
REMARK 200  DETECTOR TYPE                  : IMAGE PLATE                        
REMARK 200  DETECTOR MANUFACTURER          : MARRESEARCH                        
REMARK 200  INTENSITY-INTEGRATION SOFTWARE : DENZO                              
REMARK 200  DATA SCALING SOFTWARE          : SCALEPACK                          
REMARK 200                                                                      
REMARK 200  NUMBER OF UNIQUE REFLECTIONS   : 60481                              
REMARK 200  RESOLUTION RANGE HIGH      (A) : 2.600                              
REMARK 200  RESOLUTION RANGE LOW       (A) : 30.000                             
REMARK 200  REJECTION CRITERIA  (SIGMA(I)) : 1.000                              
REMARK 200                                                                      
REMARK 200 OVERALL.                                                             
REMARK 200  COMPLETENESS FOR RANGE     (%) : 89.5                               
REMARK 200  DATA REDUNDANCY                : 3.700                              
REMARK 200  R MERGE                    (I) : 0.07200                            
REMARK 200  R SYM                      (I) : NULL                               
REMARK 200  <I/SIGMA(I)> FOR THE DATA SET  : NULL                               
REMARK 200                                                                      
REMARK 200 IN THE HIGHEST RESOLUTION SHELL.                                     
REMARK 200  HIGHEST RESOLUTION SHELL, RANGE HIGH (A) : 2.60                     
REMARK 200  HIGHEST RESOLUTION SHELL, RANGE LOW  (A) : 2.69                     
REMARK 200  COMPLETENESS FOR SHELL     (%) : 45.7                               
REMARK 200  DATA REDUNDANCY IN SHELL       : NULL                               
REMARK 200  R MERGE FOR SHELL          (I) : 0.15700                            
REMARK 200  R SYM FOR SHELL            (I) : NULL                               
REMARK 200  <I/SIGMA(I)> FOR SHELL         : NULL                               
REMARK 200                                                                      
REMARK 200 DIFFRACTION PROTOCOL: SINGLE WAVELENGTH                              
REMARK 200 METHOD USED TO DETERMINE THE STRUCTURE: MOLECULAR REPLACEMENT        
REMARK 200 SOFTWARE USED: CNS                                                   
REMARK 200 STARTING MODEL: PDB ENTRY 1AOI                                       
REMARK 200                                                                      
REMARK 200 REMARK: NULL                                                         
REMARK 280                                                                      
REMARK 280 CRYSTAL                                                              
REMARK 280 SOLVENT CONTENT, VS   (%): 50.93                                     
REMARK 280 MATTHEWS COEFFICIENT, VM (ANGSTROMS**3/DA): 2.51                     
REMARK 280                                                                      
REMARK 280 CRYSTALLIZATION CONDITIONS: MANGANESE CHLORIDE, POTASSIUM            
REMARK 280  CHLORIDE, POTASSIUM CACODYLATE, PH 6.0, VAPOR DIFFUSION,            
REMARK 280  SITTING DROP, TEMPERATURE 293K                                      
REMARK 290                                                                      
REMARK 290 CRYSTALLOGRAPHIC SYMMETRY                                            
REMARK 290 SYMMETRY OPERATORS FOR SPACE GROUP: P 21 21 21                       
REMARK 290                                                                      
REMARK 290      SYMOP   SYMMETRY                                                
REMARK 290     NNNMMM   OPERATOR                                                
REMARK 290       1555   X,Y,Z                                                   
REMARK 290       2555   -X+1/2,-Y,Z+1/2                                         
REMARK 290       3555   -X,Y+1/2,-Z+1/2                                         
REMARK 290       4555   X+1/2,-Y+1/2,-Z                                         
REMARK 290                                                                      
REMARK 290     WHERE NNN -> OPERATOR NUMBER                                     
REMARK 290           MMM -> TRANSLATION VECTOR                                  
REMARK 290                                                                      
REMARK 290 CRYSTALLOGRAPHIC SYMMETRY TRANSFORMATIONS                            
REMARK 290 THE FOLLOWING TRANSFORMATIONS OPERATE ON THE ATOM/HETATM             
REMARK 290 RECORDS IN THIS ENTRY TO PRODUCE CRYSTALLOGRAPHICALLY                
REMARK 290 RELATED MOLECULES.                                                   
REMARK 290   SMTRY1   1  1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY2   1  0.000000  1.000000  0.000000        0.00000            
REMARK 290   SMTRY3   1  0.000000  0.000000  1.000000        0.00000            
REMARK 290   SMTRY1   2 -1.000000  0.000000  0.000000       52.65000            
REMARK 290   SMTRY2   2  0.000000 -1.000000  0.000000        0.00000            
REMARK 290   SMTRY3   2  0.000000  0.000000  1.000000       54.76500            
REMARK 290   SMTRY1   3 -1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY2   3  0.000000  1.000000  0.000000       87.84500            
REMARK 290   SMTRY3   3  0.000000  0.000000 -1.000000       54.76500            
REMARK 290   SMTRY1   4  1.000000  0.000000  0.000000       52.65000            
REMARK 290   SMTRY2   4  0.000000 -1.000000  0.000000       87.84500            
REMARK 290   SMTRY3   4  0.000000  0.000000 -1.000000        0.00000            
REMARK 290                                                                      
REMARK 290 REMARK: NULL                                                         
REMARK 300                                                                      
REMARK 300 BIOMOLECULE: 1                                                       
REMARK 300 SEE REMARK 350 FOR THE AUTHOR PROVIDED AND/OR PROGRAM                
REMARK 300 GENERATED ASSEMBLY INFORMATION FOR THE STRUCTURE IN                  
REMARK 300 THIS ENTRY. THE REMARK MAY ALSO PROVIDE INFORMATION ON               
REMARK 300 BURIED SURFACE AREA.                                                 
REMARK 350                                                                      
REMARK 350 COORDINATES FOR A COMPLETE MULTIMER REPRESENTING THE KNOWN           
REMARK 350 BIOLOGICALLY SIGNIFICANT OLIGOMERIZATION STATE OF THE                
REMARK 350 MOLECULE CAN BE GENERATED BY APPLYING BIOMT TRANSFORMATIONS          
REMARK 350 GIVEN BELOW.  BOTH NON-CRYSTALLOGRAPHIC AND                          
REMARK 350 CRYSTALLOGRAPHIC OPERATIONS ARE GIVEN.                               
REMARK 350                                                                      
REMARK 350 BIOMOLECULE: 1                                                       
REMARK 350 AUTHOR DETERMINED BIOLOGICAL UNIT: DECAMERIC                         
REMARK 350 APPLY THE FOLLOWING TO CHAINS: I, J, A, B, C, D, E, F, G, H          
REMARK 350   BIOMT1   1  1.000000  0.000000  0.000000        0.00000            
REMARK 350   BIOMT2   1  0.000000  1.000000  0.000000        0.00000            
REMARK 350   BIOMT3   1  0.000000  0.000000  1.000000        0.00000            
REMARK 465                                                                      
REMARK 465 MISSING RESIDUES                                                     
REMARK 465 THE FOLLOWING RESIDUES WERE NOT LOCATED IN THE                       
REMARK 465 EXPERIMENT. (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN               
REMARK 465 IDENTIFIER; SSSEQ=SEQUENCE NUMBER; I=INSERTION CODE.)                
REMARK 465                                                                      
REMARK 465   M RES C SSSEQI                                                     
REMARK 465     ALA A     1                                                      
REMARK 465     ARG A     2                                                      
REMARK 465     THR A     3                                                      
REMARK 465     LYS A     4                                                      
REMARK 465     GLN A     5                                                      
REMARK 465     THR A     6                                                      
REMARK 465     ALA A     7                                                      
REMARK 465     ARG A     8                                                      
REMARK 465     LYS A     9                                                      
REMARK 465     SER A    10                                                      
REMARK 465     THR A    11                                                      
REMARK 465     GLY A    12                                                      
REMARK 465     GLY A    13                                                      
REMARK 465     LYS A    14                                                      
REMARK 465     ALA A    15                                                      
REMARK 465     PRO A    16                                                      
REMARK 465     ARG A    17                                                      
REMARK 465     LYS A    18                                                      
REMARK 465     GLN A    19                                                      
REMARK 465     LEU A    20                                                      
REMARK 465     ALA A    21                                                      
REMARK 465     THR A    22                                                      
REMARK 465     LYS A    23                                                      
REMARK 465     ALA A    24                                                      
REMARK 465     ALA A    25                                                      
REMARK 465     ARG A    26                                                      
REMARK 465     LYS A    27                                                      
REMARK 465     SER A    28                                                      
REMARK 465     ALA A    29                                                      
REMARK 465     PRO A    30                                                      
REMARK 465     ALA A    31                                                      
REMARK 465     THR A    32                                                      
REMARK 465     GLY A    33                                                      
REMARK 465     GLY A    34                                                      
REMARK 465     VAL A    35                                                      
REMARK 465     LYS A    36                                                      
REMARK 465     LYS A    37                                                      
REMARK 465     SER B     1                                                      
REMARK 465     GLY B     2                                                      
REMARK 465     ARG B     3                                                      
REMARK 465     GLY B     4                                                      
REMARK 465     LYS B     5                                                      
REMARK 465     GLY B     6                                                      
REMARK 465     GLY B     7                                                      
REMARK 465     LYS B     8                                                      
REMARK 465     GLY B     9                                                      
REMARK 465     LEU B    10                                                      
REMARK 465     GLY B    11                                                      
REMARK 465     LYS B    12                                                      
REMARK 465     GLY B    13                                                      
REMARK 465     GLY B    14                                                      
REMARK 465     ALA B    15                                                      
REMARK 465     LYS B    16                                                      
REMARK 465     ARG B    17                                                      
REMARK 465     HIS B    18                                                      
REMARK 465     ARG B    19                                                      
REMARK 465     SER C     1                                                      
REMARK 465     GLY C     2                                                      
REMARK 465     ARG C     3                                                      
REMARK 465     GLY C     4                                                      
REMARK 465     LYS C     5                                                      
REMARK 465     GLN C     6                                                      
REMARK 465     GLY C     7                                                      
REMARK 465     GLY C     8                                                      
REMARK 465     LYS C     9                                                      
REMARK 465     THR C    10                                                      
REMARK 465     ARG C    11                                                      
REMARK 465     ALA C    12                                                      
REMARK 465     LYS C    13                                                      
REMARK 465     ALA C    14                                                      
REMARK 465     LYS C    15                                                      
REMARK 465     LYS C   119                                                      
REMARK 465     THR C   120                                                      
REMARK 465     GLU C   121                                                      
REMARK 465     SER C   122                                                      
REMARK 465     SER C   123                                                      
REMARK 465     LYS C   124                                                      
REMARK 465     SER C   125                                                      
REMARK 465     LYS C   126                                                      
REMARK 465     SER C   127                                                      
REMARK 465     LYS C   128                                                      
REMARK 465     PRO D    -2                                                      
REMARK 465     GLU D    -1                                                      
REMARK 465     PRO D     0                                                      
REMARK 465     ALA D     1                                                      
REMARK 465     LYS D     2                                                      
REMARK 465     SER D     3                                                      
REMARK 465     ALA D     4                                                      
REMARK 465     PRO D     5                                                      
REMARK 465     ALA D     6                                                      
REMARK 465     PRO D     7                                                      
REMARK 465     LYS D     8                                                      
REMARK 465     LYS D     9                                                      
REMARK 465     GLY D    10                                                      
REMARK 465     SER D    11                                                      
REMARK 465     LYS D    12                                                      
REMARK 465     LYS D    13                                                      
REMARK 465     ALA D    14                                                      
REMARK 465     VAL D    15                                                      
REMARK 465     THR D    16                                                      
REMARK 465     LYS D    17                                                      
REMARK 465     THR D    18                                                      
REMARK 465     GLN D    19                                                      
REMARK 465     LYS D    20                                                      
REMARK 465     LYS D    21                                                      
REMARK 465     ASP D    22                                                      
REMARK 465     GLY D    23                                                      
REMARK 465     ALA E     1                                                      
REMARK 465     ARG E     2                                                      
REMARK 465     THR E     3                                                      
REMARK 465     LYS E     4                                                      
REMARK 465     GLN E     5                                                      
REMARK 465     THR E     6                                                      
REMARK 465     ALA E     7                                                      
REMARK 465     ARG E     8                                                      
REMARK 465     LYS E     9                                                      
REMARK 465     SER E    10                                                      
REMARK 465     THR E    11                                                      
REMARK 465     GLY E    12                                                      
REMARK 465     GLY E    13                                                      
REMARK 465     LYS E    14                                                      
REMARK 465     ALA E    15                                                      
REMARK 465     PRO E    16                                                      
REMARK 465     ARG E    17                                                      
REMARK 465     LYS E    18                                                      
REMARK 465     GLN E    19                                                      
REMARK 465     LEU E    20                                                      
REMARK 465     ALA E    21                                                      
REMARK 465     THR E    22                                                      
REMARK 465     LYS E    23                                                      
REMARK 465     ALA E    24                                                      
REMARK 465     ALA E    25                                                      
REMARK 465     ARG E    26                                                      
REMARK 465     LYS E    27                                                      
REMARK 465     SER E    28                                                      
REMARK 465     ALA E    29                                                      
REMARK 465     PRO E    30                                                      
REMARK 465     ALA E    31                                                      
REMARK 465     THR E    32                                                      
REMARK 465     GLY E    33                                                      
REMARK 465     GLY E    34                                                      
REMARK 465     VAL E    35                                                      
REMARK 465     LYS E    36                                                      
REMARK 465     LYS E    37                                                      
REMARK 465     PRO E    38                                                      
REMARK 465     SER F     1                                                      
REMARK 465     GLY F     2                                                      
REMARK 465     ARG F     3                                                      
REMARK 465     GLY F     4                                                      
REMARK 465     LYS F     5                                                      
REMARK 465     GLY F     6                                                      
REMARK 465     GLY F     7                                                      
REMARK 465     LYS F     8                                                      
REMARK 465     GLY F     9                                                      
REMARK 465     LEU F    10                                                      
REMARK 465     GLY F    11                                                      
REMARK 465     LYS F    12                                                      
REMARK 465     GLY F    13                                                      
REMARK 465     GLY F    14                                                      
REMARK 465     ALA F    15                                                      
REMARK 465     LYS F    16                                                      
REMARK 465     ARG F    17                                                      
REMARK 465     HIS F    18                                                      
REMARK 465     ARG F    19                                                      
REMARK 465     LYS F    20                                                      
REMARK 465     VAL F    21                                                      
REMARK 465     LEU F    22                                                      
REMARK 465     ARG F    23                                                      
REMARK 465     ASP F    24                                                      
REMARK 465     SER G     1                                                      
REMARK 465     GLY G     2                                                      
REMARK 465     ARG G     3                                                      
REMARK 465     GLY G     4                                                      
REMARK 465     LYS G     5                                                      
REMARK 465     GLN G     6                                                      
REMARK 465     GLY G     7                                                      
REMARK 465     GLY G     8                                                      
REMARK 465     LYS G     9                                                      
REMARK 465     THR G    10                                                      
REMARK 465     ARG G    11                                                      
REMARK 465     ALA G    12                                                      
REMARK 465     LYS G    13                                                      
REMARK 465     LYS G   119                                                      
REMARK 465     THR G   120                                                      
REMARK 465     GLU G   121                                                      
REMARK 465     SER G   122                                                      
REMARK 465     SER G   123                                                      
REMARK 465     LYS G   124                                                      
REMARK 465     SER G   125                                                      
REMARK 465     LYS G   126                                                      
REMARK 465     SER G   127                                                      
REMARK 465     LYS G   128                                                      
REMARK 465     PRO H    -2                                                      
REMARK 465     GLU H    -1                                                      
REMARK 465     PRO H     0                                                      
REMARK 465     ALA H     1                                                      
REMARK 465     LYS H     2                                                      
REMARK 465     SER H     3                                                      
REMARK 465     ALA H     4                                                      
REMARK 465     PRO H     5                                                      
REMARK 465     ALA H     6                                                      
REMARK 465     PRO H     7                                                      
REMARK 465     LYS H     8                                                      
REMARK 465     LYS H     9                                                      
REMARK 465     GLY H    10                                                      
REMARK 465     SER H    11                                                      
REMARK 465     LYS H    12                                                      
REMARK 465     LYS H    13                                                      
REMARK 465     ALA H    14                                                      
REMARK 465     VAL H    15                                                      
REMARK 465     THR H    16                                                      
REMARK 465     LYS H    17                                                      
REMARK 465     THR H    18                                                      
REMARK 465     GLN H    19                                                      
REMARK 465     LYS H    20                                                      
REMARK 465     LYS H    21                                                      
REMARK 465     ASP H    22                                                      
REMARK 465     GLY H    23                                                      
REMARK 465     LYS H    24                                                      
REMARK 465     LYS H    25                                                      
REMARK 465     ARG H    26                                                      
REMARK 465     ARG H    27                                                      
REMARK 465     LYS H    28                                                      
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: TORSION ANGLES                                             
REMARK 500                                                                      
REMARK 500 TORSION ANGLES OUTSIDE THE EXPECTED RAMACHANDRAN REGIONS:            
REMARK 500 (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN IDENTIFIER;               
REMARK 500 SSEQ=SEQUENCE NUMBER; I=INSERTION CODE).                             
REMARK 500                                                                      
REMARK 500 STANDARD TABLE:                                                      
REMARK 500 FORMAT:(10X,I3,1X,A3,1X,A1,I4,A1,4X,F7.2,3X,F7.2)                    
REMARK 500                                                                      
REMARK 500 EXPECTED VALUES: GJ KLEYWEGT AND TA JONES (1996). PHI/PSI-           
REMARK 500 CHOLOGY: RAMACHANDRAN REVISITED. STRUCTURE 4, 1395 - 1400            
REMARK 500                                                                      
REMARK 500  M RES CSSEQI        PSI       PHI                                   
REMARK 500    ARG B  95       56.78   -140.98                                   
REMARK 500    PRO C  26       98.43    -60.46                                   
REMARK 500    LYS C  74       74.77     56.15                                   
REMARK 500    ASN C 110      114.32   -160.87                                   
REMARK 500    SER C 113      -60.09    -29.90                                   
REMARK 500    LYS D  25      -80.11     71.57                                   
REMARK 500    LYS D  28       80.38    -64.16                                   
REMARK 500    THR D  29     -139.40     32.49                                   
REMARK 500    ARG D  30      102.39    173.01                                   
REMARK 500    GLU D  32      116.81   -172.35                                   
REMARK 500    ALA D 121      104.61    -43.01                                   
REMARK 500    LYS E  79      117.04   -161.76                                   
REMARK 500    ASP E  81       79.38     57.49                                   
REMARK 500    THR F  96      127.44    -39.85                                   
REMARK 500    LYS G  15      -70.10    -80.79                                   
REMARK 500    ASN G 110      116.65   -161.18                                   
REMARK 500    GLU H 102      -52.06    114.65                                   
REMARK 500    ALA H 121     -163.60   -126.30                                   
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: PLANAR GROUPS                                              
REMARK 500                                                                      
REMARK 500 PLANAR GROUPS IN THE FOLLOWING RESIDUES HAVE A TOTAL                 
REMARK 500 RMS DISTANCE OF ALL ATOMS FROM THE BEST-FIT PLANE                    
REMARK 500 BY MORE THAN AN EXPECTED VALUE OF 6*RMSD, WITH AN                    
REMARK 500 RMSD 0.02 ANGSTROMS, OR AT LEAST ONE ATOM HAS                        
REMARK 500 AN RMSD GREATER THAN THIS VALUE                                      
REMARK 500 (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN IDENTIFIER;               
REMARK 500 SSEQ=SEQUENCE NUMBER; I=INSERTION CODE).                             
REMARK 500                                                                      
REMARK 500  M RES CSSEQI        RMS     TYPE                                    
REMARK 500    TYR A  54         0.07    SIDE_CHAIN                              
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 620                                                                      
REMARK 620 METAL COORDINATION                                                   
REMARK 620  (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN IDENTIFIER;              
REMARK 620  SSEQ=SEQUENCE NUMBER; I=INSERTION CODE):                            
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN A 434  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 ASP A  77   OD1                                                    
REMARK 620 2 HOH A 460   O    97.2                                              
REMARK 620 3 HOH A 457   O    80.2 174.8                                        
REMARK 620 4 VAL H  45   O    90.1  95.0  80.5                                  
REMARK 620 N                    1     2     3                                   
REMARK 800                                                                      
REMARK 800 SITE                                                                 
REMARK 800 SITE_IDENTIFIER: AC1                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN A 434                  
REMARK 800 SITE_IDENTIFIER: AC2                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN J 435                  
REMARK 800 SITE_IDENTIFIER: AC3                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 436                  
REMARK 800 SITE_IDENTIFIER: AC4                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 437                  
REMARK 800 SITE_IDENTIFIER: AC5                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 438                  
REMARK 800 SITE_IDENTIFIER: AC6                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 439                  
REMARK 800 SITE_IDENTIFIER: AC7                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE CL G 440                  
REMARK 800 SITE_IDENTIFIER: AC8                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE CL C 441                  
REMARK 800 SITE_IDENTIFIER: AC9                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE CL A 442                  
REMARK 800 SITE_IDENTIFIER: BC1                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE CL E 443                  
REMARK 900                                                                      
REMARK 900 RELATED ENTRIES                                                      
REMARK 900 RELATED ID: 1AOI   RELATED DB: PDB                                   
REMARK 900 NCP146 AT 2.8 A                                                      
REMARK 900 RELATED ID: 1KX3   RELATED DB: PDB                                   
REMARK 900 NCP146 AT 2.0 A                                                      
REMARK 900 RELATED ID: 1KX5   RELATED DB: PDB                                   
REMARK 900 NCP147 AT 1.9 A                                                      
DBREF  1KX4 A    1   135  UNP    P16105   H32_BOVIN        1    135             
DBREF  1KX4 E    1   135  UNP    P16105   H32_BOVIN        1    135             
DBREF  1KX4 B    1   102  UNP    P02304   H4_HUMANX        1    102             
DBREF  1KX4 F    1   102  UNP    P02304   H4_HUMANX        1    102             
DBREF  1KX4 C    1   128  UNP    P06897   H2A1_XENLA       1    129             
DBREF  1KX4 G    1   128  UNP    P06897   H2A1_XENLA       1    129             
DBREF  1KX4 D   -2   122  UNP    P02281   H2B1_XENLA       1    125             
DBREF  1KX4 H   -2   122  UNP    P02281   H2B1_XENLA       1    125             
DBREF  1KX4 I  -72    73  PDB    1KX4     1KX4           -72     73             
DBREF  1KX4 J  -73    72  PDB    1KX4     1KX4           -73     72             
SEQADV 1KX4 ALA A  102  UNP  P16105    GLY   102 CONFLICT                       
SEQADV 1KX4 ALA E  102  UNP  P16105    GLY   102 CONFLICT                       
SEQADV 1KX4 ARG C   99  UNP  P06897    GLY    99 VARIANT                        
SEQADV 1KX4 SER C  123  UNP  P06897    ALA   123 CONFLICT                       
SEQADV 1KX4     C       UNP  P06897    ALA   126 DELETION                       
SEQADV 1KX4 ARG G   99  UNP  P06897    GLY    99 VARIANT                        
SEQADV 1KX4 SER G  123  UNP  P06897    ALA   123 CONFLICT                       
SEQADV 1KX4     G       UNP  P06897    ALA   126 DELETION                       
SEQADV 1KX4 THR D   29  UNP  P02281    SER    32 VARIANT                        
SEQADV 1KX4 THR H   29  UNP  P02281    SER    32 VARIANT                        
SEQRES   1 I  146   DA  DT  DC  DT  DC  DC  DA  DA  DA  DT  DA  DT  DC          
SEQRES   2 I  146   DC  DC  DT  DT  DG  DC  DG  DG  DA  DT  DC  DG  DT          
SEQRES   3 I  146   DA  DG  DA  DA  DA  DA  DA  DG  DT  DG  DT  DG  DT          
SEQRES   4 I  146   DC  DA  DA  DA  DC  DT  DG  DC  DG  DC  DT  DA  DT          
SEQRES   5 I  146   DC  DA  DA  DA  DG  DG  DG  DA  DA  DA  DC  DT  DT          
SEQRES   6 I  146   DC  DA  DA  DC  DT  DG  DA  DA  DT  DT  DC  DA  DG          
SEQRES   7 I  146   DT  DT  DG  DA  DA  DG  DT  DT  DT  DC  DC  DC  DT          
SEQRES   8 I  146   DT  DT  DG  DA  DT  DA  DG  DC  DG  DC  DA  DG  DT          
SEQRES   9 I  146   DT  DT  DG  DA  DC  DA  DC  DA  DC  DT  DT  DT  DT          
SEQRES  10 I  146   DT  DC  DT  DA  DC  DG  DA  DT  DC  DC  DG  DC  DA          
SEQRES  11 I  146   DA  DG  DG  DG  DA  DT  DA  DT  DT  DT  DG  DG  DA          
SEQRES  12 I  146   DG  DA  DT                                                  
SEQRES   1 J  146   DA  DT  DC  DT  DC  DC  DA  DA  DA  DT  DA  DT  DC          
SEQRES   2 J  146   DC  DC  DT  DT  DG  DC  DG  DG  DA  DT  DC  DG  DT          
SEQRES   3 J  146   DA  DG  DA  DA  DA  DA  DA  DG  DT  DG  DT  DG  DT          
SEQRES   4 J  146   DC  DA  DA  DA  DC  DT  DG  DC  DG  DC  DT  DA  DT          
SEQRES   5 J  146   DC  DA  DA  DA  DG  DG  DG  DA  DA  DA  DC  DT  DT          
SEQRES   6 J  146   DC  DA  DA  DC  DT  DG  DA  DA  DT  DT  DC  DA  DG          
SEQRES   7 J  146   DT  DT  DG  DA  DA  DG  DT  DT  DT  DC  DC  DC  DT          
SEQRES   8 J  146   DT  DT  DG  DA  DT  DA  DG  DC  DG  DC  DA  DG  DT          
SEQRES   9 J  146   DT  DT  DG  DA  DC  DA  DC  DA  DC  DT  DT  DT  DT          
SEQRES  10 J  146   DT  DC  DT  DA  DC  DG  DA  DT  DC  DC  DG  DC  DA          
SEQRES  11 J  146   DA  DG  DG  DG  DA  DT  DA  DT  DT  DT  DG  DG  DA          
SEQRES  12 J  146   DG  DA  DT                                                  
SEQRES   1 A  135  ALA ARG THR LYS GLN THR ALA ARG LYS SER THR GLY GLY          
SEQRES   2 A  135  LYS ALA PRO ARG LYS GLN LEU ALA THR LYS ALA ALA ARG          
SEQRES   3 A  135  LYS SER ALA PRO ALA THR GLY GLY VAL LYS LYS PRO HIS          
SEQRES   4 A  135  ARG TYR ARG PRO GLY THR VAL ALA LEU ARG GLU ILE ARG          
SEQRES   5 A  135  ARG TYR GLN LYS SER THR GLU LEU LEU ILE ARG LYS LEU          
SEQRES   6 A  135  PRO PHE GLN ARG LEU VAL ARG GLU ILE ALA GLN ASP PHE          
SEQRES   7 A  135  LYS THR ASP LEU ARG PHE GLN SER SER ALA VAL MET ALA          
SEQRES   8 A  135  LEU GLN GLU ALA SER GLU ALA TYR LEU VAL ALA LEU PHE          
SEQRES   9 A  135  GLU ASP THR ASN LEU CYS ALA ILE HIS ALA LYS ARG VAL          
SEQRES  10 A  135  THR ILE MET PRO LYS ASP ILE GLN LEU ALA ARG ARG ILE          
SEQRES  11 A  135  ARG GLY GLU ARG ALA                                          
SEQRES   1 B  102  SER GLY ARG GLY LYS GLY GLY LYS GLY LEU GLY LYS GLY          
SEQRES   2 B  102  GLY ALA LYS ARG HIS ARG LYS VAL LEU ARG ASP ASN ILE          
SEQRES   3 B  102  GLN GLY ILE THR LYS PRO ALA ILE ARG ARG LEU ALA ARG          
SEQRES   4 B  102  ARG GLY GLY VAL LYS ARG ILE SER GLY LEU ILE TYR GLU          
SEQRES   5 B  102  GLU THR ARG GLY VAL LEU LYS VAL PHE LEU GLU ASN VAL          
SEQRES   6 B  102  ILE ARG ASP ALA VAL THR TYR THR GLU HIS ALA LYS ARG          
SEQRES   7 B  102  LYS THR VAL THR ALA MET ASP VAL VAL TYR ALA LEU LYS          
SEQRES   8 B  102  ARG GLN GLY ARG THR LEU TYR GLY PHE GLY GLY                  
SEQRES   1 C  128  SER GLY ARG GLY LYS GLN GLY GLY LYS THR ARG ALA LYS          
SEQRES   2 C  128  ALA LYS THR ARG SER SER ARG ALA GLY LEU GLN PHE PRO          
SEQRES   3 C  128  VAL GLY ARG VAL HIS ARG LEU LEU ARG LYS GLY ASN TYR          
SEQRES   4 C  128  ALA GLU ARG VAL GLY ALA GLY ALA PRO VAL TYR LEU ALA          
SEQRES   5 C  128  ALA VAL LEU GLU TYR LEU THR ALA GLU ILE LEU GLU LEU          
SEQRES   6 C  128  ALA GLY ASN ALA ALA ARG ASP ASN LYS LYS THR ARG ILE          
SEQRES   7 C  128  ILE PRO ARG HIS LEU GLN LEU ALA VAL ARG ASN ASP GLU          
SEQRES   8 C  128  GLU LEU ASN LYS LEU LEU GLY ARG VAL THR ILE ALA GLN          
SEQRES   9 C  128  GLY GLY VAL LEU PRO ASN ILE GLN SER VAL LEU LEU PRO          
SEQRES  10 C  128  LYS LYS THR GLU SER SER LYS SER LYS SER LYS                  
SEQRES   1 D  125  PRO GLU PRO ALA LYS SER ALA PRO ALA PRO LYS LYS GLY          
SEQRES   2 D  125  SER LYS LYS ALA VAL THR LYS THR GLN LYS LYS ASP GLY          
SEQRES   3 D  125  LYS LYS ARG ARG LYS THR ARG LYS GLU SER TYR ALA ILE          
SEQRES   4 D  125  TYR VAL TYR LYS VAL LEU LYS GLN VAL HIS PRO ASP THR          
SEQRES   5 D  125  GLY ILE SER SER LYS ALA MET SER ILE MET ASN SER PHE          
SEQRES   6 D  125  VAL ASN ASP VAL PHE GLU ARG ILE ALA GLY GLU ALA SER          
SEQRES   7 D  125  ARG LEU ALA HIS TYR ASN LYS ARG SER THR ILE THR SER          
SEQRES   8 D  125  ARG GLU ILE GLN THR ALA VAL ARG LEU LEU LEU PRO GLY          
SEQRES   9 D  125  GLU LEU ALA LYS HIS ALA VAL SER GLU GLY THR LYS ALA          
SEQRES  10 D  125  VAL THR LYS TYR THR SER ALA LYS                              
SEQRES   1 E  135  ALA ARG THR LYS GLN THR ALA ARG LYS SER THR GLY GLY          
SEQRES   2 E  135  LYS ALA PRO ARG LYS GLN LEU ALA THR LYS ALA ALA ARG          
SEQRES   3 E  135  LYS SER ALA PRO ALA THR GLY GLY VAL LYS LYS PRO HIS          
SEQRES   4 E  135  ARG TYR ARG PRO GLY THR VAL ALA LEU ARG GLU ILE ARG          
SEQRES   5 E  135  ARG TYR GLN LYS SER THR GLU LEU LEU ILE ARG LYS LEU          
SEQRES   6 E  135  PRO PHE GLN ARG LEU VAL ARG GLU ILE ALA GLN ASP PHE          
SEQRES   7 E  135  LYS THR ASP LEU ARG PHE GLN SER SER ALA VAL MET ALA          
SEQRES   8 E  135  LEU GLN GLU ALA SER GLU ALA TYR LEU VAL ALA LEU PHE          
SEQRES   9 E  135  GLU ASP THR ASN LEU CYS ALA ILE HIS ALA LYS ARG VAL          
SEQRES  10 E  135  THR ILE MET PRO LYS ASP ILE GLN LEU ALA ARG ARG ILE          
SEQRES  11 E  135  ARG GLY GLU ARG ALA                                          
SEQRES   1 F  102  SER GLY ARG GLY LYS GLY GLY LYS GLY LEU GLY LYS GLY          
SEQRES   2 F  102  GLY ALA LYS ARG HIS ARG LYS VAL LEU ARG ASP ASN ILE          
SEQRES   3 F  102  GLN GLY ILE THR LYS PRO ALA ILE ARG ARG LEU ALA ARG          
SEQRES   4 F  102  ARG GLY GLY VAL LYS ARG ILE SER GLY LEU ILE TYR GLU          
SEQRES   5 F  102  GLU THR ARG GLY VAL LEU LYS VAL PHE LEU GLU ASN VAL          
SEQRES   6 F  102  ILE ARG ASP ALA VAL THR TYR THR GLU HIS ALA LYS ARG          
SEQRES   7 F  102  LYS THR VAL THR ALA MET ASP VAL VAL TYR ALA LEU LYS          
SEQRES   8 F  102  ARG GLN GLY ARG THR LEU TYR GLY PHE GLY GLY                  
SEQRES   1 G  128  SER GLY ARG GLY LYS GLN GLY GLY LYS THR ARG ALA LYS          
SEQRES   2 G  128  ALA LYS THR ARG SER SER ARG ALA GLY LEU GLN PHE PRO          
SEQRES   3 G  128  VAL GLY ARG VAL HIS ARG LEU LEU ARG LYS GLY ASN TYR          
SEQRES   4 G  128  ALA GLU ARG VAL GLY ALA GLY ALA PRO VAL TYR LEU ALA          
SEQRES   5 G  128  ALA VAL LEU GLU TYR LEU THR ALA GLU ILE LEU GLU LEU          
SEQRES   6 G  128  ALA GLY ASN ALA ALA ARG ASP ASN LYS LYS THR ARG ILE          
SEQRES   7 G  128  ILE PRO ARG HIS LEU GLN LEU ALA VAL ARG ASN ASP GLU          
SEQRES   8 G  128  GLU LEU ASN LYS LEU LEU GLY ARG VAL THR ILE ALA GLN          
SEQRES   9 G  128  GLY GLY VAL LEU PRO ASN ILE GLN SER VAL LEU LEU PRO          
SEQRES  10 G  128  LYS LYS THR GLU SER SER LYS SER LYS SER LYS                  
SEQRES   1 H  125  PRO GLU PRO ALA LYS SER ALA PRO ALA PRO LYS LYS GLY          
SEQRES   2 H  125  SER LYS LYS ALA VAL THR LYS THR GLN LYS LYS ASP GLY          
SEQRES   3 H  125  LYS LYS ARG ARG LYS THR ARG LYS GLU SER TYR ALA ILE          
SEQRES   4 H  125  TYR VAL TYR LYS VAL LEU LYS GLN VAL HIS PRO ASP THR          
SEQRES   5 H  125  GLY ILE SER SER LYS ALA MET SER ILE MET ASN SER PHE          
SEQRES   6 H  125  VAL ASN ASP VAL PHE GLU ARG ILE ALA GLY GLU ALA SER          
SEQRES   7 H  125  ARG LEU ALA HIS TYR ASN LYS ARG SER THR ILE THR SER          
SEQRES   8 H  125  ARG GLU ILE GLN THR ALA VAL ARG LEU LEU LEU PRO GLY          
SEQRES   9 H  125  GLU LEU ALA LYS HIS ALA VAL SER GLU GLY THR LYS ALA          
SEQRES  10 H  125  VAL THR LYS TYR THR SER ALA LYS                              
HET     MN  A 434       1                                                       
HET     MN  J 435       1                                                       
HET     MN  I 436       1                                                       
HET     MN  I 437       1                                                       
HET     MN  I 438       1                                                       
HET     MN  I 439       1                                                       
HET     CL  G 440       1                                                       
HET     CL  C 441       1                                                       
HET     CL  A 442       1                                                       
HET     CL  E 443       1                                                       
HETNAM      MN MANGANESE (II) ION                                               
HETNAM      CL CHLORIDE ION                                                     
FORMUL  11   MN    6(MN 2+)                                                     
FORMUL  17   CL    4(CL 1-)                                                     
FORMUL  21  HOH   *433(H2 O)                                                    
HELIX    1   1 GLY A   44  SER A   57  1                                  14    
HELIX    2   2 ARG A   63  ASP A   77  1                                  15    
HELIX    3   3 GLN A   85  ALA A  114  1                                  30    
HELIX    4   4 MET A  120  ARG A  131  1                                  12    
HELIX    5   5 ASP B   24  ILE B   29  5                                   6    
HELIX    6   6 THR B   30  GLY B   41  1                                  12    
HELIX    7   7 LEU B   49  ALA B   76  1                                  28    
HELIX    8   8 THR B   82  GLN B   93  1                                  12    
HELIX    9   9 THR C   16  ALA C   21  1                                   6    
HELIX   10  10 PRO C   26  GLY C   37  1                                  12    
HELIX   11  11 ALA C   45  ASN C   73  1                                  29    
HELIX   12  12 ILE C   79  ASN C   89  1                                  11    
HELIX   13  13 ASP C   90  LEU C   97  1                                   8    
HELIX   14  14 GLN C  112  LEU C  116  5                                   5    
HELIX   15  15 TYR D   34  HIS D   46  1                                  13    
HELIX   16  16 SER D   52  ASN D   81  1                                  30    
HELIX   17  17 THR D   87  LEU D   99  1                                  13    
HELIX   18  18 PRO D  100  ALA D  121  1                                  22    
HELIX   19  19 GLY E   44  GLN E   55  1                                  12    
HELIX   20  20 ARG E   63  ASP E   77  1                                  15    
HELIX   21  21 GLN E   85  ALA E  114  1                                  30    
HELIX   22  22 MET E  120  ARG E  131  1                                  12    
HELIX   23  23 ASN F   25  ILE F   29  5                                   5    
HELIX   24  24 THR F   30  GLY F   41  1                                  12    
HELIX   25  25 LEU F   49  ALA F   76  1                                  28    
HELIX   26  26 THR F   82  GLN F   93  1                                  12    
HELIX   27  27 THR G   16  GLY G   22  1                                   7    
HELIX   28  28 PRO G   26  LYS G   36  1                                  11    
HELIX   29  29 GLY G   46  ASN G   73  1                                  28    
HELIX   30  30 ILE G   79  ASN G   89  1                                  11    
HELIX   31  31 ASP G   90  LEU G   97  1                                   8    
HELIX   32  32 GLN G  112  LEU G  116  5                                   5    
HELIX   33  33 TYR H   34  HIS H   46  1                                  13    
HELIX   34  34 SER H   52  ASN H   81  1                                  30    
HELIX   35  35 THR H   87  LEU H   99  1                                  13    
HELIX   36  36 GLU H  102  SER H  120  1                                  19    
SHEET    1   A 2 ARG A  83  PHE A  84  0                                        
SHEET    2   A 2 THR B  80  VAL B  81  1  O  VAL B  81   N  ARG A  83           
SHEET    1   B 2 THR A 118  ILE A 119  0                                        
SHEET    2   B 2 ARG B  45  ILE B  46  1  O  ARG B  45   N  ILE A 119           
SHEET    1   C 2 THR B  96  TYR B  98  0                                        
SHEET    2   C 2 VAL G 100  ILE G 102  1  O  THR G 101   N  TYR B  98           
SHEET    1   D 2 ARG C  42  VAL C  43  0                                        
SHEET    2   D 2 THR D  85  ILE D  86  1  O  ILE D  86   N  ARG C  42           
SHEET    1   E 2 ARG C  77  ILE C  78  0                                        
SHEET    2   E 2 GLY D  50  ILE D  51  1  O  GLY D  50   N  ILE C  78           
SHEET    1   F 2 THR C 101  ILE C 102  0                                        
SHEET    2   F 2 LEU F  97  TYR F  98  1  O  TYR F  98   N  THR C 101           
SHEET    1   G 2 ARG E  83  PHE E  84  0                                        
SHEET    2   G 2 THR F  80  VAL F  81  1  O  VAL F  81   N  ARG E  83           
SHEET    1   H 2 THR E 118  ILE E 119  0                                        
SHEET    2   H 2 ARG F  45  ILE F  46  1  O  ARG F  45   N  ILE E 119           
SHEET    1   I 2 ARG G  42  VAL G  43  0                                        
SHEET    2   I 2 THR H  85  ILE H  86  1  O  ILE H  86   N  ARG G  42           
SHEET    1   J 2 ARG G  77  ILE G  78  0                                        
SHEET    2   J 2 GLY H  50  ILE H  51  1  O  GLY H  50   N  ILE G  78           
LINK        MN    MN A 434                 OD1 ASP A  77     1555   1555  2.34  
LINK        MN    MN A 434                 O   HOH A 460     1555   1555  2.51  
LINK        MN    MN A 434                 O   HOH A 457     1555   1555  2.43  
LINK        MN    MN I 436                 N7   DG I -53     1555   1555  2.41  
LINK        MN    MN I 438                 N7   DG I  27     1555   1555  2.74  
LINK        MN    MN I 439                 N7   DG I -14     1555   1555  2.66  
LINK        MN    MN A 434                 O   VAL H  45     1555   2675  2.40  
LINK        MN    MN J 435                 OD2 ASP E  81     1555   2575  2.58  
SITE     1 AC1  4 ASP A  77  HOH A 457  HOH A 460  VAL H  45                    
SITE     1 AC2  2 ASP E  81   DT J  66                                          
SITE     1 AC3  1  DG I -53                                                     
SITE     1 AC4  2  DG I  68   DG I  69                                          
SITE     1 AC5  1  DG I  27                                                     
SITE     1 AC6  1  DG I -14                                                     
SITE     1 AC7  4 GLY G  46  ALA G  47  THR H  87  SER H  88                    
SITE     1 AC8  3 GLY C  46  THR D  87  SER D  88                               
SITE     1 AC9  1 LYS A 122                                                     
SITE     1 BC1  1 LYS E 122                                                     
CRYST1  105.300  175.690  109.530  90.00  90.00  90.00 P 21 21 21    8          
ORIGX1      1.000000  0.000000  0.000000        0.00000                         
ORIGX2      0.000000  1.000000  0.000000        0.00000                         
ORIGX3      0.000000  0.000000  1.000000        0.00000                         
SCALE1      0.009497  0.000000  0.000000        0.00000                         
SCALE2      0.000000  0.005692  0.000000        0.00000                         
SCALE3      0.000000  0.000000  0.009130        0.00000