PDB Full entry for 5C51
HEADER    TRANSFERASE/DNA                         19-JUN-15   5C51              
TITLE     PROBING THE STRUCTURAL AND MOLECULAR BASIS OF NUCLEOTIDE SELECTIVITY  
TITLE    2 BY HUMAN MITOCHONDRIAL DNA POLYMERASE GAMMA                          
CAVEAT     5C51    FEW CLOSE CONTACTS B-FACTOR VALUES ARE INCOMPLETE            
COMPND    MOL_ID: 1;                                                            
COMPND   2 MOLECULE: DNA POLYMERASE SUBUNIT GAMMA-1;                            
COMPND   3 CHAIN: A;                                                            
COMPND   4 SYNONYM: MITOCHONDRIAL DNA POLYMERASE CATALYTIC SUBUNIT,POLG-ALPHA;  
COMPND   5 EC: 2.7.7.7;                                                         
COMPND   6 ENGINEERED: YES;                                                     
COMPND   7 MOL_ID: 2;                                                           
COMPND   8 MOLECULE: DNA POLYMERASE SUBUNIT GAMMA-2, MITOCHONDRIAL;             
COMPND   9 CHAIN: B, C;                                                         
COMPND  10 SYNONYM: DNA POLYMERASE GAMMA ACCESSORY 55 KDA SUBUNIT,P55,          
COMPND  11 MITOCHONDRIAL DNA POLYMERASE ACCESSORY SUBUNIT,MTPOLB,POLG-BETA;     
COMPND  12 EC: 2.7.7.7;                                                         
COMPND  13 ENGINEERED: YES;                                                     
COMPND  14 MOL_ID: 3;                                                           
COMPND  15 MOLECULE: DNA (5'-D(*(AD)                                            
COMPND  16 P*AP*AP*AP*CP*GP*AP*GP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*GP*TP*AP*C)-3');
COMPND  17 CHAIN: P;                                                            
COMPND  18 ENGINEERED: YES;                                                     
COMPND  19 OTHER_DETAILS: AAAACGAGGGCCAGTGCCGTAC;                               
COMPND  20 MOL_ID: 4;                                                           
COMPND  21 MOLECULE: DNA;                                                       
COMPND  22 CHAIN: T;                                                            
COMPND  23 ENGINEERED: YES                                                      
SOURCE    MOL_ID: 1;                                                            
SOURCE   2 ORGANISM_SCIENTIFIC: HOMO SAPIENS;                                   
SOURCE   3 ORGANISM_COMMON: HUMAN;                                              
SOURCE   4 ORGANISM_TAXID: 9606;                                                
SOURCE   5 GENE: POLG, MDP1, POLG1, POLGA;                                      
SOURCE   6 EXPRESSION_SYSTEM: INSECT CELL EXPRESSION VECTOR PTIE1;              
SOURCE   7 EXPRESSION_SYSTEM_TAXID: 266783;                                     
SOURCE   8 EXPRESSION_SYSTEM_CELL_LINE: SF9;                                    
SOURCE   9 MOL_ID: 2;                                                           
SOURCE  10 ORGANISM_SCIENTIFIC: HOMO SAPIENS;                                   
SOURCE  11 ORGANISM_COMMON: HUMAN;                                              
SOURCE  12 ORGANISM_TAXID: 9606;                                                
SOURCE  13 GENE: POLG2, MTPOLB;                                                 
SOURCE  14 EXPRESSION_SYSTEM: INSECT CELL EXPRESSION VECTOR PTIE1;              
SOURCE  15 EXPRESSION_SYSTEM_TAXID: 266783;                                     
SOURCE  16 MOL_ID: 3;                                                           
SOURCE  17 SYNTHETIC: YES;                                                      
SOURCE  18 ORGANISM_SCIENTIFIC: VIRUS CHIMP162;                                 
SOURCE  19 ORGANISM_TAXID: 745107;                                              
SOURCE  20 MOL_ID: 4;                                                           
SOURCE  21 SYNTHETIC: YES;                                                      
SOURCE  22 ORGANISM_SCIENTIFIC: DNA LAUNCH VECTOR PDE-GFP2;                     
SOURCE  23 ORGANISM_TAXID: 415098                                               
KEYWDS    NUCLEOSIDE REVERSE TRANSCRIPTASE INHIBITORS (NRTIS), HIV RT, HUMAN    
KEYWDS   2 MITOCHONDRIAL DNA POLYMERASE, MITOCHONDRIAL TOXICITY, DRUG EFFICACY  
KEYWDS   3 AND TOXICITY, TRANSFERASE-DNA COMPLEX                                
EXPDTA    X-RAY DIFFRACTION                                                     
AUTHOR    C.D.SOHL,M.R.SZYMANSKI,A.C.MISLAK,C.K.SHUMATE,S.AMIRALAEI,            
AUTHOR   2 R.F.SCHINAZI,K.S.ANDERSON,Y.Y.WHITNEY                                
REVDAT   2   18-MAY-16 5C51    1       REMARK                                   
REVDAT   1   11-MAY-16 5C51    0                                                
JRNL        AUTH   C.D.SOHL,M.R.SZYMANSKI,A.C.MISLAK,C.K.SHUMATE,S.AMIRALAEI,   
JRNL        AUTH 2 R.F.SCHINAZI,K.S.ANDERSON,Y.W.YIN                            
JRNL        TITL   PROBING THE STRUCTURAL AND MOLECULAR BASIS OF NUCLEOTIDE     
JRNL        TITL 2 SELECTIVITY BY HUMAN MITOCHONDRIAL DNA POLYMERASE GAMMA.     
JRNL        REF    PROC.NATL.ACAD.SCI.USA        V. 112  8596 2015              
JRNL        REFN                   ESSN 1091-6490                               
JRNL        PMID   26124101                                                     
JRNL        DOI    10.1073/PNAS.1421733112                                      
REMARK   2                                                                      
REMARK   2 RESOLUTION.    3.43 ANGSTROMS.                                       
REMARK   3                                                                      
REMARK   3 REFINEMENT.                                                          
REMARK   3   PROGRAM     : PHENIX 1.9_1692                                      
REMARK   3   AUTHORS     : PAUL ADAMS,PAVEL AFONINE,VINCENT CHEN,IAN            
REMARK   3               : DAVIS,KRESHNA GOPAL,RALF GROSSE-KUNSTLEVE,           
REMARK   3               : LI-WEI HUNG,ROBERT IMMORMINO,TOM IOERGER,            
REMARK   3               : AIRLIE MCCOY,ERIK MCKEE,NIGEL MORIARTY,              
REMARK   3               : REETAL PAI,RANDY READ,JANE RICHARDSON,               
REMARK   3               : DAVID RICHARDSON,TOD ROMO,JIM SACCHETTINI,           
REMARK   3               : NICHOLAS SAUTER,JACOB SMITH,LAURENT                  
REMARK   3               : STORONI,TOM TERWILLIGER,PETER ZWART                  
REMARK   3                                                                      
REMARK   3    REFINEMENT TARGET : ML                                            
REMARK   3                                                                      
REMARK   3  DATA USED IN REFINEMENT.                                            
REMARK   3   RESOLUTION RANGE HIGH (ANGSTROMS) : 3.43                           
REMARK   3   RESOLUTION RANGE LOW  (ANGSTROMS) : 47.02                          
REMARK   3   MIN(FOBS/SIGMA_FOBS)              : 1.330                          
REMARK   3   COMPLETENESS FOR RANGE        (%) : 98.2                           
REMARK   3   NUMBER OF REFLECTIONS             : 50478                          
REMARK   3                                                                      
REMARK   3  FIT TO DATA USED IN REFINEMENT.                                     
REMARK   3   R VALUE     (WORKING + TEST SET) : 0.316                           
REMARK   3   R VALUE            (WORKING SET) : 0.315                           
REMARK   3   FREE R VALUE                     : 0.345                           
REMARK   3   FREE R VALUE TEST SET SIZE   (%) : 3.940                           
REMARK   3   FREE R VALUE TEST SET COUNT      : 1990                            
REMARK   3                                                                      
REMARK   3  FIT TO DATA USED IN REFINEMENT (IN BINS).                           
REMARK   3   BIN  RESOLUTION RANGE  COMPL.    NWORK NFREE   RWORK  RFREE        
REMARK   3     1 47.0217 -  8.2434    0.97     3672   153  0.2365 0.2815        
REMARK   3     2  8.2434 -  6.5487    1.00     3606   148  0.3067 0.3142        
REMARK   3     3  6.5487 -  5.7225    1.00     3549   145  0.3353 0.3418        
REMARK   3     4  5.7225 -  5.2001    1.00     3536   145  0.3257 0.3717        
REMARK   3     5  5.2001 -  4.8277    0.99     3495   144  0.3258 0.3358        
REMARK   3     6  4.8277 -  4.5434    0.99     3482   140  0.3348 0.3812        
REMARK   3     7  4.5434 -  4.3160    0.99     3472   143  0.3518 0.3725        
REMARK   3     8  4.3160 -  4.1282    0.99     3478   141  0.3621 0.3913        
REMARK   3     9  4.1282 -  3.9694    1.00     3458   142  0.3723 0.3972        
REMARK   3    10  3.9694 -  3.8325    0.99     3469   143  0.3860 0.4486        
REMARK   3    11  3.8325 -  3.7127    1.00     3452   141  0.4395 0.4841        
REMARK   3    12  3.7127 -  3.6066    1.00     3490   144  0.4279 0.4618        
REMARK   3    13  3.6066 -  3.5117    1.00     3450   142  0.4341 0.5075        
REMARK   3    14  3.5117 -  3.4260    0.83     2879   119  0.4766 0.4729        
REMARK   3                                                                      
REMARK   3  BULK SOLVENT MODELLING.                                             
REMARK   3   METHOD USED        : FLAT BULK SOLVENT MODEL                       
REMARK   3   SOLVENT RADIUS     : 1.11                                          
REMARK   3   SHRINKAGE RADIUS   : 0.90                                          
REMARK   3   K_SOL              : NULL                                          
REMARK   3   B_SOL              : NULL                                          
REMARK   3                                                                      
REMARK   3  ERROR ESTIMATES.                                                    
REMARK   3   COORDINATE ERROR (MAXIMUM-LIKELIHOOD BASED)     : 0.660            
REMARK   3   PHASE ERROR (DEGREES, MAXIMUM-LIKELIHOOD BASED) : 43.460           
REMARK   3                                                                      
REMARK   3  B VALUES.                                                           
REMARK   3   FROM WILSON PLOT           (A**2) : NULL                           
REMARK   3   MEAN B VALUE      (OVERALL, A**2) : NULL                           
REMARK   3   OVERALL ANISOTROPIC B VALUE.                                       
REMARK   3    B11 (A**2) : NULL                                                 
REMARK   3    B22 (A**2) : NULL                                                 
REMARK   3    B33 (A**2) : NULL                                                 
REMARK   3    B12 (A**2) : NULL                                                 
REMARK   3    B13 (A**2) : NULL                                                 
REMARK   3    B23 (A**2) : NULL                                                 
REMARK   3                                                                      
REMARK   3  TWINNING INFORMATION.                                               
REMARK   3   FRACTION: NULL                                                     
REMARK   3   OPERATOR: NULL                                                     
REMARK   3                                                                      
REMARK   3  DEVIATIONS FROM IDEAL VALUES.                                       
REMARK   3                 RMSD          COUNT                                  
REMARK   3   BOND      :  0.003          15078                                  
REMARK   3   ANGLE     :  0.755          20629                                  
REMARK   3   CHIRALITY :  0.028           2222                                  
REMARK   3   PLANARITY :  0.004           2473                                  
REMARK   3   DIHEDRAL  : 14.869           5658                                  
REMARK   3                                                                      
REMARK   3  TLS DETAILS                                                         
REMARK   3   NUMBER OF TLS GROUPS  : 12                                         
REMARK   3   TLS GROUP : 1                                                      
REMARK   3    SELECTION: CHAIN 'A' AND (RESID 78 THROUGH 417 )                  
REMARK   3    ORIGIN FOR THE GROUP (A):  63.9798 -35.5926  24.5051              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.3361 T22:   1.1007                                     
REMARK   3      T33:   1.5993 T12:   0.0070                                     
REMARK   3      T13:  -0.0228 T23:   0.1383                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   1.1020 L22:   0.8926                                     
REMARK   3      L33:   3.0974 L12:  -0.0839                                     
REMARK   3      L13:   0.1831 L23:  -0.7962                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:   0.0653 S12:  -0.1935 S13:  -0.1652                       
REMARK   3      S21:  -0.1288 S22:  -0.1695 S23:  -0.3576                       
REMARK   3      S31:   0.4047 S32:   0.3390 S33:   0.0156                       
REMARK   3   TLS GROUP : 2                                                      
REMARK   3    SELECTION: CHAIN 'A' AND (RESID 418 THROUGH 894 )                 
REMARK   3    ORIGIN FOR THE GROUP (A):  45.9603  -1.2959  27.7705              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.0179 T22:   1.1907                                     
REMARK   3      T33:   1.6092 T12:  -0.1565                                     
REMARK   3      T13:  -0.1155 T23:   0.1934                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:  -1.2034 L22:   3.6203                                     
REMARK   3      L33:   1.4707 L12:  -1.0778                                     
REMARK   3      L13:  -1.6145 L23:   0.9678                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:   0.2552 S12:   0.0378 S13:  -0.4105                       
REMARK   3      S21:  -0.3677 S22:  -0.1728 S23:   0.3949                       
REMARK   3      S31:   0.0033 S32:   0.0191 S33:   0.0373                       
REMARK   3   TLS GROUP : 3                                                      
REMARK   3    SELECTION: CHAIN 'A' AND (RESID 895 THROUGH 1228 )                
REMARK   3    ORIGIN FOR THE GROUP (A):  53.3172 -28.0765   0.8368              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.6070 T22:   1.2486                                     
REMARK   3      T33:   0.9790 T12:  -0.0958                                     
REMARK   3      T13:  -0.0418 T23:   0.1869                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   1.8007 L22:   0.8650                                     
REMARK   3      L33:  -0.5365 L12:  -0.5630                                     
REMARK   3      L13:   1.1761 L23:  -0.1068                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:   0.2886 S12:   0.5433 S13:   0.1835                       
REMARK   3      S21:  -0.4874 S22:  -0.0975 S23:   0.1872                       
REMARK   3      S31:   0.2567 S32:   0.0069 S33:   0.0143                       
REMARK   3   TLS GROUP : 4                                                      
REMARK   3    SELECTION: CHAIN 'B' AND (RESID 68 THROUGH 205 )                  
REMARK   3    ORIGIN FOR THE GROUP (A):  68.4692  28.2217  30.0144              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.4514 T22:   1.0896                                     
REMARK   3      T33:   0.4580 T12:   0.0792                                     
REMARK   3      T13:   0.2580 T23:   0.1334                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   8.4940 L22:   4.9611                                     
REMARK   3      L33:   0.3817 L12:  -0.6086                                     
REMARK   3      L13:  -0.0282 L23:   0.1222                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:  -0.5115 S12:  -0.9136 S13:   0.6562                       
REMARK   3      S21:   0.1934 S22:   0.4807 S23:  -0.8537                       
REMARK   3      S31:  -0.2941 S32:   0.6229 S33:  -0.1620                       
REMARK   3   TLS GROUP : 5                                                      
REMARK   3    SELECTION: CHAIN 'B' AND (RESID 206 THROUGH 306 )                 
REMARK   3    ORIGIN FOR THE GROUP (A):  68.2173  21.1003  19.8683              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.3403 T22:   1.1968                                     
REMARK   3      T33:   1.1084 T12:   0.0308                                     
REMARK   3      T13:   0.1909 T23:   0.0937                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   4.3754 L22:   2.7657                                     
REMARK   3      L33:   3.1201 L12:   1.0847                                     
REMARK   3      L13:  -1.2338 L23:   0.6782                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:   0.4110 S12:   0.4700 S13:  -0.8822                       
REMARK   3      S21:  -0.6642 S22:  -0.3419 S23:  -0.0962                       
REMARK   3      S31:   0.2666 S32:   0.0421 S33:   0.1268                       
REMARK   3   TLS GROUP : 6                                                      
REMARK   3    SELECTION: CHAIN 'B' AND (RESID 307 THROUGH 325 )                 
REMARK   3    ORIGIN FOR THE GROUP (A):  92.6644  20.7684  20.4487              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.4552 T22:   2.1200                                     
REMARK   3      T33:   2.1543 T12:   0.6402                                     
REMARK   3      T13:   0.5796 T23:   0.1606                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   7.2649 L22:   5.9729                                     
REMARK   3      L33:   4.2524 L12:   0.0029                                     
REMARK   3      L13:   4.4707 L23:  -3.0031                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:  -0.7776 S12:  -0.0233 S13:   0.9038                       
REMARK   3      S21:   1.1147 S22:   2.2152 S23:  -2.8945                       
REMARK   3      S31:  -0.9607 S32:   1.9999 S33:   0.4805                       
REMARK   3   TLS GROUP : 7                                                      
REMARK   3    SELECTION: CHAIN 'B' AND (RESID 326 THROUGH 352 )                 
REMARK   3    ORIGIN FOR THE GROUP (A):  71.3058  19.5272  23.5905              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   0.9843 T22:   1.0430                                     
REMARK   3      T33:   1.1828 T12:   0.1252                                     
REMARK   3      T13:   0.0828 T23:  -0.0155                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   2.5468 L22:   2.2710                                     
REMARK   3      L33:   6.5473 L12:   0.4143                                     
REMARK   3      L13:  -4.0451 L23:   0.1628                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:   0.0184 S12:  -0.2195 S13:  -0.2686                       
REMARK   3      S21:  -0.1726 S22:  -0.2356 S23:  -1.2804                       
REMARK   3      S31:  -0.2590 S32:   0.3486 S33:   0.2906                       
REMARK   3   TLS GROUP : 8                                                      
REMARK   3    SELECTION: CHAIN 'B' AND (RESID 353 THROUGH 395 )                 
REMARK   3    ORIGIN FOR THE GROUP (A):  41.9931  23.8949  39.2003              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.4097 T22:   1.4476                                     
REMARK   3      T33:   1.5616 T12:   0.1643                                     
REMARK   3      T13:   0.3300 T23:   0.1773                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   4.6414 L22:   6.1554                                     
REMARK   3      L33:   3.8229 L12:   3.8454                                     
REMARK   3      L13:   0.8077 L23:  -2.8163                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:  -0.0762 S12:   1.6476 S13:   1.4723                       
REMARK   3      S21:   0.0622 S22:  -0.0701 S23:   0.1170                       
REMARK   3      S31:  -0.5827 S32:  -1.7700 S33:   0.3420                       
REMARK   3   TLS GROUP : 9                                                      
REMARK   3    SELECTION: CHAIN 'B' AND (RESID 396 THROUGH 485 )                 
REMARK   3    ORIGIN FOR THE GROUP (A):  44.7068  21.4208  49.1116              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.3937 T22:   1.2933                                     
REMARK   3      T33:   1.5446 T12:   0.0736                                     
REMARK   3      T13:   0.2163 T23:   0.2170                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   3.2502 L22:   6.8202                                     
REMARK   3      L33:   8.6627 L12:   2.9380                                     
REMARK   3      L13:   0.3400 L23:  -1.1869                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:  -0.1080 S12:   0.1333 S13:  -0.0748                       
REMARK   3      S21:   1.0243 S22:  -0.1511 S23:   0.7541                       
REMARK   3      S31:  -1.0220 S32:  -0.9049 S33:   0.2769                       
REMARK   3   TLS GROUP : 10                                                     
REMARK   3    SELECTION: CHAIN 'C' AND (RESID 67 THROUGH 186 )                  
REMARK   3    ORIGIN FOR THE GROUP (A):  77.8279  33.4778  42.1180              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.3260 T22:   1.1883                                     
REMARK   3      T33:   1.7303 T12:  -0.2408                                     
REMARK   3      T13:  -0.1669 T23:  -0.0840                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   4.1231 L22:   5.0159                                     
REMARK   3      L33:   4.8250 L12:  -3.7732                                     
REMARK   3      L13:   2.5702 L23:  -3.6953                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:   0.8391 S12:   0.1569 S13:  -0.1993                       
REMARK   3      S21:  -0.4285 S22:  -1.3616 S23:   1.1176                       
REMARK   3      S31:   0.1955 S32:  -0.1033 S33:   0.0388                       
REMARK   3   TLS GROUP : 11                                                     
REMARK   3    SELECTION: CHAIN 'C' AND (RESID 187 THROUGH 353 )                 
REMARK   3    ORIGIN FOR THE GROUP (A):  68.0947  44.3180  49.9472              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.7048 T22:   1.0575                                     
REMARK   3      T33:   1.3036 T12:  -0.0227                                     
REMARK   3      T13:  -0.1352 T23:   0.2380                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   6.9109 L22:   9.2089                                     
REMARK   3      L33:   2.7528 L12:  -3.2251                                     
REMARK   3      L13:   2.2467 L23:   2.0281                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:  -0.5806 S12:   0.1815 S13:   1.3155                       
REMARK   3      S21:   0.5158 S22:   0.2005 S23:  -0.7700                       
REMARK   3      S31:  -0.5774 S32:   0.1953 S33:   0.3166                       
REMARK   3   TLS GROUP : 12                                                     
REMARK   3    SELECTION: CHAIN 'C' AND (RESID 354 THROUGH 485 )                 
REMARK   3    ORIGIN FOR THE GROUP (A):  81.9467   7.4375  50.1192              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.4237 T22:   1.2417                                     
REMARK   3      T33:   1.1637 T12:   0.0056                                     
REMARK   3      T13:  -0.2537 T23:   0.2859                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   3.2425 L22:   4.3247                                     
REMARK   3      L33:   2.5647 L12:  -1.4022                                     
REMARK   3      L13:  -0.8139 L23:   2.0878                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:   0.0840 S12:   0.1632 S13:   0.4197                       
REMARK   3      S21:  -0.3614 S22:   0.2260 S23:  -0.6426                       
REMARK   3      S31:  -0.2481 S32:   0.3787 S33:  -0.5845                       
REMARK   3                                                                      
REMARK   3  NCS DETAILS                                                         
REMARK   3   NUMBER OF NCS GROUPS : NULL                                        
REMARK   3                                                                      
REMARK   3  OTHER REFINEMENT REMARKS: NULL                                      
REMARK   4                                                                      
REMARK   4 5C51 COMPLIES WITH FORMAT V. 3.30, 13-JUL-11                         
REMARK 100                                                                      
REMARK 100 THIS ENTRY HAS BEEN PROCESSED BY RCSB ON 19-JUN-15.                  
REMARK 100 THE DEPOSITION ID IS D_1000211038.                                   
REMARK 200                                                                      
REMARK 200 EXPERIMENTAL DETAILS                                                 
REMARK 200  EXPERIMENT TYPE                : X-RAY DIFFRACTION                  
REMARK 200  DATE OF DATA COLLECTION        : 01-AUG-14                          
REMARK 200  TEMPERATURE           (KELVIN) : 100                                
REMARK 200  PH                             : 6.5                                
REMARK 200  NUMBER OF CRYSTALS USED        : NULL                               
REMARK 200                                                                      
REMARK 200  SYNCHROTRON              (Y/N) : Y                                  
REMARK 200  RADIATION SOURCE               : ALS                                
REMARK 200  BEAMLINE                       : 8.2.1                              
REMARK 200  X-RAY GENERATOR MODEL          : NULL                               
REMARK 200  MONOCHROMATIC OR LAUE    (M/L) : M                                  
REMARK 200  WAVELENGTH OR RANGE        (A) : 1.00                               
REMARK 200  MONOCHROMATOR                  : NULL                               
REMARK 200  OPTICS                         : NULL                               
REMARK 200                                                                      
REMARK 200  DETECTOR TYPE                  : CCD                                
REMARK 200  DETECTOR MANUFACTURER          : ADSC QUANTUM 315R                  
REMARK 200  INTENSITY-INTEGRATION SOFTWARE : HKL-2000                           
REMARK 200  DATA SCALING SOFTWARE          : HKL-3000                           
REMARK 200                                                                      
REMARK 200  NUMBER OF UNIQUE REFLECTIONS   : 50770                              
REMARK 200  RESOLUTION RANGE HIGH      (A) : 3.420                              
REMARK 200  RESOLUTION RANGE LOW       (A) : 50.000                             
REMARK 200  REJECTION CRITERIA  (SIGMA(I)) : NULL                               
REMARK 200                                                                      
REMARK 200 OVERALL.                                                             
REMARK 200  COMPLETENESS FOR RANGE     (%) : 95.0                               
REMARK 200  DATA REDUNDANCY                : 8.000                              
REMARK 200  R MERGE                    (I) : NULL                               
REMARK 200  R SYM                      (I) : NULL                               
REMARK 200  <I/SIGMA(I)> FOR THE DATA SET  : 2.0000                             
REMARK 200                                                                      
REMARK 200 IN THE HIGHEST RESOLUTION SHELL.                                     
REMARK 200  HIGHEST RESOLUTION SHELL, RANGE HIGH (A) : NULL                     
REMARK 200  HIGHEST RESOLUTION SHELL, RANGE LOW  (A) : NULL                     
REMARK 200  COMPLETENESS FOR SHELL     (%) : NULL                               
REMARK 200  DATA REDUNDANCY IN SHELL       : NULL                               
REMARK 200  R MERGE FOR SHELL          (I) : NULL                               
REMARK 200  R SYM FOR SHELL            (I) : NULL                               
REMARK 200  <I/SIGMA(I)> FOR SHELL         : NULL                               
REMARK 200                                                                      
REMARK 200 DIFFRACTION PROTOCOL: SINGLE WAVELENGTH                              
REMARK 200 METHOD USED TO DETERMINE THE STRUCTURE: NULL                         
REMARK 200 SOFTWARE USED: PHASER                                                
REMARK 200 STARTING MODEL: NULL                                                 
REMARK 200                                                                      
REMARK 200 REMARK: NULL                                                         
REMARK 280                                                                      
REMARK 280 CRYSTAL                                                              
REMARK 280 SOLVENT CONTENT, VS   (%): 66.62                                     
REMARK 280 MATTHEWS COEFFICIENT, VM (ANGSTROMS**3/DA): 3.68                     
REMARK 280                                                                      
REMARK 280 CRYSTALLIZATION CONDITIONS: PEG4000, KCL, HEPES, PH 6.5, VAPOR       
REMARK 280  DIFFUSION, SITTING DROP, TEMPERATURE 300K                           
REMARK 290                                                                      
REMARK 290 CRYSTALLOGRAPHIC SYMMETRY                                            
REMARK 290 SYMMETRY OPERATORS FOR SPACE GROUP: P 41 21 2                        
REMARK 290                                                                      
REMARK 290      SYMOP   SYMMETRY                                                
REMARK 290     NNNMMM   OPERATOR                                                
REMARK 290       1555   X,Y,Z                                                   
REMARK 290       2555   -X,-Y,Z+1/2                                             
REMARK 290       3555   -Y+1/2,X+1/2,Z+1/4                                      
REMARK 290       4555   Y+1/2,-X+1/2,Z+3/4                                      
REMARK 290       5555   -X+1/2,Y+1/2,-Z+1/4                                     
REMARK 290       6555   X+1/2,-Y+1/2,-Z+3/4                                     
REMARK 290       7555   Y,X,-Z                                                  
REMARK 290       8555   -Y,-X,-Z+1/2                                            
REMARK 290                                                                      
REMARK 290     WHERE NNN -> OPERATOR NUMBER                                     
REMARK 290           MMM -> TRANSLATION VECTOR                                  
REMARK 290                                                                      
REMARK 290 CRYSTALLOGRAPHIC SYMMETRY TRANSFORMATIONS                            
REMARK 290 THE FOLLOWING TRANSFORMATIONS OPERATE ON THE ATOM/HETATM             
REMARK 290 RECORDS IN THIS ENTRY TO PRODUCE CRYSTALLOGRAPHICALLY                
REMARK 290 RELATED MOLECULES.                                                   
REMARK 290   SMTRY1   1  1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY2   1  0.000000  1.000000  0.000000        0.00000            
REMARK 290   SMTRY3   1  0.000000  0.000000  1.000000        0.00000            
REMARK 290   SMTRY1   2 -1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY2   2  0.000000 -1.000000  0.000000        0.00000            
REMARK 290   SMTRY3   2  0.000000  0.000000  1.000000       80.84600            
REMARK 290   SMTRY1   3  0.000000 -1.000000  0.000000      107.52450            
REMARK 290   SMTRY2   3  1.000000  0.000000  0.000000      107.52450            
REMARK 290   SMTRY3   3  0.000000  0.000000  1.000000       40.42300            
REMARK 290   SMTRY1   4  0.000000  1.000000  0.000000      107.52450            
REMARK 290   SMTRY2   4 -1.000000  0.000000  0.000000      107.52450            
REMARK 290   SMTRY3   4  0.000000  0.000000  1.000000      121.26900            
REMARK 290   SMTRY1   5 -1.000000  0.000000  0.000000      107.52450            
REMARK 290   SMTRY2   5  0.000000  1.000000  0.000000      107.52450            
REMARK 290   SMTRY3   5  0.000000  0.000000 -1.000000       40.42300            
REMARK 290   SMTRY1   6  1.000000  0.000000  0.000000      107.52450            
REMARK 290   SMTRY2   6  0.000000 -1.000000  0.000000      107.52450            
REMARK 290   SMTRY3   6  0.000000  0.000000 -1.000000      121.26900            
REMARK 290   SMTRY1   7  0.000000  1.000000  0.000000        0.00000            
REMARK 290   SMTRY2   7  1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY3   7  0.000000  0.000000 -1.000000        0.00000            
REMARK 290   SMTRY1   8  0.000000 -1.000000  0.000000        0.00000            
REMARK 290   SMTRY2   8 -1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY3   8  0.000000  0.000000 -1.000000       80.84600            
REMARK 290                                                                      
REMARK 290 REMARK: NULL                                                         
REMARK 300                                                                      
REMARK 300 BIOMOLECULE: 1                                                       
REMARK 300 SEE REMARK 350 FOR THE AUTHOR PROVIDED AND/OR PROGRAM                
REMARK 300 GENERATED ASSEMBLY INFORMATION FOR THE STRUCTURE IN                  
REMARK 300 THIS ENTRY. THE REMARK MAY ALSO PROVIDE INFORMATION ON               
REMARK 300 BURIED SURFACE AREA.                                                 
REMARK 350                                                                      
REMARK 350 COORDINATES FOR A COMPLETE MULTIMER REPRESENTING THE KNOWN           
REMARK 350 BIOLOGICALLY SIGNIFICANT OLIGOMERIZATION STATE OF THE                
REMARK 350 MOLECULE CAN BE GENERATED BY APPLYING BIOMT TRANSFORMATIONS          
REMARK 350 GIVEN BELOW.  BOTH NON-CRYSTALLOGRAPHIC AND                          
REMARK 350 CRYSTALLOGRAPHIC OPERATIONS ARE GIVEN.                               
REMARK 350                                                                      
REMARK 350 BIOMOLECULE: 1                                                       
REMARK 350 AUTHOR DETERMINED BIOLOGICAL UNIT: PENTAMERIC                        
REMARK 350 SOFTWARE DETERMINED QUATERNARY STRUCTURE: PENTAMERIC                 
REMARK 350 SOFTWARE USED: PISA                                                  
REMARK 350 TOTAL BURIED SURFACE AREA: 16790 ANGSTROM**2                         
REMARK 350 SURFACE AREA OF THE COMPLEX: 84890 ANGSTROM**2                       
REMARK 350 CHANGE IN SOLVENT FREE ENERGY: -77.0 KCAL/MOL                        
REMARK 350 APPLY THE FOLLOWING TO CHAINS: A, B, C, P, T                         
REMARK 350   BIOMT1   1  1.000000  0.000000  0.000000        0.00000            
REMARK 350   BIOMT2   1  0.000000  1.000000  0.000000        0.00000            
REMARK 350   BIOMT3   1  0.000000  0.000000  1.000000        0.00000            
REMARK 465                                                                      
REMARK 465 MISSING RESIDUES                                                     
REMARK 465 THE FOLLOWING RESIDUES WERE NOT LOCATED IN THE                       
REMARK 465 EXPERIMENT. (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN               
REMARK 465 IDENTIFIER; SSSEQ=SEQUENCE NUMBER; I=INSERTION CODE.)                
REMARK 465                                                                      
REMARK 465   M RES C SSSEQI                                                     
REMARK 465     TRP A    35                                                      
REMARK 465     VAL A    36                                                      
REMARK 465     SER A    37                                                      
REMARK 465     SER A    38                                                      
REMARK 465     SER A    39                                                      
REMARK 465     VAL A    40                                                      
REMARK 465     PRO A    41                                                      
REMARK 465     ALA A    42                                                      
REMARK 465     SER A    43                                                      
REMARK 465     ASP A    44                                                      
REMARK 465     PRO A    45                                                      
REMARK 465     SER A    46                                                      
REMARK 465     ASP A    47                                                      
REMARK 465     GLY A    48                                                      
REMARK 465     GLN A    49                                                      
REMARK 465     ARG A    50                                                      
REMARK 465     ARG A    51                                                      
REMARK 465     ARG A    52                                                      
REMARK 465     GLN A    53                                                      
REMARK 465     GLN A    54                                                      
REMARK 465     GLN A    55                                                      
REMARK 465     PRO A    56                                                      
REMARK 465     GLN A    57                                                      
REMARK 465     GLN A    58                                                      
REMARK 465     PRO A    59                                                      
REMARK 465     GLN A    60                                                      
REMARK 465     VAL A    61                                                      
REMARK 465     LEU A    62                                                      
REMARK 465     SER A    63                                                      
REMARK 465     SER A    64                                                      
REMARK 465     GLU A    65                                                      
REMARK 465     GLY A    66                                                      
REMARK 465     GLY A    67                                                      
REMARK 465     GLN A    68                                                      
REMARK 465     LEU A    69                                                      
REMARK 465     ARG A    70                                                      
REMARK 465     HIS A    71                                                      
REMARK 465     ASN A    72                                                      
REMARK 465     PRO A    73                                                      
REMARK 465     LEU A    74                                                      
REMARK 465     ASP A    75                                                      
REMARK 465     ILE A    76                                                      
REMARK 465     GLN A    77                                                      
REMARK 465     PRO A   250                                                      
REMARK 465     THR A   251                                                      
REMARK 465     GLY A   252                                                      
REMARK 465     ALA A   253                                                      
REMARK 465     SER A   254                                                      
REMARK 465     SER A   255                                                      
REMARK 465     PRO A   256                                                      
REMARK 465     THR A   257                                                      
REMARK 465     GLN A   258                                                      
REMARK 465     ARG A   259                                                      
REMARK 465     ASP A   260                                                      
REMARK 465     TRP A   261                                                      
REMARK 465     GLN A   317                                                      
REMARK 465     GLY A   318                                                      
REMARK 465     LYS A   319                                                      
REMARK 465     HIS A   320                                                      
REMARK 465     LYS A   321                                                      
REMARK 465     VAL A   322                                                      
REMARK 465     GLN A   323                                                      
REMARK 465     PRO A   324                                                      
REMARK 465     PRO A   325                                                      
REMARK 465     THR A   326                                                      
REMARK 465     LYS A   327                                                      
REMARK 465     GLN A   328                                                      
REMARK 465     GLY A   329                                                      
REMARK 465     GLN A   330                                                      
REMARK 465     LYS A   331                                                      
REMARK 465     SER A   332                                                      
REMARK 465     GLN A   333                                                      
REMARK 465     ARG A   334                                                      
REMARK 465     LYS A   335                                                      
REMARK 465     ALA A   336                                                      
REMARK 465     ARG A   337                                                      
REMARK 465     ARG A   338                                                      
REMARK 465     GLY A   339                                                      
REMARK 465     PRO A   340                                                      
REMARK 465     SER A   511                                                      
REMARK 465     LYS A   512                                                      
REMARK 465     LEU A   513                                                      
REMARK 465     PRO A   514                                                      
REMARK 465     ILE A   515                                                      
REMARK 465     GLU A   516                                                      
REMARK 465     GLY A   517                                                      
REMARK 465     ALA A   518                                                      
REMARK 465     GLY A   519                                                      
REMARK 465     ALA A   520                                                      
REMARK 465     PRO A   521                                                      
REMARK 465     GLY A   522                                                      
REMARK 465     ASP A   523                                                      
REMARK 465     PRO A   524                                                      
REMARK 465     MET A   525                                                      
REMARK 465     ASP A   526                                                      
REMARK 465     GLN A   527                                                      
REMARK 465     GLU A   528                                                      
REMARK 465     ASP A   529                                                      
REMARK 465     VAL A   624                                                      
REMARK 465     PRO A   625                                                      
REMARK 465     GLY A   626                                                      
REMARK 465     ARG A   627                                                      
REMARK 465     ARG A   628                                                      
REMARK 465     ASP A   629                                                      
REMARK 465     GLN A   663                                                      
REMARK 465     GLY A   664                                                      
REMARK 465     LYS A   665                                                      
REMARK 465     GLN A   666                                                      
REMARK 465     GLN A   667                                                      
REMARK 465     LEU A   668                                                      
REMARK 465     MET A   669                                                      
REMARK 465     PRO A   670                                                      
REMARK 465     GLN A   671                                                      
REMARK 465     GLU A   672                                                      
REMARK 465     ALA A   673                                                      
REMARK 465     GLY A   674                                                      
REMARK 465     LEU A   675                                                      
REMARK 465     ALA A   676                                                      
REMARK 465     GLU A   677                                                      
REMARK 465     GLU A   678                                                      
REMARK 465     PHE A   679                                                      
REMARK 465     LEU A   680                                                      
REMARK 465     LEU A   681                                                      
REMARK 465     THR A   682                                                      
REMARK 465     ASP A   683                                                      
REMARK 465     ASN A   684                                                      
REMARK 465     SER A   685                                                      
REMARK 465     ALA A   686                                                      
REMARK 465     ILE A   687                                                      
REMARK 465     TRP A   688                                                      
REMARK 465     GLN A   689                                                      
REMARK 465     THR A   690                                                      
REMARK 465     VAL A   691                                                      
REMARK 465     GLU A   692                                                      
REMARK 465     GLU A   693                                                      
REMARK 465     LEU A   694                                                      
REMARK 465     ASP A   695                                                      
REMARK 465     TYR A   696                                                      
REMARK 465     LEU A   697                                                      
REMARK 465     GLU A   698                                                      
REMARK 465     VAL A   699                                                      
REMARK 465     GLU A   700                                                      
REMARK 465     ALA A   701                                                      
REMARK 465     GLU A   702                                                      
REMARK 465     ALA A   703                                                      
REMARK 465     LYS A   704                                                      
REMARK 465     MET A   705                                                      
REMARK 465     GLU A   706                                                      
REMARK 465     ASN A   707                                                      
REMARK 465     LEU A   708                                                      
REMARK 465     ARG A   709                                                      
REMARK 465     ALA A   710                                                      
REMARK 465     ALA A   711                                                      
REMARK 465     VAL A   712                                                      
REMARK 465     PRO A   713                                                      
REMARK 465     GLY A   714                                                      
REMARK 465     GLN A   715                                                      
REMARK 465     PRO A   716                                                      
REMARK 465     LEU A   717                                                      
REMARK 465     ALA A   718                                                      
REMARK 465     LEU A   719                                                      
REMARK 465     THR A   720                                                      
REMARK 465     ALA A   721                                                      
REMARK 465     ARG A   722                                                      
REMARK 465     GLY A   723                                                      
REMARK 465     GLY A   724                                                      
REMARK 465     PRO A   725                                                      
REMARK 465     LYS A   726                                                      
REMARK 465     ASP A   727                                                      
REMARK 465     THR A   728                                                      
REMARK 465     GLN A   729                                                      
REMARK 465     PRO A   730                                                      
REMARK 465     SER A   731                                                      
REMARK 465     TYR A   732                                                      
REMARK 465     HIS A   733                                                      
REMARK 465     HIS A   734                                                      
REMARK 465     GLY A   735                                                      
REMARK 465     ASN A   736                                                      
REMARK 465     GLY A   737                                                      
REMARK 465     ARG A   993                                                      
REMARK 465     TRP A   994                                                      
REMARK 465     TYR A   995                                                      
REMARK 465     ARG A   996                                                      
REMARK 465     LEU A   997                                                      
REMARK 465     SER A   998                                                      
REMARK 465     ASP A   999                                                      
REMARK 465     GLU A  1000                                                      
REMARK 465     GLY A  1001                                                      
REMARK 465     GLU A  1002                                                      
REMARK 465     TRP A  1003                                                      
REMARK 465     LEU A  1004                                                      
REMARK 465     VAL A  1005                                                      
REMARK 465     ARG A  1006                                                      
REMARK 465     GLU A  1007                                                      
REMARK 465     LEU A  1008                                                      
REMARK 465     ASN A  1009                                                      
REMARK 465     LEU A  1010                                                      
REMARK 465     PRO A  1011                                                      
REMARK 465     VAL A  1012                                                      
REMARK 465     ASP A  1013                                                      
REMARK 465     ARG A  1014                                                      
REMARK 465     THR A  1015                                                      
REMARK 465     GLU A  1016                                                      
REMARK 465     GLY A  1017                                                      
REMARK 465     GLY A  1018                                                      
REMARK 465     TRP A  1019                                                      
REMARK 465     ILE A  1020                                                      
REMARK 465     SER A  1021                                                      
REMARK 465     LEU A  1022                                                      
REMARK 465     GLN A  1023                                                      
REMARK 465     ASP A  1024                                                      
REMARK 465     GLY A  1229                                                      
REMARK 465     SER A  1230                                                      
REMARK 465     LEU A  1231                                                      
REMARK 465     GLU A  1232                                                      
REMARK 465     LYS A  1233                                                      
REMARK 465     ARG A  1234                                                      
REMARK 465     SER A  1235                                                      
REMARK 465     GLN A  1236                                                      
REMARK 465     PRO A  1237                                                      
REMARK 465     GLY A  1238                                                      
REMARK 465     PRO A  1239                                                      
REMARK 465     MET B     1                                                      
REMARK 465     ARG B     2                                                      
REMARK 465     SER B     3                                                      
REMARK 465     ARG B     4                                                      
REMARK 465     VAL B     5                                                      
REMARK 465     ALA B     6                                                      
REMARK 465     VAL B     7                                                      
REMARK 465     ARG B     8                                                      
REMARK 465     ALA B     9                                                      
REMARK 465     CYS B    10                                                      
REMARK 465     HIS B    11                                                      
REMARK 465     LYS B    12                                                      
REMARK 465     VAL B    13                                                      
REMARK 465     CYS B    14                                                      
REMARK 465     ARG B    15                                                      
REMARK 465     CYS B    16                                                      
REMARK 465     LEU B    17                                                      
REMARK 465     LEU B    18                                                      
REMARK 465     SER B    19                                                      
REMARK 465     GLY B    20                                                      
REMARK 465     PHE B    21                                                      
REMARK 465     GLY B    22                                                      
REMARK 465     GLY B    23                                                      
REMARK 465     ARG B    24                                                      
REMARK 465     VAL B    25                                                      
REMARK 465     ASP B    26                                                      
REMARK 465     ALA B    27                                                      
REMARK 465     GLY B    28                                                      
REMARK 465     GLN B    29                                                      
REMARK 465     PRO B    30                                                      
REMARK 465     GLU B    31                                                      
REMARK 465     LEU B    32                                                      
REMARK 465     LEU B    33                                                      
REMARK 465     THR B    34                                                      
REMARK 465     GLU B    35                                                      
REMARK 465     ARG B    36                                                      
REMARK 465     SER B    37                                                      
REMARK 465     SER B    38                                                      
REMARK 465     PRO B    39                                                      
REMARK 465     LYS B    40                                                      
REMARK 465     GLY B    41                                                      
REMARK 465     GLY B    42                                                      
REMARK 465     HIS B    43                                                      
REMARK 465     VAL B    44                                                      
REMARK 465     LYS B    45                                                      
REMARK 465     SER B    46                                                      
REMARK 465     HIS B    47                                                      
REMARK 465     ALA B    48                                                      
REMARK 465     GLU B    49                                                      
REMARK 465     LEU B    50                                                      
REMARK 465     GLU B    51                                                      
REMARK 465     GLY B    52                                                      
REMARK 465     ASN B    53                                                      
REMARK 465     GLY B    54                                                      
REMARK 465     GLU B    55                                                      
REMARK 465     HIS B    56                                                      
REMARK 465     PRO B    57                                                      
REMARK 465     GLU B    58                                                      
REMARK 465     ALA B    59                                                      
REMARK 465     PRO B    60                                                      
REMARK 465     GLY B    61                                                      
REMARK 465     SER B    62                                                      
REMARK 465     GLY B    63                                                      
REMARK 465     GLU B    64                                                      
REMARK 465     GLY B    65                                                      
REMARK 465     SER B    66                                                      
REMARK 465     GLU B    67                                                      
REMARK 465     PRO B   137                                                      
REMARK 465     LEU B   138                                                      
REMARK 465     LEU B   139                                                      
REMARK 465     PRO B   140                                                      
REMARK 465     GLY B   141                                                      
REMARK 465     ASP B   142                                                      
REMARK 465     SER B   143                                                      
REMARK 465     ALA B   144                                                      
REMARK 465     PHE B   145                                                      
REMARK 465     ARG B   146                                                      
REMARK 465     LEU B   147                                                      
REMARK 465     VAL B   148                                                      
REMARK 465     SER B   149                                                      
REMARK 465     ALA B   150                                                      
REMARK 465     GLU B   151                                                      
REMARK 465     THR B   152                                                      
REMARK 465     LEU B   153                                                      
REMARK 465     ARG B   154                                                      
REMARK 465     GLU B   155                                                      
REMARK 465     ILE B   156                                                      
REMARK 465     LEU B   157                                                      
REMARK 465     GLN B   158                                                      
REMARK 465     ASP B   159                                                      
REMARK 465     LYS B   160                                                      
REMARK 465     GLU B   161                                                      
REMARK 465     LEU B   162                                                      
REMARK 465     SER B   163                                                      
REMARK 465     LYS B   164                                                      
REMARK 465     GLU B   165                                                      
REMARK 465     GLN B   166                                                      
REMARK 465     LEU B   167                                                      
REMARK 465     VAL B   168                                                      
REMARK 465     ALA B   169                                                      
REMARK 465     PHE B   170                                                      
REMARK 465     LEU B   171                                                      
REMARK 465     GLU B   172                                                      
REMARK 465     ASN B   173                                                      
REMARK 465     VAL B   174                                                      
REMARK 465     LEU B   175                                                      
REMARK 465     LYS B   176                                                      
REMARK 465     THR B   177                                                      
REMARK 465     SER B   178                                                      
REMARK 465     LYS B   222                                                      
REMARK 465     GLN B   223                                                      
REMARK 465     ILE B   224                                                      
REMARK 465     ARG B   225                                                      
REMARK 465     ASN B   226                                                      
REMARK 465     GLY B   227                                                      
REMARK 465     VAL B   228                                                      
REMARK 465     LEU B   356                                                      
REMARK 465     THR B   357                                                      
REMARK 465     GLU B   358                                                      
REMARK 465     ASN B   359                                                      
REMARK 465     SER B   360                                                      
REMARK 465     PHE B   361                                                      
REMARK 465     MET C     1                                                      
REMARK 465     ARG C     2                                                      
REMARK 465     SER C     3                                                      
REMARK 465     ARG C     4                                                      
REMARK 465     VAL C     5                                                      
REMARK 465     ALA C     6                                                      
REMARK 465     VAL C     7                                                      
REMARK 465     ARG C     8                                                      
REMARK 465     ALA C     9                                                      
REMARK 465     CYS C    10                                                      
REMARK 465     HIS C    11                                                      
REMARK 465     LYS C    12                                                      
REMARK 465     VAL C    13                                                      
REMARK 465     CYS C    14                                                      
REMARK 465     ARG C    15                                                      
REMARK 465     CYS C    16                                                      
REMARK 465     LEU C    17                                                      
REMARK 465     LEU C    18                                                      
REMARK 465     SER C    19                                                      
REMARK 465     GLY C    20                                                      
REMARK 465     PHE C    21                                                      
REMARK 465     GLY C    22                                                      
REMARK 465     GLY C    23                                                      
REMARK 465     ARG C    24                                                      
REMARK 465     VAL C    25                                                      
REMARK 465     ASP C    26                                                      
REMARK 465     ALA C    27                                                      
REMARK 465     GLY C    28                                                      
REMARK 465     GLN C    29                                                      
REMARK 465     PRO C    30                                                      
REMARK 465     GLU C    31                                                      
REMARK 465     LEU C    32                                                      
REMARK 465     LEU C    33                                                      
REMARK 465     THR C    34                                                      
REMARK 465     GLU C    35                                                      
REMARK 465     ARG C    36                                                      
REMARK 465     SER C    37                                                      
REMARK 465     SER C    38                                                      
REMARK 465     PRO C    39                                                      
REMARK 465     LYS C    40                                                      
REMARK 465     GLY C    41                                                      
REMARK 465     GLY C    42                                                      
REMARK 465     HIS C    43                                                      
REMARK 465     VAL C    44                                                      
REMARK 465     LYS C    45                                                      
REMARK 465     SER C    46                                                      
REMARK 465     HIS C    47                                                      
REMARK 465     ALA C    48                                                      
REMARK 465     GLU C    49                                                      
REMARK 465     LEU C    50                                                      
REMARK 465     GLU C    51                                                      
REMARK 465     GLY C    52                                                      
REMARK 465     ASN C    53                                                      
REMARK 465     GLY C    54                                                      
REMARK 465     GLU C    55                                                      
REMARK 465     HIS C    56                                                      
REMARK 465     PRO C    57                                                      
REMARK 465     GLU C    58                                                      
REMARK 465     ALA C    59                                                      
REMARK 465     PRO C    60                                                      
REMARK 465     GLY C    61                                                      
REMARK 465     SER C    62                                                      
REMARK 465     GLY C    63                                                      
REMARK 465     GLU C    64                                                      
REMARK 465     GLY C    65                                                      
REMARK 465     SER C    66                                                      
REMARK 465     LEU C   138                                                      
REMARK 465     LEU C   139                                                      
REMARK 465     PRO C   140                                                      
REMARK 465     GLY C   141                                                      
REMARK 465     ASP C   142                                                      
REMARK 465     SER C   143                                                      
REMARK 465     ALA C   144                                                      
REMARK 465     PHE C   145                                                      
REMARK 465     ARG C   146                                                      
REMARK 465     LEU C   147                                                      
REMARK 465     VAL C   148                                                      
REMARK 465     SER C   149                                                      
REMARK 465     ALA C   150                                                      
REMARK 465     GLU C   151                                                      
REMARK 465     THR C   152                                                      
REMARK 465     LEU C   153                                                      
REMARK 465     ARG C   154                                                      
REMARK 465     GLU C   155                                                      
REMARK 465     ILE C   156                                                      
REMARK 465     LEU C   157                                                      
REMARK 465     GLN C   158                                                      
REMARK 465     ASP C   159                                                      
REMARK 465     LYS C   160                                                      
REMARK 465     GLU C   161                                                      
REMARK 465     LEU C   162                                                      
REMARK 465     SER C   163                                                      
REMARK 465     LYS C   164                                                      
REMARK 465     GLU C   165                                                      
REMARK 465     GLN C   166                                                      
REMARK 465     LEU C   167                                                      
REMARK 465     VAL C   168                                                      
REMARK 465     ALA C   169                                                      
REMARK 465     PHE C   170                                                      
REMARK 465     LEU C   171                                                      
REMARK 465     GLU C   172                                                      
REMARK 465     ASN C   173                                                      
REMARK 465     VAL C   174                                                      
REMARK 465     LEU C   175                                                      
REMARK 465     LYS C   176                                                      
REMARK 465     THR C   177                                                      
REMARK 465     SER C   178                                                      
REMARK 465     GLY C   179                                                      
REMARK 465     ASP C   220                                                      
REMARK 465     THR C   221                                                      
REMARK 465     LYS C   222                                                      
REMARK 465     GLN C   223                                                      
REMARK 465     ILE C   224                                                      
REMARK 465     ARG C   225                                                      
REMARK 465     ASN C   226                                                      
REMARK 465     LEU C   356                                                      
REMARK 465     THR C   357                                                      
REMARK 465     GLU C   358                                                      
REMARK 465     ASN C   359                                                      
REMARK 465     SER C   360                                                      
REMARK 465     PHE C   361                                                      
REMARK 465     THR C   362                                                      
REMARK 465     ARG C   363                                                      
REMARK 465     LYS C   364                                                      
REMARK 465     LYS C   365                                                      
REMARK 465     ASN C   366                                                      
REMARK 465     LEU C   367                                                      
REMARK 470                                                                      
REMARK 470 MISSING ATOM                                                         
REMARK 470 THE FOLLOWING RESIDUES HAVE MISSING ATOMS (M=MODEL NUMBER;           
REMARK 470 RES=RESIDUE NAME; C=CHAIN IDENTIFIER; SSEQ=SEQUENCE NUMBER;          
REMARK 470 I=INSERTION CODE):                                                   
REMARK 470   M RES CSSEQI  ATOMS                                                
REMARK 470     ASP A 198    CG   OD1  OD2                                       
REMARK 470     GLU A 200    CG   CD   OE1  OE2                                  
REMARK 470     GLU A 481    CG   CD   OE1  OE2                                  
REMARK 470     ASP A 482    CG   OD1  OD2                                       
REMARK 470     PHE A 610    CG   CD1  CD2  CE1  CE2  CZ                         
REMARK 470     TYR A 649    CG   CD1  CD2  CE1  CE2  CZ   OH                    
REMARK 470     VAL A 742    CG1  CG2                                            
REMARK 470     SER A 759    OG                                                  
REMARK 470     CYS A 760    SG                                                  
REMARK 470     PRO C 137    CB   CG   CD                                        
REMARK 470     ARG C 203    CG   CD   NE   CZ   NH1  NH2                        
REMARK 470     VAL C 485    CG1  CG2                                            
REMARK 470      DT T   6    C7                                                  
REMARK 470      DT T  26    C7                                                  
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: CLOSE CONTACTS IN SAME ASYMMETRIC UNIT                     
REMARK 500                                                                      
REMARK 500 THE FOLLOWING ATOMS ARE IN CLOSE CONTACT.                            
REMARK 500                                                                      
REMARK 500  ATM1  RES C  SSEQI   ATM2  RES C  SSEQI           DISTANCE          
REMARK 500   N3    DA P     4     O2    DT T    26              0.84            
REMARK 500   NE   ARG A   948     O6    DG T     4              1.50            
REMARK 500   C2    DA P     4     O2    DT T    26              1.60            
REMARK 500   CB   LYS A   561     OP1   DG T    22              1.62            
REMARK 500   CD   ARG A   948     O6    DG T     4              1.65            
REMARK 500   N3    DA P     4     C2    DT T    26              1.69            
REMARK 500   O    VAL A   891    MG     MG A  4002              1.69            
REMARK 500   O2    DC P    20     N2    DG T    10              1.86            
REMARK 500   NE   ARG A   948     NAA  1RY A  4003              1.86            
REMARK 500   NH2  ARG A   948     N4   DOC P    24              1.88            
REMARK 500   CD   LYS A   561     OP1   DG T    22              2.05            
REMARK 500   CZ   ARG A   948     O6    DG T     4              2.06            
REMARK 500   N2    DG P    10     O2    DC T    19              2.09            
REMARK 500   NH2  ARG A   948     NAA  1RY A  4003              2.12            
REMARK 500   C2    DA P     4     N1    DT T    26              2.12            
REMARK 500   OG1  THR A   556     O    ASN B   450              2.13            
REMARK 500   N2    DG P    10     O2    DT T    20              2.17            
REMARK 500   N1    DA P     4     N3    DT T    26              2.19            
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: CLOSE CONTACTS                                             
REMARK 500                                                                      
REMARK 500 THE FOLLOWING ATOMS THAT ARE RELATED BY CRYSTALLOGRAPHIC             
REMARK 500 SYMMETRY ARE IN CLOSE CONTACT.  AN ATOM LOCATED WITHIN 0.15          
REMARK 500 ANGSTROMS OF A SYMMETRY RELATED ATOM IS ASSUMED TO BE ON A           
REMARK 500 SPECIAL POSITION AND IS, THEREFORE, LISTED IN REMARK 375             
REMARK 500 INSTEAD OF REMARK 500.  ATOMS WITH NON-BLANK ALTERNATE               
REMARK 500 LOCATION INDICATORS ARE NOT INCLUDED IN THE CALCULATIONS.            
REMARK 500                                                                      
REMARK 500 DISTANCE CUTOFF:                                                     
REMARK 500 2.2 ANGSTROMS FOR CONTACTS NOT INVOLVING HYDROGEN ATOMS              
REMARK 500 1.6 ANGSTROMS FOR CONTACTS INVOLVING HYDROGEN ATOMS                  
REMARK 500                                                                      
REMARK 500  ATM1  RES C  SSEQI   ATM2  RES C  SSEQI  SSYMOP   DISTANCE          
REMARK 500   OD2  ASP A   136     ND2  ASN C   318     5545     2.19            
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: COVALENT BOND ANGLES                                       
REMARK 500                                                                      
REMARK 500 THE STEREOCHEMICAL PARAMETERS OF THE FOLLOWING RESIDUES              
REMARK 500 HAVE VALUES WHICH DEVIATE FROM EXPECTED VALUES BY MORE               
REMARK 500 THAN 6*RMSD (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN               
REMARK 500 IDENTIFIER; SSEQ=SEQUENCE NUMBER; I=INSERTION CODE).                 
REMARK 500                                                                      
REMARK 500 STANDARD TABLE:                                                      
REMARK 500 FORMAT: (10X,I3,1X,A3,1X,A1,I4,A1,3(1X,A4,2X),12X,F5.1)              
REMARK 500                                                                      
REMARK 500 EXPECTED VALUES PROTEIN: ENGH AND HUBER, 1999                        
REMARK 500 EXPECTED VALUES NUCLEIC ACID: CLOWNEY ET AL 1996                     
REMARK 500                                                                      
REMARK 500  M RES CSSEQI ATM1   ATM2   ATM3                                     
REMARK 500    PRO A 753   C   -  N   -  CA  ANGL. DEV. =  16.3 DEGREES          
REMARK 500    PRO A 753   C   -  N   -  CD  ANGL. DEV. = -14.5 DEGREES          
REMARK 500    PRO A1070   C   -  N   -  CA  ANGL. DEV. =  10.8 DEGREES          
REMARK 500    PRO C  97   C   -  N   -  CD  ANGL. DEV. = -15.4 DEGREES          
REMARK 500    PRO C 135   CA  -  N   -  CD  ANGL. DEV. = -12.3 DEGREES          
REMARK 500     DT T  20   O4' -  C1' -  N1  ANGL. DEV. =   2.1 DEGREES          
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: TORSION ANGLES                                             
REMARK 500                                                                      
REMARK 500 TORSION ANGLES OUTSIDE THE EXPECTED RAMACHANDRAN REGIONS:            
REMARK 500 (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN IDENTIFIER;               
REMARK 500 SSEQ=SEQUENCE NUMBER; I=INSERTION CODE).                             
REMARK 500                                                                      
REMARK 500 STANDARD TABLE:                                                      
REMARK 500 FORMAT:(10X,I3,1X,A3,1X,A1,I4,A1,4X,F7.2,3X,F7.2)                    
REMARK 500                                                                      
REMARK 500 EXPECTED VALUES: GJ KLEYWEGT AND TA JONES (1996). PHI/PSI-           
REMARK 500 CHOLOGY: RAMACHANDRAN REVISITED. STRUCTURE 4, 1395 - 1400            
REMARK 500                                                                      
REMARK 500  M RES CSSEQI        PSI       PHI                                   
REMARK 500    TRP A 113       23.77   -142.97                                   
REMARK 500    GLU A 205       45.68   -144.67                                   
REMARK 500    THR A 207       51.58    -97.93                                   
REMARK 500    ARG A 232       71.72   -103.82                                   
REMARK 500    SER A 237       71.96     53.53                                   
REMARK 500    LEU A 239       49.40    -89.91                                   
REMARK 500    PRO A 241      158.60    -46.50                                   
REMARK 500    LEU A 244      -31.20   -140.91                                   
REMARK 500    GLU A 263      -52.74   -120.75                                   
REMARK 500    ILE A 301      -70.36    -74.09                                   
REMARK 500    ALA A 315       78.66    -67.79                                   
REMARK 500    VAL A 432       54.62   -102.42                                   
REMARK 500    LEU A 473       37.00    -87.22                                   
REMARK 500    TRP A 486       -4.75   -157.87                                   
REMARK 500    LEU A 488     -164.57    -77.47                                   
REMARK 500    GLU A 494       68.05   -160.01                                   
REMARK 500    ALA A 500      -19.11   -152.35                                   
REMARK 500    CYS A 533     -164.19   -164.07                                   
REMARK 500    SER A 534       77.45   -165.70                                   
REMARK 500    PRO A 560     -157.06    -94.12                                   
REMARK 500    LYS A 561      -86.85   -145.79                                   
REMARK 500    SER A 590     -165.65   -106.81                                   
REMARK 500    MET A 603      -40.30   -135.54                                   
REMARK 500    TRP A 607       70.72     48.97                                   
REMARK 500    PHE A 610      -51.55   -121.56                                   
REMARK 500    SER A 615      -64.37   -155.35                                   
REMARK 500    HIS A 618     -149.01    -77.40                                   
REMARK 500    GLU A 641      -24.37   -153.78                                   
REMARK 500    SER A 642      136.96     66.95                                   
REMARK 500    TYR A 649       16.24   -149.51                                   
REMARK 500    ASN A 740     -141.50    -94.28                                   
REMARK 500    ASP A 743      -84.46    -70.36                                   
REMARK 500    PHE A 749     -124.98    -76.09                                   
REMARK 500    PHE A 750      -67.16   -124.62                                   
REMARK 500    LYS A 751      -88.71   -133.64                                   
REMARK 500    LEU A 752      -94.25     60.72                                   
REMARK 500    LYS A 755      -71.48    -67.91                                   
REMARK 500    VAL A 762      -46.98   -144.29                                   
REMARK 500    SER A 764       86.07   -159.96                                   
REMARK 500    ALA A 767       95.46    -54.16                                   
REMARK 500    ASP A 776       12.10   -140.82                                   
REMARK 500    ALA A 804      -17.97   -159.02                                   
REMARK 500    GLN A 811       99.24    -59.28                                   
REMARK 500    PRO A 829       51.00    -61.54                                   
REMARK 500    GLN A 843       75.53     57.38                                   
REMARK 500    GLN A 894      -64.48    -96.61                                   
REMARK 500    ALA A 908     -146.74   -148.84                                   
REMARK 500    LEU A 921       33.38    -96.89                                   
REMARK 500    ARG A 927       37.87     35.25                                   
REMARK 500    THR A 937       57.61   -109.38                                   
REMARK 500                                                                      
REMARK 500 THIS ENTRY HAS      91 RAMACHANDRAN OUTLIERS.                        
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 620                                                                      
REMARK 620 METAL COORDINATION                                                   
REMARK 620 (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN IDENTIFIER;               
REMARK 620 SSEQ=SEQUENCE NUMBER; I=INSERTION CODE):                             
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MG A4002  MG                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 ASP A 890   OD1                                                    
REMARK 620 2 ASP A1135   OD1  88.2                                              
REMARK 620 3 1RY A4003   OAF  97.0 166.8                                        
REMARK 620 4 1RY A4003   OAI 134.1 104.7  63.0                                  
REMARK 620 N                    1     2     3                                   
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MG A4001  MG                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 1RY A4003   OAH                                                    
REMARK 620 2 1RY A4003   OAO  53.6                                              
REMARK 620 N                    1                                               
REMARK 800                                                                      
REMARK 800 SITE                                                                 
REMARK 800 SITE_IDENTIFIER: AC1                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: binding site for residue MG A 4001                 
REMARK 800                                                                      
REMARK 800 SITE_IDENTIFIER: AC2                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: binding site for residue MG A 4002                 
REMARK 800                                                                      
REMARK 800 SITE_IDENTIFIER: AC3                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: binding site for residue 1RY A 4003                
REMARK 900                                                                      
REMARK 900 RELATED ENTRIES                                                      
REMARK 900 RELATED ID: 5C52   RELATED DB: PDB                                   
DBREF  5C51 A   35  1239  UNP    P54098   DPOG1_HUMAN     25   1239             
DBREF  5C51 B    1   485  UNP    Q9UHN1   DPOG2_HUMAN      1    485             
DBREF  5C51 C    1   485  UNP    Q9UHN1   DPOG2_HUMAN      1    485             
DBREF  5C51 P    3    24  PDB    5C51     5C51             3     24             
DBREF  5C51 T    2    26  PDB    5C51     5C51             2     26             
SEQADV 5C51     A       UNP  P54098    GLN    43 DELETION                       
SEQADV 5C51     A       UNP  P54098    GLN    44 DELETION                       
SEQADV 5C51     A       UNP  P54098    GLN    45 DELETION                       
SEQADV 5C51     A       UNP  P54098    GLN    46 DELETION                       
SEQADV 5C51     A       UNP  P54098    GLN    47 DELETION                       
SEQADV 5C51     A       UNP  P54098    GLN    48 DELETION                       
SEQADV 5C51     A       UNP  P54098    GLN    49 DELETION                       
SEQADV 5C51     A       UNP  P54098    GLN    50 DELETION                       
SEQADV 5C51     A       UNP  P54098    GLN    51 DELETION                       
SEQADV 5C51     A       UNP  P54098    GLN    52 DELETION                       
SEQADV 5C51 ARG A  948  UNP  P54098    ILE   948 CONFLICT                       
SEQRES   1 A 1205  TRP VAL SER SER SER VAL PRO ALA SER ASP PRO SER ASP          
SEQRES   2 A 1205  GLY GLN ARG ARG ARG GLN GLN GLN PRO GLN GLN PRO GLN          
SEQRES   3 A 1205  VAL LEU SER SER GLU GLY GLY GLN LEU ARG HIS ASN PRO          
SEQRES   4 A 1205  LEU ASP ILE GLN MET LEU SER ARG GLY LEU HIS GLU GLN          
SEQRES   5 A 1205  ILE PHE GLY GLN GLY GLY GLU MET PRO GLY GLU ALA ALA          
SEQRES   6 A 1205  VAL ARG ARG SER VAL GLU HIS LEU GLN LYS HIS GLY LEU          
SEQRES   7 A 1205  TRP GLY GLN PRO ALA VAL PRO LEU PRO ASP VAL GLU LEU          
SEQRES   8 A 1205  ARG LEU PRO PRO LEU TYR GLY ASP ASN LEU ASP GLN HIS          
SEQRES   9 A 1205  PHE ARG LEU LEU ALA GLN LYS GLN SER LEU PRO TYR LEU          
SEQRES  10 A 1205  GLU ALA ALA ASN LEU LEU LEU GLN ALA GLN LEU PRO PRO          
SEQRES  11 A 1205  LYS PRO PRO ALA TRP ALA TRP ALA GLU GLY TRP THR ARG          
SEQRES  12 A 1205  TYR GLY PRO GLU GLY GLU ALA VAL PRO VAL ALA ILE PRO          
SEQRES  13 A 1205  GLU GLU ARG ALA LEU VAL PHE ASP VAL GLU VAL CYS LEU          
SEQRES  14 A 1205  ALA GLU GLY THR CYS PRO THR LEU ALA VAL ALA ILE SER          
SEQRES  15 A 1205  PRO SER ALA TRP TYR SER TRP CYS SER GLN ARG LEU VAL          
SEQRES  16 A 1205  GLU GLU ARG TYR SER TRP THR SER GLN LEU SER PRO ALA          
SEQRES  17 A 1205  ASP LEU ILE PRO LEU GLU VAL PRO THR GLY ALA SER SER          
SEQRES  18 A 1205  PRO THR GLN ARG ASP TRP GLN GLU GLN LEU VAL VAL GLY          
SEQRES  19 A 1205  HIS ASN VAL SER PHE ASP ARG ALA HIS ILE ARG GLU GLN          
SEQRES  20 A 1205  TYR LEU ILE GLN GLY SER ARG MET ARG PHE LEU ASP THR          
SEQRES  21 A 1205  MET SER MET HIS MET ALA ILE SER GLY LEU SER SER PHE          
SEQRES  22 A 1205  GLN ARG SER LEU TRP ILE ALA ALA LYS GLN GLY LYS HIS          
SEQRES  23 A 1205  LYS VAL GLN PRO PRO THR LYS GLN GLY GLN LYS SER GLN          
SEQRES  24 A 1205  ARG LYS ALA ARG ARG GLY PRO ALA ILE SER SER TRP ASP          
SEQRES  25 A 1205  TRP LEU ASP ILE SER SER VAL ASN SER LEU ALA GLU VAL          
SEQRES  26 A 1205  HIS ARG LEU TYR VAL GLY GLY PRO PRO LEU GLU LYS GLU          
SEQRES  27 A 1205  PRO ARG GLU LEU PHE VAL LYS GLY THR MET LYS ASP ILE          
SEQRES  28 A 1205  ARG GLU ASN PHE GLN ASP LEU MET GLN TYR CYS ALA GLN          
SEQRES  29 A 1205  ASP VAL TRP ALA THR HIS GLU VAL PHE GLN GLN GLN LEU          
SEQRES  30 A 1205  PRO LEU PHE LEU GLU ARG CYS PRO HIS PRO VAL THR LEU          
SEQRES  31 A 1205  ALA GLY MET LEU GLU MET GLY VAL SER TYR LEU PRO VAL          
SEQRES  32 A 1205  ASN GLN ASN TRP GLU ARG TYR LEU ALA GLU ALA GLN GLY          
SEQRES  33 A 1205  THR TYR GLU GLU LEU GLN ARG GLU MET LYS LYS SER LEU          
SEQRES  34 A 1205  MET ASP LEU ALA ASN ASP ALA CYS GLN LEU LEU SER GLY          
SEQRES  35 A 1205  GLU ARG TYR LYS GLU ASP PRO TRP LEU TRP ASP LEU GLU          
SEQRES  36 A 1205  TRP ASP LEU GLN GLU PHE LYS GLN LYS LYS ALA LYS LYS          
SEQRES  37 A 1205  VAL LYS LYS GLU PRO ALA THR ALA SER LYS LEU PRO ILE          
SEQRES  38 A 1205  GLU GLY ALA GLY ALA PRO GLY ASP PRO MET ASP GLN GLU          
SEQRES  39 A 1205  ASP LEU GLY PRO CYS SER GLU GLU GLU GLU PHE GLN GLN          
SEQRES  40 A 1205  ASP VAL MET ALA ARG ALA CYS LEU GLN LYS LEU LYS GLY          
SEQRES  41 A 1205  THR THR GLU LEU LEU PRO LYS ARG PRO GLN HIS LEU PRO          
SEQRES  42 A 1205  GLY HIS PRO GLY TRP TYR ARG LYS LEU CYS PRO ARG LEU          
SEQRES  43 A 1205  ASP ASP PRO ALA TRP THR PRO GLY PRO SER LEU LEU SER          
SEQRES  44 A 1205  LEU GLN MET ARG VAL THR PRO LYS LEU MET ALA LEU THR          
SEQRES  45 A 1205  TRP ASP GLY PHE PRO LEU HIS TYR SER GLU ARG HIS GLY          
SEQRES  46 A 1205  TRP GLY TYR LEU VAL PRO GLY ARG ARG ASP ASN LEU ALA          
SEQRES  47 A 1205  LYS LEU PRO THR GLY THR THR LEU GLU SER ALA GLY VAL          
SEQRES  48 A 1205  VAL CYS PRO TYR ARG ALA ILE GLU SER LEU TYR ARG LYS          
SEQRES  49 A 1205  HIS CYS LEU GLU GLN GLY LYS GLN GLN LEU MET PRO GLN          
SEQRES  50 A 1205  GLU ALA GLY LEU ALA GLU GLU PHE LEU LEU THR ASP ASN          
SEQRES  51 A 1205  SER ALA ILE TRP GLN THR VAL GLU GLU LEU ASP TYR LEU          
SEQRES  52 A 1205  GLU VAL GLU ALA GLU ALA LYS MET GLU ASN LEU ARG ALA          
SEQRES  53 A 1205  ALA VAL PRO GLY GLN PRO LEU ALA LEU THR ALA ARG GLY          
SEQRES  54 A 1205  GLY PRO LYS ASP THR GLN PRO SER TYR HIS HIS GLY ASN          
SEQRES  55 A 1205  GLY PRO TYR ASN ASP VAL ASP ILE PRO GLY CYS TRP PHE          
SEQRES  56 A 1205  PHE LYS LEU PRO HIS LYS ASP GLY ASN SER CYS ASN VAL          
SEQRES  57 A 1205  GLY SER PRO PHE ALA LYS ASP PHE LEU PRO LYS MET GLU          
SEQRES  58 A 1205  ASP GLY THR LEU GLN ALA GLY PRO GLY GLY ALA SER GLY          
SEQRES  59 A 1205  PRO ARG ALA LEU GLU ILE ASN LYS MET ILE SER PHE TRP          
SEQRES  60 A 1205  ARG ASN ALA HIS LYS ARG ILE SER SER GLN MET VAL VAL          
SEQRES  61 A 1205  TRP LEU PRO ARG SER ALA LEU PRO ARG ALA VAL ILE ARG          
SEQRES  62 A 1205  HIS PRO ASP TYR ASP GLU GLU GLY LEU TYR GLY ALA ILE          
SEQRES  63 A 1205  LEU PRO GLN VAL VAL THR ALA GLY THR ILE THR ARG ARG          
SEQRES  64 A 1205  ALA VAL GLU PRO THR TRP LEU THR ALA SER ASN ALA ARG          
SEQRES  65 A 1205  PRO ASP ARG VAL GLY SER GLU LEU LYS ALA MET VAL GLN          
SEQRES  66 A 1205  ALA PRO PRO GLY TYR THR LEU VAL GLY ALA ASP VAL ASP          
SEQRES  67 A 1205  SER GLN GLU LEU TRP ILE ALA ALA VAL LEU GLY ASP ALA          
SEQRES  68 A 1205  HIS PHE ALA GLY MET HIS GLY CYS THR ALA PHE GLY TRP          
SEQRES  69 A 1205  MET THR LEU GLN GLY ARG LYS SER ARG GLY THR ASP LEU          
SEQRES  70 A 1205  HIS SER LYS THR ALA THR THR VAL GLY ILE SER ARG GLU          
SEQRES  71 A 1205  HIS ALA LYS ARG PHE ASN TYR GLY ARG ILE TYR GLY ALA          
SEQRES  72 A 1205  GLY GLN PRO PHE ALA GLU ARG LEU LEU MET GLN PHE ASN          
SEQRES  73 A 1205  HIS ARG LEU THR GLN GLN GLU ALA ALA GLU LYS ALA GLN          
SEQRES  74 A 1205  GLN MET TYR ALA ALA THR LYS GLY LEU ARG TRP TYR ARG          
SEQRES  75 A 1205  LEU SER ASP GLU GLY GLU TRP LEU VAL ARG GLU LEU ASN          
SEQRES  76 A 1205  LEU PRO VAL ASP ARG THR GLU GLY GLY TRP ILE SER LEU          
SEQRES  77 A 1205  GLN ASP LEU ARG LYS VAL GLN ARG GLU THR ALA ARG LYS          
SEQRES  78 A 1205  SER GLN TRP LYS LYS TRP GLU VAL VAL ALA GLU ARG ALA          
SEQRES  79 A 1205  TRP LYS GLY GLY THR GLU SER GLU MET PHE ASN LYS LEU          
SEQRES  80 A 1205  GLU SER ILE ALA THR SER ASP ILE PRO ARG THR PRO VAL          
SEQRES  81 A 1205  LEU GLY CYS CYS ILE SER ARG ALA LEU GLU PRO SER ALA          
SEQRES  82 A 1205  VAL GLN GLU GLU PHE MET THR SER ARG VAL ASN TRP VAL          
SEQRES  83 A 1205  VAL GLN SER SER ALA VAL ASP TYR LEU HIS LEU MET LEU          
SEQRES  84 A 1205  VAL ALA MET LYS TRP LEU PHE GLU GLU PHE ALA ILE ASP          
SEQRES  85 A 1205  GLY ARG PHE CYS ILE SER ILE HIS ASP GLU VAL ARG TYR          
SEQRES  86 A 1205  LEU VAL ARG GLU GLU ASP ARG TYR ARG ALA ALA LEU ALA          
SEQRES  87 A 1205  LEU GLN ILE THR ASN LEU LEU THR ARG CYS MET PHE ALA          
SEQRES  88 A 1205  TYR LYS LEU GLY LEU ASN ASP LEU PRO GLN SER VAL ALA          
SEQRES  89 A 1205  PHE PHE SER ALA VAL ASP ILE ASP ARG CYS LEU ARG LYS          
SEQRES  90 A 1205  GLU VAL THR MET ASP CYS LYS THR PRO SER ASN PRO THR          
SEQRES  91 A 1205  GLY MET GLU ARG ARG TYR GLY ILE PRO GLN GLY GLU ALA          
SEQRES  92 A 1205  LEU ASP ILE TYR GLN ILE ILE GLU LEU THR LYS GLY SER          
SEQRES  93 A 1205  LEU GLU LYS ARG SER GLN PRO GLY PRO                          
SEQRES   1 B  485  MET ARG SER ARG VAL ALA VAL ARG ALA CYS HIS LYS VAL          
SEQRES   2 B  485  CYS ARG CYS LEU LEU SER GLY PHE GLY GLY ARG VAL ASP          
SEQRES   3 B  485  ALA GLY GLN PRO GLU LEU LEU THR GLU ARG SER SER PRO          
SEQRES   4 B  485  LYS GLY GLY HIS VAL LYS SER HIS ALA GLU LEU GLU GLY          
SEQRES   5 B  485  ASN GLY GLU HIS PRO GLU ALA PRO GLY SER GLY GLU GLY          
SEQRES   6 B  485  SER GLU ALA LEU LEU GLU ILE CYS GLN ARG ARG HIS PHE          
SEQRES   7 B  485  LEU SER GLY SER LYS GLN GLN LEU SER ARG ASP SER LEU          
SEQRES   8 B  485  LEU SER GLY CYS HIS PRO GLY PHE GLY PRO LEU GLY VAL          
SEQRES   9 B  485  GLU LEU ARG LYS ASN LEU ALA ALA GLU TRP TRP THR SER          
SEQRES  10 B  485  VAL VAL VAL PHE ARG GLU GLN VAL PHE PRO VAL ASP ALA          
SEQRES  11 B  485  LEU HIS HIS LYS PRO GLY PRO LEU LEU PRO GLY ASP SER          
SEQRES  12 B  485  ALA PHE ARG LEU VAL SER ALA GLU THR LEU ARG GLU ILE          
SEQRES  13 B  485  LEU GLN ASP LYS GLU LEU SER LYS GLU GLN LEU VAL ALA          
SEQRES  14 B  485  PHE LEU GLU ASN VAL LEU LYS THR SER GLY LYS LEU ARG          
SEQRES  15 B  485  GLU ASN LEU LEU HIS GLY ALA LEU GLU HIS TYR VAL ASN          
SEQRES  16 B  485  CYS LEU ASP LEU VAL ASN LYS ARG LEU PRO TYR GLY LEU          
SEQRES  17 B  485  ALA GLN ILE GLY VAL CYS PHE HIS PRO VAL PHE ASP THR          
SEQRES  18 B  485  LYS GLN ILE ARG ASN GLY VAL LYS SER ILE GLY GLU LYS          
SEQRES  19 B  485  THR GLU ALA SER LEU VAL TRP PHE THR PRO PRO ARG THR          
SEQRES  20 B  485  SER ASN GLN TRP LEU ASP PHE TRP LEU ARG HIS ARG LEU          
SEQRES  21 B  485  GLN TRP TRP ARG LYS PHE ALA MET SER PRO SER ASN PHE          
SEQRES  22 B  485  SER SER SER ASP CYS GLN ASP GLU GLU GLY ARG LYS GLY          
SEQRES  23 B  485  ASN LYS LEU TYR TYR ASN PHE PRO TRP GLY LYS GLU LEU          
SEQRES  24 B  485  ILE GLU THR LEU TRP ASN LEU GLY ASP HIS GLU LEU LEU          
SEQRES  25 B  485  HIS MET TYR PRO GLY ASN VAL SER LYS LEU HIS GLY ARG          
SEQRES  26 B  485  ASP GLY ARG LYS ASN VAL VAL PRO CYS VAL LEU SER VAL          
SEQRES  27 B  485  ASN GLY ASP LEU ASP ARG GLY MET LEU ALA TYR LEU TYR          
SEQRES  28 B  485  ASP SER PHE GLN LEU THR GLU ASN SER PHE THR ARG LYS          
SEQRES  29 B  485  LYS ASN LEU HIS ARG LYS VAL LEU LYS LEU HIS PRO CYS          
SEQRES  30 B  485  LEU ALA PRO ILE LYS VAL ALA LEU ASP VAL GLY ARG GLY          
SEQRES  31 B  485  PRO THR LEU GLU LEU ARG GLN VAL CYS GLN GLY LEU PHE          
SEQRES  32 B  485  ASN GLU LEU LEU GLU ASN GLY ILE SER VAL TRP PRO GLY          
SEQRES  33 B  485  TYR LEU GLU THR MET GLN SER SER LEU GLU GLN LEU TYR          
SEQRES  34 B  485  SER LYS TYR ASP GLU MET SER ILE LEU PHE THR VAL LEU          
SEQRES  35 B  485  VAL THR GLU THR THR LEU GLU ASN GLY LEU ILE HIS LEU          
SEQRES  36 B  485  ARG SER ARG ASP THR THR MET LYS GLU MET MET HIS ILE          
SEQRES  37 B  485  SER LYS LEU LYS ASP PHE LEU ILE LYS TYR ILE SER SER          
SEQRES  38 B  485  ALA LYS ASN VAL                                              
SEQRES   1 C  485  MET ARG SER ARG VAL ALA VAL ARG ALA CYS HIS LYS VAL          
SEQRES   2 C  485  CYS ARG CYS LEU LEU SER GLY PHE GLY GLY ARG VAL ASP          
SEQRES   3 C  485  ALA GLY GLN PRO GLU LEU LEU THR GLU ARG SER SER PRO          
SEQRES   4 C  485  LYS GLY GLY HIS VAL LYS SER HIS ALA GLU LEU GLU GLY          
SEQRES   5 C  485  ASN GLY GLU HIS PRO GLU ALA PRO GLY SER GLY GLU GLY          
SEQRES   6 C  485  SER GLU ALA LEU LEU GLU ILE CYS GLN ARG ARG HIS PHE          
SEQRES   7 C  485  LEU SER GLY SER LYS GLN GLN LEU SER ARG ASP SER LEU          
SEQRES   8 C  485  LEU SER GLY CYS HIS PRO GLY PHE GLY PRO LEU GLY VAL          
SEQRES   9 C  485  GLU LEU ARG LYS ASN LEU ALA ALA GLU TRP TRP THR SER          
SEQRES  10 C  485  VAL VAL VAL PHE ARG GLU GLN VAL PHE PRO VAL ASP ALA          
SEQRES  11 C  485  LEU HIS HIS LYS PRO GLY PRO LEU LEU PRO GLY ASP SER          
SEQRES  12 C  485  ALA PHE ARG LEU VAL SER ALA GLU THR LEU ARG GLU ILE          
SEQRES  13 C  485  LEU GLN ASP LYS GLU LEU SER LYS GLU GLN LEU VAL ALA          
SEQRES  14 C  485  PHE LEU GLU ASN VAL LEU LYS THR SER GLY LYS LEU ARG          
SEQRES  15 C  485  GLU ASN LEU LEU HIS GLY ALA LEU GLU HIS TYR VAL ASN          
SEQRES  16 C  485  CYS LEU ASP LEU VAL ASN LYS ARG LEU PRO TYR GLY LEU          
SEQRES  17 C  485  ALA GLN ILE GLY VAL CYS PHE HIS PRO VAL PHE ASP THR          
SEQRES  18 C  485  LYS GLN ILE ARG ASN GLY VAL LYS SER ILE GLY GLU LYS          
SEQRES  19 C  485  THR GLU ALA SER LEU VAL TRP PHE THR PRO PRO ARG THR          
SEQRES  20 C  485  SER ASN GLN TRP LEU ASP PHE TRP LEU ARG HIS ARG LEU          
SEQRES  21 C  485  GLN TRP TRP ARG LYS PHE ALA MET SER PRO SER ASN PHE          
SEQRES  22 C  485  SER SER SER ASP CYS GLN ASP GLU GLU GLY ARG LYS GLY          
SEQRES  23 C  485  ASN LYS LEU TYR TYR ASN PHE PRO TRP GLY LYS GLU LEU          
SEQRES  24 C  485  ILE GLU THR LEU TRP ASN LEU GLY ASP HIS GLU LEU LEU          
SEQRES  25 C  485  HIS MET TYR PRO GLY ASN VAL SER LYS LEU HIS GLY ARG          
SEQRES  26 C  485  ASP GLY ARG LYS ASN VAL VAL PRO CYS VAL LEU SER VAL          
SEQRES  27 C  485  ASN GLY ASP LEU ASP ARG GLY MET LEU ALA TYR LEU TYR          
SEQRES  28 C  485  ASP SER PHE GLN LEU THR GLU ASN SER PHE THR ARG LYS          
SEQRES  29 C  485  LYS ASN LEU HIS ARG LYS VAL LEU LYS LEU HIS PRO CYS          
SEQRES  30 C  485  LEU ALA PRO ILE LYS VAL ALA LEU ASP VAL GLY ARG GLY          
SEQRES  31 C  485  PRO THR LEU GLU LEU ARG GLN VAL CYS GLN GLY LEU PHE          
SEQRES  32 C  485  ASN GLU LEU LEU GLU ASN GLY ILE SER VAL TRP PRO GLY          
SEQRES  33 C  485  TYR LEU GLU THR MET GLN SER SER LEU GLU GLN LEU TYR          
SEQRES  34 C  485  SER LYS TYR ASP GLU MET SER ILE LEU PHE THR VAL LEU          
SEQRES  35 C  485  VAL THR GLU THR THR LEU GLU ASN GLY LEU ILE HIS LEU          
SEQRES  36 C  485  ARG SER ARG ASP THR THR MET LYS GLU MET MET HIS ILE          
SEQRES  37 C  485  SER LYS LEU LYS ASP PHE LEU ILE LYS TYR ILE SER SER          
SEQRES  38 C  485  ALA LYS ASN VAL                                              
SEQRES   1 P   22   DA  DA  DA  DA  DC  DG  DA  DG  DG  DG  DC  DC  DA          
SEQRES   2 P   22   DG  DT  DG  DC  DC  DG  DT  DA DOC                          
SEQRES   1 T   25   DG  DC  DG  DG  DT  DA  DT  DG  DG  DC  DA  DC  DT          
SEQRES   2 T   25   DG  DG  DC  DC  DC  DT  DC  DG  DT  DT  DT  DT              
HET    DOC  P  24      18                                                       
HET     MG  A4001       1                                                       
HET     MG  A4002       1                                                       
HET    1RY  A4003      28                                                       
HETNAM     DOC 2',3'-DIDEOXYCYTIDINE-5'-MONOPHOSPHATE                           
HETNAM      MG MAGNESIUM ION                                                    
HETNAM     1RY [[(2R,5S)-5-(4-AZANYL-5-FLUORANYL-2-OXIDANYLIDENE-               
HETNAM   2 1RY  PYRIMIDIN-1-YL)-1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL-           
HETNAM   3 1RY  PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE                        
FORMUL   4  DOC    C9 H14 N3 O6 P                                               
FORMUL   6   MG    2(MG 2+)                                                     
FORMUL   8  1RY    C8 H13 F N3 O12 P3 S                                         
HELIX    1 AA1 GLY A   96  HIS A  110  1                                  15    
HELIX    2 AA2 ASN A  134  GLN A  159  1                                  26    
HELIX    3 AA3 GLY A  179  GLU A  183  5                                   5    
HELIX    4 AA4 LEU A  203  GLY A  206  5                                   4    
HELIX    5 AA5 ASN A  270  ALA A  276  1                                   7    
HELIX    6 AA6 THR A  294  GLY A  303  1                                  10    
HELIX    7 AA7 SER A  305  ILE A  313  1                                   9    
HELIX    8 AA8 SER A  355  VAL A  364  1                                  10    
HELIX    9 AA9 GLU A  375  GLY A  380  1                                   6    
HELIX   10 AB1 MET A  382  GLU A  387  1                                   6    
HELIX   11 AB2 ASN A  388  CYS A  418  1                                  31    
HELIX   12 AB3 HIS A  420  MET A  430  1                                  11    
HELIX   13 AB4 GLN A  439  ALA A  470  1                                  32    
HELIX   14 AB5 CYS A  471  SER A  475  5                                   5    
HELIX   15 AB6 GLU A  477  ASP A  482  5                                   6    
HELIX   16 AB7 GLN A  541  GLY A  554  1                                  14    
HELIX   17 AB8 PRO A  570  LEU A  576  1                                   7    
HELIX   18 AB9 VAL A  598  ALA A  604  1                                   7    
HELIX   19 AC1 TYR A  649  CYS A  660  1                                  12    
HELIX   20 AC2 ALA A  786  ILE A  798  1                                  13    
HELIX   21 AC3 ILE A  798  ASN A  803  1                                   6    
HELIX   22 AC4 ALA A  804  SER A  810  1                                   7    
HELIX   23 AC5 PRO A  822  HIS A  828  1                                   7    
HELIX   24 AC6 GLU A  873  VAL A  878  5                                   6    
HELIX   25 AC7 GLN A  894  ALA A  908  1                                  15    
HELIX   26 AC8 PHE A  916  LEU A  921  1                                   6    
HELIX   27 AC9 ASP A  930  THR A  937  1                                   8    
HELIX   28 AD1 ARG A  943  TYR A  955  1                                  13    
HELIX   29 AD2 GLY A  958  HIS A  971  1                                  14    
HELIX   30 AD3 LEU A  973  MET A  985  1                                  13    
HELIX   31 AD4 MET A 1057  ILE A 1064  1                                   8    
HELIX   32 AD5 PHE A 1092  GLU A 1122  1                                  31    
HELIX   33 AD6 ASP A 1145  LYS A 1167  1                                  23    
HELIX   34 AD7 GLU A 1216  TYR A 1221  5                                   6    
HELIX   35 AD8 LEU B   70  HIS B   77  1                                   8    
HELIX   36 AD9 SER B   87  SER B   93  1                                   7    
HELIX   37 AE1 GLY B  100  SER B  117  1                                  18    
HELIX   38 AE2 LEU B  186  GLU B  191  1                                   6    
HELIX   39 AE3 HIS B  192  LEU B  199  1                                   8    
HELIX   40 AE4 PRO B  244  ARG B  246  5                                   3    
HELIX   41 AE5 THR B  247  LYS B  265  1                                  19    
HELIX   42 AE6 ASP B  308  TYR B  315  1                                   8    
HELIX   43 AE7 ASN B  318  HIS B  323  5                                   6    
HELIX   44 AE8 LEU B  342  SER B  353  1                                  12    
HELIX   45 AE9 GLN B  397  ASN B  409  1                                  13    
HELIX   46 AF1 SER B  424  GLU B  434  1                                  11    
HELIX   47 AF2 THR B  444  ASN B  450  1                                   7    
HELIX   48 AF3 HIS B  467  ASN B  484  1                                  18    
HELIX   49 AF4 SER C   87  SER C   93  1                                   7    
HELIX   50 AF5 GLY C  100  VAL C  120  1                                  21    
HELIX   51 AF6 LEU C  186  HIS C  192  1                                   7    
HELIX   52 AF7 ASN C  195  VAL C  200  1                                   6    
HELIX   53 AF8 PRO C  244  ARG C  246  5                                   3    
HELIX   54 AF9 THR C  247  PHE C  266  1                                  20    
HELIX   55 AG1 SER C  269  SER C  271  5                                   3    
HELIX   56 AG2 ASP C  308  HIS C  313  1                                   6    
HELIX   57 AG3 LEU C  342  PHE C  354  1                                  13    
HELIX   58 AG4 THR C  392  GLU C  408  1                                  17    
HELIX   59 AG5 LEU C  425  MET C  435  1                                  11    
HELIX   60 AG6 GLU C  445  GLU C  449  5                                   5    
HELIX   61 AG7 LYS C  470  ALA C  482  1                                  13    
SHEET    1 AA1 5 VAL A 185  VAL A 187  0                                        
SHEET    2 AA1 5 GLY A 174  TYR A 178 -1  N  ARG A 177   O  VAL A 185           
SHEET    3 AA1 5 TRP A 220  CYS A 224 -1  O  TRP A 220   N  TYR A 178           
SHEET    4 AA1 5 PRO A 209  ILE A 215 -1  N  ALA A 214   O  TYR A 221           
SHEET    5 AA1 5 ASP A 198  VAL A 201 -1  N  GLU A 200   O  LEU A 211           
SHEET    1 AA2 3 ALA A 194  VAL A 196  0                                        
SHEET    2 AA2 3 LEU A 265  GLY A 268  1  O  VAL A 267   N  LEU A 195           
SHEET    3 AA2 3 ARG A 290  ASP A 293  1  O  LEU A 292   N  VAL A 266           
SHEET    1 AA3 3 LEU A 435  ASN A 438  0                                        
SHEET    2 AA3 3 TYR A 837  ILE A 840 -1  O  GLY A 838   N  VAL A 437           
SHEET    3 AA3 3 VAL A 814  TRP A 815 -1  N  VAL A 814   O  ALA A 839           
SHEET    1 AA4 2 VAL A 845  GLY A 848  0                                        
SHEET    2 AA4 2 ARG A 853  VAL A 855 -1  O  ARG A 853   N  GLY A 848           
SHEET    1 AA5 4 CYS A1130  ILE A1133  0                                        
SHEET    2 AA5 4 GLU A1136  ARG A1142 -1  O  ARG A1138   N  ILE A1131           
SHEET    3 AA5 4 TYR A 884  ASP A 890 -1  N  VAL A 887   O  TYR A1139           
SHEET    4 AA5 4 VAL A1183  ASP A1186 -1  O  ASP A1184   N  GLY A 888           
SHEET    1 AA6 7 VAL B 125  PRO B 127  0                                        
SHEET    2 AA6 7 TYR B 206  VAL B 218  1  O  GLY B 207   N  PHE B 126           
SHEET    3 AA6 7 SER B 230  THR B 243 -1  O  VAL B 240   N  LEU B 208           
SHEET    4 AA6 7 CYS B 334  ASP B 341 -1  O  GLY B 340   N  ALA B 237           
SHEET    5 AA6 7 GLY B 296  LEU B 306 -1  N  TRP B 304   O  SER B 337           
SHEET    6 AA6 7 LYS B 285  PHE B 293 -1  N  ASN B 287   O  LEU B 303           
SHEET    7 AA6 7 SER B 274  GLN B 279 -1  N  CYS B 278   O  GLY B 286           
SHEET    1 AA7 2 GLY B 324  ARG B 325  0                                        
SHEET    2 AA7 2 ASN B 330  VAL B 331 -1  O  VAL B 331   N  GLY B 324           
SHEET    1 AA8 5 VAL B 413  GLY B 416  0                                        
SHEET    2 AA8 5 VAL B 383  VAL B 387  1  N  LEU B 385   O  GLY B 416           
SHEET    3 AA8 5 PHE B 439  VAL B 443  1  O  VAL B 441   N  ASP B 386           
SHEET    4 AA8 5 ILE B 453  SER B 457 -1  O  HIS B 454   N  LEU B 442           
SHEET    5 AA8 5 LYS B 463  MET B 466 -1  O  MET B 466   N  ILE B 453           
SHEET    1 AA9 7 VAL C 125  PRO C 127  0                                        
SHEET    2 AA9 7 TYR C 206  VAL C 218  1  O  GLY C 207   N  PHE C 126           
SHEET    3 AA9 7 SER C 230  THR C 243 -1  O  SER C 238   N  GLN C 210           
SHEET    4 AA9 7 CYS C 334  ASP C 341 -1  O  CYS C 334   N  THR C 243           
SHEET    5 AA9 7 GLU C 298  LEU C 306 -1  N  ILE C 300   O  ASP C 341           
SHEET    6 AA9 7 GLY C 286  TYR C 291 -1  N  ASN C 287   O  LEU C 303           
SHEET    7 AA9 7 PHE C 273  CYS C 278 -1  N  SER C 276   O  LYS C 288           
SHEET    1 AB1 2 GLY C 324  ARG C 325  0                                        
SHEET    2 AB1 2 ASN C 330  VAL C 331 -1  O  VAL C 331   N  GLY C 324           
SHEET    1 AB2 5 VAL C 413  PRO C 415  0                                        
SHEET    2 AB2 5 VAL C 383  VAL C 387  1  N  VAL C 383   O  TRP C 414           
SHEET    3 AB2 5 PHE C 439  VAL C 443  1  O  VAL C 441   N  ALA C 384           
SHEET    4 AB2 5 LEU C 452  SER C 457 -1  O  HIS C 454   N  LEU C 442           
SHEET    5 AB2 5 LYS C 463  HIS C 467 -1  O  MET C 466   N  ILE C 453           
LINK         CG  LYS A 561                 OP1  DG T  22     1555   1555  1.24  
LINK         OD1 ASP A 890                MG    MG A4002     1555   1555  2.10  
LINK         OD1 ASP A1135                MG    MG A4002     1555   1555  2.41  
LINK         C2   DA P   4                 C2   DT T  26     1555   1555  1.48  
LINK         C4   DA P   4                 O2   DT T  26     1555   1555  1.35  
LINK         O3'  DA P  23                 P   DOC P  24     1555   1555  1.61  
LINK        MG    MG A4001                 OAH 1RY A4003     1555   1555  2.79  
LINK        MG    MG A4001                 OAO 1RY A4003     1555   1555  2.85  
LINK        MG    MG A4002                 OAF 1RY A4003     1555   1555  2.23  
LINK        MG    MG A4002                 OAI 1RY A4003     1555   1555  2.99  
CISPEP   1 MET A   78    LEU A   79          0        -1.72                     
CISPEP   2 GLY A   91    GLY A   92          0         1.17                     
CISPEP   3 GLU A   93    MET A   94          0         2.69                     
CISPEP   4 HIS A  110    GLY A  111          0        -0.29                     
CISPEP   5 GLY A  132    ASP A  133          0        -1.42                     
CISPEP   6 GLY A  206    THR A  207          0        -0.35                     
CISPEP   7 GLN A  262    GLU A  263          0         0.66                     
CISPEP   8 GLY A  286    SER A  287          0         0.28                     
CISPEP   9 SER A  475    GLY A  476          0         0.19                     
CISPEP  10 PHE A  495    LYS A  496          0        -1.79                     
CISPEP  11 LYS A  502    VAL A  503          0         2.69                     
CISPEP  12 SER A  593    LEU A  594          0        -6.89                     
CISPEP  13 LEU A  594    GLN A  595          0         1.72                     
CISPEP  14 SER A  642    ALA A  643          0         1.83                     
CISPEP  15 TYR A  739    ASN A  740          0         2.23                     
CISPEP  16 LEU A  752    PRO A  753          0        -7.60                     
CISPEP  17 PRO A  765    PHE A  766          0         1.03                     
CISPEP  18 THR A  778    LEU A  779          0         2.13                     
CISPEP  19 GLY A  782    PRO A  783          0        -1.02                     
CISPEP  20 PRO A  783    GLY A  784          0        -0.64                     
CISPEP  21 TYR A  831    ASP A  832          0        -0.99                     
CISPEP  22 THR A  849    ILE A  850          0       -11.91                     
CISPEP  23 ILE A  850    THR A  851          0         3.03                     
CISPEP  24 ASP A  892    SER A  893          0        -1.58                     
CISPEP  25 THR A  938    VAL A  939          0         2.62                     
CISPEP  26 VAL A  939    GLY A  940          0        -0.46                     
CISPEP  27 SER A  942    ARG A  943          0        -1.15                     
CISPEP  28 THR A  989    LYS A  990          0         1.73                     
CISPEP  29 PRO A 1073    VAL A 1074          0       -10.55                     
CISPEP  30 VAL A 1074    LEU A 1075          0        -0.52                     
CISPEP  31 LEU A 1075    GLY A 1076          0         0.15                     
CISPEP  32 GLN A 1089    GLU A 1090          0         4.52                     
CISPEP  33 GLY A 1169    LEU A 1170          0         0.19                     
CISPEP  34 GLN A 1214    GLY A 1215          0         0.17                     
CISPEP  35 LEU B  204    PRO B  205          0         5.73                     
CISPEP  36 ARG B  389    GLY B  390          0         0.36                     
CISPEP  37 GLY B  390    PRO B  391          0        -1.79                     
CISPEP  38 LEU B  393    GLU B  394          0         0.42                     
CISPEP  39 MET B  421    GLN B  422          0         3.23                     
CISPEP  40 HIS C   96    PRO C   97          0        19.50                     
CISPEP  41 ARG C  122    GLU C  123          0         3.52                     
CISPEP  42 PHE C  293    PRO C  294          0         1.18                     
CISPEP  43 PRO C  316    GLY C  317          0        -1.57                     
CISPEP  44 GLY C  317    ASN C  318          0         0.11                     
CISPEP  45 LEU C  418    GLU C  419          0         2.08                     
CISPEP  46 GLU C  419    THR C  420          0         5.39                     
SITE     1 AC1  3 ASP A1135  1RY A4003  DOC P  24                               
SITE     1 AC2  5 ASP A 890  VAL A 891  ASP A 892  ASP A1135                    
SITE     2 AC2  5 1RY A4003                                                     
SITE     1 AC3 16 ARG A 853  ASP A 890  VAL A 891  ASP A 892                    
SITE     2 AC3 16 SER A 893  GLN A 894  ARG A 943  LYS A 947                    
SITE     3 AC3 16 ARG A 948  TYR A 951  ASP A1135   MG A4001                    
SITE     4 AC3 16  MG A4002  DOC P  24   DG T   4   DG T   5                    
CRYST1  215.049  215.049  161.692  90.00  90.00  90.00 P 41 21 2    16          
ORIGX1      1.000000  0.000000  0.000000        0.00000                         
ORIGX2      0.000000  1.000000  0.000000        0.00000                         
ORIGX3      0.000000  0.000000  1.000000        0.00000                         
SCALE1      0.004650  0.000000  0.000000        0.00000                         
SCALE2      0.000000  0.004650  0.000000        0.00000                         
SCALE3      0.000000  0.000000  0.006185        0.00000                         
ATOM      1  N   MET A  78      63.173 -32.383 -21.709  1.00 96.33           N  
ATOM      2  CA  MET A  78      64.083 -33.520 -21.768  1.00 98.80           C  
ATOM      3  C   MET A  78      64.289 -34.118 -20.381  1.00 99.12           C  
ATOM      4  O   MET A  78      65.143 -33.658 -19.622  1.00 90.43           O  
ATOM      5  CB  MET A  78      65.427 -33.102 -22.375  1.00 97.73           C  
ATOM      6  CG  MET A  78      66.372 -34.257 -22.694  1.00 90.13           C  
ATOM      7  SD  MET A  78      67.506 -34.679 -21.356  1.00 90.89           S  
ATOM      8  CE  MET A  78      68.455 -33.166 -21.217  1.00 99.97           C  
ATOM      9  N   LEU A  79      63.499 -35.133 -20.040  1.00 96.55           N  
ATOM     10  CA  LEU A  79      62.450 -35.650 -20.911  1.00 96.66           C  
ATOM     11  C   LEU A  79      61.181 -35.876 -20.091  1.00 96.32           C  
ATOM     12  O   LEU A  79      61.149 -35.558 -18.901  1.00 96.24           O  
ATOM     13  CB  LEU A  79      62.901 -36.949 -21.590  1.00 97.84           C  
ATOM     14  CG  LEU A  79      62.376 -37.291 -22.992  1.00 99.75           C  
ATOM     15  CD1 LEU A  79      61.387 -38.449 -22.946  1.00 98.69           C  
ATOM     16  CD2 LEU A  79      61.755 -36.072 -23.663  1.00 95.41           C  
ATOM     17  N   SER A  80      60.147 -36.416 -20.732  1.00117.45           N  
ATOM     18  CA  SER A  80      58.875 -36.717 -20.078  1.00118.00           C  
ATOM     19  C   SER A  80      58.315 -35.506 -19.338  1.00114.38           C  
ATOM     20  O   SER A  80      57.839 -35.627 -18.207  1.00115.99           O  
ATOM     21  CB  SER A  80      59.032 -37.895 -19.113  1.00119.37           C  
ATOM     22  OG  SER A  80      59.435 -39.069 -19.800  1.00119.29           O  
ATOM     23  N   ARG A  81      58.396 -34.346 -19.984  1.00 80.84           N  
ATOM     24  CA  ARG A  81      57.883 -33.089 -19.438  1.00 78.80           C  
ATOM     25  C   ARG A  81      58.546 -32.703 -18.115  1.00 78.01           C  
ATOM     26  O   ARG A  81      57.914 -32.092 -17.253  1.00 76.44           O  
ATOM     27  CB  ARG A  81      56.363 -33.169 -19.262  1.00 78.09           C  
ATOM     28  CG  ARG A  81      55.591 -33.221 -20.573  1.00 78.45           C  
ATOM     29  CD  ARG A  81      54.428 -34.202 -20.511  1.00 79.14           C  
ATOM     30  NE  ARG A  81      54.866 -35.587 -20.671  1.00 81.02           N  
ATOM     31  CZ  ARG A  81      55.067 -36.433 -19.665  1.00 81.68           C  
ATOM     32  NH1 ARG A  81      54.865 -36.043 -18.415  1.00 80.61           N  
ATOM     33  NH2 ARG A  81      55.465 -37.673 -19.913  1.00 83.41           N  
ATOM     34  N   GLY A  82      59.820 -33.057 -17.960  1.00 65.49           N  
ATOM     35  CA  GLY A  82      60.585 -32.632 -16.801  1.00 64.09           C  
ATOM     36  C   GLY A  82      61.321 -33.726 -16.048  1.00 64.57           C  
ATOM     37  O   GLY A  82      60.717 -34.489 -15.293  1.00 64.04           O  
ATOM     38  N   LEU A  83      62.634 -33.795 -16.254  1.00106.12           N  
ATOM     39  CA  LEU A  83      63.498 -34.673 -15.467  1.00107.09           C  
ATOM     40  C   LEU A  83      64.946 -34.201 -15.566  1.00108.26           C  
ATOM     41  O   LEU A  83      65.325 -33.534 -16.526  1.00107.49           O  
ATOM     42  CB  LEU A  83      63.372 -36.134 -15.925  1.00108.88           C  
ATOM     43  CG  LEU A  83      64.060 -36.650 -17.196  1.00109.58           C  
ATOM     44  CD1 LEU A  83      65.480 -37.142 -16.924  1.00101.26           C  
ATOM     45  CD2 LEU A  83      63.233 -37.758 -17.831  1.00101.41           C  
ATOM     46  N   HIS A  84      65.750 -34.554 -14.568  1.00 84.63           N  
ATOM     47  CA  HIS A  84      67.166 -34.199 -14.555  1.00 84.52           C  
ATOM     48  C   HIS A  84      68.048 -35.441 -14.639  1.00 85.96           C  
ATOM     49  O   HIS A  84      67.580 -36.558 -14.423  1.00 85.18           O  
ATOM     50  CB  HIS A  84      67.508 -33.396 -13.298  1.00 83.66           C  
ATOM     51  CG  HIS A  84      67.025 -31.980 -13.332  1.00 81.04           C  
ATOM     52  ND1 HIS A  84      66.660 -31.344 -14.499  1.00 80.28           N  
ATOM     53  CD2 HIS A  84      66.848 -31.074 -12.340  1.00 88.32           C  
ATOM     54  CE1 HIS A  84      66.282 -30.107 -14.225  1.00 88.59           C  
ATOM     55  NE2 HIS A  84      66.384 -29.919 -12.923  1.00 86.34           N  
ATOM     56  N   GLU A  85      69.323 -35.238 -14.958  1.00 88.98           N  
ATOM     57  CA  GLU A  85      70.285 -36.335 -15.004  1.00 89.97           C  
ATOM     58  C   GLU A  85      70.498 -36.906 -13.608  1.00 80.03           C  
ATOM     59  O   GLU A  85      71.039 -36.236 -12.730  1.00 81.93           O  
ATOM     60  CB  GLU A  85      71.617 -35.864 -15.598  1.00 89.53           C  
ATOM     61  CG  GLU A  85      72.719 -36.917 -15.599  1.00 81.50           C  
ATOM     62  CD  GLU A  85      73.612 -36.841 -14.371  1.00 80.59           C  
ATOM     63  OE1 GLU A  85      74.268 -37.852 -14.047  1.00 81.29           O  
ATOM     64  OE2 GLU A  85      73.661 -35.768 -13.733  1.00 81.43           O  
ATOM     65  N   GLN A  86      70.065 -38.146 -13.405  1.00 64.19           N  
ATOM     66  CA  GLN A  86      70.166 -38.773 -12.095  1.00 63.82           C  
ATOM     67  C   GLN A  86      70.772 -40.165 -12.179  1.00 64.10           C  
ATOM     68  O   GLN A  86      70.708 -40.825 -13.216  1.00 65.10           O  
ATOM     69  CB  GLN A  86      68.790 -38.843 -11.426  1.00 64.75           C  
ATOM     70  CG  GLN A  86      68.022 -40.137 -11.672  1.00 65.22           C  
ATOM     71  CD  GLN A  86      67.619 -40.324 -13.122  1.00 66.92           C  
ATOM     72  OE1 GLN A  86      67.539 -39.364 -13.889  1.00 64.78           O  
ATOM     73  NE2 GLN A  86      67.361 -41.568 -13.505  1.00 65.34           N  
ATOM     74  N   ILE A  87      71.367 -40.603 -11.075  1.00 77.62           N  
ATOM     75  CA  ILE A  87      71.883 -41.958 -10.968  1.00 79.14           C  
ATOM     76  C   ILE A  87      71.238 -42.607  -9.747  1.00 77.15           C  
ATOM     77  O   ILE A  87      71.920 -43.048  -8.820  1.00 76.22           O  
ATOM     78  CB  ILE A  87      73.428 -41.991 -10.856  1.00 76.89           C  
ATOM     79  CG1 ILE A  87      74.070 -40.993 -11.826  1.00 78.86           C  
ATOM     80  CG2 ILE A  87      73.959 -43.392 -11.132  1.00 78.05           C  
ATOM     81  CD1 ILE A  87      74.381 -39.636 -11.221  1.00 76.88           C  
ATOM     82  N   PHE A  88      69.909 -42.642  -9.751  1.00 98.28           N  
ATOM     83  CA  PHE A  88      69.144 -43.187  -8.635  1.00 98.40           C  
ATOM     84  C   PHE A  88      68.285 -44.365  -9.081  1.00 96.79           C  
ATOM     85  O   PHE A  88      67.262 -44.667  -8.469  1.00 95.69           O  
ATOM     86  CB  PHE A  88      68.261 -42.104  -8.011  1.00 97.67           C  
ATOM     87  CG  PHE A  88      69.027 -40.917  -7.505  1.00 95.73           C  
ATOM     88  CD1 PHE A  88      70.282 -41.072  -6.940  1.00 95.03           C  
ATOM     89  CD2 PHE A  88      68.494 -39.641  -7.599  1.00 96.35           C  
ATOM     90  CE1 PHE A  88      70.990 -39.978  -6.477  1.00 96.14           C  
ATOM     91  CE2 PHE A  88      69.197 -38.545  -7.136  1.00 95.90           C  
ATOM     92  CZ  PHE A  88      70.447 -38.714  -6.573  1.00 97.54           C  
ATOM     93  N   GLY A  89      68.709 -45.026 -10.153  1.00 77.36           N  
ATOM     94  CA  GLY A  89      67.972 -46.151 -10.696  1.00 79.11           C  
ATOM     95  C   GLY A  89      67.810 -46.046 -12.198  1.00 70.63           C  
ATOM     96  O   GLY A  89      67.257 -45.069 -12.706  1.00 79.12           O  
ATOM     97  N   GLN A  90      68.293 -47.056 -12.913  1.00 93.27           N  
ATOM     98  CA  GLN A  90      68.237 -47.059 -14.369  1.00 96.22           C  
ATOM     99  C   GLN A  90      66.817 -47.313 -14.869  1.00 95.29           C  
ATOM    100  O   GLN A  90      66.408 -46.772 -15.897  1.00 97.53           O  
ATOM    101  CB  GLN A  90      69.196 -48.109 -14.936  1.00 97.41           C  
ATOM    102  CG  GLN A  90      69.356 -48.061 -16.447  1.00 95.96           C  
ATOM    103  CD  GLN A  90      70.042 -46.795 -16.926  1.00 97.93           C  
ATOM    104  OE1 GLN A  90      70.730 -46.117 -16.163  1.00 96.90           O  
ATOM    105  NE2 GLN A  90      69.856 -46.469 -18.201  1.00 98.07           N  
ATOM    106  N   GLY A  91      66.069 -48.130 -14.136  1.00 78.80           N  
ATOM    107  CA  GLY A  91      64.698 -48.437 -14.497  1.00 76.07           C  
ATOM    108  C   GLY A  91      63.800 -48.616 -13.287  1.00 75.20           C  
ATOM    109  O   GLY A  91      64.138 -49.360 -12.365  1.00 74.65           O  
ATOM    110  N   GLY A  92      62.655 -47.940 -13.286  1.00 99.92           N  
ATOM    111  CA  GLY A  92      62.252 -47.087 -14.390  1.00 90.91           C  
ATOM    112  C   GLY A  92      60.804 -47.318 -14.772  1.00 92.29           C  
ATOM    113  O   GLY A  92      60.023 -47.837 -13.974  1.00 91.30           O  
ATOM    114  N   GLU A  93      60.444 -46.924 -15.992  1.00107.57           N  
ATOM    115  CA  GLU A  93      59.100 -47.150 -16.518  1.00108.79           C  
ATOM    116  C   GLU A  93      58.755 -48.644 -16.516  1.00100.80           C  
ATOM    117  O   GLU A  93      59.579 -49.441 -16.965  1.00108.41           O  
ATOM    118  CB  GLU A  93      58.975 -46.580 -17.934  1.00109.66           C  
ATOM    119  CG  GLU A  93      58.391 -45.175 -18.004  1.00100.53           C  
ATOM    120  CD  GLU A  93      59.213 -44.152 -17.243  1.00100.20           C  
ATOM    121  OE1 GLU A  93      58.617 -43.192 -16.707  1.00109.41           O  
ATOM    122  OE2 GLU A  93      60.452 -44.298 -17.185  1.00108.60           O  
ATOM    123  N   MET A  94      57.577 -49.064 -16.031  1.00108.28           N  
ATOM    124  CA  MET A  94      56.454 -48.255 -15.505  1.00102.69           C  
ATOM    125  C   MET A  94      55.918 -47.158 -16.435  1.00102.24           C  
ATOM    126  O   MET A  94      55.971 -45.976 -16.092  1.00109.87           O  
ATOM    127  CB  MET A  94      56.830 -47.628 -14.153  1.00106.82           C  
ATOM    128  CG  MET A  94      56.961 -48.624 -13.012  1.00107.75           C  
ATOM    129  SD  MET A  94      55.363 -49.148 -12.365  1.00108.69           S  
ATOM    130  CE  MET A  94      54.700 -47.582 -11.805  1.00101.01           C  
ATOM    131  N   PRO A  95      55.387 -47.546 -17.607  1.00 92.74           N  
ATOM    132  CA  PRO A  95      54.825 -46.541 -18.516  1.00 91.22           C  
ATOM    133  C   PRO A  95      53.379 -46.169 -18.173  1.00 92.89           C  
ATOM    134  O   PRO A  95      53.078 -44.986 -18.017  1.00 93.79           O  
ATOM    135  CB  PRO A  95      54.908 -47.226 -19.882  1.00 93.09           C  
ATOM    136  CG  PRO A  95      54.793 -48.682 -19.576  1.00 96.98           C  
ATOM    137  CD  PRO A  95      55.366 -48.898 -18.197  1.00 96.09           C  
ATOM    138  N   GLY A  96      52.507 -47.166 -18.053  1.00 92.40           N  
ATOM    139  CA  GLY A  96      51.104 -46.931 -17.765  1.00 91.21           C  
ATOM    140  C   GLY A  96      50.409 -46.193 -18.891  1.00 98.69           C  
ATOM    141  O   GLY A  96      49.893 -45.094 -18.694  1.00 90.17           O  
ATOM    142  N   GLU A  97      50.392 -46.803 -20.072  1.00 83.14           N  
ATOM    143  CA  GLU A  97      49.853 -46.165 -21.270  1.00 83.14           C  
ATOM    144  C   GLU A  97      48.375 -45.809 -21.138  1.00 84.29           C  
ATOM    145  O   GLU A  97      47.950 -44.726 -21.543  1.00 81.09           O  
ATOM    146  CB  GLU A  97      50.064 -47.070 -22.484  1.00 84.90           C  
ATOM    147  CG  GLU A  97      51.523 -47.396 -22.750  1.00 86.92           C  
ATOM    148  CD  GLU A  97      51.705 -48.322 -23.933  1.00 87.02           C  
ATOM    149  OE1 GLU A  97      50.697 -48.651 -24.594  1.00 87.08           O  
ATOM    150  OE2 GLU A  97      52.857 -48.722 -24.203  1.00 86.56           O  
ATOM    151  N   ALA A  98      47.594 -46.723 -20.573  1.00 71.55           N  
ATOM    152  CA  ALA A  98      46.179 -46.468 -20.337  1.00 79.70           C  
ATOM    153  C   ALA A  98      46.010 -45.365 -19.298  1.00 79.14           C  
ATOM    154  O   ALA A  98      45.161 -44.481 -19.443  1.00 79.94           O  
ATOM    155  CB  ALA A  98      45.471 -47.736 -19.891  1.00 71.90           C  
ATOM    156  N   ALA A  99      46.832 -45.423 -18.254  1.00 85.18           N  
ATOM    157  CA  ALA A  99      46.786 -44.441 -17.180  1.00 83.26           C  
ATOM    158  C   ALA A  99      47.136 -43.044 -17.684  1.00 82.28           C  
ATOM    159  O   ALA A  99      46.455 -42.072 -17.355  1.00 80.20           O  
ATOM    160  CB  ALA A  99      47.723 -44.847 -16.052  1.00 83.05           C  
ATOM    161  N   VAL A 100      48.193 -42.945 -18.486  1.00 65.11           N  
ATOM    162  CA  VAL A 100      48.611 -41.650 -19.012  1.00 65.38           C  
ATOM    163  C   VAL A 100      47.667 -41.177 -20.113  1.00 64.33           C  
ATOM    164  O   VAL A 100      47.586 -39.981 -20.391  1.00 64.09           O  
ATOM    165  CB  VAL A 100      50.061 -41.676 -19.552  1.00 65.59           C  
ATOM    166  CG1 VAL A 100      51.033 -42.085 -18.453  1.00 67.10           C  
ATOM    167  CG2 VAL A 100      50.179 -42.593 -20.756  1.00 66.69           C  
ATOM    168  N   ARG A 101      46.949 -42.107 -20.735  1.00 83.39           N  
ATOM    169  CA  ARG A 101      45.922 -41.730 -21.700  1.00 84.36           C  
ATOM    170  C   ARG A 101      44.754 -41.102 -20.942  1.00 81.11           C  
ATOM    171  O   ARG A 101      44.179 -40.105 -21.386  1.00 80.00           O  
ATOM    172  CB  ARG A 101      45.478 -42.942 -22.538  1.00 84.63           C  
ATOM    173  CG  ARG A 101      44.012 -43.366 -22.413  1.00 83.11           C  
ATOM    174  CD  ARG A 101      43.075 -42.556 -23.308  1.00 82.93           C  
ATOM    175  NE  ARG A 101      43.447 -42.618 -24.719  1.00 84.45           N  
ATOM    176  CZ  ARG A 101      42.781 -41.999 -25.689  1.00 80.74           C  
ATOM    177  NH1 ARG A 101      41.711 -41.272 -25.400  1.00 82.60           N  
ATOM    178  NH2 ARG A 101      43.186 -42.106 -26.947  1.00 82.65           N  
ATOM    179  N   ARG A 102      44.421 -41.677 -19.788  1.00 93.38           N  
ATOM    180  CA  ARG A 102      43.349 -41.145 -18.959  1.00 94.93           C  
ATOM    181  C   ARG A 102      43.743 -39.792 -18.372  1.00 92.06           C  
ATOM    182  O   ARG A 102      42.903 -38.904 -18.225  1.00 93.08           O  
ATOM    183  CB  ARG A 102      42.991 -42.128 -17.841  1.00 93.06           C  
ATOM    184  CG  ARG A 102      42.248 -43.367 -18.318  1.00 94.06           C  
ATOM    185  CD  ARG A 102      40.877 -43.011 -18.875  1.00 95.49           C  
ATOM    186  NE  ARG A 102      40.193 -44.170 -19.443  1.00 94.50           N  
ATOM    187  CZ  ARG A 102      38.953 -44.145 -19.921  1.00 94.09           C  
ATOM    188  NH1 ARG A 102      38.253 -43.019 -19.896  1.00 95.13           N  
ATOM    189  NH2 ARG A 102      38.411 -45.246 -20.423  1.00 98.19           N  
ATOM    190  N   SER A 103      45.023 -39.640 -18.049  1.00 88.49           N  
ATOM    191  CA  SER A 103      45.526 -38.389 -17.490  1.00 88.54           C  
ATOM    192  C   SER A 103      45.546 -37.284 -18.542  1.00 85.86           C  
ATOM    193  O   SER A 103      45.118 -36.161 -18.279  1.00 84.61           O  
ATOM    194  CB  SER A 103      46.927 -38.581 -16.911  1.00 86.95           C  
ATOM    195  OG  SER A 103      47.887 -38.734 -17.941  1.00 89.48           O  
ATOM    196  N   VAL A 104      46.052 -37.610 -19.728  1.00 76.43           N  
ATOM    197  CA  VAL A 104      46.088 -36.660 -20.837  1.00 74.49           C  
ATOM    198  C   VAL A 104      44.673 -36.240 -21.222  1.00 74.31           C  
ATOM    199  O   VAL A 104      44.404 -35.058 -21.435  1.00 72.15           O  
ATOM    200  CB  VAL A 104      46.811 -37.249 -22.068  1.00 74.70           C  
ATOM    201  CG1 VAL A 104      46.454 -36.476 -23.328  1.00 76.14           C  
ATOM    202  CG2 VAL A 104      48.316 -37.252 -21.846  1.00 77.36           C  
ATOM    203  N   GLU A 105      43.769 -37.214 -21.296  1.00102.37           N  
ATOM    204  CA  GLU A 105      42.373 -36.931 -21.605  1.00102.45           C  
ATOM    205  C   GLU A 105      41.747 -36.062 -20.515  1.00100.58           C  
ATOM    206  O   GLU A 105      40.916 -35.199 -20.796  1.00107.82           O  
ATOM    207  CB  GLU A 105      41.581 -38.230 -21.769  1.00102.36           C  
ATOM    208  CG  GLU A 105      40.242 -38.062 -22.469  1.00109.94           C  
ATOM    209  CD  GLU A 105      40.391 -37.704 -23.935  1.00101.72           C  
ATOM    210  OE1 GLU A 105      40.389 -36.497 -24.259  1.00100.42           O  
ATOM    211  OE2 GLU A 105      40.508 -38.630 -24.766  1.00101.30           O  
ATOM    212  N   HIS A 106      42.156 -36.296 -19.271  1.00 70.46           N  
ATOM    213  CA  HIS A 106      41.673 -35.511 -18.139  1.00 72.14           C  
ATOM    214  C   HIS A 106      42.195 -34.080 -18.189  1.00 69.74           C  
ATOM    215  O   HIS A 106      41.454 -33.132 -17.929  1.00 70.19           O  
ATOM    216  CB  HIS A 106      42.080 -36.163 -16.817  1.00 71.57           C  
ATOM    217  CG  HIS A 106      41.913 -35.271 -15.626  1.00 69.32           C  
ATOM    218  ND1 HIS A 106      40.718 -34.661 -15.313  1.00 68.60           N  
ATOM    219  CD2 HIS A 106      42.792 -34.884 -14.672  1.00 69.09           C  
ATOM    220  CE1 HIS A 106      40.867 -33.939 -14.218  1.00 67.97           C  
ATOM    221  NE2 HIS A 106      42.117 -34.058 -13.808  1.00 68.20           N  
ATOM    222  N   LEU A 107      43.472 -33.930 -18.524  1.00 72.45           N  
ATOM    223  CA  LEU A 107      44.105 -32.616 -18.574  1.00 70.94           C  
ATOM    224  C   LEU A 107      43.762 -31.862 -19.855  1.00 72.03           C  
ATOM    225  O   LEU A 107      44.162 -30.712 -20.033  1.00 71.10           O  
ATOM    226  CB  LEU A 107      45.622 -32.752 -18.443  1.00 70.21           C  
ATOM    227  CG  LEU A 107      46.131 -33.294 -17.106  1.00 78.90           C  
ATOM    228  CD1 LEU A 107      47.648 -33.397 -17.113  1.00 78.50           C  
ATOM    229  CD2 LEU A 107      45.654 -32.419 -15.959  1.00 76.97           C  
ATOM    230  N   GLN A 108      43.025 -32.515 -20.747  1.00 93.26           N  
ATOM    231  CA  GLN A 108      42.606 -31.890 -21.993  1.00 90.28           C  
ATOM    232  C   GLN A 108      41.197 -31.321 -21.860  1.00 91.02           C  
ATOM    233  O   GLN A 108      40.894 -30.250 -22.391  1.00 99.99           O  
ATOM    234  CB  GLN A 108      42.669 -32.892 -23.148  1.00 91.09           C  
ATOM    235  CG  GLN A 108      42.299 -32.309 -24.503  1.00 91.37           C  
ATOM    236  CD  GLN A 108      42.417 -33.322 -25.626  1.00 92.55           C  
ATOM    237  OE1 GLN A 108      42.834 -34.458 -25.411  1.00 95.07           O  
ATOM    238  NE2 GLN A 108      42.044 -32.912 -26.835  1.00 93.42           N  
ATOM    239  N   LYS A 109      40.339 -32.043 -21.146  1.00 93.24           N  
ATOM    240  CA  LYS A 109      38.958 -31.617 -20.941  1.00 92.59           C  
ATOM    241  C   LYS A 109      38.853 -30.648 -19.766  1.00 90.95           C  
ATOM    242  O   LYS A 109      37.915 -29.855 -19.683  1.00 91.23           O  
ATOM    243  CB  LYS A 109      38.055 -32.834 -20.716  1.00 93.71           C  
ATOM    244  CG  LYS A 109      36.570 -32.512 -20.595  1.00 93.14           C  
ATOM    245  CD  LYS A 109      36.049 -31.802 -21.836  1.00 91.84           C  
ATOM    246  CE  LYS A 109      36.100 -32.702 -23.059  1.00 93.20           C  
ATOM    247  NZ  LYS A 109      35.224 -33.897 -22.908  1.00 94.67           N  
ATOM    248  N   HIS A 110      39.829 -30.711 -18.865  1.00 91.90           N  
ATOM    249  CA  HIS A 110      39.844 -29.855 -17.679  1.00 90.49           C  
ATOM    250  C   HIS A 110      39.833 -28.337 -17.968  1.00 91.44           C  
ATOM    251  O   HIS A 110      39.021 -27.631 -17.373  1.00 99.14           O  
ATOM    252  CB  HIS A 110      41.045 -30.205 -16.791  1.00 90.77           C  
ATOM    253  CG  HIS A 110      41.005 -29.561 -15.440  1.00 90.51           C  
ATOM    254  ND1 HIS A 110      40.094 -29.922 -14.470  1.00 90.97           N  
ATOM    255  CD2 HIS A 110      41.760 -28.576 -14.897  1.00 99.53           C  
ATOM    256  CE1 HIS A 110      40.291 -29.190 -13.389  1.00 90.12           C  
ATOM    257  NE2 HIS A 110      41.296 -28.365 -13.623  1.00 99.14           N  
ATOM    258  N   GLY A 111      40.690 -27.808 -18.850  1.00 64.29           N  
ATOM    259  CA  GLY A 111      41.695 -28.534 -19.611  1.00 64.96           C  
ATOM    260  C   GLY A 111      42.953 -27.714 -19.825  1.00 66.38           C  
ATOM    261  O   GLY A 111      42.886 -26.541 -20.189  1.00 64.85           O  
ATOM    262  N   LEU A 112      44.103 -28.336 -19.595  1.00 77.58           N  
ATOM    263  CA  LEU A 112      45.385 -27.655 -19.735  1.00 76.76           C  
ATOM    264  C   LEU A 112      46.279 -28.367 -20.743  1.00 78.09           C  
ATOM    265  O   LEU A 112      46.786 -29.458 -20.477  1.00 78.32           O  
ATOM    266  CB  LEU A 112      46.099 -27.558 -18.382  1.00 74.84           C  
ATOM    267  CG  LEU A 112      45.629 -26.521 -17.356  1.00 73.32           C  
ATOM    268  CD1 LEU A 112      44.282 -26.887 -16.751  1.00 73.43           C  
ATOM    269  CD2 LEU A 112      46.671 -26.371 -16.260  1.00 71.67           C  
ATOM    270  N   TRP A 113      46.472 -27.748 -21.902  1.00 81.33           N  
ATOM    271  CA  TRP A 113      47.350 -28.303 -22.925  1.00 83.46           C  
ATOM    272  C   TRP A 113      48.121 -27.207 -23.651  1.00 83.48           C  
ATOM    273  O   TRP A 113      48.561 -27.390 -24.786  1.00 83.99           O  
ATOM    274  CB  TRP A 113      46.551 -29.138 -23.925  1.00 85.01           C  
ATOM    275  CG  TRP A 113      46.776 -30.606 -23.771  1.00 86.49           C  
ATOM    276  CD1 TRP A 113      45.993 -31.490 -23.087  1.00 85.70           C  
ATOM    277  CD2 TRP A 113      47.869 -31.365 -24.301  1.00 85.47           C  
ATOM    278  NE1 TRP A 113      46.527 -32.755 -23.165  1.00 88.83           N  
ATOM    279  CE2 TRP A 113      47.680 -32.704 -23.905  1.00 86.33           C  
ATOM    280  CE3 TRP A 113      48.988 -31.043 -25.076  1.00 87.06           C  
ATOM    281  CZ2 TRP A 113      48.567 -33.719 -24.256  1.00 89.99           C  
ATOM    282  CZ3 TRP A 113      49.866 -32.052 -25.423  1.00 89.25           C  
ATOM    283  CH2 TRP A 113      49.652 -33.374 -25.015  1.00 90.47           C  
ATOM    284  N   GLY A 114      48.280 -26.068 -22.985  1.00105.34           N  
ATOM    285  CA  GLY A 114      49.055 -24.969 -23.527  1.00104.88           C  
ATOM    286  C   GLY A 114      50.394 -24.860 -22.827  1.00106.03           C  
ATOM    287  O   GLY A 114      50.634 -23.924 -22.066  1.00104.82           O  
ATOM    288  N   GLN A 115      51.268 -25.831 -23.084  1.00 95.86           N  
ATOM    289  CA  GLN A 115      52.578 -25.878 -22.447  1.00 94.58           C  
ATOM    290  C   GLN A 115      53.450 -24.696 -22.864  1.00 94.13           C  
ATOM    291  O   GLN A 115      53.499 -24.337 -24.041  1.00 93.04           O  
ATOM    292  CB  GLN A 115      53.287 -27.201 -22.768  1.00 97.83           C  
ATOM    293  CG  GLN A 115      53.547 -27.459 -24.250  1.00 91.50           C  
ATOM    294  CD  GLN A 115      52.321 -27.960 -24.992  1.00 92.24           C  
ATOM    295  OE1 GLN A 115      51.289 -28.252 -24.385  1.00 90.65           O  
ATOM    296  NE2 GLN A 115      52.429 -28.062 -26.311  1.00 97.04           N  
ATOM    297  N   PRO A 116      54.134 -24.077 -21.890  1.00108.00           N  
ATOM    298  CA  PRO A 116      55.016 -22.934 -22.146  1.00109.78           C  
ATOM    299  C   PRO A 116      56.346 -23.348 -22.767  1.00109.28           C  
ATOM    300  O   PRO A 116      56.987 -22.533 -23.434  1.00108.41           O  
ATOM    301  CB  PRO A 116      55.227 -22.341 -20.751  1.00106.17           C  
ATOM    302  CG  PRO A 116      55.103 -23.508 -19.838  1.00109.09           C  
ATOM    303  CD  PRO A 116      54.057 -24.401 -20.454  1.00109.97           C  
ATOM    304  N   ALA A 117      56.741 -24.601 -22.545  1.00108.32           N  
ATOM    305  CA  ALA A 117      57.995 -25.147 -23.062  1.00102.47           C  
ATOM    306  C   ALA A 117      59.195 -24.289 -22.668  1.00101.82           C  
ATOM    307  O   ALA A 117      59.897 -23.755 -23.527  1.00101.40           O  
ATOM    308  CB  ALA A 117      57.925 -25.297 -24.578  1.00102.97           C  
ATOM    309  N   VAL A 118      59.424 -24.162 -21.365  1.00 72.23           N  
ATOM    310  CA  VAL A 118      60.546 -23.383 -20.853  1.00 70.99           C  
ATOM    311  C   VAL A 118      61.468 -24.237 -19.982  1.00 74.11           C  
ATOM    312  O   VAL A 118      61.365 -24.220 -18.755  1.00 72.56           O  
ATOM    313  CB  VAL A 118      60.059 -22.163 -20.043  1.00 70.43           C  
ATOM    314  CG1 VAL A 118      59.834 -20.972 -20.961  1.00 78.40           C  
ATOM    315  CG2 VAL A 118      58.787 -22.501 -19.271  1.00 70.20           C  
ATOM    316  N   PRO A 119      62.376 -24.989 -20.624  1.00 99.41           N  
ATOM    317  CA  PRO A 119      63.299 -25.896 -19.929  1.00 90.46           C  
ATOM    318  C   PRO A 119      64.262 -25.166 -18.997  1.00 98.79           C  
ATOM    319  O   PRO A 119      64.965 -24.253 -19.429  1.00 99.34           O  
ATOM    320  CB  PRO A 119      64.064 -26.566 -21.077  1.00 90.91           C  
ATOM    321  CG  PRO A 119      63.206 -26.376 -22.283  1.00 91.66           C  
ATOM    322  CD  PRO A 119      62.546 -25.051 -22.085  1.00 99.26           C  
ATOM    323  N   LEU A 120      64.289 -25.573 -17.731  1.00 59.23           N  
ATOM    324  CA  LEU A 120      65.219 -25.006 -16.760  1.00 58.18           C  
ATOM    325  C   LEU A 120      66.635 -25.507 -17.040  1.00 61.76           C  
ATOM    326  O   LEU A 120      66.811 -26.619 -17.540  1.00 62.04           O  
ATOM    327  CB  LEU A 120      64.795 -25.359 -15.329  1.00 57.20           C  
ATOM    328  CG  LEU A 120      63.682 -24.534 -14.671  1.00 54.94           C  
ATOM    329  CD1 LEU A 120      62.326 -24.803 -15.310  1.00 56.45           C  
ATOM    330  CD2 LEU A 120      63.628 -24.813 -13.177  1.00 55.09           C  
ATOM    331  N   PRO A 121      67.651 -24.684 -16.729  1.00 77.75           N  
ATOM    332  CA  PRO A 121      69.046 -25.073 -16.969  1.00 76.90           C  
ATOM    333  C   PRO A 121      69.452 -26.315 -16.177  1.00 81.36           C  
ATOM    334  O   PRO A 121      69.502 -26.276 -14.948  1.00 80.48           O  
ATOM    335  CB  PRO A 121      69.839 -23.845 -16.503  1.00 77.43           C  
ATOM    336  CG  PRO A 121      68.920 -23.123 -15.575  1.00 76.73           C  
ATOM    337  CD  PRO A 121      67.551 -23.339 -16.136  1.00 75.83           C  
ATOM    338  N   ASP A 122      69.733 -27.403 -16.888  1.00 98.70           N  
ATOM    339  CA  ASP A 122      70.115 -28.661 -16.254  1.00 91.72           C  
ATOM    340  C   ASP A 122      71.496 -28.558 -15.614  1.00 91.04           C  
ATOM    341  O   ASP A 122      72.384 -27.888 -16.142  1.00 93.93           O  
ATOM    342  CB  ASP A 122      70.087 -29.802 -17.274  1.00 92.08           C  
ATOM    343  CG  ASP A 122      70.361 -31.154 -16.646  1.00 95.55           C  
ATOM    344  OD1 ASP A 122      71.538 -31.568 -16.617  1.00 95.03           O  
ATOM    345  OD2 ASP A 122      69.399 -31.803 -16.183  1.00 95.40           O  
ATOM    346  N   VAL A 123      71.672 -29.226 -14.478  1.00 82.22           N  
ATOM    347  CA  VAL A 123      72.925 -29.166 -13.733  1.00 82.88           C  
ATOM    348  C   VAL A 123      73.685 -30.494 -13.777  1.00 83.31           C  
ATOM    349  O   VAL A 123      73.120 -31.557 -13.513  1.00 83.62           O  
ATOM    350  CB  VAL A 123      72.676 -28.758 -12.260  1.00 80.31           C  
ATOM    351  CG1 VAL A 123      71.518 -29.552 -11.669  1.00 89.27           C  
ATOM    352  CG2 VAL A 123      73.938 -28.941 -11.426  1.00 80.65           C  
ATOM    353  N   GLU A 124      74.967 -30.426 -14.125  1.00 80.12           N  
ATOM    354  CA  GLU A 124      75.819 -31.610 -14.172  1.00 89.61           C  
ATOM    355  C   GLU A 124      76.924 -31.538 -13.123  1.00 80.92           C  
ATOM    356  O   GLU A 124      77.890 -30.791 -13.279  1.00 82.53           O  
ATOM    357  CB  GLU A 124      76.432 -31.778 -15.564  1.00 84.40           C  
ATOM    358  CG  GLU A 124      75.420 -32.009 -16.678  1.00 81.90           C  
ATOM    359  CD  GLU A 124      74.812 -33.401 -16.647  1.00 82.69           C  
ATOM    360  OE1 GLU A 124      73.784 -33.617 -17.323  1.00 82.61           O  
ATOM    361  OE2 GLU A 124      75.364 -34.282 -15.955  1.00 80.99           O  
ATOM    362  N   LEU A 125      76.779 -32.318 -12.056  1.00 83.30           N  
ATOM    363  CA  LEU A 125      77.768 -32.341 -10.984  1.00 81.88           C  
ATOM    364  C   LEU A 125      77.995 -33.760 -10.472  1.00 84.56           C  
ATOM    365  O   LEU A 125      77.136 -34.629 -10.623  1.00 83.20           O  
ATOM    366  CB  LEU A 125      77.340 -31.429  -9.829  1.00 81.72           C  
ATOM    367  CG  LEU A 125      76.334 -31.965  -8.805  1.00 82.79           C  
ATOM    368  CD1 LEU A 125      76.231 -31.017  -7.618  1.00 80.81           C  
ATOM    369  CD2 LEU A 125      74.962 -32.191  -9.423  1.00 82.34           C  
ATOM    370  N   ARG A 126      79.157 -33.989  -9.868  1.00 99.42           N  
ATOM    371  CA  ARG A 126      79.491 -35.306  -9.337  1.00 97.50           C  
ATOM    372  C   ARG A 126      78.850 -35.514  -7.973  1.00 97.42           C  
ATOM    373  O   ARG A 126      79.253 -34.904  -6.983  1.00 96.45           O  
ATOM    374  CB  ARG A 126      81.008 -35.482  -9.241  1.00 97.30           C  
ATOM    375  CG  ARG A 126      81.463 -36.895  -8.888  1.00 91.31           C  
ATOM    376  CD  ARG A 126      81.458 -37.823 -10.102  1.00 90.48           C  
ATOM    377  NE  ARG A 126      80.110 -38.198 -10.525  1.00 99.14           N  
ATOM    378  CZ  ARG A 126      79.842 -38.944 -11.590  1.00 98.50           C  
ATOM    379  NH1 ARG A 126      80.829 -39.402 -12.349  1.00 91.43           N  
ATOM    380  NH2 ARG A 126      78.584 -39.232 -11.900  1.00 90.48           N  
ATOM    381  N   LEU A 127      77.847 -36.384  -7.929  1.00 72.10           N  
ATOM    382  CA  LEU A 127      77.113 -36.656  -6.701  1.00 71.05           C  
ATOM    383  C   LEU A 127      77.965 -37.426  -5.692  1.00 70.96           C  
ATOM    384  O   LEU A 127      78.823 -38.220  -6.077  1.00 70.57           O  
ATOM    385  CB  LEU A 127      75.826 -37.432  -7.009  1.00 69.78           C  
ATOM    386  CG  LEU A 127      75.887 -38.946  -7.259  1.00 69.77           C  
ATOM    387  CD1 LEU A 127      74.481 -39.512  -7.403  1.00 69.02           C  
ATOM    388  CD2 LEU A 127      76.733 -39.298  -8.475  1.00 71.14           C  
ATOM    389  N   PRO A 128      77.737 -37.176  -4.393  1.00 57.32           N  
ATOM    390  CA  PRO A 128      78.393 -37.901  -3.297  1.00 54.36           C  
ATOM    391  C   PRO A 128      78.129 -39.405  -3.362  1.00 55.37           C  
ATOM    392  O   PRO A 128      77.115 -39.817  -3.924  1.00 56.57           O  
ATOM    393  CB  PRO A 128      77.759 -37.287  -2.044  1.00 52.71           C  
ATOM    394  CG  PRO A 128      77.345 -35.922  -2.470  1.00 53.53           C  
ATOM    395  CD  PRO A 128      76.898 -36.073  -3.894  1.00 55.31           C  
ATOM    396  N   PRO A 129      79.032 -40.217  -2.788  1.00 74.63           N  
ATOM    397  CA  PRO A 129      78.920 -41.679  -2.860  1.00 73.66           C  
ATOM    398  C   PRO A 129      77.658 -42.229  -2.197  1.00 72.57           C  
ATOM    399  O   PRO A 129      77.414 -41.978  -1.016  1.00 71.58           O  
ATOM    400  CB  PRO A 129      80.173 -42.163  -2.119  1.00 74.21           C  
ATOM    401  CG  PRO A 129      80.559 -41.024  -1.239  1.00 72.54           C  
ATOM    402  CD  PRO A 129      80.216 -39.796  -2.020  1.00 72.46           C  
ATOM    403  N   LEU A 130      76.866 -42.971  -2.964  1.00 92.39           N  
ATOM    404  CA  LEU A 130      75.685 -43.647  -2.435  1.00 92.43           C  
ATOM    405  C   LEU A 130      76.072 -45.028  -1.918  1.00 90.69           C  
ATOM    406  O   LEU A 130      77.013 -45.643  -2.420  1.00 90.62           O  
ATOM    407  CB  LEU A 130      74.579 -43.741  -3.501  1.00 91.92           C  
ATOM    408  CG  LEU A 130      74.617 -44.656  -4.740  1.00 92.84           C  
ATOM    409  CD1 LEU A 130      75.976 -44.678  -5.437  1.00 96.55           C  
ATOM    410  CD2 LEU A 130      74.153 -46.075  -4.422  1.00 92.12           C  
ATOM    411  N   TYR A 131      75.346 -45.517  -0.918  1.00 90.79           N  
ATOM    412  CA  TYR A 131      75.702 -46.773  -0.266  1.00 90.52           C  
ATOM    413  C   TYR A 131      74.885 -47.953  -0.785  1.00 91.76           C  
ATOM    414  O   TYR A 131      75.226 -49.110  -0.536  1.00 99.95           O  
ATOM    415  CB  TYR A 131      75.539 -46.642   1.250  1.00 97.43           C  
ATOM    416  CG  TYR A 131      76.512 -45.667   1.874  1.00 98.13           C  
ATOM    417  CD1 TYR A 131      77.729 -46.103   2.383  1.00 98.04           C  
ATOM    418  CD2 TYR A 131      76.222 -44.311   1.942  1.00 98.64           C  
ATOM    419  CE1 TYR A 131      78.625 -45.215   2.950  1.00 99.28           C  
ATOM    420  CE2 TYR A 131      77.111 -43.417   2.507  1.00 96.08           C  
ATOM    421  CZ  TYR A 131      78.310 -43.873   3.009  1.00 97.64           C  
ATOM    422  OH  TYR A 131      79.197 -42.985   3.572  1.00 96.59           O  
ATOM    423  N   GLY A 132      73.811 -47.660  -1.510  1.00 68.03           N  
ATOM    424  CA  GLY A 132      73.002 -48.699  -2.121  1.00 71.81           C  
ATOM    425  C   GLY A 132      72.059 -49.389  -1.153  1.00 68.17           C  
ATOM    426  O   GLY A 132      72.241 -49.304   0.062  1.00 69.12           O  
ATOM    427  N   ASP A 133      71.047 -50.073  -1.684  1.00 99.99           N  
ATOM    428  CA  ASP A 133      70.814 -50.146  -3.125  1.00 90.20           C  
ATOM    429  C   ASP A 133      70.041 -48.924  -3.603  1.00 90.50           C  
ATOM    430  O   ASP A 133      70.453 -48.242  -4.541  1.00 93.12           O  
ATOM    431  CB  ASP A 133      70.052 -51.422  -3.486  1.00 90.83           C  
ATOM    432  CG  ASP A 133      70.714 -52.669  -2.942  1.00 90.39           C  
ATOM    433  OD1 ASP A 133      70.538 -53.749  -3.544  1.00 90.36           O  
ATOM    434  OD2 ASP A 133      71.410 -52.571  -1.908  1.00 99.85           O  
ATOM    435  N   ASN A 134      68.916 -48.659  -2.950  1.00 87.20           N  
ATOM    436  CA  ASN A 134      68.151 -47.448  -3.200  1.00 88.43           C  
ATOM    437  C   ASN A 134      68.539 -46.364  -2.201  1.00 84.88           C  
ATOM    438  O   ASN A 134      69.373 -46.592  -1.326  1.00 82.41           O  
ATOM    439  CB  ASN A 134      66.650 -47.735  -3.133  1.00 86.03           C  
ATOM    440  CG  ASN A 134      66.268 -48.575  -1.927  1.00 86.65           C  
ATOM    441  OD1 ASN A 134      66.954 -48.567  -0.906  1.00 83.21           O  
ATOM    442  ND2 ASN A 134      65.170 -49.311  -2.044  1.00 86.44           N  
ATOM    443  N   LEU A 135      67.939 -45.187  -2.333  1.00 76.96           N  
ATOM    444  CA  LEU A 135      68.219 -44.097  -1.406  1.00 74.68           C  
ATOM    445  C   LEU A 135      67.486 -44.327  -0.088  1.00 73.07           C  
ATOM    446  O   LEU A 135      67.799 -43.702   0.927  1.00 71.46           O  
ATOM    447  CB  LEU A 135      67.831 -42.743  -2.013  1.00 77.41           C  
ATOM    448  CG  LEU A 135      66.364 -42.397  -2.283  1.00 74.22           C  
ATOM    449  CD1 LEU A 135      66.235 -40.900  -2.489  1.00 72.62           C  
ATOM    450  CD2 LEU A 135      65.818 -43.142  -3.491  1.00 77.80           C  
ATOM    451  N   ASP A 136      66.515 -45.235  -0.116  1.00 60.57           N  
ATOM    452  CA  ASP A 136      65.799 -45.644   1.086  1.00 67.71           C  
ATOM    453  C   ASP A 136      66.760 -46.265   2.093  1.00 67.55           C  
ATOM    454  O   ASP A 136      66.806 -45.860   3.256  1.00 66.03           O  
ATOM    455  CB  ASP A 136      64.686 -46.634   0.738  1.00 68.54           C  
ATOM    456  CG  ASP A 136      63.990 -47.187   1.968  1.00 67.25           C  
ATOM    457  OD1 ASP A 136      63.795 -46.425   2.938  1.00 67.91           O  
ATOM    458  OD2 ASP A 136      63.640 -48.386   1.966  1.00 69.24           O  
ATOM    459  N   GLN A 137      67.532 -47.244   1.635  1.00 62.37           N  
ATOM    460  CA  GLN A 137      68.516 -47.901   2.485  1.00 62.36           C  
ATOM    461  C   GLN A 137      69.690 -46.973   2.778  1.00 69.57           C  
ATOM    462  O   GLN A 137      70.396 -47.147   3.770  1.00 60.77           O  
ATOM    463  CB  GLN A 137      69.010 -49.195   1.836  1.00 62.62           C  
ATOM    464  CG  GLN A 137      67.937 -50.263   1.699  1.00 61.52           C  
ATOM    465  CD  GLN A 137      68.447 -51.520   1.025  1.00 64.36           C  
ATOM    466  OE1 GLN A 137      69.609 -51.597   0.624  1.00 64.94           O  
ATOM    467  NE2 GLN A 137      67.579 -52.516   0.894  1.00 68.29           N  
ATOM    468  N   HIS A 138      69.898 -45.989   1.909  1.00 81.55           N  
ATOM    469  CA  HIS A 138      70.911 -44.968   2.141  1.00 82.01           C  
ATOM    470  C   HIS A 138      70.561 -44.172   3.396  1.00 78.46           C  
ATOM    471  O   HIS A 138      71.312 -44.169   4.375  1.00 78.35           O  
ATOM    472  CB  HIS A 138      71.030 -44.042   0.929  1.00 83.12           C  
ATOM    473  CG  HIS A 138      71.971 -42.893   1.129  1.00 81.59           C  
ATOM    474  ND1 HIS A 138      73.333 -43.059   1.252  1.00 81.68           N  
ATOM    475  CD2 HIS A 138      71.743 -41.562   1.219  1.00 80.47           C  
ATOM    476  CE1 HIS A 138      73.905 -41.879   1.412  1.00 81.67           C  
ATOM    477  NE2 HIS A 138      72.964 -40.953   1.396  1.00 83.27           N  
ATOM    478  N   PHE A 139      69.404 -43.514   3.362  1.00 69.71           N  
ATOM    479  CA  PHE A 139      68.925 -42.739   4.503  1.00 69.85           C  
ATOM    480  C   PHE A 139      68.715 -43.614   5.736  1.00 68.79           C  
ATOM    481  O   PHE A 139      68.888 -43.154   6.867  1.00 67.07           O  
ATOM    482  CB  PHE A 139      67.623 -42.014   4.152  1.00 68.80           C  
ATOM    483  CG  PHE A 139      67.824 -40.728   3.401  1.00 68.46           C  
ATOM    484  CD1 PHE A 139      67.877 -39.518   4.075  1.00 65.89           C  
ATOM    485  CD2 PHE A 139      67.957 -40.726   2.022  1.00 62.43           C  
ATOM    486  CE1 PHE A 139      68.059 -38.335   3.389  1.00 65.37           C  
ATOM    487  CE2 PHE A 139      68.139 -39.545   1.330  1.00 61.03           C  
ATOM    488  CZ  PHE A 139      68.192 -38.347   2.015  1.00 60.85           C  
ATOM    489  N   ARG A 140      68.346 -44.873   5.519  1.00 56.22           N  
ATOM    490  CA  ARG A 140      68.126 -45.799   6.626  1.00 52.85           C  
ATOM    491  C   ARG A 140      69.438 -46.103   7.345  1.00 52.30           C  
ATOM    492  O   ARG A 140      69.518 -46.007   8.570  1.00 50.86           O  
ATOM    493  CB  ARG A 140      67.479 -47.095   6.129  1.00 55.26           C  
ATOM    494  CG  ARG A 140      66.988 -48.013   7.240  1.00 54.33           C  
ATOM    495  CD  ARG A 140      66.291 -49.246   6.679  1.00 55.14           C  
ATOM    496  NE  ARG A 140      65.100 -48.903   5.904  1.00 56.49           N  
ATOM    497  CZ  ARG A 140      63.868 -48.867   6.402  1.00 50.62           C  
ATOM    498  NH1 ARG A 140      63.657 -49.156   7.678  1.00 51.16           N  
ATOM    499  NH2 ARG A 140      62.846 -48.544   5.621  1.00 54.45           N  
ATOM    500  N   LEU A 141      70.464 -46.464   6.580  1.00 68.58           N  
ATOM    501  CA  LEU A 141      71.778 -46.746   7.145  1.00 66.77           C  
ATOM    502  C   LEU A 141      72.374 -45.508   7.809  1.00 69.65           C  
ATOM    503  O   LEU A 141      72.973 -45.599   8.881  1.00 69.07           O  
ATOM    504  CB  LEU A 141      72.730 -47.273   6.068  1.00 60.86           C  
ATOM    505  CG  LEU A 141      72.480 -48.700   5.576  1.00 63.55           C  
ATOM    506  CD1 LEU A 141      73.483 -49.080   4.497  1.00 65.92           C  
ATOM    507  CD2 LEU A 141      72.528 -49.690   6.732  1.00 63.07           C  
ATOM    508  N   LEU A 142      72.207 -44.356   7.165  1.00 61.61           N  
ATOM    509  CA  LEU A 142      72.674 -43.096   7.739  1.00 69.84           C  
ATOM    510  C   LEU A 142      72.027 -42.840   9.094  1.00 66.39           C  
ATOM    511  O   LEU A 142      72.714 -42.618  10.091  1.00 67.07           O  
ATOM    512  CB  LEU A 142      72.383 -41.930   6.795  1.00 68.85           C  
ATOM    513  CG  LEU A 142      73.214 -41.861   5.516  1.00 64.44           C  
ATOM    514  CD1 LEU A 142      72.818 -40.649   4.690  1.00 63.55           C  
ATOM    515  CD2 LEU A 142      74.696 -41.834   5.845  1.00 62.81           C  
ATOM    516  N   ALA A 143      70.698 -42.885   9.122  1.00 64.95           N  
ATOM    517  CA  ALA A 143      69.944 -42.636  10.344  1.00 65.35           C  
ATOM    518  C   ALA A 143      70.281 -43.652  11.431  1.00 66.71           C  
ATOM    519  O   ALA A 143      70.269 -43.328  12.618  1.00 65.91           O  
ATOM    520  CB  ALA A 143      68.456 -42.650  10.055  1.00 64.05           C  
ATOM    521  N   GLN A 144      70.583 -44.880  11.021  1.00 60.36           N  
ATOM    522  CA  GLN A 144      70.929 -45.928  11.973  1.00 68.80           C  
ATOM    523  C   GLN A 144      72.304 -45.686  12.592  1.00 69.77           C  
ATOM    524  O   GLN A 144      72.467 -45.801  13.806  1.00 68.84           O  
ATOM    525  CB  GLN A 144      70.883 -47.305  11.304  1.00 62.34           C  
ATOM    526  CG  GLN A 144      69.475 -47.872  11.149  1.00 62.39           C  
ATOM    527  CD  GLN A 144      69.461 -49.268  10.554  1.00 61.43           C  
ATOM    528  OE1 GLN A 144      70.509 -49.856  10.288  1.00 64.74           O  
ATOM    529  NE2 GLN A 144      68.265 -49.807  10.343  1.00 68.09           N  
ATOM    530  N   LYS A 145      73.286 -45.340  11.764  1.00 67.33           N  
ATOM    531  CA  LYS A 145      74.641 -45.123  12.265  1.00 71.94           C  
ATOM    532  C   LYS A 145      74.744 -43.808  13.036  1.00 72.12           C  
ATOM    533  O   LYS A 145      75.644 -43.632  13.857  1.00 69.94           O  
ATOM    534  CB  LYS A 145      75.657 -45.147  11.118  1.00 73.74           C  
ATOM    535  CG  LYS A 145      75.613 -43.938  10.200  1.00 72.67           C  
ATOM    536  CD  LYS A 145      76.673 -44.038   9.112  1.00 77.04           C  
ATOM    537  CE  LYS A 145      78.074 -44.122   9.701  1.00 78.72           C  
ATOM    538  NZ  LYS A 145      78.442 -42.888  10.451  1.00 77.90           N  
ATOM    539  N   GLN A 146      73.816 -42.893  12.774  1.00 60.80           N  
ATOM    540  CA  GLN A 146      73.784 -41.615  13.478  1.00 66.61           C  
ATOM    541  C   GLN A 146      73.119 -41.732  14.846  1.00 66.44           C  
ATOM    542  O   GLN A 146      73.298 -40.872  15.706  1.00 66.01           O  
ATOM    543  CB  GLN A 146      73.056 -40.558  12.645  1.00 64.90           C  
ATOM    544  CG  GLN A 146      73.860 -40.008  11.479  1.00 65.81           C  
ATOM    545  CD  GLN A 146      73.075 -39.004  10.658  1.00 67.67           C  
ATOM    546  OE1 GLN A 146      71.935 -38.673  10.984  1.00 66.01           O  
ATOM    547  NE2 GLN A 146      73.683 -38.512   9.584  1.00 61.26           N  
ATOM    548  N   SER A 147      72.349 -42.798  15.041  1.00 63.74           N  
ATOM    549  CA  SER A 147      71.589 -42.969  16.275  1.00 63.87           C  
ATOM    550  C   SER A 147      71.875 -44.301  16.963  1.00 63.77           C  
ATOM    551  O   SER A 147      71.191 -44.669  17.917  1.00 61.78           O  
ATOM    552  CB  SER A 147      70.090 -42.845  15.993  1.00 61.36           C  
ATOM    553  OG  SER A 147      69.655 -43.846  15.088  1.00 62.41           O  
ATOM    554  N   LEU A 148      72.884 -45.016  16.480  1.00 60.10           N  
ATOM    555  CA  LEU A 148      73.257 -46.300  17.071  1.00 60.12           C  
ATOM    556  C   LEU A 148      73.806 -46.182  18.504  1.00 61.68           C  
ATOM    557  O   LEU A 148      73.376 -46.936  19.379  1.00 60.82           O  
ATOM    558  CB  LEU A 148      74.274 -47.021  16.177  1.00 61.68           C  
ATOM    559  CG  LEU A 148      74.727 -48.414  16.627  1.00 64.09           C  
ATOM    560  CD1 LEU A 148      74.716 -49.383  15.455  1.00 66.03           C  
ATOM    561  CD2 LEU A 148      76.113 -48.359  17.257  1.00 65.68           C  
ATOM    562  N   PRO A 149      74.754 -45.251  18.756  1.00 51.04           N  
ATOM    563  CA  PRO A 149      75.257 -45.165  20.133  1.00 52.17           C  
ATOM    564  C   PRO A 149      74.176 -44.759  21.129  1.00 59.86           C  
ATOM    565  O   PRO A 149      74.143 -45.254  22.260  1.00 50.79           O  
ATOM    566  CB  PRO A 149      76.338 -44.084  20.048  1.00 51.17           C  
ATOM    567  CG  PRO A 149      76.733 -44.045  18.619  1.00 52.65           C  
ATOM    568  CD  PRO A 149      75.475 -44.321  17.866  1.00 50.76           C  
ATOM    569  N   TYR A 150      73.295 -43.864  20.703  1.00 52.78           N  
ATOM    570  CA  TYR A 150      72.225 -43.385  21.563  1.00 52.99           C  
ATOM    571  C   TYR A 150      71.194 -44.484  21.801  1.00 53.25           C  
ATOM    572  O   TYR A 150      70.629 -44.584  22.888  1.00 52.71           O  
ATOM    573  CB  TYR A 150      71.575 -42.142  20.953  1.00 51.74           C  
ATOM    574  CG  TYR A 150      72.592 -41.120  20.497  1.00 51.60           C  
ATOM    575  CD1 TYR A 150      73.254 -40.311  21.413  1.00 59.58           C  
ATOM    576  CD2 TYR A 150      72.906 -40.976  19.152  1.00 53.27           C  
ATOM    577  CE1 TYR A 150      74.192 -39.383  21.000  1.00 52.30           C  
ATOM    578  CE2 TYR A 150      73.841 -40.050  18.730  1.00 52.21           C  
ATOM    579  CZ  TYR A 150      74.481 -39.257  19.657  1.00 52.82           C  
ATOM    580  OH  TYR A 150      75.412 -38.335  19.239  1.00 52.13           O  
ATOM    581  N   LEU A 151      70.962 -45.319  20.794  1.00 59.56           N  
ATOM    582  CA  LEU A 151      70.079 -46.467  20.962  1.00 59.66           C  
ATOM    583  C   LEU A 151      70.690 -47.471  21.932  1.00 50.29           C  
ATOM    584  O   LEU A 151      69.984 -48.068  22.745  1.00 59.48           O  
ATOM    585  CB  LEU A 151      69.781 -47.136  19.618  1.00 59.89           C  
ATOM    586  CG  LEU A 151      68.546 -46.610  18.881  1.00 59.08           C  
ATOM    587  CD1 LEU A 151      68.339 -47.340  17.562  1.00 59.52           C  
ATOM    588  CD2 LEU A 151      67.309 -46.728  19.762  1.00 57.98           C  
ATOM    589  N   GLU A 152      72.006 -47.650  21.849  1.00 66.06           N  
ATOM    590  CA  GLU A 152      72.718 -48.508  22.788  1.00 65.62           C  
ATOM    591  C   GLU A 152      72.571 -47.984  24.215  1.00 64.24           C  
ATOM    592  O   GLU A 152      72.321 -48.752  25.144  1.00 67.85           O  
ATOM    593  CB  GLU A 152      74.199 -48.613  22.414  1.00 67.46           C  
ATOM    594  CG  GLU A 152      74.473 -49.416  21.154  1.00 60.68           C  
ATOM    595  CD  GLU A 152      75.948 -49.474  20.805  1.00 60.53           C  
ATOM    596  OE1 GLU A 152      76.723 -48.662  21.352  1.00 62.16           O  
ATOM    597  OE2 GLU A 152      76.332 -50.336  19.987  1.00 62.42           O  
ATOM    598  N   ALA A 153      72.714 -46.671  24.376  1.00 51.07           N  
ATOM    599  CA  ALA A 153      72.598 -46.036  25.685  1.00 50.04           C  
ATOM    600  C   ALA A 153      71.183 -46.161  26.251  1.00 58.57           C  
ATOM    601  O   ALA A 153      70.995 -46.439  27.442  1.00 58.67           O  
ATOM    602  CB  ALA A 153      73.005 -44.578  25.594  1.00 58.85           C  
ATOM    603  N   ALA A 154      70.191 -45.949  25.392  1.00 53.21           N  
ATOM    604  CA  ALA A 154      68.795 -46.105  25.776  1.00 52.13           C  
ATOM    605  C   ALA A 154      68.532 -47.537  26.221  1.00 52.26           C  
ATOM    606  O   ALA A 154      67.835 -47.774  27.207  1.00 52.67           O  
ATOM    607  CB  ALA A 154      67.879 -45.726  24.622  1.00 51.84           C  
ATOM    608  N   ASN A 155      69.100 -48.491  25.489  1.00 68.65           N  
ATOM    609  CA  ASN A 155      68.986 -49.895  25.855  1.00 69.03           C  
ATOM    610  C   ASN A 155      69.669 -50.171  27.189  1.00 66.56           C  
ATOM    611  O   ASN A 155      69.246 -51.051  27.938  1.00 69.29           O  
ATOM    612  CB  ASN A 155      69.578 -50.786  24.764  1.00 61.42           C  
ATOM    613  CG  ASN A 155      68.768 -50.751  23.483  1.00 69.39           C  
ATOM    614  OD1 ASN A 155      67.558 -50.524  23.507  1.00 67.17           O  
ATOM    615  ND2 ASN A 155      69.432 -50.973  22.357  1.00 61.27           N  
ATOM    616  N   LEU A 156      70.723 -49.416  27.482  1.00 56.18           N  
ATOM    617  CA  LEU A 156      71.387 -49.518  28.778  1.00 56.59           C  
ATOM    618  C   LEU A 156      70.482 -48.967  29.872  1.00 55.11           C  
ATOM    619  O   LEU A 156      70.554 -49.394  31.024  1.00 55.27           O  
ATOM    620  CB  LEU A 156      72.725 -48.780  28.769  1.00 57.54           C  
ATOM    621  CG  LEU A 156      73.826 -49.354  27.877  1.00 59.44           C  
ATOM    622  CD1 LEU A 156      75.086 -48.505  27.964  1.00 51.81           C  
ATOM    623  CD2 LEU A 156      74.123 -50.803  28.239  1.00 50.72           C  
ATOM    624  N   LEU A 157      69.630 -48.014  29.508  1.00 51.95           N  
ATOM    625  CA  LEU A 157      68.664 -47.467  30.454  1.00 50.41           C  
ATOM    626  C   LEU A 157      67.494 -48.421  30.685  1.00 50.63           C  
ATOM    627  O   LEU A 157      66.926 -48.465  31.776  1.00 50.34           O  
ATOM    628  CB  LEU A 157      68.141 -46.116  29.968  1.00 58.29           C  
ATOM    629  CG  LEU A 157      69.104 -44.939  30.105  1.00 57.86           C  
ATOM    630  CD1 LEU A 157      68.440 -43.653  29.644  1.00 55.87           C  
ATOM    631  CD2 LEU A 157      69.586 -44.818  31.542  1.00 58.37           C  
ATOM    632  N   LEU A 158      67.138 -49.179  29.654  1.00 59.64           N  
ATOM    633  CA  LEU A 158      65.997 -50.086  29.730  1.00 59.09           C  
ATOM    634  C   LEU A 158      66.279 -51.297  30.617  1.00 59.23           C  
ATOM    635  O   LEU A 158      65.457 -51.663  31.459  1.00 58.65           O  
ATOM    636  CB  LEU A 158      65.590 -50.547  28.329  1.00 59.30           C  
ATOM    637  CG  LEU A 158      64.400 -49.825  27.691  1.00 58.74           C  
ATOM    638  CD1 LEU A 158      64.635 -48.324  27.635  1.00 58.62           C  
ATOM    639  CD2 LEU A 158      64.117 -50.379  26.302  1.00 59.15           C  
ATOM    640  N   GLN A 159      67.440 -51.916  30.429  1.00 65.90           N  
ATOM    641  CA  GLN A 159      67.810 -53.094  31.208  1.00 65.93           C  
ATOM    642  C   GLN A 159      68.503 -52.709  32.512  1.00 66.63           C  
ATOM    643  O   GLN A 159      69.189 -53.527  33.125  1.00 67.18           O  
ATOM    644  CB  GLN A 159      68.717 -54.015  30.389  1.00 69.42           C  
ATOM    645  CG  GLN A 159      70.031 -53.376  29.974  1.00 70.93           C  
ATOM    646  CD  GLN A 159      70.952 -54.345  29.260  1.00 74.82           C  
ATOM    647  OE1 GLN A 159      70.861 -55.559  29.449  1.00 73.08           O  
ATOM    648  NE2 GLN A 159      71.843 -53.814  28.431  1.00 71.21           N  
ATOM    649  N   ALA A 160      68.317 -51.464  32.929  1.00 62.88           N  
ATOM    650  CA  ALA A 160      68.972 -50.949  34.124  1.00 69.76           C  
ATOM    651  C   ALA A 160      68.304 -51.446  35.402  1.00 69.75           C  
ATOM    652  O   ALA A 160      67.103 -51.262  35.600  1.00 68.87           O  
ATOM    653  CB  ALA A 160      68.991 -49.428  34.099  1.00 69.65           C  
ATOM    654  N   GLN A 161      69.090 -52.080  36.263  1.00 95.75           N  
ATOM    655  CA  GLN A 161      68.609 -52.500  37.571  1.00 92.99           C  
ATOM    656  C   GLN A 161      68.766 -51.355  38.564  1.00 94.24           C  
ATOM    657  O   GLN A 161      69.876 -50.895  38.824  1.00 95.35           O  
ATOM    658  CB  GLN A 161      69.355 -53.744  38.050  1.00 96.63           C  
ATOM    659  CG  GLN A 161      69.084 -54.979  37.204  1.00 94.26           C  
ATOM    660  CD  GLN A 161      69.908 -56.176  37.633  1.00 96.58           C  
ATOM    661  OE1 GLN A 161      70.983 -56.028  38.215  1.00 96.72           O  
ATOM    662  NE2 GLN A 161      69.406 -57.373  37.349  1.00 98.60           N  
ATOM    663  N   LEU A 162      67.643 -50.900  39.111  1.00 97.60           N  
ATOM    664  CA  LEU A 162      67.604 -49.691  39.927  1.00 99.46           C  
ATOM    665  C   LEU A 162      68.096 -49.912  41.355  1.00 90.58           C  
ATOM    666  O   LEU A 162      67.548 -50.740  42.081  1.00 91.92           O  
ATOM    667  CB  LEU A 162      66.177 -49.134  39.947  1.00 97.04           C  
ATOM    668  CG  LEU A 162      65.858 -47.805  40.646  1.00 97.44           C  
ATOM    669  CD1 LEU A 162      65.518 -47.982  42.127  1.00 98.25           C  
ATOM    670  CD2 LEU A 162      66.965 -46.776  40.441  1.00 96.33           C  
ATOM    671  N   PRO A 163      69.135 -49.164  41.758  1.00 62.67           N  
ATOM    672  CA  PRO A 163      69.538 -49.104  43.167  1.00 63.81           C  
ATOM    673  C   PRO A 163      68.637 -48.155  43.952  1.00 63.10           C  
ATOM    674  O   PRO A 163      68.302 -47.082  43.446  1.00 64.02           O  
ATOM    675  CB  PRO A 163      70.973 -48.580  43.099  1.00 65.95           C  
ATOM    676  CG  PRO A 163      71.004 -47.762  41.859  1.00 65.00           C  
ATOM    677  CD  PRO A 163      70.080 -48.445  40.884  1.00 63.81           C  
ATOM    678  N   PRO A 164      68.253 -48.539  45.179  1.00 76.52           N  
ATOM    679  CA  PRO A 164      67.286 -47.777  45.981  1.00 73.24           C  
ATOM    680  C   PRO A 164      67.750 -46.358  46.294  1.00 76.65           C  
ATOM    681  O   PRO A 164      68.949 -46.080  46.279  1.00 77.38           O  
ATOM    682  CB  PRO A 164      67.168 -48.604  47.266  1.00 76.37           C  
ATOM    683  CG  PRO A 164      68.440 -49.375  47.340  1.00 78.78           C  
ATOM    684  CD  PRO A 164      68.791 -49.693  45.918  1.00 74.36           C  
ATOM    685  N   LYS A 165      66.796 -45.473  46.569  1.00 68.22           N  
ATOM    686  CA  LYS A 165      67.099 -44.089  46.909  1.00 60.70           C  
ATOM    687  C   LYS A 165      67.873 -44.003  48.224  1.00 61.55           C  
ATOM    688  O   LYS A 165      67.637 -44.794  49.138  1.00 69.93           O  
ATOM    689  CB  LYS A 165      65.812 -43.263  46.998  1.00 67.90           C  
ATOM    690  CG  LYS A 165      65.075 -43.112  45.676  1.00 66.30           C  
ATOM    691  CD  LYS A 165      63.840 -42.235  45.818  1.00 67.75           C  
ATOM    692  CE  LYS A 165      62.808 -42.865  46.742  1.00 61.23           C  
ATOM    693  NZ  LYS A 165      62.273 -44.148  46.205  1.00 67.17           N  
ATOM    694  N   PRO A 166      68.808 -43.046  48.314  1.00 58.05           N  
ATOM    695  CA  PRO A 166      69.607 -42.810  49.522  1.00 59.48           C  
ATOM    696  C   PRO A 166      68.742 -42.423  50.718  1.00 59.38           C  
ATOM    697  O   PRO A 166      67.670 -41.851  50.530  1.00 57.99           O  
ATOM    698  CB  PRO A 166      70.522 -41.648  49.119  1.00 59.29           C  
ATOM    699  CG  PRO A 166      70.543 -41.670  47.633  1.00 58.25           C  
ATOM    700  CD  PRO A 166      69.197 -42.148  47.213  1.00 57.00           C  
ATOM    701  N   PRO A 167      69.204 -42.730  51.939  1.00 56.48           N  
ATOM    702  CA  PRO A 167      68.466 -42.374  53.156  1.00 57.40           C  
ATOM    703  C   PRO A 167      68.512 -40.875  53.436  1.00 61.75           C  
ATOM    704  O   PRO A 167      67.635 -40.349  54.121  1.00 59.93           O  
ATOM    705  CB  PRO A 167      69.195 -43.159  54.247  1.00 58.19           C  
ATOM    706  CG  PRO A 167      70.583 -43.299  53.730  1.00 60.27           C  
ATOM    707  CD  PRO A 167      70.450 -43.453  52.242  1.00 59.20           C  
ATOM    708  N   ALA A 168      69.531 -40.203  52.909  1.00 52.08           N  
ATOM    709  CA  ALA A 168      69.685 -38.764  53.095  1.00 52.76           C  
ATOM    710  C   ALA A 168      70.471 -38.153  51.939  1.00 54.34           C  
ATOM    711  O   ALA A 168      71.398 -38.768  51.413  1.00 53.82           O  
ATOM    712  CB  ALA A 168      70.371 -38.469  54.418  1.00 56.70           C  
ATOM    713  N   TRP A 169      70.095 -36.940  51.547  1.00 54.98           N  
ATOM    714  CA  TRP A 169      70.767 -36.249  50.455  1.00 55.22           C  
ATOM    715  C   TRP A 169      71.915 -35.389  50.973  1.00 56.61           C  
ATOM    716  O   TRP A 169      71.778 -34.695  51.980  1.00 57.80           O  
ATOM    717  CB  TRP A 169      69.773 -35.389  49.675  1.00 55.55           C  
ATOM    718  CG  TRP A 169      68.608 -36.163  49.166  1.00 54.21           C  
ATOM    719  CD1 TRP A 169      67.383 -36.279  49.751  1.00 54.33           C  
ATOM    720  CD2 TRP A 169      68.556 -36.943  47.966  1.00 52.44           C  
ATOM    721  NE1 TRP A 169      66.568 -37.078  48.990  1.00 52.74           N  
ATOM    722  CE2 TRP A 169      67.265 -37.498  47.888  1.00 51.53           C  
ATOM    723  CE3 TRP A 169      69.474 -37.222  46.950  1.00 51.54           C  
ATOM    724  CZ2 TRP A 169      66.868 -38.317  46.833  1.00 49.69           C  
ATOM    725  CZ3 TRP A 169      69.077 -38.036  45.904  1.00 49.77           C  
ATOM    726  CH2 TRP A 169      67.786 -38.573  45.854  1.00 48.85           C  
ATOM    727  N   ALA A 170      73.045 -35.441  50.276  1.00 56.16           N  
ATOM    728  CA  ALA A 170      74.229 -34.689  50.675  1.00 57.79           C  
ATOM    729  C   ALA A 170      74.066 -33.197  50.400  1.00 57.26           C  
ATOM    730  O   ALA A 170      73.675 -32.798  49.302  1.00 55.82           O  
ATOM    731  CB  ALA A 170      75.459 -35.229  49.961  1.00 58.81           C  
ATOM    732  N   TRP A 171      74.369 -32.380  51.405  1.00 68.86           N  
ATOM    733  CA  TRP A 171      74.273 -30.928  51.280  1.00 69.92           C  
ATOM    734  C   TRP A 171      75.627 -30.332  50.905  1.00 72.76           C  
ATOM    735  O   TRP A 171      76.197 -29.544  51.657  1.00 73.36           O  
ATOM    736  CB  TRP A 171      73.762 -30.307  52.586  1.00 73.33           C  
ATOM    737  CG  TRP A 171      73.226 -28.903  52.442  1.00 73.14           C  
ATOM    738  CD1 TRP A 171      73.199 -28.146  51.308  1.00 72.48           C  
ATOM    739  CD2 TRP A 171      72.633 -28.100  53.472  1.00 72.61           C  
ATOM    740  NE1 TRP A 171      72.630 -26.921  51.567  1.00 74.03           N  
ATOM    741  CE2 TRP A 171      72.274 -26.867  52.888  1.00 73.98           C  
ATOM    742  CE3 TRP A 171      72.372 -28.301  54.832  1.00 73.48           C  
ATOM    743  CZ2 TRP A 171      71.670 -25.843  53.615  1.00 73.98           C  
ATOM    744  CZ3 TRP A 171      71.771 -27.282  55.552  1.00 75.11           C  
ATOM    745  CH2 TRP A 171      71.428 -26.069  54.942  1.00 75.61           C  
ATOM    746  N   ALA A 172      76.138 -30.715  49.741  1.00 52.80           N  
ATOM    747  CA  ALA A 172      77.443 -30.240  49.291  1.00 53.58           C  
ATOM    748  C   ALA A 172      77.402 -29.775  47.839  1.00 52.86           C  
ATOM    749  O   ALA A 172      76.640 -30.301  47.029  1.00 51.65           O  
ATOM    750  CB  ALA A 172      78.490 -31.328  49.468  1.00 54.00           C  
ATOM    751  N   GLU A 173      78.230 -28.787  47.524  1.00 61.67           N  
ATOM    752  CA  GLU A 173      78.307 -28.233  46.177  1.00 60.91           C  
ATOM    753  C   GLU A 173      78.840 -29.262  45.185  1.00 61.70           C  
ATOM    754  O   GLU A 173      79.697 -30.076  45.526  1.00 61.70           O  
ATOM    755  CB  GLU A 173      79.192 -26.983  46.175  1.00 63.74           C  
ATOM    756  CG  GLU A 173      79.307 -26.287  44.831  1.00 61.74           C  
ATOM    757  CD  GLU A 173      80.245 -25.101  44.879  1.00 64.43           C  
ATOM    758  OE1 GLU A 173      80.808 -24.831  45.962  1.00 64.48           O  
ATOM    759  OE2 GLU A 173      80.420 -24.439  43.834  1.00 64.55           O  
ATOM    760  N   GLY A 174      78.327 -29.226  43.960  1.00 58.12           N  
ATOM    761  CA  GLY A 174      78.782 -30.140  42.928  1.00 57.97           C  
ATOM    762  C   GLY A 174      77.957 -31.410  42.890  1.00 56.62           C  
ATOM    763  O   GLY A 174      76.818 -31.429  43.361  1.00 55.29           O  
ATOM    764  N   TRP A 175      78.526 -32.476  42.330  1.00 52.31           N  
ATOM    765  CA  TRP A 175      77.795 -33.732  42.221  1.00 51.04           C  
ATOM    766  C   TRP A 175      78.105 -34.653  43.392  1.00 51.62           C  
ATOM    767  O   TRP A 175      79.207 -34.633  43.942  1.00 52.96           O  
ATOM    768  CB  TRP A 175      78.118 -34.438  40.901  1.00 50.28           C  
ATOM    769  CG  TRP A 175      77.454 -33.831  39.701  1.00 59.21           C  
ATOM    770  CD1 TRP A 175      77.981 -32.898  38.856  1.00 59.66           C  
ATOM    771  CD2 TRP A 175      76.141 -34.124  39.206  1.00 57.52           C  
ATOM    772  NE1 TRP A 175      77.078 -32.589  37.868  1.00 58.34           N  
ATOM    773  CE2 TRP A 175      75.940 -33.327  38.061  1.00 56.99           C  
ATOM    774  CE3 TRP A 175      75.117 -34.978  39.622  1.00 56.48           C  
ATOM    775  CZ2 TRP A 175      74.757 -33.362  37.327  1.00 55.37           C  
ATOM    776  CZ3 TRP A 175      73.944 -35.009  38.892  1.00 54.94           C  
ATOM    777  CH2 TRP A 175      73.772 -34.208  37.758  1.00 54.36           C  
ATOM    778  N   THR A 176      77.118 -35.452  43.779  1.00 50.17           N  
ATOM    779  CA  THR A 176      77.310 -36.451  44.818  1.00 56.06           C  
ATOM    780  C   THR A 176      76.826 -37.808  44.330  1.00 54.30           C  
ATOM    781  O   THR A 176      75.648 -37.983  44.006  1.00 57.82           O  
ATOM    782  CB  THR A 176      76.575 -36.077  46.119  1.00 59.63           C  
ATOM    783  OG1 THR A 176      75.189 -35.850  45.839  1.00 58.64           O  
ATOM    784  CG2 THR A 176      77.177 -34.819  46.725  1.00 59.21           C  
ATOM    785  N   ARG A 177      77.753 -38.757  44.267  1.00 62.69           N  
ATOM    786  CA  ARG A 177      77.458 -40.117  43.843  1.00 59.72           C  
ATOM    787  C   ARG A 177      76.935 -40.956  45.002  1.00 60.44           C  
ATOM    788  O   ARG A 177      77.558 -41.023  46.064  1.00 61.64           O  
ATOM    789  CB  ARG A 177      78.708 -40.769  43.245  1.00 60.93           C  
ATOM    790  CG  ARG A 177      78.703 -42.291  43.283  1.00 59.62           C  
ATOM    791  CD  ARG A 177      77.698 -42.881  42.306  1.00 58.32           C  
ATOM    792  NE  ARG A 177      78.339 -43.333  41.073  1.00 58.42           N  
ATOM    793  CZ  ARG A 177      78.819 -44.557  40.888  1.00 60.12           C  
ATOM    794  NH1 ARG A 177      78.734 -45.459  41.856  1.00 61.24           N  
ATOM    795  NH2 ARG A 177      79.385 -44.883  39.734  1.00 60.83           N  
ATOM    796  N   TYR A 178      75.784 -41.585  44.787  1.00 65.07           N  
ATOM    797  CA  TYR A 178      75.216 -42.518  45.747  1.00 66.71           C  
ATOM    798  C   TYR A 178      75.235 -43.931  45.179  1.00 66.47           C  
ATOM    799  O   TYR A 178      74.388 -44.291  44.356  1.00 64.00           O  
ATOM    800  CB  TYR A 178      73.782 -42.133  46.110  1.00 65.78           C  
ATOM    801  CG  TYR A 178      73.610 -40.716  46.602  1.00 66.27           C  
ATOM    802  CD1 TYR A 178      73.173 -39.717  45.745  1.00 64.61           C  
ATOM    803  CD2 TYR A 178      73.864 -40.382  47.926  1.00 66.64           C  
ATOM    804  CE1 TYR A 178      73.005 -38.423  46.188  1.00 65.36           C  
ATOM    805  CE2 TYR A 178      73.697 -39.085  48.379  1.00 69.46           C  
ATOM    806  CZ  TYR A 178      73.267 -38.111  47.505  1.00 67.75           C  
ATOM    807  OH  TYR A 178      73.099 -36.818  47.944  1.00 68.78           O  
ATOM    808  N   GLY A 179      76.205 -44.726  45.618  1.00 66.04           N  
ATOM    809  CA  GLY A 179      76.341 -46.094  45.158  1.00 67.20           C  
ATOM    810  C   GLY A 179      75.827 -47.098  46.172  1.00 68.06           C  
ATOM    811  O   GLY A 179      74.620 -47.198  46.391  1.00 66.74           O  
ATOM    812  N   PRO A 180      76.748 -47.850  46.797  1.00 82.65           N  
ATOM    813  CA  PRO A 180      76.399 -48.873  47.791  1.00 82.66           C  
ATOM    814  C   PRO A 180      75.768 -48.283  49.049  1.00 82.73           C  
ATOM    815  O   PRO A 180      76.399 -47.472  49.729  1.00 82.20           O  
ATOM    816  CB  PRO A 180      77.749 -49.525  48.111  1.00 82.69           C  
ATOM    817  CG  PRO A 180      78.762 -48.481  47.777  1.00 84.85           C  
ATOM    818  CD  PRO A 180      78.202 -47.751  46.593  1.00 83.31           C  
ATOM    819  N   GLU A 181      74.532 -48.687  49.337  1.00 81.31           N  
ATOM    820  CA  GLU A 181      73.797 -48.235  50.518  1.00 81.23           C  
ATOM    821  C   GLU A 181      73.629 -46.716  50.565  1.00 87.68           C  
ATOM    822  O   GLU A 181      73.444 -46.140  51.637  1.00 80.95           O  
ATOM    823  CB  GLU A 181      74.488 -48.724  51.798  1.00 80.71           C  
ATOM    824  CG  GLU A 181      74.611 -50.238  51.896  1.00 89.94           C  
ATOM    825  CD  GLU A 181      75.313 -50.687  53.165  1.00 80.80           C  
ATOM    826  OE1 GLU A 181      75.629 -49.823  54.010  1.00 82.79           O  
ATOM    827  OE2 GLU A 181      75.551 -51.904  53.317  1.00 80.73           O  
ATOM    828  N   GLY A 182      73.696 -46.077  49.401  1.00 71.74           N  
ATOM    829  CA  GLY A 182      73.486 -44.644  49.292  1.00 73.07           C  
ATOM    830  C   GLY A 182      74.476 -43.790  50.060  1.00 72.75           C  
ATOM    831  O   GLY A 182      74.085 -42.853  50.761  1.00 73.20           O  
ATOM    832  N   GLU A 183      75.761 -44.106  49.934  1.00 87.67           N  
ATOM    833  CA  GLU A 183      76.806 -43.312  50.572  1.00 89.16           C  
ATOM    834  C   GLU A 183      77.078 -42.050  49.760  1.00 89.14           C  
ATOM    835  O   GLU A 183      76.721 -41.974  48.587  1.00 80.19           O  
ATOM    836  CB  GLU A 183      78.092 -44.129  50.738  1.00 80.34           C  
ATOM    837  CG  GLU A 183      78.727 -44.584  49.429  1.00 89.54           C  
ATOM    838  CD  GLU A 183      80.043 -45.316  49.637  1.00 80.84           C  
ATOM    839  OE1 GLU A 183      80.492 -45.427  50.799  1.00 83.69           O  
ATOM    840  OE2 GLU A 183      80.631 -45.780  48.637  1.00 80.17           O  
ATOM    841  N   ALA A 184      77.708 -41.061  50.386  1.00 59.51           N  
ATOM    842  CA  ALA A 184      77.983 -39.792  49.718  1.00 58.76           C  
ATOM    843  C   ALA A 184      79.405 -39.743  49.168  1.00 50.45           C  
ATOM    844  O   ALA A 184      80.369 -39.652  49.926  1.00 52.51           O  
ATOM    845  CB  ALA A 184      77.748 -38.630  50.671  1.00 58.68           C  
ATOM    846  N   VAL A 185      79.529 -39.800  47.846  1.00 69.60           N  
ATOM    847  CA  VAL A 185      80.838 -39.735  47.206  1.00 70.61           C  
ATOM    848  C   VAL A 185      80.994 -38.445  46.403  1.00 70.69           C  
ATOM    849  O   VAL A 185      80.391 -38.297  45.343  1.00 69.81           O  
ATOM    850  CB  VAL A 185      81.071 -40.942  46.277  1.00 70.21           C  
ATOM    851  CG1 VAL A 185      82.432 -40.842  45.607  1.00 71.46           C  
ATOM    852  CG2 VAL A 185      80.951 -42.241  47.059  1.00 70.30           C  
ATOM    853  N   PRO A 186      81.803 -37.505  46.913  1.00 55.92           N  
ATOM    854  CA  PRO A 186      82.062 -36.224  46.244  1.00 56.20           C  
ATOM    855  C   PRO A 186      82.578 -36.399  44.817  1.00 56.00           C  
ATOM    856  O   PRO A 186      83.660 -36.947  44.616  1.00 56.98           O  
ATOM    857  CB  PRO A 186      83.125 -35.573  47.133  1.00 57.96           C  
ATOM    858  CG  PRO A 186      82.898 -36.170  48.477  1.00 58.24           C  
ATOM    859  CD  PRO A 186      82.483 -37.589  48.218  1.00 57.28           C  
ATOM    860  N   VAL A 187      81.800 -35.940  43.842  1.00 66.39           N  
ATOM    861  CA  VAL A 187      82.163 -36.080  42.435  1.00 65.83           C  
ATOM    862  C   VAL A 187      81.966 -34.758  41.687  1.00 66.10           C  
ATOM    863  O   VAL A 187      81.025 -34.005  41.959  1.00 66.09           O  
ATOM    864  CB  VAL A 187      81.335 -37.201  41.749  1.00 64.19           C  
ATOM    865  CG1 VAL A 187      81.634 -37.274  40.261  1.00 63.66           C  
ATOM    866  CG2 VAL A 187      81.613 -38.547  42.401  1.00 64.01           C  
ATOM    867  N   ALA A 188      82.874 -34.473  40.757  1.00 70.46           N  
ATOM    868  CA  ALA A 188      82.764 -33.292  39.914  1.00 70.75           C  
ATOM    869  C   ALA A 188      81.849 -33.554  38.720  1.00 68.23           C  
ATOM    870  O   ALA A 188      80.972 -32.748  38.416  1.00 66.96           O  
ATOM    871  CB  ALA A 188      84.139 -32.850  39.439  1.00 71.82           C  
ATOM    872  N   ILE A 189      82.058 -34.680  38.044  1.00 66.37           N  
ATOM    873  CA  ILE A 189      81.254 -35.036  36.876  1.00 64.49           C  
ATOM    874  C   ILE A 189      80.832 -36.504  36.899  1.00 63.44           C  
ATOM    875  O   ILE A 189      81.679 -37.393  36.968  1.00 65.97           O  
ATOM    876  CB  ILE A 189      82.014 -34.761  35.559  1.00 64.80           C  
ATOM    877  CG1 ILE A 189      82.239 -33.259  35.372  1.00 67.88           C  
ATOM    878  CG2 ILE A 189      81.250 -35.327  34.372  1.00 61.85           C  
ATOM    879  CD1 ILE A 189      83.014 -32.902  34.121  1.00 65.72           C  
ATOM    880  N   PRO A 190      79.514 -36.760  36.842  1.00 54.02           N  
ATOM    881  CA  PRO A 190      78.989 -38.129  36.803  1.00 53.82           C  
ATOM    882  C   PRO A 190      79.270 -38.809  35.466  1.00 54.16           C  
ATOM    883  O   PRO A 190      78.587 -38.539  34.478  1.00 52.63           O  
ATOM    884  CB  PRO A 190      77.487 -37.934  37.019  1.00 51.53           C  
ATOM    885  CG  PRO A 190      77.212 -36.560  36.515  1.00 50.30           C  
ATOM    886  CD  PRO A 190      78.438 -35.754  36.836  1.00 51.94           C  
ATOM    887  N   GLU A 191      80.271 -39.684  35.442  1.00 82.50           N  
ATOM    888  CA  GLU A 191      80.668 -40.355  34.210  1.00 83.41           C  
ATOM    889  C   GLU A 191      79.785 -41.563  33.923  1.00 79.23           C  
ATOM    890  O   GLU A 191      80.010 -42.651  34.453  1.00 82.10           O  
ATOM    891  CB  GLU A 191      82.136 -40.780  34.282  1.00 84.83           C  
ATOM    892  CG  GLU A 191      82.674 -41.361  32.985  1.00 85.54           C  
ATOM    893  CD  GLU A 191      84.167 -41.609  33.036  1.00 82.41           C  
ATOM    894  OE1 GLU A 191      84.736 -42.024  32.004  1.00 80.72           O  
ATOM    895  OE2 GLU A 191      84.771 -41.388  34.105  1.00 82.08           O  
ATOM    896  N   GLU A 192      78.777 -41.359  33.081  1.00 57.42           N  
ATOM    897  CA  GLU A 192      77.851 -42.420  32.705  1.00 56.48           C  
ATOM    898  C   GLU A 192      77.562 -42.372  31.209  1.00 55.95           C  
ATOM    899  O   GLU A 192      77.650 -41.314  30.589  1.00 55.67           O  
ATOM    900  CB  GLU A 192      76.545 -42.300  33.495  1.00 55.01           C  
ATOM    901  CG  GLU A 192      76.697 -42.479  34.998  1.00 55.55           C  
ATOM    902  CD  GLU A 192      76.839 -43.934  35.404  1.00 56.17           C  
ATOM    903  OE1 GLU A 192      77.206 -44.193  36.570  1.00 56.91           O  
ATOM    904  OE2 GLU A 192      76.574 -44.817  34.560  1.00 56.02           O  
ATOM    905  N   ARG A 193      77.221 -43.518  30.631  1.00 59.21           N  
ATOM    906  CA  ARG A 193      76.854 -43.577  29.222  1.00 59.95           C  
ATOM    907  C   ARG A 193      75.518 -42.881  28.987  1.00 59.79           C  
ATOM    908  O   ARG A 193      75.340 -42.178  27.993  1.00 58.91           O  
ATOM    909  CB  ARG A 193      76.785 -45.026  28.735  1.00 52.71           C  
ATOM    910  CG  ARG A 193      78.134 -45.637  28.391  1.00 56.69           C  
ATOM    911  CD  ARG A 193      78.792 -44.905  27.230  1.00 56.87           C  
ATOM    912  NE  ARG A 193      77.944 -44.877  26.041  1.00 54.37           N  
ATOM    913  CZ  ARG A 193      77.939 -45.816  25.101  1.00 53.38           C  
ATOM    914  NH1 ARG A 193      78.740 -46.867  25.206  1.00 55.96           N  
ATOM    915  NH2 ARG A 193      77.133 -45.706  24.053  1.00 52.76           N  
ATOM    916  N   ALA A 194      74.584 -43.078  29.912  1.00 51.97           N  
ATOM    917  CA  ALA A 194      73.264 -42.465  29.815  1.00 59.74           C  
ATOM    918  C   ALA A 194      72.625 -42.315  31.190  1.00 59.04           C  
ATOM    919  O   ALA A 194      72.933 -43.066  32.115  1.00 50.65           O  
ATOM    920  CB  ALA A 194      72.364 -43.284  28.905  1.00 59.36           C  
ATOM    921  N   LEU A 195      71.733 -41.339  31.312  1.00 47.66           N  
ATOM    922  CA  LEU A 195      71.028 -41.099  32.566  1.00 46.96           C  
ATOM    923  C   LEU A 195      69.751 -40.290  32.355  1.00 45.00           C  
ATOM    924  O   LEU A 195      69.571 -39.659  31.312  1.00 44.14           O  
ATOM    925  CB  LEU A 195      71.946 -40.387  33.568  1.00 47.67           C  
ATOM    926  CG  LEU A 195      73.002 -39.393  33.069  1.00 48.07           C  
ATOM    927  CD1 LEU A 195      72.372 -38.178  32.411  1.00 46.57           C  
ATOM    928  CD2 LEU A 195      73.900 -38.964  34.220  1.00 49.21           C  
ATOM    929  N   VAL A 196      68.862 -40.323  33.344  1.00 54.88           N  
ATOM    930  CA  VAL A 196      67.694 -39.455  33.348  1.00 54.00           C  
ATOM    931  C   VAL A 196      68.080 -38.143  34.017  1.00 54.78           C  
ATOM    932  O   VAL A 196      69.081 -38.083  34.730  1.00 59.70           O  
ATOM    933  CB  VAL A 196      66.497 -40.088  34.083  1.00 56.28           C  
ATOM    934  CG1 VAL A 196      66.264 -41.507  33.589  1.00 55.90           C  
ATOM    935  CG2 VAL A 196      66.733 -40.081  35.580  1.00 56.63           C  
ATOM    936  N   PHE A 197      67.301 -37.091  33.792  1.00 52.22           N  
ATOM    937  CA  PHE A 197      67.658 -35.785  34.328  1.00 53.17           C  
ATOM    938  C   PHE A 197      66.456 -34.866  34.510  1.00 55.22           C  
ATOM    939  O   PHE A 197      65.541 -34.847  33.683  1.00 50.09           O  
ATOM    940  CB  PHE A 197      68.684 -35.110  33.417  1.00 56.57           C  
ATOM    941  CG  PHE A 197      69.589 -34.144  34.129  1.00 50.20           C  
ATOM    942  CD1 PHE A 197      70.410 -33.287  33.412  1.00 55.12           C  
ATOM    943  CD2 PHE A 197      69.632 -34.105  35.514  1.00 51.52           C  
ATOM    944  CE1 PHE A 197      71.247 -32.400  34.064  1.00 57.32           C  
ATOM    945  CE2 PHE A 197      70.468 -33.221  36.170  1.00 51.72           C  
ATOM    946  CZ  PHE A 197      71.276 -32.369  35.444  1.00 59.39           C  
ATOM    947  N   ASP A 198      66.472 -34.104  35.598  1.00 56.09           N  
ATOM    948  CA  ASP A 198      65.478 -33.066  35.842  1.00 53.72           C  
ATOM    949  C   ASP A 198      66.054 -32.018  36.787  1.00 56.04           C  
ATOM    950  O   ASP A 198      66.201 -32.265  37.983  1.00 54.44           O  
ATOM    951  CB  ASP A 198      64.203 -33.662  36.412  1.00 53.25           C  
ATOM    952  N   VAL A 199      66.385 -30.851  36.243  1.00 51.41           N  
ATOM    953  CA  VAL A 199      67.010 -29.792  37.029  1.00 53.57           C  
ATOM    954  C   VAL A 199      65.979 -28.938  37.757  1.00 55.41           C  
ATOM    955  O   VAL A 199      64.822 -28.858  37.349  1.00 54.87           O  
ATOM    956  CB  VAL A 199      67.880 -28.873  36.150  1.00 53.46           C  
ATOM    957  CG1 VAL A 199      69.088 -29.627  35.626  1.00 52.37           C  
ATOM    958  CG2 VAL A 199      67.062 -28.306  35.003  1.00 52.28           C  
ATOM    959  N   GLU A 200      66.412 -28.304  38.842  1.00 50.37           N  
ATOM    960  CA  GLU A 200      65.557 -27.398  39.594  1.00 51.93           C  
ATOM    961  C   GLU A 200      66.159 -25.998  39.591  1.00 51.86           C  
ATOM    962  O   GLU A 200      67.376 -25.843  39.509  1.00 52.13           O  
ATOM    963  CB  GLU A 200      65.365 -27.898  41.014  1.00 52.30           C  
ATOM    964  N   VAL A 201      65.310 -24.980  39.674  1.00 56.02           N  
ATOM    965  CA  VAL A 201      65.788 -23.605  39.664  1.00 56.73           C  
ATOM    966  C   VAL A 201      64.857 -22.683  40.442  1.00 57.91           C  
ATOM    967  O   VAL A 201      63.650 -22.643  40.198  1.00 57.85           O  
ATOM    968  CB  VAL A 201      65.953 -23.079  38.219  1.00 56.01           C  
ATOM    969  CG1 VAL A 201      64.779 -23.506  37.356  1.00 55.01           C  
ATOM    970  CG2 VAL A 201      66.100 -21.566  38.213  1.00 57.07           C  
ATOM    971  N   CYS A 202      65.427 -21.952  41.395  1.00 58.49           N  
ATOM    972  CA  CYS A 202      64.664 -20.989  42.175  1.00 54.73           C  
ATOM    973  C   CYS A 202      64.247 -19.816  41.294  1.00 54.39           C  
ATOM    974  O   CYS A 202      65.084 -19.026  40.861  1.00 59.11           O  
ATOM    975  CB  CYS A 202      65.479 -20.497  43.372  1.00 56.54           C  
ATOM    976  SG  CYS A 202      64.576 -19.403  44.496  1.00 61.42           S  
ATOM    977  N   LEU A 203      62.948 -19.714  41.032  1.00 44.50           N  
ATOM    978  CA  LEU A 203      62.420 -18.685  40.145  1.00 44.33           C  
ATOM    979  C   LEU A 203      62.492 -17.303  40.787  1.00 46.07           C  
ATOM    980  O   LEU A 203      62.467 -16.286  40.093  1.00 46.46           O  
ATOM    981  CB  LEU A 203      60.975 -19.010  39.757  1.00 43.09           C  
ATOM    982  CG  LEU A 203      60.369 -18.191  38.614  1.00 42.64           C  
ATOM    983  CD1 LEU A 203      61.207 -18.334  37.354  1.00 41.97           C  
ATOM    984  CD2 LEU A 203      58.929 -18.610  38.362  1.00 41.62           C  
ATOM    985  N   ALA A 204      62.592 -17.274  42.112  1.00 58.87           N  
ATOM    986  CA  ALA A 204      62.639 -16.021  42.860  1.00 51.56           C  
ATOM    987  C   ALA A 204      63.829 -15.157  42.448  1.00 52.01           C  
ATOM    988  O   ALA A 204      63.744 -13.930  42.445  1.00 54.38           O  
ATOM    989  CB  ALA A 204      62.683 -16.302  44.355  1.00 53.93           C  
ATOM    990  N   GLU A 205      64.937 -15.804  42.101  1.00 62.46           N  
ATOM    991  CA  GLU A 205      66.116 -15.090  41.624  1.00 62.40           C  
ATOM    992  C   GLU A 205      66.848 -15.887  40.547  1.00 68.95           C  
ATOM    993  O   GLU A 205      68.074 -16.008  40.574  1.00 68.77           O  
ATOM    994  CB  GLU A 205      67.061 -14.770  42.786  1.00 64.72           C  
ATOM    995  CG  GLU A 205      67.414 -15.957  43.667  1.00 61.90           C  
ATOM    996  CD  GLU A 205      68.454 -15.608  44.715  1.00 64.47           C  
ATOM    997  OE1 GLU A 205      68.799 -16.488  45.531  1.00 62.91           O  
ATOM    998  OE2 GLU A 205      68.929 -14.453  44.721  1.00 67.55           O  
ATOM    999  N   GLY A 206      66.087 -16.421  39.596  1.00 62.41           N  
ATOM   1000  CA  GLY A 206      66.652 -17.207  38.512  1.00 60.18           C  
ATOM   1001  C   GLY A 206      67.391 -16.363  37.490  1.00 61.93           C  
ATOM   1002  O   GLY A 206      67.712 -15.205  37.749  1.00 62.82           O  
ATOM   1003  N   THR A 207      67.668 -16.941  36.324  1.00 69.53           N  
ATOM   1004  CA  THR A 207      67.297 -18.317  36.024  1.00 67.75           C  
ATOM   1005  C   THR A 207      68.472 -19.260  36.247  1.00 63.72           C  
ATOM   1006  O   THR A 207      68.822 -20.054  35.374  1.00 62.27           O  
ATOM   1007  CB  THR A 207      66.810 -18.462  34.575  1.00 64.72           C  
ATOM   1008  OG1 THR A 207      67.845 -18.041  33.679  1.00 62.10           O  
ATOM   1009  CG2 THR A 207      65.567 -17.615  34.346  1.00 66.56           C  
ATOM   1010  N   CYS A 208      69.077 -19.168  37.426  1.00 58.07           N  
ATOM   1011  CA  CYS A 208      70.238 -19.978  37.757  1.00 59.63           C  
ATOM   1012  C   CYS A 208      69.839 -21.244  38.505  1.00 58.25           C  
ATOM   1013  O   CYS A 208      69.170 -21.171  39.535  1.00 59.32           O  
ATOM   1014  CB  CYS A 208      71.228 -19.167  38.593  1.00 60.37           C  
ATOM   1015  SG  CYS A 208      72.646 -20.109  39.169  1.00 59.83           S  
ATOM   1016  N   PRO A 209      70.253 -22.409  37.980  1.00 46.28           N  
ATOM   1017  CA  PRO A 209      69.977 -23.726  38.567  1.00 45.72           C  
ATOM   1018  C   PRO A 209      70.367 -23.800  40.038  1.00 47.06           C  
ATOM   1019  O   PRO A 209      71.324 -23.146  40.449  1.00 48.68           O  
ATOM   1020  CB  PRO A 209      70.842 -24.670  37.728  1.00 45.68           C  
ATOM   1021  CG  PRO A 209      70.984 -23.979  36.421  1.00 45.35           C  
ATOM   1022  CD  PRO A 209      71.041 -22.515  36.740  1.00 46.29           C  
ATOM   1023  N   THR A 210      69.632 -24.582  40.823  1.00 46.52           N  
ATOM   1024  CA  THR A 210      69.903 -24.691  42.252  1.00 47.77           C  
ATOM   1025  C   THR A 210      70.014 -26.145  42.707  1.00 47.64           C  
ATOM   1026  O   THR A 210      70.883 -26.482  43.510  1.00 49.01           O  
ATOM   1027  CB  THR A 210      68.818 -23.981  43.081  1.00 47.72           C  
ATOM   1028  OG1 THR A 210      67.525 -24.445  42.678  1.00 46.06           O  
ATOM   1029  CG2 THR A 210      68.895 -22.478  42.874  1.00 48.45           C  
ATOM   1030  N   LEU A 211      69.136 -27.000  42.191  1.00 46.15           N  
ATOM   1031  CA  LEU A 211      69.158 -28.421  42.527  1.00 46.06           C  
ATOM   1032  C   LEU A 211      69.087 -29.291  41.280  1.00 45.00           C  
ATOM   1033  O   LEU A 211      68.625 -28.850  40.228  1.00 43.96           O  
ATOM   1034  CB  LEU A 211      68.002 -28.778  43.464  1.00 45.89           C  
ATOM   1035  CG  LEU A 211      68.018 -28.186  44.873  1.00 46.87           C  
ATOM   1036  CD1 LEU A 211      66.850 -28.720  45.682  1.00 46.89           C  
ATOM   1037  CD2 LEU A 211      69.333 -28.489  45.568  1.00 48.52           C  
ATOM   1038  N   ALA A 212      69.544 -30.532  41.412  1.00 50.63           N  
ATOM   1039  CA  ALA A 212      69.454 -31.505  40.329  1.00 58.23           C  
ATOM   1040  C   ALA A 212      69.581 -32.926  40.860  1.00 57.23           C  
ATOM   1041  O   ALA A 212      70.281 -33.171  41.842  1.00 58.73           O  
ATOM   1042  CB  ALA A 212      70.520 -31.235  39.279  1.00 57.56           C  
ATOM   1043  N   VAL A 213      68.887 -33.857  40.215  1.00 53.99           N  
ATOM   1044  CA  VAL A 213      68.988 -35.275  40.543  1.00 52.95           C  
ATOM   1045  C   VAL A 213      69.051 -36.077  39.249  1.00 51.06           C  
ATOM   1046  O   VAL A 213      68.303 -35.806  38.310  1.00 50.20           O  
ATOM   1047  CB  VAL A 213      67.797 -35.762  41.402  1.00 53.03           C  
ATOM   1048  CG1 VAL A 213      67.866 -37.267  41.616  1.00 51.79           C  
ATOM   1049  CG2 VAL A 213      67.766 -35.041  42.740  1.00 55.12           C  
ATOM   1050  N   ALA A 214      69.951 -37.051  39.191  1.00 51.66           N  
ATOM   1051  CA  ALA A 214      70.086 -37.880  38.001  1.00 50.71           C  
ATOM   1052  C   ALA A 214      70.427 -39.313  38.380  1.00 50.92           C  
ATOM   1053  O   ALA A 214      71.414 -39.556  39.071  1.00 52.04           O  
ATOM   1054  CB  ALA A 214      71.145 -37.309  37.077  1.00 51.04           C  
ATOM   1055  N   ILE A 215      69.610 -40.260  37.931  1.00 53.59           N  
ATOM   1056  CA  ILE A 215      69.881 -41.665  38.202  1.00 53.28           C  
ATOM   1057  C   ILE A 215      70.546 -42.309  36.992  1.00 52.87           C  
ATOM   1058  O   ILE A 215      70.388 -41.849  35.862  1.00 52.43           O  
ATOM   1059  CB  ILE A 215      68.597 -42.442  38.573  1.00 52.55           C  
ATOM   1060  CG1 ILE A 215      67.896 -42.985  37.327  1.00 51.50           C  
ATOM   1061  CG2 ILE A 215      67.662 -41.563  39.383  1.00 52.99           C  
ATOM   1062  CD1 ILE A 215      66.623 -43.742  37.629  1.00 50.85           C  
ATOM   1063  N   SER A 216      71.301 -43.374  37.238  1.00 60.13           N  
ATOM   1064  CA  SER A 216      72.035 -44.053  36.182  1.00 68.74           C  
ATOM   1065  C   SER A 216      71.873 -45.562  36.321  1.00 68.96           C  
ATOM   1066  O   SER A 216      71.491 -46.046  37.388  1.00 69.28           O  
ATOM   1067  CB  SER A 216      73.514 -43.661  36.229  1.00 60.03           C  
ATOM   1068  OG  SER A 216      74.106 -44.053  37.455  1.00 61.83           O  
ATOM   1069  N   PRO A 217      72.151 -46.316  35.243  1.00 63.40           N  
ATOM   1070  CA  PRO A 217      72.110 -47.781  35.326  1.00 63.29           C  
ATOM   1071  C   PRO A 217      73.045 -48.351  36.394  1.00 64.94           C  
ATOM   1072  O   PRO A 217      72.903 -49.514  36.773  1.00 65.71           O  
ATOM   1073  CB  PRO A 217      72.553 -48.219  33.929  1.00 64.72           C  
ATOM   1074  CG  PRO A 217      72.140 -47.097  33.045  1.00 62.31           C  
ATOM   1075  CD  PRO A 217      72.339 -45.850  33.858  1.00 63.13           C  
ATOM   1076  N   SER A 218      73.982 -47.538  36.872  1.00 50.63           N  
ATOM   1077  CA  SER A 218      74.914 -47.965  37.909  1.00 59.49           C  
ATOM   1078  C   SER A 218      74.461 -47.515  39.296  1.00 59.47           C  
ATOM   1079  O   SER A 218      74.259 -48.338  40.190  1.00 59.45           O  
ATOM   1080  CB  SER A 218      76.317 -47.429  37.619  1.00 59.22           C  
ATOM   1081  OG  SER A 218      76.783 -47.871  36.356  1.00 50.98           O  
ATOM   1082  N   ALA A 219      74.298 -46.207  39.471  1.00 53.38           N  
ATOM   1083  CA  ALA A 219      73.959 -45.653  40.778  1.00 53.34           C  
ATOM   1084  C   ALA A 219      73.240 -44.307  40.669  1.00 52.46           C  
ATOM   1085  O   ALA A 219      72.818 -43.903  39.583  1.00 51.62           O  
ATOM   1086  CB  ALA A 219      75.214 -45.515  41.621  1.00 54.85           C  
ATOM   1087  N   TRP A 220      73.103 -43.617  41.799  1.00 65.18           N  
ATOM   1088  CA  TRP A 220      72.402 -42.334  41.826  1.00 64.65           C  
ATOM   1089  C   TRP A 220      73.361 -41.145  41.876  1.00 65.62           C  
ATOM   1090  O   TRP A 220      74.541 -41.300  42.189  1.00 66.80           O  
ATOM   1091  CB  TRP A 220      71.444 -42.273  43.019  1.00 64.54           C  
ATOM   1092  CG  TRP A 220      70.144 -42.974  42.785  1.00 63.36           C  
ATOM   1093  CD1 TRP A 220      69.956 -44.310  42.585  1.00 63.01           C  
ATOM   1094  CD2 TRP A 220      68.840 -42.375  42.738  1.00 62.54           C  
ATOM   1095  NE1 TRP A 220      68.621 -44.580  42.410  1.00 62.20           N  
ATOM   1096  CE2 TRP A 220      67.916 -43.411  42.500  1.00 61.68           C  
ATOM   1097  CE3 TRP A 220      68.369 -41.066  42.873  1.00 62.62           C  
ATOM   1098  CZ2 TRP A 220      66.548 -43.177  42.393  1.00 60.86           C  
ATOM   1099  CZ3 TRP A 220      67.012 -40.838  42.767  1.00 61.86           C  
ATOM   1100  CH2 TRP A 220      66.116 -41.888  42.529  1.00 61.22           C  
ATOM   1101  N   TYR A 221      72.840 -39.963  41.560  1.00 52.47           N  
ATOM   1102  CA  TYR A 221      73.625 -38.732  41.594  1.00 53.43           C  
ATOM   1103  C   TYR A 221      72.756 -37.545  42.001  1.00 53.37           C  
ATOM   1104  O   TYR A 221      71.615 -37.423  41.551  1.00 52.27           O  
ATOM   1105  CB  TYR A 221      74.264 -38.454  40.229  1.00 53.23           C  
ATOM   1106  CG  TYR A 221      75.329 -39.443  39.808  1.00 53.81           C  
ATOM   1107  CD1 TYR A 221      76.630 -39.339  40.285  1.00 55.35           C  
ATOM   1108  CD2 TYR A 221      75.038 -40.471  38.918  1.00 52.99           C  
ATOM   1109  CE1 TYR A 221      77.607 -40.237  39.897  1.00 56.09           C  
ATOM   1110  CE2 TYR A 221      76.010 -41.372  38.526  1.00 53.79           C  
ATOM   1111  CZ  TYR A 221      77.291 -41.251  39.018  1.00 55.35           C  
ATOM   1112  OH  TYR A 221      78.258 -42.146  38.630  1.00 56.34           O  
ATOM   1113  N   SER A 222      73.290 -36.669  42.849  1.00 51.88           N  
ATOM   1114  CA  SER A 222      72.579 -35.440  43.197  1.00 51.00           C  
ATOM   1115  C   SER A 222      73.499 -34.223  43.127  1.00 52.21           C  
ATOM   1116  O   SER A 222      74.519 -34.157  43.813  1.00 53.45           O  
ATOM   1117  CB  SER A 222      71.954 -35.546  44.590  1.00 51.60           C  
ATOM   1118  OG  SER A 222      72.929 -35.397  45.607  1.00 53.03           O  
ATOM   1119  N   TRP A 223      73.124 -33.260  42.294  1.00 55.17           N  
ATOM   1120  CA  TRP A 223      73.923 -32.059  42.087  1.00 55.03           C  
ATOM   1121  C   TRP A 223      73.347 -30.841  42.802  1.00 58.04           C  
ATOM   1122  O   TRP A 223      72.161 -30.534  42.673  1.00 56.96           O  
ATOM   1123  CB  TRP A 223      74.052 -31.760  40.592  1.00 54.97           C  
ATOM   1124  CG  TRP A 223      74.832 -30.513  40.293  1.00 56.07           C  
ATOM   1125  CD1 TRP A 223      76.180 -30.346  40.410  1.00 58.11           C  
ATOM   1126  CD2 TRP A 223      74.314 -29.264  39.816  1.00 55.73           C  
ATOM   1127  NE1 TRP A 223      76.533 -29.070  40.045  1.00 58.95           N  
ATOM   1128  CE2 TRP A 223      75.406 -28.386  39.675  1.00 57.53           C  
ATOM   1129  CE3 TRP A 223      73.033 -28.804  39.499  1.00 58.27           C  
ATOM   1130  CZ2 TRP A 223      75.257 -27.077  39.231  1.00 57.73           C  
ATOM   1131  CZ3 TRP A 223      72.888 -27.502  39.056  1.00 54.23           C  
ATOM   1132  CH2 TRP A 223      73.994 -26.655  38.924  1.00 56.18           C  
ATOM   1133  N   CYS A 224      74.200 -30.151  43.553  1.00 50.26           N  
ATOM   1134  CA  CYS A 224      73.826 -28.888  44.179  1.00 51.30           C  
ATOM   1135  C   CYS A 224      74.629 -27.743  43.582  1.00 51.80           C  
ATOM   1136  O   CYS A 224      75.814 -27.897  43.275  1.00 52.03           O  
ATOM   1137  CB  CYS A 224      74.040 -28.936  45.693  1.00 52.25           C  
ATOM   1138  SG  CYS A 224      72.626 -29.525  46.645  1.00 52.15           S  
ATOM   1139  N   SER A 225      73.981 -26.595  43.421  1.00 53.06           N  
ATOM   1140  CA  SER A 225      74.650 -25.408  42.908  1.00 52.23           C  
ATOM   1141  C   SER A 225      75.475 -24.738  43.999  1.00 56.31           C  
ATOM   1142  O   SER A 225      75.550 -25.227  45.125  1.00 55.57           O  
ATOM   1143  CB  SER A 225      73.631 -24.423  42.340  1.00 55.47           C  
ATOM   1144  OG  SER A 225      72.916 -24.999  41.265  1.00 55.16           O  
ATOM   1145  N   GLN A 226      76.083 -23.608  43.658  1.00 56.12           N  
ATOM   1146  CA  GLN A 226      76.918 -22.873  44.598  1.00 53.50           C  
ATOM   1147  C   GLN A 226      76.064 -22.130  45.623  1.00 58.34           C  
ATOM   1148  O   GLN A 226      76.586 -21.535  46.569  1.00 56.94           O  
ATOM   1149  CB  GLN A 226      77.826 -21.898  43.844  1.00 54.50           C  
ATOM   1150  CG  GLN A 226      79.067 -21.467  44.604  1.00 57.45           C  
ATOM   1151  CD  GLN A 226      79.972 -20.576  43.772  1.00 57.90           C  
ATOM   1152  OE1 GLN A 226      79.600 -20.138  42.684  1.00 57.20           O  
ATOM   1153  NE2 GLN A 226      81.170 -20.308  44.282  1.00 52.38           N  
ATOM   1154  N   ARG A 227      74.749 -22.175  45.437  1.00 67.83           N  
ATOM   1155  CA  ARG A 227      73.817 -21.527  46.354  1.00 67.45           C  
ATOM   1156  C   ARG A 227      73.689 -22.296  47.665  1.00 69.59           C  
ATOM   1157  O   ARG A 227      72.596 -22.706  48.054  1.00 65.42           O  
ATOM   1158  CB  ARG A 227      72.435 -21.380  45.713  1.00 67.86           C  
ATOM   1159  CG  ARG A 227      72.340 -20.320  44.626  1.00 67.47           C  
ATOM   1160  CD  ARG A 227      72.808 -20.848  43.278  1.00 65.85           C  
ATOM   1161  NE  ARG A 227      74.173 -20.437  42.965  1.00 65.83           N  
ATOM   1162  CZ  ARG A 227      74.808 -20.761  41.844  1.00 68.56           C  
ATOM   1163  NH1 ARG A 227      76.047 -20.338  41.633  1.00 71.44           N  
ATOM   1164  NH2 ARG A 227      74.203 -21.504  40.928  1.00 67.64           N  
ATOM   1165  N   LEU A 228      74.817 -22.492  48.338  1.00 79.49           N  
ATOM   1166  CA  LEU A 228      74.837 -23.140  49.642  1.00 79.85           C  
ATOM   1167  C   LEU A 228      75.406 -22.185  50.677  1.00 72.25           C  
ATOM   1168  O   LEU A 228      75.274 -22.400  51.882  1.00 72.98           O  
ATOM   1169  CB  LEU A 228      75.658 -24.429  49.596  1.00 77.99           C  
ATOM   1170  CG  LEU A 228      74.896 -25.732  49.339  1.00 79.77           C  
ATOM   1171  CD1 LEU A 228      74.109 -25.676  48.040  1.00 76.70           C  
ATOM   1172  CD2 LEU A 228      75.855 -26.911  49.333  1.00 70.01           C  
ATOM   1173  N   VAL A 229      76.042 -21.124  50.191  1.00 72.46           N  
ATOM   1174  CA  VAL A 229      76.610 -20.103  51.059  1.00 77.07           C  
ATOM   1175  C   VAL A 229      75.879 -18.779  50.857  1.00 78.04           C  
ATOM   1176  O   VAL A 229      75.714 -18.317  49.728  1.00 77.37           O  
ATOM   1177  CB  VAL A 229      78.117 -19.910  50.793  1.00 74.99           C  
ATOM   1178  CG1 VAL A 229      78.714 -18.929  51.789  1.00 77.87           C  
ATOM   1179  CG2 VAL A 229      78.842 -21.247  50.859  1.00 74.05           C  
ATOM   1180  N   GLU A 230      75.439 -18.176  51.957  1.00 87.71           N  
ATOM   1181  CA  GLU A 230      74.699 -16.920  51.899  1.00 87.85           C  
ATOM   1182  C   GLU A 230      75.596 -15.753  51.503  1.00 87.80           C  
ATOM   1183  O   GLU A 230      76.410 -15.283  52.298  1.00 81.85           O  
ATOM   1184  CB  GLU A 230      74.030 -16.628  53.243  1.00 87.78           C  
ATOM   1185  CG  GLU A 230      72.859 -17.544  53.572  1.00 86.35           C  
ATOM   1186  CD  GLU A 230      71.645 -17.283  52.696  1.00 86.27           C  
ATOM   1187  OE1 GLU A 230      71.578 -16.204  52.069  1.00 89.08           O  
ATOM   1188  OE2 GLU A 230      70.756 -18.158  52.637  1.00 85.65           O  
ATOM   1189  N   GLU A 231      75.438 -15.289  50.267  1.00 74.58           N  
ATOM   1190  CA  GLU A 231      76.200 -14.151  49.766  1.00 73.50           C  
ATOM   1191  C   GLU A 231      75.299 -13.162  49.038  1.00 77.12           C  
ATOM   1192  O   GLU A 231      74.103 -13.400  48.874  1.00 76.02           O  
ATOM   1193  CB  GLU A 231      77.317 -14.615  48.831  1.00 72.83           C  
ATOM   1194  CG  GLU A 231      78.402 -15.441  49.497  1.00 72.07           C  
ATOM   1195  CD  GLU A 231      79.534 -15.782  48.548  1.00 71.92           C  
ATOM   1196  OE1 GLU A 231      79.468 -15.362  47.373  1.00 72.82           O  
ATOM   1197  OE2 GLU A 231      80.487 -16.467  48.974  1.00 73.81           O  
ATOM   1198  N   ARG A 232      75.882 -12.051  48.603  1.00 52.20           N  
ATOM   1199  CA  ARG A 232      75.172 -11.094  47.767  1.00 51.69           C  
ATOM   1200  C   ARG A 232      75.643 -11.242  46.326  1.00 50.58           C  
ATOM   1201  O   ARG A 232      76.358 -10.389  45.802  1.00 52.26           O  
ATOM   1202  CB  ARG A 232      75.387  -9.665  48.264  1.00 54.65           C  
ATOM   1203  CG  ARG A 232      75.132  -9.487  49.755  1.00 56.29           C  
ATOM   1204  CD  ARG A 232      74.336  -8.223  50.053  1.00 57.66           C  
ATOM   1205  NE  ARG A 232      74.952  -7.021  49.495  1.00 59.83           N  
ATOM   1206  CZ  ARG A 232      74.517  -6.396  48.406  1.00 59.07           C  
ATOM   1207  NH1 ARG A 232      73.459  -6.856  47.751  1.00 56.19           N  
ATOM   1208  NH2 ARG A 232      75.139  -5.309  47.969  1.00 51.33           N  
ATOM   1209  N   TYR A 233      75.239 -12.343  45.697  1.00 62.80           N  
ATOM   1210  CA  TYR A 233      75.687 -12.694  44.353  1.00 69.08           C  
ATOM   1211  C   TYR A 233      75.325 -11.657  43.299  1.00 60.13           C  
ATOM   1212  O   TYR A 233      74.427 -10.838  43.491  1.00 60.59           O  
ATOM   1213  CB  TYR A 233      75.106 -14.049  43.941  1.00 66.41           C  
ATOM   1214  CG  TYR A 233      75.909 -15.231  44.426  1.00 67.77           C  
ATOM   1215  CD1 TYR A 233      76.993 -15.698  43.695  1.00 66.66           C  
ATOM   1216  CD2 TYR A 233      75.586 -15.881  45.610  1.00 62.57           C  
ATOM   1217  CE1 TYR A 233      77.733 -16.778  44.129  1.00 61.40           C  
ATOM   1218  CE2 TYR A 233      76.322 -16.962  46.052  1.00 62.40           C  
ATOM   1219  CZ  TYR A 233      77.395 -17.405  45.308  1.00 61.90           C  
ATOM   1220  OH  TYR A 233      78.131 -18.482  45.745  1.00 64.50           O  
ATOM   1221  N   SER A 234      76.041 -11.707  42.181  1.00 82.90           N  
ATOM   1222  CA  SER A 234      75.749 -10.863  41.033  1.00 85.28           C  
ATOM   1223  C   SER A 234      75.590 -11.737  39.796  1.00 82.50           C  
ATOM   1224  O   SER A 234      76.575 -12.219  39.235  1.00 88.30           O  
ATOM   1225  CB  SER A 234      76.851  -9.826  40.823  1.00 86.32           C  
ATOM   1226  OG  SER A 234      78.098 -10.454  40.584  1.00 86.38           O  
ATOM   1227  N   TRP A 235      74.346 -11.945  39.377  1.00 75.38           N  
ATOM   1228  CA  TRP A 235      74.059 -12.867  38.286  1.00 73.69           C  
ATOM   1229  C   TRP A 235      74.161 -12.203  36.917  1.00 75.31           C  
ATOM   1230  O   TRP A 235      73.281 -11.441  36.514  1.00 72.51           O  
ATOM   1231  CB  TRP A 235      72.670 -13.486  38.464  1.00 72.62           C  
ATOM   1232  CG  TRP A 235      72.503 -14.219  39.764  1.00 75.20           C  
ATOM   1233  CD1 TRP A 235      71.614 -13.932  40.759  1.00 76.57           C  
ATOM   1234  CD2 TRP A 235      73.259 -15.348  40.217  1.00 73.58           C  
ATOM   1235  NE1 TRP A 235      71.764 -14.818  41.799  1.00 75.46           N  
ATOM   1236  CE2 TRP A 235      72.770 -15.698  41.491  1.00 73.62           C  
ATOM   1237  CE3 TRP A 235      74.302 -16.104  39.668  1.00 71.00           C  
ATOM   1238  CZ2 TRP A 235      73.285 -16.765  42.224  1.00 73.67           C  
ATOM   1239  CZ3 TRP A 235      74.812 -17.163  40.396  1.00 79.76           C  
ATOM   1240  CH2 TRP A 235      74.303 -17.483  41.659  1.00 77.58           C  
ATOM   1241  N   THR A 236      75.245 -12.500  36.209  1.00 85.06           N  
ATOM   1242  CA  THR A 236      75.411 -12.070  34.829  1.00 84.51           C  
ATOM   1243  C   THR A 236      75.445 -13.310  33.940  1.00 84.54           C  
ATOM   1244  O   THR A 236      75.967 -13.281  32.827  1.00 83.51           O  
ATOM   1245  CB  THR A 236      76.695 -11.237  34.636  1.00 88.00           C  
ATOM   1246  OG1 THR A 236      76.969 -10.489  35.828  1.00 88.01           O  
ATOM   1247  CG2 THR A 236      76.548 -10.276  33.463  1.00 87.08           C  
ATOM   1248  N   SER A 237      74.881 -14.399  34.459  1.00 79.94           N  
ATOM   1249  CA  SER A 237      74.816 -15.691  33.774  1.00 73.44           C  
ATOM   1250  C   SER A 237      76.182 -16.180  33.301  1.00 76.15           C  
ATOM   1251  O   SER A 237      76.474 -16.187  32.105  1.00 72.66           O  
ATOM   1252  CB  SER A 237      73.849 -15.622  32.587  1.00 74.96           C  
ATOM   1253  OG  SER A 237      74.364 -14.813  31.544  1.00 73.95           O  
ATOM   1254  N   GLN A 238      77.012 -16.595  34.251  1.00 86.94           N  
ATOM   1255  CA  GLN A 238      78.327 -17.146  33.945  1.00 86.23           C  
ATOM   1256  C   GLN A 238      78.212 -18.612  33.543  1.00 86.24           C  
ATOM   1257  O   GLN A 238      77.138 -19.075  33.162  1.00 81.13           O  
ATOM   1258  CB  GLN A 238      79.262 -16.998  35.147  1.00 88.14           C  
ATOM   1259  CG  GLN A 238      78.714 -17.602  36.433  1.00 87.94           C  
ATOM   1260  CD  GLN A 238      79.596 -17.328  37.635  1.00 80.45           C  
ATOM   1261  OE1 GLN A 238      80.631 -16.669  37.523  1.00 89.87           O  
ATOM   1262  NE2 GLN A 238      79.191 -17.832  38.795  1.00 89.47           N  
ATOM   1263  N   LEU A 239      79.318 -19.342  33.629  1.00 61.46           N  
ATOM   1264  CA  LEU A 239      79.293 -20.778  33.370  1.00 60.34           C  
ATOM   1265  C   LEU A 239      79.012 -21.532  34.665  1.00 60.10           C  
ATOM   1266  O   LEU A 239      79.717 -22.474  35.023  1.00 60.91           O  
ATOM   1267  CB  LEU A 239      80.603 -21.246  32.741  1.00 61.94           C  
ATOM   1268  CG  LEU A 239      80.605 -21.261  31.210  1.00 61.27           C  
ATOM   1269  CD1 LEU A 239      79.548 -22.218  30.692  1.00 58.81           C  
ATOM   1270  CD2 LEU A 239      80.380 -19.868  30.642  1.00 61.48           C  
ATOM   1271  N   SER A 240      77.975 -21.086  35.362  1.00 66.81           N  
ATOM   1272  CA  SER A 240      77.506 -21.720  36.591  1.00 65.56           C  
ATOM   1273  C   SER A 240      76.567 -22.930  36.408  1.00 68.20           C  
ATOM   1274  O   SER A 240      76.532 -23.792  37.287  1.00 66.19           O  
ATOM   1275  CB  SER A 240      76.806 -20.680  37.468  1.00 69.98           C  
ATOM   1276  OG  SER A 240      76.312 -21.271  38.656  1.00 70.19           O  
ATOM   1277  N   PRO A 241      75.782 -22.988  35.303  1.00 53.58           N  
ATOM   1278  CA  PRO A 241      74.976 -24.193  35.058  1.00 52.62           C  
ATOM   1279  C   PRO A 241      75.700 -25.533  35.226  1.00 52.84           C  
ATOM   1280  O   PRO A 241      76.929 -25.609  35.153  1.00 53.81           O  
ATOM   1281  CB  PRO A 241      74.540 -24.009  33.606  1.00 51.85           C  
ATOM   1282  CG  PRO A 241      74.330 -22.550  33.496  1.00 51.60           C  
ATOM   1283  CD  PRO A 241      75.354 -21.895  34.405  1.00 53.02           C  
ATOM   1284  N   ALA A 242      74.909 -26.581  35.444  1.00 61.50           N  
ATOM   1285  CA  ALA A 242      75.417 -27.909  35.774  1.00 60.29           C  
ATOM   1286  C   ALA A 242      76.332 -28.489  34.702  1.00 60.15           C  
ATOM   1287  O   ALA A 242      76.012 -28.468  33.512  1.00 57.41           O  
ATOM   1288  CB  ALA A 242      74.253 -28.856  36.029  1.00 54.61           C  
ATOM   1289  N   ASP A 243      77.473 -29.009  35.143  1.00 53.10           N  
ATOM   1290  CA  ASP A 243      78.421 -29.679  34.261  1.00 53.33           C  
ATOM   1291  C   ASP A 243      78.044 -31.144  34.090  1.00 53.94           C  
ATOM   1292  O   ASP A 243      77.721 -31.824  35.061  1.00 53.98           O  
ATOM   1293  CB  ASP A 243      79.838 -29.558  34.818  1.00 58.23           C  
ATOM   1294  CG  ASP A 243      79.912 -29.913  36.289  1.00 59.57           C  
ATOM   1295  OD1 ASP A 243      78.882 -29.777  36.984  1.00 54.01           O  
ATOM   1296  OD2 ASP A 243      80.997 -30.324  36.749  1.00 60.23           O  
ATOM   1297  N   LEU A 244      78.092 -31.630  32.855  1.00 59.24           N  
ATOM   1298  CA  LEU A 244      77.624 -32.978  32.562  1.00 59.56           C  
ATOM   1299  C   LEU A 244      78.505 -33.701  31.547  1.00 59.51           C  
ATOM   1300  O   LEU A 244      78.641 -34.924  31.593  1.00 57.86           O  
ATOM   1301  CB  LEU A 244      76.182 -32.930  32.056  1.00 56.91           C  
ATOM   1302  CG  LEU A 244      75.350 -34.197  32.250  1.00 55.30           C  
ATOM   1303  CD1 LEU A 244      75.250 -34.535  33.728  1.00 56.43           C  
ATOM   1304  CD2 LEU A 244      73.970 -34.018  31.644  1.00 52.38           C  
ATOM   1305  N   ILE A 245      79.101 -32.945  30.632  1.00 89.63           N  
ATOM   1306  CA  ILE A 245      79.927 -33.532  29.579  1.00 82.57           C  
ATOM   1307  C   ILE A 245      81.305 -33.931  30.114  1.00 86.87           C  
ATOM   1308  O   ILE A 245      81.877 -33.235  30.956  1.00 87.81           O  
ATOM   1309  CB  ILE A 245      80.078 -32.560  28.376  1.00 84.07           C  
ATOM   1310  CG1 ILE A 245      79.336 -33.108  27.155  1.00 82.78           C  
ATOM   1311  CG2 ILE A 245      81.541 -32.307  28.028  1.00 86.32           C  
ATOM   1312  CD1 ILE A 245      79.544 -32.292  25.902  1.00 83.52           C  
ATOM   1313  N   PRO A 246      81.823 -35.080  29.648  1.00 99.06           N  
ATOM   1314  CA  PRO A 246      83.172 -35.541  29.988  1.00 92.84           C  
ATOM   1315  C   PRO A 246      84.223 -34.994  29.024  1.00 93.27           C  
ATOM   1316  O   PRO A 246      83.926 -34.775  27.851  1.00 92.53           O  
ATOM   1317  CB  PRO A 246      83.055 -37.058  29.861  1.00 92.43           C  
ATOM   1318  CG  PRO A 246      82.055 -37.243  28.767  1.00 99.26           C  
ATOM   1319  CD  PRO A 246      81.077 -36.092  28.881  1.00 98.85           C  
ATOM   1320  N   LEU A 247      85.437 -34.779  29.518  1.00 97.53           N  
ATOM   1321  CA  LEU A 247      86.514 -34.261  28.681  1.00 97.88           C  
ATOM   1322  C   LEU A 247      87.219 -35.387  27.929  1.00 97.49           C  
ATOM   1323  O   LEU A 247      87.167 -36.547  28.335  1.00 97.09           O  
ATOM   1324  CB  LEU A 247      87.527 -33.461  29.517  1.00 98.99           C  
ATOM   1325  CG  LEU A 247      87.906 -33.808  30.969  1.00 98.59           C  
ATOM   1326  CD1 LEU A 247      86.832 -33.366  31.964  1.00 99.28           C  
ATOM   1327  CD2 LEU A 247      88.243 -35.286  31.150  1.00 99.63           C  
ATOM   1328  N   GLU A 248      87.871 -35.037  26.824  1.00109.92           N  
ATOM   1329  CA  GLU A 248      88.596 -36.014  26.020  1.00101.26           C  
ATOM   1330  C   GLU A 248      90.071 -36.056  26.411  1.00103.58           C  
ATOM   1331  O   GLU A 248      90.606 -37.114  26.743  1.00103.84           O  
ATOM   1332  CB  GLU A 248      88.451 -35.698  24.530  1.00100.62           C  
ATOM   1333  CG  GLU A 248      89.154 -36.688  23.609  1.00100.88           C  
ATOM   1334  CD  GLU A 248      88.528 -38.070  23.643  1.00100.13           C  
ATOM   1335  OE1 GLU A 248      87.328 -38.177  23.974  1.00109.85           O  
ATOM   1336  OE2 GLU A 248      89.238 -39.052  23.341  1.00101.28           O  
ATOM   1337  N   VAL A 249      90.722 -34.896  26.369  1.00 83.08           N  
ATOM   1338  CA  VAL A 249      92.128 -34.794  26.741  1.00 85.41           C  
ATOM   1339  C   VAL A 249      92.326 -33.808  27.887  1.00 86.55           C  
ATOM   1340  O   VAL A 249      91.581 -32.835  28.018  1.00 85.12           O  
ATOM   1341  CB  VAL A 249      92.999 -34.358  25.547  1.00 83.12           C  
ATOM   1342  CG1 VAL A 249      94.434 -34.122  25.994  1.00 86.88           C  
ATOM   1343  CG2 VAL A 249      92.943 -35.399  24.440  1.00 83.24           C  
ATOM   1344  N   GLN A 262      79.209 -44.004  21.577  1.00 61.49           N  
ATOM   1345  CA  GLN A 262      79.873 -42.853  22.174  1.00 61.52           C  
ATOM   1346  C   GLN A 262      79.232 -41.539  21.721  1.00 67.97           C  
ATOM   1347  O   GLN A 262      78.925 -41.364  20.540  1.00 69.39           O  
ATOM   1348  CB  GLN A 262      81.367 -42.869  21.835  1.00 65.62           C  
ATOM   1349  CG  GLN A 262      81.686 -42.915  20.353  1.00 65.56           C  
ATOM   1350  CD  GLN A 262      83.177 -42.949  20.085  1.00 67.23           C  
ATOM   1351  OE1 GLN A 262      83.977 -43.135  21.002  1.00 68.59           O  
ATOM   1352  NE2 GLN A 262      83.559 -42.768  18.827  1.00 69.01           N  
ATOM   1353  N   GLU A 263      79.024 -40.619  22.660  1.00 73.96           N  
ATOM   1354  CA  GLU A 263      79.397 -40.831  24.057  1.00 72.90           C  
ATOM   1355  C   GLU A 263      78.208 -40.734  25.008  1.00 71.36           C  
ATOM   1356  O   GLU A 263      77.973 -41.638  25.809  1.00 70.78           O  
ATOM   1357  CB  GLU A 263      80.468 -39.821  24.483  1.00 75.21           C  
ATOM   1358  CG  GLU A 263      81.886 -40.173  24.053  1.00 75.06           C  
ATOM   1359  CD  GLU A 263      82.446 -41.383  24.790  1.00 78.14           C  
ATOM   1360  OE1 GLU A 263      83.421 -41.984  24.292  1.00 78.53           O  
ATOM   1361  OE2 GLU A 263      81.916 -41.729  25.867  1.00 79.20           O  
ATOM   1362  N   GLN A 264      77.464 -39.636  24.921  1.00 53.09           N  
ATOM   1363  CA  GLN A 264      76.446 -39.328  25.921  1.00 54.44           C  
ATOM   1364  C   GLN A 264      75.011 -39.389  25.406  1.00 51.13           C  
ATOM   1365  O   GLN A 264      74.756 -39.271  24.208  1.00 52.68           O  
ATOM   1366  CB  GLN A 264      76.705 -37.938  26.509  1.00 54.02           C  
ATOM   1367  CG  GLN A 264      77.974 -37.834  27.344  1.00 55.51           C  
ATOM   1368  CD  GLN A 264      77.826 -38.472  28.714  1.00 59.25           C  
ATOM   1369  OE1 GLN A 264      76.730 -38.874  29.108  1.00 53.29           O  
ATOM   1370  NE2 GLN A 264      78.929 -38.563  29.445  1.00 58.14           N  
ATOM   1371  N   LEU A 265      74.080 -39.576  26.338  1.00 58.02           N  
ATOM   1372  CA  LEU A 265      72.650 -39.514  26.051  1.00 55.96           C  
ATOM   1373  C   LEU A 265      71.877 -39.176  27.320  1.00 56.05           C  
ATOM   1374  O   LEU A 265      72.013 -39.853  28.340  1.00 56.04           O  
ATOM   1375  CB  LEU A 265      72.140 -40.831  25.471  1.00 56.84           C  
ATOM   1376  CG  LEU A 265      70.613 -40.891  25.360  1.00 54.71           C  
ATOM   1377  CD1 LEU A 265      70.108 -39.955  24.271  1.00 53.53           C  
ATOM   1378  CD2 LEU A 265      70.128 -42.309  25.126  1.00 55.80           C  
ATOM   1379  N   VAL A 266      71.062 -38.129  27.255  1.00 44.02           N  
ATOM   1380  CA  VAL A 266      70.306 -37.688  28.418  1.00 43.08           C  
ATOM   1381  C   VAL A 266      68.809 -37.648  28.137  1.00 41.55           C  
ATOM   1382  O   VAL A 266      68.354 -36.939  27.239  1.00 40.60           O  
ATOM   1383  CB  VAL A 266      70.759 -36.297  28.890  1.00 42.86           C  
ATOM   1384  CG1 VAL A 266      69.911 -35.836  30.062  1.00 41.98           C  
ATOM   1385  CG2 VAL A 266      72.235 -36.318  29.261  1.00 44.56           C  
ATOM   1386  N   VAL A 267      68.049 -38.412  28.912  1.00 60.78           N  
ATOM   1387  CA  VAL A 267      66.601 -38.432  28.776  1.00 59.82           C  
ATOM   1388  C   VAL A 267      65.957 -37.656  29.919  1.00 59.67           C  
ATOM   1389  O   VAL A 267      66.573 -37.447  30.964  1.00 60.38           O  
ATOM   1390  CB  VAL A 267      66.052 -39.871  28.750  1.00 59.90           C  
ATOM   1391  CG1 VAL A 267      66.785 -40.695  27.703  1.00 60.49           C  
ATOM   1392  CG2 VAL A 267      66.176 -40.515  30.117  1.00 60.43           C  
ATOM   1393  N   GLY A 268      64.719 -37.221  29.714  1.00 43.14           N  
ATOM   1394  CA  GLY A 268      64.009 -36.467  30.728  1.00 43.51           C  
ATOM   1395  C   GLY A 268      62.738 -35.830  30.202  1.00 47.76           C  
ATOM   1396  O   GLY A 268      62.605 -35.588  29.002  1.00 40.98           O  
ATOM   1397  N   HIS A 269      61.801 -35.564  31.105  1.00 60.96           N  
ATOM   1398  CA  HIS A 269      60.552 -34.906  30.746  1.00 58.60           C  
ATOM   1399  C   HIS A 269      60.813 -33.428  30.483  1.00 58.40           C  
ATOM   1400  O   HIS A 269      61.290 -32.713  31.368  1.00 61.70           O  
ATOM   1401  CB  HIS A 269      59.512 -35.083  31.852  1.00 66.24           C  
ATOM   1402  CG  HIS A 269      58.096 -35.032  31.365  1.00 60.02           C  
ATOM   1403  ND1 HIS A 269      57.629 -35.839  30.350  1.00 64.98           N  
ATOM   1404  CD2 HIS A 269      57.045 -34.274  31.758  1.00 62.52           C  
ATOM   1405  CE1 HIS A 269      56.352 -35.579  30.136  1.00 59.77           C  
ATOM   1406  NE2 HIS A 269      55.973 -34.634  30.977  1.00 63.38           N  
ATOM   1407  N   ASN A 270      60.494 -32.982  29.269  1.00 47.73           N  
ATOM   1408  CA  ASN A 270      60.873 -31.653  28.791  1.00 42.36           C  
ATOM   1409  C   ASN A 270      62.380 -31.471  28.921  1.00 41.45           C  
ATOM   1410  O   ASN A 270      62.860 -30.665  29.717  1.00 42.32           O  
ATOM   1411  CB  ASN A 270      60.124 -30.555  29.552  1.00 43.64           C  
ATOM   1412  CG  ASN A 270      60.288 -29.190  28.913  1.00 42.64           C  
ATOM   1413  OD1 ASN A 270      60.721 -29.078  27.766  1.00 43.02           O  
ATOM   1414  ND2 ASN A 270      59.937 -28.144  29.653  1.00 43.95           N  
ATOM   1415  N   VAL A 271      63.116 -32.236  28.121  1.00 43.57           N  
ATOM   1416  CA  VAL A 271      64.559 -32.357  28.268  1.00 45.28           C  
ATOM   1417  C   VAL A 271      65.307 -31.104  27.816  1.00 45.19           C  
ATOM   1418  O   VAL A 271      66.450 -30.881  28.211  1.00 45.46           O  
ATOM   1419  CB  VAL A 271      65.083 -33.583  27.481  1.00 44.54           C  
ATOM   1420  CG1 VAL A 271      65.072 -33.304  25.983  1.00 43.21           C  
ATOM   1421  CG2 VAL A 271      66.474 -33.979  27.954  1.00 42.66           C  
ATOM   1422  N   SER A 272      64.657 -30.279  27.000  1.00 53.90           N  
ATOM   1423  CA  SER A 272      65.287 -29.070  26.476  1.00 53.10           C  
ATOM   1424  C   SER A 272      65.567 -28.065  27.588  1.00 56.38           C  
ATOM   1425  O   SER A 272      66.592 -27.383  27.581  1.00 56.87           O  
ATOM   1426  CB  SER A 272      64.410 -28.435  25.399  1.00 51.83           C  
ATOM   1427  OG  SER A 272      64.276 -29.295  24.281  1.00 56.12           O  
ATOM   1428  N   PHE A 273      64.647 -27.985  28.545  1.00 45.53           N  
ATOM   1429  CA  PHE A 273      64.802 -27.103  29.695  1.00 46.05           C  
ATOM   1430  C   PHE A 273      66.003 -27.504  30.544  1.00 47.17           C  
ATOM   1431  O   PHE A 273      66.700 -26.651  31.095  1.00 48.03           O  
ATOM   1432  CB  PHE A 273      63.532 -27.107  30.547  1.00 45.98           C  
ATOM   1433  CG  PHE A 273      63.702 -26.453  31.886  1.00 48.20           C  
ATOM   1434  CD1 PHE A 273      63.767 -25.075  31.995  1.00 49.60           C  
ATOM   1435  CD2 PHE A 273      63.795 -27.216  33.038  1.00 49.02           C  
ATOM   1436  CE1 PHE A 273      63.925 -24.472  33.227  1.00 41.91           C  
ATOM   1437  CE2 PHE A 273      63.951 -26.616  34.272  1.00 41.24           C  
ATOM   1438  CZ  PHE A 273      64.017 -25.244  34.366  1.00 42.73           C  
ATOM   1439  N   ASP A 274      66.238 -28.806  30.650  1.00 56.70           N  
ATOM   1440  CA  ASP A 274      67.379 -29.314  31.400  1.00 59.56           C  
ATOM   1441  C   ASP A 274      68.661 -29.092  30.604  1.00 60.78           C  
ATOM   1442  O   ASP A 274      69.717 -28.814  31.170  1.00 65.51           O  
ATOM   1443  CB  ASP A 274      67.195 -30.796  31.723  1.00 60.17           C  
ATOM   1444  CG  ASP A 274      65.820 -31.102  32.289  1.00 58.70           C  
ATOM   1445  OD1 ASP A 274      65.603 -30.858  33.494  1.00 59.75           O  
ATOM   1446  OD2 ASP A 274      64.956 -31.589  31.528  1.00 57.77           O  
ATOM   1447  N   ARG A 275      68.551 -29.220  29.286  1.00 45.28           N  
ATOM   1448  CA  ARG A 275      69.665 -28.972  28.380  1.00 45.82           C  
ATOM   1449  C   ARG A 275      70.148 -27.534  28.482  1.00 46.96           C  
ATOM   1450  O   ARG A 275      71.345 -27.261  28.428  1.00 48.49           O  
ATOM   1451  CB  ARG A 275      69.258 -29.286  26.940  1.00 44.53           C  
ATOM   1452  CG  ARG A 275      69.987 -28.462  25.895  1.00 45.06           C  
ATOM   1453  CD  ARG A 275      69.390 -28.677  24.519  1.00 43.81           C  
ATOM   1454  NE  ARG A 275      69.989 -27.802  23.518  1.00 44.40           N  
ATOM   1455  CZ  ARG A 275      71.152 -28.040  22.921  1.00 45.74           C  
ATOM   1456  NH1 ARG A 275      71.846 -29.127  23.229  1.00 46.52           N  
ATOM   1457  NH2 ARG A 275      71.619 -27.193  22.015  1.00 46.50           N  
ATOM   1458  N   ALA A 276      69.202 -26.615  28.645  1.00 56.72           N  
ATOM   1459  CA  ALA A 276      69.528 -25.200  28.774  1.00 50.29           C  
ATOM   1460  C   ALA A 276      70.321 -24.922  30.050  1.00 53.46           C  
ATOM   1461  O   ALA A 276      70.886 -23.842  30.213  1.00 56.10           O  
ATOM   1462  CB  ALA A 276      68.260 -24.364  28.743  1.00 57.74           C  
ATOM   1463  N   HIS A 277      70.364 -25.901  30.948  1.00 50.27           N  
ATOM   1464  CA  HIS A 277      71.117 -25.766  32.189  1.00 51.66           C  
ATOM   1465  C   HIS A 277      72.355 -26.664  32.200  1.00 52.56           C  
ATOM   1466  O   HIS A 277      72.779 -27.141  33.254  1.00 53.98           O  
ATOM   1467  CB  HIS A 277      70.226 -26.085  33.390  1.00 51.65           C  
ATOM   1468  CG  HIS A 277      69.142 -25.077  33.621  1.00 52.09           C  
ATOM   1469  ND1 HIS A 277      68.974 -23.969  32.825  1.00 51.77           N  
ATOM   1470  CD2 HIS A 277      68.174 -25.011  34.567  1.00 53.08           C  
ATOM   1471  CE1 HIS A 277      67.948 -23.260  33.266  1.00 52.57           C  
ATOM   1472  NE2 HIS A 277      67.446 -23.875  34.325  1.00 53.46           N  
ATOM   1473  N   ILE A 278      72.932 -26.888  31.021  1.00 51.65           N  
ATOM   1474  CA  ILE A 278      74.158 -27.672  30.895  1.00 59.96           C  
ATOM   1475  C   ILE A 278      75.345 -26.770  30.567  1.00 52.02           C  
ATOM   1476  O   ILE A 278      75.279 -25.956  29.647  1.00 55.28           O  
ATOM   1477  CB  ILE A 278      74.032 -28.757  29.810  1.00 58.69           C  
ATOM   1478  CG1 ILE A 278      72.850 -29.678  30.115  1.00 51.96           C  
ATOM   1479  CG2 ILE A 278      75.321 -29.558  29.701  1.00 51.96           C  
ATOM   1480  CD1 ILE A 278      72.930 -30.345  31.472  1.00 50.66           C  
ATOM   1481  N   ARG A 279      76.427 -26.930  31.321  1.00 54.65           N  
ATOM   1482  CA  ARG A 279      77.589 -26.051  31.218  1.00 57.04           C  
ATOM   1483  C   ARG A 279      78.263 -26.083  29.844  1.00 56.38           C  
ATOM   1484  O   ARG A 279      78.692 -25.049  29.335  1.00 57.94           O  
ATOM   1485  CB  ARG A 279      78.613 -26.417  32.298  1.00 53.34           C  
ATOM   1486  CG  ARG A 279      79.758 -25.426  32.435  1.00 52.34           C  
ATOM   1487  CD  ARG A 279      80.892 -25.999  33.276  1.00 52.63           C  
ATOM   1488  NE  ARG A 279      80.472 -26.316  34.638  1.00 51.80           N  
ATOM   1489  CZ  ARG A 279      80.608 -25.494  35.674  1.00 54.80           C  
ATOM   1490  NH1 ARG A 279      81.154 -24.297  35.507  1.00 56.91           N  
ATOM   1491  NH2 ARG A 279      80.201 -25.869  36.879  1.00 55.15           N  
ATOM   1492  N   GLU A 280      78.347 -27.266  29.244  1.00 58.63           N  
ATOM   1493  CA  GLU A 280      79.132 -27.447  28.025  1.00 59.62           C  
ATOM   1494  C   GLU A 280      78.298 -27.426  26.747  1.00 55.55           C  
ATOM   1495  O   GLU A 280      78.820 -27.670  25.660  1.00 55.72           O  
ATOM   1496  CB  GLU A 280      79.919 -28.761  28.089  1.00 59.84           C  
ATOM   1497  CG  GLU A 280      80.935 -28.835  29.216  1.00 53.53           C  
ATOM   1498  CD  GLU A 280      80.303 -29.173  30.552  1.00 53.17           C  
ATOM   1499  OE1 GLU A 280      80.950 -28.931  31.594  1.00 52.77           O  
ATOM   1500  OE2 GLU A 280      79.162 -29.680  30.560  1.00 50.89           O  
ATOM   1501  N   GLN A 281      77.007 -27.140  26.875  1.00 51.97           N  
ATOM   1502  CA  GLN A 281      76.130 -27.114  25.711  1.00 50.20           C  
ATOM   1503  C   GLN A 281      76.098 -25.737  25.061  1.00 51.15           C  
ATOM   1504  O   GLN A 281      75.587 -25.578  23.951  1.00 50.00           O  
ATOM   1505  CB  GLN A 281      74.716 -27.546  26.098  1.00 57.94           C  
ATOM   1506  CG  GLN A 281      74.539 -29.049  26.174  1.00 56.72           C  
ATOM   1507  CD  GLN A 281      74.788 -29.730  24.841  1.00 56.76           C  
ATOM   1508  OE1 GLN A 281      74.578 -29.142  23.781  1.00 57.95           O  
ATOM   1509  NE2 GLN A 281      75.245 -30.977  24.889  1.00 56.24           N  
ATOM   1510  N   TYR A 282      76.657 -24.750  25.753  1.00 58.28           N  
ATOM   1511  CA  TYR A 282      76.639 -23.367  25.284  1.00 58.66           C  
ATOM   1512  C   TYR A 282      77.839 -23.031  24.403  1.00 50.31           C  
ATOM   1513  O   TYR A 282      77.866 -21.982  23.757  1.00 50.02           O  
ATOM   1514  CB  TYR A 282      76.587 -22.405  26.472  1.00 58.47           C  
ATOM   1515  CG  TYR A 282      75.230 -22.317  27.129  1.00 56.66           C  
ATOM   1516  CD1 TYR A 282      74.295 -21.384  26.705  1.00 56.82           C  
ATOM   1517  CD2 TYR A 282      74.885 -23.163  28.175  1.00 56.30           C  
ATOM   1518  CE1 TYR A 282      73.055 -21.295  27.302  1.00 52.81           C  
ATOM   1519  CE2 TYR A 282      73.647 -23.083  28.776  1.00 56.77           C  
ATOM   1520  CZ  TYR A 282      72.737 -22.146  28.335  1.00 55.60           C  
ATOM   1521  OH  TYR A 282      71.499 -22.060  28.929  1.00 53.55           O  
ATOM   1522  N   LEU A 283      78.826 -23.918  24.384  1.00 58.48           N  
ATOM   1523  CA  LEU A 283      80.033 -23.699  23.594  1.00 50.41           C  
ATOM   1524  C   LEU A 283      79.715 -23.679  22.102  1.00 59.72           C  
ATOM   1525  O   LEU A 283      78.756 -24.310  21.657  1.00 59.33           O  
ATOM   1526  CB  LEU A 283      81.080 -24.772  23.898  1.00 51.98           C  
ATOM   1527  CG  LEU A 283      81.975 -24.552  25.122  1.00 53.80           C  
ATOM   1528  CD1 LEU A 283      81.191 -24.649  26.423  1.00 52.63           C  
ATOM   1529  CD2 LEU A 283      83.137 -25.536  25.122  1.00 55.72           C  
ATOM   1530  N   ILE A 284      80.520 -22.945  21.339  1.00 57.79           N  
ATOM   1531  CA  ILE A 284      80.305 -22.794  19.903  1.00 57.01           C  
ATOM   1532  C   ILE A 284      80.460 -24.135  19.190  1.00 57.26           C  
ATOM   1533  O   ILE A 284      79.688 -24.465  18.288  1.00 51.85           O  
ATOM   1534  CB  ILE A 284      81.280 -21.754  19.290  1.00 59.80           C  
ATOM   1535  CG1 ILE A 284      80.816 -20.327  19.599  1.00 58.22           C  
ATOM   1536  CG2 ILE A 284      81.386 -21.928  17.783  1.00 50.19           C  
ATOM   1537  CD1 ILE A 284      81.135 -19.850  21.001  1.00 59.40           C  
ATOM   1538  N   GLN A 285      81.449 -24.913  19.613  1.00 64.45           N  
ATOM   1539  CA  GLN A 285      81.679 -26.235  19.043  1.00 63.49           C  
ATOM   1540  C   GLN A 285      80.823 -27.291  19.737  1.00 61.26           C  
ATOM   1541  O   GLN A 285      80.008 -26.970  20.602  1.00 69.19           O  
ATOM   1542  CB  GLN A 285      83.162 -26.610  19.133  1.00 66.06           C  
ATOM   1543  CG  GLN A 285      83.733 -26.612  20.548  1.00 67.31           C  
ATOM   1544  CD  GLN A 285      84.137 -25.228  21.029  1.00 68.22           C  
ATOM   1545  OE1 GLN A 285      83.857 -24.222  20.377  1.00 67.99           O  
ATOM   1546  NE2 GLN A 285      84.802 -25.172  22.178  1.00 68.51           N  
ATOM   1547  N   GLY A 286      81.011 -28.550  19.354  1.00 84.28           N  
ATOM   1548  CA  GLY A 286      80.247 -29.645  19.922  1.00 82.12           C  
ATOM   1549  C   GLY A 286      78.940 -29.872  19.183  1.00 88.33           C  
ATOM   1550  O   GLY A 286      78.642 -29.171  18.217  1.00 89.59           O  
ATOM   1551  N   SER A 287      78.154 -30.849  19.632  1.00 85.71           N  
ATOM   1552  CA  SER A 287      78.506 -31.674  20.783  1.00 84.65           C  
ATOM   1553  C   SER A 287      78.155 -33.139  20.542  1.00 86.04           C  
ATOM   1554  O   SER A 287      77.308 -33.455  19.706  1.00 83.62           O  
ATOM   1555  CB  SER A 287      77.796 -31.169  22.040  1.00 84.80           C  
ATOM   1556  OG  SER A 287      78.022 -32.040  23.135  1.00 80.40           O  
ATOM   1557  N   ARG A 288      78.809 -34.029  21.280  1.00 97.91           N  
ATOM   1558  CA  ARG A 288      78.551 -35.462  21.165  1.00 99.11           C  
ATOM   1559  C   ARG A 288      77.281 -35.859  21.911  1.00 96.91           C  
ATOM   1560  O   ARG A 288      76.616 -36.828  21.549  1.00 96.86           O  
ATOM   1561  CB  ARG A 288      79.741 -36.265  21.694  1.00 99.44           C  
ATOM   1562  CG  ARG A 288      81.017 -36.128  20.871  1.00 92.71           C  
ATOM   1563  CD  ARG A 288      81.091 -37.165  19.754  1.00 91.57           C  
ATOM   1564  NE  ARG A 288      80.053 -36.979  18.746  1.00 91.92           N  
ATOM   1565  CZ  ARG A 288      79.902 -37.758  17.678  1.00 93.37           C  
ATOM   1566  NH1 ARG A 288      80.725 -38.778  17.475  1.00 94.09           N  
ATOM   1567  NH2 ARG A 288      78.927 -37.515  16.812  1.00 92.45           N  
ATOM   1568  N   MET A 289      76.953 -35.103  22.953  1.00 50.78           N  
ATOM   1569  CA  MET A 289      75.779 -35.388  23.770  1.00 58.15           C  
ATOM   1570  C   MET A 289      74.484 -34.986  23.072  1.00 57.76           C  
ATOM   1571  O   MET A 289      74.359 -33.872  22.567  1.00 56.83           O  
ATOM   1572  CB  MET A 289      75.880 -34.670  25.119  1.00 57.02           C  
ATOM   1573  CG  MET A 289      74.633 -34.802  25.983  1.00 57.02           C  
ATOM   1574  SD  MET A 289      74.714 -33.834  27.500  1.00 56.39           S  
ATOM   1575  CE  MET A 289      76.132 -34.574  28.302  1.00 57.92           C  
ATOM   1576  N   ARG A 290      73.525 -35.904  23.050  1.00 54.93           N  
ATOM   1577  CA  ARG A 290      72.193 -35.610  22.537  1.00 53.01           C  
ATOM   1578  C   ARG A 290      71.154 -35.861  23.624  1.00 50.97           C  
ATOM   1579  O   ARG A 290      71.476 -36.384  24.690  1.00 51.06           O  
ATOM   1580  CB  ARG A 290      71.885 -36.451  21.300  1.00 55.72           C  
ATOM   1581  CG  ARG A 290      72.872 -36.260  20.164  1.00 56.50           C  
ATOM   1582  CD  ARG A 290      72.991 -34.802  19.769  1.00 52.15           C  
ATOM   1583  NE  ARG A 290      73.990 -34.611  18.724  1.00 53.89           N  
ATOM   1584  CZ  ARG A 290      73.728 -34.656  17.422  1.00 58.29           C  
ATOM   1585  NH1 ARG A 290      72.492 -34.884  17.002  1.00 57.56           N  
ATOM   1586  NH2 ARG A 290      74.701 -34.473  16.542  1.00 50.16           N  
ATOM   1587  N   PHE A 291      69.909 -35.490  23.350  1.00 54.18           N  
ATOM   1588  CA  PHE A 291      68.857 -35.601  24.351  1.00 59.75           C  
ATOM   1589  C   PHE A 291      67.626 -36.330  23.819  1.00 57.41           C  
ATOM   1590  O   PHE A 291      67.334 -36.288  22.623  1.00 58.05           O  
ATOM   1591  CB  PHE A 291      68.463 -34.211  24.857  1.00 57.84           C  
ATOM   1592  CG  PHE A 291      69.603 -33.442  25.465  1.00 58.54           C  
ATOM   1593  CD1 PHE A 291      69.893 -33.556  26.814  1.00 51.64           C  
ATOM   1594  CD2 PHE A 291      70.383 -32.601  24.688  1.00 58.43           C  
ATOM   1595  CE1 PHE A 291      70.942 -32.849  27.376  1.00 51.97           C  
ATOM   1596  CE2 PHE A 291      71.433 -31.890  25.244  1.00 51.37           C  
ATOM   1597  CZ  PHE A 291      71.712 -32.015  26.589  1.00 53.66           C  
ATOM   1598  N   LEU A 292      66.913 -36.997  24.719  1.00 58.55           N  
ATOM   1599  CA  LEU A 292      65.687 -37.705  24.369  1.00 58.29           C  
ATOM   1600  C   LEU A 292      64.552 -37.237  25.272  1.00 52.48           C  
ATOM   1601  O   LEU A 292      64.635 -37.350  26.494  1.00 53.04           O  
ATOM   1602  CB  LEU A 292      65.884 -39.218  24.491  1.00 59.25           C  
ATOM   1603  CG  LEU A 292      65.183 -40.124  23.473  1.00 59.55           C  
ATOM   1604  CD1 LEU A 292      63.670 -39.999  23.553  1.00 58.73           C  
ATOM   1605  CD2 LEU A 292      65.673 -39.822  22.067  1.00 53.76           C  
ATOM   1606  N   ASP A 293      63.491 -36.715  24.668  1.00 57.12           N  
ATOM   1607  CA  ASP A 293      62.389 -36.139  25.431  1.00 52.25           C  
ATOM   1608  C   ASP A 293      61.231 -37.126  25.563  1.00 51.33           C  
ATOM   1609  O   ASP A 293      60.706 -37.618  24.566  1.00 56.11           O  
ATOM   1610  CB  ASP A 293      61.911 -34.844  24.770  1.00 53.52           C  
ATOM   1611  CG  ASP A 293      61.298 -33.873  25.761  1.00 51.62           C  
ATOM   1612  OD1 ASP A 293      61.554 -32.656  25.634  1.00 54.72           O  
ATOM   1613  OD2 ASP A 293      60.565 -34.323  26.666  1.00 52.90           O  
ATOM   1614  N   THR A 294      60.838 -37.412  26.803  1.00 52.61           N  
ATOM   1615  CA  THR A 294      59.743 -38.342  27.063  1.00 52.84           C  
ATOM   1616  C   THR A 294      58.390 -37.711  26.749  1.00 53.37           C  
ATOM   1617  O   THR A 294      57.429 -38.409  26.433  1.00 53.60           O  
ATOM   1618  CB  THR A 294      59.739 -38.824  28.527  1.00 53.05           C  
ATOM   1619  OG1 THR A 294      59.572 -37.702  29.403  1.00 53.64           O  
ATOM   1620  CG2 THR A 294      61.038 -39.537  28.860  1.00 52.77           C  
ATOM   1621  N   MET A 295      58.319 -36.388  26.849  1.00 58.78           N  
ATOM   1622  CA  MET A 295      57.105 -35.662  26.504  1.00 59.21           C  
ATOM   1623  C   MET A 295      56.841 -35.762  25.005  1.00 52.63           C  
ATOM   1624  O   MET A 295      55.727 -36.072  24.575  1.00 54.85           O  
ATOM   1625  CB  MET A 295      57.215 -34.198  26.931  1.00 56.56           C  
ATOM   1626  CG  MET A 295      56.003 -33.350  26.581  1.00 54.81           C  
ATOM   1627  SD  MET A 295      56.227 -31.614  27.014  1.00 56.81           S  
ATOM   1628  CE  MET A 295      56.406 -31.726  28.793  1.00 56.16           C  
ATOM   1629  N   SER A 296      57.880 -35.502  24.217  1.00 57.23           N  
ATOM   1630  CA  SER A 296      57.793 -35.590  22.765  1.00 57.11           C  
ATOM   1631  C   SER A 296      57.471 -37.014  22.329  1.00 57.27           C  
ATOM   1632  O   SER A 296      56.707 -37.238  21.386  1.00 57.83           O  
ATOM   1633  CB  SER A 296      59.103 -35.132  22.122  1.00 56.31           C  
ATOM   1634  OG  SER A 296      60.149 -36.052  22.379  1.00 56.19           O  
ATOM   1635  N   MET A 297      58.061 -37.971  23.034  1.00 62.83           N  
ATOM   1636  CA  MET A 297      57.850 -39.383  22.755  1.00 68.32           C  
ATOM   1637  C   MET A 297      56.398 -39.761  23.028  1.00 61.42           C  
ATOM   1638  O   MET A 297      55.769 -40.460  22.232  1.00 62.26           O  
ATOM   1639  CB  MET A 297      58.800 -40.230  23.598  1.00 68.25           C  
ATOM   1640  CG  MET A 297      59.111 -41.590  23.017  1.00 62.35           C  
ATOM   1641  SD  MET A 297      60.763 -42.127  23.486  1.00 60.32           S  
ATOM   1642  CE  MET A 297      60.690 -41.925  25.262  1.00 69.22           C  
ATOM   1643  N   HIS A 298      55.871 -39.287  24.155  1.00 59.93           N  
ATOM   1644  CA  HIS A 298      54.467 -39.482  24.495  1.00 50.68           C  
ATOM   1645  C   HIS A 298      53.565 -38.879  23.432  1.00 51.59           C  
ATOM   1646  O   HIS A 298      52.529 -39.444  23.085  1.00 52.25           O  
ATOM   1647  CB  HIS A 298      54.142 -38.857  25.851  1.00 50.98           C  
ATOM   1648  CG  HIS A 298      52.688 -38.553  26.037  1.00 52.64           C  
ATOM   1649  ND1 HIS A 298      51.737 -39.535  26.227  1.00 52.16           N  
ATOM   1650  CD2 HIS A 298      52.015 -37.379  26.051  1.00 53.09           C  
ATOM   1651  CE1 HIS A 298      50.549 -38.978  26.356  1.00 53.13           C  
ATOM   1652  NE2 HIS A 298      50.688 -37.668  26.251  1.00 53.80           N  
ATOM   1653  N   MET A 299      53.968 -37.721  22.919  1.00 56.53           N  
ATOM   1654  CA  MET A 299      53.202 -37.042  21.886  1.00 56.98           C  
ATOM   1655  C   MET A 299      53.176 -37.856  20.599  1.00 56.95           C  
ATOM   1656  O   MET A 299      52.159 -37.913  19.909  1.00 53.91           O  
ATOM   1657  CB  MET A 299      53.782 -35.657  21.613  1.00 57.35           C  
ATOM   1658  CG  MET A 299      52.792 -34.713  20.984  1.00 52.63           C  
ATOM   1659  SD  MET A 299      51.601 -34.100  22.189  1.00 59.03           S  
ATOM   1660  CE  MET A 299      52.633 -32.934  23.074  1.00 52.26           C  
ATOM   1661  N   ALA A 300      54.303 -38.485  20.278  1.00 55.69           N  
ATOM   1662  CA  ALA A 300      54.408 -39.294  19.070  1.00 57.07           C  
ATOM   1663  C   ALA A 300      53.609 -40.591  19.191  1.00 57.53           C  
ATOM   1664  O   ALA A 300      52.936 -41.008  18.248  1.00 63.15           O  
ATOM   1665  CB  ALA A 300      55.866 -39.597  18.762  1.00 60.48           C  
ATOM   1666  N   ILE A 301      53.688 -41.224  20.357  1.00 54.32           N  
ATOM   1667  CA  ILE A 301      52.999 -42.491  20.589  1.00 54.56           C  
ATOM   1668  C   ILE A 301      51.496 -42.299  20.759  1.00 55.51           C  
ATOM   1669  O   ILE A 301      50.713 -42.682  19.891  1.00 56.46           O  
ATOM   1670  CB  ILE A 301      53.556 -43.214  21.830  1.00 59.28           C  
ATOM   1671  CG1 ILE A 301      55.048 -43.508  21.652  1.00 52.99           C  
ATOM   1672  CG2 ILE A 301      52.791 -44.505  22.087  1.00 58.15           C  
ATOM   1673  CD1 ILE A 301      55.705 -44.098  22.879  1.00 53.15           C  
ATOM   1674  N   SER A 302      51.096 -41.704  21.880  1.00 53.69           N  
ATOM   1675  CA  SER A 302      49.679 -41.525  22.183  1.00 56.53           C  
ATOM   1676  C   SER A 302      49.339 -40.071  22.494  1.00 59.52           C  
ATOM   1677  O   SER A 302      48.882 -39.752  23.592  1.00 59.38           O  
ATOM   1678  CB  SER A 302      49.271 -42.414  23.360  1.00 57.52           C  
ATOM   1679  OG  SER A 302      47.890 -42.285  23.639  1.00 58.67           O  
ATOM   1680  N   GLY A 303      49.556 -39.193  21.519  1.00 59.62           N  
ATOM   1681  CA  GLY A 303      49.270 -37.781  21.692  1.00 58.37           C  
ATOM   1682  C   GLY A 303      47.836 -37.436  21.340  1.00 54.17           C  
ATOM   1683  O   GLY A 303      47.081 -38.284  20.872  1.00 55.31           O  
ATOM   1684  N   LEU A 304      47.462 -36.184  21.571  1.00 50.97           N  
ATOM   1685  CA  LEU A 304      46.121 -35.710  21.245  1.00 54.77           C  
ATOM   1686  C   LEU A 304      46.121 -34.216  20.939  1.00 54.85           C  
ATOM   1687  O   LEU A 304      46.989 -33.478  21.405  1.00 54.63           O  
ATOM   1688  CB  LEU A 304      45.144 -36.023  22.382  1.00 53.54           C  
ATOM   1689  CG  LEU A 304      45.671 -36.173  23.814  1.00 53.48           C  
ATOM   1690  CD1 LEU A 304      46.308 -34.889  24.324  1.00 53.26           C  
ATOM   1691  CD2 LEU A 304      44.549 -36.620  24.740  1.00 59.98           C  
ATOM   1692  N   SER A 305      45.144 -33.778  20.152  1.00 64.97           N  
ATOM   1693  CA  SER A 305      45.042 -32.378  19.752  1.00 64.52           C  
ATOM   1694  C   SER A 305      44.605 -31.497  20.918  1.00 67.05           C  
ATOM   1695  O   SER A 305      44.140 -31.995  21.943  1.00 64.55           O  
ATOM   1696  CB  SER A 305      44.065 -32.222  18.585  1.00 65.73           C  
ATOM   1697  OG  SER A 305      42.741 -32.534  18.983  1.00 64.98           O  
ATOM   1698  N   SER A 306      44.760 -30.186  20.751  1.00 66.43           N  
ATOM   1699  CA  SER A 306      44.377 -29.224  21.780  1.00 66.14           C  
ATOM   1700  C   SER A 306      42.879 -29.284  22.057  1.00 61.20           C  
ATOM   1701  O   SER A 306      42.443 -29.167  23.205  1.00 62.62           O  
ATOM   1702  CB  SER A 306      44.781 -27.808  21.364  1.00 64.02           C  
ATOM   1703  OG  SER A 306      44.200 -27.456  20.120  1.00 66.23           O  
ATOM   1704  N   PHE A 307      42.100 -29.470  20.997  1.00 67.49           N  
ATOM   1705  CA  PHE A 307      40.655 -29.618  21.123  1.00 67.45           C  
ATOM   1706  C   PHE A 307      40.322 -30.855  21.946  1.00 64.12           C  
ATOM   1707  O   PHE A 307      39.344 -30.872  22.694  1.00 63.78           O  
ATOM   1708  CB  PHE A 307      39.996 -29.703  19.744  1.00 69.63           C  
ATOM   1709  CG  PHE A 307      38.502 -29.873  19.796  1.00 68.01           C  
ATOM   1710  CD1 PHE A 307      37.675 -28.784  20.018  1.00 67.48           C  
ATOM   1711  CD2 PHE A 307      37.927 -31.120  19.614  1.00 68.91           C  
ATOM   1712  CE1 PHE A 307      36.303 -28.936  20.064  1.00 68.43           C  
ATOM   1713  CE2 PHE A 307      36.555 -31.278  19.658  1.00 67.36           C  
ATOM   1714  CZ  PHE A 307      35.742 -30.185  19.883  1.00 69.54           C  
ATOM   1715  N   GLN A 308      41.143 -31.891  21.806  1.00 60.42           N  
ATOM   1716  CA  GLN A 308      40.978 -33.101  22.597  1.00 60.31           C  
ATOM   1717  C   GLN A 308      41.397 -32.864  24.042  1.00 60.90           C  
ATOM   1718  O   GLN A 308      40.816 -33.433  24.963  1.00 67.36           O  
ATOM   1719  CB  GLN A 308      41.778 -34.257  21.991  1.00 60.77           C  
ATOM   1720  CG  GLN A 308      41.167 -34.831  20.724  1.00 61.59           C  
ATOM   1721  CD  GLN A 308      41.928 -36.032  20.201  1.00 61.85           C  
ATOM   1722  OE1 GLN A 308      43.113 -35.940  19.881  1.00 63.33           O  
ATOM   1723  NE2 GLN A 308      41.250 -37.169  20.113  1.00 63.14           N  
ATOM   1724  N   ARG A 309      42.407 -32.019  24.236  1.00 68.63           N  
ATOM   1725  CA  ARG A 309      42.861 -31.668  25.577  1.00 66.31           C  
ATOM   1726  C   ARG A 309      41.781 -30.913  26.339  1.00 68.91           C  
ATOM   1727  O   ARG A 309      41.605 -31.109  27.542  1.00 67.79           O  
ATOM   1728  CB  ARG A 309      44.133 -30.819  25.526  1.00 61.28           C  
ATOM   1729  CG  ARG A 309      45.333 -31.500  24.904  1.00 60.70           C  
ATOM   1730  CD  ARG A 309      46.602 -30.704  25.165  1.00 68.30           C  
ATOM   1731  NE  ARG A 309      47.735 -31.213  24.399  1.00 68.48           N  
ATOM   1732  CZ  ARG A 309      48.163 -30.683  23.259  1.00 69.33           C  
ATOM   1733  NH1 ARG A 309      47.557 -29.618  22.752  1.00 69.74           N  
ATOM   1734  NH2 ARG A 309      49.202 -31.212  22.629  1.00 60.93           N  
ATOM   1735  N   SER A 310      41.065 -30.047  25.629  1.00 62.99           N  
ATOM   1736  CA  SER A 310      40.055 -29.193  26.245  1.00 63.83           C  
ATOM   1737  C   SER A 310      38.936 -29.996  26.904  1.00 62.99           C  
ATOM   1738  O   SER A 310      38.409 -29.595  27.942  1.00 63.03           O  
ATOM   1739  CB  SER A 310      39.464 -28.236  25.207  1.00 65.64           C  
ATOM   1740  OG  SER A 310      38.863 -28.948  24.139  1.00 65.37           O  
ATOM   1741  N   LEU A 311      38.578 -31.127  26.304  1.00 54.62           N  
ATOM   1742  CA  LEU A 311      37.494 -31.951  26.833  1.00 53.61           C  
ATOM   1743  C   LEU A 311      38.013 -33.190  27.562  1.00 54.31           C  
ATOM   1744  O   LEU A 311      37.242 -33.920  28.184  1.00 54.10           O  
ATOM   1745  CB  LEU A 311      36.531 -32.356  25.710  1.00 55.82           C  
ATOM   1746  CG  LEU A 311      37.095 -32.717  24.333  1.00 54.00           C  
ATOM   1747  CD1 LEU A 311      37.677 -34.119  24.321  1.00 54.89           C  
ATOM   1748  CD2 LEU A 311      36.022 -32.570  23.265  1.00 54.37           C  
ATOM   1749  N   TRP A 312      39.322 -33.419  27.489  1.00 52.92           N  
ATOM   1750  CA  TRP A 312      39.945 -34.492  28.256  1.00 50.18           C  
ATOM   1751  C   TRP A 312      39.980 -34.104  29.727  1.00 52.31           C  
ATOM   1752  O   TRP A 312      39.680 -34.914  30.605  1.00 50.53           O  
ATOM   1753  CB  TRP A 312      41.360 -34.782  27.749  1.00 51.67           C  
ATOM   1754  CG  TRP A 312      41.968 -36.033  28.314  1.00 56.97           C  
ATOM   1755  CD1 TRP A 312      42.008 -37.261  27.722  1.00 58.89           C  
ATOM   1756  CD2 TRP A 312      42.625 -36.177  29.581  1.00 52.95           C  
ATOM   1757  NE1 TRP A 312      42.646 -38.162  28.541  1.00 57.26           N  
ATOM   1758  CE2 TRP A 312      43.034 -37.521  29.689  1.00 52.56           C  
ATOM   1759  CE3 TRP A 312      42.905 -35.301  30.634  1.00 59.22           C  
ATOM   1760  CZ2 TRP A 312      43.708 -38.009  30.806  1.00 57.31           C  
ATOM   1761  CZ3 TRP A 312      43.574 -35.788  31.743  1.00 52.94           C  
ATOM   1762  CH2 TRP A 312      43.968 -37.129  31.820  1.00 55.63           C  
ATOM   1763  N   ILE A 313      40.347 -32.853  29.987  1.00 63.73           N  
ATOM   1764  CA  ILE A 313      40.400 -32.331  31.345  1.00 64.12           C  
ATOM   1765  C   ILE A 313      39.000 -32.006  31.855  1.00 65.89           C  
ATOM   1766  O   ILE A 313      38.792 -31.830  33.055  1.00 64.90           O  
ATOM   1767  CB  ILE A 313      41.280 -31.070  31.432  1.00 65.87           C  
ATOM   1768  CG1 ILE A 313      40.701 -29.954  30.560  1.00 65.37           C  
ATOM   1769  CG2 ILE A 313      42.707 -31.387  31.014  1.00 65.26           C  
ATOM   1770  CD1 ILE A 313      41.508 -28.673  30.589  1.00 67.54           C  
ATOM   1771  N   ALA A 314      38.047 -31.930  30.932  1.00 66.22           N  
ATOM   1772  CA  ALA A 314      36.651 -31.703  31.289  1.00 65.82           C  
ATOM   1773  C   ALA A 314      36.081 -32.937  31.976  1.00 64.33           C  
ATOM   1774  O   ALA A 314      35.079 -32.857  32.687  1.00 64.02           O  
ATOM   1775  CB  ALA A 314      35.834 -31.350  30.059  1.00 64.46           C  
ATOM   1776  N   ALA A 315      36.727 -34.077  31.754  1.00 51.36           N  
ATOM   1777  CA  ALA A 315      36.345 -35.317  32.416  1.00 51.21           C  
ATOM   1778  C   ALA A 315      36.639 -35.229  33.910  1.00 51.36           C  
ATOM   1779  O   ALA A 315      37.640 -35.763  34.389  1.00 51.03           O  
ATOM   1780  CB  ALA A 315      37.074 -36.499  31.797  1.00 50.72           C  
ATOM   1781  N   LYS A 316      35.759 -34.547  34.635  1.00 82.18           N  
ATOM   1782  CA  LYS A 316      35.926 -34.353  36.070  1.00 80.85           C  
ATOM   1783  C   LYS A 316      34.611 -33.938  36.720  1.00 81.45           C  
ATOM   1784  O   LYS A 316      33.780 -33.275  36.098  1.00 85.07           O  
ATOM   1785  CB  LYS A 316      37.011 -33.307  36.345  1.00 82.33           C  
ATOM   1786  CG  LYS A 316      37.250 -33.014  37.820  1.00 82.86           C  
ATOM   1787  CD  LYS A 316      36.624 -31.692  38.256  1.00 86.50           C  
ATOM   1788  CE  LYS A 316      37.490 -30.490  37.885  1.00 86.97           C  
ATOM   1789  NZ  LYS A 316      37.467 -30.162  36.430  1.00 80.00           N  
ATOM   1790  N   ALA A 341      29.180 -36.820  18.481  1.00 84.89           N  
ATOM   1791  CA  ALA A 341      29.934 -37.193  19.673  1.00 82.95           C  
ATOM   1792  C   ALA A 341      29.334 -38.427  20.340  1.00 84.79           C  
ATOM   1793  O   ALA A 341      29.240 -38.497  21.565  1.00 83.08           O  
ATOM   1794  CB  ALA A 341      29.983 -36.032  20.653  1.00 84.26           C  
ATOM   1795  N   ILE A 342      28.929 -39.398  19.525  1.00103.54           N  
ATOM   1796  CA  ILE A 342      28.331 -40.628  20.035  1.00102.96           C  
ATOM   1797  C   ILE A 342      29.398 -41.582  20.577  1.00102.84           C  
ATOM   1798  O   ILE A 342      29.248 -42.137  21.667  1.00101.98           O  
ATOM   1799  CB  ILE A 342      27.492 -41.339  18.943  1.00100.91           C  
ATOM   1800  CG1 ILE A 342      27.175 -42.782  19.347  1.00104.84           C  
ATOM   1801  CG2 ILE A 342      28.204 -41.297  17.597  1.00104.52           C  
ATOM   1802  CD1 ILE A 342      26.212 -42.898  20.510  1.00104.65           C  
ATOM   1803  N   SER A 343      30.477 -41.760  19.821  1.00104.99           N  
ATOM   1804  CA  SER A 343      31.574 -42.623  20.246  1.00104.84           C  
ATOM   1805  C   SER A 343      32.881 -41.844  20.312  1.00105.33           C  
ATOM   1806  O   SER A 343      33.910 -42.290  19.805  1.00103.32           O  
ATOM   1807  CB  SER A 343      31.719 -43.818  19.301  1.00103.16           C  
ATOM   1808  OG  SER A 343      32.798 -44.650  19.691  1.00105.46           O  
ATOM   1809  N   SER A 344      32.832 -40.676  20.946  1.00 98.78           N  
ATOM   1810  CA  SER A 344      34.003 -39.820  21.067  1.00 90.10           C  
ATOM   1811  C   SER A 344      34.634 -39.931  22.451  1.00 97.61           C  
ATOM   1812  O   SER A 344      35.578 -39.211  22.771  1.00 98.71           O  
ATOM   1813  CB  SER A 344      33.630 -38.363  20.778  1.00 99.90           C  
ATOM   1814  OG  SER A 344      32.599 -37.919  21.645  1.00 99.08           O  
ATOM   1815  N   TRP A 345      34.111 -40.840  23.268  1.00 87.01           N  
ATOM   1816  CA  TRP A 345      34.605 -41.017  24.628  1.00 88.46           C  
ATOM   1817  C   TRP A 345      35.277 -42.374  24.830  1.00 86.24           C  
ATOM   1818  O   TRP A 345      35.437 -42.829  25.962  1.00 87.54           O  
ATOM   1819  CB  TRP A 345      33.468 -40.853  25.641  1.00 87.01           C  
ATOM   1820  CG  TRP A 345      32.994 -39.438  25.813  1.00 87.57           C  
ATOM   1821  CD1 TRP A 345      32.978 -38.456  24.866  1.00 85.83           C  
ATOM   1822  CD2 TRP A 345      32.480 -38.847  27.014  1.00 87.50           C  
ATOM   1823  NE1 TRP A 345      32.479 -37.292  25.400  1.00 85.88           N  
ATOM   1824  CE2 TRP A 345      32.167 -37.506  26.716  1.00 87.41           C  
ATOM   1825  CE3 TRP A 345      32.252 -39.323  28.308  1.00 86.63           C  
ATOM   1826  CZ2 TRP A 345      31.637 -36.634  27.668  1.00 86.28           C  
ATOM   1827  CZ3 TRP A 345      31.725 -38.456  29.250  1.00 83.96           C  
ATOM   1828  CH2 TRP A 345      31.424 -37.127  28.925  1.00 87.18           C  
ATOM   1829  N   ASP A 346      35.673 -43.014  23.735  1.00 87.89           N  
ATOM   1830  CA  ASP A 346      36.324 -44.316  23.813  1.00 87.92           C  
ATOM   1831  C   ASP A 346      37.845 -44.190  23.857  1.00 89.55           C  
ATOM   1832  O   ASP A 346      38.542 -45.122  24.260  1.00 89.08           O  
ATOM   1833  CB  ASP A 346      35.908 -45.196  22.633  1.00 89.88           C  
ATOM   1834  CG  ASP A 346      34.478 -45.685  22.743  1.00 80.15           C  
ATOM   1835  OD1 ASP A 346      33.565 -44.965  22.286  1.00 82.71           O  
ATOM   1836  OD2 ASP A 346      34.267 -46.791  23.284  1.00 89.68           O  
ATOM   1837  N   TRP A 347      38.351 -43.034  23.443  1.00 60.35           N  
ATOM   1838  CA  TRP A 347      39.787 -42.786  23.433  1.00 66.67           C  
ATOM   1839  C   TRP A 347      40.230 -42.042  24.689  1.00 66.45           C  
ATOM   1840  O   TRP A 347      41.402 -41.692  24.835  1.00 66.35           O  
ATOM   1841  CB  TRP A 347      40.183 -41.991  22.187  1.00 61.51           C  
ATOM   1842  CG  TRP A 347      39.418 -40.711  22.021  1.00 61.55           C  
ATOM   1843  CD1 TRP A 347      38.287 -40.523  21.282  1.00 61.20           C  
ATOM   1844  CD2 TRP A 347      39.730 -39.440  22.607  1.00 60.64           C  
ATOM   1845  NE1 TRP A 347      37.875 -39.215  21.372  1.00 69.55           N  
ATOM   1846  CE2 TRP A 347      38.744 -38.531  22.178  1.00 61.71           C  
ATOM   1847  CE3 TRP A 347      40.747 -38.984  23.451  1.00 60.09           C  
ATOM   1848  CZ2 TRP A 347      38.745 -37.192  22.565  1.00 69.41           C  
ATOM   1849  CZ3 TRP A 347      40.745 -37.656  23.834  1.00 60.44           C  
ATOM   1850  CH2 TRP A 347      39.750 -36.778  23.392  1.00 60.48           C  
ATOM   1851  N   LEU A 348      39.287 -41.813  25.596  1.00 69.43           N  
ATOM   1852  CA  LEU A 348      39.535 -41.022  26.797  1.00 69.41           C  
ATOM   1853  C   LEU A 348      40.527 -41.686  27.752  1.00 61.11           C  
ATOM   1854  O   LEU A 348      41.221 -41.008  28.509  1.00 69.67           O  
ATOM   1855  CB  LEU A 348      38.215 -40.755  27.524  1.00 61.51           C  
ATOM   1856  CG  LEU A 348      38.252 -39.836  28.748  1.00 69.68           C  
ATOM   1857  CD1 LEU A 348      38.705 -38.439  28.359  1.00 62.26           C  
ATOM   1858  CD2 LEU A 348      36.892 -39.794  29.428  1.00 60.41           C  
ATOM   1859  N   ASP A 349      40.594 -43.013  27.711  1.00 63.32           N  
ATOM   1860  CA  ASP A 349      41.425 -43.757  28.652  1.00 61.74           C  
ATOM   1861  C   ASP A 349      42.651 -44.385  27.998  1.00 69.79           C  
ATOM   1862  O   ASP A 349      43.433 -45.070  28.658  1.00 62.48           O  
ATOM   1863  CB  ASP A 349      40.597 -44.843  29.341  1.00 63.68           C  
ATOM   1864  CG  ASP A 349      39.469 -44.271  30.177  1.00 63.01           C  
ATOM   1865  OD1 ASP A 349      39.648 -43.172  30.743  1.00 61.55           O  
ATOM   1866  OD2 ASP A 349      38.402 -44.918  30.264  1.00 62.96           O  
ATOM   1867  N   ILE A 350      42.820 -44.153  26.700  1.00 59.23           N  
ATOM   1868  CA  ILE A 350      43.953 -44.717  25.976  1.00 59.11           C  
ATOM   1869  C   ILE A 350      45.026 -43.656  25.738  1.00 60.16           C  
ATOM   1870  O   ILE A 350      46.132 -43.962  25.292  1.00 60.56           O  
ATOM   1871  CB  ILE A 350      43.511 -45.328  24.629  1.00 60.35           C  
ATOM   1872  CG1 ILE A 350      44.511 -46.392  24.168  1.00 60.02           C  
ATOM   1873  CG2 ILE A 350      43.323 -44.238  23.581  1.00 59.81           C  
ATOM   1874  CD1 ILE A 350      44.008 -47.243  23.021  1.00 64.51           C  
ATOM   1875  N   SER A 351      44.690 -42.408  26.046  1.00 65.38           N  
ATOM   1876  CA  SER A 351      45.630 -41.305  25.907  1.00 65.54           C  
ATOM   1877  C   SER A 351      45.545 -40.376  27.113  1.00 65.41           C  
ATOM   1878  O   SER A 351      44.706 -40.569  27.992  1.00 64.85           O  
ATOM   1879  CB  SER A 351      45.359 -40.527  24.618  1.00 69.37           C  
ATOM   1880  OG  SER A 351      46.323 -39.508  24.429  1.00 68.27           O  
ATOM   1881  N   SER A 352      46.412 -39.371  27.150  1.00 67.78           N  
ATOM   1882  CA  SER A 352      46.436 -38.432  28.268  1.00 68.17           C  
ATOM   1883  C   SER A 352      47.098 -37.108  27.899  1.00 69.68           C  
ATOM   1884  O   SER A 352      47.717 -36.980  26.843  1.00 69.47           O  
ATOM   1885  CB  SER A 352      47.154 -39.051  29.466  1.00 67.12           C  
ATOM   1886  OG  SER A 352      47.265 -38.120  30.526  1.00 67.21           O  
ATOM   1887  N   VAL A 353      46.962 -36.127  28.785  1.00 68.55           N  
ATOM   1888  CA  VAL A 353      47.578 -34.821  28.598  1.00 60.15           C  
ATOM   1889  C   VAL A 353      49.085 -34.950  28.829  1.00 69.79           C  
ATOM   1890  O   VAL A 353      49.551 -35.972  29.332  1.00 68.28           O  
ATOM   1891  CB  VAL A 353      46.963 -33.765  29.548  1.00 60.33           C  
ATOM   1892  CG1 VAL A 353      47.597 -33.847  30.926  1.00 68.93           C  
ATOM   1893  CG2 VAL A 353      47.098 -32.362  28.965  1.00 60.52           C  
ATOM   1894  N   ASN A 354      49.843 -33.921  28.464  1.00 58.92           N  
ATOM   1895  CA  ASN A 354      51.303 -34.000  28.476  1.00 52.17           C  
ATOM   1896  C   ASN A 354      51.940 -33.821  29.854  1.00 54.26           C  
ATOM   1897  O   ASN A 354      53.164 -33.804  29.970  1.00 59.22           O  
ATOM   1898  CB  ASN A 354      51.887 -32.968  27.513  1.00 59.82           C  
ATOM   1899  CG  ASN A 354      51.178 -32.959  26.175  1.00 59.52           C  
ATOM   1900  OD1 ASN A 354      50.827 -31.903  25.650  1.00 53.01           O  
ATOM   1901  ND2 ASN A 354      50.958 -34.143  25.615  1.00 59.37           N  
ATOM   1902  N   SER A 355      51.117 -33.691  30.889  1.00 74.28           N  
ATOM   1903  CA  SER A 355      51.623 -33.567  32.254  1.00 74.70           C  
ATOM   1904  C   SER A 355      52.401 -34.816  32.655  1.00 79.67           C  
ATOM   1905  O   SER A 355      52.127 -35.908  32.162  1.00 73.15           O  
ATOM   1906  CB  SER A 355      50.473 -33.323  33.232  1.00 70.29           C  
ATOM   1907  OG  SER A 355      50.946 -33.250  34.568  1.00 70.19           O  
ATOM   1908  N   LEU A 356      53.370 -34.653  33.549  1.00 54.27           N  
ATOM   1909  CA  LEU A 356      54.214 -35.768  33.967  1.00 58.43           C  
ATOM   1910  C   LEU A 356      53.442 -36.789  34.798  1.00 57.82           C  
ATOM   1911  O   LEU A 356      53.570 -37.996  34.587  1.00 57.87           O  
ATOM   1912  CB  LEU A 356      55.422 -35.263  34.758  1.00 57.13           C  
ATOM   1913  CG  LEU A 356      56.389 -36.351  35.228  1.00 57.43           C  
ATOM   1914  CD1 LEU A 356      56.963 -37.114  34.042  1.00 52.12           C  
ATOM   1915  CD2 LEU A 356      57.500 -35.759  36.081  1.00 58.33           C  
ATOM   1916  N   ALA A 357      52.645 -36.299  35.742  1.00 59.53           N  
ATOM   1917  CA  ALA A 357      51.841 -37.174  36.589  1.00 58.06           C  
ATOM   1918  C   ALA A 357      50.838 -37.959  35.754  1.00 56.86           C  
ATOM   1919  O   ALA A 357      50.594 -39.142  36.000  1.00 57.75           O  
ATOM   1920  CB  ALA A 357      51.123 -36.366  37.659  1.00 59.33           C  
ATOM   1921  N   GLU A 358      50.267 -37.293  34.757  1.00 60.11           N  
ATOM   1922  CA  GLU A 358      49.259 -37.905  33.901  1.00 60.58           C  
ATOM   1923  C   GLU A 358      49.870 -38.930  32.949  1.00 60.93           C  
ATOM   1924  O   GLU A 358      49.318 -40.015  32.759  1.00 62.46           O  
ATOM   1925  CB  GLU A 358      48.515 -36.827  33.113  1.00 61.90           C  
ATOM   1926  CG  GLU A 358      47.762 -35.835  33.987  1.00 63.03           C  
ATOM   1927  CD  GLU A 358      46.648 -36.485  34.788  1.00 63.51           C  
ATOM   1928  OE1 GLU A 358      46.065 -37.480  34.307  1.00 63.66           O  
ATOM   1929  OE2 GLU A 358      46.355 -36.000  35.901  1.00 64.15           O  
ATOM   1930  N   VAL A 359      51.012 -38.589  32.359  1.00 55.06           N  
ATOM   1931  CA  VAL A 359      51.679 -39.493  31.425  1.00 54.56           C  
ATOM   1932  C   VAL A 359      52.264 -40.691  32.177  1.00 54.34           C  
ATOM   1933  O   VAL A 359      52.409 -41.781  31.614  1.00 54.13           O  
ATOM   1934  CB  VAL A 359      52.788 -38.768  30.617  1.00 54.26           C  
ATOM   1935  CG1 VAL A 359      54.015 -38.505  31.476  1.00 54.14           C  
ATOM   1936  CG2 VAL A 359      53.166 -39.572  29.387  1.00 53.88           C  
ATOM   1937  N   HIS A 360      52.580 -40.492  33.455  1.00 56.83           N  
ATOM   1938  CA  HIS A 360      53.040 -41.587  34.298  1.00 57.12           C  
ATOM   1939  C   HIS A 360      51.866 -42.478  34.673  1.00 53.57           C  
ATOM   1940  O   HIS A 360      51.985 -43.701  34.696  1.00 52.85           O  
ATOM   1941  CB  HIS A 360      53.731 -41.061  35.559  1.00 57.70           C  
ATOM   1942  CG  HIS A 360      54.149 -42.139  36.510  1.00 55.11           C  
ATOM   1943  ND1 HIS A 360      53.354 -42.562  37.551  1.00 53.80           N  
ATOM   1944  CD2 HIS A 360      55.281 -42.881  36.575  1.00 53.19           C  
ATOM   1945  CE1 HIS A 360      53.976 -43.518  38.219  1.00 53.28           C  
ATOM   1946  NE2 HIS A 360      55.147 -43.730  37.647  1.00 52.96           N  
ATOM   1947  N   ARG A 361      50.726 -41.858  34.956  1.00 78.28           N  
ATOM   1948  CA  ARG A 361      49.515 -42.604  35.274  1.00 78.98           C  
ATOM   1949  C   ARG A 361      49.003 -43.337  34.038  1.00 77.53           C  
ATOM   1950  O   ARG A 361      48.206 -44.269  34.140  1.00 78.45           O  
ATOM   1951  CB  ARG A 361      48.435 -41.671  35.828  1.00 79.76           C  
ATOM   1952  CG  ARG A 361      47.286 -42.383  36.519  1.00 70.75           C  
ATOM   1953  CD  ARG A 361      46.168 -41.417  36.866  1.00 72.78           C  
ATOM   1954  NE  ARG A 361      45.611 -40.782  35.677  1.00 71.08           N  
ATOM   1955  CZ  ARG A 361      44.648 -41.310  34.928  1.00 73.19           C  
ATOM   1956  NH1 ARG A 361      44.131 -42.489  35.245  1.00 73.90           N  
ATOM   1957  NH2 ARG A 361      44.203 -40.662  33.861  1.00 73.88           N  
ATOM   1958  N   LEU A 362      49.472 -42.915  32.866  1.00 57.82           N  
ATOM   1959  CA  LEU A 362      49.071 -43.538  31.612  1.00 57.88           C  
ATOM   1960  C   LEU A 362      49.984 -44.695  31.216  1.00 57.69           C  
ATOM   1961  O   LEU A 362      49.510 -45.793  30.925  1.00 57.93           O  
ATOM   1962  CB  LEU A 362      49.043 -42.504  30.483  1.00 57.95           C  
ATOM   1963  CG  LEU A 362      48.689 -43.063  29.103  1.00 58.18           C  
ATOM   1964  CD1 LEU A 362      47.295 -43.671  29.115  1.00 58.65           C  
ATOM   1965  CD2 LEU A 362      48.801 -41.993  28.030  1.00 58.30           C  
ATOM   1966  N   TYR A 363      51.291 -44.450  31.203  1.00 50.65           N  
ATOM   1967  CA  TYR A 363      52.242 -45.449  30.718  1.00 50.56           C  
ATOM   1968  C   TYR A 363      52.706 -46.419  31.799  1.00 50.62           C  
ATOM   1969  O   TYR A 363      53.083 -47.551  31.499  1.00 50.80           O  
ATOM   1970  CB  TYR A 363      53.456 -44.763  30.094  1.00 50.26           C  
ATOM   1971  CG  TYR A 363      53.192 -44.198  28.719  1.00 50.27           C  
ATOM   1972  CD1 TYR A 363      52.667 -42.926  28.559  1.00 50.26           C  
ATOM   1973  CD2 TYR A 363      53.468 -44.942  27.579  1.00 50.45           C  
ATOM   1974  CE1 TYR A 363      52.426 -42.406  27.305  1.00 50.37           C  
ATOM   1975  CE2 TYR A 363      53.230 -44.429  26.318  1.00 50.56           C  
ATOM   1976  CZ  TYR A 363      52.708 -43.160  26.186  1.00 50.49           C  
ATOM   1977  OH  TYR A 363      52.468 -42.643  24.932  1.00 50.70           O  
ATOM   1978  N   VAL A 364      52.691 -45.978  33.049  1.00 53.49           N  
ATOM   1979  CA  VAL A 364      53.069 -46.844  34.156  1.00 53.63           C  
ATOM   1980  C   VAL A 364      51.823 -47.337  34.880  1.00 53.85           C  
ATOM   1981  O   VAL A 364      51.723 -48.508  35.245  1.00 54.04           O  
ATOM   1982  CB  VAL A 364      54.000 -46.128  35.151  1.00 53.62           C  
ATOM   1983  CG1 VAL A 364      54.332 -47.036  36.326  1.00 53.88           C  
ATOM   1984  CG2 VAL A 364      55.270 -45.671  34.451  1.00 53.45           C  
ATOM   1985  N   GLY A 365      50.867 -46.434  35.074  1.00 92.07           N  
ATOM   1986  CA  GLY A 365      49.609 -46.780  35.709  1.00 94.68           C  
ATOM   1987  C   GLY A 365      49.756 -47.111  37.179  1.00 93.27           C  
ATOM   1988  O   GLY A 365      48.896 -47.770  37.766  1.00 95.52           O  
ATOM   1989  N   GLY A 366      50.852 -46.652  37.779  1.00 69.89           N  
ATOM   1990  CA  GLY A 366      51.098 -46.882  39.190  1.00 69.82           C  
ATOM   1991  C   GLY A 366      50.359 -45.883  40.059  1.00 60.51           C  
ATOM   1992  O   GLY A 366      49.387 -45.270  39.614  1.00 60.85           O  
ATOM   1993  N   PRO A 367      50.813 -45.715  41.309  1.00 70.34           N  
ATOM   1994  CA  PRO A 367      50.201 -44.745  42.223  1.00 71.14           C  
ATOM   1995  C   PRO A 367      50.445 -43.307  41.770  1.00 73.17           C  
ATOM   1996  O   PRO A 367      51.517 -43.013  41.244  1.00 74.43           O  
ATOM   1997  CB  PRO A 367      50.899 -45.030  43.556  1.00 72.65           C  
ATOM   1998  CG  PRO A 367      52.213 -45.622  43.171  1.00 72.57           C  
ATOM   1999  CD  PRO A 367      51.944 -46.427  41.931  1.00 68.96           C  
ATOM   2000  N   PRO A 368      49.455 -42.424  41.970  1.00 71.89           N  
ATOM   2001  CA  PRO A 368      49.579 -41.023  41.552  1.00 71.21           C  
ATOM   2002  C   PRO A 368      50.689 -40.293  42.304  1.00 73.27           C  
ATOM   2003  O   PRO A 368      50.636 -40.191  43.530  1.00 72.89           O  
ATOM   2004  CB  PRO A 368      48.207 -40.430  41.890  1.00 73.86           C  
ATOM   2005  CG  PRO A 368      47.665 -41.316  42.960  1.00 73.32           C  
ATOM   2006  CD  PRO A 368      48.169 -42.690  42.636  1.00 71.87           C  
ATOM   2007  N   LEU A 369      51.682 -39.800  41.573  1.00 59.69           N  
ATOM   2008  CA  LEU A 369      52.802 -39.097  42.189  1.00 58.62           C  
ATOM   2009  C   LEU A 369      52.350 -37.759  42.760  1.00 61.77           C  
ATOM   2010  O   LEU A 369      51.564 -37.039  42.143  1.00 62.05           O  
ATOM   2011  CB  LEU A 369      53.938 -38.902  41.180  1.00 58.09           C  
ATOM   2012  CG  LEU A 369      53.654 -38.157  39.871  1.00 56.23           C  
ATOM   2013  CD1 LEU A 369      53.970 -36.672  39.997  1.00 58.81           C  
ATOM   2014  CD2 LEU A 369      54.435 -38.780  38.725  1.00 58.43           C  
ATOM   2015  N   GLU A 370      52.847 -37.435  43.948  1.00 87.20           N  
ATOM   2016  CA  GLU A 370      52.482 -36.195  44.619  1.00 88.96           C  
ATOM   2017  C   GLU A 370      53.298 -35.026  44.084  1.00 80.19           C  
ATOM   2018  O   GLU A 370      54.499 -35.150  43.848  1.00 82.28           O  
ATOM   2019  CB  GLU A 370      52.675 -36.328  46.130  1.00 82.59           C  
ATOM   2020  CG  GLU A 370      52.270 -35.093  46.922  1.00 84.88           C  
ATOM   2021  CD  GLU A 370      52.509 -35.251  48.410  1.00 86.22           C  
ATOM   2022  OE1 GLU A 370      53.013 -36.316  48.823  1.00 85.51           O  
ATOM   2023  OE2 GLU A 370      52.190 -34.310  49.167  1.00 80.10           O  
ATOM   2024  N   LYS A 371      52.637 -33.890  43.891  1.00 72.18           N  
ATOM   2025  CA  LYS A 371      53.310 -32.683  43.431  1.00 73.30           C  
ATOM   2026  C   LYS A 371      53.491 -31.715  44.596  1.00 77.56           C  
ATOM   2027  O   LYS A 371      52.761 -31.786  45.584  1.00 77.72           O  
ATOM   2028  CB  LYS A 371      52.519 -32.025  42.299  1.00 71.60           C  
ATOM   2029  CG  LYS A 371      53.359 -31.153  41.381  1.00 74.03           C  
ATOM   2030  CD  LYS A 371      54.479 -31.956  40.737  1.00 71.19           C  
ATOM   2031  CE  LYS A 371      55.354 -31.083  39.854  1.00 72.89           C  
ATOM   2032  NZ  LYS A 371      56.463 -31.857  39.232  1.00 70.19           N  
ATOM   2033  N   GLU A 372      54.471 -30.822  44.479  1.00 73.34           N  
ATOM   2034  CA  GLU A 372      54.751 -29.840  45.522  1.00 73.22           C  
ATOM   2035  C   GLU A 372      53.548 -28.928  45.757  1.00 76.44           C  
ATOM   2036  O   GLU A 372      53.166 -28.158  44.875  1.00 77.45           O  
ATOM   2037  CB  GLU A 372      55.985 -29.012  45.156  1.00 74.83           C  
ATOM   2038  CG  GLU A 372      56.312 -27.896  46.140  1.00 75.62           C  
ATOM   2039  CD  GLU A 372      56.721 -28.413  47.507  1.00 76.50           C  
ATOM   2040  OE1 GLU A 372      56.598 -27.652  48.490  1.00 80.58           O  
ATOM   2041  OE2 GLU A 372      57.171 -29.575  47.599  1.00 76.16           O  
ATOM   2042  N   PRO A 373      52.946 -29.014  46.954  1.00 64.94           N  
ATOM   2043  CA  PRO A 373      51.725 -28.274  47.288  1.00 66.44           C  
ATOM   2044  C   PRO A 373      51.960 -26.777  47.476  1.00 70.30           C  
ATOM   2045  O   PRO A 373      51.031 -25.985  47.315  1.00 69.22           O  
ATOM   2046  CB  PRO A 373      51.279 -28.919  48.602  1.00 66.69           C  
ATOM   2047  CG  PRO A 373      52.545 -29.387  49.225  1.00 65.86           C  
ATOM   2048  CD  PRO A 373      53.422 -29.830  48.086  1.00 65.38           C  
ATOM   2049  N   ARG A 374      53.189 -26.400  47.811  1.00 70.85           N  
ATOM   2050  CA  ARG A 374      53.515 -25.001  48.062  1.00 79.36           C  
ATOM   2051  C   ARG A 374      54.118 -24.331  46.835  1.00 77.55           C  
ATOM   2052  O   ARG A 374      54.174 -23.103  46.760  1.00 79.17           O  
ATOM   2053  CB  ARG A 374      54.478 -24.881  49.243  1.00 70.55           C  
ATOM   2054  CG  ARG A 374      53.924 -25.415  50.549  1.00 72.67           C  
ATOM   2055  CD  ARG A 374      54.958 -25.317  51.655  1.00 74.31           C  
ATOM   2056  NE  ARG A 374      55.429 -23.948  51.838  1.00 75.45           N  
ATOM   2057  CZ  ARG A 374      56.351 -23.589  52.724  1.00 75.77           C  
ATOM   2058  NH1 ARG A 374      56.904 -24.501  53.514  1.00 75.27           N  
ATOM   2059  NH2 ARG A 374      56.721 -22.320  52.825  1.00 78.36           N  
ATOM   2060  N   GLU A 375      54.562 -25.146  45.880  1.00 66.89           N  
ATOM   2061  CA  GLU A 375      55.227 -24.662  44.671  1.00 64.27           C  
ATOM   2062  C   GLU A 375      56.399 -23.758  45.034  1.00 60.20           C  
ATOM   2063  O   GLU A 375      56.531 -22.653  44.512  1.00 62.61           O  
ATOM   2064  CB  GLU A 375      54.235 -23.925  43.767  1.00 66.60           C  
ATOM   2065  CG  GLU A 375      53.076 -24.788  43.292  1.00 64.24           C  
ATOM   2066  CD  GLU A 375      52.023 -23.998  42.540  1.00 67.09           C  
ATOM   2067  OE1 GLU A 375      52.077 -22.750  42.573  1.00 69.92           O  
ATOM   2068  OE2 GLU A 375      51.142 -24.623  41.914  1.00 65.50           O  
ATOM   2069  N   LEU A 376      57.249 -24.249  45.931  1.00 55.67           N  
ATOM   2070  CA  LEU A 376      58.308 -23.450  46.540  1.00 56.71           C  
ATOM   2071  C   LEU A 376      59.346 -22.928  45.545  1.00 55.35           C  
ATOM   2072  O   LEU A 376      59.968 -21.893  45.783  1.00 57.80           O  
ATOM   2073  CB  LEU A 376      59.009 -24.267  47.625  1.00 57.10           C  
ATOM   2074  CG  LEU A 376      59.126 -23.607  49.000  1.00 57.31           C  
ATOM   2075  CD1 LEU A 376      57.769 -23.107  49.469  1.00 59.66           C  
ATOM   2076  CD2 LEU A 376      59.713 -24.584  50.002  1.00 58.03           C  
ATOM   2077  N   PHE A 377      59.536 -23.639  44.440  1.00 52.96           N  
ATOM   2078  CA  PHE A 377      60.527 -23.230  43.450  1.00 54.70           C  
ATOM   2079  C   PHE A 377      60.057 -22.046  42.613  1.00 55.17           C  
ATOM   2080  O   PHE A 377      60.855 -21.418  41.920  1.00 54.73           O  
ATOM   2081  CB  PHE A 377      60.890 -24.402  42.532  1.00 52.61           C  
ATOM   2082  CG  PHE A 377      61.905 -25.335  43.118  1.00 56.31           C  
ATOM   2083  CD1 PHE A 377      61.517 -26.539  43.680  1.00 58.73           C  
ATOM   2084  CD2 PHE A 377      63.248 -25.003  43.117  1.00 59.02           C  
ATOM   2085  CE1 PHE A 377      62.455 -27.399  44.224  1.00 50.39           C  
ATOM   2086  CE2 PHE A 377      64.187 -25.856  43.659  1.00 59.20           C  
ATOM   2087  CZ  PHE A 377      63.789 -27.057  44.213  1.00 59.20           C  
ATOM   2088  N   VAL A 378      58.764 -21.740  42.677  1.00 60.50           N  
ATOM   2089  CA  VAL A 378      58.209 -20.645  41.889  1.00 62.22           C  
ATOM   2090  C   VAL A 378      57.426 -19.646  42.739  1.00 65.99           C  
ATOM   2091  O   VAL A 378      57.160 -18.528  42.300  1.00 65.22           O  
ATOM   2092  CB  VAL A 378      57.286 -21.171  40.770  1.00 59.47           C  
ATOM   2093  CG1 VAL A 378      58.081 -21.986  39.764  1.00 57.58           C  
ATOM   2094  CG2 VAL A 378      56.155 -21.995  41.356  1.00 61.72           C  
ATOM   2095  N   LYS A 379      57.062 -20.046  43.953  1.00 71.36           N  
ATOM   2096  CA  LYS A 379      56.265 -19.189  44.825  1.00 74.46           C  
ATOM   2097  C   LYS A 379      57.104 -18.594  45.952  1.00 77.46           C  
ATOM   2098  O   LYS A 379      56.859 -17.472  46.397  1.00 70.00           O  
ATOM   2099  CB  LYS A 379      55.087 -19.972  45.410  1.00 78.68           C  
ATOM   2100  CG  LYS A 379      54.053 -19.116  46.127  1.00 72.50           C  
ATOM   2101  CD  LYS A 379      53.258 -18.274  45.140  1.00 74.43           C  
ATOM   2102  CE  LYS A 379      52.485 -19.151  44.165  1.00 79.27           C  
ATOM   2103  NZ  LYS A 379      51.693 -18.344  43.197  1.00 71.95           N  
ATOM   2104  N   GLY A 380      58.097 -19.349  46.409  1.00 62.41           N  
ATOM   2105  CA  GLY A 380      58.923 -18.927  47.526  1.00 64.75           C  
ATOM   2106  C   GLY A 380      60.307 -18.456  47.123  1.00 64.23           C  
ATOM   2107  O   GLY A 380      60.668 -18.473  45.946  1.00 61.83           O  
ATOM   2108  N   THR A 381      61.085 -18.038  48.115  1.00 58.66           N  
ATOM   2109  CA  THR A 381      62.431 -17.531  47.880  1.00 50.09           C  
ATOM   2110  C   THR A 381      63.482 -18.611  48.095  1.00 56.04           C  
ATOM   2111  O   THR A 381      63.157 -19.786  48.253  1.00 57.20           O  
ATOM   2112  CB  THR A 381      62.748 -16.339  48.800  1.00 55.85           C  
ATOM   2113  OG1 THR A 381      62.662 -16.754  50.169  1.00 52.20           O  
ATOM   2114  CG2 THR A 381      61.765 -15.206  48.556  1.00 56.84           C  
ATOM   2115  N   MET A 382      64.747 -18.203  48.103  1.00 54.69           N  
ATOM   2116  CA  MET A 382      65.852 -19.120  48.348  1.00 50.93           C  
ATOM   2117  C   MET A 382      65.906 -19.507  49.824  1.00 54.39           C  
ATOM   2118  O   MET A 382      66.415 -20.568  50.182  1.00 53.27           O  
ATOM   2119  CB  MET A 382      67.178 -18.487  47.911  1.00 53.43           C  
ATOM   2120  CG  MET A 382      68.387 -19.408  48.008  1.00 51.01           C  
ATOM   2121  SD  MET A 382      68.378 -20.721  46.774  1.00 58.20           S  
ATOM   2122  CE  MET A 382      68.614 -19.777  45.272  1.00 57.20           C  
ATOM   2123  N   LYS A 383      65.367 -18.637  50.673  1.00 71.05           N  
ATOM   2124  CA  LYS A 383      65.374 -18.852  52.117  1.00 72.59           C  
ATOM   2125  C   LYS A 383      64.596 -20.098  52.522  1.00 71.32           C  
ATOM   2126  O   LYS A 383      65.116 -20.962  53.229  1.00 70.13           O  
ATOM   2127  CB  LYS A 383      64.796 -17.632  52.838  1.00 78.68           C  
ATOM   2128  CG  LYS A 383      64.615 -17.826  54.336  1.00 78.42           C  
ATOM   2129  CD  LYS A 383      63.846 -16.670  54.958  1.00 81.03           C  
ATOM   2130  CE  LYS A 383      63.588 -16.911  56.438  1.00 83.09           C  
ATOM   2131  NZ  LYS A 383      62.780 -15.819  57.048  1.00 86.31           N  
ATOM   2132  N   ASP A 384      63.348 -20.187  52.075  1.00 66.78           N  
ATOM   2133  CA  ASP A 384      62.478 -21.294  52.458  1.00 65.94           C  
ATOM   2134  C   ASP A 384      62.771 -22.570  51.667  1.00 65.83           C  
ATOM   2135  O   ASP A 384      62.139 -23.602  51.891  1.00 66.16           O  
ATOM   2136  CB  ASP A 384      61.007 -20.896  52.295  1.00 69.64           C  
ATOM   2137  CG  ASP A 384      60.762 -20.048  51.062  1.00 69.47           C  
ATOM   2138  OD1 ASP A 384      61.677 -19.298  50.663  1.00 61.38           O  
ATOM   2139  OD2 ASP A 384      59.649 -20.123  50.499  1.00 60.58           O  
ATOM   2140  N   ILE A 385      63.734 -22.501  50.753  1.00 52.71           N  
ATOM   2141  CA  ILE A 385      64.162 -23.680  50.009  1.00 50.90           C  
ATOM   2142  C   ILE A 385      65.117 -24.531  50.842  1.00 51.00           C  
ATOM   2143  O   ILE A 385      64.954 -25.746  50.939  1.00 50.25           O  
ATOM   2144  CB  ILE A 385      64.841 -23.304  48.677  1.00 59.97           C  
ATOM   2145  CG1 ILE A 385      63.795 -22.844  47.663  1.00 59.43           C  
ATOM   2146  CG2 ILE A 385      65.618 -24.483  48.115  1.00 58.64           C  
ATOM   2147  CD1 ILE A 385      64.362 -22.542  46.295  1.00 58.38           C  
ATOM   2148  N   ARG A 386      66.107 -23.883  51.450  1.00 50.15           N  
ATOM   2149  CA  ARG A 386      67.085 -24.583  52.277  1.00 50.93           C  
ATOM   2150  C   ARG A 386      66.436 -25.200  53.514  1.00 51.48           C  
ATOM   2151  O   ARG A 386      66.918 -26.199  54.045  1.00 51.04           O  
ATOM   2152  CB  ARG A 386      68.210 -23.634  52.700  1.00 51.53           C  
ATOM   2153  CG  ARG A 386      69.031 -23.082  51.545  1.00 50.77           C  
ATOM   2154  CD  ARG A 386      70.230 -22.296  52.054  1.00 52.58           C  
ATOM   2155  NE  ARG A 386      71.054 -21.776  50.966  1.00 51.45           N  
ATOM   2156  CZ  ARG A 386      70.953 -20.544  50.475  1.00 52.26           C  
ATOM   2157  NH1 ARG A 386      70.063 -19.700  50.977  1.00 53.63           N  
ATOM   2158  NH2 ARG A 386      71.745 -20.157  49.484  1.00 52.29           N  
ATOM   2159  N   GLU A 387      65.342 -24.598  53.968  1.00 70.47           N  
ATOM   2160  CA  GLU A 387      64.603 -25.113  55.114  1.00 74.51           C  
ATOM   2161  C   GLU A 387      63.944 -26.445  54.775  1.00 70.09           C  
ATOM   2162  O   GLU A 387      63.734 -27.289  55.646  1.00 70.88           O  
ATOM   2163  CB  GLU A 387      63.549 -24.102  55.571  1.00 73.99           C  
ATOM   2164  CG  GLU A 387      64.117 -22.743  55.948  1.00 77.04           C  
ATOM   2165  CD  GLU A 387      63.039 -21.735  56.304  1.00 81.79           C  
ATOM   2166  OE1 GLU A 387      61.843 -22.084  56.212  1.00 78.79           O  
ATOM   2167  OE2 GLU A 387      63.388 -20.594  56.672  1.00 80.45           O  
ATOM   2168  N   ASN A 388      63.622 -26.624  53.499  1.00 53.55           N  
ATOM   2169  CA  ASN A 388      62.993 -27.849  53.025  1.00 54.60           C  
ATOM   2170  C   ASN A 388      63.806 -28.498  51.911  1.00 53.71           C  
ATOM   2171  O   ASN A 388      63.250 -29.035  50.953  1.00 59.94           O  
ATOM   2172  CB  ASN A 388      61.572 -27.560  52.543  1.00 55.50           C  
ATOM   2173  CG  ASN A 388      60.760 -26.784  53.560  1.00 55.63           C  
ATOM   2174  OD1 ASN A 388      60.311 -25.670  53.292  1.00 55.33           O  
ATOM   2175  ND2 ASN A 388      60.571 -27.369  54.737  1.00 57.23           N  
ATOM   2176  N   PHE A 389      65.127 -28.441  52.052  1.00 55.35           N  
ATOM   2177  CA  PHE A 389      66.051 -28.956  51.044  1.00 56.88           C  
ATOM   2178  C   PHE A 389      65.875 -30.449  50.794  1.00 52.98           C  
ATOM   2179  O   PHE A 389      65.764 -30.889  49.646  1.00 53.61           O  
ATOM   2180  CB  PHE A 389      67.493 -28.668  51.465  1.00 54.15           C  
ATOM   2181  CG  PHE A 389      68.511 -29.523  50.768  1.00 55.73           C  
ATOM   2182  CD1 PHE A 389      68.852 -29.281  49.447  1.00 53.10           C  
ATOM   2183  CD2 PHE A 389      69.136 -30.562  51.437  1.00 54.61           C  
ATOM   2184  CE1 PHE A 389      69.791 -30.065  48.804  1.00 52.52           C  
ATOM   2185  CE2 PHE A 389      70.074 -31.349  50.800  1.00 55.53           C  
ATOM   2186  CZ  PHE A 389      70.403 -31.100  49.482  1.00 55.00           C  
ATOM   2187  N   GLN A 390      65.856 -31.219  51.876  1.00 55.38           N  
ATOM   2188  CA  GLN A 390      65.718 -32.668  51.795  1.00 54.65           C  
ATOM   2189  C   GLN A 390      64.451 -33.054  51.040  1.00 53.84           C  
ATOM   2190  O   GLN A 390      64.475 -33.908  50.150  1.00 53.19           O  
ATOM   2191  CB  GLN A 390      65.702 -33.277  53.197  1.00 55.13           C  
ATOM   2192  CG  GLN A 390      66.331 -34.656  53.282  1.00 54.46           C  
ATOM   2193  CD  GLN A 390      67.845 -34.606  53.243  1.00 54.95           C  
ATOM   2194  OE1 GLN A 390      68.500 -35.556  52.818  1.00 55.19           O  
ATOM   2195  NE2 GLN A 390      68.410 -33.492  53.696  1.00 55.91           N  
ATOM   2196  N   ASP A 391      63.348 -32.404  51.397  1.00 57.54           N  
ATOM   2197  CA  ASP A 391      62.052 -32.686  50.797  1.00 56.65           C  
ATOM   2198  C   ASP A 391      62.045 -32.392  49.302  1.00 56.32           C  
ATOM   2199  O   ASP A 391      61.605 -33.217  48.506  1.00 54.37           O  
ATOM   2200  CB  ASP A 391      60.960 -31.878  51.497  1.00 58.32           C  
ATOM   2201  CG  ASP A 391      60.997 -32.037  53.004  1.00 59.26           C  
ATOM   2202  OD1 ASP A 391      61.655 -31.211  53.671  1.00 60.36           O  
ATOM   2203  OD2 ASP A 391      60.374 -32.988  53.522  1.00 60.71           O  
ATOM   2204  N   LEU A 392      62.537 -31.214  48.926  1.00 53.89           N  
ATOM   2205  CA  LEU A 392      62.600 -30.823  47.522  1.00 53.38           C  
ATOM   2206  C   LEU A 392      63.463 -31.794  46.722  1.00 52.79           C  
ATOM   2207  O   LEU A 392      63.116 -32.170  45.596  1.00 51.73           O  
ATOM   2208  CB  LEU A 392      63.140 -29.401  47.384  1.00 53.55           C  
ATOM   2209  CG  LEU A 392      62.263 -28.300  47.987  1.00 54.22           C  
ATOM   2210  CD1 LEU A 392      62.909 -26.939  47.802  1.00 54.71           C  
ATOM   2211  CD2 LEU A 392      60.871 -28.327  47.375  1.00 53.82           C  
ATOM   2212  N   MET A 393      64.585 -32.196  47.311  1.00 55.22           N  
ATOM   2213  CA  MET A 393      65.440 -33.210  46.708  1.00 53.50           C  
ATOM   2214  C   MET A 393      64.661 -34.497  46.474  1.00 54.58           C  
ATOM   2215  O   MET A 393      64.773 -35.121  45.416  1.00 53.47           O  
ATOM   2216  CB  MET A 393      66.658 -33.483  47.593  1.00 55.04           C  
ATOM   2217  CG  MET A 393      67.880 -32.657  47.243  1.00 55.30           C  
ATOM   2218  SD  MET A 393      68.500 -33.036  45.595  1.00 51.12           S  
ATOM   2219  CE  MET A 393      69.996 -32.055  45.553  1.00 54.71           C  
ATOM   2220  N   GLN A 394      63.866 -34.884  47.468  1.00 55.01           N  
ATOM   2221  CA  GLN A 394      63.054 -36.090  47.369  1.00 53.16           C  
ATOM   2222  C   GLN A 394      62.047 -35.982  46.227  1.00 52.28           C  
ATOM   2223  O   GLN A 394      61.853 -36.934  45.471  1.00 50.56           O  
ATOM   2224  CB  GLN A 394      62.332 -36.357  48.691  1.00 53.78           C  
ATOM   2225  CG  GLN A 394      61.608 -37.694  48.748  1.00 51.90           C  
ATOM   2226  CD  GLN A 394      62.557 -38.879  48.741  1.00 50.26           C  
ATOM   2227  OE1 GLN A 394      63.750 -38.737  49.007  1.00 50.80           O  
ATOM   2228  NE2 GLN A 394      62.026 -40.058  48.435  1.00 50.26           N  
ATOM   2229  N   TYR A 395      61.416 -34.816  46.107  1.00 57.03           N  
ATOM   2230  CA  TYR A 395      60.464 -34.558  45.030  1.00 56.99           C  
ATOM   2231  C   TYR A 395      61.130 -34.686  43.666  1.00 56.11           C  
ATOM   2232  O   TYR A 395      60.587 -35.314  42.753  1.00 54.39           O  
ATOM   2233  CB  TYR A 395      59.843 -33.167  45.175  1.00 60.26           C  
ATOM   2234  CG  TYR A 395      58.633 -33.115  46.080  1.00 61.82           C  
ATOM   2235  CD1 TYR A 395      57.363 -33.395  45.591  1.00 60.31           C  
ATOM   2236  CD2 TYR A 395      58.756 -32.775  47.420  1.00 61.56           C  
ATOM   2237  CE1 TYR A 395      56.253 -33.343  46.412  1.00 59.54           C  
ATOM   2238  CE2 TYR A 395      57.652 -32.720  48.249  1.00 63.09           C  
ATOM   2239  CZ  TYR A 395      56.403 -33.005  47.740  1.00 62.81           C  
ATOM   2240  OH  TYR A 395      55.302 -32.953  48.564  1.00 63.24           O  
ATOM   2241  N   CYS A 396      62.311 -34.086  43.531  1.00 68.88           N  
ATOM   2242  CA  CYS A 396      63.070 -34.179  42.289  1.00 65.56           C  
ATOM   2243  C   CYS A 396      63.396 -35.635  41.967  1.00 64.86           C  
ATOM   2244  O   CYS A 396      63.345 -36.053  40.807  1.00 67.02           O  
ATOM   2245  CB  CYS A 396      64.354 -33.354  42.381  1.00 68.12           C  
ATOM   2246  SG  CYS A 396      65.242 -33.185  40.817  1.00 65.65           S  
ATOM   2247  N   ALA A 397      63.722 -36.403  43.004  1.00 82.31           N  
ATOM   2248  CA  ALA A 397      64.024 -37.822  42.842  1.00 82.31           C  
ATOM   2249  C   ALA A 397      62.807 -38.596  42.338  1.00 79.49           C  
ATOM   2250  O   ALA A 397      62.920 -39.448  41.453  1.00 77.89           O  
ATOM   2251  CB  ALA A 397      64.519 -38.409  44.154  1.00 81.71           C  
ATOM   2252  N   GLN A 398      61.641 -38.297  42.904  1.00 63.58           N  
ATOM   2253  CA  GLN A 398      60.400 -38.909  42.446  1.00 60.53           C  
ATOM   2254  C   GLN A 398      60.152 -38.564  40.981  1.00 61.12           C  
ATOM   2255  O   GLN A 398      59.712 -39.409  40.197  1.00 61.44           O  
ATOM   2256  CB  GLN A 398      59.220 -38.459  43.307  1.00 62.69           C  
ATOM   2257  CG  GLN A 398      59.317 -38.876  44.764  1.00 66.46           C  
ATOM   2258  CD  GLN A 398      58.142 -38.389  45.590  1.00 67.10           C  
ATOM   2259  OE1 GLN A 398      57.213 -37.770  45.067  1.00 67.83           O  
ATOM   2260  NE2 GLN A 398      58.176 -38.665  46.889  1.00 65.76           N  
ATOM   2261  N   ASP A 399      60.450 -37.319  40.618  1.00 58.41           N  
ATOM   2262  CA  ASP A 399      60.285 -36.862  39.240  1.00 55.02           C  
ATOM   2263  C   ASP A 399      61.177 -37.634  38.266  1.00 53.78           C  
ATOM   2264  O   ASP A 399      60.696 -38.136  37.247  1.00 50.57           O  
ATOM   2265  CB  ASP A 399      60.570 -35.362  39.135  1.00 58.41           C  
ATOM   2266  CG  ASP A 399      59.425 -34.511  39.649  1.00 58.40           C  
ATOM   2267  OD1 ASP A 399      58.680 -34.985  40.534  1.00 58.39           O  
ATOM   2268  OD2 ASP A 399      59.264 -33.371  39.166  1.00 56.22           O  
ATOM   2269  N   VAL A 400      62.469 -37.733  38.576  1.00 50.98           N  
ATOM   2270  CA  VAL A 400      63.398 -38.422  37.680  1.00 59.85           C  
ATOM   2271  C   VAL A 400      63.121 -39.923  37.639  1.00 59.07           C  
ATOM   2272  O   VAL A 400      63.388 -40.582  36.634  1.00 58.50           O  
ATOM   2273  CB  VAL A 400      64.877 -38.181  38.081  1.00 50.49           C  
ATOM   2274  CG1 VAL A 400      65.193 -36.699  38.082  1.00 51.63           C  
ATOM   2275  CG2 VAL A 400      65.193 -38.794  39.433  1.00 51.26           C  
ATOM   2276  N   TRP A 401      62.572 -40.457  38.728  1.00 64.38           N  
ATOM   2277  CA  TRP A 401      62.228 -41.872  38.786  1.00 63.46           C  
ATOM   2278  C   TRP A 401      61.031 -42.174  37.894  1.00 63.23           C  
ATOM   2279  O   TRP A 401      61.070 -43.091  37.067  1.00 60.36           O  
ATOM   2280  CB  TRP A 401      61.939 -42.296  40.229  1.00 65.14           C  
ATOM   2281  CG  TRP A 401      61.382 -43.684  40.359  1.00 66.49           C  
ATOM   2282  CD1 TRP A 401      60.232 -44.049  40.998  1.00 68.08           C  
ATOM   2283  CD2 TRP A 401      61.947 -44.892  39.834  1.00 66.05           C  
ATOM   2284  NE1 TRP A 401      60.049 -45.409  40.908  1.00 66.22           N  
ATOM   2285  CE2 TRP A 401      61.090 -45.948  40.195  1.00 64.29           C  
ATOM   2286  CE3 TRP A 401      63.099 -45.183  39.093  1.00 66.52           C  
ATOM   2287  CZ2 TRP A 401      61.345 -47.273  39.843  1.00 64.91           C  
ATOM   2288  CZ3 TRP A 401      63.347 -46.495  38.740  1.00 66.14           C  
ATOM   2289  CH2 TRP A 401      62.477 -47.525  39.117  1.00 65.34           C  
ATOM   2290  N   ALA A 402      59.968 -41.394  38.072  1.00 54.87           N  
ATOM   2291  CA  ALA A 402      58.778 -41.520  37.240  1.00 52.12           C  
ATOM   2292  C   ALA A 402      59.145 -41.341  35.773  1.00 50.74           C  
ATOM   2293  O   ALA A 402      58.669 -42.077  34.908  1.00 50.12           O  
ATOM   2294  CB  ALA A 402      57.727 -40.505  37.655  1.00 54.99           C  
ATOM   2295  N   THR A 403      60.008 -40.365  35.504  1.00 50.04           N  
ATOM   2296  CA  THR A 403      60.489 -40.118  34.151  1.00 52.90           C  
ATOM   2297  C   THR A 403      61.226 -41.338  33.612  1.00 59.03           C  
ATOM   2298  O   THR A 403      61.074 -41.699  32.445  1.00 53.69           O  
ATOM   2299  CB  THR A 403      61.423 -38.897  34.098  1.00 54.26           C  
ATOM   2300  OG1 THR A 403      60.756 -37.756  34.650  1.00 56.54           O  
ATOM   2301  CG2 THR A 403      61.827 -38.596  32.665  1.00 56.78           C  
ATOM   2302  N   HIS A 404      62.025 -41.971  34.467  1.00 58.96           N  
ATOM   2303  CA  HIS A 404      62.755 -43.170  34.076  1.00 57.53           C  
ATOM   2304  C   HIS A 404      61.799 -44.291  33.683  1.00 59.38           C  
ATOM   2305  O   HIS A 404      61.956 -44.905  32.627  1.00 56.92           O  
ATOM   2306  CB  HIS A 404      63.670 -43.641  35.206  1.00 52.04           C  
ATOM   2307  CG  HIS A 404      64.500 -44.833  34.848  1.00 51.71           C  
ATOM   2308  ND1 HIS A 404      64.805 -45.830  35.752  1.00 50.13           N  
ATOM   2309  CD2 HIS A 404      65.092 -45.191  33.684  1.00 52.97           C  
ATOM   2310  CE1 HIS A 404      65.547 -46.748  35.159  1.00 50.40           C  
ATOM   2311  NE2 HIS A 404      65.736 -46.385  33.903  1.00 51.08           N  
ATOM   2312  N   GLU A 405      60.811 -44.553  34.538  1.00 56.26           N  
ATOM   2313  CA  GLU A 405      59.809 -45.583  34.266  1.00 53.45           C  
ATOM   2314  C   GLU A 405      59.073 -45.322  32.956  1.00 52.44           C  
ATOM   2315  O   GLU A 405      58.963 -46.205  32.097  1.00 52.62           O  
ATOM   2316  CB  GLU A 405      58.803 -45.666  35.413  1.00 54.02           C  
ATOM   2317  CG  GLU A 405      59.373 -46.187  36.720  1.00 55.20           C  
ATOM   2318  CD  GLU A 405      58.333 -46.237  37.822  1.00 55.97           C  
ATOM   2319  OE1 GLU A 405      57.359 -45.459  37.753  1.00 56.00           O  
ATOM   2320  OE2 GLU A 405      58.485 -47.054  38.753  1.00 57.67           O  
ATOM   2321  N   VAL A 406      58.569 -44.100  32.820  1.00 42.09           N  
ATOM   2322  CA  VAL A 406      57.856 -43.680  31.622  1.00 41.88           C  
ATOM   2323  C   VAL A 406      58.706 -43.888  30.373  1.00 41.68           C  
ATOM   2324  O   VAL A 406      58.229 -44.430  29.378  1.00 41.73           O  
ATOM   2325  CB  VAL A 406      57.429 -42.200  31.715  1.00 43.59           C  
ATOM   2326  CG1 VAL A 406      56.985 -41.679  30.361  1.00 42.49           C  
ATOM   2327  CG2 VAL A 406      56.321 -42.032  32.741  1.00 44.34           C  
ATOM   2328  N   PHE A 407      59.966 -43.469  30.434  1.00 55.07           N  
ATOM   2329  CA  PHE A 407      60.895 -43.660  29.324  1.00 52.56           C  
ATOM   2330  C   PHE A 407      61.046 -45.136  28.982  1.00 52.13           C  
ATOM   2331  O   PHE A 407      60.981 -45.521  27.811  1.00 52.80           O  
ATOM   2332  CB  PHE A 407      62.263 -43.058  29.652  1.00 52.31           C  
ATOM   2333  CG  PHE A 407      63.334 -43.410  28.656  1.00 52.47           C  
ATOM   2334  CD1 PHE A 407      63.395 -42.768  27.431  1.00 52.48           C  
ATOM   2335  CD2 PHE A 407      64.280 -44.382  28.947  1.00 52.78           C  
ATOM   2336  CE1 PHE A 407      64.376 -43.089  26.511  1.00 52.88           C  
ATOM   2337  CE2 PHE A 407      65.266 -44.708  28.031  1.00 53.61           C  
ATOM   2338  CZ  PHE A 407      65.314 -44.061  26.813  1.00 53.45           C  
ATOM   2339  N   GLN A 408      61.248 -45.957  30.010  1.00 51.38           N  
ATOM   2340  CA  GLN A 408      61.396 -47.397  29.831  1.00 50.32           C  
ATOM   2341  C   GLN A 408      60.186 -48.004  29.138  1.00 50.33           C  
ATOM   2342  O   GLN A 408      60.323 -48.920  28.330  1.00 52.60           O  
ATOM   2343  CB  GLN A 408      61.617 -48.092  31.176  1.00 53.13           C  
ATOM   2344  CG  GLN A 408      63.032 -47.979  31.710  1.00 54.29           C  
ATOM   2345  CD  GLN A 408      63.263 -48.860  32.919  1.00 53.88           C  
ATOM   2346  OE1 GLN A 408      62.316 -49.358  33.529  1.00 52.54           O  
ATOM   2347  NE2 GLN A 408      64.529 -49.067  33.269  1.00 53.38           N  
ATOM   2348  N   GLN A 409      59.002 -47.491  29.453  1.00 52.51           N  
ATOM   2349  CA  GLN A 409      57.783 -48.030  28.864  1.00 51.85           C  
ATOM   2350  C   GLN A 409      57.501 -47.437  27.481  1.00 51.74           C  
ATOM   2351  O   GLN A 409      56.746 -48.010  26.696  1.00 52.06           O  
ATOM   2352  CB  GLN A 409      56.593 -47.787  29.794  1.00 51.94           C  
ATOM   2353  CG  GLN A 409      55.379 -48.645  29.476  1.00 52.19           C  
ATOM   2354  CD  GLN A 409      55.682 -50.131  29.548  1.00 53.75           C  
ATOM   2355  OE1 GLN A 409      56.495 -50.572  30.362  1.00 52.63           O  
ATOM   2356  NE2 GLN A 409      55.032 -50.911  28.691  1.00 54.73           N  
ATOM   2357  N   GLN A 410      58.120 -46.302  27.178  1.00 58.69           N  
ATOM   2358  CA  GLN A 410      57.836 -45.594  25.932  1.00 58.61           C  
ATOM   2359  C   GLN A 410      58.784 -45.952  24.795  1.00 51.20           C  
ATOM   2360  O   GLN A 410      58.372 -45.997  23.635  1.00 59.82           O  
ATOM   2361  CB  GLN A 410      57.879 -44.086  26.158  1.00 56.67           C  
ATOM   2362  CG  GLN A 410      56.624 -43.524  26.787  1.00 55.93           C  
ATOM   2363  CD  GLN A 410      56.683 -42.024  26.946  1.00 59.04           C  
ATOM   2364  OE1 GLN A 410      57.717 -41.404  26.703  1.00 58.81           O  
ATOM   2365  NE2 GLN A 410      55.571 -41.429  27.358  1.00 53.03           N  
ATOM   2366  N   LEU A 411      60.051 -46.189  25.127  1.00 55.11           N  
ATOM   2367  CA  LEU A 411      61.070 -46.466  24.115  1.00 55.47           C  
ATOM   2368  C   LEU A 411      60.679 -47.607  23.156  1.00 55.95           C  
ATOM   2369  O   LEU A 411      60.740 -47.424  21.938  1.00 56.43           O  
ATOM   2370  CB  LEU A 411      62.417 -46.763  24.790  1.00 55.62           C  
ATOM   2371  CG  LEU A 411      63.706 -46.592  23.976  1.00 56.34           C  
ATOM   2372  CD1 LEU A 411      64.031 -47.834  23.156  1.00 57.07           C  
ATOM   2373  CD2 LEU A 411      63.609 -45.369  23.077  1.00 56.36           C  
ATOM   2374  N   PRO A 412      60.263 -48.777  23.683  1.00 58.54           N  
ATOM   2375  CA  PRO A 412      59.897 -49.829  22.726  1.00 54.02           C  
ATOM   2376  C   PRO A 412      58.617 -49.511  21.955  1.00 55.85           C  
ATOM   2377  O   PRO A 412      58.495 -49.886  20.788  1.00 57.95           O  
ATOM   2378  CB  PRO A 412      59.701 -51.059  23.616  1.00 54.87           C  
ATOM   2379  CG  PRO A 412      59.329 -50.504  24.938  1.00 55.92           C  
ATOM   2380  CD  PRO A 412      60.115 -49.238  25.077  1.00 53.40           C  
ATOM   2381  N   LEU A 413      57.681 -48.827  22.605  1.00 66.98           N  
ATOM   2382  CA  LEU A 413      56.432 -48.426  21.963  1.00 66.91           C  
ATOM   2383  C   LEU A 413      56.697 -47.441  20.832  1.00 68.66           C  
ATOM   2384  O   LEU A 413      56.143 -47.570  19.739  1.00 67.42           O  
ATOM   2385  CB  LEU A 413      55.471 -47.806  22.981  1.00 66.07           C  
ATOM   2386  CG  LEU A 413      54.479 -48.737  23.682  1.00 69.75           C  
ATOM   2387  CD1 LEU A 413      55.191 -49.830  24.465  1.00 61.05           C  
ATOM   2388  CD2 LEU A 413      53.556 -47.937  24.590  1.00 66.46           C  
ATOM   2389  N   PHE A 414      57.548 -46.457  21.105  1.00 50.70           N  
ATOM   2390  CA  PHE A 414      57.935 -45.477  20.103  1.00 58.00           C  
ATOM   2391  C   PHE A 414      58.676 -46.141  18.951  1.00 52.35           C  
ATOM   2392  O   PHE A 414      58.448 -45.815  17.786  1.00 52.20           O  
ATOM   2393  CB  PHE A 414      58.803 -44.385  20.725  1.00 57.54           C  
ATOM   2394  CG  PHE A 414      59.393 -43.437  19.719  1.00 57.33           C  
ATOM   2395  CD1 PHE A 414      60.700 -43.587  19.286  1.00 56.63           C  
ATOM   2396  CD2 PHE A 414      58.636 -42.399  19.203  1.00 55.08           C  
ATOM   2397  CE1 PHE A 414      61.242 -42.718  18.360  1.00 51.55           C  
ATOM   2398  CE2 PHE A 414      59.175 -41.527  18.276  1.00 50.94           C  
ATOM   2399  CZ  PHE A 414      60.478 -41.688  17.855  1.00 51.57           C  
ATOM   2400  N   LEU A 415      59.567 -47.068  19.285  1.00 54.92           N  
ATOM   2401  CA  LEU A 415      60.316 -47.802  18.273  1.00 55.71           C  
ATOM   2402  C   LEU A 415      59.388 -48.644  17.402  1.00 56.41           C  
ATOM   2403  O   LEU A 415      59.660 -48.861  16.222  1.00 57.25           O  
ATOM   2404  CB  LEU A 415      61.378 -48.690  18.925  1.00 55.76           C  
ATOM   2405  CG  LEU A 415      62.813 -48.155  18.932  1.00 56.01           C  
ATOM   2406  CD1 LEU A 415      62.890 -46.776  19.574  1.00 55.37           C  
ATOM   2407  CD2 LEU A 415      63.743 -49.130  19.638  1.00 57.79           C  
ATOM   2408  N   GLU A 416      58.292 -49.114  17.989  1.00 69.15           N  
ATOM   2409  CA  GLU A 416      57.310 -49.899  17.249  1.00 60.30           C  
ATOM   2410  C   GLU A 416      56.481 -49.020  16.320  1.00 68.03           C  
ATOM   2411  O   GLU A 416      56.323 -49.329  15.139  1.00 67.86           O  
ATOM   2412  CB  GLU A 416      56.389 -50.658  18.206  1.00 69.49           C  
ATOM   2413  CG  GLU A 416      55.284 -51.433  17.503  1.00 61.33           C  
ATOM   2414  CD  GLU A 416      54.338 -52.119  18.470  1.00 61.22           C  
ATOM   2415  OE1 GLU A 416      53.335 -52.702  18.007  1.00 63.13           O  
ATOM   2416  OE2 GLU A 416      54.597 -52.077  19.690  1.00 68.83           O  
ATOM   2417  N   ARG A 417      55.952 -47.926  16.860  1.00 54.00           N  
ATOM   2418  CA  ARG A 417      55.096 -47.027  16.090  1.00 54.63           C  
ATOM   2419  C   ARG A 417      55.892 -46.195  15.088  1.00 54.87           C  
ATOM   2420  O   ARG A 417      55.365 -45.784  14.056  1.00 55.75           O  
ATOM   2421  CB  ARG A 417      54.306 -46.107  17.024  1.00 54.15           C  
ATOM   2422  CG  ARG A 417      53.362 -46.841  17.964  1.00 54.04           C  
ATOM   2423  CD  ARG A 417      52.414 -45.880  18.663  1.00 54.01           C  
ATOM   2424  NE  ARG A 417      51.377 -45.380  17.764  1.00 55.22           N  
ATOM   2425  CZ  ARG A 417      50.142 -45.864  17.708  1.00 56.06           C  
ATOM   2426  NH1 ARG A 417      49.784 -46.862  18.503  1.00 57.13           N  
ATOM   2427  NH2 ARG A 417      49.261 -45.350  16.862  1.00 57.37           N  
ATOM   2428  N   CYS A 418      57.161 -45.947  15.397  1.00 77.35           N  
ATOM   2429  CA  CYS A 418      58.043 -45.229  14.484  1.00 76.00           C  
ATOM   2430  C   CYS A 418      59.250 -46.088  14.131  1.00 73.72           C  
ATOM   2431  O   CYS A 418      60.346 -45.870  14.649  1.00 70.50           O  
ATOM   2432  CB  CYS A 418      58.494 -43.903  15.099  1.00 77.15           C  
ATOM   2433  SG  CYS A 418      57.140 -42.787  15.540  1.00 73.31           S  
ATOM   2434  N   PRO A 419      59.053 -47.071  13.238  1.00 85.53           N  
ATOM   2435  CA  PRO A 419      60.081 -48.063  12.905  1.00 89.12           C  
ATOM   2436  C   PRO A 419      61.274 -47.466  12.169  1.00 88.74           C  
ATOM   2437  O   PRO A 419      62.401 -47.927  12.352  1.00 87.96           O  
ATOM   2438  CB  PRO A 419      59.331 -49.051  12.008  1.00 89.32           C  
ATOM   2439  CG  PRO A 419      58.256 -48.236  11.381  1.00 80.83           C  
ATOM   2440  CD  PRO A 419      57.835 -47.246  12.427  1.00 83.21           C  
ATOM   2441  N   HIS A 420      61.028 -46.454  11.346  1.00 51.10           N  
ATOM   2442  CA  HIS A 420      62.092 -45.848  10.561  1.00 59.60           C  
ATOM   2443  C   HIS A 420      63.024 -45.039  11.456  1.00 51.07           C  
ATOM   2444  O   HIS A 420      62.568 -44.217  12.249  1.00 55.24           O  
ATOM   2445  CB  HIS A 420      61.506 -44.965   9.460  1.00 59.62           C  
ATOM   2446  CG  HIS A 420      62.256 -45.036   8.167  1.00 54.87           C  
ATOM   2447  ND1 HIS A 420      63.480 -44.430   7.983  1.00 54.11           N  
ATOM   2448  CD2 HIS A 420      61.956 -45.643   6.995  1.00 52.82           C  
ATOM   2449  CE1 HIS A 420      63.902 -44.660   6.752  1.00 51.97           C  
ATOM   2450  NE2 HIS A 420      62.995 -45.393   6.131  1.00 51.46           N  
ATOM   2451  N   PRO A 421      64.338 -45.279  11.337  1.00 62.71           N  
ATOM   2452  CA  PRO A 421      65.345 -44.601  12.160  1.00 65.38           C  
ATOM   2453  C   PRO A 421      65.497 -43.123  11.809  1.00 68.42           C  
ATOM   2454  O   PRO A 421      66.046 -42.357  12.606  1.00 72.62           O  
ATOM   2455  CB  PRO A 421      66.629 -45.373  11.844  1.00 67.00           C  
ATOM   2456  CG  PRO A 421      66.407 -45.911  10.474  1.00 61.17           C  
ATOM   2457  CD  PRO A 421      64.947 -46.243  10.403  1.00 67.43           C  
ATOM   2458  N   VAL A 422      65.021 -42.739  10.627  1.00 51.59           N  
ATOM   2459  CA  VAL A 422      65.068 -41.349  10.185  1.00 51.61           C  
ATOM   2460  C   VAL A 422      64.369 -40.442  11.187  1.00 51.67           C  
ATOM   2461  O   VAL A 422      64.879 -39.376  11.530  1.00 51.78           O  
ATOM   2462  CB  VAL A 422      64.423 -41.176   8.792  1.00 51.57           C  
ATOM   2463  CG1 VAL A 422      64.003 -39.733   8.560  1.00 51.68           C  
ATOM   2464  CG2 VAL A 422      65.379 -41.641   7.707  1.00 51.56           C  
ATOM   2465  N   THR A 423      63.209 -40.874  11.666  1.00 51.79           N  
ATOM   2466  CA  THR A 423      62.463 -40.115  12.659  1.00 52.14           C  
ATOM   2467  C   THR A 423      63.240 -40.027  13.969  1.00 56.98           C  
ATOM   2468  O   THR A 423      63.208 -39.006  14.656  1.00 57.29           O  
ATOM   2469  CB  THR A 423      61.078 -40.736  12.919  1.00 52.95           C  
ATOM   2470  OG1 THR A 423      60.370 -40.866  11.680  1.00 51.25           O  
ATOM   2471  CG2 THR A 423      60.265 -39.867  13.867  1.00 57.08           C  
ATOM   2472  N   LEU A 424      63.953 -41.099  14.304  1.00 50.67           N  
ATOM   2473  CA  LEU A 424      64.723 -41.150  15.542  1.00 59.73           C  
ATOM   2474  C   LEU A 424      65.877 -40.149  15.520  1.00 53.13           C  
ATOM   2475  O   LEU A 424      65.970 -39.279  16.387  1.00 54.87           O  
ATOM   2476  CB  LEU A 424      65.259 -42.563  15.780  1.00 57.68           C  
ATOM   2477  CG  LEU A 424      65.303 -43.081  17.222  1.00 51.75           C  
ATOM   2478  CD1 LEU A 424      65.803 -44.517  17.244  1.00 58.22           C  
ATOM   2479  CD2 LEU A 424      66.163 -42.202  18.121  1.00 58.06           C  
ATOM   2480  N   ALA A 425      66.755 -40.284  14.532  1.00 50.05           N  
ATOM   2481  CA  ALA A 425      67.909 -39.397  14.404  1.00 51.32           C  
ATOM   2482  C   ALA A 425      67.464 -37.954  14.176  1.00 52.93           C  
ATOM   2483  O   ALA A 425      68.071 -37.008  14.692  1.00 55.63           O  
ATOM   2484  CB  ALA A 425      68.811 -39.860  13.273  1.00 58.03           C  
ATOM   2485  N   GLY A 426      66.400 -37.800  13.396  1.00 58.53           N  
ATOM   2486  CA  GLY A 426      65.803 -36.505  13.144  1.00 59.95           C  
ATOM   2487  C   GLY A 426      65.361 -35.860  14.439  1.00 53.57           C  
ATOM   2488  O   GLY A 426      65.548 -34.664  14.635  1.00 55.38           O  
ATOM   2489  N   MET A 427      64.782 -36.657  15.330  1.00 51.04           N  
ATOM   2490  CA  MET A 427      64.380 -36.166  16.642  1.00 58.08           C  
ATOM   2491  C   MET A 427      65.590 -35.900  17.534  1.00 56.33           C  
ATOM   2492  O   MET A 427      65.527 -35.079  18.449  1.00 59.04           O  
ATOM   2493  CB  MET A 427      63.440 -37.159  17.328  1.00 57.69           C  
ATOM   2494  CG  MET A 427      62.003 -37.091  16.840  1.00 54.46           C  
ATOM   2495  SD  MET A 427      60.934 -38.221  17.743  1.00 55.31           S  
ATOM   2496  CE  MET A 427      61.212 -37.676  19.425  1.00 58.51           C  
ATOM   2497  N   LEU A 428      66.689 -36.595  17.266  1.00 56.92           N  
ATOM   2498  CA  LEU A 428      67.902 -36.409  18.056  1.00 54.13           C  
ATOM   2499  C   LEU A 428      68.584 -35.082  17.743  1.00 55.54           C  
ATOM   2500  O   LEU A 428      69.009 -34.371  18.654  1.00 50.49           O  
ATOM   2501  CB  LEU A 428      68.875 -37.567  17.823  1.00 52.80           C  
ATOM   2502  CG  LEU A 428      68.547 -38.858  18.576  1.00 59.50           C  
ATOM   2503  CD1 LEU A 428      69.547 -39.947  18.231  1.00 53.30           C  
ATOM   2504  CD2 LEU A 428      68.525 -38.604  20.075  1.00 53.23           C  
ATOM   2505  N   GLU A 429      68.685 -34.745  16.460  1.00 53.67           N  
ATOM   2506  CA  GLU A 429      69.354 -33.508  16.061  1.00 54.27           C  
ATOM   2507  C   GLU A 429      68.443 -32.292  16.231  1.00 54.53           C  
ATOM   2508  O   GLU A 429      68.914 -31.161  16.338  1.00 56.38           O  
ATOM   2509  CB  GLU A 429      69.831 -33.603  14.610  1.00 54.65           C  
ATOM   2510  CG  GLU A 429      70.779 -32.490  14.192  1.00 56.20           C  
ATOM   2511  CD  GLU A 429      71.078 -32.504  12.708  1.00 52.61           C  
ATOM   2512  OE1 GLU A 429      70.424 -33.276  11.977  1.00 59.02           O  
ATOM   2513  OE2 GLU A 429      71.969 -31.745  12.269  1.00 50.98           O  
ATOM   2514  N   MET A 430      67.138 -32.532  16.264  1.00 50.47           N  
ATOM   2515  CA  MET A 430      66.167 -31.447  16.348  1.00 51.35           C  
ATOM   2516  C   MET A 430      66.096 -30.861  17.756  1.00 54.83           C  
ATOM   2517  O   MET A 430      65.512 -29.798  17.966  1.00 56.38           O  
ATOM   2518  CB  MET A 430      64.788 -31.946  15.911  1.00 59.79           C  
ATOM   2519  CG  MET A 430      63.864 -30.875  15.361  1.00 50.19           C  
ATOM   2520  SD  MET A 430      62.576 -31.583  14.317  1.00 58.06           S  
ATOM   2521  CE  MET A 430      61.916 -32.845  15.401  1.00 50.82           C  
ATOM   2522  N   GLY A 431      66.700 -31.554  18.716  1.00 59.75           N  
ATOM   2523  CA  GLY A 431      66.656 -31.129  20.102  1.00 52.86           C  
ATOM   2524  C   GLY A 431      67.865 -30.324  20.538  1.00 55.58           C  
ATOM   2525  O   GLY A 431      67.838 -29.675  21.582  1.00 58.26           O  
ATOM   2526  N   VAL A 432      68.928 -30.364  19.738  1.00 54.63           N  
ATOM   2527  CA  VAL A 432      70.165 -29.669  20.080  1.00 57.66           C  
ATOM   2528  C   VAL A 432      70.332 -28.364  19.301  1.00 59.18           C  
ATOM   2529  O   VAL A 432      71.352 -28.142  18.647  1.00 53.52           O  
ATOM   2530  CB  VAL A 432      71.397 -30.568  19.838  1.00 54.11           C  
ATOM   2531  CG1 VAL A 432      71.542 -31.577  20.964  1.00 59.08           C  
ATOM   2532  CG2 VAL A 432      71.283 -31.284  18.500  1.00 50.13           C  
ATOM   2533  N   SER A 433      69.329 -27.497  19.389  1.00 58.54           N  
ATOM   2534  CA  SER A 433      69.369 -26.201  18.722  1.00 52.79           C  
ATOM   2535  C   SER A 433      70.309 -25.233  19.443  1.00 58.22           C  
ATOM   2536  O   SER A 433      70.700 -25.478  20.584  1.00 62.56           O  
ATOM   2537  CB  SER A 433      67.962 -25.613  18.632  1.00 51.74           C  
ATOM   2538  OG  SER A 433      67.287 -25.731  19.874  1.00 58.11           O  
ATOM   2539  N   TYR A 434      70.665 -24.133  18.782  1.00 55.11           N  
ATOM   2540  CA  TYR A 434      71.690 -23.230  19.301  1.00 59.78           C  
ATOM   2541  C   TYR A 434      71.578 -21.823  18.715  1.00 58.38           C  
ATOM   2542  O   TYR A 434      71.618 -21.647  17.498  1.00 57.17           O  
ATOM   2543  CB  TYR A 434      73.076 -23.811  19.011  1.00 52.03           C  
ATOM   2544  CG  TYR A 434      74.234 -23.035  19.593  1.00 54.51           C  
ATOM   2545  CD1 TYR A 434      74.656 -23.256  20.898  1.00 58.03           C  
ATOM   2546  CD2 TYR A 434      74.924 -22.103  18.833  1.00 55.01           C  
ATOM   2547  CE1 TYR A 434      75.722 -22.557  21.434  1.00 51.77           C  
ATOM   2548  CE2 TYR A 434      75.991 -21.399  19.358  1.00 59.25           C  
ATOM   2549  CZ  TYR A 434      76.385 -21.630  20.659  1.00 52.52           C  
ATOM   2550  OH  TYR A 434      77.449 -20.933  21.189  1.00 55.66           O  
ATOM   2551  N   LEU A 435      71.450 -20.822  19.584  1.00 53.63           N  
ATOM   2552  CA  LEU A 435      71.338 -19.438  19.128  1.00 53.35           C  
ATOM   2553  C   LEU A 435      72.438 -18.543  19.696  1.00 57.39           C  
ATOM   2554  O   LEU A 435      72.375 -18.141  20.854  1.00 51.24           O  
ATOM   2555  CB  LEU A 435      69.969 -18.867  19.498  1.00 52.14           C  
ATOM   2556  CG  LEU A 435      68.763 -19.539  18.845  1.00 58.54           C  
ATOM   2557  CD1 LEU A 435      67.477 -18.848  19.270  1.00 58.11           C  
ATOM   2558  CD2 LEU A 435      68.904 -19.534  17.332  1.00 55.71           C  
ATOM   2559  N   PRO A 436      73.443 -18.215  18.871  1.00 56.66           N  
ATOM   2560  CA  PRO A 436      74.559 -17.354  19.283  1.00 50.70           C  
ATOM   2561  C   PRO A 436      74.184 -15.872  19.317  1.00 50.29           C  
ATOM   2562  O   PRO A 436      73.581 -15.371  18.368  1.00 56.88           O  
ATOM   2563  CB  PRO A 436      75.613 -17.622  18.211  1.00 50.29           C  
ATOM   2564  CG  PRO A 436      74.819 -17.967  17.001  1.00 55.07           C  
ATOM   2565  CD  PRO A 436      73.614 -18.716  17.497  1.00 53.30           C  
ATOM   2566  N   VAL A 437      74.543 -15.186  20.397  1.00 57.07           N  
ATOM   2567  CA  VAL A 437      74.211 -13.773  20.560  1.00 55.15           C  
ATOM   2568  C   VAL A 437      75.327 -12.987  21.247  1.00 56.12           C  
ATOM   2569  O   VAL A 437      76.368 -13.542  21.604  1.00 58.11           O  
ATOM   2570  CB  VAL A 437      72.916 -13.589  21.372  1.00 54.06           C  
ATOM   2571  CG1 VAL A 437      71.696 -13.935  20.533  1.00 51.47           C  
ATOM   2572  CG2 VAL A 437      72.960 -14.440  22.627  1.00 56.28           C  
ATOM   2573  N   ASN A 438      75.095 -11.689  21.436  1.00 65.04           N  
ATOM   2574  CA  ASN A 438      76.064 -10.806  22.077  1.00 65.10           C  
ATOM   2575  C   ASN A 438      75.385  -9.673  22.848  1.00 63.31           C  
ATOM   2576  O   ASN A 438      74.204  -9.764  23.180  1.00 62.42           O  
ATOM   2577  CB  ASN A 438      77.029 -10.235  21.037  1.00 65.03           C  
ATOM   2578  CG  ASN A 438      76.330  -9.835  19.754  1.00 63.23           C  
ATOM   2579  OD1 ASN A 438      75.143  -9.513  19.755  1.00 61.59           O  
ATOM   2580  ND2 ASN A 438      77.065  -9.861  18.647  1.00 63.27           N  
ATOM   2581  N   GLN A 439      76.132  -8.608  23.130  1.00 70.69           N  
ATOM   2582  CA  GLN A 439      75.627  -7.479  23.916  1.00 69.21           C  
ATOM   2583  C   GLN A 439      74.473  -6.760  23.215  1.00 67.34           C  
ATOM   2584  O   GLN A 439      73.628  -6.114  23.858  1.00 66.14           O  
ATOM   2585  CB  GLN A 439      76.756  -6.486  24.209  1.00 69.70           C  
ATOM   2586  CG  GLN A 439      77.395  -5.856  22.974  1.00 69.81           C  
ATOM   2587  CD  GLN A 439      78.385  -6.775  22.280  1.00 71.30           C  
ATOM   2588  OE1 GLN A 439      78.738  -7.834  22.801  1.00 70.27           O  
ATOM   2589  NE2 GLN A 439      78.835  -6.375  21.098  1.00 72.14           N  
ATOM   2590  N   ASN A 440      74.439  -6.885  21.892  1.00 56.46           N  
ATOM   2591  CA  ASN A 440      73.380  -6.300  21.085  1.00 54.71           C  
ATOM   2592  C   ASN A 440      72.008  -6.823  21.503  1.00 54.09           C  
ATOM   2593  O   ASN A 440      70.991  -6.178  21.264  1.00 52.61           O  
ATOM   2594  CB  ASN A 440      73.628  -6.578  19.604  1.00 54.42           C  
ATOM   2595  CG  ASN A 440      74.940  -5.992  19.116  1.00 54.96           C  
ATOM   2596  OD1 ASN A 440      75.402  -4.966  19.618  1.00 54.87           O  
ATOM   2597  ND2 ASN A 440      75.550  -6.642  18.132  1.00 55.39           N  
ATOM   2598  N   TRP A 441      71.993  -7.996  22.131  1.00 47.12           N  
ATOM   2599  CA  TRP A 441      70.773  -8.551  22.700  1.00 45.36           C  
ATOM   2600  C   TRP A 441      70.269  -7.682  23.849  1.00 44.94           C  
ATOM   2601  O   TRP A 441      69.091  -7.323  23.899  1.00 43.35           O  
ATOM   2602  CB  TRP A 441      71.010  -9.980  23.187  1.00 45.70           C  
ATOM   2603  CG  TRP A 441      69.857 -10.555  23.938  1.00 44.91           C  
ATOM   2604  CD1 TRP A 441      69.705 -10.609  25.292  1.00 45.11           C  
ATOM   2605  CD2 TRP A 441      68.685 -11.151  23.377  1.00 43.75           C  
ATOM   2606  NE1 TRP A 441      68.510 -11.207  25.610  1.00 44.29           N  
ATOM   2607  CE2 TRP A 441      67.866 -11.548  24.452  1.00 43.46           C  
ATOM   2608  CE3 TRP A 441      68.250 -11.389  22.070  1.00 42.69           C  
ATOM   2609  CZ2 TRP A 441      66.635 -12.172  24.257  1.00 42.40           C  
ATOM   2610  CZ3 TRP A 441      67.029 -12.008  21.880  1.00 41.29           C  
ATOM   2611  CH2 TRP A 441      66.235 -12.391  22.967  1.00 41.29           C  
ATOM   2612  N   GLU A 442      71.170  -7.345  24.768  1.00 78.27           N  
ATOM   2613  CA  GLU A 442      70.823  -6.509  25.910  1.00 75.65           C  
ATOM   2614  C   GLU A 442      70.402  -5.121  25.432  1.00 77.10           C  
ATOM   2615  O   GLU A 442      69.428  -4.542  25.936  1.00 74.46           O  
ATOM   2616  CB  GLU A 442      72.000  -6.408  26.881  1.00 72.02           C  
ATOM   2617  CG  GLU A 442      71.601  -6.080  28.310  1.00 72.64           C  
ATOM   2618  CD  GLU A 442      70.887  -7.231  28.994  1.00 70.59           C  
ATOM   2619  OE1 GLU A 442      71.157  -8.398  28.638  1.00 73.04           O  
ATOM   2620  OE2 GLU A 442      70.055  -6.968  29.888  1.00 79.74           O  
ATOM   2621  N   ARG A 443      71.133  -4.599  24.449  1.00 74.83           N  
ATOM   2622  CA  ARG A 443      70.783  -3.312  23.849  1.00 73.21           C  
ATOM   2623  C   ARG A 443      69.384  -3.356  23.233  1.00 71.33           C  
ATOM   2624  O   ARG A 443      68.607  -2.411  23.367  1.00 72.51           O  
ATOM   2625  CB  ARG A 443      71.808  -2.905  22.787  1.00 72.76           C  
ATOM   2626  CG  ARG A 443      72.967  -2.063  23.315  1.00 75.56           C  
ATOM   2627  CD  ARG A 443      73.868  -2.857  24.252  1.00 77.87           C  
ATOM   2628  NE  ARG A 443      74.982  -2.057  24.757  1.00 80.15           N  
ATOM   2629  CZ  ARG A 443      76.157  -1.940  24.147  1.00 80.89           C  
ATOM   2630  NH1 ARG A 443      76.378  -2.572  23.002  1.00 77.74           N  
ATOM   2631  NH2 ARG A 443      77.114  -1.191  24.680  1.00 81.75           N  
ATOM   2632  N   TYR A 444      69.072  -4.465  22.568  1.00 51.36           N  
ATOM   2633  CA  TYR A 444      67.762  -4.672  21.955  1.00 50.50           C  
ATOM   2634  C   TYR A 444      66.654  -4.678  23.003  1.00 50.08           C  
ATOM   2635  O   TYR A 444      65.623  -4.029  22.828  1.00 59.21           O  
ATOM   2636  CB  TYR A 444      67.747  -5.984  21.165  1.00 50.97           C  
ATOM   2637  CG  TYR A 444      66.362  -6.509  20.847  1.00 50.22           C  
ATOM   2638  CD1 TYR A 444      65.588  -5.929  19.850  1.00 59.02           C  
ATOM   2639  CD2 TYR A 444      65.835  -7.596  21.534  1.00 50.83           C  
ATOM   2640  CE1 TYR A 444      64.323  -6.410  19.555  1.00 58.51           C  
ATOM   2641  CE2 TYR A 444      64.571  -8.085  21.246  1.00 50.21           C  
ATOM   2642  CZ  TYR A 444      63.820  -7.488  20.256  1.00 59.09           C  
ATOM   2643  OH  TYR A 444      62.563  -7.970  19.966  1.00 58.73           O  
ATOM   2644  N   LEU A 445      66.876  -5.418  24.085  1.00 50.43           N  
ATOM   2645  CA  LEU A 445      65.928  -5.459  25.193  1.00 59.90           C  
ATOM   2646  C   LEU A 445      65.661  -4.061  25.735  1.00 59.49           C  
ATOM   2647  O   LEU A 445      64.508  -3.645  25.865  1.00 58.77           O  
ATOM   2648  CB  LEU A 445      66.442  -6.364  26.315  1.00 50.66           C  
ATOM   2649  CG  LEU A 445      65.983  -7.824  26.338  1.00 50.93           C  
ATOM   2650  CD1 LEU A 445      66.244  -8.517  25.008  1.00 51.17           C  
ATOM   2651  CD2 LEU A 445      66.656  -8.576  27.480  1.00 52.12           C  
ATOM   2652  N   ALA A 446      66.737  -3.335  26.037  1.00 46.23           N  
ATOM   2653  CA  ALA A 446      66.617  -1.996  26.609  1.00 46.08           C  
ATOM   2654  C   ALA A 446      65.881  -1.026  25.684  1.00 45.60           C  
ATOM   2655  O   ALA A 446      64.953  -0.334  26.112  1.00 45.18           O  
ATOM   2656  CB  ALA A 446      67.993  -1.451  26.953  1.00 47.01           C  
ATOM   2657  N   GLU A 447      66.292  -0.980  24.418  1.00 55.51           N  
ATOM   2658  CA  GLU A 447      65.693  -0.060  23.453  1.00 55.01           C  
ATOM   2659  C   GLU A 447      64.227  -0.382  23.177  1.00 54.73           C  
ATOM   2660  O   GLU A 447      63.382   0.516  23.145  1.00 54.39           O  
ATOM   2661  CB  GLU A 447      66.479  -0.071  22.139  1.00 55.27           C  
ATOM   2662  CG  GLU A 447      67.866   0.550  22.231  1.00 55.64           C  
ATOM   2663  CD  GLU A 447      67.826   2.043  22.501  1.00 55.76           C  
ATOM   2664  OE1 GLU A 447      66.802   2.685  22.176  1.00 55.39           O  
ATOM   2665  OE2 GLU A 447      68.820   2.574  23.041  1.00 56.35           O  
ATOM   2666  N   ALA A 448      63.930  -1.662  22.973  1.00 57.45           N  
ATOM   2667  CA  ALA A 448      62.565  -2.086  22.687  1.00 57.38           C  
ATOM   2668  C   ALA A 448      61.649  -1.811  23.875  1.00 57.00           C  
ATOM   2669  O   ALA A 448      60.531  -1.319  23.705  1.00 56.94           O  
ATOM   2670  CB  ALA A 448      62.530  -3.556  22.317  1.00 57.83           C  
ATOM   2671  N   GLN A 449      62.127  -2.122  25.077  1.00 62.46           N  
ATOM   2672  CA  GLN A 449      61.343  -1.877  26.281  1.00 61.89           C  
ATOM   2673  C   GLN A 449      61.113  -0.383  26.484  1.00 61.41           C  
ATOM   2674  O   GLN A 449      60.032   0.037  26.900  1.00 61.04           O  
ATOM   2675  CB  GLN A 449      62.029  -2.478  27.508  1.00 62.11           C  
ATOM   2676  CG  GLN A 449      61.202  -2.395  28.783  1.00 61.72           C  
ATOM   2677  CD  GLN A 449      59.951  -3.254  28.729  1.00 61.61           C  
ATOM   2678  OE1 GLN A 449      59.864  -4.201  27.945  1.00 62.08           O  
ATOM   2679  NE2 GLN A 449      58.973  -2.926  29.564  1.00 61.15           N  
ATOM   2680  N   GLY A 450      62.134   0.415  26.185  1.00 53.15           N  
ATOM   2681  CA  GLY A 450      62.019   1.859  26.273  1.00 53.53           C  
ATOM   2682  C   GLY A 450      60.961   2.395  25.328  1.00 53.81           C  
ATOM   2683  O   GLY A 450      60.085   3.161  25.735  1.00 53.98           O  
ATOM   2684  N   THR A 451      61.042   1.985  24.065  1.00 44.78           N  
ATOM   2685  CA  THR A 451      60.068   2.385  23.054  1.00 45.25           C  
ATOM   2686  C   THR A 451      58.650   2.002  23.472  1.00 45.32           C  
ATOM   2687  O   THR A 451      57.724   2.816  23.394  1.00 46.01           O  
ATOM   2688  CB  THR A 451      60.381   1.744  21.689  1.00 45.12           C  
ATOM   2689  OG1 THR A 451      61.713   2.084  21.287  1.00 45.76           O  
ATOM   2690  CG2 THR A 451      59.402   2.231  20.637  1.00 45.46           C  
ATOM   2691  N   TYR A 452      58.497   0.759  23.921  1.00 49.54           N  
ATOM   2692  CA  TYR A 452      57.208   0.251  24.381  1.00 49.41           C  
ATOM   2693  C   TYR A 452      56.646   1.098  25.518  1.00 49.20           C  
ATOM   2694  O   TYR A 452      55.481   1.493  25.489  1.00 49.77           O  
ATOM   2695  CB  TYR A 452      57.339  -1.207  24.826  1.00 48.46           C  
ATOM   2696  CG  TYR A 452      56.086  -1.792  25.441  1.00 47.96           C  
ATOM   2697  CD1 TYR A 452      55.943  -1.880  26.820  1.00 46.96           C  
ATOM   2698  CD2 TYR A 452      55.050  -2.262  24.645  1.00 48.99           C  
ATOM   2699  CE1 TYR A 452      54.803  -2.416  27.389  1.00 46.58           C  
ATOM   2700  CE2 TYR A 452      53.906  -2.800  25.204  1.00 48.79           C  
ATOM   2701  CZ  TYR A 452      53.789  -2.875  26.577  1.00 47.41           C  
ATOM   2702  OH  TYR A 452      52.652  -3.409  27.139  1.00 47.22           O  
ATOM   2703  N   GLU A 453      57.480   1.379  26.514  1.00 59.81           N  
ATOM   2704  CA  GLU A 453      57.057   2.189  27.651  1.00 60.13           C  
ATOM   2705  C   GLU A 453      56.684   3.604  27.226  1.00 61.60           C  
ATOM   2706  O   GLU A 453      55.798   4.221  27.816  1.00 63.33           O  
ATOM   2707  CB  GLU A 453      58.153   2.235  28.714  1.00 59.57           C  
ATOM   2708  CG  GLU A 453      58.313   0.944  29.493  1.00 61.98           C  
ATOM   2709  CD  GLU A 453      59.384   1.043  30.558  1.00 62.20           C  
ATOM   2710  OE1 GLU A 453      59.515   0.095  31.360  1.00 60.53           O  
ATOM   2711  OE2 GLU A 453      60.093   2.070  30.594  1.00 61.64           O  
ATOM   2712  N   GLU A 454      57.362   4.115  26.204  1.00 95.86           N  
ATOM   2713  CA  GLU A 454      57.066   5.452  25.697  1.00 93.17           C  
ATOM   2714  C   GLU A 454      55.709   5.498  25.007  1.00 93.29           C  
ATOM   2715  O   GLU A 454      54.868   6.335  25.336  1.00 93.71           O  
ATOM   2716  CB  GLU A 454      58.157   5.919  24.733  1.00 96.21           C  
ATOM   2717  CG  GLU A 454      59.455   6.306  25.416  1.00 94.77           C  
ATOM   2718  CD  GLU A 454      59.262   7.397  26.452  1.00 95.11           C  
ATOM   2719  OE1 GLU A 454      59.900   7.320  27.523  1.00 98.90           O  
ATOM   2720  OE2 GLU A 454      58.476   8.333  26.195  1.00 97.45           O  
ATOM   2721  N   LEU A 455      55.501   4.601  24.049  1.00 57.44           N  
ATOM   2722  CA  LEU A 455      54.236   4.551  23.323  1.00 58.46           C  
ATOM   2723  C   LEU A 455      53.067   4.283  24.268  1.00 58.63           C  
ATOM   2724  O   LEU A 455      51.996   4.885  24.138  1.00 59.56           O  
ATOM   2725  CB  LEU A 455      54.291   3.485  22.230  1.00 58.26           C  
ATOM   2726  CG  LEU A 455      55.275   3.771  21.093  1.00 57.74           C  
ATOM   2727  CD1 LEU A 455      55.243   2.662  20.056  1.00 57.30           C  
ATOM   2728  CD2 LEU A 455      54.972   5.115  20.455  1.00 58.18           C  
ATOM   2729  N   GLN A 456      53.281   3.385  25.225  1.00 53.21           N  
ATOM   2730  CA  GLN A 456      52.256   3.090  26.220  1.00 52.36           C  
ATOM   2731  C   GLN A 456      51.992   4.311  27.093  1.00 51.76           C  
ATOM   2732  O   GLN A 456      50.851   4.575  27.475  1.00 51.76           O  
ATOM   2733  CB  GLN A 456      52.663   1.900  27.088  1.00 54.75           C  
ATOM   2734  CG  GLN A 456      51.592   1.478  28.078  1.00 52.24           C  
ATOM   2735  CD  GLN A 456      52.026   0.331  28.966  1.00 51.48           C  
ATOM   2736  OE1 GLN A 456      53.173  -0.115  28.907  1.00 50.96           O  
ATOM   2737  NE2 GLN A 456      51.111  -0.156  29.795  1.00 52.06           N  
ATOM   2738  N   ARG A 457      53.052   5.053  27.402  1.00 62.65           N  
ATOM   2739  CA  ARG A 457      52.925   6.283  28.173  1.00 64.63           C  
ATOM   2740  C   ARG A 457      52.042   7.283  27.436  1.00 66.03           C  
ATOM   2741  O   ARG A 457      51.141   7.876  28.027  1.00 67.36           O  
ATOM   2742  CB  ARG A 457      54.296   6.899  28.453  1.00 64.54           C  
ATOM   2743  CG  ARG A 457      54.246   8.187  29.261  1.00 66.27           C  
ATOM   2744  CD  ARG A 457      55.601   8.882  29.289  1.00 65.75           C  
ATOM   2745  NE  ARG A 457      56.111   9.133  27.943  1.00 65.26           N  
ATOM   2746  CZ  ARG A 457      55.747  10.161  27.184  1.00 66.10           C  
ATOM   2747  NH1 ARG A 457      54.861  11.040  27.631  1.00 66.34           N  
ATOM   2748  NH2 ARG A 457      56.266  10.307  25.971  1.00 67.05           N  
ATOM   2749  N   GLU A 458      52.304   7.459  26.142  1.00 62.59           N  
ATOM   2750  CA  GLU A 458      51.517   8.361  25.304  1.00 63.62           C  
ATOM   2751  C   GLU A 458      50.047   7.951  25.251  1.00 64.67           C  
ATOM   2752  O   GLU A 458      49.151   8.760  25.520  1.00 60.17           O  
ATOM   2753  CB  GLU A 458      52.091   8.409  23.885  1.00 63.79           C  
ATOM   2754  CG  GLU A 458      51.183   9.089  22.872  1.00 64.21           C  
ATOM   2755  CD  GLU A 458      51.737   9.043  21.460  1.00 66.59           C  
ATOM   2756  OE1 GLU A 458      52.932   8.714  21.297  1.00 67.75           O  
ATOM   2757  OE2 GLU A 458      50.976   9.335  20.513  1.00 66.00           O  
ATOM   2758  N   MET A 459      49.813   6.687  24.902  1.00 64.04           N  
ATOM   2759  CA  MET A 459      48.460   6.152  24.790  1.00 66.58           C  
ATOM   2760  C   MET A 459      47.668   6.313  26.082  1.00 65.92           C  
ATOM   2761  O   MET A 459      46.571   6.881  26.085  1.00 66.19           O  
ATOM   2762  CB  MET A 459      48.506   4.677  24.399  1.00 66.81           C  
ATOM   2763  CG  MET A 459      47.161   3.984  24.478  1.00 65.78           C  
ATOM   2764  SD  MET A 459      47.326   2.192  24.469  1.00 67.08           S  
ATOM   2765  CE  MET A 459      48.290   1.932  25.958  1.00 66.26           C  
ATOM   2766  N   LYS A 460      48.230   5.816  27.180  1.00 50.15           N  
ATOM   2767  CA  LYS A 460      47.566   5.895  28.476  1.00 58.69           C  
ATOM   2768  C   LYS A 460      47.377   7.342  28.922  1.00 59.03           C  
ATOM   2769  O   LYS A 460      46.417   7.653  29.622  1.00 58.56           O  
ATOM   2770  CB  LYS A 460      48.352   5.117  29.535  1.00 57.07           C  
ATOM   2771  CG  LYS A 460      48.358   3.612  29.324  1.00 56.64           C  
ATOM   2772  CD  LYS A 460      48.024   2.869  30.609  1.00 55.76           C  
ATOM   2773  CE  LYS A 460      49.013   3.198  31.716  1.00 55.99           C  
ATOM   2774  NZ  LYS A 460      48.693   2.465  32.974  1.00 54.73           N  
ATOM   2775  N   LYS A 461      48.289   8.221  28.513  1.00 75.61           N  
ATOM   2776  CA  LYS A 461      48.175   9.639  28.839  1.00 76.82           C  
ATOM   2777  C   LYS A 461      46.957  10.242  28.150  1.00 76.26           C  
ATOM   2778  O   LYS A 461      46.157  10.941  28.775  1.00 78.33           O  
ATOM   2779  CB  LYS A 461      49.437  10.401  28.430  1.00 77.25           C  
ATOM   2780  CG  LYS A 461      49.587  11.764  29.087  1.00 76.22           C  
ATOM   2781  CD  LYS A 461      49.834  11.623  30.581  1.00 75.76           C  
ATOM   2782  CE  LYS A 461      50.104  12.968  31.230  1.00 76.19           C  
ATOM   2783  NZ  LYS A 461      50.398  12.826  32.682  1.00 75.20           N  
ATOM   2784  N   SER A 462      46.822   9.964  26.855  1.00 53.74           N  
ATOM   2785  CA  SER A 462      45.683  10.453  26.087  1.00 53.42           C  
ATOM   2786  C   SER A 462      44.368   9.903  26.635  1.00 52.57           C  
ATOM   2787  O   SER A 462      43.405  10.649  26.842  1.00 52.38           O  
ATOM   2788  CB  SER A 462      45.832  10.080  24.611  1.00 53.59           C  
ATOM   2789  OG  SER A 462      44.722  10.533  23.855  1.00 53.57           O  
ATOM   2790  N   LEU A 463      44.336   8.596  26.878  1.00 58.48           N  
ATOM   2791  CA  LEU A 463      43.125   7.941  27.364  1.00 57.39           C  
ATOM   2792  C   LEU A 463      42.705   8.428  28.749  1.00 56.77           C  
ATOM   2793  O   LEU A 463      41.519   8.641  29.001  1.00 56.47           O  
ATOM   2794  CB  LEU A 463      43.314   6.424  27.386  1.00 56.42           C  
ATOM   2795  CG  LEU A 463      42.756   5.647  26.192  1.00 56.75           C  
ATOM   2796  CD1 LEU A 463      43.393   6.108  24.888  1.00 58.18           C  
ATOM   2797  CD2 LEU A 463      42.958   4.156  26.395  1.00 55.68           C  
ATOM   2798  N   MET A 464      43.670   8.603  29.646  1.00 69.98           N  
ATOM   2799  CA  MET A 464      43.352   9.083  30.985  1.00 69.27           C  
ATOM   2800  C   MET A 464      42.969  10.557  30.931  1.00 62.74           C  
ATOM   2801  O   MET A 464      42.215  11.041  31.774  1.00 69.62           O  
ATOM   2802  CB  MET A 464      44.524   8.857  31.947  1.00 61.73           C  
ATOM   2803  CG  MET A 464      45.711   9.784  31.749  1.00 65.17           C  
ATOM   2804  SD  MET A 464      47.193   9.162  32.569  1.00 69.77           S  
ATOM   2805  CE  MET A 464      46.738   9.345  34.290  1.00 60.01           C  
ATOM   2806  N   ASP A 465      43.483  11.265  29.928  1.00 64.04           N  
ATOM   2807  CA  ASP A 465      43.087  12.650  29.699  1.00 66.66           C  
ATOM   2808  C   ASP A 465      41.621  12.716  29.282  1.00 63.51           C  
ATOM   2809  O   ASP A 465      40.874  13.584  29.735  1.00 62.21           O  
ATOM   2810  CB  ASP A 465      43.970  13.305  28.636  1.00 65.91           C  
ATOM   2811  CG  ASP A 465      43.473  14.681  28.235  1.00 65.03           C  
ATOM   2812  OD1 ASP A 465      42.777  14.786  27.204  1.00 65.89           O  
ATOM   2813  OD2 ASP A 465      43.776  15.655  28.955  1.00 67.62           O  
ATOM   2814  N   LEU A 466      41.218  11.791  28.415  1.00 56.02           N  
ATOM   2815  CA  LEU A 466      39.823  11.687  28.001  1.00 55.73           C  
ATOM   2816  C   LEU A 466      38.930  11.269  29.166  1.00 54.94           C  
ATOM   2817  O   LEU A 466      37.783  11.702  29.267  1.00 54.83           O  
ATOM   2818  CB  LEU A 466      39.675  10.691  26.850  1.00 55.98           C  
ATOM   2819  CG  LEU A 466      39.594  11.266  25.435  1.00 56.87           C  
ATOM   2820  CD1 LEU A 466      38.401  12.200  25.311  1.00 57.00           C  
ATOM   2821  CD2 LEU A 466      40.883  11.979  25.061  1.00 57.29           C  
ATOM   2822  N   ALA A 467      39.467  10.424  30.040  1.00 55.13           N  
ATOM   2823  CA  ALA A 467      38.712   9.908  31.177  1.00 54.60           C  
ATOM   2824  C   ALA A 467      38.556  10.951  32.282  1.00 53.85           C  
ATOM   2825  O   ALA A 467      37.604  10.902  33.061  1.00 53.53           O  
ATOM   2826  CB  ALA A 467      39.380   8.657  31.728  1.00 54.26           C  
ATOM   2827  N   ASN A 468      39.494  11.888  32.350  1.00 57.41           N  
ATOM   2828  CA  ASN A 468      39.451  12.934  33.367  1.00 50.34           C  
ATOM   2829  C   ASN A 468      38.454  14.036  33.030  1.00 59.75           C  
ATOM   2830  O   ASN A 468      37.711  14.499  33.895  1.00 57.48           O  
ATOM   2831  CB  ASN A 468      40.842  13.541  33.565  1.00 58.46           C  
ATOM   2832  CG  ASN A 468      41.764  12.636  34.359  1.00 58.38           C  
ATOM   2833  OD1 ASN A 468      41.314  11.866  35.205  1.00 58.26           O  
ATOM   2834  ND2 ASN A 468      43.060  12.729  34.088  1.00 58.36           N  
ATOM   2835  N   ASP A 469      38.440  14.450  31.767  1.00 68.34           N  
ATOM   2836  CA  ASP A 469      37.574  15.538  31.330  1.00 69.10           C  
ATOM   2837  C   ASP A 469      36.130  15.085  31.136  1.00 67.11           C  
ATOM   2838  O   ASP A 469      35.234  15.906  30.943  1.00 68.12           O  
ATOM   2839  CB  ASP A 469      38.110  16.156  30.037  1.00 67.42           C  
ATOM   2840  CG  ASP A 469      39.374  16.962  30.262  1.00 68.03           C  
ATOM   2841  OD1 ASP A 469      39.547  17.482  31.384  1.00 66.77           O  
ATOM   2842  OD2 ASP A 469      40.191  17.080  29.323  1.00 70.16           O  
ATOM   2843  N   ALA A 470      35.911  13.776  31.188  1.00 51.21           N  
ATOM   2844  CA  ALA A 470      34.566  13.226  31.070  1.00 59.86           C  
ATOM   2845  C   ALA A 470      33.961  12.985  32.450  1.00 50.57           C  
ATOM   2846  O   ALA A 470      32.785  12.657  32.576  1.00 59.88           O  
ATOM   2847  CB  ALA A 470      34.586  11.938  30.265  1.00 50.07           C  
ATOM   2848  N   CYS A 471      34.779  13.158  33.483  1.00 58.33           N  
ATOM   2849  CA  CYS A 471      34.346  12.926  34.855  1.00 59.36           C  
ATOM   2850  C   CYS A 471      33.641  14.154  35.423  1.00 59.26           C  
ATOM   2851  O   CYS A 471      33.037  14.097  36.493  1.00 59.19           O  
ATOM   2852  CB  CYS A 471      35.544  12.549  35.731  1.00 57.93           C  
ATOM   2853  SG  CYS A 471      35.144  12.063  37.429  1.00 59.55           S  
ATOM   2854  N   GLN A 472      33.714  15.263  34.694  1.00 63.23           N  
ATOM   2855  CA  GLN A 472      33.181  16.530  35.179  1.00 63.22           C  
ATOM   2856  C   GLN A 472      31.662  16.625  35.044  1.00 63.31           C  
ATOM   2857  O   GLN A 472      31.024  17.416  35.738  1.00 62.33           O  
ATOM   2858  CB  GLN A 472      33.836  17.697  34.437  1.00 62.78           C  
ATOM   2859  CG  GLN A 472      33.453  17.798  32.970  1.00 62.88           C  
ATOM   2860  CD  GLN A 472      34.220  18.883  32.244  1.00 65.05           C  
ATOM   2861  OE1 GLN A 472      35.360  19.191  32.592  1.00 62.95           O  
ATOM   2862  NE2 GLN A 472      33.597  19.476  31.233  1.00 62.35           N  
ATOM   2863  N   LEU A 473      31.086  15.819  34.158  1.00 51.64           N  
ATOM   2864  CA  LEU A 473      29.647  15.870  33.919  1.00 52.24           C  
ATOM   2865  C   LEU A 473      28.872  14.972  34.884  1.00 52.34           C  
ATOM   2866  O   LEU A 473      27.874  14.354  34.513  1.00 53.27           O  
ATOM   2867  CB  LEU A 473      29.330  15.496  32.467  1.00 53.46           C  
ATOM   2868  CG  LEU A 473      30.062  14.332  31.794  1.00 53.96           C  
ATOM   2869  CD1 LEU A 473      29.446  12.989  32.154  1.00 54.40           C  
ATOM   2870  CD2 LEU A 473      30.081  14.523  30.284  1.00 54.97           C  
ATOM   2871  N   LEU A 474      29.337  14.913  36.127  1.00 60.98           N  
ATOM   2872  CA  LEU A 474      28.626  14.203  37.180  1.00 62.91           C  
ATOM   2873  C   LEU A 474      27.658  15.162  37.863  1.00 61.40           C  
ATOM   2874  O   LEU A 474      26.591  14.762  38.327  1.00 61.17           O  
ATOM   2875  CB  LEU A 474      29.612  13.605  38.190  1.00 63.27           C  
ATOM   2876  CG  LEU A 474      29.085  12.700  39.310  1.00 62.51           C  
ATOM   2877  CD1 LEU A 474      28.687  13.492  40.553  1.00 69.77           C  
ATOM   2878  CD2 LEU A 474      27.935  11.823  38.819  1.00 63.64           C  
ATOM   2879  N   SER A 475      28.042  16.433  37.918  1.00 87.23           N  
ATOM   2880  CA  SER A 475      27.207  17.465  38.518  1.00 85.76           C  
ATOM   2881  C   SER A 475      26.640  18.399  37.450  1.00 87.96           C  
ATOM   2882  O   SER A 475      27.391  19.081  36.754  1.00 85.93           O  
ATOM   2883  CB  SER A 475      28.003  18.266  39.551  1.00 87.28           C  
ATOM   2884  OG  SER A 475      27.212  19.290  40.127  1.00 83.12           O  
ATOM   2885  N   GLY A 476      25.317  18.427  37.326  1.00 80.49           N  
ATOM   2886  CA  GLY A 476      24.444  17.619  38.160  1.00 82.53           C  
ATOM   2887  C   GLY A 476      23.489  16.758  37.354  1.00 83.43           C  
ATOM   2888  O   GLY A 476      22.574  17.272  36.710  1.00 83.85           O  
ATOM   2889  N   GLU A 477      23.716  15.446  37.394  1.00 74.31           N  
ATOM   2890  CA  GLU A 477      22.874  14.468  36.702  1.00 74.43           C  
ATOM   2891  C   GLU A 477      22.788  14.734  35.201  1.00 76.54           C  
ATOM   2892  O   GLU A 477      21.795  14.389  34.559  1.00 77.35           O  
ATOM   2893  CB  GLU A 477      21.467  14.445  37.309  1.00 76.01           C  
ATOM   2894  CG  GLU A 477      21.437  14.256  38.820  1.00 75.61           C  
ATOM   2895  CD  GLU A 477      21.904  12.877  39.252  1.00 72.25           C  
ATOM   2896  OE1 GLU A 477      21.807  11.930  38.442  1.00 73.35           O  
ATOM   2897  OE2 GLU A 477      22.365  12.739  40.404  1.00 71.65           O  
ATOM   2898  N   ARG A 478      23.831  15.343  34.647  1.00 73.16           N  
ATOM   2899  CA  ARG A 478      23.860  15.668  33.224  1.00 72.67           C  
ATOM   2900  C   ARG A 478      24.458  14.530  32.405  1.00 75.58           C  
ATOM   2901  O   ARG A 478      24.570  14.626  31.183  1.00 77.49           O  
ATOM   2902  CB  ARG A 478      24.647  16.960  32.985  1.00 71.19           C  
ATOM   2903  CG  ARG A 478      26.038  16.968  33.598  1.00 70.58           C  
ATOM   2904  CD  ARG A 478      26.859  18.168  33.138  1.00 71.14           C  
ATOM   2905  NE  ARG A 478      26.240  19.444  33.487  1.00 70.54           N  
ATOM   2906  CZ  ARG A 478      25.685  20.270  32.604  1.00 70.43           C  
ATOM   2907  NH1 ARG A 478      25.673  19.957  31.316  1.00 71.24           N  
ATOM   2908  NH2 ARG A 478      25.144  21.412  33.010  1.00 70.35           N  
ATOM   2909  N   TYR A 479      24.838  13.453  33.084  1.00 61.48           N  
ATOM   2910  CA  TYR A 479      25.413  12.293  32.411  1.00 60.61           C  
ATOM   2911  C   TYR A 479      24.342  11.495  31.675  1.00 61.95           C  
ATOM   2912  O   TYR A 479      24.642  10.740  30.751  1.00 65.03           O  
ATOM   2913  CB  TYR A 479      26.147  11.395  33.412  1.00 62.13           C  
ATOM   2914  CG  TYR A 479      25.296  10.916  34.570  1.00 60.18           C  
ATOM   2915  CD1 TYR A 479      25.322  11.573  35.793  1.00 61.54           C  
ATOM   2916  CD2 TYR A 479      24.476   9.802  34.443  1.00 62.52           C  
ATOM   2917  CE1 TYR A 479      24.550  11.137  36.855  1.00 69.62           C  
ATOM   2918  CE2 TYR A 479      23.701   9.359  35.500  1.00 62.45           C  
ATOM   2919  CZ  TYR A 479      23.742  10.029  36.702  1.00 60.96           C  
ATOM   2920  OH  TYR A 479      22.973   9.590  37.755  1.00 63.95           O  
ATOM   2921  N   LYS A 480      23.092  11.668  32.091  1.00 67.93           N  
ATOM   2922  CA  LYS A 480      21.972  10.946  31.498  1.00 69.15           C  
ATOM   2923  C   LYS A 480      21.750  11.350  30.044  1.00 60.52           C  
ATOM   2924  O   LYS A 480      21.148  10.609  29.269  1.00 61.75           O  
ATOM   2925  CB  LYS A 480      20.699  11.185  32.310  1.00 69.17           C  
ATOM   2926  CG  LYS A 480      20.841  10.864  33.787  1.00 67.97           C  
ATOM   2927  CD  LYS A 480      19.579  11.216  34.553  1.00 68.03           C  
ATOM   2928  CE  LYS A 480      19.726  10.888  36.028  1.00 66.94           C  
ATOM   2929  NZ  LYS A 480      20.028   9.446  36.243  1.00 66.97           N  
ATOM   2930  N   GLU A 481      22.239  12.532  29.684  1.00 75.94           N  
ATOM   2931  CA  GLU A 481      22.105  13.035  28.323  1.00 77.40           C  
ATOM   2932  C   GLU A 481      23.210  12.487  27.424  1.00 77.36           C  
ATOM   2933  O   GLU A 481      23.058  12.431  26.204  1.00 78.95           O  
ATOM   2934  CB  GLU A 481      22.123  14.556  28.315  1.00 76.83           C  
ATOM   2935  N   ASP A 482      24.320  12.086  28.037  1.00 62.11           N  
ATOM   2936  CA  ASP A 482      25.455  11.543  27.297  1.00 62.20           C  
ATOM   2937  C   ASP A 482      25.101  10.202  26.663  1.00 63.05           C  
ATOM   2938  O   ASP A 482      24.772   9.247  27.365  1.00 62.55           O  
ATOM   2939  CB  ASP A 482      26.663  11.399  28.207  1.00 60.72           C  
ATOM   2940  N   PRO A 483      25.170  10.130  25.324  1.00 55.01           N  
ATOM   2941  CA  PRO A 483      24.801   8.923  24.576  1.00 58.25           C  
ATOM   2942  C   PRO A 483      25.828   7.799  24.701  1.00 57.15           C  
ATOM   2943  O   PRO A 483      25.586   6.698  24.208  1.00 59.11           O  
ATOM   2944  CB  PRO A 483      24.715   9.425  23.132  1.00 60.48           C  
ATOM   2945  CG  PRO A 483      25.648  10.575  23.085  1.00 60.11           C  
ATOM   2946  CD  PRO A 483      25.572  11.232  24.433  1.00 55.55           C  
ATOM   2947  N   TRP A 484      26.954   8.075  25.350  1.00 56.74           N  
ATOM   2948  CA  TRP A 484      27.982   7.059  25.558  1.00 56.52           C  
ATOM   2949  C   TRP A 484      28.139   6.706  27.034  1.00 54.45           C  
ATOM   2950  O   TRP A 484      28.508   5.584  27.376  1.00 54.29           O  
ATOM   2951  CB  TRP A 484      29.327   7.528  25.001  1.00 55.06           C  
ATOM   2952  CG  TRP A 484      29.406   7.526  23.507  1.00 57.23           C  
ATOM   2953  CD1 TRP A 484      29.623   6.447  22.700  1.00 58.84           C  
ATOM   2954  CD2 TRP A 484      29.285   8.656  22.640  1.00 58.11           C  
ATOM   2955  NE1 TRP A 484      29.639   6.836  21.384  1.00 50.72           N  
ATOM   2956  CE2 TRP A 484      29.433   8.189  21.320  1.00 50.32           C  
ATOM   2957  CE3 TRP A 484      29.063  10.020  22.852  1.00 57.29           C  
ATOM   2958  CZ2 TRP A 484      29.364   9.037  20.216  1.00 51.74           C  
ATOM   2959  CZ3 TRP A 484      28.993  10.858  21.756  1.00 58.72           C  
ATOM   2960  CH2 TRP A 484      29.145  10.365  20.454  1.00 50.93           C  
ATOM   2961  N   LEU A 485      27.854   7.668  27.906  1.00 74.33           N  
ATOM   2962  CA  LEU A 485      28.117   7.502  29.331  1.00 72.34           C  
ATOM   2963  C   LEU A 485      26.842   7.538  30.168  1.00 72.78           C  
ATOM   2964  O   LEU A 485      26.453   8.590  30.672  1.00 70.21           O  
ATOM   2965  CB  LEU A 485      29.079   8.588  29.813  1.00 79.78           C  
ATOM   2966  CG  LEU A 485      30.281   8.865  28.907  1.00 79.24           C  
ATOM   2967  CD1 LEU A 485      31.108  10.016  29.455  1.00 70.20           C  
ATOM   2968  CD2 LEU A 485      31.132   7.617  28.738  1.00 70.28           C  
ATOM   2969  N   TRP A 486      26.201   6.384  30.320  1.00 67.39           N  
ATOM   2970  CA  TRP A 486      24.984   6.292  31.122  1.00 66.11           C  
ATOM   2971  C   TRP A 486      24.736   4.864  31.600  1.00 66.92           C  
ATOM   2972  O   TRP A 486      23.807   4.609  32.366  1.00 69.08           O  
ATOM   2973  CB  TRP A 486      23.779   6.801  30.327  1.00 69.10           C  
ATOM   2974  CG  TRP A 486      23.560   6.077  29.037  1.00 61.75           C  
ATOM   2975  CD1 TRP A 486      24.170   6.327  27.844  1.00 62.19           C  
ATOM   2976  CD2 TRP A 486      22.663   4.985  28.809  1.00 61.36           C  
ATOM   2977  NE1 TRP A 486      23.711   5.458  26.886  1.00 65.06           N  
ATOM   2978  CE2 TRP A 486      22.785   4.622  27.453  1.00 63.40           C  
ATOM   2979  CE3 TRP A 486      21.773   4.275  29.619  1.00 62.48           C  
ATOM   2980  CZ2 TRP A 486      22.047   3.583  26.889  1.00 64.66           C  
ATOM   2981  CZ3 TRP A 486      21.041   3.243  29.057  1.00 64.05           C  
ATOM   2982  CH2 TRP A 486      21.184   2.907  27.707  1.00 64.31           C  
ATOM   2983  N   ASP A 487      25.575   3.936  31.149  1.00 78.90           N  
ATOM   2984  CA  ASP A 487      25.444   2.535  31.531  1.00 78.40           C  
ATOM   2985  C   ASP A 487      26.146   2.245  32.851  1.00 78.20           C  
ATOM   2986  O   ASP A 487      25.699   1.405  33.631  1.00 77.38           O  
ATOM   2987  CB  ASP A 487      26.016   1.626  30.443  1.00 78.73           C  
ATOM   2988  CG  ASP A 487      25.417   1.899  29.081  1.00 79.05           C  
ATOM   2989  OD1 ASP A 487      24.285   2.417  29.021  1.00 71.02           O  
ATOM   2990  OD2 ASP A 487      26.080   1.590  28.072  1.00 70.82           O  
ATOM   2991  N   LEU A 488      27.247   2.947  33.092  1.00 77.60           N  
ATOM   2992  CA  LEU A 488      28.105   2.654  34.233  1.00 76.70           C  
ATOM   2993  C   LEU A 488      27.536   3.185  35.550  1.00 75.43           C  
ATOM   2994  O   LEU A 488      26.360   3.538  35.635  1.00 74.78           O  
ATOM   2995  CB  LEU A 488      29.525   3.201  33.998  1.00 75.75           C  
ATOM   2996  CG  LEU A 488      29.896   4.648  33.622  1.00 75.79           C  
ATOM   2997  CD1 LEU A 488      29.317   5.102  32.279  1.00 77.51           C  
ATOM   2998  CD2 LEU A 488      29.554   5.637  34.726  1.00 76.51           C  
ATOM   2999  N   GLU A 489      28.389   3.243  36.568  1.00 70.25           N  
ATOM   3000  CA  GLU A 489      27.955   3.469  37.943  1.00 78.76           C  
ATOM   3001  C   GLU A 489      27.463   4.889  38.231  1.00 70.69           C  
ATOM   3002  O   GLU A 489      26.290   5.088  38.552  1.00 70.12           O  
ATOM   3003  CB  GLU A 489      29.096   3.124  38.901  1.00 71.09           C  
ATOM   3004  CG  GLU A 489      29.999   1.998  38.411  1.00 79.13           C  
ATOM   3005  CD  GLU A 489      29.254   0.697  38.174  1.00 70.40           C  
ATOM   3006  OE1 GLU A 489      28.299   0.406  38.926  1.00 79.88           O  
ATOM   3007  OE2 GLU A 489      29.622  -0.035  37.232  1.00 71.97           O  
ATOM   3008  N   TRP A 490      28.366   5.862  38.118  1.00 63.75           N  
ATOM   3009  CA  TRP A 490      28.111   7.240  38.545  1.00 63.69           C  
ATOM   3010  C   TRP A 490      27.703   7.293  40.017  1.00 63.54           C  
ATOM   3011  O   TRP A 490      26.715   7.935  40.372  1.00 63.51           O  
ATOM   3012  CB  TRP A 490      27.027   7.904  37.685  1.00 64.01           C  
ATOM   3013  CG  TRP A 490      27.408   8.116  36.250  1.00 64.32           C  
ATOM   3014  CD1 TRP A 490      26.789   7.592  35.153  1.00 64.89           C  
ATOM   3015  CD2 TRP A 490      28.490   8.916  35.758  1.00 64.22           C  
ATOM   3016  NE1 TRP A 490      27.418   8.015  34.007  1.00 65.16           N  
ATOM   3017  CE2 TRP A 490      28.466   8.828  34.351  1.00 64.72           C  
ATOM   3018  CE3 TRP A 490      29.477   9.696  36.368  1.00 63.92           C  
ATOM   3019  CZ2 TRP A 490      29.393   9.490  33.547  1.00 65.00           C  
ATOM   3020  CZ3 TRP A 490      30.393  10.353  35.567  1.00 64.07           C  
ATOM   3021  CH2 TRP A 490      30.345  10.245  34.172  1.00 64.48           C  
ATOM   3022  N   ASP A 491      28.473   6.622  40.868  1.00 74.02           N  
ATOM   3023  CA  ASP A 491      28.161   6.546  42.292  1.00 75.35           C  
ATOM   3024  C   ASP A 491      28.759   7.709  43.076  1.00 73.85           C  
ATOM   3025  O   ASP A 491      29.700   8.359  42.621  1.00 70.99           O  
ATOM   3026  CB  ASP A 491      28.657   5.221  42.876  1.00 74.49           C  
ATOM   3027  CG  ASP A 491      28.029   4.015  42.206  1.00 76.23           C  
ATOM   3028  OD1 ASP A 491      26.889   4.134  41.708  1.00 75.97           O  
ATOM   3029  OD2 ASP A 491      28.675   2.947  42.179  1.00 73.88           O  
ATOM   3030  N   LEU A 492      28.205   7.966  44.256  1.00 98.93           N  
ATOM   3031  CA  LEU A 492      28.706   9.021  45.130  1.00 97.81           C  
ATOM   3032  C   LEU A 492      28.680   8.542  46.579  1.00 96.19           C  
ATOM   3033  O   LEU A 492      27.642   8.585  47.238  1.00 96.73           O  
ATOM   3034  CB  LEU A 492      27.878  10.300  44.962  1.00 96.12           C  
ATOM   3035  CG  LEU A 492      28.461  11.636  45.442  1.00 94.50           C  
ATOM   3036  CD1 LEU A 492      28.264  11.844  46.939  1.00 94.70           C  
ATOM   3037  CD2 LEU A 492      29.936  11.747  45.073  1.00 95.77           C  
ATOM   3038  N   GLN A 493      29.830   8.084  47.064  1.00 82.83           N  
ATOM   3039  CA  GLN A 493      29.925   7.527  48.407  1.00 82.12           C  
ATOM   3040  C   GLN A 493      30.629   8.482  49.368  1.00 81.52           C  
ATOM   3041  O   GLN A 493      31.399   9.345  48.949  1.00 80.01           O  
ATOM   3042  CB  GLN A 493      30.659   6.185  48.371  1.00 84.80           C  
ATOM   3043  CG  GLN A 493      30.160   5.233  47.295  1.00 84.23           C  
ATOM   3044  CD  GLN A 493      28.696   4.872  47.457  1.00 83.27           C  
ATOM   3045  OE1 GLN A 493      27.812   5.585  46.981  1.00 85.74           O  
ATOM   3046  NE2 GLN A 493      28.433   3.757  48.128  1.00 84.12           N  
ATOM   3047  N   GLU A 494      30.354   8.317  50.658  1.00 97.83           N  
ATOM   3048  CA  GLU A 494      30.951   9.148  51.697  1.00 95.27           C  
ATOM   3049  C   GLU A 494      30.860   8.449  53.050  1.00 93.59           C  
ATOM   3050  O   GLU A 494      30.140   8.890  53.947  1.00 95.12           O  
ATOM   3051  CB  GLU A 494      30.273  10.521  51.745  1.00 95.83           C  
ATOM   3052  CG  GLU A 494      28.760  10.482  51.575  1.00 95.19           C  
ATOM   3053  CD  GLU A 494      28.154  11.861  51.397  1.00 93.30           C  
ATOM   3054  OE1 GLU A 494      28.906  12.857  51.473  1.00 94.01           O  
ATOM   3055  OE2 GLU A 494      26.928  11.950  51.176  1.00 92.36           O  
ATOM   3056  N   PHE A 495      31.604   7.358  53.187  1.00116.82           N  
ATOM   3057  CA  PHE A 495      31.510   6.490  54.355  1.00115.13           C  
ATOM   3058  C   PHE A 495      32.899   6.184  54.925  1.00116.61           C  
ATOM   3059  O   PHE A 495      33.865   6.113  54.165  1.00116.98           O  
ATOM   3060  CB  PHE A 495      30.791   5.191  53.979  1.00117.41           C  
ATOM   3061  CG  PHE A 495      29.566   5.397  53.132  1.00118.88           C  
ATOM   3062  CD1 PHE A 495      29.583   5.082  51.782  1.00118.63           C  
ATOM   3063  CD2 PHE A 495      28.401   5.909  53.681  1.00116.18           C  
ATOM   3064  CE1 PHE A 495      28.459   5.270  50.998  1.00117.05           C  
ATOM   3065  CE2 PHE A 495      27.274   6.100  52.900  1.00116.25           C  
ATOM   3066  CZ  PHE A 495      27.303   5.780  51.557  1.00118.81           C  
ATOM   3067  N   LYS A 496      33.024   6.005  56.243  1.00 86.04           N  
ATOM   3068  CA  LYS A 496      31.933   6.114  57.213  1.00 84.07           C  
ATOM   3069  C   LYS A 496      32.488   6.554  58.568  1.00 83.78           C  
ATOM   3070  O   LYS A 496      33.704   6.624  58.750  1.00 85.38           O  
ATOM   3071  CB  LYS A 496      31.191   4.781  57.362  1.00 86.61           C  
ATOM   3072  CG  LYS A 496      29.727   4.915  57.758  1.00 85.50           C  
ATOM   3073  CD  LYS A 496      28.858   3.828  57.129  1.00 86.42           C  
ATOM   3074  CE  LYS A 496      29.145   2.447  57.705  1.00 89.14           C  
ATOM   3075  NZ  LYS A 496      30.296   1.760  57.052  1.00 87.90           N  
ATOM   3076  N   GLN A 497      31.597   6.842  59.513  1.00115.15           N  
ATOM   3077  CA  GLN A 497      32.000   7.198  60.870  1.00111.91           C  
ATOM   3078  C   GLN A 497      30.997   6.708  61.909  1.00114.84           C  
ATOM   3079  O   GLN A 497      29.841   6.428  61.590  1.00115.41           O  
ATOM   3080  CB  GLN A 497      32.180   8.713  61.001  1.00111.81           C  
ATOM   3081  CG  GLN A 497      33.537   9.221  60.553  1.00111.70           C  
ATOM   3082  CD  GLN A 497      34.678   8.562  61.303  1.00109.86           C  
ATOM   3083  OE1 GLN A 497      35.703   8.217  60.716  1.00112.49           O  
ATOM   3084  NE2 GLN A 497      34.505   8.385  62.609  1.00110.34           N  
ATOM   3085  N   LYS A 498      31.448   6.606  63.155  1.00 87.69           N  
ATOM   3086  CA  LYS A 498      30.583   6.207  64.260  1.00 88.06           C  
ATOM   3087  C   LYS A 498      30.677   7.193  65.418  1.00 89.18           C  
ATOM   3088  O   LYS A 498      31.706   7.840  65.613  1.00 88.58           O  
ATOM   3089  CB  LYS A 498      30.933   4.796  64.737  1.00 89.80           C  
ATOM   3090  CG  LYS A 498      30.594   3.706  63.734  1.00 80.43           C  
ATOM   3091  CD  LYS A 498      29.117   3.733  63.372  1.00 80.12           C  
ATOM   3092  CE  LYS A 498      28.242   3.456  64.585  1.00 80.60           C  
ATOM   3093  NZ  LYS A 498      26.793   3.536  64.253  1.00 82.76           N  
ATOM   3094  N   LYS A 499      29.598   7.296  66.188  1.00 99.07           N  
ATOM   3095  CA  LYS A 499      29.522   8.257  67.283  1.00 97.21           C  
ATOM   3096  C   LYS A 499      30.337   7.823  68.500  1.00 97.59           C  
ATOM   3097  O   LYS A 499      30.383   6.642  68.846  1.00 95.93           O  
ATOM   3098  CB  LYS A 499      28.060   8.490  67.678  1.00 95.90           C  
ATOM   3099  CG  LYS A 499      27.175   7.253  67.606  1.00 97.63           C  
ATOM   3100  CD  LYS A 499      27.164   6.479  68.916  1.00 99.39           C  
ATOM   3101  CE  LYS A 499      26.519   7.290  70.027  1.00 96.12           C  
ATOM   3102  NZ  LYS A 499      26.437   6.520  71.298  1.00 99.06           N  
ATOM   3103  N   ALA A 500      30.981   8.796  69.141  1.00100.39           N  
ATOM   3104  CA  ALA A 500      31.785   8.542  70.329  1.00103.07           C  
ATOM   3105  C   ALA A 500      31.837   9.778  71.225  1.00101.16           C  
ATOM   3106  O   ALA A 500      32.152   9.685  72.411  1.00109.58           O  
ATOM   3107  CB  ALA A 500      33.190   8.110  69.939  1.00109.57           C  
ATOM   3108  N   LYS A 501      31.524  10.935  70.647  1.00115.00           N  
ATOM   3109  CA  LYS A 501      31.501  12.190  71.395  1.00113.85           C  
ATOM   3110  C   LYS A 501      30.069  12.593  71.746  1.00114.77           C  
ATOM   3111  O   LYS A 501      29.139  12.349  70.976  1.00112.17           O  
ATOM   3112  CB  LYS A 501      32.189  13.302  70.601  1.00111.09           C  
ATOM   3113  CG  LYS A 501      33.682  13.086  70.409  1.00111.87           C  
ATOM   3114  CD  LYS A 501      34.396  12.975  71.748  1.00111.27           C  
ATOM   3115  CE  LYS A 501      35.865  12.629  71.567  1.00111.71           C  
ATOM   3116  NZ  LYS A 501      36.585  13.658  70.769  1.00112.69           N  
ATOM   3117  N   LYS A 502      29.907  13.221  72.907  1.00102.42           N  
ATOM   3118  CA  LYS A 502      28.590  13.494  73.477  1.00 99.47           C  
ATOM   3119  C   LYS A 502      28.649  14.715  74.411  1.00 96.49           C  
ATOM   3120  O   LYS A 502      29.718  15.012  74.946  1.00 97.48           O  
ATOM   3121  CB  LYS A 502      28.089  12.249  74.221  1.00100.15           C  
ATOM   3122  CG  LYS A 502      27.327  11.263  73.346  1.00104.05           C  
ATOM   3123  CD  LYS A 502      26.732  10.129  74.165  1.00105.81           C  
ATOM   3124  CE  LYS A 502      25.887   9.209  73.297  1.00108.78           C  
ATOM   3125  NZ  LYS A 502      24.763   9.937  72.643  1.00105.66           N  
ATOM   3126  N   VAL A 503      27.537  15.429  74.620  1.00108.76           N  
ATOM   3127  CA  VAL A 503      26.214  15.120  74.071  1.00101.11           C  
ATOM   3128  C   VAL A 503      25.389  16.390  73.832  1.00108.53           C  
ATOM   3129  O   VAL A 503      25.636  17.429  74.449  1.00108.39           O  
ATOM   3130  CB  VAL A 503      25.411  14.182  75.021  1.00109.31           C  
ATOM   3131  CG1 VAL A 503      24.871  14.952  76.219  1.00109.45           C  
ATOM   3132  CG2 VAL A 503      24.288  13.470  74.276  1.00101.67           C  
ATOM   3133  N   LYS A 504      24.430  16.298  72.914  1.00110.63           N  
ATOM   3134  CA  LYS A 504      23.354  17.282  72.765  1.00107.15           C  
ATOM   3135  C   LYS A 504      23.821  18.711  72.481  1.00106.79           C  
ATOM   3136  O   LYS A 504      23.356  19.658  73.115  1.00104.86           O  
ATOM   3137  CB  LYS A 504      22.475  17.276  74.021  1.00108.44           C  
ATOM   3138  CG  LYS A 504      21.025  17.667  73.773  1.00108.12           C  
ATOM   3139  CD  LYS A 504      20.242  17.732  75.073  1.00106.98           C  
ATOM   3140  CE  LYS A 504      20.812  18.786  76.007  1.00104.79           C  
ATOM   3141  NZ  LYS A 504      20.037  18.888  77.272  1.00107.92           N  
ATOM   3142  N   LYS A 505      24.731  18.862  71.525  1.00 90.07           N  
ATOM   3143  CA  LYS A 505      25.137  20.183  71.048  1.00 90.66           C  
ATOM   3144  C   LYS A 505      25.632  20.098  69.608  1.00 99.66           C  
ATOM   3145  O   LYS A 505      26.313  19.143  69.233  1.00 91.71           O  
ATOM   3146  CB  LYS A 505      26.219  20.790  71.946  1.00 95.84           C  
ATOM   3147  CG  LYS A 505      25.679  21.705  73.040  1.00 96.65           C  
ATOM   3148  CD  LYS A 505      24.750  22.766  72.463  1.00 95.50           C  
ATOM   3149  CE  LYS A 505      24.102  23.597  73.561  1.00 93.81           C  
ATOM   3150  NZ  LYS A 505      23.137  24.591  73.011  1.00 93.21           N  
ATOM   3151  N   GLU A 506      25.283  21.101  68.807  1.00435.28           N  
ATOM   3152  CA  GLU A 506      25.610  21.095  67.384  1.00436.15           C  
ATOM   3153  C   GLU A 506      27.098  21.360  67.135  1.00431.42           C  
ATOM   3154  O   GLU A 506      27.639  22.379  67.568  1.00139.95           O  
ATOM   3155  CB  GLU A 506      24.749  22.123  66.632  1.00435.30           C  
ATOM   3156  CG  GLU A 506      24.855  23.567  67.126  1.00434.50           C  
ATOM   3157  CD  GLU A 506      23.999  23.849  68.347  1.00432.49           C  
ATOM   3158  OE1 GLU A 506      23.187  22.979  68.725  1.00435.50           O  
ATOM   3159  OE2 GLU A 506      24.137  24.946  68.929  1.00430.28           O  
ATOM   3160  N   PRO A 507      27.768  20.419  66.450  1.00 94.64           N  
ATOM   3161  CA  PRO A 507      29.178  20.551  66.078  1.00 96.45           C  
ATOM   3162  C   PRO A 507      29.365  21.035  64.640  1.00 95.45           C  
ATOM   3163  O   PRO A 507      30.497  21.151  64.172  1.00 96.23           O  
ATOM   3164  CB  PRO A 507      29.700  19.127  66.237  1.00 95.36           C  
ATOM   3165  CG  PRO A 507      28.530  18.284  65.820  1.00 97.04           C  
ATOM   3166  CD  PRO A 507      27.273  19.052  66.202  1.00 97.03           C  
ATOM   3167  N   ALA A 508      28.260  21.311  63.955  1.00119.33           N  
ATOM   3168  CA  ALA A 508      28.302  21.689  62.546  1.00126.30           C  
ATOM   3169  C   ALA A 508      28.538  23.184  62.358  1.00119.75           C  
ATOM   3170  O   ALA A 508      29.044  23.614  61.321  1.00123.25           O  
ATOM   3171  CB  ALA A 508      27.016  21.268  61.851  1.00127.32           C  
ATOM   3172  N   THR A 509      28.164  23.975  63.360  1.00112.13           N  
ATOM   3173  CA  THR A 509      28.338  25.423  63.292  1.00111.21           C  
ATOM   3174  C   THR A 509      29.261  25.924  64.398  1.00115.26           C  
ATOM   3175  O   THR A 509      29.565  27.114  64.472  1.00111.22           O  
ATOM   3176  CB  THR A 509      26.989  26.158  63.396  1.00118.92           C  
ATOM   3177  OG1 THR A 509      27.191  27.562  63.190  1.00118.61           O  
ATOM   3178  CG2 THR A 509      26.365  25.937  64.765  1.00118.73           C  
ATOM   3179  N   ALA A 510      29.704  25.008  65.253  1.00 99.36           N  
ATOM   3180  CA  ALA A 510      30.600  25.353  66.349  1.00 96.55           C  
ATOM   3181  C   ALA A 510      32.014  24.851  66.078  1.00 98.59           C  
ATOM   3182  O   ALA A 510      32.229  23.654  65.884  1.00 99.98           O  
ATOM   3183  CB  ALA A 510      30.078  24.786  67.660  1.00 97.18           C  
ATOM   3184  N   LEU A 530      41.685  42.662  58.959  1.00 84.24           N  
ATOM   3185  CA  LEU A 530      42.167  43.730  58.089  1.00 84.11           C  
ATOM   3186  C   LEU A 530      43.166  44.622  58.819  1.00 84.13           C  
ATOM   3187  O   LEU A 530      43.510  45.702  58.343  1.00 82.31           O  
ATOM   3188  CB  LEU A 530      41.001  44.574  57.562  1.00 80.61           C  
ATOM   3189  CG  LEU A 530      40.012  43.934  56.579  1.00 80.68           C  
ATOM   3190  CD1 LEU A 530      40.752  43.126  55.524  1.00 83.37           C  
ATOM   3191  CD2 LEU A 530      38.982  43.069  57.297  1.00 83.72           C  
ATOM   3192  N   GLY A 531      43.626  44.161  59.977  1.00 85.07           N  
ATOM   3193  CA  GLY A 531      44.562  44.922  60.786  1.00 86.58           C  
ATOM   3194  C   GLY A 531      46.005  44.743  60.355  1.00 87.37           C  
ATOM   3195  O   GLY A 531      46.522  43.625  60.355  1.00 92.89           O  
ATOM   3196  N   PRO A 532      46.665  45.849  59.980  1.00 98.07           N  
ATOM   3197  CA  PRO A 532      48.067  45.848  59.548  1.00 92.04           C  
ATOM   3198  C   PRO A 532      49.054  45.940  60.712  1.00 92.65           C  
ATOM   3199  O   PRO A 532      48.838  46.721  61.640  1.00 91.62           O  
ATOM   3200  CB  PRO A 532      48.150  47.094  58.668  1.00 97.73           C  
ATOM   3201  CG  PRO A 532      47.157  48.027  59.273  1.00 95.02           C  
ATOM   3202  CD  PRO A 532      46.040  47.175  59.823  1.00 92.65           C  
ATOM   3203  N   CYS A 533      50.126  45.155  60.653  1.00 82.37           N  
ATOM   3204  CA  CYS A 533      51.145  45.162  61.699  1.00 86.54           C  
ATOM   3205  C   CYS A 533      52.435  44.491  61.232  1.00 91.92           C  
ATOM   3206  O   CYS A 533      52.640  44.286  60.035  1.00 93.02           O  
ATOM   3207  CB  CYS A 533      50.624  44.468  62.960  1.00 85.62           C  
ATOM   3208  SG  CYS A 533      51.750  44.538  64.372  1.00 91.17           S  
ATOM   3209  N   SER A 534      53.297  44.154  62.189  1.00 71.38           N  
ATOM   3210  CA  SER A 534      54.566  43.488  61.905  1.00 77.63           C  
ATOM   3211  C   SER A 534      55.178  42.913  63.179  1.00 80.79           C  
ATOM   3212  O   SER A 534      56.111  43.485  63.739  1.00 84.91           O  
ATOM   3213  CB  SER A 534      55.551  44.457  61.247  1.00 81.71           C  
ATOM   3214  OG  SER A 534      56.823  43.855  61.081  1.00 86.49           O  
ATOM   3215  N   GLU A 535      54.651  41.779  63.632  1.00108.49           N  
ATOM   3216  CA  GLU A 535      55.108  41.174  64.878  1.00100.68           C  
ATOM   3217  C   GLU A 535      55.902  39.893  64.627  1.00106.79           C  
ATOM   3218  O   GLU A 535      55.607  39.140  63.699  1.00104.90           O  
ATOM   3219  CB  GLU A 535      53.917  40.883  65.792  1.00108.04           C  
ATOM   3220  CG  GLU A 535      54.298  40.593  67.233  1.00107.99           C  
ATOM   3221  CD  GLU A 535      55.037  41.749  67.880  1.00102.07           C  
ATOM   3222  OE1 GLU A 535      56.283  41.686  67.963  1.00105.49           O  
ATOM   3223  OE2 GLU A 535      54.375  42.717  68.305  1.00107.49           O  
ATOM   3224  N   GLU A 536      56.911  39.656  65.462  1.00 96.12           N  
ATOM   3225  CA  GLU A 536      57.753  38.472  65.333  1.00 98.93           C  
ATOM   3226  C   GLU A 536      58.251  37.996  66.696  1.00 98.78           C  
ATOM   3227  O   GLU A 536      59.026  37.043  66.785  1.00 94.95           O  
ATOM   3228  CB  GLU A 536      58.942  38.753  64.412  1.00 91.06           C  
ATOM   3229  CG  GLU A 536      60.095  39.501  65.073  1.00 93.83           C  
ATOM   3230  CD  GLU A 536      59.723  40.903  65.511  1.00 90.51           C  
ATOM   3231  OE1 GLU A 536      58.821  41.505  64.890  1.00 97.75           O  
ATOM   3232  OE2 GLU A 536      60.332  41.404  66.480  1.00 98.82           O  
ATOM   3233  N   GLU A 537      57.796  38.662  67.754  1.00111.10           N  
ATOM   3234  CA  GLU A 537      58.212  38.332  69.115  1.00113.33           C  
ATOM   3235  C   GLU A 537      57.768  36.927  69.514  1.00114.70           C  
ATOM   3236  O   GLU A 537      58.345  36.312  70.410  1.00117.55           O  
ATOM   3237  CB  GLU A 537      57.660  39.358  70.106  1.00113.27           C  
ATOM   3238  CG  GLU A 537      56.144  39.378  70.208  1.00107.97           C  
ATOM   3239  CD  GLU A 537      55.630  40.529  71.052  1.00104.31           C  
ATOM   3240  OE1 GLU A 537      54.398  40.636  71.227  1.00108.02           O  
ATOM   3241  OE2 GLU A 537      56.458  41.327  71.540  1.00107.85           O  
ATOM   3242  N   GLU A 538      56.735  36.426  68.843  1.00116.53           N  
ATOM   3243  CA  GLU A 538      56.257  35.070  69.071  1.00116.59           C  
ATOM   3244  C   GLU A 538      57.012  34.092  68.178  1.00110.76           C  
ATOM   3245  O   GLU A 538      56.434  33.483  67.278  1.00118.75           O  
ATOM   3246  CB  GLU A 538      54.754  34.981  68.811  1.00110.29           C  
ATOM   3247  CG  GLU A 538      53.932  35.957  69.638  1.00116.31           C  
ATOM   3248  CD  GLU A 538      52.460  35.937  69.275  1.00111.22           C  
ATOM   3249  OE1 GLU A 538      52.080  35.157  68.377  1.00110.36           O  
ATOM   3250  OE2 GLU A 538      51.686  36.703  69.884  1.00108.17           O  
ATOM   3251  N   PHE A 539      58.309  33.952  68.436  1.00 77.21           N  
ATOM   3252  CA  PHE A 539      59.172  33.098  67.628  1.00 78.98           C  
ATOM   3253  C   PHE A 539      58.756  31.633  67.709  1.00 79.01           C  
ATOM   3254  O   PHE A 539      58.966  30.866  66.770  1.00 79.05           O  
ATOM   3255  CB  PHE A 539      60.630  33.247  68.068  1.00 72.87           C  
ATOM   3256  CG  PHE A 539      61.137  34.661  68.029  1.00 73.26           C  
ATOM   3257  CD1 PHE A 539      61.090  35.458  69.161  1.00 73.84           C  
ATOM   3258  CD2 PHE A 539      61.664  35.192  66.864  1.00 73.15           C  
ATOM   3259  CE1 PHE A 539      61.555  36.759  69.129  1.00 74.26           C  
ATOM   3260  CE2 PHE A 539      62.131  36.492  66.826  1.00 73.61           C  
ATOM   3261  CZ  PHE A 539      62.077  37.276  67.962  1.00 74.15           C  
ATOM   3262  N   GLN A 540      58.159  31.253  68.833  1.00 88.09           N  
ATOM   3263  CA  GLN A 540      57.794  29.862  69.068  1.00 87.90           C  
ATOM   3264  C   GLN A 540      56.293  29.609  68.946  1.00 83.11           C  
ATOM   3265  O   GLN A 540      55.767  28.671  69.546  1.00 80.75           O  
ATOM   3266  CB  GLN A 540      58.290  29.417  70.447  1.00 81.37           C  
ATOM   3267  CG  GLN A 540      58.232  30.503  71.514  1.00 87.48           C  
ATOM   3268  CD  GLN A 540      56.812  30.870  71.904  1.00 81.42           C  
ATOM   3269  OE1 GLN A 540      55.947  30.005  72.030  1.00 89.36           O  
ATOM   3270  NE2 GLN A 540      56.568  32.159  72.097  1.00 87.46           N  
ATOM   3271  N   GLN A 541      55.604  30.440  68.172  1.00 99.45           N  
ATOM   3272  CA  GLN A 541      54.194  30.195  67.889  1.00 92.69           C  
ATOM   3273  C   GLN A 541      54.079  29.207  66.735  1.00 96.15           C  
ATOM   3274  O   GLN A 541      53.047  28.557  66.552  1.00 99.97           O  
ATOM   3275  CB  GLN A 541      53.458  31.494  67.557  1.00 90.02           C  
ATOM   3276  CG  GLN A 541      53.724  32.020  66.156  1.00 97.70           C  
ATOM   3277  CD  GLN A 541      52.594  32.887  65.639  1.00 93.65           C  
ATOM   3278  OE1 GLN A 541      51.593  33.098  66.325  1.00 91.45           O  
ATOM   3279  NE2 GLN A 541      52.746  33.394  64.420  1.00 94.05           N  
ATOM   3280  N   ASP A 542      55.150  29.106  65.955  1.00 89.03           N  
ATOM   3281  CA  ASP A 542      55.212  28.167  64.847  1.00 80.99           C  
ATOM   3282  C   ASP A 542      55.181  26.732  65.355  1.00 84.49           C  
ATOM   3283  O   ASP A 542      54.448  25.893  64.830  1.00 81.06           O  
ATOM   3284  CB  ASP A 542      56.470  28.409  64.010  1.00 85.13           C  
ATOM   3285  CG  ASP A 542      56.782  27.253  63.080  1.00 89.36           C  
ATOM   3286  OD1 ASP A 542      57.621  26.406  63.449  1.00 84.10           O  
ATOM   3287  OD2 ASP A 542      56.189  27.193  61.983  1.00 87.28           O  
ATOM   3288  N   VAL A 543      55.978  26.453  66.383  1.00 70.90           N  
ATOM   3289  CA  VAL A 543      56.008  25.125  66.984  1.00 73.73           C  
ATOM   3290  C   VAL A 543      54.753  24.889  67.818  1.00 77.55           C  
ATOM   3291  O   VAL A 543      54.435  23.753  68.171  1.00 76.29           O  
ATOM   3292  CB  VAL A 543      57.258  24.921  67.864  1.00 80.33           C  
ATOM   3293  CG1 VAL A 543      58.522  25.142  67.045  1.00 84.99           C  
ATOM   3294  CG2 VAL A 543      57.228  25.849  69.065  1.00 77.12           C  
ATOM   3295  N   MET A 544      54.043  25.968  68.131  1.00 93.07           N  
ATOM   3296  CA  MET A 544      52.761  25.867  68.819  1.00 96.75           C  
ATOM   3297  C   MET A 544      51.694  25.384  67.846  1.00 95.02           C  
ATOM   3298  O   MET A 544      50.907  24.488  68.158  1.00 90.91           O  
ATOM   3299  CB  MET A 544      52.361  27.212  69.429  1.00 94.39           C  
ATOM   3300  CG  MET A 544      51.014  27.197  70.130  1.00 98.71           C  
ATOM   3301  SD  MET A 544      50.520  28.827  70.717  1.00 96.94           S  
ATOM   3302  CE  MET A 544      51.889  29.226  71.798  1.00 99.86           C  
ATOM   3303  N   ALA A 545      51.678  25.986  66.659  1.00 86.43           N  
ATOM   3304  CA  ALA A 545      50.776  25.560  65.598  1.00 84.36           C  
ATOM   3305  C   ALA A 545      51.129  24.149  65.139  1.00 86.39           C  
ATOM   3306  O   ALA A 545      50.253  23.362  64.782  1.00 85.95           O  
ATOM   3307  CB  ALA A 545      50.828  26.530  64.430  1.00 80.78           C  
ATOM   3308  N   ARG A 546      52.423  23.837  65.157  1.00 66.74           N  
ATOM   3309  CA  ARG A 546      52.904  22.503  64.812  1.00 68.07           C  
ATOM   3310  C   ARG A 546      52.427  21.466  65.822  1.00 67.60           C  
ATOM   3311  O   ARG A 546      51.915  20.408  65.446  1.00 67.69           O  
ATOM   3312  CB  ARG A 546      54.433  22.487  64.732  1.00 65.86           C  
ATOM   3313  CG  ARG A 546      55.031  21.090  64.643  1.00 69.48           C  
ATOM   3314  CD  ARG A 546      56.548  21.119  64.774  1.00 76.82           C  
ATOM   3315  NE  ARG A 546      57.183  21.833  63.672  1.00 77.92           N  
ATOM   3316  CZ  ARG A 546      57.602  21.254  62.550  1.00 79.69           C  
ATOM   3317  NH1 ARG A 546      57.452  19.948  62.381  1.00 72.61           N  
ATOM   3318  NH2 ARG A 546      58.170  21.982  61.599  1.00 70.05           N  
ATOM   3319  N   ALA A 547      52.601  21.775  67.104  1.00 82.38           N  
ATOM   3320  CA  ALA A 547      52.172  20.883  68.176  1.00 81.85           C  
ATOM   3321  C   ALA A 547      50.663  20.674  68.127  1.00 85.92           C  
ATOM   3322  O   ALA A 547      50.179  19.555  68.298  1.00 87.83           O  
ATOM   3323  CB  ALA A 547      52.587  21.435  69.530  1.00 81.68           C  
ATOM   3324  N   CYS A 548      49.929  21.757  67.891  1.00 81.88           N  
ATOM   3325  CA  CYS A 548      48.483  21.685  67.717  1.00 84.98           C  
ATOM   3326  C   CYS A 548      48.120  20.763  66.558  1.00 85.24           C  
ATOM   3327  O   CYS A 548      47.212  19.934  66.667  1.00 84.09           O  
ATOM   3328  CB  CYS A 548      47.905  23.084  67.483  1.00 83.20           C  
ATOM   3329  SG  CYS A 548      46.225  23.107  66.814  1.00 81.23           S  
ATOM   3330  N   LEU A 549      48.846  20.911  65.455  1.00 72.03           N  
ATOM   3331  CA  LEU A 549      48.623  20.105  64.259  1.00 74.04           C  
ATOM   3332  C   LEU A 549      48.832  18.616  64.518  1.00 75.76           C  
ATOM   3333  O   LEU A 549      47.981  17.793  64.176  1.00 73.39           O  
ATOM   3334  CB  LEU A 549      49.545  20.570  63.130  1.00 74.51           C  
ATOM   3335  CG  LEU A 549      49.543  19.729  61.851  1.00 75.07           C  
ATOM   3336  CD1 LEU A 549      48.167  19.726  61.205  1.00 70.56           C  
ATOM   3337  CD2 LEU A 549      50.596  20.232  60.876  1.00 80.79           C  
ATOM   3338  N   GLN A 550      49.965  18.272  65.123  1.00 93.91           N  
ATOM   3339  CA  GLN A 550      50.297  16.874  65.382  1.00 97.17           C  
ATOM   3340  C   GLN A 550      49.367  16.256  66.425  1.00 94.48           C  
ATOM   3341  O   GLN A 550      48.979  15.093  66.308  1.00 95.52           O  
ATOM   3342  CB  GLN A 550      51.754  16.741  65.832  1.00 93.29           C  
ATOM   3343  CG  GLN A 550      52.228  15.301  65.974  1.00 97.10           C  
ATOM   3344  CD  GLN A 550      53.704  15.198  66.307  1.00 92.95           C  
ATOM   3345  OE1 GLN A 550      54.382  16.208  66.496  1.00 94.34           O  
ATOM   3346  NE2 GLN A 550      54.211  13.972  66.378  1.00 94.44           N  
ATOM   3347  N   LYS A 551      49.012  17.037  67.442  1.00 85.56           N  
ATOM   3348  CA  LYS A 551      48.076  16.578  68.465  1.00 84.44           C  
ATOM   3349  C   LYS A 551      46.692  16.351  67.868  1.00 88.68           C  
ATOM   3350  O   LYS A 551      45.948  15.478  68.315  1.00 87.63           O  
ATOM   3351  CB  LYS A 551      47.997  17.578  69.619  1.00 80.33           C  
ATOM   3352  CG  LYS A 551      49.187  17.537  70.566  1.00 84.41           C  
ATOM   3353  CD  LYS A 551      49.173  18.695  71.559  1.00 80.50           C  
ATOM   3354  CE  LYS A 551      47.960  18.652  72.482  1.00 89.96           C  
ATOM   3355  NZ  LYS A 551      46.794  19.410  71.948  1.00 85.65           N  
ATOM   3356  N   LEU A 552      46.353  17.145  66.857  1.00 67.13           N  
ATOM   3357  CA  LEU A 552      45.079  16.994  66.162  1.00 63.60           C  
ATOM   3358  C   LEU A 552      45.112  15.792  65.221  1.00 67.59           C  
ATOM   3359  O   LEU A 552      44.086  15.157  64.967  1.00 65.70           O  
ATOM   3360  CB  LEU A 552      44.740  18.273  65.390  1.00 62.54           C  
ATOM   3361  CG  LEU A 552      43.427  18.328  64.605  1.00 69.45           C  
ATOM   3362  CD1 LEU A 552      42.780  19.689  64.770  1.00 69.03           C  
ATOM   3363  CD2 LEU A 552      43.660  18.029  63.131  1.00 61.63           C  
ATOM   3364  N   LYS A 553      46.300  15.483  64.712  1.00 80.88           N  
ATOM   3365  CA  LYS A 553      46.470  14.403  63.747  1.00 85.12           C  
ATOM   3366  C   LYS A 553      46.234  13.020  64.348  1.00 84.39           C  
ATOM   3367  O   LYS A 553      45.414  12.251  63.850  1.00 85.84           O  
ATOM   3368  CB  LYS A 553      47.872  14.459  63.138  1.00 87.65           C  
ATOM   3369  CG  LYS A 553      48.219  13.255  62.285  1.00 82.28           C  
ATOM   3370  CD  LYS A 553      47.363  13.197  61.031  1.00 80.24           C  
ATOM   3371  CE  LYS A 553      47.505  11.854  60.340  1.00 82.72           C  
ATOM   3372  NZ  LYS A 553      47.055  11.906  58.923  1.00 81.46           N  
ATOM   3373  N   GLY A 554      46.955  12.709  65.421  1.00 67.57           N  
ATOM   3374  CA  GLY A 554      46.922  11.382  66.009  1.00 66.43           C  
ATOM   3375  C   GLY A 554      45.711  11.080  66.873  1.00 63.28           C  
ATOM   3376  O   GLY A 554      45.786  10.260  67.787  1.00 64.43           O  
ATOM   3377  N   THR A 555      44.592  11.738  66.587  1.00109.59           N  
ATOM   3378  CA  THR A 555      43.359  11.507  67.331  1.00105.98           C  
ATOM   3379  C   THR A 555      42.206  11.173  66.389  1.00105.00           C  
ATOM   3380  O   THR A 555      41.070  10.985  66.825  1.00105.73           O  
ATOM   3381  CB  THR A 555      42.972  12.730  68.182  1.00105.00           C  
ATOM   3382  OG1 THR A 555      42.875  13.887  67.342  1.00104.47           O  
ATOM   3383  CG2 THR A 555      44.013  12.979  69.262  1.00104.96           C  
ATOM   3384  N   THR A 556      42.507  11.104  65.098  1.00 85.23           N  
ATOM   3385  CA  THR A 556      41.498  10.815  64.089  1.00 87.07           C  
ATOM   3386  C   THR A 556      41.774   9.463  63.439  1.00 87.73           C  
ATOM   3387  O   THR A 556      40.923   8.909  62.750  1.00 89.65           O  
ATOM   3388  CB  THR A 556      41.457  11.910  63.003  1.00 85.81           C  
ATOM   3389  OG1 THR A 556      41.606  13.199  63.612  1.00 82.16           O  
ATOM   3390  CG2 THR A 556      40.144  11.864  62.232  1.00 83.81           C  
ATOM   3391  N   GLU A 557      42.970   8.935  63.677  1.00 84.94           N  
ATOM   3392  CA  GLU A 557      43.409   7.699  63.040  1.00 87.82           C  
ATOM   3393  C   GLU A 557      42.544   6.501  63.427  1.00 87.40           C  
ATOM   3394  O   GLU A 557      42.373   5.571  62.639  1.00 87.30           O  
ATOM   3395  CB  GLU A 557      44.874   7.422  63.387  1.00 81.16           C  
ATOM   3396  CG  GLU A 557      45.487   6.262  62.624  1.00 83.09           C  
ATOM   3397  CD  GLU A 557      46.967   6.099  62.902  1.00 85.40           C  
ATOM   3398  OE1 GLU A 557      47.574   5.147  62.368  1.00 87.63           O  
ATOM   3399  OE2 GLU A 557      47.526   6.924  63.655  1.00 84.47           O  
ATOM   3400  N   LEU A 558      41.994   6.528  64.636  1.00 88.91           N  
ATOM   3401  CA  LEU A 558      41.181   5.415  65.121  1.00 88.07           C  
ATOM   3402  C   LEU A 558      39.723   5.538  64.684  1.00 86.76           C  
ATOM   3403  O   LEU A 558      38.912   4.651  64.951  1.00 87.52           O  
ATOM   3404  CB  LEU A 558      41.276   5.299  66.653  1.00 88.52           C  
ATOM   3405  CG  LEU A 558      40.654   6.280  67.665  1.00 84.31           C  
ATOM   3406  CD1 LEU A 558      40.902   7.746  67.318  1.00 83.12           C  
ATOM   3407  CD2 LEU A 558      39.166   6.013  67.912  1.00 84.23           C  
ATOM   3408  N   LEU A 559      39.390   6.633  64.005  1.00 88.21           N  
ATOM   3409  CA  LEU A 559      38.027   6.832  63.517  1.00 86.91           C  
ATOM   3410  C   LEU A 559      37.696   5.935  62.310  1.00 89.54           C  
ATOM   3411  O   LEU A 559      36.634   5.313  62.289  1.00 88.90           O  
ATOM   3412  CB  LEU A 559      37.782   8.307  63.172  1.00 84.37           C  
ATOM   3413  CG  LEU A 559      37.248   9.214  64.285  1.00 84.55           C  
ATOM   3414  CD1 LEU A 559      38.242   9.340  65.426  1.00 82.57           C  
ATOM   3415  CD2 LEU A 559      36.896  10.586  63.732  1.00 83.14           C  
ATOM   3416  N   PRO A 560      38.589   5.862  61.301  1.00 85.85           N  
ATOM   3417  CA  PRO A 560      38.307   4.872  60.259  1.00 88.52           C  
ATOM   3418  C   PRO A 560      39.020   3.552  60.533  1.00 88.06           C  
ATOM   3419  O   PRO A 560      39.365   3.273  61.681  1.00 88.37           O  
ATOM   3420  CB  PRO A 560      38.850   5.535  58.984  1.00 88.25           C  
ATOM   3421  CG  PRO A 560      39.592   6.795  59.444  1.00 86.63           C  
ATOM   3422  CD  PRO A 560      39.744   6.691  60.927  1.00 84.48           C  
ATOM   3423  N   LYS A 561      39.242   2.756  59.492  1.00 78.08           N  
ATOM   3424  CA  LYS A 561      39.915   1.472  59.649  1.00 79.23           C  
ATOM   3425  C   LYS A 561      40.776   1.141  58.437  1.00 81.96           C  
ATOM   3426  O   LYS A 561      41.970   1.434  58.411  1.00 83.50           O  
ATOM   3427  CB  LYS A 561      38.894   0.358  59.879  1.00 79.72           C  
ATOM   3428  CG  LYS A 561      39.473  -0.892  60.518  1.00 81.98           C  
ATOM   3429  CD  LYS A 561      39.915  -0.619  61.946  1.00 81.22           C  
ATOM   3430  CE  LYS A 561      40.388  -1.890  62.631  1.00 81.87           C  
ATOM   3431  NZ  LYS A 561      40.765  -1.648  64.051  1.00 79.25           N  
ATOM   3432  N   ARG A 562      40.158   0.522  57.436  1.00 89.59           N  
ATOM   3433  CA  ARG A 562      40.861   0.149  56.215  1.00 92.93           C  
ATOM   3434  C   ARG A 562      40.630   1.188  55.124  1.00 91.76           C  
ATOM   3435  O   ARG A 562      39.494   1.410  54.706  1.00 89.69           O  
ATOM   3436  CB  ARG A 562      40.407  -1.231  55.734  1.00 94.58           C  
ATOM   3437  CG  ARG A 562      41.353  -1.887  54.741  1.00 96.09           C  
ATOM   3438  CD  ARG A 562      42.681  -2.222  55.400  1.00 96.93           C  
ATOM   3439  NE  ARG A 562      43.581  -2.950  54.508  1.00 98.12           N  
ATOM   3440  CZ  ARG A 562      44.539  -2.383  53.783  1.00 98.47           C  
ATOM   3441  NH1 ARG A 562      44.729  -1.070  53.842  1.00 97.90           N  
ATOM   3442  NH2 ARG A 562      45.310  -3.124  53.001  1.00 90.16           N  
ATOM   3443  N   PRO A 563      41.712   1.830  54.660  1.00 91.30           N  
ATOM   3444  CA  PRO A 563      41.633   2.868  53.624  1.00 91.00           C  
ATOM   3445  C   PRO A 563      41.099   2.337  52.295  1.00 99.42           C  
ATOM   3446  O   PRO A 563      41.824   1.666  51.560  1.00 90.96           O  
ATOM   3447  CB  PRO A 563      43.086   3.335  53.480  1.00 90.77           C  
ATOM   3448  CG  PRO A 563      43.906   2.200  53.993  1.00 94.67           C  
ATOM   3449  CD  PRO A 563      43.098   1.592  55.096  1.00 93.47           C  
ATOM   3450  N   GLN A 564      39.839   2.637  51.999  1.00 76.25           N  
ATOM   3451  CA  GLN A 564      39.215   2.198  50.757  1.00 75.06           C  
ATOM   3452  C   GLN A 564      39.581   3.122  49.601  1.00 76.65           C  
ATOM   3453  O   GLN A 564      40.267   4.126  49.790  1.00 76.23           O  
ATOM   3454  CB  GLN A 564      37.693   2.131  50.910  1.00 76.92           C  
ATOM   3455  CG  GLN A 564      37.021   3.477  51.157  1.00 73.30           C  
ATOM   3456  CD  GLN A 564      37.167   3.954  52.588  1.00 74.40           C  
ATOM   3457  OE1 GLN A 564      37.600   3.203  53.463  1.00 73.69           O  
ATOM   3458  NE2 GLN A 564      36.805   5.207  52.836  1.00 72.83           N  
ATOM   3459  N   HIS A 565      39.116   2.778  48.405  1.00 52.47           N  
ATOM   3460  CA  HIS A 565      39.363   3.598  47.228  1.00 52.78           C  
ATOM   3461  C   HIS A 565      38.583   4.902  47.324  1.00 51.24           C  
ATOM   3462  O   HIS A 565      37.648   5.011  48.114  1.00 50.02           O  
ATOM   3463  CB  HIS A 565      38.988   2.845  45.951  1.00 52.08           C  
ATOM   3464  CG  HIS A 565      40.068   2.847  44.917  1.00 50.36           C  
ATOM   3465  ND1 HIS A 565      39.913   2.264  43.674  1.00 50.68           N  
ATOM   3466  CD2 HIS A 565      41.322   3.354  44.934  1.00 52.35           C  
ATOM   3467  CE1 HIS A 565      41.021   2.416  42.977  1.00 50.27           C  
ATOM   3468  NE2 HIS A 565      41.895   3.076  43.719  1.00 59.86           N  
ATOM   3469  N   LEU A 566      38.974   5.883  46.516  1.00 60.93           N  
ATOM   3470  CA  LEU A 566      38.361   7.209  46.549  1.00 59.56           C  
ATOM   3471  C   LEU A 566      36.862   7.156  46.254  1.00 61.02           C  
ATOM   3472  O   LEU A 566      36.451   6.864  45.133  1.00 58.98           O  
ATOM   3473  CB  LEU A 566      39.059   8.163  45.562  1.00 59.53           C  
ATOM   3474  CG  LEU A 566      39.870   7.716  44.333  1.00 61.57           C  
ATOM   3475  CD1 LEU A 566      41.250   7.169  44.714  1.00 62.27           C  
ATOM   3476  CD2 LEU A 566      39.114   6.735  43.435  1.00 61.84           C  
ATOM   3477  N   PRO A 567      36.039   7.445  47.274  1.00 60.50           N  
ATOM   3478  CA  PRO A 567      34.580   7.371  47.162  1.00 67.16           C  
ATOM   3479  C   PRO A 567      33.977   8.575  46.444  1.00 69.21           C  
ATOM   3480  O   PRO A 567      32.888   8.468  45.882  1.00 61.24           O  
ATOM   3481  CB  PRO A 567      34.126   7.329  48.620  1.00 66.65           C  
ATOM   3482  CG  PRO A 567      35.160   8.121  49.337  1.00 68.68           C  
ATOM   3483  CD  PRO A 567      36.463   7.851  48.626  1.00 67.76           C  
ATOM   3484  N   GLY A 568      34.679   9.703  46.468  1.00 87.97           N  
ATOM   3485  CA  GLY A 568      34.192  10.919  45.841  1.00 85.55           C  
ATOM   3486  C   GLY A 568      34.019  10.773  44.342  1.00 86.01           C  
ATOM   3487  O   GLY A 568      33.100  11.345  43.755  1.00 86.82           O  
ATOM   3488  N   HIS A 569      34.903   9.998  43.726  1.00 58.16           N  
ATOM   3489  CA  HIS A 569      34.858   9.769  42.286  1.00 58.26           C  
ATOM   3490  C   HIS A 569      33.914   8.615  41.947  1.00 58.00           C  
ATOM   3491  O   HIS A 569      33.788   7.671  42.724  1.00 58.02           O  
ATOM   3492  CB  HIS A 569      36.265   9.486  41.749  1.00 58.60           C  
ATOM   3493  CG  HIS A 569      37.246  10.588  42.007  1.00 58.90           C  
ATOM   3494  ND1 HIS A 569      37.739  10.865  43.266  1.00 58.71           N  
ATOM   3495  CD2 HIS A 569      37.823  11.483  41.172  1.00 59.20           C  
ATOM   3496  CE1 HIS A 569      38.577  11.883  43.192  1.00 58.63           C  
ATOM   3497  NE2 HIS A 569      38.647  12.277  41.933  1.00 59.14           N  
ATOM   3498  N   PRO A 570      33.238   8.699  40.787  1.00 52.53           N  
ATOM   3499  CA  PRO A 570      32.296   7.670  40.321  1.00 52.30           C  
ATOM   3500  C   PRO A 570      32.915   6.274  40.232  1.00 52.26           C  
ATOM   3501  O   PRO A 570      34.133   6.153  40.127  1.00 52.33           O  
ATOM   3502  CB  PRO A 570      31.893   8.173  38.932  1.00 52.25           C  
ATOM   3503  CG  PRO A 570      32.075   9.645  39.003  1.00 52.36           C  
ATOM   3504  CD  PRO A 570      33.272   9.860  39.881  1.00 52.58           C  
ATOM   3505  N   GLY A 571      32.074   5.244  40.265  1.00 59.87           N  
ATOM   3506  CA  GLY A 571      32.533   3.864  40.265  1.00 59.82           C  
ATOM   3507  C   GLY A 571      33.381   3.478  39.069  1.00 59.52           C  
ATOM   3508  O   GLY A 571      34.382   2.763  39.208  1.00 59.45           O  
ATOM   3509  N   TRP A 572      32.986   3.951  37.890  1.00 58.15           N  
ATOM   3510  CA  TRP A 572      33.735   3.684  36.669  1.00 60.26           C  
ATOM   3511  C   TRP A 572      35.132   4.289  36.757  1.00 59.93           C  
ATOM   3512  O   TRP A 572      36.073   3.801  36.134  1.00 60.33           O  
ATOM   3513  CB  TRP A 572      32.999   4.241  35.450  1.00 61.66           C  
ATOM   3514  CG  TRP A 572      33.192   5.709  35.271  1.00 58.99           C  
ATOM   3515  CD1 TRP A 572      32.534   6.708  35.924  1.00 58.29           C  
ATOM   3516  CD2 TRP A 572      34.117   6.350  34.382  1.00 60.96           C  
ATOM   3517  NE1 TRP A 572      32.987   7.932  35.496  1.00 58.92           N  
ATOM   3518  CE2 TRP A 572      33.959   7.741  34.551  1.00 60.98           C  
ATOM   3519  CE3 TRP A 572      35.061   5.883  33.463  1.00 60.20           C  
ATOM   3520  CZ2 TRP A 572      34.712   8.668  33.829  1.00 61.80           C  
ATOM   3521  CZ3 TRP A 572      35.807   6.807  32.748  1.00 61.12           C  
ATOM   3522  CH2 TRP A 572      35.627   8.183  32.936  1.00 61.04           C  
ATOM   3523  N   TYR A 573      35.257   5.355  37.542  1.00 65.19           N  
ATOM   3524  CA  TYR A 573      36.537   6.026  37.722  1.00 64.90           C  
ATOM   3525  C   TYR A 573      37.356   5.346  38.817  1.00 64.30           C  
ATOM   3526  O   TYR A 573      38.586   5.362  38.778  1.00 65.79           O  
ATOM   3527  CB  TYR A 573      36.325   7.506  38.054  1.00 63.28           C  
ATOM   3528  CG  TYR A 573      37.559   8.361  37.869  1.00 64.33           C  
ATOM   3529  CD1 TYR A 573      38.414   8.622  38.931  1.00 65.80           C  
ATOM   3530  CD2 TYR A 573      37.870   8.904  36.629  1.00 63.12           C  
ATOM   3531  CE1 TYR A 573      39.542   9.400  38.766  1.00 66.47           C  
ATOM   3532  CE2 TYR A 573      38.996   9.684  36.454  1.00 64.47           C  
ATOM   3533  CZ  TYR A 573      39.827   9.927  37.526  1.00 64.37           C  
ATOM   3534  OH  TYR A 573      40.949  10.702  37.357  1.00 65.94           O  
ATOM   3535  N   ARG A 574      36.673   4.752  39.791  1.00 57.27           N  
ATOM   3536  CA  ARG A 574      37.348   3.997  40.840  1.00 58.34           C  
ATOM   3537  C   ARG A 574      37.980   2.743  40.255  1.00 57.26           C  
ATOM   3538  O   ARG A 574      39.117   2.399  40.580  1.00 57.53           O  
ATOM   3539  CB  ARG A 574      36.382   3.616  41.963  1.00 57.96           C  
ATOM   3540  CG  ARG A 574      35.670   4.781  42.630  1.00 58.84           C  
ATOM   3541  CD  ARG A 574      34.913   4.310  43.866  1.00 59.10           C  
ATOM   3542  NE  ARG A 574      33.967   5.307  44.359  1.00 58.18           N  
ATOM   3543  CZ  ARG A 574      32.653   5.243  44.173  1.00 57.91           C  
ATOM   3544  NH1 ARG A 574      32.122   4.227  43.507  1.00 57.81           N  
ATOM   3545  NH2 ARG A 574      31.867   6.196  44.655  1.00 59.01           N  
ATOM   3546  N   LYS A 575      37.236   2.059  39.391  1.00 74.06           N  
ATOM   3547  CA  LYS A 575      37.735   0.847  38.747  1.00 74.80           C  
ATOM   3548  C   LYS A 575      38.907   1.162  37.815  1.00 73.65           C  
ATOM   3549  O   LYS A 575      39.765   0.313  37.566  1.00 73.37           O  
ATOM   3550  CB  LYS A 575      36.612   0.151  37.972  1.00 74.62           C  
ATOM   3551  CG  LYS A 575      36.988  -1.207  37.396  1.00 74.66           C  
ATOM   3552  CD  LYS A 575      35.825  -1.831  36.640  1.00 74.78           C  
ATOM   3553  CE  LYS A 575      34.631  -2.063  37.553  1.00 74.26           C  
ATOM   3554  NZ  LYS A 575      33.485  -2.680  36.828  1.00 74.97           N  
ATOM   3555  N   LEU A 576      38.942   2.392  37.314  1.00 51.32           N  
ATOM   3556  CA  LEU A 576      39.975   2.818  36.376  1.00 50.75           C  
ATOM   3557  C   LEU A 576      41.159   3.453  37.107  1.00 51.74           C  
ATOM   3558  O   LEU A 576      41.912   4.235  36.530  1.00 52.19           O  
ATOM   3559  CB  LEU A 576      39.391   3.795  35.354  1.00 50.53           C  
ATOM   3560  CG  LEU A 576      40.051   3.860  33.974  1.00 50.19           C  
ATOM   3561  CD1 LEU A 576      40.011   2.500  33.299  1.00 50.85           C  
ATOM   3562  CD2 LEU A 576      39.372   4.910  33.112  1.00 50.54           C  
ATOM   3563  N   CYS A 577      41.312   3.112  38.382  1.00 56.03           N  
ATOM   3564  CA  CYS A 577      42.412   3.629  39.189  1.00 59.25           C  
ATOM   3565  C   CYS A 577      43.091   2.517  39.979  1.00 57.69           C  
ATOM   3566  O   CYS A 577      42.438   1.565  40.405  1.00 51.27           O  
ATOM   3567  CB  CYS A 577      41.917   4.716  40.148  1.00 50.07           C  
ATOM   3568  SG  CYS A 577      41.755   6.359  39.414  1.00 50.38           S  
ATOM   3569  N   PRO A 578      44.413   2.632  40.170  1.00 58.92           N  
ATOM   3570  CA  PRO A 578      45.157   1.700  41.021  1.00 58.72           C  
ATOM   3571  C   PRO A 578      44.880   1.945  42.503  1.00 60.14           C  
ATOM   3572  O   PRO A 578      44.576   3.072  42.890  1.00 61.49           O  
ATOM   3573  CB  PRO A 578      46.616   2.004  40.677  1.00 60.82           C  
ATOM   3574  CG  PRO A 578      46.603   3.424  40.247  1.00 58.65           C  
ATOM   3575  CD  PRO A 578      45.300   3.617  39.528  1.00 57.63           C  
ATOM   3576  N   ARG A 579      44.981   0.897  43.314  1.00 67.04           N  
ATOM   3577  CA  ARG A 579      44.724   1.004  44.745  1.00 66.69           C  
ATOM   3578  C   ARG A 579      45.763   1.899  45.418  1.00 68.69           C  
ATOM   3579  O   ARG A 579      46.898   1.999  44.957  1.00 68.44           O  
ATOM   3580  CB  ARG A 579      44.715  -0.388  45.386  1.00 68.59           C  
ATOM   3581  CG  ARG A 579      44.193  -0.420  46.810  1.00 62.14           C  
ATOM   3582  CD  ARG A 579      42.790   0.159  46.895  1.00 62.45           C  
ATOM   3583  NE  ARG A 579      42.290   0.181  48.267  1.00 69.05           N  
ATOM   3584  CZ  ARG A 579      41.568  -0.792  48.816  1.00 69.50           C  
ATOM   3585  NH1 ARG A 579      41.258  -1.870  48.107  1.00 60.53           N  
ATOM   3586  NH2 ARG A 579      41.156  -0.687  50.072  1.00 69.79           N  
ATOM   3587  N   LEU A 580      45.365   2.555  46.505  1.00 97.06           N  
ATOM   3588  CA  LEU A 580      46.244   3.484  47.207  1.00 97.76           C  
ATOM   3589  C   LEU A 580      47.404   2.762  47.886  1.00 91.40           C  
ATOM   3590  O   LEU A 580      48.536   3.245  47.869  1.00 91.42           O  
ATOM   3591  CB  LEU A 580      45.445   4.292  48.236  1.00 96.91           C  
ATOM   3592  CG  LEU A 580      46.085   5.539  48.858  1.00 95.78           C  
ATOM   3593  CD1 LEU A 580      46.892   5.205  50.108  1.00 98.89           C  
ATOM   3594  CD2 LEU A 580      46.951   6.268  47.838  1.00 95.32           C  
ATOM   3595  N   ASP A 581      47.123   1.606  48.482  1.00 82.76           N  
ATOM   3596  CA  ASP A 581      48.151   0.848  49.190  1.00 84.04           C  
ATOM   3597  C   ASP A 581      48.865  -0.140  48.271  1.00 86.35           C  
ATOM   3598  O   ASP A 581      49.353  -1.178  48.716  1.00 87.75           O  
ATOM   3599  CB  ASP A 581      47.543   0.111  50.390  1.00 86.03           C  
ATOM   3600  CG  ASP A 581      46.339  -0.736  50.014  1.00 85.31           C  
ATOM   3601  OD1 ASP A 581      45.300  -0.617  50.698  1.00 83.62           O  
ATOM   3602  OD2 ASP A 581      46.426  -1.528  49.053  1.00 85.47           O  
ATOM   3603  N   ASP A 582      48.920   0.191  46.985  1.00 62.78           N  
ATOM   3604  CA  ASP A 582      49.582  -0.657  46.003  1.00 64.64           C  
ATOM   3605  C   ASP A 582      51.007  -0.172  45.754  1.00 66.45           C  
ATOM   3606  O   ASP A 582      51.229   1.015  45.523  1.00 64.97           O  
ATOM   3607  CB  ASP A 582      48.790  -0.683  44.695  1.00 60.83           C  
ATOM   3608  CG  ASP A 582      49.344  -1.677  43.695  1.00 63.61           C  
ATOM   3609  OD1 ASP A 582      48.898  -2.845  43.709  1.00 63.76           O  
ATOM   3610  OD2 ASP A 582      50.225  -1.294  42.897  1.00 61.41           O  
ATOM   3611  N   PRO A 583      51.979  -1.098  45.805  1.00 78.56           N  
ATOM   3612  CA  PRO A 583      53.406  -0.797  45.631  1.00 82.20           C  
ATOM   3613  C   PRO A 583      53.734  -0.145  44.288  1.00 79.70           C  
ATOM   3614  O   PRO A 583      54.760   0.525  44.174  1.00 80.55           O  
ATOM   3615  CB  PRO A 583      54.067  -2.174  45.735  1.00 84.57           C  
ATOM   3616  CG  PRO A 583      53.114  -2.990  46.534  1.00 84.61           C  
ATOM   3617  CD  PRO A 583      51.754  -2.518  46.123  1.00 81.37           C  
ATOM   3618  N   ALA A 584      52.881  -0.342  43.289  1.00 67.59           N  
ATOM   3619  CA  ALA A 584      53.104   0.241  41.970  1.00 61.60           C  
ATOM   3620  C   ALA A 584      52.027   1.266  41.628  1.00 67.95           C  
ATOM   3621  O   ALA A 584      51.447   1.234  40.542  1.00 66.60           O  
ATOM   3622  CB  ALA A 584      53.152  -0.848  40.911  1.00 60.22           C  
ATOM   3623  N   TRP A 585      51.769   2.180  42.559  1.00 59.84           N  
ATOM   3624  CA  TRP A 585      50.729   3.186  42.374  1.00 57.92           C  
ATOM   3625  C   TRP A 585      51.188   4.325  41.469  1.00 56.44           C  
ATOM   3626  O   TRP A 585      52.243   4.923  41.686  1.00 57.16           O  
ATOM   3627  CB  TRP A 585      50.284   3.747  43.728  1.00 57.04           C  
ATOM   3628  CG  TRP A 585      49.211   4.794  43.621  1.00 57.37           C  
ATOM   3629  CD1 TRP A 585      47.863   4.584  43.572  1.00 57.20           C  
ATOM   3630  CD2 TRP A 585      49.400   6.212  43.553  1.00 56.93           C  
ATOM   3631  NE1 TRP A 585      47.200   5.785  43.476  1.00 55.72           N  
ATOM   3632  CE2 TRP A 585      48.120   6.799  43.464  1.00 55.63           C  
ATOM   3633  CE3 TRP A 585      50.523   7.042  43.559  1.00 56.60           C  
ATOM   3634  CZ2 TRP A 585      47.937   8.176  43.380  1.00 53.22           C  
ATOM   3635  CZ3 TRP A 585      50.338   8.410  43.476  1.00 55.36           C  
ATOM   3636  CH2 TRP A 585      49.055   8.963  43.388  1.00 53.57           C  
ATOM   3637  N   THR A 586      50.385   4.618  40.452  1.00 63.97           N  
ATOM   3638  CA  THR A 586      50.639   5.743  39.559  1.00 60.59           C  
ATOM   3639  C   THR A 586      49.518   6.771  39.702  1.00 62.63           C  
ATOM   3640  O   THR A 586      48.365   6.404  39.928  1.00 63.48           O  
ATOM   3641  CB  THR A 586      50.754   5.288  38.090  1.00 62.07           C  
ATOM   3642  OG1 THR A 586      49.582   4.551  37.724  1.00 61.49           O  
ATOM   3643  CG2 THR A 586      51.974   4.404  37.904  1.00 57.97           C  
ATOM   3644  N   PRO A 587      49.855   8.063  39.576  1.00 64.12           N  
ATOM   3645  CA  PRO A 587      48.871   9.127  39.806  1.00 63.78           C  
ATOM   3646  C   PRO A 587      47.752   9.136  38.772  1.00 63.10           C  
ATOM   3647  O   PRO A 587      47.949   8.689  37.642  1.00 59.72           O  
ATOM   3648  CB  PRO A 587      49.712  10.401  39.707  1.00 64.41           C  
ATOM   3649  CG  PRO A 587      50.835  10.028  38.813  1.00 63.83           C  
ATOM   3650  CD  PRO A 587      51.156   8.603  39.149  1.00 65.84           C  
ATOM   3651  N   GLY A 588      46.589   9.642  39.169  1.00 68.69           N  
ATOM   3652  CA  GLY A 588      45.445   9.726  38.281  1.00 65.63           C  
ATOM   3653  C   GLY A 588      44.907   8.364  37.890  1.00 69.91           C  
ATOM   3654  O   GLY A 588      45.236   7.358  38.518  1.00 67.35           O  
ATOM   3655  N   PRO A 589      44.067   8.327  36.846  1.00 85.94           N  
ATOM   3656  CA  PRO A 589      43.494   7.073  36.350  1.00 84.27           C  
ATOM   3657  C   PRO A 589      44.475   6.294  35.480  1.00 86.62           C  
ATOM   3658  O   PRO A 589      44.854   6.751  34.402  1.00 85.76           O  
ATOM   3659  CB  PRO A 589      42.288   7.541  35.535  1.00 84.58           C  
ATOM   3660  CG  PRO A 589      42.674   8.890  35.050  1.00 86.30           C  
ATOM   3661  CD  PRO A 589      43.564   9.496  36.105  1.00 86.12           C  
ATOM   3662  N   SER A 590      44.891   5.128  35.958  1.00 83.82           N  
ATOM   3663  CA  SER A 590      45.765   4.262  35.181  1.00 82.49           C  
ATOM   3664  C   SER A 590      44.977   3.067  34.670  1.00 83.58           C  
ATOM   3665  O   SER A 590      43.746   3.070  34.703  1.00 83.49           O  
ATOM   3666  CB  SER A 590      46.958   3.800  36.018  1.00 82.33           C  
ATOM   3667  OG  SER A 590      47.733   4.904  36.447  1.00 85.09           O  
ATOM   3668  N   LEU A 591      45.694   2.049  34.201  1.00 67.80           N  
ATOM   3669  CA  LEU A 591      45.083   0.821  33.699  1.00 66.75           C  
ATOM   3670  C   LEU A 591      44.162   1.099  32.515  1.00 68.11           C  
ATOM   3671  O   LEU A 591      43.146   0.428  32.339  1.00 69.02           O  
ATOM   3672  CB  LEU A 591      44.314   0.110  34.817  1.00 68.09           C  
ATOM   3673  CG  LEU A 591      45.058  -0.045  36.145  1.00 68.79           C  
ATOM   3674  CD1 LEU A 591      44.146  -0.625  37.214  1.00 69.65           C  
ATOM   3675  CD2 LEU A 591      46.299  -0.906  35.966  1.00 60.39           C  
ATOM   3676  N   LEU A 592      44.522   2.091  31.708  1.00 69.83           N  
ATOM   3677  CA  LEU A 592      43.736   2.444  30.531  1.00 60.83           C  
ATOM   3678  C   LEU A 592      44.014   1.469  29.389  1.00 60.29           C  
ATOM   3679  O   LEU A 592      45.133   0.983  29.235  1.00 60.87           O  
ATOM   3680  CB  LEU A 592      44.030   3.882  30.092  1.00 63.82           C  
ATOM   3681  CG  LEU A 592      43.185   5.005  30.710  1.00 61.52           C  
ATOM   3682  CD1 LEU A 592      41.737   4.890  30.278  1.00 60.87           C  
ATOM   3683  CD2 LEU A 592      43.284   5.030  32.225  1.00 60.91           C  
ATOM   3684  N   SER A 593      42.987   1.192  28.592  1.00 61.94           N  
ATOM   3685  CA  SER A 593      43.051   0.148  27.575  1.00 62.13           C  
ATOM   3686  C   SER A 593      41.882   0.298  26.591  1.00 67.51           C  
ATOM   3687  O   SER A 593      40.855   0.838  26.987  1.00 68.84           O  
ATOM   3688  CB  SER A 593      43.022  -1.230  28.240  1.00 60.97           C  
ATOM   3689  OG  SER A 593      44.215  -1.476  28.965  1.00 64.67           O  
ATOM   3690  N   LEU A 594      41.981  -0.134  25.325  1.00 67.30           N  
ATOM   3691  CA  LEU A 594      43.161  -0.662  24.612  1.00 68.87           C  
ATOM   3692  C   LEU A 594      43.872  -1.872  25.235  1.00 65.59           C  
ATOM   3693  O   LEU A 594      45.000  -1.745  25.713  1.00 66.89           O  
ATOM   3694  CB  LEU A 594      44.183   0.464  24.397  1.00 69.52           C  
ATOM   3695  CG  LEU A 594      43.991   1.388  23.187  1.00 70.27           C  
ATOM   3696  CD1 LEU A 594      43.991   0.583  21.898  1.00 73.00           C  
ATOM   3697  CD2 LEU A 594      42.728   2.226  23.298  1.00 69.56           C  
ATOM   3698  N   GLN A 595      43.230  -3.042  25.222  1.00 72.20           N  
ATOM   3699  CA  GLN A 595      41.913  -3.227  24.616  1.00 71.18           C  
ATOM   3700  C   GLN A 595      40.846  -3.515  25.668  1.00 70.69           C  
ATOM   3701  O   GLN A 595      40.481  -4.670  25.893  1.00 70.95           O  
ATOM   3702  CB  GLN A 595      41.944  -4.364  23.592  1.00 71.76           C  
ATOM   3703  CG  GLN A 595      42.962  -4.190  22.483  1.00 74.20           C  
ATOM   3704  CD  GLN A 595      44.334  -4.705  22.861  1.00 74.87           C  
ATOM   3705  OE1 GLN A 595      44.494  -5.433  23.841  1.00 71.25           O  
ATOM   3706  NE2 GLN A 595      45.339  -4.325  22.081  1.00 75.06           N  
ATOM   3707  N   MET A 596      40.348  -2.465  26.311  1.00 70.42           N  
ATOM   3708  CA  MET A 596      39.294  -2.611  27.309  1.00 78.55           C  
ATOM   3709  C   MET A 596      37.926  -2.546  26.638  1.00 71.51           C  
ATOM   3710  O   MET A 596      37.812  -2.740  25.428  1.00 71.92           O  
ATOM   3711  CB  MET A 596      39.420  -1.533  28.386  1.00 78.80           C  
ATOM   3712  CG  MET A 596      39.299  -2.044  29.814  1.00 78.23           C  
ATOM   3713  SD  MET A 596      40.025  -0.902  31.006  1.00 73.59           S  
ATOM   3714  CE  MET A 596      39.559  -1.668  32.555  1.00 71.71           C  
ATOM   3715  N   ARG A 597      36.891  -2.270  27.423  1.00 69.05           N  
ATOM   3716  CA  ARG A 597      35.532  -2.219  26.897  1.00 61.05           C  
ATOM   3717  C   ARG A 597      34.790  -0.970  27.362  1.00 62.11           C  
ATOM   3718  O   ARG A 597      33.635  -0.751  26.996  1.00 63.56           O  
ATOM   3719  CB  ARG A 597      34.760  -3.473  27.307  1.00 62.27           C  
ATOM   3720  CG  ARG A 597      35.141  -4.719  26.521  1.00 62.87           C  
ATOM   3721  CD  ARG A 597      34.683  -5.981  27.234  1.00 62.08           C  
ATOM   3722  NE  ARG A 597      33.383  -5.803  27.872  1.00 64.41           N  
ATOM   3723  CZ  ARG A 597      32.745  -6.756  28.542  1.00 63.28           C  
ATOM   3724  NH1 ARG A 597      33.283  -7.963  28.654  1.00 64.96           N  
ATOM   3725  NH2 ARG A 597      31.566  -6.507  29.095  1.00 66.85           N  
ATOM   3726  N   VAL A 598      35.461  -0.153  28.166  1.00 51.94           N  
ATOM   3727  CA  VAL A 598      34.881   1.091  28.663  1.00 53.33           C  
ATOM   3728  C   VAL A 598      35.371   2.275  27.838  1.00 52.79           C  
ATOM   3729  O   VAL A 598      34.582   3.086  27.344  1.00 53.67           O  
ATOM   3730  CB  VAL A 598      35.237   1.323  30.143  1.00 51.14           C  
ATOM   3731  CG1 VAL A 598      34.675   2.651  30.622  1.00 54.90           C  
ATOM   3732  CG2 VAL A 598      34.722   0.174  30.998  1.00 50.75           C  
ATOM   3733  N   THR A 599      36.687   2.356  27.686  1.00 53.55           N  
ATOM   3734  CA  THR A 599      37.315   3.429  26.927  1.00 53.65           C  
ATOM   3735  C   THR A 599      36.980   3.474  25.421  1.00 55.93           C  
ATOM   3736  O   THR A 599      36.950   4.561  24.843  1.00 57.19           O  
ATOM   3737  CB  THR A 599      38.845   3.372  27.083  1.00 54.32           C  
ATOM   3738  OG1 THR A 599      39.383   2.324  26.267  1.00 53.06           O  
ATOM   3739  CG2 THR A 599      39.210   3.119  28.537  1.00 53.09           C  
ATOM   3740  N   PRO A 600      36.733   2.314  24.772  1.00 55.51           N  
ATOM   3741  CA  PRO A 600      36.360   2.463  23.359  1.00 57.18           C  
ATOM   3742  C   PRO A 600      35.000   3.127  23.172  1.00 57.97           C  
ATOM   3743  O   PRO A 600      34.790   3.848  22.198  1.00 59.25           O  
ATOM   3744  CB  PRO A 600      36.330   1.020  22.851  1.00 57.47           C  
ATOM   3745  CG  PRO A 600      36.091   0.201  24.063  1.00 55.99           C  
ATOM   3746  CD  PRO A 600      36.864   0.891  25.137  1.00 54.71           C  
ATOM   3747  N   LYS A 601      34.086   2.874  24.100  1.00 57.61           N  
ATOM   3748  CA  LYS A 601      32.778   3.509  24.068  1.00 59.44           C  
ATOM   3749  C   LYS A 601      32.888   4.931  24.602  1.00 60.14           C  
ATOM   3750  O   LYS A 601      32.066   5.794  24.291  1.00 59.42           O  
ATOM   3751  CB  LYS A 601      31.768   2.700  24.885  1.00 63.18           C  
ATOM   3752  CG  LYS A 601      30.357   3.258  24.865  1.00 61.81           C  
ATOM   3753  CD  LYS A 601      29.383   2.334  25.570  1.00 62.86           C  
ATOM   3754  CE  LYS A 601      27.999   2.951  25.621  1.00 65.04           C  
ATOM   3755  NZ  LYS A 601      26.981   1.971  26.072  1.00 63.16           N  
ATOM   3756  N   LEU A 602      33.926   5.170  25.395  1.00 68.95           N  
ATOM   3757  CA  LEU A 602      34.144   6.467  26.026  1.00 67.11           C  
ATOM   3758  C   LEU A 602      34.307   7.619  25.027  1.00 68.33           C  
ATOM   3759  O   LEU A 602      33.989   8.764  25.342  1.00 67.88           O  
ATOM   3760  CB  LEU A 602      35.372   6.391  26.940  1.00 68.19           C  
ATOM   3761  CG  LEU A 602      35.909   7.649  27.625  1.00 65.36           C  
ATOM   3762  CD1 LEU A 602      36.392   7.313  29.024  1.00 65.35           C  
ATOM   3763  CD2 LEU A 602      37.040   8.250  26.809  1.00 66.02           C  
ATOM   3764  N   MET A 603      34.791   7.321  23.824  1.00 76.09           N  
ATOM   3765  CA  MET A 603      35.128   8.383  22.880  1.00 77.93           C  
ATOM   3766  C   MET A 603      34.658   8.145  21.445  1.00 72.17           C  
ATOM   3767  O   MET A 603      34.195   9.069  20.778  1.00 72.42           O  
ATOM   3768  CB  MET A 603      36.642   8.602  22.880  1.00 70.02           C  
ATOM   3769  CG  MET A 603      37.446   7.319  22.757  1.00 79.66           C  
ATOM   3770  SD  MET A 603      39.195   7.615  22.460  1.00 77.03           S  
ATOM   3771  CE  MET A 603      39.129   8.477  20.891  1.00 77.14           C  
ATOM   3772  N   ALA A 604      34.777   6.909  20.974  1.00 80.65           N  
ATOM   3773  CA  ALA A 604      34.607   6.609  19.555  1.00 80.87           C  
ATOM   3774  C   ALA A 604      33.169   6.748  19.062  1.00 82.48           C  
ATOM   3775  O   ALA A 604      32.226   6.327  19.731  1.00 82.75           O  
ATOM   3776  CB  ALA A 604      35.119   5.207  19.260  1.00 80.44           C  
ATOM   3777  N   LEU A 605      33.019   7.352  17.887  1.00 79.99           N  
ATOM   3778  CA  LEU A 605      31.748   7.346  17.172  1.00 86.21           C  
ATOM   3779  C   LEU A 605      31.579   5.977  16.524  1.00 84.24           C  
ATOM   3780  O   LEU A 605      32.559   5.267  16.307  1.00 83.67           O  
ATOM   3781  CB  LEU A 605      31.690   8.463  16.125  1.00 84.23           C  
ATOM   3782  CG  LEU A 605      31.208   9.849  16.576  1.00 86.23           C  
ATOM   3783  CD1 LEU A 605      32.126  10.456  17.629  1.00 81.18           C  
ATOM   3784  CD2 LEU A 605      31.075  10.787  15.382  1.00 86.01           C  
ATOM   3785  N   THR A 606      30.342   5.604  16.215  1.00 93.35           N  
ATOM   3786  CA  THR A 606      30.049   4.212  15.883  1.00 98.20           C  
ATOM   3787  C   THR A 606      29.385   3.987  14.527  1.00 97.40           C  
ATOM   3788  O   THR A 606      28.158   3.931  14.439  1.00 90.71           O  
ATOM   3789  CB  THR A 606      29.142   3.586  16.954  1.00 95.44           C  
ATOM   3790  OG1 THR A 606      27.806   4.083  16.803  1.00 98.60           O  
ATOM   3791  CG2 THR A 606      29.650   3.935  18.339  1.00 92.43           C  
ATOM   3792  N   TRP A 607      30.204   3.841  13.486  1.00 75.78           N  
ATOM   3793  CA  TRP A 607      29.737   3.436  12.156  1.00 78.59           C  
ATOM   3794  C   TRP A 607      28.537   4.229  11.652  1.00 82.44           C  
ATOM   3795  O   TRP A 607      27.430   3.694  11.578  1.00 80.55           O  
ATOM   3796  CB  TRP A 607      29.386   1.947  12.157  1.00 81.54           C  
ATOM   3797  CG  TRP A 607      30.568   1.047  12.007  1.00 77.38           C  
ATOM   3798  CD1 TRP A 607      31.545   0.816  12.929  1.00 77.59           C  
ATOM   3799  CD2 TRP A 607      30.891   0.240  10.866  1.00 80.18           C  
ATOM   3800  NE1 TRP A 607      32.462  -0.078  12.431  1.00 75.07           N  
ATOM   3801  CE2 TRP A 607      32.082  -0.448  11.167  1.00 77.54           C  
ATOM   3802  CE3 TRP A 607      30.289   0.036   9.621  1.00 82.56           C  
ATOM   3803  CZ2 TRP A 607      32.687  -1.323  10.268  1.00 80.35           C  
ATOM   3804  CZ3 TRP A 607      30.890  -0.836   8.729  1.00 86.18           C  
ATOM   3805  CH2 TRP A 607      32.076  -1.504   9.057  1.00 82.69           C  
ATOM   3806  N   ASP A 608      28.762   5.496  11.317  1.00 95.14           N  
ATOM   3807  CA  ASP A 608      27.700   6.391  10.860  1.00 99.70           C  
ATOM   3808  C   ASP A 608      26.575   6.493  11.889  1.00 98.42           C  
ATOM   3809  O   ASP A 608      25.433   6.799  11.547  1.00 99.86           O  
ATOM   3810  CB  ASP A 608      27.141   5.924   9.512  1.00 91.57           C  
ATOM   3811  CG  ASP A 608      28.218   5.763   8.458  1.00 91.49           C  
ATOM   3812  OD1 ASP A 608      29.186   6.552   8.471  1.00 90.56           O  
ATOM   3813  OD2 ASP A 608      28.099   4.847   7.617  1.00 92.12           O  
ATOM   3814  N   GLY A 609      26.910   6.230  13.147  1.00 82.46           N  
ATOM   3815  CA  GLY A 609      25.951   6.290  14.234  1.00 83.60           C  
ATOM   3816  C   GLY A 609      26.576   6.920  15.461  1.00 89.50           C  
ATOM   3817  O   GLY A 609      27.620   7.567  15.369  1.00 88.00           O  
ATOM   3818  N   PHE A 610      25.945   6.731  16.613  1.00112.85           N  
ATOM   3819  CA  PHE A 610      26.436   7.329  17.848  1.00111.03           C  
ATOM   3820  C   PHE A 610      26.753   6.305  18.947  1.00110.41           C  
ATOM   3821  O   PHE A 610      27.849   6.330  19.505  1.00118.38           O  
ATOM   3822  CB  PHE A 610      25.436   8.369  18.365  1.00119.15           C  
ATOM   3823  N   PRO A 611      25.811   5.398  19.270  1.00 86.33           N  
ATOM   3824  CA  PRO A 611      26.137   4.551  20.419  1.00 87.42           C  
ATOM   3825  C   PRO A 611      26.737   3.198  20.051  1.00 86.77           C  
ATOM   3826  O   PRO A 611      26.411   2.619  19.013  1.00 85.80           O  
ATOM   3827  CB  PRO A 611      24.776   4.366  21.095  1.00 86.47           C  
ATOM   3828  CG  PRO A 611      23.750   4.541  19.972  1.00 86.36           C  
ATOM   3829  CD  PRO A 611      24.463   5.096  18.756  1.00 87.89           C  
ATOM   3830  N   LEU A 612      27.625   2.708  20.909  1.00 65.19           N  
ATOM   3831  CA  LEU A 612      28.136   1.352  20.798  1.00 63.89           C  
ATOM   3832  C   LEU A 612      27.723   0.590  22.045  1.00 62.86           C  
ATOM   3833  O   LEU A 612      27.466   1.195  23.083  1.00 61.19           O  
ATOM   3834  CB  LEU A 612      29.654   1.346  20.636  1.00 61.82           C  
ATOM   3835  CG  LEU A 612      30.213   0.359  19.612  1.00 63.50           C  
ATOM   3836  CD1 LEU A 612      29.280   0.241  18.417  1.00 66.13           C  
ATOM   3837  CD2 LEU A 612      31.591   0.801  19.162  1.00 62.52           C  
ATOM   3838  N   HIS A 613      27.651  -0.731  21.953  1.00 65.34           N  
ATOM   3839  CA  HIS A 613      27.196  -1.514  23.089  1.00 64.91           C  
ATOM   3840  C   HIS A 613      27.828  -2.893  23.141  1.00 63.48           C  
ATOM   3841  O   HIS A 613      28.482  -3.329  22.196  1.00 63.07           O  
ATOM   3842  CB  HIS A 613      25.674  -1.645  23.060  1.00 65.34           C  
ATOM   3843  CG  HIS A 613      25.008  -1.159  24.308  1.00 67.04           C  
ATOM   3844  ND1 HIS A 613      24.929   0.178  24.638  1.00 67.80           N  
ATOM   3845  CD2 HIS A 613      24.399  -1.830  25.313  1.00 69.00           C  
ATOM   3846  CE1 HIS A 613      24.295   0.308  25.788  1.00 66.16           C  
ATOM   3847  NE2 HIS A 613      23.962  -0.895  26.219  1.00 67.69           N  
ATOM   3848  N   TYR A 614      27.622  -3.577  24.263  1.00 83.82           N  
ATOM   3849  CA  TYR A 614      28.140  -4.923  24.450  1.00 84.19           C  
ATOM   3850  C   TYR A 614      27.172  -5.750  25.294  1.00 84.03           C  
ATOM   3851  O   TYR A 614      26.567  -5.245  26.240  1.00 82.14           O  
ATOM   3852  CB  TYR A 614      29.521  -4.880  25.108  1.00 80.66           C  
ATOM   3853  CG  TYR A 614      30.208  -6.227  25.179  1.00 80.82           C  
ATOM   3854  CD1 TYR A 614      30.989  -6.686  24.127  1.00 82.02           C  
ATOM   3855  CD2 TYR A 614      30.075  -7.038  26.298  1.00 89.86           C  
ATOM   3856  CE1 TYR A 614      31.617  -7.916  24.185  1.00 81.92           C  
ATOM   3857  CE2 TYR A 614      30.697  -8.271  26.366  1.00 80.16           C  
ATOM   3858  CZ  TYR A 614      31.468  -8.705  25.308  1.00 81.14           C  
ATOM   3859  OH  TYR A 614      32.093  -9.930  25.370  1.00 89.05           O  
ATOM   3860  N   SER A 615      27.026  -7.022  24.934  1.00 60.31           N  
ATOM   3861  CA  SER A 615      26.182  -7.947  25.681  1.00 60.10           C  
ATOM   3862  C   SER A 615      26.652  -9.378  25.454  1.00 60.22           C  
ATOM   3863  O   SER A 615      27.091 -10.057  26.382  1.00 58.38           O  
ATOM   3864  CB  SER A 615      24.717  -7.794  25.273  1.00 63.10           C  
ATOM   3865  OG  SER A 615      23.891  -8.693  25.994  1.00 64.76           O  
ATOM   3866  N   GLU A 616      26.546  -9.831  24.208  1.00 92.00           N  
ATOM   3867  CA  GLU A 616      27.098 -11.115  23.801  1.00 99.94           C  
ATOM   3868  C   GLU A 616      28.185 -10.858  22.767  1.00 91.05           C  
ATOM   3869  O   GLU A 616      28.998 -11.729  22.462  1.00 99.58           O  
ATOM   3870  CB  GLU A 616      26.010 -12.028  23.230  1.00 94.86           C  
ATOM   3871  CG  GLU A 616      24.631 -11.827  23.844  1.00 94.67           C  
ATOM   3872  CD  GLU A 616      24.585 -12.140  25.328  1.00 94.09           C  
ATOM   3873  OE1 GLU A 616      23.675 -11.626  26.014  1.00 94.11           O  
ATOM   3874  OE2 GLU A 616      25.448 -12.903  25.811  1.00 90.11           O  
ATOM   3875  N   ARG A 617      28.173  -9.641  22.234  1.00 90.83           N  
ATOM   3876  CA  ARG A 617      29.157  -9.186  21.263  1.00 98.26           C  
ATOM   3877  C   ARG A 617      29.113  -7.662  21.197  1.00 98.28           C  
ATOM   3878  O   ARG A 617      28.073  -7.057  21.461  1.00 90.26           O  
ATOM   3879  CB  ARG A 617      28.900  -9.798  19.882  1.00 91.60           C  
ATOM   3880  CG  ARG A 617      27.484  -9.611  19.352  1.00 95.76           C  
ATOM   3881  CD  ARG A 617      26.586 -10.783  19.723  1.00 98.20           C  
ATOM   3882  NE  ARG A 617      25.177 -10.485  19.492  1.00 97.19           N  
ATOM   3883  CZ  ARG A 617      24.403  -9.834  20.354  1.00 99.27           C  
ATOM   3884  NH1 ARG A 617      24.904  -9.407  21.506  1.00 97.57           N  
ATOM   3885  NH2 ARG A 617      23.130  -9.603  20.066  1.00100.95           N  
ATOM   3886  N   HIS A 618      30.238  -7.042  20.853  1.00 64.49           N  
ATOM   3887  CA  HIS A 618      30.320  -5.583  20.806  1.00 62.82           C  
ATOM   3888  C   HIS A 618      29.656  -5.041  19.542  1.00 66.10           C  
ATOM   3889  O   HIS A 618      28.699  -5.625  19.034  1.00 66.21           O  
ATOM   3890  CB  HIS A 618      31.777  -5.122  20.881  1.00 60.83           C  
ATOM   3891  CG  HIS A 618      31.967  -3.824  21.605  1.00 61.82           C  
ATOM   3892  ND1 HIS A 618      32.009  -3.737  22.980  1.00 68.14           N  
ATOM   3893  CD2 HIS A 618      32.128  -2.560  21.144  1.00 60.36           C  
ATOM   3894  CE1 HIS A 618      32.187  -2.477  23.335  1.00 68.75           C  
ATOM   3895  NE2 HIS A 618      32.263  -1.743  22.240  1.00 60.07           N  
ATOM   3896  N   GLY A 619      30.163  -3.919  19.041  1.00 93.86           N  
ATOM   3897  CA  GLY A 619      29.644  -3.331  17.819  1.00 95.80           C  
ATOM   3898  C   GLY A 619      29.859  -4.249  16.633  1.00 97.52           C  
ATOM   3899  O   GLY A 619      30.993  -4.606  16.313  1.00 97.83           O  
ATOM   3900  N   TRP A 620      28.765  -4.636  15.984  1.00 94.82           N  
ATOM   3901  CA  TRP A 620      28.825  -5.570  14.864  1.00 96.99           C  
ATOM   3902  C   TRP A 620      29.642  -5.021  13.698  1.00 98.06           C  
ATOM   3903  O   TRP A 620      29.448  -3.884  13.269  1.00 97.99           O  
ATOM   3904  CB  TRP A 620      27.411  -5.931  14.394  1.00 98.79           C  
ATOM   3905  CG  TRP A 620      26.436  -4.787  14.411  1.00 99.52           C  
ATOM   3906  CD1 TRP A 620      26.349  -3.767  13.507  1.00 90.83           C  
ATOM   3907  CD2 TRP A 620      25.394  -4.559  15.370  1.00 91.88           C  
ATOM   3908  NE1 TRP A 620      25.326  -2.917  13.849  1.00 92.56           N  
ATOM   3909  CE2 TRP A 620      24.723  -3.381  14.988  1.00 93.31           C  
ATOM   3910  CE3 TRP A 620      24.967  -5.237  16.516  1.00 99.70           C  
ATOM   3911  CZ2 TRP A 620      23.650  -2.866  15.709  1.00 91.33           C  
ATOM   3912  CZ3 TRP A 620      23.901  -4.724  17.233  1.00 98.99           C  
ATOM   3913  CH2 TRP A 620      23.254  -3.549  16.827  1.00 90.70           C  
ATOM   3914  N   GLY A 621      30.562  -5.838  13.197  1.00 54.03           N  
ATOM   3915  CA  GLY A 621      31.422  -5.445  12.097  1.00 53.52           C  
ATOM   3916  C   GLY A 621      31.892  -6.632  11.278  1.00 54.10           C  
ATOM   3917  O   GLY A 621      31.081  -7.364  10.714  1.00 56.80           O  
ATOM   3918  N   TYR A 622      33.206  -6.824  11.215  1.00101.64           N  
ATOM   3919  CA  TYR A 622      33.782  -7.923  10.447  1.00102.61           C  
ATOM   3920  C   TYR A 622      34.409  -8.964  11.370  1.00102.11           C  
ATOM   3921  O   TYR A 622      35.385  -8.675  12.066  1.00107.71           O  
ATOM   3922  CB  TYR A 622      34.828  -7.402   9.457  1.00101.42           C  
ATOM   3923  CG  TYR A 622      34.343  -6.282   8.562  1.00109.84           C  
ATOM   3924  CD1 TYR A 622      35.208  -5.279   8.144  1.00109.14           C  
ATOM   3925  CD2 TYR A 622      33.024  -6.230   8.127  1.00103.44           C  
ATOM   3926  CE1 TYR A 622      34.775  -4.252   7.327  1.00109.75           C  
ATOM   3927  CE2 TYR A 622      32.580  -5.208   7.308  1.00104.22           C  
ATOM   3928  CZ  TYR A 622      33.461  -4.223   6.911  1.00101.39           C  
ATOM   3929  OH  TYR A 622      33.025  -3.202   6.097  1.00103.82           O  
ATOM   3930  N   LEU A 623      33.843 -10.168  11.366  1.00 54.86           N  
ATOM   3931  CA  LEU A 623      34.319 -11.278  12.194  1.00 53.77           C  
ATOM   3932  C   LEU A 623      34.376 -10.904  13.672  1.00 50.99           C  
ATOM   3933  O   LEU A 623      35.265 -11.347  14.397  1.00 59.56           O  
ATOM   3934  CB  LEU A 623      35.697 -11.760  11.727  1.00 54.37           C  
ATOM   3935  CG  LEU A 623      35.797 -12.423  10.352  1.00 57.07           C  
ATOM   3936  CD1 LEU A 623      36.013 -11.395   9.251  1.00 58.07           C  
ATOM   3937  CD2 LEU A 623      36.903 -13.468  10.341  1.00 57.46           C  
ATOM   3938  N   ASN A 630      11.180 -11.023  -1.060  1.00157.36           N  
ATOM   3939  CA  ASN A 630      12.322 -11.403  -0.236  1.00114.40           C  
ATOM   3940  C   ASN A 630      12.728 -10.298   0.735  1.00112.28           C  
ATOM   3941  O   ASN A 630      13.900  -9.930   0.818  1.00117.11           O  
ATOM   3942  CB  ASN A 630      13.509 -11.787  -1.122  1.00117.98           C  
ATOM   3943  CG  ASN A 630      13.806 -10.748  -2.188  1.00118.95           C  
ATOM   3944  OD1 ASN A 630      13.312  -9.622  -2.131  1.00119.08           O  
ATOM   3945  ND2 ASN A 630      14.621 -11.124  -3.167  1.00119.67           N  
ATOM   3946  N   LEU A 631      11.751  -9.780   1.472  1.00430.92           N  
ATOM   3947  CA  LEU A 631      11.991  -8.703   2.430  1.00136.04           C  
ATOM   3948  C   LEU A 631      11.904  -9.203   3.870  1.00136.92           C  
ATOM   3949  O   LEU A 631      11.073 -10.052   4.193  1.00135.10           O  
ATOM   3950  CB  LEU A 631      10.994  -7.564   2.208  1.00135.64           C  
ATOM   3951  CG  LEU A 631      11.012  -6.913   0.823  1.00135.76           C  
ATOM   3952  CD1 LEU A 631      10.013  -5.766   0.744  1.00139.65           C  
ATOM   3953  CD2 LEU A 631      12.413  -6.436   0.471  1.00134.97           C  
ATOM   3954  N   ALA A 632      12.766  -8.673   4.732  1.00119.36           N  
ATOM   3955  CA  ALA A 632      12.765  -9.041   6.145  1.00117.64           C  
ATOM   3956  C   ALA A 632      12.446  -7.834   7.024  1.00116.45           C  
ATOM   3957  O   ALA A 632      13.013  -6.757   6.840  1.00115.28           O  
ATOM   3958  CB  ALA A 632      14.105  -9.645   6.539  1.00111.81           C  
ATOM   3959  N   LYS A 633      11.539  -8.022   7.978  1.00124.93           N  
ATOM   3960  CA  LYS A 633      11.109  -6.935   8.854  1.00122.08           C  
ATOM   3961  C   LYS A 633      11.153  -7.323  10.332  1.00120.55           C  
ATOM   3962  O   LYS A 633      11.081  -8.501  10.680  1.00121.23           O  
ATOM   3963  CB  LYS A 633       9.695  -6.482   8.480  1.00114.93           C  
ATOM   3964  CG  LYS A 633       9.569  -5.923   7.073  1.00118.12           C  
ATOM   3965  CD  LYS A 633      10.409  -4.668   6.902  1.00115.24           C  
ATOM   3966  CE  LYS A 633      10.404  -4.190   5.460  1.00118.19           C  
ATOM   3967  NZ  LYS A 633      11.028  -5.185   4.548  1.00119.10           N  
ATOM   3968  N   LEU A 634      11.270  -6.316  11.195  1.00115.45           N  
ATOM   3969  CA  LEU A 634      11.260  -6.525  12.640  1.00110.77           C  
ATOM   3970  C   LEU A 634      10.559  -5.366  13.347  1.00111.26           C  
ATOM   3971  O   LEU A 634      10.810  -4.201  13.039  1.00112.14           O  
ATOM   3972  CB  LEU A 634      12.685  -6.694  13.173  1.00115.62           C  
ATOM   3973  CG  LEU A 634      13.269  -8.106  13.087  1.00115.10           C  
ATOM   3974  CD1 LEU A 634      14.764  -8.093  13.344  1.00110.76           C  
ATOM   3975  CD2 LEU A 634      12.564  -9.030  14.068  1.00115.45           C  
ATOM   3976  N   PRO A 635       9.674  -5.689  14.305  1.00123.99           N  
ATOM   3977  CA  PRO A 635       8.839  -4.696  14.991  1.00122.30           C  
ATOM   3978  C   PRO A 635       9.614  -3.784  15.938  1.00119.91           C  
ATOM   3979  O   PRO A 635      10.827  -3.925  16.096  1.00117.08           O  
ATOM   3980  CB  PRO A 635       7.846  -5.562  15.773  1.00115.70           C  
ATOM   3981  CG  PRO A 635       8.580  -6.830  16.019  1.00113.79           C  
ATOM   3982  CD  PRO A 635       9.416  -7.056  14.791  1.00113.85           C  
ATOM   3983  N   THR A 636       8.899  -2.853  16.560  1.00113.94           N  
ATOM   3984  CA  THR A 636       9.491  -1.914  17.505  1.00111.63           C  
ATOM   3985  C   THR A 636       8.596  -1.743  18.727  1.00119.62           C  
ATOM   3986  O   THR A 636       7.472  -2.242  18.757  1.00111.97           O  
ATOM   3987  CB  THR A 636       9.733  -0.538  16.857  1.00111.62           C  
ATOM   3988  OG1 THR A 636      10.045   0.422  17.873  1.00118.88           O  
ATOM   3989  CG2 THR A 636       8.495  -0.083  16.104  1.00113.07           C  
ATOM   3990  N   GLY A 637       9.097  -1.035  19.734  1.00 95.68           N  
ATOM   3991  CA  GLY A 637       8.340  -0.818  20.953  1.00 94.56           C  
ATOM   3992  C   GLY A 637       9.018   0.131  21.922  1.00 98.91           C  
ATOM   3993  O   GLY A 637      10.245   0.214  21.975  1.00 96.01           O  
ATOM   3994  N   THR A 638       8.208   0.851  22.693  1.00 95.65           N  
ATOM   3995  CA  THR A 638       8.715   1.791  23.684  1.00 92.84           C  
ATOM   3996  C   THR A 638       7.711   1.970  24.822  1.00 93.42           C  
ATOM   3997  O   THR A 638       6.597   2.450  24.607  1.00 96.95           O  
ATOM   3998  CB  THR A 638       9.021   3.166  23.058  1.00 96.92           C  
ATOM   3999  OG1 THR A 638       9.977   3.014  22.001  1.00 95.82           O  
ATOM   4000  CG2 THR A 638       9.579   4.117  24.105  1.00 93.79           C  
ATOM   4001  N   THR A 639       8.106   1.575  26.031  1.00131.94           N  
ATOM   4002  CA  THR A 639       7.234   1.677  27.200  1.00132.01           C  
ATOM   4003  C   THR A 639       8.037   1.967  28.470  1.00128.33           C  
ATOM   4004  O   THR A 639       9.244   1.729  28.518  1.00124.31           O  
ATOM   4005  CB  THR A 639       6.411   0.383  27.407  1.00121.59           C  
ATOM   4006  OG1 THR A 639       6.151  -0.239  26.143  1.00124.08           O  
ATOM   4007  CG2 THR A 639       5.087   0.686  28.101  1.00124.49           C  
ATOM   4008  N   LEU A 640       7.360   2.485  29.493  1.00137.25           N  
ATOM   4009  CA  LEU A 640       7.981   2.755  30.790  1.00135.19           C  
ATOM   4010  C   LEU A 640       7.258   1.988  31.898  1.00136.50           C  
ATOM   4011  O   LEU A 640       6.070   1.682  31.774  1.00136.26           O  
ATOM   4012  CB  LEU A 640       7.988   4.266  31.089  1.00136.41           C  
ATOM   4013  CG  LEU A 640       6.743   5.086  31.484  1.00139.19           C  
ATOM   4014  CD1 LEU A 640       5.504   4.734  30.663  1.00133.50           C  
ATOM   4015  CD2 LEU A 640       6.440   4.998  32.982  1.00138.60           C  
ATOM   4016  N   GLU A 641       7.969   1.675  32.980  1.00114.29           N  
ATOM   4017  CA  GLU A 641       7.368   0.924  34.082  1.00112.06           C  
ATOM   4018  C   GLU A 641       8.040   1.188  35.431  1.00112.22           C  
ATOM   4019  O   GLU A 641       7.413   1.000  36.475  1.00112.20           O  
ATOM   4020  CB  GLU A 641       7.397  -0.577  33.775  1.00117.45           C  
ATOM   4021  CG  GLU A 641       8.779  -1.209  33.829  1.00114.05           C  
ATOM   4022  CD  GLU A 641       8.977  -2.078  35.057  1.00113.04           C  
ATOM   4023  OE1 GLU A 641      10.122  -2.517  35.296  1.00110.23           O  
ATOM   4024  OE2 GLU A 641       7.988  -2.328  35.779  1.00115.17           O  
ATOM   4025  N   SER A 642       9.307   1.608  35.396  1.00137.04           N  
ATOM   4026  CA  SER A 642      10.096   1.929  36.594  1.00133.98           C  
ATOM   4027  C   SER A 642      10.391   0.694  37.457  1.00160.79           C  
ATOM   4028  O   SER A 642       9.513  -0.139  37.681  1.00137.15           O  
ATOM   4029  CB  SER A 642       9.385   3.003  37.430  1.00138.24           C  
ATOM   4030  OG  SER A 642      10.072   3.261  38.641  1.00135.94           O  
ATOM   4031  N   ALA A 643      11.626   0.575  37.945  1.00102.81           N  
ATOM   4032  CA  ALA A 643      12.668   1.573  37.725  1.00102.82           C  
ATOM   4033  C   ALA A 643      13.922   0.966  37.107  1.00102.49           C  
ATOM   4034  O   ALA A 643      14.508   0.032  37.654  1.00102.19           O  
ATOM   4035  CB  ALA A 643      13.018   2.268  39.034  1.00101.48           C  
ATOM   4036  N   GLY A 644      14.331   1.509  35.966  1.00 85.39           N  
ATOM   4037  CA  GLY A 644      15.571   1.115  35.324  1.00 83.12           C  
ATOM   4038  C   GLY A 644      16.405   2.344  35.026  1.00 80.04           C  
ATOM   4039  O   GLY A 644      15.992   3.463  35.333  1.00 79.68           O  
ATOM   4040  N   VAL A 645      17.578   2.150  34.430  1.00 97.53           N  
ATOM   4041  CA  VAL A 645      18.433   3.276  34.075  1.00 96.67           C  
ATOM   4042  C   VAL A 645      17.850   4.006  32.864  1.00 98.35           C  
ATOM   4043  O   VAL A 645      17.326   3.382  31.940  1.00 99.75           O  
ATOM   4044  CB  VAL A 645      19.885   2.824  33.789  1.00 98.86           C  
ATOM   4045  CG1 VAL A 645      19.939   1.883  32.594  1.00 98.07           C  
ATOM   4046  CG2 VAL A 645      20.794   4.027  33.583  1.00 97.63           C  
ATOM   4047  N   VAL A 646      17.919   5.334  32.888  1.00 93.62           N  
ATOM   4048  CA  VAL A 646      17.356   6.146  31.815  1.00 93.53           C  
ATOM   4049  C   VAL A 646      18.176   6.014  30.534  1.00 94.64           C  
ATOM   4050  O   VAL A 646      19.400   6.148  30.548  1.00 94.10           O  
ATOM   4051  CB  VAL A 646      17.264   7.633  32.229  1.00 93.57           C  
ATOM   4052  CG1 VAL A 646      18.563   8.093  32.877  1.00 92.01           C  
ATOM   4053  CG2 VAL A 646      16.901   8.508  31.037  1.00 96.89           C  
ATOM   4054  N   CYS A 647      17.493   5.740  29.427  1.00 78.25           N  
ATOM   4055  CA  CYS A 647      18.153   5.584  28.138  1.00 79.84           C  
ATOM   4056  C   CYS A 647      17.751   6.682  27.158  1.00 76.60           C  
ATOM   4057  O   CYS A 647      16.606   6.728  26.707  1.00 70.98           O  
ATOM   4058  CB  CYS A 647      17.835   4.214  27.537  1.00 71.39           C  
ATOM   4059  SG  CYS A 647      18.460   3.984  25.859  1.00 79.20           S  
ATOM   4060  N   PRO A 648      18.699   7.572  26.828  1.00107.60           N  
ATOM   4061  CA  PRO A 648      18.474   8.647  25.856  1.00109.33           C  
ATOM   4062  C   PRO A 648      18.548   8.143  24.418  1.00101.54           C  
ATOM   4063  O   PRO A 648      19.295   7.206  24.132  1.00102.34           O  
ATOM   4064  CB  PRO A 648      19.614   9.621  26.151  1.00105.53           C  
ATOM   4065  CG  PRO A 648      20.713   8.748  26.643  1.00105.55           C  
ATOM   4066  CD  PRO A 648      20.047   7.640  27.420  1.00104.84           C  
ATOM   4067  N   TYR A 649      17.782   8.763  23.525  1.00 79.68           N  
ATOM   4068  CA  TYR A 649      17.785   8.371  22.121  1.00 79.29           C  
ATOM   4069  C   TYR A 649      17.491   9.557  21.211  1.00 80.84           C  
ATOM   4070  O   TYR A 649      17.157   9.384  20.039  1.00 83.53           O  
ATOM   4071  CB  TYR A 649      16.782   7.258  21.880  1.00 83.44           C  
ATOM   4072  N   ARG A 650      17.614  10.761  21.756  1.00100.00           N  
ATOM   4073  CA  ARG A 650      17.429  11.974  20.970  1.00101.84           C  
ATOM   4074  C   ARG A 650      18.787  12.533  20.566  1.00100.97           C  
ATOM   4075  O   ARG A 650      18.972  13.001  19.440  1.00 99.37           O  
ATOM   4076  CB  ARG A 650      16.634  13.016  21.755  1.00100.75           C  
ATOM   4077  CG  ARG A 650      15.440  12.452  22.504  1.00101.63           C  
ATOM   4078  CD  ARG A 650      14.508  13.563  22.957  1.00 99.71           C  
ATOM   4079  NE  ARG A 650      13.574  13.117  23.985  1.00101.74           N  
ATOM   4080  CZ  ARG A 650      13.710  13.383  25.281  1.00 99.60           C  
ATOM   4081  NH1 ARG A 650      14.740  14.101  25.706  1.00 96.30           N  
ATOM   4082  NH2 ARG A 650      12.813  12.938  26.150  1.00 97.93           N  
ATOM   4083  N   ALA A 651      19.733  12.474  21.498  1.00118.73           N  
ATOM   4084  CA  ALA A 651      21.106  12.887  21.234  1.00119.39           C  
ATOM   4085  C   ALA A 651      21.724  12.000  20.161  1.00117.11           C  
ATOM   4086  O   ALA A 651      22.630  12.416  19.442  1.00118.21           O  
ATOM   4087  CB  ALA A 651      21.932  12.840  22.509  1.00117.92           C  
ATOM   4088  N   ILE A 652      21.223  10.772  20.065  1.00 64.48           N  
ATOM   4089  CA  ILE A 652      21.652   9.841  19.031  1.00 65.21           C  
ATOM   4090  C   ILE A 652      21.221  10.340  17.656  1.00 66.79           C  
ATOM   4091  O   ILE A 652      22.029  10.426  16.729  1.00 66.86           O  
ATOM   4092  CB  ILE A 652      21.077   8.430  19.269  1.00 65.53           C  
ATOM   4093  CG1 ILE A 652      21.426   7.942  20.676  1.00 63.86           C  
ATOM   4094  CG2 ILE A 652      21.586   7.458  18.214  1.00 66.29           C  
ATOM   4095  CD1 ILE A 652      20.874   6.573  21.004  1.00 63.98           C  
ATOM   4096  N   GLU A 653      19.940  10.675  17.536  1.00 93.61           N  
ATOM   4097  CA  GLU A 653      19.386  11.164  16.280  1.00 96.91           C  
ATOM   4098  C   GLU A 653      20.049  12.476  15.878  1.00 96.33           C  
ATOM   4099  O   GLU A 653      20.363  12.688  14.706  1.00 95.36           O  
ATOM   4100  CB  GLU A 653      17.870  11.342  16.399  1.00 96.46           C  
ATOM   4101  CG  GLU A 653      17.104  11.164  15.091  1.00 98.56           C  
ATOM   4102  CD  GLU A 653      17.204  12.367  14.174  1.00 90.28           C  
ATOM   4103  OE1 GLU A 653      17.437  13.486  14.681  1.00 97.74           O  
ATOM   4104  OE2 GLU A 653      17.049  12.196  12.946  1.00 90.58           O  
ATOM   4105  N   SER A 654      20.267  13.352  16.854  1.00 92.94           N  
ATOM   4106  CA  SER A 654      20.914  14.633  16.594  1.00 93.06           C  
ATOM   4107  C   SER A 654      22.367  14.438  16.168  1.00 91.86           C  
ATOM   4108  O   SER A 654      22.876  15.171  15.320  1.00 92.22           O  
ATOM   4109  CB  SER A 654      20.841  15.536  17.827  1.00 91.03           C  
ATOM   4110  OG  SER A 654      21.628  15.021  18.885  1.00 90.11           O  
ATOM   4111  N   LEU A 655      23.031  13.450  16.761  1.00114.35           N  
ATOM   4112  CA  LEU A 655      24.409  13.134  16.400  1.00114.02           C  
ATOM   4113  C   LEU A 655      24.451  12.608  14.970  1.00116.71           C  
ATOM   4114  O   LEU A 655      25.386  12.895  14.219  1.00116.63           O  
ATOM   4115  CB  LEU A 655      25.007  12.110  17.370  1.00115.70           C  
ATOM   4116  CG  LEU A 655      26.505  12.194  17.684  1.00114.16           C  
ATOM   4117  CD1 LEU A 655      27.363  11.749  16.508  1.00113.03           C  
ATOM   4118  CD2 LEU A 655      26.881  13.605  18.119  1.00112.94           C  
ATOM   4119  N   TYR A 656      23.431  11.841  14.598  1.00 61.43           N  
ATOM   4120  CA  TYR A 656      23.311  11.350  13.231  1.00 62.72           C  
ATOM   4121  C   TYR A 656      23.095  12.516  12.275  1.00 62.92           C  
ATOM   4122  O   TYR A 656      23.615  12.517  11.158  1.00 63.24           O  
ATOM   4123  CB  TYR A 656      22.168  10.343  13.109  1.00 64.16           C  
ATOM   4124  CG  TYR A 656      22.070   9.701  11.744  1.00 65.67           C  
ATOM   4125  CD1 TYR A 656      21.245  10.232  10.761  1.00 66.91           C  
ATOM   4126  CD2 TYR A 656      22.808   8.566  11.435  1.00 65.91           C  
ATOM   4127  CE1 TYR A 656      21.157   9.651   9.510  1.00 68.39           C  
ATOM   4128  CE2 TYR A 656      22.726   7.977  10.187  1.00 67.38           C  
ATOM   4129  CZ  TYR A 656      21.899   8.523   9.230  1.00 68.64           C  
ATOM   4130  OH  TYR A 656      21.814   7.938   7.987  1.00 60.18           O  
ATOM   4131  N   ARG A 657      22.325  13.505  12.720  1.00 97.55           N  
ATOM   4132  CA  ARG A 657      22.097  14.714  11.937  1.00 97.40           C  
ATOM   4133  C   ARG A 657      23.401  15.476  11.718  1.00 94.89           C  
ATOM   4134  O   ARG A 657      23.669  15.962  10.619  1.00 95.44           O  
ATOM   4135  CB  ARG A 657      21.067  15.616  12.623  1.00 96.35           C  
ATOM   4136  CG  ARG A 657      19.652  15.059  12.638  1.00 90.01           C  
ATOM   4137  CD  ARG A 657      19.071  14.974  11.234  1.00 90.25           C  
ATOM   4138  NE  ARG A 657      17.697  14.477  11.241  1.00 91.50           N  
ATOM   4139  CZ  ARG A 657      16.626  15.249  11.396  1.00 92.10           C  
ATOM   4140  NH1 ARG A 657      16.764  16.557  11.559  1.00 92.87           N  
ATOM   4141  NH2 ARG A 657      15.412  14.712  11.387  1.00 94.95           N  
ATOM   4142  N   LYS A 658      24.206  15.576  12.771  1.00 84.85           N  
ATOM   4143  CA  LYS A 658      25.492  16.263  12.696  1.00 83.00           C  
ATOM   4144  C   LYS A 658      26.465  15.506  11.798  1.00 83.79           C  
ATOM   4145  O   LYS A 658      27.295  16.106  11.115  1.00 84.78           O  
ATOM   4146  CB  LYS A 658      26.089  16.438  14.096  1.00 83.92           C  
ATOM   4147  CG  LYS A 658      27.445  17.136  14.119  1.00 80.11           C  
ATOM   4148  CD  LYS A 658      28.000  17.267  15.534  1.00 80.02           C  
ATOM   4149  CE  LYS A 658      27.542  18.552  16.215  1.00 80.59           C  
ATOM   4150  NZ  LYS A 658      26.082  18.579  16.504  1.00 81.46           N  
ATOM   4151  N   HIS A 659      26.350  14.181  11.797  1.00 87.01           N  
ATOM   4152  CA  HIS A 659      27.239  13.338  11.009  1.00 89.02           C  
ATOM   4153  C   HIS A 659      26.984  13.478   9.510  1.00 90.77           C  
ATOM   4154  O   HIS A 659      27.921  13.529   8.715  1.00 88.54           O  
ATOM   4155  CB  HIS A 659      27.090  11.874  11.424  1.00 90.05           C  
ATOM   4156  CG  HIS A 659      27.944  10.935  10.634  1.00 91.02           C  
ATOM   4157  ND1 HIS A 659      29.320  11.033  10.598  1.00 89.88           N  
ATOM   4158  CD2 HIS A 659      27.623   9.884   9.843  1.00 90.21           C  
ATOM   4159  CE1 HIS A 659      29.806  10.081   9.823  1.00 88.65           C  
ATOM   4160  NE2 HIS A 659      28.798   9.369   9.352  1.00 91.42           N  
ATOM   4161  N   CYS A 660      25.711  13.540   9.132  1.00 84.28           N  
ATOM   4162  CA  CYS A 660      25.338  13.651   7.726  1.00 85.42           C  
ATOM   4163  C   CYS A 660      25.202  15.107   7.293  1.00 81.53           C  
ATOM   4164  O   CYS A 660      24.603  15.401   6.259  1.00 84.98           O  
ATOM   4165  CB  CYS A 660      24.029  12.904   7.460  1.00 85.92           C  
ATOM   4166  SG  CYS A 660      22.589  13.603   8.299  1.00 87.65           S  
ATOM   4167  N   LEU A 661      25.758  16.015   8.088  1.00103.15           N  
ATOM   4168  CA  LEU A 661      25.688  17.440   7.785  1.00109.40           C  
ATOM   4169  C   LEU A 661      26.643  17.792   6.649  1.00100.14           C  
ATOM   4170  O   LEU A 661      26.392  18.720   5.880  1.00107.84           O  
ATOM   4171  CB  LEU A 661      26.004  18.269   9.036  1.00107.18           C  
ATOM   4172  CG  LEU A 661      25.660  19.764   9.052  1.00106.23           C  
ATOM   4173  CD1 LEU A 661      26.793  20.618   8.495  1.00103.59           C  
ATOM   4174  CD2 LEU A 661      24.363  20.032   8.298  1.00107.72           C  
ATOM   4175  N   GLU A 662      27.735  17.042   6.545  1.00 96.81           N  
ATOM   4176  CA  GLU A 662      28.739  17.278   5.513  1.00 96.79           C  
ATOM   4177  C   GLU A 662      28.195  16.991   4.116  1.00 99.36           C  
ATOM   4178  O   GLU A 662      27.248  16.220   3.953  1.00 91.91           O  
ATOM   4179  CB  GLU A 662      29.986  16.429   5.781  1.00 97.09           C  
ATOM   4180  CG  GLU A 662      29.696  14.986   6.177  1.00 98.71           C  
ATOM   4181  CD  GLU A 662      29.308  14.114   4.999  1.00 98.17           C  
ATOM   4182  OE1 GLU A 662      28.552  13.143   5.199  1.00 90.61           O  
ATOM   4183  OE2 GLU A 662      29.766  14.398   3.871  1.00 97.23           O  
ATOM   4184  N   PRO A 738      14.799   0.977  13.389  1.00 83.38           N  
ATOM   4185  CA  PRO A 738      15.293  -0.306  12.877  1.00 83.96           C  
ATOM   4186  C   PRO A 738      15.343  -0.345  11.351  1.00 85.90           C  
ATOM   4187  O   PRO A 738      16.194  -1.026  10.778  1.00 86.02           O  
ATOM   4188  CB  PRO A 738      14.272  -1.311  13.418  1.00 84.78           C  
ATOM   4189  CG  PRO A 738      13.767  -0.680  14.670  1.00 83.50           C  
ATOM   4190  CD  PRO A 738      13.741   0.800  14.398  1.00 83.33           C  
ATOM   4191  N   TYR A 739      14.437   0.386  10.706  1.00 91.68           N  
ATOM   4192  CA  TYR A 739      14.378   0.438   9.249  1.00 95.09           C  
ATOM   4193  C   TYR A 739      14.007   1.838   8.765  1.00 94.82           C  
ATOM   4194  O   TYR A 739      13.171   2.505   9.373  1.00 94.92           O  
ATOM   4195  CB  TYR A 739      13.375  -0.591   8.718  1.00 98.19           C  
ATOM   4196  CG  TYR A 739      13.846  -2.018   8.859  1.00 96.37           C  
ATOM   4197  CD1 TYR A 739      14.688  -2.587   7.914  1.00 96.34           C  
ATOM   4198  CD2 TYR A 739      13.452  -2.796   9.939  1.00 96.87           C  
ATOM   4199  CE1 TYR A 739      15.125  -3.891   8.039  1.00 97.19           C  
ATOM   4200  CE2 TYR A 739      13.882  -4.102  10.072  1.00 97.38           C  
ATOM   4201  CZ  TYR A 739      14.718  -4.643   9.120  1.00 96.97           C  
ATOM   4202  OH  TYR A 739      15.150  -5.943   9.247  1.00 96.38           O  
ATOM   4203  N   ASN A 740      14.622   2.284   7.668  1.00 95.93           N  
ATOM   4204  CA  ASN A 740      15.576   1.478   6.910  1.00 95.31           C  
ATOM   4205  C   ASN A 740      17.016   1.745   7.342  1.00 93.91           C  
ATOM   4206  O   ASN A 740      17.289   1.925   8.530  1.00 92.52           O  
ATOM   4207  CB  ASN A 740      15.414   1.748   5.410  1.00 97.08           C  
ATOM   4208  CG  ASN A 740      15.818   0.562   4.554  1.00 99.18           C  
ATOM   4209  OD1 ASN A 740      16.964   0.461   4.117  1.00 97.92           O  
ATOM   4210  ND2 ASN A 740      14.877  -0.341   4.312  1.00 92.59           N  
ATOM   4211  N   ASP A 741      17.925   1.766   6.369  1.00 89.50           N  
ATOM   4212  CA  ASP A 741      19.348   2.005   6.608  1.00 88.12           C  
ATOM   4213  C   ASP A 741      19.936   1.003   7.600  1.00 84.74           C  
ATOM   4214  O   ASP A 741      20.420   1.383   8.665  1.00 84.63           O  
ATOM   4215  CB  ASP A 741      19.577   3.435   7.109  1.00 86.92           C  
ATOM   4216  CG  ASP A 741      18.955   4.475   6.200  1.00 87.70           C  
ATOM   4217  OD1 ASP A 741      18.392   5.460   6.723  1.00 85.57           O  
ATOM   4218  OD2 ASP A 741      19.030   4.310   4.964  1.00 86.88           O  
ATOM   4219  N   VAL A 742      19.892  -0.276   7.240  1.00108.63           N  
ATOM   4220  CA  VAL A 742      20.410  -1.334   8.102  1.00109.50           C  
ATOM   4221  C   VAL A 742      21.337  -2.272   7.333  1.00109.58           C  
ATOM   4222  O   VAL A 742      22.187  -2.942   7.921  1.00109.56           O  
ATOM   4223  CB  VAL A 742      19.264  -2.115   8.724  1.00108.91           C  
ATOM   4224  N   ASP A 743      21.165  -2.312   6.015  1.00109.62           N  
ATOM   4225  CA  ASP A 743      21.975  -3.169   5.156  1.00102.92           C  
ATOM   4226  C   ASP A 743      23.410  -2.661   5.069  1.00100.37           C  
ATOM   4227  O   ASP A 743      24.288  -3.119   5.802  1.00108.31           O  
ATOM   4228  CB  ASP A 743      21.366  -3.252   3.754  1.00104.70           C  
ATOM   4229  CG  ASP A 743      19.851  -3.334   3.779  1.00106.00           C  
ATOM   4230  OD1 ASP A 743      19.231  -2.670   4.637  1.00104.34           O  
ATOM   4231  OD2 ASP A 743      19.279  -4.061   2.939  1.00109.24           O  
ATOM   4232  N   ILE A 744      23.639  -1.714   4.166  1.00120.31           N  
ATOM   4233  CA  ILE A 744      24.963  -1.126   3.973  1.00117.94           C  
ATOM   4234  C   ILE A 744      25.209   0.129   4.837  1.00115.43           C  
ATOM   4235  O   ILE A 744      26.311   0.293   5.366  1.00115.25           O  
ATOM   4236  CB  ILE A 744      25.213  -0.804   2.465  1.00117.68           C  
ATOM   4237  CG1 ILE A 744      25.857   0.574   2.278  1.00117.23           C  
ATOM   4238  CG2 ILE A 744      23.923  -0.922   1.658  1.00122.06           C  
ATOM   4239  CD1 ILE A 744      26.110   0.940   0.829  1.00119.41           C  
ATOM   4240  N   PRO A 745      24.198   1.013   5.004  1.00139.79           N  
ATOM   4241  CA  PRO A 745      24.476   2.138   5.908  1.00137.59           C  
ATOM   4242  C   PRO A 745      24.549   1.720   7.378  1.00137.94           C  
ATOM   4243  O   PRO A 745      24.490   0.531   7.691  1.00432.10           O  
ATOM   4244  CB  PRO A 745      23.288   3.083   5.677  1.00432.38           C  
ATOM   4245  CG  PRO A 745      22.720   2.682   4.362  1.00433.17           C  
ATOM   4246  CD  PRO A 745      22.919   1.204   4.294  1.00434.50           C  
ATOM   4247  N   GLY A 746      24.673   2.700   8.268  1.00119.07           N  
ATOM   4248  CA  GLY A 746      24.783   2.426   9.690  1.00117.43           C  
ATOM   4249  C   GLY A 746      23.884   3.294  10.549  1.00118.98           C  
ATOM   4250  O   GLY A 746      23.889   4.519  10.432  1.00116.58           O  
ATOM   4251  N   CYS A 747      23.109   2.652  11.418  1.00 92.95           N  
ATOM   4252  CA  CYS A 747      22.221   3.358  12.334  1.00 91.44           C  
ATOM   4253  C   CYS A 747      21.836   2.470  13.512  1.00 91.69           C  
ATOM   4254  O   CYS A 747      21.777   1.247  13.386  1.00 90.11           O  
ATOM   4255  CB  CYS A 747      20.963   3.839  11.608  1.00 93.27           C  
ATOM   4256  SG  CYS A 747      19.755   4.664  12.677  1.00 94.33           S  
ATOM   4257  N   TRP A 748      21.579   3.093  14.656  1.00 73.33           N  
ATOM   4258  CA  TRP A 748      21.161   2.364  15.846  1.00 72.62           C  
ATOM   4259  C   TRP A 748      19.691   2.642  16.153  1.00 74.28           C  
ATOM   4260  O   TRP A 748      19.203   3.753  15.948  1.00 74.89           O  
ATOM   4261  CB  TRP A 748      22.044   2.734  17.040  1.00 69.71           C  
ATOM   4262  CG  TRP A 748      22.947   1.620  17.507  1.00 68.19           C  
ATOM   4263  CD1 TRP A 748      22.820   0.893  18.655  1.00 67.08           C  
ATOM   4264  CD2 TRP A 748      24.108   1.107  16.833  1.00 67.66           C  
ATOM   4265  NE1 TRP A 748      23.830  -0.036  18.741  1.00 65.85           N  
ATOM   4266  CE2 TRP A 748      24.632   0.073  17.636  1.00 66.20           C  
ATOM   4267  CE3 TRP A 748      24.753   1.421  15.633  1.00 68.31           C  
ATOM   4268  CZ2 TRP A 748      25.772  -0.647  17.278  1.00 65.40           C  
ATOM   4269  CZ3 TRP A 748      25.887   0.702  15.279  1.00 67.55           C  
ATOM   4270  CH2 TRP A 748      26.382  -0.320  16.100  1.00 66.13           C  
ATOM   4271  N   PHE A 749      18.991   1.622  16.638  1.00 84.36           N  
ATOM   4272  CA  PHE A 749      17.557   1.723  16.904  1.00 85.37           C  
ATOM   4273  C   PHE A 749      17.259   2.509  18.178  1.00 84.39           C  
ATOM   4274  O   PHE A 749      17.688   3.654  18.326  1.00 83.34           O  
ATOM   4275  CB  PHE A 749      16.935   0.326  16.993  1.00 86.40           C  
ATOM   4276  CG  PHE A 749      17.882  -0.730  17.488  1.00 85.24           C  
ATOM   4277  CD1 PHE A 749      18.590  -1.518  16.595  1.00 87.64           C  
ATOM   4278  CD2 PHE A 749      18.066  -0.935  18.845  1.00 84.22           C  
ATOM   4279  CE1 PHE A 749      19.465  -2.491  17.044  1.00 85.60           C  
ATOM   4280  CE2 PHE A 749      18.939  -1.906  19.301  1.00 83.78           C  
ATOM   4281  CZ  PHE A 749      19.640  -2.685  18.398  1.00 85.00           C  
ATOM   4282  N   PHE A 750      16.513   1.895  19.090  1.00 93.94           N  
ATOM   4283  CA  PHE A 750      16.133   2.560  20.330  1.00 94.29           C  
ATOM   4284  C   PHE A 750      16.553   1.743  21.548  1.00 92.63           C  
ATOM   4285  O   PHE A 750      17.421   2.160  22.316  1.00 99.39           O  
ATOM   4286  CB  PHE A 750      14.626   2.811  20.363  1.00 95.47           C  
ATOM   4287  CG  PHE A 750      14.234   4.048  21.119  1.00 93.04           C  
ATOM   4288  CD1 PHE A 750      14.344   4.098  22.500  1.00 94.38           C  
ATOM   4289  CD2 PHE A 750      13.754   5.162  20.450  1.00 96.72           C  
ATOM   4290  CE1 PHE A 750      13.984   5.234  23.199  1.00 91.12           C  
ATOM   4291  CE2 PHE A 750      13.391   6.302  21.143  1.00 95.00           C  
ATOM   4292  CZ  PHE A 750      13.504   6.338  22.519  1.00 94.91           C  
ATOM   4293  N   LYS A 751      15.930   0.582  21.727  1.00 70.73           N  
ATOM   4294  CA  LYS A 751      16.253  -0.296  22.848  1.00 67.82           C  
ATOM   4295  C   LYS A 751      16.417  -1.749  22.401  1.00 68.79           C  
ATOM   4296  O   LYS A 751      17.518  -2.175  22.073  1.00 68.49           O  
ATOM   4297  CB  LYS A 751      15.177  -0.203  23.937  1.00 69.18           C  
ATOM   4298  CG  LYS A 751      14.096   0.839  23.678  1.00 71.92           C  
ATOM   4299  CD  LYS A 751      13.260   1.117  24.923  1.00 70.96           C  
ATOM   4300  CE  LYS A 751      13.881   2.204  25.797  1.00 69.11           C  
ATOM   4301  NZ  LYS A 751      15.171   1.801  26.422  1.00 66.54           N  
ATOM   4302  N   LEU A 752      15.308  -2.485  22.393  1.00112.74           N  
ATOM   4303  CA  LEU A 752      15.256  -3.916  22.063  1.00116.22           C  
ATOM   4304  C   LEU A 752      16.120  -4.761  23.049  1.00111.43           C  
ATOM   4305  O   LEU A 752      15.598  -5.126  24.104  1.00109.17           O  
ATOM   4306  CB  LEU A 752      15.609  -4.134  20.585  1.00116.35           C  
ATOM   4307  CG  LEU A 752      14.683  -3.467  19.562  1.00110.27           C  
ATOM   4308  CD1 LEU A 752      15.107  -3.811  18.141  1.00111.26           C  
ATOM   4309  CD2 LEU A 752      13.234  -3.861  19.803  1.00111.63           C  
ATOM   4310  N   PRO A 753      17.408  -5.091  22.762  1.00100.39           N  
ATOM   4311  CA  PRO A 753      18.430  -5.051  21.702  1.00104.15           C  
ATOM   4312  C   PRO A 753      18.594  -6.386  20.968  1.00103.59           C  
ATOM   4313  O   PRO A 753      18.541  -7.447  21.591  1.00104.89           O  
ATOM   4314  CB  PRO A 753      19.698  -4.699  22.471  1.00101.75           C  
ATOM   4315  CG  PRO A 753      19.523  -5.402  23.767  1.00108.26           C  
ATOM   4316  CD  PRO A 753      18.031  -5.463  24.048  1.00109.83           C  
ATOM   4317  N   HIS A 754      18.787  -6.322  19.654  1.00 93.44           N  
ATOM   4318  CA  HIS A 754      19.038  -7.518  18.851  1.00 95.03           C  
ATOM   4319  C   HIS A 754      19.946  -7.206  17.665  1.00 92.81           C  
ATOM   4320  O   HIS A 754      20.431  -6.083  17.523  1.00 90.71           O  
ATOM   4321  CB  HIS A 754      17.724  -8.129  18.359  1.00 95.67           C  
ATOM   4322  CG  HIS A 754      16.916  -8.771  19.443  1.00 96.48           C  
ATOM   4323  ND1 HIS A 754      16.023  -8.066  20.223  1.00 95.41           N  
ATOM   4324  CD2 HIS A 754      16.874 -10.050  19.885  1.00 96.60           C  
ATOM   4325  CE1 HIS A 754      15.461  -8.887  21.094  1.00 93.72           C  
ATOM   4326  NE2 HIS A 754      15.960 -10.094  20.910  1.00 93.79           N  
ATOM   4327  N   LYS A 755      20.173  -8.205  16.816  1.00 86.15           N  
ATOM   4328  CA  LYS A 755      21.053  -8.047  15.662  1.00 87.77           C  
ATOM   4329  C   LYS A 755      20.457  -7.093  14.631  1.00 89.26           C  
ATOM   4330  O   LYS A 755      20.941  -5.972  14.462  1.00 87.68           O  
ATOM   4331  CB  LYS A 755      21.344  -9.405  15.016  1.00 87.00           C  
ATOM   4332  CG  LYS A 755      22.049 -10.397  15.932  1.00 85.78           C  
ATOM   4333  CD  LYS A 755      23.139 -11.158  15.188  1.00 86.70           C  
ATOM   4334  CE  LYS A 755      22.602 -11.822  13.930  1.00 88.93           C  
ATOM   4335  NZ  LYS A 755      23.678 -12.504  13.158  1.00 89.13           N  
ATOM   4336  N   ASP A 756      19.411  -7.553  13.948  1.00 82.67           N  
ATOM   4337  CA  ASP A 756      18.681  -6.751  12.966  1.00 84.98           C  
ATOM   4338  C   ASP A 756      19.573  -6.257  11.827  1.00 86.10           C  
ATOM   4339  O   ASP A 756      19.460  -5.111  11.393  1.00 86.52           O  
ATOM   4340  CB  ASP A 756      18.006  -5.557  13.647  1.00 85.64           C  
ATOM   4341  CG  ASP A 756      17.394  -5.920  14.984  1.00 84.93           C  
ATOM   4342  OD1 ASP A 756      17.199  -7.128  15.240  1.00 83.72           O  
ATOM   4343  OD2 ASP A 756      17.110  -5.001  15.779  1.00 81.07           O  
ATOM   4344  N   GLY A 757      20.457  -7.127  11.345  1.00 80.08           N  
ATOM   4345  CA  GLY A 757      21.318  -6.793  10.223  1.00 80.76           C  
ATOM   4346  C   GLY A 757      22.800  -6.904  10.523  1.00 89.06           C  
ATOM   4347  O   GLY A 757      23.538  -5.925  10.411  1.00 88.16           O  
ATOM   4348  N   ASN A 758      23.239  -8.101  10.902  1.00101.97           N  
ATOM   4349  CA  ASN A 758      24.651  -8.347  11.178  1.00101.95           C  
ATOM   4350  C   ASN A 758      25.220  -9.457  10.300  1.00102.64           C  
ATOM   4351  O   ASN A 758      24.489 -10.337   9.841  1.00104.79           O  
ATOM   4352  CB  ASN A 758      24.858  -8.699  12.651  1.00108.08           C  
ATOM   4353  CG  ASN A 758      24.433  -7.582  13.584  1.00108.92           C  
ATOM   4354  OD1 ASN A 758      24.238  -6.442  13.161  1.00107.55           O  
ATOM   4355  ND2 ASN A 758      24.300  -7.903  14.864  1.00107.04           N  
ATOM   4356  N   SER A 759      26.529  -9.414  10.071  1.00 84.20           N  
ATOM   4357  CA  SER A 759      27.192 -10.407   9.233  1.00 84.76           C  
ATOM   4358  C   SER A 759      28.053 -11.357  10.062  1.00 83.21           C  
ATOM   4359  O   SER A 759      28.076 -12.563   9.813  1.00 85.99           O  
ATOM   4360  CB  SER A 759      28.035  -9.719   8.169  1.00 85.53           C  
ATOM   4361  N   CYS A 760      28.761 -10.810  11.045  1.00112.54           N  
ATOM   4362  CA  CYS A 760      29.627 -11.612  11.900  1.00119.79           C  
ATOM   4363  C   CYS A 760      28.817 -12.383  12.937  1.00118.40           C  
ATOM   4364  O   CYS A 760      27.835 -11.874  13.479  1.00118.19           O  
ATOM   4365  CB  CYS A 760      30.660 -10.732  12.583  1.00117.94           C  
ATOM   4366  N   ASN A 761      29.232 -13.616  13.207  1.00 70.76           N  
ATOM   4367  CA  ASN A 761      28.542 -14.466  14.172  1.00 72.36           C  
ATOM   4368  C   ASN A 761      29.336 -14.626  15.463  1.00 70.66           C  
ATOM   4369  O   ASN A 761      29.230 -15.648  16.141  1.00 69.71           O  
ATOM   4370  CB  ASN A 761      28.260 -15.842  13.567  1.00 76.30           C  
ATOM   4371  CG  ASN A 761      28.581 -15.909  12.087  1.00 74.99           C  
ATOM   4372  OD1 ASN A 761      28.409 -14.933  11.357  1.00 76.79           O  
ATOM   4373  ND2 ASN A 761      29.054 -17.065  11.636  1.00 79.42           N  
ATOM   4374  N   VAL A 762      30.131 -13.616  15.801  1.00 61.40           N  
ATOM   4375  CA  VAL A 762      30.974 -13.681  16.989  1.00 58.47           C  
ATOM   4376  C   VAL A 762      31.094 -12.321  17.677  1.00 56.85           C  
ATOM   4377  O   VAL A 762      30.936 -12.217  18.894  1.00 55.30           O  
ATOM   4378  CB  VAL A 762      32.384 -14.217  16.638  1.00 57.57           C  
ATOM   4379  CG1 VAL A 762      32.859 -13.663  15.299  1.00 58.93           C  
ATOM   4380  CG2 VAL A 762      33.377 -13.908  17.752  1.00 54.74           C  
ATOM   4381  N   GLY A 763      31.358 -11.281  16.896  1.00 98.18           N  
ATOM   4382  CA  GLY A 763      31.572  -9.955  17.444  1.00 97.70           C  
ATOM   4383  C   GLY A 763      33.050  -9.629  17.500  1.00 93.90           C  
ATOM   4384  O   GLY A 763      33.885 -10.454  17.126  1.00 96.19           O  
ATOM   4385  N   SER A 764      33.382  -8.432  17.972  1.00104.53           N  
ATOM   4386  CA  SER A 764      34.773  -7.995  18.004  1.00101.52           C  
ATOM   4387  C   SER A 764      35.023  -6.853  18.987  1.00100.06           C  
ATOM   4388  O   SER A 764      34.989  -5.684  18.606  1.00100.19           O  
ATOM   4389  CB  SER A 764      35.218  -7.574  16.602  1.00104.17           C  
ATOM   4390  OG  SER A 764      34.320  -6.629  16.046  1.00104.50           O  
ATOM   4391  N   PRO A 765      35.272  -7.192  20.260  1.00 90.51           N  
ATOM   4392  CA  PRO A 765      35.667  -6.222  21.284  1.00 86.54           C  
ATOM   4393  C   PRO A 765      37.171  -6.254  21.564  1.00 84.84           C  
ATOM   4394  O   PRO A 765      37.645  -7.188  22.211  1.00 84.63           O  
ATOM   4395  CB  PRO A 765      34.874  -6.678  22.510  1.00 87.08           C  
ATOM   4396  CG  PRO A 765      34.606  -8.173  22.271  1.00 86.51           C  
ATOM   4397  CD  PRO A 765      35.020  -8.513  20.856  1.00 88.43           C  
ATOM   4398  N   PHE A 766      37.911  -5.254  21.090  1.00 77.62           N  
ATOM   4399  CA  PHE A 766      37.345  -4.135  20.344  1.00 70.47           C  
ATOM   4400  C   PHE A 766      38.003  -4.014  18.970  1.00 70.12           C  
ATOM   4401  O   PHE A 766      39.004  -4.676  18.698  1.00 71.71           O  
ATOM   4402  CB  PHE A 766      37.509  -2.835  21.137  1.00 77.52           C  
ATOM   4403  CG  PHE A 766      36.740  -1.679  20.568  1.00 78.78           C  
ATOM   4404  CD1 PHE A 766      37.394  -0.654  19.904  1.00 71.16           C  
ATOM   4405  CD2 PHE A 766      35.363  -1.624  20.685  1.00 71.07           C  
ATOM   4406  CE1 PHE A 766      36.688   0.409  19.374  1.00 70.56           C  
ATOM   4407  CE2 PHE A 766      34.651  -0.564  20.158  1.00 70.00           C  
ATOM   4408  CZ  PHE A 766      35.314   0.454  19.502  1.00 72.92           C  
ATOM   4409  N   ALA A 767      37.429  -3.175  18.111  1.00 53.87           N  
ATOM   4410  CA  ALA A 767      37.962  -2.919  16.774  1.00 54.35           C  
ATOM   4411  C   ALA A 767      39.428  -2.486  16.817  1.00 52.34           C  
ATOM   4412  O   ALA A 767      39.733  -1.308  17.003  1.00 51.43           O  
ATOM   4413  CB  ALA A 767      37.123  -1.865  16.074  1.00 55.82           C  
ATOM   4414  N   LYS A 768      40.328  -3.450  16.637  1.00 56.70           N  
ATOM   4415  CA  LYS A 768      41.761  -3.194  16.749  1.00 56.08           C  
ATOM   4416  C   LYS A 768      42.523  -3.512  15.465  1.00 57.19           C  
ATOM   4417  O   LYS A 768      43.735  -3.310  15.391  1.00 56.40           O  
ATOM   4418  CB  LYS A 768      42.345  -3.995  17.913  1.00 54.62           C  
ATOM   4419  CG  LYS A 768      42.616  -3.168  19.158  1.00 52.79           C  
ATOM   4420  CD  LYS A 768      41.387  -2.397  19.623  1.00 52.28           C  
ATOM   4421  CE  LYS A 768      41.630  -0.895  19.562  1.00 52.43           C  
ATOM   4422  NZ  LYS A 768      40.504  -0.106  20.129  1.00 51.92           N  
ATOM   4423  N   ASP A 769      41.814  -4.012  14.460  1.00 70.82           N  
ATOM   4424  CA  ASP A 769      42.417  -4.263  13.157  1.00 71.49           C  
ATOM   4425  C   ASP A 769      41.508  -3.790  12.032  1.00 73.19           C  
ATOM   4426  O   ASP A 769      41.279  -4.507  11.059  1.00 74.26           O  
ATOM   4427  CB  ASP A 769      42.740  -5.747  12.986  1.00 71.53           C  
ATOM   4428  CG  ASP A 769      44.077  -6.124  13.591  1.00 69.64           C  
ATOM   4429  OD1 ASP A 769      44.950  -5.237  13.699  1.00 68.34           O  
ATOM   4430  OD2 ASP A 769      44.257  -7.305  13.950  1.00 69.86           O  
ATOM   4431  N   PHE A 770      40.993  -2.574  12.176  1.00 64.25           N  
ATOM   4432  CA  PHE A 770      40.133  -1.977  11.163  1.00 65.39           C  
ATOM   4433  C   PHE A 770      40.669  -0.623  10.719  1.00 64.70           C  
ATOM   4434  O   PHE A 770      39.910   0.330  10.560  1.00 65.56           O  
ATOM   4435  CB  PHE A 770      38.704  -1.833  11.686  1.00 65.70           C  
ATOM   4436  CG  PHE A 770      38.023  -3.143  11.961  1.00 66.00           C  
ATOM   4437  CD1 PHE A 770      37.958  -3.648  13.247  1.00 64.50           C  
ATOM   4438  CD2 PHE A 770      37.450  -3.871  10.932  1.00 67.66           C  
ATOM   4439  CE1 PHE A 770      37.331  -4.853  13.504  1.00 64.77           C  
ATOM   4440  CE2 PHE A 770      36.823  -5.078  11.181  1.00 67.98           C  
ATOM   4441  CZ  PHE A 770      36.763  -5.569  12.468  1.00 66.34           C  
ATOM   4442  N   LEU A 771      41.982  -0.546  10.526  1.00 60.15           N  
ATOM   4443  CA  LEU A 771      42.621   0.672  10.032  1.00 69.12           C  
ATOM   4444  C   LEU A 771      42.094   1.128   8.665  1.00 67.36           C  
ATOM   4445  O   LEU A 771      41.864   2.323   8.470  1.00 69.29           O  
ATOM   4446  CB  LEU A 771      44.141   0.491   9.970  1.00 66.06           C  
ATOM   4447  CG  LEU A 771      44.936   0.884  11.218  1.00 63.18           C  
ATOM   4448  CD1 LEU A 771      44.703   2.350  11.562  1.00 63.73           C  
ATOM   4449  CD2 LEU A 771      44.590  -0.012  12.398  1.00 62.71           C  
ATOM   4450  N   PRO A 772      41.903   0.197   7.706  1.00 67.69           N  
ATOM   4451  CA  PRO A 772      41.305   0.683   6.457  1.00 66.18           C  
ATOM   4452  C   PRO A 772      39.846   1.095   6.638  1.00 67.54           C  
ATOM   4453  O   PRO A 772      39.316   1.845   5.821  1.00 68.03           O  
ATOM   4454  CB  PRO A 772      41.423  -0.520   5.517  1.00 68.18           C  
ATOM   4455  CG  PRO A 772      41.497  -1.697   6.418  1.00 66.98           C  
ATOM   4456  CD  PRO A 772      42.278  -1.227   7.605  1.00 67.61           C  
ATOM   4457  N   LYS A 773      39.212   0.605   7.700  1.00 84.81           N  
ATOM   4458  CA  LYS A 773      37.846   0.995   8.018  1.00 86.69           C  
ATOM   4459  C   LYS A 773      37.859   2.085   9.086  1.00 85.66           C  
ATOM   4460  O   LYS A 773      36.872   2.306   9.786  1.00 84.85           O  
ATOM   4461  CB  LYS A 773      37.031  -0.214   8.485  1.00 86.97           C  
ATOM   4462  CG  LYS A 773      35.536  -0.091   8.235  1.00 87.75           C  
ATOM   4463  CD  LYS A 773      35.242   0.156   6.763  1.00 81.25           C  
ATOM   4464  CE  LYS A 773      33.757   0.388   6.524  1.00 81.03           C  
ATOM   4465  NZ  LYS A 773      33.450   0.656   5.090  1.00 83.39           N  
ATOM   4466  N   MET A 774      38.996   2.761   9.203  1.00 71.33           N  
ATOM   4467  CA  MET A 774      39.153   3.859  10.146  1.00 73.27           C  
ATOM   4468  C   MET A 774      39.760   5.056   9.427  1.00 70.98           C  
ATOM   4469  O   MET A 774      39.559   6.204   9.822  1.00 72.57           O  
ATOM   4470  CB  MET A 774      40.032   3.438  11.324  1.00 71.33           C  
ATOM   4471  CG  MET A 774      39.486   3.829  12.688  1.00 71.31           C  
ATOM   4472  SD  MET A 774      39.474   5.609  12.959  1.00 71.56           S  
ATOM   4473  CE  MET A 774      38.806   5.688  14.619  1.00 72.69           C  
ATOM   4474  N   GLU A 775      40.504   4.774   8.363  1.00 84.02           N  
ATOM   4475  CA  GLU A 775      41.123   5.815   7.553  1.00 84.73           C  
ATOM   4476  C   GLU A 775      40.411   5.956   6.210  1.00 83.83           C  
ATOM   4477  O   GLU A 775      41.045   6.192   5.183  1.00 84.86           O  
ATOM   4478  CB  GLU A 775      42.607   5.515   7.334  1.00 81.62           C  
ATOM   4479  CG  GLU A 775      43.431   5.494   8.612  1.00 82.58           C  
ATOM   4480  CD  GLU A 775      44.898   5.221   8.354  1.00 89.28           C  
ATOM   4481  OE1 GLU A 775      45.261   4.984   7.182  1.00 80.10           O  
ATOM   4482  OE2 GLU A 775      45.691   5.246   9.318  1.00 89.71           O  
ATOM   4483  N   ASP A 776      39.091   5.804   6.231  1.00 79.94           N  
ATOM   4484  CA  ASP A 776      38.279   5.963   5.029  1.00 80.72           C  
ATOM   4485  C   ASP A 776      36.972   6.675   5.357  1.00 82.12           C  
ATOM   4486  O   ASP A 776      36.052   6.712   4.539  1.00 81.77           O  
ATOM   4487  CB  ASP A 776      37.990   4.606   4.385  1.00 80.35           C  
ATOM   4488  CG  ASP A 776      37.031   3.766   5.203  1.00 81.21           C  
ATOM   4489  OD1 ASP A 776      37.091   3.835   6.449  1.00 81.01           O  
ATOM   4490  OD2 ASP A 776      36.214   3.038   4.600  1.00 82.80           O  
ATOM   4491  N   GLY A 777      36.899   7.236   6.557  1.00 92.06           N  
ATOM   4492  CA  GLY A 777      35.697   7.907   7.017  1.00 93.81           C  
ATOM   4493  C   GLY A 777      34.988   7.107   8.091  1.00 94.35           C  
ATOM   4494  O   GLY A 777      35.109   7.401   9.280  1.00 95.22           O  
ATOM   4495  N   THR A 778      34.244   6.088   7.671  1.00 80.62           N  
ATOM   4496  CA  THR A 778      33.540   5.211   8.600  1.00 89.14           C  
ATOM   4497  C   THR A 778      34.390   3.998   8.947  1.00 88.91           C  
ATOM   4498  O   THR A 778      34.749   3.218   8.067  1.00 88.64           O  
ATOM   4499  CB  THR A 778      32.198   4.733   8.017  1.00 83.66           C  
ATOM   4500  OG1 THR A 778      31.326   5.855   7.833  1.00 83.43           O  
ATOM   4501  CG2 THR A 778      31.537   3.734   8.951  1.00 82.69           C  
ATOM   4502  N   LEU A 779      34.704   3.831  10.229  1.00 61.51           N  
ATOM   4503  CA  LEU A 779      34.229   4.728  11.280  1.00 61.77           C  
ATOM   4504  C   LEU A 779      35.333   5.664  11.762  1.00 68.75           C  
ATOM   4505  O   LEU A 779      36.504   5.481  11.429  1.00 68.76           O  
ATOM   4506  CB  LEU A 779      33.660   3.921  12.460  1.00 62.00           C  
ATOM   4507  CG  LEU A 779      34.527   3.144  13.471  1.00 69.71           C  
ATOM   4508  CD1 LEU A 779      35.692   2.397  12.826  1.00 69.51           C  
ATOM   4509  CD2 LEU A 779      35.029   4.033  14.610  1.00 68.43           C  
ATOM   4510  N   GLN A 780      34.951   6.664  12.551  1.00 66.66           N  
ATOM   4511  CA  GLN A 780      35.911   7.609  13.111  1.00 65.10           C  
ATOM   4512  C   GLN A 780      35.632   7.856  14.591  1.00 66.38           C  
ATOM   4513  O   GLN A 780      34.696   7.292  15.157  1.00 62.95           O  
ATOM   4514  CB  GLN A 780      35.881   8.932  12.337  1.00 65.11           C  
ATOM   4515  CG  GLN A 780      34.690   9.835  12.649  1.00 64.67           C  
ATOM   4516  CD  GLN A 780      33.385   9.344  12.043  1.00 68.19           C  
ATOM   4517  OE1 GLN A 780      33.347   8.316  11.367  1.00 67.93           O  
ATOM   4518  NE2 GLN A 780      32.310  10.084  12.283  1.00 65.87           N  
ATOM   4519  N   ALA A 781      36.446   8.703  15.213  1.00 65.27           N  
ATOM   4520  CA  ALA A 781      36.280   9.026  16.626  1.00 63.52           C  
ATOM   4521  C   ALA A 781      36.149  10.529  16.840  1.00 65.22           C  
ATOM   4522  O   ALA A 781      36.507  11.325  15.971  1.00 65.45           O  
ATOM   4523  CB  ALA A 781      37.445   8.478  17.433  1.00 60.65           C  
ATOM   4524  N   GLY A 782      35.631  10.912  18.002  1.00101.55           N  
ATOM   4525  CA  GLY A 782      35.446  12.312  18.331  1.00109.82           C  
ATOM   4526  C   GLY A 782      35.037  12.514  19.778  1.00108.08           C  
ATOM   4527  O   GLY A 782      34.080  11.898  20.242  1.00109.87           O  
ATOM   4528  N   PRO A 783      35.762  13.380  20.503  1.00 81.95           N  
ATOM   4529  CA  PRO A 783      36.924  14.118  19.996  1.00 81.62           C  
ATOM   4530  C   PRO A 783      38.205  13.283  20.008  1.00 83.10           C  
ATOM   4531  O   PRO A 783      38.496  12.620  21.003  1.00 81.79           O  
ATOM   4532  CB  PRO A 783      37.031  15.297  20.964  1.00 81.05           C  
ATOM   4533  CG  PRO A 783      36.502  14.758  22.249  1.00 88.90           C  
ATOM   4534  CD  PRO A 783      35.423  13.768  21.884  1.00 80.29           C  
ATOM   4535  N   GLY A 784      38.956  13.313  18.908  1.00 98.34           N  
ATOM   4536  CA  GLY A 784      38.580  14.087  17.740  1.00 97.48           C  
ATOM   4537  C   GLY A 784      39.700  14.217  16.725  1.00 98.02           C  
ATOM   4538  O   GLY A 784      40.872  14.316  17.087  1.00 96.82           O  
ATOM   4539  N   GLY A 785      39.334  14.216  15.446  1.00 85.98           N  
ATOM   4540  CA  GLY A 785      40.301  14.371  14.376  1.00 86.34           C  
ATOM   4541  C   GLY A 785      40.962  13.065  13.979  1.00 88.36           C  
ATOM   4542  O   GLY A 785      40.287  12.073  13.704  1.00 89.30           O  
ATOM   4543  N   ALA A 786      42.291  13.069  13.948  1.00 68.71           N  
ATOM   4544  CA  ALA A 786      43.052  11.884  13.571  1.00 68.91           C  
ATOM   4545  C   ALA A 786      43.584  11.153  14.798  1.00 68.87           C  
ATOM   4546  O   ALA A 786      44.497  10.333  14.694  1.00 67.54           O  
ATOM   4547  CB  ALA A 786      44.196  12.263  12.643  1.00 67.69           C  
ATOM   4548  N   SER A 787      43.013  11.454  15.961  1.00 79.92           N  
ATOM   4549  CA  SER A 787      43.407  10.800  17.202  1.00 79.38           C  
ATOM   4550  C   SER A 787      43.039   9.319  17.171  1.00 80.31           C  
ATOM   4551  O   SER A 787      43.734   8.483  17.747  1.00 78.77           O  
ATOM   4552  CB  SER A 787      42.751  11.483  18.404  1.00 80.00           C  
ATOM   4553  OG  SER A 787      43.141  10.866  19.618  1.00 79.05           O  
ATOM   4554  N   GLY A 788      41.938   9.009  16.494  1.00 80.59           N  
ATOM   4555  CA  GLY A 788      41.492   7.638  16.325  1.00 80.55           C  
ATOM   4556  C   GLY A 788      42.490   6.748  15.605  1.00 81.71           C  
ATOM   4557  O   GLY A 788      43.029   5.813  16.205  1.00 81.09           O  
ATOM   4558  N   PRO A 789      42.741   7.025  14.314  1.00 59.74           N  
ATOM   4559  CA  PRO A 789      43.693   6.233  13.526  1.00 56.95           C  
ATOM   4560  C   PRO A 789      45.089   6.191  14.145  1.00 55.62           C  
ATOM   4561  O   PRO A 789      45.792   5.192  13.998  1.00 57.74           O  
ATOM   4562  CB  PRO A 789      43.717   6.952  12.170  1.00 59.75           C  
ATOM   4563  CG  PRO A 789      43.131   8.303  12.426  1.00 57.66           C  
ATOM   4564  CD  PRO A 789      42.127   8.091  13.508  1.00 58.41           C  
ATOM   4565  N   ARG A 790      45.480   7.259  14.834  1.00 71.89           N  
ATOM   4566  CA  ARG A 790      46.767   7.275  15.516  1.00 70.49           C  
ATOM   4567  C   ARG A 790      46.749   6.338  16.718  1.00 69.79           C  
ATOM   4568  O   ARG A 790      47.737   5.663  16.995  1.00 68.15           O  
ATOM   4569  CB  ARG A 790      47.142   8.689  15.958  1.00 70.09           C  
ATOM   4570  CG  ARG A 790      48.480   8.763  16.683  1.00 70.45           C  
ATOM   4571  CD  ARG A 790      49.597   8.175  15.832  1.00 66.01           C  
ATOM   4572  NE  ARG A 790      50.649   7.574  16.647  1.00 67.07           N  
ATOM   4573  CZ  ARG A 790      51.709   8.232  17.105  1.00 65.18           C  
ATOM   4574  NH1 ARG A 790      51.863   9.520  16.831  1.00 67.67           N  
ATOM   4575  NH2 ARG A 790      52.616   7.601  17.837  1.00 65.65           N  
ATOM   4576  N   ALA A 791      45.624   6.297  17.428  1.00 50.65           N  
ATOM   4577  CA  ALA A 791      45.475   5.387  18.560  1.00 59.92           C  
ATOM   4578  C   ALA A 791      45.521   3.937  18.090  1.00 50.61           C  
ATOM   4579  O   ALA A 791      46.148   3.084  18.723  1.00 59.95           O  
ATOM   4580  CB  ALA A 791      44.181   5.665  19.303  1.00 59.94           C  
ATOM   4581  N   LEU A 792      44.857   3.666  16.970  1.00 65.32           N  
ATOM   4582  CA  LEU A 792      44.888   2.338  16.366  1.00 65.35           C  
ATOM   4583  C   LEU A 792      46.302   1.976  15.917  1.00 64.58           C  
ATOM   4584  O   LEU A 792      46.722   0.823  16.025  1.00 65.69           O  
ATOM   4585  CB  LEU A 792      43.919   2.260  15.183  1.00 66.65           C  
ATOM   4586  CG  LEU A 792      42.490   1.775  15.456  1.00 69.31           C  
ATOM   4587  CD1 LEU A 792      42.494   0.340  15.956  1.00 61.00           C  
ATOM   4588  CD2 LEU A 792      41.771   2.685  16.442  1.00 67.19           C  
ATOM   4589  N   GLU A 793      47.034   2.970  15.414  1.00 87.22           N  
ATOM   4590  CA  GLU A 793      48.429   2.773  15.031  1.00 85.36           C  
ATOM   4591  C   GLU A 793      49.276   2.398  16.241  1.00 85.49           C  
ATOM   4592  O   GLU A 793      50.074   1.463  16.182  1.00 85.34           O  
ATOM   4593  CB  GLU A 793      48.993   4.030  14.367  1.00 87.25           C  
ATOM   4594  CG  GLU A 793      48.637   4.179  12.896  1.00 80.32           C  
ATOM   4595  CD  GLU A 793      49.395   3.210  12.007  1.00 86.53           C  
ATOM   4596  OE1 GLU A 793      48.984   3.026  10.842  1.00 80.28           O  
ATOM   4597  OE2 GLU A 793      50.403   2.637  12.471  1.00 86.03           O  
ATOM   4598  N   ILE A 794      49.096   3.135  17.333  1.00 50.69           N  
ATOM   4599  CA  ILE A 794      49.805   2.866  18.578  1.00 50.21           C  
ATOM   4600  C   ILE A 794      49.506   1.455  19.071  1.00 50.40           C  
ATOM   4601  O   ILE A 794      50.403   0.741  19.520  1.00 59.72           O  
ATOM   4602  CB  ILE A 794      49.434   3.884  19.671  1.00 50.54           C  
ATOM   4603  CG1 ILE A 794      49.929   5.278  19.286  1.00 50.28           C  
ATOM   4604  CG2 ILE A 794      50.023   3.477  21.013  1.00 50.29           C  
ATOM   4605  CD1 ILE A 794      49.597   6.350  20.301  1.00 50.57           C  
ATOM   4606  N   ASN A 795      48.243   1.052  18.969  1.00 62.49           N  
ATOM   4607  CA  ASN A 795      47.851  -0.302  19.345  1.00 62.73           C  
ATOM   4608  C   ASN A 795      48.529  -1.356  18.479  1.00 62.46           C  
ATOM   4609  O   ASN A 795      48.994  -2.381  18.981  1.00 62.09           O  
ATOM   4610  CB  ASN A 795      46.334  -0.475  19.265  1.00 63.38           C  
ATOM   4611  CG  ASN A 795      45.899  -1.890  19.589  1.00 63.33           C  
ATOM   4612  OD1 ASN A 795      45.660  -2.228  20.746  1.00 62.44           O  
ATOM   4613  ND2 ASN A 795      45.802  -2.730  18.562  1.00 63.74           N  
ATOM   4614  N   LYS A 796      48.577  -1.104  17.176  1.00 46.44           N  
ATOM   4615  CA  LYS A 796      49.153  -2.057  16.239  1.00 45.85           C  
ATOM   4616  C   LYS A 796      50.660  -2.196  16.434  1.00 44.10           C  
ATOM   4617  O   LYS A 796      51.218  -3.283  16.272  1.00 47.90           O  
ATOM   4618  CB  LYS A 796      48.853  -1.640  14.799  1.00 46.17           C  
ATOM   4619  CG  LYS A 796      49.363  -2.625  13.762  1.00 45.55           C  
ATOM   4620  CD  LYS A 796      49.165  -2.106  12.350  1.00 46.16           C  
ATOM   4621  CE  LYS A 796      47.693  -1.974  12.014  1.00 50.87           C  
ATOM   4622  NZ  LYS A 796      47.496  -1.528  10.610  1.00 51.79           N  
ATOM   4623  N   MET A 797      51.311  -1.094  16.784  1.00 66.57           N  
ATOM   4624  CA  MET A 797      52.756  -1.086  16.981  1.00 65.11           C  
ATOM   4625  C   MET A 797      53.179  -1.990  18.136  1.00 64.74           C  
ATOM   4626  O   MET A 797      54.073  -2.823  17.986  1.00 65.56           O  
ATOM   4627  CB  MET A 797      53.252   0.340  17.226  1.00 67.40           C  
ATOM   4628  CG  MET A 797      53.218   1.234  15.995  1.00 65.75           C  
ATOM   4629  SD  MET A 797      53.693   2.941  16.346  1.00 67.61           S  
ATOM   4630  CE  MET A 797      53.621   3.661  14.707  1.00 65.38           C  
ATOM   4631  N   ILE A 798      52.530  -1.825  19.283  1.00 58.06           N  
ATOM   4632  CA  ILE A 798      52.918  -2.558  20.484  1.00 57.48           C  
ATOM   4633  C   ILE A 798      52.102  -3.830  20.693  1.00 57.84           C  
ATOM   4634  O   ILE A 798      52.106  -4.402  21.782  1.00 57.00           O  
ATOM   4635  CB  ILE A 798      52.784  -1.678  21.740  1.00 57.60           C  
ATOM   4636  CG1 ILE A 798      51.324  -1.268  21.951  1.00 58.63           C  
ATOM   4637  CG2 ILE A 798      53.673  -0.452  21.628  1.00 57.38           C  
ATOM   4638  CD1 ILE A 798      51.092  -0.462  23.210  1.00 57.68           C  
ATOM   4639  N   SER A 799      51.409  -4.275  19.650  1.00 59.93           N  
ATOM   4640  CA  SER A 799      50.576  -5.470  19.744  1.00 62.40           C  
ATOM   4641  C   SER A 799      51.407  -6.723  20.013  1.00 60.50           C  
ATOM   4642  O   SER A 799      50.999  -7.595  20.778  1.00 59.08           O  
ATOM   4643  CB  SER A 799      49.754  -5.653  18.468  1.00 63.06           C  
ATOM   4644  OG  SER A 799      48.813  -4.604  18.315  1.00 66.29           O  
ATOM   4645  N   PHE A 800      52.575  -6.804  19.384  1.00 50.55           N  
ATOM   4646  CA  PHE A 800      53.450  -7.961  19.540  1.00 59.06           C  
ATOM   4647  C   PHE A 800      54.187  -7.944  20.871  1.00 58.20           C  
ATOM   4648  O   PHE A 800      54.215  -8.944  21.589  1.00 57.58           O  
ATOM   4649  CB  PHE A 800      54.464  -8.023  18.397  1.00 57.92           C  
ATOM   4650  CG  PHE A 800      55.534  -9.059  18.593  1.00 56.55           C  
ATOM   4651  CD1 PHE A 800      56.845  -8.684  18.831  1.00 55.86           C  
ATOM   4652  CD2 PHE A 800      55.227 -10.407  18.546  1.00 56.21           C  
ATOM   4653  CE1 PHE A 800      57.832  -9.637  19.014  1.00 55.05           C  
ATOM   4654  CE2 PHE A 800      56.208 -11.362  18.729  1.00 55.10           C  
ATOM   4655  CZ  PHE A 800      57.512 -10.976  18.963  1.00 54.61           C  
ATOM   4656  N   TRP A 801      54.787  -6.803  21.193  1.00 51.64           N  
ATOM   4657  CA  TRP A 801      55.601  -6.681  22.395  1.00 50.85           C  
ATOM   4658  C   TRP A 801      54.760  -6.771  23.662  1.00 50.42           C  
ATOM   4659  O   TRP A 801      55.278  -7.055  24.737  1.00 59.57           O  
ATOM   4660  CB  TRP A 801      56.382  -5.367  22.380  1.00 50.96           C  
ATOM   4661  CG  TRP A 801      57.479  -5.318  23.398  1.00 50.34           C  
ATOM   4662  CD1 TRP A 801      57.421  -4.760  24.642  1.00 59.91           C  
ATOM   4663  CD2 TRP A 801      58.798  -5.859  23.261  1.00 50.19           C  
ATOM   4664  NE1 TRP A 801      58.625  -4.915  25.287  1.00 59.71           N  
ATOM   4665  CE2 TRP A 801      59.485  -5.587  24.461  1.00 50.05           C  
ATOM   4666  CE3 TRP A 801      59.463  -6.545  22.241  1.00 50.14           C  
ATOM   4667  CZ2 TRP A 801      60.808  -5.978  24.665  1.00 50.36           C  
ATOM   4668  CZ3 TRP A 801      60.773  -6.930  22.447  1.00 50.27           C  
ATOM   4669  CH2 TRP A 801      61.432  -6.647  23.648  1.00 50.62           C  
ATOM   4670  N   ARG A 802      53.462  -6.528  23.537  1.00 59.70           N  
ATOM   4671  CA  ARG A 802      52.576  -6.630  24.687  1.00 59.16           C  
ATOM   4672  C   ARG A 802      52.428  -8.084  25.111  1.00 58.87           C  
ATOM   4673  O   ARG A 802      52.376  -8.391  26.302  1.00 58.36           O  
ATOM   4674  CB  ARG A 802      51.205  -6.034  24.378  1.00 59.79           C  
ATOM   4675  CG  ARG A 802      50.288  -5.957  25.587  1.00 59.09           C  
ATOM   4676  CD  ARG A 802      48.826  -5.831  25.186  1.00 59.85           C  
ATOM   4677  NE  ARG A 802      48.545  -4.594  24.461  1.00 50.90           N  
ATOM   4678  CZ  ARG A 802      48.430  -4.512  23.140  1.00 52.55           C  
ATOM   4679  NH1 ARG A 802      48.572  -5.598  22.391  1.00 53.16           N  
ATOM   4680  NH2 ARG A 802      48.171  -3.345  22.566  1.00 53.87           N  
ATOM   4681  N   ASN A 803      52.370  -8.977  24.129  1.00 62.75           N  
ATOM   4682  CA  ASN A 803      52.139 -10.392  24.395  1.00 62.51           C  
ATOM   4683  C   ASN A 803      53.384 -11.253  24.216  1.00 63.38           C  
ATOM   4684  O   ASN A 803      53.284 -12.416  23.825  1.00 62.51           O  
ATOM   4685  CB  ASN A 803      51.026 -10.922  23.488  1.00 64.79           C  
ATOM   4686  CG  ASN A 803      49.771 -10.077  23.553  1.00 64.67           C  
ATOM   4687  OD1 ASN A 803      49.488  -9.442  24.568  1.00 65.35           O  
ATOM   4688  ND2 ASN A 803      49.008 -10.064  22.464  1.00 65.58           N  
ATOM   4689  N   ALA A 804      54.552 -10.692  24.507  1.00 57.65           N  
ATOM   4690  CA  ALA A 804      55.800 -11.416  24.298  1.00 57.63           C  
ATOM   4691  C   ALA A 804      56.960 -10.866  25.125  1.00 56.13           C  
ATOM   4692  O   ALA A 804      57.961 -11.554  25.315  1.00 56.54           O  
ATOM   4693  CB  ALA A 804      56.166 -11.404  22.821  1.00 56.03           C  
ATOM   4694  N   HIS A 805      56.821  -9.636  25.617  1.00 67.53           N  
ATOM   4695  CA  HIS A 805      57.907  -8.969  26.338  1.00 69.01           C  
ATOM   4696  C   HIS A 805      58.411  -9.796  27.518  1.00 64.11           C  
ATOM   4697  O   HIS A 805      59.595  -9.760  27.847  1.00 63.36           O  
ATOM   4698  CB  HIS A 805      57.466  -7.587  26.832  1.00 69.36           C  
ATOM   4699  CG  HIS A 805      56.520  -7.628  27.992  1.00 69.57           C  
ATOM   4700  ND1 HIS A 805      56.946  -7.639  29.302  1.00 62.73           N  
ATOM   4701  CD2 HIS A 805      55.165  -7.657  28.039  1.00 64.06           C  
ATOM   4702  CE1 HIS A 805      55.898  -7.676  30.106  1.00 64.66           C  
ATOM   4703  NE2 HIS A 805      54.806  -7.688  29.363  1.00 63.48           N  
ATOM   4704  N   LYS A 806      57.509 -10.545  28.141  1.00 56.03           N  
ATOM   4705  CA  LYS A 806      57.883 -11.426  29.236  1.00 60.07           C  
ATOM   4706  C   LYS A 806      58.805 -12.530  28.732  1.00 60.43           C  
ATOM   4707  O   LYS A 806      59.871 -12.774  29.301  1.00 56.64           O  
ATOM   4708  CB  LYS A 806      56.642 -12.033  29.891  1.00 53.28           C  
ATOM   4709  CG  LYS A 806      56.953 -13.054  30.973  1.00 55.12           C  
ATOM   4710  CD  LYS A 806      55.681 -13.637  31.564  1.00 59.24           C  
ATOM   4711  CE  LYS A 806      54.877 -12.576  32.300  1.00 59.63           C  
ATOM   4712  NZ  LYS A 806      55.630 -12.022  33.460  1.00 58.46           N  
ATOM   4713  N   ARG A 807      58.392 -13.181  27.649  1.00 55.64           N  
ATOM   4714  CA  ARG A 807      59.145 -14.294  27.085  1.00 55.73           C  
ATOM   4715  C   ARG A 807      60.488 -13.847  26.515  1.00 59.81           C  
ATOM   4716  O   ARG A 807      61.453 -14.606  26.526  1.00 53.76           O  
ATOM   4717  CB  ARG A 807      58.326 -14.998  26.001  1.00 53.53           C  
ATOM   4718  CG  ARG A 807      56.945 -15.445  26.451  1.00 50.47           C  
ATOM   4719  CD  ARG A 807      56.346 -16.445  25.477  1.00 56.81           C  
ATOM   4720  NE  ARG A 807      56.313 -15.931  24.110  1.00 50.50           N  
ATOM   4721  CZ  ARG A 807      55.247 -15.370  23.547  1.00 58.00           C  
ATOM   4722  NH1 ARG A 807      54.118 -15.250  24.232  1.00 56.35           N  
ATOM   4723  NH2 ARG A 807      55.310 -14.931  22.298  1.00 50.58           N  
ATOM   4724  N   ILE A 808      60.546 -12.615  26.017  1.00 47.99           N  
ATOM   4725  CA  ILE A 808      61.775 -12.091  25.429  1.00 48.38           C  
ATOM   4726  C   ILE A 808      62.759 -11.616  26.493  1.00 49.58           C  
ATOM   4727  O   ILE A 808      63.951 -11.916  26.427  1.00 50.78           O  
ATOM   4728  CB  ILE A 808      61.497 -10.917  24.468  1.00 47.32           C  
ATOM   4729  CG1 ILE A 808      60.425 -11.294  23.445  1.00 46.26           C  
ATOM   4730  CG2 ILE A 808      62.778 -10.489  23.765  1.00 47.72           C  
ATOM   4731  CD1 ILE A 808      60.821 -12.423  22.539  1.00 45.81           C  
ATOM   4732  N   SER A 809      62.259 -10.868  27.473  1.00 59.33           N  
ATOM   4733  CA  SER A 809      63.113 -10.323  28.522  1.00 55.79           C  
ATOM   4734  C   SER A 809      63.611 -11.410  29.469  1.00 59.73           C  
ATOM   4735  O   SER A 809      64.741 -11.349  29.952  1.00 61.44           O  
ATOM   4736  CB  SER A 809      62.370  -9.245  29.314  1.00 57.05           C  
ATOM   4737  OG  SER A 809      61.231  -9.785  29.963  1.00 58.19           O  
ATOM   4738  N   SER A 810      62.760 -12.397  29.734  1.00 53.68           N  
ATOM   4739  CA  SER A 810      63.126 -13.495  30.624  1.00 57.74           C  
ATOM   4740  C   SER A 810      63.960 -14.538  29.893  1.00 58.91           C  
ATOM   4741  O   SER A 810      64.545 -15.424  30.516  1.00 58.73           O  
ATOM   4742  CB  SER A 810      61.878 -14.147  31.217  1.00 56.14           C  
ATOM   4743  OG  SER A 810      61.059 -14.682  30.191  1.00 57.78           O  
ATOM   4744  N   GLN A 811      63.999 -14.428  28.568  1.00 55.87           N  
ATOM   4745  CA  GLN A 811      64.794 -15.332  27.746  1.00 56.68           C  
ATOM   4746  C   GLN A 811      66.255 -15.240  28.149  1.00 52.71           C  
ATOM   4747  O   GLN A 811      66.961 -14.320  27.743  1.00 57.68           O  
ATOM   4748  CB  GLN A 811      64.632 -14.997  26.262  1.00 58.24           C  
ATOM   4749  CG  GLN A 811      65.331 -15.957  25.321  1.00 54.65           C  
ATOM   4750  CD  GLN A 811      64.629 -17.295  25.217  1.00 55.38           C  
ATOM   4751  OE1 GLN A 811      65.252 -18.309  24.905  1.00 55.43           O  
ATOM   4752  NE2 GLN A 811      63.324 -17.306  25.469  1.00 55.81           N  
ATOM   4753  N   MET A 812      66.703 -16.193  28.959  1.00 54.39           N  
ATOM   4754  CA  MET A 812      68.054 -16.152  29.500  1.00 55.17           C  
ATOM   4755  C   MET A 812      69.106 -16.359  28.419  1.00 55.74           C  
ATOM   4756  O   MET A 812      68.787 -16.708  27.283  1.00 56.56           O  
ATOM   4757  CB  MET A 812      68.231 -17.200  30.599  1.00 56.48           C  
ATOM   4758  CG  MET A 812      68.362 -18.623  30.089  1.00 57.17           C  
ATOM   4759  SD  MET A 812      68.985 -19.747  31.353  1.00 58.54           S  
ATOM   4760  CE  MET A 812      68.839 -21.308  30.501  1.00 58.16           C  
ATOM   4761  N   VAL A 813      70.361 -16.139  28.791  1.00 52.04           N  
ATOM   4762  CA  VAL A 813      71.483 -16.289  27.876  1.00 52.58           C  
ATOM   4763  C   VAL A 813      72.784 -16.369  28.668  1.00 50.63           C  
ATOM   4764  O   VAL A 813      73.062 -15.508  29.501  1.00 53.08           O  
ATOM   4765  CB  VAL A 813      71.553 -15.125  26.862  1.00 52.21           C  
ATOM   4766  CG1 VAL A 813      71.272 -13.796  27.549  1.00 57.10           C  
ATOM   4767  CG2 VAL A 813      72.908 -15.096  26.176  1.00 54.21           C  
ATOM   4768  N   VAL A 814      73.569 -17.412  28.420  1.00 51.45           N  
ATOM   4769  CA  VAL A 814      74.832 -17.596  29.123  1.00 54.05           C  
ATOM   4770  C   VAL A 814      75.996 -17.014  28.330  1.00 55.65           C  
ATOM   4771  O   VAL A 814      76.167 -17.317  27.149  1.00 55.17           O  
ATOM   4772  CB  VAL A 814      75.104 -19.084  29.409  1.00 54.70           C  
ATOM   4773  CG1 VAL A 814      76.509 -19.274  29.962  1.00 57.68           C  
ATOM   4774  CG2 VAL A 814      74.066 -19.635  30.375  1.00 53.60           C  
ATOM   4775  N   TRP A 815      76.787 -16.169  28.985  1.00 57.66           N  
ATOM   4776  CA  TRP A 815      77.962 -15.573  28.361  1.00 59.61           C  
ATOM   4777  C   TRP A 815      79.202 -16.416  28.632  1.00 52.30           C  
ATOM   4778  O   TRP A 815      79.527 -16.699  29.783  1.00 53.87           O  
ATOM   4779  CB  TRP A 815      78.183 -14.148  28.871  1.00 50.57           C  
ATOM   4780  CG  TRP A 815      76.967 -13.284  28.815  1.00 58.12           C  
ATOM   4781  CD1 TRP A 815      76.203 -12.879  29.868  1.00 57.33           C  
ATOM   4782  CD2 TRP A 815      76.372 -12.715  27.645  1.00 56.28           C  
ATOM   4783  NE1 TRP A 815      75.168 -12.092  29.427  1.00 55.09           N  
ATOM   4784  CE2 TRP A 815      75.249 -11.976  28.065  1.00 54.45           C  
ATOM   4785  CE3 TRP A 815      76.680 -12.759  26.281  1.00 56.10           C  
ATOM   4786  CZ2 TRP A 815      74.434 -11.287  27.172  1.00 52.53           C  
ATOM   4787  CZ3 TRP A 815      75.868 -12.073  25.399  1.00 54.20           C  
ATOM   4788  CH2 TRP A 815      74.759 -11.348  25.847  1.00 52.48           C  
ATOM   4789  N   LEU A 816      79.893 -16.817  27.571  1.00 58.46           N  
ATOM   4790  CA  LEU A 816      81.127 -17.577  27.728  1.00 52.02           C  
ATOM   4791  C   LEU A 816      82.347 -16.659  27.650  1.00 52.66           C  
ATOM   4792  O   LEU A 816      82.442 -15.816  26.758  1.00 52.34           O  
ATOM   4793  CB  LEU A 816      81.212 -18.692  26.679  1.00 58.78           C  
ATOM   4794  CG  LEU A 816      80.507 -18.503  25.332  1.00 59.00           C  
ATOM   4795  CD1 LEU A 816      81.312 -17.609  24.406  1.00 51.12           C  
ATOM   4796  CD2 LEU A 816      80.240 -19.851  24.678  1.00 58.77           C  
ATOM   4797  N   PRO A 817      83.281 -16.815  28.600  1.00 61.64           N  
ATOM   4798  CA  PRO A 817      84.466 -15.955  28.689  1.00 62.60           C  
ATOM   4799  C   PRO A 817      85.462 -16.200  27.561  1.00 63.07           C  
ATOM   4800  O   PRO A 817      85.277 -17.113  26.757  1.00 62.30           O  
ATOM   4801  CB  PRO A 817      85.072 -16.340  30.040  1.00 63.02           C  
ATOM   4802  CG  PRO A 817      84.638 -17.745  30.251  1.00 62.47           C  
ATOM   4803  CD  PRO A 817      83.260 -17.836  29.661  1.00 62.22           C  
ATOM   4804  N   ARG A 818      86.515 -15.389  27.517  1.00102.29           N  
ATOM   4805  CA  ARG A 818      87.512 -15.469  26.455  1.00101.50           C  
ATOM   4806  C   ARG A 818      88.433 -16.675  26.616  1.00102.25           C  
ATOM   4807  O   ARG A 818      89.311 -16.908  25.787  1.00103.67           O  
ATOM   4808  CB  ARG A 818      88.343 -14.182  26.400  1.00100.59           C  
ATOM   4809  CG  ARG A 818      89.397 -14.040  27.493  1.00104.79           C  
ATOM   4810  CD  ARG A 818      88.832 -13.435  28.773  1.00104.51           C  
ATOM   4811  NE  ARG A 818      88.216 -14.435  29.640  1.00103.46           N  
ATOM   4812  CZ  ARG A 818      88.866 -15.111  30.582  1.00106.08           C  
ATOM   4813  NH1 ARG A 818      90.159 -14.894  30.783  1.00108.50           N  
ATOM   4814  NH2 ARG A 818      88.225 -16.003  31.323  1.00105.82           N  
ATOM   4815  N   SER A 819      88.231 -17.440  27.685  1.00 66.64           N  
ATOM   4816  CA  SER A 819      89.035 -18.630  27.932  1.00 67.74           C  
ATOM   4817  C   SER A 819      88.385 -19.870  27.330  1.00 66.59           C  
ATOM   4818  O   SER A 819      89.071 -20.825  26.965  1.00 67.47           O  
ATOM   4819  CB  SER A 819      89.254 -18.829  29.434  1.00 68.46           C  
ATOM   4820  OG  SER A 819      88.022 -19.035  30.106  1.00 67.56           O  
ATOM   4821  N   ALA A 820      87.060 -19.849  27.222  1.00 68.89           N  
ATOM   4822  CA  ALA A 820      86.317 -21.002  26.725  1.00 69.25           C  
ATOM   4823  C   ALA A 820      85.637 -20.712  25.391  1.00 67.52           C  
ATOM   4824  O   ALA A 820      84.456 -21.008  25.209  1.00 66.07           O  
ATOM   4825  CB  ALA A 820      85.287 -21.447  27.752  1.00 68.26           C  
ATOM   4826  N   LEU A 821      86.385 -20.135  24.459  1.00 53.18           N  
ATOM   4827  CA  LEU A 821      85.877 -19.898  23.113  1.00 50.89           C  
ATOM   4828  C   LEU A 821      86.959 -20.174  22.074  1.00 52.72           C  
ATOM   4829  O   LEU A 821      88.146 -20.082  22.382  1.00 56.05           O  
ATOM   4830  CB  LEU A 821      85.346 -18.466  22.981  1.00 59.92           C  
ATOM   4831  CG  LEU A 821      86.079 -17.303  23.656  1.00 52.61           C  
ATOM   4832  CD1 LEU A 821      87.435 -17.023  23.024  1.00 55.74           C  
ATOM   4833  CD2 LEU A 821      85.205 -16.059  23.620  1.00 50.76           C  
ATOM   4834  N   PRO A 822      86.550 -20.527  20.843  1.00 66.23           N  
ATOM   4835  CA  PRO A 822      87.509 -20.794  19.767  1.00 68.04           C  
ATOM   4836  C   PRO A 822      88.446 -19.617  19.522  1.00 60.65           C  
ATOM   4837  O   PRO A 822      87.998 -18.524  19.181  1.00 69.93           O  
ATOM   4838  CB  PRO A 822      86.613 -21.046  18.545  1.00 66.50           C  
ATOM   4839  CG  PRO A 822      85.266 -20.516  18.926  1.00 67.38           C  
ATOM   4840  CD  PRO A 822      85.163 -20.724  20.395  1.00 67.46           C  
ATOM   4841  N   ARG A 823      89.741 -19.851  19.704  1.00 89.81           N  
ATOM   4842  CA  ARG A 823      90.749 -18.814  19.531  1.00 81.96           C  
ATOM   4843  C   ARG A 823      90.857 -18.385  18.071  1.00 81.09           C  
ATOM   4844  O   ARG A 823      91.395 -17.320  17.764  1.00 89.22           O  
ATOM   4845  CB  ARG A 823      92.099 -19.307  20.052  1.00 81.34           C  
ATOM   4846  CG  ARG A 823      92.072 -19.693  21.525  1.00 83.14           C  
ATOM   4847  CD  ARG A 823      93.214 -20.629  21.885  1.00 85.13           C  
ATOM   4848  NE  ARG A 823      94.520 -20.005  21.707  1.00 84.19           N  
ATOM   4849  CZ  ARG A 823      95.676 -20.613  21.954  1.00 85.70           C  
ATOM   4850  NH1 ARG A 823      95.686 -21.866  22.392  1.00 87.62           N  
ATOM   4851  NH2 ARG A 823      96.821 -19.973  21.765  1.00 86.93           N  
ATOM   4852  N   ALA A 824      90.331 -19.215  17.175  1.00 88.90           N  
ATOM   4853  CA  ALA A 824      90.275 -18.885  15.753  1.00 80.31           C  
ATOM   4854  C   ALA A 824      89.323 -17.718  15.510  1.00 84.51           C  
ATOM   4855  O   ALA A 824      89.376 -17.063  14.469  1.00 86.11           O  
ATOM   4856  CB  ALA A 824      89.849 -20.100  14.943  1.00 88.93           C  
ATOM   4857  N   VAL A 825      88.446 -17.470  16.477  1.00 61.04           N  
ATOM   4858  CA  VAL A 825      87.550 -16.324  16.434  1.00 69.46           C  
ATOM   4859  C   VAL A 825      88.269 -15.095  16.981  1.00 60.71           C  
ATOM   4860  O   VAL A 825      88.070 -13.977  16.502  1.00 68.39           O  
ATOM   4861  CB  VAL A 825      86.258 -16.592  17.235  1.00 66.74           C  
ATOM   4862  CG1 VAL A 825      85.397 -15.344  17.312  1.00 65.05           C  
ATOM   4863  CG2 VAL A 825      85.483 -17.736  16.608  1.00 69.21           C  
ATOM   4864  N   ILE A 826      89.114 -15.313  17.984  1.00 79.15           N  
ATOM   4865  CA  ILE A 826      89.934 -14.241  18.541  1.00 71.70           C  
ATOM   4866  C   ILE A 826      90.896 -13.711  17.482  1.00 72.77           C  
ATOM   4867  O   ILE A 826      91.125 -12.504  17.386  1.00 71.61           O  
ATOM   4868  CB  ILE A 826      90.726 -14.716  19.777  1.00 71.97           C  
ATOM   4869  CG1 ILE A 826      89.767 -15.119  20.897  1.00 71.50           C  
ATOM   4870  CG2 ILE A 826      91.667 -13.627  20.270  1.00 72.96           C  
ATOM   4871  CD1 ILE A 826      88.906 -13.976  21.400  1.00 79.01           C  
ATOM   4872  N   ARG A 827      91.442 -14.619  16.679  1.00 85.02           N  
ATOM   4873  CA  ARG A 827      92.336 -14.242  15.589  1.00 83.63           C  
ATOM   4874  C   ARG A 827      91.605 -13.399  14.545  1.00 83.28           C  
ATOM   4875  O   ARG A 827      92.205 -12.539  13.900  1.00 84.90           O  
ATOM   4876  CB  ARG A 827      92.937 -15.486  14.931  1.00 81.40           C  
ATOM   4877  CG  ARG A 827      93.794 -16.333  15.860  1.00 83.85           C  
ATOM   4878  CD  ARG A 827      94.985 -15.548  16.388  1.00 85.82           C  
ATOM   4879  NE  ARG A 827      95.880 -16.382  17.186  1.00 85.17           N  
ATOM   4880  CZ  ARG A 827      95.802 -16.513  18.505  1.00 87.12           C  
ATOM   4881  NH1 ARG A 827      94.869 -15.863  19.187  1.00 86.54           N  
ATOM   4882  NH2 ARG A 827      96.662 -17.295  19.147  1.00 89.67           N  
ATOM   4883  N   HIS A 828      90.310 -13.653  14.385  1.00 83.42           N  
ATOM   4884  CA  HIS A 828      89.475 -12.877  13.476  1.00 89.69           C  
ATOM   4885  C   HIS A 828      89.368 -11.437  13.978  1.00 89.86           C  
ATOM   4886  O   HIS A 828      89.162 -11.210  15.170  1.00 80.96           O  
ATOM   4887  CB  HIS A 828      88.088 -13.511  13.348  1.00 80.34           C  
ATOM   4888  CG  HIS A 828      87.281 -12.981  12.203  1.00 87.37           C  
ATOM   4889  ND1 HIS A 828      86.426 -11.908  12.328  1.00 85.21           N  
ATOM   4890  CD2 HIS A 828      87.203 -13.375  10.909  1.00 86.26           C  
ATOM   4891  CE1 HIS A 828      85.854 -11.664  11.163  1.00 81.98           C  
ATOM   4892  NE2 HIS A 828      86.308 -12.540  10.285  1.00 82.68           N  
ATOM   4893  N   PRO A 829      89.506 -10.459  13.067  1.00 79.59           N  
ATOM   4894  CA  PRO A 829      89.554  -9.031  13.414  1.00 76.45           C  
ATOM   4895  C   PRO A 829      88.293  -8.493  14.095  1.00 76.69           C  
ATOM   4896  O   PRO A 829      87.765  -7.469  13.667  1.00 76.15           O  
ATOM   4897  CB  PRO A 829      89.752  -8.350  12.053  1.00 76.41           C  
ATOM   4898  CG  PRO A 829      89.257  -9.342  11.053  1.00 76.60           C  
ATOM   4899  CD  PRO A 829      89.634 -10.673  11.616  1.00 76.68           C  
ATOM   4900  N   ASP A 830      87.840  -9.171  15.147  1.00 65.79           N  
ATOM   4901  CA  ASP A 830      86.698  -8.728  15.944  1.00 65.82           C  
ATOM   4902  C   ASP A 830      86.804  -9.271  17.365  1.00 64.95           C  
ATOM   4903  O   ASP A 830      87.036 -10.464  17.564  1.00 66.50           O  
ATOM   4904  CB  ASP A 830      85.377  -9.180  15.314  1.00 62.69           C  
ATOM   4905  CG  ASP A 830      84.953  -8.315  14.143  1.00 62.74           C  
ATOM   4906  OD1 ASP A 830      85.070  -7.077  14.241  1.00 62.03           O  
ATOM   4907  OD2 ASP A 830      84.499  -8.875  13.122  1.00 69.97           O  
ATOM   4908  N   TYR A 831      86.636  -8.397  18.352  1.00 86.81           N  
ATOM   4909  CA  TYR A 831      86.658  -8.824  19.751  1.00 85.58           C  
ATOM   4910  C   TYR A 831      85.289  -8.830  20.464  1.00 84.29           C  
ATOM   4911  O   TYR A 831      84.983  -9.814  21.136  1.00 87.36           O  
ATOM   4912  CB  TYR A 831      87.647  -7.975  20.558  1.00 88.10           C  
ATOM   4913  CG  TYR A 831      87.705  -8.375  22.016  1.00 87.81           C  
ATOM   4914  CD1 TYR A 831      87.175  -7.557  23.005  1.00 87.12           C  
ATOM   4915  CD2 TYR A 831      88.269  -9.585  22.400  1.00 80.51           C  
ATOM   4916  CE1 TYR A 831      87.221  -7.925  24.335  1.00 89.54           C  
ATOM   4917  CE2 TYR A 831      88.319  -9.962  23.729  1.00 81.04           C  
ATOM   4918  CZ  TYR A 831      87.793  -9.127  24.692  1.00 88.32           C  
ATOM   4919  OH  TYR A 831      87.839  -9.498  26.016  1.00 80.12           O  
ATOM   4920  N   ASP A 832      84.463  -7.779  20.364  1.00110.19           N  
ATOM   4921  CA  ASP A 832      84.725  -6.541  19.631  1.00114.58           C  
ATOM   4922  C   ASP A 832      84.573  -5.332  20.546  1.00114.08           C  
ATOM   4923  O   ASP A 832      83.466  -5.012  20.983  1.00113.79           O  
ATOM   4924  CB  ASP A 832      83.782  -6.420  18.430  1.00115.72           C  
ATOM   4925  CG  ASP A 832      84.272  -5.419  17.399  1.00113.99           C  
ATOM   4926  OD1 ASP A 832      85.131  -4.575  17.735  1.00114.63           O  
ATOM   4927  OD2 ASP A 832      83.795  -5.476  16.247  1.00113.77           O  
ATOM   4928  N   GLU A 833      85.695  -4.671  20.827  1.00135.08           N  
ATOM   4929  CA  GLU A 833      85.728  -3.496  21.695  1.00135.46           C  
ATOM   4930  C   GLU A 833      85.108  -3.806  23.056  1.00134.05           C  
ATOM   4931  O   GLU A 833      84.068  -3.251  23.414  1.00131.62           O  
ATOM   4932  CB  GLU A 833      85.006  -2.316  21.034  1.00132.52           C  
ATOM   4933  CG  GLU A 833      85.399  -0.951  21.580  1.00132.03           C  
ATOM   4934  CD  GLU A 833      86.771  -0.506  21.110  1.00133.79           C  
ATOM   4935  OE1 GLU A 833      87.293  -1.096  20.141  1.00134.04           O  
ATOM   4936  OE2 GLU A 833      87.329   0.437  21.710  1.00135.05           O  
ATOM   4937  N   GLU A 834      85.754  -4.704  23.798  1.00107.37           N  
ATOM   4938  CA  GLU A 834      85.272  -5.156  25.102  1.00108.94           C  
ATOM   4939  C   GLU A 834      83.860  -5.726  25.005  1.00105.67           C  
ATOM   4940  O   GLU A 834      83.030  -5.515  25.890  1.00107.49           O  
ATOM   4941  CB  GLU A 834      85.314  -4.015  26.122  1.00109.30           C  
ATOM   4942  CG  GLU A 834      86.702  -3.440  26.354  1.00108.60           C  
ATOM   4943  CD  GLU A 834      86.699  -2.287  27.339  1.00109.83           C  
ATOM   4944  OE1 GLU A 834      85.614  -1.953  27.863  1.00108.21           O  
ATOM   4945  OE2 GLU A 834      87.780  -1.715  27.589  1.00103.05           O  
ATOM   4946  N   GLY A 835      83.595  -6.451  23.923  1.00 92.06           N  
ATOM   4947  CA  GLY A 835      82.283  -7.024  23.688  1.00 90.17           C  
ATOM   4948  C   GLY A 835      82.136  -8.425  24.246  1.00 99.85           C  
ATOM   4949  O   GLY A 835      83.074  -9.222  24.208  1.00 99.47           O  
ATOM   4950  N   LEU A 836      80.951  -8.726  24.766  1.00 75.86           N  
ATOM   4951  CA  LEU A 836      80.673 -10.041  25.331  1.00 77.43           C  
ATOM   4952  C   LEU A 836      79.935 -10.927  24.339  1.00 76.46           C  
ATOM   4953  O   LEU A 836      78.911 -10.534  23.782  1.00 75.30           O  
ATOM   4954  CB  LEU A 836      79.854  -9.915  26.620  1.00 77.55           C  
ATOM   4955  CG  LEU A 836      80.620  -9.754  27.936  1.00 77.28           C  
ATOM   4956  CD1 LEU A 836      81.553 -10.938  28.158  1.00 80.11           C  
ATOM   4957  CD2 LEU A 836      81.393  -8.442  27.978  1.00 79.15           C  
ATOM   4958  N   TYR A 837      80.463 -12.126  24.120  1.00 63.58           N  
ATOM   4959  CA  TYR A 837      79.809 -13.098  23.255  1.00 66.16           C  
ATOM   4960  C   TYR A 837      79.239 -14.250  24.071  1.00 66.18           C  
ATOM   4961  O   TYR A 837      79.878 -14.741  25.001  1.00 66.19           O  
ATOM   4962  CB  TYR A 837      80.781 -13.625  22.200  1.00 67.40           C  
ATOM   4963  CG  TYR A 837      81.026 -12.656  21.067  1.00 64.16           C  
ATOM   4964  CD1 TYR A 837      80.130 -12.557  20.010  1.00 65.50           C  
ATOM   4965  CD2 TYR A 837      82.147 -11.839  21.053  1.00 64.57           C  
ATOM   4966  CE1 TYR A 837      80.345 -11.670  18.972  1.00 65.37           C  
ATOM   4967  CE2 TYR A 837      82.371 -10.951  20.019  1.00 63.97           C  
ATOM   4968  CZ  TYR A 837      81.467 -10.871  18.982  1.00 64.31           C  
ATOM   4969  OH  TYR A 837      81.688  -9.988  17.950  1.00 66.19           O  
ATOM   4970  N   GLY A 838      78.029 -14.669  23.722  1.00 52.48           N  
ATOM   4971  CA  GLY A 838      77.379 -15.765  24.412  1.00 52.48           C  
ATOM   4972  C   GLY A 838      76.380 -16.455  23.510  1.00 52.50           C  
ATOM   4973  O   GLY A 838      76.430 -16.303  22.290  1.00 53.90           O  
ATOM   4974  N   ALA A 839      75.469 -17.213  24.112  1.00 52.24           N  
ATOM   4975  CA  ALA A 839      74.440 -17.909  23.355  1.00 50.11           C  
ATOM   4976  C   ALA A 839      73.310 -18.389  24.255  1.00 48.74           C  
ATOM   4977  O   ALA A 839      73.392 -18.298  25.481  1.00 49.47           O  
ATOM   4978  CB  ALA A 839      75.040 -19.082  22.601  1.00 50.58           C  
ATOM   4979  N   ILE A 840      72.253 -18.895  23.627  1.00 58.73           N  
ATOM   4980  CA  ILE A 840      71.122 -19.475  24.333  1.00 61.46           C  
ATOM   4981  C   ILE A 840      70.542 -20.630  23.523  1.00 55.46           C  
ATOM   4982  O   ILE A 840      70.394 -20.537  22.299  1.00 50.48           O  
ATOM   4983  CB  ILE A 840      70.020 -18.425  24.616  1.00 61.68           C  
ATOM   4984  CG1 ILE A 840      68.782 -19.092  25.222  1.00 58.05           C  
ATOM   4985  CG2 ILE A 840      69.652 -17.669  23.344  1.00 54.74           C  
ATOM   4986  CD1 ILE A 840      69.037 -19.780  26.552  1.00 60.16           C  
ATOM   4987  N   LEU A 841      70.244 -21.730  24.208  1.00 50.54           N  
ATOM   4988  CA  LEU A 841      69.558 -22.848  23.585  1.00 57.36           C  
ATOM   4989  C   LEU A 841      68.058 -22.575  23.587  1.00 55.17           C  
ATOM   4990  O   LEU A 841      67.472 -22.350  24.646  1.00 56.42           O  
ATOM   4991  CB  LEU A 841      69.870 -24.162  24.306  1.00 58.17           C  
ATOM   4992  CG  LEU A 841      71.332 -24.616  24.391  1.00 50.32           C  
ATOM   4993  CD1 LEU A 841      72.133 -24.136  23.189  1.00 59.93           C  
ATOM   4994  CD2 LEU A 841      71.977 -24.143  25.680  1.00 53.68           C  
ATOM   4995  N   PRO A 842      67.437 -22.591  22.396  1.00 59.71           N  
ATOM   4996  CA  PRO A 842      66.024 -22.266  22.170  1.00 57.76           C  
ATOM   4997  C   PRO A 842      65.056 -22.991  23.099  1.00 57.79           C  
ATOM   4998  O   PRO A 842      63.925 -22.529  23.253  1.00 57.17           O  
ATOM   4999  CB  PRO A 842      65.801 -22.701  20.722  1.00 54.52           C  
ATOM   5000  CG  PRO A 842      67.117 -22.502  20.086  1.00 54.91           C  
ATOM   5001  CD  PRO A 842      68.132 -22.885  21.131  1.00 58.00           C  
ATOM   5002  N   GLN A 843      65.491 -24.096  23.695  1.00 52.17           N  
ATOM   5003  CA  GLN A 843      64.666 -24.849  24.632  1.00 52.47           C  
ATOM   5004  C   GLN A 843      63.362 -25.275  23.961  1.00 49.82           C  
ATOM   5005  O   GLN A 843      62.301 -24.698  24.203  1.00 49.72           O  
ATOM   5006  CB  GLN A 843      64.391 -24.018  25.888  1.00 54.85           C  
ATOM   5007  CG  GLN A 843      63.724 -24.773  27.017  1.00 55.64           C  
ATOM   5008  CD  GLN A 843      63.622 -23.940  28.276  1.00 58.09           C  
ATOM   5009  OE1 GLN A 843      64.436 -23.047  28.511  1.00 59.87           O  
ATOM   5010  NE2 GLN A 843      62.613 -24.222  29.090  1.00 58.23           N  
ATOM   5011  N   VAL A 844      63.460 -26.287  23.105  1.00 49.33           N  
ATOM   5012  CA  VAL A 844      62.342 -26.708  22.276  1.00 48.33           C  
ATOM   5013  C   VAL A 844      61.925 -28.154  22.545  1.00 47.91           C  
ATOM   5014  O   VAL A 844      62.762 -29.058  22.583  1.00 50.13           O  
ATOM   5015  CB  VAL A 844      62.682 -26.549  20.775  1.00 47.01           C  
ATOM   5016  CG1 VAL A 844      64.061 -27.125  20.471  1.00 46.02           C  
ATOM   5017  CG2 VAL A 844      61.624 -27.208  19.905  1.00 44.77           C  
ATOM   5018  N   VAL A 845      60.628 -28.365  22.746  1.00 58.42           N  
ATOM   5019  CA  VAL A 845      60.077 -29.710  22.818  1.00 57.73           C  
ATOM   5020  C   VAL A 845      60.227 -30.381  21.457  1.00 55.41           C  
ATOM   5021  O   VAL A 845      59.709 -29.885  20.456  1.00 54.38           O  
ATOM   5022  CB  VAL A 845      58.595 -29.705  23.236  1.00 58.31           C  
ATOM   5023  CG1 VAL A 845      58.004 -31.101  23.120  1.00 57.61           C  
ATOM   5024  CG2 VAL A 845      58.445 -29.171  24.652  1.00 50.48           C  
ATOM   5025  N   THR A 846      60.938 -31.504  21.433  1.00 67.35           N  
ATOM   5026  CA  THR A 846      61.321 -32.168  20.192  1.00 63.49           C  
ATOM   5027  C   THR A 846      60.142 -32.487  19.270  1.00 66.05           C  
ATOM   5028  O   THR A 846      60.237 -32.333  18.053  1.00 64.52           O  
ATOM   5029  CB  THR A 846      62.082 -33.473  20.487  1.00 66.06           C  
ATOM   5030  OG1 THR A 846      63.199 -33.191  21.342  1.00 69.54           O  
ATOM   5031  CG2 THR A 846      62.579 -34.105  19.201  1.00 64.51           C  
ATOM   5032  N   ALA A 847      59.028 -32.916  19.851  1.00 59.07           N  
ATOM   5033  CA  ALA A 847      57.873 -33.317  19.057  1.00 50.32           C  
ATOM   5034  C   ALA A 847      56.554 -32.983  19.748  1.00 59.42           C  
ATOM   5035  O   ALA A 847      56.262 -33.491  20.829  1.00 51.08           O  
ATOM   5036  CB  ALA A 847      57.945 -34.804  18.747  1.00 59.65           C  
ATOM   5037  N   GLY A 848      55.763 -32.127  19.112  1.00 57.54           N  
ATOM   5038  CA  GLY A 848      54.447 -31.778  19.614  1.00 54.72           C  
ATOM   5039  C   GLY A 848      53.406 -31.886  18.517  1.00 58.54           C  
ATOM   5040  O   GLY A 848      53.694 -31.590  17.357  1.00 54.31           O  
ATOM   5041  N   THR A 849      52.205 -32.323  18.885  1.00 83.41           N  
ATOM   5042  CA  THR A 849      51.098 -32.440  17.943  1.00 84.92           C  
ATOM   5043  C   THR A 849      50.872 -31.129  17.209  1.00 88.97           C  
ATOM   5044  O   THR A 849      50.999 -30.060  17.806  1.00 84.67           O  
ATOM   5045  CB  THR A 849      49.778 -32.828  18.646  1.00 81.53           C  
ATOM   5046  OG1 THR A 849      49.530 -31.923  19.729  1.00 82.88           O  
ATOM   5047  CG2 THR A 849      49.834 -34.245  19.184  1.00 87.29           C  
ATOM   5048  N   ILE A 850      50.579 -31.188  15.912  1.00 93.19           N  
ATOM   5049  CA  ILE A 850      50.701 -32.390  15.092  1.00 92.80           C  
ATOM   5050  C   ILE A 850      51.366 -31.876  13.811  1.00 92.98           C  
ATOM   5051  O   ILE A 850      51.090 -30.752  13.386  1.00 93.67           O  
ATOM   5052  CB  ILE A 850      49.316 -33.082  14.824  1.00 96.80           C  
ATOM   5053  CG1 ILE A 850      49.433 -34.609  14.721  1.00 94.11           C  
ATOM   5054  CG2 ILE A 850      48.667 -32.565  13.552  1.00 97.65           C  
ATOM   5055  CD1 ILE A 850      50.090 -35.287  15.894  1.00 91.53           C  
ATOM   5056  N   THR A 851      52.266 -32.650  13.214  1.00 69.71           N  
ATOM   5057  CA  THR A 851      52.606 -33.986  13.678  1.00 60.12           C  
ATOM   5058  C   THR A 851      54.050 -34.076  14.133  1.00 66.75           C  
ATOM   5059  O   THR A 851      54.965 -34.086  13.313  1.00 66.19           O  
ATOM   5060  CB  THR A 851      52.372 -35.009  12.575  1.00 66.84           C  
ATOM   5061  OG1 THR A 851      53.617 -35.312  11.934  1.00 64.80           O  
ATOM   5062  CG2 THR A 851      51.405 -34.434  11.559  1.00 64.45           C  
ATOM   5063  N   ARG A 852      54.242 -34.146  15.446  1.00 50.94           N  
ATOM   5064  CA  ARG A 852      55.571 -34.214  16.040  1.00 59.92           C  
ATOM   5065  C   ARG A 852      56.414 -33.004  15.638  1.00 50.51           C  
ATOM   5066  O   ARG A 852      57.640 -33.089  15.550  1.00 57.78           O  
ATOM   5067  CB  ARG A 852      56.276 -35.514  15.640  1.00 59.58           C  
ATOM   5068  CG  ARG A 852      55.408 -36.757  15.783  1.00 56.54           C  
ATOM   5069  CD  ARG A 852      56.146 -38.012  15.344  1.00 56.84           C  
ATOM   5070  NE  ARG A 852      56.727 -37.876  14.011  1.00 51.74           N  
ATOM   5071  CZ  ARG A 852      56.063 -38.084  12.879  1.00 51.62           C  
ATOM   5072  NH1 ARG A 852      54.784 -38.431  12.914  1.00 52.52           N  
ATOM   5073  NH2 ARG A 852      56.674 -37.937  11.712  1.00 50.88           N  
ATOM   5074  N   ARG A 853      55.742 -31.882  15.389  1.00 55.97           N  
ATOM   5075  CA  ARG A 853      56.417 -30.634  15.063  1.00 55.67           C  
ATOM   5076  C   ARG A 853      57.125 -30.065  16.283  1.00 56.33           C  
ATOM   5077  O   ARG A 853      56.975 -30.573  17.393  1.00 57.22           O  
ATOM   5078  CB  ARG A 853      55.425 -29.604  14.517  1.00 58.35           C  
ATOM   5079  CG  ARG A 853      55.130 -29.735  13.038  1.00 56.44           C  
ATOM   5080  CD  ARG A 853      54.499 -28.471  12.486  1.00 58.72           C  
ATOM   5081  NE  ARG A 853      54.414 -28.496  11.028  1.00 57.17           N  
ATOM   5082  CZ  ARG A 853      53.994 -27.475  10.287  1.00 58.21           C  
ATOM   5083  NH1 ARG A 853      53.619 -26.345  10.869  1.00 59.99           N  
ATOM   5084  NH2 ARG A 853      53.949 -27.585   8.967  1.00 57.42           N  
ATOM   5085  N   ALA A 854      57.889 -29.002  16.070  1.00 47.16           N  
ATOM   5086  CA  ALA A 854      58.572 -28.328  17.165  1.00 48.15           C  
ATOM   5087  C   ALA A 854      57.586 -27.492  17.974  1.00 50.09           C  
ATOM   5088  O   ALA A 854      56.633 -26.940  17.425  1.00 50.63           O  
ATOM   5089  CB  ALA A 854      59.699 -27.460  16.633  1.00 47.44           C  
ATOM   5090  N   VAL A 855      57.812 -27.407  19.282  1.00 64.77           N  
ATOM   5091  CA  VAL A 855      56.986 -26.579  20.155  1.00 66.47           C  
ATOM   5092  C   VAL A 855      57.853 -25.728  21.080  1.00 67.44           C  
ATOM   5093  O   VAL A 855      58.495 -26.248  21.993  1.00 68.11           O  
ATOM   5094  CB  VAL A 855      56.023 -27.429  21.007  1.00 67.44           C  
ATOM   5095  CG1 VAL A 855      55.311 -26.556  22.028  1.00 69.10           C  
ATOM   5096  CG2 VAL A 855      55.013 -28.141  20.120  1.00 67.10           C  
ATOM   5097  N   GLU A 856      57.865 -24.421  20.840  1.00 56.97           N  
ATOM   5098  CA  GLU A 856      58.691 -23.506  21.617  1.00 53.18           C  
ATOM   5099  C   GLU A 856      57.944 -22.204  21.888  1.00 56.42           C  
ATOM   5100  O   GLU A 856      57.432 -21.571  20.963  1.00 58.17           O  
ATOM   5101  CB  GLU A 856      60.010 -23.231  20.891  1.00 51.06           C  
ATOM   5102  CG  GLU A 856      61.148 -22.782  21.795  1.00 52.72           C  
ATOM   5103  CD  GLU A 856      61.077 -21.309  22.141  1.00 57.73           C  
ATOM   5104  OE1 GLU A 856      60.476 -20.549  21.357  1.00 59.55           O  
ATOM   5105  OE2 GLU A 856      61.618 -20.912  23.195  1.00 60.22           O  
ATOM   5106  N   PRO A 857      57.881 -21.802  23.167  1.00 57.02           N  
ATOM   5107  CA  PRO A 857      57.110 -20.653  23.659  1.00 57.83           C  
ATOM   5108  C   PRO A 857      57.441 -19.312  23.000  1.00 57.62           C  
ATOM   5109  O   PRO A 857      56.561 -18.458  22.892  1.00 57.81           O  
ATOM   5110  CB  PRO A 857      57.475 -20.606  25.147  1.00 59.38           C  
ATOM   5111  CG  PRO A 857      57.837 -21.999  25.486  1.00 59.53           C  
ATOM   5112  CD  PRO A 857      58.533 -22.530  24.272  1.00 58.11           C  
ATOM   5113  N   THR A 858      58.683 -19.125  22.569  1.00 65.12           N  
ATOM   5114  CA  THR A 858      59.134 -17.803  22.157  1.00 64.07           C  
ATOM   5115  C   THR A 858      59.515 -17.708  20.681  1.00 64.34           C  
ATOM   5116  O   THR A 858      58.962 -16.897  19.937  1.00 64.42           O  
ATOM   5117  CB  THR A 858      60.345 -17.359  22.999  1.00 66.27           C  
ATOM   5118  OG1 THR A 858      59.962 -17.262  24.377  1.00 67.11           O  
ATOM   5119  CG2 THR A 858      60.857 -16.015  22.526  1.00 65.24           C  
ATOM   5120  N   TRP A 859      60.458 -18.544  20.263  1.00 52.63           N  
ATOM   5121  CA  TRP A 859      61.103 -18.394  18.963  1.00 51.35           C  
ATOM   5122  C   TRP A 859      60.288 -18.928  17.789  1.00 59.81           C  
ATOM   5123  O   TRP A 859      60.574 -18.607  16.636  1.00 58.75           O  
ATOM   5124  CB  TRP A 859      62.468 -19.076  18.992  1.00 51.40           C  
ATOM   5125  CG  TRP A 859      63.367 -18.498  20.033  1.00 53.56           C  
ATOM   5126  CD1 TRP A 859      63.518 -18.928  21.319  1.00 55.34           C  
ATOM   5127  CD2 TRP A 859      64.227 -17.364  19.886  1.00 58.51           C  
ATOM   5128  NE1 TRP A 859      64.426 -18.137  21.980  1.00 57.53           N  
ATOM   5129  CE2 TRP A 859      64.878 -17.170  21.120  1.00 51.09           C  
ATOM   5130  CE3 TRP A 859      64.517 -16.497  18.828  1.00 57.89           C  
ATOM   5131  CZ2 TRP A 859      65.797 -16.146  21.327  1.00 58.71           C  
ATOM   5132  CZ3 TRP A 859      65.430 -15.482  19.034  1.00 55.06           C  
ATOM   5133  CH2 TRP A 859      66.059 -15.315  20.273  1.00 57.57           C  
ATOM   5134  N   LEU A 860      59.278 -19.740  18.073  1.00 58.19           N  
ATOM   5135  CA  LEU A 860      58.418 -20.249  17.012  1.00 57.33           C  
ATOM   5136  C   LEU A 860      57.286 -19.273  16.718  1.00 58.34           C  
ATOM   5137  O   LEU A 860      56.711 -19.278  15.629  1.00 58.13           O  
ATOM   5138  CB  LEU A 860      57.860 -21.623  17.383  1.00 57.21           C  
ATOM   5139  CG  LEU A 860      58.877 -22.766  17.401  1.00 56.07           C  
ATOM   5140  CD1 LEU A 860      58.182 -24.093  17.625  1.00 55.91           C  
ATOM   5141  CD2 LEU A 860      59.681 -22.798  16.112  1.00 54.42           C  
ATOM   5142  N   THR A 861      56.971 -18.431  17.695  1.00 54.90           N  
ATOM   5143  CA  THR A 861      55.973 -17.388  17.511  1.00 55.15           C  
ATOM   5144  C   THR A 861      56.654 -16.031  17.406  1.00 55.49           C  
ATOM   5145  O   THR A 861      56.036 -14.991  17.642  1.00 54.70           O  
ATOM   5146  CB  THR A 861      54.953 -17.369  18.662  1.00 57.63           C  
ATOM   5147  OG1 THR A 861      55.615 -17.026  19.886  1.00 55.65           O  
ATOM   5148  CG2 THR A 861      54.297 -18.731  18.807  1.00 57.67           C  
ATOM   5149  N   ALA A 862      57.933 -16.051  17.050  1.00 58.91           N  
ATOM   5150  CA  ALA A 862      58.721 -14.836  16.911  1.00 52.40           C  
ATOM   5151  C   ALA A 862      58.288 -14.039  15.688  1.00 52.77           C  
ATOM   5152  O   ALA A 862      58.264 -14.565  14.576  1.00 59.33           O  
ATOM   5153  CB  ALA A 862      60.198 -15.173  16.827  1.00 51.50           C  
ATOM   5154  N   SER A 863      57.947 -12.772  15.899  1.00 56.99           N  
ATOM   5155  CA  SER A 863      57.493 -11.905  14.818  1.00 57.13           C  
ATOM   5156  C   SER A 863      58.571 -11.708  13.759  1.00 55.74           C  
ATOM   5157  O   SER A 863      59.764 -11.763  14.053  1.00 55.14           O  
ATOM   5158  CB  SER A 863      57.058 -10.546  15.367  1.00 58.47           C  
ATOM   5159  OG  SER A 863      56.709  -9.665  14.315  1.00 58.71           O  
ATOM   5160  N   ASN A 864      58.138 -11.480  12.524  1.00 59.59           N  
ATOM   5161  CA  ASN A 864      59.058 -11.244  11.421  1.00 51.79           C  
ATOM   5162  C   ASN A 864      59.528  -9.796  11.371  1.00 59.74           C  
ATOM   5163  O   ASN A 864      59.343  -9.041  12.326  1.00 52.15           O  
ATOM   5164  CB  ASN A 864      58.406 -11.628  10.094  1.00 50.33           C  
ATOM   5165  CG  ASN A 864      58.322 -13.128   9.901  1.00 56.69           C  
ATOM   5166  OD1 ASN A 864      59.192 -13.872  10.354  1.00 54.69           O  
ATOM   5167  ND2 ASN A 864      57.273 -13.581   9.226  1.00 59.71           N  
ATOM   5168  N   ALA A 865      60.136  -9.415  10.252  1.00 76.24           N  
ATOM   5169  CA  ALA A 865      60.685  -8.074  10.096  1.00 72.63           C  
ATOM   5170  C   ALA A 865      59.661  -7.103   9.518  1.00 75.80           C  
ATOM   5171  O   ALA A 865      59.529  -6.977   8.301  1.00 73.40           O  
ATOM   5172  CB  ALA A 865      61.926  -8.116   9.218  1.00 75.39           C  
ATOM   5173  N   ARG A 866      58.938  -6.418  10.400  1.00 58.84           N  
ATOM   5174  CA  ARG A 866      57.970  -5.411   9.978  1.00 60.93           C  
ATOM   5175  C   ARG A 866      58.364  -4.037  10.505  1.00 60.13           C  
ATOM   5176  O   ARG A 866      58.752  -3.902  11.665  1.00 61.49           O  
ATOM   5177  CB  ARG A 866      56.561  -5.775  10.455  1.00 62.87           C  
ATOM   5178  CG  ARG A 866      55.527  -5.860   9.338  1.00 64.08           C  
ATOM   5179  CD  ARG A 866      54.105  -5.865   9.886  1.00 65.42           C  
ATOM   5180  NE  ARG A 866      53.901  -6.903  10.893  1.00 66.26           N  
ATOM   5181  CZ  ARG A 866      53.460  -8.129  10.630  1.00 67.18           C  
ATOM   5182  NH1 ARG A 866      53.174  -8.479   9.382  1.00 69.24           N  
ATOM   5183  NH2 ARG A 866      53.304  -9.005  11.613  1.00 66.72           N  
ATOM   5184  N   PRO A 867      58.258  -3.005   9.651  1.00 55.87           N  
ATOM   5185  CA  PRO A 867      58.608  -1.628  10.018  1.00 56.13           C  
ATOM   5186  C   PRO A 867      57.557  -0.977  10.913  1.00 58.14           C  
ATOM   5187  O   PRO A 867      57.622   0.222  11.177  1.00 58.49           O  
ATOM   5188  CB  PRO A 867      58.681  -0.919   8.665  1.00 54.84           C  
ATOM   5189  CG  PRO A 867      57.715  -1.663   7.817  1.00 55.09           C  
ATOM   5190  CD  PRO A 867      57.817  -3.103   8.248  1.00 55.17           C  
ATOM   5191  N   ASP A 868      56.599  -1.771  11.373  1.00 64.89           N  
ATOM   5192  CA  ASP A 868      55.517  -1.273  12.209  1.00 63.88           C  
ATOM   5193  C   ASP A 868      55.648  -1.757  13.651  1.00 66.92           C  
ATOM   5194  O   ASP A 868      55.491  -0.981  14.593  1.00 64.95           O  
ATOM   5195  CB  ASP A 868      54.169  -1.706  11.628  1.00 65.47           C  
ATOM   5196  CG  ASP A 868      53.050  -1.650  12.646  1.00 67.14           C  
ATOM   5197  OD1 ASP A 868      52.852  -0.581  13.259  1.00 60.41           O  
ATOM   5198  OD2 ASP A 868      52.374  -2.680  12.838  1.00 68.60           O  
ATOM   5199  N   ARG A 869      55.942  -3.043  13.813  1.00 67.21           N  
ATOM   5200  CA  ARG A 869      56.002  -3.658  15.136  1.00 68.63           C  
ATOM   5201  C   ARG A 869      57.254  -3.235  15.898  1.00 64.80           C  
ATOM   5202  O   ARG A 869      58.291  -2.952  15.300  1.00 67.01           O  
ATOM   5203  CB  ARG A 869      55.947  -5.180  15.013  1.00 66.88           C  
ATOM   5204  CG  ARG A 869      54.987  -5.669  13.940  1.00 67.43           C  
ATOM   5205  CD  ARG A 869      54.661  -7.141  14.106  1.00 66.94           C  
ATOM   5206  NE  ARG A 869      53.848  -7.380  15.293  1.00 71.33           N  
ATOM   5207  CZ  ARG A 869      52.528  -7.231  15.335  1.00 71.75           C  
ATOM   5208  NH1 ARG A 869      51.869  -6.844  14.251  1.00 73.28           N  
ATOM   5209  NH2 ARG A 869      51.865  -7.470  16.458  1.00 73.41           N  
ATOM   5210  N   VAL A 870      57.150  -3.198  17.223  1.00 50.17           N  
ATOM   5211  CA  VAL A 870      58.248  -2.736  18.066  1.00 50.04           C  
ATOM   5212  C   VAL A 870      59.386  -3.750  18.135  1.00 59.05           C  
ATOM   5213  O   VAL A 870      60.492  -3.482  17.670  1.00 51.37           O  
ATOM   5214  CB  VAL A 870      57.765  -2.420  19.494  1.00 59.50           C  
ATOM   5215  CG1 VAL A 870      58.933  -1.981  20.364  1.00 59.32           C  
ATOM   5216  CG2 VAL A 870      56.689  -1.347  19.465  1.00 50.89           C  
ATOM   5217  N   GLY A 871      59.113  -4.915  18.716  1.00 58.56           N  
ATOM   5218  CA  GLY A 871      60.128  -5.944  18.863  1.00 58.01           C  
ATOM   5219  C   GLY A 871      60.245  -6.842  17.647  1.00 56.97           C  
ATOM   5220  O   GLY A 871      60.465  -8.045  17.772  1.00 56.52           O  
ATOM   5221  N   SER A 872      60.111  -6.251  16.466  1.00 51.73           N  
ATOM   5222  CA  SER A 872      60.125  -7.002  15.215  1.00 50.53           C  
ATOM   5223  C   SER A 872      61.529  -7.464  14.833  1.00 59.57           C  
ATOM   5224  O   SER A 872      61.705  -8.231  13.885  1.00 58.30           O  
ATOM   5225  CB  SER A 872      59.532  -6.156  14.088  1.00 50.40           C  
ATOM   5226  OG  SER A 872      59.568  -6.852  12.856  1.00 59.15           O  
ATOM   5227  N   GLU A 873      62.525  -6.997  15.578  1.00 59.45           N  
ATOM   5228  CA  GLU A 873      63.916  -7.317  15.282  1.00 59.03           C  
ATOM   5229  C   GLU A 873      64.370  -8.579  16.008  1.00 53.26           C  
ATOM   5230  O   GLU A 873      65.507  -9.022  15.841  1.00 54.16           O  
ATOM   5231  CB  GLU A 873      64.827  -6.147  15.662  1.00 51.50           C  
ATOM   5232  CG  GLU A 873      64.371  -4.798  15.134  1.00 55.25           C  
ATOM   5233  CD  GLU A 873      63.398  -4.099  16.067  1.00 56.79           C  
ATOM   5234  OE1 GLU A 873      63.335  -4.479  17.254  1.00 54.40           O  
ATOM   5235  OE2 GLU A 873      62.697  -3.170  15.610  1.00 56.17           O  
ATOM   5236  N   LEU A 874      63.470  -9.150  16.805  1.00 52.56           N  
ATOM   5237  CA  LEU A 874      63.767 -10.326  17.621  1.00 53.04           C  
ATOM   5238  C   LEU A 874      64.357 -11.461  16.794  1.00 51.88           C  
ATOM   5239  O   LEU A 874      65.238 -12.186  17.254  1.00 52.60           O  
ATOM   5240  CB  LEU A 874      62.498 -10.799  18.339  1.00 53.17           C  
ATOM   5241  CG  LEU A 874      62.610 -11.839  19.460  1.00 53.91           C  
ATOM   5242  CD1 LEU A 874      62.549 -13.271  18.937  1.00 52.84           C  
ATOM   5243  CD2 LEU A 874      63.861 -11.611  20.297  1.00 55.50           C  
ATOM   5244  N   LYS A 875      63.866 -11.605  15.569  1.00 71.99           N  
ATOM   5245  CA  LYS A 875      64.318 -12.667  14.681  1.00 69.68           C  
ATOM   5246  C   LYS A 875      65.739 -12.417  14.187  1.00 69.92           C  
ATOM   5247  O   LYS A 875      66.521 -13.352  14.021  1.00 68.34           O  
ATOM   5248  CB  LYS A 875      63.365 -12.798  13.491  1.00 67.13           C  
ATOM   5249  CG  LYS A 875      63.441 -14.129  12.764  1.00 65.80           C  
ATOM   5250  CD  LYS A 875      62.931 -15.260  13.640  1.00 65.52           C  
ATOM   5251  CE  LYS A 875      62.722 -16.529  12.831  1.00 63.64           C  
ATOM   5252  NZ  LYS A 875      61.702 -16.340  11.762  1.00 65.46           N  
ATOM   5253  N   ALA A 876      66.073 -11.150  13.960  1.00 58.61           N  
ATOM   5254  CA  ALA A 876      67.366 -10.792  13.387  1.00 57.16           C  
ATOM   5255  C   ALA A 876      68.396 -10.411  14.448  1.00 59.51           C  
ATOM   5256  O   ALA A 876      69.385  -9.741  14.148  1.00 60.30           O  
ATOM   5257  CB  ALA A 876      67.198  -9.653  12.391  1.00 55.67           C  
ATOM   5258  N   MET A 877      68.169 -10.842  15.685  1.00 54.38           N  
ATOM   5259  CA  MET A 877      69.102 -10.541  16.766  1.00 57.29           C  
ATOM   5260  C   MET A 877      70.060 -11.693  17.033  1.00 54.08           C  
ATOM   5261  O   MET A 877      71.062 -11.528  17.731  1.00 51.65           O  
ATOM   5262  CB  MET A 877      68.348 -10.185  18.050  1.00 58.54           C  
ATOM   5263  CG  MET A 877      67.757  -8.786  18.045  1.00 56.16           C  
ATOM   5264  SD  MET A 877      68.915  -7.545  17.430  1.00 54.31           S  
ATOM   5265  CE  MET A 877      70.254  -7.709  18.606  1.00 56.71           C  
ATOM   5266  N   VAL A 878      69.751 -12.860  16.482  1.00 60.84           N  
ATOM   5267  CA  VAL A 878      70.647 -14.001  16.589  1.00 61.79           C  
ATOM   5268  C   VAL A 878      71.838 -13.780  15.665  1.00 61.70           C  
ATOM   5269  O   VAL A 878      71.847 -14.232  14.520  1.00 59.13           O  
ATOM   5270  CB  VAL A 878      69.942 -15.322  16.233  1.00 59.58           C  
ATOM   5271  CG1 VAL A 878      70.859 -16.501  16.510  1.00 60.82           C  
ATOM   5272  CG2 VAL A 878      68.651 -15.458  17.022  1.00 59.45           C  
ATOM   5273  N   GLN A 879      72.838 -13.066  16.170  1.00 56.53           N  
ATOM   5274  CA  GLN A 879      73.997 -12.692  15.372  1.00 56.82           C  
ATOM   5275  C   GLN A 879      75.126 -13.708  15.507  1.00 58.95           C  
ATOM   5276  O   GLN A 879      75.610 -13.971  16.608  1.00 62.43           O  
ATOM   5277  CB  GLN A 879      74.488 -11.302  15.776  1.00 58.67           C  
ATOM   5278  CG  GLN A 879      73.433 -10.218  15.632  1.00 56.81           C  
ATOM   5279  CD  GLN A 879      73.882  -8.883  16.191  1.00 58.47           C  
ATOM   5280  OE1 GLN A 879      74.918  -8.788  16.848  1.00 60.94           O  
ATOM   5281  NE2 GLN A 879      73.100  -7.843  15.934  1.00 57.00           N  
ATOM   5282  N   ALA A 880      75.536 -14.276  14.378  1.00 53.36           N  
ATOM   5283  CA  ALA A 880      76.616 -15.252  14.360  1.00 54.68           C  
ATOM   5284  C   ALA A 880      77.929 -14.608  14.782  1.00 52.27           C  
ATOM   5285  O   ALA A 880      78.207 -13.467  14.414  1.00 51.59           O  
ATOM   5286  CB  ALA A 880      76.749 -15.870  12.978  1.00 59.41           C  
ATOM   5287  N   PRO A 881      78.738 -15.336  15.565  1.00 73.24           N  
ATOM   5288  CA  PRO A 881      80.056 -14.870  16.005  1.00 77.77           C  
ATOM   5289  C   PRO A 881      80.967 -14.570  14.818  1.00 79.34           C  
ATOM   5290  O   PRO A 881      80.782 -15.160  13.754  1.00 75.25           O  
ATOM   5291  CB  PRO A 881      80.592 -16.051  16.822  1.00 70.28           C  
ATOM   5292  CG  PRO A 881      79.378 -16.802  17.244  1.00 70.51           C  
ATOM   5293  CD  PRO A 881      78.415 -16.664  16.111  1.00 74.84           C  
ATOM   5294  N   PRO A 882      81.931 -13.654  14.996  1.00 65.96           N  
ATOM   5295  CA  PRO A 882      82.875 -13.309  13.927  1.00 62.24           C  
ATOM   5296  C   PRO A 882      83.669 -14.521  13.454  1.00 63.68           C  
ATOM   5297  O   PRO A 882      84.123 -15.324  14.268  1.00 68.80           O  
ATOM   5298  CB  PRO A 882      83.792 -12.270  14.583  1.00 64.34           C  
ATOM   5299  CG  PRO A 882      83.609 -12.459  16.055  1.00 67.38           C  
ATOM   5300  CD  PRO A 882      82.190 -12.892  16.228  1.00 65.83           C  
ATOM   5301  N   GLY A 883      83.831 -14.642  12.141  1.00 68.81           N  
ATOM   5302  CA  GLY A 883      84.462 -15.808  11.557  1.00 69.23           C  
ATOM   5303  C   GLY A 883      83.409 -16.817  11.154  1.00 64.88           C  
ATOM   5304  O   GLY A 883      83.618 -17.632  10.255  1.00 62.82           O  
ATOM   5305  N   TYR A 884      82.263 -16.756  11.825  1.00 66.32           N  
ATOM   5306  CA  TYR A 884      81.142 -17.636  11.523  1.00 61.31           C  
ATOM   5307  C   TYR A 884      80.021 -16.890  10.814  1.00 56.25           C  
ATOM   5308  O   TYR A 884      79.897 -15.671  10.928  1.00 58.01           O  
ATOM   5309  CB  TYR A 884      80.602 -18.282  12.801  1.00 64.81           C  
ATOM   5310  CG  TYR A 884      81.536 -19.285  13.433  1.00 66.01           C  
ATOM   5311  CD1 TYR A 884      81.724 -20.538  12.865  1.00 63.96           C  
ATOM   5312  CD2 TYR A 884      82.224 -18.986  14.602  1.00 62.94           C  
ATOM   5313  CE1 TYR A 884      82.575 -21.460  13.438  1.00 67.16           C  
ATOM   5314  CE2 TYR A 884      83.075 -19.903  15.182  1.00 64.62           C  
ATOM   5315  CZ  TYR A 884      83.248 -21.137  14.597  1.00 64.54           C  
ATOM   5316  OH  TYR A 884      84.097 -22.050  15.174  1.00 64.34           O  
ATOM   5317  N   THR A 885      79.207 -17.639  10.081  1.00 65.68           N  
ATOM   5318  CA  THR A 885      78.037 -17.090   9.409  1.00 61.71           C  
ATOM   5319  C   THR A 885      76.992 -18.188   9.253  1.00 68.58           C  
ATOM   5320  O   THR A 885      77.335 -19.361   9.103  1.00 67.80           O  
ATOM   5321  CB  THR A 885      78.390 -16.499   8.029  1.00 68.71           C  
ATOM   5322  OG1 THR A 885      77.197 -16.055   7.374  1.00 65.35           O  
ATOM   5323  CG2 THR A 885      79.066 -17.539   7.158  1.00 67.32           C  
ATOM   5324  N   LEU A 886      75.718 -17.819   9.302  1.00 55.47           N  
ATOM   5325  CA  LEU A 886      74.662 -18.811   9.152  1.00 53.06           C  
ATOM   5326  C   LEU A 886      74.185 -18.927   7.704  1.00 52.62           C  
ATOM   5327  O   LEU A 886      74.060 -17.928   6.977  1.00 52.96           O  
ATOM   5328  CB  LEU A 886      73.488 -18.500  10.090  1.00 52.92           C  
ATOM   5329  CG  LEU A 886      72.913 -17.086  10.213  1.00 53.79           C  
ATOM   5330  CD1 LEU A 886      71.911 -16.791   9.106  1.00 54.28           C  
ATOM   5331  CD2 LEU A 886      72.275 -16.902  11.582  1.00 59.22           C  
ATOM   5332  N   VAL A 887      73.955 -20.176   7.304  1.00 58.25           N  
ATOM   5333  CA  VAL A 887      73.448 -20.531   5.985  1.00 54.23           C  
ATOM   5334  C   VAL A 887      72.181 -21.366   6.128  1.00 52.32           C  
ATOM   5335  O   VAL A 887      72.216 -22.465   6.680  1.00 52.57           O  
ATOM   5336  CB  VAL A 887      74.483 -21.328   5.167  1.00 52.25           C  
ATOM   5337  CG1 VAL A 887      73.917 -21.691   3.803  1.00 52.80           C  
ATOM   5338  CG2 VAL A 887      75.776 -20.544   5.025  1.00 52.83           C  
ATOM   5339  N   GLY A 888      71.064 -20.843   5.632  1.00 76.40           N  
ATOM   5340  CA  GLY A 888      69.789 -21.522   5.752  1.00 78.07           C  
ATOM   5341  C   GLY A 888      68.957 -21.518   4.485  1.00 73.71           C  
ATOM   5342  O   GLY A 888      69.342 -20.918   3.480  1.00 73.20           O  
ATOM   5343  N   ALA A 889      67.810 -22.189   4.535  1.00 66.98           N  
ATOM   5344  CA  ALA A 889      66.932 -22.284   3.371  1.00 64.35           C  
ATOM   5345  C   ALA A 889      65.475 -22.524   3.763  1.00 66.71           C  
ATOM   5346  O   ALA A 889      65.182 -23.063   4.834  1.00 67.10           O  
ATOM   5347  CB  ALA A 889      67.414 -23.384   2.439  1.00 61.61           C  
ATOM   5348  N   ASP A 890      64.568 -22.123   2.875  1.00 53.90           N  
ATOM   5349  CA  ASP A 890      63.132 -22.244   3.105  1.00 55.53           C  
ATOM   5350  C   ASP A 890      62.477 -23.019   1.962  1.00 52.59           C  
ATOM   5351  O   ASP A 890      62.544 -22.602   0.805  1.00 53.85           O  
ATOM   5352  CB  ASP A 890      62.501 -20.855   3.249  1.00 58.20           C  
ATOM   5353  CG  ASP A 890      61.022 -20.912   3.590  1.00 63.03           C  
ATOM   5354  OD1 ASP A 890      60.193 -20.864   2.658  1.00 63.90           O  
ATOM   5355  OD2 ASP A 890      60.687 -20.998   4.792  1.00 63.28           O  
ATOM   5356  N   VAL A 891      61.848 -24.144   2.291  1.00 46.41           N  
ATOM   5357  CA  VAL A 891      61.260 -25.023   1.282  1.00 46.95           C  
ATOM   5358  C   VAL A 891      60.084 -24.371   0.556  1.00 47.85           C  
ATOM   5359  O   VAL A 891      59.088 -23.989   1.172  1.00 47.80           O  
ATOM   5360  CB  VAL A 891      60.789 -26.351   1.904  1.00 46.42           C  
ATOM   5361  CG1 VAL A 891      60.246 -27.272   0.828  1.00 47.09           C  
ATOM   5362  CG2 VAL A 891      61.925 -27.021   2.659  1.00 45.67           C  
ATOM   5363  N   ASP A 892      60.205 -24.257  -0.762  1.00 98.79           N  
ATOM   5364  CA  ASP A 892      59.187 -23.606  -1.575  1.00 98.06           C  
ATOM   5365  C   ASP A 892      58.808 -24.456  -2.789  1.00 95.67           C  
ATOM   5366  O   ASP A 892      59.492 -24.429  -3.814  1.00 94.27           O  
ATOM   5367  CB  ASP A 892      59.677 -22.222  -2.019  1.00 99.67           C  
ATOM   5368  CG  ASP A 892      61.173 -22.193  -2.301  1.00 94.39           C  
ATOM   5369  OD1 ASP A 892      61.791 -21.110  -2.194  1.00 93.55           O  
ATOM   5370  OD2 ASP A 892      61.739 -23.260  -2.623  1.00 90.33           O  
ATOM   5371  N   SER A 893      57.723 -25.215  -2.674  1.00 84.35           N  
ATOM   5372  CA  SER A 893      56.933 -25.281  -1.450  1.00 84.87           C  
ATOM   5373  C   SER A 893      56.878 -26.722  -0.965  1.00 85.70           C  
ATOM   5374  O   SER A 893      57.149 -27.639  -1.739  1.00 82.66           O  
ATOM   5375  CB  SER A 893      55.523 -24.741  -1.690  1.00 88.57           C  
ATOM   5376  OG  SER A 893      54.827 -25.540  -2.634  1.00 89.35           O  
ATOM   5377  N   GLN A 894      56.532 -26.941   0.302  1.00 57.73           N  
ATOM   5378  CA  GLN A 894      56.514 -28.309   0.810  1.00 57.01           C  
ATOM   5379  C   GLN A 894      55.119 -28.942   0.776  1.00 59.93           C  
ATOM   5380  O   GLN A 894      54.911 -29.896   0.036  1.00 57.76           O  
ATOM   5381  CB  GLN A 894      57.115 -28.389   2.229  1.00 53.55           C  
ATOM   5382  CG  GLN A 894      56.441 -27.586   3.332  1.00 51.85           C  
ATOM   5383  CD  GLN A 894      57.025 -27.904   4.698  1.00 51.40           C  
ATOM   5384  OE1 GLN A 894      58.120 -28.456   4.804  1.00 59.70           O  
ATOM   5385  NE2 GLN A 894      56.291 -27.564   5.751  1.00 55.48           N  
ATOM   5386  N   GLU A 895      54.163 -28.418   1.538  1.00 54.91           N  
ATOM   5387  CA  GLU A 895      52.887 -29.109   1.713  1.00 56.24           C  
ATOM   5388  C   GLU A 895      52.033 -29.122   0.448  1.00 53.77           C  
ATOM   5389  O   GLU A 895      51.286 -30.075   0.201  1.00 54.23           O  
ATOM   5390  CB  GLU A 895      52.103 -28.486   2.867  1.00 61.61           C  
ATOM   5391  CG  GLU A 895      52.740 -28.736   4.223  1.00 61.70           C  
ATOM   5392  CD  GLU A 895      51.725 -28.832   5.342  1.00 57.32           C  
ATOM   5393  OE1 GLU A 895      50.513 -28.705   5.064  1.00 58.71           O  
ATOM   5394  OE2 GLU A 895      52.139 -29.023   6.506  1.00 61.31           O  
ATOM   5395  N   LEU A 896      52.148 -28.070  -0.355  1.00 53.04           N  
ATOM   5396  CA  LEU A 896      51.428 -27.993  -1.618  1.00 52.70           C  
ATOM   5397  C   LEU A 896      51.888 -29.103  -2.560  1.00 51.97           C  
ATOM   5398  O   LEU A 896      51.077 -29.871  -3.084  1.00 52.72           O  
ATOM   5399  CB  LEU A 896      51.638 -26.624  -2.265  1.00 53.36           C  
ATOM   5400  CG  LEU A 896      50.654 -26.210  -3.359  1.00 53.14           C  
ATOM   5401  CD1 LEU A 896      49.282 -25.940  -2.762  1.00 53.61           C  
ATOM   5402  CD2 LEU A 896      51.170 -24.990  -4.104  1.00 53.55           C  
ATOM   5403  N   TRP A 897      53.200 -29.181  -2.759  1.00 83.23           N  
ATOM   5404  CA  TRP A 897      53.804 -30.203  -3.607  1.00 82.04           C  
ATOM   5405  C   TRP A 897      53.597 -31.600  -3.028  1.00 81.32           C  
ATOM   5406  O   TRP A 897      53.543 -32.585  -3.761  1.00 81.84           O  
ATOM   5407  CB  TRP A 897      55.297 -29.921  -3.791  1.00 86.99           C  
ATOM   5408  CG  TRP A 897      56.016 -30.952  -4.603  1.00 86.72           C  
ATOM   5409  CD1 TRP A 897      56.079 -31.025  -5.964  1.00 86.81           C  
ATOM   5410  CD2 TRP A 897      56.788 -32.052  -4.107  1.00 86.44           C  
ATOM   5411  NE1 TRP A 897      56.838 -32.104  -6.346  1.00 87.63           N  
ATOM   5412  CE2 TRP A 897      57.284 -32.751  -5.224  1.00 87.90           C  
ATOM   5413  CE3 TRP A 897      57.104 -32.515  -2.825  1.00 86.24           C  
ATOM   5414  CZ2 TRP A 897      58.081 -33.888  -5.099  1.00 86.53           C  
ATOM   5415  CZ3 TRP A 897      57.893 -33.644  -2.704  1.00 85.34           C  
ATOM   5416  CH2 TRP A 897      58.372 -34.319  -3.835  1.00 82.76           C  
ATOM   5417  N   ILE A 898      53.488 -31.672  -1.706  1.00 53.31           N  
ATOM   5418  CA  ILE A 898      53.205 -32.923  -1.015  1.00 53.04           C  
ATOM   5419  C   ILE A 898      51.823 -33.425  -1.400  1.00 53.14           C  
ATOM   5420  O   ILE A 898      51.665 -34.578  -1.800  1.00 53.42           O  
ATOM   5421  CB  ILE A 898      53.293 -32.755   0.517  1.00 52.52           C  
ATOM   5422  CG1 ILE A 898      54.748 -32.853   0.977  1.00 52.27           C  
ATOM   5423  CG2 ILE A 898      52.451 -33.805   1.225  1.00 52.30           C  
ATOM   5424  CD1 ILE A 898      54.982 -32.337   2.380  1.00 51.85           C  
ATOM   5425  N   ALA A 899      50.828 -32.549  -1.292  1.00 52.30           N  
ATOM   5426  CA  ALA A 899      49.466 -32.886  -1.693  1.00 52.83           C  
ATOM   5427  C   ALA A 899      49.423 -33.262  -3.171  1.00 54.43           C  
ATOM   5428  O   ALA A 899      48.753 -34.225  -3.566  1.00 55.17           O  
ATOM   5429  CB  ALA A 899      48.530 -31.723  -1.409  1.00 52.50           C  
ATOM   5430  N   ALA A 900      50.155 -32.496  -3.976  1.00 51.58           N  
ATOM   5431  CA  ALA A 900      50.265 -32.746  -5.409  1.00 53.23           C  
ATOM   5432  C   ALA A 900      50.749 -34.164  -5.688  1.00 53.81           C  
ATOM   5433  O   ALA A 900      50.133 -34.897  -6.462  1.00 54.98           O  
ATOM   5434  CB  ALA A 900      51.200 -31.734  -6.047  1.00 53.72           C  
ATOM   5435  N   VAL A 901      51.850 -34.540  -5.047  1.00 62.14           N  
ATOM   5436  CA  VAL A 901      52.426 -35.870  -5.206  1.00 62.88           C  
ATOM   5437  C   VAL A 901      51.466 -36.951  -4.720  1.00 62.98           C  
ATOM   5438  O   VAL A 901      51.286 -37.974  -5.380  1.00 64.87           O  
ATOM   5439  CB  VAL A 901      53.766 -35.991  -4.453  1.00 63.06           C  
ATOM   5440  CG1 VAL A 901      54.207 -37.444  -4.363  1.00 64.12           C  
ATOM   5441  CG2 VAL A 901      54.827 -35.154  -5.139  1.00 63.13           C  
ATOM   5442  N   LEU A 902      50.837 -36.712  -3.572  1.00 45.52           N  
ATOM   5443  CA  LEU A 902      49.855 -37.646  -3.032  1.00 45.38           C  
ATOM   5444  C   LEU A 902      48.669 -37.816  -3.978  1.00 46.68           C  
ATOM   5445  O   LEU A 902      47.939 -38.804  -3.897  1.00 47.05           O  
ATOM   5446  CB  LEU A 902      49.373 -37.184  -1.657  1.00 48.59           C  
ATOM   5447  CG  LEU A 902      50.398 -37.280  -0.524  1.00 47.43           C  
ATOM   5448  CD1 LEU A 902      49.781 -36.861   0.801  1.00 46.28           C  
ATOM   5449  CD2 LEU A 902      50.972 -38.686  -0.435  1.00 47.78           C  
ATOM   5450  N   GLY A 903      48.481 -36.851  -4.874  1.00 57.49           N  
ATOM   5451  CA  GLY A 903      47.453 -36.961  -5.894  1.00 55.40           C  
ATOM   5452  C   GLY A 903      47.899 -37.704  -7.142  1.00 56.88           C  
ATOM   5453  O   GLY A 903      47.241 -38.652  -7.585  1.00 57.84           O  
ATOM   5454  N   ASP A 904      49.023 -37.278  -7.712  1.00 98.54           N  
ATOM   5455  CA  ASP A 904      49.497 -37.833  -8.978  1.00 91.59           C  
ATOM   5456  C   ASP A 904      50.011 -39.267  -8.841  1.00 92.39           C  
ATOM   5457  O   ASP A 904      49.845 -40.081  -9.750  1.00 93.30           O  
ATOM   5458  CB  ASP A 904      50.586 -36.935  -9.576  1.00 98.46           C  
ATOM   5459  CG  ASP A 904      51.708 -36.633  -8.597  1.00 99.70           C  
ATOM   5460  OD1 ASP A 904      52.040 -35.442  -8.427  1.00 97.29           O  
ATOM   5461  OD2 ASP A 904      52.267 -37.581  -8.009  1.00 99.61           O  
ATOM   5462  N   ALA A 905      50.632 -39.573  -7.706  1.00 88.71           N  
ATOM   5463  CA  ALA A 905      51.153 -40.915  -7.467  1.00 87.78           C  
ATOM   5464  C   ALA A 905      50.012 -41.904  -7.267  1.00 89.29           C  
ATOM   5465  O   ALA A 905      50.163 -43.101  -7.517  1.00 80.21           O  
ATOM   5466  CB  ALA A 905      52.079 -40.924  -6.265  1.00 88.84           C  
ATOM   5467  N   HIS A 906      48.873 -41.395  -6.815  1.00 76.40           N  
ATOM   5468  CA  HIS A 906      47.686 -42.217  -6.629  1.00 78.11           C  
ATOM   5469  C   HIS A 906      46.938 -42.381  -7.945  1.00 75.95           C  
ATOM   5470  O   HIS A 906      46.388 -43.448  -8.227  1.00 79.53           O  
ATOM   5471  CB  HIS A 906      46.768 -41.603  -5.573  1.00 76.10           C  
ATOM   5472  CG  HIS A 906      45.466 -42.325  -5.414  1.00 74.06           C  
ATOM   5473  ND1 HIS A 906      44.318 -41.941  -6.076  1.00 73.46           N  
ATOM   5474  CD2 HIS A 906      45.130 -43.406  -4.674  1.00 76.17           C  
ATOM   5475  CE1 HIS A 906      43.332 -42.758  -5.747  1.00 72.68           C  
ATOM   5476  NE2 HIS A 906      43.796 -43.656  -4.899  1.00 74.37           N  
ATOM   5477  N   PHE A 907      46.921 -41.322  -8.747  1.00 60.78           N  
ATOM   5478  CA  PHE A 907      46.240 -41.355 -10.037  1.00 62.86           C  
ATOM   5479  C   PHE A 907      47.003 -42.215 -11.045  1.00 63.87           C  
ATOM   5480  O   PHE A 907      46.428 -43.101 -11.678  1.00 66.02           O  
ATOM   5481  CB  PHE A 907      46.060 -39.933 -10.579  1.00 61.47           C  
ATOM   5482  CG  PHE A 907      45.097 -39.837 -11.729  1.00 61.67           C  
ATOM   5483  CD1 PHE A 907      43.744 -39.642 -11.502  1.00 60.28           C  
ATOM   5484  CD2 PHE A 907      45.545 -39.933 -13.037  1.00 63.29           C  
ATOM   5485  CE1 PHE A 907      42.854 -39.548 -12.558  1.00 69.00           C  
ATOM   5486  CE2 PHE A 907      44.660 -39.841 -14.097  1.00 62.24           C  
ATOM   5487  CZ  PHE A 907      43.313 -39.648 -13.856  1.00 60.24           C  
ATOM   5488  N   ALA A 908      48.299 -41.952 -11.188  1.00 52.46           N  
ATOM   5489  CA  ALA A 908      49.135 -42.712 -12.112  1.00 54.02           C  
ATOM   5490  C   ALA A 908      50.575 -42.813 -11.614  1.00 53.23           C  
ATOM   5491  O   ALA A 908      50.820 -42.869 -10.409  1.00 51.51           O  
ATOM   5492  CB  ALA A 908      49.097 -42.085 -13.498  1.00 55.80           C  
ATOM   5493  N   GLY A 909      51.522 -42.833 -12.547  1.00 87.77           N  
ATOM   5494  CA  GLY A 909      52.922 -42.996 -12.206  1.00 88.91           C  
ATOM   5495  C   GLY A 909      53.724 -41.708 -12.271  1.00 81.03           C  
ATOM   5496  O   GLY A 909      54.632 -41.496 -11.469  1.00 80.07           O  
ATOM   5497  N   MET A 910      53.390 -40.849 -13.229  1.00 98.68           N  
ATOM   5498  CA  MET A 910      54.111 -39.595 -13.414  1.00 97.21           C  
ATOM   5499  C   MET A 910      53.665 -38.554 -12.386  1.00 96.83           C  
ATOM   5500  O   MET A 910      52.724 -38.788 -11.629  1.00 94.92           O  
ATOM   5501  CB  MET A 910      53.910 -39.068 -14.837  1.00 98.44           C  
ATOM   5502  CG  MET A 910      55.056 -38.214 -15.356  1.00 98.88           C  
ATOM   5503  SD  MET A 910      56.642 -39.064 -15.243  1.00 91.48           S  
ATOM   5504  CE  MET A 910      57.770 -37.740 -15.669  1.00 90.08           C  
ATOM   5505  N   HIS A 911      54.343 -37.410 -12.364  1.00 57.32           N  
ATOM   5506  CA  HIS A 911      54.081 -36.372 -11.372  1.00 55.52           C  
ATOM   5507  C   HIS A 911      53.090 -35.319 -11.860  1.00 53.88           C  
ATOM   5508  O   HIS A 911      52.472 -34.619 -11.059  1.00 53.03           O  
ATOM   5509  CB  HIS A 911      55.388 -35.687 -10.965  1.00 53.90           C  
ATOM   5510  CG  HIS A 911      56.420 -36.628 -10.423  1.00 56.39           C  
ATOM   5511  ND1 HIS A 911      56.605 -36.833  -9.074  1.00 56.03           N  
ATOM   5512  CD2 HIS A 911      57.326 -37.414 -11.050  1.00 58.61           C  
ATOM   5513  CE1 HIS A 911      57.578 -37.707  -8.891  1.00 55.85           C  
ATOM   5514  NE2 HIS A 911      58.032 -38.076 -10.076  1.00 56.87           N  
ATOM   5515  N   GLY A 912      52.944 -35.201 -13.174  1.00 60.60           N  
ATOM   5516  CA  GLY A 912      52.060 -34.204 -13.745  1.00 67.85           C  
ATOM   5517  C   GLY A 912      50.815 -34.798 -14.372  1.00 60.32           C  
ATOM   5518  O   GLY A 912      50.400 -34.383 -15.452  1.00 68.93           O  
ATOM   5519  N   CYS A 913      50.213 -35.771 -13.695  1.00 73.40           N  
ATOM   5520  CA  CYS A 913      49.024 -36.428 -14.221  1.00 75.81           C  
ATOM   5521  C   CYS A 913      47.766 -36.027 -13.454  1.00 72.26           C  
ATOM   5522  O   CYS A 913      46.780 -36.763 -13.433  1.00 71.88           O  
ATOM   5523  CB  CYS A 913      49.201 -37.950 -14.191  1.00 76.25           C  
ATOM   5524  SG  CYS A 913      49.630 -38.636 -12.579  1.00 78.08           S  
ATOM   5525  N   THR A 914      47.808 -34.854 -12.828  1.00 69.45           N  
ATOM   5526  CA  THR A 914      46.655 -34.323 -12.106  1.00 68.86           C  
ATOM   5527  C   THR A 914      46.442 -32.845 -12.423  1.00 69.45           C  
ATOM   5528  O   THR A 914      47.380 -32.136 -12.789  1.00 67.28           O  
ATOM   5529  CB  THR A 914      46.811 -34.493 -10.581  1.00 60.29           C  
ATOM   5530  OG1 THR A 914      48.139 -34.126 -10.191  1.00 69.48           O  
ATOM   5531  CG2 THR A 914      46.553 -35.937 -10.178  1.00 69.04           C  
ATOM   5532  N   ALA A 915      45.202 -32.388 -12.281  1.00 84.33           N  
ATOM   5533  CA  ALA A 915      44.856 -30.997 -12.562  1.00 83.55           C  
ATOM   5534  C   ALA A 915      45.473 -30.056 -11.533  1.00 82.23           C  
ATOM   5535  O   ALA A 915      45.858 -28.932 -11.855  1.00 87.00           O  
ATOM   5536  CB  ALA A 915      43.346 -30.825 -12.595  1.00 84.13           C  
ATOM   5537  N   PHE A 916      45.563 -30.527 -10.294  1.00 59.74           N  
ATOM   5538  CA  PHE A 916      46.120 -29.730  -9.207  1.00 58.62           C  
ATOM   5539  C   PHE A 916      47.634 -29.895  -9.109  1.00 59.25           C  
ATOM   5540  O   PHE A 916      48.355 -28.937  -8.839  1.00 59.32           O  
ATOM   5541  CB  PHE A 916      45.457 -30.114  -7.882  1.00 58.07           C  
ATOM   5542  CG  PHE A 916      46.180 -29.598  -6.672  1.00 58.09           C  
ATOM   5543  CD1 PHE A 916      45.999 -28.293  -6.246  1.00 58.01           C  
ATOM   5544  CD2 PHE A 916      47.033 -30.421  -5.954  1.00 58.24           C  
ATOM   5545  CE1 PHE A 916      46.660 -27.817  -5.131  1.00 58.23           C  
ATOM   5546  CE2 PHE A 916      47.699 -29.951  -4.839  1.00 58.23           C  
ATOM   5547  CZ  PHE A 916      47.512 -28.648  -4.426  1.00 58.30           C  
ATOM   5548  N   GLY A 917      48.110 -31.116  -9.333  1.00 72.77           N  
ATOM   5549  CA  GLY A 917      49.520 -31.425  -9.181  1.00 72.59           C  
ATOM   5550  C   GLY A 917      50.400 -30.948 -10.322  1.00 74.03           C  
ATOM   5551  O   GLY A 917      51.618 -31.124 -10.287  1.00 74.02           O  
ATOM   5552  N   TRP A 918      49.789 -30.343 -11.334  1.00 76.01           N  
ATOM   5553  CA  TRP A 918      50.534 -29.860 -12.490  1.00 77.81           C  
ATOM   5554  C   TRP A 918      50.915 -28.393 -12.330  1.00 79.08           C  
ATOM   5555  O   TRP A 918      51.987 -27.969 -12.759  1.00 77.78           O  
ATOM   5556  CB  TRP A 918      49.720 -30.054 -13.772  1.00 77.50           C  
ATOM   5557  CG  TRP A 918      50.508 -29.832 -15.030  1.00 70.94           C  
ATOM   5558  CD1 TRP A 918      51.269 -30.749 -15.689  1.00 71.68           C  
ATOM   5559  CD2 TRP A 918      50.603 -28.616 -15.782  1.00 71.43           C  
ATOM   5560  NE1 TRP A 918      51.837 -30.182 -16.805  1.00 72.84           N  
ATOM   5561  CE2 TRP A 918      51.444 -28.871 -16.884  1.00 72.33           C  
ATOM   5562  CE3 TRP A 918      50.063 -27.334 -15.631  1.00 71.40           C  
ATOM   5563  CZ2 TRP A 918      51.756 -27.896 -17.831  1.00 79.54           C  
ATOM   5564  CZ3 TRP A 918      50.374 -26.366 -16.572  1.00 79.91           C  
ATOM   5565  CH2 TRP A 918      51.213 -26.653 -17.656  1.00 79.34           C  
ATOM   5566  N   MET A 919      50.030 -27.624 -11.705  1.00 85.00           N  
ATOM   5567  CA  MET A 919      50.244 -26.193 -11.530  1.00 85.17           C  
ATOM   5568  C   MET A 919      51.238 -25.899 -10.413  1.00 86.09           C  
ATOM   5569  O   MET A 919      51.853 -24.834 -10.380  1.00 85.84           O  
ATOM   5570  CB  MET A 919      48.917 -25.490 -11.243  1.00 81.86           C  
ATOM   5571  CG  MET A 919      47.847 -25.733 -12.295  1.00 82.38           C  
ATOM   5572  SD  MET A 919      46.311 -24.859 -11.939  1.00 81.15           S  
ATOM   5573  CE  MET A 919      46.853 -23.156 -12.064  1.00 80.81           C  
ATOM   5574  N   THR A 920      51.387 -26.849  -9.494  1.00 63.57           N  
ATOM   5575  CA  THR A 920      52.294 -26.687  -8.365  1.00 64.02           C  
ATOM   5576  C   THR A 920      53.750 -26.667  -8.815  1.00 62.57           C  
ATOM   5577  O   THR A 920      54.526 -25.800  -8.411  1.00 63.13           O  
ATOM   5578  CB  THR A 920      52.113 -27.816  -7.330  1.00 63.85           C  
ATOM   5579  OG1 THR A 920      52.419 -29.077  -7.938  1.00 62.87           O  
ATOM   5580  CG2 THR A 920      50.685 -27.842  -6.813  1.00 63.66           C  
ATOM   5581  N   LEU A 921      54.113 -27.628  -9.657  1.00 84.34           N  
ATOM   5582  CA  LEU A 921      55.485 -27.769 -10.124  1.00 84.45           C  
ATOM   5583  C   LEU A 921      55.690 -27.113 -11.486  1.00 84.67           C  
ATOM   5584  O   LEU A 921      56.491 -27.582 -12.295  1.00 86.14           O  
ATOM   5585  CB  LEU A 921      55.871 -29.249 -10.182  1.00 86.54           C  
ATOM   5586  CG  LEU A 921      54.799 -30.230 -10.672  1.00 84.84           C  
ATOM   5587  CD1 LEU A 921      54.757 -30.317 -12.194  1.00 86.90           C  
ATOM   5588  CD2 LEU A 921      55.001 -31.606 -10.053  1.00 86.37           C  
ATOM   5589  N   GLN A 922      54.972 -26.021 -11.730  1.00 83.84           N  
ATOM   5590  CA  GLN A 922      55.033 -25.346 -13.021  1.00 85.18           C  
ATOM   5591  C   GLN A 922      55.591 -23.930 -12.903  1.00 84.16           C  
ATOM   5592  O   GLN A 922      56.287 -23.452 -13.799  1.00 85.12           O  
ATOM   5593  CB  GLN A 922      53.644 -25.307 -13.661  1.00 84.51           C  
ATOM   5594  CG  GLN A 922      53.644 -24.902 -15.127  1.00 82.88           C  
ATOM   5595  CD  GLN A 922      54.262 -25.958 -16.027  1.00 84.54           C  
ATOM   5596  OE1 GLN A 922      54.412 -27.115 -15.635  1.00 83.04           O  
ATOM   5597  NE2 GLN A 922      54.623 -25.561 -17.241  1.00 85.30           N  
ATOM   5598  N   GLY A 923      55.287 -23.263 -11.795  1.00 86.93           N  
ATOM   5599  CA  GLY A 923      55.702 -21.886 -11.604  1.00 88.29           C  
ATOM   5600  C   GLY A 923      57.000 -21.730 -10.836  1.00 87.78           C  
ATOM   5601  O   GLY A 923      57.321 -22.538  -9.967  1.00 80.23           O  
ATOM   5602  N   ARG A 924      57.749 -20.680 -11.164  1.00 81.43           N  
ATOM   5603  CA  ARG A 924      58.996 -20.376 -10.474  1.00 82.65           C  
ATOM   5604  C   ARG A 924      58.895 -19.013  -9.795  1.00 82.80           C  
ATOM   5605  O   ARG A 924      58.401 -18.055 -10.387  1.00 83.36           O  
ATOM   5606  CB  ARG A 924      60.175 -20.400 -11.450  1.00 83.97           C  
ATOM   5607  CG  ARG A 924      61.540 -20.474 -10.782  1.00 82.42           C  
ATOM   5608  CD  ARG A 924      61.755 -21.818 -10.101  1.00 85.19           C  
ATOM   5609  NE  ARG A 924      63.094 -21.942  -9.531  1.00 84.69           N  
ATOM   5610  CZ  ARG A 924      63.557 -23.039  -8.940  1.00 81.80           C  
ATOM   5611  NH1 ARG A 924      62.788 -24.115  -8.839  1.00 81.82           N  
ATOM   5612  NH2 ARG A 924      64.790 -23.064  -8.451  1.00 82.74           N  
ATOM   5613  N   LYS A 925      59.361 -18.932  -8.552  1.00 86.63           N  
ATOM   5614  CA  LYS A 925      59.265 -17.693  -7.786  1.00 88.29           C  
ATOM   5615  C   LYS A 925      60.219 -16.627  -8.318  1.00 87.18           C  
ATOM   5616  O   LYS A 925      59.963 -15.432  -8.183  1.00 87.78           O  
ATOM   5617  CB  LYS A 925      59.535 -17.956  -6.303  1.00 88.78           C  
ATOM   5618  CG  LYS A 925      60.891 -18.576  -6.006  1.00 89.53           C  
ATOM   5619  CD  LYS A 925      61.050 -18.862  -4.521  1.00 80.76           C  
ATOM   5620  CE  LYS A 925      60.913 -17.593  -3.692  1.00 81.99           C  
ATOM   5621  NZ  LYS A 925      61.056 -17.860  -2.233  1.00 81.82           N  
ATOM   5622  N   SER A 926      61.317 -17.067  -8.925  1.00103.31           N  
ATOM   5623  CA  SER A 926      62.279 -16.145  -9.517  1.00103.71           C  
ATOM   5624  C   SER A 926      61.747 -15.596 -10.835  1.00101.14           C  
ATOM   5625  O   SER A 926      61.490 -16.358 -11.768  1.00101.02           O  
ATOM   5626  CB  SER A 926      63.627 -16.835  -9.734  1.00104.78           C  
ATOM   5627  OG  SER A 926      63.509 -17.910 -10.651  1.00103.51           O  
ATOM   5628  N   ARG A 927      61.591 -14.271 -10.892  1.00 95.41           N  
ATOM   5629  CA  ARG A 927      61.018 -13.537 -12.031  1.00 95.14           C  
ATOM   5630  C   ARG A 927      59.889 -14.277 -12.756  1.00 94.12           C  
ATOM   5631  O   ARG A 927      59.772 -14.208 -13.980  1.00 94.10           O  
ATOM   5632  CB  ARG A 927      62.116 -13.160 -13.042  1.00 96.80           C  
ATOM   5633  CG  ARG A 927      62.884 -14.323 -13.658  1.00 95.38           C  
ATOM   5634  CD  ARG A 927      63.286 -14.031 -15.097  1.00 96.66           C  
ATOM   5635  NE  ARG A 927      62.151 -14.122 -16.013  1.00 95.40           N  
ATOM   5636  CZ  ARG A 927      61.453 -13.077 -16.453  1.00 93.87           C  
ATOM   5637  NH1 ARG A 927      61.773 -11.851 -16.065  1.00 96.68           N  
ATOM   5638  NH2 ARG A 927      60.437 -13.261 -17.285  1.00 93.00           N  
ATOM   5639  N   GLY A 928      59.055 -14.971 -11.992  1.00 88.16           N  
ATOM   5640  CA  GLY A 928      57.968 -15.741 -12.564  1.00 87.55           C  
ATOM   5641  C   GLY A 928      56.706 -15.668 -11.730  1.00 87.55           C  
ATOM   5642  O   GLY A 928      56.362 -14.614 -11.195  1.00 87.67           O  
ATOM   5643  N   THR A 929      56.012 -16.797 -11.616  1.00 66.73           N  
ATOM   5644  CA  THR A 929      54.748 -16.843 -10.896  1.00 67.57           C  
ATOM   5645  C   THR A 929      54.416 -18.257 -10.426  1.00 65.84           C  
ATOM   5646  O   THR A 929      54.130 -19.139 -11.236  1.00 64.92           O  
ATOM   5647  CB  THR A 929      53.593 -16.316 -11.771  1.00 64.89           C  
ATOM   5648  OG1 THR A 929      53.815 -14.934 -12.080  1.00 63.81           O  
ATOM   5649  CG2 THR A 929      52.271 -16.455 -11.046  1.00 64.47           C  
ATOM   5650  N   ASP A 930      54.452 -18.465  -9.112  1.00 80.58           N  
ATOM   5651  CA  ASP A 930      54.116 -19.758  -8.523  1.00 81.48           C  
ATOM   5652  C   ASP A 930      52.613 -19.992  -8.567  1.00 80.02           C  
ATOM   5653  O   ASP A 930      51.869 -19.175  -9.106  1.00 79.69           O  
ATOM   5654  CB  ASP A 930      54.612 -19.838  -7.079  1.00 83.10           C  
ATOM   5655  CG  ASP A 930      56.036 -19.346  -6.924  1.00 82.82           C  
ATOM   5656  OD1 ASP A 930      56.968 -20.170  -7.027  1.00 81.51           O  
ATOM   5657  OD2 ASP A 930      56.222 -18.132  -6.696  1.00 82.54           O  
ATOM   5658  N   LEU A 931      52.166 -21.105  -7.993  1.00 75.98           N  
ATOM   5659  CA  LEU A 931      50.739 -21.388  -7.911  1.00 74.93           C  
ATOM   5660  C   LEU A 931      50.057 -20.398  -6.971  1.00 74.77           C  
ATOM   5661  O   LEU A 931      48.999 -19.849  -7.291  1.00 73.56           O  
ATOM   5662  CB  LEU A 931      50.491 -22.822  -7.440  1.00 73.49           C  
ATOM   5663  CG  LEU A 931      49.018 -23.222  -7.323  1.00 74.12           C  
ATOM   5664  CD1 LEU A 931      48.277 -22.937  -8.620  1.00 72.63           C  
ATOM   5665  CD2 LEU A 931      48.878 -24.683  -6.935  1.00 79.77           C  
ATOM   5666  N   HIS A 932      50.675 -20.174  -5.815  1.00 72.68           N  
ATOM   5667  CA  HIS A 932      50.190 -19.185  -4.862  1.00 73.74           C  
ATOM   5668  C   HIS A 932      50.150 -17.805  -5.506  1.00 74.95           C  
ATOM   5669  O   HIS A 932      49.196 -17.049  -5.325  1.00 75.54           O  
ATOM   5670  CB  HIS A 932      51.073 -19.155  -3.612  1.00 75.55           C  
ATOM   5671  CG  HIS A 932      51.083 -20.441  -2.848  1.00 75.76           C  
ATOM   5672  ND1 HIS A 932      50.145 -20.739  -1.881  1.00 74.56           N  
ATOM   5673  CD2 HIS A 932      51.920 -21.504  -2.899  1.00 74.67           C  
ATOM   5674  CE1 HIS A 932      50.401 -21.931  -1.375  1.00 74.59           C  
ATOM   5675  NE2 HIS A 932      51.474 -22.417  -1.976  1.00 71.60           N  
ATOM   5676  N   SER A 933      51.193 -17.492  -6.267  1.00 98.74           N  
ATOM   5677  CA  SER A 933      51.289 -16.212  -6.955  1.00 97.13           C  
ATOM   5678  C   SER A 933      50.304 -16.131  -8.117  1.00 94.88           C  
ATOM   5679  O   SER A 933      49.858 -15.047  -8.488  1.00 94.57           O  
ATOM   5680  CB  SER A 933      52.716 -15.982  -7.455  1.00 98.95           C  
ATOM   5681  OG  SER A 933      52.826 -14.746  -8.139  1.00 96.45           O  
ATOM   5682  N   LYS A 934      49.965 -17.283  -8.690  1.00 76.01           N  
ATOM   5683  CA  LYS A 934      49.021 -17.332  -9.801  1.00 76.16           C  
ATOM   5684  C   LYS A 934      47.602 -17.105  -9.299  1.00 74.72           C  
ATOM   5685  O   LYS A 934      46.775 -16.509  -9.989  1.00 73.29           O  
ATOM   5686  CB  LYS A 934      49.120 -18.668 -10.541  1.00 74.83           C  
ATOM   5687  CG  LYS A 934      48.389 -18.698 -11.874  1.00 74.03           C  
ATOM   5688  CD  LYS A 934      48.665 -19.992 -12.623  1.00 72.05           C  
ATOM   5689  CE  LYS A 934      47.955 -20.017 -13.966  1.00 73.62           C  
ATOM   5690  NZ  LYS A 934      48.216 -21.280 -14.709  1.00 70.89           N  
ATOM   5691  N   THR A 935      47.325 -17.586  -8.091  1.00 83.75           N  
ATOM   5692  CA  THR A 935      46.031 -17.350  -7.463  1.00 81.89           C  
ATOM   5693  C   THR A 935      45.980 -15.958  -6.840  1.00 85.53           C  
ATOM   5694  O   THR A 935      44.905 -15.404  -6.617  1.00 83.02           O  
ATOM   5695  CB  THR A 935      45.722 -18.402  -6.383  1.00 82.29           C  
ATOM   5696  OG1 THR A 935      46.754 -18.384  -5.387  1.00 83.76           O  
ATOM   5697  CG2 THR A 935      45.643 -19.791  -6.999  1.00 81.11           C  
ATOM   5698  N   ALA A 936      47.155 -15.396  -6.566  1.00 63.26           N  
ATOM   5699  CA  ALA A 936      47.251 -14.065  -5.977  1.00 62.79           C  
ATOM   5700  C   ALA A 936      47.099 -12.978  -7.034  1.00 64.14           C  
ATOM   5701  O   ALA A 936      46.820 -11.824  -6.716  1.00 63.96           O  
ATOM   5702  CB  ALA A 936      48.571 -13.904  -5.241  1.00 62.08           C  
ATOM   5703  N   THR A 937      47.292 -13.353  -8.294  1.00 95.64           N  
ATOM   5704  CA  THR A 937      47.137 -12.414  -9.399  1.00 95.87           C  
ATOM   5705  C   THR A 937      45.893 -12.742 -10.213  1.00 95.08           C  
ATOM   5706  O   THR A 937      45.969 -12.980 -11.418  1.00 92.48           O  
ATOM   5707  CB  THR A 937      48.368 -12.417 -10.327  1.00 95.39           C  
ATOM   5708  OG1 THR A 937      48.590 -13.741 -10.826  1.00 96.32           O  
ATOM   5709  CG2 THR A 937      49.603 -11.948  -9.574  1.00 97.12           C  
ATOM   5710  N   THR A 938      44.744 -12.754  -9.544  1.00 58.72           N  
ATOM   5711  CA  THR A 938      43.477 -13.058 -10.205  1.00 59.32           C  
ATOM   5712  C   THR A 938      42.588 -11.854 -10.601  1.00 59.84           C  
ATOM   5713  O   THR A 938      42.036 -11.878 -11.702  1.00 51.10           O  
ATOM   5714  CB  THR A 938      42.624 -14.031  -9.349  1.00 58.10           C  
ATOM   5715  OG1 THR A 938      42.697 -13.665  -7.968  1.00 56.59           O  
ATOM   5716  CG2 THR A 938      43.132 -15.457  -9.506  1.00 58.20           C  
ATOM   5717  N   VAL A 939      42.422 -10.808  -9.780  1.00114.00           N  
ATOM   5718  CA  VAL A 939      43.048 -10.595  -8.474  1.00117.06           C  
ATOM   5719  C   VAL A 939      42.003 -10.587  -7.355  1.00117.36           C  
ATOM   5720  O   VAL A 939      40.867 -10.165  -7.571  1.00115.91           O  
ATOM   5721  CB  VAL A 939      43.844  -9.265  -8.451  1.00115.70           C  
ATOM   5722  CG1 VAL A 939      45.015  -9.331  -9.417  1.00117.99           C  
ATOM   5723  CG2 VAL A 939      42.937  -8.091  -8.790  1.00113.45           C  
ATOM   5724  N   GLY A 940      42.374 -11.059  -6.165  1.00 67.93           N  
ATOM   5725  CA  GLY A 940      43.702 -11.580  -5.895  1.00 67.65           C  
ATOM   5726  C   GLY A 940      44.523 -10.664  -5.008  1.00 66.97           C  
ATOM   5727  O   GLY A 940      44.507  -9.446  -5.175  1.00 67.39           O  
ATOM   5728  N   ILE A 941      45.243 -11.260  -4.063  1.00 87.00           N  
ATOM   5729  CA  ILE A 941      46.087 -10.508  -3.141  1.00 87.65           C  
ATOM   5730  C   ILE A 941      47.385 -11.261  -2.854  1.00 88.88           C  
ATOM   5731  O   ILE A 941      47.363 -12.435  -2.479  1.00 81.62           O  
ATOM   5732  CB  ILE A 941      45.362 -10.205  -1.808  1.00 88.58           C  
ATOM   5733  CG1 ILE A 941      44.541 -11.416  -1.340  1.00 80.86           C  
ATOM   5734  CG2 ILE A 941      44.479  -8.971  -1.948  1.00 86.87           C  
ATOM   5735  CD1 ILE A 941      43.074 -11.396  -1.757  1.00 88.53           C  
ATOM   5736  N   SER A 942      48.513 -10.581  -3.031  1.00 99.25           N  
ATOM   5737  CA  SER A 942      49.824 -11.198  -2.855  1.00 99.51           C  
ATOM   5738  C   SER A 942      50.415 -10.898  -1.478  1.00 90.44           C  
ATOM   5739  O   SER A 942      50.375  -9.758  -1.015  1.00 91.11           O  
ATOM   5740  CB  SER A 942      50.789 -10.724  -3.946  1.00 99.81           C  
ATOM   5741  OG  SER A 942      50.298 -11.045  -5.236  1.00 96.85           O  
ATOM   5742  N   ARG A 943      50.965 -11.920  -0.825  1.00 63.06           N  
ATOM   5743  CA  ARG A 943      50.994 -13.277  -1.362  1.00 62.31           C  
ATOM   5744  C   ARG A 943      50.630 -14.286  -0.280  1.00 63.71           C  
ATOM   5745  O   ARG A 943      50.090 -15.354  -0.567  1.00 63.17           O  
ATOM   5746  CB  ARG A 943      52.375 -13.601  -1.942  1.00 62.05           C  
ATOM   5747  CG  ARG A 943      52.470 -14.969  -2.605  1.00 61.27           C  
ATOM   5748  CD  ARG A 943      53.877 -15.244  -3.115  1.00 60.88           C  
ATOM   5749  NE  ARG A 943      53.993 -16.560  -3.739  1.00 59.96           N  
ATOM   5750  CZ  ARG A 943      54.383 -17.659  -3.101  1.00 60.18           C  
ATOM   5751  NH1 ARG A 943      54.698 -17.607  -1.814  1.00 61.44           N  
ATOM   5752  NH2 ARG A 943      54.458 -18.813  -3.751  1.00 59.05           N  
ATOM   5753  N   GLU A 944      50.926 -13.932   0.966  1.00 60.96           N  
ATOM   5754  CA  GLU A 944      50.646 -14.796   2.109  1.00 63.30           C  
ATOM   5755  C   GLU A 944      49.151 -15.071   2.241  1.00 62.12           C  
ATOM   5756  O   GLU A 944      48.742 -16.143   2.690  1.00 63.52           O  
ATOM   5757  CB  GLU A 944      51.177 -14.163   3.398  1.00 67.14           C  
ATOM   5758  CG  GLU A 944      52.624 -13.692   3.316  1.00 67.05           C  
ATOM   5759  CD  GLU A 944      53.615 -14.837   3.223  1.00 66.30           C  
ATOM   5760  OE1 GLU A 944      53.268 -15.963   3.635  1.00 64.67           O  
ATOM   5761  OE2 GLU A 944      54.744 -14.609   2.740  1.00 64.53           O  
ATOM   5762  N   HIS A 945      48.343 -14.093   1.843  1.00 91.18           N  
ATOM   5763  CA  HIS A 945      46.894 -14.213   1.915  1.00 91.26           C  
ATOM   5764  C   HIS A 945      46.390 -15.324   0.997  1.00 89.71           C  
ATOM   5765  O   HIS A 945      45.543 -16.129   1.388  1.00 87.83           O  
ATOM   5766  CB  HIS A 945      46.230 -12.883   1.553  1.00 88.66           C  
ATOM   5767  CG  HIS A 945      46.792 -11.709   2.293  1.00 89.02           C  
ATOM   5768  ND1 HIS A 945      47.981 -11.109   1.940  1.00 87.80           N  
ATOM   5769  CD2 HIS A 945      46.329 -11.027   3.366  1.00 86.49           C  
ATOM   5770  CE1 HIS A 945      48.227 -10.106   2.765  1.00 88.93           C  
ATOM   5771  NE2 HIS A 945      47.241 -10.034   3.639  1.00 89.98           N  
ATOM   5772  N   ALA A 946      46.923 -15.363  -0.221  1.00 79.14           N  
ATOM   5773  CA  ALA A 946      46.566 -16.402  -1.180  1.00 76.76           C  
ATOM   5774  C   ALA A 946      47.032 -17.769  -0.691  1.00 78.47           C  
ATOM   5775  O   ALA A 946      46.389 -18.785  -0.952  1.00 76.74           O  
ATOM   5776  CB  ALA A 946      47.159 -16.091  -2.546  1.00 75.49           C  
ATOM   5777  N   LYS A 947      48.158 -17.782   0.016  1.00 52.77           N  
ATOM   5778  CA  LYS A 947      48.684 -19.001   0.616  1.00 54.62           C  
ATOM   5779  C   LYS A 947      47.713 -19.534   1.664  1.00 55.68           C  
ATOM   5780  O   LYS A 947      47.400 -20.725   1.694  1.00 54.94           O  
ATOM   5781  CB  LYS A 947      50.057 -18.741   1.243  1.00 55.65           C  
ATOM   5782  CG  LYS A 947      50.708 -19.963   1.866  1.00 55.62           C  
ATOM   5783  CD  LYS A 947      51.933 -19.582   2.690  1.00 56.68           C  
ATOM   5784  CE  LYS A 947      53.001 -18.911   1.839  1.00 53.57           C  
ATOM   5785  NZ  LYS A 947      54.167 -18.477   2.659  1.00 54.08           N  
ATOM   5786  N   ARG A 948      47.187 -18.627   2.493  1.00 69.30           N  
ATOM   5787  CA  ARG A 948      46.216 -18.963   3.548  1.00 69.88           C  
ATOM   5788  C   ARG A 948      44.800 -19.175   3.022  1.00 69.28           C  
ATOM   5789  O   ARG A 948      43.910 -19.613   3.753  1.00 67.30           O  
ATOM   5790  CB  ARG A 948      46.200 -17.898   4.651  1.00 20.00           C  
ATOM   5791  CG  ARG A 948      45.253 -18.192   5.812  1.00 20.00           C  
ATOM   5792  CD  ARG A 948      45.549 -19.524   6.476  1.00 20.00           C  
ATOM   5793  NE  ARG A 948      46.919 -19.616   6.960  1.00 20.00           N  
ATOM   5794  CZ  ARG A 948      47.319 -19.162   8.141  1.00 20.00           C  
ATOM   5795  NH1 ARG A 948      46.453 -18.580   8.953  1.00 20.00           N  
ATOM   5796  NH2 ARG A 948      48.584 -19.289   8.513  1.00 20.00           N  
ATOM   5797  N   PHE A 949      44.599 -18.851   1.754  1.00 77.77           N  
ATOM   5798  CA  PHE A 949      43.386 -19.220   1.033  1.00 75.31           C  
ATOM   5799  C   PHE A 949      43.480 -20.629   0.450  1.00 72.78           C  
ATOM   5800  O   PHE A 949      42.563 -21.434   0.612  1.00 74.33           O  
ATOM   5801  CB  PHE A 949      43.103 -18.210  -0.083  1.00 74.16           C  
ATOM   5802  CG  PHE A 949      41.743 -18.359  -0.701  1.00 70.66           C  
ATOM   5803  CD1 PHE A 949      40.646 -17.715  -0.153  1.00 70.11           C  
ATOM   5804  CD2 PHE A 949      41.562 -19.141  -1.830  1.00 69.82           C  
ATOM   5805  CE1 PHE A 949      39.393 -17.848  -0.719  1.00 67.89           C  
ATOM   5806  CE2 PHE A 949      40.313 -19.280  -2.399  1.00 66.52           C  
ATOM   5807  CZ  PHE A 949      39.227 -18.632  -1.843  1.00 66.24           C  
ATOM   5808  N   ASN A 950      44.586 -20.918  -0.231  1.00 51.50           N  
ATOM   5809  CA  ASN A 950      44.821 -22.239  -0.808  1.00 51.43           C  
ATOM   5810  C   ASN A 950      44.917 -23.323   0.257  1.00 50.81           C  
ATOM   5811  O   ASN A 950      44.165 -24.299   0.239  1.00 58.26           O  
ATOM   5812  CB  ASN A 950      46.103 -22.243  -1.646  1.00 57.67           C  
ATOM   5813  CG  ASN A 950      45.978 -21.428  -2.915  1.00 50.54           C  
ATOM   5814  OD1 ASN A 950      44.890 -21.280  -3.473  1.00 58.44           O  
ATOM   5815  ND2 ASN A 950      47.101 -20.899  -3.388  1.00 59.72           N  
ATOM   5816  N   TYR A 951      45.853 -23.143   1.185  1.00 58.55           N  
ATOM   5817  CA  TYR A 951      46.085 -24.112   2.253  1.00 57.97           C  
ATOM   5818  C   TYR A 951      44.860 -24.269   3.152  1.00 56.12           C  
ATOM   5819  O   TYR A 951      44.704 -25.285   3.830  1.00 50.02           O  
ATOM   5820  CB  TYR A 951      47.299 -23.706   3.088  1.00 56.56           C  
ATOM   5821  CG  TYR A 951      48.633 -24.049   2.462  1.00 56.37           C  
ATOM   5822  CD1 TYR A 951      48.763 -25.138   1.613  1.00 55.72           C  
ATOM   5823  CD2 TYR A 951      49.763 -23.283   2.725  1.00 57.31           C  
ATOM   5824  CE1 TYR A 951      49.980 -25.456   1.040  1.00 55.96           C  
ATOM   5825  CE2 TYR A 951      50.983 -23.592   2.156  1.00 56.07           C  
ATOM   5826  CZ  TYR A 951      51.086 -24.680   1.314  1.00 54.54           C  
ATOM   5827  OH  TYR A 951      52.299 -24.994   0.744  1.00 53.54           O  
ATOM   5828  N   GLY A 952      43.995 -23.259   3.159  1.00 56.20           N  
ATOM   5829  CA  GLY A 952      42.744 -23.338   3.887  1.00 56.02           C  
ATOM   5830  C   GLY A 952      41.700 -24.075   3.072  1.00 56.82           C  
ATOM   5831  O   GLY A 952      40.795 -24.705   3.619  1.00 56.77           O  
ATOM   5832  N   ARG A 953      41.836 -23.994   1.753  1.00 72.37           N  
ATOM   5833  CA  ARG A 953      40.934 -24.681   0.836  1.00 77.65           C  
ATOM   5834  C   ARG A 953      41.187 -26.182   0.851  1.00 74.79           C  
ATOM   5835  O   ARG A 953      40.252 -26.981   0.783  1.00 73.28           O  
ATOM   5836  CB  ARG A 953      41.088 -24.135  -0.586  1.00 75.81           C  
ATOM   5837  CG  ARG A 953      40.266 -24.871  -1.632  1.00 74.51           C  
ATOM   5838  CD  ARG A 953      40.455 -24.277  -3.017  1.00 73.92           C  
ATOM   5839  NE  ARG A 953      41.826 -24.429  -3.497  1.00 74.87           N  
ATOM   5840  CZ  ARG A 953      42.268 -25.488  -4.168  1.00 72.53           C  
ATOM   5841  NH1 ARG A 953      41.446 -26.493  -4.436  1.00 70.82           N  
ATOM   5842  NH2 ARG A 953      43.530 -25.545  -4.568  1.00 73.91           N  
ATOM   5843  N   ILE A 954      42.459 -26.560   0.944  1.00 56.59           N  
ATOM   5844  CA  ILE A 954      42.839 -27.966   0.947  1.00 56.71           C  
ATOM   5845  C   ILE A 954      42.291 -28.691   2.175  1.00 56.09           C  
ATOM   5846  O   ILE A 954      41.882 -29.848   2.089  1.00 56.47           O  
ATOM   5847  CB  ILE A 954      44.372 -28.135   0.894  1.00 56.44           C  
ATOM   5848  CG1 ILE A 954      44.950 -27.370  -0.295  1.00 57.18           C  
ATOM   5849  CG2 ILE A 954      44.749 -29.606   0.802  1.00 56.67           C  
ATOM   5850  CD1 ILE A 954      46.449 -27.512  -0.443  1.00 57.06           C  
ATOM   5851  N   TYR A 955      42.266 -28.004   3.313  1.00 59.12           N  
ATOM   5852  CA  TYR A 955      41.810 -28.624   4.554  1.00 51.44           C  
ATOM   5853  C   TYR A 955      40.419 -28.137   4.949  1.00 51.24           C  
ATOM   5854  O   TYR A 955      40.173 -27.815   6.111  1.00 59.43           O  
ATOM   5855  CB  TYR A 955      42.795 -28.348   5.693  1.00 55.51           C  
ATOM   5856  CG  TYR A 955      44.250 -28.506   5.311  1.00 54.91           C  
ATOM   5857  CD1 TYR A 955      44.663 -29.513   4.449  1.00 58.25           C  
ATOM   5858  CD2 TYR A 955      45.210 -27.640   5.813  1.00 56.63           C  
ATOM   5859  CE1 TYR A 955      45.993 -29.649   4.098  1.00 58.03           C  
ATOM   5860  CE2 TYR A 955      46.539 -27.768   5.471  1.00 56.84           C  
ATOM   5861  CZ  TYR A 955      46.925 -28.774   4.614  1.00 51.54           C  
ATOM   5862  OH  TYR A 955      48.252 -28.898   4.274  1.00 50.92           O  
ATOM   5863  N   GLY A 956      39.512 -28.084   3.978  1.00 67.07           N  
ATOM   5864  CA  GLY A 956      38.141 -27.692   4.243  1.00 67.27           C  
ATOM   5865  C   GLY A 956      37.824 -26.281   3.787  1.00 67.35           C  
ATOM   5866  O   GLY A 956      37.900 -25.332   4.568  1.00 66.95           O  
ATOM   5867  N   ALA A 957      37.462 -26.147   2.515  1.00 89.62           N  
ATOM   5868  CA  ALA A 957      37.114 -24.849   1.945  1.00 88.54           C  
ATOM   5869  C   ALA A 957      35.663 -24.493   2.228  1.00 88.89           C  
ATOM   5870  O   ALA A 957      34.823 -24.532   1.328  1.00 84.16           O  
ATOM   5871  CB  ALA A 957      37.371 -24.842   0.450  1.00 86.19           C  
ATOM   5872  N   GLY A 958      35.368 -24.147   3.475  1.00 76.53           N  
ATOM   5873  CA  GLY A 958      34.022 -23.757   3.852  1.00 76.22           C  
ATOM   5874  C   GLY A 958      33.567 -22.523   3.102  1.00 72.27           C  
ATOM   5875  O   GLY A 958      34.290 -21.528   3.034  1.00 73.89           O  
ATOM   5876  N   GLN A 959      32.370 -22.596   2.530  1.00 93.52           N  
ATOM   5877  CA  GLN A 959      31.815 -21.488   1.759  1.00 98.73           C  
ATOM   5878  C   GLN A 959      31.746 -20.173   2.549  1.00 90.56           C  
ATOM   5879  O   GLN A 959      32.209 -19.149   2.052  1.00 91.75           O  
ATOM   5880  CB  GLN A 959      30.425 -21.849   1.224  1.00 95.13           C  
ATOM   5881  CG  GLN A 959      29.750 -20.722   0.458  1.00 92.92           C  
ATOM   5882  CD  GLN A 959      28.363 -21.093  -0.031  1.00 87.87           C  
ATOM   5883  OE1 GLN A 959      27.929 -22.237   0.105  1.00 88.10           O  
ATOM   5884  NE2 GLN A 959      27.658 -20.123  -0.604  1.00 86.26           N  
ATOM   5885  N   PRO A 960      31.181 -20.189   3.774  1.00 80.52           N  
ATOM   5886  CA  PRO A 960      31.156 -18.904   4.483  1.00 80.43           C  
ATOM   5887  C   PRO A 960      32.541 -18.465   4.956  1.00 85.43           C  
ATOM   5888  O   PRO A 960      32.812 -17.262   5.015  1.00 83.72           O  
ATOM   5889  CB  PRO A 960      30.238 -19.178   5.675  1.00 81.84           C  
ATOM   5890  CG  PRO A 960      30.392 -20.633   5.928  1.00 83.67           C  
ATOM   5891  CD  PRO A 960      30.547 -21.257   4.572  1.00 82.64           C  
ATOM   5892  N   PHE A 961      33.402 -19.424   5.287  1.00 74.21           N  
ATOM   5893  CA  PHE A 961      34.751 -19.094   5.731  1.00 77.45           C  
ATOM   5894  C   PHE A 961      35.544 -18.467   4.597  1.00 74.70           C  
ATOM   5895  O   PHE A 961      36.124 -17.396   4.761  1.00 75.98           O  
ATOM   5896  CB  PHE A 961      35.492 -20.322   6.257  1.00 78.90           C  
ATOM   5897  CG  PHE A 961      36.855 -20.004   6.806  1.00 82.04           C  
ATOM   5898  CD1 PHE A 961      37.015 -19.661   8.140  1.00 83.79           C  
ATOM   5899  CD2 PHE A 961      37.974 -20.025   5.989  1.00 79.92           C  
ATOM   5900  CE1 PHE A 961      38.261 -19.355   8.649  1.00 85.85           C  
ATOM   5901  CE2 PHE A 961      39.222 -19.718   6.492  1.00 83.97           C  
ATOM   5902  CZ  PHE A 961      39.366 -19.384   7.825  1.00 86.44           C  
ATOM   5903  N   ALA A 962      35.575 -19.143   3.452  1.00 65.40           N  
ATOM   5904  CA  ALA A 962      36.250 -18.615   2.275  1.00 67.87           C  
ATOM   5905  C   ALA A 962      35.626 -17.282   1.876  1.00 64.27           C  
ATOM   5906  O   ALA A 962      36.309 -16.389   1.368  1.00 65.66           O  
ATOM   5907  CB  ALA A 962      36.182 -19.606   1.126  1.00 65.19           C  
ATOM   5908  N   GLU A 963      34.326 -17.157   2.128  1.00 82.19           N  
ATOM   5909  CA  GLU A 963      33.604 -15.922   1.853  1.00 89.49           C  
ATOM   5910  C   GLU A 963      34.175 -14.758   2.649  1.00 89.01           C  
ATOM   5911  O   GLU A 963      34.734 -13.822   2.073  1.00 88.83           O  
ATOM   5912  CB  GLU A 963      32.112 -16.085   2.159  1.00 87.63           C  
ATOM   5913  CG  GLU A 963      31.293 -14.820   1.975  1.00 82.53           C  
ATOM   5914  CD  GLU A 963      29.802 -15.088   1.971  1.00 80.10           C  
ATOM   5915  OE1 GLU A 963      29.022 -14.120   1.848  1.00 76.09           O  
ATOM   5916  OE2 GLU A 963      29.409 -16.269   2.084  1.00 81.79           O  
ATOM   5917  N   ARG A 964      34.049 -14.822   3.972  1.00 63.63           N  
ATOM   5918  CA  ARG A 964      34.476 -13.710   4.815  1.00 64.93           C  
ATOM   5919  C   ARG A 964      35.991 -13.516   4.763  1.00 69.82           C  
ATOM   5920  O   ARG A 964      36.482 -12.415   4.992  1.00 68.48           O  
ATOM   5921  CB  ARG A 964      34.005 -13.913   6.260  1.00 65.39           C  
ATOM   5922  CG  ARG A 964      35.089 -14.331   7.244  1.00 68.75           C  
ATOM   5923  CD  ARG A 964      35.157 -15.838   7.397  1.00 65.82           C  
ATOM   5924  NE  ARG A 964      33.894 -16.393   7.881  1.00 66.24           N  
ATOM   5925  CZ  ARG A 964      33.556 -16.472   9.163  1.00 66.46           C  
ATOM   5926  NH1 ARG A 964      34.384 -16.030  10.100  1.00 70.52           N  
ATOM   5927  NH2 ARG A 964      32.387 -16.993   9.510  1.00 65.41           N  
ATOM   5928  N   LEU A 965      36.724 -14.578   4.441  1.00 80.67           N  
ATOM   5929  CA  LEU A 965      38.181 -14.498   4.349  1.00 83.25           C  
ATOM   5930  C   LEU A 965      38.612 -13.733   3.102  1.00 80.94           C  
ATOM   5931  O   LEU A 965      39.342 -12.740   3.188  1.00 82.72           O  
ATOM   5932  CB  LEU A 965      38.802 -15.897   4.345  1.00 85.63           C  
ATOM   5933  CG  LEU A 965      40.318 -15.980   4.535  1.00 89.42           C  
ATOM   5934  CD1 LEU A 965      40.705 -15.557   5.944  1.00 81.65           C  
ATOM   5935  CD2 LEU A 965      40.819 -17.383   4.232  1.00 87.64           C  
ATOM   5936  N   LEU A 966      38.157 -14.204   1.943  1.00 89.28           N  
ATOM   5937  CA  LEU A 966      38.488 -13.566   0.674  1.00 89.04           C  
ATOM   5938  C   LEU A 966      37.956 -12.136   0.633  1.00 84.60           C  
ATOM   5939  O   LEU A 966      38.588 -11.242   0.069  1.00 83.58           O  
ATOM   5940  CB  LEU A 966      37.930 -14.372  -0.500  1.00 86.10           C  
ATOM   5941  CG  LEU A 966      38.271 -13.869  -1.903  1.00 83.46           C  
ATOM   5942  CD1 LEU A 966      39.779 -13.828  -2.107  1.00 84.95           C  
ATOM   5943  CD2 LEU A 966      37.608 -14.736  -2.961  1.00 80.04           C  
ATOM   5944  N   MET A 967      36.795 -11.928   1.246  1.00 87.12           N  
ATOM   5945  CA  MET A 967      36.200 -10.599   1.319  1.00 84.82           C  
ATOM   5946  C   MET A 967      36.982  -9.702   2.275  1.00 87.59           C  
ATOM   5947  O   MET A 967      37.049  -8.489   2.084  1.00 86.14           O  
ATOM   5948  CB  MET A 967      34.735 -10.693   1.748  1.00 83.11           C  
ATOM   5949  CG  MET A 967      33.979  -9.380   1.703  1.00 88.57           C  
ATOM   5950  SD  MET A 967      32.210  -9.625   1.944  1.00 87.36           S  
ATOM   5951  CE  MET A 967      32.201 -10.470   3.522  1.00 80.64           C  
ATOM   5952  N   GLN A 968      37.576 -10.305   3.303  1.00 82.90           N  
ATOM   5953  CA  GLN A 968      38.414  -9.562   4.240  1.00 86.50           C  
ATOM   5954  C   GLN A 968      39.729  -9.148   3.588  1.00 85.44           C  
ATOM   5955  O   GLN A 968      40.261  -8.073   3.867  1.00 86.65           O  
ATOM   5956  CB  GLN A 968      38.696 -10.394   5.496  1.00 87.62           C  
ATOM   5957  CG  GLN A 968      39.555  -9.702   6.541  1.00 88.95           C  
ATOM   5958  CD  GLN A 968      39.862 -10.595   7.730  1.00 82.54           C  
ATOM   5959  OE1 GLN A 968      39.482 -11.766   7.755  1.00 85.27           O  
ATOM   5960  NE2 GLN A 968      40.553 -10.045   8.722  1.00 84.34           N  
ATOM   5961  N   PHE A 969      40.248 -10.003   2.712  1.00 94.84           N  
ATOM   5962  CA  PHE A 969      41.558  -9.772   2.113  1.00 94.28           C  
ATOM   5963  C   PHE A 969      41.513  -8.920   0.846  1.00 92.64           C  
ATOM   5964  O   PHE A 969      42.484  -8.235   0.526  1.00 92.73           O  
ATOM   5965  CB  PHE A 969      42.238 -11.108   1.805  1.00 97.77           C  
ATOM   5966  CG  PHE A 969      42.662 -11.867   3.028  1.00 90.25           C  
ATOM   5967  CD1 PHE A 969      42.836 -11.215   4.238  1.00 91.66           C  
ATOM   5968  CD2 PHE A 969      42.886 -13.231   2.968  1.00 90.46           C  
ATOM   5969  CE1 PHE A 969      43.227 -11.910   5.367  1.00 93.03           C  
ATOM   5970  CE2 PHE A 969      43.278 -13.933   4.092  1.00 94.85           C  
ATOM   5971  CZ  PHE A 969      43.447 -13.271   5.293  1.00 94.51           C  
ATOM   5972  N   ASN A 970      40.396  -8.957   0.128  1.00 90.88           N  
ATOM   5973  CA  ASN A 970      40.302  -8.239  -1.140  1.00 98.44           C  
ATOM   5974  C   ASN A 970      39.625  -6.875  -1.015  1.00 93.77           C  
ATOM   5975  O   ASN A 970      39.869  -5.982  -1.828  1.00 92.72           O  
ATOM   5976  CB  ASN A 970      39.561  -9.087  -2.175  1.00 96.76           C  
ATOM   5977  CG  ASN A 970      39.813  -8.623  -3.596  1.00 95.48           C  
ATOM   5978  OD1 ASN A 970      39.166  -7.697  -4.084  1.00 91.49           O  
ATOM   5979  ND2 ASN A 970      40.761  -9.267  -4.266  1.00 92.07           N  
ATOM   5980  N   HIS A 971      38.782  -6.726   0.004  1.00 85.96           N  
ATOM   5981  CA  HIS A 971      38.053  -5.482   0.260  1.00 84.78           C  
ATOM   5982  C   HIS A 971      37.214  -5.028  -0.934  1.00 81.25           C  
ATOM   5983  O   HIS A 971      37.590  -4.099  -1.648  1.00 86.63           O  
ATOM   5984  CB  HIS A 971      39.023  -4.364   0.663  1.00 84.19           C  
ATOM   5985  CG  HIS A 971      39.491  -4.450   2.081  1.00 86.77           C  
ATOM   5986  ND1 HIS A 971      40.597  -3.768   2.544  1.00 88.16           N  
ATOM   5987  CD2 HIS A 971      39.000  -5.132   3.144  1.00 88.46           C  
ATOM   5988  CE1 HIS A 971      40.768  -4.029   3.826  1.00 90.12           C  
ATOM   5989  NE2 HIS A 971      39.812  -4.854   4.216  1.00 90.78           N  
ATOM   5990  N   ARG A 972      36.075  -5.685  -1.139  1.00 74.08           N  
ATOM   5991  CA  ARG A 972      35.146  -5.303  -2.197  1.00 68.81           C  
ATOM   5992  C   ARG A 972      33.706  -5.610  -1.781  1.00 65.94           C  
ATOM   5993  O   ARG A 972      33.375  -5.572  -0.597  1.00 69.17           O  
ATOM   5994  CB  ARG A 972      35.487  -6.020  -3.505  1.00 69.35           C  
ATOM   5995  CG  ARG A 972      35.407  -5.133  -4.738  1.00 68.13           C  
ATOM   5996  CD  ARG A 972      36.442  -4.021  -4.673  1.00 66.64           C  
ATOM   5997  NE  ARG A 972      37.802  -4.551  -4.633  1.00 73.00           N  
ATOM   5998  CZ  ARG A 972      38.889  -3.808  -4.439  1.00 71.70           C  
ATOM   5999  NH1 ARG A 972      38.778  -2.499  -4.262  1.00 71.62           N  
ATOM   6000  NH2 ARG A 972      40.087  -4.377  -4.419  1.00 76.69           N  
ATOM   6001  N   LEU A 973      32.855  -5.917  -2.757  1.00 82.48           N  
ATOM   6002  CA  LEU A 973      31.450  -6.214  -2.484  1.00 80.98           C  
ATOM   6003  C   LEU A 973      31.196  -7.724  -2.495  1.00 80.97           C  
ATOM   6004  O   LEU A 973      31.937  -8.482  -3.119  1.00 84.15           O  
ATOM   6005  CB  LEU A 973      30.533  -5.487  -3.483  1.00 85.40           C  
ATOM   6006  CG  LEU A 973      30.459  -5.732  -5.001  1.00 86.42           C  
ATOM   6007  CD1 LEU A 973      31.829  -5.801  -5.678  1.00 87.13           C  
ATOM   6008  CD2 LEU A 973      29.634  -6.966  -5.337  1.00 86.45           C  
ATOM   6009  N   THR A 974      30.140  -8.146  -1.805  1.00 99.05           N  
ATOM   6010  CA  THR A 974      29.915  -9.563  -1.519  1.00 91.95           C  
ATOM   6011  C   THR A 974      29.424 -10.393  -2.708  1.00 99.66           C  
ATOM   6012  O   THR A 974      29.659 -11.600  -2.757  1.00 92.00           O  
ATOM   6013  CB  THR A 974      28.902  -9.736  -0.366  1.00 98.32           C  
ATOM   6014  OG1 THR A 974      28.626 -11.129  -0.170  1.00 91.55           O  
ATOM   6015  CG2 THR A 974      27.603  -9.005  -0.674  1.00 94.05           C  
ATOM   6016  N   GLN A 975      28.743  -9.757  -3.657  1.00 96.99           N  
ATOM   6017  CA  GLN A 975      28.182 -10.483  -4.795  1.00 94.63           C  
ATOM   6018  C   GLN A 975      29.270 -10.996  -5.738  1.00 95.67           C  
ATOM   6019  O   GLN A 975      29.354 -12.199  -6.008  1.00 97.22           O  
ATOM   6020  CB  GLN A 975      27.196  -9.600  -5.565  1.00 97.68           C  
ATOM   6021  CG  GLN A 975      25.889  -9.326  -4.833  1.00 93.75           C  
ATOM   6022  CD  GLN A 975      25.786  -7.900  -4.327  1.00 91.48           C  
ATOM   6023  OE1 GLN A 975      26.752  -7.337  -3.811  1.00 93.07           O  
ATOM   6024  NE2 GLN A 975      24.607  -7.304  -4.477  1.00 94.16           N  
ATOM   6025  N   GLN A 976      30.096 -10.081  -6.240  1.00 88.73           N  
ATOM   6026  CA  GLN A 976      31.198 -10.434  -7.130  1.00 80.81           C  
ATOM   6027  C   GLN A 976      32.159 -11.395  -6.443  1.00 86.53           C  
ATOM   6028  O   GLN A 976      32.678 -12.326  -7.065  1.00 87.73           O  
ATOM   6029  CB  GLN A 976      31.952  -9.182  -7.586  1.00 80.96           C  
ATOM   6030  CG  GLN A 976      31.139  -8.243  -8.460  1.00 85.64           C  
ATOM   6031  CD  GLN A 976      31.944  -7.045  -8.922  1.00 83.81           C  
ATOM   6032  OE1 GLN A 976      33.125  -6.915  -8.596  1.00 88.28           O  
ATOM   6033  NE2 GLN A 976      31.310  -6.160  -9.683  1.00 89.84           N  
ATOM   6034  N   GLU A 977      32.389 -11.159  -5.155  1.00 85.38           N  
ATOM   6035  CA  GLU A 977      33.209 -12.042  -4.339  1.00 89.34           C  
ATOM   6036  C   GLU A 977      32.640 -13.456  -4.348  1.00 80.75           C  
ATOM   6037  O   GLU A 977      33.360 -14.425  -4.595  1.00 82.95           O  
ATOM   6038  CB  GLU A 977      33.302 -11.514  -2.906  1.00 83.79           C  
ATOM   6039  CG  GLU A 977      34.689 -11.050  -2.483  1.00 85.39           C  
ATOM   6040  CD  GLU A 977      34.991  -9.621  -2.896  1.00 85.20           C  
ATOM   6041  OE1 GLU A 977      35.682  -8.920  -2.128  1.00 86.69           O  
ATOM   6042  OE2 GLU A 977      34.545  -9.197  -3.984  1.00 80.93           O  
ATOM   6043  N   ALA A 978      31.340 -13.562  -4.081  1.00 55.90           N  
ATOM   6044  CA  ALA A 978      30.651 -14.849  -4.075  1.00 57.70           C  
ATOM   6045  C   ALA A 978      30.751 -15.529  -5.436  1.00 54.84           C  
ATOM   6046  O   ALA A 978      30.835 -16.756  -5.522  1.00 57.47           O  
ATOM   6047  CB  ALA A 978      29.194 -14.669  -3.678  1.00 54.61           C  
ATOM   6048  N   ALA A 979      30.738 -14.725  -6.494  1.00116.36           N  
ATOM   6049  CA  ALA A 979      30.917 -15.246  -7.845  1.00114.14           C  
ATOM   6050  C   ALA A 979      32.305 -15.855  -8.000  1.00118.54           C  
ATOM   6051  O   ALA A 979      32.451 -16.955  -8.537  1.00119.29           O  
ATOM   6052  CB  ALA A 979      30.694 -14.150  -8.876  1.00111.99           C  
ATOM   6053  N   GLU A 980      33.320 -15.140  -7.521  1.00 80.00           N  
ATOM   6054  CA  GLU A 980      34.697 -15.627  -7.578  1.00 83.91           C  
ATOM   6055  C   GLU A 980      34.854 -16.937  -6.808  1.00 86.82           C  
ATOM   6056  O   GLU A 980      35.512 -17.870  -7.277  1.00 87.05           O  
ATOM   6057  CB  GLU A 980      35.666 -14.577  -7.023  1.00 87.71           C  
ATOM   6058  CG  GLU A 980      35.612 -13.231  -7.732  1.00 84.12           C  
ATOM   6059  CD  GLU A 980      35.972 -13.323  -9.202  1.00 82.45           C  
ATOM   6060  OE1 GLU A 980      36.840 -14.148  -9.557  1.00 86.39           O  
ATOM   6061  OE2 GLU A 980      35.385 -12.567 -10.005  1.00 82.46           O  
ATOM   6062  N   LYS A 981      34.243 -17.000  -5.628  1.00 85.79           N  
ATOM   6063  CA  LYS A 981      34.288 -18.202  -4.802  1.00 88.18           C  
ATOM   6064  C   LYS A 981      33.619 -19.374  -5.508  1.00 85.93           C  
ATOM   6065  O   LYS A 981      34.170 -20.473  -5.557  1.00 86.96           O  
ATOM   6066  CB  LYS A 981      33.624 -17.947  -3.449  1.00 86.67           C  
ATOM   6067  CG  LYS A 981      34.274 -16.828  -2.657  1.00 90.95           C  
ATOM   6068  CD  LYS A 981      33.256 -16.088  -1.811  1.00 88.25           C  
ATOM   6069  CE  LYS A 981      33.783 -14.723  -1.405  1.00 89.28           C  
ATOM   6070  NZ  LYS A 981      32.733 -13.896  -0.754  1.00 87.65           N  
ATOM   6071  N   ALA A 982      32.434 -19.130  -6.061  1.00 83.69           N  
ATOM   6072  CA  ALA A 982      31.708 -20.156  -6.807  1.00 82.04           C  
ATOM   6073  C   ALA A 982      32.524 -20.646  -7.999  1.00 84.09           C  
ATOM   6074  O   ALA A 982      32.448 -21.817  -8.373  1.00 83.77           O  
ATOM   6075  CB  ALA A 982      30.359 -19.623  -7.267  1.00 78.43           C  
ATOM   6076  N   GLN A 983      33.303 -19.747  -8.593  1.00 84.43           N  
ATOM   6077  CA  GLN A 983      34.200 -20.116  -9.685  1.00 86.66           C  
ATOM   6078  C   GLN A 983      35.365 -20.963  -9.179  1.00 89.40           C  
ATOM   6079  O   GLN A 983      35.856 -21.844  -9.887  1.00 88.25           O  
ATOM   6080  CB  GLN A 983      34.733 -18.869 -10.395  1.00 85.91           C  
ATOM   6081  CG  GLN A 983      33.689 -18.105 -11.194  1.00 82.68           C  
ATOM   6082  CD  GLN A 983      34.242 -16.830 -11.806  1.00 89.31           C  
ATOM   6083  OE1 GLN A 983      35.455 -16.630 -11.859  1.00 84.11           O  
ATOM   6084  NE2 GLN A 983      33.351 -15.960 -12.269  1.00 86.99           N  
ATOM   6085  N   GLN A 984      35.803 -20.695  -7.952  1.00 79.25           N  
ATOM   6086  CA  GLN A 984      36.937 -21.407  -7.371  1.00 73.20           C  
ATOM   6087  C   GLN A 984      36.520 -22.677  -6.629  1.00 73.05           C  
ATOM   6088  O   GLN A 984      37.358 -23.522  -6.312  1.00 72.78           O  
ATOM   6089  CB  GLN A 984      37.712 -20.487  -6.424  1.00 74.36           C  
ATOM   6090  CG  GLN A 984      38.512 -19.402  -7.127  1.00 75.27           C  
ATOM   6091  CD  GLN A 984      39.705 -19.952  -7.889  1.00 75.78           C  
ATOM   6092  OE1 GLN A 984      40.156 -21.069  -7.634  1.00 74.29           O  
ATOM   6093  NE2 GLN A 984      40.220 -19.169  -8.828  1.00 75.01           N  
ATOM   6094  N   MET A 985      35.225 -22.812  -6.359  1.00104.59           N  
ATOM   6095  CA  MET A 985      34.712 -23.995  -5.674  1.00103.94           C  
ATOM   6096  C   MET A 985      34.552 -25.172  -6.630  1.00103.70           C  
ATOM   6097  O   MET A 985      34.046 -26.226  -6.248  1.00102.78           O  
ATOM   6098  CB  MET A 985      33.374 -23.692  -4.994  1.00104.60           C  
ATOM   6099  CG  MET A 985      33.494 -22.887  -3.710  1.00105.32           C  
ATOM   6100  SD  MET A 985      34.553 -23.668  -2.477  1.00109.38           S  
ATOM   6101  CE  MET A 985      34.489 -22.451  -1.165  1.00101.16           C  
ATOM   6102  N   TYR A 986      34.989 -24.989  -7.872  1.00 90.41           N  
ATOM   6103  CA  TYR A 986      34.913 -26.047  -8.872  1.00 98.74           C  
ATOM   6104  C   TYR A 986      35.892 -27.173  -8.549  1.00 90.36           C  
ATOM   6105  O   TYR A 986      35.701 -28.314  -8.970  1.00 92.23           O  
ATOM   6106  CB  TYR A 986      35.205 -25.493 -10.267  1.00 99.11           C  
ATOM   6107  CG  TYR A 986      36.658 -25.610 -10.671  1.00 92.34           C  
ATOM   6108  CD1 TYR A 986      37.076 -26.597 -11.557  1.00 91.95           C  
ATOM   6109  CD2 TYR A 986      37.615 -24.744 -10.156  1.00 93.99           C  
ATOM   6110  CE1 TYR A 986      38.403 -26.712 -11.923  1.00 93.22           C  
ATOM   6111  CE2 TYR A 986      38.944 -24.853 -10.517  1.00 94.94           C  
ATOM   6112  CZ  TYR A 986      39.332 -25.837 -11.401  1.00 93.19           C  
ATOM   6113  OH  TYR A 986      40.654 -25.948 -11.764  1.00 95.83           O  
ATOM   6114  N   ALA A 987      36.938 -26.840  -7.801  1.00 67.87           N  
ATOM   6115  CA  ALA A 987      38.018 -27.776  -7.514  1.00 67.69           C  
ATOM   6116  C   ALA A 987      37.570 -28.925  -6.611  1.00 67.10           C  
ATOM   6117  O   ALA A 987      37.971 -30.071  -6.812  1.00 67.53           O  
ATOM   6118  CB  ALA A 987      39.191 -27.041  -6.887  1.00 66.81           C  
ATOM   6119  N   ALA A 988      36.738 -28.616  -5.621  1.00 59.11           N  
ATOM   6120  CA  ALA A 988      36.273 -29.625  -4.675  1.00 58.76           C  
ATOM   6121  C   ALA A 988      35.092 -30.424  -5.227  1.00 56.61           C  
ATOM   6122  O   ALA A 988      34.871 -31.569  -4.832  1.00 55.45           O  
ATOM   6123  CB  ALA A 988      35.897 -28.971  -3.354  1.00 57.06           C  
ATOM   6124  N   THR A 989      34.339 -29.816  -6.140  1.00104.35           N  
ATOM   6125  CA  THR A 989      33.193 -30.474  -6.763  1.00101.76           C  
ATOM   6126  C   THR A 989      33.637 -31.638  -7.651  1.00101.70           C  
ATOM   6127  O   THR A 989      34.666 -31.546  -8.322  1.00102.60           O  
ATOM   6128  CB  THR A 989      32.369 -29.480  -7.610  1.00100.07           C  
ATOM   6129  OG1 THR A 989      33.222 -28.839  -8.566  1.00100.25           O  
ATOM   6130  CG2 THR A 989      31.727 -28.428  -6.721  1.00108.62           C  
ATOM   6131  N   LYS A 990      32.870 -32.727  -7.664  1.00 89.62           N  
ATOM   6132  CA  LYS A 990      31.624 -32.842  -6.908  1.00 87.98           C  
ATOM   6133  C   LYS A 990      31.836 -33.517  -5.558  1.00 81.99           C  
ATOM   6134  O   LYS A 990      32.347 -32.909  -4.619  1.00 80.96           O  
ATOM   6135  CB  LYS A 990      30.581 -33.622  -7.717  1.00 85.79           C  
ATOM   6136  CG  LYS A 990      30.125 -32.925  -8.989  1.00 86.21           C  
ATOM   6137  CD  LYS A 990      29.219 -31.746  -8.680  1.00 84.82           C  
ATOM   6138  CE  LYS A 990      27.926 -32.202  -8.023  1.00 80.80           C  
ATOM   6139  NZ  LYS A 990      27.181 -33.165  -8.883  1.00 87.92           N  
ATOM   6140  N   GLY A 991      31.438 -34.782  -5.473  1.00 82.31           N  
ATOM   6141  CA  GLY A 991      31.567 -35.540  -4.244  1.00 84.02           C  
ATOM   6142  C   GLY A 991      30.917 -36.903  -4.362  1.00 83.01           C  
ATOM   6143  O   GLY A 991      31.171 -37.639  -5.316  1.00 81.20           O  
ATOM   6144  N   LEU A 992      30.071 -37.236  -3.393  1.00 58.41           N  
ATOM   6145  CA  LEU A 992      29.390 -38.524  -3.380  1.00 56.38           C  
ATOM   6146  C   LEU A 992      28.487 -38.674  -4.599  1.00 55.61           C  
ATOM   6147  O   LEU A 992      28.801 -39.424  -5.522  1.00 56.61           O  
ATOM   6148  CB  LEU A 992      28.576 -38.687  -2.094  1.00 54.43           C  
ATOM   6149  CG  LEU A 992      28.548 -40.073  -1.443  1.00 54.23           C  
ATOM   6150  CD1 LEU A 992      27.761 -40.027  -0.143  1.00 53.77           C  
ATOM   6151  CD2 LEU A 992      27.975 -41.130  -2.378  1.00 55.59           C  
ATOM   6152  N   LEU A1025      17.039 -43.914   1.370  1.00 80.48           N  
ATOM   6153  CA  LEU A1025      15.794 -43.155   1.313  1.00 89.54           C  
ATOM   6154  C   LEU A1025      16.059 -41.742   0.798  1.00 87.84           C  
ATOM   6155  O   LEU A1025      16.098 -41.512  -0.412  1.00 88.17           O  
ATOM   6156  CB  LEU A1025      15.130 -43.114   2.693  1.00 89.91           C  
ATOM   6157  CG  LEU A1025      13.637 -42.790   2.746  1.00 80.23           C  
ATOM   6158  CD1 LEU A1025      12.831 -43.830   1.980  1.00 80.14           C  
ATOM   6159  CD2 LEU A1025      13.161 -42.701   4.188  1.00 80.67           C  
ATOM   6160  N   ARG A1026      16.242 -40.801   1.717  1.00 80.19           N  
ATOM   6161  CA  ARG A1026      16.579 -39.427   1.353  1.00 82.98           C  
ATOM   6162  C   ARG A1026      18.090 -39.208   1.423  1.00 88.33           C  
ATOM   6163  O   ARG A1026      18.745 -39.637   2.373  1.00 89.32           O  
ATOM   6164  CB  ARG A1026      15.841 -38.434   2.258  1.00 83.42           C  
ATOM   6165  CG  ARG A1026      15.461 -38.989   3.625  1.00 87.83           C  
ATOM   6166  CD  ARG A1026      16.641 -39.008   4.581  1.00 83.75           C  
ATOM   6167  NE  ARG A1026      16.448 -39.969   5.662  1.00 85.21           N  
ATOM   6168  CZ  ARG A1026      16.882 -41.225   5.626  1.00 84.49           C  
ATOM   6169  NH1 ARG A1026      17.537 -41.672   4.564  1.00 82.29           N  
ATOM   6170  NH2 ARG A1026      16.663 -42.035   6.653  1.00 83.71           N  
ATOM   6171  N   LYS A1027      18.637 -38.540   0.411  1.00 86.25           N  
ATOM   6172  CA  LYS A1027      20.084 -38.368   0.303  1.00 85.57           C  
ATOM   6173  C   LYS A1027      20.474 -37.333  -0.749  1.00 85.23           C  
ATOM   6174  O   LYS A1027      19.615 -36.735  -1.401  1.00 85.50           O  
ATOM   6175  CB  LYS A1027      20.756 -39.706  -0.026  1.00 86.19           C  
ATOM   6176  CG  LYS A1027      20.659 -40.140  -1.493  1.00 87.11           C  
ATOM   6177  CD  LYS A1027      19.281 -40.677  -1.867  1.00 88.17           C  
ATOM   6178  CE  LYS A1027      18.466 -39.655  -2.654  1.00 88.21           C  
ATOM   6179  NZ  LYS A1027      19.127 -39.262  -3.929  1.00 88.34           N  
ATOM   6180  N   VAL A1028      21.779 -37.128  -0.908  1.00 87.44           N  
ATOM   6181  CA  VAL A1028      22.310 -36.261  -1.953  1.00 88.73           C  
ATOM   6182  C   VAL A1028      22.148 -36.935  -3.313  1.00 86.29           C  
ATOM   6183  O   VAL A1028      22.406 -38.130  -3.454  1.00 84.38           O  
ATOM   6184  CB  VAL A1028      23.796 -35.925  -1.712  1.00 80.84           C  
ATOM   6185  CG1 VAL A1028      24.324 -35.001  -2.802  1.00 80.87           C  
ATOM   6186  CG2 VAL A1028      23.980 -35.295  -0.341  1.00 82.54           C  
ATOM   6187  N   GLN A1029      21.726 -36.163  -4.309  1.00 98.45           N  
ATOM   6188  CA  GLN A1029      21.384 -36.713  -5.618  1.00 91.48           C  
ATOM   6189  C   GLN A1029      22.610 -37.108  -6.443  1.00 94.70           C  
ATOM   6190  O   GLN A1029      22.797 -36.619  -7.557  1.00 95.20           O  
ATOM   6191  CB  GLN A1029      20.535 -35.706  -6.397  1.00 90.97           C  
ATOM   6192  CG  GLN A1029      19.522 -34.955  -5.541  1.00 98.83           C  
ATOM   6193  CD  GLN A1029      18.580 -35.878  -4.788  1.00 97.29           C  
ATOM   6194  OE1 GLN A1029      18.183 -36.930  -5.292  1.00 95.63           O  
ATOM   6195  NE2 GLN A1029      18.220 -35.489  -3.570  1.00 96.65           N  
ATOM   6196  N   ARG A1030      23.434 -38.000  -5.894  1.00 84.28           N  
ATOM   6197  CA  ARG A1030      24.596 -38.532  -6.604  1.00 86.85           C  
ATOM   6198  C   ARG A1030      25.144 -39.778  -5.908  1.00 88.08           C  
ATOM   6199  O   ARG A1030      25.611 -39.706  -4.772  1.00 82.14           O  
ATOM   6200  CB  ARG A1030      25.693 -37.471  -6.724  1.00 82.29           C  
ATOM   6201  CG  ARG A1030      26.864 -37.890  -7.602  1.00 83.84           C  
ATOM   6202  CD  ARG A1030      27.885 -36.772  -7.740  1.00 87.14           C  
ATOM   6203  NE  ARG A1030      29.019 -37.164  -8.572  1.00 87.71           N  
ATOM   6204  CZ  ARG A1030      29.051 -37.046  -9.895  1.00 87.58           C  
ATOM   6205  NH1 ARG A1030      28.007 -36.548 -10.545  1.00 83.65           N  
ATOM   6206  NH2 ARG A1030      30.126 -37.428 -10.571  1.00 90.17           N  
ATOM   6207  N   GLU A1031      25.082 -40.917  -6.595  1.00108.36           N  
ATOM   6208  CA  GLU A1031      25.535 -42.190  -6.032  1.00107.24           C  
ATOM   6209  C   GLU A1031      26.406 -42.966  -7.019  1.00101.71           C  
ATOM   6210  O   GLU A1031      26.943 -42.396  -7.969  1.00101.19           O  
ATOM   6211  CB  GLU A1031      24.340 -43.055  -5.614  1.00104.00           C  
ATOM   6212  CG  GLU A1031      23.385 -42.398  -4.623  1.00101.64           C  
ATOM   6213  CD  GLU A1031      22.369 -41.494  -5.297  1.00 98.07           C  
ATOM   6214  OE1 GLU A1031      22.266 -41.537  -6.541  1.00100.77           O  
ATOM   6215  OE2 GLU A1031      21.675 -40.739  -4.584  1.00100.11           O  
ATOM   6216  N   THR A1032      26.539 -44.271  -6.790  1.00 78.92           N  
ATOM   6217  CA  THR A1032      27.299 -45.135  -7.689  1.00 80.45           C  
ATOM   6218  C   THR A1032      26.445 -45.554  -8.883  1.00 75.11           C  
ATOM   6219  O   THR A1032      26.968 -45.911  -9.938  1.00 78.75           O  
ATOM   6220  CB  THR A1032      27.824 -46.397  -6.972  1.00 80.35           C  
ATOM   6221  OG1 THR A1032      28.574 -47.197  -7.893  1.00 79.69           O  
ATOM   6222  CG2 THR A1032      26.673 -47.223  -6.418  1.00 77.08           C  
ATOM   6223  N   ALA A1033      25.129 -45.507  -8.707  1.00113.87           N  
ATOM   6224  CA  ALA A1033      24.206 -45.794  -9.794  1.00112.27           C  
ATOM   6225  C   ALA A1033      24.179 -44.621 -10.763  1.00112.53           C  
ATOM   6226  O   ALA A1033      24.603 -43.516 -10.421  1.00113.07           O  
ATOM   6227  CB  ALA A1033      22.813 -46.082  -9.259  1.00111.53           C  
ATOM   6228  N   ARG A1034      23.683 -44.859 -11.970  1.00114.64           N  
ATOM   6229  CA  ARG A1034      23.661 -43.823 -12.995  1.00116.12           C  
ATOM   6230  C   ARG A1034      22.578 -42.785 -12.704  1.00112.29           C  
ATOM   6231  O   ARG A1034      22.703 -41.622 -13.092  1.00114.00           O  
ATOM   6232  CB  ARG A1034      23.453 -44.449 -14.374  1.00117.08           C  
ATOM   6233  CG  ARG A1034      24.420 -45.586 -14.677  1.00119.84           C  
ATOM   6234  CD  ARG A1034      25.867 -45.153 -14.474  1.00113.13           C  
ATOM   6235  NE  ARG A1034      26.794 -46.278 -14.552  1.00115.98           N  
ATOM   6236  CZ  ARG A1034      27.178 -47.005 -13.507  1.00115.12           C  
ATOM   6237  NH1 ARG A1034      28.026 -48.010 -13.671  1.00118.69           N  
ATOM   6238  NH2 ARG A1034      26.715 -46.726 -12.296  1.00111.75           N  
ATOM   6239  N   LYS A1035      21.522 -43.209 -12.018  1.00117.01           N  
ATOM   6240  CA  LYS A1035      20.454 -42.302 -11.606  1.00117.26           C  
ATOM   6241  C   LYS A1035      19.967 -42.633 -10.198  1.00114.83           C  
ATOM   6242  O   LYS A1035      20.072 -43.774  -9.746  1.00112.97           O  
ATOM   6243  CB  LYS A1035      19.289 -42.349 -12.596  1.00115.53           C  
ATOM   6244  CG  LYS A1035      19.519 -41.540 -13.865  1.00118.02           C  
ATOM   6245  CD  LYS A1035      19.700 -40.062 -13.544  1.00115.42           C  
ATOM   6246  CE  LYS A1035      19.958 -39.242 -14.798  1.00115.77           C  
ATOM   6247  NZ  LYS A1035      21.236 -39.621 -15.462  1.00118.33           N  
ATOM   6248  N   SER A1036      19.432 -41.630  -9.510  1.00 93.95           N  
ATOM   6249  CA  SER A1036      19.009 -41.789  -8.123  1.00 93.56           C  
ATOM   6250  C   SER A1036      17.586 -42.333  -8.000  1.00 94.63           C  
ATOM   6251  O   SER A1036      17.280 -43.085  -7.074  1.00 94.45           O  
ATOM   6252  CB  SER A1036      19.119 -40.454  -7.380  1.00 92.99           C  
ATOM   6253  OG  SER A1036      18.321 -39.456  -7.994  1.00 92.38           O  
ATOM   6254  N   GLN A1037      16.720 -41.952  -8.935  1.00 90.28           N  
ATOM   6255  CA  GLN A1037      15.317 -42.353  -8.887  1.00 93.07           C  
ATOM   6256  C   GLN A1037      15.124 -43.849  -9.116  1.00 99.82           C  
ATOM   6257  O   GLN A1037      15.565 -44.398 -10.125  1.00 92.03           O  
ATOM   6258  CB  GLN A1037      14.503 -41.566  -9.918  1.00 90.55           C  
ATOM   6259  CG  GLN A1037      14.236 -40.121  -9.530  1.00 92.30           C  
ATOM   6260  CD  GLN A1037      13.306 -39.997  -8.337  1.00 90.09           C  
ATOM   6261  OE1 GLN A1037      12.573 -40.930  -8.004  1.00 91.44           O  
ATOM   6262  NE2 GLN A1037      13.331 -38.840  -7.685  1.00 90.66           N  
ATOM   6263  N   TRP A1038      14.456 -44.500  -8.169  1.00115.03           N  
ATOM   6264  CA  TRP A1038      14.153 -45.923  -8.270  1.00117.46           C  
ATOM   6265  C   TRP A1038      12.940 -46.256  -7.405  1.00117.35           C  
ATOM   6266  O   TRP A1038      12.410 -45.389  -6.711  1.00117.82           O  
ATOM   6267  CB  TRP A1038      15.359 -46.765  -7.848  1.00117.01           C  
ATOM   6268  CG  TRP A1038      15.630 -47.931  -8.755  1.00117.87           C  
ATOM   6269  CD1 TRP A1038      14.896 -49.076  -8.861  1.00118.56           C  
ATOM   6270  CD2 TRP A1038      16.718 -48.064  -9.679  1.00118.37           C  
ATOM   6271  NE1 TRP A1038      15.457 -49.912  -9.796  1.00110.49           N  
ATOM   6272  CE2 TRP A1038      16.577 -49.316 -10.311  1.00110.36           C  
ATOM   6273  CE3 TRP A1038      17.798 -47.248 -10.031  1.00117.26           C  
ATOM   6274  CZ2 TRP A1038      17.473 -49.769 -11.278  1.00114.92           C  
ATOM   6275  CZ3 TRP A1038      18.686 -47.700 -10.991  1.00118.64           C  
ATOM   6276  CH2 TRP A1038      18.518 -48.950 -11.603  1.00111.45           C  
ATOM   6277  N   LYS A1039      12.502 -47.509  -7.450  1.00 84.44           N  
ATOM   6278  CA  LYS A1039      11.354 -47.938  -6.657  1.00 84.16           C  
ATOM   6279  C   LYS A1039      11.654 -49.207  -5.864  1.00 83.60           C  
ATOM   6280  O   LYS A1039      11.797 -50.290  -6.435  1.00 86.46           O  
ATOM   6281  CB  LYS A1039      10.135 -48.151  -7.558  1.00 85.91           C  
ATOM   6282  CG  LYS A1039      10.433 -48.873  -8.862  1.00 86.82           C  
ATOM   6283  CD  LYS A1039       9.153 -49.209  -9.608  1.00 86.12           C  
ATOM   6284  CE  LYS A1039       8.260 -50.117  -8.778  1.00 88.08           C  
ATOM   6285  NZ  LYS A1039       6.996 -50.451  -9.489  1.00 88.86           N  
ATOM   6286  N   LYS A1040      11.747 -49.056  -4.544  1.00 93.99           N  
ATOM   6287  CA  LYS A1040      12.001 -50.168  -3.629  1.00 95.04           C  
ATOM   6288  C   LYS A1040      13.258 -50.944  -4.015  1.00 96.47           C  
ATOM   6289  O   LYS A1040      13.243 -52.173  -4.089  1.00 95.95           O  
ATOM   6290  CB  LYS A1040      10.792 -51.108  -3.584  1.00 96.23           C  
ATOM   6291  CG  LYS A1040       9.469 -50.400  -3.336  1.00 96.49           C  
ATOM   6292  CD  LYS A1040       9.498 -49.606  -2.039  1.00 94.57           C  
ATOM   6293  CE  LYS A1040       8.226 -48.791  -1.861  1.00 97.17           C  
ATOM   6294  NZ  LYS A1040       7.009 -49.650  -1.876  1.00 92.95           N  
ATOM   6295  N   TRP A1041      14.345 -50.216  -4.257  1.00 97.73           N  
ATOM   6296  CA  TRP A1041      15.600 -50.826  -4.685  1.00 99.64           C  
ATOM   6297  C   TRP A1041      16.572 -50.971  -3.516  1.00 99.67           C  
ATOM   6298  O   TRP A1041      17.093 -49.982  -3.000  1.00 97.59           O  
ATOM   6299  CB  TRP A1041      16.232 -50.001  -5.809  1.00101.06           C  
ATOM   6300  CG  TRP A1041      17.482 -50.595  -6.397  1.00 99.99           C  
ATOM   6301  CD1 TRP A1041      18.715 -50.013  -6.457  1.00 99.29           C  
ATOM   6302  CD2 TRP A1041      17.618 -51.884  -7.013  1.00102.58           C  
ATOM   6303  NE1 TRP A1041      19.609 -50.856  -7.071  1.00101.47           N  
ATOM   6304  CE2 TRP A1041      18.961 -52.012  -7.419  1.00103.52           C  
ATOM   6305  CE3 TRP A1041      16.735 -52.940  -7.258  1.00102.76           C  
ATOM   6306  CZ2 TRP A1041      19.442 -53.154  -8.057  1.00104.79           C  
ATOM   6307  CZ3 TRP A1041      17.216 -54.073  -7.891  1.00104.12           C  
ATOM   6308  CH2 TRP A1041      18.556 -54.170  -8.283  1.00103.49           C  
ATOM   6309  N   GLU A1042      16.807 -52.214  -3.106  1.00 91.46           N  
ATOM   6310  CA  GLU A1042      17.673 -52.506  -1.969  1.00 92.61           C  
ATOM   6311  C   GLU A1042      19.150 -52.361  -2.314  1.00 93.46           C  
ATOM   6312  O   GLU A1042      19.719 -53.196  -3.016  1.00 93.25           O  
ATOM   6313  CB  GLU A1042      17.402 -53.918  -1.445  1.00 91.63           C  
ATOM   6314  CG  GLU A1042      16.061 -54.081  -0.752  1.00 91.62           C  
ATOM   6315  CD  GLU A1042      16.012 -53.388   0.596  1.00 99.54           C  
ATOM   6316  OE1 GLU A1042      15.812 -52.154   0.630  1.00 99.67           O  
ATOM   6317  OE2 GLU A1042      16.176 -54.078   1.624  1.00 91.78           O  
ATOM   6318  N   VAL A1043      19.767 -51.298  -1.805  1.00 86.03           N  
ATOM   6319  CA  VAL A1043      21.186 -51.046  -2.026  1.00 85.22           C  
ATOM   6320  C   VAL A1043      21.818 -50.338  -0.835  1.00 83.75           C  
ATOM   6321  O   VAL A1043      22.184 -49.167  -0.921  1.00 82.69           O  
ATOM   6322  CB  VAL A1043      21.423 -50.200  -3.292  1.00 85.09           C  
ATOM   6323  CG1 VAL A1043      21.617 -51.092  -4.508  1.00 86.45           C  
ATOM   6324  CG2 VAL A1043      20.277 -49.217  -3.499  1.00 84.93           C  
ATOM   6325  N   VAL A1044      21.942 -51.048   0.282  1.00 74.04           N  
ATOM   6326  CA  VAL A1044      22.582 -50.487   1.462  1.00 72.77           C  
ATOM   6327  C   VAL A1044      24.050 -50.906   1.489  1.00 72.30           C  
ATOM   6328  O   VAL A1044      24.831 -50.446   2.324  1.00 71.19           O  
ATOM   6329  CB  VAL A1044      21.876 -50.931   2.762  1.00 73.07           C  
ATOM   6330  CG1 VAL A1044      22.368 -52.299   3.199  1.00 73.78           C  
ATOM   6331  CG2 VAL A1044      22.098 -49.907   3.866  1.00 71.81           C  
ATOM   6332  N   ALA A1045      24.422 -51.776   0.555  1.00 94.34           N  
ATOM   6333  CA  ALA A1045      25.790 -52.267   0.465  1.00 95.54           C  
ATOM   6334  C   ALA A1045      26.648 -51.382  -0.434  1.00 98.63           C  
ATOM   6335  O   ALA A1045      27.831 -51.655  -0.638  1.00 91.07           O  
ATOM   6336  CB  ALA A1045      25.804 -53.701  -0.041  1.00 95.41           C  
ATOM   6337  N   GLU A1046      26.053 -50.321  -0.973  1.00 99.52           N  
ATOM   6338  CA  GLU A1046      26.775 -49.424  -1.867  1.00 93.54           C  
ATOM   6339  C   GLU A1046      27.067 -48.075  -1.212  1.00 93.88           C  
ATOM   6340  O   GLU A1046      27.942 -47.336  -1.662  1.00 96.24           O  
ATOM   6341  CB  GLU A1046      25.991 -49.222  -3.169  1.00 91.75           C  
ATOM   6342  CG  GLU A1046      24.625 -48.566  -3.001  1.00 98.16           C  
ATOM   6343  CD  GLU A1046      24.687 -47.047  -2.992  1.00 91.18           C  
ATOM   6344  OE1 GLU A1046      23.697 -46.413  -2.569  1.00 96.63           O  
ATOM   6345  OE2 GLU A1046      25.724 -46.488  -3.407  1.00 91.23           O  
ATOM   6346  N   ARG A1047      26.332 -47.759  -0.150  1.00 71.22           N  
ATOM   6347  CA  ARG A1047      26.485 -46.477   0.532  1.00 79.91           C  
ATOM   6348  C   ARG A1047      27.669 -46.472   1.496  1.00 79.47           C  
ATOM   6349  O   ARG A1047      27.541 -46.074   2.654  1.00 72.49           O  
ATOM   6350  CB  ARG A1047      25.193 -46.116   1.273  1.00 79.94           C  
ATOM   6351  CG  ARG A1047      24.475 -47.299   1.910  1.00 70.87           C  
ATOM   6352  CD  ARG A1047      24.752 -47.399   3.403  1.00 70.26           C  
ATOM   6353  NE  ARG A1047      24.245 -46.240   4.130  1.00 79.49           N  
ATOM   6354  CZ  ARG A1047      24.260 -46.123   5.454  1.00 79.06           C  
ATOM   6355  NH1 ARG A1047      24.757 -47.099   6.204  1.00 79.28           N  
ATOM   6356  NH2 ARG A1047      23.778 -45.030   6.030  1.00 72.04           N  
ATOM   6357  N   ALA A1048      28.827 -46.904   1.006  1.00 91.91           N  
ATOM   6358  CA  ALA A1048      30.035 -46.968   1.819  1.00 94.85           C  
ATOM   6359  C   ALA A1048      31.195 -46.252   1.136  1.00 97.40           C  
ATOM   6360  O   ALA A1048      32.247 -46.037   1.742  1.00 91.56           O  
ATOM   6361  CB  ALA A1048      30.401 -48.417   2.106  1.00 96.06           C  
ATOM   6362  N   TRP A1049      30.999 -45.883  -0.127  1.00101.86           N  
ATOM   6363  CA  TRP A1049      32.027 -45.180  -0.887  1.00104.07           C  
ATOM   6364  C   TRP A1049      31.762 -43.679  -0.899  1.00102.93           C  
ATOM   6365  O   TRP A1049      30.614 -43.240  -0.990  1.00103.60           O  
ATOM   6366  CB  TRP A1049      32.106 -45.717  -2.322  1.00104.20           C  
ATOM   6367  CG  TRP A1049      31.045 -45.171  -3.237  1.00102.97           C  
ATOM   6368  CD1 TRP A1049      29.728 -45.520  -3.264  1.00 98.98           C  
ATOM   6369  CD2 TRP A1049      31.218 -44.182  -4.262  1.00102.43           C  
ATOM   6370  NE1 TRP A1049      29.068 -44.808  -4.236  1.00 97.86           N  
ATOM   6371  CE2 TRP A1049      29.960 -43.981  -4.863  1.00101.10           C  
ATOM   6372  CE3 TRP A1049      32.314 -43.447  -4.726  1.00105.86           C  
ATOM   6373  CZ2 TRP A1049      29.767 -43.075  -5.905  1.00100.51           C  
ATOM   6374  CZ3 TRP A1049      32.119 -42.548  -5.760  1.00106.22           C  
ATOM   6375  CH2 TRP A1049      30.856 -42.371  -6.338  1.00101.53           C  
ATOM   6376  N   LYS A1050      32.832 -42.897  -0.797  1.00 82.91           N  
ATOM   6377  CA  LYS A1050      32.730 -41.444  -0.847  1.00 84.77           C  
ATOM   6378  C   LYS A1050      34.041 -40.839  -1.339  1.00 86.21           C  
ATOM   6379  O   LYS A1050      35.126 -41.274  -0.951  1.00 86.78           O  
ATOM   6380  CB  LYS A1050      32.355 -40.881   0.531  1.00 85.68           C  
ATOM   6381  CG  LYS A1050      31.909 -39.423   0.524  1.00 85.77           C  
ATOM   6382  CD  LYS A1050      33.077 -38.463   0.723  1.00 88.09           C  
ATOM   6383  CE  LYS A1050      32.662 -37.023   0.464  1.00 88.34           C  
ATOM   6384  NZ  LYS A1050      33.812 -36.078   0.532  1.00 82.05           N  
ATOM   6385  N   GLY A1051      33.931 -39.834  -2.200  1.00 64.88           N  
ATOM   6386  CA  GLY A1051      35.097 -39.140  -2.708  1.00 67.18           C  
ATOM   6387  C   GLY A1051      34.731 -38.078  -3.724  1.00 67.63           C  
ATOM   6388  O   GLY A1051      33.796 -38.250  -4.506  1.00 65.94           O  
ATOM   6389  N   GLY A1052      35.475 -36.976  -3.712  1.00 54.60           N  
ATOM   6390  CA  GLY A1052      35.251 -35.889  -4.646  1.00 54.39           C  
ATOM   6391  C   GLY A1052      35.621 -36.259  -6.070  1.00 54.77           C  
ATOM   6392  O   GLY A1052      36.071 -37.374  -6.336  1.00 55.40           O  
ATOM   6393  N   THR A1053      35.426 -35.321  -6.991  1.00 89.53           N  
ATOM   6394  CA  THR A1053      35.739 -35.555  -8.397  1.00 80.21           C  
ATOM   6395  C   THR A1053      36.540 -34.404  -9.003  1.00 89.73           C  
ATOM   6396  O   THR A1053      36.881 -33.439  -8.316  1.00 82.51           O  
ATOM   6397  CB  THR A1053      34.459 -35.761  -9.233  1.00 86.96           C  
ATOM   6398  OG1 THR A1053      33.583 -34.643  -9.055  1.00 84.23           O  
ATOM   6399  CG2 THR A1053      33.738 -37.035  -8.815  1.00 86.50           C  
ATOM   6400  N   GLU A1054      36.839 -34.529 -10.294  1.00 93.20           N  
ATOM   6401  CA  GLU A1054      37.495 -33.482 -11.080  1.00 94.57           C  
ATOM   6402  C   GLU A1054      38.889 -33.078 -10.587  1.00 97.59           C  
ATOM   6403  O   GLU A1054      39.779 -33.918 -10.453  1.00 98.79           O  
ATOM   6404  CB  GLU A1054      36.600 -32.239 -11.150  1.00 92.63           C  
ATOM   6405  CG  GLU A1054      35.911 -32.060 -12.489  1.00 91.21           C  
ATOM   6406  CD  GLU A1054      36.900 -31.903 -13.629  1.00 93.60           C  
ATOM   6407  OE1 GLU A1054      36.765 -32.629 -14.636  1.00 91.96           O  
ATOM   6408  OE2 GLU A1054      37.811 -31.054 -13.518  1.00 93.31           O  
ATOM   6409  N   SER A1055      39.059 -31.783 -10.328  1.00 72.08           N  
ATOM   6410  CA  SER A1055      40.373 -31.172 -10.118  1.00 71.58           C  
ATOM   6411  C   SER A1055      41.210 -31.786  -8.994  1.00 70.39           C  
ATOM   6412  O   SER A1055      42.257 -32.382  -9.248  1.00 70.76           O  
ATOM   6413  CB  SER A1055      40.207 -29.673  -9.849  1.00 70.90           C  
ATOM   6414  OG  SER A1055      41.461 -29.055  -9.621  1.00 70.44           O  
ATOM   6415  N   GLU A1056      40.753 -31.632  -7.757  1.00 89.82           N  
ATOM   6416  CA  GLU A1056      41.571 -31.975  -6.598  1.00 87.92           C  
ATOM   6417  C   GLU A1056      41.748 -33.477  -6.385  1.00 80.04           C  
ATOM   6418  O   GLU A1056      41.289 -34.295  -7.182  1.00 89.75           O  
ATOM   6419  CB  GLU A1056      40.980 -31.346  -5.337  1.00 82.56           C  
ATOM   6420  CG  GLU A1056      40.930 -29.830  -5.388  1.00 82.18           C  
ATOM   6421  CD  GLU A1056      42.245 -29.220  -5.829  1.00 85.23           C  
ATOM   6422  OE1 GLU A1056      42.244 -28.445  -6.808  1.00 81.47           O  
ATOM   6423  OE2 GLU A1056      43.281 -29.514  -5.197  1.00 84.72           O  
ATOM   6424  N   MET A1057      42.422 -33.818  -5.291  1.00 72.88           N  
ATOM   6425  CA  MET A1057      42.795 -35.197  -4.995  1.00 73.58           C  
ATOM   6426  C   MET A1057      42.495 -35.546  -3.542  1.00 72.82           C  
ATOM   6427  O   MET A1057      43.144 -36.414  -2.954  1.00 71.89           O  
ATOM   6428  CB  MET A1057      44.279 -35.412  -5.289  1.00 74.99           C  
ATOM   6429  CG  MET A1057      45.203 -34.626  -4.367  1.00 76.47           C  
ATOM   6430  SD  MET A1057      44.738 -32.891  -4.233  1.00 75.38           S  
ATOM   6431  CE  MET A1057      45.215 -32.542  -2.544  1.00 76.28           C  
ATOM   6432  N   PHE A1058      41.500 -34.872  -2.971  1.00 74.87           N  
ATOM   6433  CA  PHE A1058      41.117 -35.068  -1.573  1.00 74.97           C  
ATOM   6434  C   PHE A1058      40.765 -36.520  -1.262  1.00 73.71           C  
ATOM   6435  O   PHE A1058      40.746 -36.932  -0.102  1.00 73.91           O  
ATOM   6436  CB  PHE A1058      39.932 -34.165  -1.219  1.00 74.98           C  
ATOM   6437  CG  PHE A1058      40.223 -32.696  -1.354  1.00 73.77           C  
ATOM   6438  CD1 PHE A1058      41.416 -32.166  -0.893  1.00 77.38           C  
ATOM   6439  CD2 PHE A1058      39.304 -31.848  -1.949  1.00 73.22           C  
ATOM   6440  CE1 PHE A1058      41.685 -30.815  -1.017  1.00 77.80           C  
ATOM   6441  CE2 PHE A1058      39.567 -30.494  -2.077  1.00 74.41           C  
ATOM   6442  CZ  PHE A1058      40.759 -29.977  -1.610  1.00 77.00           C  
ATOM   6443  N   ASN A1059      40.485 -37.288  -2.310  1.00 87.57           N  
ATOM   6444  CA  ASN A1059      40.128 -38.694  -2.181  1.00 86.03           C  
ATOM   6445  C   ASN A1059      41.236 -39.527  -1.540  1.00 86.69           C  
ATOM   6446  O   ASN A1059      40.957 -40.478  -0.813  1.00 85.72           O  
ATOM   6447  CB  ASN A1059      39.778 -39.266  -3.553  1.00 81.62           C  
ATOM   6448  CG  ASN A1059      38.978 -38.296  -4.400  1.00 85.49           C  
ATOM   6449  OD1 ASN A1059      37.761 -38.191  -4.262  1.00 83.54           O  
ATOM   6450  ND2 ASN A1059      39.663 -37.578  -5.284  1.00 85.37           N  
ATOM   6451  N   LYS A1060      42.487 -39.169  -1.813  1.00 58.65           N  
ATOM   6452  CA  LYS A1060      43.628 -39.890  -1.251  1.00 59.56           C  
ATOM   6453  C   LYS A1060      43.859 -39.465   0.197  1.00 59.55           C  
ATOM   6454  O   LYS A1060      44.158 -40.295   1.063  1.00 59.75           O  
ATOM   6455  CB  LYS A1060      44.886 -39.650  -2.089  1.00 60.58           C  
ATOM   6456  CG  LYS A1060      45.818 -40.855  -2.193  1.00 62.21           C  
ATOM   6457  CD  LYS A1060      46.593 -41.105  -0.906  1.00 63.60           C  
ATOM   6458  CE  LYS A1060      47.479 -42.335  -1.028  1.00 64.75           C  
ATOM   6459  NZ  LYS A1060      48.477 -42.208  -2.128  1.00 65.92           N  
ATOM   6460  N   LEU A1061      43.714 -38.169   0.451  1.00 53.96           N  
ATOM   6461  CA  LEU A1061      43.850 -37.628   1.798  1.00 52.40           C  
ATOM   6462  C   LEU A1061      42.774 -38.203   2.714  1.00 54.46           C  
ATOM   6463  O   LEU A1061      42.969 -38.308   3.924  1.00 52.03           O  
ATOM   6464  CB  LEU A1061      43.774 -36.100   1.768  1.00 52.80           C  
ATOM   6465  CG  LEU A1061      44.869 -35.408   0.951  1.00 55.39           C  
ATOM   6466  CD1 LEU A1061      44.646 -33.904   0.906  1.00 53.71           C  
ATOM   6467  CD2 LEU A1061      46.243 -35.733   1.516  1.00 54.38           C  
ATOM   6468  N   GLU A1062      41.640 -38.575   2.128  1.00 73.52           N  
ATOM   6469  CA  GLU A1062      40.591 -39.270   2.865  1.00 71.53           C  
ATOM   6470  C   GLU A1062      40.877 -40.767   2.915  1.00 79.61           C  
ATOM   6471  O   GLU A1062      40.478 -41.450   3.857  1.00 71.50           O  
ATOM   6472  CB  GLU A1062      39.218 -39.016   2.236  1.00 78.94           C  
ATOM   6473  CG  GLU A1062      38.702 -37.594   2.400  1.00 72.95           C  
ATOM   6474  CD  GLU A1062      37.287 -37.422   1.877  1.00 70.93           C  
ATOM   6475  OE1 GLU A1062      36.722 -38.407   1.357  1.00 78.70           O  
ATOM   6476  OE2 GLU A1062      36.740 -36.304   1.987  1.00 70.77           O  
ATOM   6477  N   SER A1063      41.574 -41.270   1.899  1.00 77.67           N  
ATOM   6478  CA  SER A1063      41.927 -42.685   1.831  1.00 77.26           C  
ATOM   6479  C   SER A1063      42.869 -43.056   2.967  1.00 80.30           C  
ATOM   6480  O   SER A1063      42.788 -44.153   3.523  1.00 78.89           O  
ATOM   6481  CB  SER A1063      42.570 -43.021   0.482  1.00 79.74           C  
ATOM   6482  OG  SER A1063      42.990 -44.375   0.442  1.00 81.01           O  
ATOM   6483  N   ILE A1064      43.762 -42.134   3.308  1.00 54.32           N  
ATOM   6484  CA  ILE A1064      44.653 -42.329   4.445  1.00 53.29           C  
ATOM   6485  C   ILE A1064      43.893 -42.043   5.740  1.00 52.68           C  
ATOM   6486  O   ILE A1064      44.307 -42.453   6.824  1.00 53.11           O  
ATOM   6487  CB  ILE A1064      45.903 -41.427   4.342  1.00 52.57           C  
ATOM   6488  CG1 ILE A1064      46.494 -41.494   2.934  1.00 53.30           C  
ATOM   6489  CG2 ILE A1064      46.955 -41.839   5.359  1.00 54.60           C  
ATOM   6490  CD1 ILE A1064      47.010 -42.868   2.553  1.00 54.48           C  
ATOM   6491  N   ALA A1065      42.762 -41.356   5.617  1.00 60.47           N  
ATOM   6492  CA  ALA A1065      41.955 -40.986   6.777  1.00 69.82           C  
ATOM   6493  C   ALA A1065      40.824 -41.980   7.042  1.00 69.84           C  
ATOM   6494  O   ALA A1065      39.992 -41.760   7.925  1.00 69.93           O  
ATOM   6495  CB  ALA A1065      41.387 -39.586   6.596  1.00 60.67           C  
ATOM   6496  N   THR A1066      40.790 -43.068   6.281  1.00 83.64           N  
ATOM   6497  CA  THR A1066      39.765 -44.091   6.467  1.00 80.45           C  
ATOM   6498  C   THR A1066      40.359 -45.374   7.032  1.00 81.20           C  
ATOM   6499  O   THR A1066      39.654 -46.180   7.639  1.00 89.16           O  
ATOM   6500  CB  THR A1066      39.039 -44.418   5.151  1.00 81.59           C  
ATOM   6501  OG1 THR A1066      39.999 -44.571   4.098  1.00 81.80           O  
ATOM   6502  CG2 THR A1066      38.066 -43.309   4.789  1.00 89.69           C  
ATOM   6503  N   SER A1067      41.660 -45.557   6.827  1.00 62.68           N  
ATOM   6504  CA  SER A1067      42.343 -46.761   7.281  1.00 63.00           C  
ATOM   6505  C   SER A1067      42.366 -46.845   8.803  1.00 64.00           C  
ATOM   6506  O   SER A1067      42.812 -45.918   9.475  1.00 63.60           O  
ATOM   6507  CB  SER A1067      43.769 -46.804   6.729  1.00 64.46           C  
ATOM   6508  OG  SER A1067      43.771 -46.705   5.316  1.00 64.84           O  
ATOM   6509  N   ASP A1068      41.881 -47.961   9.338  1.00 84.11           N  
ATOM   6510  CA  ASP A1068      41.900 -48.191  10.779  1.00 87.35           C  
ATOM   6511  C   ASP A1068      43.253 -48.747  11.213  1.00 88.19           C  
ATOM   6512  O   ASP A1068      43.421 -49.202  12.345  1.00 86.29           O  
ATOM   6513  CB  ASP A1068      40.772 -49.142  11.193  1.00 87.17           C  
ATOM   6514  CG  ASP A1068      40.667 -50.358  10.290  1.00 85.47           C  
ATOM   6515  OD1 ASP A1068      39.579 -50.972  10.247  1.00 81.71           O  
ATOM   6516  OD2 ASP A1068      41.664 -50.704   9.621  1.00 85.32           O  
ATOM   6517  N   ILE A1069      44.213 -48.695  10.296  1.00 86.01           N  
ATOM   6518  CA  ILE A1069      45.550 -49.222  10.521  1.00 85.08           C  
ATOM   6519  C   ILE A1069      46.595 -48.138  10.230  1.00 82.60           C  
ATOM   6520  O   ILE A1069      46.493 -47.443   9.221  1.00 88.11           O  
ATOM   6521  CB  ILE A1069      45.799 -50.472   9.643  1.00 86.47           C  
ATOM   6522  CG1 ILE A1069      45.103 -50.320   8.289  1.00 86.02           C  
ATOM   6523  CG2 ILE A1069      45.294 -51.720  10.348  1.00 82.57           C  
ATOM   6524  CD1 ILE A1069      45.153 -51.568   7.432  1.00 87.11           C  
ATOM   6525  N   PRO A1070      47.616 -48.019  11.102  1.00103.81           N  
ATOM   6526  CA  PRO A1070      48.634 -46.968  11.230  1.00106.99           C  
ATOM   6527  C   PRO A1070      48.544 -45.719  10.331  1.00102.87           C  
ATOM   6528  O   PRO A1070      48.794 -44.629  10.844  1.00106.55           O  
ATOM   6529  CB  PRO A1070      49.915 -47.752  10.936  1.00107.71           C  
ATOM   6530  CG  PRO A1070      49.605 -49.177  11.486  1.00102.71           C  
ATOM   6531  CD  PRO A1070      48.108 -49.224  11.786  1.00101.40           C  
ATOM   6532  N   ARG A1071      48.197 -45.868   9.053  1.00 67.64           N  
ATOM   6533  CA  ARG A1071      48.126 -44.738   8.117  1.00 67.56           C  
ATOM   6534  C   ARG A1071      49.430 -43.941   8.097  1.00 63.71           C  
ATOM   6535  O   ARG A1071      49.485 -42.825   8.613  1.00 60.87           O  
ATOM   6536  CB  ARG A1071      46.967 -43.793   8.466  1.00 69.64           C  
ATOM   6537  CG  ARG A1071      45.680 -44.461   8.924  1.00 65.88           C  
ATOM   6538  CD  ARG A1071      45.516 -44.345  10.433  1.00 62.61           C  
ATOM   6539  NE  ARG A1071      45.648 -42.965  10.890  1.00 66.32           N  
ATOM   6540  CZ  ARG A1071      45.824 -42.610  12.161  1.00 68.89           C  
ATOM   6541  NH1 ARG A1071      45.892 -43.537  13.104  1.00 66.17           N  
ATOM   6542  NH2 ARG A1071      45.936 -41.328  12.486  1.00 69.24           N  
ATOM   6543  N   THR A1072      50.477 -44.507   7.502  1.00131.43           N  
ATOM   6544  CA  THR A1072      51.812 -43.919   7.606  1.00131.73           C  
ATOM   6545  C   THR A1072      52.540 -43.738   6.275  1.00133.40           C  
ATOM   6546  O   THR A1072      53.388 -44.557   5.919  1.00135.53           O  
ATOM   6547  CB  THR A1072      52.717 -44.781   8.502  1.00132.17           C  
ATOM   6548  OG1 THR A1072      53.110 -45.962   7.793  1.00131.38           O  
ATOM   6549  CG2 THR A1072      52.003 -45.172   9.768  1.00130.34           C  
ATOM   6550  N   PRO A1073      52.222 -42.667   5.535  1.00 64.42           N  
ATOM   6551  CA  PRO A1073      52.938 -42.433   4.280  1.00 65.44           C  
ATOM   6552  C   PRO A1073      53.741 -41.126   4.227  1.00 64.38           C  
ATOM   6553  O   PRO A1073      53.187 -40.106   4.634  1.00 63.90           O  
ATOM   6554  CB  PRO A1073      51.799 -42.392   3.258  1.00 65.22           C  
ATOM   6555  CG  PRO A1073      50.560 -41.933   4.071  1.00 63.51           C  
ATOM   6556  CD  PRO A1073      50.932 -41.961   5.544  1.00 63.17           C  
ATOM   6557  N   VAL A1074      54.993 -41.113   3.755  1.00 66.90           N  
ATOM   6558  CA  VAL A1074      55.849 -42.267   3.440  1.00 69.68           C  
ATOM   6559  C   VAL A1074      57.293 -41.765   3.410  1.00 68.99           C  
ATOM   6560  O   VAL A1074      57.713 -41.215   2.393  1.00 68.94           O  
ATOM   6561  CB  VAL A1074      55.559 -42.926   2.056  1.00 62.20           C  
ATOM   6562  CG1 VAL A1074      54.958 -44.324   2.213  1.00 61.33           C  
ATOM   6563  CG2 VAL A1074      54.699 -42.026   1.170  1.00 68.81           C  
ATOM   6564  N   LEU A1075      58.064 -41.918   4.486  1.00 63.63           N  
ATOM   6565  CA  LEU A1075      57.659 -42.530   5.748  1.00 65.24           C  
ATOM   6566  C   LEU A1075      56.703 -41.628   6.535  1.00 62.70           C  
ATOM   6567  O   LEU A1075      56.687 -40.417   6.321  1.00 61.01           O  
ATOM   6568  CB  LEU A1075      58.906 -42.837   6.586  1.00 61.86           C  
ATOM   6569  CG  LEU A1075      59.708 -41.615   7.038  1.00 62.51           C  
ATOM   6570  CD1 LEU A1075      60.206 -41.793   8.461  1.00 61.28           C  
ATOM   6571  CD2 LEU A1075      60.874 -41.357   6.096  1.00 59.99           C  
ATOM   6572  N   GLY A1076      55.907 -42.203   7.435  1.00 65.72           N  
ATOM   6573  CA  GLY A1076      55.907 -43.631   7.703  1.00 66.09           C  
ATOM   6574  C   GLY A1076      55.933 -43.918   9.190  1.00 66.48           C  
ATOM   6575  O   GLY A1076      56.594 -44.852   9.642  1.00 65.82           O  
ATOM   6576  N   CYS A1077      55.204 -43.106   9.951  1.00 75.79           N  
ATOM   6577  CA  CYS A1077      55.112 -43.263  11.398  1.00 72.99           C  
ATOM   6578  C   CYS A1077      53.691 -42.983  11.872  1.00 73.66           C  
ATOM   6579  O   CYS A1077      53.147 -41.913  11.606  1.00 69.41           O  
ATOM   6580  CB  CYS A1077      56.096 -42.330  12.108  1.00 72.65           C  
ATOM   6581  SG  CYS A1077      57.828 -42.533  11.622  1.00 72.62           S  
ATOM   6582  N   CYS A1078      53.088 -43.940  12.569  1.00 73.74           N  
ATOM   6583  CA  CYS A1078      51.716 -43.778  13.045  1.00 74.69           C  
ATOM   6584  C   CYS A1078      51.677 -42.961  14.328  1.00 73.29           C  
ATOM   6585  O   CYS A1078      52.620 -42.985  15.120  1.00 71.42           O  
ATOM   6586  CB  CYS A1078      51.052 -45.139  13.263  1.00 74.71           C  
ATOM   6587  SG  CYS A1078      51.901 -46.232  14.426  1.00 74.14           S  
ATOM   6588  N   ILE A1079      50.585 -42.236  14.529  1.00 77.48           N  
ATOM   6589  CA  ILE A1079      50.455 -41.376  15.698  1.00 79.72           C  
ATOM   6590  C   ILE A1079      49.130 -41.568  16.417  1.00 76.44           C  
ATOM   6591  O   ILE A1079      48.100 -41.802  15.782  1.00 70.64           O  
ATOM   6592  CB  ILE A1079      50.587 -39.884  15.321  1.00 70.58           C  
ATOM   6593  CG1 ILE A1079      49.543 -39.503  14.269  1.00 72.42           C  
ATOM   6594  CG2 ILE A1079      51.994 -39.573  14.833  1.00 71.59           C  
ATOM   6595  CD1 ILE A1079      48.408 -38.647  14.790  1.00 72.12           C  
ATOM   6596  N   SER A1080      49.182 -41.473  17.742  1.00 67.11           N  
ATOM   6597  CA  SER A1080      48.001 -41.351  18.597  1.00 68.49           C  
ATOM   6598  C   SER A1080      47.043 -42.538  18.554  1.00 67.56           C  
ATOM   6599  O   SER A1080      46.498 -42.883  17.508  1.00 66.35           O  
ATOM   6600  CB  SER A1080      47.230 -40.081  18.237  1.00 63.23           C  
ATOM   6601  OG  SER A1080      46.587 -40.216  16.984  1.00 62.59           O  
ATOM   6602  N   ARG A1081      46.819 -43.143  19.714  1.00 75.37           N  
ATOM   6603  CA  ARG A1081      45.772 -44.144  19.844  1.00 74.94           C  
ATOM   6604  C   ARG A1081      44.429 -43.450  20.048  1.00 79.13           C  
ATOM   6605  O   ARG A1081      43.406 -44.100  20.263  1.00 76.93           O  
ATOM   6606  CB  ARG A1081      46.063 -45.096  21.007  1.00 75.96           C  
ATOM   6607  CG  ARG A1081      47.281 -45.989  20.815  1.00 71.63           C  
ATOM   6608  CD  ARG A1081      48.533 -45.367  21.410  1.00 73.94           C  
ATOM   6609  NE  ARG A1081      49.292 -46.332  22.200  1.00 79.74           N  
ATOM   6610  CZ  ARG A1081      49.082 -46.566  23.492  1.00 70.09           C  
ATOM   6611  NH1 ARG A1081      48.133 -45.906  24.142  1.00 71.18           N  
ATOM   6612  NH2 ARG A1081      49.820 -47.462  24.134  1.00 76.81           N  
ATOM   6613  N   ALA A1082      44.442 -42.121  19.976  1.00 56.80           N  
ATOM   6614  CA  ALA A1082      43.251 -41.318  20.233  1.00 59.03           C  
ATOM   6615  C   ALA A1082      42.641 -40.751  18.952  1.00 50.67           C  
ATOM   6616  O   ALA A1082      41.493 -40.306  18.953  1.00 52.63           O  
ATOM   6617  CB  ALA A1082      43.579 -40.190  21.203  1.00 50.81           C  
ATOM   6618  N   LEU A1083      43.408 -40.757  17.866  1.00 40.56           N  
ATOM   6619  CA  LEU A1083      42.900 -40.285  16.580  1.00 41.25           C  
ATOM   6620  C   LEU A1083      42.757 -41.434  15.591  1.00 40.23           C  
ATOM   6621  O   LEU A1083      42.165 -41.276  14.523  1.00 40.69           O  
ATOM   6622  CB  LEU A1083      43.809 -39.202  15.998  1.00 41.59           C  
ATOM   6623  CG  LEU A1083      43.906 -37.898  16.790  1.00 43.10           C  
ATOM   6624  CD1 LEU A1083      44.876 -36.947  16.119  1.00 43.18           C  
ATOM   6625  CD2 LEU A1083      42.536 -37.258  16.930  1.00 45.17           C  
ATOM   6626  N   GLU A1084      43.311 -42.588  15.949  1.00 66.76           N  
ATOM   6627  CA  GLU A1084      43.173 -43.785  15.134  1.00 61.38           C  
ATOM   6628  C   GLU A1084      41.708 -44.213  15.116  1.00 65.52           C  
ATOM   6629  O   GLU A1084      41.128 -44.473  16.166  1.00 60.61           O  
ATOM   6630  CB  GLU A1084      44.066 -44.906  15.673  1.00 59.54           C  
ATOM   6631  CG  GLU A1084      44.330 -46.030  14.689  1.00 62.33           C  
ATOM   6632  CD  GLU A1084      45.420 -46.966  15.170  1.00 61.32           C  
ATOM   6633  OE1 GLU A1084      45.788 -46.886  16.361  1.00 59.16           O  
ATOM   6634  OE2 GLU A1084      45.912 -47.776  14.356  1.00 59.78           O  
ATOM   6635  N   PRO A1085      41.109 -44.291  13.915  1.00 55.33           N  
ATOM   6636  CA  PRO A1085      39.668 -44.540  13.764  1.00 54.90           C  
ATOM   6637  C   PRO A1085      39.207 -45.853  14.393  1.00 52.98           C  
ATOM   6638  O   PRO A1085      38.005 -46.057  14.551  1.00 52.62           O  
ATOM   6639  CB  PRO A1085      39.473 -44.567  12.245  1.00 58.03           C  
ATOM   6640  CG  PRO A1085      40.811 -44.885  11.694  1.00 53.87           C  
ATOM   6641  CD  PRO A1085      41.796 -44.239  12.616  1.00 55.13           C  
ATOM   6642  N   SER A1086      40.145 -46.729  14.736  1.00 58.81           N  
ATOM   6643  CA  SER A1086      39.813 -47.920  15.503  1.00 59.46           C  
ATOM   6644  C   SER A1086      39.393 -47.508  16.910  1.00 59.32           C  
ATOM   6645  O   SER A1086      40.150 -46.845  17.620  1.00 51.38           O  
ATOM   6646  CB  SER A1086      40.996 -48.891  15.552  1.00 50.30           C  
ATOM   6647  OG  SER A1086      42.127 -48.288  16.157  1.00 58.39           O  
ATOM   6648  N   ALA A1087      38.174 -47.887  17.288  1.00116.75           N  
ATOM   6649  CA  ALA A1087      37.586 -47.534  18.581  1.00110.19           C  
ATOM   6650  C   ALA A1087      37.470 -46.021  18.779  1.00114.47           C  
ATOM   6651  O   ALA A1087      37.413 -45.541  19.908  1.00115.20           O  
ATOM   6652  CB  ALA A1087      38.386 -48.158  19.724  1.00118.57           C  
ATOM   6653  N   VAL A1088      37.451 -45.276  17.676  1.00 80.55           N  
ATOM   6654  CA  VAL A1088      37.169 -43.843  17.711  1.00 80.64           C  
ATOM   6655  C   VAL A1088      36.187 -43.524  16.581  1.00 85.75           C  
ATOM   6656  O   VAL A1088      36.283 -44.089  15.493  1.00 84.53           O  
ATOM   6657  CB  VAL A1088      38.451 -42.986  17.578  1.00 82.14           C  
ATOM   6658  CG1 VAL A1088      38.127 -41.512  17.733  1.00 84.80           C  
ATOM   6659  CG2 VAL A1088      39.480 -43.394  18.622  1.00 80.00           C  
ATOM   6660  N   GLN A1089      35.250 -42.617  16.851  1.00100.00           N  
ATOM   6661  CA  GLN A1089      34.103 -42.353  15.969  1.00101.13           C  
ATOM   6662  C   GLN A1089      34.342 -42.273  14.440  1.00108.56           C  
ATOM   6663  O   GLN A1089      33.627 -42.945  13.700  1.00106.39           O  
ATOM   6664  CB  GLN A1089      33.399 -41.067  16.429  1.00104.17           C  
ATOM   6665  CG  GLN A1089      32.230 -40.647  15.550  1.00105.43           C  
ATOM   6666  CD  GLN A1089      31.119 -41.683  15.514  1.00103.33           C  
ATOM   6667  OE1 GLN A1089      30.988 -42.506  16.419  1.00103.30           O  
ATOM   6668  NE2 GLN A1089      30.310 -41.643  14.460  1.00102.71           N  
ATOM   6669  N   GLU A1090      35.306 -41.494  13.938  1.00 79.32           N  
ATOM   6670  CA  GLU A1090      36.279 -40.727  14.708  1.00 81.35           C  
ATOM   6671  C   GLU A1090      36.018 -39.225  14.639  1.00 87.19           C  
ATOM   6672  O   GLU A1090      36.591 -38.457  15.412  1.00 89.75           O  
ATOM   6673  CB  GLU A1090      37.691 -41.046  14.217  1.00 78.84           C  
ATOM   6674  CG  GLU A1090      37.833 -41.088  12.706  1.00 80.09           C  
ATOM   6675  CD  GLU A1090      38.448 -39.825  12.144  1.00 78.20           C  
ATOM   6676  OE1 GLU A1090      38.800 -38.929  12.939  1.00 80.74           O  
ATOM   6677  OE2 GLU A1090      38.591 -39.733  10.908  1.00 74.96           O  
ATOM   6678  N   GLU A1091      35.166 -38.823  13.697  1.00 79.33           N  
ATOM   6679  CA  GLU A1091      34.691 -37.439  13.530  1.00 84.31           C  
ATOM   6680  C   GLU A1091      35.777 -36.351  13.549  1.00 86.13           C  
ATOM   6681  O   GLU A1091      35.462 -35.160  13.596  1.00 89.61           O  
ATOM   6682  CB  GLU A1091      33.626 -37.124  14.595  1.00 87.35           C  
ATOM   6683  CG  GLU A1091      34.156 -36.736  15.972  1.00 88.62           C  
ATOM   6684  CD  GLU A1091      33.094 -36.820  17.053  1.00 83.65           C  
ATOM   6685  OE1 GLU A1091      32.579 -35.762  17.472  1.00 86.63           O  
ATOM   6686  OE2 GLU A1091      32.777 -37.947  17.488  1.00 89.95           O  
ATOM   6687  N   PHE A1092      37.043 -36.751  13.492  1.00 67.52           N  
ATOM   6688  CA  PHE A1092      38.152 -35.801  13.456  1.00 68.29           C  
ATOM   6689  C   PHE A1092      38.874 -35.869  12.114  1.00 65.77           C  
ATOM   6690  O   PHE A1092      40.085 -36.085  12.064  1.00 62.55           O  
ATOM   6691  CB  PHE A1092      39.141 -36.075  14.592  1.00 66.04           C  
ATOM   6692  CG  PHE A1092      38.558 -35.894  15.964  1.00 68.81           C  
ATOM   6693  CD1 PHE A1092      39.052 -36.614  17.040  1.00 69.63           C  
ATOM   6694  CD2 PHE A1092      37.523 -35.002  16.182  1.00 74.13           C  
ATOM   6695  CE1 PHE A1092      38.522 -36.450  18.305  1.00 71.86           C  
ATOM   6696  CE2 PHE A1092      36.988 -34.835  17.445  1.00 76.44           C  
ATOM   6697  CZ  PHE A1092      37.488 -35.560  18.509  1.00 76.65           C  
ATOM   6698  N   MET A1093      38.126 -35.680  11.032  1.00 66.90           N  
ATOM   6699  CA  MET A1093      38.649 -35.867   9.681  1.00 66.12           C  
ATOM   6700  C   MET A1093      39.701 -34.832   9.290  1.00 64.51           C  
ATOM   6701  O   MET A1093      40.795 -35.188   8.850  1.00 64.36           O  
ATOM   6702  CB  MET A1093      37.506 -35.834   8.667  1.00 62.89           C  
ATOM   6703  CG  MET A1093      36.499 -36.965   8.808  1.00 62.44           C  
ATOM   6704  SD  MET A1093      37.184 -38.566   8.349  1.00 60.27           S  
ATOM   6705  CE  MET A1093      37.715 -38.239   6.669  1.00 54.10           C  
ATOM   6706  N   THR A1094      39.353 -33.556   9.440  1.00 58.12           N  
ATOM   6707  CA  THR A1094      40.227 -32.453   9.048  1.00 58.49           C  
ATOM   6708  C   THR A1094      41.583 -32.523   9.735  1.00 58.55           C  
ATOM   6709  O   THR A1094      42.628 -32.321   9.107  1.00 57.57           O  
ATOM   6710  CB  THR A1094      39.581 -31.096   9.368  1.00 60.69           C  
ATOM   6711  OG1 THR A1094      39.297 -31.027  10.770  1.00 62.97           O  
ATOM   6712  CG2 THR A1094      38.290 -30.926   8.585  1.00 60.22           C  
ATOM   6713  N   SER A1095      41.552 -32.819  11.030  1.00 68.79           N  
ATOM   6714  CA  SER A1095      42.765 -32.956  11.823  1.00 68.52           C  
ATOM   6715  C   SER A1095      43.621 -34.110  11.316  1.00 64.86           C  
ATOM   6716  O   SER A1095      44.838 -34.107  11.491  1.00 63.98           O  
ATOM   6717  CB  SER A1095      42.421 -33.167  13.298  1.00 60.39           C  
ATOM   6718  OG  SER A1095      41.604 -32.116  13.781  1.00 64.45           O  
ATOM   6719  N   ARG A1096      42.985 -35.087  10.681  1.00 64.89           N  
ATOM   6720  CA  ARG A1096      43.699 -36.250  10.170  1.00 62.45           C  
ATOM   6721  C   ARG A1096      44.256 -36.024   8.765  1.00 61.67           C  
ATOM   6722  O   ARG A1096      45.310 -36.548   8.426  1.00 63.10           O  
ATOM   6723  CB  ARG A1096      42.794 -37.480  10.184  1.00 63.63           C  
ATOM   6724  CG  ARG A1096      42.559 -38.039  11.575  1.00 65.69           C  
ATOM   6725  CD  ARG A1096      41.729 -39.304  11.518  1.00 63.08           C  
ATOM   6726  NE  ARG A1096      42.403 -40.369  10.781  1.00 60.55           N  
ATOM   6727  CZ  ARG A1096      41.813 -41.492  10.387  1.00 60.03           C  
ATOM   6728  NH1 ARG A1096      40.529 -41.694  10.652  1.00 69.07           N  
ATOM   6729  NH2 ARG A1096      42.500 -42.409   9.724  1.00 67.83           N  
ATOM   6730  N   VAL A1097      43.550 -35.254   7.946  1.00 54.41           N  
ATOM   6731  CA  VAL A1097      44.088 -34.866   6.645  1.00 54.08           C  
ATOM   6732  C   VAL A1097      45.319 -33.990   6.876  1.00 56.74           C  
ATOM   6733  O   VAL A1097      46.414 -34.234   6.326  1.00 54.37           O  
ATOM   6734  CB  VAL A1097      43.048 -34.109   5.798  1.00 55.09           C  
ATOM   6735  CG1 VAL A1097      43.655 -33.655   4.482  1.00 54.05           C  
ATOM   6736  CG2 VAL A1097      41.826 -34.981   5.559  1.00 53.67           C  
ATOM   6737  N   ASN A1098      45.124 -32.977   7.717  1.00 66.58           N  
ATOM   6738  CA  ASN A1098      46.211 -32.117   8.154  1.00 67.18           C  
ATOM   6739  C   ASN A1098      47.327 -32.950   8.772  1.00 66.62           C  
ATOM   6740  O   ASN A1098      48.503 -32.659   8.570  1.00 65.14           O  
ATOM   6741  CB  ASN A1098      45.706 -31.068   9.148  1.00 71.37           C  
ATOM   6742  CG  ASN A1098      46.772 -30.053   9.517  1.00 72.47           C  
ATOM   6743  OD1 ASN A1098      47.377 -30.132  10.586  1.00 74.61           O  
ATOM   6744  ND2 ASN A1098      47.010 -29.094   8.630  1.00 69.91           N  
ATOM   6745  N   TRP A1099      46.958 -33.995   9.511  1.00 53.98           N  
ATOM   6746  CA  TRP A1099      47.949 -34.911  10.068  1.00 57.60           C  
ATOM   6747  C   TRP A1099      48.768 -35.543   8.952  1.00 59.81           C  
ATOM   6748  O   TRP A1099      49.985 -35.594   9.039  1.00 51.00           O  
ATOM   6749  CB  TRP A1099      47.285 -35.997  10.929  1.00 57.49           C  
ATOM   6750  CG  TRP A1099      47.708 -37.417  10.604  1.00 56.17           C  
ATOM   6751  CD1 TRP A1099      46.949 -38.379  10.003  1.00 55.39           C  
ATOM   6752  CD2 TRP A1099      48.982 -38.023  10.869  1.00 54.27           C  
ATOM   6753  NE1 TRP A1099      47.670 -39.542   9.873  1.00 54.20           N  
ATOM   6754  CE2 TRP A1099      48.921 -39.349  10.395  1.00 54.66           C  
ATOM   6755  CE3 TRP A1099      50.167 -37.571  11.453  1.00 54.59           C  
ATOM   6756  CZ2 TRP A1099      49.998 -40.225  10.492  1.00 53.85           C  
ATOM   6757  CZ3 TRP A1099      51.235 -38.442  11.545  1.00 53.79           C  
ATOM   6758  CH2 TRP A1099      51.143 -39.753  11.067  1.00 53.23           C  
ATOM   6759  N   VAL A1100      48.103 -36.009   7.900  1.00 47.58           N  
ATOM   6760  CA  VAL A1100      48.799 -36.648   6.788  1.00 46.55           C  
ATOM   6761  C   VAL A1100      49.821 -35.713   6.155  1.00 46.59           C  
ATOM   6762  O   VAL A1100      51.027 -36.007   6.129  1.00 46.19           O  
ATOM   6763  CB  VAL A1100      47.818 -37.119   5.696  1.00 46.16           C  
ATOM   6764  CG1 VAL A1100      48.580 -37.583   4.463  1.00 45.78           C  
ATOM   6765  CG2 VAL A1100      46.921 -38.227   6.223  1.00 45.89           C  
ATOM   6766  N   VAL A1101      49.341 -34.576   5.660  1.00 40.07           N  
ATOM   6767  CA  VAL A1101      50.212 -33.681   4.899  1.00 40.13           C  
ATOM   6768  C   VAL A1101      51.305 -33.044   5.771  1.00 49.04           C  
ATOM   6769  O   VAL A1101      52.467 -32.933   5.357  1.00 48.97           O  
ATOM   6770  CB  VAL A1101      49.387 -32.586   4.194  1.00 40.68           C  
ATOM   6771  CG1 VAL A1101      48.429 -31.924   5.173  1.00 40.15           C  
ATOM   6772  CG2 VAL A1101      50.293 -31.569   3.521  1.00 40.76           C  
ATOM   6773  N   GLN A1102      50.942 -32.653   6.990  1.00 50.26           N  
ATOM   6774  CA  GLN A1102      51.897 -32.027   7.896  1.00 59.00           C  
ATOM   6775  C   GLN A1102      52.918 -33.047   8.383  1.00 56.40           C  
ATOM   6776  O   GLN A1102      54.051 -32.691   8.696  1.00 55.24           O  
ATOM   6777  CB  GLN A1102      51.175 -31.382   9.078  1.00 51.85           C  
ATOM   6778  CG  GLN A1102      51.977 -30.342   9.826  1.00 52.38           C  
ATOM   6779  CD  GLN A1102      51.090 -29.313  10.499  1.00 54.47           C  
ATOM   6780  OE1 GLN A1102      51.453 -28.733  11.522  1.00 56.38           O  
ATOM   6781  NE2 GLN A1102      49.916 -29.076   9.921  1.00 57.99           N  
ATOM   6782  N   SER A1103      52.518 -34.314   8.446  1.00 58.87           N  
ATOM   6783  CA  SER A1103      53.456 -35.374   8.790  1.00 58.20           C  
ATOM   6784  C   SER A1103      54.428 -35.582   7.658  1.00 58.01           C  
ATOM   6785  O   SER A1103      55.603 -35.839   7.888  1.00 57.68           O  
ATOM   6786  CB  SER A1103      52.746 -36.687   9.095  1.00 58.19           C  
ATOM   6787  OG  SER A1103      53.665 -37.663   9.553  1.00 57.88           O  
ATOM   6788  N   SER A1104      53.934 -35.493   6.429  1.00 51.64           N  
ATOM   6789  CA  SER A1104      54.828 -35.536   5.283  1.00 51.50           C  
ATOM   6790  C   SER A1104      55.835 -34.391   5.390  1.00 52.03           C  
ATOM   6791  O   SER A1104      57.015 -34.555   5.080  1.00 51.23           O  
ATOM   6792  CB  SER A1104      54.045 -35.454   3.975  1.00 51.72           C  
ATOM   6793  OG  SER A1104      53.085 -36.495   3.890  1.00 53.02           O  
ATOM   6794  N   ALA A1105      55.363 -33.236   5.856  1.00 55.95           N  
ATOM   6795  CA  ALA A1105      56.231 -32.077   6.055  1.00 57.79           C  
ATOM   6796  C   ALA A1105      57.287 -32.310   7.143  1.00 57.22           C  
ATOM   6797  O   ALA A1105      58.437 -31.886   7.004  1.00 54.77           O  
ATOM   6798  CB  ALA A1105      55.399 -30.850   6.393  1.00 57.38           C  
ATOM   6799  N   VAL A1106      56.896 -32.978   8.222  1.00 42.59           N  
ATOM   6800  CA  VAL A1106      57.796 -33.199   9.352  1.00 42.01           C  
ATOM   6801  C   VAL A1106      58.811 -34.300   9.054  1.00 41.53           C  
ATOM   6802  O   VAL A1106      59.967 -34.221   9.468  1.00 41.07           O  
ATOM   6803  CB  VAL A1106      57.006 -33.548  10.625  1.00 42.12           C  
ATOM   6804  CG1 VAL A1106      57.941 -33.927  11.764  1.00 41.47           C  
ATOM   6805  CG2 VAL A1106      56.149 -32.370  11.022  1.00 43.12           C  
ATOM   6806  N   ASP A1107      58.377 -35.321   8.329  1.00 57.91           N  
ATOM   6807  CA  ASP A1107      59.287 -36.358   7.866  1.00 58.13           C  
ATOM   6808  C   ASP A1107      60.247 -35.756   6.846  1.00 58.00           C  
ATOM   6809  O   ASP A1107      61.412 -36.144   6.776  1.00 58.13           O  
ATOM   6810  CB  ASP A1107      58.517 -37.538   7.268  1.00 50.84           C  
ATOM   6811  CG  ASP A1107      57.863 -38.405   8.332  1.00 50.15           C  
ATOM   6812  OD1 ASP A1107      58.598 -39.057   9.104  1.00 50.73           O  
ATOM   6813  OD2 ASP A1107      56.617 -38.443   8.392  1.00 59.29           O  
ATOM   6814  N   TYR A1108      59.748 -34.801   6.066  1.00 53.68           N  
ATOM   6815  CA  TYR A1108      60.600 -34.019   5.178  1.00 55.36           C  
ATOM   6816  C   TYR A1108      61.675 -33.308   5.998  1.00 54.48           C  
ATOM   6817  O   TYR A1108      62.855 -33.319   5.640  1.00 54.62           O  
ATOM   6818  CB  TYR A1108      59.768 -33.004   4.383  1.00 55.89           C  
ATOM   6819  CG  TYR A1108      60.499 -32.348   3.230  1.00 53.89           C  
ATOM   6820  CD1 TYR A1108      60.310 -32.785   1.925  1.00 57.26           C  
ATOM   6821  CD2 TYR A1108      61.370 -31.288   3.443  1.00 53.65           C  
ATOM   6822  CE1 TYR A1108      60.971 -32.192   0.868  1.00 54.84           C  
ATOM   6823  CE2 TYR A1108      62.036 -30.688   2.390  1.00 53.78           C  
ATOM   6824  CZ  TYR A1108      61.834 -31.143   1.106  1.00 54.62           C  
ATOM   6825  OH  TYR A1108      62.498 -30.547   0.061  1.00 56.46           O  
ATOM   6826  N   LEU A1109      61.254 -32.701   7.106  1.00 54.53           N  
ATOM   6827  CA  LEU A1109      62.171 -32.010   8.011  1.00 54.06           C  
ATOM   6828  C   LEU A1109      63.250 -32.954   8.539  1.00 53.39           C  
ATOM   6829  O   LEU A1109      64.438 -32.642   8.481  1.00 53.13           O  
ATOM   6830  CB  LEU A1109      61.399 -31.387   9.180  1.00 54.60           C  
ATOM   6831  CG  LEU A1109      61.891 -30.079   9.814  1.00 55.08           C  
ATOM   6832  CD1 LEU A1109      60.895 -29.610  10.866  1.00 56.47           C  
ATOM   6833  CD2 LEU A1109      63.280 -30.212  10.422  1.00 53.95           C  
ATOM   6834  N   HIS A1110      62.828 -34.106   9.058  1.00 53.87           N  
ATOM   6835  CA  HIS A1110      63.752 -35.099   9.601  1.00 51.70           C  
ATOM   6836  C   HIS A1110      64.753 -35.559   8.547  1.00 52.08           C  
ATOM   6837  O   HIS A1110      65.954 -35.665   8.819  1.00 51.88           O  
ATOM   6838  CB  HIS A1110      62.986 -36.306  10.150  1.00 56.37           C  
ATOM   6839  CG  HIS A1110      62.109 -35.986  11.319  1.00 55.56           C  
ATOM   6840  ND1 HIS A1110      61.103 -36.825  11.746  1.00 52.36           N  
ATOM   6841  CD2 HIS A1110      62.088 -34.921  12.155  1.00 51.24           C  
ATOM   6842  CE1 HIS A1110      60.498 -36.290  12.792  1.00 52.03           C  
ATOM   6843  NE2 HIS A1110      61.076 -35.134  13.060  1.00 51.53           N  
ATOM   6844  N   LEU A1111      64.250 -35.830   7.348  1.00 47.47           N  
ATOM   6845  CA  LEU A1111      65.096 -36.232   6.231  1.00 47.08           C  
ATOM   6846  C   LEU A1111      66.135 -35.164   5.930  1.00 46.98           C  
ATOM   6847  O   LEU A1111      67.308 -35.472   5.715  1.00 47.18           O  
ATOM   6848  CB  LEU A1111      64.254 -36.511   4.986  1.00 48.55           C  
ATOM   6849  CG  LEU A1111      63.478 -37.829   4.975  1.00 49.21           C  
ATOM   6850  CD1 LEU A1111      62.539 -37.883   3.782  1.00 50.42           C  
ATOM   6851  CD2 LEU A1111      64.431 -39.013   4.962  1.00 51.22           C  
ATOM   6852  N   MET A1112      65.700 -33.907   5.924  1.00 53.15           N  
ATOM   6853  CA  MET A1112      66.616 -32.793   5.708  1.00 52.47           C  
ATOM   6854  C   MET A1112      67.693 -32.752   6.786  1.00 51.65           C  
ATOM   6855  O   MET A1112      68.868 -32.523   6.493  1.00 51.37           O  
ATOM   6856  CB  MET A1112      65.864 -31.463   5.676  1.00 52.33           C  
ATOM   6857  CG  MET A1112      65.064 -31.227   4.407  1.00 53.08           C  
ATOM   6858  SD  MET A1112      64.677 -29.483   4.174  1.00 53.52           S  
ATOM   6859  CE  MET A1112      66.323 -28.800   3.985  1.00 53.01           C  
ATOM   6860  N   LEU A1113      67.287 -32.981   8.031  1.00 53.53           N  
ATOM   6861  CA  LEU A1113      68.215 -32.964   9.155  1.00 52.68           C  
ATOM   6862  C   LEU A1113      69.285 -34.045   9.020  1.00 53.08           C  
ATOM   6863  O   LEU A1113      70.481 -33.744   9.032  1.00 52.46           O  
ATOM   6864  CB  LEU A1113      67.462 -33.134  10.477  1.00 52.46           C  
ATOM   6865  CG  LEU A1113      66.519 -31.994  10.876  1.00 52.58           C  
ATOM   6866  CD1 LEU A1113      65.945 -32.229  12.266  1.00 52.54           C  
ATOM   6867  CD2 LEU A1113      67.231 -30.655  10.807  1.00 52.32           C  
ATOM   6868  N   VAL A1114      68.860 -35.298   8.885  1.00 59.41           N  
ATOM   6869  CA  VAL A1114      69.810 -36.404   8.810  1.00 52.94           C  
ATOM   6870  C   VAL A1114      70.686 -36.302   7.560  1.00 54.08           C  
ATOM   6871  O   VAL A1114      71.864 -36.669   7.588  1.00 54.83           O  
ATOM   6872  CB  VAL A1114      69.098 -37.777   8.837  1.00 53.99           C  
ATOM   6873  CG1 VAL A1114      68.415 -37.989  10.177  1.00 52.51           C  
ATOM   6874  CG2 VAL A1114      68.095 -37.903   7.700  1.00 56.17           C  
ATOM   6875  N   ALA A1115      70.118 -35.785   6.472  1.00 56.08           N  
ATOM   6876  CA  ALA A1115      70.878 -35.610   5.241  1.00 56.65           C  
ATOM   6877  C   ALA A1115      71.966 -34.557   5.423  1.00 55.10           C  
ATOM   6878  O   ALA A1115      73.118 -34.776   5.050  1.00 55.56           O  
ATOM   6879  CB  ALA A1115      69.960 -35.231   4.091  1.00 56.88           C  
ATOM   6880  N   MET A1116      71.594 -33.420   6.002  1.00 59.92           N  
ATOM   6881  CA  MET A1116      72.549 -32.346   6.254  1.00 58.37           C  
ATOM   6882  C   MET A1116      73.642 -32.787   7.222  1.00 59.08           C  
ATOM   6883  O   MET A1116      74.802 -32.402   7.079  1.00 57.39           O  
ATOM   6884  CB  MET A1116      71.837 -31.105   6.796  1.00 58.42           C  
ATOM   6885  CG  MET A1116      71.118 -30.293   5.735  1.00 57.46           C  
ATOM   6886  SD  MET A1116      72.258 -29.546   4.555  1.00 50.58           S  
ATOM   6887  CE  MET A1116      73.136 -28.400   5.614  1.00 51.46           C  
ATOM   6888  N   LYS A1117      73.269 -33.599   8.205  1.00 57.30           N  
ATOM   6889  CA  LYS A1117      74.230 -34.095   9.182  1.00 56.49           C  
ATOM   6890  C   LYS A1117      75.182 -35.105   8.554  1.00 58.79           C  
ATOM   6891  O   LYS A1117      76.348 -35.194   8.943  1.00 57.70           O  
ATOM   6892  CB  LYS A1117      73.507 -34.726  10.374  1.00 56.30           C  
ATOM   6893  CG  LYS A1117      74.428 -35.177  11.498  1.00 54.79           C  
ATOM   6894  CD  LYS A1117      73.642 -35.833  12.622  1.00 55.28           C  
ATOM   6895  CE  LYS A1117      74.555 -36.296  13.745  1.00 52.56           C  
ATOM   6896  NZ  LYS A1117      73.798 -36.986  14.827  1.00 53.69           N  
ATOM   6897  N   TRP A1118      74.686 -35.860   7.579  1.00 68.24           N  
ATOM   6898  CA  TRP A1118      75.478 -36.924   6.969  1.00 71.47           C  
ATOM   6899  C   TRP A1118      76.693 -36.399   6.205  1.00 72.17           C  
ATOM   6900  O   TRP A1118      77.768 -36.994   6.268  1.00 71.80           O  
ATOM   6901  CB  TRP A1118      74.596 -37.780   6.047  1.00 73.79           C  
ATOM   6902  CG  TRP A1118      75.020 -37.815   4.603  1.00 74.95           C  
ATOM   6903  CD1 TRP A1118      74.467 -37.112   3.572  1.00 76.49           C  
ATOM   6904  CD2 TRP A1118      76.072 -38.603   4.030  1.00 74.13           C  
ATOM   6905  NE1 TRP A1118      75.111 -37.407   2.396  1.00 75.55           N  
ATOM   6906  CE2 TRP A1118      76.101 -38.319   2.650  1.00 78.46           C  
ATOM   6907  CE3 TRP A1118      76.996 -39.514   4.549  1.00 70.53           C  
ATOM   6908  CZ2 TRP A1118      77.015 -38.915   1.784  1.00 78.38           C  
ATOM   6909  CZ3 TRP A1118      77.902 -40.105   3.688  1.00 70.17           C  
ATOM   6910  CH2 TRP A1118      77.904 -39.803   2.321  1.00 72.22           C  
ATOM   6911  N   LEU A1119      76.535 -35.287   5.493  1.00 51.94           N  
ATOM   6912  CA  LEU A1119      77.631 -34.776   4.674  1.00 52.07           C  
ATOM   6913  C   LEU A1119      78.333 -33.592   5.337  1.00 50.35           C  
ATOM   6914  O   LEU A1119      79.152 -32.915   4.716  1.00 50.30           O  
ATOM   6915  CB  LEU A1119      77.126 -34.390   3.277  1.00 52.83           C  
ATOM   6916  CG  LEU A1119      76.465 -33.034   3.004  1.00 52.01           C  
ATOM   6917  CD1 LEU A1119      76.111 -32.924   1.528  1.00 53.14           C  
ATOM   6918  CD2 LEU A1119      75.235 -32.816   3.859  1.00 51.21           C  
ATOM   6919  N   PHE A1120      78.019 -33.361   6.607  1.00 50.93           N  
ATOM   6920  CA  PHE A1120      78.674 -32.308   7.379  1.00 53.21           C  
ATOM   6921  C   PHE A1120      79.809 -32.873   8.223  1.00 59.94           C  
ATOM   6922  O   PHE A1120      80.760 -32.166   8.555  1.00 58.14           O  
ATOM   6923  CB  PHE A1120      77.661 -31.590   8.272  1.00 52.02           C  
ATOM   6924  CG  PHE A1120      77.316 -30.208   7.801  1.00 58.47           C  
ATOM   6925  CD1 PHE A1120      76.906 -29.989   6.498  1.00 50.28           C  
ATOM   6926  CD2 PHE A1120      77.394 -29.130   8.665  1.00 56.34           C  
ATOM   6927  CE1 PHE A1120      76.588 -28.717   6.059  1.00 52.08           C  
ATOM   6928  CE2 PHE A1120      77.075 -27.855   8.235  1.00 56.67           C  
ATOM   6929  CZ  PHE A1120      76.670 -27.649   6.930  1.00 51.10           C  
ATOM   6930  N   GLU A1121      79.699 -34.149   8.569  1.00 70.68           N  
ATOM   6931  CA  GLU A1121      80.733 -34.828   9.340  1.00 78.06           C  
ATOM   6932  C   GLU A1121      81.661 -35.601   8.412  1.00 79.68           C  
ATOM   6933  O   GLU A1121      82.838 -35.799   8.713  1.00 76.68           O  
ATOM   6934  CB  GLU A1121      80.104 -35.767  10.371  1.00 77.44           C  
ATOM   6935  CG  GLU A1121      79.124 -35.082  11.308  1.00 75.67           C  
ATOM   6936  CD  GLU A1121      78.517 -36.035  12.318  1.00 78.30           C  
ATOM   6937  OE1 GLU A1121      78.898 -37.225  12.320  1.00 75.67           O  
ATOM   6938  OE2 GLU A1121      77.658 -35.595  13.111  1.00 76.78           O  
ATOM   6939  N   GLU A1122      81.116 -36.035   7.280  1.00 63.34           N  
ATOM   6940  CA  GLU A1122      81.884 -36.763   6.280  1.00 67.08           C  
ATOM   6941  C   GLU A1122      82.894 -35.848   5.601  1.00 65.60           C  
ATOM   6942  O   GLU A1122      84.004 -36.265   5.275  1.00 65.75           O  
ATOM   6943  CB  GLU A1122      80.951 -37.382   5.237  1.00 61.48           C  
ATOM   6944  CG  GLU A1122      81.663 -38.166   4.146  1.00 62.75           C  
ATOM   6945  CD  GLU A1122      82.360 -39.405   4.675  1.00 61.59           C  
ATOM   6946  OE1 GLU A1122      81.923 -39.935   5.719  1.00 69.21           O  
ATOM   6947  OE2 GLU A1122      83.345 -39.846   4.049  1.00 61.65           O  
ATOM   6948  N   PHE A1123      82.499 -34.597   5.392  1.00 63.01           N  
ATOM   6949  CA  PHE A1123      83.370 -33.618   4.757  1.00 61.03           C  
ATOM   6950  C   PHE A1123      83.813 -32.555   5.755  1.00 67.28           C  
ATOM   6951  O   PHE A1123      83.268 -32.457   6.855  1.00 62.55           O  
ATOM   6952  CB  PHE A1123      82.666 -32.970   3.564  1.00 62.50           C  
ATOM   6953  CG  PHE A1123      82.226 -33.952   2.515  1.00 66.69           C  
ATOM   6954  CD1 PHE A1123      80.942 -34.472   2.527  1.00 66.90           C  
ATOM   6955  CD2 PHE A1123      83.099 -34.360   1.522  1.00 65.24           C  
ATOM   6956  CE1 PHE A1123      80.538 -35.379   1.565  1.00 69.26           C  
ATOM   6957  CE2 PHE A1123      82.700 -35.266   0.557  1.00 69.83           C  
ATOM   6958  CZ  PHE A1123      81.419 -35.775   0.578  1.00 69.78           C  
ATOM   6959  N   ALA A1124      84.808 -31.765   5.367  1.00 81.18           N  
ATOM   6960  CA  ALA A1124      85.363 -30.746   6.249  1.00 86.58           C  
ATOM   6961  C   ALA A1124      84.480 -29.503   6.295  1.00 85.94           C  
ATOM   6962  O   ALA A1124      84.846 -28.451   5.773  1.00 86.86           O  
ATOM   6963  CB  ALA A1124      86.769 -30.376   5.808  1.00 85.59           C  
ATOM   6964  N   ILE A1125      83.317 -29.632   6.923  1.00 69.58           N  
ATOM   6965  CA  ILE A1125      82.410 -28.502   7.083  1.00 69.10           C  
ATOM   6966  C   ILE A1125      82.205 -28.193   8.562  1.00 67.43           C  
ATOM   6967  O   ILE A1125      81.422 -28.855   9.242  1.00 64.27           O  
ATOM   6968  CB  ILE A1125      81.044 -28.767   6.424  1.00 62.58           C  
ATOM   6969  CG1 ILE A1125      81.231 -29.278   4.994  1.00 62.38           C  
ATOM   6970  CG2 ILE A1125      80.193 -27.506   6.439  1.00 60.86           C  
ATOM   6971  CD1 ILE A1125      79.930 -29.552   4.269  1.00 68.93           C  
ATOM   6972  N   ASP A1126      82.915 -27.182   9.053  1.00 61.50           N  
ATOM   6973  CA  ASP A1126      82.841 -26.809  10.460  1.00 58.85           C  
ATOM   6974  C   ASP A1126      81.544 -26.065  10.771  1.00 60.81           C  
ATOM   6975  O   ASP A1126      81.087 -25.240   9.980  1.00 62.26           O  
ATOM   6976  CB  ASP A1126      84.046 -25.951  10.849  1.00 54.43           C  
ATOM   6977  CG  ASP A1126      84.060 -25.603  12.324  1.00 52.16           C  
ATOM   6978  OD1 ASP A1126      83.488 -24.556  12.697  1.00 54.27           O  
ATOM   6979  OD2 ASP A1126      84.641 -26.376  13.111  1.00 51.00           O  
ATOM   6980  N   GLY A1127      80.959 -26.362  11.927  1.00 50.89           N  
ATOM   6981  CA  GLY A1127      79.716 -25.735  12.340  1.00 51.96           C  
ATOM   6982  C   GLY A1127      78.505 -26.542  11.921  1.00 56.99           C  
ATOM   6983  O   GLY A1127      77.971 -26.357  10.828  1.00 57.87           O  
ATOM   6984  N   ARG A1128      78.067 -27.440  12.798  1.00 86.65           N  
ATOM   6985  CA  ARG A1128      76.980 -28.356  12.478  1.00 87.92           C  
ATOM   6986  C   ARG A1128      75.712 -28.020  13.266  1.00 82.32           C  
ATOM   6987  O   ARG A1128      74.686 -28.685  13.120  1.00 82.12           O  
ATOM   6988  CB  ARG A1128      77.413 -29.799  12.756  1.00 86.66           C  
ATOM   6989  CG  ARG A1128      76.558 -30.865  12.087  1.00 81.91           C  
ATOM   6990  CD  ARG A1128      76.626 -32.166  12.862  1.00 89.77           C  
ATOM   6991  NE  ARG A1128      76.478 -31.935  14.296  1.00 89.11           N  
ATOM   6992  CZ  ARG A1128      75.310 -31.784  14.912  1.00 80.35           C  
ATOM   6993  NH1 ARG A1128      74.179 -31.842  14.224  1.00 80.43           N  
ATOM   6994  NH2 ARG A1128      75.273 -31.572  16.222  1.00 87.81           N  
ATOM   6995  N   PHE A1129      75.787 -26.984  14.096  1.00 54.49           N  
ATOM   6996  CA  PHE A1129      74.656 -26.587  14.930  1.00 56.18           C  
ATOM   6997  C   PHE A1129      73.430 -26.235  14.084  1.00 58.34           C  
ATOM   6998  O   PHE A1129      73.545 -25.566  13.057  1.00 52.64           O  
ATOM   6999  CB  PHE A1129      75.044 -25.413  15.830  1.00 57.44           C  
ATOM   7000  CG  PHE A1129      75.526 -25.829  17.196  1.00 54.60           C  
ATOM   7001  CD1 PHE A1129      76.470 -25.076  17.873  1.00 55.55           C  
ATOM   7002  CD2 PHE A1129      75.024 -26.968  17.803  1.00 55.76           C  
ATOM   7003  CE1 PHE A1129      76.907 -25.455  19.130  1.00 52.71           C  
ATOM   7004  CE2 PHE A1129      75.459 -27.350  19.061  1.00 53.29           C  
ATOM   7005  CZ  PHE A1129      76.401 -26.593  19.724  1.00 52.06           C  
ATOM   7006  N   CYS A1130      72.261 -26.696  14.524  1.00 72.45           N  
ATOM   7007  CA  CYS A1130      71.033 -26.572  13.743  1.00 74.22           C  
ATOM   7008  C   CYS A1130      70.008 -25.633  14.381  1.00 76.86           C  
ATOM   7009  O   CYS A1130      69.871 -25.587  15.603  1.00 77.06           O  
ATOM   7010  CB  CYS A1130      70.407 -27.958  13.536  1.00 71.92           C  
ATOM   7011  SG  CYS A1130      68.782 -27.943  12.745  1.00 73.62           S  
ATOM   7012  N   ILE A1131      69.301 -24.880  13.539  1.00 65.44           N  
ATOM   7013  CA  ILE A1131      68.220 -23.996  13.978  1.00 67.33           C  
ATOM   7014  C   ILE A1131      67.056 -24.075  12.988  1.00 69.35           C  
ATOM   7015  O   ILE A1131      67.054 -23.377  11.976  1.00 68.65           O  
ATOM   7016  CB  ILE A1131      68.671 -22.518  14.093  1.00 60.55           C  
ATOM   7017  CG1 ILE A1131      69.922 -22.377  14.966  1.00 68.97           C  
ATOM   7018  CG2 ILE A1131      67.538 -21.661  14.645  1.00 64.38           C  
ATOM   7019  CD1 ILE A1131      71.229 -22.386  14.192  1.00 68.13           C  
ATOM   7020  N   SER A1132      66.070 -24.920  13.279  1.00 65.81           N  
ATOM   7021  CA  SER A1132      64.993 -25.174  12.323  1.00 67.17           C  
ATOM   7022  C   SER A1132      63.630 -24.655  12.775  1.00 69.15           C  
ATOM   7023  O   SER A1132      63.273 -24.738  13.951  1.00 69.52           O  
ATOM   7024  CB  SER A1132      64.889 -26.675  12.036  1.00 64.87           C  
ATOM   7025  OG  SER A1132      64.475 -27.386  13.191  1.00 64.04           O  
ATOM   7026  N   ILE A1133      62.872 -24.121  11.819  1.00 58.53           N  
ATOM   7027  CA  ILE A1133      61.496 -23.699  12.054  1.00 60.97           C  
ATOM   7028  C   ILE A1133      60.561 -24.325  11.014  1.00 60.10           C  
ATOM   7029  O   ILE A1133      60.284 -23.732   9.967  1.00 62.45           O  
ATOM   7030  CB  ILE A1133      61.343 -22.153  12.032  1.00 64.09           C  
ATOM   7031  CG1 ILE A1133      62.212 -21.516  10.939  1.00 63.18           C  
ATOM   7032  CG2 ILE A1133      61.688 -21.564  13.391  1.00 65.99           C  
ATOM   7033  CD1 ILE A1133      63.564 -21.003  11.413  1.00 62.74           C  
ATOM   7034  N   HIS A1134      60.100 -25.536  11.315  1.00 55.75           N  
ATOM   7035  CA  HIS A1134      59.132 -26.258  10.492  1.00 55.16           C  
ATOM   7036  C   HIS A1134      59.578 -26.399   9.038  1.00 53.65           C  
ATOM   7037  O   HIS A1134      60.122 -27.429   8.643  1.00 51.40           O  
ATOM   7038  CB  HIS A1134      57.768 -25.568  10.560  1.00 58.27           C  
ATOM   7039  CG  HIS A1134      57.187 -25.515  11.940  1.00 50.27           C  
ATOM   7040  ND1 HIS A1134      57.731 -26.205  13.003  1.00 58.65           N  
ATOM   7041  CD2 HIS A1134      56.115 -24.853  12.429  1.00 53.87           C  
ATOM   7042  CE1 HIS A1134      57.015 -25.970  14.088  1.00 50.84           C  
ATOM   7043  NE2 HIS A1134      56.028 -25.153  13.769  1.00 54.33           N  
ATOM   7044  N   ASP A1135      59.343 -25.356   8.248  1.00 54.40           N  
ATOM   7045  CA  ASP A1135      59.699 -25.369   6.835  1.00 53.25           C  
ATOM   7046  C   ASP A1135      61.125 -24.904   6.609  1.00 52.34           C  
ATOM   7047  O   ASP A1135      61.850 -25.472   5.795  1.00 50.64           O  
ATOM   7048  CB  ASP A1135      58.745 -24.479   6.044  1.00 55.15           C  
ATOM   7049  CG  ASP A1135      59.057 -24.455   4.554  1.00 54.08           C  
ATOM   7050  OD1 ASP A1135      59.880 -23.621   4.135  1.00 53.77           O  
ATOM   7051  OD2 ASP A1135      58.467 -25.255   3.799  1.00 53.68           O  
ATOM   7052  N   GLU A1136      61.514 -23.852   7.320  1.00 70.84           N  
ATOM   7053  CA  GLU A1136      62.830 -23.254   7.139  1.00 72.96           C  
ATOM   7054  C   GLU A1136      63.855 -23.953   8.026  1.00 67.71           C  
ATOM   7055  O   GLU A1136      63.498 -24.558   9.035  1.00 72.16           O  
ATOM   7056  CB  GLU A1136      62.775 -21.752   7.444  1.00 73.14           C  
ATOM   7057  CG  GLU A1136      63.942 -20.948   6.890  1.00 73.14           C  
ATOM   7058  CD  GLU A1136      63.783 -19.454   7.105  1.00 79.09           C  
ATOM   7059  OE1 GLU A1136      62.862 -19.046   7.844  1.00 71.77           O  
ATOM   7060  OE2 GLU A1136      64.582 -18.683   6.530  1.00 79.38           O  
ATOM   7061  N   VAL A1137      65.126 -23.881   7.642  1.00 53.97           N  
ATOM   7062  CA  VAL A1137      66.192 -24.487   8.439  1.00 52.22           C  
ATOM   7063  C   VAL A1137      67.524 -23.770   8.213  1.00 51.56           C  
ATOM   7064  O   VAL A1137      67.964 -23.606   7.076  1.00 51.18           O  
ATOM   7065  CB  VAL A1137      66.346 -25.993   8.123  1.00 50.36           C  
ATOM   7066  CG1 VAL A1137      66.339 -26.238   6.619  1.00 50.17           C  
ATOM   7067  CG2 VAL A1137      67.608 -26.553   8.765  1.00 58.79           C  
ATOM   7068  N   ARG A1138      68.153 -23.340   9.306  1.00 53.16           N  
ATOM   7069  CA  ARG A1138      69.387 -22.556   9.238  1.00 55.10           C  
ATOM   7070  C   ARG A1138      70.523 -23.204  10.028  1.00 56.09           C  
ATOM   7071  O   ARG A1138      70.357 -23.552  11.196  1.00 57.71           O  
ATOM   7072  CB  ARG A1138      69.148 -21.136   9.766  1.00 50.33           C  
ATOM   7073  CG  ARG A1138      67.726 -20.623   9.592  1.00 53.04           C  
ATOM   7074  CD  ARG A1138      67.396 -20.334   8.137  1.00 56.27           C  
ATOM   7075  NE  ARG A1138      68.088 -19.148   7.645  1.00 55.77           N  
ATOM   7076  CZ  ARG A1138      67.592 -17.918   7.714  1.00 58.87           C  
ATOM   7077  NH1 ARG A1138      66.402 -17.712   8.260  1.00 60.61           N  
ATOM   7078  NH2 ARG A1138      68.287 -16.893   7.242  1.00 58.52           N  
ATOM   7079  N   TYR A1139      71.682 -23.351   9.392  1.00 58.03           N  
ATOM   7080  CA  TYR A1139      72.849 -23.928  10.055  1.00 58.67           C  
ATOM   7081  C   TYR A1139      73.915 -22.878  10.353  1.00 57.08           C  
ATOM   7082  O   TYR A1139      74.167 -21.991   9.542  1.00 57.65           O  
ATOM   7083  CB  TYR A1139      73.453 -25.046   9.203  1.00 57.70           C  
ATOM   7084  CG  TYR A1139      72.717 -26.362   9.305  1.00 57.42           C  
ATOM   7085  CD1 TYR A1139      73.045 -27.287  10.288  1.00 55.29           C  
ATOM   7086  CD2 TYR A1139      71.696 -26.681   8.420  1.00 59.57           C  
ATOM   7087  CE1 TYR A1139      72.377 -28.493  10.388  1.00 56.97           C  
ATOM   7088  CE2 TYR A1139      71.022 -27.885   8.511  1.00 59.50           C  
ATOM   7089  CZ  TYR A1139      71.367 -28.786   9.497  1.00 55.71           C  
ATOM   7090  OH  TYR A1139      70.701 -29.987   9.595  1.00 56.58           O  
ATOM   7091  N   LEU A1140      74.543 -22.994  11.519  1.00 41.16           N  
ATOM   7092  CA  LEU A1140      75.586 -22.059  11.931  1.00 40.34           C  
ATOM   7093  C   LEU A1140      76.949 -22.504  11.406  1.00 48.96           C  
ATOM   7094  O   LEU A1140      77.663 -23.249  12.071  1.00 47.53           O  
ATOM   7095  CB  LEU A1140      75.615 -21.934  13.459  1.00 49.83           C  
ATOM   7096  CG  LEU A1140      76.339 -20.742  14.099  1.00 49.22           C  
ATOM   7097  CD1 LEU A1140      77.822 -21.015  14.317  1.00 46.94           C  
ATOM   7098  CD2 LEU A1140      76.141 -19.489  13.260  1.00 40.26           C  
ATOM   7099  N   VAL A1141      77.301 -22.044  10.211  1.00 50.81           N  
ATOM   7100  CA  VAL A1141      78.571 -22.409   9.591  1.00 58.24           C  
ATOM   7101  C   VAL A1141      79.611 -21.312   9.810  1.00 56.82           C  
ATOM   7102  O   VAL A1141      79.454 -20.469  10.691  1.00 56.77           O  
ATOM   7103  CB  VAL A1141      78.410 -22.667   8.079  1.00 59.59           C  
ATOM   7104  CG1 VAL A1141      79.171 -23.918   7.668  1.00 58.73           C  
ATOM   7105  CG2 VAL A1141      76.940 -22.796   7.719  1.00 51.68           C  
ATOM   7106  N   ARG A1142      80.671 -21.330   9.008  1.00 78.00           N  
ATOM   7107  CA  ARG A1142      81.682 -20.279   9.064  1.00 77.06           C  
ATOM   7108  C   ARG A1142      81.836 -19.593   7.710  1.00 76.91           C  
ATOM   7109  O   ARG A1142      81.338 -20.081   6.696  1.00 79.17           O  
ATOM   7110  CB  ARG A1142      83.026 -20.839   9.532  1.00 72.32           C  
ATOM   7111  CG  ARG A1142      83.442 -22.131   8.859  1.00 74.17           C  
ATOM   7112  CD  ARG A1142      84.856 -22.536   9.260  1.00 79.18           C  
ATOM   7113  NE  ARG A1142      85.026 -22.642  10.709  1.00 77.32           N  
ATOM   7114  CZ  ARG A1142      85.620 -21.723  11.465  1.00 74.69           C  
ATOM   7115  NH1 ARG A1142      86.104 -20.619  10.914  1.00 74.59           N  
ATOM   7116  NH2 ARG A1142      85.729 -21.906  12.773  1.00 73.44           N  
ATOM   7117  N   GLU A1143      82.535 -18.462   7.707  1.00 86.97           N  
ATOM   7118  CA  GLU A1143      82.611 -17.594   6.536  1.00 87.10           C  
ATOM   7119  C   GLU A1143      83.394 -18.198   5.372  1.00 88.65           C  
ATOM   7120  O   GLU A1143      83.295 -17.721   4.241  1.00 81.12           O  
ATOM   7121  CB  GLU A1143      83.232 -16.250   6.925  1.00 87.12           C  
ATOM   7122  CG  GLU A1143      82.440 -15.490   7.980  1.00 87.69           C  
ATOM   7123  CD  GLU A1143      83.096 -14.182   8.376  1.00 84.67           C  
ATOM   7124  OE1 GLU A1143      84.177 -13.868   7.835  1.00 83.92           O  
ATOM   7125  OE2 GLU A1143      82.529 -13.465   9.228  1.00 84.75           O  
ATOM   7126  N   GLU A1144      84.167 -19.243   5.645  1.00 76.34           N  
ATOM   7127  CA  GLU A1144      84.994 -19.861   4.614  1.00 70.64           C  
ATOM   7128  C   GLU A1144      84.402 -21.173   4.105  1.00 70.46           C  
ATOM   7129  O   GLU A1144      84.893 -21.747   3.132  1.00 70.96           O  
ATOM   7130  CB  GLU A1144      86.416 -20.093   5.138  1.00 76.44           C  
ATOM   7131  CG  GLU A1144      86.495 -20.683   6.540  1.00 76.27           C  
ATOM   7132  CD  GLU A1144      86.484 -19.623   7.628  1.00 73.73           C  
ATOM   7133  OE1 GLU A1144      86.817 -19.954   8.786  1.00 68.96           O  
ATOM   7134  OE2 GLU A1144      86.142 -18.460   7.330  1.00 72.12           O  
ATOM   7135  N   ASP A1145      83.342 -21.641   4.758  1.00 84.51           N  
ATOM   7136  CA  ASP A1145      82.681 -22.878   4.355  1.00 84.99           C  
ATOM   7137  C   ASP A1145      81.181 -22.676   4.176  1.00 87.60           C  
ATOM   7138  O   ASP A1145      80.393 -23.595   4.397  1.00 88.40           O  
ATOM   7139  CB  ASP A1145      82.936 -23.984   5.383  1.00 84.13           C  
ATOM   7140  CG  ASP A1145      84.388 -24.410   5.432  1.00 84.06           C  
ATOM   7141  OD1 ASP A1145      85.066 -24.338   4.386  1.00 84.84           O  
ATOM   7142  OD2 ASP A1145      84.851 -24.823   6.516  1.00 79.31           O  
ATOM   7143  N   ARG A1146      80.793 -21.473   3.772  1.00 82.70           N  
ATOM   7144  CA  ARG A1146      79.383 -21.135   3.632  1.00 84.04           C  
ATOM   7145  C   ARG A1146      78.795 -21.629   2.310  1.00 84.50           C  
ATOM   7146  O   ARG A1146      77.663 -22.112   2.267  1.00 86.38           O  
ATOM   7147  CB  ARG A1146      79.187 -19.621   3.764  1.00 83.75           C  
ATOM   7148  CG  ARG A1146      80.167 -18.783   2.954  1.00 81.99           C  
ATOM   7149  CD  ARG A1146      79.898 -17.296   3.135  1.00 85.65           C  
ATOM   7150  NE  ARG A1146      80.852 -16.469   2.402  1.00 84.84           N  
ATOM   7151  CZ  ARG A1146      80.780 -15.145   2.318  1.00 85.48           C  
ATOM   7152  NH1 ARG A1146      79.797 -14.492   2.922  1.00 85.47           N  
ATOM   7153  NH2 ARG A1146      81.693 -14.473   1.629  1.00 85.12           N  
ATOM   7154  N   TYR A1147      79.571 -21.511   1.236  1.00 71.99           N  
ATOM   7155  CA  TYR A1147      79.099 -21.883  -0.092  1.00 73.59           C  
ATOM   7156  C   TYR A1147      78.952 -23.393  -0.228  1.00 74.82           C  
ATOM   7157  O   TYR A1147      78.014 -23.884  -0.860  1.00 76.37           O  
ATOM   7158  CB  TYR A1147      80.047 -21.341  -1.163  1.00 75.48           C  
ATOM   7159  CG  TYR A1147      80.246 -19.846  -1.084  1.00 75.75           C  
ATOM   7160  CD1 TYR A1147      79.314 -18.973  -1.628  1.00 77.60           C  
ATOM   7161  CD2 TYR A1147      81.362 -19.307  -0.457  1.00 74.87           C  
ATOM   7162  CE1 TYR A1147      79.490 -17.604  -1.553  1.00 78.63           C  
ATOM   7163  CE2 TYR A1147      81.546 -17.940  -0.378  1.00 73.88           C  
ATOM   7164  CZ  TYR A1147      80.606 -17.092  -0.927  1.00 74.65           C  
ATOM   7165  OH  TYR A1147      80.784 -15.728  -0.851  1.00 75.03           O  
ATOM   7166  N   ARG A1148      79.882 -24.124   0.376  1.00 62.16           N  
ATOM   7167  CA  ARG A1148      79.837 -25.580   0.360  1.00 60.80           C  
ATOM   7168  C   ARG A1148      78.715 -26.087   1.263  1.00 60.77           C  
ATOM   7169  O   ARG A1148      78.156 -27.162   1.034  1.00 61.81           O  
ATOM   7170  CB  ARG A1148      81.184 -26.159   0.790  1.00 61.33           C  
ATOM   7171  CG  ARG A1148      82.358 -25.602  -0.004  1.00 60.02           C  
ATOM   7172  CD  ARG A1148      83.650 -26.361   0.265  1.00 61.26           C  
ATOM   7173  NE  ARG A1148      84.074 -26.273   1.657  1.00 69.46           N  
ATOM   7174  CZ  ARG A1148      83.977 -27.268   2.533  1.00 68.14           C  
ATOM   7175  NH1 ARG A1148      83.472 -28.436   2.160  1.00 68.36           N  
ATOM   7176  NH2 ARG A1148      84.389 -27.100   3.782  1.00 65.20           N  
ATOM   7177  N   ALA A1149      78.385 -25.301   2.283  1.00 50.79           N  
ATOM   7178  CA  ALA A1149      77.272 -25.621   3.169  1.00 57.68           C  
ATOM   7179  C   ALA A1149      75.943 -25.403   2.452  1.00 51.07           C  
ATOM   7180  O   ALA A1149      75.012 -26.195   2.599  1.00 59.82           O  
ATOM   7181  CB  ALA A1149      77.337 -24.782   4.435  1.00 55.70           C  
ATOM   7182  N   ALA A1150      75.861 -24.322   1.681  1.00 62.49           N  
ATOM   7183  CA  ALA A1150      74.688 -24.058   0.855  1.00 64.40           C  
ATOM   7184  C   ALA A1150      74.535 -25.159  -0.188  1.00 64.28           C  
ATOM   7185  O   ALA A1150      73.422 -25.589  -0.508  1.00 66.03           O  
ATOM   7186  CB  ALA A1150      74.799 -22.698   0.188  1.00 64.72           C  
ATOM   7187  N   LEU A1151      75.671 -25.612  -0.708  1.00 50.25           N  
ATOM   7188  CA  LEU A1151      75.702 -26.729  -1.642  1.00 51.06           C  
ATOM   7189  C   LEU A1151      75.155 -27.983  -0.966  1.00 50.88           C  
ATOM   7190  O   LEU A1151      74.405 -28.754  -1.570  1.00 51.71           O  
ATOM   7191  CB  LEU A1151      77.127 -26.955  -2.155  1.00 51.15           C  
ATOM   7192  CG  LEU A1151      77.364 -27.925  -3.316  1.00 52.38           C  
ATOM   7193  CD1 LEU A1151      77.642 -29.331  -2.807  1.00 52.47           C  
ATOM   7194  CD2 LEU A1151      76.184 -27.920  -4.281  1.00 53.38           C  
ATOM   7195  N   ALA A1152      75.529 -28.172   0.296  1.00 53.04           N  
ATOM   7196  CA  ALA A1152      75.018 -29.279   1.093  1.00 51.85           C  
ATOM   7197  C   ALA A1152      73.506 -29.163   1.270  1.00 51.73           C  
ATOM   7198  O   ALA A1152      72.800 -30.169   1.298  1.00 51.68           O  
ATOM   7199  CB  ALA A1152      75.710 -29.328   2.445  1.00 50.00           C  
ATOM   7200  N   LEU A1153      73.016 -27.932   1.389  1.00 58.40           N  
ATOM   7201  CA  LEU A1153      71.581 -27.691   1.492  1.00 55.76           C  
ATOM   7202  C   LEU A1153      70.864 -28.090   0.208  1.00 51.80           C  
ATOM   7203  O   LEU A1153      69.817 -28.742   0.249  1.00 51.39           O  
ATOM   7204  CB  LEU A1153      71.298 -26.220   1.811  1.00 58.06           C  
ATOM   7205  CG  LEU A1153      71.432 -25.785   3.270  1.00 55.83           C  
ATOM   7206  CD1 LEU A1153      71.296 -24.277   3.383  1.00 57.68           C  
ATOM   7207  CD2 LEU A1153      70.390 -26.479   4.129  1.00 54.63           C  
ATOM   7208  N   GLN A1154      71.430 -27.698  -0.929  1.00 52.63           N  
ATOM   7209  CA  GLN A1154      70.853 -28.042  -2.224  1.00 52.91           C  
ATOM   7210  C   GLN A1154      70.817 -29.556  -2.426  1.00 54.42           C  
ATOM   7211  O   GLN A1154      69.792 -30.114  -2.831  1.00 54.74           O  
ATOM   7212  CB  GLN A1154      71.637 -27.376  -3.357  1.00 55.56           C  
ATOM   7213  CG  GLN A1154      71.571 -25.856  -3.355  1.00 54.51           C  
ATOM   7214  CD  GLN A1154      70.210 -25.319  -3.758  1.00 55.11           C  
ATOM   7215  OE1 GLN A1154      69.332 -26.070  -4.186  1.00 55.84           O  
ATOM   7216  NE2 GLN A1154      70.030 -24.011  -3.628  1.00 57.47           N  
ATOM   7217  N   ILE A1155      71.940 -30.212  -2.138  1.00 58.87           N  
ATOM   7218  CA  ILE A1155      72.022 -31.669  -2.212  1.00 59.48           C  
ATOM   7219  C   ILE A1155      70.963 -32.315  -1.329  1.00 58.77           C  
ATOM   7220  O   ILE A1155      70.247 -33.222  -1.758  1.00 59.67           O  
ATOM   7221  CB  ILE A1155      73.411 -32.185  -1.786  1.00 50.97           C  
ATOM   7222  CG1 ILE A1155      74.464 -31.820  -2.831  1.00 51.19           C  
ATOM   7223  CG2 ILE A1155      73.385 -33.691  -1.578  1.00 51.52           C  
ATOM   7224  CD1 ILE A1155      75.815 -32.445  -2.568  1.00 59.79           C  
ATOM   7225  N   THR A1156      70.869 -31.829  -0.095  1.00 58.49           N  
ATOM   7226  CA  THR A1156      69.896 -32.325   0.870  1.00 58.28           C  
ATOM   7227  C   THR A1156      68.471 -32.242   0.329  1.00 58.73           C  
ATOM   7228  O   THR A1156      67.728 -33.228   0.352  1.00 59.34           O  
ATOM   7229  CB  THR A1156      69.980 -31.542   2.191  1.00 57.01           C  
ATOM   7230  OG1 THR A1156      71.226 -31.825   2.839  1.00 56.57           O  
ATOM   7231  CG2 THR A1156      68.839 -31.926   3.109  1.00 58.76           C  
ATOM   7232  N   ASN A1157      68.100 -31.062  -0.159  1.00 59.65           N  
ATOM   7233  CA  ASN A1157      66.774 -30.849  -0.723  1.00 50.01           C  
ATOM   7234  C   ASN A1157      66.501 -31.786  -1.891  1.00 51.24           C  
ATOM   7235  O   ASN A1157      65.420 -32.377  -1.985  1.00 51.03           O  
ATOM   7236  CB  ASN A1157      66.612 -29.398  -1.175  1.00 51.62           C  
ATOM   7237  CG  ASN A1157      65.256 -29.133  -1.794  1.00 52.89           C  
ATOM   7238  OD1 ASN A1157      64.263 -28.958  -1.087  1.00 54.14           O  
ATOM   7239  ND2 ASN A1157      65.205 -29.095  -3.119  1.00 52.81           N  
ATOM   7240  N   LEU A1158      67.486 -31.920  -2.773  1.00 45.45           N  
ATOM   7241  CA  LEU A1158      67.371 -32.809  -3.924  1.00 47.10           C  
ATOM   7242  C   LEU A1158      67.105 -34.251  -3.498  1.00 46.60           C  
ATOM   7243  O   LEU A1158      66.174 -34.895  -3.990  1.00 47.41           O  
ATOM   7244  CB  LEU A1158      68.639 -32.741  -4.775  1.00 48.29           C  
ATOM   7245  CG  LEU A1158      68.677 -33.662  -5.997  1.00 50.18           C  
ATOM   7246  CD1 LEU A1158      67.580 -33.289  -6.980  1.00 51.68           C  
ATOM   7247  CD2 LEU A1158      70.041 -33.610  -6.664  1.00 51.22           C  
ATOM   7248  N   LEU A1159      67.923 -34.747  -2.576  1.00 53.94           N  
ATOM   7249  CA  LEU A1159      67.806 -36.120  -2.096  1.00 55.37           C  
ATOM   7250  C   LEU A1159      66.482 -36.369  -1.380  1.00 55.15           C  
ATOM   7251  O   LEU A1159      65.906 -37.451  -1.492  1.00 56.18           O  
ATOM   7252  CB  LEU A1159      68.973 -36.461  -1.165  1.00 55.17           C  
ATOM   7253  CG  LEU A1159      70.365 -36.484  -1.798  1.00 55.69           C  
ATOM   7254  CD1 LEU A1159      71.414 -36.911  -0.782  1.00 55.85           C  
ATOM   7255  CD2 LEU A1159      70.388 -37.394  -3.015  1.00 57.53           C  
ATOM   7256  N   THR A1160      66.003 -35.371  -0.645  1.00 53.73           N  
ATOM   7257  CA  THR A1160      64.743 -35.511   0.080  1.00 53.23           C  
ATOM   7258  C   THR A1160      63.559 -35.546  -0.889  1.00 53.85           C  
ATOM   7259  O   THR A1160      62.646 -36.369  -0.744  1.00 54.22           O  
ATOM   7260  CB  THR A1160      64.544 -34.373   1.096  1.00 51.86           C  
ATOM   7261  OG1 THR A1160      65.703 -34.272   1.933  1.00 51.25           O  
ATOM   7262  CG2 THR A1160      63.327 -34.642   1.962  1.00 51.41           C  
ATOM   7263  N   ARG A1161      63.580 -34.654  -1.878  1.00 60.99           N  
ATOM   7264  CA  ARG A1161      62.556 -34.656  -2.921  1.00 62.16           C  
ATOM   7265  C   ARG A1161      62.545 -35.998  -3.652  1.00 66.92           C  
ATOM   7266  O   ARG A1161      61.480 -36.571  -3.910  1.00 65.61           O  
ATOM   7267  CB  ARG A1161      62.788 -33.514  -3.914  1.00 65.00           C  
ATOM   7268  CG  ARG A1161      62.522 -32.119  -3.359  1.00 64.30           C  
ATOM   7269  CD  ARG A1161      61.065 -31.939  -2.962  1.00 64.64           C  
ATOM   7270  NE  ARG A1161      60.535 -30.648  -3.396  1.00 62.84           N  
ATOM   7271  CZ  ARG A1161      60.612 -29.527  -2.686  1.00 64.55           C  
ATOM   7272  NH1 ARG A1161      61.202 -29.531  -1.500  1.00 64.22           N  
ATOM   7273  NH2 ARG A1161      60.101 -28.401  -3.163  1.00 63.43           N  
ATOM   7274  N   CYS A1162      63.735 -36.499  -3.970  1.00 64.88           N  
ATOM   7275  CA  CYS A1162      63.865 -37.792  -4.634  1.00 67.29           C  
ATOM   7276  C   CYS A1162      63.372 -38.929  -3.743  1.00 67.53           C  
ATOM   7277  O   CYS A1162      62.908 -39.954  -4.238  1.00 68.93           O  
ATOM   7278  CB  CYS A1162      65.316 -38.044  -5.047  1.00 68.27           C  
ATOM   7279  SG  CYS A1162      65.909 -36.972  -6.376  1.00 70.22           S  
ATOM   7280  N   MET A1163      63.481 -38.744  -2.430  1.00 57.75           N  
ATOM   7281  CA  MET A1163      62.972 -39.725  -1.477  1.00 58.48           C  
ATOM   7282  C   MET A1163      61.450 -39.769  -1.509  1.00 57.71           C  
ATOM   7283  O   MET A1163      60.851 -40.845  -1.611  1.00 59.99           O  
ATOM   7284  CB  MET A1163      63.460 -39.411  -0.064  1.00 57.30           C  
ATOM   7285  CG  MET A1163      62.792 -40.247   1.013  1.00 59.77           C  
ATOM   7286  SD  MET A1163      63.096 -42.011   0.808  1.00 66.61           S  
ATOM   7287  CE  MET A1163      64.863 -42.077   1.076  1.00 63.86           C  
ATOM   7288  N   PHE A1164      60.828 -38.595  -1.425  1.00 55.87           N  
ATOM   7289  CA  PHE A1164      59.372 -38.503  -1.505  1.00 55.40           C  
ATOM   7290  C   PHE A1164      58.857 -39.021  -2.844  1.00 58.44           C  
ATOM   7291  O   PHE A1164      57.744 -39.542  -2.932  1.00 58.78           O  
ATOM   7292  CB  PHE A1164      58.910 -37.060  -1.284  1.00 55.67           C  
ATOM   7293  CG  PHE A1164      58.784 -36.680   0.164  1.00 54.04           C  
ATOM   7294  CD1 PHE A1164      57.540 -36.586   0.763  1.00 53.08           C  
ATOM   7295  CD2 PHE A1164      59.909 -36.428   0.930  1.00 53.45           C  
ATOM   7296  CE1 PHE A1164      57.420 -36.242   2.094  1.00 51.77           C  
ATOM   7297  CE2 PHE A1164      59.794 -36.085   2.262  1.00 52.34           C  
ATOM   7298  CZ  PHE A1164      58.549 -35.991   2.845  1.00 52.06           C  
ATOM   7299  N   ALA A1165      59.674 -38.883  -3.883  1.00 69.83           N  
ATOM   7300  CA  ALA A1165      59.316 -39.388  -5.203  1.00 61.97           C  
ATOM   7301  C   ALA A1165      59.434 -40.910  -5.264  1.00 65.90           C  
ATOM   7302  O   ALA A1165      58.610 -41.583  -5.882  1.00 65.93           O  
ATOM   7303  CB  ALA A1165      60.190 -38.748  -6.272  1.00 64.47           C  
ATOM   7304  N   TYR A1166      60.463 -41.442  -4.610  1.00 71.18           N  
ATOM   7305  CA  TYR A1166      60.743 -42.874  -4.636  1.00 73.33           C  
ATOM   7306  C   TYR A1166      59.762 -43.673  -3.789  1.00 74.69           C  
ATOM   7307  O   TYR A1166      59.420 -44.805  -4.126  1.00 75.49           O  
ATOM   7308  CB  TYR A1166      62.173 -43.141  -4.161  1.00 73.41           C  
ATOM   7309  CG  TYR A1166      62.480 -44.603  -3.933  1.00 77.77           C  
ATOM   7310  CD1 TYR A1166      62.736 -45.453  -5.000  1.00 80.43           C  
ATOM   7311  CD2 TYR A1166      62.520 -45.132  -2.650  1.00 78.16           C  
ATOM   7312  CE1 TYR A1166      63.018 -46.790  -4.796  1.00 82.38           C  
ATOM   7313  CE2 TYR A1166      62.800 -46.468  -2.436  1.00 80.74           C  
ATOM   7314  CZ  TYR A1166      63.049 -47.292  -3.512  1.00 82.20           C  
ATOM   7315  OH  TYR A1166      63.330 -48.623  -3.307  1.00 84.29           O  
ATOM   7316  N   LYS A1167      59.308 -43.079  -2.689  1.00 53.63           N  
ATOM   7317  CA  LYS A1167      58.402 -43.765  -1.773  1.00 53.62           C  
ATOM   7318  C   LYS A1167      57.025 -44.028  -2.381  1.00 56.51           C  
ATOM   7319  O   LYS A1167      56.200 -44.717  -1.782  1.00 57.23           O  
ATOM   7320  CB  LYS A1167      58.244 -42.960  -0.483  1.00 51.11           C  
ATOM   7321  CG  LYS A1167      59.455 -43.003   0.428  1.00 51.40           C  
ATOM   7322  CD  LYS A1167      59.723 -44.413   0.931  1.00 54.09           C  
ATOM   7323  CE  LYS A1167      60.807 -44.411   1.994  1.00 58.42           C  
ATOM   7324  NZ  LYS A1167      61.174 -45.782   2.434  1.00 50.67           N  
ATOM   7325  N   LEU A1168      56.778 -43.481  -3.567  1.00 65.12           N  
ATOM   7326  CA  LEU A1168      55.502 -43.679  -4.244  1.00 63.83           C  
ATOM   7327  C   LEU A1168      55.690 -44.052  -5.712  1.00 64.29           C  
ATOM   7328  O   LEU A1168      54.771 -44.558  -6.354  1.00 67.24           O  
ATOM   7329  CB  LEU A1168      54.637 -42.421  -4.127  1.00 60.41           C  
ATOM   7330  CG  LEU A1168      54.151 -42.057  -2.723  1.00 58.61           C  
ATOM   7331  CD1 LEU A1168      53.382 -40.745  -2.743  1.00 57.61           C  
ATOM   7332  CD2 LEU A1168      53.294 -43.174  -2.148  1.00 61.32           C  
ATOM   7333  N   GLY A1169      56.886 -43.800  -6.236  1.00 80.58           N  
ATOM   7334  CA  GLY A1169      57.185 -44.097  -7.625  1.00 82.70           C  
ATOM   7335  C   GLY A1169      56.645 -43.044  -8.576  1.00 89.41           C  
ATOM   7336  O   GLY A1169      55.531 -42.552  -8.396  1.00 88.64           O  
ATOM   7337  N   LEU A1170      57.429 -42.692  -9.590  1.00 72.58           N  
ATOM   7338  CA  LEU A1170      58.748 -43.282  -9.798  1.00 75.71           C  
ATOM   7339  C   LEU A1170      59.834 -42.455  -9.120  1.00 73.49           C  
ATOM   7340  O   LEU A1170      59.556 -41.415  -8.523  1.00 73.45           O  
ATOM   7341  CB  LEU A1170      59.051 -43.414 -11.294  1.00 77.42           C  
ATOM   7342  CG  LEU A1170      58.442 -44.595 -12.056  1.00 78.15           C  
ATOM   7343  CD1 LEU A1170      58.774 -45.900 -11.348  1.00 78.72           C  
ATOM   7344  CD2 LEU A1170      56.937 -44.442 -12.232  1.00 76.43           C  
ATOM   7345  N   ASN A1171      61.076 -42.921  -9.220  1.00 92.14           N  
ATOM   7346  CA  ASN A1171      62.212 -42.207  -8.651  1.00 91.58           C  
ATOM   7347  C   ASN A1171      62.488 -40.907  -9.398  1.00 91.04           C  
ATOM   7348  O   ASN A1171      63.147 -40.007  -8.878  1.00 87.13           O  
ATOM   7349  CB  ASN A1171      63.460 -43.091  -8.662  1.00 92.47           C  
ATOM   7350  CG  ASN A1171      63.860 -43.514 -10.062  1.00 93.06           C  
ATOM   7351  OD1 ASN A1171      63.009 -43.728 -10.924  1.00 95.71           O  
ATOM   7352  ND2 ASN A1171      65.162 -43.633 -10.294  1.00 95.08           N  
ATOM   7353  N   ASP A1172      61.985 -40.824 -10.626  1.00 90.82           N  
ATOM   7354  CA  ASP A1172      62.117 -39.622 -11.439  1.00 98.50           C  
ATOM   7355  C   ASP A1172      61.351 -38.471 -10.794  1.00 99.37           C  
ATOM   7356  O   ASP A1172      60.310 -38.680 -10.173  1.00 97.89           O  
ATOM   7357  CB  ASP A1172      61.611 -39.881 -12.861  1.00 91.60           C  
ATOM   7358  CG  ASP A1172      62.043 -38.808 -13.844  1.00 90.16           C  
ATOM   7359  OD1 ASP A1172      61.868 -37.608 -13.546  1.00 99.70           O  
ATOM   7360  OD2 ASP A1172      62.566 -39.169 -14.919  1.00 91.32           O  
ATOM   7361  N   LEU A1173      61.874 -37.259 -10.942  1.00 82.74           N  
ATOM   7362  CA  LEU A1173      61.254 -36.084 -10.341  1.00 80.69           C  
ATOM   7363  C   LEU A1173      61.320 -34.884 -11.283  1.00 82.09           C  
ATOM   7364  O   LEU A1173      62.212 -34.804 -12.131  1.00 84.78           O  
ATOM   7365  CB  LEU A1173      61.923 -35.748  -9.001  1.00 79.85           C  
ATOM   7366  CG  LEU A1173      63.200 -34.902  -9.011  1.00 80.07           C  
ATOM   7367  CD1 LEU A1173      63.550 -34.469  -7.597  1.00 78.66           C  
ATOM   7368  CD2 LEU A1173      64.364 -35.651  -9.644  1.00 80.56           C  
ATOM   7369  N   PRO A1174      60.364 -33.949 -11.145  1.00 75.51           N  
ATOM   7370  CA  PRO A1174      60.314 -32.730 -11.963  1.00 74.31           C  
ATOM   7371  C   PRO A1174      61.549 -31.841 -11.818  1.00 74.00           C  
ATOM   7372  O   PRO A1174      62.453 -32.142 -11.038  1.00 70.58           O  
ATOM   7373  CB  PRO A1174      59.071 -32.009 -11.432  1.00 74.62           C  
ATOM   7374  CG  PRO A1174      58.216 -33.095 -10.886  1.00 72.32           C  
ATOM   7375  CD  PRO A1174      59.171 -34.083 -10.292  1.00 72.66           C  
ATOM   7376  N   GLN A1175      61.571 -30.746 -12.570  1.00 66.74           N  
ATOM   7377  CA  GLN A1175      62.720 -29.850 -12.593  1.00 66.86           C  
ATOM   7378  C   GLN A1175      62.584 -28.719 -11.577  1.00 65.21           C  
ATOM   7379  O   GLN A1175      63.410 -28.579 -10.676  1.00 64.94           O  
ATOM   7380  CB  GLN A1175      62.908 -29.273 -13.997  1.00 69.30           C  
ATOM   7381  CG  GLN A1175      62.936 -30.325 -15.095  1.00 71.31           C  
ATOM   7382  CD  GLN A1175      63.040 -29.723 -16.482  1.00 73.86           C  
ATOM   7383  OE1 GLN A1175      63.015 -30.438 -17.485  1.00 75.79           O  
ATOM   7384  NE2 GLN A1175      63.157 -28.401 -16.548  1.00 73.97           N  
ATOM   7385  N   SER A1176      61.534 -27.916 -11.723  1.00 96.76           N  
ATOM   7386  CA  SER A1176      61.326 -26.753 -10.865  1.00 96.39           C  
ATOM   7387  C   SER A1176      60.790 -27.137  -9.490  1.00 93.63           C  
ATOM   7388  O   SER A1176      59.773 -26.609  -9.041  1.00 92.87           O  
ATOM   7389  CB  SER A1176      60.370 -25.765 -11.535  1.00 95.43           C  
ATOM   7390  OG  SER A1176      60.138 -24.639 -10.704  1.00 96.49           O  
ATOM   7391  N   VAL A1177      61.489 -28.051  -8.823  1.00 66.19           N  
ATOM   7392  CA  VAL A1177      61.098 -28.520  -7.502  1.00 67.33           C  
ATOM   7393  C   VAL A1177      62.249 -29.312  -6.887  1.00 65.45           C  
ATOM   7394  O   VAL A1177      62.243 -29.626  -5.696  1.00 66.87           O  
ATOM   7395  CB  VAL A1177      59.830 -29.400  -7.562  1.00 68.17           C  
ATOM   7396  CG1 VAL A1177      60.169 -30.793  -8.071  1.00 66.40           C  
ATOM   7397  CG2 VAL A1177      59.159 -29.474  -6.199  1.00 67.39           C  
ATOM   7398  N   ALA A1178      63.244 -29.617  -7.713  1.00 58.26           N  
ATOM   7399  CA  ALA A1178      64.370 -30.443  -7.293  1.00 58.32           C  
ATOM   7400  C   ALA A1178      65.320 -29.695  -6.364  1.00 57.29           C  
ATOM   7401  O   ALA A1178      65.833 -30.265  -5.401  1.00 56.68           O  
ATOM   7402  CB  ALA A1178      65.123 -30.952  -8.513  1.00 60.71           C  
ATOM   7403  N   PHE A1179      65.552 -28.419  -6.653  1.00 84.59           N  
ATOM   7404  CA  PHE A1179      66.521 -27.638  -5.892  1.00 85.28           C  
ATOM   7405  C   PHE A1179      65.895 -26.422  -5.220  1.00 86.01           C  
ATOM   7406  O   PHE A1179      64.848 -25.932  -5.644  1.00 87.13           O  
ATOM   7407  CB  PHE A1179      67.667 -27.188  -6.799  1.00 85.01           C  
ATOM   7408  CG  PHE A1179      68.427 -28.324  -7.418  1.00 87.30           C  
ATOM   7409  CD1 PHE A1179      69.487 -28.909  -6.749  1.00 86.56           C  
ATOM   7410  CD2 PHE A1179      68.080 -28.805  -8.669  1.00 87.53           C  
ATOM   7411  CE1 PHE A1179      70.188 -29.953  -7.314  1.00 85.37           C  
ATOM   7412  CE2 PHE A1179      68.777 -29.850  -9.240  1.00 87.87           C  
ATOM   7413  CZ  PHE A1179      69.832 -30.425  -8.563  1.00 89.17           C  
ATOM   7414  N   PHE A1180      66.551 -25.944  -4.167  1.00 56.99           N  
ATOM   7415  CA  PHE A1180      66.127 -24.733  -3.480  1.00 59.16           C  
ATOM   7416  C   PHE A1180      66.233 -23.523  -4.398  1.00 57.87           C  
ATOM   7417  O   PHE A1180      67.101 -23.464  -5.268  1.00 58.25           O  
ATOM   7418  CB  PHE A1180      66.965 -24.511  -2.219  1.00 55.08           C  
ATOM   7419  CG  PHE A1180      66.483 -25.284  -1.028  1.00 54.39           C  
ATOM   7420  CD1 PHE A1180      65.128 -25.436  -0.789  1.00 57.56           C  
ATOM   7421  CD2 PHE A1180      67.382 -25.859  -0.147  1.00 54.94           C  
ATOM   7422  CE1 PHE A1180      64.678 -26.145   0.307  1.00 55.46           C  
ATOM   7423  CE2 PHE A1180      66.938 -26.572   0.951  1.00 54.37           C  
ATOM   7424  CZ  PHE A1180      65.584 -26.714   1.177  1.00 55.13           C  
ATOM   7425  N   SER A1181      65.342 -22.560  -4.201  1.00 64.15           N  
ATOM   7426  CA  SER A1181      65.365 -21.336  -4.987  1.00 67.85           C  
ATOM   7427  C   SER A1181      66.025 -20.211  -4.198  1.00 67.21           C  
ATOM   7428  O   SER A1181      66.646 -19.319  -4.774  1.00 68.95           O  
ATOM   7429  CB  SER A1181      63.950 -20.937  -5.404  1.00 68.44           C  
ATOM   7430  OG  SER A1181      63.966 -19.777  -6.218  1.00 67.52           O  
ATOM   7431  N   ALA A1182      65.890 -20.262  -2.876  1.00 64.89           N  
ATOM   7432  CA  ALA A1182      66.449 -19.231  -2.010  1.00 65.97           C  
ATOM   7433  C   ALA A1182      67.292 -19.824  -0.881  1.00 62.41           C  
ATOM   7434  O   ALA A1182      66.804 -20.628  -0.086  1.00 63.90           O  
ATOM   7435  CB  ALA A1182      65.334 -18.367  -1.433  1.00 65.44           C  
ATOM   7436  N   VAL A1183      68.559 -19.423  -0.819  1.00 67.81           N  
ATOM   7437  CA  VAL A1183      69.454 -19.843   0.258  1.00 68.49           C  
ATOM   7438  C   VAL A1183      70.104 -18.633   0.926  1.00 68.36           C  
ATOM   7439  O   VAL A1183      70.953 -17.969   0.333  1.00 61.78           O  
ATOM   7440  CB  VAL A1183      70.559 -20.792  -0.251  1.00 67.79           C  
ATOM   7441  CG1 VAL A1183      71.492 -21.171   0.887  1.00 63.57           C  
ATOM   7442  CG2 VAL A1183      69.952 -22.034  -0.882  1.00 64.71           C  
ATOM   7443  N   ASP A1184      69.703 -18.354   2.161  1.00 84.82           N  
ATOM   7444  CA  ASP A1184      70.195 -17.185   2.885  1.00 88.84           C  
ATOM   7445  C   ASP A1184      71.561 -17.442   3.518  1.00 84.32           C  
ATOM   7446  O   ASP A1184      71.746 -18.427   4.225  1.00 82.58           O  
ATOM   7447  CB  ASP A1184      69.189 -16.770   3.961  1.00 87.37           C  
ATOM   7448  CG  ASP A1184      67.782 -16.612   3.414  1.00 89.53           C  
ATOM   7449  OD1 ASP A1184      66.829 -17.087   4.069  1.00 80.58           O  
ATOM   7450  OD2 ASP A1184      67.628 -16.013   2.329  1.00 81.30           O  
ATOM   7451  N   ILE A1185      72.516 -16.553   3.261  1.00 50.72           N  
ATOM   7452  CA  ILE A1185      73.865 -16.687   3.807  1.00 58.73           C  
ATOM   7453  C   ILE A1185      74.354 -15.373   4.407  1.00 58.78           C  
ATOM   7454  O   ILE A1185      74.799 -14.491   3.671  1.00 59.06           O  
ATOM   7455  CB  ILE A1185      74.876 -17.130   2.726  1.00 58.68           C  
ATOM   7456  CG1 ILE A1185      74.419 -18.417   2.037  1.00 58.91           C  
ATOM   7457  CG2 ILE A1185      76.260 -17.308   3.330  1.00 57.26           C  
ATOM   7458  CD1 ILE A1185      75.307 -18.835   0.885  1.00 59.27           C  
ATOM   7459  N   ASP A1186      74.283 -15.236   5.730  1.00 51.53           N  
ATOM   7460  CA  ASP A1186      74.743 -13.997   6.368  1.00 51.03           C  
ATOM   7461  C   ASP A1186      74.928 -14.131   7.877  1.00 59.99           C  
ATOM   7462  O   ASP A1186      74.843 -15.224   8.425  1.00 57.93           O  
ATOM   7463  CB  ASP A1186      73.776 -12.846   6.071  1.00 52.50           C  
ATOM   7464  CG  ASP A1186      72.404 -13.064   6.668  1.00 54.24           C  
ATOM   7465  OD1 ASP A1186      72.011 -14.234   6.851  1.00 53.00           O  
ATOM   7466  OD2 ASP A1186      71.720 -12.058   6.950  1.00 55.53           O  
ATOM   7467  N   ARG A1187      75.183 -13.008   8.542  1.00 80.58           N  
ATOM   7468  CA  ARG A1187      75.507 -13.011   9.966  1.00 76.15           C  
ATOM   7469  C   ARG A1187      74.296 -13.343  10.836  1.00 78.90           C  
ATOM   7470  O   ARG A1187      74.301 -14.338  11.558  1.00 77.36           O  
ATOM   7471  CB  ARG A1187      76.090 -11.660  10.381  1.00 75.51           C  
ATOM   7472  CG  ARG A1187      76.689 -11.641  11.778  1.00 75.13           C  
ATOM   7473  CD  ARG A1187      77.394 -10.322  12.051  1.00 73.28           C  
ATOM   7474  NE  ARG A1187      78.025 -10.295  13.368  1.00 73.27           N  
ATOM   7475  CZ  ARG A1187      79.278 -10.671  13.605  1.00 77.69           C  
ATOM   7476  NH1 ARG A1187      80.041 -11.107  12.611  1.00 79.21           N  
ATOM   7477  NH2 ARG A1187      79.769 -10.614  14.836  1.00 78.81           N  
ATOM   7478  N   CYS A1188      73.266 -12.505  10.775  1.00 49.33           N  
ATOM   7479  CA  CYS A1188      72.046 -12.750  11.537  1.00 54.09           C  
ATOM   7480  C   CYS A1188      70.979 -13.378  10.648  1.00 55.87           C  
ATOM   7481  O   CYS A1188      70.959 -13.154   9.439  1.00 53.48           O  
ATOM   7482  CB  CYS A1188      71.523 -11.453  12.156  1.00 53.27           C  
ATOM   7483  SG  CYS A1188      70.877 -10.258  10.964  1.00 54.36           S  
ATOM   7484  N   LEU A1189      70.093 -14.167  11.248  1.00 48.28           N  
ATOM   7485  CA  LEU A1189      69.042 -14.835  10.486  1.00 49.18           C  
ATOM   7486  C   LEU A1189      67.797 -13.957  10.380  1.00 51.65           C  
ATOM   7487  O   LEU A1189      67.424 -13.266  11.326  1.00 50.58           O  
ATOM   7488  CB  LEU A1189      68.700 -16.193  11.114  1.00 47.63           C  
ATOM   7489  CG  LEU A1189      68.178 -16.254  12.553  1.00 47.68           C  
ATOM   7490  CD1 LEU A1189      66.656 -16.282  12.587  1.00 50.53           C  
ATOM   7491  CD2 LEU A1189      68.752 -17.462  13.275  1.00 48.43           C  
ATOM   7492  N   ARG A1190      67.166 -13.987   9.211  1.00 66.24           N  
ATOM   7493  CA  ARG A1190      65.958 -13.213   8.960  1.00 66.07           C  
ATOM   7494  C   ARG A1190      65.176 -13.835   7.807  1.00 67.16           C  
ATOM   7495  O   ARG A1190      65.411 -14.987   7.443  1.00 65.24           O  
ATOM   7496  CB  ARG A1190      66.296 -11.750   8.652  1.00 66.53           C  
ATOM   7497  CG  ARG A1190      67.167 -11.551   7.421  1.00 68.06           C  
ATOM   7498  CD  ARG A1190      68.651 -11.580   7.753  1.00 65.95           C  
ATOM   7499  NE  ARG A1190      69.107 -10.325   8.342  1.00 64.76           N  
ATOM   7500  CZ  ARG A1190      69.673  -9.339   7.650  1.00 62.31           C  
ATOM   7501  NH1 ARG A1190      69.853  -9.464   6.342  1.00 64.07           N  
ATOM   7502  NH2 ARG A1190      70.059  -8.231   8.266  1.00 60.03           N  
ATOM   7503  N   LYS A1191      64.250 -13.075   7.233  1.00 76.88           N  
ATOM   7504  CA  LYS A1191      63.419 -13.583   6.147  1.00 70.32           C  
ATOM   7505  C   LYS A1191      64.096 -13.367   4.798  1.00 79.22           C  
ATOM   7506  O   LYS A1191      64.620 -14.303   4.197  1.00 77.81           O  
ATOM   7507  CB  LYS A1191      62.041 -12.919   6.159  1.00 70.51           C  
ATOM   7508  CG  LYS A1191      61.270 -13.078   7.464  1.00 74.04           C  
ATOM   7509  CD  LYS A1191      61.552 -11.930   8.423  1.00 72.73           C  
ATOM   7510  CE  LYS A1191      62.158 -12.425   9.728  1.00 74.00           C  
ATOM   7511  NZ  LYS A1191      62.498 -11.297  10.639  1.00 70.14           N  
ATOM   7512  N   GLU A1192      64.081 -12.126   4.325  1.00 72.00           N  
ATOM   7513  CA  GLU A1192      64.713 -11.782   3.058  1.00 79.64           C  
ATOM   7514  C   GLU A1192      66.156 -11.348   3.297  1.00 79.63           C  
ATOM   7515  O   GLU A1192      66.539 -11.055   4.426  1.00 77.99           O  
ATOM   7516  CB  GLU A1192      63.928 -10.676   2.350  1.00 71.66           C  
ATOM   7517  CG  GLU A1192      64.020 -10.716   0.831  1.00 79.32           C  
ATOM   7518  CD  GLU A1192      63.273 -11.892   0.228  1.00 73.03           C  
ATOM   7519  OE1 GLU A1192      62.391 -12.456   0.911  1.00 72.47           O  
ATOM   7520  OE2 GLU A1192      63.568 -12.254  -0.930  1.00 70.05           O  
ATOM   7521  N   VAL A1193      66.955 -11.304   2.235  1.00 87.28           N  
ATOM   7522  CA  VAL A1193      68.362 -10.930   2.357  1.00 87.94           C  
ATOM   7523  C   VAL A1193      68.532  -9.462   2.745  1.00 85.99           C  
ATOM   7524  O   VAL A1193      69.516  -9.092   3.387  1.00 84.97           O  
ATOM   7525  CB  VAL A1193      69.131 -11.203   1.051  1.00 84.66           C  
ATOM   7526  CG1 VAL A1193      69.301 -12.699   0.842  1.00 83.59           C  
ATOM   7527  CG2 VAL A1193      68.420 -10.567  -0.135  1.00 85.43           C  
ATOM   7528  N   THR A1194      67.572  -8.632   2.354  1.00 72.29           N  
ATOM   7529  CA  THR A1194      67.579  -7.217   2.708  1.00 78.19           C  
ATOM   7530  C   THR A1194      66.640  -6.974   3.882  1.00 77.09           C  
ATOM   7531  O   THR A1194      65.466  -7.338   3.824  1.00 79.01           O  
ATOM   7532  CB  THR A1194      67.161  -6.335   1.520  1.00 76.45           C  
ATOM   7533  OG1 THR A1194      65.803  -6.623   1.166  1.00 79.34           O  
ATOM   7534  CG2 THR A1194      68.057  -6.600   0.320  1.00 77.65           C  
ATOM   7535  N   MET A1195      67.148  -6.355   4.944  1.00 67.67           N  
ATOM   7536  CA  MET A1195      66.368  -6.217   6.169  1.00 67.61           C  
ATOM   7537  C   MET A1195      66.318  -4.785   6.696  1.00 66.57           C  
ATOM   7538  O   MET A1195      67.350  -4.141   6.885  1.00 64.61           O  
ATOM   7539  CB  MET A1195      66.928  -7.150   7.249  1.00 67.13           C  
ATOM   7540  CG  MET A1195      66.038  -7.320   8.478  1.00 68.01           C  
ATOM   7541  SD  MET A1195      66.264  -6.043   9.733  1.00 69.58           S  
ATOM   7542  CE  MET A1195      65.165  -6.635  11.019  1.00 72.46           C  
ATOM   7543  N   ASP A1196      65.102  -4.303   6.934  1.00 94.14           N  
ATOM   7544  CA  ASP A1196      64.887  -3.028   7.605  1.00 91.91           C  
ATOM   7545  C   ASP A1196      64.170  -3.280   8.927  1.00 90.68           C  
ATOM   7546  O   ASP A1196      63.670  -4.381   9.162  1.00 92.83           O  
ATOM   7547  CB  ASP A1196      64.079  -2.071   6.726  1.00 91.85           C  
ATOM   7548  CG  ASP A1196      62.658  -2.548   6.497  1.00 92.30           C  
ATOM   7549  OD1 ASP A1196      62.433  -3.295   5.522  1.00 93.21           O  
ATOM   7550  OD2 ASP A1196      61.768  -2.174   7.289  1.00 92.32           O  
ATOM   7551  N   CYS A1197      64.107  -2.268   9.784  1.00 75.83           N  
ATOM   7552  CA  CYS A1197      63.550  -2.455  11.119  1.00 75.66           C  
ATOM   7553  C   CYS A1197      62.911  -1.190  11.686  1.00 73.21           C  
ATOM   7554  O   CYS A1197      62.880  -0.151  11.032  1.00 70.82           O  
ATOM   7555  CB  CYS A1197      64.640  -2.959  12.063  1.00 75.61           C  
ATOM   7556  SG  CYS A1197      66.294  -2.360  11.655  1.00 72.82           S  
ATOM   7557  N   LYS A1198      62.399  -1.291  12.910  1.00 52.22           N  
ATOM   7558  CA  LYS A1198      61.693  -0.182  13.545  1.00 52.60           C  
ATOM   7559  C   LYS A1198      62.493   0.422  14.695  1.00 52.31           C  
ATOM   7560  O   LYS A1198      62.923   1.572  14.622  1.00 53.02           O  
ATOM   7561  CB  LYS A1198      60.320  -0.644  14.048  1.00 52.25           C  
ATOM   7562  CG  LYS A1198      59.233   0.435  14.069  1.00 53.01           C  
ATOM   7563  CD  LYS A1198      59.485   1.500  15.128  1.00 53.16           C  
ATOM   7564  CE  LYS A1198      59.650   0.880  16.506  1.00 52.25           C  
ATOM   7565  NZ  LYS A1198      60.320   1.810  17.457  1.00 52.39           N  
ATOM   7566  N   THR A1199      62.670  -0.351  15.764  1.00 78.40           N  
ATOM   7567  CA  THR A1199      63.289   0.155  16.989  1.00 73.62           C  
ATOM   7568  C   THR A1199      64.711   0.703  16.786  1.00 72.53           C  
ATOM   7569  O   THR A1199      65.007   1.811  17.234  1.00 68.00           O  
ATOM   7570  CB  THR A1199      63.314  -0.930  18.094  1.00 76.25           C  
ATOM   7571  OG1 THR A1199      61.975  -1.336  18.397  1.00 75.46           O  
ATOM   7572  CG2 THR A1199      63.968  -0.394  19.358  1.00 71.56           C  
ATOM   7573  N   PRO A1200      65.599  -0.051  16.106  1.00 80.67           N  
ATOM   7574  CA  PRO A1200      66.910   0.573  15.908  1.00 88.22           C  
ATOM   7575  C   PRO A1200      66.926   1.514  14.706  1.00 85.32           C  
ATOM   7576  O   PRO A1200      67.952   2.144  14.437  1.00 87.35           O  
ATOM   7577  CB  PRO A1200      67.829  -0.626  15.680  1.00 80.92           C  
ATOM   7578  CG  PRO A1200      66.957  -1.619  15.013  1.00 89.37           C  
ATOM   7579  CD  PRO A1200      65.568  -1.426  15.571  1.00 82.62           C  
ATOM   7580  N   SER A1201      65.802   1.591  13.996  1.00 51.64           N  
ATOM   7581  CA  SER A1201      65.642   2.464  12.831  1.00 51.21           C  
ATOM   7582  C   SER A1201      66.621   2.132  11.701  1.00 51.96           C  
ATOM   7583  O   SER A1201      66.205   1.787  10.594  1.00 53.48           O  
ATOM   7584  CB  SER A1201      65.788   3.932  13.240  1.00 58.62           C  
ATOM   7585  OG  SER A1201      64.869   4.261  14.267  1.00 57.78           O  
ATOM   7586  N   ASN A1202      67.916   2.239  11.982  1.00 91.44           N  
ATOM   7587  CA  ASN A1202      68.943   1.900  11.003  1.00 94.25           C  
ATOM   7588  C   ASN A1202      69.612   0.559  11.309  1.00 95.93           C  
ATOM   7589  O   ASN A1202      70.341   0.436  12.294  1.00 93.67           O  
ATOM   7590  CB  ASN A1202      69.995   3.010  10.929  1.00 91.66           C  
ATOM   7591  CG  ASN A1202      70.365   3.558  12.296  1.00 96.50           C  
ATOM   7592  OD1 ASN A1202      71.267   3.047  12.961  1.00 95.81           O  
ATOM   7593  ND2 ASN A1202      69.671   4.606  12.720  1.00 97.45           N  
ATOM   7594  N   PRO A1203      69.356  -0.455  10.464  1.00 65.09           N  
ATOM   7595  CA  PRO A1203      69.937  -1.794  10.632  1.00 61.93           C  
ATOM   7596  C   PRO A1203      71.452  -1.817  10.431  1.00 63.64           C  
ATOM   7597  O   PRO A1203      72.186  -2.186  11.346  1.00 59.20           O  
ATOM   7598  CB  PRO A1203      69.229  -2.625   9.554  1.00 64.69           C  
ATOM   7599  CG  PRO A1203      68.764  -1.632   8.543  1.00 63.58           C  
ATOM   7600  CD  PRO A1203      68.435  -0.390   9.315  1.00 63.38           C  
ATOM   7601  N   THR A1204      71.907  -1.426   9.243  1.00 61.13           N  
ATOM   7602  CA  THR A1204      73.332  -1.369   8.942  1.00 65.61           C  
ATOM   7603  C   THR A1204      73.983  -0.226   9.722  1.00 60.59           C  
ATOM   7604  O   THR A1204      75.202  -0.188   9.890  1.00 68.93           O  
ATOM   7605  CB  THR A1204      73.585  -1.189   7.429  1.00 65.36           C  
ATOM   7606  OG1 THR A1204      72.724  -2.068   6.694  1.00 66.13           O  
ATOM   7607  CG2 THR A1204      75.033  -1.501   7.078  1.00 61.65           C  
ATOM   7608  N   GLY A1205      73.156   0.704  10.195  1.00 73.85           N  
ATOM   7609  CA  GLY A1205      73.610   1.756  11.084  1.00 70.30           C  
ATOM   7610  C   GLY A1205      74.193   1.142  12.341  1.00 69.73           C  
ATOM   7611  O   GLY A1205      75.210   1.603  12.856  1.00 66.48           O  
ATOM   7612  N   MET A1206      73.539   0.095  12.835  1.00 68.44           N  
ATOM   7613  CA  MET A1206      74.097  -0.725  13.902  1.00 67.28           C  
ATOM   7614  C   MET A1206      75.063  -1.726  13.278  1.00 66.24           C  
ATOM   7615  O   MET A1206      75.009  -1.972  12.074  1.00 69.45           O  
ATOM   7616  CB  MET A1206      72.994  -1.444  14.683  1.00 72.45           C  
ATOM   7617  CG  MET A1206      71.871  -0.532  15.162  1.00 72.53           C  
ATOM   7618  SD  MET A1206      72.423   0.778  16.270  1.00 65.08           S  
ATOM   7619  CE  MET A1206      73.103  -0.182  17.619  1.00 68.17           C  
ATOM   7620  N   GLU A1207      75.942  -2.301  14.091  1.00 96.36           N  
ATOM   7621  CA  GLU A1207      76.983  -3.192  13.584  1.00 97.17           C  
ATOM   7622  C   GLU A1207      76.401  -4.435  12.914  1.00 99.43           C  
ATOM   7623  O   GLU A1207      76.212  -5.468  13.556  1.00 92.78           O  
ATOM   7624  CB  GLU A1207      77.930  -3.601  14.714  1.00 95.44           C  
ATOM   7625  CG  GLU A1207      78.524  -2.424  15.485  1.00 91.72           C  
ATOM   7626  CD  GLU A1207      79.363  -1.506  14.611  1.00 87.00           C  
ATOM   7627  OE1 GLU A1207      79.992  -1.998  13.650  1.00 88.80           O  
ATOM   7628  OE2 GLU A1207      79.396  -0.287  14.887  1.00 84.74           O  
ATOM   7629  N   ARG A1208      76.118  -4.323  11.618  1.00 74.21           N  
ATOM   7630  CA  ARG A1208      75.570  -5.430  10.837  1.00 74.44           C  
ATOM   7631  C   ARG A1208      76.251  -5.544   9.476  1.00 75.10           C  
ATOM   7632  O   ARG A1208      77.181  -4.798   9.171  1.00 73.22           O  
ATOM   7633  CB  ARG A1208      74.062  -5.263  10.641  1.00 70.87           C  
ATOM   7634  CG  ARG A1208      73.239  -5.312  11.917  1.00 72.53           C  
ATOM   7635  CD  ARG A1208      71.751  -5.283  11.600  1.00 76.59           C  
ATOM   7636  NE  ARG A1208      70.932  -5.242  12.806  1.00 74.24           N  
ATOM   7637  CZ  ARG A1208      69.604  -5.230  12.803  1.00 77.75           C  
ATOM   7638  NH1 ARG A1208      68.940  -5.253  11.655  1.00 76.21           N  
ATOM   7639  NH2 ARG A1208      68.937  -5.194  13.949  1.00 78.23           N  
ATOM   7640  N   ARG A1209      75.778  -6.482   8.660  1.00 59.09           N  
ATOM   7641  CA  ARG A1209      76.278  -6.638   7.298  1.00 58.03           C  
ATOM   7642  C   ARG A1209      75.128  -6.663   6.298  1.00 60.73           C  
ATOM   7643  O   ARG A1209      74.204  -5.855   6.379  1.00 61.86           O  
ATOM   7644  CB  ARG A1209      77.118  -7.910   7.165  1.00 58.66           C  
ATOM   7645  CG  ARG A1209      78.362  -7.931   8.036  1.00 56.17           C  
ATOM   7646  CD  ARG A1209      79.388  -8.919   7.503  1.00 53.39           C  
ATOM   7647  NE  ARG A1209      78.849 -10.269   7.387  1.00 54.09           N  
ATOM   7648  CZ  ARG A1209      78.973 -11.205   8.323  1.00 53.28           C  
ATOM   7649  NH1 ARG A1209      79.619 -10.937   9.450  1.00 52.81           N  
ATOM   7650  NH2 ARG A1209      78.452 -12.410   8.132  1.00 54.52           N  
ATOM   7651  N   TYR A1210      75.190  -7.600   5.358  1.00 70.97           N  
ATOM   7652  CA  TYR A1210      74.156  -7.731   4.341  1.00 74.67           C  
ATOM   7653  C   TYR A1210      73.963  -9.192   3.955  1.00 73.88           C  
ATOM   7654  O   TYR A1210      74.775 -10.048   4.304  1.00 72.78           O  
ATOM   7655  CB  TYR A1210      74.508  -6.898   3.107  1.00 73.67           C  
ATOM   7656  CG  TYR A1210      73.370  -6.044   2.597  1.00 74.07           C  
ATOM   7657  CD1 TYR A1210      72.453  -6.546   1.684  1.00 79.65           C  
ATOM   7658  CD2 TYR A1210      73.212  -4.733   3.030  1.00 73.63           C  
ATOM   7659  CE1 TYR A1210      71.411  -5.767   1.215  1.00 80.62           C  
ATOM   7660  CE2 TYR A1210      72.172  -3.947   2.568  1.00 75.16           C  
ATOM   7661  CZ  TYR A1210      71.275  -4.468   1.661  1.00 79.39           C  
ATOM   7662  OH  TYR A1210      70.238  -3.689   1.197  1.00 78.17           O  
ATOM   7663  N   GLY A1211      72.883  -9.474   3.231  1.00 84.17           N  
ATOM   7664  CA  GLY A1211      72.582 -10.830   2.810  1.00 86.66           C  
ATOM   7665  C   GLY A1211      72.866 -11.067   1.338  1.00 85.60           C  
ATOM   7666  O   GLY A1211      73.106 -10.125   0.582  1.00 85.82           O  
ATOM   7667  N   ILE A1212      72.843 -12.333   0.933  1.00 84.52           N  
ATOM   7668  CA  ILE A1212      73.086 -12.700  -0.461  1.00 87.58           C  
ATOM   7669  C   ILE A1212      72.126 -13.794  -0.935  1.00 87.19           C  
ATOM   7670  O   ILE A1212      72.094 -14.889  -0.369  1.00 84.47           O  
ATOM   7671  CB  ILE A1212      74.543 -13.174  -0.675  1.00 85.01           C  
ATOM   7672  CG1 ILE A1212      74.993 -14.075   0.476  1.00 80.21           C  
ATOM   7673  CG2 ILE A1212      75.480 -11.982  -0.798  1.00 83.98           C  
ATOM   7674  CD1 ILE A1212      76.420 -14.562   0.350  1.00 80.22           C  
ATOM   7675  N   PRO A1213      71.331 -13.490  -1.974  1.00123.58           N  
ATOM   7676  CA  PRO A1213      70.401 -14.452  -2.579  1.00123.51           C  
ATOM   7677  C   PRO A1213      71.130 -15.622  -3.234  1.00121.05           C  
ATOM   7678  O   PRO A1213      72.223 -15.430  -3.769  1.00129.95           O  
ATOM   7679  CB  PRO A1213      69.661 -13.615  -3.630  1.00123.69           C  
ATOM   7680  CG  PRO A1213      69.854 -12.194  -3.208  1.00124.60           C  
ATOM   7681  CD  PRO A1213      71.212 -12.153  -2.581  1.00124.54           C  
ATOM   7682  N   GLN A1214      70.536 -16.812  -3.201  1.00 74.89           N  
ATOM   7683  CA  GLN A1214      71.178 -17.997  -3.767  1.00 74.33           C  
ATOM   7684  C   GLN A1214      70.183 -19.127  -4.045  1.00 70.87           C  
ATOM   7685  O   GLN A1214      69.489 -19.587  -3.137  1.00 70.61           O  
ATOM   7686  CB  GLN A1214      72.278 -18.497  -2.830  1.00 71.78           C  
ATOM   7687  CG  GLN A1214      73.454 -19.130  -3.546  1.00 71.00           C  
ATOM   7688  CD  GLN A1214      74.209 -18.136  -4.405  1.00 71.35           C  
ATOM   7689  OE1 GLN A1214      74.698 -18.475  -5.483  1.00 71.47           O  
ATOM   7690  NE2 GLN A1214      74.311 -16.900  -3.930  1.00 73.90           N  
ATOM   7691  N   GLY A1215      70.122 -19.579  -5.296  1.00 57.25           N  
ATOM   7692  CA  GLY A1215      70.953 -19.042  -6.358  1.00 59.13           C  
ATOM   7693  C   GLY A1215      71.443 -20.103  -7.327  1.00 60.48           C  
ATOM   7694  O   GLY A1215      71.098 -21.279  -7.205  1.00 59.96           O  
ATOM   7695  N   GLU A1216      72.251 -19.682  -8.295  1.00 84.40           N  
ATOM   7696  CA  GLU A1216      72.813 -20.593  -9.287  1.00 87.16           C  
ATOM   7697  C   GLU A1216      74.336 -20.532  -9.300  1.00 85.96           C  
ATOM   7698  O   GLU A1216      74.994 -21.347  -9.947  1.00 84.25           O  
ATOM   7699  CB  GLU A1216      72.265 -20.273 -10.681  1.00 85.81           C  
ATOM   7700  CG  GLU A1216      70.903 -20.879 -10.975  1.00 84.37           C  
ATOM   7701  CD  GLU A1216      70.980 -22.360 -11.300  1.00 84.14           C  
ATOM   7702  OE1 GLU A1216      72.104 -22.875 -11.478  1.00 84.12           O  
ATOM   7703  OE2 GLU A1216      69.917 -23.010 -11.378  1.00 86.21           O  
ATOM   7704  N   ALA A1217      74.892 -19.563  -8.580  1.00 89.33           N  
ATOM   7705  CA  ALA A1217      76.336 -19.359  -8.551  1.00 89.45           C  
ATOM   7706  C   ALA A1217      77.024 -20.279  -7.544  1.00 87.07           C  
ATOM   7707  O   ALA A1217      78.239 -20.466  -7.598  1.00 87.85           O  
ATOM   7708  CB  ALA A1217      76.653 -17.905  -8.240  1.00 89.31           C  
ATOM   7709  N   LEU A1218      76.244 -20.851  -6.631  1.00 60.76           N  
ATOM   7710  CA  LEU A1218      76.792 -21.752  -5.621  1.00 68.91           C  
ATOM   7711  C   LEU A1218      76.959 -23.155  -6.190  1.00 69.54           C  
ATOM   7712  O   LEU A1218      77.555 -24.028  -5.558  1.00 68.35           O  
ATOM   7713  CB  LEU A1218      75.905 -21.776  -4.363  1.00 66.76           C  
ATOM   7714  CG  LEU A1218      74.552 -22.504  -4.255  1.00 66.28           C  
ATOM   7715  CD1 LEU A1218      73.672 -22.337  -5.494  1.00 68.17           C  
ATOM   7716  CD2 LEU A1218      74.715 -23.978  -3.886  1.00 65.40           C  
ATOM   7717  N   ASP A1219      76.435 -23.360  -7.394  1.00 98.93           N  
ATOM   7718  CA  ASP A1219      76.505 -24.656  -8.058  1.00100.15           C  
ATOM   7719  C   ASP A1219      77.825 -24.838  -8.805  1.00101.18           C  
ATOM   7720  O   ASP A1219      77.909 -25.626  -9.748  1.00101.81           O  
ATOM   7721  CB  ASP A1219      75.328 -24.824  -9.021  1.00101.48           C  
ATOM   7722  CG  ASP A1219      73.985 -24.742  -8.320  1.00101.37           C  
ATOM   7723  OD1 ASP A1219      73.581 -25.742  -7.689  1.00 98.73           O  
ATOM   7724  OD2 ASP A1219      73.327 -23.685  -8.406  1.00 98.79           O  
ATOM   7725  N   ILE A1220      78.851 -24.105  -8.382  1.00 60.03           N  
ATOM   7726  CA  ILE A1220      80.179 -24.228  -8.974  1.00 61.34           C  
ATOM   7727  C   ILE A1220      81.193 -24.685  -7.930  1.00 69.48           C  
ATOM   7728  O   ILE A1220      82.322 -25.047  -8.262  1.00 60.22           O  
ATOM   7729  CB  ILE A1220      80.652 -22.898  -9.599  1.00 62.95           C  
ATOM   7730  CG1 ILE A1220      80.968 -21.875  -8.509  1.00 61.25           C  
ATOM   7731  CG2 ILE A1220      79.611 -22.362 -10.574  1.00 64.71           C  
ATOM   7732  CD1 ILE A1220      81.405 -20.529  -9.041  1.00 62.76           C  
ATOM   7733  N   TYR A1221      80.781 -24.665  -6.665  1.00 83.78           N  
ATOM   7734  CA  TYR A1221      81.630 -25.123  -5.571  1.00 82.07           C  
ATOM   7735  C   TYR A1221      81.207 -26.511  -5.115  1.00 82.98           C  
ATOM   7736  O   TYR A1221      80.189 -26.667  -4.441  1.00 82.97           O  
ATOM   7737  CB  TYR A1221      81.573 -24.146  -4.395  1.00 81.46           C  
ATOM   7738  CG  TYR A1221      81.673 -22.698  -4.802  1.00 80.71           C  
ATOM   7739  CD1 TYR A1221      80.547 -21.888  -4.830  1.00 84.16           C  
ATOM   7740  CD2 TYR A1221      82.891 -22.144  -5.169  1.00 82.64           C  
ATOM   7741  CE1 TYR A1221      80.631 -20.562  -5.203  1.00 82.68           C  
ATOM   7742  CE2 TYR A1221      82.985 -20.819  -5.546  1.00 89.89           C  
ATOM   7743  CZ  TYR A1221      81.852 -20.035  -5.561  1.00 83.06           C  
ATOM   7744  OH  TYR A1221      81.939 -18.713  -5.935  1.00 82.55           O  
ATOM   7745  N   GLN A1222      81.995 -27.517  -5.481  1.00 77.21           N  
ATOM   7746  CA  GLN A1222      81.670 -28.903  -5.158  1.00 78.41           C  
ATOM   7747  C   GLN A1222      81.855 -29.195  -3.672  1.00 74.39           C  
ATOM   7748  O   GLN A1222      82.394 -28.374  -2.928  1.00 73.79           O  
ATOM   7749  CB  GLN A1222      82.523 -29.860  -5.998  1.00 75.65           C  
ATOM   7750  CG  GLN A1222      82.079 -29.989  -7.452  1.00 77.20           C  
ATOM   7751  CD  GLN A1222      82.294 -28.721  -8.260  1.00 77.82           C  
ATOM   7752  OE1 GLN A1222      83.050 -27.834  -7.862  1.00 77.12           O  
ATOM   7753  NE2 GLN A1222      81.625 -28.629  -9.403  1.00 72.42           N  
ATOM   7754  N   ILE A1223      81.407 -30.373  -3.245  1.00 73.58           N  
ATOM   7755  CA  ILE A1223      81.437 -30.750  -1.835  1.00 72.91           C  
ATOM   7756  C   ILE A1223      82.867 -31.023  -1.362  1.00 76.60           C  
ATOM   7757  O   ILE A1223      83.139 -31.050  -0.160  1.00 72.44           O  
ATOM   7758  CB  ILE A1223      80.550 -31.993  -1.571  1.00 75.03           C  
ATOM   7759  CG1 ILE A1223      80.173 -32.092  -0.089  1.00 74.45           C  
ATOM   7760  CG2 ILE A1223      81.233 -33.262  -2.064  1.00 75.96           C  
ATOM   7761  CD1 ILE A1223      79.342 -30.930   0.411  1.00 69.76           C  
ATOM   7762  N   ILE A1224      83.776 -31.212  -2.313  1.00 99.55           N  
ATOM   7763  CA  ILE A1224      85.182 -31.434  -1.999  1.00 97.56           C  
ATOM   7764  C   ILE A1224      85.782 -30.170  -1.385  1.00 96.63           C  
ATOM   7765  O   ILE A1224      85.387 -29.058  -1.734  1.00 98.05           O  
ATOM   7766  CB  ILE A1224      85.982 -31.842  -3.254  1.00 91.15           C  
ATOM   7767  CG1 ILE A1224      85.221 -32.907  -4.047  1.00 90.71           C  
ATOM   7768  CG2 ILE A1224      87.366 -32.352  -2.876  1.00 99.67           C  
ATOM   7769  CD1 ILE A1224      85.008 -34.198  -3.286  1.00 91.67           C  
ATOM   7770  N   GLU A1225      86.724 -30.348  -0.463  1.00 90.70           N  
ATOM   7771  CA  GLU A1225      87.347 -29.232   0.243  1.00 99.01           C  
ATOM   7772  C   GLU A1225      88.035 -28.257  -0.706  1.00 99.30           C  
ATOM   7773  O   GLU A1225      87.922 -27.040  -0.552  1.00 98.23           O  
ATOM   7774  CB  GLU A1225      88.362 -29.751   1.262  1.00 96.06           C  
ATOM   7775  CG  GLU A1225      87.815 -30.815   2.195  1.00 94.97           C  
ATOM   7776  CD  GLU A1225      88.890 -31.417   3.078  1.00 95.29           C  
ATOM   7777  OE1 GLU A1225      90.013 -30.870   3.103  1.00 92.19           O  
ATOM   7778  OE2 GLU A1225      88.617 -32.439   3.743  1.00 96.13           O  
ATOM   7779  N   LEU A1226      88.751 -28.800  -1.684  1.00 76.14           N  
ATOM   7780  CA  LEU A1226      89.516 -27.983  -2.618  1.00 75.31           C  
ATOM   7781  C   LEU A1226      88.626 -27.352  -3.685  1.00 76.54           C  
ATOM   7782  O   LEU A1226      88.374 -27.950  -4.732  1.00 78.38           O  
ATOM   7783  CB  LEU A1226      90.612 -28.824  -3.276  1.00 76.84           C  
ATOM   7784  CG  LEU A1226      91.597 -29.499  -2.318  1.00 75.75           C  
ATOM   7785  CD1 LEU A1226      92.649 -30.290  -3.085  1.00 76.98           C  
ATOM   7786  CD2 LEU A1226      92.250 -28.470  -1.408  1.00 73.19           C  
ATOM   7787  N   THR A1227      88.155 -26.137  -3.414  1.00 85.34           N  
ATOM   7788  CA  THR A1227      87.346 -25.390  -4.371  1.00 86.85           C  
ATOM   7789  C   THR A1227      87.989 -24.048  -4.703  1.00 87.31           C  
ATOM   7790  O   THR A1227      89.063 -23.723  -4.192  1.00 85.86           O  
ATOM   7791  CB  THR A1227      85.916 -25.143  -3.848  1.00 87.84           C  
ATOM   7792  OG1 THR A1227      85.977 -24.477  -2.580  1.00 84.55           O  
ATOM   7793  CG2 THR A1227      85.168 -26.455  -3.692  1.00 85.45           C  
ATOM   7794  N   LYS A1228      87.322 -23.282  -5.564  1.00 80.70           N  
ATOM   7795  CA  LYS A1228      87.767 -21.943  -5.951  1.00 81.96           C  
ATOM   7796  C   LYS A1228      89.167 -21.945  -6.561  1.00 80.28           C  
ATOM   7797  O   LYS A1228      89.809 -20.900  -6.672  1.00 82.47           O  
ATOM   7798  CB  LYS A1228      87.722 -21.000  -4.746  1.00 80.25           C  
ATOM   7799  CG  LYS A1228      86.378 -20.968  -4.038  1.00 88.00           C  
ATOM   7800  CD  LYS A1228      86.435 -20.127  -2.773  1.00 87.43           C  
ATOM   7801  CE  LYS A1228      85.111 -20.168  -2.026  1.00 85.52           C  
ATOM   7802  NZ  LYS A1228      85.162 -19.386  -0.761  1.00 83.95           N  
TER    7803      LYS A1228                                                      
ATOM   7804  N   ALA B  68      44.753  30.988  20.754  1.00 66.69           N  
ATOM   7805  CA  ALA B  68      45.205  32.373  20.693  1.00 68.67           C  
ATOM   7806  C   ALA B  68      44.276  33.292  21.483  1.00 60.70           C  
ATOM   7807  O   ALA B  68      43.983  34.409  21.060  1.00 62.91           O  
ATOM   7808  CB  ALA B  68      45.304  32.833  19.247  1.00 60.04           C  
ATOM   7809  N   LEU B  69      43.815  32.807  22.632  1.00 76.14           N  
ATOM   7810  CA  LEU B  69      42.931  33.587  23.492  1.00 77.92           C  
ATOM   7811  C   LEU B  69      43.166  33.262  24.964  1.00 81.68           C  
ATOM   7812  O   LEU B  69      42.454  33.747  25.840  1.00 85.29           O  
ATOM   7813  CB  LEU B  69      41.457  33.357  23.123  1.00 77.62           C  
ATOM   7814  CG  LEU B  69      40.892  32.000  22.673  1.00 75.32           C  
ATOM   7815  CD1 LEU B  69      41.172  31.729  21.195  1.00 72.04           C  
ATOM   7816  CD2 LEU B  69      41.379  30.837  23.538  1.00 73.45           C  
ATOM   7817  N   LEU B  70      44.172  32.434  25.223  1.00 52.45           N  
ATOM   7818  CA  LEU B  70      44.526  32.063  26.589  1.00 54.36           C  
ATOM   7819  C   LEU B  70      45.452  33.100  27.205  1.00 60.25           C  
ATOM   7820  O   LEU B  70      45.882  32.962  28.348  1.00 63.50           O  
ATOM   7821  CB  LEU B  70      45.186  30.683  26.627  1.00 51.03           C  
ATOM   7822  CG  LEU B  70      46.648  30.568  26.183  1.00 57.33           C  
ATOM   7823  CD1 LEU B  70      47.263  29.281  26.713  1.00 55.39           C  
ATOM   7824  CD2 LEU B  70      46.774  30.627  24.670  1.00 55.33           C  
ATOM   7825  N   GLU B  71      45.757  34.138  26.434  1.00 74.26           N  
ATOM   7826  CA  GLU B  71      46.639  35.204  26.886  1.00 78.03           C  
ATOM   7827  C   GLU B  71      46.039  35.925  28.088  1.00 75.88           C  
ATOM   7828  O   GLU B  71      46.755  36.317  29.012  1.00 78.41           O  
ATOM   7829  CB  GLU B  71      46.899  36.195  25.750  1.00 78.16           C  
ATOM   7830  CG  GLU B  71      46.903  35.563  24.365  1.00 73.38           C  
ATOM   7831  CD  GLU B  71      47.962  34.488  24.208  1.00 70.56           C  
ATOM   7832  OE1 GLU B  71      49.039  34.612  24.831  1.00 70.04           O  
ATOM   7833  OE2 GLU B  71      47.714  33.517  23.462  1.00 64.18           O  
ATOM   7834  N   ILE B  72      44.719  36.090  28.068  1.00 51.94           N  
ATOM   7835  CA  ILE B  72      44.004  36.725  29.168  1.00 60.17           C  
ATOM   7836  C   ILE B  72      44.183  35.913  30.448  1.00 61.82           C  
ATOM   7837  O   ILE B  72      44.198  36.465  31.547  1.00 60.68           O  
ATOM   7838  CB  ILE B  72      42.502  36.875  28.853  1.00 59.22           C  
ATOM   7839  CG1 ILE B  72      42.299  37.349  27.413  1.00 55.62           C  
ATOM   7840  CG2 ILE B  72      41.842  37.835  29.834  1.00 65.26           C  
ATOM   7841  CD1 ILE B  72      42.865  38.723  27.133  1.00 57.68           C  
ATOM   7842  N   CYS B  73      44.324  34.600  30.294  1.00 61.16           N  
ATOM   7843  CA  CYS B  73      44.572  33.715  31.425  1.00 65.44           C  
ATOM   7844  C   CYS B  73      46.001  33.880  31.932  1.00 69.31           C  
ATOM   7845  O   CYS B  73      46.286  33.651  33.107  1.00 63.38           O  
ATOM   7846  CB  CYS B  73      44.318  32.257  31.037  1.00 61.15           C  
ATOM   7847  SG  CYS B  73      42.781  31.986  30.128  1.00 55.64           S  
ATOM   7848  N   GLN B  74      46.896  34.282  31.032  1.00 69.83           N  
ATOM   7849  CA  GLN B  74      48.297  34.490  31.380  1.00 62.47           C  
ATOM   7850  C   GLN B  74      48.498  35.836  32.064  1.00 74.09           C  
ATOM   7851  O   GLN B  74      49.431  36.013  32.846  1.00 76.46           O  
ATOM   7852  CB  GLN B  74      49.181  34.402  30.135  1.00 66.63           C  
ATOM   7853  CG  GLN B  74      48.921  33.185  29.268  1.00 67.13           C  
ATOM   7854  CD  GLN B  74      49.098  31.881  30.018  1.00 67.81           C  
ATOM   7855  OE1 GLN B  74      49.893  31.790  30.954  1.00 61.08           O  
ATOM   7856  NE2 GLN B  74      48.354  30.862  29.608  1.00 61.52           N  
ATOM   7857  N   ARG B  75      47.622  36.785  31.754  1.00 64.58           N  
ATOM   7858  CA  ARG B  75      47.692  38.108  32.361  1.00 65.86           C  
ATOM   7859  C   ARG B  75      46.970  38.125  33.704  1.00 70.17           C  
ATOM   7860  O   ARG B  75      47.489  38.650  34.689  1.00 76.07           O  
ATOM   7861  CB  ARG B  75      47.096  39.164  31.429  1.00 63.75           C  
ATOM   7862  CG  ARG B  75      47.742  39.233  30.055  1.00 67.02           C  
ATOM   7863  CD  ARG B  75      47.198  40.410  29.265  1.00 67.48           C  
ATOM   7864  NE  ARG B  75      45.738  40.450  29.295  1.00 68.03           N  
ATOM   7865  CZ  ARG B  75      45.006  41.463  28.838  1.00 67.74           C  
ATOM   7866  NH1 ARG B  75      45.596  42.527  28.312  1.00 63.20           N  
ATOM   7867  NH2 ARG B  75      43.683  41.411  28.910  1.00 66.63           N  
ATOM   7868  N   ARG B  76      45.772  37.547  33.730  1.00 66.73           N  
ATOM   7869  CA  ARG B  76      44.965  37.478  34.945  1.00 71.60           C  
ATOM   7870  C   ARG B  76      45.718  36.752  36.052  1.00 70.02           C  
ATOM   7871  O   ARG B  76      45.768  37.208  37.194  1.00 73.33           O  
ATOM   7872  CB  ARG B  76      43.635  36.774  34.665  1.00 65.62           C  
ATOM   7873  CG  ARG B  76      42.696  36.699  35.858  1.00 70.13           C  
ATOM   7874  CD  ARG B  76      41.477  35.833  35.560  1.00 66.35           C  
ATOM   7875  NE  ARG B  76      40.734  36.291  34.387  1.00 65.18           N  
ATOM   7876  CZ  ARG B  76      40.773  35.697  33.198  1.00 64.46           C  
ATOM   7877  NH1 ARG B  76      41.518  34.614  33.017  1.00 61.08           N  
ATOM   7878  NH2 ARG B  76      40.065  36.185  32.188  1.00 64.41           N  
ATOM   7879  N   HIS B  77      46.302  35.613  35.695  1.00 60.15           N  
ATOM   7880  CA  HIS B  77      47.149  34.858  36.601  1.00 57.27           C  
ATOM   7881  C   HIS B  77      48.565  34.888  36.051  1.00 58.58           C  
ATOM   7882  O   HIS B  77      48.857  34.287  35.017  1.00 58.94           O  
ATOM   7883  CB  HIS B  77      46.627  33.434  36.758  1.00 51.28           C  
ATOM   7884  CG  HIS B  77      45.164  33.372  37.060  1.00 55.26           C  
ATOM   7885  ND1 HIS B  77      44.661  33.451  38.340  1.00 57.21           N  
ATOM   7886  CD2 HIS B  77      44.089  33.271  36.241  1.00 52.57           C  
ATOM   7887  CE1 HIS B  77      43.343  33.386  38.300  1.00 57.30           C  
ATOM   7888  NE2 HIS B  77      42.970  33.274  37.039  1.00 57.29           N  
ATOM   7889  N   PHE B  78      49.435  35.604  36.749  1.00 61.80           N  
ATOM   7890  CA  PHE B  78      50.707  36.039  36.183  1.00 64.17           C  
ATOM   7891  C   PHE B  78      51.686  34.917  35.874  1.00 68.50           C  
ATOM   7892  O   PHE B  78      52.587  34.626  36.661  1.00 68.44           O  
ATOM   7893  CB  PHE B  78      51.362  37.051  37.121  1.00 61.99           C  
ATOM   7894  CG  PHE B  78      50.611  38.345  37.218  1.00 69.23           C  
ATOM   7895  CD1 PHE B  78      50.891  39.388  36.350  1.00 71.89           C  
ATOM   7896  CD2 PHE B  78      49.610  38.511  38.161  1.00 70.92           C  
ATOM   7897  CE1 PHE B  78      50.195  40.577  36.428  1.00 77.62           C  
ATOM   7898  CE2 PHE B  78      48.911  39.698  38.245  1.00 76.92           C  
ATOM   7899  CZ  PHE B  78      49.202  40.732  37.376  1.00 70.47           C  
ATOM   7900  N   LEU B  79      51.503  34.295  34.716  1.00 47.48           N  
ATOM   7901  CA  LEU B  79      52.520  33.422  34.152  1.00 42.04           C  
ATOM   7902  C   LEU B  79      53.316  34.224  33.127  1.00 43.17           C  
ATOM   7903  O   LEU B  79      54.324  33.758  32.599  1.00 49.98           O  
ATOM   7904  CB  LEU B  79      51.899  32.174  33.514  1.00 44.48           C  
ATOM   7905  CG  LEU B  79      51.393  31.074  34.457  1.00 42.40           C  
ATOM   7906  CD1 LEU B  79      49.921  31.253  34.798  1.00 44.05           C  
ATOM   7907  CD2 LEU B  79      51.650  29.692  33.875  1.00 46.08           C  
ATOM   7908  N   SER B  80      52.847  35.440  32.857  1.00 42.68           N  
ATOM   7909  CA  SER B  80      53.522  36.350  31.939  1.00 44.87           C  
ATOM   7910  C   SER B  80      53.295  37.804  32.350  1.00 45.12           C  
ATOM   7911  O   SER B  80      52.649  38.077  33.362  1.00 50.36           O  
ATOM   7912  CB  SER B  80      53.035  36.128  30.506  1.00 47.54           C  
ATOM   7913  OG  SER B  80      53.313  34.810  30.070  1.00 41.56           O  
ATOM   7914  N   GLY B  81      53.832  38.732  31.564  1.00 87.24           N  
ATOM   7915  CA  GLY B  81      53.636  40.147  31.818  1.00 98.08           C  
ATOM   7916  C   GLY B  81      52.205  40.559  31.529  1.00 95.01           C  
ATOM   7917  O   GLY B  81      51.509  39.894  30.761  1.00 85.23           O  
ATOM   7918  N   SER B  82      51.762  41.652  32.142  1.00108.28           N  
ATOM   7919  CA  SER B  82      50.395  42.125  31.955  1.00109.56           C  
ATOM   7920  C   SER B  82      50.304  43.122  30.803  1.00106.39           C  
ATOM   7921  O   SER B  82      49.243  43.694  30.548  1.00102.99           O  
ATOM   7922  CB  SER B  82      49.863  42.760  33.243  1.00111.39           C  
ATOM   7923  OG  SER B  82      50.582  43.939  33.565  1.00116.79           O  
ATOM   7924  N   LYS B  83      51.422  43.325  30.112  1.00 67.03           N  
ATOM   7925  CA  LYS B  83      51.464  44.228  28.968  1.00 62.16           C  
ATOM   7926  C   LYS B  83      50.696  43.639  27.789  1.00 66.32           C  
ATOM   7927  O   LYS B  83      50.775  42.441  27.522  1.00 60.27           O  
ATOM   7928  CB  LYS B  83      52.913  44.519  28.565  1.00 63.14           C  
ATOM   7929  CG  LYS B  83      53.056  45.491  27.400  1.00 64.39           C  
ATOM   7930  CD  LYS B  83      54.511  45.679  26.982  1.00 64.85           C  
ATOM   7931  CE  LYS B  83      55.235  46.703  27.850  1.00 64.00           C  
ATOM   7932  NZ  LYS B  83      55.576  46.193  29.207  1.00 68.21           N  
ATOM   7933  N   GLN B  84      49.950  44.488  27.089  1.00103.19           N  
ATOM   7934  CA  GLN B  84      49.181  44.052  25.931  1.00 96.32           C  
ATOM   7935  C   GLN B  84      50.102  43.732  24.757  1.00 91.27           C  
ATOM   7936  O   GLN B  84      49.775  42.905  23.905  1.00 93.78           O  
ATOM   7937  CB  GLN B  84      48.158  45.120  25.534  1.00 95.43           C  
ATOM   7938  CG  GLN B  84      47.206  44.698  24.421  1.00 90.81           C  
ATOM   7939  CD  GLN B  84      46.317  43.532  24.814  1.00 97.35           C  
ATOM   7940  OE1 GLN B  84      46.050  43.308  25.995  1.00 90.58           O  
ATOM   7941  NE2 GLN B  84      45.853  42.780  23.821  1.00 92.51           N  
ATOM   7942  N   GLN B  85      51.260  44.385  24.721  1.00 88.45           N  
ATOM   7943  CA  GLN B  85      52.224  44.166  23.649  1.00 83.62           C  
ATOM   7944  C   GLN B  85      53.044  42.905  23.903  1.00 82.79           C  
ATOM   7945  O   GLN B  85      54.204  42.974  24.311  1.00 85.57           O  
ATOM   7946  CB  GLN B  85      53.150  45.376  23.497  1.00 81.84           C  
ATOM   7947  CG  GLN B  85      53.507  45.705  22.053  1.00 88.23           C  
ATOM   7948  CD  GLN B  85      54.133  44.535  21.314  1.00 83.08           C  
ATOM   7949  OE1 GLN B  85      55.080  43.915  21.797  1.00 82.71           O  
ATOM   7950  NE2 GLN B  85      53.602  44.229  20.136  1.00 87.34           N  
ATOM   7951  N   LEU B  86      52.423  41.756  23.663  1.00 51.16           N  
ATOM   7952  CA  LEU B  86      53.098  40.470  23.777  1.00 56.77           C  
ATOM   7953  C   LEU B  86      52.823  39.628  22.540  1.00 50.07           C  
ATOM   7954  O   LEU B  86      52.252  38.541  22.631  1.00 46.91           O  
ATOM   7955  CB  LEU B  86      52.648  39.725  25.035  1.00 56.69           C  
ATOM   7956  CG  LEU B  86      53.122  40.300  26.372  1.00 54.93           C  
ATOM   7957  CD1 LEU B  86      52.558  39.496  27.530  1.00 54.67           C  
ATOM   7958  CD2 LEU B  86      54.639  40.330  26.426  1.00 56.88           C  
ATOM   7959  N   SER B  87      53.226  40.140  21.382  1.00 51.60           N  
ATOM   7960  CA  SER B  87      53.012  39.445  20.120  1.00 59.05           C  
ATOM   7961  C   SER B  87      53.833  38.165  20.054  1.00 55.08           C  
ATOM   7962  O   SER B  87      54.731  37.953  20.869  1.00 55.55           O  
ATOM   7963  CB  SER B  87      53.363  40.357  18.939  1.00 50.28           C  
ATOM   7964  OG  SER B  87      54.727  40.739  18.983  1.00 52.96           O  
ATOM   7965  N   ARG B  88      53.517  37.314  19.083  1.00 67.98           N  
ATOM   7966  CA  ARG B  88      54.247  36.068  18.889  1.00 65.19           C  
ATOM   7967  C   ARG B  88      55.709  36.362  18.572  1.00 69.36           C  
ATOM   7968  O   ARG B  88      56.603  35.615  18.969  1.00 68.78           O  
ATOM   7969  CB  ARG B  88      53.616  35.239  17.770  1.00 62.61           C  
ATOM   7970  CG  ARG B  88      52.120  35.020  17.930  1.00 59.98           C  
ATOM   7971  CD  ARG B  88      51.548  34.206  16.779  1.00 58.37           C  
ATOM   7972  NE  ARG B  88      51.990  34.707  15.481  1.00 60.06           N  
ATOM   7973  CZ  ARG B  88      51.434  34.372  14.319  1.00 62.64           C  
ATOM   7974  NH1 ARG B  88      51.904  34.875  13.188  1.00 67.84           N  
ATOM   7975  NH2 ARG B  88      50.402  33.539  14.292  1.00 63.60           N  
ATOM   7976  N   ASP B  89      55.940  37.460  17.861  1.00 59.90           N  
ATOM   7977  CA  ASP B  89      57.291  37.891  17.526  1.00 51.74           C  
ATOM   7978  C   ASP B  89      58.048  38.319  18.777  1.00 55.46           C  
ATOM   7979  O   ASP B  89      59.214  37.969  18.962  1.00 56.53           O  
ATOM   7980  CB  ASP B  89      57.253  39.038  16.514  1.00 56.72           C  
ATOM   7981  CG  ASP B  89      56.435  38.703  15.284  1.00 53.84           C  
ATOM   7982  OD1 ASP B  89      56.780  39.191  14.188  1.00 55.79           O  
ATOM   7983  OD2 ASP B  89      55.445  37.952  15.415  1.00 51.25           O  
ATOM   7984  N   SER B  90      57.370  39.075  19.637  1.00 59.94           N  
ATOM   7985  CA  SER B  90      57.972  39.595  20.859  1.00 52.93           C  
ATOM   7986  C   SER B  90      58.308  38.482  21.852  1.00 52.74           C  
ATOM   7987  O   SER B  90      59.199  38.635  22.689  1.00 55.23           O  
ATOM   7988  CB  SER B  90      57.038  40.617  21.512  1.00 55.70           C  
ATOM   7989  OG  SER B  90      57.634  41.199  22.659  1.00 51.48           O  
ATOM   7990  N   LEU B  91      57.596  37.365  21.752  1.00 50.12           N  
ATOM   7991  CA  LEU B  91      57.818  36.227  22.642  1.00 56.88           C  
ATOM   7992  C   LEU B  91      58.830  35.244  22.066  1.00 54.64           C  
ATOM   7993  O   LEU B  91      59.569  34.592  22.807  1.00 54.78           O  
ATOM   7994  CB  LEU B  91      56.499  35.505  22.924  1.00 53.93           C  
ATOM   7995  CG  LEU B  91      55.464  36.267  23.753  1.00 55.29           C  
ATOM   7996  CD1 LEU B  91      54.197  35.443  23.901  1.00 52.17           C  
ATOM   7997  CD2 LEU B  91      56.033  36.631  25.114  1.00 51.88           C  
ATOM   7998  N   LEU B  92      58.857  35.135  20.743  1.00 51.49           N  
ATOM   7999  CA  LEU B  92      59.771  34.215  20.073  1.00 55.11           C  
ATOM   8000  C   LEU B  92      61.169  34.815  19.927  1.00 51.80           C  
ATOM   8001  O   LEU B  92      62.155  34.087  19.808  1.00 53.89           O  
ATOM   8002  CB  LEU B  92      59.218  33.820  18.700  1.00 55.51           C  
ATOM   8003  CG  LEU B  92      58.357  32.555  18.604  1.00 51.73           C  
ATOM   8004  CD1 LEU B  92      57.259  32.533  19.658  1.00 56.07           C  
ATOM   8005  CD2 LEU B  92      57.758  32.427  17.210  1.00 51.97           C  
ATOM   8006  N   SER B  93      61.251  36.143  19.938  1.00 54.91           N  
ATOM   8007  CA  SER B  93      62.534  36.828  19.802  1.00 59.05           C  
ATOM   8008  C   SER B  93      63.229  36.988  21.151  1.00 56.04           C  
ATOM   8009  O   SER B  93      64.452  37.112  21.219  1.00 55.97           O  
ATOM   8010  CB  SER B  93      62.346  38.199  19.148  1.00 55.97           C  
ATOM   8011  OG  SER B  93      61.686  38.088  17.899  1.00 54.55           O  
ATOM   8012  N   GLY B  94      62.443  36.983  22.224  1.00 55.75           N  
ATOM   8013  CA  GLY B  94      62.979  37.153  23.562  1.00 53.93           C  
ATOM   8014  C   GLY B  94      63.022  38.613  23.966  1.00 50.82           C  
ATOM   8015  O   GLY B  94      63.804  39.006  24.833  1.00 51.67           O  
ATOM   8016  N   CYS B  95      62.179  39.419  23.329  1.00 61.56           N  
ATOM   8017  CA  CYS B  95      62.105  40.845  23.624  1.00 67.03           C  
ATOM   8018  C   CYS B  95      60.967  41.151  24.592  1.00 66.37           C  
ATOM   8019  O   CYS B  95      60.614  42.312  24.801  1.00 63.60           O  
ATOM   8020  CB  CYS B  95      61.925  41.653  22.336  1.00 68.84           C  
ATOM   8021  SG  CYS B  95      63.256  41.448  21.132  1.00 66.60           S  
ATOM   8022  N   HIS B  96      60.397  40.102  25.174  1.00 68.90           N  
ATOM   8023  CA  HIS B  96      59.314  40.253  26.142  1.00 61.14           C  
ATOM   8024  C   HIS B  96      59.815  40.929  27.416  1.00 69.59           C  
ATOM   8025  O   HIS B  96      60.953  40.708  27.830  1.00 62.33           O  
ATOM   8026  CB  HIS B  96      58.691  38.889  26.462  1.00 67.13           C  
ATOM   8027  CG  HIS B  96      59.696  37.816  26.747  1.00 63.42           C  
ATOM   8028  ND1 HIS B  96      60.456  37.793  27.895  1.00 68.34           N  
ATOM   8029  CD2 HIS B  96      60.065  36.731  26.028  1.00 58.74           C  
ATOM   8030  CE1 HIS B  96      61.252  36.738  27.872  1.00 66.28           C  
ATOM   8031  NE2 HIS B  96      61.036  36.077  26.750  1.00 59.36           N  
ATOM   8032  N   PRO B  97      58.961  41.759  28.041  1.00 63.87           N  
ATOM   8033  CA  PRO B  97      59.321  42.511  29.250  1.00 62.81           C  
ATOM   8034  C   PRO B  97      59.665  41.619  30.440  1.00 66.45           C  
ATOM   8035  O   PRO B  97      60.250  42.093  31.414  1.00 63.44           O  
ATOM   8036  CB  PRO B  97      58.059  43.335  29.539  1.00 65.72           C  
ATOM   8037  CG  PRO B  97      56.957  42.605  28.850  1.00 67.44           C  
ATOM   8038  CD  PRO B  97      57.581  42.045  27.612  1.00 63.04           C  
ATOM   8039  N   GLY B  98      59.301  40.344  30.360  1.00 59.43           N  
ATOM   8040  CA  GLY B  98      59.595  39.406  31.425  1.00 58.37           C  
ATOM   8041  C   GLY B  98      58.412  38.517  31.747  1.00 52.45           C  
ATOM   8042  O   GLY B  98      57.273  38.828  31.400  1.00 52.82           O  
ATOM   8043  N   PHE B  99      58.689  37.401  32.412  1.00 57.99           N  
ATOM   8044  CA  PHE B  99      57.647  36.458  32.791  1.00 59.37           C  
ATOM   8045  C   PHE B  99      57.142  36.750  34.199  1.00 55.48           C  
ATOM   8046  O   PHE B  99      57.839  37.370  35.000  1.00 59.25           O  
ATOM   8047  CB  PHE B  99      58.170  35.021  32.702  1.00 52.52           C  
ATOM   8048  CG  PHE B  99      58.603  34.615  31.319  1.00 47.61           C  
ATOM   8049  CD1 PHE B  99      57.940  35.095  30.202  1.00 46.91           C  
ATOM   8050  CD2 PHE B  99      59.675  33.756  31.138  1.00 43.44           C  
ATOM   8051  CE1 PHE B  99      58.335  34.723  28.928  1.00 41.90           C  
ATOM   8052  CE2 PHE B  99      60.077  33.382  29.867  1.00 49.46           C  
ATOM   8053  CZ  PHE B  99      59.406  33.866  28.760  1.00 43.83           C  
ATOM   8054  N   GLY B 100      55.923  36.305  34.493  1.00 52.53           N  
ATOM   8055  CA  GLY B 100      55.359  36.461  35.821  1.00 57.65           C  
ATOM   8056  C   GLY B 100      55.953  35.453  36.784  1.00 55.15           C  
ATOM   8057  O   GLY B 100      56.747  34.603  36.381  1.00 51.79           O  
ATOM   8058  N   PRO B 101      55.577  35.543  38.068  1.00 44.10           N  
ATOM   8059  CA  PRO B 101      56.064  34.624  39.104  1.00 43.46           C  
ATOM   8060  C   PRO B 101      55.746  33.161  38.797  1.00 48.07           C  
ATOM   8061  O   PRO B 101      56.624  32.305  38.912  1.00 46.13           O  
ATOM   8062  CB  PRO B 101      55.330  35.093  40.366  1.00 51.42           C  
ATOM   8063  CG  PRO B 101      54.184  35.909  39.871  1.00 48.66           C  
ATOM   8064  CD  PRO B 101      54.662  36.554  38.618  1.00 48.93           C  
ATOM   8065  N   LEU B 102      54.507  32.884  38.405  1.00 55.98           N  
ATOM   8066  CA  LEU B 102      54.111  31.527  38.044  1.00 59.39           C  
ATOM   8067  C   LEU B 102      54.852  31.068  36.794  1.00 54.45           C  
ATOM   8068  O   LEU B 102      55.132  29.882  36.627  1.00 50.94           O  
ATOM   8069  CB  LEU B 102      52.600  31.445  37.820  1.00 57.55           C  
ATOM   8070  CG  LEU B 102      51.698  31.934  38.952  1.00 52.88           C  
ATOM   8071  CD1 LEU B 102      50.236  31.777  38.570  1.00 53.42           C  
ATOM   8072  CD2 LEU B 102      52.003  31.188  40.240  1.00 53.78           C  
ATOM   8073  N   GLY B 103      55.167  32.018  35.921  1.00 48.24           N  
ATOM   8074  CA  GLY B 103      55.871  31.721  34.688  1.00 44.13           C  
ATOM   8075  C   GLY B 103      57.333  31.392  34.915  1.00 44.96           C  
ATOM   8076  O   GLY B 103      57.867  30.455  34.319  1.00 40.29           O  
ATOM   8077  N   VAL B 104      57.982  32.163  35.783  1.00 61.38           N  
ATOM   8078  CA  VAL B 104      59.390  31.935  36.093  1.00 62.29           C  
ATOM   8079  C   VAL B 104      59.537  30.721  37.010  1.00 69.36           C  
ATOM   8080  O   VAL B 104      60.597  30.097  37.060  1.00 60.30           O  
ATOM   8081  CB  VAL B 104      60.042  33.181  36.742  1.00 60.51           C  
ATOM   8082  CG1 VAL B 104      59.548  33.374  38.165  1.00 63.95           C  
ATOM   8083  CG2 VAL B 104      61.561  33.069  36.713  1.00 62.75           C  
ATOM   8084  N   GLU B 105      58.467  30.383  37.725  1.00 54.25           N  
ATOM   8085  CA  GLU B 105      58.455  29.179  38.548  1.00 53.72           C  
ATOM   8086  C   GLU B 105      58.283  27.952  37.660  1.00 56.87           C  
ATOM   8087  O   GLU B 105      58.925  26.920  37.870  1.00 57.80           O  
ATOM   8088  CB  GLU B 105      57.339  29.241  39.591  1.00 59.72           C  
ATOM   8089  CG  GLU B 105      57.302  28.051  40.538  1.00 59.10           C  
ATOM   8090  CD  GLU B 105      58.456  28.050  41.523  1.00 57.26           C  
ATOM   8091  OE1 GLU B 105      59.050  29.126  41.748  1.00 54.19           O  
ATOM   8092  OE2 GLU B 105      58.771  26.973  42.073  1.00 57.97           O  
ATOM   8093  N   LEU B 106      57.406  28.076  36.670  1.00 54.97           N  
ATOM   8094  CA  LEU B 106      57.210  27.035  35.667  1.00 53.50           C  
ATOM   8095  C   LEU B 106      58.512  26.776  34.922  1.00 56.25           C  
ATOM   8096  O   LEU B 106      58.919  25.625  34.736  1.00 57.89           O  
ATOM   8097  CB  LEU B 106      56.096  27.436  34.694  1.00 52.68           C  
ATOM   8098  CG  LEU B 106      55.892  26.633  33.406  1.00 55.46           C  
ATOM   8099  CD1 LEU B 106      55.655  25.165  33.694  1.00 53.87           C  
ATOM   8100  CD2 LEU B 106      54.726  27.209  32.618  1.00 54.45           C  
ATOM   8101  N   ARG B 107      59.172  27.854  34.509  1.00 46.48           N  
ATOM   8102  CA  ARG B 107      60.454  27.744  33.828  1.00 46.48           C  
ATOM   8103  C   ARG B 107      61.517  27.178  34.763  1.00 45.17           C  
ATOM   8104  O   ARG B 107      62.411  26.451  34.332  1.00 46.69           O  
ATOM   8105  CB  ARG B 107      60.898  29.102  33.286  1.00 43.83           C  
ATOM   8106  CG  ARG B 107      62.131  29.033  32.404  1.00 43.67           C  
ATOM   8107  CD  ARG B 107      62.524  30.405  31.901  1.00 40.69           C  
ATOM   8108  NE  ARG B 107      62.778  31.336  32.996  1.00 44.97           N  
ATOM   8109  CZ  ARG B 107      63.174  32.591  32.829  1.00 50.18           C  
ATOM   8110  NH1 ARG B 107      63.365  33.070  31.607  1.00 49.11           N  
ATOM   8111  NH2 ARG B 107      63.380  33.371  33.881  1.00 59.30           N  
ATOM   8112  N   LYS B 108      61.411  27.515  36.046  1.00 46.16           N  
ATOM   8113  CA  LYS B 108      62.322  26.981  37.053  1.00 40.51           C  
ATOM   8114  C   LYS B 108      62.224  25.464  37.125  1.00 45.96           C  
ATOM   8115  O   LYS B 108      63.233  24.765  37.051  1.00 46.77           O  
ATOM   8116  CB  LYS B 108      62.029  27.578  38.432  1.00 47.37           C  
ATOM   8117  CG  LYS B 108      62.722  26.848  39.572  1.00 52.88           C  
ATOM   8118  CD  LYS B 108      62.298  27.379  40.931  1.00 53.92           C  
ATOM   8119  CE  LYS B 108      62.716  28.830  41.111  1.00 59.83           C  
ATOM   8120  NZ  LYS B 108      62.403  29.328  42.478  1.00 55.75           N  
ATOM   8121  N   ASN B 109      61.002  24.963  37.270  1.00 56.51           N  
ATOM   8122  CA  ASN B 109      60.772  23.527  37.375  1.00 53.80           C  
ATOM   8123  C   ASN B 109      61.091  22.791  36.080  1.00 58.51           C  
ATOM   8124  O   ASN B 109      61.533  21.642  36.102  1.00 58.30           O  
ATOM   8125  CB  ASN B 109      59.330  23.250  37.792  1.00 54.04           C  
ATOM   8126  CG  ASN B 109      59.020  23.760  39.182  1.00 56.35           C  
ATOM   8127  OD1 ASN B 109      59.909  23.867  40.027  1.00 50.16           O  
ATOM   8128  ND2 ASN B 109      57.756  24.078  39.428  1.00 54.00           N  
ATOM   8129  N   LEU B 110      60.862  23.456  34.952  1.00 40.28           N  
ATOM   8130  CA  LEU B 110      61.216  22.883  33.660  1.00 47.22           C  
ATOM   8131  C   LEU B 110      62.728  22.721  33.543  1.00 40.98           C  
ATOM   8132  O   LEU B 110      63.224  21.665  33.144  1.00 41.06           O  
ATOM   8133  CB  LEU B 110      60.685  23.754  32.520  1.00 45.03           C  
ATOM   8134  CG  LEU B 110      61.004  23.262  31.109  1.00 43.19           C  
ATOM   8135  CD1 LEU B 110      60.407  21.886  30.881  1.00 42.54           C  
ATOM   8136  CD2 LEU B 110      60.506  24.248  30.064  1.00 41.82           C  
ATOM   8137  N   ALA B 111      63.453  23.778  33.900  1.00 56.34           N  
ATOM   8138  CA  ALA B 111      64.912  23.774  33.854  1.00 50.25           C  
ATOM   8139  C   ALA B 111      65.494  22.758  34.829  1.00 59.33           C  
ATOM   8140  O   ALA B 111      66.505  22.113  34.543  1.00 50.52           O  
ATOM   8141  CB  ALA B 111      65.453  25.162  34.154  1.00 58.04           C  
ATOM   8142  N   ALA B 112      64.851  22.623  35.984  1.00 48.68           N  
ATOM   8143  CA  ALA B 112      65.264  21.644  36.980  1.00 52.01           C  
ATOM   8144  C   ALA B 112      65.035  20.237  36.452  1.00 48.62           C  
ATOM   8145  O   ALA B 112      65.836  19.336  36.696  1.00 51.66           O  
ATOM   8146  CB  ALA B 112      64.511  21.857  38.285  1.00 54.42           C  
ATOM   8147  N   GLU B 113      63.940  20.056  35.721  1.00 53.44           N  
ATOM   8148  CA  GLU B 113      63.618  18.757  35.147  1.00 56.07           C  
ATOM   8149  C   GLU B 113      64.597  18.420  34.024  1.00 55.70           C  
ATOM   8150  O   GLU B 113      64.876  17.249  33.764  1.00 57.43           O  
ATOM   8151  CB  GLU B 113      62.177  18.730  34.636  1.00 59.60           C  
ATOM   8152  CG  GLU B 113      61.407  17.475  35.028  1.00 58.92           C  
ATOM   8153  CD  GLU B 113      61.196  17.355  36.528  1.00 52.30           C  
ATOM   8154  OE1 GLU B 113      61.168  18.398  37.217  1.00 59.46           O  
ATOM   8155  OE2 GLU B 113      61.056  16.217  37.021  1.00 54.40           O  
ATOM   8156  N   TRP B 114      65.114  19.452  33.362  1.00 41.46           N  
ATOM   8157  CA  TRP B 114      66.214  19.279  32.419  1.00 43.02           C  
ATOM   8158  C   TRP B 114      67.447  18.796  33.163  1.00 49.16           C  
ATOM   8159  O   TRP B 114      68.052  17.788  32.802  1.00 51.09           O  
ATOM   8160  CB  TRP B 114      66.521  20.588  31.681  1.00 42.42           C  
ATOM   8161  CG  TRP B 114      67.873  20.620  30.997  1.00 46.09           C  
ATOM   8162  CD1 TRP B 114      69.089  20.837  31.584  1.00 54.55           C  
ATOM   8163  CD2 TRP B 114      68.131  20.456  29.598  1.00 43.94           C  
ATOM   8164  NE1 TRP B 114      70.084  20.801  30.640  1.00 53.98           N  
ATOM   8165  CE2 TRP B 114      69.523  20.573  29.411  1.00 48.88           C  
ATOM   8166  CE3 TRP B 114      67.320  20.219  28.483  1.00 49.33           C  
ATOM   8167  CZ2 TRP B 114      70.122  20.460  28.163  1.00 48.90           C  
ATOM   8168  CZ3 TRP B 114      67.916  20.108  27.244  1.00 43.09           C  
ATOM   8169  CH2 TRP B 114      69.303  20.227  27.092  1.00 47.49           C  
ATOM   8170  N   TRP B 115      67.809  19.537  34.205  1.00 52.18           N  
ATOM   8171  CA  TRP B 115      69.013  19.268  34.982  1.00 50.87           C  
ATOM   8172  C   TRP B 115      69.004  17.860  35.572  1.00 52.80           C  
ATOM   8173  O   TRP B 115      70.052  17.229  35.712  1.00 57.22           O  
ATOM   8174  CB  TRP B 115      69.156  20.310  36.094  1.00 56.66           C  
ATOM   8175  CG  TRP B 115      70.557  20.485  36.592  1.00 50.88           C  
ATOM   8176  CD1 TRP B 115      71.040  20.149  37.822  1.00 56.97           C  
ATOM   8177  CD2 TRP B 115      71.660  21.038  35.865  1.00 51.42           C  
ATOM   8178  NE1 TRP B 115      72.374  20.461  37.909  1.00 51.31           N  
ATOM   8179  CE2 TRP B 115      72.780  21.008  36.719  1.00 59.01           C  
ATOM   8180  CE3 TRP B 115      71.809  21.557  34.576  1.00 53.16           C  
ATOM   8181  CZ2 TRP B 115      74.031  21.477  36.327  1.00 55.09           C  
ATOM   8182  CZ3 TRP B 115      73.053  22.022  34.187  1.00 53.26           C  
ATOM   8183  CH2 TRP B 115      74.148  21.979  35.061  1.00 54.02           C  
ATOM   8184  N   THR B 116      67.816  17.367  35.905  1.00 55.65           N  
ATOM   8185  CA  THR B 116      67.678  16.029  36.463  1.00 53.91           C  
ATOM   8186  C   THR B 116      67.889  14.955  35.401  1.00 59.26           C  
ATOM   8187  O   THR B 116      68.672  14.026  35.594  1.00 58.74           O  
ATOM   8188  CB  THR B 116      66.296  15.829  37.112  1.00 55.12           C  
ATOM   8189  OG1 THR B 116      66.159  16.715  38.229  1.00 51.16           O  
ATOM   8190  CG2 THR B 116      66.132  14.397  37.593  1.00 57.21           C  
ATOM   8191  N   SER B 117      67.197  15.091  34.275  1.00 59.48           N  
ATOM   8192  CA  SER B 117      67.233  14.074  33.231  1.00 54.90           C  
ATOM   8193  C   SER B 117      68.317  14.327  32.187  1.00 53.01           C  
ATOM   8194  O   SER B 117      68.195  13.889  31.043  1.00 56.92           O  
ATOM   8195  CB  SER B 117      65.869  13.977  32.543  1.00 52.51           C  
ATOM   8196  OG  SER B 117      65.882  13.001  31.514  1.00 53.90           O  
ATOM   8197  N   VAL B 118      69.376  15.031  32.579  1.00 69.18           N  
ATOM   8198  CA  VAL B 118      70.513  15.267  31.690  1.00 68.10           C  
ATOM   8199  C   VAL B 118      71.844  15.160  32.430  1.00 66.05           C  
ATOM   8200  O   VAL B 118      72.765  14.482  31.974  1.00 60.17           O  
ATOM   8201  CB  VAL B 118      70.437  16.658  31.014  1.00 65.28           C  
ATOM   8202  CG1 VAL B 118      71.773  17.020  30.377  1.00 62.91           C  
ATOM   8203  CG2 VAL B 118      69.326  16.700  29.976  1.00 57.93           C  
ATOM   8204  N   VAL B 119      71.938  15.823  33.578  1.00 53.65           N  
ATOM   8205  CA  VAL B 119      73.210  15.942  34.285  1.00 51.73           C  
ATOM   8206  C   VAL B 119      73.373  14.941  35.425  1.00 55.00           C  
ATOM   8207  O   VAL B 119      74.375  14.228  35.496  1.00 60.41           O  
ATOM   8208  CB  VAL B 119      73.388  17.359  34.860  1.00 52.69           C  
ATOM   8209  CG1 VAL B 119      74.734  17.484  35.558  1.00 60.71           C  
ATOM   8210  CG2 VAL B 119      73.254  18.394  33.760  1.00 58.73           C  
ATOM   8211  N   VAL B 120      72.390  14.901  36.318  1.00 40.58           N  
ATOM   8212  CA  VAL B 120      72.494  14.096  37.531  1.00 44.35           C  
ATOM   8213  C   VAL B 120      72.570  12.596  37.248  1.00 45.29           C  
ATOM   8214  O   VAL B 120      73.553  11.944  37.601  1.00 49.95           O  
ATOM   8215  CB  VAL B 120      71.307  14.361  38.474  1.00 42.52           C  
ATOM   8216  CG1 VAL B 120      71.477  13.589  39.771  1.00 47.01           C  
ATOM   8217  CG2 VAL B 120      71.175  15.849  38.754  1.00 41.93           C  
ATOM   8218  N   PHE B 121      71.533  12.057  36.612  1.00 87.43           N  
ATOM   8219  CA  PHE B 121      71.432  10.618  36.375  1.00 81.23           C  
ATOM   8220  C   PHE B 121      72.573  10.069  35.524  1.00 87.21           C  
ATOM   8221  O   PHE B 121      73.054   8.962  35.761  1.00 80.85           O  
ATOM   8222  CB  PHE B 121      70.095  10.283  35.713  1.00 86.10           C  
ATOM   8223  CG  PHE B 121      68.923  10.346  36.649  1.00 81.54           C  
ATOM   8224  CD1 PHE B 121      69.095  10.156  38.012  1.00 82.66           C  
ATOM   8225  CD2 PHE B 121      67.648  10.595  36.168  1.00 75.60           C  
ATOM   8226  CE1 PHE B 121      68.018  10.213  38.877  1.00 85.40           C  
ATOM   8227  CE2 PHE B 121      66.565  10.656  37.026  1.00 73.31           C  
ATOM   8228  CZ  PHE B 121      66.750  10.465  38.383  1.00 78.96           C  
ATOM   8229  N   ARG B 122      73.002  10.839  34.532  1.00 70.90           N  
ATOM   8230  CA  ARG B 122      74.061  10.389  33.638  1.00 74.93           C  
ATOM   8231  C   ARG B 122      75.428  10.879  34.093  1.00 73.05           C  
ATOM   8232  O   ARG B 122      75.663  12.081  34.213  1.00 73.10           O  
ATOM   8233  CB  ARG B 122      73.782  10.851  32.207  1.00 73.62           C  
ATOM   8234  CG  ARG B 122      72.498  10.285  31.628  1.00 66.41           C  
ATOM   8235  CD  ARG B 122      72.247  10.788  30.218  1.00 65.92           C  
ATOM   8236  NE  ARG B 122      71.006  10.247  29.672  1.00 69.05           N  
ATOM   8237  CZ  ARG B 122      69.810  10.794  29.856  1.00 65.58           C  
ATOM   8238  NH1 ARG B 122      69.688  11.901  30.576  1.00 61.20           N  
ATOM   8239  NH2 ARG B 122      68.733  10.235  29.322  1.00 61.93           N  
ATOM   8240  N   GLU B 123      76.328   9.935  34.345  1.00 69.24           N  
ATOM   8241  CA  GLU B 123      77.687  10.258  34.756  1.00 75.13           C  
ATOM   8242  C   GLU B 123      78.470  10.857  33.594  1.00 73.56           C  
ATOM   8243  O   GLU B 123      77.943  10.995  32.491  1.00 72.52           O  
ATOM   8244  CB  GLU B 123      78.402   9.014  35.292  1.00 79.22           C  
ATOM   8245  CG  GLU B 123      78.570   7.887  34.277  1.00 70.35           C  
ATOM   8246  CD  GLU B 123      77.346   6.996  34.171  1.00 78.96           C  
ATOM   8247  OE1 GLU B 123      77.341   6.095  33.306  1.00 78.11           O  
ATOM   8248  OE2 GLU B 123      76.393   7.194  34.954  1.00 75.23           O  
ATOM   8249  N   GLN B 124      79.725  11.217  33.858  1.00 73.28           N  
ATOM   8250  CA  GLN B 124      80.601  11.843  32.866  1.00 70.61           C  
ATOM   8251  C   GLN B 124      80.057  13.190  32.385  1.00 70.74           C  
ATOM   8252  O   GLN B 124      80.518  13.730  31.381  1.00 68.48           O  
ATOM   8253  CB  GLN B 124      80.825  10.907  31.671  1.00 71.20           C  
ATOM   8254  CG  GLN B 124      81.510   9.595  32.029  1.00 75.80           C  
ATOM   8255  CD  GLN B 124      81.511   8.600  30.882  1.00 76.33           C  
ATOM   8256  OE1 GLN B 124      80.717   8.711  29.947  1.00 77.53           O  
ATOM   8257  NE2 GLN B 124      82.406   7.620  30.950  1.00 72.61           N  
ATOM   8258  N   VAL B 125      79.083  13.730  33.112  1.00 50.49           N  
ATOM   8259  CA  VAL B 125      78.510  15.032  32.794  1.00 46.38           C  
ATOM   8260  C   VAL B 125      78.618  15.961  33.996  1.00 48.97           C  
ATOM   8261  O   VAL B 125      78.112  15.658  35.078  1.00 49.04           O  
ATOM   8262  CB  VAL B 125      77.036  14.921  32.366  1.00 48.57           C  
ATOM   8263  CG1 VAL B 125      76.441  16.304  32.158  1.00 44.08           C  
ATOM   8264  CG2 VAL B 125      76.913  14.090  31.100  1.00 46.87           C  
ATOM   8265  N   PHE B 126      79.282  17.095  33.796  1.00 43.46           N  
ATOM   8266  CA  PHE B 126      79.565  18.017  34.886  1.00 47.12           C  
ATOM   8267  C   PHE B 126      79.136  19.443  34.543  1.00 44.56           C  
ATOM   8268  O   PHE B 126      79.224  19.861  33.387  1.00 41.93           O  
ATOM   8269  CB  PHE B 126      81.054  17.978  35.229  1.00 54.42           C  
ATOM   8270  CG  PHE B 126      81.575  16.596  35.508  1.00 57.09           C  
ATOM   8271  CD1 PHE B 126      82.202  15.863  34.514  1.00 57.04           C  
ATOM   8272  CD2 PHE B 126      81.434  16.029  36.764  1.00 59.67           C  
ATOM   8273  CE1 PHE B 126      82.680  14.594  34.766  1.00 59.34           C  
ATOM   8274  CE2 PHE B 126      81.910  14.759  37.023  1.00 51.91           C  
ATOM   8275  CZ  PHE B 126      82.534  14.041  36.024  1.00 51.65           C  
ATOM   8276  N   PRO B 127      78.661  20.191  35.550  1.00 50.79           N  
ATOM   8277  CA  PRO B 127      78.236  21.581  35.361  1.00 52.52           C  
ATOM   8278  C   PRO B 127      79.406  22.500  35.036  1.00 54.98           C  
ATOM   8279  O   PRO B 127      80.491  22.343  35.597  1.00 52.99           O  
ATOM   8280  CB  PRO B 127      77.618  21.945  36.715  1.00 52.32           C  
ATOM   8281  CG  PRO B 127      78.292  21.039  37.684  1.00 50.64           C  
ATOM   8282  CD  PRO B 127      78.498  19.751  36.947  1.00 58.16           C  
ATOM   8283  N   VAL B 128      79.184  23.449  34.134  1.00 50.28           N  
ATOM   8284  CA  VAL B 128      80.223  24.387  33.740  1.00 54.46           C  
ATOM   8285  C   VAL B 128      79.719  25.824  33.880  1.00 54.18           C  
ATOM   8286  O   VAL B 128      78.568  26.119  33.560  1.00 58.60           O  
ATOM   8287  CB  VAL B 128      80.699  24.122  32.288  1.00 56.21           C  
ATOM   8288  CG1 VAL B 128      79.521  24.121  31.321  1.00 58.35           C  
ATOM   8289  CG2 VAL B 128      81.757  25.131  31.864  1.00 54.86           C  
ATOM   8290  N   ASP B 129      80.574  26.708  34.385  1.00 67.21           N  
ATOM   8291  CA  ASP B 129      80.205  28.109  34.553  1.00 68.53           C  
ATOM   8292  C   ASP B 129      80.913  28.993  33.536  1.00 60.05           C  
ATOM   8293  O   ASP B 129      82.077  29.350  33.712  1.00 67.93           O  
ATOM   8294  CB  ASP B 129      80.529  28.587  35.967  1.00 67.91           C  
ATOM   8295  CG  ASP B 129      80.119  30.026  36.202  1.00 61.54           C  
ATOM   8296  OD1 ASP B 129      80.815  30.725  36.968  1.00 70.21           O  
ATOM   8297  OD2 ASP B 129      79.103  30.456  35.620  1.00 63.43           O  
ATOM   8298  N   ALA B 130      80.200  29.346  32.471  1.00 53.78           N  
ATOM   8299  CA  ALA B 130      80.742  30.226  31.447  1.00 54.49           C  
ATOM   8300  C   ALA B 130      80.310  31.665  31.699  1.00 57.51           C  
ATOM   8301  O   ALA B 130      79.192  31.921  32.147  1.00 54.15           O  
ATOM   8302  CB  ALA B 130      80.302  29.770  30.066  1.00 54.08           C  
ATOM   8303  N   LEU B 131      81.205  32.604  31.413  1.00 53.46           N  
ATOM   8304  CA  LEU B 131      80.914  34.017  31.610  1.00 56.21           C  
ATOM   8305  C   LEU B 131      79.945  34.521  30.545  1.00 58.65           C  
ATOM   8306  O   LEU B 131      79.726  33.860  29.529  1.00 51.83           O  
ATOM   8307  CB  LEU B 131      82.203  34.843  31.597  1.00 65.19           C  
ATOM   8308  CG  LEU B 131      83.172  34.662  32.773  1.00 64.32           C  
ATOM   8309  CD1 LEU B 131      82.417  34.602  34.095  1.00 64.52           C  
ATOM   8310  CD2 LEU B 131      84.069  33.440  32.597  1.00 66.23           C  
ATOM   8311  N   HIS B 132      79.367  35.694  30.784  1.00 69.34           N  
ATOM   8312  CA  HIS B 132      78.376  36.264  29.876  1.00 63.29           C  
ATOM   8313  C   HIS B 132      79.019  37.139  28.803  1.00 65.05           C  
ATOM   8314  O   HIS B 132      78.378  37.489  27.811  1.00 57.88           O  
ATOM   8315  CB  HIS B 132      77.343  37.080  30.659  1.00 60.83           C  
ATOM   8316  CG  HIS B 132      76.565  36.280  31.657  1.00 62.76           C  
ATOM   8317  ND1 HIS B 132      75.306  35.783  31.395  1.00 54.91           N  
ATOM   8318  CD2 HIS B 132      76.864  35.893  32.921  1.00 67.39           C  
ATOM   8319  CE1 HIS B 132      74.864  35.124  32.451  1.00 53.42           C  
ATOM   8320  NE2 HIS B 132      75.791  35.176  33.392  1.00 61.21           N  
ATOM   8321  N   HIS B 133      80.287  37.488  29.002  1.00 69.63           N  
ATOM   8322  CA  HIS B 133      80.984  38.389  28.089  1.00 64.82           C  
ATOM   8323  C   HIS B 133      82.390  37.905  27.754  1.00 68.70           C  
ATOM   8324  O   HIS B 133      82.779  36.791  28.105  1.00 67.96           O  
ATOM   8325  CB  HIS B 133      81.059  39.793  28.690  1.00 73.77           C  
ATOM   8326  CG  HIS B 133      81.978  39.895  29.867  1.00 70.90           C  
ATOM   8327  ND1 HIS B 133      81.571  39.631  31.157  1.00 70.58           N  
ATOM   8328  CD2 HIS B 133      83.289  40.229  29.950  1.00 74.17           C  
ATOM   8329  CE1 HIS B 133      82.587  39.801  31.983  1.00 77.09           C  
ATOM   8330  NE2 HIS B 133      83.642  40.165  31.274  1.00 78.14           N  
ATOM   8331  N   LYS B 134      83.146  38.759  27.074  1.00 90.14           N  
ATOM   8332  CA  LYS B 134      84.544  38.486  26.763  1.00 92.98           C  
ATOM   8333  C   LYS B 134      85.444  39.560  27.370  1.00 92.67           C  
ATOM   8334  O   LYS B 134      85.096  40.741  27.357  1.00 92.32           O  
ATOM   8335  CB  LYS B 134      84.758  38.408  25.250  1.00 87.68           C  
ATOM   8336  CG  LYS B 134      84.227  37.139  24.612  1.00 89.80           C  
ATOM   8337  CD  LYS B 134      84.918  35.912  25.184  1.00 80.83           C  
ATOM   8338  CE  LYS B 134      84.511  34.651  24.440  1.00 83.15           C  
ATOM   8339  NZ  LYS B 134      84.905  34.711  23.006  1.00 81.52           N  
ATOM   8340  N   PRO B 135      86.603  39.148  27.908  1.00 74.86           N  
ATOM   8341  CA  PRO B 135      87.562  40.066  28.536  1.00 80.97           C  
ATOM   8342  C   PRO B 135      88.039  41.168  27.590  1.00 83.26           C  
ATOM   8343  O   PRO B 135      88.336  42.276  28.040  1.00 88.92           O  
ATOM   8344  CB  PRO B 135      88.722  39.145  28.924  1.00 83.38           C  
ATOM   8345  CG  PRO B 135      88.102  37.801  29.065  1.00 77.80           C  
ATOM   8346  CD  PRO B 135      87.039  37.745  28.011  1.00 71.71           C  
ATOM   8347  N   GLY B 136      88.104  40.865  26.299  1.00107.20           N  
ATOM   8348  CA  GLY B 136      88.539  41.834  25.309  1.00108.52           C  
ATOM   8349  C   GLY B 136      87.517  42.929  25.075  1.00106.05           C  
ATOM   8350  O   GLY B 136      86.330  42.654  24.894  1.00100.71           O  
ATOM   8351  N   GLY B 179      78.669  47.582  23.110  1.00 62.13           N  
ATOM   8352  CA  GLY B 179      79.235  46.288  23.445  1.00 60.87           C  
ATOM   8353  C   GLY B 179      78.259  45.149  23.223  1.00 63.17           C  
ATOM   8354  O   GLY B 179      77.064  45.285  23.483  1.00 63.44           O  
ATOM   8355  N   LYS B 180      78.775  44.021  22.744  1.00 96.98           N  
ATOM   8356  CA  LYS B 180      77.951  42.843  22.482  1.00 98.98           C  
ATOM   8357  C   LYS B 180      78.367  41.675  23.375  1.00 97.82           C  
ATOM   8358  O   LYS B 180      79.527  41.571  23.775  1.00 92.96           O  
ATOM   8359  CB  LYS B 180      78.038  42.446  21.005  1.00 94.79           C  
ATOM   8360  CG  LYS B 180      77.621  43.551  20.040  1.00 95.11           C  
ATOM   8361  CD  LYS B 180      77.755  43.113  18.587  1.00 88.79           C  
ATOM   8362  CE  LYS B 180      76.825  41.954  18.265  1.00 82.45           C  
ATOM   8363  NZ  LYS B 180      76.913  41.544  16.834  1.00 89.07           N  
ATOM   8364  N   LEU B 181      77.417  40.794  23.681  1.00 61.86           N  
ATOM   8365  CA  LEU B 181      77.664  39.689  24.603  1.00 60.28           C  
ATOM   8366  C   LEU B 181      77.739  38.346  23.886  1.00 51.06           C  
ATOM   8367  O   LEU B 181      78.049  38.280  22.696  1.00 52.16           O  
ATOM   8368  CB  LEU B 181      76.578  39.631  25.681  1.00 56.63           C  
ATOM   8369  CG  LEU B 181      76.525  40.750  26.725  1.00 66.37           C  
ATOM   8370  CD1 LEU B 181      77.921  41.064  27.243  1.00 62.69           C  
ATOM   8371  CD2 LEU B 181      75.842  42.003  26.184  1.00 69.46           C  
ATOM   8372  N   ARG B 182      77.450  37.275  24.622  1.00 52.31           N  
ATOM   8373  CA  ARG B 182      77.494  35.928  24.069  1.00 55.75           C  
ATOM   8374  C   ARG B 182      76.206  35.589  23.324  1.00 49.44           C  
ATOM   8375  O   ARG B 182      75.110  35.925  23.772  1.00 45.33           O  
ATOM   8376  CB  ARG B 182      77.745  34.901  25.177  1.00 56.07           C  
ATOM   8377  CG  ARG B 182      76.689  34.891  26.271  1.00 54.87           C  
ATOM   8378  CD  ARG B 182      76.923  33.766  27.268  1.00 51.73           C  
ATOM   8379  NE  ARG B 182      75.847  33.689  28.252  1.00 54.28           N  
ATOM   8380  CZ  ARG B 182      75.824  32.834  29.270  1.00 55.94           C  
ATOM   8381  NH1 ARG B 182      76.821  31.979  29.442  1.00 56.89           N  
ATOM   8382  NH2 ARG B 182      74.804  32.835  30.118  1.00 50.37           N  
ATOM   8383  N   GLU B 183      76.347  34.926  22.181  1.00 76.99           N  
ATOM   8384  CA  GLU B 183      75.192  34.478  21.413  1.00 78.36           C  
ATOM   8385  C   GLU B 183      74.857  33.038  21.771  1.00 73.60           C  
ATOM   8386  O   GLU B 183      73.716  32.598  21.624  1.00 68.39           O  
ATOM   8387  CB  GLU B 183      75.452  34.615  19.912  1.00 70.00           C  
ATOM   8388  CG  GLU B 183      75.626  36.052  19.445  1.00 74.00           C  
ATOM   8389  CD  GLU B 183      75.777  36.166  17.940  1.00 73.71           C  
ATOM   8390  OE1 GLU B 183      75.783  35.117  17.265  1.00 72.08           O  
ATOM   8391  OE2 GLU B 183      75.889  37.304  17.435  1.00 78.41           O  
ATOM   8392  N   ASN B 184      75.861  32.311  22.245  1.00 55.24           N  
ATOM   8393  CA  ASN B 184      75.685  30.930  22.673  1.00 53.49           C  
ATOM   8394  C   ASN B 184      76.638  30.582  23.809  1.00 56.94           C  
ATOM   8395  O   ASN B 184      77.741  31.126  23.893  1.00 53.54           O  
ATOM   8396  CB  ASN B 184      75.896  29.973  21.499  1.00 50.03           C  
ATOM   8397  CG  ASN B 184      77.294  30.061  20.918  1.00 54.97           C  
ATOM   8398  OD1 ASN B 184      78.208  29.365  21.360  1.00 57.94           O  
ATOM   8399  ND2 ASN B 184      77.467  30.921  19.920  1.00 56.50           N  
ATOM   8400  N   LEU B 185      76.212  29.677  24.682  1.00 41.61           N  
ATOM   8401  CA  LEU B 185      77.023  29.287  25.829  1.00 47.01           C  
ATOM   8402  C   LEU B 185      77.790  27.999  25.540  1.00 47.38           C  
ATOM   8403  O   LEU B 185      78.123  27.238  26.451  1.00 50.22           O  
ATOM   8404  CB  LEU B 185      76.154  29.130  27.086  1.00 46.40           C  
ATOM   8405  CG  LEU B 185      75.057  28.061  27.173  1.00 49.94           C  
ATOM   8406  CD1 LEU B 185      74.647  27.882  28.623  1.00 41.83           C  
ATOM   8407  CD2 LEU B 185      73.842  28.412  26.329  1.00 43.50           C  
ATOM   8408  N   LEU B 186      78.074  27.772  24.263  1.00 48.33           N  
ATOM   8409  CA  LEU B 186      78.858  26.622  23.833  1.00 49.50           C  
ATOM   8410  C   LEU B 186      80.351  26.902  23.943  1.00 46.52           C  
ATOM   8411  O   LEU B 186      81.107  26.087  24.473  1.00 50.46           O  
ATOM   8412  CB  LEU B 186      78.499  26.240  22.395  1.00 44.95           C  
ATOM   8413  CG  LEU B 186      79.543  25.462  21.589  1.00 47.51           C  
ATOM   8414  CD1 LEU B 186      78.897  24.291  20.873  1.00 44.64           C  
ATOM   8415  CD2 LEU B 186      80.243  26.371  20.586  1.00 49.38           C  
ATOM   8416  N   HIS B 187      80.767  28.059  23.438  1.00 56.37           N  
ATOM   8417  CA  HIS B 187      82.175  28.437  23.405  1.00 58.50           C  
ATOM   8418  C   HIS B 187      82.776  28.512  24.807  1.00 62.81           C  
ATOM   8419  O   HIS B 187      83.867  27.991  25.056  1.00 60.74           O  
ATOM   8420  CB  HIS B 187      82.344  29.779  22.692  1.00 64.70           C  
ATOM   8421  CG  HIS B 187      83.771  30.200  22.523  1.00 67.96           C  
ATOM   8422  ND1 HIS B 187      84.637  29.563  21.665  1.00 69.59           N  
ATOM   8423  CD2 HIS B 187      84.481  31.196  23.106  1.00 63.41           C  
ATOM   8424  CE1 HIS B 187      85.823  30.146  21.724  1.00 63.51           C  
ATOM   8425  NE2 HIS B 187      85.753  31.140  22.590  1.00 69.46           N  
ATOM   8426  N   GLY B 188      82.055  29.159  25.717  1.00 43.88           N  
ATOM   8427  CA  GLY B 188      82.491  29.289  27.096  1.00 42.17           C  
ATOM   8428  C   GLY B 188      82.648  27.943  27.773  1.00 42.74           C  
ATOM   8429  O   GLY B 188      83.451  27.790  28.695  1.00 48.26           O  
ATOM   8430  N   ALA B 189      81.879  26.962  27.314  1.00 47.91           N  
ATOM   8431  CA  ALA B 189      81.995  25.602  27.820  1.00 46.44           C  
ATOM   8432  C   ALA B 189      83.191  24.901  27.181  1.00 49.30           C  
ATOM   8433  O   ALA B 189      83.852  24.080  27.816  1.00 49.93           O  
ATOM   8434  CB  ALA B 189      80.717  24.825  27.556  1.00 43.03           C  
ATOM   8435  N   LEU B 190      83.464  25.235  25.923  1.00 44.39           N  
ATOM   8436  CA  LEU B 190      84.615  24.687  25.213  1.00 47.27           C  
ATOM   8437  C   LEU B 190      85.919  25.170  25.836  1.00 45.25           C  
ATOM   8438  O   LEU B 190      86.935  24.477  25.786  1.00 49.16           O  
ATOM   8439  CB  LEU B 190      84.572  25.071  23.733  1.00 47.22           C  
ATOM   8440  CG  LEU B 190      84.070  24.005  22.757  1.00 45.75           C  
ATOM   8441  CD1 LEU B 190      82.654  23.576  23.101  1.00 41.74           C  
ATOM   8442  CD2 LEU B 190      84.146  24.515  21.327  1.00 47.18           C  
ATOM   8443  N   GLU B 191      85.883  26.363  26.421  1.00 67.94           N  
ATOM   8444  CA  GLU B 191      87.062  26.932  27.063  1.00 67.78           C  
ATOM   8445  C   GLU B 191      87.474  26.147  28.308  1.00 73.21           C  
ATOM   8446  O   GLU B 191      88.636  26.180  28.714  1.00 78.18           O  
ATOM   8447  CB  GLU B 191      86.815  28.397  27.431  1.00 68.03           C  
ATOM   8448  CG  GLU B 191      86.635  29.319  26.235  1.00 66.34           C  
ATOM   8449  CD  GLU B 191      86.429  30.766  26.641  1.00 66.64           C  
ATOM   8450  OE1 GLU B 191      86.445  31.645  25.754  1.00 64.84           O  
ATOM   8451  OE2 GLU B 191      86.251  31.024  27.850  1.00 71.17           O  
ATOM   8452  N   HIS B 192      86.521  25.442  28.908  1.00 56.32           N  
ATOM   8453  CA  HIS B 192      86.789  24.677  30.122  1.00 50.73           C  
ATOM   8454  C   HIS B 192      87.042  23.202  29.826  1.00 50.25           C  
ATOM   8455  O   HIS B 192      86.801  22.347  30.676  1.00 52.70           O  
ATOM   8456  CB  HIS B 192      85.623  24.809  31.107  1.00 54.25           C  
ATOM   8457  CG  HIS B 192      85.437  26.191  31.650  1.00 51.94           C  
ATOM   8458  ND1 HIS B 192      85.221  27.286  30.840  1.00 58.00           N  
ATOM   8459  CD2 HIS B 192      85.427  26.657  32.921  1.00 57.43           C  
ATOM   8460  CE1 HIS B 192      85.090  28.366  31.589  1.00 55.01           C  
ATOM   8461  NE2 HIS B 192      85.211  28.012  32.855  1.00 59.96           N  
ATOM   8462  N   TYR B 193      87.531  22.906  28.629  1.00 54.29           N  
ATOM   8463  CA  TYR B 193      87.698  21.520  28.208  1.00 53.29           C  
ATOM   8464  C   TYR B 193      88.826  20.798  28.941  1.00 58.16           C  
ATOM   8465  O   TYR B 193      88.653  19.666  29.387  1.00 58.21           O  
ATOM   8466  CB  TYR B 193      87.943  21.444  26.699  1.00 59.86           C  
ATOM   8467  CG  TYR B 193      88.312  20.057  26.235  1.00 59.72           C  
ATOM   8468  CD1 TYR B 193      89.614  19.753  25.861  1.00 52.56           C  
ATOM   8469  CD2 TYR B 193      87.364  19.044  26.190  1.00 56.67           C  
ATOM   8470  CE1 TYR B 193      89.960  18.482  25.443  1.00 52.31           C  
ATOM   8471  CE2 TYR B 193      87.697  17.769  25.773  1.00 56.94           C  
ATOM   8472  CZ  TYR B 193      88.996  17.493  25.400  1.00 59.63           C  
ATOM   8473  OH  TYR B 193      89.335  16.225  24.987  1.00 59.71           O  
ATOM   8474  N   VAL B 194      89.977  21.453  29.064  1.00 51.65           N  
ATOM   8475  CA  VAL B 194      91.174  20.813  29.603  1.00 56.53           C  
ATOM   8476  C   VAL B 194      91.043  20.448  31.083  1.00 59.61           C  
ATOM   8477  O   VAL B 194      91.371  19.333  31.488  1.00 60.17           O  
ATOM   8478  CB  VAL B 194      92.411  21.715  29.416  1.00 60.38           C  
ATOM   8479  CG1 VAL B 194      93.650  21.061  30.017  1.00 62.46           C  
ATOM   8480  CG2 VAL B 194      92.621  22.010  27.941  1.00 56.93           C  
ATOM   8481  N   ASN B 195      90.563  21.390  31.886  1.00 58.59           N  
ATOM   8482  CA  ASN B 195      90.385  21.152  33.314  1.00 64.08           C  
ATOM   8483  C   ASN B 195      89.355  20.059  33.582  1.00 60.21           C  
ATOM   8484  O   ASN B 195      89.551  19.189  34.443  1.00 63.69           O  
ATOM   8485  CB  ASN B 195      89.968  22.438  34.021  1.00 67.01           C  
ATOM   8486  CG  ASN B 195      90.981  23.551  33.850  1.00 60.80           C  
ATOM   8487  OD1 ASN B 195      91.843  23.755  34.705  1.00 67.19           O  
ATOM   8488  ND2 ASN B 195      90.881  24.278  32.745  1.00 66.88           N  
ATOM   8489  N   CYS B 196      88.258  20.104  32.835  1.00 75.77           N  
ATOM   8490  CA  CYS B 196      87.213  19.097  32.955  1.00 70.69           C  
ATOM   8491  C   CYS B 196      87.685  17.755  32.402  1.00 70.61           C  
ATOM   8492  O   CYS B 196      87.114  16.710  32.710  1.00 69.24           O  
ATOM   8493  CB  CYS B 196      85.939  19.563  32.251  1.00 64.21           C  
ATOM   8494  SG  CYS B 196      85.155  20.981  33.060  1.00 65.97           S  
ATOM   8495  N   LEU B 197      88.737  17.792  31.587  1.00 53.88           N  
ATOM   8496  CA  LEU B 197      89.416  16.577  31.157  1.00 54.34           C  
ATOM   8497  C   LEU B 197      90.290  16.047  32.286  1.00 59.09           C  
ATOM   8498  O   LEU B 197      90.479  14.840  32.425  1.00 59.62           O  
ATOM   8499  CB  LEU B 197      90.273  16.831  29.915  1.00 54.06           C  
ATOM   8500  CG  LEU B 197      89.868  16.150  28.610  1.00 50.49           C  
ATOM   8501  CD1 LEU B 197      91.087  15.942  27.724  1.00 52.05           C  
ATOM   8502  CD2 LEU B 197      89.167  14.832  28.885  1.00 59.21           C  
ATOM   8503  N   ASP B 198      90.823  16.961  33.091  1.00 61.95           N  
ATOM   8504  CA  ASP B 198      91.685  16.594  34.208  1.00 65.72           C  
ATOM   8505  C   ASP B 198      90.891  15.973  35.356  1.00 67.53           C  
ATOM   8506  O   ASP B 198      91.394  15.096  36.061  1.00 60.73           O  
ATOM   8507  CB  ASP B 198      92.460  17.816  34.705  1.00 60.45           C  
ATOM   8508  CG  ASP B 198      93.421  17.484  35.832  1.00 67.53           C  
ATOM   8509  OD1 ASP B 198      94.601  17.190  35.542  1.00 68.72           O  
ATOM   8510  OD2 ASP B 198      92.999  17.524  37.007  1.00 68.28           O  
ATOM   8511  N   LEU B 199      89.654  16.428  35.547  1.00 65.09           N  
ATOM   8512  CA  LEU B 199      88.838  15.896  36.640  1.00 65.62           C  
ATOM   8513  C   LEU B 199      88.188  14.563  36.272  1.00 61.83           C  
ATOM   8514  O   LEU B 199      87.687  13.849  37.142  1.00 62.43           O  
ATOM   8515  CB  LEU B 199      87.766  16.907  37.067  1.00 64.41           C  
ATOM   8516  CG  LEU B 199      86.638  17.337  36.121  1.00 68.30           C  
ATOM   8517  CD1 LEU B 199      85.453  16.378  36.157  1.00 63.84           C  
ATOM   8518  CD2 LEU B 199      86.186  18.749  36.464  1.00 69.09           C  
ATOM   8519  N   VAL B 200      88.195  14.236  34.983  1.00 66.49           N  
ATOM   8520  CA  VAL B 200      87.604  12.991  34.499  1.00 69.80           C  
ATOM   8521  C   VAL B 200      88.705  12.003  34.115  1.00 62.46           C  
ATOM   8522  O   VAL B 200      88.431  10.880  33.685  1.00 68.14           O  
ATOM   8523  CB  VAL B 200      86.673  13.242  33.290  1.00 63.86           C  
ATOM   8524  CG1 VAL B 200      87.483  13.399  32.008  1.00 64.29           C  
ATOM   8525  CG2 VAL B 200      85.652  12.121  33.151  1.00 60.05           C  
ATOM   8526  N   ASN B 201      89.950  12.441  34.282  1.00 62.92           N  
ATOM   8527  CA  ASN B 201      91.125  11.631  33.975  1.00 64.38           C  
ATOM   8528  C   ASN B 201      91.147  11.179  32.517  1.00 69.50           C  
ATOM   8529  O   ASN B 201      91.417  10.016  32.223  1.00 67.96           O  
ATOM   8530  CB  ASN B 201      91.197  10.418  34.909  1.00 64.63           C  
ATOM   8531  CG  ASN B 201      92.602   9.863  35.043  1.00 69.95           C  
ATOM   8532  OD1 ASN B 201      93.474  10.139  34.219  1.00 69.61           O  
ATOM   8533  ND2 ASN B 201      92.827   9.071  36.085  1.00 74.55           N  
ATOM   8534  N   LYS B 202      90.850  12.113  31.618  1.00 69.80           N  
ATOM   8535  CA  LYS B 202      90.890  11.881  30.174  1.00 67.36           C  
ATOM   8536  C   LYS B 202      90.039  10.694  29.722  1.00 64.85           C  
ATOM   8537  O   LYS B 202      90.407   9.980  28.790  1.00 66.21           O  
ATOM   8538  CB  LYS B 202      92.339  11.682  29.712  1.00 71.25           C  
ATOM   8539  CG  LYS B 202      93.227  12.901  29.915  1.00 74.19           C  
ATOM   8540  CD  LYS B 202      94.638  12.654  29.402  1.00 77.61           C  
ATOM   8541  CE  LYS B 202      95.509  13.890  29.565  1.00 70.16           C  
ATOM   8542  NZ  LYS B 202      94.974  15.056  28.808  1.00 76.37           N  
ATOM   8543  N   ARG B 203      88.898  10.492  30.374  1.00 73.48           N  
ATOM   8544  CA  ARG B 203      87.986   9.421  29.989  1.00 75.10           C  
ATOM   8545  C   ARG B 203      86.773   9.953  29.233  1.00 69.10           C  
ATOM   8546  O   ARG B 203      85.732  10.228  29.829  1.00 70.32           O  
ATOM   8547  CB  ARG B 203      87.520   8.632  31.216  1.00 75.08           C  
ATOM   8548  CG  ARG B 203      88.607   7.812  31.894  1.00 70.50           C  
ATOM   8549  CD  ARG B 203      88.007   6.841  32.906  1.00 78.52           C  
ATOM   8550  NE  ARG B 203      87.171   7.521  33.892  1.00 79.48           N  
ATOM   8551  CZ  ARG B 203      87.604   7.950  35.073  1.00 72.85           C  
ATOM   8552  NH1 ARG B 203      86.773   8.563  35.906  1.00 71.81           N  
ATOM   8553  NH2 ARG B 203      88.869   7.765  35.425  1.00 76.96           N  
ATOM   8554  N   LEU B 204      86.913  10.100  27.920  1.00 53.92           N  
ATOM   8555  CA  LEU B 204      85.791  10.494  27.080  1.00 59.06           C  
ATOM   8556  C   LEU B 204      85.109   9.228  26.550  1.00 51.80           C  
ATOM   8557  O   LEU B 204      85.739   8.173  26.488  1.00 51.03           O  
ATOM   8558  CB  LEU B 204      86.259  11.406  25.938  1.00 58.45           C  
ATOM   8559  CG  LEU B 204      86.697  10.783  24.612  1.00 58.41           C  
ATOM   8560  CD1 LEU B 204      86.916  11.866  23.571  1.00 56.46           C  
ATOM   8561  CD2 LEU B 204      87.950   9.951  24.780  1.00 54.03           C  
ATOM   8562  N   PRO B 205      83.822   9.317  26.163  1.00 52.39           N  
ATOM   8563  CA  PRO B 205      82.950  10.495  26.056  1.00 59.88           C  
ATOM   8564  C   PRO B 205      82.563  11.124  27.393  1.00 59.04           C  
ATOM   8565  O   PRO B 205      82.327  10.416  28.370  1.00 59.23           O  
ATOM   8566  CB  PRO B 205      81.709   9.941  25.352  1.00 56.29           C  
ATOM   8567  CG  PRO B 205      81.674   8.514  25.740  1.00 58.14           C  
ATOM   8568  CD  PRO B 205      83.111   8.081  25.792  1.00 51.32           C  
ATOM   8569  N   TYR B 206      82.511  12.454  27.418  1.00 52.83           N  
ATOM   8570  CA  TYR B 206      82.084  13.187  28.606  1.00 57.14           C  
ATOM   8571  C   TYR B 206      81.537  14.549  28.198  1.00 59.84           C  
ATOM   8572  O   TYR B 206      81.952  15.109  27.185  1.00 55.21           O  
ATOM   8573  CB  TYR B 206      83.240  13.344  29.598  1.00 54.11           C  
ATOM   8574  CG  TYR B 206      84.004  14.643  29.473  1.00 56.91           C  
ATOM   8575  CD1 TYR B 206      83.801  15.679  30.376  1.00 52.75           C  
ATOM   8576  CD2 TYR B 206      84.930  14.834  28.456  1.00 57.85           C  
ATOM   8577  CE1 TYR B 206      84.499  16.869  30.270  1.00 53.21           C  
ATOM   8578  CE2 TYR B 206      85.633  16.020  28.341  1.00 57.02           C  
ATOM   8579  CZ  TYR B 206      85.413  17.033  29.250  1.00 54.46           C  
ATOM   8580  OH  TYR B 206      86.108  18.216  29.140  1.00 55.15           O  
ATOM   8581  N   GLY B 207      80.607  15.083  28.984  1.00 50.20           N  
ATOM   8582  CA  GLY B 207      79.928  16.309  28.610  1.00 52.87           C  
ATOM   8583  C   GLY B 207      79.899  17.407  29.656  1.00 52.26           C  
ATOM   8584  O   GLY B 207      80.112  17.165  30.843  1.00 50.46           O  
ATOM   8585  N   LEU B 208      79.630  18.624  29.195  1.00 44.63           N  
ATOM   8586  CA  LEU B 208      79.501  19.784  30.068  1.00 42.89           C  
ATOM   8587  C   LEU B 208      78.167  20.481  29.816  1.00 49.99           C  
ATOM   8588  O   LEU B 208      77.875  20.888  28.693  1.00 48.81           O  
ATOM   8589  CB  LEU B 208      80.659  20.760  29.847  1.00 43.88           C  
ATOM   8590  CG  LEU B 208      82.070  20.203  30.042  1.00 49.87           C  
ATOM   8591  CD1 LEU B 208      83.117  21.268  29.758  1.00 41.15           C  
ATOM   8592  CD2 LEU B 208      82.234  19.646  31.447  1.00 43.60           C  
ATOM   8593  N   ALA B 209      77.357  20.614  30.861  1.00 56.66           N  
ATOM   8594  CA  ALA B 209      76.033  21.210  30.719  1.00 50.16           C  
ATOM   8595  C   ALA B 209      75.906  22.509  31.508  1.00 56.39           C  
ATOM   8596  O   ALA B 209      76.551  22.682  32.544  1.00 51.23           O  
ATOM   8597  CB  ALA B 209      74.963  20.224  31.152  1.00 54.51           C  
ATOM   8598  N   GLN B 210      75.066  23.412  31.011  1.00 49.96           N  
ATOM   8599  CA  GLN B 210      74.850  24.703  31.655  1.00 54.85           C  
ATOM   8600  C   GLN B 210      73.537  25.334  31.201  1.00 50.07           C  
ATOM   8601  O   GLN B 210      73.189  25.282  30.022  1.00 45.46           O  
ATOM   8602  CB  GLN B 210      76.015  25.650  31.358  1.00 58.21           C  
ATOM   8603  CG  GLN B 210      75.880  27.032  31.978  1.00 54.36           C  
ATOM   8604  CD  GLN B 210      76.991  27.971  31.553  1.00 58.21           C  
ATOM   8605  OE1 GLN B 210      77.843  27.617  30.738  1.00 55.08           O  
ATOM   8606  NE2 GLN B 210      76.988  29.179  32.106  1.00 52.61           N  
ATOM   8607  N   ILE B 211      72.806  25.924  32.142  1.00 57.13           N  
ATOM   8608  CA  ILE B 211      71.580  26.646  31.818  1.00 53.78           C  
ATOM   8609  C   ILE B 211      71.784  28.145  32.014  1.00 52.29           C  
ATOM   8610  O   ILE B 211      71.682  28.656  33.130  1.00 55.07           O  
ATOM   8611  CB  ILE B 211      70.391  26.178  32.680  1.00 47.61           C  
ATOM   8612  CG1 ILE B 211      70.227  24.659  32.592  1.00 48.57           C  
ATOM   8613  CG2 ILE B 211      69.111  26.878  32.247  1.00 48.12           C  
ATOM   8614  CD1 ILE B 211      69.067  24.123  33.404  1.00 46.97           C  
ATOM   8615  N   GLY B 212      72.080  28.847  30.924  1.00 74.76           N  
ATOM   8616  CA  GLY B 212      72.354  30.270  30.994  1.00 78.61           C  
ATOM   8617  C   GLY B 212      71.585  31.086  29.975  1.00 72.88           C  
ATOM   8618  O   GLY B 212      71.218  30.585  28.911  1.00 71.51           O  
ATOM   8619  N   VAL B 213      71.342  32.350  30.302  1.00 50.88           N  
ATOM   8620  CA  VAL B 213      70.631  33.250  29.404  1.00 49.23           C  
ATOM   8621  C   VAL B 213      71.564  33.780  28.315  1.00 50.06           C  
ATOM   8622  O   VAL B 213      72.671  34.233  28.602  1.00 50.58           O  
ATOM   8623  CB  VAL B 213      70.002  34.433  30.178  1.00 52.72           C  
ATOM   8624  CG1 VAL B 213      70.997  35.020  31.170  1.00 58.91           C  
ATOM   8625  CG2 VAL B 213      69.491  35.499  29.216  1.00 58.64           C  
ATOM   8626  N   CYS B 214      71.118  33.704  27.065  1.00 57.49           N  
ATOM   8627  CA  CYS B 214      71.911  34.208  25.947  1.00 56.12           C  
ATOM   8628  C   CYS B 214      71.283  35.455  25.335  1.00 54.92           C  
ATOM   8629  O   CYS B 214      70.078  35.676  25.456  1.00 59.39           O  
ATOM   8630  CB  CYS B 214      72.084  33.130  24.878  1.00 50.73           C  
ATOM   8631  SG  CYS B 214      73.231  31.815  25.333  1.00 58.19           S  
ATOM   8632  N   PHE B 215      72.109  36.262  24.678  1.00 47.23           N  
ATOM   8633  CA  PHE B 215      71.657  37.516  24.085  1.00 47.93           C  
ATOM   8634  C   PHE B 215      71.738  37.477  22.565  1.00 44.63           C  
ATOM   8635  O   PHE B 215      72.815  37.309  21.995  1.00 44.84           O  
ATOM   8636  CB  PHE B 215      72.484  38.684  24.620  1.00 43.31           C  
ATOM   8637  CG  PHE B 215      72.532  38.755  26.116  1.00 47.73           C  
ATOM   8638  CD1 PHE B 215      71.568  39.452  26.821  1.00 50.07           C  
ATOM   8639  CD2 PHE B 215      73.541  38.117  26.819  1.00 50.05           C  
ATOM   8640  CE1 PHE B 215      71.609  39.515  28.202  1.00 54.73           C  
ATOM   8641  CE2 PHE B 215      73.588  38.177  28.199  1.00 54.57           C  
ATOM   8642  CZ  PHE B 215      72.621  38.876  28.891  1.00 56.89           C  
ATOM   8643  N   HIS B 216      70.593  37.641  21.914  1.00 60.18           N  
ATOM   8644  CA  HIS B 216      70.527  37.604  20.459  1.00 64.79           C  
ATOM   8645  C   HIS B 216      70.211  38.975  19.877  1.00 65.79           C  
ATOM   8646  O   HIS B 216      69.198  39.584  20.221  1.00 66.24           O  
ATOM   8647  CB  HIS B 216      69.481  36.588  19.995  1.00 60.48           C  
ATOM   8648  CG  HIS B 216      69.821  35.170  20.331  1.00 68.78           C  
ATOM   8649  ND1 HIS B 216      69.948  34.723  21.630  1.00 64.32           N  
ATOM   8650  CD2 HIS B 216      70.062  34.099  19.542  1.00 67.29           C  
ATOM   8651  CE1 HIS B 216      70.252  33.438  21.624  1.00 67.51           C  
ATOM   8652  NE2 HIS B 216      70.327  33.034  20.368  1.00 66.85           N  
ATOM   8653  N   PRO B 217      71.088  39.471  18.992  1.00 51.85           N  
ATOM   8654  CA  PRO B 217      70.842  40.729  18.281  1.00 55.06           C  
ATOM   8655  C   PRO B 217      69.692  40.583  17.292  1.00 50.87           C  
ATOM   8656  O   PRO B 217      69.678  39.636  16.506  1.00 59.70           O  
ATOM   8657  CB  PRO B 217      72.168  40.990  17.558  1.00 59.11           C  
ATOM   8658  CG  PRO B 217      72.773  39.642  17.390  1.00 55.17           C  
ATOM   8659  CD  PRO B 217      72.377  38.866  18.613  1.00 56.71           C  
ATOM   8660  N   VAL B 218      68.738  41.507  17.334  1.00 50.97           N  
ATOM   8661  CA  VAL B 218      67.568  41.413  16.472  1.00 58.27           C  
ATOM   8662  C   VAL B 218      67.231  42.749  15.810  1.00 50.53           C  
ATOM   8663  O   VAL B 218      67.083  43.776  16.477  1.00 50.00           O  
ATOM   8664  CB  VAL B 218      66.342  40.901  17.259  1.00 56.89           C  
ATOM   8665  CG1 VAL B 218      66.262  41.563  18.629  1.00 59.36           C  
ATOM   8666  CG2 VAL B 218      65.059  41.113  16.466  1.00 57.61           C  
ATOM   8667  N   PHE B 219      67.124  42.727  14.484  1.00 66.81           N  
ATOM   8668  CA  PHE B 219      66.734  43.907  13.723  1.00 66.71           C  
ATOM   8669  C   PHE B 219      65.228  43.917  13.480  1.00 69.10           C  
ATOM   8670  O   PHE B 219      64.738  43.299  12.534  1.00 65.98           O  
ATOM   8671  CB  PHE B 219      67.490  43.969  12.393  1.00 66.85           C  
ATOM   8672  CG  PHE B 219      68.937  44.360  12.532  1.00 69.73           C  
ATOM   8673  CD1 PHE B 219      69.399  44.969  13.688  1.00 62.63           C  
ATOM   8674  CD2 PHE B 219      69.833  44.126  11.500  1.00 68.27           C  
ATOM   8675  CE1 PHE B 219      70.729  45.332  13.816  1.00 63.08           C  
ATOM   8676  CE2 PHE B 219      71.164  44.488  11.622  1.00 60.19           C  
ATOM   8677  CZ  PHE B 219      71.611  45.091  12.780  1.00 62.59           C  
ATOM   8678  N   ASP B 220      64.496  44.618  14.340  1.00 97.80           N  
ATOM   8679  CA  ASP B 220      63.040  44.671  14.251  1.00 97.70           C  
ATOM   8680  C   ASP B 220      62.582  45.449  13.020  1.00 99.82           C  
ATOM   8681  O   ASP B 220      62.896  46.630  12.868  1.00 91.89           O  
ATOM   8682  CB  ASP B 220      62.448  45.293  15.518  1.00 90.03           C  
ATOM   8683  CG  ASP B 220      60.933  45.229  15.548  1.00 99.70           C  
ATOM   8684  OD1 ASP B 220      60.390  44.219  16.042  1.00 98.14           O  
ATOM   8685  OD2 ASP B 220      60.284  46.191  15.082  1.00 91.99           O  
ATOM   8686  N   THR B 221      61.838  44.777  12.148  1.00 74.74           N  
ATOM   8687  CA  THR B 221      61.334  45.395  10.926  1.00 77.78           C  
ATOM   8688  C   THR B 221      59.845  45.702  11.035  1.00 78.14           C  
ATOM   8689  O   THR B 221      59.122  45.679  10.037  1.00 82.31           O  
ATOM   8690  CB  THR B 221      61.571  44.496   9.699  1.00 76.67           C  
ATOM   8691  OG1 THR B 221      60.909  43.239   9.888  1.00 75.73           O  
ATOM   8692  CG2 THR B 221      63.060  44.255   9.496  1.00 76.14           C  
ATOM   8693  N   LYS B 229      67.192  46.575  15.435  1.00 69.16           N  
ATOM   8694  CA  LYS B 229      68.071  47.499  16.136  1.00 62.27           C  
ATOM   8695  C   LYS B 229      68.106  47.186  17.625  1.00 62.10           C  
ATOM   8696  O   LYS B 229      68.862  47.795  18.381  1.00 64.78           O  
ATOM   8697  CB  LYS B 229      67.620  48.941  15.904  1.00 64.73           C  
ATOM   8698  CG  LYS B 229      66.184  49.211  16.323  1.00 64.46           C  
ATOM   8699  CD  LYS B 229      65.681  50.517  15.739  1.00 66.65           C  
ATOM   8700  CE  LYS B 229      65.702  50.479  14.220  1.00 69.29           C  
ATOM   8701  NZ  LYS B 229      65.213  51.752  13.626  1.00 64.31           N  
ATOM   8702  N   SER B 230      67.283  46.229  18.044  1.00 68.70           N  
ATOM   8703  CA  SER B 230      67.185  45.882  19.455  1.00 71.36           C  
ATOM   8704  C   SER B 230      67.909  44.576  19.762  1.00 67.64           C  
ATOM   8705  O   SER B 230      68.502  43.959  18.877  1.00 66.87           O  
ATOM   8706  CB  SER B 230      65.718  45.780  19.879  1.00 70.25           C  
ATOM   8707  OG  SER B 230      65.606  45.504  21.265  1.00 71.72           O  
ATOM   8708  N   ILE B 231      67.856  44.160  21.022  1.00 65.02           N  
ATOM   8709  CA  ILE B 231      68.501  42.924  21.446  1.00 64.17           C  
ATOM   8710  C   ILE B 231      67.598  42.141  22.397  1.00 64.70           C  
ATOM   8711  O   ILE B 231      67.118  42.675  23.397  1.00 69.26           O  
ATOM   8712  CB  ILE B 231      69.868  43.205  22.115  1.00 67.76           C  
ATOM   8713  CG1 ILE B 231      70.437  41.926  22.741  1.00 66.21           C  
ATOM   8714  CG2 ILE B 231      69.752  44.336  23.133  1.00 62.75           C  
ATOM   8715  CD1 ILE B 231      70.424  41.904  24.259  1.00 69.57           C  
ATOM   8716  N   GLY B 232      67.367  40.873  22.072  1.00 52.37           N  
ATOM   8717  CA  GLY B 232      66.480  40.036  22.858  1.00 52.25           C  
ATOM   8718  C   GLY B 232      67.206  38.910  23.564  1.00 51.22           C  
ATOM   8719  O   GLY B 232      67.929  38.133  22.939  1.00 57.62           O  
ATOM   8720  N   GLU B 233      67.013  38.820  24.874  1.00 56.80           N  
ATOM   8721  CA  GLU B 233      67.648  37.777  25.668  1.00 56.25           C  
ATOM   8722  C   GLU B 233      66.688  36.623  25.933  1.00 52.02           C  
ATOM   8723  O   GLU B 233      65.481  36.824  26.075  1.00 48.06           O  
ATOM   8724  CB  GLU B 233      68.161  38.350  26.990  1.00 52.83           C  
ATOM   8725  CG  GLU B 233      67.073  38.896  27.896  1.00 50.80           C  
ATOM   8726  CD  GLU B 233      67.619  39.437  29.201  1.00 50.88           C  
ATOM   8727  OE1 GLU B 233      67.017  39.161  30.259  1.00 50.98           O  
ATOM   8728  OE2 GLU B 233      68.649  40.143  29.170  1.00 50.80           O  
ATOM   8729  N   LYS B 234      67.231  35.413  25.994  1.00 55.62           N  
ATOM   8730  CA  LYS B 234      66.421  34.239  26.295  1.00 59.87           C  
ATOM   8731  C   LYS B 234      67.243  33.133  26.948  1.00 54.87           C  
ATOM   8732  O   LYS B 234      68.373  32.853  26.542  1.00 50.27           O  
ATOM   8733  CB  LYS B 234      65.740  33.719  25.027  1.00 55.80           C  
ATOM   8734  CG  LYS B 234      66.653  33.585  23.825  1.00 53.44           C  
ATOM   8735  CD  LYS B 234      65.844  33.265  22.580  1.00 50.74           C  
ATOM   8736  CE  LYS B 234      66.719  33.191  21.343  1.00 58.07           C  
ATOM   8737  NZ  LYS B 234      65.911  32.899  20.126  1.00 57.52           N  
ATOM   8738  N   THR B 235      66.661  32.518  27.972  1.00 58.44           N  
ATOM   8739  CA  THR B 235      67.317  31.459  28.727  1.00 58.21           C  
ATOM   8740  C   THR B 235      67.471  30.196  27.889  1.00 53.43           C  
ATOM   8741  O   THR B 235      66.507  29.718  27.291  1.00 50.16           O  
ATOM   8742  CB  THR B 235      66.531  31.122  30.010  1.00 58.84           C  
ATOM   8743  OG1 THR B 235      66.371  32.304  30.802  1.00 53.53           O  
ATOM   8744  CG2 THR B 235      67.261  30.065  30.824  1.00 59.24           C  
ATOM   8745  N   GLU B 236      68.686  29.656  27.851  1.00 57.83           N  
ATOM   8746  CA  GLU B 236      68.958  28.444  27.090  1.00 55.42           C  
ATOM   8747  C   GLU B 236      69.714  27.407  27.915  1.00 58.16           C  
ATOM   8748  O   GLU B 236      70.639  27.742  28.658  1.00 62.14           O  
ATOM   8749  CB  GLU B 236      69.749  28.773  25.822  1.00 58.89           C  
ATOM   8750  CG  GLU B 236      68.986  29.626  24.822  1.00 53.87           C  
ATOM   8751  CD  GLU B 236      69.760  29.855  23.541  1.00 55.88           C  
ATOM   8752  OE1 GLU B 236      70.955  29.496  23.494  1.00 58.52           O  
ATOM   8753  OE2 GLU B 236      69.172  30.391  22.577  1.00 54.05           O  
ATOM   8754  N   ALA B 237      69.310  26.150  27.781  1.00 52.69           N  
ATOM   8755  CA  ALA B 237      69.994  25.047  28.439  1.00 54.60           C  
ATOM   8756  C   ALA B 237      70.801  24.251  27.419  1.00 55.71           C  
ATOM   8757  O   ALA B 237      70.240  23.529  26.593  1.00 54.79           O  
ATOM   8758  CB  ALA B 237      69.000  24.150  29.153  1.00 53.87           C  
ATOM   8759  N   SER B 238      72.120  24.392  27.479  1.00 48.71           N  
ATOM   8760  CA  SER B 238      72.995  23.754  26.505  1.00 56.73           C  
ATOM   8761  C   SER B 238      73.875  22.675  27.126  1.00 52.52           C  
ATOM   8762  O   SER B 238      74.295  22.779  28.280  1.00 59.09           O  
ATOM   8763  CB  SER B 238      73.874  24.799  25.820  1.00 53.13           C  
ATOM   8764  OG  SER B 238      74.762  24.193  24.896  1.00 57.70           O  
ATOM   8765  N   LEU B 239      74.145  21.643  26.337  1.00 54.56           N  
ATOM   8766  CA  LEU B 239      75.038  20.562  26.727  1.00 50.00           C  
ATOM   8767  C   LEU B 239      76.017  20.275  25.600  1.00 52.41           C  
ATOM   8768  O   LEU B 239      75.612  19.968  24.477  1.00 50.19           O  
ATOM   8769  CB  LEU B 239      74.243  19.302  27.077  1.00 50.18           C  
ATOM   8770  CG  LEU B 239      75.033  17.995  27.196  1.00 56.28           C  
ATOM   8771  CD1 LEU B 239      76.022  18.056  28.348  1.00 51.33           C  
ATOM   8772  CD2 LEU B 239      74.094  16.810  27.354  1.00 56.14           C  
ATOM   8773  N   VAL B 240      77.308  20.391  25.892  1.00 52.86           N  
ATOM   8774  CA  VAL B 240      78.336  20.057  24.917  1.00 55.29           C  
ATOM   8775  C   VAL B 240      78.928  18.686  25.243  1.00 50.32           C  
ATOM   8776  O   VAL B 240      79.517  18.481  26.305  1.00 54.00           O  
ATOM   8777  CB  VAL B 240      79.446  21.131  24.865  1.00 55.96           C  
ATOM   8778  CG1 VAL B 240      79.854  21.562  26.264  1.00 58.28           C  
ATOM   8779  CG2 VAL B 240      80.640  20.622  24.075  1.00 59.15           C  
ATOM   8780  N   TRP B 241      78.748  17.747  24.322  1.00 52.83           N  
ATOM   8781  CA  TRP B 241      79.134  16.358  24.540  1.00 57.94           C  
ATOM   8782  C   TRP B 241      80.391  15.994  23.757  1.00 51.29           C  
ATOM   8783  O   TRP B 241      80.335  15.768  22.552  1.00 50.47           O  
ATOM   8784  CB  TRP B 241      77.979  15.432  24.150  1.00 57.59           C  
ATOM   8785  CG  TRP B 241      78.239  13.974  24.379  1.00 53.24           C  
ATOM   8786  CD1 TRP B 241      78.589  13.048  23.442  1.00 56.57           C  
ATOM   8787  CD2 TRP B 241      78.156  13.270  25.625  1.00 56.10           C  
ATOM   8788  NE1 TRP B 241      78.736  11.812  24.025  1.00 52.22           N  
ATOM   8789  CE2 TRP B 241      78.475  11.922  25.366  1.00 52.23           C  
ATOM   8790  CE3 TRP B 241      77.847  13.648  26.935  1.00 54.50           C  
ATOM   8791  CZ2 TRP B 241      78.493  10.954  26.367  1.00 55.54           C  
ATOM   8792  CZ3 TRP B 241      77.865  12.684  27.927  1.00 58.06           C  
ATOM   8793  CH2 TRP B 241      78.186  11.353  27.637  1.00 53.17           C  
ATOM   8794  N   PHE B 242      81.524  15.944  24.450  1.00 50.52           N  
ATOM   8795  CA  PHE B 242      82.781  15.542  23.828  1.00 54.16           C  
ATOM   8796  C   PHE B 242      82.821  14.028  23.653  1.00 58.46           C  
ATOM   8797  O   PHE B 242      82.871  13.282  24.634  1.00 53.43           O  
ATOM   8798  CB  PHE B 242      83.976  16.011  24.660  1.00 58.48           C  
ATOM   8799  CG  PHE B 242      83.962  17.482  24.963  1.00 55.21           C  
ATOM   8800  CD1 PHE B 242      84.397  18.402  24.025  1.00 52.67           C  
ATOM   8801  CD2 PHE B 242      83.516  17.945  26.192  1.00 55.87           C  
ATOM   8802  CE1 PHE B 242      84.383  19.756  24.303  1.00 59.08           C  
ATOM   8803  CE2 PHE B 242      83.502  19.297  26.477  1.00 55.21           C  
ATOM   8804  CZ  PHE B 242      83.936  20.204  25.532  1.00 59.94           C  
ATOM   8805  N   THR B 243      82.799  13.584  22.399  1.00 50.33           N  
ATOM   8806  CA  THR B 243      82.709  12.162  22.085  1.00 54.55           C  
ATOM   8807  C   THR B 243      83.678  11.755  20.981  1.00 56.22           C  
ATOM   8808  O   THR B 243      83.885  12.505  20.032  1.00 52.54           O  
ATOM   8809  CB  THR B 243      81.280  11.779  21.653  1.00 51.71           C  
ATOM   8810  OG1 THR B 243      81.292  10.477  21.059  1.00 55.69           O  
ATOM   8811  CG2 THR B 243      80.747  12.777  20.639  1.00 54.82           C  
ATOM   8812  N   PRO B 244      84.271  10.555  21.102  1.00 55.88           N  
ATOM   8813  CA  PRO B 244      85.189  10.010  20.094  1.00 57.41           C  
ATOM   8814  C   PRO B 244      84.570   9.962  18.699  1.00 54.36           C  
ATOM   8815  O   PRO B 244      83.369   9.719  18.572  1.00 52.69           O  
ATOM   8816  CB  PRO B 244      85.470   8.595  20.606  1.00 51.36           C  
ATOM   8817  CG  PRO B 244      85.249   8.677  22.071  1.00 54.58           C  
ATOM   8818  CD  PRO B 244      84.131   9.654  22.261  1.00 50.06           C  
ATOM   8819  N   PRO B 245      85.386  10.198  17.660  1.00 69.75           N  
ATOM   8820  CA  PRO B 245      84.945  10.206  16.259  1.00 61.74           C  
ATOM   8821  C   PRO B 245      84.342   8.875  15.811  1.00 64.17           C  
ATOM   8822  O   PRO B 245      83.519   8.850  14.896  1.00 65.15           O  
ATOM   8823  CB  PRO B 245      86.235  10.502  15.488  1.00 64.60           C  
ATOM   8824  CG  PRO B 245      87.110  11.203  16.472  1.00 62.96           C  
ATOM   8825  CD  PRO B 245      86.807  10.559  17.788  1.00 61.18           C  
ATOM   8826  N   ARG B 246      84.753   7.788  16.453  1.00 70.90           N  
ATOM   8827  CA  ARG B 246      84.259   6.457  16.113  1.00 73.33           C  
ATOM   8828  C   ARG B 246      82.777   6.310  16.453  1.00 71.49           C  
ATOM   8829  O   ARG B 246      82.059   5.536  15.822  1.00 73.93           O  
ATOM   8830  CB  ARG B 246      85.077   5.387  16.841  1.00 74.20           C  
ATOM   8831  CG  ARG B 246      84.701   3.954  16.491  1.00 77.12           C  
ATOM   8832  CD  ARG B 246      85.545   2.961  17.274  1.00 78.04           C  
ATOM   8833  NE  ARG B 246      85.395   3.133  18.715  1.00 74.64           N  
ATOM   8834  CZ  ARG B 246      84.475   2.515  19.449  1.00 73.42           C  
ATOM   8835  NH1 ARG B 246      83.620   1.679  18.877  1.00 75.40           N  
ATOM   8836  NH2 ARG B 246      84.411   2.731  20.756  1.00 70.48           N  
ATOM   8837  N   THR B 247      82.325   7.067  17.445  1.00 56.10           N  
ATOM   8838  CA  THR B 247      80.955   6.941  17.930  1.00 53.30           C  
ATOM   8839  C   THR B 247      80.230   8.286  18.001  1.00 52.21           C  
ATOM   8840  O   THR B 247      79.403   8.509  18.884  1.00 56.41           O  
ATOM   8841  CB  THR B 247      80.929   6.272  19.321  1.00 53.49           C  
ATOM   8842  OG1 THR B 247      79.611   6.365  19.873  1.00 58.20           O  
ATOM   8843  CG2 THR B 247      81.916   6.947  20.261  1.00 51.00           C  
ATOM   8844  N   SER B 248      80.531   9.176  17.059  1.00 60.59           N  
ATOM   8845  CA  SER B 248      79.915  10.498  17.031  1.00 58.65           C  
ATOM   8846  C   SER B 248      78.443  10.441  16.632  1.00 57.57           C  
ATOM   8847  O   SER B 248      77.574  10.942  17.350  1.00 54.03           O  
ATOM   8848  CB  SER B 248      80.672  11.420  16.074  1.00 61.61           C  
ATOM   8849  OG  SER B 248      81.994  11.645  16.522  1.00 59.79           O  
ATOM   8850  N   ASN B 249      78.169   9.834  15.482  1.00 60.76           N  
ATOM   8851  CA  ASN B 249      76.810   9.744  14.963  1.00 62.31           C  
ATOM   8852  C   ASN B 249      75.896   8.940  15.879  1.00 58.45           C  
ATOM   8853  O   ASN B 249      74.702   9.224  15.986  1.00 60.19           O  
ATOM   8854  CB  ASN B 249      76.816   9.128  13.564  1.00 68.18           C  
ATOM   8855  CG  ASN B 249      77.704   9.887  12.598  1.00 68.75           C  
ATOM   8856  OD1 ASN B 249      78.608   9.317  11.987  1.00 62.25           O  
ATOM   8857  ND2 ASN B 249      77.452  11.185  12.456  1.00 68.77           N  
ATOM   8858  N   GLN B 250      76.464   7.936  16.541  1.00 60.05           N  
ATOM   8859  CA  GLN B 250      75.705   7.110  17.472  1.00 60.06           C  
ATOM   8860  C   GLN B 250      75.243   7.931  18.671  1.00 53.46           C  
ATOM   8861  O   GLN B 250      74.096   7.816  19.105  1.00 52.09           O  
ATOM   8862  CB  GLN B 250      76.536   5.913  17.938  1.00 61.23           C  
ATOM   8863  CG  GLN B 250      76.914   4.949  16.821  1.00 64.42           C  
ATOM   8864  CD  GLN B 250      77.615   3.706  17.334  1.00 67.02           C  
ATOM   8865  OE1 GLN B 250      77.687   3.473  18.541  1.00 63.00           O  
ATOM   8866  NE2 GLN B 250      78.137   2.901  16.418  1.00 63.58           N  
ATOM   8867  N   TRP B 251      76.135   8.762  19.203  1.00 51.03           N  
ATOM   8868  CA  TRP B 251      75.780   9.637  20.314  1.00 56.08           C  
ATOM   8869  C   TRP B 251      74.836  10.743  19.854  1.00 54.63           C  
ATOM   8870  O   TRP B 251      74.020  11.236  20.634  1.00 51.46           O  
ATOM   8871  CB  TRP B 251      77.030  10.243  20.958  1.00 53.92           C  
ATOM   8872  CG  TRP B 251      77.714   9.326  21.928  1.00 54.11           C  
ATOM   8873  CD1 TRP B 251      78.942   8.754  21.788  1.00 56.47           C  
ATOM   8874  CD2 TRP B 251      77.205   8.875  23.188  1.00 52.90           C  
ATOM   8875  NE1 TRP B 251      79.234   7.976  22.881  1.00 58.26           N  
ATOM   8876  CE2 TRP B 251      78.180   8.031  23.757  1.00 56.35           C  
ATOM   8877  CE3 TRP B 251      76.017   9.099  23.894  1.00 50.64           C  
ATOM   8878  CZ2 TRP B 251      78.008   7.415  24.992  1.00 57.66           C  
ATOM   8879  CZ3 TRP B 251      75.848   8.485  25.122  1.00 51.83           C  
ATOM   8880  CH2 TRP B 251      76.839   7.653  25.659  1.00 55.34           C  
ATOM   8881  N   LEU B 252      74.949  11.133  18.589  1.00 53.04           N  
ATOM   8882  CA  LEU B 252      74.044  12.123  18.018  1.00 51.86           C  
ATOM   8883  C   LEU B 252      72.620  11.581  17.980  1.00 53.43           C  
ATOM   8884  O   LEU B 252      71.679  12.251  18.406  1.00 59.98           O  
ATOM   8885  CB  LEU B 252      74.492  12.530  16.613  1.00 56.09           C  
ATOM   8886  CG  LEU B 252      73.566  13.499  15.875  1.00 55.81           C  
ATOM   8887  CD1 LEU B 252      73.382  14.785  16.669  1.00 53.04           C  
ATOM   8888  CD2 LEU B 252      74.099  13.799  14.482  1.00 50.90           C  
ATOM   8889  N   ASP B 253      72.473  10.361  17.469  1.00 58.53           N  
ATOM   8890  CA  ASP B 253      71.177   9.694  17.418  1.00 51.29           C  
ATOM   8891  C   ASP B 253      70.637   9.451  18.824  1.00 51.28           C  
ATOM   8892  O   ASP B 253      69.449   9.652  19.090  1.00 56.30           O  
ATOM   8893  CB  ASP B 253      71.288   8.372  16.654  1.00 58.26           C  
ATOM   8894  CG  ASP B 253      70.008   7.561  16.698  1.00 51.13           C  
ATOM   8895  OD1 ASP B 253      69.090   7.855  15.903  1.00 54.20           O  
ATOM   8896  OD2 ASP B 253      69.921   6.626  17.521  1.00 50.64           O  
ATOM   8897  N   PHE B 254      71.524   9.020  19.716  1.00 52.06           N  
ATOM   8898  CA  PHE B 254      71.185   8.781  21.117  1.00 49.82           C  
ATOM   8899  C   PHE B 254      70.581  10.022  21.764  1.00 45.80           C  
ATOM   8900  O   PHE B 254      69.472   9.980  22.309  1.00 45.35           O  
ATOM   8901  CB  PHE B 254      72.433   8.333  21.887  1.00 50.10           C  
ATOM   8902  CG  PHE B 254      72.232   8.227  23.374  1.00 49.48           C  
ATOM   8903  CD1 PHE B 254      71.730   7.067  23.935  1.00 52.09           C  
ATOM   8904  CD2 PHE B 254      72.564   9.279  24.211  1.00 46.64           C  
ATOM   8905  CE1 PHE B 254      71.552   6.964  25.303  1.00 51.87           C  
ATOM   8906  CE2 PHE B 254      72.386   9.183  25.575  1.00 46.40           C  
ATOM   8907  CZ  PHE B 254      71.879   8.024  26.124  1.00 49.02           C  
ATOM   8908  N   TRP B 255      71.315  11.127  21.695  1.00 56.09           N  
ATOM   8909  CA  TRP B 255      70.867  12.370  22.308  1.00 52.35           C  
ATOM   8910  C   TRP B 255      69.632  12.922  21.612  1.00 52.84           C  
ATOM   8911  O   TRP B 255      68.789  13.539  22.252  1.00 50.68           O  
ATOM   8912  CB  TRP B 255      71.988  13.407  22.305  1.00 50.16           C  
ATOM   8913  CG  TRP B 255      72.983  13.175  23.393  1.00 49.48           C  
ATOM   8914  CD1 TRP B 255      74.298  12.846  23.247  1.00 50.95           C  
ATOM   8915  CD2 TRP B 255      72.736  13.227  24.802  1.00 47.84           C  
ATOM   8916  NE1 TRP B 255      74.889  12.704  24.480  1.00 50.31           N  
ATOM   8917  CE2 TRP B 255      73.950  12.931  25.451  1.00 48.45           C  
ATOM   8918  CE3 TRP B 255      71.605  13.503  25.578  1.00 46.39           C  
ATOM   8919  CZ2 TRP B 255      74.067  12.903  26.839  1.00 47.73           C  
ATOM   8920  CZ3 TRP B 255      71.724  13.473  26.955  1.00 45.64           C  
ATOM   8921  CH2 TRP B 255      72.944  13.176  27.571  1.00 46.33           C  
ATOM   8922  N   LEU B 256      69.523  12.696  20.308  1.00 53.86           N  
ATOM   8923  CA  LEU B 256      68.314  13.066  19.582  1.00 56.31           C  
ATOM   8924  C   LEU B 256      67.101  12.375  20.197  1.00 58.07           C  
ATOM   8925  O   LEU B 256      66.142  13.030  20.615  1.00 56.80           O  
ATOM   8926  CB  LEU B 256      68.436  12.702  18.101  1.00 51.75           C  
ATOM   8927  CG  LEU B 256      67.156  12.816  17.267  1.00 56.36           C  
ATOM   8928  CD1 LEU B 256      66.648  14.248  17.253  1.00 53.04           C  
ATOM   8929  CD2 LEU B 256      67.391  12.309  15.854  1.00 52.79           C  
ATOM   8930  N   ARG B 257      67.173  11.049  20.275  1.00 54.03           N  
ATOM   8931  CA  ARG B 257      66.078  10.245  20.805  1.00 58.12           C  
ATOM   8932  C   ARG B 257      65.749  10.584  22.259  1.00 52.67           C  
ATOM   8933  O   ARG B 257      64.580  10.621  22.638  1.00 53.68           O  
ATOM   8934  CB  ARG B 257      66.408   8.753  20.683  1.00 59.58           C  
ATOM   8935  CG  ARG B 257      66.522   8.261  19.247  1.00 55.46           C  
ATOM   8936  CD  ARG B 257      66.738   6.755  19.174  1.00 52.39           C  
ATOM   8937  NE  ARG B 257      68.044   6.348  19.686  1.00 57.79           N  
ATOM   8938  CZ  ARG B 257      68.247   5.801  20.881  1.00 55.59           C  
ATOM   8939  NH1 ARG B 257      69.473   5.462  21.258  1.00 53.15           N  
ATOM   8940  NH2 ARG B 257      67.224   5.590  21.699  1.00 56.70           N  
ATOM   8941  N   HIS B 258      66.775  10.842  23.067  1.00 55.53           N  
ATOM   8942  CA  HIS B 258      66.560  11.082  24.494  1.00 52.01           C  
ATOM   8943  C   HIS B 258      66.059  12.496  24.803  1.00 58.84           C  
ATOM   8944  O   HIS B 258      65.247  12.682  25.711  1.00 57.81           O  
ATOM   8945  CB  HIS B 258      67.845  10.797  25.273  1.00 59.06           C  
ATOM   8946  CG  HIS B 258      68.040   9.347  25.596  1.00 51.48           C  
ATOM   8947  ND1 HIS B 258      67.815   8.829  26.853  1.00 50.77           N  
ATOM   8948  CD2 HIS B 258      68.418   8.303  24.821  1.00 54.85           C  
ATOM   8949  CE1 HIS B 258      68.057   7.531  26.842  1.00 55.05           C  
ATOM   8950  NE2 HIS B 258      68.423   7.186  25.619  1.00 58.91           N  
ATOM   8951  N   ARG B 259      66.540  13.485  24.054  1.00 54.64           N  
ATOM   8952  CA  ARG B 259      66.034  14.849  24.182  1.00 54.00           C  
ATOM   8953  C   ARG B 259      64.586  14.904  23.715  1.00 60.00           C  
ATOM   8954  O   ARG B 259      63.716  15.453  24.398  1.00 51.27           O  
ATOM   8955  CB  ARG B 259      66.882  15.834  23.373  1.00 51.52           C  
ATOM   8956  CG  ARG B 259      68.289  16.067  23.905  1.00 58.37           C  
ATOM   8957  CD  ARG B 259      68.340  17.165  24.951  1.00 53.55           C  
ATOM   8958  NE  ARG B 259      67.918  16.703  26.270  1.00 53.30           N  
ATOM   8959  CZ  ARG B 259      66.747  16.993  26.824  1.00 50.07           C  
ATOM   8960  NH1 ARG B 259      65.874  17.753  26.176  1.00 52.75           N  
ATOM   8961  NH2 ARG B 259      66.453  16.528  28.031  1.00 54.11           N  
ATOM   8962  N   LEU B 260      64.342  14.326  22.542  1.00 43.23           N  
ATOM   8963  CA  LEU B 260      62.997  14.268  21.986  1.00 47.58           C  
ATOM   8964  C   LEU B 260      62.049  13.531  22.927  1.00 49.49           C  
ATOM   8965  O   LEU B 260      60.888  13.910  23.067  1.00 41.57           O  
ATOM   8966  CB  LEU B 260      63.012  13.592  20.615  1.00 43.21           C  
ATOM   8967  CG  LEU B 260      61.672  13.514  19.878  1.00 49.67           C  
ATOM   8968  CD1 LEU B 260      61.080  14.903  19.707  1.00 48.11           C  
ATOM   8969  CD2 LEU B 260      61.848  12.830  18.531  1.00 55.84           C  
ATOM   8970  N   GLN B 261      62.548  12.482  23.576  1.00 62.72           N  
ATOM   8971  CA  GLN B 261      61.751  11.739  24.546  1.00 65.30           C  
ATOM   8972  C   GLN B 261      61.459  12.598  25.770  1.00 61.17           C  
ATOM   8973  O   GLN B 261      60.357  12.562  26.317  1.00 64.20           O  
ATOM   8974  CB  GLN B 261      62.464  10.449  24.963  1.00 68.52           C  
ATOM   8975  CG  GLN B 261      61.682   9.578  25.941  1.00 60.35           C  
ATOM   8976  CD  GLN B 261      61.946   9.931  27.394  1.00 65.54           C  
ATOM   8977  OE1 GLN B 261      62.901  10.640  27.710  1.00 61.19           O  
ATOM   8978  NE2 GLN B 261      61.097   9.436  28.288  1.00 65.82           N  
ATOM   8979  N   TRP B 262      62.456  13.366  26.197  1.00 56.79           N  
ATOM   8980  CA  TRP B 262      62.302  14.243  27.351  1.00 53.63           C  
ATOM   8981  C   TRP B 262      61.286  15.346  27.077  1.00 54.32           C  
ATOM   8982  O   TRP B 262      60.612  15.821  27.992  1.00 54.02           O  
ATOM   8983  CB  TRP B 262      63.648  14.856  27.741  1.00 59.22           C  
ATOM   8984  CG  TRP B 262      63.574  15.784  28.920  1.00 56.67           C  
ATOM   8985  CD1 TRP B 262      63.698  15.450  30.236  1.00 56.24           C  
ATOM   8986  CD2 TRP B 262      63.368  17.202  28.886  1.00 54.76           C  
ATOM   8987  NE1 TRP B 262      63.578  16.569  31.024  1.00 54.60           N  
ATOM   8988  CE2 TRP B 262      63.375  17.658  30.219  1.00 53.61           C  
ATOM   8989  CE3 TRP B 262      63.174  18.129  27.858  1.00 54.24           C  
ATOM   8990  CZ2 TRP B 262      63.196  18.998  30.549  1.00 52.20           C  
ATOM   8991  CZ3 TRP B 262      62.998  19.459  28.189  1.00 52.32           C  
ATOM   8992  CH2 TRP B 262      63.012  19.881  29.523  1.00 51.45           C  
ATOM   8993  N   TRP B 263      61.177  15.753  25.818  1.00 63.79           N  
ATOM   8994  CA  TRP B 263      60.245  16.815  25.461  1.00 64.05           C  
ATOM   8995  C   TRP B 263      58.864  16.272  25.089  1.00 61.27           C  
ATOM   8996  O   TRP B 263      57.880  17.012  25.107  1.00 69.89           O  
ATOM   8997  CB  TRP B 263      60.805  17.654  24.308  1.00 62.59           C  
ATOM   8998  CG  TRP B 263      60.879  19.118  24.628  1.00 61.42           C  
ATOM   8999  CD1 TRP B 263      59.829  19.972  24.793  1.00 64.32           C  
ATOM   9000  CD2 TRP B 263      62.063  19.897  24.825  1.00 52.45           C  
ATOM   9001  NE1 TRP B 263      60.284  21.235  25.079  1.00 56.43           N  
ATOM   9002  CE2 TRP B 263      61.654  21.217  25.105  1.00 59.24           C  
ATOM   9003  CE3 TRP B 263      63.430  19.610  24.788  1.00 54.09           C  
ATOM   9004  CZ2 TRP B 263      62.559  22.243  25.348  1.00 55.95           C  
ATOM   9005  CZ3 TRP B 263      64.327  20.629  25.033  1.00 50.69           C  
ATOM   9006  CH2 TRP B 263      63.888  21.931  25.307  1.00 58.65           C  
ATOM   9007  N   ARG B 264      58.789  14.986  24.763  1.00 55.07           N  
ATOM   9008  CA  ARG B 264      57.515  14.377  24.386  1.00 51.56           C  
ATOM   9009  C   ARG B 264      56.704  13.946  25.603  1.00 51.94           C  
ATOM   9010  O   ARG B 264      55.491  13.765  25.510  1.00 55.73           O  
ATOM   9011  CB  ARG B 264      57.733  13.187  23.451  1.00 55.41           C  
ATOM   9012  CG  ARG B 264      57.744  13.574  21.980  1.00 58.89           C  
ATOM   9013  CD  ARG B 264      57.850  12.363  21.072  1.00 52.64           C  
ATOM   9014  NE  ARG B 264      57.780  12.741  19.662  1.00 55.88           N  
ATOM   9015  CZ  ARG B 264      57.904  11.888  18.651  1.00 58.65           C  
ATOM   9016  NH1 ARG B 264      58.108  10.598  18.890  1.00 58.73           N  
ATOM   9017  NH2 ARG B 264      57.826  12.322  17.400  1.00 50.66           N  
ATOM   9018  N   LYS B 265      57.369  13.778  26.743  1.00 53.80           N  
ATOM   9019  CA  LYS B 265      56.645  13.589  27.994  1.00 54.32           C  
ATOM   9020  C   LYS B 265      56.246  14.961  28.521  1.00 52.98           C  
ATOM   9021  O   LYS B 265      56.534  15.974  27.883  1.00 51.50           O  
ATOM   9022  CB  LYS B 265      57.477  12.816  29.022  1.00 52.64           C  
ATOM   9023  CG  LYS B 265      58.825  13.426  29.350  1.00 48.76           C  
ATOM   9024  CD  LYS B 265      59.532  12.625  30.435  1.00 48.06           C  
ATOM   9025  CE  LYS B 265      60.938  13.148  30.692  1.00 44.79           C  
ATOM   9026  NZ  LYS B 265      61.615  12.425  31.805  1.00 44.73           N  
ATOM   9027  N   PHE B 266      55.564  14.985  29.665  1.00 55.22           N  
ATOM   9028  CA  PHE B 266      54.970  16.207  30.225  1.00 56.22           C  
ATOM   9029  C   PHE B 266      53.892  16.806  29.317  1.00 56.60           C  
ATOM   9030  O   PHE B 266      53.259  17.800  29.673  1.00 58.93           O  
ATOM   9031  CB  PHE B 266      56.032  17.280  30.503  1.00 57.98           C  
ATOM   9032  CG  PHE B 266      57.240  16.776  31.237  1.00 54.17           C  
ATOM   9033  CD1 PHE B 266      57.131  16.265  32.519  1.00 52.19           C  
ATOM   9034  CD2 PHE B 266      58.494  16.846  30.652  1.00 59.54           C  
ATOM   9035  CE1 PHE B 266      58.249  15.814  33.195  1.00 59.36           C  
ATOM   9036  CE2 PHE B 266      59.613  16.398  31.321  1.00 56.71           C  
ATOM   9037  CZ  PHE B 266      59.491  15.880  32.594  1.00 58.35           C  
ATOM   9038  N   ALA B 267      53.685  16.204  28.152  1.00 42.79           N  
ATOM   9039  CA  ALA B 267      52.772  16.751  27.157  1.00 43.36           C  
ATOM   9040  C   ALA B 267      51.434  16.022  27.160  1.00 45.96           C  
ATOM   9041  O   ALA B 267      51.373  14.810  27.364  1.00 47.79           O  
ATOM   9042  CB  ALA B 267      53.404  16.688  25.774  1.00 43.86           C  
ATOM   9043  N   MET B 268      50.363  16.776  26.937  1.00 69.07           N  
ATOM   9044  CA  MET B 268      49.032  16.201  26.836  1.00 61.13           C  
ATOM   9045  C   MET B 268      48.817  15.686  25.419  1.00 66.07           C  
ATOM   9046  O   MET B 268      47.885  14.928  25.150  1.00 67.43           O  
ATOM   9047  CB  MET B 268      47.966  17.235  27.206  1.00 63.87           C  
ATOM   9048  CG  MET B 268      46.723  16.639  27.836  1.00 63.35           C  
ATOM   9049  SD  MET B 268      47.102  15.728  29.343  1.00 60.79           S  
ATOM   9050  CE  MET B 268      47.934  16.988  30.303  1.00 68.58           C  
ATOM   9051  N   SER B 269      49.697  16.110  24.519  1.00 62.51           N  
ATOM   9052  CA  SER B 269      49.674  15.666  23.133  1.00 65.40           C  
ATOM   9053  C   SER B 269      51.091  15.646  22.568  1.00 68.09           C  
ATOM   9054  O   SER B 269      51.528  16.612  21.946  1.00 63.04           O  
ATOM   9055  CB  SER B 269      48.776  16.570  22.289  1.00 69.91           C  
ATOM   9056  OG  SER B 269      49.246  17.907  22.299  1.00 65.93           O  
ATOM   9057  N   PRO B 270      51.816  14.539  22.789  1.00 54.27           N  
ATOM   9058  CA  PRO B 270      53.209  14.376  22.356  1.00 53.68           C  
ATOM   9059  C   PRO B 270      53.379  14.410  20.839  1.00 59.89           C  
ATOM   9060  O   PRO B 270      54.507  14.483  20.356  1.00 56.69           O  
ATOM   9061  CB  PRO B 270      53.587  12.994  22.904  1.00 53.79           C  
ATOM   9062  CG  PRO B 270      52.616  12.738  24.007  1.00 53.98           C  
ATOM   9063  CD  PRO B 270      51.344  13.379  23.563  1.00 53.57           C  
ATOM   9064  N   SER B 271      52.274  14.361  20.101  1.00 53.33           N  
ATOM   9065  CA  SER B 271      52.325  14.325  18.646  1.00 57.91           C  
ATOM   9066  C   SER B 271      52.782  15.653  18.046  1.00 53.90           C  
ATOM   9067  O   SER B 271      53.163  15.715  16.877  1.00 55.88           O  
ATOM   9068  CB  SER B 271      50.956  13.945  18.078  1.00 51.34           C  
ATOM   9069  OG  SER B 271      50.985  13.899  16.663  1.00 51.67           O  
ATOM   9070  N   ASN B 272      52.742  16.714  18.846  1.00 51.20           N  
ATOM   9071  CA  ASN B 272      53.131  18.039  18.375  1.00 57.53           C  
ATOM   9072  C   ASN B 272      54.643  18.183  18.207  1.00 54.32           C  
ATOM   9073  O   ASN B 272      55.113  18.752  17.221  1.00 52.07           O  
ATOM   9074  CB  ASN B 272      52.608  19.116  19.329  1.00 53.57           C  
ATOM   9075  CG  ASN B 272      51.098  19.258  19.276  1.00 55.33           C  
ATOM   9076  OD1 ASN B 272      50.475  18.996  18.249  1.00 57.49           O  
ATOM   9077  ND2 ASN B 272      50.504  19.680  20.388  1.00 53.98           N  
ATOM   9078  N   PHE B 273      55.398  17.669  19.173  1.00 52.28           N  
ATOM   9079  CA  PHE B 273      56.854  17.727  19.120  1.00 47.38           C  
ATOM   9080  C   PHE B 273      57.402  16.781  18.058  1.00 51.73           C  
ATOM   9081  O   PHE B 273      57.094  15.590  18.058  1.00 56.26           O  
ATOM   9082  CB  PHE B 273      57.458  17.382  20.483  1.00 43.46           C  
ATOM   9083  CG  PHE B 273      56.951  18.237  21.605  1.00 49.71           C  
ATOM   9084  CD1 PHE B 273      57.592  19.415  21.938  1.00 42.75           C  
ATOM   9085  CD2 PHE B 273      55.833  17.858  22.328  1.00 43.86           C  
ATOM   9086  CE1 PHE B 273      57.126  20.203  22.972  1.00 40.48           C  
ATOM   9087  CE2 PHE B 273      55.364  18.639  23.362  1.00 41.00           C  
ATOM   9088  CZ  PHE B 273      56.011  19.813  23.684  1.00 44.26           C  
ATOM   9089  N   SER B 274      58.219  17.316  17.157  1.00 51.56           N  
ATOM   9090  CA  SER B 274      58.790  16.511  16.085  1.00 55.38           C  
ATOM   9091  C   SER B 274      60.289  16.745  15.947  1.00 50.65           C  
ATOM   9092  O   SER B 274      60.851  17.629  16.593  1.00 43.88           O  
ATOM   9093  CB  SER B 274      58.089  16.813  14.758  1.00 58.18           C  
ATOM   9094  OG  SER B 274      58.221  18.181  14.411  1.00 53.28           O  
ATOM   9095  N   SER B 275      60.932  15.948  15.099  1.00 51.34           N  
ATOM   9096  CA  SER B 275      62.363  16.084  14.854  1.00 57.90           C  
ATOM   9097  C   SER B 275      62.650  16.134  13.358  1.00 58.06           C  
ATOM   9098  O   SER B 275      61.899  15.585  12.551  1.00 50.45           O  
ATOM   9099  CB  SER B 275      63.136  14.937  15.503  1.00 54.98           C  
ATOM   9100  OG  SER B 275      62.801  13.694  14.910  1.00 55.52           O  
ATOM   9101  N   SER B 276      63.742  16.797  12.994  1.00 61.71           N  
ATOM   9102  CA  SER B 276      64.129  16.926  11.596  1.00 69.50           C  
ATOM   9103  C   SER B 276      65.617  16.659  11.412  1.00 66.59           C  
ATOM   9104  O   SER B 276      66.455  17.264  12.083  1.00 63.41           O  
ATOM   9105  CB  SER B 276      63.775  18.317  11.066  1.00 66.45           C  
ATOM   9106  OG  SER B 276      64.147  18.458   9.705  1.00 66.82           O  
ATOM   9107  N   ASP B 277      65.935  15.744  10.502  1.00 84.54           N  
ATOM   9108  CA  ASP B 277      67.321  15.425  10.182  1.00 81.84           C  
ATOM   9109  C   ASP B 277      67.833  16.341   9.079  1.00 83.60           C  
ATOM   9110  O   ASP B 277      67.259  16.397   7.991  1.00 88.08           O  
ATOM   9111  CB  ASP B 277      67.453  13.960   9.761  1.00 80.42           C  
ATOM   9112  CG  ASP B 277      66.883  13.005  10.789  1.00 88.98           C  
ATOM   9113  OD1 ASP B 277      65.922  13.387  11.489  1.00 89.18           O  
ATOM   9114  OD2 ASP B 277      67.396  11.870  10.897  1.00 81.38           O  
ATOM   9115  N   CYS B 278      68.912  17.062   9.362  1.00 69.76           N  
ATOM   9116  CA  CYS B 278      69.459  18.013   8.402  1.00 69.22           C  
ATOM   9117  C   CYS B 278      70.981  17.981   8.385  1.00 66.44           C  
ATOM   9118  O   CYS B 278      71.614  17.609   9.371  1.00 65.54           O  
ATOM   9119  CB  CYS B 278      68.967  19.427   8.719  1.00 61.23           C  
ATOM   9120  SG  CYS B 278      69.305  19.966  10.409  1.00 55.86           S  
ATOM   9121  N   GLN B 279      71.564  18.378   7.259  1.00 65.52           N  
ATOM   9122  CA  GLN B 279      73.015  18.386   7.119  1.00 67.67           C  
ATOM   9123  C   GLN B 279      73.563  19.808   7.091  1.00 62.84           C  
ATOM   9124  O   GLN B 279      72.833  20.762   6.822  1.00 60.95           O  
ATOM   9125  CB  GLN B 279      73.437  17.636   5.853  1.00 72.04           C  
ATOM   9126  CG  GLN B 279      72.941  18.262   4.562  1.00 73.64           C  
ATOM   9127  CD  GLN B 279      73.469  17.552   3.332  1.00 70.77           C  
ATOM   9128  OE1 GLN B 279      74.234  16.593   3.434  1.00 73.44           O  
ATOM   9129  NE2 GLN B 279      73.064  18.022   2.157  1.00 71.14           N  
ATOM   9130  N   ASP B 280      74.854  19.936   7.370  1.00 68.68           N  
ATOM   9131  CA  ASP B 280      75.523  21.231   7.379  1.00 66.33           C  
ATOM   9132  C   ASP B 280      75.863  21.666   5.956  1.00 67.55           C  
ATOM   9133  O   ASP B 280      75.617  20.931   5.001  1.00 61.30           O  
ATOM   9134  CB  ASP B 280      76.790  21.163   8.236  1.00 64.57           C  
ATOM   9135  CG  ASP B 280      77.229  22.521   8.742  1.00 60.76           C  
ATOM   9136  OD1 ASP B 280      78.451  22.733   8.894  1.00 62.26           O  
ATOM   9137  OD2 ASP B 280      76.351  23.373   8.993  1.00 69.37           O  
ATOM   9138  N   GLU B 281      76.423  22.862   5.820  1.00 88.37           N  
ATOM   9139  CA  GLU B 281      76.871  23.351   4.520  1.00 81.39           C  
ATOM   9140  C   GLU B 281      78.111  22.590   4.068  1.00 82.93           C  
ATOM   9141  O   GLU B 281      78.400  22.504   2.874  1.00 86.64           O  
ATOM   9142  CB  GLU B 281      77.159  24.853   4.572  1.00 88.18           C  
ATOM   9143  CG  GLU B 281      78.134  25.274   5.661  1.00 84.06           C  
ATOM   9144  CD  GLU B 281      77.455  25.512   6.996  1.00 89.77           C  
ATOM   9145  OE1 GLU B 281      76.207  25.554   7.030  1.00 89.21           O  
ATOM   9146  OE2 GLU B 281      78.169  25.653   8.013  1.00 89.99           O  
ATOM   9147  N   GLU B 282      78.841  22.039   5.032  1.00 83.88           N  
ATOM   9148  CA  GLU B 282      80.028  21.246   4.744  1.00 88.29           C  
ATOM   9149  C   GLU B 282      79.677  19.766   4.625  1.00 81.51           C  
ATOM   9150  O   GLU B 282      80.222  19.055   3.781  1.00 81.91           O  
ATOM   9151  CB  GLU B 282      81.088  21.454   5.828  1.00 82.97           C  
ATOM   9152  CG  GLU B 282      81.682  22.852   5.852  1.00 81.17           C  
ATOM   9153  CD  GLU B 282      82.511  23.155   4.618  1.00 86.68           C  
ATOM   9154  OE1 GLU B 282      83.041  22.203   4.006  1.00 89.31           O  
ATOM   9155  OE2 GLU B 282      82.632  24.345   4.258  1.00 85.01           O  
ATOM   9156  N   GLY B 283      78.761  19.309   5.473  1.00 52.90           N  
ATOM   9157  CA  GLY B 283      78.316  17.930   5.434  1.00 56.61           C  
ATOM   9158  C   GLY B 283      78.058  17.345   6.809  1.00 51.63           C  
ATOM   9159  O   GLY B 283      77.624  16.199   6.931  1.00 53.81           O  
ATOM   9160  N   ARG B 284      78.326  18.134   7.844  1.00 78.84           N  
ATOM   9161  CA  ARG B 284      78.125  17.698   9.223  1.00 78.63           C  
ATOM   9162  C   ARG B 284      76.654  17.398   9.501  1.00 76.11           C  
ATOM   9163  O   ARG B 284      75.777  18.202   9.182  1.00 76.03           O  
ATOM   9164  CB  ARG B 284      78.641  18.756  10.200  1.00 74.22           C  
ATOM   9165  CG  ARG B 284      80.106  19.118  10.013  1.00 77.94           C  
ATOM   9166  CD  ARG B 284      80.529  20.236  10.955  1.00 73.58           C  
ATOM   9167  NE  ARG B 284      81.952  20.541  10.835  1.00 76.71           N  
ATOM   9168  CZ  ARG B 284      82.458  21.429   9.986  1.00 75.80           C  
ATOM   9169  NH1 ARG B 284      81.657  22.109   9.177  1.00 78.90           N  
ATOM   9170  NH2 ARG B 284      83.767  21.641   9.947  1.00 76.82           N  
ATOM   9171  N   LYS B 285      76.390  16.240  10.095  1.00 64.97           N  
ATOM   9172  CA  LYS B 285      75.024  15.834  10.406  1.00 63.11           C  
ATOM   9173  C   LYS B 285      74.495  16.544  11.647  1.00 67.57           C  
ATOM   9174  O   LYS B 285      75.250  16.846  12.571  1.00 63.49           O  
ATOM   9175  CB  LYS B 285      74.944  14.317  10.599  1.00 60.77           C  
ATOM   9176  CG  LYS B 285      75.123  13.515   9.320  1.00 64.96           C  
ATOM   9177  CD  LYS B 285      74.011  13.809   8.326  1.00 65.22           C  
ATOM   9178  CE  LYS B 285      74.161  12.978   7.061  1.00 71.81           C  
ATOM   9179  NZ  LYS B 285      75.415  13.298   6.324  1.00 71.85           N  
ATOM   9180  N   GLY B 286      73.194  16.804  11.659  1.00 52.29           N  
ATOM   9181  CA  GLY B 286      72.561  17.486  12.772  1.00 57.54           C  
ATOM   9182  C   GLY B 286      71.062  17.266  12.812  1.00 56.94           C  
ATOM   9183  O   GLY B 286      70.457  16.845  11.824  1.00 53.10           O  
ATOM   9184  N   ASN B 287      70.459  17.552  13.960  1.00 58.98           N  
ATOM   9185  CA  ASN B 287      69.026  17.365  14.131  1.00 54.31           C  
ATOM   9186  C   ASN B 287      68.369  18.539  14.844  1.00 58.61           C  
ATOM   9187  O   ASN B 287      68.916  19.076  15.808  1.00 53.04           O  
ATOM   9188  CB  ASN B 287      68.749  16.075  14.900  1.00 52.19           C  
ATOM   9189  CG  ASN B 287      69.179  14.841  14.136  1.00 51.11           C  
ATOM   9190  OD1 ASN B 287      68.414  14.292  13.343  1.00 57.51           O  
ATOM   9191  ND2 ASN B 287      70.410  14.399  14.370  1.00 51.76           N  
ATOM   9192  N   LYS B 288      67.195  18.931  14.361  1.00 52.06           N  
ATOM   9193  CA  LYS B 288      66.441  20.016  14.977  1.00 58.86           C  
ATOM   9194  C   LYS B 288      65.162  19.493  15.620  1.00 55.68           C  
ATOM   9195  O   LYS B 288      64.596  18.496  15.174  1.00 54.44           O  
ATOM   9196  CB  LYS B 288      66.105  21.094  13.944  1.00 57.80           C  
ATOM   9197  CG  LYS B 288      67.317  21.745  13.295  1.00 58.84           C  
ATOM   9198  CD  LYS B 288      66.893  22.887  12.384  1.00 59.88           C  
ATOM   9199  CE  LYS B 288      68.089  23.543  11.711  1.00 53.55           C  
ATOM   9200  NZ  LYS B 288      68.767  22.623  10.758  1.00 56.42           N  
ATOM   9201  N   LEU B 289      64.716  20.167  16.675  1.00 55.98           N  
ATOM   9202  CA  LEU B 289      63.479  19.798  17.353  1.00 57.65           C  
ATOM   9203  C   LEU B 289      62.429  20.891  17.203  1.00 56.82           C  
ATOM   9204  O   LEU B 289      62.701  22.061  17.458  1.00 52.37           O  
ATOM   9205  CB  LEU B 289      63.736  19.523  18.837  1.00 54.38           C  
ATOM   9206  CG  LEU B 289      64.030  18.076  19.241  1.00 56.95           C  
ATOM   9207  CD1 LEU B 289      65.314  17.575  18.600  1.00 57.46           C  
ATOM   9208  CD2 LEU B 289      64.095  17.952  20.755  1.00 53.62           C  
ATOM   9209  N   TYR B 290      61.228  20.505  16.788  1.00 54.21           N  
ATOM   9210  CA  TYR B 290      60.158  21.470  16.572  1.00 50.08           C  
ATOM   9211  C   TYR B 290      58.963  21.211  17.486  1.00 56.42           C  
ATOM   9212  O   TYR B 290      58.725  20.079  17.906  1.00 57.83           O  
ATOM   9213  CB  TYR B 290      59.700  21.443  15.112  1.00 55.66           C  
ATOM   9214  CG  TYR B 290      60.767  21.823  14.111  1.00 56.37           C  
ATOM   9215  CD1 TYR B 290      61.777  22.715  14.443  1.00 59.87           C  
ATOM   9216  CD2 TYR B 290      60.764  21.288  12.829  1.00 57.01           C  
ATOM   9217  CE1 TYR B 290      62.754  23.064  13.528  1.00 52.11           C  
ATOM   9218  CE2 TYR B 290      61.736  21.630  11.908  1.00 54.32           C  
ATOM   9219  CZ  TYR B 290      62.728  22.518  12.262  1.00 50.21           C  
ATOM   9220  OH  TYR B 290      63.698  22.862  11.348  1.00 51.83           O  
ATOM   9221  N   TYR B 291      58.221  22.271  17.795  1.00 51.37           N  
ATOM   9222  CA  TYR B 291      56.927  22.134  18.453  1.00 54.01           C  
ATOM   9223  C   TYR B 291      55.840  22.730  17.573  1.00 56.07           C  
ATOM   9224  O   TYR B 291      56.019  23.801  16.994  1.00 53.06           O  
ATOM   9225  CB  TYR B 291      56.912  22.810  19.824  1.00 51.66           C  
ATOM   9226  CG  TYR B 291      55.525  22.890  20.425  1.00 55.11           C  
ATOM   9227  CD1 TYR B 291      54.839  24.096  20.488  1.00 50.77           C  
ATOM   9228  CD2 TYR B 291      54.890  21.754  20.905  1.00 57.59           C  
ATOM   9229  CE1 TYR B 291      53.568  24.168  21.030  1.00 53.32           C  
ATOM   9230  CE2 TYR B 291      53.619  21.816  21.448  1.00 60.38           C  
ATOM   9231  CZ  TYR B 291      52.963  23.025  21.508  1.00 57.97           C  
ATOM   9232  OH  TYR B 291      51.698  23.089  22.048  1.00 60.49           O  
ATOM   9233  N   ASN B 292      54.709  22.041  17.480  1.00 53.76           N  
ATOM   9234  CA  ASN B 292      53.625  22.490  16.619  1.00 55.63           C  
ATOM   9235  C   ASN B 292      52.719  23.511  17.298  1.00 53.35           C  
ATOM   9236  O   ASN B 292      51.725  23.153  17.928  1.00 55.89           O  
ATOM   9237  CB  ASN B 292      52.796  21.297  16.146  1.00 61.98           C  
ATOM   9238  CG  ASN B 292      51.780  21.678  15.091  1.00 63.42           C  
ATOM   9239  OD1 ASN B 292      52.094  21.730  13.902  1.00 63.96           O  
ATOM   9240  ND2 ASN B 292      50.554  21.950  15.520  1.00 64.04           N  
ATOM   9241  N   PHE B 293      53.078  24.786  17.168  1.00 40.20           N  
ATOM   9242  CA  PHE B 293      52.230  25.874  17.634  1.00 48.53           C  
ATOM   9243  C   PHE B 293      51.009  25.994  16.723  1.00 41.61           C  
ATOM   9244  O   PHE B 293      51.030  25.498  15.596  1.00 44.01           O  
ATOM   9245  CB  PHE B 293      53.015  27.191  17.672  1.00 45.70           C  
ATOM   9246  CG  PHE B 293      53.886  27.346  18.885  1.00 42.55           C  
ATOM   9247  CD1 PHE B 293      53.328  27.603  20.126  1.00 41.52           C  
ATOM   9248  CD2 PHE B 293      55.261  27.245  18.782  1.00 40.94           C  
ATOM   9249  CE1 PHE B 293      54.126  27.750  21.244  1.00 48.99           C  
ATOM   9250  CE2 PHE B 293      56.063  27.392  19.895  1.00 48.41           C  
ATOM   9251  CZ  PHE B 293      55.494  27.644  21.128  1.00 47.46           C  
ATOM   9252  N   PRO B 294      49.937  26.643  17.206  1.00 44.28           N  
ATOM   9253  CA  PRO B 294      48.723  26.829  16.401  1.00 46.85           C  
ATOM   9254  C   PRO B 294      48.949  27.540  15.063  1.00 47.37           C  
ATOM   9255  O   PRO B 294      48.064  27.505  14.208  1.00 50.89           O  
ATOM   9256  CB  PRO B 294      47.834  27.679  17.311  1.00 45.92           C  
ATOM   9257  CG  PRO B 294      48.259  27.308  18.682  1.00 44.90           C  
ATOM   9258  CD  PRO B 294      49.739  27.089  18.599  1.00 42.54           C  
ATOM   9259  N   TRP B 295      50.107  28.170  14.879  1.00 51.81           N  
ATOM   9260  CA  TRP B 295      50.398  28.872  13.633  1.00 51.25           C  
ATOM   9261  C   TRP B 295      51.489  28.178  12.818  1.00 51.71           C  
ATOM   9262  O   TRP B 295      51.956  28.712  11.812  1.00 51.18           O  
ATOM   9263  CB  TRP B 295      50.811  30.317  13.919  1.00 57.48           C  
ATOM   9264  CG  TRP B 295      52.006  30.433  14.809  1.00 53.96           C  
ATOM   9265  CD1 TRP B 295      53.315  30.424  14.430  1.00 51.90           C  
ATOM   9266  CD2 TRP B 295      52.001  30.576  16.233  1.00 52.24           C  
ATOM   9267  NE1 TRP B 295      54.127  30.554  15.530  1.00 48.81           N  
ATOM   9268  CE2 TRP B 295      53.345  30.649  16.650  1.00 49.01           C  
ATOM   9269  CE3 TRP B 295      50.991  30.652  17.198  1.00 53.33           C  
ATOM   9270  CZ2 TRP B 295      53.705  30.793  17.988  1.00 46.86           C  
ATOM   9271  CZ3 TRP B 295      51.351  30.794  18.527  1.00 51.38           C  
ATOM   9272  CH2 TRP B 295      52.696  30.864  18.909  1.00 48.20           C  
ATOM   9273  N   GLY B 296      51.888  26.990  13.258  1.00 50.86           N  
ATOM   9274  CA  GLY B 296      52.927  26.238  12.578  1.00 52.15           C  
ATOM   9275  C   GLY B 296      53.998  25.751  13.534  1.00 47.91           C  
ATOM   9276  O   GLY B 296      53.971  26.069  14.722  1.00 45.33           O  
ATOM   9277  N   LYS B 297      54.945  24.976  13.016  1.00 62.50           N  
ATOM   9278  CA  LYS B 297      56.025  24.444  13.838  1.00 60.37           C  
ATOM   9279  C   LYS B 297      57.037  25.529  14.192  1.00 53.27           C  
ATOM   9280  O   LYS B 297      57.119  26.557  13.518  1.00 52.32           O  
ATOM   9281  CB  LYS B 297      56.723  23.283  13.125  1.00 62.16           C  
ATOM   9282  CG  LYS B 297      55.837  22.065  12.902  1.00 69.50           C  
ATOM   9283  CD  LYS B 297      56.624  20.908  12.306  1.00 65.15           C  
ATOM   9284  CE  LYS B 297      57.238  21.284  10.967  1.00 64.71           C  
ATOM   9285  NZ  LYS B 297      58.013  20.158  10.371  1.00 66.52           N  
ATOM   9286  N   GLU B 298      57.800  25.300  15.256  1.00 70.21           N  
ATOM   9287  CA  GLU B 298      58.795  26.266  15.703  1.00 66.54           C  
ATOM   9288  C   GLU B 298      59.979  25.561  16.361  1.00 64.08           C  
ATOM   9289  O   GLU B 298      59.799  24.624  17.140  1.00 65.72           O  
ATOM   9290  CB  GLU B 298      58.168  27.267  16.675  1.00 62.89           C  
ATOM   9291  CG  GLU B 298      58.787  28.656  16.630  1.00 62.05           C  
ATOM   9292  CD  GLU B 298      58.350  29.450  15.414  1.00 64.07           C  
ATOM   9293  OE1 GLU B 298      57.250  29.178  14.885  1.00 65.63           O  
ATOM   9294  OE2 GLU B 298      59.105  30.348  14.985  1.00 62.51           O  
ATOM   9295  N   LEU B 299      61.186  26.015  16.041  1.00 57.81           N  
ATOM   9296  CA  LEU B 299      62.405  25.428  16.588  1.00 56.14           C  
ATOM   9297  C   LEU B 299      62.519  25.660  18.091  1.00 52.94           C  
ATOM   9298  O   LEU B 299      62.341  26.779  18.568  1.00 50.51           O  
ATOM   9299  CB  LEU B 299      63.631  25.999  15.873  1.00 54.62           C  
ATOM   9300  CG  LEU B 299      65.001  25.557  16.392  1.00 52.98           C  
ATOM   9301  CD1 LEU B 299      65.182  24.058  16.224  1.00 56.14           C  
ATOM   9302  CD2 LEU B 299      66.111  26.320  15.683  1.00 52.03           C  
ATOM   9303  N   ILE B 300      62.813  24.600  18.837  1.00 46.68           N  
ATOM   9304  CA  ILE B 300      62.907  24.691  20.290  1.00 44.82           C  
ATOM   9305  C   ILE B 300      64.225  24.136  20.822  1.00 43.57           C  
ATOM   9306  O   ILE B 300      64.633  24.461  21.935  1.00 41.96           O  
ATOM   9307  CB  ILE B 300      61.739  23.952  20.980  1.00 46.60           C  
ATOM   9308  CG1 ILE B 300      61.717  22.478  20.574  1.00 49.28           C  
ATOM   9309  CG2 ILE B 300      60.417  24.612  20.639  1.00 48.01           C  
ATOM   9310  CD1 ILE B 300      60.594  21.683  21.208  1.00 51.84           C  
ATOM   9311  N   GLU B 301      64.887  23.302  20.025  1.00 54.07           N  
ATOM   9312  CA  GLU B 301      66.171  22.728  20.417  1.00 52.56           C  
ATOM   9313  C   GLU B 301      66.951  22.251  19.196  1.00 51.88           C  
ATOM   9314  O   GLU B 301      66.377  21.707  18.255  1.00 56.68           O  
ATOM   9315  CB  GLU B 301      65.969  21.572  21.402  1.00 55.25           C  
ATOM   9316  CG  GLU B 301      67.261  21.001  21.964  1.00 57.94           C  
ATOM   9317  CD  GLU B 301      67.030  20.065  23.133  1.00 57.98           C  
ATOM   9318  OE1 GLU B 301      67.669  20.262  24.185  1.00 58.49           O  
ATOM   9319  OE2 GLU B 301      66.212  19.130  22.998  1.00 50.65           O  
ATOM   9320  N   THR B 302      68.263  22.460  19.220  1.00 55.85           N  
ATOM   9321  CA  THR B 302      69.106  22.114  18.083  1.00 50.12           C  
ATOM   9322  C   THR B 302      70.271  21.210  18.488  1.00 59.05           C  
ATOM   9323  O   THR B 302      70.916  21.428  19.516  1.00 57.28           O  
ATOM   9324  CB  THR B 302      69.651  23.383  17.393  1.00 57.15           C  
ATOM   9325  OG1 THR B 302      70.629  23.016  16.415  1.00 59.36           O  
ATOM   9326  CG2 THR B 302      70.284  24.322  18.411  1.00 53.76           C  
ATOM   9327  N   LEU B 303      70.524  20.186  17.677  1.00 59.15           N  
ATOM   9328  CA  LEU B 303      71.613  19.245  17.929  1.00 50.54           C  
ATOM   9329  C   LEU B 303      72.547  19.163  16.725  1.00 53.35           C  
ATOM   9330  O   LEU B 303      72.098  18.955  15.597  1.00 56.18           O  
ATOM   9331  CB  LEU B 303      71.066  17.853  18.260  1.00 52.44           C  
ATOM   9332  CG  LEU B 303      70.329  17.646  19.587  1.00 50.43           C  
ATOM   9333  CD1 LEU B 303      68.885  18.122  19.509  1.00 59.95           C  
ATOM   9334  CD2 LEU B 303      70.391  16.186  20.012  1.00 52.59           C  
ATOM   9335  N   TRP B 304      73.846  19.321  16.968  1.00 49.80           N  
ATOM   9336  CA  TRP B 304      74.836  19.298  15.896  1.00 53.36           C  
ATOM   9337  C   TRP B 304      76.102  18.532  16.263  1.00 55.36           C  
ATOM   9338  O   TRP B 304      76.468  18.433  17.434  1.00 53.11           O  
ATOM   9339  CB  TRP B 304      75.208  20.723  15.490  1.00 51.91           C  
ATOM   9340  CG  TRP B 304      74.179  21.378  14.640  1.00 51.56           C  
ATOM   9341  CD1 TRP B 304      73.179  22.203  15.058  1.00 48.15           C  
ATOM   9342  CD2 TRP B 304      74.043  21.264  13.219  1.00 55.20           C  
ATOM   9343  NE1 TRP B 304      72.427  22.614  13.984  1.00 49.39           N  
ATOM   9344  CE2 TRP B 304      72.936  22.051  12.845  1.00 53.65           C  
ATOM   9345  CE3 TRP B 304      74.749  20.574  12.229  1.00 59.92           C  
ATOM   9346  CZ2 TRP B 304      72.520  22.167  11.519  1.00 56.56           C  
ATOM   9347  CZ3 TRP B 304      74.331  20.691  10.914  1.00 52.69           C  
ATOM   9348  CH2 TRP B 304      73.229  21.481  10.572  1.00 50.96           C  
ATOM   9349  N   ASN B 305      76.769  18.007  15.240  1.00 64.00           N  
ATOM   9350  CA  ASN B 305      78.001  17.252  15.417  1.00 68.66           C  
ATOM   9351  C   ASN B 305      79.201  17.985  14.819  1.00 60.17           C  
ATOM   9352  O   ASN B 305      79.572  17.754  13.668  1.00 66.55           O  
ATOM   9353  CB  ASN B 305      77.864  15.864  14.787  1.00 63.31           C  
ATOM   9354  CG  ASN B 305      78.985  14.931  15.183  1.00 65.56           C  
ATOM   9355  OD1 ASN B 305      79.564  15.060  16.263  1.00 61.98           O  
ATOM   9356  ND2 ASN B 305      79.302  13.981  14.311  1.00 70.09           N  
ATOM   9357  N   LEU B 306      79.797  18.872  15.611  1.00 57.14           N  
ATOM   9358  CA  LEU B 306      80.946  19.662  15.178  1.00 50.47           C  
ATOM   9359  C   LEU B 306      82.214  18.817  15.093  1.00 55.63           C  
ATOM   9360  O   LEU B 306      82.623  18.189  16.072  1.00 52.70           O  
ATOM   9361  CB  LEU B 306      81.167  20.839  16.129  1.00 56.85           C  
ATOM   9362  CG  LEU B 306      79.917  21.644  16.488  1.00 50.48           C  
ATOM   9363  CD1 LEU B 306      80.254  22.749  17.476  1.00 53.27           C  
ATOM   9364  CD2 LEU B 306      79.270  22.212  15.236  1.00 50.56           C  
ATOM   9365  N   GLY B 307      82.840  18.818  13.920  1.00 93.48           N  
ATOM   9366  CA  GLY B 307      84.007  17.992  13.674  1.00 94.57           C  
ATOM   9367  C   GLY B 307      85.312  18.559  14.201  1.00 99.85           C  
ATOM   9368  O   GLY B 307      86.201  18.899  13.417  1.00 95.31           O  
ATOM   9369  N   ASP B 308      85.419  18.650  15.526  1.00 80.88           N  
ATOM   9370  CA  ASP B 308      86.629  19.082  16.238  1.00 84.74           C  
ATOM   9371  C   ASP B 308      87.405  20.222  15.576  1.00 80.98           C  
ATOM   9372  O   ASP B 308      88.633  20.259  15.630  1.00 86.06           O  
ATOM   9373  CB  ASP B 308      87.571  17.889  16.449  1.00 86.55           C  
ATOM   9374  CG  ASP B 308      88.016  17.251  15.144  1.00 85.06           C  
ATOM   9375  OD1 ASP B 308      87.359  16.286  14.700  1.00 82.53           O  
ATOM   9376  OD2 ASP B 308      89.023  17.712  14.566  1.00 82.14           O  
ATOM   9377  N   HIS B 309      86.685  21.151  14.959  1.00 69.07           N  
ATOM   9378  CA  HIS B 309      87.314  22.280  14.285  1.00 68.98           C  
ATOM   9379  C   HIS B 309      87.643  23.391  15.275  1.00 74.98           C  
ATOM   9380  O   HIS B 309      88.771  23.892  15.317  1.00 78.18           O  
ATOM   9381  CB  HIS B 309      86.402  22.806  13.175  1.00 70.71           C  
ATOM   9382  CG  HIS B 309      86.903  24.054  12.520  1.00 72.81           C  
ATOM   9383  ND1 HIS B 309      88.128  24.127  11.894  1.00 78.56           N  
ATOM   9384  CD2 HIS B 309      86.342  25.280  12.390  1.00 73.67           C  
ATOM   9385  CE1 HIS B 309      88.302  25.343  11.408  1.00 78.59           C  
ATOM   9386  NE2 HIS B 309      87.232  26.063  11.696  1.00 76.49           N  
ATOM   9387  N   GLU B 310      86.655  23.762  16.082  1.00 84.22           N  
ATOM   9388  CA  GLU B 310      86.808  24.867  17.020  1.00 88.49           C  
ATOM   9389  C   GLU B 310      87.846  24.564  18.094  1.00 85.14           C  
ATOM   9390  O   GLU B 310      88.605  25.445  18.491  1.00 90.84           O  
ATOM   9391  CB  GLU B 310      85.465  25.204  17.669  1.00 88.31           C  
ATOM   9392  CG  GLU B 310      85.470  26.512  18.447  1.00 82.71           C  
ATOM   9393  CD  GLU B 310      85.735  27.718  17.561  1.00 86.47           C  
ATOM   9394  OE1 GLU B 310      85.374  27.675  16.366  1.00 81.96           O  
ATOM   9395  OE2 GLU B 310      86.306  28.711  18.059  1.00 92.33           O  
ATOM   9396  N   LEU B 311      87.881  23.321  18.564  1.00 50.34           N  
ATOM   9397  CA  LEU B 311      88.865  22.919  19.561  1.00 54.50           C  
ATOM   9398  C   LEU B 311      90.278  22.980  18.992  1.00 59.74           C  
ATOM   9399  O   LEU B 311      91.229  23.320  19.697  1.00 55.26           O  
ATOM   9400  CB  LEU B 311      88.571  21.511  20.084  1.00 51.27           C  
ATOM   9401  CG  LEU B 311      87.483  21.395  21.154  1.00 58.55           C  
ATOM   9402  CD1 LEU B 311      87.462  19.992  21.739  1.00 56.98           C  
ATOM   9403  CD2 LEU B 311      87.689  22.430  22.250  1.00 53.24           C  
ATOM   9404  N   LEU B 312      90.410  22.645  17.712  1.00 62.70           N  
ATOM   9405  CA  LEU B 312      91.693  22.734  17.030  1.00 66.85           C  
ATOM   9406  C   LEU B 312      92.108  24.188  16.844  1.00 61.92           C  
ATOM   9407  O   LEU B 312      93.295  24.515  16.890  1.00 66.96           O  
ATOM   9408  CB  LEU B 312      91.636  22.029  15.674  1.00 64.49           C  
ATOM   9409  CG  LEU B 312      92.291  20.649  15.604  1.00 63.60           C  
ATOM   9410  CD1 LEU B 312      91.703  19.723  16.654  1.00 69.30           C  
ATOM   9411  CD2 LEU B 312      92.134  20.059  14.211  1.00 62.01           C  
ATOM   9412  N   HIS B 313      91.127  25.059  16.636  1.00 64.72           N  
ATOM   9413  CA  HIS B 313      91.412  26.479  16.459  1.00 69.38           C  
ATOM   9414  C   HIS B 313      91.774  27.150  17.784  1.00 64.48           C  
ATOM   9415  O   HIS B 313      92.549  28.105  17.812  1.00 71.36           O  
ATOM   9416  CB  HIS B 313      90.216  27.190  15.819  1.00 65.53           C  
ATOM   9417  CG  HIS B 313      90.466  28.632  15.512  1.00 68.96           C  
ATOM   9418  ND1 HIS B 313      90.005  29.656  16.316  1.00 62.29           N  
ATOM   9419  CD2 HIS B 313      91.134  29.226  14.496  1.00 61.32           C  
ATOM   9420  CE1 HIS B 313      90.374  30.815  15.804  1.00 66.28           C  
ATOM   9421  NE2 HIS B 313      91.062  30.583  14.698  1.00 63.97           N  
ATOM   9422  N   MET B 314      91.216  26.642  18.877  1.00 63.22           N  
ATOM   9423  CA  MET B 314      91.453  27.218  20.199  1.00 67.60           C  
ATOM   9424  C   MET B 314      92.822  26.840  20.757  1.00 71.63           C  
ATOM   9425  O   MET B 314      93.432  27.613  21.494  1.00 77.31           O  
ATOM   9426  CB  MET B 314      90.359  26.786  21.178  1.00 64.43           C  
ATOM   9427  CG  MET B 314      89.008  27.446  20.939  1.00 62.29           C  
ATOM   9428  SD  MET B 314      87.742  26.901  22.103  1.00 69.17           S  
ATOM   9429  CE  MET B 314      88.497  27.363  23.660  1.00 65.99           C  
ATOM   9430  N   TYR B 315      93.296  25.648  20.411  1.00 66.66           N  
ATOM   9431  CA  TYR B 315      94.598  25.181  20.878  1.00 63.21           C  
ATOM   9432  C   TYR B 315      95.513  24.828  19.710  1.00 63.40           C  
ATOM   9433  O   TYR B 315      95.721  23.651  19.413  1.00 69.96           O  
ATOM   9434  CB  TYR B 315      94.433  23.967  21.796  1.00 60.50           C  
ATOM   9435  CG  TYR B 315      93.657  24.244  23.065  1.00 61.43           C  
ATOM   9436  CD1 TYR B 315      92.275  24.107  23.102  1.00 64.57           C  
ATOM   9437  CD2 TYR B 315      94.309  24.637  24.226  1.00 67.13           C  
ATOM   9438  CE1 TYR B 315      91.563  24.358  24.262  1.00 66.15           C  
ATOM   9439  CE2 TYR B 315      93.606  24.890  25.389  1.00 65.67           C  
ATOM   9440  CZ  TYR B 315      92.234  24.749  25.401  1.00 60.93           C  
ATOM   9441  OH  TYR B 315      91.529  24.998  26.556  1.00 63.96           O  
ATOM   9442  N   PRO B 316      96.071  25.850  19.046  1.00 66.89           N  
ATOM   9443  CA  PRO B 316      96.923  25.617  17.877  1.00 60.11           C  
ATOM   9444  C   PRO B 316      98.311  25.113  18.263  1.00 66.63           C  
ATOM   9445  O   PRO B 316      98.928  24.368  17.502  1.00 68.19           O  
ATOM   9446  CB  PRO B 316      97.004  26.999  17.231  1.00 63.88           C  
ATOM   9447  CG  PRO B 316      96.874  27.942  18.373  1.00 66.41           C  
ATOM   9448  CD  PRO B 316      95.944  27.285  19.359  1.00 60.40           C  
ATOM   9449  N   GLY B 317      98.787  25.515  19.437  1.00 89.22           N  
ATOM   9450  CA  GLY B 317     100.111  25.138  19.898  1.00 84.61           C  
ATOM   9451  C   GLY B 317     100.241  23.651  20.156  1.00 81.40           C  
ATOM   9452  O   GLY B 317     100.621  22.887  19.267  1.00 80.90           O  
ATOM   9453  N   ASN B 318      99.925  23.241  21.377  1.00 93.67           N  
ATOM   9454  CA  ASN B 318     100.003  21.837  21.752  1.00 90.22           C  
ATOM   9455  C   ASN B 318      98.647  21.150  21.647  1.00 90.72           C  
ATOM   9456  O   ASN B 318      97.734  21.436  22.420  1.00 91.14           O  
ATOM   9457  CB  ASN B 318     100.556  21.694  23.170  1.00 92.38           C  
ATOM   9458  CG  ASN B 318     101.943  22.288  23.317  1.00103.60           C  
ATOM   9459  OD1 ASN B 318     102.734  22.287  22.374  1.00104.72           O  
ATOM   9460  ND2 ASN B 318     102.245  22.800  24.506  1.00106.19           N  
ATOM   9461  N   VAL B 319      98.523  20.245  20.682  1.00 94.84           N  
ATOM   9462  CA  VAL B 319      97.298  19.476  20.504  1.00 87.51           C  
ATOM   9463  C   VAL B 319      97.335  18.220  21.366  1.00 85.21           C  
ATOM   9464  O   VAL B 319      96.411  17.408  21.341  1.00 89.44           O  
ATOM   9465  CB  VAL B 319      97.085  19.079  19.032  1.00 85.35           C  
ATOM   9466  CG1 VAL B 319      96.937  20.320  18.166  1.00 87.26           C  
ATOM   9467  CG2 VAL B 319      98.237  18.214  18.546  1.00 88.86           C  
ATOM   9468  N   SER B 320      98.414  18.070  22.125  1.00 85.39           N  
ATOM   9469  CA  SER B 320      98.592  16.913  22.993  1.00 85.73           C  
ATOM   9470  C   SER B 320      97.695  16.999  24.223  1.00 82.60           C  
ATOM   9471  O   SER B 320      97.315  15.978  24.797  1.00 80.33           O  
ATOM   9472  CB  SER B 320     100.057  16.786  23.417  1.00 83.90           C  
ATOM   9473  OG  SER B 320     100.253  15.651  24.239  1.00 84.62           O  
ATOM   9474  N   LYS B 321      97.356  18.220  24.620  1.00 60.30           N  
ATOM   9475  CA  LYS B 321      96.506  18.435  25.786  1.00 68.40           C  
ATOM   9476  C   LYS B 321      95.031  18.266  25.436  1.00 60.67           C  
ATOM   9477  O   LYS B 321      94.155  18.499  26.268  1.00 68.76           O  
ATOM   9478  CB  LYS B 321      96.749  19.825  26.382  1.00 63.01           C  
ATOM   9479  CG  LYS B 321      96.471  20.974  25.424  1.00 62.05           C  
ATOM   9480  CD  LYS B 321      96.420  22.309  26.155  1.00 66.08           C  
ATOM   9481  CE  LYS B 321      97.768  22.670  26.754  1.00 74.63           C  
ATOM   9482  NZ  LYS B 321      98.797  22.904  25.705  1.00 78.27           N  
ATOM   9483  N   LEU B 322      94.766  17.859  24.200  1.00 74.72           N  
ATOM   9484  CA  LEU B 322      93.399  17.666  23.729  1.00 68.47           C  
ATOM   9485  C   LEU B 322      93.066  16.188  23.548  1.00 63.66           C  
ATOM   9486  O   LEU B 322      91.898  15.816  23.450  1.00 68.39           O  
ATOM   9487  CB  LEU B 322      93.177  18.417  22.414  1.00 68.21           C  
ATOM   9488  CG  LEU B 322      92.575  19.823  22.496  1.00 69.51           C  
ATOM   9489  CD1 LEU B 322      93.366  20.711  23.440  1.00 75.90           C  
ATOM   9490  CD2 LEU B 322      92.499  20.448  21.110  1.00 69.60           C  
ATOM   9491  N   HIS B 323      94.099  15.352  23.505  1.00 71.05           N  
ATOM   9492  CA  HIS B 323      93.921  13.917  23.307  1.00 67.01           C  
ATOM   9493  C   HIS B 323      93.163  13.274  24.463  1.00 61.02           C  
ATOM   9494  O   HIS B 323      93.539  13.424  25.626  1.00 65.29           O  
ATOM   9495  CB  HIS B 323      95.277  13.229  23.125  1.00 69.50           C  
ATOM   9496  CG  HIS B 323      95.959  13.580  21.842  1.00 72.03           C  
ATOM   9497  ND1 HIS B 323      97.204  13.084  21.500  1.00 78.92           N  
ATOM   9498  CD2 HIS B 323      95.582  14.370  20.811  1.00 71.39           C  
ATOM   9499  CE1 HIS B 323      97.555  13.556  20.322  1.00 71.28           C  
ATOM   9500  NE2 HIS B 323      96.588  14.343  19.878  1.00 76.59           N  
ATOM   9501  N   GLY B 324      92.093  12.560  24.133  1.00 82.81           N  
ATOM   9502  CA  GLY B 324      91.295  11.873  25.131  1.00 79.25           C  
ATOM   9503  C   GLY B 324      91.309  10.372  24.922  1.00 76.32           C  
ATOM   9504  O   GLY B 324      91.162   9.898  23.797  1.00 74.58           O  
ATOM   9505  N   ARG B 325      91.476   9.623  26.008  1.00 88.47           N  
ATOM   9506  CA  ARG B 325      91.569   8.167  25.927  1.00 85.29           C  
ATOM   9507  C   ARG B 325      90.242   7.528  25.526  1.00 88.61           C  
ATOM   9508  O   ARG B 325      89.329   7.404  26.342  1.00 88.25           O  
ATOM   9509  CB  ARG B 325      92.039   7.583  27.261  1.00 89.14           C  
ATOM   9510  CG  ARG B 325      93.419   8.045  27.699  1.00 95.87           C  
ATOM   9511  CD  ARG B 325      94.036   7.065  28.687  1.00 95.28           C  
ATOM   9512  NE  ARG B 325      93.164   6.811  29.830  1.00 96.18           N  
ATOM   9513  CZ  ARG B 325      93.279   7.416  31.009  1.00 96.12           C  
ATOM   9514  NH1 ARG B 325      94.234   8.313  31.205  1.00 95.66           N  
ATOM   9515  NH2 ARG B 325      92.440   7.120  31.992  1.00 95.63           N  
ATOM   9516  N   ASP B 326      90.147   7.124  24.264  1.00 76.09           N  
ATOM   9517  CA  ASP B 326      88.962   6.443  23.756  1.00 72.90           C  
ATOM   9518  C   ASP B 326      88.834   5.062  24.388  1.00 73.00           C  
ATOM   9519  O   ASP B 326      87.729   4.548  24.574  1.00 69.66           O  
ATOM   9520  CB  ASP B 326      89.025   6.331  22.229  1.00 72.09           C  
ATOM   9521  CG  ASP B 326      87.799   5.661  21.640  1.00 68.65           C  
ATOM   9522  OD1 ASP B 326      87.922   5.036  20.565  1.00 69.70           O  
ATOM   9523  OD2 ASP B 326      86.712   5.759  22.247  1.00 65.15           O  
ATOM   9524  N   GLY B 327      89.974   4.468  24.722  1.00 69.21           N  
ATOM   9525  CA  GLY B 327      90.008   3.158  25.343  1.00 61.14           C  
ATOM   9526  C   GLY B 327      91.417   2.602  25.369  1.00 67.31           C  
ATOM   9527  O   GLY B 327      92.068   2.578  26.414  1.00 70.71           O  
ATOM   9528  N   ARG B 328      91.889   2.161  24.209  1.00124.96           N  
ATOM   9529  CA  ARG B 328      93.237   1.623  24.082  1.00121.75           C  
ATOM   9530  C   ARG B 328      94.127   2.618  23.348  1.00122.42           C  
ATOM   9531  O   ARG B 328      95.268   2.312  23.003  1.00126.33           O  
ATOM   9532  CB  ARG B 328      93.225   0.281  23.343  1.00129.01           C  
ATOM   9533  CG  ARG B 328      92.241  -0.745  23.893  1.00125.63           C  
ATOM   9534  CD  ARG B 328      90.895  -0.671  23.182  1.00121.75           C  
ATOM   9535  NE  ARG B 328      89.955  -1.673  23.675  1.00120.33           N  
ATOM   9536  CZ  ARG B 328      89.801  -2.880  23.141  1.00121.06           C  
ATOM   9537  NH1 ARG B 328      90.526  -3.239  22.090  1.00124.18           N  
ATOM   9538  NH2 ARG B 328      88.922  -3.728  23.655  1.00119.00           N  
ATOM   9539  N   LYS B 329      93.591   3.812  23.120  1.00 84.36           N  
ATOM   9540  CA  LYS B 329      94.283   4.832  22.342  1.00 86.24           C  
ATOM   9541  C   LYS B 329      93.680   6.209  22.596  1.00 83.49           C  
ATOM   9542  O   LYS B 329      92.487   6.332  22.874  1.00 76.89           O  
ATOM   9543  CB  LYS B 329      94.229   4.503  20.845  1.00 84.44           C  
ATOM   9544  CG  LYS B 329      92.819   4.415  20.258  1.00 78.41           C  
ATOM   9545  CD  LYS B 329      92.212   3.027  20.420  1.00 78.60           C  
ATOM   9546  CE  LYS B 329      90.754   3.002  19.993  1.00 72.90           C  
ATOM   9547  NZ  LYS B 329      90.120   1.678  20.250  1.00 72.16           N  
ATOM   9548  N   ASN B 330      94.510   7.242  22.504  1.00 73.49           N  
ATOM   9549  CA  ASN B 330      94.044   8.612  22.679  1.00 71.54           C  
ATOM   9550  C   ASN B 330      93.724   9.263  21.336  1.00 65.50           C  
ATOM   9551  O   ASN B 330      94.515   9.194  20.398  1.00 70.95           O  
ATOM   9552  CB  ASN B 330      95.085   9.439  23.437  1.00 72.68           C  
ATOM   9553  CG  ASN B 330      96.457   9.380  22.798  1.00 79.87           C  
ATOM   9554  OD1 ASN B 330      96.805   8.396  22.144  1.00 71.68           O  
ATOM   9555  ND2 ASN B 330      97.242  10.434  22.983  1.00 73.66           N  
ATOM   9556  N   VAL B 331      92.557   9.893  21.255  1.00 63.39           N  
ATOM   9557  CA  VAL B 331      92.083  10.469  20.003  1.00 60.79           C  
ATOM   9558  C   VAL B 331      91.610  11.907  20.207  1.00 68.84           C  
ATOM   9559  O   VAL B 331      91.342  12.329  21.334  1.00 68.32           O  
ATOM   9560  CB  VAL B 331      90.935   9.623  19.403  1.00 66.72           C  
ATOM   9561  CG1 VAL B 331      89.621   9.928  20.105  1.00 62.15           C  
ATOM   9562  CG2 VAL B 331      90.811   9.849  17.899  1.00 65.86           C  
ATOM   9563  N   VAL B 332      91.531  12.660  19.112  1.00 64.86           N  
ATOM   9564  CA  VAL B 332      90.979  14.008  19.139  1.00 62.98           C  
ATOM   9565  C   VAL B 332      89.453  13.947  19.195  1.00 68.85           C  
ATOM   9566  O   VAL B 332      88.813  13.365  18.318  1.00 65.50           O  
ATOM   9567  CB  VAL B 332      91.433  14.830  17.912  1.00 64.28           C  
ATOM   9568  CG1 VAL B 332      91.418  13.973  16.651  1.00 63.72           C  
ATOM   9569  CG2 VAL B 332      90.572  16.072  17.747  1.00 62.05           C  
ATOM   9570  N   PRO B 333      88.866  14.546  20.240  1.00 51.75           N  
ATOM   9571  CA  PRO B 333      87.426  14.459  20.507  1.00 56.78           C  
ATOM   9572  C   PRO B 333      86.567  15.229  19.511  1.00 54.07           C  
ATOM   9573  O   PRO B 333      86.795  16.414  19.274  1.00 55.30           O  
ATOM   9574  CB  PRO B 333      87.299  15.071  21.904  1.00 56.73           C  
ATOM   9575  CG  PRO B 333      88.430  16.028  21.986  1.00 51.24           C  
ATOM   9576  CD  PRO B 333      89.559  15.381  21.236  1.00 54.78           C  
ATOM   9577  N   CYS B 334      85.589  14.546  18.929  1.00 69.86           N  
ATOM   9578  CA  CYS B 334      84.567  15.196  18.121  1.00 70.47           C  
ATOM   9579  C   CYS B 334      83.569  15.875  19.056  1.00 64.25           C  
ATOM   9580  O   CYS B 334      83.170  15.299  20.070  1.00 63.11           O  
ATOM   9581  CB  CYS B 334      83.868  14.182  17.214  1.00 68.65           C  
ATOM   9582  SG  CYS B 334      82.755  14.895  15.983  1.00 68.47           S  
ATOM   9583  N   VAL B 335      83.168  17.097  18.718  1.00 56.57           N  
ATOM   9584  CA  VAL B 335      82.380  17.914  19.637  1.00 52.81           C  
ATOM   9585  C   VAL B 335      80.891  17.941  19.298  1.00 57.68           C  
ATOM   9586  O   VAL B 335      80.465  18.668  18.406  1.00 51.98           O  
ATOM   9587  CB  VAL B 335      82.902  19.363  19.668  1.00 53.36           C  
ATOM   9588  CG1 VAL B 335      82.225  20.146  20.779  1.00 50.93           C  
ATOM   9589  CG2 VAL B 335      84.410  19.379  19.849  1.00 53.02           C  
ATOM   9590  N   LEU B 336      80.104  17.152  20.022  1.00 57.38           N  
ATOM   9591  CA  LEU B 336      78.652  17.170  19.877  1.00 51.51           C  
ATOM   9592  C   LEU B 336      78.079  18.338  20.675  1.00 51.24           C  
ATOM   9593  O   LEU B 336      78.696  18.792  21.635  1.00 50.09           O  
ATOM   9594  CB  LEU B 336      78.049  15.846  20.348  1.00 59.82           C  
ATOM   9595  CG  LEU B 336      76.665  15.467  19.820  1.00 56.82           C  
ATOM   9596  CD1 LEU B 336      76.705  15.298  18.311  1.00 59.92           C  
ATOM   9597  CD2 LEU B 336      76.163  14.196  20.487  1.00 57.85           C  
ATOM   9598  N   SER B 337      76.908  18.831  20.281  1.00 48.08           N  
ATOM   9599  CA  SER B 337      76.310  19.970  20.977  1.00 44.18           C  
ATOM   9600  C   SER B 337      74.790  20.014  20.861  1.00 49.15           C  
ATOM   9601  O   SER B 337      74.236  19.899  19.771  1.00 49.17           O  
ATOM   9602  CB  SER B 337      76.893  21.278  20.444  1.00 46.97           C  
ATOM   9603  OG  SER B 337      76.230  22.392  21.016  1.00 44.30           O  
ATOM   9604  N   VAL B 338      74.122  20.196  21.996  1.00 57.98           N  
ATOM   9605  CA  VAL B 338      72.668  20.304  22.011  1.00 54.99           C  
ATOM   9606  C   VAL B 338      72.212  21.519  22.820  1.00 51.77           C  
ATOM   9607  O   VAL B 338      72.415  21.594  24.030  1.00 51.94           O  
ATOM   9608  CB  VAL B 338      72.013  19.024  22.575  1.00 56.37           C  
ATOM   9609  CG1 VAL B 338      72.772  18.511  23.792  1.00 56.32           C  
ATOM   9610  CG2 VAL B 338      70.548  19.273  22.901  1.00 53.22           C  
ATOM   9611  N   ASN B 339      71.598  22.476  22.134  1.00 54.27           N  
ATOM   9612  CA  ASN B 339      71.128  23.691  22.781  1.00 53.65           C  
ATOM   9613  C   ASN B 339      69.608  23.759  22.787  1.00 51.17           C  
ATOM   9614  O   ASN B 339      68.977  23.721  21.732  1.00 54.77           O  
ATOM   9615  CB  ASN B 339      71.713  24.921  22.086  1.00 57.11           C  
ATOM   9616  CG  ASN B 339      71.309  26.218  22.755  1.00 54.42           C  
ATOM   9617  OD1 ASN B 339      71.917  26.639  23.737  1.00 59.41           O  
ATOM   9618  ND2 ASN B 339      70.282  26.866  22.217  1.00 53.74           N  
ATOM   9619  N   GLY B 340      69.022  23.861  23.977  1.00 50.55           N  
ATOM   9620  CA  GLY B 340      67.576  23.872  24.110  1.00 51.63           C  
ATOM   9621  C   GLY B 340      67.008  25.153  24.689  1.00 52.51           C  
ATOM   9622  O   GLY B 340      67.255  25.485  25.848  1.00 57.24           O  
ATOM   9623  N   ASP B 341      66.243  25.872  23.876  1.00 52.79           N  
ATOM   9624  CA  ASP B 341      65.567  27.086  24.318  1.00 53.00           C  
ATOM   9625  C   ASP B 341      64.458  26.737  25.304  1.00 56.31           C  
ATOM   9626  O   ASP B 341      63.452  26.134  24.930  1.00 58.87           O  
ATOM   9627  CB  ASP B 341      64.998  27.849  23.118  1.00 55.09           C  
ATOM   9628  CG  ASP B 341      64.692  29.303  23.435  1.00 58.00           C  
ATOM   9629  OD1 ASP B 341      64.938  30.162  22.563  1.00 57.86           O  
ATOM   9630  OD2 ASP B 341      64.204  29.589  24.549  1.00 57.05           O  
ATOM   9631  N   LEU B 342      64.643  27.117  26.564  1.00 48.58           N  
ATOM   9632  CA  LEU B 342      63.678  26.780  27.603  1.00 40.02           C  
ATOM   9633  C   LEU B 342      62.537  27.789  27.701  1.00 40.16           C  
ATOM   9634  O   LEU B 342      61.513  27.513  28.323  1.00 40.77           O  
ATOM   9635  CB  LEU B 342      64.378  26.654  28.956  1.00 40.74           C  
ATOM   9636  CG  LEU B 342      65.285  25.432  29.101  1.00 40.30           C  
ATOM   9637  CD1 LEU B 342      65.760  25.284  30.534  1.00 40.17           C  
ATOM   9638  CD2 LEU B 342      64.566  24.174  28.641  1.00 46.97           C  
ATOM   9639  N   ASP B 343      62.713  28.959  27.095  1.00 50.43           N  
ATOM   9640  CA  ASP B 343      61.642  29.947  27.046  1.00 54.64           C  
ATOM   9641  C   ASP B 343      60.559  29.484  26.079  1.00 51.45           C  
ATOM   9642  O   ASP B 343      59.390  29.369  26.449  1.00 53.49           O  
ATOM   9643  CB  ASP B 343      62.174  31.323  26.639  1.00 53.22           C  
ATOM   9644  CG  ASP B 343      63.001  31.975  27.731  1.00 55.68           C  
ATOM   9645  OD1 ASP B 343      62.979  31.474  28.875  1.00 56.64           O  
ATOM   9646  OD2 ASP B 343      63.665  32.993  27.449  1.00 61.08           O  
ATOM   9647  N   ARG B 344      60.963  29.210  24.841  1.00 52.50           N  
ATOM   9648  CA  ARG B 344      60.049  28.690  23.828  1.00 50.47           C  
ATOM   9649  C   ARG B 344      59.449  27.363  24.267  1.00 51.75           C  
ATOM   9650  O   ARG B 344      58.330  27.025  23.889  1.00 50.10           O  
ATOM   9651  CB  ARG B 344      60.760  28.513  22.486  1.00 59.12           C  
ATOM   9652  CG  ARG B 344      61.146  29.809  21.797  1.00 51.48           C  
ATOM   9653  CD  ARG B 344      61.613  29.545  20.375  1.00 50.74           C  
ATOM   9654  NE  ARG B 344      62.018  30.771  19.694  1.00 58.52           N  
ATOM   9655  CZ  ARG B 344      62.424  30.825  18.429  1.00 58.91           C  
ATOM   9656  NH1 ARG B 344      62.478  29.720  17.697  1.00 51.08           N  
ATOM   9657  NH2 ARG B 344      62.774  31.987  17.893  1.00 50.23           N  
ATOM   9658  N   GLY B 345      60.203  26.609  25.062  1.00 52.68           N  
ATOM   9659  CA  GLY B 345      59.717  25.354  25.603  1.00 52.06           C  
ATOM   9660  C   GLY B 345      58.650  25.600  26.649  1.00 51.28           C  
ATOM   9661  O   GLY B 345      57.625  24.917  26.679  1.00 53.51           O  
ATOM   9662  N   MET B 346      58.896  26.582  27.508  1.00 55.90           N  
ATOM   9663  CA  MET B 346      57.945  26.955  28.546  1.00 50.53           C  
ATOM   9664  C   MET B 346      56.635  27.407  27.908  1.00 57.31           C  
ATOM   9665  O   MET B 346      55.551  27.021  28.351  1.00 50.77           O  
ATOM   9666  CB  MET B 346      58.529  28.055  29.437  1.00 58.51           C  
ATOM   9667  CG  MET B 346      57.754  28.311  30.717  1.00 52.80           C  
ATOM   9668  SD  MET B 346      56.464  29.556  30.530  1.00 53.14           S  
ATOM   9669  CE  MET B 346      57.449  31.022  30.238  1.00 51.81           C  
ATOM   9670  N   LEU B 347      56.746  28.213  26.855  1.00 52.78           N  
ATOM   9671  CA  LEU B 347      55.580  28.652  26.092  1.00 54.88           C  
ATOM   9672  C   LEU B 347      54.903  27.480  25.384  1.00 56.82           C  
ATOM   9673  O   LEU B 347      53.683  27.462  25.223  1.00 50.82           O  
ATOM   9674  CB  LEU B 347      55.974  29.721  25.069  1.00 54.52           C  
ATOM   9675  CG  LEU B 347      55.932  31.194  25.489  1.00 59.20           C  
ATOM   9676  CD1 LEU B 347      54.532  31.584  25.936  1.00 59.49           C  
ATOM   9677  CD2 LEU B 347      56.950  31.498  26.579  1.00 58.37           C  
ATOM   9678  N   ALA B 348      55.704  26.504  24.964  1.00 51.06           N  
ATOM   9679  CA  ALA B 348      55.193  25.336  24.254  1.00 53.20           C  
ATOM   9680  C   ALA B 348      54.326  24.481  25.169  1.00 55.57           C  
ATOM   9681  O   ALA B 348      53.243  24.043  24.784  1.00 59.06           O  
ATOM   9682  CB  ALA B 348      56.337  24.512  23.690  1.00 51.57           C  
ATOM   9683  N   TYR B 349      54.812  24.246  26.383  1.00 46.24           N  
ATOM   9684  CA  TYR B 349      54.045  23.510  27.379  1.00 49.80           C  
ATOM   9685  C   TYR B 349      52.849  24.329  27.839  1.00 41.86           C  
ATOM   9686  O   TYR B 349      51.796  23.783  28.171  1.00 45.94           O  
ATOM   9687  CB  TYR B 349      54.928  23.134  28.570  1.00 47.45           C  
ATOM   9688  CG  TYR B 349      55.826  21.949  28.301  1.00 44.83           C  
ATOM   9689  CD1 TYR B 349      55.511  21.026  27.312  1.00 47.30           C  
ATOM   9690  CD2 TYR B 349      56.986  21.750  29.034  1.00 44.15           C  
ATOM   9691  CE1 TYR B 349      56.324  19.942  27.062  1.00 46.17           C  
ATOM   9692  CE2 TYR B 349      57.805  20.667  28.790  1.00 42.49           C  
ATOM   9693  CZ  TYR B 349      57.470  19.768  27.803  1.00 42.11           C  
ATOM   9694  OH  TYR B 349      58.284  18.683  27.553  1.00 40.90           O  
ATOM   9695  N   LEU B 350      53.023  25.647  27.847  1.00 44.86           N  
ATOM   9696  CA  LEU B 350      51.955  26.556  28.235  1.00 51.14           C  
ATOM   9697  C   LEU B 350      50.800  26.500  27.240  1.00 51.64           C  
ATOM   9698  O   LEU B 350      49.638  26.636  27.620  1.00 51.18           O  
ATOM   9699  CB  LEU B 350      52.492  27.982  28.346  1.00 46.69           C  
ATOM   9700  CG  LEU B 350      51.610  28.975  29.104  1.00 46.01           C  
ATOM   9701  CD1 LEU B 350      51.264  28.422  30.474  1.00 52.10           C  
ATOM   9702  CD2 LEU B 350      52.317  30.312  29.225  1.00 47.44           C  
ATOM   9703  N   TYR B 351      51.125  26.303  25.966  1.00 59.35           N  
ATOM   9704  CA  TYR B 351      50.108  26.172  24.928  1.00 56.51           C  
ATOM   9705  C   TYR B 351      49.522  24.766  24.909  1.00 58.99           C  
ATOM   9706  O   TYR B 351      48.322  24.582  24.700  1.00 53.99           O  
ATOM   9707  CB  TYR B 351      50.688  26.509  23.554  1.00 55.40           C  
ATOM   9708  CG  TYR B 351      50.517  27.955  23.152  1.00 55.00           C  
ATOM   9709  CD1 TYR B 351      51.388  28.932  23.611  1.00 54.27           C  
ATOM   9710  CD2 TYR B 351      49.484  28.343  22.308  1.00 54.10           C  
ATOM   9711  CE1 TYR B 351      51.235  30.253  23.246  1.00 55.03           C  
ATOM   9712  CE2 TYR B 351      49.323  29.662  21.937  1.00 52.59           C  
ATOM   9713  CZ  TYR B 351      50.203  30.613  22.409  1.00 55.23           C  
ATOM   9714  OH  TYR B 351      50.049  31.930  22.042  1.00 58.79           O  
ATOM   9715  N   ASP B 352      50.381  23.777  25.129  1.00 57.46           N  
ATOM   9716  CA  ASP B 352      49.968  22.381  25.111  1.00 50.74           C  
ATOM   9717  C   ASP B 352      49.007  22.071  26.252  1.00 52.08           C  
ATOM   9718  O   ASP B 352      48.126  21.224  26.120  1.00 54.87           O  
ATOM   9719  CB  ASP B 352      51.189  21.463  25.188  1.00 59.86           C  
ATOM   9720  CG  ASP B 352      50.815  19.998  25.255  1.00 53.89           C  
ATOM   9721  OD1 ASP B 352      50.643  19.377  24.184  1.00 56.06           O  
ATOM   9722  OD2 ASP B 352      50.692  19.467  26.379  1.00 51.68           O  
ATOM   9723  N   SER B 353      49.181  22.767  27.370  1.00 63.76           N  
ATOM   9724  CA  SER B 353      48.353  22.546  28.552  1.00 60.43           C  
ATOM   9725  C   SER B 353      46.902  22.948  28.322  1.00 61.65           C  
ATOM   9726  O   SER B 353      45.992  22.386  28.929  1.00 60.25           O  
ATOM   9727  CB  SER B 353      48.911  23.321  29.743  1.00 55.46           C  
ATOM   9728  OG  SER B 353      48.904  24.715  29.488  1.00 55.46           O  
ATOM   9729  N   PHE B 354      46.693  23.925  27.446  1.00 61.21           N  
ATOM   9730  CA  PHE B 354      45.356  24.445  27.188  1.00 63.62           C  
ATOM   9731  C   PHE B 354      44.651  23.658  26.086  1.00 67.17           C  
ATOM   9732  O   PHE B 354      45.280  23.216  25.125  1.00 68.93           O  
ATOM   9733  CB  PHE B 354      45.429  25.927  26.816  1.00 61.75           C  
ATOM   9734  CG  PHE B 354      44.088  26.597  26.731  1.00 66.45           C  
ATOM   9735  CD1 PHE B 354      43.442  27.030  27.877  1.00 66.79           C  
ATOM   9736  CD2 PHE B 354      43.478  26.799  25.505  1.00 70.24           C  
ATOM   9737  CE1 PHE B 354      42.209  27.647  27.803  1.00 71.78           C  
ATOM   9738  CE2 PHE B 354      42.245  27.416  25.423  1.00 75.69           C  
ATOM   9739  CZ  PHE B 354      41.610  27.841  26.574  1.00 77.15           C  
ATOM   9740  N   GLN B 355      43.341  23.488  26.237  1.00 95.63           N  
ATOM   9741  CA  GLN B 355      42.543  22.752  25.263  1.00 97.64           C  
ATOM   9742  C   GLN B 355      42.454  23.506  23.940  1.00 90.40           C  
ATOM   9743  O   GLN B 355      42.218  22.910  22.890  1.00 93.03           O  
ATOM   9744  CB  GLN B 355      41.139  22.488  25.813  1.00 91.59           C  
ATOM   9745  CG  GLN B 355      41.117  21.694  27.111  1.00 94.12           C  
ATOM   9746  CD  GLN B 355      41.597  20.266  26.935  1.00 92.62           C  
ATOM   9747  OE1 GLN B 355      41.538  19.710  25.838  1.00 92.38           O  
ATOM   9748  NE2 GLN B 355      42.075  19.665  28.017  1.00 97.21           N  
ATOM   9749  N   THR B 362      38.381  19.075  20.721  1.00 97.68           N  
ATOM   9750  CA  THR B 362      37.824  20.413  20.869  1.00101.80           C  
ATOM   9751  C   THR B 362      36.522  20.560  20.085  1.00107.67           C  
ATOM   9752  O   THR B 362      36.269  21.593  19.464  1.00101.51           O  
ATOM   9753  CB  THR B 362      38.827  21.492  20.409  1.00103.45           C  
ATOM   9754  OG1 THR B 362      38.167  22.763  20.340  1.00106.97           O  
ATOM   9755  CG2 THR B 362      39.401  21.147  19.042  1.00105.05           C  
ATOM   9756  N   ARG B 363      35.695  19.519  20.127  1.00 99.39           N  
ATOM   9757  CA  ARG B 363      34.422  19.522  19.415  1.00 94.14           C  
ATOM   9758  C   ARG B 363      33.410  18.610  20.107  1.00 97.63           C  
ATOM   9759  O   ARG B 363      33.787  17.628  20.748  1.00 99.36           O  
ATOM   9760  CB  ARG B 363      34.631  19.100  17.956  1.00 97.03           C  
ATOM   9761  CG  ARG B 363      33.407  19.228  17.053  1.00104.30           C  
ATOM   9762  CD  ARG B 363      32.690  20.561  17.235  1.00101.24           C  
ATOM   9763  NE  ARG B 363      33.591  21.706  17.146  1.00109.70           N  
ATOM   9764  CZ  ARG B 363      33.537  22.761  17.956  1.00102.50           C  
ATOM   9765  NH1 ARG B 363      32.624  22.813  18.917  1.00104.63           N  
ATOM   9766  NH2 ARG B 363      34.395  23.760  17.808  1.00101.04           N  
ATOM   9767  N   LYS B 364      32.128  18.950  19.954  1.00 95.84           N  
ATOM   9768  CA  LYS B 364      30.985  18.272  20.582  1.00 97.78           C  
ATOM   9769  C   LYS B 364      31.250  17.785  22.010  1.00 91.67           C  
ATOM   9770  O   LYS B 364      30.854  16.683  22.389  1.00 98.21           O  
ATOM   9771  CB  LYS B 364      30.494  17.106  19.700  1.00 99.33           C  
ATOM   9772  CG  LYS B 364      31.548  16.130  19.178  1.00 92.58           C  
ATOM   9773  CD  LYS B 364      31.589  14.868  20.014  1.00 96.70           C  
ATOM   9774  CE  LYS B 364      30.199  14.271  20.152  1.00 91.30           C  
ATOM   9775  NZ  LYS B 364      30.121  13.333  21.300  1.00 96.14           N  
ATOM   9776  N   LYS B 365      31.899  18.633  22.802  1.00 98.09           N  
ATOM   9777  CA  LYS B 365      32.158  18.337  24.207  1.00 93.07           C  
ATOM   9778  C   LYS B 365      30.941  18.674  25.065  1.00 99.32           C  
ATOM   9779  O   LYS B 365      30.851  18.252  26.219  1.00 94.81           O  
ATOM   9780  CB  LYS B 365      33.383  19.107  24.709  1.00 93.62           C  
ATOM   9781  CG  LYS B 365      33.105  20.552  25.120  1.00 99.53           C  
ATOM   9782  CD  LYS B 365      32.848  21.467  23.927  1.00105.89           C  
ATOM   9783  CE  LYS B 365      34.135  22.073  23.382  1.00103.83           C  
ATOM   9784  NZ  LYS B 365      35.070  21.057  22.823  1.00 97.07           N  
ATOM   9785  N   ASN B 366      30.027  19.458  24.493  1.00 97.11           N  
ATOM   9786  CA  ASN B 366      28.756  19.832  25.124  1.00 99.20           C  
ATOM   9787  C   ASN B 366      28.879  20.704  26.378  1.00100.55           C  
ATOM   9788  O   ASN B 366      27.899  21.310  26.811  1.00103.75           O  
ATOM   9789  CB  ASN B 366      27.946  18.574  25.460  1.00 98.68           C  
ATOM   9790  CG  ASN B 366      27.642  17.732  24.237  1.00 97.18           C  
ATOM   9791  OD1 ASN B 366      28.280  17.876  23.195  1.00100.24           O  
ATOM   9792  ND2 ASN B 366      26.661  16.845  24.360  1.00 98.33           N  
ATOM   9793  N   LEU B 367      30.075  20.769  26.957  1.00 99.63           N  
ATOM   9794  CA  LEU B 367      30.312  21.589  28.142  1.00 94.80           C  
ATOM   9795  C   LEU B 367      31.805  21.861  28.304  1.00 91.92           C  
ATOM   9796  O   LEU B 367      32.609  20.931  28.369  1.00 93.68           O  
ATOM   9797  CB  LEU B 367      29.758  20.906  29.394  1.00 93.79           C  
ATOM   9798  CG  LEU B 367      29.598  21.790  30.633  1.00 93.90           C  
ATOM   9799  CD1 LEU B 367      28.593  22.903  30.366  1.00 90.86           C  
ATOM   9800  CD2 LEU B 367      29.178  20.963  31.837  1.00 96.56           C  
ATOM   9801  N   HIS B 368      32.172  23.138  28.370  1.00 94.81           N  
ATOM   9802  CA  HIS B 368      33.578  23.519  28.396  1.00 93.85           C  
ATOM   9803  C   HIS B 368      33.956  24.286  29.662  1.00 91.07           C  
ATOM   9804  O   HIS B 368      33.163  25.067  30.189  1.00 98.58           O  
ATOM   9805  CB  HIS B 368      33.916  24.360  27.164  1.00 97.56           C  
ATOM   9806  CG  HIS B 368      35.170  23.936  26.465  1.00 95.06           C  
ATOM   9807  ND1 HIS B 368      35.918  22.851  26.872  1.00 95.85           N  
ATOM   9808  CD2 HIS B 368      35.807  24.447  25.385  1.00 97.06           C  
ATOM   9809  CE1 HIS B 368      36.961  22.713  26.073  1.00 95.23           C  
ATOM   9810  NE2 HIS B 368      36.917  23.669  25.163  1.00 92.20           N  
ATOM   9811  N   ARG B 369      35.175  24.054  30.141  1.00 62.41           N  
ATOM   9812  CA  ARG B 369      35.709  24.775  31.292  1.00 60.04           C  
ATOM   9813  C   ARG B 369      37.135  25.232  31.015  1.00 68.28           C  
ATOM   9814  O   ARG B 369      37.906  24.526  30.363  1.00 65.43           O  
ATOM   9815  CB  ARG B 369      35.664  23.904  32.550  1.00 63.49           C  
ATOM   9816  CG  ARG B 369      36.366  22.561  32.409  1.00 67.70           C  
ATOM   9817  CD  ARG B 369      36.254  21.739  33.687  1.00 61.85           C  
ATOM   9818  NE  ARG B 369      37.246  22.120  34.688  1.00 57.49           N  
ATOM   9819  CZ  ARG B 369      38.398  21.485  34.876  1.00 52.34           C  
ATOM   9820  NH1 ARG B 369      38.710  20.435  34.129  1.00 51.11           N  
ATOM   9821  NH2 ARG B 369      39.244  21.900  35.811  1.00 58.88           N  
ATOM   9822  N   LYS B 370      37.483  26.416  31.506  1.00 74.06           N  
ATOM   9823  CA  LYS B 370      38.813  26.969  31.281  1.00 72.22           C  
ATOM   9824  C   LYS B 370      39.827  26.417  32.279  1.00 60.83           C  
ATOM   9825  O   LYS B 370      39.752  26.694  33.477  1.00 69.80           O  
ATOM   9826  CB  LYS B 370      38.778  28.499  31.351  1.00 78.22           C  
ATOM   9827  CG  LYS B 370      37.899  29.063  32.456  1.00 72.14           C  
ATOM   9828  CD  LYS B 370      38.016  30.578  32.534  1.00 79.37           C  
ATOM   9829  CE  LYS B 370      37.709  31.232  31.195  1.00 82.95           C  
ATOM   9830  NZ  LYS B 370      37.891  32.709  31.242  1.00 85.89           N  
ATOM   9831  N   VAL B 371      40.770  25.629  31.770  1.00 57.05           N  
ATOM   9832  CA  VAL B 371      41.824  25.050  32.595  1.00 51.92           C  
ATOM   9833  C   VAL B 371      43.000  24.593  31.732  1.00 51.51           C  
ATOM   9834  O   VAL B 371      42.817  23.921  30.715  1.00 53.65           O  
ATOM   9835  CB  VAL B 371      41.300  23.857  33.432  1.00 58.71           C  
ATOM   9836  CG1 VAL B 371      40.553  22.861  32.552  1.00 50.69           C  
ATOM   9837  CG2 VAL B 371      42.439  23.177  34.177  1.00 53.94           C  
ATOM   9838  N   LEU B 372      44.207  24.982  32.129  1.00 58.37           N  
ATOM   9839  CA  LEU B 372      45.412  24.523  31.450  1.00 58.04           C  
ATOM   9840  C   LEU B 372      46.025  23.348  32.202  1.00 53.75           C  
ATOM   9841  O   LEU B 372      46.359  23.452  33.382  1.00 50.45           O  
ATOM   9842  CB  LEU B 372      46.431  25.657  31.301  1.00 59.01           C  
ATOM   9843  CG  LEU B 372      46.271  26.943  32.117  1.00 59.05           C  
ATOM   9844  CD1 LEU B 372      46.554  26.708  33.590  1.00 54.67           C  
ATOM   9845  CD2 LEU B 372      47.176  28.035  31.567  1.00 61.41           C  
ATOM   9846  N   LYS B 373      46.163  22.223  31.507  1.00 64.49           N  
ATOM   9847  CA  LYS B 373      46.625  20.989  32.127  1.00 61.32           C  
ATOM   9848  C   LYS B 373      48.132  20.799  31.989  1.00 60.32           C  
ATOM   9849  O   LYS B 373      48.597  20.084  31.102  1.00 69.62           O  
ATOM   9850  CB  LYS B 373      45.894  19.790  31.523  1.00 61.42           C  
ATOM   9851  CG  LYS B 373      44.386  19.842  31.684  1.00 64.15           C  
ATOM   9852  CD  LYS B 373      43.720  18.672  30.980  1.00 65.27           C  
ATOM   9853  CE  LYS B 373      42.214  18.703  31.172  1.00 69.57           C  
ATOM   9854  NZ  LYS B 373      41.830  18.549  32.603  1.00 65.53           N  
ATOM   9855  N   LEU B 374      48.890  21.441  32.870  1.00 54.47           N  
ATOM   9856  CA  LEU B 374      50.334  21.256  32.902  1.00 52.84           C  
ATOM   9857  C   LEU B 374      50.681  19.975  33.646  1.00 58.75           C  
ATOM   9858  O   LEU B 374      49.926  19.528  34.510  1.00 56.34           O  
ATOM   9859  CB  LEU B 374      51.026  22.453  33.560  1.00 52.69           C  
ATOM   9860  CG  LEU B 374      51.136  23.741  32.742  1.00 57.23           C  
ATOM   9861  CD1 LEU B 374      51.632  24.881  33.614  1.00 57.09           C  
ATOM   9862  CD2 LEU B 374      52.061  23.540  31.552  1.00 59.45           C  
ATOM   9863  N   HIS B 375      51.820  19.384  33.301  1.00 51.22           N  
ATOM   9864  CA  HIS B 375      52.285  18.175  33.967  1.00 58.29           C  
ATOM   9865  C   HIS B 375      52.584  18.474  35.432  1.00 55.05           C  
ATOM   9866  O   HIS B 375      53.194  19.494  35.747  1.00 55.38           O  
ATOM   9867  CB  HIS B 375      53.525  17.618  33.265  1.00 59.78           C  
ATOM   9868  CG  HIS B 375      53.848  16.204  33.636  1.00 58.38           C  
ATOM   9869  ND1 HIS B 375      54.708  15.882  34.664  1.00 56.18           N  
ATOM   9870  CD2 HIS B 375      53.425  15.028  33.116  1.00 59.57           C  
ATOM   9871  CE1 HIS B 375      54.802  14.569  34.760  1.00 56.16           C  
ATOM   9872  NE2 HIS B 375      54.034  14.026  33.832  1.00 58.17           N  
ATOM   9873  N   PRO B 376      52.146  17.582  36.335  1.00 56.74           N  
ATOM   9874  CA  PRO B 376      52.287  17.751  37.788  1.00 54.15           C  
ATOM   9875  C   PRO B 376      53.727  17.949  38.267  1.00 53.94           C  
ATOM   9876  O   PRO B 376      53.928  18.383  39.401  1.00 52.83           O  
ATOM   9877  CB  PRO B 376      51.707  16.444  38.352  1.00 52.34           C  
ATOM   9878  CG  PRO B 376      51.679  15.493  37.202  1.00 54.06           C  
ATOM   9879  CD  PRO B 376      51.436  16.337  36.000  1.00 56.74           C  
ATOM   9880  N   CYS B 377      54.706  17.640  37.422  1.00 69.53           N  
ATOM   9881  CA  CYS B 377      56.110  17.813  37.786  1.00 67.92           C  
ATOM   9882  C   CYS B 377      56.577  19.256  37.620  1.00 67.99           C  
ATOM   9883  O   CYS B 377      57.225  19.812  38.507  1.00 72.96           O  
ATOM   9884  CB  CYS B 377      57.000  16.889  36.951  1.00 68.18           C  
ATOM   9885  SG  CYS B 377      57.206  15.229  37.628  1.00 69.62           S  
ATOM   9886  N   LEU B 378      56.248  19.860  36.483  1.00 45.24           N  
ATOM   9887  CA  LEU B 378      56.718  21.207  36.182  1.00 46.87           C  
ATOM   9888  C   LEU B 378      55.689  22.281  36.531  1.00 46.56           C  
ATOM   9889  O   LEU B 378      55.929  23.467  36.314  1.00 48.89           O  
ATOM   9890  CB  LEU B 378      57.117  21.314  34.704  1.00 50.84           C  
ATOM   9891  CG  LEU B 378      56.252  20.637  33.634  1.00 52.69           C  
ATOM   9892  CD1 LEU B 378      54.960  21.400  33.379  1.00 52.79           C  
ATOM   9893  CD2 LEU B 378      57.040  20.471  32.344  1.00 57.06           C  
ATOM   9894  N   ALA B 379      54.551  21.864  37.080  1.00 52.83           N  
ATOM   9895  CA  ALA B 379      53.500  22.797  37.476  1.00 53.64           C  
ATOM   9896  C   ALA B 379      54.005  23.781  38.530  1.00 54.83           C  
ATOM   9897  O   ALA B 379      54.642  23.376  39.501  1.00 53.15           O  
ATOM   9898  CB  ALA B 379      52.289  22.042  37.993  1.00 51.57           C  
ATOM   9899  N   PRO B 380      53.719  25.079  38.334  1.00 53.97           N  
ATOM   9900  CA  PRO B 380      54.193  26.151  39.219  1.00 55.41           C  
ATOM   9901  C   PRO B 380      53.756  25.965  40.669  1.00 53.82           C  
ATOM   9902  O   PRO B 380      54.605  25.848  41.551  1.00 52.75           O  
ATOM   9903  CB  PRO B 380      53.559  27.412  38.613  1.00 59.58           C  
ATOM   9904  CG  PRO B 380      52.439  26.919  37.765  1.00 60.01           C  
ATOM   9905  CD  PRO B 380      52.886  25.598  37.239  1.00 57.03           C  
ATOM   9906  N   ILE B 381      52.450  25.935  40.910  1.00 56.01           N  
ATOM   9907  CA  ILE B 381      51.936  25.714  42.257  1.00 54.89           C  
ATOM   9908  C   ILE B 381      51.246  24.360  42.350  1.00 51.53           C  
ATOM   9909  O   ILE B 381      50.287  24.090  41.628  1.00 51.68           O  
ATOM   9910  CB  ILE B 381      50.957  26.820  42.678  1.00 58.61           C  
ATOM   9911  CG1 ILE B 381      51.668  28.174  42.699  1.00 62.11           C  
ATOM   9912  CG2 ILE B 381      50.361  26.512  44.044  1.00 57.78           C  
ATOM   9913  CD1 ILE B 381      50.795  29.317  43.175  1.00 66.57           C  
ATOM   9914  N   LYS B 382      51.740  23.515  43.249  1.00 54.19           N  
ATOM   9915  CA  LYS B 382      51.240  22.151  43.382  1.00 56.45           C  
ATOM   9916  C   LYS B 382      49.850  22.108  44.006  1.00 55.29           C  
ATOM   9917  O   LYS B 382      48.874  21.758  43.343  1.00 57.76           O  
ATOM   9918  CB  LYS B 382      52.210  21.311  44.212  1.00 55.77           C  
ATOM   9919  CG  LYS B 382      53.648  21.364  43.724  1.00 54.88           C  
ATOM   9920  CD  LYS B 382      53.763  20.917  42.276  1.00 57.86           C  
ATOM   9921  CE  LYS B 382      55.200  21.005  41.791  1.00 57.78           C  
ATOM   9922  NZ  LYS B 382      55.335  20.592  40.368  1.00 56.79           N  
ATOM   9923  N   VAL B 383      49.764  22.461  45.283  1.00 41.57           N  
ATOM   9924  CA  VAL B 383      48.501  22.405  46.008  1.00 41.86           C  
ATOM   9925  C   VAL B 383      48.067  23.808  46.434  1.00 44.44           C  
ATOM   9926  O   VAL B 383      48.864  24.744  46.415  1.00 45.54           O  
ATOM   9927  CB  VAL B 383      48.609  21.482  47.246  1.00 49.93           C  
ATOM   9928  CG1 VAL B 383      49.211  22.230  48.424  1.00 40.57           C  
ATOM   9929  CG2 VAL B 383      47.251  20.898  47.609  1.00 49.93           C  
ATOM   9930  N   ALA B 384      46.798  23.951  46.804  1.00 59.54           N  
ATOM   9931  CA  ALA B 384      46.268  25.237  47.243  1.00 52.89           C  
ATOM   9932  C   ALA B 384      45.458  25.091  48.528  1.00 53.63           C  
ATOM   9933  O   ALA B 384      44.393  24.473  48.533  1.00 53.69           O  
ATOM   9934  CB  ALA B 384      45.416  25.857  46.148  1.00 55.63           C  
ATOM   9935  N   LEU B 385      45.968  25.665  49.612  1.00 62.68           N  
ATOM   9936  CA  LEU B 385      45.314  25.576  50.913  1.00 63.68           C  
ATOM   9937  C   LEU B 385      44.389  26.765  51.159  1.00 69.53           C  
ATOM   9938  O   LEU B 385      44.767  27.913  50.931  1.00 66.28           O  
ATOM   9939  CB  LEU B 385      46.358  25.481  52.026  1.00 64.13           C  
ATOM   9940  CG  LEU B 385      45.822  25.376  53.455  1.00 67.17           C  
ATOM   9941  CD1 LEU B 385      44.901  24.176  53.591  1.00 63.47           C  
ATOM   9942  CD2 LEU B 385      46.967  25.295  54.453  1.00 66.00           C  
ATOM   9943  N   ASP B 386      43.178  26.481  51.628  1.00 70.23           N  
ATOM   9944  CA  ASP B 386      42.199  27.531  51.898  1.00 74.50           C  
ATOM   9945  C   ASP B 386      41.458  27.301  53.209  1.00 74.56           C  
ATOM   9946  O   ASP B 386      41.752  26.359  53.948  1.00 70.76           O  
ATOM   9947  CB  ASP B 386      41.193  27.632  50.750  1.00 75.20           C  
ATOM   9948  CG  ASP B 386      41.825  28.118  49.462  1.00 75.63           C  
ATOM   9949  OD1 ASP B 386      42.309  27.270  48.682  1.00 72.64           O  
ATOM   9950  OD2 ASP B 386      41.836  29.344  49.228  1.00 79.91           O  
ATOM   9951  N   VAL B 387      40.494  28.172  53.486  1.00 81.51           N  
ATOM   9952  CA  VAL B 387      39.687  28.080  54.696  1.00 82.52           C  
ATOM   9953  C   VAL B 387      38.200  28.095  54.361  1.00 81.49           C  
ATOM   9954  O   VAL B 387      37.704  29.031  53.733  1.00 85.57           O  
ATOM   9955  CB  VAL B 387      39.998  29.234  55.668  1.00 89.01           C  
ATOM   9956  CG1 VAL B 387      38.951  29.302  56.770  1.00 80.82           C  
ATOM   9957  CG2 VAL B 387      41.396  29.078  56.252  1.00 86.79           C  
ATOM   9958  N   GLY B 388      37.491  27.052  54.782  1.00104.35           N  
ATOM   9959  CA  GLY B 388      36.066  26.950  54.531  1.00106.22           C  
ATOM   9960  C   GLY B 388      35.258  26.860  55.810  1.00107.10           C  
ATOM   9961  O   GLY B 388      35.681  26.222  56.772  1.00105.71           O  
ATOM   9962  N   ARG B 389      34.094  27.504  55.812  1.00 92.58           N  
ATOM   9963  CA  ARG B 389      33.178  27.506  56.955  1.00 96.30           C  
ATOM   9964  C   ARG B 389      33.869  27.823  58.284  1.00 97.64           C  
ATOM   9965  O   ARG B 389      34.074  26.930  59.105  1.00 95.35           O  
ATOM   9966  CB  ARG B 389      32.464  26.155  57.065  1.00 92.73           C  
ATOM   9967  CG  ARG B 389      31.838  25.646  55.770  1.00 93.18           C  
ATOM   9968  CD  ARG B 389      30.722  26.554  55.269  1.00 97.63           C  
ATOM   9969  NE  ARG B 389      31.218  27.604  54.385  1.00 98.79           N  
ATOM   9970  CZ  ARG B 389      30.447  28.507  53.789  1.00 93.41           C  
ATOM   9971  NH1 ARG B 389      29.135  28.492  53.981  1.00 96.58           N  
ATOM   9972  NH2 ARG B 389      30.987  29.426  53.001  1.00 96.57           N  
ATOM   9973  N   GLY B 390      34.225  29.087  58.501  1.00 87.23           N  
ATOM   9974  CA  GLY B 390      33.978  30.151  57.544  1.00 80.24           C  
ATOM   9975  C   GLY B 390      32.753  30.978  57.883  1.00 83.94           C  
ATOM   9976  O   GLY B 390      31.692  30.785  57.289  1.00 84.91           O  
ATOM   9977  N   PRO B 391      32.889  31.909  58.841  1.00133.37           N  
ATOM   9978  CA  PRO B 391      34.117  32.158  59.605  1.00136.57           C  
ATOM   9979  C   PRO B 391      34.259  31.227  60.808  1.00132.91           C  
ATOM   9980  O   PRO B 391      33.257  30.838  61.407  1.00134.30           O  
ATOM   9981  CB  PRO B 391      33.950  33.608  60.055  1.00432.85           C  
ATOM   9982  CG  PRO B 391      32.475  33.763  60.216  1.00436.96           C  
ATOM   9983  CD  PRO B 391      31.838  32.893  59.158  1.00432.36           C  
ATOM   9984  N   THR B 392      35.494  30.876  61.151  1.00 96.98           N  
ATOM   9985  CA  THR B 392      35.753  30.016  62.301  1.00 98.04           C  
ATOM   9986  C   THR B 392      37.015  30.450  63.039  1.00 96.63           C  
ATOM   9987  O   THR B 392      38.116  30.414  62.486  1.00 98.73           O  
ATOM   9988  CB  THR B 392      35.888  28.540  61.886  1.00 90.64           C  
ATOM   9989  OG1 THR B 392      34.679  28.107  61.252  1.00 89.48           O  
ATOM   9990  CG2 THR B 392      36.153  27.668  63.103  1.00 86.72           C  
ATOM   9991  N   LEU B 393      36.844  30.858  64.291  1.00133.88           N  
ATOM   9992  CA  LEU B 393      37.944  31.356  65.108  1.00135.50           C  
ATOM   9993  C   LEU B 393      38.029  30.585  66.427  1.00134.37           C  
ATOM   9994  O   LEU B 393      37.002  30.210  66.992  1.00133.69           O  
ATOM   9995  CB  LEU B 393      37.773  32.856  65.380  1.00133.49           C  
ATOM   9996  CG  LEU B 393      37.851  33.832  64.199  1.00133.31           C  
ATOM   9997  CD1 LEU B 393      38.977  33.455  63.245  1.00131.13           C  
ATOM   9998  CD2 LEU B 393      36.520  33.948  63.461  1.00135.87           C  
ATOM   9999  N   GLU B 394      39.245  30.346  66.919  1.00101.62           N  
ATOM  10000  CA  GLU B 394      40.468  30.793  66.261  1.00 99.20           C  
ATOM  10001  C   GLU B 394      41.534  29.702  66.270  1.00 97.20           C  
ATOM  10002  O   GLU B 394      42.710  29.972  66.513  1.00 97.33           O  
ATOM  10003  CB  GLU B 394      41.006  32.056  66.936  1.00104.48           C  
ATOM  10004  CG  GLU B 394      41.464  33.131  65.963  1.00108.49           C  
ATOM  10005  CD  GLU B 394      42.486  32.622  64.967  1.00105.60           C  
ATOM  10006  OE1 GLU B 394      42.129  32.444  63.784  1.00103.84           O  
ATOM  10007  OE2 GLU B 394      43.648  32.400  65.368  1.00105.85           O  
ATOM  10008  N   LEU B 395      41.116  28.467  66.011  1.00 83.13           N  
ATOM  10009  CA  LEU B 395      42.052  27.356  65.899  1.00 87.61           C  
ATOM  10010  C   LEU B 395      42.448  27.153  64.441  1.00 85.85           C  
ATOM  10011  O   LEU B 395      42.687  26.029  64.001  1.00 80.94           O  
ATOM  10012  CB  LEU B 395      41.447  26.074  66.474  1.00 86.05           C  
ATOM  10013  CG  LEU B 395      41.230  26.039  67.989  1.00 80.31           C  
ATOM  10014  CD1 LEU B 395      40.584  24.728  68.410  1.00 84.89           C  
ATOM  10015  CD2 LEU B 395      42.545  26.251  68.725  1.00 87.03           C  
ATOM  10016  N   ARG B 396      42.518  28.254  63.700  1.00 83.25           N  
ATOM  10017  CA  ARG B 396      42.867  28.215  62.286  1.00 88.33           C  
ATOM  10018  C   ARG B 396      44.381  28.271  62.102  1.00 88.51           C  
ATOM  10019  O   ARG B 396      44.879  28.374  60.981  1.00 87.37           O  
ATOM  10020  CB  ARG B 396      42.194  29.368  61.538  1.00 81.22           C  
ATOM  10021  CG  ARG B 396      41.943  29.105  60.059  1.00 87.93           C  
ATOM  10022  CD  ARG B 396      40.600  28.422  59.813  1.00 87.52           C  
ATOM  10023  NE  ARG B 396      40.569  27.032  60.260  1.00 83.64           N  
ATOM  10024  CZ  ARG B 396      39.987  26.620  61.381  1.00 86.58           C  
ATOM  10025  NH1 ARG B 396      40.006  25.336  61.708  1.00 83.48           N  
ATOM  10026  NH2 ARG B 396      39.386  27.493  62.179  1.00 81.13           N  
ATOM  10027  N   GLN B 397      45.105  28.198  63.214  1.00 99.26           N  
ATOM  10028  CA  GLN B 397      46.561  28.183  63.185  1.00 96.98           C  
ATOM  10029  C   GLN B 397      47.076  26.846  62.665  1.00 91.40           C  
ATOM  10030  O   GLN B 397      48.263  26.696  62.373  1.00 98.73           O  
ATOM  10031  CB  GLN B 397      47.128  28.462  64.578  1.00 99.89           C  
ATOM  10032  CG  GLN B 397      46.645  27.498  65.647  1.00 90.25           C  
ATOM  10033  CD  GLN B 397      47.216  27.816  67.013  1.00 93.40           C  
ATOM  10034  OE1 GLN B 397      48.094  28.668  67.149  1.00 94.76           O  
ATOM  10035  NE2 GLN B 397      46.717  27.133  68.038  1.00 94.75           N  
ATOM  10036  N   VAL B 398      46.172  25.878  62.555  1.00 83.35           N  
ATOM  10037  CA  VAL B 398      46.499  24.569  62.004  1.00 78.93           C  
ATOM  10038  C   VAL B 398      46.862  24.702  60.523  1.00 74.50           C  
ATOM  10039  O   VAL B 398      47.687  23.948  60.003  1.00 71.07           O  
ATOM  10040  CB  VAL B 398      45.326  23.575  62.187  1.00 79.58           C  
ATOM  10041  CG1 VAL B 398      44.043  24.130  61.578  1.00 80.87           C  
ATOM  10042  CG2 VAL B 398      45.666  22.211  61.603  1.00 75.53           C  
ATOM  10043  N   CYS B 399      46.254  25.680  59.857  1.00 60.03           N  
ATOM  10044  CA  CYS B 399      46.549  25.958  58.456  1.00 66.61           C  
ATOM  10045  C   CYS B 399      48.015  26.334  58.286  1.00 65.19           C  
ATOM  10046  O   CYS B 399      48.656  25.948  57.310  1.00 61.70           O  
ATOM  10047  CB  CYS B 399      45.648  27.074  57.925  1.00 68.85           C  
ATOM  10048  SG  CYS B 399      43.882  26.686  57.938  1.00 61.28           S  
ATOM  10049  N   GLN B 400      48.540  27.088  59.247  1.00 85.84           N  
ATOM  10050  CA  GLN B 400      49.952  27.450  59.255  1.00 87.53           C  
ATOM  10051  C   GLN B 400      50.816  26.204  59.405  1.00 82.72           C  
ATOM  10052  O   GLN B 400      51.851  26.069  58.746  1.00 82.91           O  
ATOM  10053  CB  GLN B 400      50.247  28.443  60.382  1.00 91.54           C  
ATOM  10054  CG  GLN B 400      51.700  28.885  60.468  1.00 86.60           C  
ATOM  10055  CD  GLN B 400      52.116  29.766  59.306  1.00 88.94           C  
ATOM  10056  OE1 GLN B 400      51.279  30.386  58.650  1.00 92.11           O  
ATOM  10057  NE2 GLN B 400      53.418  29.828  59.045  1.00 90.45           N  
ATOM  10058  N   GLY B 401      50.376  25.296  60.272  1.00 68.35           N  
ATOM  10059  CA  GLY B 401      51.062  24.036  60.492  1.00 65.01           C  
ATOM  10060  C   GLY B 401      51.172  23.220  59.222  1.00 62.55           C  
ATOM  10061  O   GLY B 401      52.261  22.781  58.841  1.00 60.38           O  
ATOM  10062  N   LEU B 402      50.036  23.023  58.558  1.00 63.34           N  
ATOM  10063  CA  LEU B 402      49.996  22.299  57.295  1.00 59.97           C  
ATOM  10064  C   LEU B 402      50.818  23.016  56.229  1.00 58.64           C  
ATOM  10065  O   LEU B 402      51.406  22.384  55.350  1.00 55.86           O  
ATOM  10066  CB  LEU B 402      48.550  22.131  56.822  1.00 59.31           C  
ATOM  10067  CG  LEU B 402      48.334  21.296  55.556  1.00 56.25           C  
ATOM  10068  CD1 LEU B 402      48.748  19.852  55.791  1.00 55.51           C  
ATOM  10069  CD2 LEU B 402      46.887  21.375  55.095  1.00 56.69           C  
ATOM  10070  N   PHE B 403      50.860  24.342  56.322  1.00 69.63           N  
ATOM  10071  CA  PHE B 403      51.614  25.162  55.381  1.00 67.76           C  
ATOM  10072  C   PHE B 403      53.113  24.897  55.488  1.00 69.28           C  
ATOM  10073  O   PHE B 403      53.759  24.537  54.496  1.00 67.58           O  
ATOM  10074  CB  PHE B 403      51.320  26.646  55.620  1.00 71.25           C  
ATOM  10075  CG  PHE B 403      51.957  27.564  54.616  1.00 74.26           C  
ATOM  10076  CD1 PHE B 403      51.491  27.616  53.314  1.00 70.40           C  
ATOM  10077  CD2 PHE B 403      53.008  28.390  54.980  1.00 76.41           C  
ATOM  10078  CE1 PHE B 403      52.069  28.464  52.388  1.00 71.43           C  
ATOM  10079  CE2 PHE B 403      53.590  29.243  54.059  1.00 76.45           C  
ATOM  10080  CZ  PHE B 403      53.120  29.280  52.762  1.00 74.63           C  
ATOM  10081  N   ASN B 404      53.664  25.064  56.687  1.00 99.90           N  
ATOM  10082  CA  ASN B 404      55.094  24.847  56.872  1.00 99.47           C  
ATOM  10083  C   ASN B 404      55.461  23.380  56.669  1.00 97.85           C  
ATOM  10084  O   ASN B 404      56.528  23.073  56.139  1.00 97.99           O  
ATOM  10085  CB  ASN B 404      55.561  25.337  58.252  1.00 91.24           C  
ATOM  10086  CG  ASN B 404      55.003  24.514  59.395  1.00 96.23           C  
ATOM  10087  OD1 ASN B 404      54.005  24.882  60.007  1.00 96.52           O  
ATOM  10088  ND2 ASN B 404      55.662  23.403  59.705  1.00 93.49           N  
ATOM  10089  N   GLU B 405      54.567  22.479  57.075  1.00 61.90           N  
ATOM  10090  CA  GLU B 405      54.782  21.053  56.853  1.00 69.03           C  
ATOM  10091  C   GLU B 405      54.883  20.757  55.362  1.00 66.50           C  
ATOM  10092  O   GLU B 405      55.712  19.956  54.932  1.00 66.30           O  
ATOM  10093  CB  GLU B 405      53.656  20.222  57.472  1.00 68.72           C  
ATOM  10094  CG  GLU B 405      53.808  18.721  57.258  1.00 69.48           C  
ATOM  10095  CD  GLU B 405      52.564  17.942  57.634  1.00 69.00           C  
ATOM  10096  OE1 GLU B 405      52.622  16.693  57.644  1.00 61.73           O  
ATOM  10097  OE2 GLU B 405      51.526  18.574  57.915  1.00 60.56           O  
ATOM  10098  N   LEU B 406      54.036  21.417  54.578  1.00 54.49           N  
ATOM  10099  CA  LEU B 406      54.028  21.226  53.134  1.00 51.04           C  
ATOM  10100  C   LEU B 406      55.286  21.791  52.480  1.00 53.16           C  
ATOM  10101  O   LEU B 406      55.943  21.104  51.700  1.00 53.03           O  
ATOM  10102  CB  LEU B 406      52.782  21.867  52.516  1.00 50.41           C  
ATOM  10103  CG  LEU B 406      51.653  20.908  52.134  1.00 58.72           C  
ATOM  10104  CD1 LEU B 406      51.415  19.879  53.227  1.00 50.81           C  
ATOM  10105  CD2 LEU B 406      50.378  21.682  51.842  1.00 51.20           C  
ATOM  10106  N   LEU B 407      55.630  23.036  52.801  1.00 83.67           N  
ATOM  10107  CA  LEU B 407      56.799  23.652  52.178  1.00 84.74           C  
ATOM  10108  C   LEU B 407      58.099  22.977  52.616  1.00 88.12           C  
ATOM  10109  O   LEU B 407      59.102  23.039  51.905  1.00 88.83           O  
ATOM  10110  CB  LEU B 407      56.851  25.156  52.477  1.00 86.58           C  
ATOM  10111  CG  LEU B 407      56.819  25.692  53.911  1.00 81.03           C  
ATOM  10112  CD1 LEU B 407      58.160  25.563  54.624  1.00 82.59           C  
ATOM  10113  CD2 LEU B 407      56.357  27.139  53.915  1.00 82.49           C  
ATOM  10114  N   GLU B 408      58.081  22.336  53.781  1.00 78.71           N  
ATOM  10115  CA  GLU B 408      59.254  21.613  54.262  1.00 77.43           C  
ATOM  10116  C   GLU B 408      59.588  20.433  53.356  1.00 79.94           C  
ATOM  10117  O   GLU B 408      60.754  20.070  53.202  1.00 70.60           O  
ATOM  10118  CB  GLU B 408      59.044  21.126  55.696  1.00 79.17           C  
ATOM  10119  CG  GLU B 408      59.463  22.126  56.761  1.00 70.24           C  
ATOM  10120  CD  GLU B 408      59.253  21.602  58.168  1.00 72.16           C  
ATOM  10121  OE1 GLU B 408      58.646  20.520  58.317  1.00 71.64           O  
ATOM  10122  OE2 GLU B 408      59.697  22.269  59.126  1.00 74.39           O  
ATOM  10123  N   ASN B 409      58.561  19.838  52.759  1.00 50.60           N  
ATOM  10124  CA  ASN B 409      58.757  18.713  51.853  1.00 59.43           C  
ATOM  10125  C   ASN B 409      58.983  19.170  50.416  1.00 51.71           C  
ATOM  10126  O   ASN B 409      59.165  18.352  49.514  1.00 51.82           O  
ATOM  10127  CB  ASN B 409      57.564  17.759  51.923  1.00 51.26           C  
ATOM  10128  CG  ASN B 409      57.497  17.012  53.241  1.00 51.68           C  
ATOM  10129  OD1 ASN B 409      56.876  17.471  54.198  1.00 50.77           O  
ATOM  10130  ND2 ASN B 409      58.146  15.853  53.297  1.00 52.76           N  
ATOM  10131  N   GLY B 410      58.967  20.484  50.209  1.00 54.03           N  
ATOM  10132  CA  GLY B 410      59.322  21.063  48.926  1.00 52.23           C  
ATOM  10133  C   GLY B 410      58.211  21.083  47.894  1.00 50.28           C  
ATOM  10134  O   GLY B 410      58.475  21.071  46.693  1.00 51.13           O  
ATOM  10135  N   ILE B 411      56.966  21.115  48.356  1.00 56.97           N  
ATOM  10136  CA  ILE B 411      55.834  21.208  47.444  1.00 54.90           C  
ATOM  10137  C   ILE B 411      55.170  22.578  47.548  1.00 54.77           C  
ATOM  10138  O   ILE B 411      54.875  23.059  48.644  1.00 55.47           O  
ATOM  10139  CB  ILE B 411      54.798  20.094  47.707  1.00 53.62           C  
ATOM  10140  CG1 ILE B 411      54.461  20.008  49.195  1.00 54.21           C  
ATOM  10141  CG2 ILE B 411      55.327  18.755  47.220  1.00 54.05           C  
ATOM  10142  CD1 ILE B 411      53.537  18.865  49.549  1.00 53.61           C  
ATOM  10143  N   SER B 412      54.952  23.204  46.396  1.00 53.58           N  
ATOM  10144  CA  SER B 412      54.385  24.547  46.336  1.00 53.71           C  
ATOM  10145  C   SER B 412      52.944  24.570  46.832  1.00 53.87           C  
ATOM  10146  O   SER B 412      52.111  23.780  46.387  1.00 50.40           O  
ATOM  10147  CB  SER B 412      54.457  25.093  44.908  1.00 51.60           C  
ATOM  10148  OG  SER B 412      55.799  25.193  44.467  1.00 55.16           O  
ATOM  10149  N   VAL B 413      52.660  25.483  47.755  1.00 54.28           N  
ATOM  10150  CA  VAL B 413      51.321  25.610  48.321  1.00 56.67           C  
ATOM  10151  C   VAL B 413      50.857  27.065  48.349  1.00 50.98           C  
ATOM  10152  O   VAL B 413      51.506  27.928  48.942  1.00 52.99           O  
ATOM  10153  CB  VAL B 413      51.258  25.021  49.750  1.00 56.94           C  
ATOM  10154  CG1 VAL B 413      52.503  25.396  50.545  1.00 58.41           C  
ATOM  10155  CG2 VAL B 413      49.989  25.471  50.463  1.00 58.37           C  
ATOM  10156  N   TRP B 414      49.733  27.331  47.693  1.00 63.89           N  
ATOM  10157  CA  TRP B 414      49.157  28.672  47.665  1.00 68.45           C  
ATOM  10158  C   TRP B 414      48.296  28.915  48.900  1.00 63.36           C  
ATOM  10159  O   TRP B 414      47.432  28.103  49.226  1.00 61.24           O  
ATOM  10160  CB  TRP B 414      48.331  28.872  46.392  1.00 61.11           C  
ATOM  10161  CG  TRP B 414      47.598  30.180  46.341  1.00 66.80           C  
ATOM  10162  CD1 TRP B 414      46.319  30.419  46.751  1.00 61.13           C  
ATOM  10163  CD2 TRP B 414      48.100  31.428  45.846  1.00 62.33           C  
ATOM  10164  NE1 TRP B 414      45.994  31.739  46.545  1.00 67.75           N  
ATOM  10165  CE2 TRP B 414      47.070  32.378  45.991  1.00 68.44           C  
ATOM  10166  CE3 TRP B 414      49.321  31.833  45.298  1.00 61.42           C  
ATOM  10167  CZ2 TRP B 414      47.224  33.710  45.606  1.00 72.11           C  
ATOM  10168  CZ3 TRP B 414      49.471  33.155  44.915  1.00 63.02           C  
ATOM  10169  CH2 TRP B 414      48.429  34.077  45.072  1.00 70.05           C  
ATOM  10170  N   PRO B 415      48.528  30.042  49.591  1.00 64.32           N  
ATOM  10171  CA  PRO B 415      47.819  30.348  50.834  1.00 68.11           C  
ATOM  10172  C   PRO B 415      46.523  31.123  50.606  1.00 63.34           C  
ATOM  10173  O   PRO B 415      46.556  32.260  50.132  1.00 67.50           O  
ATOM  10174  CB  PRO B 415      48.834  31.194  51.607  1.00 60.13           C  
ATOM  10175  CG  PRO B 415      49.768  31.769  50.545  1.00 69.00           C  
ATOM  10176  CD  PRO B 415      49.457  31.120  49.219  1.00 65.88           C  
ATOM  10177  N   GLY B 416      45.397  30.506  50.942  1.00 60.23           N  
ATOM  10178  CA  GLY B 416      44.106  31.154  50.821  1.00 64.37           C  
ATOM  10179  C   GLY B 416      43.586  31.612  52.169  1.00 68.71           C  
ATOM  10180  O   GLY B 416      42.538  31.161  52.629  1.00 60.65           O  
ATOM  10181  N   TYR B 417      44.329  32.510  52.807  1.00 89.86           N  
ATOM  10182  CA  TYR B 417      43.952  33.023  54.119  1.00 81.45           C  
ATOM  10183  C   TYR B 417      43.261  34.373  53.993  1.00 88.82           C  
ATOM  10184  O   TYR B 417      42.033  34.453  54.000  1.00 87.56           O  
ATOM  10185  CB  TYR B 417      45.179  33.140  55.022  1.00 84.21           C  
ATOM  10186  CG  TYR B 417      45.914  31.835  55.219  1.00 88.74           C  
ATOM  10187  CD1 TYR B 417      45.242  30.621  55.142  1.00 82.60           C  
ATOM  10188  CD2 TYR B 417      47.278  31.814  55.473  1.00 87.34           C  
ATOM  10189  CE1 TYR B 417      45.908  29.426  55.317  1.00 78.19           C  
ATOM  10190  CE2 TYR B 417      47.953  30.622  55.650  1.00 83.03           C  
ATOM  10191  CZ  TYR B 417      47.262  29.432  55.573  1.00 77.41           C  
ATOM  10192  OH  TYR B 417      47.931  28.243  55.747  1.00 71.48           O  
ATOM  10193  N   LEU B 418      44.056  35.433  53.881  1.00 91.99           N  
ATOM  10194  CA  LEU B 418      43.510  36.767  53.667  1.00 97.56           C  
ATOM  10195  C   LEU B 418      42.867  36.837  52.289  1.00 95.04           C  
ATOM  10196  O   LEU B 418      43.548  36.744  51.268  1.00 92.87           O  
ATOM  10197  CB  LEU B 418      44.593  37.838  53.811  1.00 91.88           C  
ATOM  10198  CG  LEU B 418      45.184  38.055  55.207  1.00 92.15           C  
ATOM  10199  CD1 LEU B 418      46.367  37.127  55.465  1.00 90.40           C  
ATOM  10200  CD2 LEU B 418      45.581  39.510  55.404  1.00100.31           C  
ATOM  10201  N   GLU B 419      41.548  36.998  52.268  1.00 97.63           N  
ATOM  10202  CA  GLU B 419      40.796  36.950  51.022  1.00 94.99           C  
ATOM  10203  C   GLU B 419      39.666  37.971  50.994  1.00 90.13           C  
ATOM  10204  O   GLU B 419      39.112  38.332  52.033  1.00 95.65           O  
ATOM  10205  CB  GLU B 419      40.234  35.543  50.805  1.00 90.95           C  
ATOM  10206  CG  GLU B 419      39.383  35.043  51.963  1.00 89.28           C  
ATOM  10207  CD  GLU B 419      38.979  33.590  51.810  1.00 86.38           C  
ATOM  10208  OE1 GLU B 419      38.219  33.091  52.666  1.00 86.62           O  
ATOM  10209  OE2 GLU B 419      39.423  32.946  50.837  1.00 89.41           O  
ATOM  10210  N   THR B 420      39.332  38.434  49.794  1.00114.16           N  
ATOM  10211  CA  THR B 420      38.204  39.335  49.604  1.00118.51           C  
ATOM  10212  C   THR B 420      36.971  38.535  49.194  1.00118.39           C  
ATOM  10213  O   THR B 420      35.851  39.045  49.209  1.00112.80           O  
ATOM  10214  CB  THR B 420      38.505  40.410  48.542  1.00111.40           C  
ATOM  10215  OG1 THR B 420      37.367  41.264  48.384  1.00115.69           O  
ATOM  10216  CG2 THR B 420      38.841  39.762  47.206  1.00118.14           C  
ATOM  10217  N   MET B 421      37.195  37.277  48.829  1.00109.36           N  
ATOM  10218  CA  MET B 421      36.115  36.375  48.447  1.00108.62           C  
ATOM  10219  C   MET B 421      36.106  35.142  49.359  1.00100.89           C  
ATOM  10220  O   MET B 421      37.119  34.446  49.420  1.00108.71           O  
ATOM  10221  CB  MET B 421      36.258  35.956  46.984  1.00106.76           C  
ATOM  10222  CG  MET B 421      36.237  37.113  45.996  1.00110.24           C  
ATOM  10223  SD  MET B 421      34.723  38.093  46.083  1.00114.72           S  
ATOM  10224  CE  MET B 421      35.000  39.266  44.757  1.00119.16           C  
ATOM  10225  N   GLN B 422      35.010  34.834  50.069  1.00121.51           N  
ATOM  10226  CA  GLN B 422      33.695  35.506  50.068  1.00129.22           C  
ATOM  10227  C   GLN B 422      33.052  35.581  48.678  1.00120.57           C  
ATOM  10228  O   GLN B 422      32.681  36.656  48.204  1.00126.84           O  
ATOM  10229  CB  GLN B 422      33.788  36.909  50.698  1.00124.30           C  
ATOM  10230  CG  GLN B 422      32.468  37.452  51.230  1.00129.25           C  
ATOM  10231  CD  GLN B 422      32.610  38.835  51.837  1.00135.52           C  
ATOM  10232  OE1 GLN B 422      33.695  39.417  51.837  1.00136.76           O  
ATOM  10233  NE2 GLN B 422      31.510  39.368  52.360  1.00132.08           N  
ATOM  10234  N   SER B 423      32.932  34.421  48.037  1.00111.69           N  
ATOM  10235  CA  SER B 423      32.282  34.302  46.735  1.00112.05           C  
ATOM  10236  C   SER B 423      31.934  32.847  46.449  1.00117.90           C  
ATOM  10237  O   SER B 423      32.125  31.976  47.299  1.00114.54           O  
ATOM  10238  CB  SER B 423      33.175  34.854  45.622  1.00113.24           C  
ATOM  10239  OG  SER B 423      32.583  34.664  44.348  1.00114.50           O  
ATOM  10240  N   SER B 424      31.423  32.586  45.251  1.00106.33           N  
ATOM  10241  CA  SER B 424      31.107  31.225  44.835  1.00106.41           C  
ATOM  10242  C   SER B 424      32.382  30.396  44.742  1.00107.24           C  
ATOM  10243  O   SER B 424      33.429  30.902  44.345  1.00105.01           O  
ATOM  10244  CB  SER B 424      30.375  31.223  43.492  1.00109.76           C  
ATOM  10245  OG  SER B 424      29.154  31.935  43.576  1.00104.56           O  
ATOM  10246  N   LEU B 425      32.287  29.124  45.114  1.00 80.70           N  
ATOM  10247  CA  LEU B 425      33.437  28.227  45.087  1.00 72.70           C  
ATOM  10248  C   LEU B 425      33.940  28.018  43.664  1.00 71.94           C  
ATOM  10249  O   LEU B 425      35.125  27.768  43.445  1.00 76.53           O  
ATOM  10250  CB  LEU B 425      33.093  26.879  45.725  1.00 79.32           C  
ATOM  10251  CG  LEU B 425      33.018  26.810  47.254  1.00 78.04           C  
ATOM  10252  CD1 LEU B 425      34.245  27.456  47.885  1.00 74.44           C  
ATOM  10253  CD2 LEU B 425      31.735  27.434  47.791  1.00 75.26           C  
ATOM  10254  N   GLU B 426      33.030  28.127  42.700  1.00 81.47           N  
ATOM  10255  CA  GLU B 426      33.377  27.995  41.289  1.00 89.94           C  
ATOM  10256  C   GLU B 426      34.378  29.070  40.865  1.00 83.88           C  
ATOM  10257  O   GLU B 426      35.210  28.843  39.987  1.00 83.65           O  
ATOM  10258  CB  GLU B 426      32.115  28.073  40.423  1.00 89.26           C  
ATOM  10259  CG  GLU B 426      32.350  27.858  38.935  1.00 91.19           C  
ATOM  10260  CD  GLU B 426      31.078  28.001  38.115  1.00 97.29           C  
ATOM  10261  OE1 GLU B 426      30.016  28.282  38.707  1.00 91.36           O  
ATOM  10262  OE2 GLU B 426      31.141  27.829  36.879  1.00 90.55           O  
ATOM  10263  N   GLN B 427      34.296  30.233  41.506  1.00 85.28           N  
ATOM  10264  CA  GLN B 427      35.179  31.352  41.190  1.00 85.59           C  
ATOM  10265  C   GLN B 427      36.641  31.030  41.484  1.00 81.70           C  
ATOM  10266  O   GLN B 427      37.495  31.158  40.606  1.00 81.92           O  
ATOM  10267  CB  GLN B 427      34.758  32.602  41.968  1.00 90.99           C  
ATOM  10268  CG  GLN B 427      35.670  33.803  41.759  1.00 93.28           C  
ATOM  10269  CD  GLN B 427      35.635  34.328  40.335  1.00 98.25           C  
ATOM  10270  OE1 GLN B 427      34.650  34.153  39.619  1.00 90.13           O  
ATOM  10271  NE2 GLN B 427      36.717  34.977  39.918  1.00 98.89           N  
ATOM  10272  N   LEU B 428      36.930  30.614  42.714  1.00 84.18           N  
ATOM  10273  CA  LEU B 428      38.305  30.311  43.097  1.00 80.27           C  
ATOM  10274  C   LEU B 428      38.741  28.934  42.596  1.00 73.76           C  
ATOM  10275  O   LEU B 428      39.937  28.655  42.496  1.00 70.13           O  
ATOM  10276  CB  LEU B 428      38.502  30.422  44.621  1.00 78.16           C  
ATOM  10277  CG  LEU B 428      37.603  29.816  45.714  1.00 76.64           C  
ATOM  10278  CD1 LEU B 428      36.242  30.504  45.797  1.00 82.10           C  
ATOM  10279  CD2 LEU B 428      37.449  28.301  45.592  1.00 72.34           C  
ATOM  10280  N   TYR B 429      37.776  28.076  42.278  1.00 63.53           N  
ATOM  10281  CA  TYR B 429      38.093  26.800  41.649  1.00 62.34           C  
ATOM  10282  C   TYR B 429      38.614  27.041  40.238  1.00 63.65           C  
ATOM  10283  O   TYR B 429      39.638  26.488  39.843  1.00 68.42           O  
ATOM  10284  CB  TYR B 429      36.874  25.875  41.620  1.00 62.75           C  
ATOM  10285  CG  TYR B 429      36.651  25.113  42.907  1.00 60.21           C  
ATOM  10286  CD1 TYR B 429      35.430  24.504  43.174  1.00 62.02           C  
ATOM  10287  CD2 TYR B 429      37.660  24.999  43.854  1.00 63.97           C  
ATOM  10288  CE1 TYR B 429      35.223  23.804  44.351  1.00 69.13           C  
ATOM  10289  CE2 TYR B 429      37.461  24.301  45.032  1.00 61.11           C  
ATOM  10290  CZ  TYR B 429      36.240  23.705  45.276  1.00 64.82           C  
ATOM  10291  OH  TYR B 429      36.041  23.010  46.447  1.00 63.39           O  
ATOM  10292  N   SER B 430      37.905  27.877  39.484  1.00 55.08           N  
ATOM  10293  CA  SER B 430      38.348  28.260  38.149  1.00 57.52           C  
ATOM  10294  C   SER B 430      39.623  29.087  38.233  1.00 56.97           C  
ATOM  10295  O   SER B 430      40.472  29.033  37.345  1.00 56.93           O  
ATOM  10296  CB  SER B 430      37.258  29.046  37.417  1.00 64.68           C  
ATOM  10297  OG  SER B 430      37.717  29.495  36.154  1.00 68.27           O  
ATOM  10298  N   LYS B 431      39.749  29.850  39.315  1.00 70.33           N  
ATOM  10299  CA  LYS B 431      40.940  30.651  39.564  1.00 69.29           C  
ATOM  10300  C   LYS B 431      42.155  29.755  39.794  1.00 63.05           C  
ATOM  10301  O   LYS B 431      43.277  30.114  39.440  1.00 63.62           O  
ATOM  10302  CB  LYS B 431      40.717  31.575  40.763  1.00 70.71           C  
ATOM  10303  CG  LYS B 431      41.919  32.411  41.162  1.00 71.60           C  
ATOM  10304  CD  LYS B 431      41.558  33.393  42.262  1.00 74.31           C  
ATOM  10305  CE  LYS B 431      42.759  34.218  42.687  1.00 75.49           C  
ATOM  10306  NZ  LYS B 431      43.827  33.365  43.276  1.00 71.43           N  
ATOM  10307  N   TYR B 432      41.922  28.584  40.377  1.00 50.17           N  
ATOM  10308  CA  TYR B 432      43.002  27.634  40.630  1.00 51.67           C  
ATOM  10309  C   TYR B 432      43.272  26.757  39.411  1.00 50.08           C  
ATOM  10310  O   TYR B 432      44.386  26.266  39.226  1.00 54.93           O  
ATOM  10311  CB  TYR B 432      42.678  26.764  41.848  1.00 57.86           C  
ATOM  10312  CG  TYR B 432      42.687  27.519  43.158  1.00 58.62           C  
ATOM  10313  CD1 TYR B 432      43.308  28.757  43.267  1.00 58.38           C  
ATOM  10314  CD2 TYR B 432      42.072  26.994  44.287  1.00 59.26           C  
ATOM  10315  CE1 TYR B 432      43.318  29.450  44.463  1.00 55.42           C  
ATOM  10316  CE2 TYR B 432      42.076  27.680  45.487  1.00 59.94           C  
ATOM  10317  CZ  TYR B 432      42.701  28.907  45.569  1.00 56.51           C  
ATOM  10318  OH  TYR B 432      42.708  29.593  46.762  1.00 56.73           O  
ATOM  10319  N   ASP B 433      42.252  26.563  38.582  1.00 56.18           N  
ATOM  10320  CA  ASP B 433      42.400  25.777  37.361  1.00 54.83           C  
ATOM  10321  C   ASP B 433      43.063  26.596  36.261  1.00 57.45           C  
ATOM  10322  O   ASP B 433      43.639  26.044  35.322  1.00 55.49           O  
ATOM  10323  CB  ASP B 433      41.045  25.256  36.886  1.00 57.58           C  
ATOM  10324  CG  ASP B 433      40.414  24.294  37.870  1.00 54.94           C  
ATOM  10325  OD1 ASP B 433      41.159  23.686  38.666  1.00 50.12           O  
ATOM  10326  OD2 ASP B 433      39.175  24.149  37.848  1.00 58.22           O  
ATOM  10327  N   GLU B 434      42.975  27.917  36.381  1.00 50.73           N  
ATOM  10328  CA  GLU B 434      43.664  28.817  35.465  1.00 52.15           C  
ATOM  10329  C   GLU B 434      45.129  28.952  35.862  1.00 59.19           C  
ATOM  10330  O   GLU B 434      45.936  29.510  35.120  1.00 59.96           O  
ATOM  10331  CB  GLU B 434      42.994  30.194  35.444  1.00 56.68           C  
ATOM  10332  CG  GLU B 434      41.694  30.260  34.656  1.00 51.02           C  
ATOM  10333  CD  GLU B 434      41.056  31.637  34.706  1.00 56.24           C  
ATOM  10334  OE1 GLU B 434      40.551  32.099  33.663  1.00 60.41           O  
ATOM  10335  OE2 GLU B 434      41.059  32.257  35.790  1.00 56.66           O  
ATOM  10336  N   MET B 435      45.462  28.439  37.041  1.00 55.24           N  
ATOM  10337  CA  MET B 435      46.833  28.455  37.534  1.00 51.88           C  
ATOM  10338  C   MET B 435      47.425  27.050  37.521  1.00 45.64           C  
ATOM  10339  O   MET B 435      48.520  26.823  38.035  1.00 43.81           O  
ATOM  10340  CB  MET B 435      46.886  29.037  38.945  1.00 53.01           C  
ATOM  10341  CG  MET B 435      46.416  30.477  39.036  1.00 53.16           C  
ATOM  10342  SD  MET B 435      46.195  31.022  40.740  1.00 51.88           S  
ATOM  10343  CE  MET B 435      47.851  30.796  41.382  1.00 59.01           C  
ATOM  10344  N   SER B 436      46.680  26.117  36.934  1.00 57.98           N  
ATOM  10345  CA  SER B 436      47.104  24.726  36.793  1.00 53.25           C  
ATOM  10346  C   SER B 436      47.453  24.080  38.129  1.00 58.98           C  
ATOM  10347  O   SER B 436      48.312  23.202  38.194  1.00 53.47           O  
ATOM  10348  CB  SER B 436      48.300  24.625  35.846  1.00 51.34           C  
ATOM  10349  OG  SER B 436      48.626  23.271  35.588  1.00 58.89           O  
ATOM  10350  N   ILE B 437      46.788  24.516  39.194  1.00 46.76           N  
ATOM  10351  CA  ILE B 437      47.009  23.930  40.510  1.00 43.97           C  
ATOM  10352  C   ILE B 437      46.432  22.522  40.559  1.00 40.85           C  
ATOM  10353  O   ILE B 437      45.248  22.320  40.292  1.00 41.92           O  
ATOM  10354  CB  ILE B 437      46.386  24.783  41.626  1.00 46.78           C  
ATOM  10355  CG1 ILE B 437      46.971  26.197  41.602  1.00 50.97           C  
ATOM  10356  CG2 ILE B 437      46.615  24.137  42.983  1.00 44.55           C  
ATOM  10357  CD1 ILE B 437      46.431  27.100  42.688  1.00 54.78           C  
ATOM  10358  N   LEU B 438      47.281  21.557  40.900  1.00 53.77           N  
ATOM  10359  CA  LEU B 438      46.906  20.145  40.919  1.00 51.94           C  
ATOM  10360  C   LEU B 438      45.719  19.856  41.828  1.00 53.29           C  
ATOM  10361  O   LEU B 438      44.659  19.436  41.365  1.00 54.66           O  
ATOM  10362  CB  LEU B 438      48.096  19.293  41.356  1.00 50.09           C  
ATOM  10363  CG  LEU B 438      49.321  19.327  40.444  1.00 58.48           C  
ATOM  10364  CD1 LEU B 438      50.450  18.513  41.050  1.00 58.70           C  
ATOM  10365  CD2 LEU B 438      48.956  18.805  39.065  1.00 52.71           C  
ATOM  10366  N   PHE B 439      45.904  20.077  43.123  1.00 56.43           N  
ATOM  10367  CA  PHE B 439      44.863  19.776  44.095  1.00 57.35           C  
ATOM  10368  C   PHE B 439      44.468  21.003  44.908  1.00 59.73           C  
ATOM  10369  O   PHE B 439      45.279  21.900  45.137  1.00 50.45           O  
ATOM  10370  CB  PHE B 439      45.318  18.654  45.027  1.00 56.22           C  
ATOM  10371  CG  PHE B 439      45.498  17.331  44.340  1.00 55.08           C  
ATOM  10372  CD1 PHE B 439      44.427  16.468  44.180  1.00 55.86           C  
ATOM  10373  CD2 PHE B 439      46.737  16.950  43.853  1.00 54.03           C  
ATOM  10374  CE1 PHE B 439      44.588  15.249  43.550  1.00 55.73           C  
ATOM  10375  CE2 PHE B 439      46.904  15.732  43.221  1.00 53.93           C  
ATOM  10376  CZ  PHE B 439      45.829  14.881  43.069  1.00 54.84           C  
ATOM  10377  N   THR B 440      43.210  21.031  45.337  1.00 59.88           N  
ATOM  10378  CA  THR B 440      42.703  22.095  46.189  1.00 52.96           C  
ATOM  10379  C   THR B 440      42.261  21.514  47.528  1.00 53.52           C  
ATOM  10380  O   THR B 440      41.213  20.871  47.621  1.00 54.25           O  
ATOM  10381  CB  THR B 440      41.523  22.836  45.536  1.00 56.21           C  
ATOM  10382  OG1 THR B 440      41.912  23.320  44.243  1.00 56.36           O  
ATOM  10383  CG2 THR B 440      41.080  24.005  46.402  1.00 50.13           C  
ATOM  10384  N   VAL B 441      43.075  21.728  48.558  1.00 56.10           N  
ATOM  10385  CA  VAL B 441      42.778  21.221  49.892  1.00 58.07           C  
ATOM  10386  C   VAL B 441      41.974  22.237  50.698  1.00 52.26           C  
ATOM  10387  O   VAL B 441      42.375  23.392  50.845  1.00 54.20           O  
ATOM  10388  CB  VAL B 441      44.071  20.851  50.658  1.00 56.32           C  
ATOM  10389  CG1 VAL B 441      45.148  21.906  50.449  1.00 57.00           C  
ATOM  10390  CG2 VAL B 441      43.781  20.652  52.139  1.00 58.75           C  
ATOM  10391  N   LEU B 442      40.829  21.801  51.213  1.00 64.96           N  
ATOM  10392  CA  LEU B 442      39.957  22.685  51.976  1.00 68.15           C  
ATOM  10393  C   LEU B 442      39.891  22.263  53.440  1.00 68.41           C  
ATOM  10394  O   LEU B 442      39.615  21.102  53.753  1.00 67.50           O  
ATOM  10395  CB  LEU B 442      38.553  22.710  51.363  1.00 68.69           C  
ATOM  10396  CG  LEU B 442      37.607  23.833  51.800  1.00 72.12           C  
ATOM  10397  CD1 LEU B 442      36.826  23.470  53.060  1.00 74.68           C  
ATOM  10398  CD2 LEU B 442      38.379  25.130  52.003  1.00 76.82           C  
ATOM  10399  N   VAL B 443      40.144  23.219  54.329  1.00 56.87           N  
ATOM  10400  CA  VAL B 443      40.098  22.973  55.765  1.00 57.77           C  
ATOM  10401  C   VAL B 443      38.892  23.652  56.400  1.00 53.69           C  
ATOM  10402  O   VAL B 443      38.794  24.880  56.411  1.00 56.27           O  
ATOM  10403  CB  VAL B 443      41.381  23.469  56.463  1.00 58.91           C  
ATOM  10404  CG1 VAL B 443      41.235  23.371  57.974  1.00 51.21           C  
ATOM  10405  CG2 VAL B 443      42.585  22.678  55.984  1.00 53.76           C  
ATOM  10406  N   THR B 444      37.971  22.849  56.924  1.00 60.80           N  
ATOM  10407  CA  THR B 444      36.790  23.381  57.594  1.00 62.79           C  
ATOM  10408  C   THR B 444      36.738  22.940  59.054  1.00 65.87           C  
ATOM  10409  O   THR B 444      37.635  22.247  59.534  1.00 64.34           O  
ATOM  10410  CB  THR B 444      35.489  22.955  56.881  1.00 64.67           C  
ATOM  10411  OG1 THR B 444      34.359  23.482  57.590  1.00 67.59           O  
ATOM  10412  CG2 THR B 444      35.377  21.445  56.820  1.00 61.81           C  
ATOM  10413  N   GLU B 445      35.684  23.349  59.752  1.00104.90           N  
ATOM  10414  CA  GLU B 445      35.565  23.098  61.186  1.00107.03           C  
ATOM  10415  C   GLU B 445      35.309  21.627  61.508  1.00105.47           C  
ATOM  10416  O   GLU B 445      35.652  21.156  62.594  1.00106.78           O  
ATOM  10417  CB  GLU B 445      34.452  23.963  61.782  1.00104.37           C  
ATOM  10418  CG  GLU B 445      33.106  23.816  61.093  1.00104.88           C  
ATOM  10419  CD  GLU B 445      32.013  24.599  61.791  1.00104.29           C  
ATOM  10420  OE1 GLU B 445      31.691  25.717  61.335  1.00104.73           O  
ATOM  10421  OE2 GLU B 445      31.473  24.097  62.799  1.00106.97           O  
ATOM  10422  N   THR B 446      34.705  20.905  60.569  1.00 86.41           N  
ATOM  10423  CA  THR B 446      34.465  19.480  60.758  1.00 85.16           C  
ATOM  10424  C   THR B 446      35.797  18.736  60.789  1.00 83.66           C  
ATOM  10425  O   THR B 446      35.951  17.739  61.500  1.00 84.06           O  
ATOM  10426  CB  THR B 446      33.566  18.897  59.650  1.00 84.56           C  
ATOM  10427  OG1 THR B 446      34.280  18.881  58.406  1.00 82.09           O  
ATOM  10428  CG2 THR B 446      32.300  19.727  59.498  1.00 89.85           C  
ATOM  10429  N   THR B 447      36.759  19.235  60.019  1.00 80.07           N  
ATOM  10430  CA  THR B 447      38.110  18.690  60.022  1.00 79.08           C  
ATOM  10431  C   THR B 447      38.797  19.030  61.336  1.00 80.48           C  
ATOM  10432  O   THR B 447      39.639  18.278  61.825  1.00 80.84           O  
ATOM  10433  CB  THR B 447      38.945  19.233  58.853  1.00 75.09           C  
ATOM  10434  OG1 THR B 447      39.421  20.547  59.168  1.00 77.24           O  
ATOM  10435  CG2 THR B 447      38.106  19.295  57.593  1.00 75.47           C  
ATOM  10436  N   LEU B 448      38.431  20.176  61.902  1.00 71.50           N  
ATOM  10437  CA  LEU B 448      38.934  20.587  63.206  1.00 75.40           C  
ATOM  10438  C   LEU B 448      38.365  19.658  64.275  1.00 77.56           C  
ATOM  10439  O   LEU B 448      38.990  19.430  65.312  1.00 78.82           O  
ATOM  10440  CB  LEU B 448      38.566  22.050  63.490  1.00 77.78           C  
ATOM  10441  CG  LEU B 448      39.284  22.836  64.596  1.00 70.69           C  
ATOM  10442  CD1 LEU B 448      38.675  22.578  65.969  1.00 73.47           C  
ATOM  10443  CD2 LEU B 448      40.777  22.534  64.602  1.00 78.30           C  
ATOM  10444  N   GLU B 449      37.182  19.113  64.007  1.00 96.88           N  
ATOM  10445  CA  GLU B 449      36.562  18.146  64.910  1.00 96.96           C  
ATOM  10446  C   GLU B 449      37.230  16.778  64.805  1.00 96.20           C  
ATOM  10447  O   GLU B 449      37.852  16.311  65.759  1.00 96.51           O  
ATOM  10448  CB  GLU B 449      35.065  18.021  64.621  1.00 98.62           C  
ATOM  10449  CG  GLU B 449      34.357  16.972  65.469  1.00 91.60           C  
ATOM  10450  CD  GLU B 449      32.876  16.872  65.160  1.00 92.70           C  
ATOM  10451  OE1 GLU B 449      32.228  15.926  65.654  1.00 98.00           O  
ATOM  10452  OE2 GLU B 449      32.360  17.740  64.423  1.00 94.91           O  
ATOM  10453  N   ASN B 450      37.103  16.135  63.646  1.00 81.75           N  
ATOM  10454  CA  ASN B 450      37.695  14.815  63.452  1.00 80.29           C  
ATOM  10455  C   ASN B 450      39.122  14.891  62.905  1.00 79.69           C  
ATOM  10456  O   ASN B 450      40.085  14.691  63.646  1.00 79.44           O  
ATOM  10457  CB  ASN B 450      36.816  13.959  62.531  1.00 81.08           C  
ATOM  10458  CG  ASN B 450      36.323  14.720  61.314  1.00 80.07           C  
ATOM  10459  OD1 ASN B 450      36.984  14.747  60.277  1.00 74.79           O  
ATOM  10460  ND2 ASN B 450      35.155  15.339  61.435  1.00 81.98           N  
ATOM  10461  N   GLY B 451      39.258  15.180  61.614  1.00 93.63           N  
ATOM  10462  CA  GLY B 451      40.566  15.284  60.992  1.00 91.94           C  
ATOM  10463  C   GLY B 451      40.579  14.812  59.550  1.00 90.10           C  
ATOM  10464  O   GLY B 451      41.532  14.175  59.105  1.00 90.15           O  
ATOM  10465  N   LEU B 452      39.515  15.126  58.819  1.00 73.39           N  
ATOM  10466  CA  LEU B 452      39.408  14.728  57.421  1.00 79.39           C  
ATOM  10467  C   LEU B 452      39.107  15.926  56.525  1.00 77.29           C  
ATOM  10468  O   LEU B 452      37.952  16.318  56.369  1.00 77.80           O  
ATOM  10469  CB  LEU B 452      38.328  13.657  57.250  1.00 70.42           C  
ATOM  10470  CG  LEU B 452      38.538  12.348  58.014  1.00 71.01           C  
ATOM  10471  CD1 LEU B 452      37.360  11.410  57.808  1.00 71.91           C  
ATOM  10472  CD2 LEU B 452      39.839  11.682  57.594  1.00 79.83           C  
ATOM  10473  N   ILE B 453      40.152  16.500  55.935  1.00 61.10           N  
ATOM  10474  CA  ILE B 453      39.997  17.680  55.091  1.00 60.43           C  
ATOM  10475  C   ILE B 453      39.508  17.327  53.689  1.00 68.41           C  
ATOM  10476  O   ILE B 453      39.555  16.163  53.271  1.00 67.02           O  
ATOM  10477  CB  ILE B 453      41.318  18.478  54.974  1.00 68.99           C  
ATOM  10478  CG1 ILE B 453      42.265  17.834  53.957  1.00 65.34           C  
ATOM  10479  CG2 ILE B 453      41.976  18.623  56.340  1.00 61.09           C  
ATOM  10480  CD1 ILE B 453      43.127  16.732  54.521  1.00 64.91           C  
ATOM  10481  N   HIS B 454      39.035  18.346  52.974  1.00 79.91           N  
ATOM  10482  CA  HIS B 454      38.505  18.173  51.625  1.00 77.10           C  
ATOM  10483  C   HIS B 454      39.606  18.318  50.577  1.00 74.56           C  
ATOM  10484  O   HIS B 454      40.651  18.913  50.837  1.00 72.70           O  
ATOM  10485  CB  HIS B 454      37.388  19.184  51.351  1.00 79.61           C  
ATOM  10486  CG  HIS B 454      36.218  19.062  52.278  1.00 74.61           C  
ATOM  10487  ND1 HIS B 454      35.024  18.486  51.900  1.00 77.77           N  
ATOM  10488  CD2 HIS B 454      36.056  19.448  53.566  1.00 74.98           C  
ATOM  10489  CE1 HIS B 454      34.179  18.520  52.914  1.00 80.67           C  
ATOM  10490  NE2 HIS B 454      34.780  19.099  53.938  1.00 81.71           N  
ATOM  10491  N   LEU B 455      39.355  17.777  49.388  1.00 50.83           N  
ATOM  10492  CA  LEU B 455      40.340  17.777  48.312  1.00 57.87           C  
ATOM  10493  C   LEU B 455      39.663  17.771  46.944  1.00 58.52           C  
ATOM  10494  O   LEU B 455      38.754  16.976  46.698  1.00 59.76           O  
ATOM  10495  CB  LEU B 455      41.267  16.567  48.434  1.00 55.77           C  
ATOM  10496  CG  LEU B 455      42.434  16.502  47.450  1.00 53.17           C  
ATOM  10497  CD1 LEU B 455      43.583  17.371  47.935  1.00 52.54           C  
ATOM  10498  CD2 LEU B 455      42.889  15.067  47.230  1.00 52.84           C  
ATOM  10499  N   ARG B 456      40.109  18.656  46.059  1.00 59.38           N  
ATOM  10500  CA  ARG B 456      39.569  18.701  44.701  1.00 52.03           C  
ATOM  10501  C   ARG B 456      40.672  18.668  43.646  1.00 58.65           C  
ATOM  10502  O   ARG B 456      41.451  19.614  43.525  1.00 57.65           O  
ATOM  10503  CB  ARG B 456      38.708  19.951  44.506  1.00 54.74           C  
ATOM  10504  CG  ARG B 456      38.196  20.119  43.083  1.00 56.85           C  
ATOM  10505  CD  ARG B 456      37.502  21.457  42.888  1.00 51.28           C  
ATOM  10506  NE  ARG B 456      37.082  21.652  41.504  1.00 57.55           N  
ATOM  10507  CZ  ARG B 456      37.863  22.146  40.550  1.00 55.45           C  
ATOM  10508  NH1 ARG B 456      39.111  22.498  40.825  1.00 52.03           N  
ATOM  10509  NH2 ARG B 456      37.397  22.287  39.316  1.00 57.85           N  
ATOM  10510  N   SER B 457      40.729  17.583  42.881  1.00 60.55           N  
ATOM  10511  CA  SER B 457      41.737  17.442  41.836  1.00 68.40           C  
ATOM  10512  C   SER B 457      41.415  18.322  40.632  1.00 61.60           C  
ATOM  10513  O   SER B 457      40.261  18.681  40.402  1.00 66.15           O  
ATOM  10514  CB  SER B 457      41.860  15.981  41.398  1.00 68.80           C  
ATOM  10515  OG  SER B 457      40.647  15.512  40.836  1.00 63.00           O  
ATOM  10516  N   ARG B 458      42.445  18.663  39.866  1.00 53.80           N  
ATOM  10517  CA  ARG B 458      42.281  19.503  38.686  1.00 57.62           C  
ATOM  10518  C   ARG B 458      41.939  18.667  37.455  1.00 61.52           C  
ATOM  10519  O   ARG B 458      41.050  19.026  36.682  1.00 67.25           O  
ATOM  10520  CB  ARG B 458      43.550  20.322  38.433  1.00 57.83           C  
ATOM  10521  CG  ARG B 458      43.560  21.077  37.113  1.00 61.23           C  
ATOM  10522  CD  ARG B 458      44.537  20.451  36.125  1.00 59.75           C  
ATOM  10523  NE  ARG B 458      45.929  20.706  36.486  1.00 55.60           N  
ATOM  10524  CZ  ARG B 458      46.970  20.121  35.902  1.00 51.80           C  
ATOM  10525  NH1 ARG B 458      46.776  19.236  34.935  1.00 55.44           N  
ATOM  10526  NH2 ARG B 458      48.203  20.416  36.289  1.00 50.83           N  
ATOM  10527  N   ASP B 459      42.652  17.557  37.282  1.00 69.11           N  
ATOM  10528  CA  ASP B 459      42.425  16.658  36.154  1.00 62.26           C  
ATOM  10529  C   ASP B 459      40.980  16.178  36.130  1.00 63.71           C  
ATOM  10530  O   ASP B 459      40.338  16.155  35.080  1.00 65.18           O  
ATOM  10531  CB  ASP B 459      43.378  15.460  36.219  1.00 67.81           C  
ATOM  10532  CG  ASP B 459      44.836  15.872  36.197  1.00 63.50           C  
ATOM  10533  OD1 ASP B 459      45.401  16.010  35.091  1.00 65.75           O  
ATOM  10534  OD2 ASP B 459      45.421  16.055  37.286  1.00 69.98           O  
ATOM  10535  N   THR B 460      40.473  15.802  37.299  1.00 58.02           N  
ATOM  10536  CA  THR B 460      39.082  15.394  37.439  1.00 61.31           C  
ATOM  10537  C   THR B 460      38.432  16.113  38.615  1.00 61.71           C  
ATOM  10538  O   THR B 460      38.643  15.752  39.773  1.00 60.17           O  
ATOM  10539  CB  THR B 460      38.954  13.868  37.624  1.00 62.00           C  
ATOM  10540  OG1 THR B 460      37.710  13.565  38.267  1.00 64.79           O  
ATOM  10541  CG2 THR B 460      40.101  13.331  38.469  1.00 58.67           C  
ATOM  10542  N   THR B 461      37.650  17.143  38.308  1.00 53.35           N  
ATOM  10543  CA  THR B 461      36.980  17.930  39.339  1.00 54.76           C  
ATOM  10544  C   THR B 461      36.040  17.065  40.172  1.00 57.00           C  
ATOM  10545  O   THR B 461      34.926  16.756  39.752  1.00 51.16           O  
ATOM  10546  CB  THR B 461      36.193  19.105  38.725  1.00 58.49           C  
ATOM  10547  OG1 THR B 461      35.126  19.480  39.604  1.00 51.93           O  
ATOM  10548  CG2 THR B 461      35.616  18.717  37.368  1.00 51.61           C  
ATOM  10549  N   MET B 462      36.502  16.671  41.354  1.00 53.69           N  
ATOM  10550  CA  MET B 462      35.719  15.800  42.220  1.00 55.12           C  
ATOM  10551  C   MET B 462      36.109  15.957  43.688  1.00 52.92           C  
ATOM  10552  O   MET B 462      37.290  15.940  44.037  1.00 59.18           O  
ATOM  10553  CB  MET B 462      35.882  14.342  41.786  1.00 54.78           C  
ATOM  10554  CG  MET B 462      34.817  13.407  42.332  1.00 58.03           C  
ATOM  10555  SD  MET B 462      33.162  13.820  41.748  1.00 54.36           S  
ATOM  10556  CE  MET B 462      33.403  13.777  39.974  1.00 55.44           C  
ATOM  10557  N   LYS B 463      35.102  16.111  44.540  1.00 83.33           N  
ATOM  10558  CA  LYS B 463      35.305  16.243  45.978  1.00 84.67           C  
ATOM  10559  C   LYS B 463      35.779  14.925  46.587  1.00 82.24           C  
ATOM  10560  O   LYS B 463      35.256  13.860  46.259  1.00 82.87           O  
ATOM  10561  CB  LYS B 463      34.009  16.709  46.648  1.00 88.15           C  
ATOM  10562  CG  LYS B 463      34.024  16.684  48.168  1.00 82.21           C  
ATOM  10563  CD  LYS B 463      32.672  17.106  48.725  1.00 84.55           C  
ATOM  10564  CE  LYS B 463      32.607  16.932  50.233  1.00 83.24           C  
ATOM  10565  NZ  LYS B 463      31.287  17.346  50.783  1.00 88.93           N  
ATOM  10566  N   GLU B 464      36.770  14.999  47.472  1.00 54.83           N  
ATOM  10567  CA  GLU B 464      37.321  13.801  48.096  1.00 55.65           C  
ATOM  10568  C   GLU B 464      37.874  14.077  49.494  1.00 54.56           C  
ATOM  10569  O   GLU B 464      38.680  14.987  49.681  1.00 54.31           O  
ATOM  10570  CB  GLU B 464      38.418  13.202  47.211  1.00 52.72           C  
ATOM  10571  CG  GLU B 464      39.025  11.925  47.758  1.00 51.87           C  
ATOM  10572  CD  GLU B 464      37.983  10.860  48.023  1.00 55.88           C  
ATOM  10573  OE1 GLU B 464      37.847  10.442  49.191  1.00 59.67           O  
ATOM  10574  OE2 GLU B 464      37.299  10.445  47.063  1.00 56.23           O  
ATOM  10575  N   MET B 465      37.444  13.284  50.472  1.00 56.15           N  
ATOM  10576  CA  MET B 465      37.895  13.444  51.855  1.00 56.71           C  
ATOM  10577  C   MET B 465      39.211  12.708  52.090  1.00 56.99           C  
ATOM  10578  O   MET B 465      39.432  11.635  51.529  1.00 54.87           O  
ATOM  10579  CB  MET B 465      36.831  12.931  52.828  1.00 60.73           C  
ATOM  10580  CG  MET B 465      35.423  13.403  52.513  1.00 64.85           C  
ATOM  10581  SD  MET B 465      35.234  15.189  52.618  1.00 65.68           S  
ATOM  10582  CE  MET B 465      35.511  15.454  54.367  1.00 67.30           C  
ATOM  10583  N   MET B 466      40.082  13.276  52.921  1.00 67.00           N  
ATOM  10584  CA  MET B 466      41.372  12.644  53.196  1.00 64.93           C  
ATOM  10585  C   MET B 466      41.956  13.102  54.534  1.00 67.70           C  
ATOM  10586  O   MET B 466      41.490  14.076  55.113  1.00 67.67           O  
ATOM  10587  CB  MET B 466      42.350  12.935  52.053  1.00 63.17           C  
ATOM  10588  CG  MET B 466      43.500  11.948  51.930  1.00 64.66           C  
ATOM  10589  SD  MET B 466      44.291  12.010  50.311  1.00 61.60           S  
ATOM  10590  CE  MET B 466      44.610  13.763  50.159  1.00 68.40           C  
ATOM  10591  N   HIS B 467      42.968  12.392  55.027  1.00 79.79           N  
ATOM  10592  CA  HIS B 467      43.610  12.743  56.292  1.00 71.53           C  
ATOM  10593  C   HIS B 467      44.809  13.662  56.048  1.00 79.95           C  
ATOM  10594  O   HIS B 467      45.249  13.814  54.912  1.00 77.48           O  
ATOM  10595  CB  HIS B 467      44.041  11.479  57.039  1.00 73.55           C  
ATOM  10596  CG  HIS B 467      44.020  11.623  58.531  1.00 76.24           C  
ATOM  10597  ND1 HIS B 467      43.789  12.824  59.157  1.00 76.88           N  
ATOM  10598  CD2 HIS B 467      44.198  10.707  59.514  1.00 78.49           C  
ATOM  10599  CE1 HIS B 467      43.828  12.648  60.471  1.00 79.28           C  
ATOM  10600  NE2 HIS B 467      44.075  11.375  60.709  1.00 80.07           N  
ATOM  10601  N   ILE B 468      45.338  14.264  57.111  1.00 94.91           N  
ATOM  10602  CA  ILE B 468      46.359  15.309  56.987  1.00 94.21           C  
ATOM  10603  C   ILE B 468      47.725  14.790  56.526  1.00 91.24           C  
ATOM  10604  O   ILE B 468      48.187  15.121  55.427  1.00 89.79           O  
ATOM  10605  CB  ILE B 468      46.552  16.069  58.321  1.00 94.75           C  
ATOM  10606  CG1 ILE B 468      45.284  16.842  58.696  1.00 97.99           C  
ATOM  10607  CG2 ILE B 468      47.722  17.037  58.222  1.00 95.88           C  
ATOM  10608  CD1 ILE B 468      44.314  16.070  59.567  1.00 99.65           C  
ATOM  10609  N   SER B 469      48.382  13.994  57.367  1.00 96.00           N  
ATOM  10610  CA  SER B 469      49.687  13.445  57.012  1.00 97.14           C  
ATOM  10611  C   SER B 469      49.529  12.535  55.804  1.00 94.71           C  
ATOM  10612  O   SER B 469      50.429  12.422  54.969  1.00 95.47           O  
ATOM  10613  CB  SER B 469      50.305  12.678  58.182  1.00 98.36           C  
ATOM  10614  OG  SER B 469      49.854  11.335  58.207  1.00 91.94           O  
ATOM  10615  N   LYS B 470      48.366  11.898  55.721  1.00 77.53           N  
ATOM  10616  CA  LYS B 470      48.010  11.100  54.559  1.00 73.22           C  
ATOM  10617  C   LYS B 470      47.952  11.975  53.311  1.00 73.62           C  
ATOM  10618  O   LYS B 470      48.293  11.521  52.226  1.00 71.07           O  
ATOM  10619  CB  LYS B 470      46.674  10.389  54.779  1.00 76.19           C  
ATOM  10620  CG  LYS B 470      46.724   9.281  55.821  1.00 76.89           C  
ATOM  10621  CD  LYS B 470      47.697   8.188  55.412  1.00 81.80           C  
ATOM  10622  CE  LYS B 470      47.703   7.048  56.415  1.00 85.89           C  
ATOM  10623  NZ  LYS B 470      46.357   6.430  56.557  1.00 85.87           N  
ATOM  10624  N   LEU B 471      47.529  13.228  53.472  1.00 59.28           N  
ATOM  10625  CA  LEU B 471      47.503  14.175  52.356  1.00 57.80           C  
ATOM  10626  C   LEU B 471      48.918  14.573  51.958  1.00 57.91           C  
ATOM  10627  O   LEU B 471      49.234  14.655  50.771  1.00 54.83           O  
ATOM  10628  CB  LEU B 471      46.684  15.423  52.708  1.00 55.54           C  
ATOM  10629  CG  LEU B 471      46.698  16.589  51.714  1.00 55.41           C  
ATOM  10630  CD1 LEU B 471      45.297  17.146  51.524  1.00 54.82           C  
ATOM  10631  CD2 LEU B 471      47.646  17.687  52.178  1.00 57.20           C  
ATOM  10632  N   LYS B 472      49.760  14.829  52.955  1.00 68.92           N  
ATOM  10633  CA  LYS B 472      51.163  15.155  52.707  1.00 69.93           C  
ATOM  10634  C   LYS B 472      51.851  14.052  51.898  1.00 60.63           C  
ATOM  10635  O   LYS B 472      52.404  14.301  50.818  1.00 69.10           O  
ATOM  10636  CB  LYS B 472      51.890  15.387  54.034  1.00 63.76           C  
ATOM  10637  CG  LYS B 472      53.407  15.391  53.943  1.00 65.77           C  
ATOM  10638  CD  LYS B 472      53.992  14.131  54.562  1.00 66.36           C  
ATOM  10639  CE  LYS B 472      55.510  14.183  54.608  1.00 69.07           C  
ATOM  10640  NZ  LYS B 472      56.003  15.260  55.512  1.00 60.18           N  
ATOM  10641  N   ASP B 473      51.793  12.830  52.422  1.00 67.44           N  
ATOM  10642  CA  ASP B 473      52.404  11.686  51.758  1.00 66.50           C  
ATOM  10643  C   ASP B 473      51.727  11.374  50.428  1.00 64.95           C  
ATOM  10644  O   ASP B 473      52.351  10.813  49.528  1.00 65.69           O  
ATOM  10645  CB  ASP B 473      52.368  10.456  52.665  1.00 69.40           C  
ATOM  10646  CG  ASP B 473      53.324  10.570  53.836  1.00 61.87           C  
ATOM  10647  OD1 ASP B 473      54.509  10.213  53.670  1.00 64.99           O  
ATOM  10648  OD2 ASP B 473      52.891  11.013  54.920  1.00 63.75           O  
ATOM  10649  N   PHE B 474      50.451  11.735  50.303  1.00 60.19           N  
ATOM  10650  CA  PHE B 474      49.739  11.552  49.043  1.00 57.03           C  
ATOM  10651  C   PHE B 474      50.268  12.507  47.987  1.00 54.41           C  
ATOM  10652  O   PHE B 474      50.343  12.157  46.817  1.00 56.37           O  
ATOM  10653  CB  PHE B 474      48.234  11.760  49.212  1.00 54.60           C  
ATOM  10654  CG  PHE B 474      47.487  11.858  47.913  1.00 51.99           C  
ATOM  10655  CD1 PHE B 474      47.226  10.726  47.161  1.00 52.57           C  
ATOM  10656  CD2 PHE B 474      47.048  13.086  47.443  1.00 59.64           C  
ATOM  10657  CE1 PHE B 474      46.541  10.815  45.965  1.00 51.48           C  
ATOM  10658  CE2 PHE B 474      46.363  13.181  46.248  1.00 58.46           C  
ATOM  10659  CZ  PHE B 474      46.109  12.046  45.507  1.00 59.37           C  
ATOM  10660  N   LEU B 475      50.620  13.718  48.405  1.00 57.27           N  
ATOM  10661  CA  LEU B 475      51.171  14.708  47.488  1.00 55.84           C  
ATOM  10662  C   LEU B 475      52.579  14.312  47.068  1.00 57.39           C  
ATOM  10663  O   LEU B 475      52.919  14.344  45.877  1.00 56.62           O  
ATOM  10664  CB  LEU B 475      51.180  16.096  48.130  1.00 55.63           C  
ATOM  10665  CG  LEU B 475      49.808  16.707  48.418  1.00 54.94           C  
ATOM  10666  CD1 LEU B 475      49.951  18.054  49.108  1.00 55.97           C  
ATOM  10667  CD2 LEU B 475      48.996  16.837  47.138  1.00 53.15           C  
ATOM  10668  N   ILE B 476      53.393  13.936  48.051  1.00 55.09           N  
ATOM  10669  CA  ILE B 476      54.756  13.493  47.779  1.00 57.79           C  
ATOM  10670  C   ILE B 476      54.754  12.290  46.835  1.00 59.07           C  
ATOM  10671  O   ILE B 476      55.491  12.265  45.844  1.00 59.62           O  
ATOM  10672  CB  ILE B 476      55.511  13.141  49.085  1.00 50.83           C  
ATOM  10673  CG1 ILE B 476      56.230  14.371  49.641  1.00 51.15           C  
ATOM  10674  CG2 ILE B 476      56.533  12.039  48.847  1.00 54.96           C  
ATOM  10675  CD1 ILE B 476      55.313  15.476  50.114  1.00 58.49           C  
ATOM  10676  N   LYS B 477      53.904  11.308  47.129  1.00 58.83           N  
ATOM  10677  CA  LYS B 477      53.799  10.112  46.299  1.00 53.73           C  
ATOM  10678  C   LYS B 477      53.223  10.446  44.927  1.00 58.56           C  
ATOM  10679  O   LYS B 477      53.563   9.807  43.933  1.00 50.30           O  
ATOM  10680  CB  LYS B 477      52.935   9.051  46.990  1.00 55.59           C  
ATOM  10681  CG  LYS B 477      52.876   7.717  46.262  1.00 59.11           C  
ATOM  10682  CD  LYS B 477      51.938   6.746  46.959  1.00 60.55           C  
ATOM  10683  CE  LYS B 477      52.367   6.498  48.396  1.00 62.56           C  
ATOM  10684  NZ  LYS B 477      51.448   5.560  49.097  1.00 60.96           N  
ATOM  10685  N   TYR B 478      52.355  11.453  44.877  1.00 56.93           N  
ATOM  10686  CA  TYR B 478      51.739  11.872  43.623  1.00 54.30           C  
ATOM  10687  C   TYR B 478      52.791  12.442  42.683  1.00 57.01           C  
ATOM  10688  O   TYR B 478      52.860  12.057  41.519  1.00 56.15           O  
ATOM  10689  CB  TYR B 478      50.638  12.907  43.869  1.00 50.26           C  
ATOM  10690  CG  TYR B 478      49.714  13.126  42.688  1.00 50.05           C  
ATOM  10691  CD1 TYR B 478      49.981  14.108  41.745  1.00 59.56           C  
ATOM  10692  CD2 TYR B 478      48.572  12.353  42.524  1.00 50.96           C  
ATOM  10693  CE1 TYR B 478      49.137  14.312  40.666  1.00 50.00           C  
ATOM  10694  CE2 TYR B 478      47.723  12.549  41.450  1.00 51.48           C  
ATOM  10695  CZ  TYR B 478      48.012  13.530  40.526  1.00 50.99           C  
ATOM  10696  OH  TYR B 478      47.171  13.731  39.454  1.00 52.01           O  
ATOM  10697  N   ILE B 479      53.607  13.357  43.194  1.00 59.20           N  
ATOM  10698  CA  ILE B 479      54.674  13.947  42.393  1.00 59.01           C  
ATOM  10699  C   ILE B 479      55.720  12.904  42.015  1.00 53.05           C  
ATOM  10700  O   ILE B 479      56.101  12.784  40.843  1.00 52.07           O  
ATOM  10701  CB  ILE B 479      55.367  15.105  43.137  1.00 50.16           C  
ATOM  10702  CG1 ILE B 479      54.345  16.164  43.552  1.00 57.70           C  
ATOM  10703  CG2 ILE B 479      56.458  15.722  42.270  1.00 50.54           C  
ATOM  10704  CD1 ILE B 479      53.605  16.789  42.391  1.00 55.74           C  
ATOM  10705  N   SER B 480      56.173  12.147  43.011  1.00 64.11           N  
ATOM  10706  CA  SER B 480      57.203  11.131  42.811  1.00 69.17           C  
ATOM  10707  C   SER B 480      56.798  10.100  41.762  1.00 61.97           C  
ATOM  10708  O   SER B 480      57.604   9.712  40.918  1.00 62.28           O  
ATOM  10709  CB  SER B 480      57.519  10.427  44.133  1.00 67.09           C  
ATOM  10710  OG  SER B 480      57.947  11.355  45.114  1.00 67.64           O  
ATOM  10711  N   SER B 481      55.543   9.664  41.815  1.00 59.46           N  
ATOM  10712  CA  SER B 481      55.048   8.671  40.871  1.00 51.11           C  
ATOM  10713  C   SER B 481      54.726   9.305  39.522  1.00 58.44           C  
ATOM  10714  O   SER B 481      54.777   8.640  38.487  1.00 50.52           O  
ATOM  10715  CB  SER B 481      53.817   7.963  41.432  1.00 51.88           C  
ATOM  10716  OG  SER B 481      54.112   7.336  42.669  1.00 55.33           O  
ATOM  10717  N   ALA B 482      54.391  10.592  39.536  1.00 54.54           N  
ATOM  10718  CA  ALA B 482      54.158  11.324  38.297  1.00 54.25           C  
ATOM  10719  C   ALA B 482      55.455  11.425  37.507  1.00 57.02           C  
ATOM  10720  O   ALA B 482      55.443  11.400  36.276  1.00 58.77           O  
ATOM  10721  CB  ALA B 482      53.600  12.708  38.581  1.00 51.07           C  
ATOM  10722  N   LYS B 483      56.570  11.538  38.224  1.00 81.54           N  
ATOM  10723  CA  LYS B 483      57.884  11.575  37.589  1.00 80.16           C  
ATOM  10724  C   LYS B 483      58.146  10.267  36.843  1.00 84.16           C  
ATOM  10725  O   LYS B 483      58.779  10.262  35.786  1.00 86.50           O  
ATOM  10726  CB  LYS B 483      58.981  11.836  38.630  1.00 84.22           C  
ATOM  10727  CG  LYS B 483      60.302  12.348  38.055  1.00 84.68           C  
ATOM  10728  CD  LYS B 483      61.239  11.210  37.668  1.00 89.89           C  
ATOM  10729  CE  LYS B 483      62.509  11.730  37.014  1.00 82.15           C  
ATOM  10730  NZ  LYS B 483      63.388  10.620  36.551  1.00 87.97           N  
ATOM  10731  N   ASN B 484      57.644   9.164  37.390  1.00 86.20           N  
ATOM  10732  CA  ASN B 484      57.796   7.852  36.769  1.00 80.35           C  
ATOM  10733  C   ASN B 484      56.841   7.647  35.594  1.00 80.71           C  
ATOM  10734  O   ASN B 484      56.400   8.608  34.964  1.00 81.38           O  
ATOM  10735  CB  ASN B 484      57.584   6.744  37.804  1.00 82.96           C  
ATOM  10736  CG  ASN B 484      58.617   6.775  38.914  1.00 87.06           C  
ATOM  10737  OD1 ASN B 484      59.261   7.798  39.151  1.00 85.71           O  
ATOM  10738  ND2 ASN B 484      58.780   5.651  39.603  1.00 89.91           N  
ATOM  10739  N   VAL B 485      56.525   6.387  35.306  1.00 77.64           N  
ATOM  10740  CA  VAL B 485      55.627   6.051  34.205  1.00 79.32           C  
ATOM  10741  C   VAL B 485      54.168   6.184  34.640  1.00 74.45           C  
ATOM  10742  O   VAL B 485      53.840   6.040  35.818  1.00 74.04           O  
ATOM  10743  CB  VAL B 485      55.890   4.620  33.678  1.00 84.29           C  
ATOM  10744  CG1 VAL B 485      55.546   3.582  34.738  1.00 87.88           C  
ATOM  10745  CG2 VAL B 485      55.119   4.365  32.388  1.00 81.53           C  
ATOM  10746  OXT VAL B 485      53.277   6.453  33.832  1.00 74.79           O  
TER   10747      VAL B 485                                                      
ATOM  10748  N   GLU C  67      96.425  32.066  50.062  1.00 66.78           N  
ATOM  10749  CA  GLU C  67      97.440  31.204  50.660  1.00 66.06           C  
ATOM  10750  C   GLU C  67      97.504  29.861  49.941  1.00 68.35           C  
ATOM  10751  O   GLU C  67      97.471  29.805  48.712  1.00 71.46           O  
ATOM  10752  CB  GLU C  67      97.156  30.994  52.149  1.00 20.00           C  
ATOM  10753  CG  GLU C  67      97.312  32.248  52.994  1.00 20.00           C  
ATOM  10754  CD  GLU C  67      96.953  32.016  54.450  1.00 20.00           C  
ATOM  10755  OE1 GLU C  67      96.405  30.939  54.764  1.00 20.00           O  
ATOM  10756  OE2 GLU C  67      97.216  32.912  55.279  1.00 20.00           O  
ATOM  10757  N   ALA C  68      97.594  28.780  50.712  1.00 98.78           N  
ATOM  10758  CA  ALA C  68      97.630  27.434  50.151  1.00 92.87           C  
ATOM  10759  C   ALA C  68      96.221  26.903  49.893  1.00 96.92           C  
ATOM  10760  O   ALA C  68      96.032  25.708  49.663  1.00 97.38           O  
ATOM  10761  CB  ALA C  68      98.388  26.493  51.076  1.00 98.11           C  
ATOM  10762  N   LEU C  69      95.241  27.797  49.934  1.00 65.16           N  
ATOM  10763  CA  LEU C  69      93.854  27.430  49.684  1.00 66.14           C  
ATOM  10764  C   LEU C  69      93.489  27.662  48.222  1.00 64.56           C  
ATOM  10765  O   LEU C  69      92.683  26.931  47.647  1.00 68.84           O  
ATOM  10766  CB  LEU C  69      92.919  28.224  50.599  1.00 61.87           C  
ATOM  10767  CG  LEU C  69      91.409  28.074  50.383  1.00 68.91           C  
ATOM  10768  CD1 LEU C  69      90.979  26.622  50.484  1.00 62.38           C  
ATOM  10769  CD2 LEU C  69      90.647  28.929  51.380  1.00 60.97           C  
ATOM  10770  N   LEU C  70      94.094  28.681  47.621  1.00 75.06           N  
ATOM  10771  CA  LEU C  70      93.826  29.017  46.229  1.00 77.31           C  
ATOM  10772  C   LEU C  70      94.412  27.980  45.273  1.00 74.10           C  
ATOM  10773  O   LEU C  70      94.017  27.905  44.109  1.00 76.52           O  
ATOM  10774  CB  LEU C  70      94.380  30.405  45.900  1.00 76.27           C  
ATOM  10775  CG  LEU C  70      93.809  31.570  46.708  1.00 72.87           C  
ATOM  10776  CD1 LEU C  70      94.437  32.885  46.276  1.00 70.21           C  
ATOM  10777  CD2 LEU C  70      92.295  31.623  46.575  1.00 77.20           C  
ATOM  10778  N   GLU C  71      95.352  27.181  45.769  1.00 80.30           N  
ATOM  10779  CA  GLU C  71      96.006  26.174  44.940  1.00 84.80           C  
ATOM  10780  C   GLU C  71      95.260  24.842  44.967  1.00 89.72           C  
ATOM  10781  O   GLU C  71      95.310  24.078  44.001  1.00 93.52           O  
ATOM  10782  CB  GLU C  71      97.459  25.974  45.386  1.00 80.99           C  
ATOM  10783  CG  GLU C  71      97.620  25.490  46.819  1.00 85.64           C  
ATOM  10784  CD  GLU C  71      99.072  25.263  47.201  1.00 83.94           C  
ATOM  10785  OE1 GLU C  71      99.966  25.640  46.413  1.00 81.38           O  
ATOM  10786  OE2 GLU C  71      99.321  24.703  48.290  1.00 81.22           O  
ATOM  10787  N   ILE C  72      94.566  24.565  46.067  1.00 58.84           N  
ATOM  10788  CA  ILE C  72      93.805  23.324  46.189  1.00 63.52           C  
ATOM  10789  C   ILE C  72      92.404  23.491  45.612  1.00 60.26           C  
ATOM  10790  O   ILE C  72      91.612  22.551  45.597  1.00 63.24           O  
ATOM  10791  CB  ILE C  72      93.700  22.854  47.655  1.00 60.21           C  
ATOM  10792  CG1 ILE C  72      92.838  23.821  48.468  1.00 54.99           C  
ATOM  10793  CG2 ILE C  72      95.084  22.703  48.270  1.00 54.28           C  
ATOM  10794  CD1 ILE C  72      92.685  23.421  49.918  1.00 58.58           C  
ATOM  10795  N   CYS C  73      92.102  24.697  45.144  1.00 53.72           N  
ATOM  10796  CA  CYS C  73      90.845  24.957  44.454  1.00 59.77           C  
ATOM  10797  C   CYS C  73      91.061  24.893  42.948  1.00 60.93           C  
ATOM  10798  O   CYS C  73      90.109  24.939  42.168  1.00 65.53           O  
ATOM  10799  CB  CYS C  73      90.271  26.318  44.858  1.00 55.20           C  
ATOM  10800  SG  CYS C  73      89.637  26.389  46.551  1.00 55.76           S  
ATOM  10801  N   GLN C  74      92.322  24.788  42.548  1.00 87.95           N  
ATOM  10802  CA  GLN C  74      92.675  24.652  41.142  1.00 88.95           C  
ATOM  10803  C   GLN C  74      92.816  23.184  40.761  1.00 83.40           C  
ATOM  10804  O   GLN C  74      92.340  22.756  39.709  1.00 86.87           O  
ATOM  10805  CB  GLN C  74      93.973  25.406  40.839  1.00 84.89           C  
ATOM  10806  CG  GLN C  74      94.643  25.010  39.529  1.00 86.40           C  
ATOM  10807  CD  GLN C  74      93.813  25.359  38.308  1.00 87.71           C  
ATOM  10808  OE1 GLN C  74      92.944  26.230  38.358  1.00 87.55           O  
ATOM  10809  NE2 GLN C  74      94.078  24.676  37.200  1.00 88.45           N  
ATOM  10810  N   ARG C  75      93.466  22.416  41.628  1.00 74.64           N  
ATOM  10811  CA  ARG C  75      93.690  20.999  41.378  1.00 76.98           C  
ATOM  10812  C   ARG C  75      92.440  20.173  41.670  1.00 74.94           C  
ATOM  10813  O   ARG C  75      92.358  19.005  41.289  1.00 77.19           O  
ATOM  10814  CB  ARG C  75      94.866  20.491  42.215  1.00 74.82           C  
ATOM  10815  CG  ARG C  75      94.674  20.638  43.717  1.00 71.63           C  
ATOM  10816  CD  ARG C  75      95.944  20.296  44.489  1.00 68.50           C  
ATOM  10817  NE  ARG C  75      96.349  18.902  44.317  1.00 72.79           N  
ATOM  10818  CZ  ARG C  75      97.333  18.498  43.520  1.00 72.38           C  
ATOM  10819  NH1 ARG C  75      98.022  19.383  42.815  1.00 69.30           N  
ATOM  10820  NH2 ARG C  75      97.629  17.209  43.430  1.00 76.41           N  
ATOM  10821  N   ARG C  76      91.469  20.782  42.345  1.00 56.39           N  
ATOM  10822  CA  ARG C  76      90.223  20.095  42.671  1.00 58.40           C  
ATOM  10823  C   ARG C  76      89.033  20.740  41.962  1.00 59.87           C  
ATOM  10824  O   ARG C  76      87.878  20.414  42.240  1.00 50.76           O  
ATOM  10825  CB  ARG C  76      89.996  20.080  44.185  1.00 54.97           C  
ATOM  10826  CG  ARG C  76      91.142  19.464  44.974  1.00 52.73           C  
ATOM  10827  CD  ARG C  76      91.584  18.140  44.370  1.00 56.45           C  
ATOM  10828  NE  ARG C  76      92.728  17.569  45.077  1.00 54.56           N  
ATOM  10829  CZ  ARG C  76      93.492  16.594  44.596  1.00 57.19           C  
ATOM  10830  NH1 ARG C  76      94.512  16.135  45.308  1.00 55.24           N  
ATOM  10831  NH2 ARG C  76      93.240  16.081  43.399  1.00 51.68           N  
ATOM  10832  N   HIS C  77      89.337  21.663  41.054  1.00 52.37           N  
ATOM  10833  CA  HIS C  77      88.349  22.276  40.166  1.00 53.70           C  
ATOM  10834  C   HIS C  77      87.204  22.987  40.883  1.00 54.35           C  
ATOM  10835  O   HIS C  77      86.036  22.788  40.550  1.00 56.20           O  
ATOM  10836  CB  HIS C  77      87.775  21.221  39.216  1.00 55.22           C  
ATOM  10837  CG  HIS C  77      88.800  20.598  38.324  1.00 54.06           C  
ATOM  10838  ND1 HIS C  77      89.731  19.687  38.780  1.00 52.08           N  
ATOM  10839  CD2 HIS C  77      89.052  20.759  37.003  1.00 51.20           C  
ATOM  10840  CE1 HIS C  77      90.505  19.313  37.779  1.00 51.45           C  
ATOM  10841  NE2 HIS C  77      90.114  19.949  36.688  1.00 51.41           N  
ATOM  10842  N   PHE C  78      87.544  23.817  41.863  1.00 57.01           N  
ATOM  10843  CA  PHE C  78      86.577  24.739  42.448  1.00 56.68           C  
ATOM  10844  C   PHE C  78      86.542  26.014  41.614  1.00 56.77           C  
ATOM  10845  O   PHE C  78      85.502  26.654  41.473  1.00 58.51           O  
ATOM  10846  CB  PHE C  78      86.924  25.059  43.905  1.00 51.60           C  
ATOM  10847  CG  PHE C  78      86.404  24.051  44.889  1.00 50.83           C  
ATOM  10848  CD1 PHE C  78      87.147  22.929  45.209  1.00 50.36           C  
ATOM  10849  CD2 PHE C  78      85.173  24.231  45.499  1.00 59.25           C  
ATOM  10850  CE1 PHE C  78      86.671  22.002  46.117  1.00 59.81           C  
ATOM  10851  CE2 PHE C  78      84.691  23.307  46.408  1.00 57.59           C  
ATOM  10852  CZ  PHE C  78      85.442  22.192  46.717  1.00 58.58           C  
ATOM  10853  N   LEU C  79      87.698  26.367  41.061  1.00 52.08           N  
ATOM  10854  CA  LEU C  79      87.824  27.540  40.205  1.00 51.11           C  
ATOM  10855  C   LEU C  79      88.344  27.142  38.829  1.00 50.74           C  
ATOM  10856  O   LEU C  79      88.790  26.012  38.629  1.00 50.74           O  
ATOM  10857  CB  LEU C  79      88.757  28.570  40.840  1.00 55.79           C  
ATOM  10858  CG  LEU C  79      88.481  28.939  42.299  1.00 52.89           C  
ATOM  10859  CD1 LEU C  79      89.477  29.980  42.783  1.00 46.59           C  
ATOM  10860  CD2 LEU C  79      87.055  29.434  42.469  1.00 55.60           C  
ATOM  10861  N   SER C  80      88.291  28.074  37.884  1.00 63.98           N  
ATOM  10862  CA  SER C  80      88.767  27.807  36.533  1.00 68.05           C  
ATOM  10863  C   SER C  80      90.288  27.875  36.459  1.00 64.06           C  
ATOM  10864  O   SER C  80      90.943  28.396  37.363  1.00 62.15           O  
ATOM  10865  CB  SER C  80      88.147  28.789  35.538  1.00 68.88           C  
ATOM  10866  OG  SER C  80      88.560  28.495  34.215  1.00 60.01           O  
ATOM  10867  N   GLY C  81      90.845  27.346  35.373  1.00 76.09           N  
ATOM  10868  CA  GLY C  81      92.284  27.289  35.196  1.00 74.00           C  
ATOM  10869  C   GLY C  81      92.912  28.637  34.903  1.00 70.29           C  
ATOM  10870  O   GLY C  81      92.645  29.248  33.869  1.00 70.61           O  
ATOM  10871  N   SER C  82      93.752  29.099  35.822  1.00 86.60           N  
ATOM  10872  CA  SER C  82      94.452  30.366  35.658  1.00 82.93           C  
ATOM  10873  C   SER C  82      95.838  30.297  36.288  1.00 80.50           C  
ATOM  10874  O   SER C  82      96.098  29.448  37.140  1.00 89.58           O  
ATOM  10875  CB  SER C  82      93.645  31.511  36.270  1.00 83.97           C  
ATOM  10876  OG  SER C  82      94.318  32.748  36.115  1.00 82.89           O  
ATOM  10877  N   LYS C  83      96.723  31.192  35.865  1.00 99.20           N  
ATOM  10878  CA  LYS C  83      98.089  31.210  36.374  1.00 97.01           C  
ATOM  10879  C   LYS C  83      98.489  32.604  36.847  1.00 94.39           C  
ATOM  10880  O   LYS C  83      99.408  32.753  37.653  1.00 90.71           O  
ATOM  10881  CB  LYS C  83      99.073  30.713  35.306  1.00 95.00           C  
ATOM  10882  CG  LYS C  83      99.294  31.664  34.135  1.00 96.74           C  
ATOM  10883  CD  LYS C  83      98.205  31.541  33.078  1.00 99.45           C  
ATOM  10884  CE  LYS C  83      98.127  30.127  32.525  1.00 92.46           C  
ATOM  10885  NZ  LYS C  83      99.405  29.706  31.887  1.00 92.33           N  
ATOM  10886  N   GLN C  84      97.793  33.620  36.350  1.00103.98           N  
ATOM  10887  CA  GLN C  84      98.083  34.999  36.726  1.00 99.85           C  
ATOM  10888  C   GLN C  84      96.885  35.655  37.401  1.00102.71           C  
ATOM  10889  O   GLN C  84      97.043  36.437  38.339  1.00 98.33           O  
ATOM  10890  CB  GLN C  84      98.505  35.812  35.500  1.00 99.19           C  
ATOM  10891  CG  GLN C  84      99.753  35.286  34.803  1.00 98.85           C  
ATOM  10892  CD  GLN C  84     100.994  35.368  35.674  1.00 96.48           C  
ATOM  10893  OE1 GLN C  84     101.084  36.207  36.570  1.00 93.84           O  
ATOM  10894  NE2 GLN C  84     101.958  34.490  35.415  1.00 97.75           N  
ATOM  10895  N   GLN C  85      95.687  35.335  36.921  1.00 74.19           N  
ATOM  10896  CA  GLN C  85      94.464  35.872  37.506  1.00 75.14           C  
ATOM  10897  C   GLN C  85      93.897  34.920  38.555  1.00 77.39           C  
ATOM  10898  O   GLN C  85      92.694  34.661  38.591  1.00 79.73           O  
ATOM  10899  CB  GLN C  85      93.419  36.146  36.421  1.00 78.96           C  
ATOM  10900  CG  GLN C  85      93.833  37.213  35.418  1.00 77.00           C  
ATOM  10901  CD  GLN C  85      92.723  37.563  34.444  1.00 81.34           C  
ATOM  10902  OE1 GLN C  85      91.607  37.054  34.547  1.00 82.55           O  
ATOM  10903  NE2 GLN C  85      93.026  38.440  33.492  1.00 80.48           N  
ATOM  10904  N   LEU C  86      94.776  34.401  39.406  1.00 95.94           N  
ATOM  10905  CA  LEU C  86      94.371  33.513  40.489  1.00 93.51           C  
ATOM  10906  C   LEU C  86      94.520  34.197  41.845  1.00 92.19           C  
ATOM  10907  O   LEU C  86      94.314  33.577  42.889  1.00 91.00           O  
ATOM  10908  CB  LEU C  86      95.188  32.214  40.454  1.00 92.54           C  
ATOM  10909  CG  LEU C  86      96.644  32.250  39.973  1.00 89.93           C  
ATOM  10910  CD1 LEU C  86      97.522  33.148  40.836  1.00 86.53           C  
ATOM  10911  CD2 LEU C  86      97.215  30.841  39.925  1.00 93.58           C  
ATOM  10912  N   SER C  87      94.879  35.476  41.820  1.00 82.09           N  
ATOM  10913  CA  SER C  87      95.101  36.237  43.044  1.00 77.01           C  
ATOM  10914  C   SER C  87      93.789  36.549  43.758  1.00 79.16           C  
ATOM  10915  O   SER C  87      92.709  36.402  43.184  1.00 81.42           O  
ATOM  10916  CB  SER C  87      95.853  37.536  42.739  1.00 76.10           C  
ATOM  10917  OG  SER C  87      95.111  38.362  41.858  1.00 80.17           O  
ATOM  10918  N   ARG C  88      93.892  36.974  45.011  1.00109.17           N  
ATOM  10919  CA  ARG C  88      92.719  37.301  45.813  1.00107.16           C  
ATOM  10920  C   ARG C  88      92.017  38.542  45.276  1.00100.28           C  
ATOM  10921  O   ARG C  88      90.793  38.654  45.347  1.00101.77           O  
ATOM  10922  CB  ARG C  88      93.111  37.518  47.274  1.00105.54           C  
ATOM  10923  CG  ARG C  88      93.827  36.341  47.912  1.00102.98           C  
ATOM  10924  CD  ARG C  88      94.281  36.682  49.321  1.00 98.68           C  
ATOM  10925  NE  ARG C  88      95.046  35.598  49.930  1.00 96.23           N  
ATOM  10926  CZ  ARG C  88      95.629  35.675  51.123  1.00 97.25           C  
ATOM  10927  NH1 ARG C  88      95.535  36.788  51.838  1.00 96.31           N  
ATOM  10928  NH2 ARG C  88      96.305  34.641  51.601  1.00 93.12           N  
ATOM  10929  N   ASP C  89      92.797  39.473  44.742  1.00 81.26           N  
ATOM  10930  CA  ASP C  89      92.253  40.722  44.227  1.00 83.97           C  
ATOM  10931  C   ASP C  89      91.437  40.492  42.957  1.00 88.36           C  
ATOM  10932  O   ASP C  89      90.451  41.187  42.709  1.00 88.55           O  
ATOM  10933  CB  ASP C  89      93.378  41.723  43.958  1.00 82.48           C  
ATOM  10934  CG  ASP C  89      92.861  43.121  43.689  1.00 85.21           C  
ATOM  10935  OD1 ASP C  89      93.506  43.857  42.912  1.00 84.68           O  
ATOM  10936  OD2 ASP C  89      91.811  43.488  44.256  1.00 84.80           O  
ATOM  10937  N   SER C  90      91.852  39.513  42.160  1.00 64.11           N  
ATOM  10938  CA  SER C  90      91.148  39.187  40.926  1.00 67.90           C  
ATOM  10939  C   SER C  90      89.893  38.366  41.211  1.00 69.22           C  
ATOM  10940  O   SER C  90      88.916  38.431  40.466  1.00 63.78           O  
ATOM  10941  CB  SER C  90      92.069  38.432  39.964  1.00 68.18           C  
ATOM  10942  OG  SER C  90      92.589  37.259  40.567  1.00 67.09           O  
ATOM  10943  N   LEU C  91      89.927  37.595  42.294  1.00 71.17           N  
ATOM  10944  CA  LEU C  91      88.769  36.813  42.713  1.00 71.27           C  
ATOM  10945  C   LEU C  91      87.711  37.712  43.346  1.00 73.14           C  
ATOM  10946  O   LEU C  91      86.514  37.525  43.123  1.00 75.29           O  
ATOM  10947  CB  LEU C  91      89.182  35.711  43.690  1.00 68.20           C  
ATOM  10948  CG  LEU C  91      89.283  34.296  43.117  1.00 69.17           C  
ATOM  10949  CD1 LEU C  91      87.929  33.835  42.596  1.00 77.17           C  
ATOM  10950  CD2 LEU C  91      90.334  34.222  42.022  1.00 72.53           C  
ATOM  10951  N   LEU C  92      88.159  38.682  44.137  1.00 65.24           N  
ATOM  10952  CA  LEU C  92      87.261  39.680  44.710  1.00 64.50           C  
ATOM  10953  C   LEU C  92      86.635  40.511  43.599  1.00 69.65           C  
ATOM  10954  O   LEU C  92      85.495  40.961  43.706  1.00 71.15           O  
ATOM  10955  CB  LEU C  92      88.002  40.580  45.699  1.00 61.98           C  
ATOM  10956  CG  LEU C  92      87.883  40.243  47.188  1.00 64.47           C  
ATOM  10957  CD1 LEU C  92      88.336  38.818  47.473  1.00 64.14           C  
ATOM  10958  CD2 LEU C  92      88.680  41.236  48.022  1.00 66.32           C  
ATOM  10959  N   SER C  93      87.399  40.712  42.530  1.00 64.99           N  
ATOM  10960  CA  SER C  93      86.894  41.382  41.341  1.00 65.60           C  
ATOM  10961  C   SER C  93      86.017  40.430  40.537  1.00 63.51           C  
ATOM  10962  O   SER C  93      86.109  39.212  40.689  1.00 64.10           O  
ATOM  10963  CB  SER C  93      88.048  41.896  40.481  1.00 66.92           C  
ATOM  10964  OG  SER C  93      87.578  42.385  39.239  1.00 62.68           O  
ATOM  10965  N   GLY C  94      85.171  40.988  39.681  1.00 51.77           N  
ATOM  10966  CA  GLY C  94      84.307  40.184  38.838  1.00 55.73           C  
ATOM  10967  C   GLY C  94      85.059  39.567  37.677  1.00 58.11           C  
ATOM  10968  O   GLY C  94      84.505  38.765  36.925  1.00 51.50           O  
ATOM  10969  N   CYS C  95      86.325  39.949  37.525  1.00 98.75           N  
ATOM  10970  CA  CYS C  95      87.165  39.426  36.458  1.00 95.29           C  
ATOM  10971  C   CYS C  95      87.350  37.922  36.610  1.00 97.06           C  
ATOM  10972  O   CYS C  95      87.671  37.428  37.691  1.00 93.57           O  
ATOM  10973  CB  CYS C  95      88.522  40.130  36.442  1.00 91.30           C  
ATOM  10974  SG  CYS C  95      89.557  39.706  35.024  1.00 90.30           S  
ATOM  10975  N   HIS C  96      87.149  37.201  35.511  1.00 76.51           N  
ATOM  10976  CA  HIS C  96      87.130  35.746  35.526  1.00 76.89           C  
ATOM  10977  C   HIS C  96      87.592  35.213  34.166  1.00 73.86           C  
ATOM  10978  O   HIS C  96      87.425  35.901  33.158  1.00 74.46           O  
ATOM  10979  CB  HIS C  96      85.725  35.259  35.890  1.00 81.12           C  
ATOM  10980  CG  HIS C  96      85.487  35.175  37.367  1.00 79.60           C  
ATOM  10981  ND1 HIS C  96      86.515  35.119  38.282  1.00 78.42           N  
ATOM  10982  CD2 HIS C  96      84.341  35.141  38.088  1.00 80.95           C  
ATOM  10983  CE1 HIS C  96      86.016  35.052  39.503  1.00 78.01           C  
ATOM  10984  NE2 HIS C  96      84.697  35.064  39.413  1.00 79.30           N  
ATOM  10985  N   PRO C  97      88.179  33.997  34.109  1.00 84.67           N  
ATOM  10986  CA  PRO C  97      88.302  32.757  34.887  1.00 84.27           C  
ATOM  10987  C   PRO C  97      87.208  32.488  35.915  1.00 87.98           C  
ATOM  10988  O   PRO C  97      87.379  32.769  37.101  1.00 86.60           O  
ATOM  10989  CB  PRO C  97      89.665  32.940  35.549  1.00 88.82           C  
ATOM  10990  CG  PRO C  97      90.473  33.732  34.464  1.00 81.02           C  
ATOM  10991  CD  PRO C  97      89.456  34.218  33.418  1.00 81.72           C  
ATOM  10992  N   GLY C  98      86.092  31.940  35.437  1.00 56.34           N  
ATOM  10993  CA  GLY C  98      84.899  31.758  36.242  1.00 58.28           C  
ATOM  10994  C   GLY C  98      85.012  30.725  37.345  1.00 61.06           C  
ATOM  10995  O   GLY C  98      85.726  30.926  38.326  1.00 58.84           O  
ATOM  10996  N   PHE C  99      84.298  29.616  37.186  1.00 52.28           N  
ATOM  10997  CA  PHE C  99      84.236  28.600  38.229  1.00 53.68           C  
ATOM  10998  C   PHE C  99      84.356  27.182  37.683  1.00 53.02           C  
ATOM  10999  O   PHE C  99      83.972  26.903  36.547  1.00 52.09           O  
ATOM  11000  CB  PHE C  99      82.930  28.734  39.016  1.00 55.37           C  
ATOM  11001  CG  PHE C  99      82.892  29.920  39.934  1.00 54.41           C  
ATOM  11002  CD1 PHE C  99      83.961  30.200  40.766  1.00 50.64           C  
ATOM  11003  CD2 PHE C  99      81.791  30.756  39.963  1.00 55.95           C  
ATOM  11004  CE1 PHE C  99      83.932  31.291  41.612  1.00 57.22           C  
ATOM  11005  CE2 PHE C  99      81.757  31.850  40.807  1.00 53.57           C  
ATOM  11006  CZ  PHE C  99      82.828  32.116  41.631  1.00 58.39           C  
ATOM  11007  N   GLY C 100      84.898  26.291  38.507  1.00 61.00           N  
ATOM  11008  CA  GLY C 100      84.932  24.876  38.190  1.00 61.96           C  
ATOM  11009  C   GLY C 100      83.655  24.227  38.682  1.00 69.10           C  
ATOM  11010  O   GLY C 100      82.916  24.837  39.454  1.00 69.75           O  
ATOM  11011  N   PRO C 101      83.389  22.989  38.238  1.00 57.72           N  
ATOM  11012  CA  PRO C 101      82.170  22.242  38.572  1.00 59.66           C  
ATOM  11013  C   PRO C 101      81.840  22.232  40.065  1.00 59.24           C  
ATOM  11014  O   PRO C 101      80.674  22.384  40.434  1.00 59.81           O  
ATOM  11015  CB  PRO C 101      82.489  20.831  38.077  1.00 50.91           C  
ATOM  11016  CG  PRO C 101      83.422  21.052  36.939  1.00 50.04           C  
ATOM  11017  CD  PRO C 101      84.271  22.227  37.337  1.00 57.80           C  
ATOM  11018  N   LEU C 102      82.855  22.066  40.908  1.00 56.03           N  
ATOM  11019  CA  LEU C 102      82.659  22.049  42.355  1.00 55.14           C  
ATOM  11020  C   LEU C 102      82.128  23.388  42.857  1.00 53.40           C  
ATOM  11021  O   LEU C 102      81.212  23.438  43.682  1.00 59.94           O  
ATOM  11022  CB  LEU C 102      83.966  21.703  43.074  1.00 52.84           C  
ATOM  11023  CG  LEU C 102      84.333  20.223  43.231  1.00 53.29           C  
ATOM  11024  CD1 LEU C 102      83.214  19.459  43.925  1.00 53.28           C  
ATOM  11025  CD2 LEU C 102      84.681  19.580  41.894  1.00 54.51           C  
ATOM  11026  N   GLY C 103      82.710  24.472  42.354  1.00 55.64           N  
ATOM  11027  CA  GLY C 103      82.273  25.809  42.713  1.00 53.83           C  
ATOM  11028  C   GLY C 103      80.868  26.093  42.217  1.00 55.66           C  
ATOM  11029  O   GLY C 103      80.089  26.774  42.884  1.00 51.16           O  
ATOM  11030  N   VAL C 104      80.546  25.566  41.040  1.00 59.44           N  
ATOM  11031  CA  VAL C 104      79.220  25.733  40.463  1.00 50.51           C  
ATOM  11032  C   VAL C 104      78.171  25.029  41.318  1.00 57.37           C  
ATOM  11033  O   VAL C 104      77.127  25.602  41.623  1.00 54.04           O  
ATOM  11034  CB  VAL C 104      79.155  25.193  39.022  1.00 53.14           C  
ATOM  11035  CG1 VAL C 104      77.755  25.356  38.456  1.00 54.40           C  
ATOM  11036  CG2 VAL C 104      80.167  25.904  38.147  1.00 51.93           C  
ATOM  11037  N   GLU C 105      78.455  23.788  41.704  1.00 61.31           N  
ATOM  11038  CA  GLU C 105      77.548  23.024  42.559  1.00 67.32           C  
ATOM  11039  C   GLU C 105      77.398  23.671  43.933  1.00 60.83           C  
ATOM  11040  O   GLU C 105      76.306  23.697  44.504  1.00 56.75           O  
ATOM  11041  CB  GLU C 105      78.035  21.582  42.709  1.00 69.68           C  
ATOM  11042  CG  GLU C 105      77.746  20.701  41.505  1.00 65.00           C  
ATOM  11043  CD  GLU C 105      76.270  20.379  41.362  1.00 61.69           C  
ATOM  11044  OE1 GLU C 105      75.539  20.473  42.371  1.00 64.56           O  
ATOM  11045  OE2 GLU C 105      75.842  20.031  40.242  1.00 65.82           O  
ATOM  11046  N   LEU C 106      78.505  24.187  44.458  1.00 59.67           N  
ATOM  11047  CA  LEU C 106      78.495  24.877  45.742  1.00 52.13           C  
ATOM  11048  C   LEU C 106      77.616  26.121  45.676  1.00 50.49           C  
ATOM  11049  O   LEU C 106      76.829  26.394  46.587  1.00 50.76           O  
ATOM  11050  CB  LEU C 106      79.922  25.247  46.156  1.00 50.73           C  
ATOM  11051  CG  LEU C 106      80.112  26.009  47.467  1.00 55.47           C  
ATOM  11052  CD1 LEU C 106      79.391  25.317  48.606  1.00 57.04           C  
ATOM  11053  CD2 LEU C 106      81.592  26.140  47.782  1.00 53.31           C  
ATOM  11054  N   ARG C 107      77.748  26.865  44.583  1.00 56.32           N  
ATOM  11055  CA  ARG C 107      76.963  28.074  44.375  1.00 55.70           C  
ATOM  11056  C   ARG C 107      75.488  27.746  44.177  1.00 56.66           C  
ATOM  11057  O   ARG C 107      74.616  28.512  44.585  1.00 55.41           O  
ATOM  11058  CB  ARG C 107      77.494  28.854  43.172  1.00 51.95           C  
ATOM  11059  CG  ARG C 107      76.859  30.223  42.982  1.00 51.36           C  
ATOM  11060  CD  ARG C 107      77.552  31.003  41.876  1.00 57.81           C  
ATOM  11061  NE  ARG C 107      77.497  30.302  40.597  1.00 55.05           N  
ATOM  11062  CZ  ARG C 107      78.077  30.735  39.483  1.00 59.50           C  
ATOM  11063  NH1 ARG C 107      78.760  31.871  39.488  1.00 59.12           N  
ATOM  11064  NH2 ARG C 107      77.974  30.032  38.363  1.00 50.76           N  
ATOM  11065  N   LYS C 108      75.214  26.606  43.549  1.00 53.02           N  
ATOM  11066  CA  LYS C 108      73.841  26.191  43.287  1.00 54.16           C  
ATOM  11067  C   LYS C 108      73.154  25.759  44.575  1.00 51.50           C  
ATOM  11068  O   LYS C 108      71.990  26.089  44.806  1.00 51.62           O  
ATOM  11069  CB  LYS C 108      73.801  25.055  42.263  1.00 57.70           C  
ATOM  11070  CG  LYS C 108      72.400  24.729  41.769  1.00 59.26           C  
ATOM  11071  CD  LYS C 108      72.399  23.534  40.829  1.00 52.50           C  
ATOM  11072  CE  LYS C 108      72.728  22.245  41.566  1.00 51.77           C  
ATOM  11073  NZ  LYS C 108      71.713  21.921  42.607  1.00 59.81           N  
ATOM  11074  N   ASN C 109      73.874  25.017  45.411  1.00 69.17           N  
ATOM  11075  CA  ASN C 109      73.352  24.630  46.714  1.00 66.34           C  
ATOM  11076  C   ASN C 109      73.152  25.856  47.596  1.00 69.32           C  
ATOM  11077  O   ASN C 109      72.167  25.951  48.332  1.00 69.08           O  
ATOM  11078  CB  ASN C 109      74.284  23.628  47.399  1.00 65.24           C  
ATOM  11079  CG  ASN C 109      74.205  22.242  46.786  1.00 67.36           C  
ATOM  11080  OD1 ASN C 109      73.358  21.432  47.165  1.00 67.60           O  
ATOM  11081  ND2 ASN C 109      75.088  21.962  45.836  1.00 63.24           N  
ATOM  11082  N   LEU C 110      74.085  26.801  47.505  1.00 52.01           N  
ATOM  11083  CA  LEU C 110      74.009  28.036  48.274  1.00 50.88           C  
ATOM  11084  C   LEU C 110      72.793  28.874  47.876  1.00 52.84           C  
ATOM  11085  O   LEU C 110      72.060  29.373  48.733  1.00 54.48           O  
ATOM  11086  CB  LEU C 110      75.294  28.848  48.099  1.00 57.31           C  
ATOM  11087  CG  LEU C 110      75.426  30.114  48.946  1.00 56.37           C  
ATOM  11088  CD1 LEU C 110      75.236  29.795  50.419  1.00 57.63           C  
ATOM  11089  CD2 LEU C 110      76.777  30.764  48.709  1.00 53.46           C  
ATOM  11090  N   ALA C 111      72.585  29.020  46.571  1.00 60.29           N  
ATOM  11091  CA  ALA C 111      71.443  29.762  46.053  1.00 61.75           C  
ATOM  11092  C   ALA C 111      70.139  29.052  46.393  1.00 61.31           C  
ATOM  11093  O   ALA C 111      69.125  29.693  46.665  1.00 62.49           O  
ATOM  11094  CB  ALA C 111      71.567  29.950  44.550  1.00 67.21           C  
ATOM  11095  N   ALA C 112      70.174  27.722  46.376  1.00 52.39           N  
ATOM  11096  CA  ALA C 112      69.005  26.927  46.727  1.00 52.33           C  
ATOM  11097  C   ALA C 112      68.617  27.155  48.183  1.00 59.33           C  
ATOM  11098  O   ALA C 112      67.441  27.346  48.499  1.00 59.01           O  
ATOM  11099  CB  ALA C 112      69.267  25.451  46.470  1.00 50.65           C  
ATOM  11100  N   GLU C 113      69.612  27.137  49.067  1.00 65.47           N  
ATOM  11101  CA  GLU C 113      69.367  27.373  50.485  1.00 63.89           C  
ATOM  11102  C   GLU C 113      68.948  28.819  50.729  1.00 65.77           C  
ATOM  11103  O   GLU C 113      68.230  29.114  51.683  1.00 66.47           O  
ATOM  11104  CB  GLU C 113      70.606  27.031  51.315  1.00 61.43           C  
ATOM  11105  CG  GLU C 113      70.981  25.551  51.306  1.00 60.52           C  
ATOM  11106  CD  GLU C 113      69.970  24.675  52.030  1.00 63.49           C  
ATOM  11107  OE1 GLU C 113      69.969  23.448  51.796  1.00 61.36           O  
ATOM  11108  OE2 GLU C 113      69.180  25.208  52.837  1.00 63.89           O  
ATOM  11109  N   TRP C 114      69.400  29.719  49.860  1.00 53.37           N  
ATOM  11110  CA  TRP C 114      68.998  31.117  49.939  1.00 57.52           C  
ATOM  11111  C   TRP C 114      67.518  31.264  49.613  1.00 58.26           C  
ATOM  11112  O   TRP C 114      66.773  31.931  50.332  1.00 61.86           O  
ATOM  11113  CB  TRP C 114      69.833  31.979  48.989  1.00 58.62           C  
ATOM  11114  CG  TRP C 114      69.543  33.448  49.111  1.00 59.42           C  
ATOM  11115  CD1 TRP C 114      70.209  34.351  49.887  1.00 60.31           C  
ATOM  11116  CD2 TRP C 114      68.510  34.181  48.441  1.00 62.26           C  
ATOM  11117  NE1 TRP C 114      69.656  35.600  49.739  1.00 60.89           N  
ATOM  11118  CE2 TRP C 114      68.610  35.523  48.857  1.00 63.09           C  
ATOM  11119  CE3 TRP C 114      67.508  33.833  47.528  1.00 63.48           C  
ATOM  11120  CZ2 TRP C 114      67.751  36.516  48.394  1.00 68.03           C  
ATOM  11121  CZ3 TRP C 114      66.655  34.820  47.070  1.00 67.89           C  
ATOM  11122  CH2 TRP C 114      66.783  36.145  47.503  1.00 68.70           C  
ATOM  11123  N   TRP C 115      67.102  30.634  48.520  1.00 66.01           N  
ATOM  11124  CA  TRP C 115      65.712  30.681  48.084  1.00 69.56           C  
ATOM  11125  C   TRP C 115      64.817  29.935  49.064  1.00 72.88           C  
ATOM  11126  O   TRP C 115      63.624  30.213  49.164  1.00 76.12           O  
ATOM  11127  CB  TRP C 115      65.573  30.090  46.681  1.00 71.98           C  
ATOM  11128  CG  TRP C 115      64.830  30.976  45.732  1.00 76.78           C  
ATOM  11129  CD1 TRP C 115      63.884  31.905  46.048  1.00 70.57           C  
ATOM  11130  CD2 TRP C 115      64.990  31.030  44.307  1.00 70.37           C  
ATOM  11131  NE1 TRP C 115      63.435  32.528  44.907  1.00 74.30           N  
ATOM  11132  CE2 TRP C 115      64.096  32.011  43.831  1.00 71.52           C  
ATOM  11133  CE3 TRP C 115      65.795  30.343  43.397  1.00 72.05           C  
ATOM  11134  CZ2 TRP C 115      63.990  32.318  42.473  1.00 76.41           C  
ATOM  11135  CZ3 TRP C 115      65.685  30.652  42.050  1.00 73.94           C  
ATOM  11136  CH2 TRP C 115      64.790  31.631  41.602  1.00 75.75           C  
ATOM  11137  N   THR C 116      65.405  28.988  49.785  1.00 81.07           N  
ATOM  11138  CA  THR C 116      64.675  28.228  50.794  1.00 82.41           C  
ATOM  11139  C   THR C 116      64.490  29.054  52.065  1.00 82.38           C  
ATOM  11140  O   THR C 116      63.459  28.967  52.729  1.00 84.52           O  
ATOM  11141  CB  THR C 116      65.400  26.909  51.138  1.00 80.80           C  
ATOM  11142  OG1 THR C 116      65.649  26.169  49.935  1.00 81.13           O  
ATOM  11143  CG2 THR C 116      64.559  26.060  52.081  1.00 80.77           C  
ATOM  11144  N   SER C 117      65.487  29.871  52.389  1.00 66.30           N  
ATOM  11145  CA  SER C 117      65.450  30.680  53.603  1.00 67.36           C  
ATOM  11146  C   SER C 117      64.560  31.912  53.448  1.00 71.24           C  
ATOM  11147  O   SER C 117      64.413  32.699  54.383  1.00 74.71           O  
ATOM  11148  CB  SER C 117      66.864  31.108  54.000  1.00 64.47           C  
ATOM  11149  OG  SER C 117      67.458  31.914  52.996  1.00 64.91           O  
ATOM  11150  N   VAL C 118      63.969  32.077  52.269  1.00 66.75           N  
ATOM  11151  CA  VAL C 118      63.072  33.201  52.017  1.00 72.15           C  
ATOM  11152  C   VAL C 118      61.702  32.728  51.536  1.00 73.48           C  
ATOM  11153  O   VAL C 118      60.767  33.522  51.436  1.00 76.48           O  
ATOM  11154  CB  VAL C 118      63.656  34.175  50.977  1.00 69.20           C  
ATOM  11155  CG1 VAL C 118      64.976  34.749  51.470  1.00 65.81           C  
ATOM  11156  CG2 VAL C 118      63.835  33.480  49.638  1.00 66.92           C  
ATOM  11157  N   VAL C 119      61.586  31.437  51.238  1.00 87.02           N  
ATOM  11158  CA  VAL C 119      60.310  30.866  50.818  1.00 89.35           C  
ATOM  11159  C   VAL C 119      59.516  30.415  52.042  1.00 89.52           C  
ATOM  11160  O   VAL C 119      58.295  30.256  51.986  1.00 82.27           O  
ATOM  11161  CB  VAL C 119      60.503  29.678  49.844  1.00 85.79           C  
ATOM  11162  CG1 VAL C 119      60.995  28.444  50.586  1.00 81.34           C  
ATOM  11163  CG2 VAL C 119      59.209  29.377  49.098  1.00 88.92           C  
ATOM  11164  N   VAL C 120      60.218  30.223  53.155  1.00108.38           N  
ATOM  11165  CA  VAL C 120      59.578  29.869  54.416  1.00101.53           C  
ATOM  11166  C   VAL C 120      59.041  31.121  55.097  1.00109.28           C  
ATOM  11167  O   VAL C 120      58.335  31.045  56.102  1.00100.38           O  
ATOM  11168  CB  VAL C 120      60.554  29.153  55.371  1.00108.59           C  
ATOM  11169  CG1 VAL C 120      61.111  27.899  54.718  1.00102.50           C  
ATOM  11170  CG2 VAL C 120      61.680  30.090  55.779  1.00105.60           C  
ATOM  11171  N   PHE C 121      59.387  32.272  54.533  1.00129.01           N  
ATOM  11172  CA  PHE C 121      59.004  33.561  55.088  1.00123.74           C  
ATOM  11173  C   PHE C 121      57.550  33.911  54.781  1.00134.37           C  
ATOM  11174  O   PHE C 121      57.130  33.913  53.624  1.00132.22           O  
ATOM  11175  CB  PHE C 121      59.936  34.652  54.556  1.00125.18           C  
ATOM  11176  CG  PHE C 121      59.459  36.048  54.833  1.00129.78           C  
ATOM  11177  CD1 PHE C 121      59.589  36.603  56.095  1.00136.55           C  
ATOM  11178  CD2 PHE C 121      58.892  36.810  53.826  1.00131.66           C  
ATOM  11179  CE1 PHE C 121      59.153  37.890  56.349  1.00134.60           C  
ATOM  11180  CE2 PHE C 121      58.454  38.096  54.073  1.00139.59           C  
ATOM  11181  CZ  PHE C 121      58.585  38.638  55.335  1.00133.66           C  
ATOM  11182  N   ARG C 122      56.790  34.203  55.831  1.00 91.51           N  
ATOM  11183  CA  ARG C 122      55.398  34.616  55.697  1.00 97.57           C  
ATOM  11184  C   ARG C 122      55.314  36.120  55.431  1.00 99.33           C  
ATOM  11185  O   ARG C 122      56.091  36.892  55.990  1.00 91.54           O  
ATOM  11186  CB  ARG C 122      54.609  34.240  56.955  1.00 91.84           C  
ATOM  11187  CG  ARG C 122      55.239  34.717  58.254  1.00 91.72           C  
ATOM  11188  CD  ARG C 122      54.461  35.871  58.864  1.00 90.70           C  
ATOM  11189  NE  ARG C 122      53.114  35.468  59.259  1.00 93.74           N  
ATOM  11190  CZ  ARG C 122      52.260  36.250  59.910  1.00104.02           C  
ATOM  11191  NH1 ARG C 122      52.611  37.485  60.245  1.00108.40           N  
ATOM  11192  NH2 ARG C 122      51.054  35.798  60.228  1.00107.08           N  
ATOM  11193  N   GLU C 123      54.374  36.544  54.588  1.00105.05           N  
ATOM  11194  CA  GLU C 123      53.393  35.653  53.980  1.00104.90           C  
ATOM  11195  C   GLU C 123      53.869  35.079  52.650  1.00108.33           C  
ATOM  11196  O   GLU C 123      54.125  33.880  52.538  1.00103.67           O  
ATOM  11197  CB  GLU C 123      52.069  36.390  53.774  1.00108.58           C  
ATOM  11198  CG  GLU C 123      51.542  37.078  55.020  1.00108.41           C  
ATOM  11199  CD  GLU C 123      50.239  37.808  54.768  1.00110.36           C  
ATOM  11200  OE1 GLU C 123      49.615  37.566  53.714  1.00109.11           O  
ATOM  11201  OE2 GLU C 123      49.837  38.626  55.624  1.00119.45           O  
ATOM  11202  N   GLN C 124      53.982  35.940  51.643  1.00 89.46           N  
ATOM  11203  CA  GLN C 124      54.318  35.486  50.302  1.00 85.62           C  
ATOM  11204  C   GLN C 124      55.280  36.426  49.579  1.00 84.66           C  
ATOM  11205  O   GLN C 124      55.067  37.638  49.524  1.00 88.75           O  
ATOM  11206  CB  GLN C 124      53.042  35.307  49.476  1.00 87.80           C  
ATOM  11207  CG  GLN C 124      52.080  36.483  49.553  1.00 83.96           C  
ATOM  11208  CD  GLN C 124      50.756  36.200  48.870  1.00 87.20           C  
ATOM  11209  OE1 GLN C 124      50.561  35.132  48.291  1.00 84.07           O  
ATOM  11210  NE2 GLN C 124      49.838  37.157  48.937  1.00 80.63           N  
ATOM  11211  N   VAL C 125      56.342  35.846  49.032  1.00 66.29           N  
ATOM  11212  CA  VAL C 125      57.302  36.579  48.218  1.00 62.95           C  
ATOM  11213  C   VAL C 125      57.388  35.939  46.837  1.00 60.08           C  
ATOM  11214  O   VAL C 125      57.649  34.742  46.718  1.00 67.83           O  
ATOM  11215  CB  VAL C 125      58.700  36.606  48.865  1.00 69.47           C  
ATOM  11216  CG1 VAL C 125      59.702  37.283  47.943  1.00 65.95           C  
ATOM  11217  CG2 VAL C 125      58.648  37.308  50.212  1.00 63.12           C  
ATOM  11218  N   PHE C 126      57.167  36.736  45.799  1.00 66.70           N  
ATOM  11219  CA  PHE C 126      57.119  36.213  44.437  1.00 65.46           C  
ATOM  11220  C   PHE C 126      58.461  36.333  43.725  1.00 62.29           C  
ATOM  11221  O   PHE C 126      59.078  37.399  43.727  1.00 62.34           O  
ATOM  11222  CB  PHE C 126      56.037  36.932  43.632  1.00 69.27           C  
ATOM  11223  CG  PHE C 126      54.658  36.784  44.205  1.00 63.30           C  
ATOM  11224  CD1 PHE C 126      54.318  35.661  44.941  1.00 63.88           C  
ATOM  11225  CD2 PHE C 126      53.704  37.767  44.010  1.00 67.29           C  
ATOM  11226  CE1 PHE C 126      53.051  35.523  45.472  1.00 68.82           C  
ATOM  11227  CE2 PHE C 126      52.436  37.634  44.538  1.00 71.84           C  
ATOM  11228  CZ  PHE C 126      52.107  36.510  45.271  1.00 72.47           C  
ATOM  11229  N   PRO C 127      58.920  35.231  43.116  1.00 60.10           N  
ATOM  11230  CA  PRO C 127      60.157  35.230  42.330  1.00 68.03           C  
ATOM  11231  C   PRO C 127      59.962  35.872  40.960  1.00 60.32           C  
ATOM  11232  O   PRO C 127      58.943  35.644  40.312  1.00 62.55           O  
ATOM  11233  CB  PRO C 127      60.483  33.743  42.197  1.00 66.03           C  
ATOM  11234  CG  PRO C 127      59.153  33.069  42.256  1.00 67.86           C  
ATOM  11235  CD  PRO C 127      58.323  33.885  43.210  1.00 69.83           C  
ATOM  11236  N   VAL C 128      60.933  36.672  40.531  1.00 64.18           N  
ATOM  11237  CA  VAL C 128      60.873  37.314  39.223  1.00 66.51           C  
ATOM  11238  C   VAL C 128      62.231  37.271  38.532  1.00 65.75           C  
ATOM  11239  O   VAL C 128      63.233  36.892  39.136  1.00 63.46           O  
ATOM  11240  CB  VAL C 128      60.410  38.782  39.327  1.00 68.87           C  
ATOM  11241  CG1 VAL C 128      58.918  38.857  39.621  1.00 62.88           C  
ATOM  11242  CG2 VAL C 128      61.214  39.519  40.387  1.00 68.91           C  
ATOM  11243  N   ASP C 129      62.255  37.654  37.261  1.00 86.43           N  
ATOM  11244  CA  ASP C 129      63.505  37.748  36.521  1.00 87.48           C  
ATOM  11245  C   ASP C 129      63.555  39.050  35.728  1.00 89.80           C  
ATOM  11246  O   ASP C 129      62.600  39.409  35.038  1.00 80.94           O  
ATOM  11247  CB  ASP C 129      63.688  36.542  35.594  1.00 89.33           C  
ATOM  11248  CG  ASP C 129      62.607  36.445  34.536  1.00 80.81           C  
ATOM  11249  OD1 ASP C 129      61.455  36.835  34.822  1.00 81.90           O  
ATOM  11250  OD2 ASP C 129      62.911  35.978  33.419  1.00 81.35           O  
ATOM  11251  N   ALA C 130      64.671  39.758  35.845  1.00 69.28           N  
ATOM  11252  CA  ALA C 130      64.839  41.040  35.175  1.00 62.29           C  
ATOM  11253  C   ALA C 130      65.700  40.896  33.930  1.00 64.40           C  
ATOM  11254  O   ALA C 130      66.459  39.938  33.797  1.00 63.76           O  
ATOM  11255  CB  ALA C 130      65.450  42.055  36.126  1.00 60.89           C  
ATOM  11256  N   LEU C 131      65.577  41.854  33.017  1.00 67.55           N  
ATOM  11257  CA  LEU C 131      66.411  41.874  31.825  1.00 63.96           C  
ATOM  11258  C   LEU C 131      67.837  42.264  32.192  1.00 63.10           C  
ATOM  11259  O   LEU C 131      68.068  42.934  33.200  1.00 64.26           O  
ATOM  11260  CB  LEU C 131      65.849  42.841  30.783  1.00 63.04           C  
ATOM  11261  CG  LEU C 131      64.429  42.550  30.293  1.00 64.36           C  
ATOM  11262  CD1 LEU C 131      64.037  43.524  29.194  1.00 64.68           C  
ATOM  11263  CD2 LEU C 131      64.308  41.112  29.816  1.00 63.60           C  
ATOM  11264  N   HIS C 132      68.793  41.839  31.373  1.00 66.40           N  
ATOM  11265  CA  HIS C 132      70.198  42.123  31.632  1.00 64.51           C  
ATOM  11266  C   HIS C 132      70.631  43.429  30.970  1.00 65.34           C  
ATOM  11267  O   HIS C 132      71.369  44.220  31.560  1.00 67.94           O  
ATOM  11268  CB  HIS C 132      71.075  40.965  31.147  1.00 64.18           C  
ATOM  11269  CG  HIS C 132      70.796  39.665  31.837  1.00 64.62           C  
ATOM  11270  ND1 HIS C 132      69.598  38.995  31.710  1.00 65.25           N  
ATOM  11271  CD2 HIS C 132      71.563  38.911  32.660  1.00 62.57           C  
ATOM  11272  CE1 HIS C 132      69.638  37.886  32.426  1.00 66.50           C  
ATOM  11273  NE2 HIS C 132      70.820  37.811  33.013  1.00 63.42           N  
ATOM  11274  N   HIS C 133      70.165  43.654  29.745  1.00 72.44           N  
ATOM  11275  CA  HIS C 133      70.521  44.857  29.000  1.00 72.70           C  
ATOM  11276  C   HIS C 133      69.518  45.984  29.234  1.00 74.82           C  
ATOM  11277  O   HIS C 133      68.495  45.793  29.891  1.00 73.30           O  
ATOM  11278  CB  HIS C 133      70.620  44.548  27.503  1.00 69.86           C  
ATOM  11279  CG  HIS C 133      69.319  44.140  26.883  1.00 67.38           C  
ATOM  11280  ND1 HIS C 133      68.844  42.848  26.931  1.00 67.72           N  
ATOM  11281  CD2 HIS C 133      68.396  44.855  26.195  1.00 67.77           C  
ATOM  11282  CE1 HIS C 133      67.683  42.783  26.302  1.00 67.89           C  
ATOM  11283  NE2 HIS C 133      67.389  43.988  25.847  1.00 69.85           N  
ATOM  11284  N   LYS C 134      69.823  47.159  28.693  1.00 99.39           N  
ATOM  11285  CA  LYS C 134      68.933  48.308  28.807  1.00 96.08           C  
ATOM  11286  C   LYS C 134      67.723  48.139  27.894  1.00 94.94           C  
ATOM  11287  O   LYS C 134      67.869  47.832  26.711  1.00 92.10           O  
ATOM  11288  CB  LYS C 134      69.676  49.602  28.468  1.00 96.28           C  
ATOM  11289  CG  LYS C 134      68.839  50.858  28.632  1.00 96.07           C  
ATOM  11290  CD  LYS C 134      69.548  52.071  28.051  1.00 99.13           C  
ATOM  11291  CE  LYS C 134      68.745  53.340  28.279  1.00 90.49           C  
ATOM  11292  NZ  LYS C 134      68.712  53.720  29.717  1.00 96.88           N  
ATOM  11293  N   PRO C 135      66.534  48.342  28.450  1.00 83.37           N  
ATOM  11294  CA  PRO C 135      65.292  48.159  27.704  1.00 82.47           C  
ATOM  11295  C   PRO C 135      65.185  49.135  26.536  1.00 89.56           C  
ATOM  11296  O   PRO C 135      64.562  48.832  25.519  1.00 89.69           O  
ATOM  11297  CB  PRO C 135      64.210  48.459  28.745  1.00 20.00           C  
ATOM  11298  CG  PRO C 135      64.837  49.445  29.669  1.00 20.00           C  
ATOM  11299  CD  PRO C 135      66.218  49.667  29.136  1.00 20.00           C  
ATOM  11300  N   GLY C 136      65.796  50.304  26.689  1.00 95.87           N  
ATOM  11301  CA  GLY C 136      65.759  51.325  25.658  1.00 93.44           C  
ATOM  11302  C   GLY C 136      67.032  51.385  24.837  1.00 93.29           C  
ATOM  11303  O   GLY C 136      67.403  52.441  24.325  1.00 95.02           O  
ATOM  11304  N   PRO C 137      67.703  50.244  24.710  1.00 80.26           N  
ATOM  11305  CA  PRO C 137      68.938  50.169  23.954  1.00 77.58           C  
ATOM  11306  C   PRO C 137      70.082  49.607  24.777  1.00 77.95           C  
ATOM  11307  O   PRO C 137      70.771  48.681  24.348  1.00 79.44           O  
ATOM  11308  N   LYS C 180      74.952  49.767  29.244  1.00 72.91           N  
ATOM  11309  CA  LYS C 180      73.602  49.287  28.974  1.00 75.73           C  
ATOM  11310  C   LYS C 180      73.221  48.148  29.912  1.00 76.58           C  
ATOM  11311  O   LYS C 180      72.051  47.989  30.263  1.00 77.60           O  
ATOM  11312  CB  LYS C 180      73.477  48.833  27.518  1.00 70.90           C  
ATOM  11313  CG  LYS C 180      73.670  49.947  26.503  1.00 71.96           C  
ATOM  11314  CD  LYS C 180      72.653  51.058  26.707  1.00 76.64           C  
ATOM  11315  CE  LYS C 180      72.817  52.160  25.673  1.00 75.84           C  
ATOM  11316  NZ  LYS C 180      71.812  53.242  25.853  1.00 76.61           N  
ATOM  11317  N   LEU C 181      74.213  47.361  30.316  1.00 83.79           N  
ATOM  11318  CA  LEU C 181      73.981  46.239  31.219  1.00 85.32           C  
ATOM  11319  C   LEU C 181      73.591  46.726  32.610  1.00 86.56           C  
ATOM  11320  O   LEU C 181      73.823  47.882  32.960  1.00 88.66           O  
ATOM  11321  CB  LEU C 181      75.221  45.350  31.298  1.00 83.51           C  
ATOM  11322  CG  LEU C 181      75.702  44.769  29.968  1.00 88.20           C  
ATOM  11323  CD1 LEU C 181      76.874  43.827  30.183  1.00 85.65           C  
ATOM  11324  CD2 LEU C 181      74.563  44.060  29.250  1.00 89.64           C  
ATOM  11325  N   ARG C 182      72.999  45.837  33.402  1.00 55.83           N  
ATOM  11326  CA  ARG C 182      72.502  46.208  34.720  1.00 56.27           C  
ATOM  11327  C   ARG C 182      73.609  46.226  35.769  1.00 54.80           C  
ATOM  11328  O   ARG C 182      74.532  45.415  35.733  1.00 53.70           O  
ATOM  11329  CB  ARG C 182      71.383  45.257  35.154  1.00 56.90           C  
ATOM  11330  CG  ARG C 182      71.783  43.791  35.194  1.00 56.17           C  
ATOM  11331  CD  ARG C 182      70.581  42.899  35.465  1.00 56.90           C  
ATOM  11332  NE  ARG C 182      70.955  41.491  35.562  1.00 56.25           N  
ATOM