>1evv_A mol:na length:76  PHENYLALANINE TRANSFER RNA
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAU
CCACAGAAUUCGCACCA
>1evv_A mol:na length:76  PHENYLALANINE TRANSFER RNA
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAU
CCACAGAAUUCGCACCA