>1h88_E mol:na length:26  DNA(5'-(*CP*CP*AP*GP*TP*CP*CP*GP*TP*TP*AP* AP*GP*GP*AP*TP*TP*GP*CP*GP*CP*CP*AP*CP*AP*T)-3')
CCAGTCCGTTAAGGATTGCGCCACAT