>1hf0_M mol:na length:22  DNA 5'-D(*CP*AP*CP*AP*TP*TP*TP*GP*AP*AP*AP*GP*GP* CP*AP*AP*AP*TP*GP*GP*AP*G)-3'
CACATTTGAAAGGCAAATGGAG