>1mm8_C mol:na length:20  ME DNA non-transferred strand
CTGTCTCTTATACACATCTC