>1nzb_D mol:na length:37  loxP DNA
GGATAACTTCGTATAGCATACATTATACGAAGTTATC