>1s32_I mol:na length:146  palindromic alpha-satellite 146 bp DNA fragment
ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGG
CATGTTCAGCGGAATTCCGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTT
TTGGTAGAATCTGCAGGTGGATATTGAT