>1s72_0 mol:na length:2922  23S ribosomal RNA
UUGGCUACUAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAA
GCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGA
AUCUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAU
CGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAG
CCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCG
UCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGAC
CAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGC
AGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAA
CGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGA
UCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAA
GACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUGAAAAACGAGCCAGGGAGUGUGUC
UGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAG
GGCUUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAU
CCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUA
GAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGA
GUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGU
CUGUGAGGUAGAGCGACCGAUUGGUGUGUCCGCCUCCGAGAGGAGUCGGCACACCUGUC
AAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUG
UGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGU
AAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUA
CCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGG
GACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUG
GCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAA
UCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGG
UUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGA
CUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACG
CCCUGGGGUCGAUCACGCUGGGCAUUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCC
GUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCA
UGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAA
GCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUU
CGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGAC
UGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCC
UGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGG
GGGUAACUAUGACCCUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCA
UGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCC
AGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGG
CUGUCGCUGAGACGUGGUCGCCGAUGUGCAGCAUAGGUAGGAGACACUACACAGGUACC
CGCGCUAGCGGGCCACCGAGUCAACAGUGAAAUACUACCCGUCGGUGACUGCGACUCUC
ACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAA
AGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGACAGAGACCCGGCGAAGAGUGCA
AGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUG
GUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUA
GGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGA
UGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUUGUUCGCCUAU
UAAAGGAGGUCGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUG
GGUGUGUAAUGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUG
GCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGU
AAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCC
GCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAG
CCCACGAGCACUAACAGACCAAAGCCAUCAU