>1tf6_E mol:na length:31  DNA (5'-D(*AP*CP*GP*GP*GP*CP*CP*TP*GP*GP*TP*TP*AP*GP*TP*AP*C P*CP*TP*GP*GP*AP* TP*GP*GP*GP*AP*GP*AP*CP*C)-3')
ACGGGCCTGGTTAGTACCTGGATGGGAGACC