>2hvy_E mol:na length:65  H/ACA RNA
GGGUCCGCCUUGAGUGCCCGGGUGAGAAGCAUGAUCCCGGGUAAUUAUGGCGGACCCAC
AGAAUU