>2iy3_B mol:na length:110  4.5S RNA
GGGGGCUCUGUUGGUUCUCCCGCAACGCUACUCUGUUUACCAGGUCAGGUCCGAAAGGA
AGCAGCCAAGGCAGAUGACGCGUGUGCCGGGAUGUAGCUGGCAGGGCCCCC