>2nvx_T mol:na length:28  28-MER DNA template strand
CTACCGATAAGCAGACGATCCTCTCGAT