>2o93_B mol:na length:25  kappaB enhancer element, DNA 25-mer
TGGAAAGTCCCCAGCGGAAAGTCCC