>2r5y_C mol:na length:20  DNA (5'-D(*DAP*DCP*DTP*DCP*DTP*DAP*DTP*DGP*DAP*DTP*DTP*DTP*DAP*DTP*DGP*DGP*DGP*DCP*DTP*DG)-3')
ACTCTATGATTTATGGGCTG