>3azj_I mol:na length:146  146-MER DNA
ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGG
CATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTT
TTGGTAGAATCTGCAGGTGGATATTGAT