>3dlh_X mol:na length:21  DNA (5'-D(DTP*DGP*DAP*DGP*DGP*DTP*DAP*DGP*DTP*DAP*DGP*DGP*DTP*DTP*DGP*DTP*DAP*DTP*DAP*DGP*DT)-3')
TGAGGTAGTAGGTTGTATAGT