>3k0j_E mol:na length:87  RNA (87-MER)
GCGACUCGGGGUGCCCUCCAUUGCACUCCGGAGGCUGAGAAAUACCCGUAUCACCUGAU
CUGGAUAAUGCCAGCGUAGGGAAGUCGC