>3k0j_F mol:na length:87  RNA (87-MER)
GCGACUCGGGGUGCCCUCCAUUGCACUCCGGAGGCUGAGAAAUACCCGUAUCACCUGAU
CUGGAUAAUGCCAGCGUAGGGAAGUCGC