>3lz1_I mol:na length:145  DNA (145-MER)
ATCGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAA
AACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATT
GAGCGGCCTCGGCACCGGGATTCTGAT