>3nbn_Y mol:na length:37  DNA, HES1 promoter
ACTCGTGTGAAACTTCCCAAACTTTCTTTCCCACAGT