>3ouy_C mol:na length:35  RNA (35-MER)
GGAAGUAGAUGGUUCAAGUCCAUUUACUUCCACCA