>3pdr_A mol:na length:161  M-box Riboswitch RNA
GGGCUUCGUUAGGUGAGGCUCCUGUAUGGAGAUACGCUGCUGCCCAAAAAUGUCCAAAG
ACGCCAAUGGGUCAACAGAAAUCAUCGACAUAAGGUGAUUUUUAAUGCAGCUGGAUGCU
UGUCCUAUGCCAUACAGUGCUAAAGCUCUACGAUUGAAGCCCA