>3x1t_I mol:na length:146  DNA (146-MER)
ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGG
CATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTT
TTGGTAGAATCTGCAGGTGGATATTGAT