>4b3q_D mol:na length:25  PRIMER DNA
TCGTATGCCTATAGTTATTGTGGCC