>4iqj_F mol:na length:28  DNA (5'-D(*TP*TP*TP*TP*TP*TP*TP*GP*TP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*CP*G)-3')
TTTTTTTGTGGCACTGGCCGTCGTTTCG