>4iqj_K mol:na length:20  DNA (5'-D(P*CP*GP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*A)-3')
CGAAACGACGGCCAGTGCCA