>4kgc_J mol:na length:145  DNA (145-mer)
ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGG
CATGTTCAGCTGATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTT
TGGTAGTATCTGCAGGTGGATATTGAT