>4oqb_M mol:na length:26  DNA (26-MER)
GCCTACCGGTTCGCGAACCGGTAGGC