>4pjo_3 mol:na length:60  U1 RNA variant (48-MER) with 4-helix junction replaced by kissing loop (HIV-1 (Mal) DIS) and shorter stem-loop 4.
GGACUUACCUGGCAGUGAGGUGCACACACUGCAUAAUUUGUGGUAGUGGGCGAAAGCCC
G