>4u7b_F mol:na length:31  DNA (31-MER)
AAACGACATTTCATACTTGTACACCTGATAG