>4u7b_H mol:na length:25  DNA (25-MER)
GGTGTACAAGTATGAAATGTCGTTT