>4v4b_B4 mol:na length:125  5S RIBOSOMAL RNA
ACGUUAGGCGGCCACAGCGGUGGGGUUGCCUCCCGUACCCAUCCCGAACACGGAAGAUA
AGCCCACCAGCGUUCCGGGGAGUACUGGAGUGCGCGAGCCUCUGGGAAACCCGGUUCGC
CGCCACC