>4wfn_Y mol:na length:124  5S ribosomal RNA
ACACCCCCGUGCCCAUAGCACUGUGGAACCACCCCACCCCAUGCCGAACUGGGUCGUGA
AACACAGCAGCGCCAAUGAUACUCGGACCGCAGGGUCCCGGAAAAGUCGGUCAGCGCGG
GGGUUU