>5aj0_A4 mol:na length:121  5S ribosomal RNA
GUCUACGGCCAUACCACCCUGAACGCGCCCGAUCUCGUCUGAUCUCGGAAGCUAAGCAG
GGUCGGGCCUGGUUAGUACUUGGAUGGGAGACCGCCUGGGAAUACCGGGUGCUGUAGGC
UUU