>5crx_D mol:na length:35  DNA (35-MER)
TATAACTTCGTATAGCATATGCTATACGAAGTTAT