>5d4c_S mol:na length:27  DNA (27-MER)
TATAATGGGAGCTGTCACGGATGCAGG