>5d4d_S mol:na length:27  DNA (27-MER)
TATAATGGGAGCTGTCACGGATGCAGG