>5flm_T mol:na length:39  DNA, DNA-RNA ELONGATION SCAFFOLD
AAGCTCAAGTACTTAAGCCTGGTCATTACTAGTACTGCC