>5hoo_D mol:na length:36  Mos1 IR TS joined to Target DNA,Mos1 IR TS joined to Target DNA
AAACGACATTTCATACTTGTACACCTGATAGCAGTG