>5hoo_E mol:na length:25  Mos1 IR DNA NTS
GGTGTACAAGTATGAAATGTCGTTT