>5hp1_F mol:na length:38  DNA (38-MER)
TAATACCCCCCCTTCGGTGCTTTGCACCGAAGGGGGGG