>5i4a_D mol:na length:21  RNA (5'-R(*UP*AP*UP*AP*CP*AP*AP*CP*CP*UP*AP*CP*UP*U)-3')
UAUACAACCUACUACCUCAUU