>5j2q_T mol:na length:27  DNA (27-MER)
ATGGATGGCGCCCGAACAGGGACTGTG