>5lks_L5 mol:na length:5070  28S ribosomal RNA
CGCGACCUCAGAUCAGACGUGGCGACCCGCUGAAUUUAAGCAUAUUAGUCAGCGGAGGA
GAAGAAACUAACCAGGAUUCCCUCAGUAACGGCGAGUGAACAGGGAAGAGCCCAGCGCC
GAAUCCCCGCCCCGCGGCGGGGCGCGGGACAUGUGGCGUACGGAAGACCCGCUCCCCGG
CGCCGCUCGUGGGGGGCCCAAGUCCUUCUGAUCGAGGCCCAGCCCGUGGACGGUGUGAG
GCCGGUAGCGGCCCCCGGCGCGCCGGGCCCGGGUCUUCCCGGAGUCGGGUUGCUUGGGA
AUGCAGCCCAAAGCGGGUGGUAAACUCCAUCUAAGGCUAAAUACCGGCACGAGACCGAU
AGUCAACAAGUACCGUAAGGGAAAGUUGAAAAGAACUUUGAAGAGAGAGUUCAAGAGGG
CGUGAAACCGUUAAGAGGUAAACGGGUGGGGUCCGCGCAGUCCGCCCGGAGGAUUCAAC
CCGGCGGCGGGUCCGGCCGUGUCGGCGGCCCGGCGGAUCUUUCCCGCCCCCCGUUCCUC
CCGACCCCUCCACCCGCCCUCCCUUCCCCCGCCGCCCCUCCUCCUCCUCCCCGGAGGGG
GCGGGCUCCGGCGGGUGCGGGGGUGGGCGGGCGGGGCCGGGGGUGGGGUCGGCGGGGGA
CCGUCCCCCGACCGGCGACCGGCCGCCGCCGGGCGCAUUUCCACCGCGGCGGUGCGCCG
CGACCGGCUCCGGGACGGCUGGGAAGGCCCGGCGGGGAAGGUGGCUCGGGGGGCCCCGU
CCGUCCGUCCGUCCGUCCUCCUCCUCCCCCGUCUCCGCCCCCCGGCCCCGCGUCCUCCC
UCGGGAGGGCGCGCGGGUCGGGGCGGCGGCGGCGGCGGCGGUGGCGGCGGCGGCGGCGG
CGGCGGGACCGAAACCCCCCCCGAGUGUUACAGCCCCCCCGGCAGCAGCACUCGCCGAA
UCCCGGGGCCGAGGGAGCGAGACCCGUCGCCGCGCUCUCCCCCCUCCCGGCGCCCACCC
CCGCGGGGAAUCCCCCGCGAGGGGGGUCUCCCCCGCGGGGGCGCGCCGGCGUCUCCUCG
UGGGGGGGCCGGGCCACCCCUCCCACGGCGCGACCGCUCUCCCACCCCUCCUCCCCGCG
CCCCCGCCCCGGCGACGGGGGGGGUGCCGCGCGCGGGUCGGGGGGCGGGGCGGACUGUC
CCCAGUGCGCCCCGGGCGGGUCGCGCCGUCGGGCCCGGGGGAGGUUCUCUCGGGGCCAC
GCGCGCGUCCCCCGAAGAGGGGGACGGCGGAGCGAGCGCACGGGGUCGGCGGCGACGUC
GGCUACCCACCCGACCCGUCUUGAAACACGGACCAAGGAGUCUAACACGUGCGCGAGUC
GGGGGCUCGCACGAAAGCCGCCGUGGCGCAAUGAAGGUGAAGGCCGGCGCGCUCGCCGG
CCGAGGUGGGAUCCCGAGGCCUCUCCAGUCCGCCGAGGGCGCACCACCGGCCCGUCUCG
CCCGCCGCGCCGGGGAGGUGGAGCACGAGCGCACGUGUUAGGACCCGAAAGAUGGUGAA
CUAUGCCUGGGCAGGGCGAAGCCAGAGGAAACUCUGGUGGAGGUCCGUAGCGGUCCUGA
CGUGCAAAUCGGUCGUCCGACCUGGGUAUAGGGGCGAAAGACUAAUCGAACCAUCUAGU
AGCUGGUUCCCUCCGAAGUUUCCCUCAGGAUAGCUGGCGCUCUCGCAGACCCGACGCAC
CCCCGCCACGCAGUUUUAUCCGGUAAAGCGAAUGAUUAGAGGUCUUGGGGCCGAAACGA
UCUCAACCUAUUCUCAAACUUUAAAUGGGUAAGAAGCCCGGCUCGCUGGCGUGGAGCCG
GGCGUGGAAUGCGAGUGCCUAGUGGGCCACUUUUGGUAAGCAGAACUGGCGCUGCGGGA
UGAACCGAACGCCGGGUUAAGGCGCCCGAUGCCGACGCUCAUCAGACCCCAGAAAAGGU
GUUGGUUGAUAUAGACAGCAGGACGGUGGCCAUGGAAGUCGGAAUCCGCUAAGGAGUGU
GUAACAACUCACCUGCCGAAUCAACUAGCCCUGAAAAUGGAUGGCGCUGGAGCGUCGGG
CCCAUACCCGGCCGUCGCCGGCAGUCGAGAGUGGACGGGAGCGGCGGGGGCGGCGCGCG
CGCGCGCGCGUGUGGUGUGCGUCGGAGGGCGGCGGCGGCGGCGGCGGCGGGGGUGUGGG
GUCCUUCCCCCGCCCCCCCCCCCACGCCUCCUCCCCUCCUCCCGCCCACGCCCCGCUCC
CCGCCCCCGGAGCCCCGCGGACGCUACGCCGCGACGAGUAGGAGGGCCGCUGCGGUGAG
CCUUGAAGCCUAGGGCGCGGGCCCGGGUGGAGCCGCCGCAGGUGCAGAUCUUGGUGGUA
GUAGCAAAUAUUCAAACGAGAACUUUGAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAAC
AGCAGUUGAACAUGGGUCAGUCGGUCCUGAGAGAUGGGCGAGCGCCGUUCCGAAGGGAC
GGGCGAUGGCCUCCGUUGCCCUCGGCCGAUCGAAAGGGAGUCGGGUUCAGAUCCCCGAA
UCCGGAGUGGCGGAGAUGGGCGCCGCGAGGCGUCCAGUGCGGUAACGCGACCGAUCCCG
GAGAAGCCGGCGGGAGCCCCGGGGAGAGUUCUCUUUUCUUUGUGAAGGGCAGGGCGCCC
UGGAAUGGGUUCGCCCCGAGAGAGGGGCCCGUGCCUUGGAAAGCGUCGCGGUUCCGGCG
GCGUCCGGUGAGCUCUCGCUGGCCCUUGAAAAUCCGGGGGAGAGGGUGUAAAUCUCGCG
CCGGGCCGUACCCAUAUCCGCAGCAGGUCUCCAAGGUGAACAGCCUCUGGCAUGUUGGA
ACAAUGUAGGUAAGGGAAGUCGGCAAGCCGGAUCCGUAACUUCGGGAUAAGGAUUGGCU
CUAAGGGCUGGGUCGGUCGGGCUGGGGCGCGAAGCGGGGCUGGGCGCGCGCCGCGGCUG
GACGAGGCGCCGCCGCCCCCCCCACGCCCGGGGCACCCCCCUCGCGGCCCUCCCCCGCC
CCACCCCGCGCGCGCCGCUCGCUCCCUCCCCGCCCCGCGCCCUCUCUCUCUCUCUCUCC
CCCGCUCCCCGUCCUCCCCCCUCCCCGGGGGAGCGCCGCGUGGGGGCGGCGGCGGGGGG
AGAAGGGUCGGGGCGGCAGGGGCCGGCGGCGGCCCGCCGCGGGGCCCCGGCGGCGGGGG
CACGGUCCCCCGCGAGGGGGGCCCGGGCACCCGGGGGGCCGGCGGCGGCGGCGACUCUG
GACGCGAGCCGGGCCCUUCCCGUGGAUCGCCCCAGCUGCGGCGGGCGUCGCGGCCGCCC
CCGGGGAGCCCGGCGGGCGCCGGCGCGCCCCCCCCCCCACCCCACGUCUCGUCGCGCGC
GCGUCCGCUGGGGGCGGGGAGCGGUCGGGCGGCGGCGGUCGGCGGGCGGCGGGGCGGGG
CGGUUCGUCCCCCCGCCCUACCCCCCCGGCCCCGUCCGCCCCCCGUUCCCCCCUCCUCC
UCGGCGCGCGGCGGCGGCGGCGGCAGGCGGCGGAGGGGCCGCGGGCCGGUCCCCCCCGC
CGGGUCCGCCCCCGGGGCCGCGGUUCCGCGCGGCGCCUCGCCUCGGCCGGCGCCUAGCA
GCCGACUUAGAACUGGUGCGGACCAGGGGAAUCCGACUGUUUAAUUAAAACAAAGCAUC
GCGAAGGCCCGCGGCGGGUGUUGACGCGAUGUGAUUUCUGCCCAGUGCUCUGAAUGUCA
AAGUGAAGAAAUUCAAUGAAGCGCGGGUAAACGGCGGGAGUAACUAUGACUCUCUUAAG
GUAGCCAAAUGCCUCGUCAUCUAAUUAGUGACGCGCAUGAAUGGAUGAACGAGAUUCCC
ACUGUCCCUACCUACUAUCCAGCGAAACCACAGCCAAGGGAACGGGCUUGGCGGAAUCA
GCGGGGAAAGAAGACCCUGUUGAGCUUGACUCUAGUCUGGCACGGUGAAGAGACAUGAG
AGGUGUAGAAUAAGUGGGAGGCCCCCGGCGCCCCCCCGGUGUCCCCGCGAGGGGCCCGG
GGCGGGGUCCGCCGGCCCUGCGGGCCGCCGGUGAAAUACCACUACUCUGAUCGUUUUUU
CACUGACCCGGUGAGGCGGGGGGGCGAGCCCCGAGGGGCUCUCGCUUCUGGCGCCAAGC
GCCCGGCCGCGCGCCGGCCGGGCGCGACCCGCUCCGGGGACAGUGCCAGGUGGGGAGUU
UGACUGGGGCGGUACACCUGUCAAACGGUAACGCAGGUGUCCUAAGGCGAGCUCAGGGA
GGACAGAAACCUCCCGUGGAGCAGAAGGGCAAAAGCUCGCUUGAUCUUGAUUUUCAGUA
CGAAUACAGACCGUGAAAGCGGGGCCUCACGAUCCUUCUGACCUUUUGGGUUUUAAGCA
GGAGGUGUCAGAAAAGUUACCACAGGGAUAACUGGCUUGUGGCGGCCAAGCGUUCAUAG
CGACGUCGCUUUUUGAUCCUUCGAUGUCGGCUCUUCCUAUCAUUGUGAAGCAGAAUUCA
CCAAGCGUUGGAUUGUUCACCCACUAAUAGGGAACGUGAGCUGGGUUUAGACCGUCGUG
AGACAGGUUAGUUUUACCCUACUGAUGAUGUGUUGUUGCCAUGGUAAUCCUGCUCAGUA
CGAGAGGAACCGCAGGUUCAGACAUUUGGUGUAUGUGCUUGGCUGAGGAGCCAAUGGGG
CGAAGCUACCAUCUGUGGGAUUAUGACUGAACGCCUCUAAGUCAGAAUCCCGCCCAGGC
GGAACGAUACGGCAGCGCCGCGGAGCCUCGGUUGGCCUCGGAUAGCCGGUCCCCCGCCU
GUCCCCGCCGGCGGGCCGCCCCCCCCCUCCACGCGCCCCGCGCGCGCGGGAGGGCGCGU
GCCCCGCCGCGCGCCGGGACCGGGGUCCGGUGCGGAGUGCCCUUCGUCCUGGGAAACGG
GGCGCGGCCGGAGAGGCGGCCGCCCCCUCGCCCGUCACGCACCGGCCGUUCGUGGGGAA
CCUGGCGCUAAACCAUUCGUAGACGACCUGCUUCUGGGUCGGGGUUUCGUACGUAGCAG
AGCAGCUCCCUCGCUGCGAUCUAUUGAAAGUCAGCCCUCGACACAAGGGUUUGUC